Chk2 regulates transcription-independent p53-mediated apoptosis in response to DNA damage
International Nuclear Information System (INIS)
Chen Chen; Shimizu, Shigeomi; Tsujimoto, Yoshihide; Motoyama, Noboru
2005-01-01
The tumor suppressor protein p53 plays a central role in the induction of apoptosis in response to genotoxic stress. The protein kinase Chk2 is an important regulator of p53 function in mammalian cells exposed to ionizing radiation (IR). Cells derived from Chk2-deficient mice are resistant to the induction of apoptosis by IR, and this resistance has been thought to be a result of the defective transcriptional activation of p53 target genes. It was recently shown, however, that p53 itself and histone H1.2 translocate to mitochondria and thereby induces apoptosis in a transcription-independent manner in response to IR. We have now examined whether Chk2 also regulates the transcription-independent induction of apoptosis by p53 and histone H1.2. The reduced ability of IR to induce p53 stabilization in Chk2-deficient thymocytes was associated with a marked impairment of p53 and histone H1 translocation to mitochondria. These results suggest that Chk2 regulates the transcription-independent mechanism of p53-mediated apoptosis by inducing stabilization of p53 in response to IR
Energy Technology Data Exchange (ETDEWEB)
Wan, Chunhua [Department of Nutrition and Food Hygiene, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu (China); Ma, Xa; Shi, Shangshi [Department of Occupational Medicine and Environmental Toxicology, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Zhao, Jianya; Nie, Xiaoke [Department of Nutrition and Food Hygiene, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Han, Jingling; Xiao, Jing; Wang, Xiaoke [Department of Occupational Medicine and Environmental Toxicology, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Jiang, Shengyang [Department of Nutrition and Food Hygiene, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu (China); Jiang, Junkang, E-mail: Jiang_junkang@163.com [Department of Occupational Medicine and Environmental Toxicology, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu (China)
2014-12-15
Chronic exposure to excessive manganese (Mn) has been known to lead to neuronal loss and a clinical syndrome resembling idiopathic Parkinson's disease (IPD). p53 plays an integral role in the development of various human diseases, including neurodegenerative disorders. However, the role of p53 in Mn-induced neuronal apoptosis and neurological deficits remains obscure. In the present study, we showed that p53 was critically involved in Mn-induced neuronal apoptosis in rat striatum through both transcription-dependent and -independent mechanisms. Western blot and immunohistochemistrical analyses revealed that p53 was remarkably upregulated in the striatum of rats following Mn exposure. Coincidentally, increased level of cleaved PARP, a hallmark of apoptosis, was observed. Furthermore, using nerve growth factor (NGF)-differentiated PC12 cells as a neuronal cell model, we showed that Mn exposure decreased cell viability and induced apparent apoptosis. Importantly, p53 was progressively upregulated, and accumulated in both the nucleus and the cytoplasm. The cytoplasmic p53 had a remarkable distribution in mitochondria, suggesting an involvement of p53 mitochondrial translocation in Mn-induced neuronal apoptosis. In addition, Mn-induced impairment of mitochondrial membrane potential (ΔΨm) could be partially rescued by pretreatment with inhibitors of p53 transcriptional activity and p53 mitochondrial translocation, Pifithrin-α (PFT-α) and Pifithrin-μ (PFT-μ), respectively. Moreover, blockage of p53 activities with PFT-α and PFT-μ significantly attenuated Mn-induced reactive oxidative stress (ROS) generation and mitochondrial H{sub 2}O{sub 2} production. Finally, we observed that pretreatment with PFT-α and PFT-μ ameliorated Mn-induced apoptosis in PC12 cells. Collectively, these findings implicate that p53 transcription-dependent and -independent pathways may play crucial roles in the regulation of Mn-induced neuronal death. - Highlights: • p53 is
International Nuclear Information System (INIS)
Wan, Chunhua; Ma, Xa; Shi, Shangshi; Zhao, Jianya; Nie, Xiaoke; Han, Jingling; Xiao, Jing; Wang, Xiaoke; Jiang, Shengyang; Jiang, Junkang
2014-01-01
Chronic exposure to excessive manganese (Mn) has been known to lead to neuronal loss and a clinical syndrome resembling idiopathic Parkinson's disease (IPD). p53 plays an integral role in the development of various human diseases, including neurodegenerative disorders. However, the role of p53 in Mn-induced neuronal apoptosis and neurological deficits remains obscure. In the present study, we showed that p53 was critically involved in Mn-induced neuronal apoptosis in rat striatum through both transcription-dependent and -independent mechanisms. Western blot and immunohistochemistrical analyses revealed that p53 was remarkably upregulated in the striatum of rats following Mn exposure. Coincidentally, increased level of cleaved PARP, a hallmark of apoptosis, was observed. Furthermore, using nerve growth factor (NGF)-differentiated PC12 cells as a neuronal cell model, we showed that Mn exposure decreased cell viability and induced apparent apoptosis. Importantly, p53 was progressively upregulated, and accumulated in both the nucleus and the cytoplasm. The cytoplasmic p53 had a remarkable distribution in mitochondria, suggesting an involvement of p53 mitochondrial translocation in Mn-induced neuronal apoptosis. In addition, Mn-induced impairment of mitochondrial membrane potential (ΔΨm) could be partially rescued by pretreatment with inhibitors of p53 transcriptional activity and p53 mitochondrial translocation, Pifithrin-α (PFT-α) and Pifithrin-μ (PFT-μ), respectively. Moreover, blockage of p53 activities with PFT-α and PFT-μ significantly attenuated Mn-induced reactive oxidative stress (ROS) generation and mitochondrial H 2 O 2 production. Finally, we observed that pretreatment with PFT-α and PFT-μ ameliorated Mn-induced apoptosis in PC12 cells. Collectively, these findings implicate that p53 transcription-dependent and -independent pathways may play crucial roles in the regulation of Mn-induced neuronal death. - Highlights: • p53 is robustly
Pax3 stimulates p53 ubiquitination and degradation independent of transcription.
Directory of Open Access Journals (Sweden)
Xiao Dan Wang
Full Text Available Pax3 is a developmental transcription factor that is required for neural tube and neural crest development. We previously showed that inactivating the p53 tumor suppressor protein prevents neural tube and cardiac neural crest defects in Pax3-mutant mouse embryos. This demonstrates that Pax3 regulates these processes by blocking p53 function. Here we investigated the mechanism by which Pax3 blocks p53 function.We employed murine embryonic stem cell (ESC-derived neuronal precursors as a cell culture model of embryonic neuroepithelium or neural crest. Pax3 reduced p53 protein stability, but had no effect on p53 mRNA levels or the rate of p53 synthesis. Full length Pax3 as well as fragments that contained either the DNA-binding paired box or the homeodomain, expressed as GST or FLAG fusion proteins, physically associated with p53 and Mdm2 both in vitro and in vivo. In contrast, Splotch Pax3, which causes neural tube and neural crest defects in homozygous embryos, bound weakly, or not at all, to p53 or Mdm2. The paired domain and homeodomain each stimulated Mdm2-mediated ubiquitination of p53 and p53 degradation in the absence of the Pax3 transcription regulatory domains, whereas Splotch Pax3 did not stimulate p53 ubiquitination or degradation.Pax3 inactivates p53 function by stimulating its ubiquitination and degradation. This process utilizes the Pax3 paired domain and homeodomain but is independent of DNA-binding and transcription regulation. Because inactivating p53 is the only required Pax3 function during neural tube closure and cardiac neural crest development, and inactivating p53 does not require Pax3-dependent transcription regulation, this indicates that Pax3 is not required to function as a transcription factor during neural tube closure and cardiac neural crest development. These findings further suggest novel explanations for PAX3 functions in human diseases, such as in neural crest-derived cancers and Waardenburg syndrome types 1 and 3.
OTUD5 regulates p53 stability by deubiquitinating p53.
Directory of Open Access Journals (Sweden)
Judong Luo
Full Text Available The p53 tumour suppressor protein is a transcription factor that prevents oncogenic progression by activating the expression of apoptosis and cell-cycle arrest genes in stressed cells. The stability of p53 is tightly regulated by ubiquitin-dependent degradation, driven mainly by its negative regulators ubiquitin ligase MDM2.In this study, we have identified OTUD5 as a DUB that interacts with and deubiquitinates p53. OTUD5 forms a direct complex with p53 and controls level of ubiquitination. The function of OTUD5 is required to allow the rapid activation of p53-dependent transcription and a p53-dependent apoptosis in response to DNA damage stress.As a novel deubiquitinating enzyme for p53, OTUD5 is required for the stabilization and the activation of a p53 response.
Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena
2016-11-02
Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Chromatin-Bound MDM2 Regulates Serine Metabolism and Redox Homeostasis Independently of p53.
Riscal, Romain; Schrepfer, Emilie; Arena, Giuseppe; Cissé, Madi Y; Bellvert, Floriant; Heuillet, Maud; Rambow, Florian; Bonneil, Eric; Sabourdy, Frédérique; Vincent, Charles; Ait-Arsa, Imade; Levade, Thierry; Thibaut, Pierre; Marine, Jean-Christophe; Portais, Jean-Charles; Sarry, Jean-Emmanuel; Le Cam, Laurent; Linares, Laetitia K
2016-06-16
The mouse double minute 2 (MDM2) oncoprotein is recognized as a major negative regulator of the p53 tumor suppressor, but growing evidence indicates that its oncogenic activities extend beyond p53. Here, we show that MDM2 is recruited to chromatin independently of p53 to regulate a transcriptional program implicated in amino acid metabolism and redox homeostasis. Identification of MDM2 target genes at the whole-genome level highlights an important role for ATF3/4 transcription factors in tethering MDM2 to chromatin. MDM2 recruitment to chromatin is a tightly regulated process that occurs during oxidative stress and serine/glycine deprivation and is modulated by the pyruvate kinase M2 (PKM2) metabolic enzyme. Depletion of endogenous MDM2 in p53-deficient cells impairs serine/glycine metabolism, the NAD(+)/NADH ratio, and glutathione (GSH) recycling, impacting their redox state and tumorigenic potential. Collectively, our data illustrate a previously unsuspected function of chromatin-bound MDM2 in cancer cell metabolism. Copyright © 2016 Elsevier Inc. All rights reserved.
APAF1 is a key transcriptional target for p53 in the regulation of neuronal cell death
DEFF Research Database (Denmark)
Fortin, A; Cregan, S P; MacLaurin, J G
2001-01-01
p53 is a transcriptional activator which has been implicated as a key regulator of neuronal cell death after acute injury. We have shown previously that p53-mediated neuronal cell death involves a Bax-dependent activation of caspase 3; however, the transcriptional targets involved in the regulati...
FATS is a transcriptional target of p53 and associated with antitumor activity
Directory of Open Access Journals (Sweden)
Zhang Xifeng
2010-09-01
Full Text Available Abstract Frequent mutations of p53 in human cancers exemplify its crucial role as a tumor suppressor transcription factor, and p21, a transcriptional target of p53, plays a central role in surveillance of cell-cycle checkpoints. Our previous study has shown that FATS stabilize p21 to preserve genome integrity. In this study we identified a novel transcript variant of FATS (GenBank: GQ499374 through screening a cDNA library from mouse testis, which uncovered the promoter region of mouse FATS. Mouse FATS was highly expressed in testis. The p53-responsive elements existed in proximal region of both mouse and human FATS promoters. Functional study indicated that the transcription of FATS gene was activated by p53, whereas such effect was abolished by site-directed mutagenesis in the p53-RE of FATS promoter. Furthermore, the expression of FATS increased upon DNA damage in a p53-dependent manner. FATS expression was silent or downregulated in human cancers, and overexpression of FATS suppressed tumorigenicity in vivo independently of p53. Our results reveal FATS as a p53-regulated gene to monitor genomic stability.
International Nuclear Information System (INIS)
Liang Xin; Xu Ke; Xu Yufang; Liu Jianwen; Qian Xuhong
2011-01-01
The Bcl-2 family contains a panel of proteins which are conserved regulators of apoptosis in mammalian cells, like the anti-apoptotic protein Bcl-2. According to its significant role in altering susceptibility to apoptosis, the deciphering of the mechanism of Bcl-2 expression modulation may be crucial for identifying therapeutics strategies for cancer. Treatment with naphthalimide-based DNA intercalators, including M2-A and R16, generally leads to a decrease in Bcl-2 intracellular amounts. Whereas the interest for these chemotherapeutics is accompanied by advances in the fundamental understanding of their anticancer properties, the molecular mechanism underlying changes in Bcl-2 expression remains poorly understood. We report here that p53 contributes to Bcl-2 down-regulation induced by B1, a novel naphthalimide-based DNA intercalating agent. Indeed, the decrease in Bcl-2 protein levels observed during B1-induced apoptosis was correlated to the decrease in mRNA levels, as a result of the inhibition of Bcl-2 transcription and promoter activity. In this context, we evaluated p53 contribution in the Bcl-2 transcriptional down-regulation. We found a significant increase of p53 binding to P 2 promoter TATA box in MCF7 cells by chromatin immunoprecipitation. These data suggest that B1-induced caspase-independent apoptosis in MCF-7 cells is associated with the activation of p53 and the down-regulation of Bcl-2. Our study strengthens the links between p53 and Bcl-2 at a transcriptional level, upon naphthalimide-based DNA intercalator treatment. - Research highlights: → B1 induced apoptosis in MCF-7 cells, following a transcriptional decrease in Bcl-2. → B1 treatment triggered p53 activation and leads to a p53-dependent down-regulation of Bcl-2. → B1 induced significant increase of p53 binding to Bcl-2 P 2 promoter TATA box.
He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang
2010-08-27
P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
Stabilization and activation of p53 are regulated independently by different phosphorylation events
Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.
1998-01-01
Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitutive PKC-dependent phosphorylation of p53 itself, or of a protein that interacts with p53, is required for the rapid degradation of p53 in untreated cells. Furthermore, an increase in the lifetime of p53 is not accompanied necessarily by its activation. Treatment with the PKC inhibitors decreased the overall level of p53 phosphorylation but led to the appearance of a phosphopeptide not seen in tryptic digests of p53 from untreated cells. Therefore, the lifetime and activities of p53 are likely to be regulated by distinct alterations of the phosphorylation pattern of p53, probably caused by the actions of different kinases. PMID:9482877
p53 Maintains Genomic Stability by Preventing Interference between Transcription and Replication
Directory of Open Access Journals (Sweden)
Constance Qiao Xin Yeo
2016-04-01
Full Text Available p53 tumor suppressor maintains genomic stability, typically acting through cell-cycle arrest, senescence, and apoptosis. We discovered a function of p53 in preventing conflicts between transcription and replication, independent of its canonical roles. p53 deficiency sensitizes cells to Topoisomerase (Topo II inhibitors, resulting in DNA damage arising spontaneously during replication. Topoisomerase IIα (TOP2A-DNA complexes preferentially accumulate in isogenic p53 mutant or knockout cells, reflecting an increased recruitment of TOP2A to regulate DNA topology. We propose that p53 acts to prevent DNA topological stress originating from transcription during the S phase and, therefore, promotes normal replication fork progression. Consequently, replication fork progression is impaired in the absence of p53, which is reversed by transcription inhibition. Pharmacologic inhibition of transcription also attenuates DNA damage and decreases Topo-II-DNA complexes, restoring cell viability in p53-deficient cells. Together, our results demonstrate a function of p53 that may underlie its role in tumor suppression.
Directory of Open Access Journals (Sweden)
Wei Xu
2010-08-01
Full Text Available P-glycoprotein (Pgp, encoded by the multidrug resistance 1 (MDR1 gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
Post-translational regulation enables robust p53 regulation.
Shin, Yong-Jun; Chen, Kai-Yuan; Sayed, Ali H; Hencey, Brandon; Shen, Xiling
2013-08-30
The tumor suppressor protein p53 plays important roles in DNA damage repair, cell cycle arrest and apoptosis. Due to its critical functions, the level of p53 is tightly regulated by a negative feedback mechanism to increase its tolerance towards fluctuations and disturbances. Interestingly, the p53 level is controlled by post-translational regulation rather than transcriptional regulation in this feedback mechanism. We analyzed the dynamics of this feedback to understand whether post-translational regulation provides any advantages over transcriptional regulation in regard to disturbance rejection. When a disturbance happens, even though negative feedback reduces the steady-state error, it can cause a system to become less stable and transiently overshoots, which may erroneously trigger downstream reactions. Therefore, the system needs to balance the trade-off between steady-state and transient errors. Feedback control and adaptive estimation theories revealed that post-translational regulation achieves a better trade-off than transcriptional regulation, contributing to a more steady level of p53 under the influence of noise and disturbances. Furthermore, post-translational regulation enables cells to respond more promptly to stress conditions with consistent amplitude. However, for better disturbance rejection, the p53- Mdm2 negative feedback has to pay a price of higher stochastic noise. Our analyses suggest that the p53-Mdm2 feedback favors regulatory mechanisms that provide the optimal trade-offs for dynamic control.
Energy Technology Data Exchange (ETDEWEB)
Sun, Lin [West Biostatistics and Cost-effectiveness Research Center, Medical Insurance Office, West China Hospital of Sichuan University, 610041, Sichuan (China); Li, Yu [Department of Anesthesiology, West China Hospital, Sichuan University, 610041, Sichuan (China); Yang, Bangxiang, E-mail: b19933009@qq.coom [Department of Pain Management, West China Hospital of Sichuan University, 610041, Sichuan (China)
2016-09-09
Long non-coding RNAs (lncRNAs) was found to play critical roles in tumorigenesis, hence, screen of tumor-related lncRNAs, identification of their biological roles is important for understanding the processes of tumorigenesis. In this study, we identified the expressing difference of several tumor-related lncRNAs in breast cancer samples and found that, MEG3, which is downregulated in non-small cell lung cancer (NSCLC) tumor tissues, is also downregulated in breast cancer samples compared with adjacent tissues. For figuring out the effect of MEG3 in breast cancer cells MCF7 and MB231, we overexpressed MEG3 in these cells, and found that it resulted the inhibition of proliferation, colony formation, migration and invasion capacities by enhancing p53’s transcriptional activity on its target genes, including p21, Maspin and KAI1. MEG3 presented similar effects in MB157, which is a p53-null breast cancer cell line, when functional p53 but not p53R273H mutant, which lacks transcriptional activity, was introduced. Surprisingly, overexpression of MEG3 activates p53’s transcriptional activity by decreasing MDM2’s transcription level, and thus stabilizes and accumulates P53. Taken together, our findings indicate that MEG3 is downregulated in breast cancer tissues and affects breast cancer cells’ malignant behaviors, which indicate MEG3 a potential therapeutic target for breast cancer. - Highlights: • MEG3 RNA is widely downregulated in breast tumor tissue. • MEG3 regulates P53 indirectly through transcriptional regulation of MDM2. • Under unstressed condition, MEG3-related P53 accumulation transcriptionally activates p53’s target genes. • MEG3 expression level tightly regulates proliferation, colony formation, migration and invasion in breast tumor cells.
E2F1 and p53 Transcription Factors as Accessory Factors for Nucleotide Excision Repair
Directory of Open Access Journals (Sweden)
David G. Johnson
2012-10-01
Full Text Available Many of the biochemical details of nucleotide excision repair (NER have been established using purified proteins and DNA substrates. In cells however, DNA is tightly packaged around histones and other chromatin-associated proteins, which can be an obstacle to efficient repair. Several cooperating mechanisms enhance the efficiency of NER by altering chromatin structure. Interestingly, many of the players involved in modifying chromatin at sites of DNA damage were originally identified as regulators of transcription. These include ATP-dependent chromatin remodelers, histone modifying enzymes and several transcription factors. The p53 and E2F1 transcription factors are well known for their abilities to regulate gene expression in response to DNA damage. This review will highlight the underappreciated, transcription-independent functions of p53 and E2F1 in modifying chromatin structure in response to DNA damage to promote global NER.
Herr, D; Keck, C; Tempfer, C; Pietrowski, Detlef
2004-12-01
The ovarian corpus luteum plays a critical role in reproduction being the primary source of circulating progesterone. After ovulation the corpus luteum is build by avascular granulosa lutein cells through rapid vascularization regulated by gonadotropic hormones. The present study was performed to investigate whether this process might be influenced by the human chorionic gonadotropin (hCG)-dependent expression of different tumor suppressor genes and hypoxia dependent transcription factors. RNA was isolated from cultured granulosa lutein cells, transcribed into cDNA, and the transcript level of following genes were determined: RB-1, VHL, NF-1, NF-2, Wt-1, p53, APC, and hypoxia inducible factor-1 (HIF-1), -2, and -3alpha. Additionally, the influence of hCG on the expression of VHL, p53, and HIf2alpha were investigated. We demonstrate that in human granulosa lutein cells the tumor suppressor genes RB-1, VHL, NF-1, NF-2, Wt-1, p53, and APC and the hypoxia dependent transcription factors HIF-1alpha, -2alpha, and -3alpha are expressed. In addition, we showed that hCG regulates the expression of p53, VHL, and HIF-2alpha. Our results indicate that hCG may determine the growth and development of the corpus luteum by mediating hypoxic and apoptotic pathways in human granulosa lutein cells. Copyright 2004 Wiley-Liss, Inc.
Nardilysin controls intestinal tumorigenesis through HDAC1/p53-dependent transcriptional regulation.
Kanda, Keitaro; Sakamoto, Jiro; Matsumoto, Yoshihide; Ikuta, Kozo; Goto, Norihiro; Morita, Yusuke; Ohno, Mikiko; Nishi, Kiyoto; Eto, Koji; Kimura, Yuto; Nakanishi, Yuki; Ikegami, Kanako; Yoshikawa, Takaaki; Fukuda, Akihisa; Kawada, Kenji; Sakai, Yoshiharu; Ito, Akihiro; Yoshida, Minoru; Kimura, Takeshi; Chiba, Tsutomu; Nishi, Eiichiro; Seno, Hiroshi
2018-04-19
Colon cancer is a complex disease affected by a combination of genetic and epigenetic factors. Here we demonstrate that nardilysin (N-arginine dibasic convertase; NRDC), a metalloendopeptidase of the M16 family, regulates intestinal tumorigenesis via its nuclear functions. NRDC is highly expressed in human colorectal cancers. Deletion of the Nrdc gene in ApcMin mice crucially suppressed intestinal tumor development. In ApcMin mice, epithelial cell-specific deletion of Nrdc recapitulated the tumor suppression observed in Nrdc-null mice. Moreover, epithelial cell-specific overexpression of Nrdc significantly enhanced tumor formation in ApcMin mice. Notably, epithelial NRDC controlled cell apoptosis in a gene dosage-dependent manner. In human colon cancer cells, nuclear NRDC directly associated with HDAC1, and controlled both acetylation and stabilization of p53, with alterations of p53 target apoptotic factors. These findings demonstrate that NRDC is critically involved in intestinal tumorigenesis through its epigenetic regulatory function, and targeting NRDC may lead to a novel prevention or therapeutic strategy against colon cancer.
Molecular mechanism of X-ray-induced p53-dependent apoptosis
Energy Technology Data Exchange (ETDEWEB)
Nakano, Hisako [Tokyo Metropolitan Inst. of Medical Center (Japan)
1999-03-01
Radiation-induced cell death has been classified into the interphase- and mitotic-ones, both of which apoptosis involving. This review described the molecular mechanism of the apoptosis, focusing on its p53-dependent process. It is known that there are genes regulating cell death either negatively or positively and the latter is involved in apoptosis. As an important factor in the apoptosis, p53 has become remarkable since it was shown that X-ray-induced apoptosis required RNA and protein syntheses in thymocytes and those cells of p53 gene-depleted mouse were shown to be resistant to gamma-ray-induced apoptosis. Radiation sensitivity of MOLT-4 cells derived from human T cell leukemia, exhibiting the typical X-ray-induced p53-dependent apoptosis, depends on the levels of p53 mRNA and protein. p53 is a gene suppressing tumor and also a transcription factor. Consequently, mutation of p53 conceivably leads to the failure of cell cycle regulation, which allows damaged cells to divide without both repair and exclusion due to loss of the apoptotic mechanism, and finally results in carcinogenesis. The radiation effect occurs in the order of the cell damage, inhibition of p53-Mdm2 binding, accumulation of p53, activation of mdm2 transcription, Mdm2 accumulation, p53-protein degradation and recovery to the steady state level. Here, the cystein protease (caspases) plays an important role as a disposing mechanism for cells scheduled to die. However, many are unknown to be solved in future. (K.H.) 119 refs.
Directory of Open Access Journals (Sweden)
Yitao Wang
2017-03-01
Full Text Available We previously identified proline-rich protein 11 (PRR11 as a novel cancer-related gene that is implicated in the regulation of cell cycle and tumorigenesis. Our recent study demonstrated that PRR11 and its adjacent gene, kinetochore associated 2 (SKA2, constitute a classic head-to-head gene pair that is coordinately regulated by nuclear factor Y (NF-Y. In the present study, we further show that the PRR11-SKA2 bidirectional transcription unit is an indirect target of the tumor suppressor p53. A luciferase reporter assay revealed that overexpression of wild type p53, but not mutant p53, significantly represses the basal activity and NF-Y mediated transactivation of the PRR11-SKA2 bidirectional promoter. Deletion and mutation analysis of the PRR11-SKA2 promoter revealed that p53-mediated PRR11-SKA2 repression is dependent on the presence of functional NF-Y binding sites. Furthermore, a co-immunoprecipitation assay revealed that p53 associates with NF-Y in lung cancer cells, and a chromatin immunoprecipitation assay showed that p53 represses PRR11-SKA2 transcription by reducing the binding amount of NF-Y in the PRR11-SKA2 promoter region. Consistently, the ability of p53 to downregulate PRR11-SKA2 transcription was significantly attenuated upon siRNA-mediated depletion of nuclear factor Y subunit beta (NF-YB. Notably, lung cancer patients with lower expression of either PRR11 or SKA2 along with wild type p53 exhibited the best overall survival compared with others with p53 mutation and/or higher expression of either PRR11 or SKA2. Taken together, our results demonstrate that p53 negatively regulates the expression of the PRR11-SKA2 bidirectional transcription unit through NF-Y, suggesting that the inability to repress the PRR11-SKA2 bidirectional transcription unit after loss of p53 might contribute to tumorigenesis.
p53 Acetylation: Regulation and Consequences
International Nuclear Information System (INIS)
Reed, Sara M.; Quelle, Dawn E.
2014-01-01
Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer
p53 Acetylation: Regulation and Consequences
Energy Technology Data Exchange (ETDEWEB)
Reed, Sara M. [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Quelle, Dawn E., E-mail: dawn-quelle@uiowa.edu [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Department of Pathology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States)
2014-12-23
Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer.
Wild type p53 transcriptionally represses the SALL2 transcription factor under genotoxic stress.
Directory of Open Access Journals (Sweden)
Carlos Farkas
Full Text Available SALL2- a member of the Spalt gene family- is a poorly characterized transcription factor found deregulated in various cancers, which suggests it plays a role in the disease. We previously identified SALL2 as a novel interacting protein of neurotrophin receptors and showed that it plays a role in neuronal function, which does not necessarily explain why or how SALL2 is deregulated in cancer. Previous evidences indicate that SALL2 gene is regulated by the WT1 and AP4 transcription factors. Here, we identified SALL2 as a novel downstream target of the p53 tumor suppressor protein. Bioinformatic analysis of the SALL2 gene revealed several putative p53 half sites along the promoter region. Either overexpression of wild-type p53 or induction of the endogenous p53 by the genotoxic agent doxorubicin repressed SALL2 promoter activity in various cell lines. However R175H, R249S, and R248W p53 mutants, frequently found in the tumors of cancer patients, were unable to repress SALL2 promoter activity, suggesting that p53 specific binding to DNA is important for the regulation of SALL2. Electrophoretic mobility shift assay demonstrated binding of p53 to one of the identified p53 half sites in the Sall2 promoter, and chromatin immunoprecipitation analysis confirmed in vivo interaction of p53 with the promoter region of Sall2 containing this half site. Importantly, by using a p53ER (TAM knockin model expressing a variant of p53 that is completely dependent on 4-hydroxy-tamoxifen for its activity, we show that p53 activation diminished SALL2 RNA and protein levels during genotoxic cellular stress in primary mouse embryo fibroblasts (MEFs and radiosensitive tissues in vivo. Thus, our finding indicates that p53 represses SALL2 expression in a context-specific manner, adding knowledge to the understanding of SALL2 gene regulation, and to a potential mechanism for its deregulation in cancer.
Regulation of p73 by Hck through kinase-dependent and independent mechanisms
Directory of Open Access Journals (Sweden)
Radha Vegesna
2007-05-01
Full Text Available Abstract Background p73, a p53 family member is a transcription factor that plays a role in cell cycle, differentiation and apoptosis. p73 is regulated through post translational modifications and protein interactions. c-Abl is the only known tyrosine kinase that phosphorylates and activates p73. Here we have analyzed the role of Src family kinases, which are involved in diverse signaling pathways, in regulating p73. Results Exogenously expressed as well as cellular Hck and p73 interact in vivo. In vitro binding assays show that SH3 domain of Hck interacts with p73. Co-expression of p73 with Hck or c-Src in mammalian cells resulted in tyrosine phosphorylation of p73. Using site directed mutational analysis, we determined that Tyr-28 was the major site of phosphorylation by Hck and c-Src, unlike c-Abl which phosphorylates Tyr-99. In a kinase dependent manner, Hck co-expression resulted in stabilization of p73 protein in the cytoplasm. Activation of Hck in HL-60 cells resulted in tyrosine phosphorylation of endogenous p73. Both exogenous and endogenous Hck localize to the nuclear as well as cytoplasmic compartment, just as does p73. Ectopically expressed Hck repressed the transcriptional activity of p73 as determined by promoter assays and semi-quantitative RT-PCR analysis of the p73 target, Ipaf and MDM2. SH3 domain- dependent function of Hck was required for its effect on p73 activity, which was also reflected in its ability to inhibit p73-mediated apoptosis. We also show that Hck interacts with Yes associated protein (YAP, a transcriptional co-activator of p73, and shRNA mediated knockdown of YAP protein reduces p73 induced Ipaf promoter activation. Conclusion We have identified p73 as a novel substrate and interacting partner of Hck and show that it regulates p73 through mechanisms that are dependent on either catalytic activity or protein interaction domains. Hck-SH3 domain-mediated interactions play an important role in the inhibition of p73
NGF-mediated transcriptional targets of p53 in PC12 neuronal differentiation
Directory of Open Access Journals (Sweden)
Labhart Paul
2007-05-01
Full Text Available Abstract Background p53 is recognized as a critical regulator of the cell cycle and apoptosis. Mounting evidence also suggests a role for p53 in differentiation of cells including neuronal precursors. We studied the transcriptional role of p53 during nerve growth factor-induced differentiation of the PC12 line into neuron-like cells. We hypothesized that p53 contributed to PC12 differentiation through the regulation of gene targets distinct from its known transcriptional targets for apoptosis or DNA repair. Results Using a genome-wide chromatin immunoprecipitation cloning technique, we identified and validated 14 novel p53-regulated genes following NGF treatment. The data show p53 protein was transcriptionally activated and contributed to NGF-mediated neurite outgrowth during differentiation of PC12 cells. Furthermore, we describe stimulus-specific regulation of a subset of these target genes by p53. The most salient differentiation-relevant target genes included wnt7b involved in dendritic extension and the tfcp2l4/grhl3 grainyhead homolog implicated in ectodermal development. Additional targets included brk, sdk2, sesn3, txnl2, dusp5, pon3, lect1, pkcbpb15 and other genes. Conclusion Within the PC12 neuronal context, putative p53-occupied genomic loci spanned the entire Rattus norvegicus genome upon NGF treatment. We conclude that receptor-mediated p53 transcriptional activity is involved in PC12 differentiation and may suggest a contributory role for p53 in neuronal development.
RITA enhances chemosensivity of pre-B ALL cells to doxorubicin by inducing p53-dependent apoptosis.
Kazemi, Ahmad; Safa, Majid; Shahbazi, Atefeh
2011-07-01
The use of low-molecular-weight, non-peptidic molecules that disrupt the interaction between the p53 tumor suppressor and its negative regulator MDM2 has provided a promising alternative for the treatment of different types of cancer. Here, we used small-molecule reactivation of p53 and induction of tumor cell apoptosis (RITA) to sensitize leukemic NALM-6 cells to doxorubicin by upregulating p53 protein. RITA alone effectively inhibited NALM-6 cells viability in dose-dependent manner as measured by 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide assay and induced apoptosis as evaluated by flow cytometry, whereas RITA in combination with doxorubicin enhanced NALM-6 cells to doxorubicin-sensitivity and promoted doxorubicin induced apoptosis. Levels of p53 protein and its proapoptotic target genes, quantified by western blot and real-time PCR respectively, showed that expression of p53 was significantly increased after RITA treatment. Using p53 inhibitors PFT-alpha and PFT-mu it was shown that p53-mediated apoptosis induced by RITA can be regulated by both p53-transcription-dependent and -independent pathways. Moreover, RITA-induced apoptosis was accompanied by the activation of caspase-3 and PARP cleavage. Therefore, exploiting synergistic effects between RITA and chemotherapeutics might be an effective clinical strategy for leukemia chemotherapy.
P53-dependent upregulation of neutral sphingomyelinase-2: role in doxorubicin-induced growth arrest.
Shamseddine, A A; Clarke, C J; Carroll, B; Airola, M V; Mohammed, S; Rella, A; Obeid, L M; Hannun, Y A
2015-10-29
Neutral sphingomyelinase-2 (nSMase2) is a ceramide-generating enzyme that has been implicated in growth arrest, apoptosis and exosome secretion. Although previous studies have reported transcriptional upregulation of nSMase2 in response to daunorubicin, through Sp1 and Sp3 transcription factors, the role of the DNA damage pathway in regulating nSMase2 remains unclear. In this study, we show that doxorubicin induces a dose-dependent induction of nSMase2 mRNA and protein with concomitant increases in nSMase activity and ceramide levels. Upregulation of nSMase2 was dependent on ATR, Chk1 and p53, thus placing it downstream of the DNA damage pathway. Moreover, overexpression of p53 was sufficient to transcriptionally induce nSMase2, without the need for DNA damage. DNA-binding mutants as well as acetylation mutants of p53 were unable to induce nSMase2, suggesting a role of nSMase2 in growth arrest. Moreover, knockdown of nSMase2 prevented doxorubicin-induced growth arrest. Finally, p53-induced nSMase2 upregulation appears to occur via a novel transcription start site upstream of exon 3. These results identify nSMase2 as a novel p53 target gene, regulated by the DNA damage pathway to induce cell growth arrest.
A nanobody modulates the p53 transcriptional program without perturbing its functional architecture
Bethuyne, Jonas; De Gieter, Steven; Zwaenepoel, Olivier; Garcia-Pino, Abel; Durinck, Kaat; Verhelle, Adriaan; Hassanzadeh-Ghassabeh, Gholamreza; Speleman, Frank; Loris, Remy; Gettemans, Jan
2014-01-01
The p53 transcription factor plays an important role in genome integrity. To perform this task, p53 regulates the transcription of genes promoting various cellular outcomes including cell cycle arrest, apoptosis or senescence. The precise regulation of this activity remains elusive as numerous mechanisms, e.g. posttranslational modifications of p53 and (non-)covalent p53 binding partners, influence the p53 transcriptional program. We developed a novel, non-invasive tool to manipulate endogenous p53. Nanobodies (Nb), raised against the DNA-binding domain of p53, allow us to distinctively target both wild type and mutant p53 with great specificity. Nb3 preferentially binds ‘structural’ mutant p53, i.e. R175H and R282W, while a second but distinct nanobody, Nb139, binds both mutant and wild type p53. The co-crystal structure of the p53 DNA-binding domain in complex with Nb139 (1.9 Å resolution) reveals that Nb139 binds opposite the DNA-binding surface. Furthermore, we demonstrate that Nb139 does not disturb the functional architecture of the p53 DNA-binding domain using conformation-specific p53 antibody immunoprecipitations, glutaraldehyde crosslinking assays and chromatin immunoprecipitation. Functionally, the binding of Nb139 to p53 allows us to perturb the transactivation of p53 target genes. We propose that reduced recruitment of transcriptional co-activators or modulation of selected post-transcriptional modifications account for these observations. PMID:25324313
Thymocyte apoptosis induced by p53-dependent and independent pathways
International Nuclear Information System (INIS)
Clarke, A.R.; Purdie, C.A.; Harrison, D.J.; Morris, R.G.; Bird, C.C.; Hooper, M.L.; Wyllie, A.H.
1993-01-01
The authors studied the dependence of apoptosis on p53 expression in cells from the thymus cortex. Short-term thymocyte cultures were prepared from mice constitutively heterozygous or homozygous for a deletion in the p53 gene introduced into the germ line after gene targeting. Wild-type thymocytes readily undergo apoptosis after treatment with ionizing radiation, the glucocorticoid methylprednisolone, or etoposide (an inhibitor of topoisomerase II), or after Ca 2+ -dependent activation by phorbol ester and a calcium ionophore. In contrast, homozygous null p53 thymocytes are resistant to induction of apoptosis by radiation or etoposide, but retain normal sensitivity to glucocorticoid and calcium. The time-dependent apoptosis that occurs in untreated cultures is unaffected by p53 status. Cells heterozygous for p53 deletion are partially resistant to radiation and etoposide. Results show that p53 exerts a significant and dose-dependent effect in the initiation of apoptosis, but only when it is induced by agents that cause DNA-strand breakage. (Author)
Regulation of p53 tetramerization and nuclear export by ARC.
Foo, Roger S-Y; Nam, Young-Jae; Ostreicher, Marc Jason; Metzl, Mark D; Whelan, Russell S; Peng, Chang-Fu; Ashton, Anthony W; Fu, Weimin; Mani, Kartik; Chin, Suet-Feung; Provenzano, Elena; Ellis, Ian; Figg, Nichola; Pinder, Sarah; Bennett, Martin R; Caldas, Carlos; Kitsis, Richard N
2007-12-26
Inactivation of the transcription factor p53 is central to carcinogenesis. Yet only approximately one-half of cancers have p53 loss-of-function mutations. Here, we demonstrate a mechanism for p53 inactivation by apoptosis repressor with caspase recruitment domain (ARC), a protein induced in multiple cancer cells. The direct binding in the nucleus of ARC to the p53 tetramerization domain inhibits p53 tetramerization. This exposes a nuclear export signal in p53, triggering Crm1-dependent relocation of p53 to the cytoplasm. Knockdown of endogenous ARC in breast cancer cells results in spontaneous tetramerization of endogenous p53, accumulation of p53 in the nucleus, and activation of endogenous p53 target genes. In primary human breast cancers with nuclear ARC, p53 is almost always WT. Conversely, nearly all breast cancers with mutant p53 lack nuclear ARC. We conclude that nuclear ARC is induced in cancer cells and negatively regulates p53.
Zhang, Jing; Biggar, Kyle K; Storey, Kenneth B
2013-01-15
The red-eared slider turtle (Trachemys scripta elegans) exhibits well-developed natural anoxia tolerance that depends on multiple biochemical adaptations, including anoxia-induced hypometabolism. We hypothesized that signaling by the p53 protein could aid in establishing the hypometabolic state by arresting the cell cycle, protecting against DNA damage as well as altering pathways of energy metabolism. Immunoblotting was used to evaluate the regulation and post-transcriptional modifications of p53 in liver and skeletal muscle of red-eared slider turtles subjected to 5h or 20h of anoxic submergence. Tissue specific regulation of p53 was observed with the liver showing a more rapid activation of p53 in response to anoxia as well as differential expression of seven serine phosphorylation and two lysine acetylation sites when compared with skeletal muscle. Protein expression of MDM2, a major p53 inhibitor, was also examined but did not change during anoxia. Reverse-transcriptase PCR was used to assess transcript levels of selected p53 target genes (14-3-3σ, Gadd45α and Pgm) and one microRNA (miR-34a); results showed down-regulation of Pgm and up-regulation of the other three. These findings show an activation of p53 in response to anoxia exposure and suggest an important role for the p53 stress response pathway in regulating natural anoxia tolerance and hypometabolism in a vertebrate facultative anaerobe. Copyright © 2012 Elsevier B.V. All rights reserved.
p21-LacZ reporter mice reflect p53-dependent toxic insult
International Nuclear Information System (INIS)
Vasey, Douglas B.; Wolf, C. Roland; MacArtney, Thomas; Brown, Ken; Whitelaw, C. Bruce A.
2008-01-01
There is an urgent need to discover less toxic and more selective drugs to treat disease. The use of transgenic mice that report on toxic insult-induced transcription can provide a valuable tool in this regard. To exemplify this strategy, we have generated transgenic mice carrying a p21-LacZ transgene. Transgene activity reflected endogenous p21 gene activation in various tissues, displayed compound-specific spatial expression signatures in the brain and immune tissues and enabled p53-dependent and p53-independent responses to be identified. We discuss the application of these mice in delineating the molecular events in normal cellular growth and disease and for the evaluation of drug toxicity
Neitemeier, Sandra; Ganjam, Goutham K; Diemert, Sebastian; Culmsee, Carsten
2014-12-01
Impaired mitochondrial integrity and function are key features of intrinsic death pathways in neuronal cells. Therefore, key regulators of intrinsic death pathways acting upstream of mitochondria are potential targets for therapeutic approaches of neuroprotection. The tumor suppressor p53 is a well-established regulator of cellular responses towards different kinds of lethal stress, including oxidative stress. Recent reports suggested that p53 may affect mitochondrial integrity and function through both, transcriptional activation of mitochondria-targeted pro-death proteins and direct effects at the mitochondrial membrane. In the present study, we compared the effects of pharmacological inhibition of p53 by pifithrin-α with those of selective p53 gene silencing by RNA interference. Using MTT assay and real-time cell impedance measurements we confirmed the protective effect of both strategies against glutamate-induced oxidative stress in immortalized mouse hippocampal HT-22 neurons. Further, we observed full restoration of mitochondrial membrane potential and inhibition of glutamate-induced mitochondrial fragmentation by pifithrin-α which was, in contrast, not achieved by p53 gene silencing. Downregulation of p53 by siRNA decreased p53 transcriptional activity and reduced expression levels of p21 mRNA, while pifithrin-α did not affect these endpoints. These results suggest a neuroprotective effect of pifithrin-α which occurred at the level of mitochondria and independently of p53 inhibition.
RUNX Family Participates in the Regulation of p53-Dependent DNA Damage Response
Directory of Open Access Journals (Sweden)
Toshinori Ozaki
2013-01-01
Full Text Available A proper DNA damage response (DDR, which monitors and maintains the genomic integrity, has been considered to be a critical barrier against genetic alterations to prevent tumor initiation and progression. The representative tumor suppressor p53 plays an important role in the regulation of DNA damage response. When cells receive DNA damage, p53 is quickly activated and induces cell cycle arrest and/or apoptotic cell death through transactivating its target genes implicated in the promotion of cell cycle arrest and/or apoptotic cell death such as p21WAF1, BAX, and PUMA. Accumulating evidence strongly suggests that DNA damage-mediated activation as well as induction of p53 is regulated by posttranslational modifications and also by protein-protein interaction. Loss of p53 activity confers growth advantage and ensures survival in cancer cells by inhibiting apoptotic response required for tumor suppression. RUNX family, which is composed of RUNX1, RUNX2, and RUNX3, is a sequence-specific transcription factor and is closely involved in a variety of cellular processes including development, differentiation, and/or tumorigenesis. In this review, we describe a background of p53 and a functional collaboration between p53 and RUNX family in response to DNA damage.
DEFF Research Database (Denmark)
Williams, Kristine; Christensen, Jesper; Rappsilber, Juri
2014-01-01
linked to the regulation of different biological processes such as differentiation of embryonic stem cells, inflammatory responses in macrophages, and induction of cellular senescence via regulation of the INK4A-ARF locus. Here we show here that JMJD3 interacts with the tumour suppressor protein p53. We...... find that the interaction is dependent on the p53 tetramerization domain. Following DNA damage, JMJD3 is transcriptionally upregulated and by performing genome-wide mapping of JMJD3, we demonstrate that it binds genes involved in basic cellular processes, as well as genes regulating cell cycle......, response to stress and apoptosis. Moreover, we find that JMJD3 binding sites show significant overlap with p53 bound promoters and enhancer elements. The binding of JMJD3 to p53 target sites is increased in response to DNA damage, and we demonstrate that the recruitment of JMJD3 to these sites is dependent...
Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6
Energy Technology Data Exchange (ETDEWEB)
Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Yu, Ting, E-mail: t.yu2@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Lang, Matti A., E-mail: m.lang@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Hakkola, Jukka, E-mail: Jukka.hakkola@oulu.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Abu-Bakar, A' edah, E-mail: a.abubakar@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia)
2015-11-15
Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsiveness in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4
Regulation of Mdmx and its role in the p53 pathway
Meulmeester, Erik
2006-01-01
The p53 protein is an important tumor suppressor that acts as a key regulator of the integrity of the genome. Two essential regulators of the p53 protein are Mdm2 and its homologue Mdmx. Like Mdm2, Mdmx represses p53-induced transcription. However, Mdmx cannot ubiquitinate or degrade p53 opposed to
Energy Technology Data Exchange (ETDEWEB)
Cappadone, C., E-mail: concettina.cappadone@unibo.it [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Stefanelli, C. [Department for Life Quality Studies, University of Bologna, Rimini Campus, Rimini (Italy); Malucelli, E. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Zini, M. [Department of Biomedical and Neuromotor Sciences, University of Bologna, Bologna (Italy); Onofrillo, C. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Locatelli, A.; Rambaldi, M.; Sargenti, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Merolle, L. [ELETTRA–Sincrotrone Trieste S.C.p.A., Trieste (Italy); Farruggia, G. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy); Graziadio, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Montanaro, L. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Iotti, S. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy)
2015-11-13
Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.
International Nuclear Information System (INIS)
Cappadone, C.; Stefanelli, C.; Malucelli, E.; Zini, M.; Onofrillo, C.; Locatelli, A.; Rambaldi, M.; Sargenti, A.; Merolle, L.; Farruggia, G.; Graziadio, A.; Montanaro, L.; Iotti, S.
2015-01-01
Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.
Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda
International Nuclear Information System (INIS)
Mohareer, Krishnaveni; Sahdev, Sudhir; Hasnain, Seyed E.
2011-01-01
Highlights: ► Baculovirus p35 is regulated by both viral and host factors. ► Baculovirus p35 is negatively regulated by SfP53-like factor. ► Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at −1401 while P53 motif is at −1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.
Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda
Energy Technology Data Exchange (ETDEWEB)
Mohareer, Krishnaveni [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Sahdev, Sudhir [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Ranbaxy Pharmaceuticals, Gurgaon, New Delhi (India); Hasnain, Seyed E., E-mail: seh@bioschool.iitd.ac.in [Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Kusuma School of Biological Sciences, IIT Delhi, New Delhi 110016 (India); ILBS, Vasant Kunj, New Delhi (India); King Saud University, Riyadh, KSA (Saudi Arabia)
2011-11-04
Highlights: Black-Right-Pointing-Pointer Baculovirus p35 is regulated by both viral and host factors. Black-Right-Pointing-Pointer Baculovirus p35 is negatively regulated by SfP53-like factor. Black-Right-Pointing-Pointer Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at -1401 while P53 motif is at -1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.
Directory of Open Access Journals (Sweden)
Ching-Hao Li
2010-02-01
Full Text Available p53, can regulate cell apoptosis in both transcription-dependent and -independent manners. The transcription-independent pathway was demonstrated by the translocation of p53 to mitochondria. Our study showed that p53 mitochondrial translocation was found in mitomycin C (MMC-treated HepG2. The p53 C-terminal domain is clustered with potential nuclear leading sequences and showed strong electrostatic ion-ion interactions with cardiolipin, phosphatidylglycerol and phosphatidic acid in vitro. Disruption of cardiolipin biosynthesis by phosphatidylglycero-phosphate synthase (PGS or CDP-diacylglycerol synthase 2 (CDS-2 short hairpin RNA (shRNA transfection eliminated the MMC-induced translocation of mitochondrial p53. The elimination of mitochondrial p53 translocation also reduced Bcl-xL and Bcl-2 mitochondrial distribution. In HEK 293T models with saturated p53 expression, the mitochondrial partition of p53, Bcl-xL, and Bcl-2 obviously decreased in their PGS shRNA- or CDS-2 shRNA-expressing stable clones. In p53-null H1299 models, both the mitochondrial partitions of Bcl-xL and Bcl-2 were strongly reduced in relation to the HEK 293T models. The Bcl-xL mitochondrial partition was elevated in H1299 models expressing pCEP4-p53wt suggesting the direct carrier role of p53 in transporting Bcl-xL to the mitochondria. We also found that the cytosolic pool of Bcl-xL and Bcl-2 remained unaffected in the low-dose MMC treatment but decreased in the high-dose MMC treatment. The cytosolic pool of Bcl-2 and Bcl-xL directly regulated their amounts in p53-dependent mitochondrial distribution. In the low-dose MMC treatment, the increased mitochondrial p53, Bcl-xL, and Bcl-2 could attenuate apoptosis. However, in the high-dose MMC treatment, only the p53 translocated to the mitochondria and resulted in apoptosis progression. On the basis of this study, we thought mitochondrial p53 might regulate apoptosis in a biphasic manner.
Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H
2014-07-10
Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.
Apaf-1 is a transcriptional target for E2F and p53
DEFF Research Database (Denmark)
Moroni, M C; Hickman, E S; Lazzerini Denchi, E
2001-01-01
between the deregulation of the pRB pathway and apoptosis. Furthermore, because the pRB pathway is functionally inactivated in most cancers, the identification of Apaf-1 as a transcriptional target for E2F might explain the increased sensitivity of tumour cells to chemotherapy. We also show that......, independently of the pRB pathway, Apaf-1 is a direct transcriptional target of p53, suggesting that p53 might sensitize cells to apoptosis by increasing Apaf-1 levels....
Directory of Open Access Journals (Sweden)
Tayebeh Hamzehloie
2012-03-01
Full Text Available The gene TP53 (also known as protein 53 or tumor protein 53, encoding transcription factor P53, is mutated or deleted in half of human cancers, demonstrating the crucial role of P53 in tumor suppression. There are reports of nearly 250 independent germ line TP53 mutations in over 100 publications. The P53 protein has the structure of a transcription factor and, is made up of several domains. The main function of P53 is to organize cell defense against cancerous transformation. P53 is a potent transcription factor that is activated in response to diverse stresses, leading to the induction of cell cycle arrest, apoptosis or senescence. The P53 tumor suppressor is negatively regulated in cells by the murine double minute 2 (MDM2 protein. Murine double minute 2 favors its nuclear export, and stimulates its degradation. Inhibitors of the P53-MDM2 interaction might be attractive new anticancer agents that could be used to activate wild-type P53 in tumors. Down regulation of MDM2 using an small interfering RNA (siRNA approach has recently provided evidence for a new role of MDM2 in the P53 response, by modulating the inhibition of the cyclin dependent kinase 2 (cdk2 by P21/WAF1 (also known as cyclin-dependent kinase inhibitor 1 or CDK-interacting protein 1.
p53-Dependent and -Independent Epithelial Integrity: Beyond miRNAs and Metabolic Fluctuations
Directory of Open Access Journals (Sweden)
Tsukasa Oikawa
2018-05-01
Full Text Available In addition to its classical roles as a tumor suppressor, p53 has also been shown to act as a guardian of epithelial integrity by inducing the microRNAs that target transcriptional factors driving epithelial–mesenchymal transition. On the other hand, the ENCODE project demonstrated an enrichment of putative motifs for the binding of p53 in epithelial-specific enhancers, such as CDH1 (encoding E-cadherin enhancers although its biological significance remained unknown. Recently, we identified two novel modes of epithelial integrity (i.e., maintenance of CDH1 expression: one involves the binding of p53 to a CDH1 enhancer region and the other does not. In the former, the binding of p53 is necessary to maintain permissive histone modifications around the CDH1 transcription start site, whereas in the latter, p53 does not bind to this region nor affect histone modifications. Furthermore, these mechanisms likely coexisted within the same tissue. Thus, the mechanisms involved in epithelial integrity appear to be much more complex than previously thought. In this review, we describe our findings, which may instigate further experimental scrutiny towards understanding the whole picture of epithelial integrity as well as the related complex asymmetrical functions of p53. Such understanding will be important not only for cancer biology but also for the safety of regenerative medicine.
The antagonism between MCT-1 and p53 affects the tumorigenic outcomes
Directory of Open Access Journals (Sweden)
Lin Tai-Du
2010-12-01
Full Text Available Abstract Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1 are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development.
Stabilization and activation of p53 are regulated independently by different phosphorylation events
Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.
1998-01-01
Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitut...
Polycomb Group Protein PHF1 Regulates p53-dependent Cell Growth Arrest and Apoptosis*
Yang, Yang; Wang, Chenji; Zhang, Pingzhao; Gao, Kun; Wang, Dejie; Yu, Hongxiu; Zhang, Ting; Jiang, Sirui; Hexige, Saiyin; Hong, Zehui; Yasui, Akira; Liu, Jun O.; Huang, Haojie; Yu, Long
2013-01-01
Polycomb group protein PHF1 is well known as a component of a novel EED-EZH2·Polycomb repressive complex 2 complex and plays important roles in H3K27 methylation and Hox gene silencing. PHF1 is also involved in the response to DNA double-strand breaks in human cells, promotes nonhomologous end-joining processes through interaction with Ku70/Ku80. Here, we identified another function of PHF1 as a potential p53 pathway activator in a pathway screen using luminescence reporter assay. Subsequent studies showed PHF1 directly interacts with p53 proteins both in vivo and in vitro and co-localized in nucleus. PHF1 binds to the C-terminal regulatory domain of p53. Overexpression of PHF1 elevated p53 protein level and prolonged its turnover. Knockdown of PHF1 reduced p53 protein level and its target gene expression both in normal state and DNA damage response. Mechanically, PHF1 protects p53 proteins from MDM2-mediated ubiquitination and degradation. Furthermore, we showed that PHF1 regulates cell growth arrest and etoposide-induced apoptosis in a p53-dependent manner. Finally, PHF1 expression was significantly down-regulated in human breast cancer samples. Taken together, we establish PHF1 as a novel positive regulator of the p53 pathway. These data shed light on the potential roles of PHF1 in tumorigenesis and/or tumor progression. PMID:23150668
International Nuclear Information System (INIS)
Turinetto, Valentina; Porcedda, Paola; Orlando, Luca; De Marchi, Mario; Amoroso, Antonio; Giachino, Claudia
2009-01-01
Current chemotherapy of human cancers focuses on the DNA damage pathway to induce a p53-mediated cellular response leading to either G1 arrest or apoptosis. However, genotoxic treatments may induce mutations and translocations that result in secondary malignancies or recurrent disease. In addition, about 50% of human cancers are associated with mutations in the p53 gene. Nongenotoxic activation of apoptosis by targeting specific molecular pathways thus provides an attractive therapeutic approach. Normal and leukemic cells were evaluated for their sensitivity to 5, 6-dichloro-1-beta-D-ribofuranosylbenzimidazole (DRB) through cell viability and caspase activation tests. The apoptotic pathway induced by DRB was analysed by immunfluorescence and immunoblot analysis. H2AX phosphorylation and cell cycle analysis were performed to study the dependance of apoptosis on DNA damage and DNA replication, respectively. To investigate the role of p53 in DRB-induced apoptosis, specific p53 inhibitors were used. Statistical analysis on cell survival was performed with the test of independence. Here we report that DRB, an inhibitor of the transcriptional cyclin-dependent kinases (CDKs) 7 and 9, triggers DNA replication-independent apoptosis in normal and leukemic human cells regardless of their p53 status and without inducing DNA damage. Our data indicate that (i) in p53-competent cells, apoptosis induced by DRB relies on a cytosolic accumulation of p53 and subsequent Bax activation, (ii) in the absence of p53, it may rely on p73, and (iii) it is independent of ATM and NBS1 proteins. Notably, even apoptosis-resistant leukemic cells such as Raji were sensitive to DRB. Our results indicate that DRB represents a potentially useful cancer chemotherapeutic strategy that employs both the p53-dependent and -independent apoptotic pathways without inducing genotoxic stress, thereby decreasing the risk of secondary malignancies
Non-Canonical Cell Death Induced by p53
Directory of Open Access Journals (Sweden)
Atul Ranjan
2016-12-01
Full Text Available Programmed cell death is a vital biological process for multicellular organisms to maintain cellular homeostasis, which is regulated in a complex manner. Over the past several years, apart from apoptosis, which is the principal mechanism of caspase-dependent cell death, research on non-apoptotic forms of programmed cell death has gained momentum. p53 is a well characterized tumor suppressor that controls cell proliferation and apoptosis and has also been linked to non-apoptotic, non-canonical cell death mechanisms. p53 impacts these non-canonical forms of cell death through transcriptional regulation of its downstream targets, as well as direct interactions with key players involved in these mechanisms, in a cell type- or tissue context-dependent manner. In this review article, we summarize and discuss the involvement of p53 in several non-canonical modes of cell death, including caspase-independent apoptosis (CIA, ferroptosis, necroptosis, autophagic cell death, mitotic catastrophe, paraptosis, and pyroptosis, as well as its role in efferocytosis which is the process of clearing dead or dying cells.
Pardossi-Piquard, Raphaëlle; Dunys, Julie; Giaime, Emilie; Guillot-Sestier, Marie-Victoire; St George-Hyslop, Peter; Checler, Frédéric; Alves da Costa, Cristine
2009-04-01
Nicastrin (NCT) is a component of the presenilin (PS)-dependent gamma-secretase complexes that liberate amyloid beta-peptides from the beta-Amyloid Precursor Protein. Several lines of evidence indicate that the members of these complexes could also contribute to the control of cell death. Here we show that over-expression of NCT increases the viability of human embryonic kidney (HEK293) cells and decreases staurosporine (STS)- and thapsigargin (TPS)-induced caspase-3 activation in various cell lines from human and neuronal origins by Akt-dependent pathway. NCT lowers p53 expression, transcriptional activity and promoter transactivation and reduces p53 phosphorylation. NCT-associated protection against STS-stimulated cell death was completely abolished by p53 deficiency. Conversely, the depletion of NCT drastically enhances STS-induced caspase-3 activation and p53 pathway and favored p53 nuclear translocation. We examined whether NCT protective function depends on PS-dependent gamma-secretase activity. First, a 29-amino acid deletion known to reduce NCT-dependent amyloid beta-peptide production did not affect NCT-associated protective phenotype. Second, NCT still reduces STS-induced caspase-3 activation in fibroblasts lacking PS1 and PS2. Third, the gamma-secretase inhibitor DFK167 did not affect NCT-mediated reduction of p53 activity. Altogether, our study indicates that NCT controls cell death via phosphoinositide 3-kinase/Akt and p53-dependent pathways and that this function remains independent of the activity and molecular integrity of the gamma-secretase complexes.
DEFF Research Database (Denmark)
Savelyeva, I.; Dobbelstein, M.
2011-01-01
to the suppression of p21 transcription. Depending on the E1A conserved region 3, E1B-defective adenovirus impaired the ability of the transcription factor Sp1 to bind the p21 promoter. Moreover, the amino terminal region of E1A, binding the acetyl transferases p300 and CREB-binding protein, blocked p53 K382...... accumulation of p53, without obvious defects in p53 localization, phosphorylation, conformation and oligomerization. Nonetheless, p53 completely failed to induce its target genes in this scenario, for example, p21/CDKN1A, Mdm2 and PUMA. Two regions of the E1A gene products independently contributed...... acetylation in infected cells. Mutating either of these E1A regions, in addition to E1B, partially restored p21 mRNA levels. Our findings argue that adenovirus attenuates p53-mediated p21 induction, through at least two E1B-independent mechanisms. Other virus species and cancer cells may employ analogous...
A p53-independent role for the MDM2 antagonist Nutlin-3 in DNA damage response initiation
Directory of Open Access Journals (Sweden)
Kumar Sonia
2011-02-01
Full Text Available Abstract Background The mammalian DNA-damage response (DDR has evolved to protect genome stability and maximize cell survival following DNA-damage. One of the key regulators of the DDR is p53, itself tightly regulated by MDM2. Following double-strand DNA breaks (DSBs, mediators including ATM are recruited to the site of DNA-damage. Subsequent phosphorylation of p53 by ATM and ATM-induced CHK2 results in p53 stabilization, ultimately intensifying transcription of p53-responsive genes involved in DNA repair, cell-cycle checkpoint control and apoptosis. Methods In the current study, we investigated the stabilization and activation of p53 and associated DDR proteins in response to treatment of human colorectal cancer cells (HCT116p53+/+ with the MDM2 antagonist, Nutlin-3. Results Using immunoblotting, Nutlin-3 was observed to stabilize p53, and activate p53 target proteins. Unexpectedly, Nutlin-3 also mediated phosphorylation of p53 at key DNA-damage-specific serine residues (Ser15, 20 and 37. Furthermore, Nutlin-3 induced activation of CHK2 and ATM - proteins required for DNA-damage-dependent phosphorylation and activation of p53, and the phosphorylation of BRCA1 and H2AX - proteins known to be activated specifically in response to DNA damage. Indeed, using immunofluorescent labeling, Nutlin-3 was seen to induce formation of γH2AX foci, an early hallmark of the DDR. Moreover, Nutlin-3 induced phosphorylation of key DDR proteins, initiated cell cycle arrest and led to formation of γH2AX foci in cells lacking p53, whilst γH2AX foci were also noted in MDM2-deficient cells. Conclusion To our knowledge, this is the first solid evidence showing a secondary role for Nutlin-3 as a DDR triggering agent, independent of p53 status, and unrelated to its role as an MDM2 antagonist.
Crescenzi, Elvira; Raia, Zelinda; Pacifico, Francesco; Mellone, Stefano; Moscato, Fortunato; Palumbo, Giuseppe; Leonardi, Antonio
2013-01-01
Premature or drug-induced senescence is a major cellular response to chemotherapy in solid tumors. The senescent phenotype develops slowly and is associated with chronic DNA damage response. We found that expression of wild-type p53-induced phosphatase 1 (Wip1) is markedly down-regulated during persistent DNA damage and after drug release during the acquisition of the senescent phenotype in carcinoma cells. We demonstrate that down-regulation of Wip1 is required for maintenance of permanent G2 arrest. In fact, we show that forced expression of Wip1 in premature senescent tumor cells induces inappropriate re-initiation of mitosis, uncontrolled polyploid progression, and cell death by mitotic failure. Most of the effects of Wip1 may be attributed to its ability to dephosphorylate p53 at Ser15 and to inhibit DNA damage response. However, we also uncover a regulatory pathway whereby suppression of p53 Ser15 phosphorylation is associated with enhanced phosphorylation at Ser46, increased p53 protein levels, and induction of Noxa expression. On the whole, our data indicate that down-regulation of Wip1 expression during premature senescence plays a pivotal role in regulating several p53-dependent aspects of the senescent phenotype. PMID:23612976
Hale, T K; Braithwaite, A W
1999-08-20
Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.
International Nuclear Information System (INIS)
An, Joo-Hee; Kim, Jung-Woong; Jang, Sang-Min; Kim, Chul-Hong; Kang, Eun-Jin; Choi, Kyung-Hee
2011-01-01
Highlights: → The actin binding protein Gelsolin (GSN) interacts with transcription factor p53. → GSN interacts with transactivation- and DNA binding domains of p53. → GSN represses transactivity of p53 via inhibition of nuclear translocation of p53. → GSN inhibits the p53-mediated apoptosis in hepatocarcinoma HepG2 cells. -- Abstract: As a transcription factor, p53 modulates several cellular responses including cell-cycle control, apoptosis, and differentiation. In this study, we have shown that an actin regulatory protein, gelsolin (GSN), can physically interact with p53. The nuclear localization of p53 is inhibited by GSN overexpression in hepatocarcinoma HepG2 cells. Additionally, we demonstrate that GSN negatively regulates p53-dependent transcriptional activity of a reporter construct, driven by the p21-promoter. Furthermore, p53-mediated apoptosis was repressed in GSN-transfected HepG2 cells. Taken together, these results suggest that GSN binds to p53 and this interaction leads to the inhibition of p53-induced apoptosis by anchoring of p53 in the cytoplasm in HepG2 cells.
Yu, Miao; King, Brenee; Ewert, Emily; Su, Xiaoyu; Mardiyati, Nur; Zhao, Zhihui; Wang, Weiqun
2016-01-01
Exercise has been previously reported to lower cancer risk through reducing circulating IGF-1 and IGF-1-dependent signaling in a mouse skin cancer model. This study aims to investigate the underlying mechanisms by which exercise may down-regulate the IGF-1 pathway via p53 and p53-related regulators in the skin epidermis. Female SENCAR mice were pair-fed an AIN-93 diet with or without 10-week treadmill exercise at 20 m/min, 60 min/day and 5 days/week. Animals were topically treated with TPA 2 hours before sacrifice and the target proteins in the epidermis were analyzed by both immunohistochemistry and Western blot. Under TPA or vehicle treatment, MDM2 expression was significantly reduced in exercised mice when compared with sedentary control. Meanwhile, p53 was significantly elevated. In addition, p53-transcriptioned proteins, i.e., p21, IGFBP-3, and PTEN, increased in response to exercise. There was a synergy effect between exercise and TPA on the decreased MDM2 and increased p53, but not p53-transcripted proteins. Taken together, exercise appeared to activate p53, resulting in enhanced expression of p21, IGFBP-3, and PTEN that might induce a negative regulation of IGF-1 pathway and thus contribute to the observed cancer prevention by exercise in this skin cancer model.
Arecoline-induced growth arrest and p21WAF1 expression are dependent on p53 in rat hepatocytes
International Nuclear Information System (INIS)
Chou, W.-W.; Guh, J.-Y.; Tsai, J.-F.; Hwang, C.-C.; Chen, H.-C.; Huang, J.-S.; Yang, Y.-L.; Hung, W.-C.; Chuang, L.-Y.
2008-01-01
Betel-quid use is associated with the risk of liver cirrhosis and hepatocellular carcinoma and arecoline, the major alkaloid of betel-quid, is hepatotoxic in mice. Therefore, we studied the cytotoxic and genotoxic effects of arecoline in normal rat hepatocytes (Clone-9 cells). Arecoline dose-dependently (0.1-1 mM) decreased cell cycle-dependent proliferation while inducing DNA damage at 24 h. Moreover, arecoline (1 mM)-induced apoptosis and necrosis at 24 h. Arecoline dose-dependently (0.1-0.5 mM) increased transforming growth factor-β (TGF-β) mRNA, gene transcription and bioactivity and neutralizing TGF-β antibody attenuated arecoline (0.5 mM)-inhibited cell proliferation at 24 h. Arecoline (0.5 mM) also increased p21 WAF1 protein expression and p21 WAF1 gene transcription. Moreover, arecoline (0.5 mM) time-dependently (8-24 h) increased p53 serine 15 phosphorylation. Pifithrin-α (p53 inhibitor) and the loss of the two p53-binding elements in the p21 WAF1 gene promoter attenuated arecoline-induced p21 WAF1 gene transcription at 24 h. Pifithrin-α also attenuated arecoline (0.5 mM)-inhibited cell proliferation at 24 h. We concluded that arecoline induces cytotoxicity, DNA damage, G 0 /G 1 cell cycle arrest, TGF-β1, p21 WAF1 and activates p53 in Clone-9 cells. Moreover, arecoline-induced p21 WAF1 is dependent on p53 while arecoline-inhibited growth is dependent on both TGF-β and p53
Directory of Open Access Journals (Sweden)
Qiong Jia
Full Text Available Diamond-Blackfan anemia (DBA is a rare inherited bone marrow failure syndrome that is characterized by pure red-cell aplasia and associated physical deformities. It has been proven that defects of ribosomal proteins can lead to this disease and that RPS19 is the most frequently mutated gene in DBA patients. Previous studies suggest that p53-dependent genes and pathways play important roles in RPS19-deficient embryos. However, whether there are other vital factors linked to DBA has not been fully clarified. In this study, we compared the whole genome RNA-Seq data of zebrafish embryos injected with RPS19 morpholino (RPS19 MO, RPS19 and p53 morpholino simultaneously (RPS19+p53 MO and control morpholino (control. We found that genes enriched in the functions of hematological systems, nervous system development and skeletal and muscular disorders had significant differential expression in RPS19 MO embryos compared with controls. Co-inhibition of p53 partially alleviates the abnormalities for RPS19-deficient embryos. However, the hematopoietic genes, which were down-regulated significantly in RPS19 MO embryos, were not completely recovered by the co-inhibition of p53. Furthermore, we identified the genome-wide p53-dependent and -independent genes and pathways. These results indicate that not only p53 family members but also other factors have important impacts on RPS19-deficient embryos. The detection of potential pathogenic genes and pathways provides us a new paradigm for future research on DBA, which is a systematic and complex hereditary disease.
The nucleolus directly regulates p53 export and degradation.
Boyd, Mark T; Vlatkovic, Nikolina; Rubbi, Carlos P
2011-09-05
The correlation between stress-induced nucleolar disruption and abrogation of p53 degradation is evident after a wide variety of cellular stresses. This link may be caused by steps in p53 regulation occurring in nucleoli, as suggested by some biochemical evidence. Alternatively, nucleolar disruption also causes redistribution of nucleolar proteins, potentially altering their interactions with p53 and/or MDM2. This raises the fundamental question of whether the nucleolus controls p53 directly, i.e., as a site where p53 regulatory processes occur, or indirectly, i.e., by determining the cellular localization of p53/MDM2-interacting factors. In this work, transport experiments based on heterokaryons, photobleaching, and micronucleation demonstrate that p53 regulatory events are directly regulated by nucleoli and are dependent on intact nucleolar structure and function. Subcellular fractionation and nucleolar isolation revealed a distribution of ubiquitylated p53 that supports these findings. In addition, our results indicate that p53 is exported by two pathways: one stress sensitive and one stress insensitive, the latter being regulated by activities present in the nucleolus.
International Nuclear Information System (INIS)
Kuo, Kung-Kai; Chen, Yi-Ling; Chen, Lih-Ren; Li, Chien-Feng; Lan, Yu-Hsuan; Chang, Fang-Rong; Wu, Yang-Chang; Shiue, Yow-Ling
2011-01-01
The objective was to investigate the upstream apoptotic mechanisms that were triggered by a styrylpyrone derivative, goniothalamin (GTN), in tumor protein p53 (TP53)-positive and -negative hepatocellular carcinoma (HCC)-derived cells. Effects of GTN were evaluated by the flow cytometry, alkaline comet assay, immunocytochemistry, small-hairpin RNA interference, mitochondria/cytosol fractionation, quantitative reverse transcription-polymerase chain reaction, immunoblotting analysis and caspase 3 activity assays in two HCC-derived cell lines. Results indicated that GTN triggered phorbol-12-myristate-13-acetate-induced protein 1 (PMAIP1, also known as NOXA)-mediated apoptosis via TP53-dependent and -independent pathways. In TP53-positive SK-Hep1 cells, GTN furthermore induced TP53 transcription-dependent and -independent apoptosis. After GTN treatment, accumulation of reactive oxygen species, formation of DNA double-strand breaks, transactivation of TP53 and/or PMAIP1 gene, translocation of TP53 and/or PMAIP1 proteins to mitochondria, release of cytochrome c from mitochondria, cleavage of caspases and induction of apoptosis in both cell lines were sustained. GTN might represent a novel class of anticancer drug that induces apoptosis in HCC-derived cells through PMAIP1 transactivation regardless of the status of TP53 gene. - Highlights: → Goniothalamin (GTN) induced apoptosis in hepatocellular carcinomas-derived cells. → The apoptosis induced by GTN is PMAIP1-dependent, regardless of TP53 status. → The apoptosis induced by GTN might be TP53 transcription-dependent or -independent. → GTN-induced apoptosis is mitochondria- and caspases-mediated.
Directory of Open Access Journals (Sweden)
Jeyran eShahbazi
2013-05-01
Full Text Available Tumor protein 53-induced nuclear protein 1 (TP53INP1 is a stress-induced p53 target gene whose expression is modulated by transcription factors such as p53, p73 and E2F1. TP53INP1 gene encodes two isoforms of TP53INP1 proteins, TP53INP1α and TP53INP1β, both of which appear to be key elements in p53 function. When associated with homeodomain-interacting protein kinase-2 (HIPK2, TP53INP1 phosphorylates p53 protein at Serine 46, enhances p53 protein stability and its transcriptional activity, leading to transcriptional activation of p53 target genes such as p21, PIG-3 and MDM2, cell growth arrest and apoptosis upon DNA damage stress. The anti-proliferative and pro-apoptotic activities of TP53INP1 indicate that TP53INP1 has an important role in cellular homeostasis and DNA damage response. Deficiency in TP53INP1 expression results in increased tumorigenesis; while TP53INP1 expression is repressed during early stages of cancer by factors such as miR-155. This review aims to summarize the roles of TP53INP1 in blocking tumor progression through p53-dependant and p53-independent pathways, as well as the elements which repress TP53INP1 expression, hence highlighting its potential as a therapeutic target in cancer treatment.
Heat shock factor-1 modulates p53 activity in the transcriptional response to DNA damage
Logan, Ian R.; McNeill, Hesta V.; Cook, Susan; Lu, Xiaohong; Meek, David W.; Fuller-Pace, Frances V.; Lunec, John; Robson, Craig N.
2009-01-01
Here we define an important role for heat shock factor 1 (HSF1) in the cellular response to genotoxic agents. We demonstrate for the first time that HSF1 can complex with nuclear p53 and that both proteins are co-operatively recruited to p53-responsive genes such as p21. Analysis of natural and synthetic cis elements demonstrates that HSF1 can enhance p53-mediated transcription, whilst depletion of HSF1 reduces the expression of p53-responsive transcripts. We find that HSF1 is required for optimal p21 expression and p53-mediated cell-cycle arrest in response to genotoxins while loss of HSF1 attenuates apoptosis in response to these agents. To explain these novel properties of HSF1 we show that HSF1 can complex with DNA damage kinases ATR and Chk1 to effect p53 phosphorylation in response to DNA damage. Our data reveal HSF1 as a key transcriptional regulator in response to genotoxic compounds widely used in the clinical setting, and suggest that HSF1 will contribute to the efficacy of these agents. PMID:19295133
Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.
2009-01-01
Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229
Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo
2014-04-01
p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.
International Nuclear Information System (INIS)
Rodin, S.N.; Rodin, A.S.; Juhasz, A.; Holmquist, G.P.
2002-01-01
The database of tumor-associated p53 base substitutions includes about 5% of tumors with two or more base substitutions. These multiplet base substitutions in one tumor are evidence for hyper-mutagenesis. Our retrospective analysis of this database indicates that most multiplets arise from a single transient hyper-mutagenic event in one cell that subsequently proliferated into a clonal tumor. The hyper-mutagenesis, 1.8x10 -4 substitutions per base pair, is detected as multiple mutations in p53 genes of tumors. It requires one strongly tumorigenic p53 substitution, usually missense, called the driver mutation. The occurrence frequencies of ancillary base substitutions, those that hitch-hike along with the driver mutation, are independent of their amino acid coding properties. In this respect, they act like neutral mutations. In support of this neutrality, we find that the frequency distribution of hitch-hiking CpG transitions along the p53 exons, their mutational spectrum, approximates the spontaneous pre-selection mutational spectrum of most human tissues and is correlated with the mutational spectrum of p53 pseudogenes in mammalian germ cells. The driver substitutions of multiplets predominantly originate along the transcribed strand while the ancillary substitutions tend to originate along the non-transcribed strand. This data is consistent with a model of time-dependent mutagenesis in non-dividing stem cells for generating multiple strand-asymmetric p53 mutations in tumors. By transcriptional bypass of DNA lesions with concomitant misincorporation, transcriptional mutagenesis generates a transient mutant p53 mRNA. The associated mutant p53 protein could allow the host cell a growth advantage, release from G 1 -arrest. Then, during subsequent DNA replication and misreading of the same lesion, the damaged base along the transcribed DNA strand would serve as the origin of the p53 base substitution that drives the hyper-mutagenic event leading to tumors with
Expression of Androgen Receptor Is Negatively Regulated By p53
Directory of Open Access Journals (Sweden)
Fatouma Alimirah
2007-12-01
Full Text Available Increased expression of androgen receptor (AR in prostate cancer (PC is associated with transition to androgen independence. Because the progression of PC to advanced stages is often associated with the loss of p53 function, we tested whether the p53 could regulate the expression of AR gene. Here we report that p53 negatively regulates the expression of AR in prostate epithelial cells (PrECs. We found that in LNCaP human prostate cancer cells that express the wild-type p53 and AR and in human normal PrECs, the activation of p53 by genotoxic stress or by inhibition of p53 nuclear export downregulated the expression of AR. Furthermore, forced expression of p53 in LNCaP cells decreased the expression of AR. Conversely, knockdown of p53 expression in LNCaP cells increased the AR expression. Consistent with the negative regulation of AR expression by p53, the p53-null HCT116 cells expressed higher levels of AR compared with the isogenic HCT116 cells that express the wildtype p53. Moreover, we noted that in etoposide treated LNCaP cells p53 bound to the promoter region of the AR gene, which contains a potential p53 DNA-binding consensus sequence, in chromatin immunoprecipitation assays. Together, our observations provide support for the idea that the loss of p53 function in prostate cancer cells contributes to increased expression of AR.
Directory of Open Access Journals (Sweden)
Danielle B Ulanet
2010-08-01
Full Text Available The Arf tumor suppressor acts as a sensor of oncogenic signals, countering aberrant proliferation in large part via activation of the p53 transcriptional program, though a number of p53-independent functions have been described. Mounting evidence suggests that, in addition to promoting tumorigenesis via disruptions in the homeostatic balance between cell proliferation and apoptosis of overt cancer cells, genetic alterations leading to tumor suppressor loss of function or oncogene gain of function can also incite tumor development via effects on the tumor microenvironment. In a transgenic mouse model of multi-stage pancreatic neuroendocrine carcinogenesis (PNET driven by inhibition of the canonical p53 and Rb tumor suppressors with SV40 large T-antigen (Tag, stochastic progression to tumors is limited in part by a requirement for initiation of an angiogenic switch. Despite inhibition of p53 by Tag in this mouse PNET model, concomitant disruption of Arf via genetic knockout resulted in a significantly accelerated pathway to tumor formation that was surprisingly not driven by alterations in tumor cell proliferation or apoptosis, but rather via earlier activation of the angiogenic switch. In the setting of a constitutional p53 gene knockout, loss of Arf also accelerated tumor development, albeit to a lesser degree. These findings demonstrate that Arf loss of function can promote tumorigenesis via facilitating angiogenesis, at least in part, through p53-independent mechanisms.
International Nuclear Information System (INIS)
Yun, Hong Shik; Baek, Jeong-Hwa; Yim, Ji-Hye; Lee, Su-Jae; Lee, Chang-Woo; Song, Jie-Young; Um, Hong-Duck; Park, Jong Kuk; Park, In-Chul; Hwang, Sang-Gu
2014-01-01
Highlights: • HRP-3 is a radiation- and anticancer drug-responsive protein in H1299 cells. • Depletion of HRP-3 induces apoptosis of radio- and chemoresistant H1299 cells. • Depletion of HRP-3 promotes ROS generation via inhibition of the Nrf2/HO-1 pathway. • ROS generation enhances NF-κB activity, which acts as an upstream signal in the c-Myc/Noxa apoptotic pathway. - Abstract: We previously identified hepatoma-derived growth factor-related protein-3 (HRP-3) as a radioresistant biomarker in p53 wild-type A549 cells and found that p53-dependent induction of the PUMA pathway was a critical event in regulating the radioresistant phenotype. Here, we found that HRP-3 knockdown regulates the radioresistance of p53-null H1299 cells through a distinctly different molecular mechanism. HRP-3 depletion was sufficient to cause apoptosis of H1299 cells by generating substantial levels of reactive oxygen species (ROS) through inhibition of the Nrf2/HO-1 antioxidant pathway. Subsequent, ROS-dependent and p53-independent NF-κB activation stimulated expression of c-Myc and Noxa proteins, thereby inducing the apoptotic machinery. Our results thus extend the range of targets for the development of new drugs to treat both p53 wild-type or p53-null radioresistant lung cancer cells
Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.
Hirsch, Matthew L; Fagan, B Matthew; Dumitru, Raluca; Bower, Jacquelyn J; Yadav, Swati; Porteus, Matthew H; Pevny, Larysa H; Samulski, R Jude
2011-01-01
Human embryonic stem cells (hESCs) are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV) single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.
Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.
Directory of Open Access Journals (Sweden)
Matthew L Hirsch
Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.
E2F-1-Induced p53-independent apoptosis in transgenic mice
DEFF Research Database (Denmark)
Holmberg, Christian Henrik; Helin, K.; Sehested, M.
1998-01-01
The E2F transcription factors are key targets for the retinoblastoma protein, pRB. By inactivation of E2Fs, pRB prevents progression to the S phase. To test proliferative functions of E2F, we generated transgenic mice expressing human E2F-1 and/or human DP-1. When the hydroxymethyl glutaryl...... involving increased apoptosis in the germinal epithelium. This effect was potentiated by simultaneous overexpression of DP-1. Testicular atrophy as a result of overexpression of E2F-1 and DP-1 is independent of functional p53, since p53-nullizygous transgenic mice overexpressing E2F-1 and DP-1 also suffered...
p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.
Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R
2007-10-01
Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).
hSSB1 regulates both the stability and the transcriptional activity of p53
Xu, Shuangbing; Wu, Yuanzhong; Chen, Qiong; Cao, Jingying; Hu, Kaishun; Tang, Jianjun; Sang, Yi; Lai, Fenju; Wang, Li; Zhang, Ruhua; Li, Sheng-Ping; Zeng, Yi-Xin; Yin, Yuxin; Kang, Tiebang
2012-01-01
The tumor suppressor p53 is essential for several cellular processes that are involved in the response to diverse genotoxic stress, including cell cycle arrest, DNA repair, apoptosis and senescence. Studies of the regulation of p53 have mostly focused on its stability and transactivation; however, new regulatory molecules for p53 have also been frequently identified. Here, we report that human ssDNA binding protein SSB1 (hSSB1), a novel DNA damage-associated protein, can interact with p53 and...
Directory of Open Access Journals (Sweden)
Raúl Esteban Ithuralde
Full Text Available Disordered regions and Intrinsically Disordered Proteins (IDPs are involved in critical cellular processes and may acquire a stable three-dimensional structure only upon binding to their partners. IDPs may follow a folding-after-binding process, known as induced folding, or a folding-before-binding process, known as conformational selection. The transcription factor p53 is involved in the regulation of cellular events that arise upon stress or DNA damage. The p53 domain structure is composed of an N-terminal transactivation domain (p53TAD, a DNA Binding Domain and a tetramerization domain. The activity of TAD is tightly regulated by interactions with cofactors, inhibitors and phosphorylation. To initiate transcription, p53TAD binds to the TAZ2 domain of CBP, a co-transcription factor, and undergoes a folding and binding process, as revealed by the recent NMR structure of the complex. The activity of p53 is regulated by phosphorylation at multiple sites on the TAD domain and recent studies have shown that modifications at three residues affect the binding towards TAZ2. However, we still do not know how these phosphorylations affect the structure of the bound state and, therefore, how they regulate the p53 function. In this work, we have used computational simulations to understand how phosphorylation affects the structure of the p53TAD:TAZ2 complex and regulates the recognition mechanism. Phosphorylation has been proposed to enhance binding by direct interaction with the folded protein or by changing the unbound conformation of IDPs, for example by pre-folding the protein favoring the recognition mechanism. Here, we show an interesting turn in the p53 case: phosphorylation mainly affects the bound structure of p53TAD, highlighting the complexity of IDP protein-protein interactions. Our results are in agreement with previous experimental studies, allowing a clear picture of how p53 is regulated by phosphorylation and giving new insights into how
Novel small molecule induces p53-dependent apoptosis in human colon cancer cells
International Nuclear Information System (INIS)
Park, Sang Eun; Min, Yong Ki; Ha, Jae Du; Kim, Bum Tae; Lee, Woo Ghil
2007-01-01
Using high-throughput screening with small-molecule libraries, we identified a compound, KCG165 [(2-(3-(2-(pyrrolidin-1-yl)ethoxy)-1,10b-dihydro-[1,2,4]triazolo[1,5-c] quinazolin-5(6H)-one)], which strongly activated p53-mediated transcriptional activity. KCG165-induced phosphorylations of p53 at Ser 6 , Ser 15 , and Ser 20 , which are all key residues involved in the activation and stabilization of p53. Consistent with these findings, KCG165 increased level of p53 protein and led to the accumulation of transcriptionally active p53 in the nucleus with the increased occupancy of p53 in the endogenous promoter region of its downstream target gene, p21 WAF1/CIP . Notably, KCG165-induced p53-dependent apoptosis in cancer cells. Furthermore, we suggested topoisomerase II as the molecular target of KCG165. Together, these results indicate that KCG165 may have potential applications as an antitumor agent
Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT
Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.
2015-01-01
Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455
Perfettini, Jean-Luc; Roumier, Thomas; Castedo, Maria; Larochette, Nathanael; Boya, Patricia; Raynal, Brigitte; Lazar, Vladimir; Ciccosanti, Fabiola; Nardacci, Roberta; Penninger, Josef; Piacentini, Mauro; Kroemer, Guido
2004-03-01
The coculture of cells expressing the HIV-1 envelope glycoprotein complex (Env) with cells expressing CD4 results into cell fusion, deregulated mitosis, and subsequent cell death. Here, we show that NF-kappaB, p53, and AP1 are activated in Env-elicited apoptosis. The nuclear factor kappaB (NF-kappaB) super repressor had an antimitotic and antiapoptotic effect and prevented the Env-elicited phosphorylation of p53 on serine 15 and 46, as well as the activation of AP1. Transfection with dominant-negative p53 abolished apoptosis and AP1 activation. Signs of NF-kappaB and p53 activation were also detected in lymph node biopsies from HIV-1-infected individuals. Microarrays revealed that most (85%) of the transcriptional effects of HIV-1 Env were blocked by the p53 inhibitor pifithrin-alpha. Macroarrays led to the identification of several Env-elicited, p53-dependent proapoptotic transcripts, in particular Puma, a proapoptotic "BH3-only" protein from the Bcl-2 family known to activate Bax/Bak. Down modulation of Puma by antisense oligonucleotides, as well as RNA interference of Bax and Bak, prevented Env-induced apoptosis. HIV-1-infected primary lymphoblasts up-regulated Puma in vitro. Moreover, circulating CD4+ lymphocytes from untreated, HIV-1-infected donors contained enhanced amounts of Puma protein, and these elevated Puma levels dropped upon antiretroviral therapy. Altogether, these data indicate that NF-kappaB and p53 cooperate as the dominant proapoptotic transcription factors participating in HIV-1 infection.
Directory of Open Access Journals (Sweden)
Harrison David J
2007-11-01
Full Text Available Abstract Background TGFβ is critical to control hepatocyte proliferation by inducing G1-growth arrest through multiple pathways leading to inhibition of E2F transcription activity. The retinoblastoma protein pRb is a key controller of E2F activity and G1/S transition which can be inhibited in viral hepatitis. It is not known whether the impairment of pRb would alter the growth inhibitory potential of TGFβ in disease. We asked how Rb-deficiency would affect responses to TGFβ-induced cell cycle arrest. Results Primary hepatocytes isolated from Rb-floxed mice were infected with an adenovirus expressing CRE-recombinase to delete the Rb gene. In control cells treatment with TGFβ prevented cells to enter S phase via decreased cMYC activity, activation of P16INK4A and P21Cip and reduction of E2F activity. In Rb-null hepatocytes, cMYC activity decreased slightly but P16INK4A was not activated and the great majority of cells continued cycling. Rb is therefore central to TGFβ-induced cell cycle arrest in hepatocytes. However some Rb-null hepatocytes remained sensitive to TGFβ-induced cell cycle arrest. As these hepatocytes expressed very high levels of P21Cip1 and P53 we investigated whether these proteins regulate pRb-independent signaling to cell cycle arrest by evaluating the consequences of disruption of p53 and p21Cip1. Hepatocytes deficient in p53 or p21Cip1 showed diminished growth inhibition by TGFβ. Double deficiency had a similar impact showing that in cells containing functional pRb; P21Cip and P53 work through the same pathway to regulate G1/S in response to TGFβ. In Rb-deficient cells however, p53 but not p21Cip deficiency had an additive effect highlighting a pRb-independent-P53-dependent effector pathway of inhibition of E2F activity. Conclusion The present results show that otherwise genetically normal hepatocytes with disabled p53, p21Cip1 or Rb genes respond less well to the antiproliferative effects of TGFβ. As the function of
Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.
Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom
2012-01-01
The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.
Regulation of protein quality control by UBE4B and LSD1 through p53-mediated transcription.
Directory of Open Access Journals (Sweden)
Goran Periz
2015-04-01
Full Text Available Protein quality control is essential for clearing misfolded and aggregated proteins from the cell, and its failure is associated with many neurodegenerative disorders. Here, we identify two genes, ufd-2 and spr-5, that when inactivated, synergistically and robustly suppress neurotoxicity associated with misfolded proteins in Caenorhabditis elegans. Loss of human orthologs ubiquitination factor E4 B (UBE4B and lysine-specific demethylase 1 (LSD1, respectively encoding a ubiquitin ligase and a lysine-specific demethylase, promotes the clearance of misfolded proteins in mammalian cells by activating both proteasomal and autophagic degradation machineries. An unbiased search in this pathway reveals a downstream effector as the transcription factor p53, a shared substrate of UBE4B and LSD1 that functions as a key regulator of protein quality control to protect against proteotoxicity. These studies identify a new protein quality control pathway via regulation of transcription factors and point to the augmentation of protein quality control as a wide-spectrum antiproteotoxicity strategy.
Serrano, M A; Li, Z; Dangeti, M; Musich, P R; Patrick, S; Roginskaya, M; Cartwright, B; Zou, Y
2013-05-09
Homologous recombination (HR) and nonhomologous end joining (NHEJ) are two distinct DNA double-stranded break (DSB) repair pathways. Here, we report that DNA-dependent protein kinase (DNA-PK), the core component of NHEJ, partnering with DNA-damage checkpoint kinases ataxia telangiectasia mutated (ATM) and ATM- and Rad3-related (ATR), regulates HR repair of DSBs. The regulation was accomplished through modulation of the p53 and replication protein A (RPA) interaction. We show that upon DNA damage, p53 and RPA were freed from a p53-RPA complex by simultaneous phosphorylations of RPA at the N-terminus of RPA32 subunit by DNA-PK and of p53 at Ser37 and Ser46 in a Chk1/Chk2-independent manner by ATR and ATM, respectively. Neither the phosphorylation of RPA nor of p53 alone could dissociate p53 and RPA. Furthermore, disruption of the release significantly compromised HR repair of DSBs. Our results reveal a mechanism for the crosstalk between HR repair and NHEJ through the co-regulation of p53-RPA interaction by DNA-PK, ATM and ATR.
The expanding universe of p53 targets.
Menendez, Daniel; Inga, Alberto; Resnick, Michael A
2009-10-01
The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.
Benatti, Paolo; Basile, Valentina; Dolfini, Diletta; Belluti, Silvia; Tomei, Margherita; Imbriano, Carol
2016-07-19
The expression of the high risk HPV18 E6 and E7 oncogenic proteins induces the transformation of epithelial cells, through the disruption of p53 and Rb function. The binding of cellular transcription factors to cis-regulatory elements in the viral Upstream Regulatory Region (URR) stimulates E6/E7 transcription. Here, we demonstrate that the CCAAT-transcription factor NF-Y binds to a non-canonical motif within the URR and activates viral gene expression. In addition, NF-Y indirectly up-regulates HPV18 transcription through the transactivation of multiple cellular transcription factors. NF-YA depletion inhibits the expression of E6 and E7 genes and re-establishes functional p53. The activation of p53 target genes in turn leads to apoptotic cell death. Finally, we show that NF-YA loss sensitizes HPV18-positive cells toward the DNA damaging agent Doxorubicin, via p53-mediated transcriptional response.
UVC-induced apoptosis in Dubca cells is independent of JNK activation and p53Ser-15 phosphorylation
International Nuclear Information System (INIS)
Chathoth, Shahanas; Thayyullathil, Faisal; Hago, Abdulkader; Shahin, Allen; Patel, Mahendra; Galadari, Sehamuddin
2009-01-01
Ultraviolet C (UVC) irradiation in mammalian cell lines activates a complex signaling network that leads to apoptosis. By using Dubca cells as a model system, we report the presence of a UVC-induced apoptotic pathway that is independent of c-Jun N-terminal kinases (JNKs) activation and p53 phosphorylation at Ser 15 . Irradiation of Dubca cells with UVC results in a rapid JNK activation and phosphorylation of its downstream target c-Jun, as well as, phosphorylation of activating transcription factor 2 (ATF2). Pre-treatment with JNK inhibitor, SP600125, inhibited UVC-induced c-Jun phosphorylation without preventing UVC-induced apoptosis. Similarly, inhibition of UVC-induced p53 phosphorylation did not prevent Dubca cell apoptosis, suggesting that p53 Ser-15 phosphorylation is not associated with UVC-induced apoptosis signaling. The pan-caspase inhibitor z-VAD-fmk inhibited UVC-induced PARP cleavage, DNA fragmentation, and ultimately apoptosis of Dubca cells. Altogether, our study clearly indicates that UVC-induced apoptosis is independent of JNK and p53 activation in Dubca cells, rather, it is mediated through a caspase dependent pathway. Our findings are not in line with the ascribed critical role for JNKs activation, and downstream phosphorylation of targets such as c-Jun and ATF2 in UVC-induced apoptosis.
A systematic review of p53 regulation of oxidative stress in skeletal muscle.
Beyfuss, Kaitlyn; Hood, David A
2018-12-01
transcription factor 4; ATM: ATM serine/threonine kinase; Bax: BCL2 associated X, apoptosis regulator; Bcl-2: B cell Leukemia/Lymphoma 2 apoptosis regulator; Bhlhe40: basic helix-loop-helix family member e40; BH3: Borane; Bim: bcl-2 interacting mediator of cell death; Bok: Bcl-2 related ovarian killer; COX-IV: cytochrome c oxidase IV; cGMP: Cyclic guanosine monophosphate; c-myc: proto-oncogene protein; Cpt1b: carnitine palmitoyltransferase 1B; Dr5: death receptor 5; eNOS: endothelial nitric oxide synthase; ERK: extracellular regulated MAP kinase; Fas: Fas Cell surface death receptor; FDXR: Ferredoxin Reductase; FOXO3a: forkhead box O3; Gadd45a: growth arrest and DNA damage-inducible 45 alpha; GLS2: glutaminase 2; GLUT 1 and 4: glucose transporter 1(endothelial) and 4 (skeletal muscle); GSH: Glutathione; Hes1: hes family bHLH transcription factor 1; Hey1: hes related family bHLH transcription factor with YRPW motif 1; HIFI-α: hypoxia-inducible factor 1, α-subunit; HK2: Hexokinase 2; HSP70: Heat Shock Protein 70; H 2 O 2 : Hydrogen Peroxide; Id2: inhibitor of DNA-binding 2; IGF-1-BP3: Insulin-like growth factor binding protein 3; IL-1β: Interleukin 1 beta; iNOS: inducible nitric oxide synthase; IRS-1: Insulin receptor substrate 1; JNK: c-Jun N-terminal kinases; LY-83583: 6-anilino-5,8-quinolinedione; inhibitor of soluble guanylate cyclase and of cGMP production; Mdm 2/ 4: Mouse double minute 2 homolog (mouse) Mdm4 (humans); mtDNA: mitochondrial DNA; MURF1: Muscle RING-finger protein-1; MyoD: Myogenic differentiation 1; MyoG: myogenin; Nanog: Nanog homeobox; NF-kB: Nuclear factor-κB; NO: nitric oxide; NoxA: phorbol-12-myristate-13-acetate-induced protein 1 (Pmaip1); NRF-1: nuclear respiratory factor 1; Nrf2: Nuclear factor erythroid 2-related factor 2; P21: Cdkn1a cyclin-dependent kinase inhibitor 1A (P21); P38 MAPK: mitogen-activated protein kinases; p53R2: p53 inducible ribonucleotide reductase gene; P66Shc: src homology 2 domain-containing transforming protein C1; PERP: p
P53-dependent ceramide generation in response ro ionizing irradiation is caspase-dependent
International Nuclear Information System (INIS)
Dbaibo, G.; El-Assaad, W.
2000-01-01
Full text.We have previously reported that p53-dependent apoptosis is accompanied by ceramide accumulation. Lack of p53 prevents ceramide accumulation in response to induces such as ionizing irradiation. The mechanisms of ceramide accumulation have not been explored. P53 has been reported to function by inducing the death receptors Fas and DR5 both of which function by initiating a caspase cascade that results in apoptosis. We decided to examine the role of caspases in the elevation of cellular ceramide levels. We treated Molt-4 cells with 5Gy of ionizing irradiation and examined the effects of co-treatment with the general caspase inhibitor z-VAD-fmk at concentration of 50 and 100μM. We found that z-VAD blocked apoptosis induced by irradiation without interfering with p53 accumulation indicating that it was not functioning upstream of p53. However, z-VAD treatment resulted in a significant decrease in ceramide accumulation. Additionally, z-VAD partially blocked the loss of glutathione in response to irradiation. This was important since glutathione has been described as an inhibitor of neutral sphindomyelinase, a major source of cellular ceramide via sphingomyelin hydrolysis. These studies indicate that p53 induces ceramide accumulation in a caspase-dependent manner and that the regulation of cellular glutathione by caspases may be a mechanism by which they regulate ceramide accumulation
40 Years of Research Put p53 in Translation
Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques
2018-01-01
Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.
p53 regulates cytoskeleton remodeling to suppress tumor progression.
Araki, Keigo; Ebata, Takahiro; Guo, Alvin Kunyao; Tobiume, Kei; Wolf, Steven John; Kawauchi, Keiko
2015-11-01
Cancer cells possess unique characteristics such as invasiveness, the ability to undergo epithelial-mesenchymal transition, and an inherent stemness. Cell morphology is altered during these processes and this is highly dependent on actin cytoskeleton remodeling. Regulation of the actin cytoskeleton is, therefore, important for determination of cell fate. Mutations within the TP53 (tumor suppressor p53) gene leading to loss or gain of function (GOF) of the protein are often observed in aggressive cancer cells. Here, we highlight the roles of p53 and its GOF mutants in cancer cell invasion from the perspective of the actin cytoskeleton; in particular its reorganization and regulation by cell adhesion molecules such as integrins and cadherins. We emphasize the multiple functions of p53 in the regulation of actin cytoskeleton remodeling in response to the extracellular microenvironment, and oncogene activation. Such an approach provides a new perspective in the consideration of novel targets for anti-cancer therapy.
Directory of Open Access Journals (Sweden)
Kiran Hasygar
2014-11-01
Full Text Available Insulin-like signalling is a conserved mechanism that coordinates animal growth and metabolism with nutrient status. In Drosophila, insulin-producing median neurosecretory cells (IPCs regulate larval growth by secreting insulin-like peptides (dILPs in a diet-dependent manner. Previous studies have shown that nutrition affects dILP secretion through humoral signals derived from the fat body. Here we uncover a novel mechanism that operates cell autonomously in the IPCs to regulate dILP secretion. We observed that impairment of ribosome biogenesis specifically in the IPCs strongly inhibits dILP secretion, which consequently leads to reduced body size and a delay in larval development. This response is dependent on p53, a known surveillance factor for ribosome biogenesis. A downstream effector of this growth inhibitory response is an atypical MAP kinase ERK7 (ERK8/MAPK15, which is upregulated in the IPCs following impaired ribosome biogenesis as well as starvation. We show that ERK7 is sufficient and essential to inhibit dILP secretion upon impaired ribosome biogenesis, and it acts epistatically to p53. Moreover, we provide evidence that p53 and ERK7 contribute to the inhibition of dILP secretion upon starvation. Thus, we conclude that a cell autonomous ribosome surveillance response, which leads to upregulation of ERK7, inhibits dILP secretion to impede tissue growth under limiting dietary conditions.
International Nuclear Information System (INIS)
Tommaso, Anne di; Hagen, Jussara; Tompkins, Van; Muniz, Viviane; Dudakovic, Amel; Kitzis, Alain; Ladeveze, Veronique; Quelle, Dawn E.
2009-01-01
The Alternative Reading Frame (ARF) protein suppresses tumorigenesis through p53-dependent and p53-independent pathways. Most of ARF's anti-proliferative activity is conferred by sequences in its first exon. Previous work showed specific amino acid changes occurred in that region during primate evolution, so we programmed those changes into human p14ARF to assay their functional impact. Two human p14ARF residues (Ala 14 and Thr 31 ) were found to destabilize the protein while two others (Val 24 and Ala 41 ) promoted more efficient p53 stabilization and activation. Despite those effects, all modified p14ARF forms displayed robust p53-dependent anti-proliferative activity demonstrating there are no significant biological differences in p53-mediated growth suppression associated with simian versus human p14ARF residues. In contrast, p53-independent p14ARF function was considerably altered by several residue changes. Val 24 was required for p53-independent growth suppression whereas multiple residues (Val 24 , Thr 31 , Ala 41 and His 60 ) enabled p14ARF to block or reverse the inherent chromosomal instability of p53-null MEFs. Together, these data pinpoint specific residues outside of established p14ARF functional domains that influence its expression and signaling activities. Most intriguingly, this work reveals a novel and direct role for p14ARF in the p53-independent maintenance of genomic stability.
Regulation of GAD65 expression by SMAR1 and p53 upon Streptozotocin treatment
Directory of Open Access Journals (Sweden)
Singh Sandeep
2012-09-01
Full Text Available Abstract Background GAD65 (Glutamic acid decarboxylase 65 KDa isoform is one of the most important auto-antigens involved in Type 1 diabetes induction. Although it serves as one of the first injury markers of β-islets, the mechanisms governing GAD65 expression remain poorly understood. Since the regulation of GAD65 is crucial for the proper functioning of insulin secreting cells, we investigated the stress induced regulation of GAD65 transcription. Results The present study shows that SMAR1 regulates GAD65 expression at the transcription level. Using a novel protein-DNA pull-down assay, we show that SMAR1 binding is very specific to GAD65 promoter but not to the other isoform, GAD67. We show that Streptozotocin (STZ mediated DNA damage leads to upregulation of SMAR1 and p53 expression, resulting in elevated levels of GAD65, in both cell lines as well as mouse β-islets. SMAR1 and p53 act synergistically to up-regulate GAD65 expression upon STZ treatment. Conclusion We propose a novel mechanism of GAD65 regulation by synergistic activities of SMAR1 and p53.
CK1α ablation in keratinocytes induces p53-dependent, sunburn-protective skin hyperpigmentation.
Chang, Chung-Hsing; Kuo, Che-Jung; Ito, Takamichi; Su, Yu-Ya; Jiang, Si-Tse; Chiu, Min-Hsi; Lin, Yi-Hsiung; Nist, Andrea; Mernberger, Marco; Stiewe, Thorsten; Ito, Shosuke; Wakamatsu, Kazumasa; Hsueh, Yi-An; Shieh, Sheau-Yann; Snir-Alkalay, Irit; Ben-Neriah, Yinon
2017-09-19
Casein kinase 1α (CK1α), a component of the β-catenin destruction complex, is a critical regulator of Wnt signaling; its ablation induces both Wnt and p53 activation. To characterize the role of CK1α (encoded by Csnk1a1 ) in skin physiology, we crossed mice harboring floxed Csnk1a1 with mice expressing K14-Cre-ER T2 to generate mice in which tamoxifen induces the deletion of Csnk1a1 exclusively in keratinocytes [single-knockout (SKO) mice]. As expected, CK1α loss was accompanied by β-catenin and p53 stabilization, with the preferential induction of p53 target genes, but phenotypically most striking was hyperpigmentation of the skin, importantly without tumorigenesis, for at least 9 mo after Csnk1a1 ablation. The number of epidermal melanocytes and eumelanin levels were dramatically increased in SKO mice. To clarify the putative role of p53 in epidermal hyperpigmentation, we established K14-Cre-ER T2 CK1α/p53 double-knockout (DKO) mice and found that coablation failed to induce epidermal hyperpigmentation, demonstrating that it was p53-dependent. Transcriptome analysis of the epidermis revealed p53-dependent up-regulation of Kit ligand (KitL). SKO mice treated with ACK2 (a Kit-neutralizing antibody) or imatinib (a Kit inhibitor) abrogated the CK1α ablation-induced hyperpigmentation, demonstrating that it requires the KitL/Kit pathway. Pro-opiomelanocortin (POMC), a precursor of α-melanocyte-stimulating hormone (α-MSH), was not activated in the CK1α ablation-induced hyperpigmentation, which is in contrast to the mechanism of p53-dependent UV tanning. Nevertheless, acute sunburn effects were successfully prevented in the hyperpigmented skin of SKO mice. CK1α inhibition induces skin-protective eumelanin but no carcinogenic pheomelanin and may therefore constitute an effective strategy for safely increasing eumelanin via UV-independent pathways, protecting against acute sunburn.
DEFF Research Database (Denmark)
Galanos, Panagiotis; Vougas, Konstantinos; Walter, David
2016-01-01
The cyclin-dependent kinase inhibitor p21(WAF1/CIP1) (p21) is a cell-cycle checkpoint effector and inducer of senescence, regulated by p53. Yet, evidence suggests that p21 could also be oncogenic, through a mechanism that has so far remained obscure. We report that a subset of atypical cancerous ...
Mitofusin-2 is a novel direct target of p53
International Nuclear Information System (INIS)
Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen
2010-01-01
Research highlights: → Mfn2 is a novel target gene of p53. → Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. → Mfn2 promoter activity can be elevated by the p53 protein. → P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.
Directory of Open Access Journals (Sweden)
Ivan Raimondi
Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.
The p53-dependent radioadaptive response
Ohnishi, Takeo
We already reported that conditioning exposures at low doses, or at low dose-rates, lowered radiation-induced p53-dependent apoptosis in cultured cells in vitro and in the spleens of mice in vivo. In this study, the aim was to characterize the p53-dependent radioadaptive response at the molecular level. We used wild-type (wt) p53 and mutated (m) p53 containing cells derived from the human lung cancer H1299 cell line, which is p53-null. Cellular radiation sensitivities were determined with a colony-forming assay. The accumulation of p53, Hdm2, and iNOS was analyzed with Western blotting. The quantification of chromosomal aberrations was estimated by scoring dicentrics per cell. In wtp53 cells, it was demonstrated that the lack of p53 accumulation was coupled with the activation of Hdm2 after low dose irradiation (0.02 Gy). Although NO radicals were only minimally induced in wtp53 cells irradiated with a challenging irradiation (6 Gy) alone, NO radicals were seen to increase about 2-4 fold after challenging irradiation following a priming irradiation (0.02 Gy). Under similar irradiation conditions with a priming and challenging irradiation in wtp53 cells, induction of radioresistance and a depression of chromosomal aberrations were observed only in the absence of Pifithrin-α (a p53 inhibitor), RITA or Nutlin-3 (p53-Hdm2 interaction inhibitors), aminoguanidine (an iNOS inhibitor) and c-PTIO (an NO radical scavenger). On the other hand, in p53 dysfunctional cells, a radioadaptive response was not observed in the presence or absence of those inhibitors. Moreover, radioresistance developed when wtp53 cells were treated with ISDN (an NO generating agent) alone. These findings suggest that NO radicals are an initiator of the radioadaptive response acting through the activation of Hdm2 and the depression of p53 accumulations.
Jang, Sang-Min; Kang, Eun-Jin; Kim, Jung-Woong; Kim, Chul-Hong; An, Joo-Hee; Choi, Kyung-Hee
2013-08-23
PUMA is a crucial regulator of apoptotic cell death mediated by p53-dependent and p53-independent mechanisms. In many cancer cells, PUMA expression is induced in response to DNA-damaging reagent in a p53-dependent manner. However, few studies have investigated transcription factors that lead to the induction of PUMA expression via p53-independent apoptotic signaling. In this study, we found that the transcription factor Sox4 increased PUMA expression in response to trichostatin A (TSA), a histone deacetylase inhibitor in the p53-null human lung cancer cell line H1299. Ectopic expression of Sox4 led to the induction of PUMA expression at the mRNA and protein levels, and TSA-mediated up-regulation of PUMA transcription was repressed by the knockdown of Sox4. Using luciferase assays and chromatin immunoprecipitation, we also determined that Sox4 recruits p300 on the PUMA promoter region and increases PUMA gene expression in response to TSA treatment. Taken together, these results suggest that Sox4 is required for p53-independent apoptotic cell death mediated by PUMA induction via TSA treatment. Crown Copyright © 2013. Published by Elsevier Inc. All rights reserved.
Palazzo, E; Kellett, M; Cataisson, C; Gormley, A; Bible, P W; Pietroni, V; Radoja, N; Hwang, J; Blumenberg, M; Yuspa, S H; Morasso, M I
2016-06-16
Epidermal homeostasis depends on the coordinated control of keratinocyte cell cycle. Differentiation and the alteration of this balance can result in neoplastic development. Here we report on a novel DLX3-dependent network that constrains epidermal hyperplasia and squamous tumorigenesis. By integrating genetic and transcriptomic approaches, we demonstrate that DLX3 operates through a p53-regulated network. DLX3 and p53 physically interact on the p21 promoter to enhance p21 expression. Elevating DLX3 in keratinocytes produces a G1-S blockade associated with p53 signature transcriptional profiles. In contrast, DLX3 loss promotes a mitogenic phenotype associated with constitutive activation of ERK. DLX3 expression is lost in human skin cancers and is extinguished during progression of experimentally induced mouse squamous cell carcinoma (SCC). Reinstatement of DLX3 function is sufficient to attenuate the migration of SCC cells, leading to decreased wound closure. Our data establish the DLX3-p53 interplay as a major regulatory axis in epidermal differentiation and suggest that DLX3 is a modulator of skin carcinogenesis.
Cyclin D1 represses p300 transactivation through a cyclin-dependent kinase-independent mechanism.
Fu, Maofu; Wang, Chenguang; Rao, Mahadev; Wu, Xiaofang; Bouras, Toula; Zhang, Xueping; Li, Zhiping; Jiao, Xuanmao; Yang, Jianguo; Li, Anping; Perkins, Neil D; Thimmapaya, Bayar; Kung, Andrew L; Munoz, Alberto; Giordano, Antonio; Lisanti, Michael P; Pestell, Richard G
2005-08-19
Cyclin D1 encodes a regulatory subunit, which with its cyclin-dependent kinase (Cdk)-binding partner forms a holoenzyme that phosphorylates and inactivates the retinoblastoma protein. In addition to its Cdk binding-dependent functions, cyclin D1 regulates cellular differentiation in part by modifying several transcription factors and nuclear receptors. The molecular mechanism through which cyclin D1 regulates the function of transcription factors involved in cellular differentiation remains to be clarified. The histone acetyltransferase protein p300 is a co-integrator required for regulation of multiple transcription factors. Here we show that cyclin D1 physically interacts with p300 and represses p300 transactivation. We demonstrated further that the interaction of the two proteins occurs at the peroxisome proliferator-activated receptor gamma-responsive element of the lipoprotein lipase promoter in the context of the local chromatin structure. We have mapped the domains in p300 and cyclin D1 involved in this interaction. The bromo domain and cysteine- and histidine-rich domains of p300 were required for repression by cyclin D1. Cyclin D1 repression of p300 was independent of the Cdk- and retinoblastoma protein-binding domains of cyclin D1. Cyclin D1 inhibits histone acetyltransferase activity of p300 in vitro. Microarray analysis identified a signature of genes repressed by cyclin D1 and induced by p300 that promotes cellular differentiation and induces cell cycle arrest. Together, our results suggest that cyclin D1 plays an important role in cellular proliferation and differentiation through regulation of p300.
Wang, Dongfang; Qin, Jingkai; Jia, Jirong; Yan, Peipei; Li, Wensheng
2017-01-29
This study aims to determine the post-transcriptional regulation mechanism of the transcription factor pou1f1 (pou class 1 homeobox 1), which is the key gene for pituitary development, somatic growth in vertebrates, and transcription of several hormone genes in teleost fish. MicroRNA miR-223-3p was identified as a bona fide target of pou1f; overexpression of miR-223-3p in primary pituitary cells led to the down-regulation of pou1f1 and downstream genes, and inhibition of miR-223-3p led to the up-regulation of pou1f1 in Nile tilapia dispersed primary pituitary cells. An adenylate-uridylate-rich element (AU-Rich element) was found in the 3'UTR of pou1f1 mRNA, and deletion of the AU-Rich element led to slower mRNA decay and therefore more protein output. A potential mutual relationship between miR-223-3p and the AU-rich element was also investigated, and the results demonstrated that with or without the AU-Rich element, miR-223-3p induced the up-regulation of a reporter system under serum starvation conditions, indicating that miR-223-3p and the AU-Rich element function independent of each other. This study is the first to investigate the post-transcriptional mechanism of pou1f1, which revealed that miR-223-3p down-regulated pou1f1 and downstream gene expressions, and the AU-Rich element led to rapid decay of pou1f1 mRNA. MicroRNA miR-223-3p and the AU-Rich element co-regulated the post-transcriptional expression of pou1f1 independently in Nile tilapia, demonstrating that pou1f1 is under the control of a dual post-transcription regulation mechanism. Copyright © 2016 Elsevier Inc. All rights reserved.
Fong, Chii Shyang; Mazo, Gregory; Das, Tuhin; Goodman, Joshua; Kim, Minhee; O'Rourke, Brian P; Izquierdo, Denisse; Tsou, Meng-Fu Bryan
2016-07-02
Mitosis occurs efficiently, but when it is disturbed or delayed, p53-dependent cell death or senescence is often triggered after mitotic exit. To characterize this process, we conducted CRISPR-mediated loss-of-function screens using a cell-based assay in which mitosis is consistently disturbed by centrosome loss. We identified 53BP1 and USP28 as essential components acting upstream of p53, evoking p21-dependent cell cycle arrest in response not only to centrosome loss, but also to other distinct defects causing prolonged mitosis. Intriguingly, 53BP1 mediates p53 activation independently of its DNA repair activity, but requiring its interacting protein USP28 that can directly deubiquitinate p53 in vitro and ectopically stabilize p53 in vivo. Moreover, 53BP1 can transduce prolonged mitosis to cell cycle arrest independently of the spindle assembly checkpoint (SAC), suggesting that while SAC protects mitotic accuracy by slowing down mitosis, 53BP1 and USP28 function in parallel to select against disturbed or delayed mitosis, promoting mitotic efficiency.
Directory of Open Access Journals (Sweden)
Xiao-Su Zhao
Full Text Available Cyclin-dependent kinase 5 (Cdk5 is a proline-directed serine/threonine kinase, which plays critical roles in a wide spectrum of neuronal functions including neuronal survival, neurite outgrowth, and synapse development and plasticity. Cdk5 activity is controlled by its specific activators: p35 or p39. While knockout studies reveal that Cdk5/p35 is critical for neuronal migration during early brain development, functions of Cdk5/p35 have been unraveled through the identification of the interacting proteins of p35, most of which are Cdk5/p35 substrates. However, it remains unclear whether p35 can regulate neuronal functions independent of Cdk5 activity. Here, we report that a nuclear protein, nuclear hormone receptor coregulator (NRC-interacting factor 1 (NIF-1, is a new interacting partner of p35. Interestingly, p35 regulates the functions of NIF-1 independent of Cdk5 activity. NIF-1 was initially discovered as a transcriptional regulator that enhances the transcriptional activity of nuclear hormone receptors. Our results show that p35 interacts with NIF-1 and regulates its nucleocytoplasmic trafficking via the nuclear export pathway. Furthermore, we identified a nuclear export signal on p35; mutation of this site or blockade of the CRM1/exportin-dependent nuclear export pathway resulted in the nuclear accumulation of p35. Intriguingly, blocking the nuclear export of p35 attenuated the nuclear accumulation of NIF-1. These findings reveal a new p35-dependent mechanism in transcriptional regulation that involves the nucleocytoplasmic shuttling of transcription regulators.
Zhao, Xiao-Su; Fu, Wing-Yu; Chien, Winnie W Y; Li, Zhen; Fu, Amy K Y; Ip, Nancy Y
2014-01-01
Cyclin-dependent kinase 5 (Cdk5) is a proline-directed serine/threonine kinase, which plays critical roles in a wide spectrum of neuronal functions including neuronal survival, neurite outgrowth, and synapse development and plasticity. Cdk5 activity is controlled by its specific activators: p35 or p39. While knockout studies reveal that Cdk5/p35 is critical for neuronal migration during early brain development, functions of Cdk5/p35 have been unraveled through the identification of the interacting proteins of p35, most of which are Cdk5/p35 substrates. However, it remains unclear whether p35 can regulate neuronal functions independent of Cdk5 activity. Here, we report that a nuclear protein, nuclear hormone receptor coregulator (NRC)-interacting factor 1 (NIF-1), is a new interacting partner of p35. Interestingly, p35 regulates the functions of NIF-1 independent of Cdk5 activity. NIF-1 was initially discovered as a transcriptional regulator that enhances the transcriptional activity of nuclear hormone receptors. Our results show that p35 interacts with NIF-1 and regulates its nucleocytoplasmic trafficking via the nuclear export pathway. Furthermore, we identified a nuclear export signal on p35; mutation of this site or blockade of the CRM1/exportin-dependent nuclear export pathway resulted in the nuclear accumulation of p35. Intriguingly, blocking the nuclear export of p35 attenuated the nuclear accumulation of NIF-1. These findings reveal a new p35-dependent mechanism in transcriptional regulation that involves the nucleocytoplasmic shuttling of transcription regulators.
FATS is a transcriptional target of p53 and associated with antitumor activity
Zhang Xifeng; Zhang Qian; Zhang Jun; Qiu Li; Yan Shuang-shuang; Feng Juling; Sun Yan; Huang Xingxu; Lu Karen H; Li Zheng
2010-01-01
Abstract Frequent mutations of p53 in human cancers exemplify its crucial role as a tumor suppressor transcription factor, and p21, a transcriptional target of p53, plays a central role in surveillance of cell-cycle checkpoints. Our previous study has shown that FATS stabilize p21 to preserve genome integrity. In this study we identified a novel transcript variant of FATS (GenBank: GQ499374) through screening a cDNA library from mouse testis, which uncovered the promoter region of mouse FATS....
Noda, Takeshi
2011-12-01
I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.
The Transcriptional Landscape of p53 Signalling Pathway
Directory of Open Access Journals (Sweden)
Chizu Tanikawa
2017-06-01
Full Text Available Although recent cancer genomics studies have identified a large number of genes that were mutated in human cancers, p53 remains as the most frequently mutated gene. To further elucidate the p53-signalling network, we performed transcriptome analysis on 24 tissues in p53+/+ or p53−/− mice after whole-body X-ray irradiation. Here we found transactivation of a total of 3551 genes in one or more of the 24 tissues only in p53+/+ mice, while 2576 genes were downregulated. p53 mRNA expression level in each tissue was significantly associated with the number of genes upregulated by irradiation. Annotation using TCGA (The Cancer Genome Atlas database revealed that p53 negatively regulated mRNA expression of several cancer therapeutic targets or pathways such as BTK, SYK, and CTLA4 in breast cancer tissues. In addition, stomach exhibited the induction of Krt6, Krt16, and Krt17 as well as loricrin, an epidermal differentiation marker, after the X-ray irradiation only in p53+/+ mice, implying a mechanism to protect damaged tissues by rapid induction of differentiation. Our comprehensive transcriptome analysis elucidated tissue specific roles of p53 and its signalling networks in DNA-damage response that will enhance our understanding of cancer biology.
Flamini, Valentina; Ghadiali, Rachel S; Antczak, Philipp; Rothwell, Amy; Turnbull, Jeremy E; Pisconti, Addolorata
2018-03-13
Satellite cells are adult muscle stem cells residing in a specialized niche that regulates their homeostasis. How niche-generated signals integrate to regulate gene expression in satellite cell-derived myoblasts is poorly understood. We undertook an unbiased approach to study the effect of the satellite cell niche on satellite cell-derived myoblast transcriptional regulation and identified the tumor suppressor p53 as a key player in the regulation of myoblast quiescence. After activation and proliferation, a subpopulation of myoblasts cultured in the presence of the niche upregulates p53 and fails to differentiate. When satellite cell self-renewal is modeled ex vivo in a reserve cell assay, myoblasts treated with Nutlin-3, which increases p53 levels in the cell, fail to differentiate and instead become quiescent. Since both these Nutlin-3 effects are rescued by small interfering RNA-mediated p53 knockdown, we conclude that a tight control of p53 levels in myoblasts regulates the balance between differentiation and return to quiescence. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Hayashi, Yoko; Kondo, Takashi; Zhao Qingli; Ogawa Ryohei; Cui Zhengguo; Feril, Loreto B.; Teranishi, Hidetoyo; Kasuya, Minoru
2004-01-01
It has been reported that the hexavalent chromium compound (Cr(VI)) can induce both p53-dependent and p53-independent apoptosis. While a considerable amount of information is available on the p53-dependent pathway, only little is known about the p53-independent pathway. To elucidate the p53-independent mechanism, the roles of the Ca 2+ -calpain- and mitochondria-caspase-dependent pathways in apoptosis induced by Cr(VI) were investigated. When human lymphoma U937 cells, p53 mutated cells, were treated with 20 μM Cr(VI) for 24 h, nuclear morphological changes and DNA fragmentation were observed. Production of hydroxyl radicals revealed by electron paramagnetic resonance (EPR)-spin trapping, and increase of intracellular calcium ion concentration monitored by digital imaging were also observed in Cr(VI)-treated cells. An intracellular Ca 2+ chelator, BAPTA-AM, and calpain inhibitors suppressed the Cr(VI)-induced DNA fragmentation. The number of cells showing low mitochondrial membrane potential (MMP), high level of superoxide anion radicals (O 2 - ), and high activity of caspase-3, which are indicators of mitochondria-caspase-dependent pathway, increased significantly in Cr(VI)-treated cells. An antioxidant, N-acetyl-L-cysteine (NAC), decreased DNA fragmentation and inhibited the changes in MMP, O 2 - formation, and activation of caspase-3 induced by Cr(VI). No increase of the expressions of Fas and phosphorylated JNK was observed after Cr(VI) treatment. Cell cycle analysis revealed that the fraction of G2/M phase tended to increase after 24 h of treatment, suggesting that Cr(VI)-induced apoptosis is related to the G2 block. These results indicate that Ca 2+ -calpain- and mitochondria-caspase-dependent pathways play significant roles in the Cr(VI)-induced apoptosis via the G2 block, which are independent of JNK and Fas activation. The inhibition of apoptosis and all its signal transductions by NAC suggests that intracellular reactive oxygen species (ROS) are
Stimulation of autophagy by the p53 target gene Sestrin2.
Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido
2009-05-15
The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.
Nitrous oxide discretely up-regulates nNOS and p53 in neonatal rat brain.
Cattano, D; Valleggi, S; Abramo, A; Forfori, F; Maze, M; Giunta, F
2010-06-01
Animal studies suggest that neuronal cell death often results from anesthetic administration during synaptogenesis. Volatile anesthetics are strongly involved in triggering neuronal apoptosis, whereas other inhalational agents (xenon) demonstrate protective effects. Nitrous oxide (N2O) has modest pro-apoptotic effects on its own and potent, synergistic toxic effects when combined with volatile agents. Recent findings suggest that, during periods of rapid brain development, the enhanced neurodegeneration triggered by anesthetic drugs may be caused by a compensatory increase in intracellular free calcium, a potent activator of neuronal nitric oxide synthase (nNOS). Anesthesia-induced neuro-apoptosis is also activated via the intrinsic and the extrinsic apoptotic pathways because both pathways involve p53, a key regulatory gene. The molecular events related to neuronal cell apoptosis are not completely understood. To gain further insight into the events underlying neuro-apoptosis, we analyzed the transcriptional consequences of N2O exposure on nNOS, iNOS and p53 mRNA levels. The study used 2 groups of postnatal day seven Sprague/Dawley rats (N=6 each) that were exposed for 120 minutes to air (75% N2, 25% O2) or N2O (75% N2O, 25% O2; this N2O concentration is commonly used to induce anesthesia and has been demonstrated to trigger neurodegeneration in postnatal day seven rats). Total RNA was isolated from each brain and expression analyses on iNOS and nNOS transcripts were performed using relative Real-Time C-reactive protein PCR (using G3PDH as a housekeeping gene). A semi-quantitative RT-PCR analysis was performed on the p53 transcript (using Ciclophylin A as a housekeeping gene). Statistical analysis (REST 2005) revealed a significant, 11-fold up-regulation (P=0.026) of the nNOS transcript but no significant changes in iNOS transcription. The p53 mRNA was up-regulated almost 2-fold (P=0.0002; Student's t-Test; GraphPad Prism 4.00) in N2O-treated samples relative to
Transcription of five p53- and Stat-3-Inducible genes after ionizing radiation
Energy Technology Data Exchange (ETDEWEB)
Grace, M.B. [Uniformed Services University (USUHS), Armed Forces Radiobiology Research Institute, Building 42, RM 3321, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)], E-mail: grace@afrri.usuhs.mil; Blakely, W.F. [Uniformed Services University (USUHS), Armed Forces Radiobiology Research Institute, Building 42, RM 3321, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)
2007-07-15
Ionizing radiation (IR) produces temporal- and dose-dependent changes in multiple gene mRNA targets that are potential biomarkers of radiation dose. We confirmed IR-induced changes in expression of gadd45a, ddb-2, and cdkn1a downstream transcripts of p53 by quantitative reverse transcription-polymerase chain reaction (QRT-PCR) assay in total RNA samples from the whole blood of radiotherapy patients undergoing total-body irradiation [Amundson, S.A., Grace, M.B., McLeland, C.B., Epperly, M.W., Yeager, A., Zhan, Q., Greenberger, J.S., Fornace Jr., A.J., 2004. Human in vivo radiation-induced biomarkers: gene expression changes in radiotherapy patients. Cancer Res. 64, 6368-6371.]. We now confirm dose-dependent up-regulation of bax in addition to these p53-dependent transcripts, and bcl-2, a downstream transcript of Stat-3, in ex vivo irradiated blood samples from healthy unrelated volunteers. Together these biomarkers represent pathways involved in growth arrest, DNA damage, and apoptosis. The objectives of this study were to (1) investigate the relationship between baseline mRNA expression levels, and (2) define expression patterns in response to IR in a large cohort (n=20). Whole-blood samples were irradiated ex vivo to measure gene expression in samples from (i) three healthy donors over a broad dose range (0, 0.25, 0.50, 0.75, 1, 2, and 3 Gy), and (ii) 20 healthy donors at two doses, 0.25 and 2.5 Gy. Expression level variance ({sigma}{sub 2}) of baseline values (0 Gy) showed negligible inter-individual variation with all values {<=}1.0. {sigma}{sub 2}values=0.50bax, 0.25 bcl-2, 0.73 gadd45a, 0.66 cdkn1a, and 1.0 ddb-2. Meaningful IR dose-responses were observed for bax, gadd45a, and ddb-2 profiles and the ratio of bax:bcl-2 mRNA expression over a broad dose range. QRT-PCR studies were extended in the lower dose range (0, 0.1, 0.5, 0.75, and 1 Gy). Results showed that bax:bcl-2 ratio initially favors bax expression at doses of <1Gy, with IR-induced dose responses
International Nuclear Information System (INIS)
Sheahan, Sharon; Bellamy, Christopher O; Harland, Stephen N; Harrison, David J; Prost, Sandrine
2008-01-01
TGFβ has pleiotropic effects that range from regulation of proliferation and apoptosis to morphological changes and epithelial-mesenchymal transition (EMT). Some evidence suggests that these effects may be interconnected. We have recently reported that P53, P21 Cip1 and pRB, three critical regulators of the G1/S transition are variably involved in TGFβ-induced cell cycle arrest in hepatocytes. As these proteins are also involved in the regulation of apoptosis in many circumstances, we investigated their contribution to other relevant TGFβ-induced effects, namely apoptosis and EMT, and examined how the various processes were interrelated. Primary mouse hepatocytes deficient in p53, p21 and/or Rb, singly or in combination were treated with TGFβ for 24 to 96 hours. Apoptosis was quantified according to morphology and by immunostaining for cleaved-capsase 3. Epithelial and mesenchymal marker expression was studied using immunocytochemistry and real time PCR. We found that TGFβ similarly induced morphological changes regardless of genotype and independently of proliferation index or sensitivity to inhibition of proliferation by TGFβ. Morphological changes were accompanied by decrease in E-cadherin and increased Snail expression but the mesenchymal markers (N-cadherin, SMAα and Vimentin) studied remained unchanged. TGFβ induced high levels of apoptosis in p53-/-, Rb-/-, p21 cip1 -/- and control hepatocytes although with slight differences in kinetics. This was unrelated to proliferation or changes in morphology and loss of cell-cell adhesion. However, hepatocytes deficient in both p53 and p21 cip1 were less sensitive to TGFβ-induced apoptosis. Although p53, p21 Cip1 and pRb are well known regulators of both proliferation and apoptosis in response to a multitude of stresses, we conclude that they are critical for TGFβ-driven inhibition of hepatocytes proliferation, but only slightly modulate TGFβ-induced apoptosis. This effect may depend on other parameters
Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine
2014-06-14
The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.
Friend or Foe: MicroRNAs in the p53 network.
Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo
2018-04-10
The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.
p53 Over-expression and p53 mutations in colon carcinomas: Relation to dietary risk factors
Voskuil, D.W.; Kampman, E.; Kraats, A.A. van; Balder, H.F.; Muijen, G.N.P. van; Goldbohm, R.A.; Veer, P. van 't
1999-01-01
Epidemiological studies have suggested that dietary factors may differently affect p53-dependent and p53-independent pathways to colon cancer. Results of such studies may depend on the method used to assess p53 status. This case-control study of 185 colon-cancer cases and 259 controls examines this
Drosophila UTX coordinates with p53 to regulate ku80 expression in response to DNA damage.
Directory of Open Access Journals (Sweden)
Chengwan Zhang
Full Text Available UTX is known as a general factor that activates gene transcription during development. Here, we demonstrate an additional essential role of UTX in the DNA damage response, in which it upregulates the expression of ku80 in Drosophila, both in cultured cells and in third instar larvae. We further showed that UTX mediates the expression of ku80 by the demethylation of H3K27me3 at the ku80 promoter upon exposure to ionizing radiation (IR in a p53-dependent manner. UTX interacts physically with p53, and both UTX and p53 are recruited to the ku80 promoter following IR exposure in an interdependent manner. In contrast, the loss of utx has little impact on the expression of ku70, mre11, hid and reaper, suggesting the specific regulation of ku80 expression by UTX. Thus, our findings further elucidate the molecular function of UTX.
Pirou, Caroline; Montazer-Torbati, Fatemeh; Jah, Nadège; Delmas, Elisabeth; Lasbleiz, Christelle; Mignotte, Bernard; Renaud, Flore
2017-01-01
Neuroblastoma, a sympathetic nervous system tumor, accounts for 15% of cancer deaths in children. In contrast to most human tumors, p53 is rarely mutated in human primary neuroblastoma, suggesting impaired p53 activation in neuroblastoma. Various studies have shown correlations between fgf1 expression levels and both prognosis severity and tumor chemoresistance. As we previously showed that fibroblast growth factor 1 (FGF1) inhibited p53-dependent apoptosis in neuron-like PC12 cells, we initiated the study of the interaction between the FGF1 and p53 pathways in neuroblastoma. We focused on the activity of either extracellular FGF1 by adding recombinant rFGF1 in media, or of intracellular FGF1 by overexpression in human SH-SY5Y and mouse N2a neuroblastoma cell lines. In both cell lines, the genotoxic drug etoposide induced a classical mitochondrial p53-dependent apoptosis. FGF1 was able to inhibit p53-dependent apoptosis upstream of mitochondrial events in SH-SY5Y cells by both extracellular and intracellular pathways. Both rFGF1 addition and etoposide treatment increased fgf1 expression in SH-SY5Y cells. Conversely, rFGF1 or overexpressed FGF1 had no effect on p53-dependent apoptosis and fgf1 expression in neuroblastoma N2a cells. Using different FGF1 mutants (that is, FGF1K132E, FGF1S130A and FGF1S130D), we further showed that the C-terminal domain and phosphorylation of FGF1 regulate its intracrine anti-apoptotic activity in neuroblastoma SH-SY5Y cells. This study provides the first evidence for a role of an intracrine growth factor pathway on p53-dependent apoptosis in neuroblastoma, and could lead to the identification of key regulators involved in neuroblastoma tumor progression and chemoresistance. PMID:29048426
Directory of Open Access Journals (Sweden)
Dana Austin
Full Text Available Rift Valley fever virus (RVFV is an emerging viral zoonosis that is responsible for devastating outbreaks among livestock and is capable of causing potentially fatal disease in humans. Studies have shown that upon infection, certain viruses have the capability of utilizing particular cellular signaling pathways to propagate viral infection. Activation of p53 is important for the DNA damage signaling cascade, initiation of apoptosis, cell cycle arrest and transcriptional regulation of multiple genes. The current study focuses on the role of p53 signaling in RVFV infection and viral replication. These results show an up-regulation of p53 phosphorylation at several serine sites after RVFV MP-12 infection that is highly dependent on the viral protein NSs. qRT-PCR data showed a transcriptional up-regulation of several p53 targeted genes involved in cell cycle and apoptosis regulation following RVFV infection. Cell viability assays demonstrate that loss of p53 results in less RVFV induced cell death. Furthermore, decreased viral titers in p53 null cells indicate that RVFV utilizes p53 to enhance viral production. Collectively, these experiments indicate that the p53 signaling pathway is utilized during RVFV infection to induce cell death and increase viral production.
HEXIM1, a New Player in the p53 Pathway
Energy Technology Data Exchange (ETDEWEB)
Lew, Qiao Jing; Chu, Kai Ling; Chia, Yi Ling; Cheong, Nge [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Chao, Sheng-Hao, E-mail: jimmy_chao@bti.a-star.edu.sg [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Department of Microbiology, National University of Singapore, Singapore 117597 (Singapore)
2013-07-04
Hexamethylene bisacetamide-inducible protein 1 (HEXIM1) is best known as the inhibitor of positive transcription elongation factor b (P-TEFb), which controls transcription elongation of RNA polymerase II and Tat transactivation of human immunodeficiency virus. Besides P-TEFb, several proteins have been identified as HEXIM1 binding proteins. It is noteworthy that more than half of the HEXIM1 binding partners are involved in cancers. P53 and two key regulators of the p53 pathway, nucleophosmin (NPM) and human double minute-2 protein (HDM2), are among the factors identified. This review will focus on the functional importance of the interactions between HEXIM1 and p53/NPM/HDM2. NPM and the cytoplasmic mutant of NPM, NPMc+, were found to regulate P-TEFb activity and RNA polymerase II transcription through the interaction with HEXIM1. Importantly, more than one-third of acute myeloid leukemia (AML) patients carry NPMc+, suggesting the involvement of HEXIM1 in tumorigenesis of AML. HDM2 was found to ubiquitinate HEXIM1. The HDM2-mediated ubiquitination of HEXIM1 did not lead to protein degradation of HEXIM1 but enhanced its inhibitory activity on P-TEFb. Recently, HEXIM1 was identified as a novel positive regulator of p53. HEXIM1 prevented p53 ubiquitination by competing with HDM2 in binding to p53. Taken together, the new evidence suggests a role of HEXIM1 in regulating the p53 pathway and tumorigenesis.
Heo, Jong-Ik; Cho, Jung Hee; Kim, Jae-Ryong
2013-08-01
Holliday junction recognition protein (HJURP), a centromere protein-A (CENP-A) histone chaperone, mediates centromere-specific assembly of CENP-A nucleosome, contributing to high-fidelity chromosome segregation during cell division. However, the role of HJURP in cellular senescence of human primary cells remains unclear. We found that the expression levels of HJURP decreased in human dermal fibroblasts and umbilical vein endothelial cells in replicative or premature senescence. Ectopic expression of HJURP in senescent cells partially overcame cell senescence. Conversely, downregulation of HJURP in young cells led to premature senescence. p53 knockdown, but not p16 knockdown, abolished senescence phenotypes caused by HJURP reduction. These data suggest that HJURP plays an important role in the regulation of cellular senescence through a p53-dependent pathway and might contribute to tissue or organismal aging and protection of cellular transformation.
Alonso, Michelle; Tamasdan, Cristina; Miller, Douglas C; Newcomb, Elizabeth W
2003-02-01
Flavopiridol is a synthetic flavone, which inhibits growth in vitro and in vivo of several solid malignancies such as renal, prostate, and colon cancers. It is a potent cyclin-dependent kinase inhibitor presently in clinical trials. In this study, we examined the effect of flavopiridol on a panel of glioma cell lines having different genetic profiles: five of six have codeletion of p16(INK4a) and p14(ARF); three of six have p53 mutations; and one of six shows overexpression of mouse double minute-2 (MDM2) protein. Independent of retinoblastoma and p53 tumor suppressor pathway alterations, flavopiridol induced apoptosis in all cell lines but through a caspase-independent mechanism. No cleavage products for caspase 3 or its substrate poly(ADP-ribose) polymerase or caspase 8 were detected. The pan-caspase inhibitor Z-VAD-fmk did not inhibit flavopiridol-induced apoptosis. Mitochondrial damage measured by cytochrome c release and transmission electron microscopy was not observed in drug-treated glioma cells. In contrast, flavopiridol treatment induced translocation of apoptosis-inducing factor from the mitochondria to the nucleus. The proteins cyclin D(1) and MDM2 involved in the regulation of retinoblastoma and p53 activity, respectively, were down-regulated early after flavopiridol treatment. Given that MDM2 protein can confer oncogenic properties under certain circumstances, loss of MDM2 expression in tumor cells could promote increased chemosensitivity. After drug treatment, a low Bcl-2/Bax ratio was observed, a condition that may favor apoptosis. Taken together, the data indicate that flavopiridol has activity against glioma cell lines in vitro and should be considered for clinical development in the treatment of glioblastoma multiforme.
Zhang, E-b; Yin, D-d; Sun, M; Kong, R; Liu, X-h; You, L-h; Han, L; Xia, R; Wang, K-m; Yang, J-s; De, W; Shu, Y-q; Wang, Z-x
2014-05-22
Recently, a novel class of transcripts, long non-coding RNAs (lncRNAs), is being identified at a rapid pace. These RNAs have critical roles in diverse biological processes, including tumorigenesis. Here we report that taurine-upregulated gene 1 (TUG1), a 7.1-kb lncRNA, recruiting and binding to polycomb repressive complex 2 (PRC2), is generally downregulated in non-small cell lung carcinoma (NSCLC) tissues. In a cohort of 192 NSCLC patients, the lower expression of TUG1 was associated with a higher TNM stage and tumor size, as well as poorer overall survival (PTUG1 expression serves as an independent predictor for overall survival (PTUG1 expression was induced by p53, and luciferase and chromatin immunoprecipitation (ChIP) assays confirmed that TUG1 was a direct transcriptional target of p53. TUG1 knockdown significantly promoted the proliferation in vitro and in vivo. Moreover, the lncRNA-mediated regulation of the expression of HOX genes in tumorigenesis and development has been recently receiving increased attention. Interestingly, inhibition of TUG1 could upregulate homeobox B7 (HOXB7) expression; ChIP assays demonstrated that the promoter of HOXB7 locus was bound by EZH2 (enhancer of zeste homolog 2), a key component of PRC2, and was H3K27 trimethylated. This TUG1-mediated growth regulation is in part due to specific modulation of HOXB7, thus participating in AKT and MAPK pathways. Together, these results suggest that p53-regulated TUG1 is a growth regulator, which acts in part through control of HOXB7. The p53/TUG1/PRC2/HOXB7 interaction might serve as targets for NSCLC diagnosis and therapy.
Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva
2018-03-01
HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.
Gene expression and apoptosis induction in p53-heterozygous irradiated mice
International Nuclear Information System (INIS)
Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina
2006-01-01
The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses
Gene expression and apoptosis induction in p53-heterozygous irradiated mice
Energy Technology Data Exchange (ETDEWEB)
Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it
2006-02-22
The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.
Directory of Open Access Journals (Sweden)
Peng Zhang
2014-03-01
Full Text Available Hypoxia-inducible factors (HIFs play key roles in the cellular response to hypoxia. It is widely accepted that whereas HIF-1 and HIF-2 function as transcriptional activators, HIF-3 inhibits HIF-1/2α action. Contrary to this idea, we show that zebrafish Hif-3α has strong transactivation activity. Hif-3α is degraded under normoxia. Mutation of P393, P493, and L503 inhibits this oxygen-dependent degradation. Transcriptomics and chromatin immunoprecipitation analyses identify genes that are regulated by Hif-3α, Hif-1α, or both. Under hypoxia or when overexpressed, Hif-3α binds to its target gene promoters and upregulates their expression. Dominant-negative inhibition and knockdown of Hif-3α abolish hypoxia-induced Hif-3α-promoter binding and gene expression. Hif-3α not only mediates hypoxia-induced growth and developmental retardation but also possesses hypoxia-independent activities. Importantly, transactivation activity is conserved and human HIF-3α upregulates similar genes in human cells. These findings suggest that Hif-3 is an oxygen-dependent transcription factor and activates a distinct transcriptional response to hypoxia.
Directory of Open Access Journals (Sweden)
Li Xie
Full Text Available Numerous genetic and epigenetic alterations render cancer cells selectively dependent on specific genes and regulatory pathways, and represent potential vulnerabilities that can be therapeutically exploited. Here we describe an RNA interference (RNAi-based synthetic interaction screen to identify genes preferentially required for proliferation of p53-deficient (p53- human cancer cells. We find that compared to p53-competent (p53+ human cancer cell lines, diverse p53- human cancer cell lines are preferentially sensitive to loss of the transcription factor ETV1 and the DNA damage kinase ATR. In p53- cells, RNAi-mediated knockdown of ETV1 or ATR results in decreased expression of the telomerase catalytic subunit TERT leading to growth arrest, which can be reversed by ectopic TERT expression. Chromatin immunoprecipitation analysis reveals that ETV1 binds to a region downstream of the TERT transcriptional start-site in p53- but not p53+ cells. We find that the role of ATR is to phosphorylate and thereby stabilize ETV1. Our collective results identify a regulatory pathway involving ETV1, ATR, and TERT that is preferentially important for proliferation of diverse p53- cancer cells.
p53-dependent inhibition of TrxR1 contributes to the tumor-specific induction of apoptosis by RITA.
Hedström, Elisabeth; Eriksson, Sofi; Zawacka-Pankau, Joanna; Arnér, Elias S J; Selivanova, Galina
2009-11-01
Thioredoxin reductase 1 (TrxR1) is a key regulator in many redox-dependent cellular pathways, and is often overexpressed in cancer. Several studies have identified TrxR1 as a potentially important target for anticancer therapy. The low molecular weight compound RITA (NSC 652287) binds p53 and induces p53-dependent apoptosis. Here we found that RITA also targets TrxR1 by non-covalent binding, followed by inhibition of its activity in vitro and by inhibition of TrxR activity in cancer cells. Interestingly, a novel approximately 130 kDa form of TrxR1, presumably representing a stable covalently linked dimer, and an increased generation of reactive oxygen species (ROS) were induced by RITA in cancer cells in a p53-dependent manner. Similarly, the gold-based TrxR inhibitor auranofin induced apoptosis related to oxidative stress, but independently of p53 and without apparent induction of the approximately 130 kDa form of TrxR1. In contrast to the effects observed in cancer cells, RITA did not inhibit TrxR or ROS formation in normal fibroblasts (NHDF). The inhibition of TrxR1 can sensitize tumor cells to agents that induce oxidative stress and may directly trigger cell death. Thus, our results suggest that a unique p53-dependent effect of RITA on TrxR1 in cancer cells might synergize with p53-dependent induction of pro-apoptotic genes and oxidative stress, thereby leading to a robust induction of cancer cell death, without affecting non-transformed cells.
Bajbouj, K; Mawrin, C; Hartig, R; Schulze-Luehrmann, J; Wilisch-Neumann, A; Roessner, A; Schneider-Stock, R
2012-05-01
Glioblastomas are known to be highly chemoresistant, but HDAC inhibitors (HDACi) have been shown to be of therapeutic relevance for this aggressive tumor type. We treated U87 glioblastoma cells with trichostatin A (TSA) to define potential epigenetic targets for HDACi-mediated antitumor effects. Using a cDNA array analysis covering 96 cell cycle genes, cyclin-dependent kinase inhibitor p21(WAF1) was identified as the major player in TSA-induced cell cycle arrest. TSA slightly inhibited proliferation and viability of U87 cells, cumulating in a G1/S cell cycle arrest. This effect was accompanied by a significant up-regulation of p53 and its transcriptional target p21(WAF1) and by down-regulation of key G1/S regulators, such as cdk4, cdk6, and cyclin D1. Nevertheless, TSA did not induce apoptosis in U87 cells. As expected, TSA promoted the accumulation of total acetylated histones H3 and H4 and a decrease in endogenous HDAC activity. Characterizing the chromatin modulation around the p21(WAF1) promoter after TSA treatment using chromatin immunoprecipitation, we found (1) a release of HDAC1, (2) an increase of acetylated H4 binding, and (3) enhanced recruitment of p53. p53-depleted U87 cells showed an abrogation of the G1/S arrest and re-entered the cell cycle. Immunofluorescence staining revealed that TSA induced the nuclear translocation of p21(WAF1) verifying a cell cycle arrest. On the other hand, a significant portion of p21(WAF1) was present in the cytoplasmic compartment causing apoptosis resistance. Furthermore, TSA-treated p53-mutant cell line U138 failed to show an induction in p21(WAF1), showed a deficient G2/M checkpoint, and underwent mitotic catastrophe. We suggest that HDAC inhibition in combination with other clinically used drugs may be considered an effective strategy to overcome chemoresistance in glioblastoma cells.
Min, Kyoung-Jin; Nam, Ju-Ock; Kwon, Taeg Kyu
2017-08-02
Fisetin is a natural compound found in fruits and vegetables such as strawberries, apples, cucumbers, and onions. Since fisetin can elicit anti-cancer effects, including anti-proliferation and anti-migration, we investigated whether fisetin induced apoptosis in human renal carcinoma (Caki) cells. Fisetin markedly induced sub-G1 population and cleavage of poly (ADP-ribose) polymerase (PARP), which is a marker of apoptosis, and increased caspase activation. We found that pan-caspase inhibitor (z-VAD-fmk) inhibited fisetin-induced apoptosis. In addition, fisetin induced death receptor 5 (DR5) expression at the transcriptional level, and down-regulation of DR5 by siRNA blocked fisetin-induced apoptosis. Furthermore, fisetin induced p53 protein expression through up-regulation of protein stability, whereas down-regulation of p53 by siRNA markedly inhibited fisetin-induced DR5 expression. In contrast, fisetin induced up-regulation of CHOP expression and reactive oxygen species production, which had no effect on fisetin-induced apoptosis. Taken together, our study demonstrates that fisetin induced apoptosis through p53 mediated up-regulation of DR5 expression at the transcriptional level.
Cdk2 is required for p53-independent G2/M checkpoint control.
Directory of Open Access Journals (Sweden)
Jon H Chung
2010-02-01
Full Text Available The activation of phase-specific cyclin-dependent kinases (Cdks is associated with ordered cell cycle transitions. Among the mammalian Cdks, only Cdk1 is essential for somatic cell proliferation. Cdk1 can apparently substitute for Cdk2, Cdk4, and Cdk6, which are individually dispensable in mice. It is unclear if all functions of non-essential Cdks are fully redundant with Cdk1. Using a genetic approach, we show that Cdk2, the S-phase Cdk, uniquely controls the G(2/M checkpoint that prevents cells with damaged DNA from initiating mitosis. CDK2-nullizygous human cells exposed to ionizing radiation failed to exclude Cdk1 from the nucleus and exhibited a marked defect in G(2/M arrest that was unmasked by the disruption of P53. The DNA replication licensing protein Cdc6, which is normally stabilized by Cdk2, was physically associated with the checkpoint regulator ATR and was required for efficient ATR-Chk1-Cdc25A signaling. These findings demonstrate that Cdk2 maintains a balance of S-phase regulatory proteins and thereby coordinates subsequent p53-independent G(2/M checkpoint activation.
Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.
Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel
2012-02-01
Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.
Novel Functions for TAF7, a Regulator of TAF1-independent Transcription
Devaiah, Ballachanda N.; Lu, Hanxin; Gegonne, Anne; Sercan, Zeynep; Zhang, Hongen; Clifford, Robert J.; Lee, Maxwell P.; Singer, Dinah S.
2010-01-01
The transcription factor TFIID components TAF7 and TAF1 regulate eukaryotic transcription initiation. TAF7 regulates transcription initiation of TAF1-dependent genes by binding to the acetyltransferase (AT) domain of TAF1 and inhibiting the enzymatic activity that is essential for transcription. TAF7 is released from the TAF1-TFIID complex upon completion of preinitiation complex assembly, allowing transcription to initiate. However, not all transcription is TAF1-dependent, and the role of TA...
Imiquimod activates p53-dependent apoptosis in a human basal cell carcinoma cell line.
Huang, Shi-Wei; Chang, Shu-Hao; Mu, Szu-Wei; Jiang, Hsin-Yi; Wang, Sin-Ting; Kao, Jun-Kai; Huang, Jau-Ling; Wu, Chun-Ying; Chen, Yi-Ju; Shieh, Jeng-Jer
2016-03-01
The tumor suppressor p53 controls DNA repair, cell cycle, apoptosis, autophagy and numerous other cellular processes. Imiquimod (IMQ), a synthetic toll-like receptor (TLR) 7 ligand for the treatment of superficial basal cell carcinoma (BCC), eliminates cancer cells by activating cell-mediated immunity and directly inducing apoptosis and autophagy in cancer cells. To evaluate the role of p53 in IMQ-induced cell death in skin cancer cells. The expression, phosphorylation and subcellular localization of p53 were detected by real-time PCR, luciferase reporter assay, cycloheximide chase analysis, immunoblotting and immunocytochemistry. Using BCC/KMC1 cell line as a model, the upstream signaling of p53 activation was dissected by over-expression of TLR7/8, the addition of ROS scavenger, ATM/ATR inhibitors and pan-caspase inhibitor. The role of p53 in IMQ-induced apoptosis and autophagy was assessed by genetically silencing p53 and evaluated by a DNA content assay, immunoblotting, LC3 puncta detection and acridine orange staining. IMQ induced p53 mRNA expression and protein accumulation, increased Ser15 phosphorylation, promoted nuclear translocation and up-regulated its target genes in skin cancer cells in a TLR7/8-independent manner. In BCC/KMC1 cells, the induction of p53 by IMQ was achieved through increased ROS production to stimulate the ATM/ATR-Chk1/Chk2 axis but was not mediated by inducing DNA damage. The pharmacological inhibition of ATM/ATR significantly suppressed IMQ-induced p53 activation and apoptosis. Silencing of p53 significantly decreased the IMQ-induced caspase cascade activation and apoptosis but enhanced autophagy. Mutant p53 skin cancer cell lines were more resistant to IMQ-induced apoptosis than wildtype p53 skin cancer cell lines. IMQ induced ROS production to stimulate ATM/ATR pathways and contributed to p53-dependent apoptosis in a skin basal cell carcinoma cell line BCC/KMC1. Copyright © 2015 Japanese Society for Investigative Dermatology
Directory of Open Access Journals (Sweden)
Ajay Kumar
Full Text Available Minnelide/Triptolide (TL has recently emerged as a potent anticancer drug in non-small cell lung cancer (NSCLC. However, the precise mechanism of its action remains ambiguous. In this study, we elucidated the molecular basis for TL-induced cell death in context to p53 status. Cell death was attributed to dysfunction of mitochondrial bioenergetics in p53-deficient cells, which was characterized by decreased mitochondrial respiration, steady-state ATP level and membrane potential, but augmented reactive oxygen species (ROS. Increased ROS production resulted in oxidative stress in TL-treated cells. This was exhibited by elevated nuclear levels of a redox-sensitive transcriptional factor, NF-E2-related factor-2 (NRF2, along with diminished cellular glutathione (GSH content. We further demonstrated that in the absence of p53, TL blunted the expression of mitochondrial SIRT3 triggering increased acetylation of NDUAF9 and succinate dehydrogenase, components of complexes I and II of the electron transport chain (ETC. TL-mediated hyperacetylation of complexes I and II proteins and these complexes displayed decreased enzymatic activities. We also provide the evidence that P53 regulate steady-state level of SIRT3 through Proteasome-Pathway. Finally, forced overexpression of Sirt3, but not deacetylase-deficient mutant of Sirt3 (H243Y, restored the deleterious effect of TL on p53-deficient cells by rescuing mitochondrial bioenergetics. On contrary, Sirt3 deficiency in the background of wild-type p53 triggered TL-induced mitochondrial impairment that echoed TL effect in p53-deficeint cells. These findings illustrate a novel mechanism by which TL exerts its potent effects on mitochondrial function and ultimately the viability of NSCLC tumor.
Mitochondrial localization of the low level p53 protein in proliferative cells
Energy Technology Data Exchange (ETDEWEB)
Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Oliver, Lisa [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Rincheval, Vincent; Renaud, Flore [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vallette, Francois M. [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Mignotte, Bernard [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vayssiere, Jean-Luc, E-mail: jean-luc.vayssiere@uvsq.fr [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France)
2009-10-02
p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.
Mitochondrial localization of the low level p53 protein in proliferative cells
International Nuclear Information System (INIS)
Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie; Oliver, Lisa; Rincheval, Vincent; Renaud, Flore; Vallette, Francois M.; Mignotte, Bernard; Vayssiere, Jean-Luc
2009-01-01
p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.
Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT
Leszczynska, K.B.; Foskolou, I.P.; Abraham, A.G.; Anbalagan, S.; Tellier, C.; Haider, S.; Span, P.N.; O'Neill, E.E.; Buffa, F.M.; Hammond, E.M.
2015-01-01
Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent
The miR-1000-p53 pathway regulates apoptosis and virus infection in shrimp.
Gong, Yi; Ju, Chenyu; Zhang, Xiaobo
2015-10-01
The p53 protein plays an important role in apoptosis which is involved in the immunity of animals. However, effects of the miRNA-mediated regulation of p53 expression on apoptosis and virus infection are not extensively investigated. To address this issue, the miRNA-mediated p53-dependent apoptotic pathway was explored in this study. The results indicated that p53 could regulate the apoptotic activity of Marsupenaeus japonicas shrimp and influence the infection of white spot syndrome virus (WSSV). The further data presented that miR-1000 could target the 3'-untranslated region (3'UTR) of p53 gene. The results of in vivo experiments showed that the miR-1000 overexpression led to significant decreases of shrimp apoptotic activity and the capacity of WSSV infection, while the miR-1000 silencing resulted in significant increases of apoptotic activity and virus infection, indicating that miR-1000 took great effects on apoptosis and virus infection by targeting p53. Therefore, our study revealed a novel mechanism that the miR-1000-p53 pathway regulated apoptosis and virus infection in shrimp. Copyright © 2015 Elsevier Ltd. All rights reserved.
Andrographolide induces degradation of mutant p53 via activation of Hsp70.
Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu
2018-05-22
The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.
Roles of p53, MYC and HIF-1 in regulating glycolysis - the seventh hallmark of cancer.
Yeung, S J; Pan, J; Lee, M-H
2008-12-01
Despite diversity in genetic events in oncogenesis, cancer cells exhibit a common set of functional characteristics. Otto Warburg discovered that cancer cells have consistently higher rates of glycolysis than normal cells. The underlying mechanisms leading to the Warburg phenomenon include mitochondrial changes, upregulation of rate-limiting enzymes/proteins in glycolysis and intracellular pH regulation, hypoxia-induced switch to anaerobic metabolism, and metabolic reprogramming after loss of p53 function. The regulation of energy metabolism can be traced to a "triad" of transcription factors: c-MYC, HIF-1 and p53. Oncogenetic changes involve a nonrandom set of gene deletions, amplifications and mutations, and many oncogenes and tumor suppressor genes cluster along the signaling pathways that regulate c-MYC, HIF-1 and p53. Glycolysis in cancer cells has clinical implications in cancer diagnosis, treatment and interaction with diabetes mellitus. Many drugs targeting energy metabolism are in development. Future advances in technology may bring about transcriptome and metabolome-guided chemotherapy.
Chou, Wen-Wen; Guh, Jinn-Yuh; Tsai, Jung-Fa; Hwang, Chi-Ching; Chiou, Shean-Jaw; Chuang, Lea-Yea
2009-06-01
Betel-quid use is associated with liver cancer whereas its constituent arecoline is cytotoxic, genotoxic, and induces p53-dependent p21(WAF1) protein expression in Clone-9 cells (rat hepatocytes). The ataxia telangiectasia mutated (ATM)/rad3-related (ATR)-p53-p21(WAF1) and the phosphatidylinositol-3-kinase (PI3K)-mammalian target of rapamycin (mTOR) pathways are involved in the DNA damage response and the pathogenesis of cancers. Thus, we studied the role of ATM/ATR and PI3K in arecoline-induced p53 and p21(WAF1) protein expression in Clone-9 cells. We found that arecoline (0.5 mM) activated the ATM/ATR kinase at 30 min. The arecoline-activated ATM/ATR substrate contained p-p53Ser15. Moreover, arecoline only increased the levels of the p-p53Ser6, p-p53Ser15, and p-p53Ser392 phosphorylated p53 isoforms among the known isoforms. ATM shRNA attenuated arecoline-induced p-p53Ser15 and p21(WAF1) at 24 h. Arecoline (0.5 mM) increased phosphorylation levels of p-AktSer473 and p-mTORSer2448 at 30-60 min. Dominant-negative PI3K plasmids attenuated arecoline-induced p21(WAF1), but not p-p53Ser15, at 24 h. Rapamycin attenuated arecoline-induced phosphrylated p-p53Ser15, but not p21(WAF1), at 24 h. ATM shRNA, but not dominant-negative PI3K plasmids, attenuated arecoline-induced p21(WAF1) gene transcription. We conclude that arecoline activates the ATM/ATR-p53-p21(WAF1) and the PI3K/Akt-mTOR-p53 pathways in Clone-9 cells. Arecoline-induced phosphorylated p-p53Ser15 expression is dependent on ATM whereas arecoline-induced p21(WAF1) protein expression is dependent on ATM and PI3K. Moreover, p21(WAF1) gene is transcriptionally induced by arecoline-activated ATM. (c) 2009 Wiley-Liss, Inc.
The nucleolus as a fundamental regulator of the p53 response and a new target for cancer therapy.
Woods, Simone J; Hannan, Katherine M; Pearson, Richard B; Hannan, Ross D
2015-07-01
Recent studies have highlighted the fundamental role that key oncogenes such as MYC, RAS and PI3K occupy in driving RNA Polymerase I transcription in the nucleolus. In addition to maintaining essential levels of protein synthesis, hyperactivated ribosome biogenesis and nucleolar function plays a central role in suppressing p53 activation in response to oncogenic stress. Consequently, disruption of ribosome biogenesis by agents such as the small molecule inhibitor of RNA Polymerase I transcription, CX-5461, has shown unexpected, potent, and selective effects in killing tumour cells via disruption of nucleolar function leading to activation of p53, independent of DNA damage. This review will explore the mechanism of DNA damage-independent activation of p53 via the nucleolar surveillance pathway and how this can be utilised to design novel cancer therapies. Non-genotoxic targeting of nucleolar function may provide a new paradigm for treatment of a broad range of oncogene-driven malignancies with improved therapeutic windows. This article is part of a Special Issue entitled: Translation and Cancer. Copyright © 2014 Elsevier B.V. All rights reserved.
Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa
2016-07-26
DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress.
Directory of Open Access Journals (Sweden)
Kyoung-jin Min
2017-08-01
Full Text Available Fisetin is a natural compound found in fruits and vegetables such as strawberries, apples, cucumbers, and onions. Since fisetin can elicit anti-cancer effects, including anti-proliferation and anti-migration, we investigated whether fisetin induced apoptosis in human renal carcinoma (Caki cells. Fisetin markedly induced sub-G1 population and cleavage of poly (ADP-ribose polymerase (PARP, which is a marker of apoptosis, and increased caspase activation. We found that pan-caspase inhibitor (z-VAD-fmk inhibited fisetin-induced apoptosis. In addition, fisetin induced death receptor 5 (DR5 expression at the transcriptional level, and down-regulation of DR5 by siRNA blocked fisetin-induced apoptosis. Furthermore, fisetin induced p53 protein expression through up-regulation of protein stability, whereas down-regulation of p53 by siRNA markedly inhibited fisetin-induced DR5 expression. In contrast, fisetin induced up-regulation of CHOP expression and reactive oxygen species production, which had no effect on fisetin-induced apoptosis. Taken together, our study demonstrates that fisetin induced apoptosis through p53 mediated up-regulation of DR5 expression at the transcriptional level.
2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.
Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R
2016-09-06
The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.
Ishizawa, Jo; Kojima, Kensuke; Chachad, Dhruv; Ruvolo, Peter; Ruvolo, Vivian; Jacamo, Rodrigo O; Borthakur, Gautam; Mu, Hong; Zeng, Zhihong; Tabe, Yoko; Allen, Joshua E; Wang, Zhiqiang; Ma, Wencai; Lee, Hans C; Orlowski, Robert; Sarbassov, Dos D; Lorenzi, Philip L; Huang, Xuelin; Neelapu, Sattva S; McDonnell, Timothy; Miranda, Roberto N; Wang, Michael; Kantarjian, Hagop; Konopleva, Marina; Davis, R Eric; Andreeff, Michael
2016-02-16
The clinical challenge posed by p53 abnormalities in hematological malignancies requires therapeutic strategies other than standard genotoxic chemotherapies. ONC201 is a first-in-class small molecule that activates p53-independent apoptosis, has a benign safety profile, and is in early clinical trials. We found that ONC201 caused p53-independent apoptosis and cell cycle arrest in cell lines and in mantle cell lymphoma (MCL) and acute myeloid leukemia (AML) samples from patients; these included samples from patients with genetic abnormalities associated with poor prognosis or cells that had developed resistance to the nongenotoxic agents ibrutinib and bortezomib. Moreover, ONC201 caused apoptosis in stem and progenitor AML cells and abrogated the engraftment of leukemic stem cells in mice while sparing normal bone marrow cells. ONC201 caused changes in gene expression similar to those caused by the unfolded protein response (UPR) and integrated stress responses (ISRs), which increase the translation of the transcription factor ATF4 through an increase in the phosphorylation of the translation initiation factor eIF2α. However, unlike the UPR and ISR, the increase in ATF4 abundance in ONC201-treated hematopoietic cells promoted apoptosis and did not depend on increased phosphorylation of eIF2α. ONC201 also inhibited mammalian target of rapamycin complex 1 (mTORC1) signaling, likely through ATF4-mediated induction of the mTORC1 inhibitor DDIT4. Overexpression of BCL-2 protected against ONC201-induced apoptosis, and the combination of ONC201 and the BCL-2 antagonist ABT-199 synergistically increased apoptosis. Thus, our results suggest that by inducing an atypical ISR and p53-independent apoptosis, ONC201 has clinical potential in hematological malignancies. Copyright © 2016, American Association for the Advancement of Science.
International Nuclear Information System (INIS)
Stubbert, Lawton J; Smith, Jennifer M; McKay, Bruce C
2010-01-01
One of the most commonly used classes of anti-cancer drugs presently in clinical practice is the platinum-based drugs, including cisplatin. The efficacy of cisplatin therapy is often limited by the emergence of resistant tumours following treatment. Cisplatin resistance is multi-factorial but can be associated with increased DNA repair capacity, mutations in p53 or loss of DNA mismatch repair capacity. RNA interference (RNAi) was used to reduce the transcription-coupled nucleotide excision repair (TC-NER) capacity of several prostate and colorectal carcinoma cell lines with specific defects in p53 and/or DNA mismatch repair. The effect of small inhibitory RNAs designed to target the CSB (Cockayne syndrome group B) transcript on TC-NER and the sensitivity of cells to cisplatin-induced apoptosis was determined. These prostate and colon cancer cell lines were initially TC-NER proficient and RNAi against CSB significantly reduced their DNA repair capacity. Decreased TC-NER capacity was associated with an increase in the sensitivity of tumour cells to cisplatin-induced apoptosis, even in p53 null and DNA mismatch repair-deficient cell lines. The present work indicates that CSB and TC-NER play a prominent role in determining the sensitivity of tumour cells to cisplatin even in the absence of p53 and DNA mismatch repair. These results further suggest that CSB represents a potential target for cancer therapy that may be important to overcome resistance to cisplatin in the clinic
Directory of Open Access Journals (Sweden)
Smith Jennifer M
2010-05-01
Full Text Available Abstract Background One of the most commonly used classes of anti-cancer drugs presently in clinical practice is the platinum-based drugs, including cisplatin. The efficacy of cisplatin therapy is often limited by the emergence of resistant tumours following treatment. Cisplatin resistance is multi-factorial but can be associated with increased DNA repair capacity, mutations in p53 or loss of DNA mismatch repair capacity. Methods RNA interference (RNAi was used to reduce the transcription-coupled nucleotide excision repair (TC-NER capacity of several prostate and colorectal carcinoma cell lines with specific defects in p53 and/or DNA mismatch repair. The effect of small inhibitory RNAs designed to target the CSB (Cockayne syndrome group B transcript on TC-NER and the sensitivity of cells to cisplatin-induced apoptosis was determined. Results These prostate and colon cancer cell lines were initially TC-NER proficient and RNAi against CSB significantly reduced their DNA repair capacity. Decreased TC-NER capacity was associated with an increase in the sensitivity of tumour cells to cisplatin-induced apoptosis, even in p53 null and DNA mismatch repair-deficient cell lines. Conclusion The present work indicates that CSB and TC-NER play a prominent role in determining the sensitivity of tumour cells to cisplatin even in the absence of p53 and DNA mismatch repair. These results further suggest that CSB represents a potential target for cancer therapy that may be important to overcome resistance to cisplatin in the clinic.
Tumour suppression in skin and other tissues via cross-talk between vitamin D- and p53-signalling
Directory of Open Access Journals (Sweden)
Joerg eReichrath
2014-06-01
Full Text Available P53 and its family members have been implicated in the direct regulation of the vitamin D receptor (VDR. Vitamin D- and p53-signaling pathways have a significant impact on spontaneous or carcinogen-induced malignant transformation of cells, with VDR and p53 representing important tumour suppressors. VDR and the p53/p63/p73 proteins all function typically as receptors or sensors that turn into transcriptional regulators upon stimulus, with the main difference being that the nuclear VDR is activated as a transcription factor after binding its naturally occurring ligand 1,25-dihydroxyvitamin D with high affinity while the p53 family of transcription factors, mostly in the nucleoplasm, responds to a large number of alterations in cell homeostasis commonly referred to as stress. An increasing body of evidence now convincingly demonstrates a cross-talk between vitamin D- and p53-signaling that occurs at different levels, has genome-wide implications and that should be of high importance for many malignancies, including non-melanoma skin cancer. One interaction involves the ability of p53 to increase skin pigmentation via POMC derivatives including alpha-MSH and ACTH. Pigmentation protects the skin against UV-induced DNA damage and skin carcinogenesis, yet on the other hand reduces cutaneous synthesis of vitamin D. A second level of interaction may be through the ability of 1,25-dihydroxyvitamin D to increase the survival of skin cells after UV irradiation. UV irradiation-surviving cells show significant reductions in thymine dimers in the presence of 1,25-dihydroxyvitamin D that are associated with increased nuclear p53 protein expression, and significantly reduced NO products. A third level of interaction is documented by the ability of vitamin D compounds to regulate the expression of the murine double minute 2 (MDM2 gene in dependence of the presence of wild-type p53. MDM2 has a well established role as a key negative regulator of p53 activity
Battle Against Cancer: An Everlasting Saga of p53
Directory of Open Access Journals (Sweden)
Qian Hao
2014-12-01
Full Text Available Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress—p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.
Directory of Open Access Journals (Sweden)
Jennifer M. Smith
2007-12-01
Full Text Available Two adjacent regions within the transactivation domain of p53 are sufficient to support sequence-specific transactivation when fused to a heterologous DNA binding domain. It has been hypothesized that these two subdomains of p53 may contribute to the expression of distinct p53-responsive genes. Here we have used oligonucleotide microarrays to identify transcripts induced by variants of p53 with point mutations within subdomains 1, 2, or 1 and 2 (QS1, QS2, QS1/QS2, respectively. The expression of 254 transcripts was increased in response to wild-type p53 expression but most of these transcripts were poorly induced by these variants of p53. Strikingly, a number of known p53regulated transcripts including TNFRSF10B, BAX, BTG2, POLH were increased to wild-type levels by p53QS1 and p53QS2 but not p53QS1/QS2, indicating that either sub domain 1 or 2 is sufficient for p53-dependent expression of a small subset of p53-responsive genes. Unexpectedly, there was no evidence for p53QS1- or p53QS2-specific gene expression. Taken together, we found heterogeneity in the requirement for transactivation subdomains 1 and 2 of p53 without any subdomain-specific contribution to p53-induced gene expression.
Radiation-induced p53 protein response in the A549 cell line is culture growth-phase dependent
Energy Technology Data Exchange (ETDEWEB)
Johnson, N.F.; Gurule, D.M.; Carpenter, T.R.
1995-12-01
One role of the p53 tumor suppressor protein has been recently revealed. Kastan, M.B. reported that p53 protein accumulates in cells exposed to ionizing radiation. The accumulation of p53 protein is in response to DNA damage, most importantly double-strand breaks, that results from exposure to ionizing radiation. The rise in cellular p53 levels is necessary for an arrest in the G{sub 1} phase of the cell cycle to provide additional time for DNA repair. The p53 response has also been demonstrated to enhance PCNA-dependent repair. p53 is thus an important regulator of the cellular response to DNA-damaging radiation. From this data, it can be concluded that the magnitude of the p53 response is not dependent on the phase of culture growth.
A Dual Role of P53 in Regulating Colistin-Induced Autophagy in PC-12 Cells
Directory of Open Access Journals (Sweden)
Ziyin Lu
2017-10-01
Full Text Available This study aimed to investigate the mechanism of p53 in regulating colistin-induced autophagy in PC-12 cells. Importantly, cells were treated with 125 μg/ml colistin for 12 and 24 h after transfection with p53 siRNA or recombinant plasmid. The hallmarks of autophagy and apoptosis were examined by real-time PCR and western blot, fluorescence/immunofluorescence microscopy, and electron microscopy. The results showed that silencing of p53 leads to down-regulation of Atg5 and beclin1 for 12 h while up-regulation at 24 h and up-regulation of p62 noted. The ratio of LC3-II/I and autophagic vacuoles were significantly increased at 24 h, but autophagy flux was blocked. The cleavage of caspase3 and PARP (poly ADP-ribose polymerase were enhanced, while PC-12-sip53 cells exposed to 3-MA showed down-regulation of apoptosis. By contrast, the expression of autophagy-related genes and protein reduced in p53 overexpressing cells following a time dependent manner. Meanwhile, there was an increase in the expression of activated caspase3 and PARP, condensed and fragmented nuclei were evident. Conclusively, the data supported that silencing of p53 promotes impaired autophagy, which acts as a pro-apoptotic induction factor in PC-12 cells treated with colistin for 24 h, and overexpression of p53 inhibits autophagy and accelerates apoptosis. Hence, it has been suggested that p53 could not act as a neuro-protective target in colistin-induced neurotoxicity.
Effect of hydroxyurea on the promoter occupancy profiles of tumor suppressor p53 and p73
Directory of Open Access Journals (Sweden)
Lu Xin
2009-06-01
Full Text Available Abstract Background The p53 tumor suppressor and its related protein, p73, share a homologous DNA binding domain, and mouse genetics studies have suggested that they have overlapping as well as distinct biological functions. Both p53 and p73 are activated by genotoxic stress to regulate an array of cellular responses. Previous studies have suggested that p53 and p73 independently activate the cellular apoptotic program in response to cytotoxic drugs. The goal of this study was to compare the promoter-binding activity of p53 and p73 at steady state and after genotoxic stress induced by hydroxyurea. Results We employed chromatin immunoprecipitation, the NimbleGen promoter arrays and a model-based algorithm for promoter arrays to identify promoter sequences enriched in anti-p53 or anti-p73 immunoprecipitates, either before or after treatment with hydroxyurea, which increased the expression of both p53 and p73 in the human colon cancer cell line HCT116-3(6. We calculated a model-based algorithm for promoter array score for each promoter and found a significant correlation between the promoter occupancy profiles of p53 and p73. We also found that after hydroxyurea treatment, the p53-bound promoters were still bound by p73, but p73 became associated with additional promoters that that did not bind p53. In particular, we showed that hydroxyurea induces the binding of p73 but not p53 to the promoter of MLH3, which encodes a mismatch repair protein, and causes an up-regulation of the MLH3 mRNA. Conclusion These results suggest that hydroxyurea exerts differential effects on the promoter-binding functions of p53 and p73 and illustrate the power of model-based algorithm for promoter array in the analyses of promoter occupancy profiles of highly homologous transcription factors.
p53 Represses the Oncogenic Sno-MiR-28 Derived from a SnoRNA.
Directory of Open Access Journals (Sweden)
Feng Yu
Full Text Available p53 is a master tumour repressor that participates in vast regulatory networks, including feedback loops involving microRNAs (miRNAs that regulate p53 and that themselves are direct p53 transcriptional targets. We show here that a group of polycistronic miRNA-like non-coding RNAs derived from small nucleolar RNAs (sno-miRNAs are transcriptionally repressed by p53 through their host gene, SNHG1. The most abundant of these, sno-miR-28, directly targets the p53-stabilizing gene, TAF9B. Collectively, p53, SNHG1, sno-miR-28 and TAF9B form a regulatory loop which affects p53 stability and downstream p53-regulated pathways. In addition, SNHG1, SNORD28 and sno-miR-28 are all significantly upregulated in breast tumours and the overexpression of sno-miR-28 promotes breast epithelial cell proliferation. This research has broadened our knowledge of the crosstalk between small non-coding RNA pathways and roles of sno-miRNAs in p53 regulation.
Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression
International Nuclear Information System (INIS)
Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng
2008-01-01
Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression
International Nuclear Information System (INIS)
Willers, H.; Powell, S.N.; Dahm-Daphi, J.
2003-01-01
Full text: p53 is known to suppress spontaneous homologous recombination (HR), while its role in non-homologous recombination (NHR) remains to be clarified. Here, we sought to determine the influence of p53 on the repair of chromosomal double-strand breaks (DSBs) by HR or NHR using specially designed recombination substrates that integrate into the genome. Isogenic mouse fibroblast pairs with or without expression of exogenous p53 protein were utilized. A reporter plasmid carrying a mutated XGPRT gene was chromosomally integrated and DSBs were generated within the plasmid by the I-SceI endonuclease. Subsequent homology-mediated repair from an episomal donor resulted in XGPRT reconstitution and cellular resistance to a selection antibiotic. Analogously, the repair of chromosomal I-SceI breaks by NHR using another novel reporter plasmid restored XGPRT translation. For p53-null cells, the mean frequency of I-SceI break repair via HR was 5.5 x 10 -4 . The p53-Val135 mutant, which previously has been shown to suppress spontaneous HR by 14-fold employing the same cell system and reporter gene, only caused a 2- to 3-fold suppression of break-induced HR. In contrast, a dramatic effect of p53 on repair via NHR was found. Preliminary sequence analysis indicated that there was at least a 1000-fold reduction of illegitimate repair events resulting in loss of sequence at the break sites. The observed effects were mediated by p53 mutants defective in regulation of the cell-cycle and apoptosis. The main findings were: (1) p53 virtually blocked illegitimate rejoining of chromosomal ends. (2) The suppression of homologous DSB repair was less pronounced than the inhibition of spontaneous HR. We hypothesize that p53 allows to a certain extent error-free homology-dependent repair to proceed, while blocking error-prone NHR. The data support and extent a previous model, in which p53 maintains genomic stability by regulating recombination independently of its transactivation function
Directory of Open Access Journals (Sweden)
Bruce C. McKay
1999-08-01
Full Text Available We have previously suggested that the inhibition of RNA polymerase II-mediated transcription after exposure to UV light promotes the accumulation of p53 and the induction of apoptosis (Oncogene 13, 823–831. However, it was not clear whether p53 induction was contributing to apoptosis. Here we report that apoptosis is triggered at lower UV doses in p53-deficient Li-Fraumeni syndrome (LFS and human papillomavirus (HPV E6 expressing fibroblasts than in normal cells, suggesting that p53 can be protective against UVinduced apoptosis. There is no significant difference in the effect of UV-irradiation on the cell cycle distribution of normal and primary LFS fibroblasts. Importantly, the recovery of nascent mRNA synthesis in all p53-deficient fibroblasts is significantly impaired compared with control cells after exposure to relevant doses of UV light. Taken together, our results suggest that wild-type p53 can protect cells against UV-induced apoptosis by facilitating the recovery of transcription. Furthermore, we suggest that the capacity of cells to recover transcription after genotoxic damage is an important determinant of sensitivity to apoptosis.
Age-dependent regulation of ERF-VII transcription factor activity in Arabidopsis thaliana.
Giuntoli, Beatrice; Shukla, Vinay; Maggiorelli, Federica; Giorgi, Federico M; Lombardi, Lara; Perata, Pierdomenico; Licausi, Francesco
2017-10-01
The Group VII Ethylene Responsive Factors (ERFs-VII) RAP2.2 and RAP2.12 have been mainly characterized with regard to their contribution as activators of fermentation in plants. However, transcriptional changes measured in conditions that stabilize these transcription factors exceed the mere activation of this biochemical pathway, implying additional roles performed by the ERF-VIIs in other processes. We evaluated gene expression in transgenic Arabidopsis lines expressing a stabilized form of RAP2.12, or hampered in ERF-VII activity, and identified genes affected by this transcriptional regulator and its homologs, including some involved in oxidative stress response, which are not universally induced under anaerobic conditions. The contribution of the ERF-VIIs in regulating this set of genes in response to chemically induced or submergence-stimulated mitochondria malfunctioning was found to depend on the plant developmental stage. A similar age-dependent mechanism also restrained ERF-VII activity upon the core-hypoxic genes, independently of the N-end rule pathway, which is accounted for the control of the anaerobic response. To conclude, this study shed new light on a dual role of ERF-VII proteins under submergence: as positive regulators of the hypoxic response and as repressors of oxidative-stress related genes, depending on the developmental stage at which plants are challenged by stress conditions. © 2017 John Wiley & Sons Ltd.
Astrocytes Can Adopt Endothelial Cell Fates in a p53-Dependent Manner.
Brumm, Andrew J; Nunez, Stefanie; Doroudchi, Mehdi M; Kawaguchi, Riki; Duan, Jinhzu; Pellegrini, Matteo; Lam, Larry; Carmichael, S Thomas; Deb, Arjun; Hinman, Jason D
2017-08-01
Astrocytes respond to a variety of CNS injuries by cellular enlargement, process outgrowth, and upregulation of extracellular matrix proteins that function to prevent expansion of the injured region. This astrocytic response, though critical to the acute injury response, results in the formation of a glial scar that inhibits neural repair. Scar-forming cells (fibroblasts) in the heart can undergo mesenchymal-endothelial transition into endothelial cell fates following cardiac injury in a process dependent on p53 that can be modulated to augment cardiac repair. Here, we sought to determine whether astrocytes, as the primary scar-forming cell of the CNS, are able to undergo a similar cellular phenotypic transition and adopt endothelial cell fates. Serum deprivation of differentiated astrocytes resulted in a change in cellular morphology and upregulation of endothelial cell marker genes. In a tube formation assay, serum-deprived astrocytes showed a substantial increase in vessel-like morphology that was comparable to human umbilical vein endothelial cells and dependent on p53. RNA sequencing of serum-deprived astrocytes demonstrated an expression profile that mimicked an endothelial rather than astrocyte transcriptome and identified p53 and angiogenic pathways as specifically upregulated. Inhibition of p53 with genetic or pharmacologic strategies inhibited astrocyte-endothelial transition. Astrocyte-endothelial cell transition could also be modulated by miR-194, a microRNA downstream of p53 that affects expression of genes regulating angiogenesis. Together, these studies demonstrate that differentiated astrocytes retain a stimulus-dependent mechanism for cellular transition into an endothelial phenotype that may modulate formation of the glial scar and promote injury-induced angiogenesis.
ATM-dependent phosphorylation of Mdm2 on serine 395: role in p53 activation by DNA damage
Maya, Ruth; Balass, Moshe; Kim, Seong-Tae; Shkedy, Dganit; Leal, Juan-Fernando Martinez; Shifman, Ohad; Moas, Miri; Buschmann, Thomas; Ronai, Ze'ev; Shiloh, Yosef; Kastan, Michael B.; Katzir, Ephraim; Oren, Moshe
2001-01-01
The p53 tumor suppressor protein, a key regulator of cellular responses to genotoxic stress, is stabilized and activated after DNA damage. The rapid activation of p53 by ionizing radiation and radiomimetic agents is largely dependent on the ATM kinase. p53 is phosphorylated by ATM shortly after DNA damage, resulting in enhanced stability and activity of p53. The Mdm2 oncoprotein is a pivotal negative regulator of p53. In response to ionizing radiation and radiomimetic drugs, Mdm2 undergoes rapid ATM-dependent phosphorylation prior to p53 accumulation. This results in a decrease in its reactivity with the 2A10 monoclonal antibody. Phage display analysis identified a consensus 2A10 recognition sequence, possessing the core motif DYS. Unexpectedly, this motif appears twice within the human Mdm2 molecule, at positions corresponding to residues 258–260 and 393–395. Both putative 2A10 epitopes are highly conserved and encompass potential phosphorylation sites. Serine 395, residing within the carboxy-terminal 2A10 epitope, is the major target on Mdm2 for phosphorylation by ATM in vitro. Mutational analysis supports the conclusion that Mdm2 undergoes ATM-dependent phosphorylation on serine 395 in vivo in response to DNA damage. The data further suggests that phosphorylated Mdm2 may be less capable of promoting the nucleo-cytoplasmic shuttling of p53 and its subsequent degradation, thereby enabling p53 accumulation. Our findings imply that activation of p53 by DNA damage is achieved, in part, through attenuation of the p53-inhibitory potential of Mdm2. PMID:11331603
Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki
2012-01-20
The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Gomez-Gonzalo, Marta; Benedicto, Ignacio; Carretero, Marta; Lara-Pezzi, Enrique; Maldonado-Rodriguez, Alejandra; Moreno-Otero, Ricardo; Lai, Michael M.C.; Lopez-Cabrera, Manuel
2004-01-01
Hepatitis C virus (HCV) core is a viral structural protein; it also participates in some cellular processes, including transcriptional regulation. However, the mechanisms of core-mediated transcriptional regulation remain poorly understood. Oncogenic virus proteins often target p300/CBP, a known co-activator of a wide variety of transcription factors, to regulate the expression of cellular and viral genes. Here we demonstrate, for the first time, that HCV core protein interacts with p300/CBP and enhances both its acetyl-transferase and transcriptional activities. In addition, we demonstrate that nuclear core protein activates the NH 2 -terminal transcription activation domain (TAD) of NF-AT1 in a p300/CBP-dependent manner. We propose a model in which core protein regulates the co-activation function of p300/CBP and activates NF-AT1, and probably other p300/CBP-regulated transcription factors, by a novel mechanism involving the regulation of the acetylation state of histones and/or components of the transcriptional machinery
International Nuclear Information System (INIS)
Lee, Sang-Wang; Kim, Eun-Joo; Um, Soo-Jong
2007-01-01
To elucidate the regulatory mechanism of p73 gene expression, we analyzed the human p73 promoter and found three putative Egr-1-binding sites located upstream of exon 1 (-1728, -321, and -38). The Egr-1 responsiveness of these sites was analyzed by transient transfection assays using 5'- and 3'-serial truncations of the p73 promoter, subcloned in a CAT reporter vector. The functional significance of the region was further confirmed by an electrophoretic mobility shift assay using the Egr-1 protein synthesized in vitro and a [ 32 P]-labeled middle site sequence, followed by competition with unlabeled wild-type or mutant oligonucleotides and supershift assays using an anti-Egr-1 antibody. When induced by either the nitric oxide donor NOC-18 or the PPARγ agonist troglitazone, Egr-1 bound to the p73 promoter, as assessed by chromatin immunoprecipitation assays, accompanied by increased expression of p73. MTT assays revealed that cell growth was significantly inhibited on treating the cells with troglitazone. Overall, our results provide direct evidence that Egr-1 positively regulated p73 expression by binding to its promoter in vivo, consistent with Egr-1 and p73 being involved in p53-independent tumor suppression
International Nuclear Information System (INIS)
Golubovskaya, Vita M; Ho, Baotran; Zheng, Min; Magis, Andrew; Ostrov, David; Morrison, Carl; Cance, William G
2013-01-01
Focal Adhesion Kinase (FAK) is a 125 kDa non-receptor kinase that plays a major role in cancer cell survival and metastasis. We performed computer modeling of the p53 peptide containing the site of interaction with FAK, predicted the peptide structure and docked it into the three-dimensional structure of the N-terminal domain of FAK involved in the complex with p53. We screened small molecule compounds that targeted the site of the FAK-p53 interaction and identified compounds (called Roslins, or R compounds) docked in silico to this site. By different assays in isogenic HCT116p53 + / + and HCT116 p53 - / - cells we identified a small molecule compound called Roslin 2 (R2) that bound FAK, disrupted the binding of FAK and p53 and decreased cancer cell viability and clonogenicity in a p53-dependent manner. In addition, dual-luciferase assays demonstrated that the R2 compound increased p53 transcriptional activity that was inhibited by FAK using p21, Mdm-2, and Bax-promoter targets. R2 also caused increased expression of p53 targets: p21, Mdm-2 and Bax proteins. Furthermore, R2 significantly decreased tumor growth, disrupted the complex of FAK and p53, and up-regulated p21 in HCT116 p53 + / + but not in HCT116 p53 - / - xenografts in vivo. In addition, R2 sensitized HCT116p53 + / + cells to doxorubicin and 5-fluorouracil. Thus, disruption of the FAK and p53 interaction with a novel small molecule reactivated p53 in cancer cells in vitro and in vivo and can be effectively used for development of FAK-p53 targeted cancer therapy approaches
Regulation of Metabolic Activity by p53
Directory of Open Access Journals (Sweden)
Jessica Flöter
2017-05-01
Full Text Available Metabolic reprogramming in cancer cells is controlled by the activation of multiple oncogenic signalling pathways in order to promote macromolecule biosynthesis during rapid proliferation. Cancer cells also need to adapt their metabolism to survive and multiply under the metabolically compromised conditions provided by the tumour microenvironment. The tumour suppressor p53 interacts with the metabolic network at multiple nodes, mostly to reduce anabolic metabolism and promote preservation of cellular energy under conditions of nutrient restriction. Inactivation of this tumour suppressor by deletion or mutation is a frequent event in human cancer. While loss of p53 function lifts an important barrier to cancer development by deleting cell cycle and apoptosis checkpoints, it also removes a crucial regulatory mechanism and can render cancer cells highly sensitive to metabolic perturbation. In this review, we will summarise the major concepts of metabolic regulation by p53 and explore how this knowledge can be used to selectively target p53 deficient cancer cells in the context of the tumour microenvironment.
Transactivation domain of p53 regulates DNA repair and integrity in human iPS cells.
Kannappan, Ramaswamy; Mattapally, Saidulu; Wagle, Pooja A; Zhang, Jianyi
2018-05-18
The role of p53 transactivation domain (p53-TAD), a multifunctional and dynamic domain, on DNA repair and retaining DNA integrity in human iPS cells has never been studied. p53-TAD was knocked out in iPS cells using CRISPR/Cas9 and was confirmed by DNA sequencing. p53-TAD KO cells were characterized by: accelerated proliferation, decreased population doubling time, and unaltered Bcl2, BBC3, IGF1R, Bax and altered Mdm2, p21, and PIDD transcripts expression. In p53-TAD KO cells p53 regulated DNA repair proteins XPA, DNA polH and DDB2 expression were found to be reduced compared to p53-WT cells. Exposure to low dose of doxorubicin (Doxo) induced similar DNA damage and DNA damage response (DDR) measured by RAD50 and MRE11 expression, Checkpoint kinase 2 activation and γH2A.X recruitment at DNA strand breaks in both the cell groups indicating silencing p53-TAD do not affect DDR mechanism upstream of p53. Following removal of Doxo p53-WT hiPS cells underwent DNA repair, corrected their damaged DNA and restored DNA integrity. Conversely, p53-TAD KO hiPS cells did not undergo complete DNA repair and failed to restore DNA integrity. More importantly continuous culture of p53-TAD KO hiPS cells underwent G2/M cell cycle arrest and expressed cellular senescent marker p16 INK4a . Our data clearly shows that silencing transactivation domain of p53 did not affect DDR but affected the DNA repair process implying the crucial role of p53 transactivation domain in maintaining DNA integrity. Therefore, activating p53-TAD domain using small molecules may promote DNA repair and integrity of cells and prevent senescence.
TAF6delta controls apoptosis and gene expression in the absence of p53.
Directory of Open Access Journals (Sweden)
Emmanuelle Wilhelm
Full Text Available BACKGROUND: Life and death decisions of metazoan cells hinge on the balance between the expression of pro- versus anti-apoptotic gene products. The general RNA polymerase II transcription factor, TFIID, plays a central role in the regulation of gene expression through its core promoter recognition and co-activator functions. The core TFIID subunit TAF6 acts in vitro as an essential co-activator of transcription for the p53 tumor suppressor protein. We previously identified a splice variant of TAF6, termed TAF6delta that can be induced during apoptosis. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate the impact of TAF6delta on cell death and gene expression, we have employed modified antisense oligonucleotides to enforce expression of endogenous TAF6delta. The induction of endogenous TAF6delta triggered apoptosis in tumor cell lines, including cells devoid of p53. Microarray experiments revealed that TAF6delta activates gene expression independently of cellular p53 status. CONCLUSIONS: Our data define TAF6delta as a pivotal node in a signaling pathway that controls gene expression programs and apoptosis in the absence of p53.
Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.
Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E
2014-07-01
Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.
Langen, Jan-Stephan; Schoenfelder, Gilbert; Resnick, Michael A.; Inga, Alberto
2010-01-01
Background Recently, we established that a C>T single nucleotide polymorphism (SNP) in the promoter of the VEGF receptor FLT1 gene generates a ½ site p53 response element (RE-T) that results in p53 responsiveness of the promoter. The transcriptional control required an estrogen receptor (ER) ½ site response element (ERE1) 225 nt upstream to the RE-T. Methodology/Principal Findings Here we report the identification of a second ER ½ site (ERE2) located 145 bp downstream of the RE-T and establish that both EREs can impact p53-mediated transactivation of FLT1-T in a manner that is cell type and ER level dependent. Gene reporter assays and ChIP experiments conducted in the breast cancer-derived MCF7 cells revealed that the ERE2 site was sufficient for p53-mediated ERα recruitment and transactivation of the FLT1-T promoter/reporter construct. Surprisingly, unlike the case for other p53 target promoters, p53-mediated transactivation of FLT1-T constructs or expression of the endogenous FLT1 gene, as well as binding of p53 and ER at the promoter constructs, was inducible by doxorubicin but not by 5-fluorouracil. Furthermore, ER activity at FLT1-T was differentially affected by ER ligands, compared to a control TFF1/pS2 ER target promoter. The p53-related transcription factors (TFs) p73 and p63 had no effect on FLT1 transactivation. Conclusions/Significance We establish a new dimension to the p53 master regulatory network where p53-mediated transcription from a ½ site RE can be determined by ER binding at one or more cis-acting EREs in manner that is dependent on level of ER protein, the type of ER ligand and the specific p53-inducing agent. PMID:20422012
p53 Aggregates penetrate cells and induce the co-aggregation of intracellular p53.
Directory of Open Access Journals (Sweden)
Karolyn J Forget
Full Text Available Prion diseases are unique pathologies in which the infectious particles are prions, a protein aggregate. The prion protein has many particular features, such as spontaneous aggregation, conformation transmission to other native PrP proteins and transmission from an individual to another. Protein aggregation is now frequently associated to many human diseases, for example Alzheimer's disease, Parkinson's disease or type 2 diabetes. A few proteins associated to these conformational diseases are part of a new category of proteins, called prionoids: proteins that share some, but not all, of the characteristics associated with prions. The p53 protein, a transcription factor that plays a major role in cancer, has recently been suggested to be a possible prionoid. The protein has been shown to accumulate in multiple cancer cell types, and its aggregation has also been reproduced in vitro by many independent groups. These observations suggest a role for p53 aggregates in cancer development. This study aims to test the «prion-like» features of p53. Our results show in vitro aggregation of the full length and N-terminally truncated protein (p53C, and penetration of these aggregates into cells. According to our findings, the aggregates enter cells using macropinocytosis, a non-specific pathway of entry. Lastly, we also show that once internalized by the cell, p53C aggregates can co-aggregate with endogenous p53 protein. Together, these findings suggest prion-like characteristics for p53 protein, based on the fact that p53 can spontaneously aggregate, these aggregates can penetrate cells and co-aggregate with cellular p53.
POSTRANSLATIONAL MODIFICATIONS OF P53: UPSTREAM SIGNALING PATHWAYS.
Energy Technology Data Exchange (ETDEWEB)
ANDERSON,C.W.APPELLA,E.
2003-10-23
The p53 tumor suppressor is a tetrameric transcription factor that is posttranslational modified at >20 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review recent progress in characterizing the upstream signaling pathways whose activation in response to various genotoxic and non-genotoxic stresses result in p53 posttranslational modifications.
Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response
Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.
2005-01-01
p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161
Energy Technology Data Exchange (ETDEWEB)
Armesilla-Diaz, Alejandro, E-mail: aarmesilla@cib.csic.es [Department of Cellular and Molecular Physiopathology, Centro de Investigaciones Biologicas, CSIC, Ramiro de Maeztu, 9, 28040 Madrid (Spain); Elvira, Gema; Silva, Augusto [Department of Cellular and Molecular Physiopathology, Centro de Investigaciones Biologicas, CSIC, Ramiro de Maeztu, 9, 28040 Madrid (Spain)
2009-12-10
Mesenchymal stem cells (MSC) have been extensively studied and gained wide popularity due to their therapeutic potential. Spontaneous transformation of MSC, from both human and murine origin, has been reported in many studies. MSC transformation depends on the culture conditions, the origin of the cells and the time on culture; however, the precise biological characteristics involved in this process have not been fully defined yet. In this study, we investigated the role of p53 in the biology and transformation of murine bone marrow (BM)-derived MSC. We demonstrate that the MSC derived from p53KO mice showed an augmented proliferation rate, a shorter doubling time and also morphologic and phenotypic changes, as compared to MSC derived from wild-type animals. Furthermore, the MSC devoid of p53 had an increased number of cells able to generate colonies. In addition, not only proliferation but also MSC differentiation is controlled by p53 since its absence modifies the speed of the process. Moreover, genomic instability, changes in the expression of c-myc and anchorage independent growth were also observed in p53KO MSC. In addition, the absence of p53 implicates the spontaneous transformation of MSC in long-term cultures. Our results reveal that p53 plays a central role in the biology of MSC.
TLR4 has a TP53-dependent dual role in regulating breast cancer cell growth
Haricharan, Svasti; Brown, Powel
2015-01-01
This study fundamentally alters our understanding of how TLR4 drives breast cancer. Although TLR4 was previously considered a tumor promoter, we demonstrate a complex, TP53-dependent role for TLR4 in regulating tumor growth. TP53 is a tumor suppressor commonly inactivated across cancer types. In TP53 wild-type cancer cells, TLR4 activation causes secretion of IFN-γ into the microenvironment, resulting in induction of p21 and inhibition of cell growth. Conversely, TLR4 activation in TP53 mutan...
International Nuclear Information System (INIS)
Yu Dehua; Fan, Wufang; Liu, Guohong; Nguy, Vivian; Chatterton, Jon E.; Long Shilong; Ke, Ning; Meyhack, Bernd; Bruengger, Adrian; Brachat, Arndt; Wong-Staal, Flossie; Li, Qi-Xiang
2006-01-01
HeLaHF is a non-transformed revertant of HeLa cells, likely resulting from the activation of a putative tumor suppressor(s). p53 protein was stabilized in this revertant and reactivated for certain transactivation functions. Although p53 stabilization has not conclusively been linked to the reversion, it is clear that the genes in p53 pathway are involved. The present study confirms the direct role of p53 in HeLaHF reversion by demonstrating that RNAi-mediated p53 silencing partially restores anchorage-independent growth potential of the revertant through the suppression of anoikis. In addition, we identified a novel gene, named PHTS, with putative tumor suppressor properties, and showed that this gene is also involved in HeLaHF reversion independently of the p53 pathway. Expression profiling revealed that PHTS is one of the genes that is up-regulated in HeLaHF but not in HeLa. It encodes a putative protein with CD59-like domains. RNAi-mediated PHTS silencing resulted in the partial restoration of transformation (anchorage-independent growth) in HeLaHF cells, similar to that of p53 gene silencing, implying its tumor suppressor effect. However, the observed increased transformation potential by PHTS silencing appears to be due to an increased anchorage-independent proliferation rate rather than suppression of anoikis, unlike the effect of p53 silencing. p53 silencing did not affect PHTS gene expression, and vice versa, suggesting PHTS may function in a new and p53-independent tumor suppressor pathway. Furthermore, over-expression of PHTS in different cancer cell lines, in addition to HeLa, reduces cell growth likely via induced apoptosis, confirming the broad PHTS tumor suppressor properties
International Nuclear Information System (INIS)
Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.
2014-01-01
Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach
Recent progress of the study of p53 control mechanism by ionizing radiation
International Nuclear Information System (INIS)
Kawai, Hidehiko
2004-01-01
Reviewed are the recent findings on the control mechanism of function and activity of p53 as a response factor to stress of ionizing radiation. The p53 protein is controlled to be essentially inactive in cells under normal conditions and is activated by various stresses. The role of p53 as a stress-responding and tumor-suppressing factor in cells with damaged DNA is discussed in relation with its participation in G1/S and G2/M checkpoints, DNA repair, and apoptosis. The stress like radiation affects the control mechanisms of stability and function of p53 through modification of its N-terminal region (the activation domain of transcription), DNA binding region (core domain) and C-terminal region (domains of the nuclear export signaling, tetramer formation and its own regulation). MDM2 (mouse double minute 2) family, the most important regulatory factor of p53, forms a negative feedback cycle since the family is the target factor of p53 transcription and also suppressor of p53. MDM2 is regulated by phosphorylation and by interaction with itself or other factors like p300/CBP. Further studies on p53 are thus important in various fields as well as in radiation biology. (N.I.)
International Nuclear Information System (INIS)
Liu Zhaojian; Liu Qiao; Xu Bing; Wu Jingjing; Guo Chun; Zhu Faliang; Yang Qiaozi; Gao Guimin; Gong Yaoqin; Shao Changshun
2009-01-01
Alkaloid berberine is widely used for the treatment of diarrhea and other diseases. Many laboratory studies showed that it exhibits anti-proliferative activity against a wide spectrum of cancer cells in culture. In this report we studied the mechanisms underlying the inhibitory effects of berberine on human osteosarcoma cells and on normal osteoblasts. The inhibition was largely attributed to cell cycle arrest at G1 and G2/M, and to a less extent, to apoptosis. The G1 arrest was dependent on p53, as G1 arrest was abolished in p53-deficient osteosarcoma cells. The induction of G1 arrest and apoptosis was accompanied by a p53-dependent up-regulation of p21 and pro-apoptotic genes. However, the G2/M arrest could be induced by berberine regardless of the status of p53. Interestingly, DNA double-strand breaks, as measured by the phosphorylation of H2AX, were remarkably accumulated in berberine-treated cells in a dose-dependent manner. Thus, one major mechanism by which berberine exerts its growth-inhibitory effect is to inflict genomic lesions on cells, which in turn trigger the activation of p53 and the p53-dependent cellular responses including cell cycle arrest and apoptosis
Energy Technology Data Exchange (ETDEWEB)
Liu Zhaojian; Liu Qiao; Xu Bing; Wu Jingjing [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Guo Chun; Zhu Faliang [Institute of Immunology, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Yang Qiaozi [Department of Genetics, Rutgers University, Piscataway, NJ 08854 (United States); Gao Guimin [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Gong Yaoqin [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China)], E-mail: yxg8@sdu.edu.cn; Shao Changshun [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Department of Genetics, Rutgers University, Piscataway, NJ 08854 (United States)], E-mail: shao@biology.rutgers.edu
2009-03-09
Alkaloid berberine is widely used for the treatment of diarrhea and other diseases. Many laboratory studies showed that it exhibits anti-proliferative activity against a wide spectrum of cancer cells in culture. In this report we studied the mechanisms underlying the inhibitory effects of berberine on human osteosarcoma cells and on normal osteoblasts. The inhibition was largely attributed to cell cycle arrest at G1 and G2/M, and to a less extent, to apoptosis. The G1 arrest was dependent on p53, as G1 arrest was abolished in p53-deficient osteosarcoma cells. The induction of G1 arrest and apoptosis was accompanied by a p53-dependent up-regulation of p21 and pro-apoptotic genes. However, the G2/M arrest could be induced by berberine regardless of the status of p53. Interestingly, DNA double-strand breaks, as measured by the phosphorylation of H2AX, were remarkably accumulated in berberine-treated cells in a dose-dependent manner. Thus, one major mechanism by which berberine exerts its growth-inhibitory effect is to inflict genomic lesions on cells, which in turn trigger the activation of p53 and the p53-dependent cellular responses including cell cycle arrest and apoptosis.
A negative regulation loop of long noncoding RNA HOTAIR and p53 in non-small-cell lung cancer
Directory of Open Access Journals (Sweden)
Zhai N
2016-09-01
Full Text Available Nailiang Zhai,1 Yongfu Xia,1 Rui Yin,2 Jinping Liu,3 Fuquan Gao1 1Department of Respiratory Medicine, Affiliated Hospital of Binzhou Medical University, 2Department of Respiratory Medicine, People’s Hospital of Binzhou City, 3Department of Pharmacology, Binzhou Medical University, Binzhou, Shandong, People’s Republic of China Abstract: Non-small-cell lung cancer (NSCLC is one of the leading causes of cancer-related death worldwide, and the 5-year survival rate is still low despite advances in diagnosis and therapeutics. A long noncoding RNA (lncRNA HOX antisense intergenic RNA (HOTAIR has been revealed to play important roles in NSCLC carcinogenesis but the detailed mechanisms are still unclear. In the current study, we aimed to investigate the regulation between the lncRNA HOTAIR and p53 in the NSCLC patient samples and cell lines. Our results showed that HOTAIR expression was significantly higher in the cancer tissues than that in the adjacent normal tissue, and was negatively correlated with p53 functionality rather than expression. When p53 was overexpressed in A549 cells, the lncRNA HOTAIR expression was downregulated, and the cell proliferation rate and cell invasion capacity decreased as a consequence. We identified two binding sites of p53 on the promoter region of HOTAIR, where the p53 protein would bind to and suppress the HOTAIR mRNA transcription. Inversely, overexpression of lncRNA HOTAIR inhibited the expression of p53 in A549 cells. Mechanistic studies revealed that HOTAIR modified the promoter of p53 and enhanced histone H3 lysine 27 trimethylation (H3K27me3. These studies identified a specific negative regulation loop of lncRNA HOTAIR and p53 in NSCLC cells, which revealed a new understanding of tumorigenesis in p53 dysfunction NSCLC cells. Keywords: NSCLC, LncRNA HOTAIR, p53, negative loop
Human herpesvirus 6B inhibits cell proliferation by a p53-independent pathway
DEFF Research Database (Denmark)
Øster, Bodil; Kaspersen, M.D.; Kofod-Olsen, Emil
2006-01-01
BACKGROUND: Various forms of cellular stress can activate the tumour suppressor protein p53, an important regulator of cell cycle arrest, apoptosis, and cellular senescence. Cells infected by human herpesvirus 6B (HHV-6B) accumulate aberrant amounts of p53. OBJECTIVES: The aim of this study...
A dual role of p53 in the control of autophagy.
Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido
2008-08-01
Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.
A dynamic P53-MDM2 model with time delay
Energy Technology Data Exchange (ETDEWEB)
Mihalas, Gh.I. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: mihalas@medinfo.umft.ro; Neamtu, M. [Department of Forecasting, Economic Analysis, Mathematics and Statistics, West University of Timisoara, Str. Pestalozzi, nr. 14A, 300115 Timisoara (Romania)]. E-mail: mihaela.neamtu@fse.uvt.ro; Opris, D. [Department of Applied Mathematics, West University of Timisoara, Bd. V. Parvan, nr. 4, 300223 Timisoara (Romania)]. E-mail: opris@math.uvt.ro; Horhat, R.F. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: rhorhat@yahoo.com
2006-11-15
Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results.
A dynamic P53-MDM2 model with time delay
International Nuclear Information System (INIS)
Mihalas, Gh.I.; Neamtu, M.; Opris, D.; Horhat, R.F.
2006-01-01
Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results
The contribution of p53 and Y chromosome long arm genes to regulation of apoptosis in mouse testis.
Lech, Tomasz; Styrna, Józefa; Kotarska, Katarzyna
2018-03-01
Apoptosis of excessive or defective germ cells is a natural process occurring in mammalian testes. Tumour suppressor protein p53 is involved in this process both in developing and adult male gonads. Its contribution to testicular physiology is known to be modified by genetic background. The aim of this study was to evaluate the combined influence of the p53 and Y chromosome long arm genes on male germ cell apoptosis. Knockout of the transformation related protein 53 (Trp53) gene was introduced into congenic strains: B10.BR (intact Y chromosome) and B10.BR-Ydel (Y chromosome with a deletion in the long arm). The level of apoptosis in the testes of 19-day-old and 3-month-old male mice was determined using the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate in situ nick-end labelling (TUNEL) method. The study revealed that although p53 is involved in germ cell apoptosis in peripubertal testes, this process can also be mediated by p53-independent mechanisms. However, activation of p53-independent apoptotic pathways in the absence of the p53 protein requires engagement of the multicopy Yq genes and was not observed in gonads of B10.BR-Ydel-p53-/- males. The role of Yq genes in the regulation of testicular apoptosis seems to be restricted to the initial wave of spermatogenesis and is not evident in adult gonads. The study confirmed, instead, that p53 does participate in spontaneous apoptosis in mature testes.
Different regulation of limb development by p63 transcript variants.
Directory of Open Access Journals (Sweden)
Manabu Kawata
Full Text Available The apical ectodermal ridge (AER, located at the distal end of each limb bud, is a key signaling center which controls outgrowth and patterning of the proximal-distal axis of the limb through secretion of various molecules. Fibroblast growth factors (FGFs, particularly Fgf8 and Fgf4, are representative molecules produced by AER cells, and essential to maintain the AER and cell proliferation in the underlying mesenchyme, meanwhile Jag2-Notch pathway negatively regulates the AER and limb development. p63, a transcription factor of the p53 family, is expressed in the AER and indispensable for limb formation. However, the underlying mechanisms and specific roles of p63 variants are unknown. Here, we quantified the expression of p63 variants in mouse limbs from embryonic day (E 10.5 to E12.5, and found that ΔNp63γ was strongly expressed in limbs at all stages, while TAp63γ expression was rapidly increased in the later stages. Fluorescence-activated cell sorting analysis of limb bud cells from reporter mouse embryos at E11.5 revealed that all variants were abundantly expressed in AER cells, and their expression was very low in mesenchymal cells. We then generated AER-specific p63 knockout mice by mating mice with a null and a flox allele of p63, and Msx2-Cre mice (Msx2-Cre;p63Δ/fl. Msx2-Cre;p63Δ/fl neonates showed limb malformation that was more obvious in distal elements. Expression of various AER-related genes was decreased in Msx2-Cre;p63Δ/fl limb buds and embryoid bodies formed by p63-knockdown induced pluripotent stem cells. Promoter analyses and chromatin immunoprecipitation assays demonstrated Fgf8 and Fgf4 as transcriptional targets of ΔNp63γ, and Jag2 as that of TAp63γ. Furthermore, TAp63γ overexpression exacerbated the phenotype of Msx2-Cre;p63Δ/fl mice. These data indicate that ΔNp63 and TAp63 control limb development through transcriptional regulation of different target molecules with different roles in the AER. Our findings
p53-Dependent Nestin Regulation Links Tumor Suppression to Cellular Plasticity in Liver Cancer
DEFF Research Database (Denmark)
Tschaharganeh, Darjus F; Xue, Wen; Calvisi, Diego F
2014-01-01
The p53 tumor suppressor coordinates a series of antiproliferative responses that restrict the expansion of malignant cells, and as a consequence, p53 is lost or mutated in the majority of human cancers. Here, we show that p53 restricts expression of the stem and progenitor-cell-associated protei...... by p53 restricts cellular plasticity and tumorigenesis in liver cancer....
Directory of Open Access Journals (Sweden)
Vladimir O. Pustylnyak
2015-01-01
Full Text Available Gene expression plays an important role in the mechanisms of long-term potentiation (LTP, which is a widely accepted experimental model of synaptic plasticity. We have studied the expression of at least 50 genes that are transcriptionally regulated by p53, as well as other genes that are related to p53-dependent processes, in the early phase of LTP. Within 30 min after Schaffer collaterals (SC tetanization, increases in the mRNA and protein levels of Bax, which are upregulated by p53, and a decrease in the mRNA and protein levels of Bcl2, which are downregulated by p53, were observed. The inhibition of Mdm2 by nutlin-3 increased the basal p53 protein level and rescued its tetanization-induced depletion, which suggested the involvement of Mdm2 in the control over p53 during LTP. Furthermore, nutlin-3 caused an increase in the basal expression of Bax and a decrease in the basal expression of Bcl2, whereas tetanization-induced changes in their expression were occluded. These results support the hypothesis that p53 may be involved in transcriptional regulation during the early phase of LTP. We hope that the presented data may aid in the understanding of the contribution of p53 and related genes in the processes that are associated with synaptic plasticity.
The Prognostic Impact of p53 Expression on Sporadic Colorectal Cancer Is Dependent on p21 Status
International Nuclear Information System (INIS)
Kruschewski, Martin; Mueller, Kathrin; Lipka, Sybille; Budczies, Jan; Noske, Aurelia; Buhr, Heinz Johannes; Elezkurtaj, Sefer
2011-01-01
The prognostic value of p53 and p21 expression in colorectal cancer is still under debate. We hypothesize that the prognostic impact of p53 expression is dependent on p21 status. The expression of p53 and p21 was immunohistochemically investigated in a prospective cohort of 116 patients with UICC stage II and III sporadic colorectal cancer. The results were correlated with overall and recurrence-free survival. The mean observation period was 51.8 ± 2.5 months. Expression of p53 was observed in 72 tumors (63%). Overall survival was significantly better in patients with p53-positive carcinomas than in those without p53 expression (p = 0.048). No differences were found in recurrence-free survival (p = 0.161). The p53+/p21− combination was seen in 68% (n = 49), the p53+/p21+ combination in 32% (n = 23). Patients with p53+/p21− carcinomas had significantly better overall and recurrence-free survival than those with p53+/p21+ (p < 0.0001 resp. p = 0.003). Our data suggest that the prognostic impact of p53 expression on sporadic colorectal cancer is dependent on p21 status
International Nuclear Information System (INIS)
Takahashi, Akihisa; Suzuki, Hiromi; Shimazu, Toru; Omori, Katsunori; Ishioka, Noriaki; Ohnishi, Takeo; Seki, Masaya; Hashizume, Toko
2012-01-01
The aim of this study was to determine the biological effects of space radiations, microgravity, and the interaction of them on the expression of p53-regulated proteins. Space experiments were performed with two human cultured lymphoblastoid cell lines: one line (TSCE5) bears a wild-type p53 gene status, and another line (WTK1) bears a mutated p53 gene status. Under 1 gravity or microgravity conditions, the cells were grown in the cell biology experimental facility (CBEF) of the International Space Station for 8 days without experiencing the stress during launching and landing because the cells were frozen during these periods. Ground control samples were simultaneously cultured for 8 days in the CBEF on the ground for 8 days. After spaceflight, protein expression was analyzed using a Panorama TM Ab MicroArray protein chips. It was found that p53-dependent up-regulated proteins in response to space radiations and space environment were MeCP2 (methyl CpG binding protein 2), and Notch1 (Notch homolog 1), respectively. On the other hand, p53-dependent down-regulated proteins were TGF-β, TWEAKR (tumor necrosis factor-like weak inducer of apoptosis receptor), phosho-Pyk2 (Proline-rich tyrosine kinase 2), and 14-3-3θ/τ which were affected by microgravity, and DR4 (death receptor 4), PRMT1 (protein arginine methyltransferase 1) and ROCK-2 (Rho-associated, coiled-coil containing protein kinase 2) in response to space radiations. ROCK-2 was also suppressed in response to the space environment. The data provides the p53-dependent regulated proteins by exposure to space radiations and/or microgravity during spaceflight. Our expression data revealed proteins that might help to advance the basic space radiation biology. (author)
International Nuclear Information System (INIS)
Kim, W.-J.; Beardsley, Dillon I.; Adamson, Aaron W.; Brown, Kevin D.
2005-01-01
One of the cellular responses to DNA damaging events is the activation of programmed cell death, also known as apoptosis. Apoptosis is an important process in limiting tumorigenesis by eliminating cells with damaged DNA. This view is reinforced by the finding that many genes with pro-apoptotic function are absent or altered in cancer cells. The tumor suppressor p53 performs a significant role in apoptotic signaling by controlling expression of a host of genes that have pro-apoptotic or pro-survival function. The S N 1 DNA alkylating agent N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) triggers apoptosis and the upregulation/phosphorylation of p53; however, the mechanism(s) governing MNNG-induced cell death remain unresolved. We observed that the human lymphoblastoid cell line WTK-1, which expresses mutant p53, shows far less sensitivity to the cytotoxic effects of MNNG than the closely related, p53-normal line TK-6. Exposure to 15 μM MNNG (LD50 at 24 h in TK-6) leads to a kinetically slower rate of apoptotic onset in WTK-1 cells compared to TK-6 as judged by viability assays and approaches that directly examine apoptotic onset. Similar results were obtained using an unrelated human lymphoblastoid line B310 expressing reduced levels of p53 due to E6 oncoprotein expression, indicating that MNNG activates both p53-dependent and -independent apoptotic mechanisms and that these two mechanisms are discernable by the rates which they trigger apoptotic onset. We document, during time points corresponding to peak apoptotic response in TK6, WTK-1, B310, and B310-E6, that these cell lines show marked decreases in mitochondrial transmembrane potential and increases in cytochrome c within the cytosolic fraction of MNNG-treated cells. Consistent with these events, we observed that both caspase-9 and -3 are activated in our panel of lymphoblastoid cells after MNNG exposure. We also found, using both broad spectrum and specific inhibitors, that blocking caspase activity in TK-6 and
HAMLET triggers apoptosis but tumor cell death is independent of caspases, Bcl-2 and p53.
Hallgren, O; Gustafsson, L; Irjala, H; Selivanova, G; Orrenius, S; Svanborg, C
2006-02-01
HAMLET (Human alpha-lactalbumin Made Lethal to Tumor cells) triggers selective tumor cell death in vitro and limits tumor progression in vivo. Dying cells show features of apoptosis but it is not clear if the apoptotic response explains tumor cell death. This study examined the contribution of apoptosis to cell death in response to HAMLET. Apoptotic changes like caspase activation, phosphatidyl serine externalization, chromatin condensation were detected in HAMLET-treated tumor cells, but caspase inhibition or Bcl-2 over-expression did not prolong cell survival and the caspase response was Bcl-2 independent. HAMLET translocates to the nuclei and binds directly to chromatin, but the death response was unrelated to the p53 status of the tumor cells. p53 deletions or gain of function mutations did not influence the HAMLET sensitivity of tumor cells. Chromatin condensation was partly caspase dependent, but apoptosis-like marginalization of chromatin was also observed. The results show that tumor cell death in response to HAMLET is independent of caspases, p53 and Bcl-2 even though HAMLET activates an apoptotic response. The use of other cell death pathways allows HAMLET to successfully circumvent fundamental anti-apoptotic strategies that are present in many tumor cells.
Directory of Open Access Journals (Sweden)
Jennifer A Talarico
Full Text Available β-adrenergic receptor (βAR-mediated transactivation of epidermal growth factor receptor (EGFR has been shown to promote cardioprotection in a mouse model of heart failure and we recently showed that this mechanism leads to enhanced cell survival in part via regulation of apoptotic transcript expression in isolated primary rat neonatal cardiomyocytes. Thus, we hypothesized that this process could regulate cardiac transcript expression in vivo. To comprehensively assess cardiac transcript alterations in response to acute βAR-dependent EGFR transactivation, we performed whole transcriptome analysis of hearts from C57BL/6 mice given i.p. injections of the βAR agonist isoproterenol in the presence or absence of the EGFR antagonist gefitinib for 1 hour. Total cardiac RNA from each treatment group underwent transcriptome analysis, revealing a substantial number of transcripts regulated by each treatment. Gefitinib alone significantly altered the expression of 405 transcripts, while isoproterenol either alone or in conjunction with gefitinib significantly altered 493 and 698 distinct transcripts, respectively. Further statistical analysis was performed, confirming 473 transcripts whose regulation by isoproterenol were significantly altered by gefitinib (isoproterenol-induced up/downregulation antagonized/promoted by gefinitib, including several known to be involved in the regulation of numerous processes including cell death and survival. Thus, βAR-dependent regulation of cardiac transcript expression in vivo can be modulated by the EGFR antagonist gefitinib.
Long Non-coding RNA, PANDA, Contributes to the Stabilization of p53 Tumor Suppressor Protein.
Kotake, Yojiro; Kitagawa, Kyoko; Ohhata, Tatsuya; Sakai, Satoshi; Uchida, Chiharu; Niida, Hiroyuki; Naemura, Madoka; Kitagawa, Masatoshi
2016-04-01
P21-associated noncoding RNA DNA damage-activated (PANDA) is induced in response to DNA damage and represses apoptosis by inhibiting the function of nuclear transcription factor Y subunit alpha (NF-YA) transcription factor. Herein, we report that PANDA affects regulation of p53 tumor-suppressor protein. U2OS cells were transfected with PANDA siRNAs. At 72 h post-transfection, cells were subjected to immunoblotting and quantitative reverse transcription-polymerase chain reaction. Depletion of PANDA was associated with decreased levels of p53 protein, but not p53 mRNA. The stability of p53 protein was markedly reduced by PANDA silencing. Degradation of p53 protein by silencing PANDA was prevented by treatment of MG132, a proteasome inhibitor. Moreover, depletion of PANDA prevented accumulation of p53 protein, as a result of DNA damage, induced by the genotoxic agent etoposide. These results suggest that PANDA stabilizes p53 protein in response to DNA damage, and provide new insight into the regulatory mechanisms of p53. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Regulation of autophagy by cytoplasmic p53.
Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido
2008-06-01
Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.
Directory of Open Access Journals (Sweden)
Bo Ram Seo
Full Text Available The PI3K/Akt and mTOR signaling pathways are important for cell survival and growth, and they are highly activated in cancer cells compared with normal cells. Therefore, these signaling pathways are targets for inducing cancer cell death. The dual PI3K/Akt and mTOR inhibitor NVP-BEZ235 completely inhibited both signaling pathways. However, NVP-BEZ235 had no effect on cell death in human renal carcinoma Caki cells. We tested whether combined treatment with natural compounds and NVP-BEZ235 could induce cell death. Among several chemopreventive agents, curcumin, a natural biologically active compound that is extracted from the rhizomes of Curcuma species, markedly induced apoptosis in NVP-BEZ235-treated cells. Co-treatment with curcumin and NVP-BEZ235 led to the down-regulation of Mcl-1 protein expression but not mRNA expression. Ectopic expression of Mcl-1 completely inhibited curcumin plus NVP-NEZ235-induced apoptosis. Furthermore, the down-regulation of Bcl-2 was involved in curcumin plus NVP-BEZ235-induced apoptosis. Curcumin or NVP-BEZ235 alone did not change Bcl-2 mRNA or protein expression, but co-treatment reduced Bcl-2 mRNA and protein expression. Combined treatment with NVP-BEZ235 and curcumin reduced Bcl-2 expression in wild-type p53 HCT116 human colon carcinoma cells but not p53-null HCT116 cells. Moreover, Bcl-2 expression was completely reversed by treatment with pifithrin-α, a p53-specific inhibitor. Ectopic expression of Bcl-2 also inhibited apoptosis in NVP-BE235 plus curcumin-treated cells. In contrast, NVP-BEZ235 combined with curcumin did not have a synergistic effect on normal human skin fibroblasts and normal human mesangial cells. Taken together, combined treatment with NVP-BEZ235 and curcumin induces apoptosis through p53-dependent Bcl-2 mRNA down-regulation at the transcriptional level and Mcl-1 protein down-regulation at the post-transcriptional level.
Lv, Jianrui; Tian, Junbin; Zheng, Guoxi; Zhao, Jing
2017-10-01
Sirtuin7 (SIRT7) is known to regulate apoptosis and stress responses. So far, very little is known about the role of SIRT7 in cerebral ischemia/reperfusion injury. In this study, we aimed to investigate the potential role of SIRT7 in regulating oxygen-glucose deprivation and reoxygenation (OGD/R)-induced injury in neurons. We found a significant increase of SIRT7 expression in neurons in response to OGD/R treatment. Knockdown of SIRT7 aggravated OGD/R-induced injury. Knockdown of SIRT7 augmented the levels of total and acetylated p53 protein. Moreover, knockdown of SIRT7 markedly increased the transcriptional activity of p53 toward apoptosis and activated the p53-mediated proapoptotic signaling pathway. By contrast, overexpression of SIRT7 showed the opposite effects. Taken together, the results of our study suggest that SIRT7 is involved in protecting neurons against OGD/R-induced injury, possibly through regulation of the p53-mediated proapoptotic signaling pathway, indicating a potential therapeutic target for cerebral ischemia/reperfusion injury. © 2017 Wiley Periodicals, Inc.
ZNF307, a novel zinc finger gene suppresses p53 and p21 pathway
International Nuclear Information System (INIS)
Li Jing; Wang Yuequn; Fan Xiongwei; Mo Xiaoyang; Wang Zequn; Li Yongqing; Yin Zhaochu; Deng Yun; Luo Na; Zhu Chuanbing; Liu Mingyao; Ma Qian; Ocorr, Karen; Yuan Wuzhou; Wu Xiushan
2007-01-01
We have cloned a novel KRAB-related zinc finger gene, ZNF307, encoding a protein of 545 aa. ZNF307 is conserved across species in evolution and is differentially expressed in human adult and fetal tissues. The fusion protein of EGFP-ZNF307 localizes in the nucleus. Transcriptional activity assays show ZNF307 suppresses transcriptional activity of L8G5-luciferase. Overexpressing ZNF307 in different cell lines also inhibits the transcriptional activities of p53 and p21. Moreover, ZNF307 works by reducing the p53 protein level and p53 protein reduction is achieved by increasing transcription of MDM2 and EP300. ZNF307 might suppress p53-p21 pathway through activating MDM2 and EP300 expression and inducing p53 degradation
Seth, Rohit; Corniola, Rikki S.; Gower-Winter, Shannon D.; Morgan, Thomas J., Jr.; Bishop, Brian; Levenson, Cathy W.
2015-01-01
Previous studies have shown that zinc deficiency leads to apoptosis of neuronal precursor cells in vivo and in vitro. In addition to the role of p53 as a nuclear transcription factor in zinc deficient cultured human neuronal precursors (NT-2), we have now identified the translocation of phosphorylated p53 to the mitochondria and p53-dependent…
The DNA replication checkpoint directly regulates MBF-dependent G1/S transcription.
Dutta, Chaitali; Patel, Prasanta K; Rosebrock, Adam; Oliva, Anna; Leatherwood, Janet; Rhind, Nicholas
2008-10-01
The DNA replication checkpoint transcriptionally upregulates genes that allow cells to adapt to and survive replication stress. Our results show that, in the fission yeast Schizosaccharomyces pombe, the replication checkpoint regulates the entire G(1)/S transcriptional program by directly regulating MBF, the G(1)/S transcription factor. Instead of initiating a checkpoint-specific transcriptional program, the replication checkpoint targets MBF to maintain the normal G(1)/S transcriptional program during replication stress. We propose a mechanism for this regulation, based on in vitro phosphorylation of the Cdc10 subunit of MBF by the Cds1 replication-checkpoint kinase. Replacement of two potential phosphorylation sites with phosphomimetic amino acids suffices to promote the checkpoint transcriptional program, suggesting that Cds1 phosphorylation directly regulates MBF-dependent transcription. The conservation of MBF between fission and budding yeast, and recent results implicating MBF as a target of the budding yeast replication checkpoint, suggests that checkpoint regulation of the MBF transcription factor is a conserved strategy for coping with replication stress. Furthermore, the structural and regulatory similarity between MBF and E2F, the metazoan G(1)/S transcription factor, suggests that this checkpoint mechanism may be broadly conserved among eukaryotes.
Ets-2 and p53 mediate cAMP-induced MMP-2 expression, activity and trophoblast invasion
Directory of Open Access Journals (Sweden)
Goldman Shlomit
2009-11-01
Full Text Available Abstract Background We have previously shown that Matrix metalloproteinase (MMP -2 is a key-enzyme in early trophoblast invasion and that Protein Kinase A (PKA increases MMP-2 expression and trophoblast invasion. The aim of this study was to examine MMP -2 regulation by PKA in invasive trophoblasts: JAR choriocarcinoma cell-line and 6-8 w first trimester trophoblasts. Methods The effect of Forskolin (PKA on MMP-2 expression was assessed by Northern Blot and RT-PCR. Possible transcription factors binding to consensus MMP-2 promoter sequences in response to Forskolin, were detected by EMSA binding assay and their expression assessed by western blot analysis. Antisense transfection of relevant transcription factors was performed and the inhibitory effect assessed on MMP-2 expression (RT-PCR, secretion (zymography and trophoblast invasiveness (transwell migration assay. Results We found that Forskolin increased MMP-2 mRNA in JAR cells within 24 hours, and induced binding to p53, Ets, C/EBP and AP-2. Transcription factors Ets-2, phospho- p53, C/EBP epsilon, C/EBP lambda and AP-2 alpha bound to their respective binding sequences in response to Forskolin and the expressions of these transcription factors were all elevated in Forskolin- treated cells. Inhibition of Ets-2 and p53 reduced MMP-2 expression, secretion and invasiveness of Forskolin treated cells. Conclusion MMP-2 is regulated by PKA through several binding sites and transcription factors including Ets-2, p53, C/EBP, C/EBP lambda and AP-2 alpha. Ets-2 and p53 mediate cAMP- induced trophoblast invasiveness, through regulation of MMP-2.
VirF-Independent Regulation of Shigella virB Transcription is Mediated by the Small RNA RyhB
Broach, William H.; Egan, Nicholas; Wing, Helen J.; Payne, Shelley M.; Murphy, Erin R.
2012-01-01
Infection of the human host by Shigella species requires the coordinated production of specific Shigella virulence factors, a process mediated largely by the VirF/VirB regulatory cascade. VirF promotes the transcription of virB, a gene encoding the transcriptional activator of several virulence-associated genes. This study reveals that transcription of virB is also regulated by the small RNA RyhB, and importantly, that this regulation is not achieved indirectly via modulation of VirF activity. These data are the first to demonstrate that the regulation of virB transcription can be uncoupled from the master regulator VirF. It is also established that efficient RyhB-dependent regulation of transcription is facilitated by specific nucleic acid sequences within virB. This study not only reveals RyhB-dependent regulation of virB transcription as a novel point of control in the central regulatory circuit modulating Shigella virulence, but also highlights the versatility of RyhB in controlling bacterial gene expression. PMID:22701677
Riaz, Muhammad; Ashfaq, Usman A; Qasim, Muhammad; Yasmeen, Erum; Ul Qamar, Muhammad T; Anwar, Farooq
2017-10-01
In most types of cancer, overexpression of murine double minute 2 (MDM2) often leads to inactivation of p53. The crystal structure of MDM2, with a 109-residue amino-terminal domain, reveals that MDM2 has a core hydrophobic region to which p53 binds as an amphipathic α helix. The interface depends on the steric complementarity between MDM2 and the hydrophobic region of p53. Especially, on p53's triad, amino acids Phe19, Trp23 and Leu26 bind to the MDM2 core. Results from studies suggest that the structural motif of both p53 and MDM2 can be attributed to similarities in the amphipathic α helix. Thus, in the current investigation it is hypothesized that the similarity in the structural motif might be the cause of p53 inactivation by MDM2. Hence, molecular docking and phytochemical screening approaches are appraised to inhibit the hydrophobic cleft of MDM2 and to stop p53-MDM2 interaction, resulting in reactivation of p53 activity. For this purpose, a library of 2295 phytochemicals were screened against p53-MDM2 to find potential candidates. Of these, four phytochemicals including epigallocatechin gallate, alvaradoin M, alvaradoin E and nordihydroguaiaretic acid were found to be potential inhibitors of p53-MDM2 interaction. The screened phytochemicals, derived from natural extracts, may have negligible side effects and can be explored as potent antagonists of p53-MDM2 interactions, resulting in reactivation of the normal transcription of p53.
Mutant p53 drives cancer by subverting multiple tumour suppression pathways
Directory of Open Access Journals (Sweden)
Sue eHaupt
2016-01-01
Full Text Available The tumour suppressor p53 normally acts as a brake to halt damaged cells from perpetrating their genetic errors into future generations. If p53 is disrupted by mutation, it may not only lose these corrective powers, but counter-productively acquire new capacities that drive cancer. A newly emerging manner in which mutant p53 executes its cancer promoting functions is by harnessing key proteins (including many transcription factors, which normally partner with its wild type, tumour-inhibiting counterpart. In association with the subverted activities of these protein partners, mutant p53 is empowered to act across multiple fundamental cellular pathways (regulating cell division and metabolism and corrupt them to become cancer promoting.
De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic
2017-05-01
Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great
p53-Induced Apoptosis Occurs in the Absence of p14ARF in Malignant Pleural Mesothelioma
Directory of Open Access Journals (Sweden)
Sally Hopkins-Donaldson
2006-07-01
Full Text Available Malignant pleural mesotheliomas (MPMs are usually wild type for the p53 gene but contain homozygous deletions in the INK4A locus that encodes p14ARF, an inhibitor of p53-MDM2 interaction. Previous findings suggest that lack of p14ARF expression and the presence of SV40 large T antigen (L-Tag result in p53 inactivation in MPM. We did not detect SV40 L-Tag mRNA in either MPM cell lines or primary cultures, treatment of p14ARF-deficient cells with cisplatin (CDDP increased both total and phosphorylated p53 and enhanced p53 DNA-binding activity. On incubation with CDDP, levels of positively regulated p53 transcriptional targets p21WAF, PIG3, MDM2, Bax, PUMA increased in p14ARF-deficient cells, whereas negatively regulated survivin decreased. Significantly, p53-induced apoptosis was activated by CDDP in p14ARF-deficient cells, treatment with p53-specific siRNA rendered them more CDDP-resistant. p53 was also activated by: 1 inhibition of MDM2 (using nutlin-3; 2 transient overexpression of p14ARF; and 3 targeting of survivin using antisense oligonucleotides. However, it is noteworthy that only survivin downregulation sensitized cells to CDDP-induced apoptosis. These results suggest that p53 is functional in the absence of p14ARF in MPM and that targeting of the downstream apoptosis inhibitor survivin can sensitize to CDDP-induced apoptosis.
RNA content in the nucleolus alters p53 acetylation via MYBBP1A
Kuroda, Takao; Murayama, Akiko; Katagiri, Naohiro; Ohta, Yu-mi; Fujita, Etsuko; Masumoto, Hiroshi; Ema, Masatsugu; Takahashi, Satoru; Kimura, Keiji; Yanagisawa, Junn
2011-01-01
A number of external and internal insults disrupt nucleolar structure, and the resulting nucleolar stress stabilizes and activates p53. We show here that nucleolar disruption induces acetylation and accumulation of p53 without phosphorylation. We identified three nucleolar proteins, MYBBP1A, RPL5, and RPL11, involved in p53 acetylation and accumulation. MYBBP1A was tethered to the nucleolus through nucleolar RNA. When rRNA transcription was suppressed by nucleolar stress, MYBBP1A translocated to the nucleoplasm and facilitated p53–p300 interaction to enhance p53 acetylation. We also found that RPL5 and RPL11 were required for rRNA export from the nucleolus. Depletion of RPL5 or RPL11 blocked rRNA export and counteracted reduction of nucleolar RNA levels caused by inhibition of rRNA transcription. As a result, RPL5 or RPL11 depletion inhibited MYBBP1A translocation and p53 activation. Our observations indicated that a dynamic equilibrium between RNA generation and export regulated nucleolar RNA content. Perturbation of this balance by nucleolar stress altered the nucleolar RNA content and modulated p53 activity. PMID:21297583
A limited role for p53 in modulating the immediate phenotype of Apc loss in the intestine
International Nuclear Information System (INIS)
Reed, Karen R; Meniel, Valerie S; Marsh, Victoria; Cole, Alicia; Sansom, Owen J; Clarke, Alan R
2008-01-01
p53 is an important tumour suppressor with a known role in the later stages of colorectal cancer, but its relevance to the early stages of neoplastic initiation remains somewhat unclear. Although p53-dependent regulation of Wnt signalling activity is known to occur, the importance of these regulatory mechanisms during the early stages of intestinal neoplasia has not been demonstrated. We have conditionally deleted the Adenomatous Polyposis coli gene (Apc) from the adult murine intestine in wild type and p53 deficient environments and subsequently compared the phenotype and transcriptome profiles in both genotypes. Expression of p53 was shown to be elevated following the conditional deletion of Apc in the adult small intestine. Furthermore, p53 status was shown to impact on the transcription profile observed following Apc loss. A number of key Wnt pathway components and targets were altered in the p53 deficient environment. However, the aberrant phenotype observed following loss of Apc (rapid nuclear localisation of β-catenin, increased levels of DNA damage, nuclear atypia, perturbed cell death, proliferation, differentiation and migration) was not significantly altered by the absence of p53. p53 related feedback mechanisms regulating Wnt signalling activity are present in the intestine, and become activated following loss of Apc. However, the physiological Wnt pathway regulation by p53 appears to be overwhelmed by Apc loss and consequently the activity of these regulatory mechanisms is not sufficient to modulate the immediate phenotypes seen following Apc loss. Thus we are able to provide an explanation to the apparent contradiction that, despite having a Wnt regulatory capacity, p53 loss is not associated with early lesion development
Autoimmune regulator is acetylated by transcription coactivator CBP/p300
Energy Technology Data Exchange (ETDEWEB)
Saare, Mario, E-mail: mario.saare@ut.ee [Molecular Pathology, Institute of General and Molecular Pathology, University of Tartu, 19th Ravila Str, Tartu (Estonia); Rebane, Ana [Molecular Pathology, Institute of General and Molecular Pathology, University of Tartu, 19th Ravila Str, Tartu (Estonia); SIAF, Swiss Institute of Allergy and Asthma Research, University of Zuerich, Davos (Switzerland); Rajashekar, Balaji; Vilo, Jaak [BIIT, Bioinformatics, Algorithmics and Data Mining group, Institute of Computer Science, University of Tartu, Tartu (Estonia); Peterson, Paert [Molecular Pathology, Institute of General and Molecular Pathology, University of Tartu, 19th Ravila Str, Tartu (Estonia)
2012-08-15
The Autoimmune Regulator (AIRE) is a regulator of transcription in the thymic medulla, where it controls the expression of a large set of peripheral-tissue specific genes. AIRE interacts with the transcriptional coactivator and acetyltransferase CBP and synergistically cooperates with it in transcriptional activation. Here, we aimed to study a possible role of AIRE acetylation in the modulation of its activity. We found that AIRE is acetylated in tissue culture cells and this acetylation is enhanced by overexpression of CBP and the CBP paralog p300. The acetylated lysines were located within nuclear localization signal and SAND domain. AIRE with mutations that mimicked acetylated K243 and K253 in the SAND domain had reduced transactivation activity and accumulated into fewer and larger nuclear bodies, whereas mutations that mimicked the unacetylated lysines were functionally similar to wild-type AIRE. Analogously to CBP, p300 localized to AIRE-containing nuclear bodies, however, the overexpression of p300 did not enhance the transcriptional activation of AIRE-regulated genes. Further studies showed that overexpression of p300 stabilized the AIRE protein. Interestingly, gene expression profiling revealed that AIRE, with mutations mimicking K243/K253 acetylation in SAND, was able to activate gene expression, although the affected genes were different and the activation level was lower from those regulated by wild-type AIRE. Our results suggest that the AIRE acetylation can influence the selection of AIRE activated genes. -- Highlights: Black-Right-Pointing-Pointer AIRE is acetylated by the acetyltransferases p300 and CBP. Black-Right-Pointing-Pointer Acetylation occurs between CARD and SAND domains and within the SAND domain. Black-Right-Pointing-Pointer Acetylation increases the size of AIRE nuclear dots. Black-Right-Pointing-Pointer Acetylation increases AIRE protein stability. Black-Right-Pointing-Pointer AIRE acetylation mimic regulates a different set of AIRE
Genetic Stabilization by p53 Involves Growth Regulatory and Repair Pathways
Directory of Open Access Journals (Sweden)
Lisa Wiesmüller
2001-01-01
Full Text Available p53 performs a plethora of activities, which are directed towards the maintenance of the genomic integrity and constitute its universal role as a tumor suppressor. 1000 to 10000 latent p53 molecules are permanently available in order to monitor DNA exchange processes in mitotically growing cells. After the introduction of major DNA injuries the levels of posttranslationally modified p53 proteins rise, which in turn transcriptionally signal transient cell cycle arrest or apoptotic cell death, depending on the extent of damage. Taken together, p53 inhibits the manifestation of genomic instabilities at different control levels both during naturally occurring metabolic processes and in response to genotoxic treatments.
Implication of p53-dependent cellular senescence related gene, TARSH in tumor suppression
International Nuclear Information System (INIS)
Wakoh, Takeshi; Uekawa, Natsuko; Terauchi, Kunihiko; Sugimoto, Masataka; Ishigami, Akihito; Shimada, Jun-ichi; Maruyama, Mitsuo
2009-01-01
A novel target of NESH-SH3 (TARSH) was identified as a cellular senescence related gene in mouse embryonic fibroblasts (MEFs) replicative senescence, the expression of which has been suppressed in primary clinical lung cancer specimens. However, the molecular mechanism underlying the regulation of TARSH involved in pulmonary tumorigenesis remains unclear. Here we demonstrate that the reduction of TARSH gene expression by short hairpin RNA (shRNA) system robustly inhibited the MEFs proliferation with increase in senescence-associated β-galactosidase (SA-β-gal) activity. Using p53 -/- MEFs, we further suggest that this growth arrest by loss of TARSH is evoked by p53-dependent p21 Cip1 accumulation. Moreover, we also reveal that TARSH reduction induces multicentrosome in MEFs, which is linked in chromosome instability and tumor development. These results suggest that TARSH plays an important role in proliferation of replicative senescence and may serve as a trigger of tumor development.
The expanding regulatory universe of p53 in gastrointestinal cancer.
Fesler, Andrew; Zhang, Ning; Ju, Jingfang
2016-01-01
Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs. Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology. With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.
REDOX IMAGING OF THE p53-DEPENDENT MITOCHONDRIAL REDOX STATE IN COLON CANCER EX VIVO
XU, HE N.; FENG, MIN; MOON, LILY; DOLLOFF, NATHAN; EL-DEIRY, WAFIK; LI, LIN Z.
2015-01-01
The mitochondrial redox state and its heterogeneity of colon cancer at tissue level have not been previously reported. Nor has how p53 regulates mitochondrial respiration been measured at (deep) tissue level, presumably due to the unavailability of the technology that has sufficient spatial resolution and tissue penetration depth. Our prior work demonstrated that the mitochondrial redox state and its intratumor heterogeneity is associated with cancer aggressiveness in human melanoma and breast cancer in mouse models, with the more metastatic tumors exhibiting localized regions of more oxidized redox state. Using the Chance redox scanner with an in-plane spatial resolution of 200 μm, we imaged the mitochondrial redox state of the wild-type p53 colon tumors (HCT116 p53 wt) and the p53-deleted colon tumors (HCT116 p53−/−) by collecting the fluorescence signals of nicotinamide adenine dinucleotide (NADH) and oxidized flavoproteins [Fp, including flavin adenine dinucleotide (FAD)] from the mouse xenografts snap-frozen at low temperature. Our results show that: (1) both tumor lines have significant degree of intratumor heterogeneity of the redox state, typically exhibiting a distinct bi-modal distribution that either correlates with the spatial core–rim pattern or the “hot/cold” oxidation-reduction patches; (2) the p53−/− group is significantly more heterogeneous in the mitochondrial redox state and has a more oxidized tumor core compared to the p53 wt group when the tumor sizes of the two groups are matched; (3) the tumor size dependence of the redox indices (such as Fp and Fp redox ratio) is significant in the p53−/− group with the larger ones being more oxidized and more heterogeneous in their redox state, particularly more oxidized in the tumor central regions; (4) the H&E staining images of tumor sections grossly correlate with the redox images. The present work is the first to reveal at the submillimeter scale the intratumor heterogeneity pattern
Directory of Open Access Journals (Sweden)
Ben Stocks
2017-12-01
Full Text Available Tumour protein 53 (p53 has been implicated in the regulation of mitochondrial biogenesis in skeletal muscle, with whole-body p53 knockout mice displaying impairments in basal mitochondrial content, respiratory capacity, and enzyme activity. This study aimed to determine the effect of skeletal muscle-specific loss of p53 on mitochondrial content and enzyme activity. Mitochondrial protein content, enzyme activity and mRNA profiles were assessed in skeletal muscle of 8-week-old male muscle fibre-specific p53 knockout mice (p53 mKO and floxed littermate controls (WT under basal conditions. p53 mKO and WT mice displayed similar content of electron transport chain proteins I-V and citrate synthase enzyme activity in skeletal muscle. In addition, the content of proteins regulating mitochondrial morphology (MFN2, mitofillin, OPA1, DRP1, FIS1, fatty acid metabolism (β-HAD, ACADM, ACADL, ACADVL, carbohydrate metabolism (HKII, PDH, energy sensing (AMPKα2, AMPKβ2, and gene transcription (NRF1, PGC-1α, and TFAM were comparable in p53 mKO and WT mice (p > 0.05. Furthermore, p53 mKO mice exhibited normal mRNA profiles of targeted mitochondrial, metabolic and transcriptional proteins (p > 0.05. Thus, it appears that p53 expression in skeletal muscle fibres is not required to develop or maintain mitochondrial protein content or enzyme function in skeletal muscle under basal conditions.
A Small Ras-like protein Ray/Rab1c modulates the p53-regulating activity of PRPK
International Nuclear Information System (INIS)
Abe, Yasuhito; Takeuchi, Takashi; Imai, Yoshinori; Murase, Ryuichi; Kamei, Yoshiaki; Fujibuchi, Taketsugu; Matsumoto, Suguru; Ueda, Norifumi; Ogasawara, Masahito; Shigemoto, Kazuhiro; Kito, Katsumi
2006-01-01
PRPK phosphorylates serine-15 residue of p53 and enhances transcriptional activity. PRPK possesses a bipartite nuclear localization signal and localizes in nucleus when over-expressed in cells. However, intrinsic PRPK localizes mainly in the cytosol in situ. While studying the mechanisms in the distribution of intrinsic PRPK, we identified a PRPK binding protein, an ubiquitously expressed Small Ras-like GTPase, Rab1c, also named Ray or Rab35. The over-expressed Ray was distributed in the nucleus, cytosol, and cell membrane. Both Ray wild type and GTP-restrictively binding mutant Ray-Q67L, but not guanine nucleotide unstable binding mutant Ray-N120I, partially distributed the over-expressed PRPK to the cytosol and also suppressed the PRPK-induced p53-transcriptional activity profoundly. A Small Ras-like GTPase protein Ray was thus indicated to modulate p53 transcriptional activity of PRPK
Directory of Open Access Journals (Sweden)
Rouba Hage-Sleiman
Full Text Available Molt-4 leukemia cells undergo p53-dependent apoptosis accompanied by accumulation of de novo ceramide after 14 hours of γ-irradiation. In order to identify the potential mediators involved in ceramide accumulation and the cell death response, differentially expressed genes were identified by Affymetrix Microarray Analysis. Molt-4-LXSN cells, expressing wild type p53, and p53-deficient Molt-4-E6 cells were irradiated and harvested at 3 and 8 hours post-irradiation. Human genome U133 plus 2.0 array containing >47,000 transcripts was used for gene expression profiling. From over 10,000 probes, 281 and 12 probes were differentially expressed in Molt-4-LXSN and Molt-4-E6 cells, respectively. Data analysis revealed 63 (upregulated and 20 (downregulated genes (>2 fold in Molt-4-LXSN at 3 hours and 140 (upregulated and 21 (downregulated at 8 hours post-irradiation. In Molt-4-E6 cells, 5 (upregulated genes each were found at 3 hours and 8 hours, respectively. In Molt-4-LXSN cells, a significant fraction of the genes with altered expression at 3 hours were found to be involved in apoptosis signaling pathway (BCL2L11, p53 pathway (PMAIP1, CDKN1A and FAS and oxidative stress response (FDXR, CROT and JUN. Similarly, at 8 hours the genes with altered expression were involved in the apoptosis signaling pathway (BAX, BIK and JUN, p53 pathway (BAX, CDKN1A and FAS, oxidative stress response (FDXR and CROT and p53 pathway feedback loops 2 (MDM2 and CDKN1A. A global molecular and biological interaction map analysis showed an association of these altered genes with apoptosis, senescence, DNA damage, oxidative stress, cell cycle arrest and caspase activation. In a targeted study, activation of apoptosis correlated with changes in gene expression of some of the above genes and revealed sequential activation of both intrinsic and extrinsic apoptotic pathways that precede ceramide accumulation and subsequent execution of apoptosis. One or more of these altered genes
SETD1A modulates cell cycle progression through a miRNA network that regulates p53 target genes
Tajima, Ken; Yae, Toshifumi; Javaid, Sarah; Tam, Oliver; Comaills, Valentine; Morris, Robert; Wittner, Ben S.; Liu, Mingzhu; Engstrom, Amanda; Takahashi, Fumiyuki; Black, Joshua C.; Ramaswamy, Sridhar; Shioda, Toshihiro; Hammell, Molly; Haber, Daniel A.
2015-01-01
Expression of the p53-inducible antiproliferative gene BTG2 is suppressed in many cancers in the absence of inactivating gene mutations, suggesting alternative mechanisms of silencing. Using a shRNA screen targeting 43 histone lysine methyltransferases (KMTs), we show that SETD1A suppresses BTG2 expression through its induction of several BTG2-targeting miRNAs. This indirect but highly specific mechanism, by which a chromatin regulator that mediates transcriptional activating marks can lead t...
International Nuclear Information System (INIS)
Sato, Tsuyoshi; Abe, Takahiro; Nakamoto, Norimichi; Tomaru, Yasuhisa; Koshikiya, Noboru; Nojima, Junya; Kokabu, Shoichiro; Sakata, Yasuaki; Kobayashi, Akio; Yoda, Tetsuya
2008-01-01
Recent studies have suggested that nicotine critically affects bone metabolism. Many studies have examined the effects of nicotine on proliferation and differentiation, but the underlying molecular mechanisms remain unclear. We examined cell cycle regulators involved in the proliferation and differentiation of MC3T3-E1 cells. Nicotine induced cell proliferation in association with p53 down-regulation and cyclin D1 up-regulation. In differentiated cells, nicotine reduced alkaline phosphatase activity and mineralized nodule formation in dose-dependent manners. Furthermore, p53 expression was sustained in nicotine-treated cells during differentiation. These findings indicate that nicotine promotes the cell cycle and inhibits differentiation in association with p53 regulation in pre-osteoblastic cells
The critical role of catalase in prooxidant and antioxidant function of p53
Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J
2013-01-01
The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438
International Nuclear Information System (INIS)
Wei Tang; Powell, Simon N.
1996-01-01
Purpose: The tumor suppressor gene p53 can mediate cell cycle arrest or apoptosis in response to DNA damage. Accumulating evidence suggests that it may also directly or indirectly influence the DNA repair machinery. In the present study, we investigated whether p53, induced by DNA damage, could enhance the rejoining of double-strand DNA breaks. Materials and Methods: DNA double-strand breaks (dsb) were made by restriction enzyme digestion of a plasmid, between a promoter and a 'reporter' gene: luciferase (LUC) or chloramphenicol acetyl-transferase (CAT). Linear or circular plasmid DNA (LUC or CAT) was co-transfected with circular β-Gal plasmid (to normalize for uptake) into mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) for p53. Their ability to rejoin linearized plasmid was measured by the luciferase or CAT activity detected in rescued plasmids. The activity detected in cells transfected with linear plasmid was scored relative to the activity detected in cells transfected with circular plasmid. Results: Ionizing radiation (IR, 2 Gy) enhanced the dsb repair activity in wild type p53 cells; however, p53 null cells lose this effect, indicating that the enhancement of dsb repair was p53-dependent. REF cells with dominant-negative mutant p53 showed a similar induction compared with the parental REF cells with wild-type p53. This ala-143 mutant p53 prevents cell cycle arrest and transactivation of p21 WAF1/cip1) following IR, indicating that the p53-dependent enhancement of DNA repair is distinct from transactivation. Immortalized murine embryonic fibroblasts, 10(1)VasK1 cells, which express p53 cDNA encoding a temperature-sensitive mutant in the DNA sequence specific binding domain (ala135 to val135) with an alternatively spliced C-terminal domain (ASp53: amino-acids 360-381) and, 10(1)Val5 cells, which express the normal spliced p53 (NSp53) with the same temperature-sensitive mutant were compared. It was found that 10(1)VasK1 cells showed no DNA
Energy Technology Data Exchange (ETDEWEB)
Choi, Yeon-Sook; Park, Jeong Ae; Kim, Jihye; Rho, Seung-Sik; Park, Hyojin [Department of Biochemistry, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of); Kim, Young-Myeong [Department of Molecular and Cellular Biochemistry, School of Medicine, Kangwon National University, Chuncheon (Korea, Republic of); Kwon, Young-Guen, E-mail: ygkwon@yonsei.ac.kr [Department of Biochemistry, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of)
2012-05-04
Highlights: Black-Right-Pointing-Pointer IL-33 as nuclear factor regulated expression of ICAM-1 and VCAM-1. Black-Right-Pointing-Pointer Nuclear IL-33 increased the transcription of NF-{kappa}B p65 by binding to the p65 promoter. Black-Right-Pointing-Pointer Nuclear IL-33 controls NF-{kappa}B-dependent inflammatory responses. -- Abstract: Interleukin (IL)-33, an IL-1 family member, acts as an extracellular cytokine by binding its cognate receptor, ST2. IL-33 is also a chromatin-binding transcriptional regulator highly expressed in the nuclei of endothelial cells. However, the function of IL-33 as a nuclear factor is poorly defined. Here, we show that IL-33 is a novel transcriptional regulator of the p65 subunit of the NF-{kappa}B complex and is involved in endothelial cell activation. Quantitative reverse transcriptase PCR and Western blot analyses indicated that IL-33 mediates the expression of intercellular adhesion molecule (ICAM)-1 and vascular cell adhesion molecule (VCAM)-1 in endothelial cells basally and in response to tumor necrosis factor-{alpha}-treatment. IL-33-induced ICAM-1/VCAM-1 expression was dependent on the regulatory effect of IL-33 on the nuclear factor (NF)-{kappa}B pathway; NF-{kappa}B p65 expression was enhanced by IL-33 overexpression and, conversely, reduced by IL-33 knockdown. Moreover, NF-{kappa}B p65 promoter activity and chromatin immunoprecipitation analysis revealed that IL-33 binds to the p65 promoter region in the nucleus. Our data provide the first evidence that IL-33 in the nucleus of endothelial cells participates in inflammatory reactions as a transcriptional regulator of NF-{kappa}B p65.
Long Non-Coding RNAs Embedded in the Rb and p53 Pathways
Energy Technology Data Exchange (ETDEWEB)
Subramanian, Murugan; Jones, Matthew F.; Lal, Ashish, E-mail: ashish.lal@nih.gov [Genetics Branch, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892 (United States)
2013-12-04
In recent years, long non-coding RNAs (lncRNAs) have gained significant attention as a novel class of gene regulators. Although a small number of lncRNAs have been shown to regulate gene expression through diverse mechanisms including transcriptional regulation, mRNA splicing and translation, the physiological function and mechanism of action of the vast majority are not known. Profiling studies in cell lines and tumor samples have suggested a potential role of lncRNAs in cancer. Indeed, distinct lncRNAs have been shown to be embedded in the p53 and Rb networks, two of the major tumor suppressor pathways that control cell cycle progression and survival. Given the fact that inactivation of Rb and p53 is a hallmark of human cancer, in this review we discuss recent evidence on the function of lncRNAs in the Rb and p53 signaling pathways.
Long Non-Coding RNAs Embedded in the Rb and p53 Pathways
International Nuclear Information System (INIS)
Subramanian, Murugan; Jones, Matthew F.; Lal, Ashish
2013-01-01
In recent years, long non-coding RNAs (lncRNAs) have gained significant attention as a novel class of gene regulators. Although a small number of lncRNAs have been shown to regulate gene expression through diverse mechanisms including transcriptional regulation, mRNA splicing and translation, the physiological function and mechanism of action of the vast majority are not known. Profiling studies in cell lines and tumor samples have suggested a potential role of lncRNAs in cancer. Indeed, distinct lncRNAs have been shown to be embedded in the p53 and Rb networks, two of the major tumor suppressor pathways that control cell cycle progression and survival. Given the fact that inactivation of Rb and p53 is a hallmark of human cancer, in this review we discuss recent evidence on the function of lncRNAs in the Rb and p53 signaling pathways
Bublik, Débora R.; Bursać, Slađana; Sheffer, Michal; Oršolić, Ines; Shalit, Tali; Tarcic, Ohad; Kotler, Eran; Mouhadeb, Odelia; Hoffman, Yonit; Fuchs, Gilad; Levin, Yishai; Volarević, Siniša; Oren, Moshe
2017-01-01
The microRNA miR-504 targets TP53 mRNA encoding the p53 tumor suppressor. miR-504 resides within the fibroblast growth factor 13 (FGF13) gene, which is overexpressed in various cancers. We report that the FGF13 locus, comprising FGF13 and miR-504, is transcriptionally repressed by p53, defining an additional negative feedback loop in the p53 network. Furthermore, we show that FGF13 1A is a nucleolar protein that represses ribosomal RNA transcription and attenuates protein synthesis. Importantly, in cancer cells expressing high levels of FGF13, the depletion of FGF13 elicits increased proteostasis stress, associated with the accumulation of reactive oxygen species and apoptosis. Notably, stepwise neoplastic transformation is accompanied by a gradual increase in FGF13 expression and increased dependence on FGF13 for survival (“nononcogene addiction”). Moreover, FGF13 overexpression enables cells to cope more effectively with the stress elicited by oncogenic Ras protein. We propose that, in cells in which activated oncogenes drive excessive protein synthesis, FGF13 may favor survival by maintaining translation rates at a level compatible with the protein quality-control capacity of the cell. Thus, FGF13 may serve as an enabler, allowing cancer cells to evade proteostasis stress triggered by oncogene activation. PMID:27994142
Mohamed, Anis Syamimi; Hanafi, Noorul Izzati; Sheikh Abdul Kadir, Siti Hamimah; Md Noor, Julina; Abdul Hamid Hasani, Narimah; Ab Rahim, Sharaniza; Siran, Rosfaiizah
2017-10-01
In hepatocytes, ursodeoxycholic acid (UDCA) activates cell signalling pathways such as p53, intracellular calcium ([Ca 2+ ] i ), and sphingosine-1-phosphate (S1P)-receptor via Gα i -coupled-receptor. Recently, UDCA has been shown to protect the heart against hypoxia-reoxygenation injury. However, it is not clear whether UDCA cardioprotection against hypoxia acts through a transcriptional mediator of cells stress, HIF-1α and p53. Therefore, in here, we aimed to investigate whether UDCA could protect cardiomyocytes (CMs) against hypoxia by regulating expression of HIF-1α, p53, [Ca 2+ ] i , and S1P-Gα i -coupled-receptor. Cardiomyocytes were isolated from newborn rats (0-2 days), and hypoxia was induced by using cobalt chloride (CoCl 2 ). Cardiomyocytes were treated with UDCA and cotreated with either FTY720 (S1P-receptor agonist) or pertussis toxin (PTX; Gα i inhibitor). Cells were subjected for proliferation assay, beating frequency, QuantiGene Plex assay, western blot, immunofluorescence, and calcium imaging. Our findings showed that UDCA counteracted the effects of CoCl 2 on cell viability, beating frequency, HIF-1α, and p53 protein expression. We found that these cardioprotection effects of UDCA were similar to FTY720, S1P agonist. Furthermore, we observed that UDCA protects CMs against CoCl 2 -induced [Ca 2+ ] i dynamic alteration. Pharmacological inhibition of the Gα i -sensitive receptor did not abolish the cardioprotection of UDCA against CoCl 2 detrimental effects, except for cell viability and [Ca 2+ ] i . Pertussis toxin is partially effective in inhibiting UDCA protection against CoCl 2 effects on CM cell viability. Interestingly, PTX fully inhibits UDCA cardioprotection on CoCl 2 -induced [Ca 2+ ] i dynamic changes. We conclude that UDCA cardioprotection against CoCl 2 -induced hypoxia is similar to FTY720, and its actions are not fully mediated by the Gα i -coupled protein sensitive pathways. Ursodeoxycholic acid is the most hydrophilic bile
p53-Independent thermosensitization by mitomycin C in human non-small cell lung carcinoma cells
International Nuclear Information System (INIS)
Jin, Z.-H.; Matsumoto, H.; Hayashi, S.; Shioura, H.; Kitai, R.; Kano, E.; Hatashita, M.
2003-01-01
The combined treatment with hyperthermia and chemotherapeutic drugs such as cisplatin (CDDP), doxorubicin (DOX) and mitomycin C (MMC) has been widely adopted as a strategy of interdisciplinary cancer therapy to obtain greater therapeutic benefits. However, the involved mechanisms of the interactive cytotoxic effects of hyperthermia and MMC remain unclear. To elucidate the relationship between p53 functions and the interactive effects of the combined treatment with mild-hyperthermia and MMC, we examined the potentiation of cytotoxic effects, the induction of apoptosis, the changes in cell cycles and the accumulation of Hsp72 after the combined treatment with hyperthermia at 42 degree C and MMC using human non-small cell lung carcinoma H1299 transfectants with either null, wild-type (wt) or mutant (m) p53 gene. H1299/null, H1299/wtp53 and H1299/mp53 cells showed similar sensitivities to either hyperthermia at 42 degree C alone or MMC alone. The combined treatment resulted in a synergistically enhanced cytotoxicity in H1299 transfectants in a p53-independent manner. The mechanisms involved an enhancement of heat-induced apoptosis and a modulation of the cell cycle distribution by the combined treatment. The accumulation of Hsp72 was not suppressed by the combined treatment, as is not the case of the combined treatment with hyperthermia and either CDDP (1) or bleomycin (2). Our findings demonstrate a p53-independent mechanism for a synergistically cytotoxic enhancement by the combined treatment with mild-hyperthermia and MMC
International Nuclear Information System (INIS)
Oh, Sang Taek; Cho, Mun Ju; Gwak, Jung Sug; Ryu, Min Jung; Song, Jie Young; Yun, Yeon Sook
2009-01-01
The tumor suppressor p53 is key molecule to protect the cell against genotoxic stress and..the most frequently mutated..protein..in cancer cells. Lack of functional p53..is accompanied by high rate of genomic instability, rapid tumor progression, resistance to anticancer therapy, and increased angiogenesis. In response to DNA damage, p53 protein rapidly accumulated through attenuated proteolysis and is also activated as transcription factor. Activated p53 up-regulates target genes involved in cell cycle arrest and/or apoptosis and then lead to suppression of malignant transformation and the maintenance of genomic integrity. Chemical genetics is a new technology to uncover the signaling networks that regulated biological phenotype using exogenous reagents such as small molecules. Analogous to classical forward genetic screens in model organism, this approach makes use of high throughput, phenotypic assay to identify small molecules that disrupt gene product function in a way that alters a phenotype of interest. Recently, interesting small molecules were identified from cell based high throughput screening and its target protein or mechanism of action were identified by various methods including affinity chromatography, protein array profiling, mRNA or phage display, transcription profiling, and RNA interference
Energy Technology Data Exchange (ETDEWEB)
Oh, Sang Taek; Cho, Mun Ju; Gwak, Jung Sug; Ryu, Min Jung [PharmacoGenomics Research Center, Inje University, Busan (Korea, Republic of); Song, Jie Young; Yun, Yeon Sook [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)
2009-05-15
The tumor suppressor p53 is key molecule to protect the cell against genotoxic stress and..the most frequently mutated..protein..in cancer cells. Lack of functional p53..is accompanied by high rate of genomic instability, rapid tumor progression, resistance to anticancer therapy, and increased angiogenesis. In response to DNA damage, p53 protein rapidly accumulated through attenuated proteolysis and is also activated as transcription factor. Activated p53 up-regulates target genes involved in cell cycle arrest and/or apoptosis and then lead to suppression of malignant transformation and the maintenance of genomic integrity. Chemical genetics is a new technology to uncover the signaling networks that regulated biological phenotype using exogenous reagents such as small molecules. Analogous to classical forward genetic screens in model organism, this approach makes use of high throughput, phenotypic assay to identify small molecules that disrupt gene product function in a way that alters a phenotype of interest. Recently, interesting small molecules were identified from cell based high throughput screening and its target protein or mechanism of action were identified by various methods including affinity chromatography, protein array profiling, mRNA or phage display, transcription profiling, and RNA interference.
Cellular inactivation of nitric oxide induces p53-dependent ...
African Journals Online (AJOL)
Tropical Journal of Pharmaceutical Research August 2016; 15 (8): 1595-1603 ... Cellular inactivation of nitric oxide induces p53-dependent apoptosis in ... apoptosis induced by a selective iNOS inhibitor, N-[(3-aminomethyl) benzyl] acetamidine (1400W), .... and nitrate. ... Nitrite production was measured in culture media.
Directory of Open Access Journals (Sweden)
Wei-Ru Huang
Full Text Available Avian reovirus (ARV protein p17 has been shown to regulate cell cycle and autophagy by activation of p53/PTEN pathway; nevertheless, it is still unclear how p53 and PTEN are activated by p17. Here, we report for the first time that p17 functions as a nucleoporin Tpr suppressor that leads to p53 nuclear accumulation and consequently activates p53, p21, and PTEN. The nuclear localization signal (119IAAKRGRQLD128 of p17 has been identified for Tpr binding. This study has shown that Tpr suppression occurs by p17 interacting with Tpr and by reducing the transcription level of Tpr, which together inhibit Tpr function. In addition to upregulation of PTEN by activation of p53 pathway, this study also suggests that ARV protein p17 acts as a positive regulator of PTEN. ARV p17 stabilizes PTEN by stimulating phosphorylation of cytoplasmic PTEN and by elevating Rak-PTEN association to prevent it from E3 ligase NEDD4-1 targeting. To activate PTEN, p17 is able to promote β-arrestin-mediated PTEN translocation from the cytoplasm to the plasma membrane via a Rock-1-dependent manner. The accumulation of p53 in the nucleus induces the PTEN- and p21-mediated downregulation of cyclin D1 and CDK4. Furthermore, Tpr and CDK4 knockdown increased virus production in contrast to depletion of p53, PTEN, and LC3 reducing virus yield. Taken together, our data suggest that p17-mediated Tpr suppression positively regulates p53, PTEN, and p21 and negatively regulates PI3K/AKT/mTOR and ERK signaling pathways, both of which are beneficial for virus replication.
Expression of p53 and p21 in primary glioblastomas
International Nuclear Information System (INIS)
Gross, M.W.; Nashwan, K.; Engenhart-Cabillic, R.; Kraus, A.; Mennel, H.D.; Schlegel, J.
2005-01-01
Background and purpose: primary glioblastomas (GBMs) are highly radioresistant, and in contrast to secondary GBMs, they bear wild-type (wt) p53 protein, which is stabilized in a proportion of these tumors. Therefore, it was investigated in vivo whether p53 expression has prognostic value in patients undergoing radiochemotherapy. Additionally, the authors tried to identify, in vitro, subgroups of primary GBM with different susceptibilities to irradiation, on the basis of their p53 and p21 responses to ionizing radiation. Material and methods: tumor tissue samples from 31 patients suffering from primary GBM undergoing a combined radiochemotherapy with topotecan were investigated. The percentage of cells expressing p53 protein was determined immunohistochemically. Additionally, primary cultures from eleven primary GBMs were established and investigated. p53 and p21 expressions were evaluated before irradiation with 10 Gy and at 2 and 8 h after irradiation. p53 protein expression was measured by western analysis and p21 mRNA expression by reverse transcription-polymerase chain reaction (RT-PCR). Results: the percentage of p53-positive cells within the tumor specimens obtained from the 31 patients ranged from 0% to 28%, the median value being 4.3%. No significant correlation with disease-free survival or overall survival was found. In vitro, p53 protein was detected in seven of eleven cultures from primary GBM. After irradiation a decrease in p53 protein expression was seen in six of the seven p53-positive cultures. Half of the cultures (two of four) without basal p53 expression showed an increase in p53 expression after irradiation. Basal overexpression of p21 was detected in six of the eleven cultures; in four out of six irradiation led to a decrease in p21 expression. In all cell lines (five of eleven) initially showing absent p21 expression, irradiation induced p21 expression. Despite these responses, G1 arrest was not detectable in any of the GBM cultures
Alcohol alters hepatic FoxO1, p53, and mitochondrial SIRT5 deacetylation function
International Nuclear Information System (INIS)
Lieber, Charles S.; Leo, Maria Anna; Wang, Xiaolei; DeCarli, Leonore M.
2008-01-01
Chronic alcohol consumption affects the gene expression of a NAD-dependent deacetylase Sirtuis 1 (SIRT1) and the peroxisome proliferator-activated receptor-γ coactivator1α (PGC-1α). Our aim was to verify that it also alters the forkhead (FoxO1) and p53 transcription factor proteins, critical in the hepatic response to oxidative stress and regulated by SIRT1 through its deacetylating capacity. Accordingly, rats were pair-fed the Lieber-DeCarli alcohol-containing liquid diets for 28 days. Alcohol increased hepatic mRNA expression of FoxO1 (p = 0.003) and p53 (p = 0.001) while corresponding protein levels remained unchanged. However phospho-FoxO1 and phospho-Akt (protein kinase) were both decreased by alcohol consumption (p = 0.04 and p = 0.02, respectively) while hepatic p53 was found hyperacetylated (p = 0.017). Furthermore, mitochondrial SIRT5 was reduced (p = 0.0025), and PGC-1α hyperacetylated (p = 0.027), establishing their role in protein modification. Thus, alcohol consumption disrupts nuclear-mitochondrial interactions by post-translation protein modifications, which contribute to alteration of mitochondrial biogenesis through the newly discovered reduction of SIRT5
Requirement of the ATM/p53 tumor suppressor pathway for glucose homeostasis.
Armata, Heather L; Golebiowski, Diane; Jung, Dae Young; Ko, Hwi Jin; Kim, Jason K; Sluss, Hayla K
2010-12-01
Ataxia telangiectasia (A-T) patients can develop multiple clinical pathologies, including neuronal degeneration, an elevated risk of cancer, telangiectasias, and growth retardation. Patients with A-T can also exhibit an increased risk of insulin resistance and type 2 diabetes. The ATM protein kinase, the product of the gene mutated in A-T patients (Atm), has been implicated in metabolic disease, which is characterized by insulin resistance and increased cholesterol and lipid levels, blood pressure, and atherosclerosis. ATM phosphorylates the p53 tumor suppressor on a site (Ser15) that regulates transcription activity. To test whether the ATM pathway that regulates insulin resistance is mediated by p53 phosphorylation, we examined insulin sensitivity in mice with a germ line mutation that replaces the p53 phosphorylation site with alanine. The loss of p53 Ser18 (murine Ser15) led to increased metabolic stress, including severe defects in glucose homeostasis. The mice developed glucose intolerance and insulin resistance. The insulin resistance correlated with the loss of antioxidant gene expression and decreased insulin signaling. N-Acetyl cysteine (NAC) treatment restored insulin signaling in late-passage primary fibroblasts. The addition of an antioxidant in the diet rendered the p53 Ser18-deficient mice glucose tolerant. This analysis demonstrates that p53 phosphorylation on an ATM site is an important mechanism in the physiological regulation of glucose homeostasis.
CLCA2 as a p53-Inducible Senescence Mediator
Directory of Open Access Journals (Sweden)
Chizu Tanikawa
2012-02-01
Full Text Available p53 is a tumor suppressor gene that is frequently mutated in multiple cancer tissues. Activated p53 protein regulates its downstream genes and subsequently inhibits malignant transformation by inducing cell cycle arrest, apoptosis, DNA repair, and senescence. However, genes involved in the p53-mediated senescence pathway are not yet fully elucidated. Through the screening of two genome-wide expression profile data sets, one for cells in which exogenous p53 was introduced and the other for senescent fibroblasts, we have identified chloride channel accessory 2 (CLCA2 as a p53-inducible senescence-associated gene. CLCA2 was remarkably induced by replicative senescence as well as oxidative stress in a p53-dependent manner. We also found that ectopically expressed CLCA2 induced cellular senescence, and the down-regulation of CLCA2 by small interfering RNA caused inhibition of oxidative stress-induced senescence. Interestingly, the reduced expression of CLCA2 was frequently observed in various kinds of cancers including prostate cancer, whereas its expression was not affected in precancerous prostatic intraepithelial neoplasia. Thus, our findings suggest a crucial role of p53/CLCA2-mediated senescence induction as a barrier for malignant transformation.
Cisplatinum and Taxol Induce Different Patterns of p53 Phosphorylation
Directory of Open Access Journals (Sweden)
Giovanna Damia
2001-01-01
Full Text Available Posttranslational modifications of p53 induced by two widely used anticancer agents, cisplatinum (DDP and taxol were investigated in two human cancer cell lines. Although both drugs were able to induce phosphorylation at serine 20 (Ser20, only DDP treatment induced p53 phosphorylation at serine 15 (Ser15. Moreover, both drug treatments were able to increase p53 levels and consequently the transcription of waf1 and mdm-2 genes, although DDP treatment resulted in a stronger inducer of both genes. Using two ataxia telangiectasia mutated (ATM cell lines, the role of ATM in druginduced p53 phosphorylations was investigated. No differences in drug-induced p53 phosphorylation could be observed, indicating that ATM is not the kinase involved in these phosphorylation events. In addition, inhibition of DNA-dependent protein kinase activity by wortmannin did not abolish p53 phosphorylation at Ser15 and Ser20, again indicating that DNA-PK is unlikely to be the kinase involved. After both taxol and DDP treatments, an activation of hCHK2 was found and this is likely to be responsible for phosphorylation at Ser20. In contrast, only DDP was able to activate ATR, which is the candidate kinase for phosphorylation of Ser15 by this drug. This data clearly suggests that differential mechanisms are involved in phosphorylation and activation of p53 depending on the drug type.
ATF3 activates Stat3 phosphorylation through inhibition of p53 expression in skin cancer cells.
Hao, Zhen-Feng; Ao, Jun-Hong; Zhang, Jie; Su, You-Ming; Yang, Rong-Ya
2013-01-01
ATF3, a member of the ATF/CREB family of transcription factors, has been found to be selectively induced by calcineurin/NFAT inhibition and to enhance keratinocyte tumor formation, although the precise role of ATF3 in human skin cancer and possible mechanisms remain unknown. In this study, clinical analysis of 30 skin cancer patients and 30 normal donors revealed that ATF3 was accumulated in skin cancer tissues. Functional assays demonstrated that ATF3 significantly promoted skin cancer cell proliferation. Mechanically, ATF3 activated Stat3 phosphorylation in skin cancer cell through regulation of p53 expression. Moreover, the promotion effect of ATF3 on skin cancer cell proliferation was dependent on the p53-Stat3 signaling cascade. Together, the results indicate that ATF3 might promote skin cancer cell proliferation and enhance skin keratinocyte tumor development through inhibiting p53 expression and then activating Stat3 phosphorylation.
TRIM65 negatively regulates p53 through ubiquitination
Energy Technology Data Exchange (ETDEWEB)
Li, Yang [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Ma, Chengyuan [Department of Neurosurgery, The First Hospital of Jilin University, Changchun 130021 (China); Zhou, Tong [Department of Endocrinology, The First Hospital of Jilin University, Changchun 130021 (China); Liu, Ying [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Sun, Luyao [Department of Infectious Diseases, The First Hospital of Jilin University, Changchun 130021 (China); Yu, Zhenxiang, E-mail: zhenxiangyu2015@gmail.com [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China)
2016-04-22
Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediated degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.
International Nuclear Information System (INIS)
Yi Fuming; Saha, Abhik; Murakami, Masanao; Kumar, Pankaj; Knight, Jason S.; Cai Qiliang; Choudhuri, Tathagata; Robertson, Erle S.
2009-01-01
The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3C with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF Skp2 , cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53 -/- ) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.
Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response
Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.
2005-01-01
p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus la...
Subhash, Vinod Vijay; Tan, Shi Hui; Yeo, Mei Shi; Yan, Fui Leng; Peethala, Praveen C; Liem, Natalia; Krishnan, Vaidehi; Yong, Wei Peng
2016-12-01
Identification of synthetically lethal cellular targets and synergistic drug combinations is important in cancer chemotherapy as they help to overcome treatment resistance and increase efficacy. The Ataxia Telangiectasia Mutated (ATM) kinase is a nuclear protein that plays a major role in the initiation of DNA repair signaling and cell-cycle check points during DNA damage. Although ATM was shown to be associated with poor prognosis in gastric cancer, its implications as a predictive biomarker for cancer chemotherapy remain unexplored. The present study evaluated ATM-induced synthetic lethality and its role in sensitization of gastric cancer cells to PARP and TOP1 inhibitors, veliparib (ABT-888) and irinotecan (CPT-11), respectively. ATM expression was detected in a panel of gastric cell lines, and the IC 50 against each inhibitors was determined. The combinatorial effect of ABT-888 and CPT-11 in gastric cancer cells was also determined both in vitro and in vivo ATM deficiency was found to be associated with enhanced sensitivity to ABT-888 and CPT-11 monotherapy, hence suggesting a mechanism of synthetic lethality. Cells with high ATM expression showed reduced sensitivity to monotherapy; however, they showed a higher therapeutic effect with ABT-888 and CPT-11 combinatorial therapy. Furthermore, ATM expression was shown to play a major role in cellular homeostasis by regulating cell-cycle progression and apoptosis in a P53-independent manner. The present study highlights the clinical utility of ATM expression as a predictive marker for sensitivity of gastric cancer cells to PARP and TOP1 inhibition and provides a deeper mechanistic insight into ATM-dependent regulation of cellular processes. Mol Cancer Ther; 15(12); 3087-96. ©2016 AACR. ©2016 American Association for Cancer Research.
Directory of Open Access Journals (Sweden)
Maria Maqueda
Full Text Available Gene expression (GE analyses on blood samples from marathon and half-marathon runners have reported significant impacts on the immune and inflammatory systems. An ultra-marathon trail (UMT represents a greater effort due to its more testing conditions. For the first time, we report the genome-wide GE profiling in a group of 16 runners participating in an 82 km UMT competition. We quantified their differential GE profile before and after the race using HuGene2.0st microarrays (Affymetrix Inc., California, US. The results obtained were decomposed by means of an independent component analysis (ICA targeting independent expression modes. We observed significant differences in the expression levels of 5,084 protein coding genes resulting in an overrepresentation of 14% of the human biological pathways from the Kyoto Encyclopedia of Genes and Genomes database. These were mainly clustered on terms related with protein synthesis repression, altered immune system and infectious diseases related mechanisms. In a second analysis, 27 out of the 196 transcriptional regulators (TRs included in the Open Regulatory Annotation database were overrepresented. Among these TRs, we identified transcription factors from the hypoxia-inducible factors (HIF family EPAS1 (p< 0.01 and HIF1A (p<0.001, and others jointly described in the gluconeogenesis program such as HNF4 (p< 0.001, EGR1 (p<0.001, CEBPA (p< 0.001 and a highly specific TR, YY1 (p<0.01. The five independent components, obtained from ICA, further revealed a down-regulation of 10 genes distributed in the complex I, III and V from the electron transport chain. This mitochondrial activity reduction is compatible with HIF-1 system activation. The vascular endothelial growth factor (VEGF pathway, known to be regulated by HIF, also emerged (p<0.05. Additionally, and related to the brain rewarding circuit, the endocannabinoid signalling pathway was overrepresented (p<0.05.
DEFF Research Database (Denmark)
Møller, Michael Boe; Ino, Y; Gerdes, A M
1999-01-01
The two gene products of the CDKN2A gene, p16 and p19ARF, have recently been linked to each of two major tumour suppressor pathways in human carcinogenesis, the RB1 pathway and the p53 pathway. p16 inhibits the phosphorylation of the retinoblastoma gene product by cyclin D-dependent kinases...
Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals
Directory of Open Access Journals (Sweden)
Yasuhito Ohsaka
2010-01-01
Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.
Directory of Open Access Journals (Sweden)
Yen-An Tang
2014-06-01
Conclusions: This study provides cell and clinical evidence that p53 and RB pathways transcriptionally repress DNMT expression. Normal expression of DNMT3A, RB and MDM2 proteins can be a biomarker for good prognosis in lung cancer.
Gibberellic acid and cGMP-dependent transcriptional regulation in arabidopsis thaliana
Bastian, René
2010-03-01
An ever increasing amount of transcriptomic data and analysis tools provide novel insight into complex responses of biological systems. Given these resources we have undertaken to review aspects of transcriptional regulation in response to the plant hormone gibberellic acid (GA) and its second messenger guanosine 3\\',5\\'-cyclic monophosphate (cGMP) in Arabidopsis thaliana, both wild type and selected mutants. Evidence suggests enrichment of GA-responsive (GARE) elements in promoters of genes that are transcriptionally upregulated in response to cGMP but downregulated in a GA insensitive mutant (ga1-3). In contrast, in the genes upregulated in the mutant, no enrichment in the GARE is observed suggesting that GARE motifs are diagnostic for GA-induced and cGMP-dependent transcriptional upregulation. Further, we review how expression studies of GA-dependent transcription factors and transcriptional networks based on common promoter signatures derived from ab initio analyses can contribute to our understanding of plant responses at the systems level. © 2010 Landes Bioscience.
Microbial Regulation of p53 Tumor Suppressor.
Directory of Open Access Journals (Sweden)
Alexander I Zaika
2015-09-01
Full Text Available p53 tumor suppressor has been identified as a protein interacting with the large T antigen produced by simian vacuolating virus 40 (SV40. Subsequent research on p53 inhibition by SV40 and other tumor viruses has not only helped to gain a better understanding of viral biology, but also shaped our knowledge of human tumorigenesis. Recent studies have found, however, that inhibition of p53 is not strictly in the realm of viruses. Some bacterial pathogens also actively inhibit p53 protein and induce its degradation, resulting in alteration of cellular stress responses. This phenomenon was initially characterized in gastric epithelial cells infected with Helicobacter pylori, a bacterial pathogen that commonly infects the human stomach and is strongly linked to gastric cancer. Besides H. pylori, a number of other bacterial species were recently discovered to inhibit p53. These findings provide novel insights into host-bacteria interactions and tumorigenesis associated with bacterial infections.
Directory of Open Access Journals (Sweden)
R Geetha Ramani
Full Text Available Prediction of secondary site mutations that reinstate mutated p53 to normalcy has been the focus of intense research in the recent past owing to the fact that p53 mutants have been implicated in more than half of all human cancers and restoration of p53 causes tumor regression. However laboratory investigations are more often laborious and resource intensive but computational techniques could well surmount these drawbacks. In view of this, we formulated a novel approach utilizing computational techniques to predict the transcriptional activity of multiple site (one-site to five-site p53 mutants. The optimal MCC obtained by the proposed approach on prediction of one-site, two-site, three-site, four-site and five-site mutants were 0.775,0.341,0.784,0.916 and 0.655 respectively, the highest reported thus far in literature. We have also demonstrated that 2D and 3D features generate higher prediction accuracy of p53 activity and our findings revealed the optimal results for prediction of p53 status, reported till date. We believe detection of the secondary site mutations that suppress tumor growth may facilitate better understanding of the relationship between p53 structure and function and further knowledge on the molecular mechanisms and biological activity of p53, a targeted source for cancer therapy. We expect that our prediction methods and reported results may provide useful insights on p53 functional mechanisms and generate more avenues for utilizing computational techniques in biological data analysis.
International Nuclear Information System (INIS)
Pang Dequan; Wang Peiguo; Wang Ping; Zhang Weiming
2008-01-01
Objective: To investigate the enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell lines(A549 and GLC-82) with different p53 status in vitro. Methods: Two human lung adenocarcinoma cell lines of A549 and GLC-82 were examined on their difference in p53 status with immunohistochemistry stain and PCR-SSCP technique. Expand Ad-wtp53 was transfected into tumor cells. Clonogenic assays were performed to evaluate the inhibition effect on cell growth and the degree of sensitization to irradiation. Apoptosis and cell cycle changes were determined using the flow cytometry assay. Results: The A549 cell line presented positive P53 expression while GLC-82 negative. GLC-82 bore mutant p53 on the exon 7. The wtp53 gene could be efficiently expressed in the two cell lines and greatly inhibit the cell growth. Its efficiency didn't depend on the intrinsic p53 genetic status. After irradiation, its function of inducing G 1 arrest and apoptosis on GLC-82 cell line was much stronger than the A549 cell line. In both the A549 and GLC-82 cell lines, the combination of Ad-p53 plus radiation resulted in more apoptosis than the others. There was no significant difference between two groups. Conclusions: Ad-p53 can depress the tumor growth and enhance the radiosensitivity of human lung adenocarcinoma cells. And this effect is independent of endogenous p53 status. (authors)
Fox, Daniel K.; Ebert, Scott M.; Bongers, Kale S.; Dyle, Michael C.; Bullard, Steven A.; Dierdorff, Jason M.; Kunkel, Steven D.
2014-01-01
Immobilization causes skeletal muscle atrophy via complex signaling pathways that are not well understood. To better understand these pathways, we investigated the roles of p53 and ATF4, two transcription factors that mediate adaptations to a variety of cellular stresses. Using mouse models, we demonstrate that 3 days of muscle immobilization induces muscle atrophy and increases expression of p53 and ATF4. Furthermore, muscle fibers lacking p53 or ATF4 are partially resistant to immobilization-induced muscle atrophy, and forced expression of p53 or ATF4 induces muscle fiber atrophy in the absence of immobilization. Importantly, however, p53 and ATF4 do not require each other to promote atrophy, and coexpression of p53 and ATF4 induces more atrophy than either transcription factor alone. Moreover, muscle fibers lacking both p53 and ATF4 are more resistant to immobilization-induced atrophy than fibers lacking only p53 or ATF4. Interestingly, the independent and additive nature of the p53 and ATF4 pathways allows for combinatorial control of at least one downstream effector, p21. Using genome-wide mRNA expression arrays, we identified p21 mRNA as a skeletal muscle transcript that is highly induced in immobilized muscle via the combined actions of p53 and ATF4. Additionally, in mouse muscle, p21 induces atrophy in a manner that does not require immobilization, p53 or ATF4, and p21 is required for atrophy induced by immobilization, p53, and ATF4. Collectively, these results identify p53 and ATF4 as essential and complementary mediators of immobilization-induced muscle atrophy and discover p21 as a critical downstream effector of the p53 and ATF4 pathways. PMID:24895282
Gene expression patterns associated with p53 status in breast cancer
International Nuclear Information System (INIS)
Troester, Melissa A; Herschkowitz, Jason I; Oh, Daniel S; He, Xiaping; Hoadley, Katherine A; Barbier, Claire S; Perou, Charles M
2006-01-01
Breast cancer subtypes identified in genomic studies have different underlying genetic defects. Mutations in the tumor suppressor p53 occur more frequently in estrogen receptor (ER) negative, basal-like and HER2-amplified tumors than in luminal, ER positive tumors. Thus, because p53 mutation status is tightly linked to other characteristics of prognostic importance, it is difficult to identify p53's independent prognostic effects. The relation between p53 status and subtype can be better studied by combining data from primary tumors with data from isogenic cell line pairs (with and without p53 function). The p53-dependent gene expression signatures of four cell lines (MCF-7, ZR-75-1, and two immortalized human mammary epithelial cell lines) were identified by comparing p53-RNAi transduced cell lines to their parent cell lines. Cell lines were treated with vehicle only or doxorubicin to identify p53 responses in both non-induced and induced states. The cell line signatures were compared with p53-mutation associated genes in breast tumors. Each cell line displayed distinct patterns of p53-dependent gene expression, but cell type specific (basal vs. luminal) commonalities were evident. Further, a common gene expression signature associated with p53 loss across all four cell lines was identified. This signature showed overlap with the signature of p53 loss/mutation status in primary breast tumors. Moreover, the common cell-line tumor signature excluded genes that were breast cancer subtype-associated, but not downstream of p53. To validate the biological relevance of the common signature, we demonstrated that this gene set predicted relapse-free, disease-specific, and overall survival in independent test data. In the presence of breast cancer heterogeneity, experimental and biologically-based methods for assessing gene expression in relation to p53 status provide prognostic and biologically-relevant gene lists. Our biologically-based refinements excluded genes
Directory of Open Access Journals (Sweden)
Ariel M Wilson
Full Text Available The transcription factor p53 mediates the apoptosis of post-mitotic neurons exposed to a wide range of stress stimuli. The apoptotic activity of p53 is tightly regulated by the apoptosis-stimulating proteins of p53 (ASPP family members: ASPP1, ASPP2 and iASPP. We previously showed that the pro-apoptotic members ASPP1 and ASPP2 contribute to p53-dependent death of retinal ganglion cells (RGCs. However, the role of the p53 inhibitor iASPP in the central nervous system (CNS remains to be elucidated. To address this, we asked whether iASPP contributes to the survival of RGCs in an in vivo model of acute optic nerve damage. We demonstrate that iASPP is expressed by injured RGCs and that iASPP phosphorylation at serine residues, which increase iASPP affinity towards p53, is significantly reduced following axotomy. We show that short interference RNA (siRNA-induced iASPP knockdown exacerbates RGC death, whereas adeno-associated virus (AAV-mediated iASPP expression promotes RGC survival. Importantly, our data also demonstrate that increasing iASPP expression in RGCs downregulates p53 activity and blocks the expression of pro-apoptotic targets PUMA and Fas/CD95. This study demonstrates a novel role for iASPP in the survival of RGCs, and provides further evidence of the importance of the ASPP family in the regulation of neuronal loss after axonal injury.
Directory of Open Access Journals (Sweden)
Kazuho Nishimura
2015-03-01
Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.
Acetylation Is Crucial for p53-Mediated Ferroptosis and Tumor Suppression
Directory of Open Access Journals (Sweden)
Shang-Jui Wang
2016-10-01
Full Text Available Although previous studies indicate that loss of p53-mediated cell cycle arrest, apoptosis, and senescence does not completely abrogate its tumor suppression function, it is unclear how the remaining activities of p53 are regulated. Here, we have identified an acetylation site at lysine K98 in mouse p53 (or K101 for human p53. Whereas the loss of K98 acetylation (p53K98R alone has very modest effects on p53-mediated transactivation, simultaneous mutations at all four acetylation sites (p534KR: K98R+ 3KR[K117R+K161R+K162R] completely abolish its ability to regulate metabolic targets, such as TIGAR and SLC7A11. Notably, in contrast to p533KR, p534KR is severely defective in suppressing tumor growth in mouse xenograft models. Moreover, p534KR is still capable of inducing the p53-Mdm2 feedback loop, but p53-dependent ferroptotic responses are markedly abrogated. Together, these data indicate the critical role of p53 acetylation in ferroptotic responses and its remaining tumor suppression activity.
p53-Mediated Molecular Control of Autophagy in Tumor Cells
Directory of Open Access Journals (Sweden)
Maria Mrakovcic
2018-03-01
Full Text Available Autophagy is an indispensable mechanism of the eukaryotic cell, facilitating the removal and renewal of cellular components and thereby balancing the cell’s energy consumption and homeostasis. Deregulation of autophagy is now regarded as one of the characteristic key features contributing to the development of tumors. In recent years, the suppression of autophagy in combination with chemotherapeutic treatment has been approached as a novel therapy in cancer treatment. However, depending on the type of cancer and context, interference with the autophagic machinery can either promote or disrupt tumorigenesis. Therefore, disclosure of the major signaling pathways that regulate autophagy and control tumorigenesis is crucial. To date, several tumor suppressor proteins and oncogenes have emerged as eminent regulators of autophagy whose depletion or mutation favor tumor formation. The mammalian cell “janitor” p53 belongs to one of these tumor suppressors that are most commonly mutated in human tumors. Experimental evidence over the last decade convincingly reports that p53 can act as either an activator or an inhibitor of autophagy depending on its subcellular localization and its mode of action. This finding gains particular significance as p53 deficiency or mutant variants of p53 that accumulate in the cytoplasm of tumor cells enable activation of autophagy. Accordingly, we recently identified p53 as a molecular hub that regulates autophagy and apoptosis in histone deacetylase inhibitor-treated uterine sarcoma cells. In light of this novel experimental evidence, in this review, we focus on p53 signaling as a mediator of the autophagic pathway in tumor cells.
miR-34 and p53: New Insights into a Complex Functional Relationship.
Directory of Open Access Journals (Sweden)
Francisco Navarro
Full Text Available miR-34, a tumor suppressor miRNA family transcriptionally activated by p53, is considered a critical mediator of p53 function. However, knockout of the mouse miR-34 family has little or no effect on the p53 response. The relative contribution of different miR-34 family members to p53 function or how much p53 relies on miR-34 in human cells is unclear. Here we show that miR-34a has a complex effect on the p53 response in human cells. In HCT116 cells miR-34a overexpression enhances p53 transcriptional activity, but the closely related family members, miR-34b and miR-34c, even when over-expressed, have little effect. Both TP53 itself and MDM4, a strong p53 transactivation inhibitor, are direct targets of miR-34a. The genes regulated by miR-34a also include four other post-translational inhibitors of p53. miR-34a overexpression leads to variable effects on p53 levels in p53-sufficient human cancer cell lines. In HCT116, miR-34a overexpression increases p53 protein levels and stability. About a quarter of all mRNAs that participate in the human p53 network bind to biotinylated miR-34a, suggesting that many are direct miR-34a targets. However, only about a fifth of the mRNAs that bind to miR-34a also bind to miR-34b or miR-34c. Two human cell lines knocked out for miR-34a have unimpaired p53-mediated responses to genotoxic stress, like mouse cells. The complex positive and negative effects of miR-34 on the p53 network suggest that rather than simply promoting the p53 response, miR-34a might act at a systems level to stabilize the robustness of the p53 response to genotoxic stress.
Taylor, Lisa M; James, Alexander; Schuller, Christine E; Brce, Jesena; Lock, Richard B; Mackenzie, Karen L
2004-10-15
Recent investigations, including our own, have shown that specific strains of fibroblasts expressing telomerase reverse transcriptase (hTERT) have an extended lifespan, but are not immortal. We previously demonstrated that hTERT-transduced MRC5 fetal lung fibroblasts (MRC5hTERTs) bypassed senescence but eventually succumbed to a second mortality barrier (crisis). In the present study, 67 MRC5hTERT clones were established by limiting dilution of a mass culture. Whereas 39/67 clones had an extended lifespan, all 39 extended lifespan clones underwent crisis. 11 of 39 clones escaped crisis and were immortalized. There was no apparent relationship between the fate of clones at crisis and the level of telomerase activity. Telomeres were hyperextended in the majority of the clones analyzed. There was no difference in telomere length of pre-crisis compared with post-crisis and immortal clones, indicating that hyperextended telomeres were conducive for immortalization and confirming that crisis was independent of telomere length. Immortalization of MRC5hTERT cells was associated with repression of the cyclin-dependent kinase inhibitor p16INK4a and up-regulation of pRB. However, the regulation of pRB phosphorylation and the response of the p53/p21cip1/waf1 pathway were normal in immortal cells subject to genotoxic stress. Overexpression of oncogenic ras failed to de-repress p16INK4a in immortal cells. Furthermore, expression of ras enforced senescent-like growth arrest in p16INK4a-positive, but not p16INK4a-negative MRC5hTERT cells. Immortal cells expressing ras formed small, infrequent colonies in soft agarose, but were non-tumorigenic. Overall, these results implicate the inactivation of p16INK4a as a critical event for overcoming telomere-independent crisis, immortalizing MRC5 fibroblasts and overcoming ras-induced premature senescence.
Carr, Michael I; Roderick, Justine E; Zhang, Hong; Woda, Bruce A; Kelliher, Michelle A; Jones, Stephen N
2016-12-27
The p53 tumor suppressor acts as a guardian of the genome by preventing the propagation of DNA damage-induced breaks and mutations to subsequent generations of cells. We have previously shown that phosphorylation of the Mdm2 oncoprotein at Ser394 by the ATM kinase is required for robust p53 stabilization and activation in cells treated with ionizing radiation, and that loss of Mdm2 Ser394 phosphorylation leads to spontaneous tumorigenesis and radioresistance in Mdm2 S394A mice. Previous in vitro data indicate that the c-Abl kinase phosphorylates Mdm2 at the neighboring residue (Tyr393) in response to DNA damage to regulate p53-dependent apoptosis. In this present study, we have generated an Mdm2 mutant mouse (Mdm2 Y393F ) to determine whether c-Abl phosphorylation of Mdm2 regulates the p53-mediated DNA damage response or p53 tumor suppression in vivo. The Mdm2 Y393F mice develop accelerated spontaneous and oncogene-induced tumors, yet display no defects in p53 stabilization and activity following acute genotoxic stress. Although apoptosis is unaltered in these mice, they recover more rapidly from radiation-induced bone marrow ablation and are more resistant to whole-body radiation-induced lethality. These data reveal an in vivo role for c-Abl phosphorylation of Mdm2 in regulation of p53 tumor suppression and bone marrow failure. However, c-Abl phosphorylation of Mdm2 Tyr393 appears to play a lesser role in governing Mdm2-p53 signaling than ATM phosphorylation of Mdm2 Ser394. Furthermore, the effects of these phosphorylation events on p53 regulation are not additive, as Mdm2 Y393F/S394A mice and Mdm2 S394A mice display similar phenotypes.
Sun, Pei; Wu, Haoyang; Huang, Jiali; Xu, Ying; Yang, Feng; Zhang, Qi; Xu, Xingang
2018-05-22
Porcine epidemic diarrhea virus (PEDV), an enteropathogenic Alphacoronavirus, has caused enormous economic losses in the swine industry. p53 protein exists in a wide variety of animal cells, which is involved in cell cycle regulation, apoptosis, cell differentiation and other biological functions. In this study, we investigated the effects of PEDV infection on the cell cycle of Vero cells and p53 activation. The results demonstrated that PEDV infection induces cell cycle arrest at G0/G1 phase in Vero cells, while UV-inactivated PEDV does not cause cell cycle arrest. PEDV infection up-regulates the levels of p21, cdc2, cdk2, cdk4, Cyclin A protein and down-regulates Cyclin E protein. Further research results showed that inhibition of p53 signaling pathway can reverse the cell cycle arrest in G0/G1 phase induced by PEDV infection and cancel out the up-regulation of p21 and corresponding Cyclin/cdk mentioned above. In addition, PEDV infection of the cells synchronized in various stages of cell cycle showed that viral subgenomic RNA and virus titer were higher in the cells released from G0/G1 phase synchronized cells than that in the cells released from the G1/S phase and G2/M phase synchronized or asynchronous cells after 18 h p.i.. This is the first report to demonstrate that the p53-dependent pathway plays an important role in PEDV induced cell cycle arrest and beneficially contributes to viral infection. Copyright © 2018 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Drane, P.; Alvarez, S.; Meiller, A.; May, E. [CEA Fontenay-aux-Roses, Dept. de Radiobiologie et de Radiopathologie, Lab. de Cancerogenese Moleculaire, CNRS, UMR 217, 92 (France)
2002-03-01
The tumor suppressor gene p53 encodes a protein whose major function is to protect organisms from proliferation of potentially tumorigenic cells. In normal conditions (unstressed cells), the p53 protein is inert and maintained at low level through its association with the Mdm2 oncogene, causing its translocation from the nucleus into the cytoplasm and its degradation through ubiquitin/proteasome pathway. In response to damaged DNA or to a variety of stresses, p53 accumulates in the nucleus and is activated as a transcriptional trans-activator. Posttranslational modifications of p53 including multi-site phosphorylation and acetylation are the major mechanism of p53 regulation. After exposure to ionising radiation, p53 activation implicates ATM, ATR, Chk2 and Chk1 kinases that phosphorylate the N-terminal domain on Ser15 (ATM and/or ATR), and Ser20 (Chk2 and/or Chk1), causing the dissociation of the p53/Mdm2 complex and thereby the stabilisation of p53. The process initiated by {gamma}-irradiation exposure involves also increased interaction of the p53 N-terminal domain with CBP/p300 and P/CAF leading to acetylation of the distant C-terminal domain at Lys 320, 373 and 382. In addition, the ATM-mediated dephosphorylation of Ser376 creates a fixation site for 14-3-3 protein. Taken together, phosphorylation, acetylation and association with co factors induce the stimulation of p53 transcriptional activity resulting in the expression of a set of genes involved, notably, in cell cycle arrest and apoptosis. This stress-induced p53 pathways lead to one of two outcomes: growth arrest or apoptosis and consequently protects the organism from the genotoxic effects of ionising radiation. (author)
International Nuclear Information System (INIS)
Ohnishi, T.; Asakawa, I.; Tamamoto, T.; Takahashi, A.; Ohnishi, K.
2003-01-01
The mutations of many kinds of cancer related genes have been investigated for the predictive assay against cancer therapy by the application of molecular biology. A tumor suppressor gene product of wtp53 plays important roles in cancer suppression through the induction of cell growth arrest, DNA repair or apoptosis. The p53 exerts its function by induction of downstream genes and/or interaction to various proteins. Mutations in the p53 gene (mp53) cause conformational alterations in the p53 protein, the majority of which can no longer induce expression of the downstream genes. The genetic status of p53 gene has been focused as the most important candidate among them for cancer therapy. The gene therapy of p53 has been already applied. We reported that the transfection of mp53 gene increased the radio-, thermo- and chemo-resistance, and depressed apoptosis introduced with them through bax-induction and proteolysis of PARP and caspase-3. From these results, we propose that the gene therapy of wtp53 to p53-deleted cancer cells may be very useful for cancer therapy by the combination with radiotherapy. Even in the case of mp53 cancer cells, we succeeded the restoration of mp53 to wtp53 by glycerol or C-terminal peptide of p53 as chemical chaperones. These experimental progresses might support effective cancer therapy against individual patients bearing with different p53 gene status by the use of the most suitable treatment to them in the near future
Millat, Thomas; Janssen, Holger; Bahl, Hubert; Fischer, Ralf-Jörg; Wolkenhauer, Olaf
2013-01-01
Summary In a continuous culture under phosphate limitation the metabolism of Clostridium acetobutylicum depends on the external pH level. By comparing seven steady-state conditions between pH 5.7 and pH 4.5 we show that the switch from acidogenesis to solventogenesis occurs between pH 5.3 and pH 5.0 with an intermediate state at pH 5.1. Here, an integrative study is presented investigating how a changing external pH level affects the clostridial acetone–butanol–ethanol (ABE) fermentation pathway. This is of particular interest as the biotechnological production of n-butanol as biofuel has recently returned into the focus of industrial applications. One prerequisite is the furthering of the knowledge of the factors determining the solvent production and their integrative regulations. We have mathematically analysed the influence of pH-dependent specific enzyme activities of branch points of the metabolism on the product formation. This kinetic regulation was compared with transcriptomic regulation regarding gene transcription and the proteomic profile. Furthermore, both regulatory mechanisms were combined yielding a detailed projection of their individual and joint effects on the product formation. The resulting model represents an important platform for future developments of industrial butanol production based on C. acetobutylicum. PMID:23332010
Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice; Kramer, Daniela; Najafova, Zeynab; Weiss, Miriam; Karpiuk, Oleksandra; Kassem, Moustapha; Zhang, Yanping; Lozano, Guillermina; Johnsen, Steven A; Moll, Ute M; Zhang, Xin; Dobbelstein, Matthias
2016-01-07
The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell proliferation. In conclusion, MDM2 supports the Polycomb-mediated repression of lineage-specific genes, independent of p53. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Anirban Chakraborty
Full Text Available Ribosome is responsible for protein synthesis in all organisms and ribosomal proteins (RPs play important roles in the formation of a functional ribosome. L11 was recently shown to regulate p53 activity through a direct binding with MDM2 and abrogating the MDM2-induced p53 degradation in response to ribosomal stress. However, the studies were performed in cell lines and the significance of this tumor suppressor function of L11 has yet to be explored in animal models. To investigate the effects of the deletion of L11 and its physiological relevance to p53 activity, we knocked down the rpl11 gene in zebrafish and analyzed the p53 response. Contrary to the cell line-based results, our data indicate that an L11 deficiency in a model organism activates the p53 pathway. The L11-deficient embryos (morphants displayed developmental abnormalities primarily in the brain, leading to embryonic lethality within 6-7 days post fertilization. Extensive apoptosis was observed in the head region of the morphants, thus correlating the morphological defects with apparent cell death. A decrease in total abundance of genes involved in neural patterning of the brain was observed in the morphants, suggesting a reduction in neural progenitor cells. Upregulation of the genes involved in the p53 pathway were observed in the morphants. Simultaneous knockdown of the p53 gene rescued the developmental defects and apoptosis in the morphants. These results suggest that ribosomal dysfunction due to the loss of L11 activates a p53-dependent checkpoint response to prevent improper embryonic development.
Involvement of hGLD-2 in cytoplasmic polyadenylation of human p53 mRNA
DEFF Research Database (Denmark)
Glahder, Jacob-Andreas Harald; Norrild, Bodil
2011-01-01
Cytoplasmic polyadenylation is a post-transcriptional mechanism regulating mRNA stability and translation. The human p53 3'-untranslated region (3'-UTR) contains two regions similar to cytoplasmic polyadenylation elements (CPEs) just upstream of the poly(A) hexanucleotide. Evaluation of the p53 CPE......-like elements was performed by luciferase reporter assays, qPCR, and poly(A) assays. Herein, we report the down regulation of a luciferase reporter fused to the p53 3'-UTR, when human CPE-binding protein 1 (hCPEB1) is overexpressed. This inhibition is partially rescued when hCPEB1fused to hGLD-2 [a human...... cytoplasmic poly(A) polymerase] is overexpressed instead. The stability of a luciferase mRNA containing the p53 3'-UTR downstream, is decreased when hCPEB1 is overexpressed as seen by qPCR. Expression of hGLD-2 restores the mRNA stability. This is due to elongation of the poly(A) tail as seen by a PCR...
Directory of Open Access Journals (Sweden)
Harish Chander
Full Text Available We previously reported that the degradation of prohibitin by the SCF(Skp2B ubiquitin ligase results in a defect in the activity of p53. We also reported that MMTV-Skp2B transgenic mice develop mammary gland tumors that are characterized by an increased proteolytic cleavage of the insulin-like growth factor binding protein 4 (IGFBP-4, an inhibitor of IGF signaling. However, whether a link exists between a defect in p53 activity and proteolysis of IGFBP-4 was not established.We analyzed the levels of pregnancy-associated plasma protein A (PAPP-A, the protease of IGFBP-4, in MMTV-Skp2B transgenic mice and found that PAPP-A levels are elevated. Further, we found a p53 binding site in intron 1 of the PAPP-A gene and that both wild type and mutant p53 bind to this site. However, binding of wild type p53 results in the transcriptional repression of PAPP-A, while binding of mutant p53 results in the transcriptional activation of PAPP-A. Since MMTV-Skp2B mice express wild type p53 and yet show elevated levels of PAPP-A, at first, these observations appeared contradictory. However, further analysis revealed that the defect in p53 activity in Skp2B overexpressing cells does not only abolish the activity of wild type of p53 but actually mimics that of mutant p53. Our results suggest that in absence of prohibitin, the half-life of p53 is increased and like mutant p53, the conformation of p53 is denatured.These observations revealed a novel function of prohibitin as a chaperone of p53. Further, they suggest that binding of denatured p53 in intron 1 causes an enhancer effect and increases the transcription of PAPP-A. Therefore, these findings indicate that the defect in p53 function and the increased proteolysis of IGFBP-4, we had observed, represent two components of the same pathway, which contributes to the oncogenic function of Skp2B.
Energy Technology Data Exchange (ETDEWEB)
Nakagawa, Yosuke [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Takahashi, Akihisa [Advanced Scientific Research Leader Development Unit, Gunma University, 3-39-22 Showa-machi, Maebashi, Gunma 371-8511 (Japan); Kajihara, Atsuhisa; Yamakawa, Nobuhiro; Imai, Yuichiro [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ota, Ichiro; Okamoto, Noritomo [Department of Otorhinolaryngology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Mori, Eiichiro [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Noda, Taichi [Department of Dermatology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Furusawa, Yoshiya [Heavy-ion Radiobiology Research Group, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Kirita, Tadaaki [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ohnishi, Takeo, E-mail: tohnishi@naramed-u.ac.jp [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan)
2012-07-13
Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggested that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling, even in mp
Rambhatla, Lakshmi; Ram-Mohan, Sumati; Cheng, Jennifer J; Sherley, James L
2005-04-15
Because they are long-lived and cycle continuously, adult stem cells (ASCs) are predicted as the most common precursor for cancers in adult mammalian tissues. Two unique attributes have been proposed to restrict the carcinogenic potential of ASCs. These are asymmetric self-renewal that limits their number and immortal DNA strand cosegregation that limits their accumulation of mutations due to DNA replication errors. Until recently, the molecular basis and regulation of these important ASC-specific functions were unknown. We developed engineered cultured cells that exhibit asymmetric self-renewal and immortal DNA strand cosegregation. These model cells were used to show that both ASC-specific functions are regulated by the p53 cancer gene. Previously, we proposed that IMP dehydrogenase (IMPDH) was an essential factor for p53-dependent asymmetric self-renewal. We now confirm this proposal and provide quantitative evidence that asymmetric self-renewal is acutely sensitive to even modest changes in IMPDH expression. These analyses reveal that immortal DNA strand cosegregation is also regulated by IMPDH and confirm the original implicit precept that immortal DNA strand cosegregation is specific to cells undergoing asymmetric self-renewal (i.e., ASCs). With IMPDH being the rate-determining enzyme for guanine ribonucleotide (rGNP) biosynthesis, its requirement implicates rGNPs as important regulators of ASC asymmetric self-renewal and immortal DNA strand cosegregation. An in silico analysis of global gene expression data from human cancer cell lines underscored the importance of p53-IMPDH-rGNP regulation for normal tissue cell kinetics, providing further support for the concept that ASCs are key targets for adult tissue carcinogenesis.
Synergistic cooperation of MDM2 and E2F1 contributes to TAp73 transcriptional activity
Energy Technology Data Exchange (ETDEWEB)
Kasim, Vivi, E-mail: vivikasim78@gmail.com [The Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Huang, Can; Zhang, Jing; Jia, Huizhen; Wang, Yunxia [The Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Yang, Li [The Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); The 111 Project Laboratory of Biomechanics and Tissue Repair, College of Bioengineering, Chongqing University, Chongqing 400044 (China); Miyagishi, Makoto [Molecular Composite Medicine Research Group, Biomedical Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba 305-8566 (Japan); Wu, Shourong, E-mail: shourongwu@hotmail.com [The Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing 400044 (China); The 111 Project Laboratory of Biomechanics and Tissue Repair, College of Bioengineering, Chongqing University, Chongqing 400044 (China)
2014-07-04
Highlights: • MDM2 is a novel positive regulator of TAp73 transcriptional activity. • MDM2 colocalizes together and physically interacts with E2F1. • Synergistic cooperation of MDM2 and E2F1 is crucial for TAp73 transcription. • MDM2 regulates TAp73 transcriptional activity in a p53-independent manner. - Abstract: TAp73, a structural homologue of p53, plays an important role in tumorigenesis. E2F1 had been reported as a transcriptional regulator of TAp73, however, the detailed mechanism remains to be elucidated. Here we reported that MDM2-silencing reduced the activities of the TAp73 promoters and the endogenous TAp73 expression level significantly; while MDM2 overexpression upregulated them. We further revealed that the regulation of TAp73 transcriptional activity occurs as a synergistic effect of MDM2 and E2F1, most probably through their physical interaction in the nuclei. Furthermore, we also suggested that MDM2 might be involved in DNA damage-induced TAp73 transcriptional activity. Finally, we elucidated that MDM2-silencing reduced the proliferation rate of colon carcinoma cells regardless of the p53 status. Our data show a synergistic effect of MDM2 and E2F1 on TAp73 transcriptional activity, suggesting a novel regulation pathway of TAp73.
Synergistic cooperation of MDM2 and E2F1 contributes to TAp73 transcriptional activity
International Nuclear Information System (INIS)
Kasim, Vivi; Huang, Can; Zhang, Jing; Jia, Huizhen; Wang, Yunxia; Yang, Li; Miyagishi, Makoto; Wu, Shourong
2014-01-01
Highlights: • MDM2 is a novel positive regulator of TAp73 transcriptional activity. • MDM2 colocalizes together and physically interacts with E2F1. • Synergistic cooperation of MDM2 and E2F1 is crucial for TAp73 transcription. • MDM2 regulates TAp73 transcriptional activity in a p53-independent manner. - Abstract: TAp73, a structural homologue of p53, plays an important role in tumorigenesis. E2F1 had been reported as a transcriptional regulator of TAp73, however, the detailed mechanism remains to be elucidated. Here we reported that MDM2-silencing reduced the activities of the TAp73 promoters and the endogenous TAp73 expression level significantly; while MDM2 overexpression upregulated them. We further revealed that the regulation of TAp73 transcriptional activity occurs as a synergistic effect of MDM2 and E2F1, most probably through their physical interaction in the nuclei. Furthermore, we also suggested that MDM2 might be involved in DNA damage-induced TAp73 transcriptional activity. Finally, we elucidated that MDM2-silencing reduced the proliferation rate of colon carcinoma cells regardless of the p53 status. Our data show a synergistic effect of MDM2 and E2F1 on TAp73 transcriptional activity, suggesting a novel regulation pathway of TAp73
Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji
2015-03-03
The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Abnormal mitosis triggers p53-dependent cell cycle arrest in human tetraploid cells.
Kuffer, Christian; Kuznetsova, Anastasia Yurievna; Storchová, Zuzana
2013-08-01
Erroneously arising tetraploid mammalian cells are chromosomally instable and may facilitate cell transformation. An increasing body of evidence shows that the propagation of mammalian tetraploid cells is limited by a p53-dependent arrest. The trigger of this arrest has not been identified so far. Here we show by live cell imaging of tetraploid cells generated by an induced cytokinesis failure that most tetraploids arrest and die in a p53-dependent manner after the first tetraploid mitosis. Furthermore, we found that the main trigger is a mitotic defect, in particular, chromosome missegregation during bipolar mitosis or spindle multipolarity. Both a transient multipolar spindle followed by efficient clustering in anaphase as well as a multipolar spindle followed by multipolar mitosis inhibited subsequent proliferation to a similar degree. We found that the tetraploid cells did not accumulate double-strand breaks that could cause the cell cycle arrest after tetraploid mitosis. In contrast, tetraploid cells showed increased levels of oxidative DNA damage coinciding with the p53 activation. To further elucidate the pathways involved in the proliferation control of tetraploid cells, we knocked down specific kinases that had been previously linked to the cell cycle arrest and p53 phosphorylation. Our results suggest that the checkpoint kinase ATM phosphorylates p53 in tetraploid cells after abnormal mitosis and thus contributes to proliferation control of human aberrantly arising tetraploids.
Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit; Das, Saumitra
2017-09-29
p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3'UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3'UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3'UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3'UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3'UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3'UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3'UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Energy Technology Data Exchange (ETDEWEB)
ANDERSON,C.W.APPELLA,E.
2002-07-01
The p53 tumor suppressor is a tetrameric transcription factor that is post-translational modified at {approx}18 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review the posttranslational modifications to p53 and the pathways that produce them in response to both genotoxic and non-genotoxic stresses.
International Nuclear Information System (INIS)
Sung, Ki Sa; Lee, Yun-Ah; Kim, Eui Tae; Lee, Seung-Rock; Ahn, Jin-Hyun; Choi, Cheol Yong
2011-01-01
Homeodomain-interacting protein kinase 2 (HIPK2) is a key regulator of various transcription factors including p53 and CtBP in the DNA damage signaling pathway. PML-nuclear body (NB) is required for HIPK2-mediated p53 phosphorylation at Ser46 and induction of apoptosis. Although PML-NB targeting of HIPK2 has been shown, much is not clear about the molecular mechanism of HIPK2 recruitment to PML-NBs. Here we show that HIPK2 colocalizes specifically with PML-I and PML-IV. Mutational analysis showed that HIPK2 recruitment to PML-IV-NBs is mediated by the SUMO-interaction motifs (SIMs) of both PML-IV and HIPK2. Wild-type HIPK2 associated with SUMO-conjugated PML-IV at a higher affinity than with un-conjugated PML-IV, while the association of a HIPK2 SIM mutant with SUMO-modified PML-IV was impaired. In colony formation assays, HIPK2 strongly suppressed cell proliferation, but HIPK2 SIM mutants did not. In addition, activation and phosphorylation of p53 at the Ser46 residue were impaired by HIPK2 SIM mutants. These results suggest that SIM-mediated HIPK2 targeting to PML-NBs is crucial for HIPK2-mediated p53 activation and induction of apoptosis.
Directory of Open Access Journals (Sweden)
Michele A. Wozniak
2013-08-01
Full Text Available Loss of function mutations in the nuclear inner membrane protein, emerin, cause X-linked Emery-Dreifuss muscular dystrophy (X-EDMD. X-EDMD is characterized by contractures of major tendons, skeletal muscle weakening and wasting, and cardiac conduction system defects. The transcription factor Lmo7 regulates muscle- and heart-relevant genes and is inhibited by binding to emerin, suggesting Lmo7 misregulation contributes to EDMD disease. Lmo7 associates with cell adhesions and shuttles between the plasma membrane and nucleus, but the regulation and biological consequences of this dual localization were unknown. We report endogenous Lmo7 also associates with focal adhesions in cells, and both co-localizes and co-immunoprecipitates with p130Cas, a key signaling component of focal adhesions. Lmo7 nuclear localization and transcriptional activity increased significantly in p130Cas-null MEFs, suggesting Lmo7 is negatively regulated by p130Cas-dependent association with focal adhesions. These results support EDMD models in which Lmo7 is a downstream mediator of integrin-dependent signaling that allows tendon cells and muscles to adapt to and withstand mechanical stress.
Nicastro, Raffaele; Tripodi, Farida; Gaggini, Marco; Castoldi, Andrea; Reghellin, Veronica; Nonnis, Simona; Tedeschi, Gabriella; Coccetti, Paola
2015-10-09
In eukaryotes, nutrient availability and metabolism are coordinated by sensing mechanisms and signaling pathways, which influence a broad set of cellular functions such as transcription and metabolic pathways to match environmental conditions. In yeast, PKA is activated in the presence of high glucose concentrations, favoring fast nutrient utilization, shutting down stress responses, and boosting growth. On the contrary, Snf1/AMPK is activated in the presence of low glucose or alternative carbon sources, thus promoting an energy saving program through transcriptional activation and phosphorylation of metabolic enzymes. The PKA and Snf1/AMPK pathways share common downstream targets. Moreover, PKA has been reported to negatively influence the activation of Snf1/AMPK. We report a new cross-talk mechanism with a Snf1-dependent regulation of the PKA pathway. We show that Snf1 and adenylate cyclase (Cyr1) interact in a nutrient-independent manner. Moreover, we identify Cyr1 as a Snf1 substrate and show that Snf1 activation state influences Cyr1 phosphorylation pattern, cAMP intracellular levels, and PKA-dependent transcription. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
S100A4 interacts with p53 in the nucleus and promotes p53 degradation.
Orre, L M; Panizza, E; Kaminskyy, V O; Vernet, E; Gräslund, T; Zhivotovsky, B; Lehtiö, J
2013-12-05
S100A4 is a small calcium-binding protein that is commonly overexpressed in a range of different tumor types, and it is widely accepted that S100A4 has an important role in the process of cancer metastasis. In vitro binding assays has shown that S100A4 interacts with the tumor suppressor protein p53, indicating that S100A4 may have additional roles in tumor development. In the present study, we show that endogenous S100A4 and p53 interact in complex samples, and that the interaction increases after inhibition of MDM2-dependent p53 degradation using Nutlin-3A. Further, using proximity ligation assay, we show that the interaction takes place in the cell nucleus. S100A4 knockdown experiments in two p53 wild-type cell lines, A549 and HeLa, resulted in stabilization of p53 protein, indicating that S100A4 is promoting p53 degradation. Finally, we demonstrate that S100A4 knockdown leads to p53-dependent cell cycle arrest and increased cisplatin-induced apoptosis. Thus, our data add a new layer to the oncogenic properties of S100A4 through its inhibition of p53-dependent processes.
Deben, Christophe; Wouters, An; de Beeck, Ken Op; van Den Bossche, Jolien; Jacobs, Julie; Zwaenepoel, Karen; Peeters, Marc; Van Meerbeeck, Jan; Lardon, Filip; Rolfo, Christian; Deschoolmeester, Vanessa; Pauwels, Patrick
2015-01-01
The p53/MDM2 interaction has been a well-studied target for new drug design leading to the development of the small molecule inhibitor Nutlin-3. Our objectives were to combine Nutlin-3 with cisplatin (CDDP), a well-known activator of the p53 pathway, in a series of non-small cell lung cancer cell lines in order to increase the cytotoxic response to CDDP. We report that sequential treatment (CDDP followed by Nutlin-3), but not simultaneous treatment, resulted in strong synergism. Combination treatment induced p53's transcriptional activity, resulting in increased mRNA and protein levels of MDM2, p21, PUMA and BAX. In addition we report the induction of a strong p53 dependent apoptotic response and induction of G2/M cell cycle arrest. The strongest synergistic effect was observed at low doses of both CDDP and Nutlin-3, which could result in fewer (off-target) side effects while maintaining a strong cytotoxic effect. Our results indicate a promising preclinical potential, emphasizing the importance of the applied treatment scheme and the presence of wild type p53 for the combination of CDDP and Nutlin-3. PMID:26125230
Ching, L Y; Yeung, Bonnie H Y; Wong, Chris K C
2012-06-01
Human stanniocalcin 1 (STC1) has recently been identified as a putative protein factor involved in cellular apoptosis. The use of histone deacetylase inhibitor (i.e. trichostatin A (TSA)) and doxorubicin (Dox) is one of the common treatment methods to induce apoptosis in human cancer cells. A study on TSA and Dox-mediated apoptosis may shed light on the regulation and function of STC1 in cancer treatment. In this study, TSA and Dox cotreatment in human nasopharyngeal carcinoma cells (CNE2) elicited synergistic effects on STC1 gene expression and cellular apoptosis. An activation of p53 (TP53) transcriptional activity in Dox- or Dox+TSA-treated cells was revealed by the increased expression levels of p53 mRNA/protein as well as p53-driven luciferase activities. To elucidate the possible involvement of p53 in STC1 gene transcription, a vector expressing wild-type or dominant negative (DN) p53 was transiently transfected into the cells. Both STC1 promoter luciferase constructs and chromatin immunoprecipitation assays did not support the direct role of p53 in STC1 gene transactivation. However, the synergistic effects of p53 on the induction of NF-κB phosphorylation and the recruitment of acetylated histone H3 in STC1 promoter were observed in TSA-cotreated cells. The overexpression of exogenous STC1 sensitized apoptosis in Dox-treated cells. Taken together, this study provides data to show the cross talk of NF-κB, p53, and histone protein in the regulation of STC1 expression and function.
Amino acid-dependent signaling via S6K1 and MYC is essential for regulation of rDNA transcription
Kang, Jian; Kusnadi, Eric P.; Ogden, Allison J.; Hicks, Rodney J.; Bammert, Lukas; Kutay, Ulrike; Hung, Sandy; Sanij, Elaine; Hannan, Ross D.; Hannan, Katherine M.; Pearson, Richard B.
2016-01-01
Dysregulation of RNA polymerase I (Pol I)-dependent ribosomal DNA (rDNA) transcription is a consistent feature of malignant transformation that can be targeted to treat cancer. Understanding how rDNA transcription is coupled to the availability of growth factors and nutrients will provide insight into how ribosome biogenesis is maintained in a tumour environment characterised by limiting nutrients. We demonstrate that modulation of rDNA transcription initiation, elongation and rRNA processing is an immediate, co-regulated response to altered amino acid abundance, dependent on both mTORC1 activation of S6K1 and MYC activity. Growth factors regulate rDNA transcription initiation while amino acids modulate growth factor-dependent rDNA transcription by primarily regulating S6K1-dependent rDNA transcription elongation and processing. Thus, we show for the first time amino acids regulate rRNA synthesis by a distinct, post-initiation mechanism, providing a novel model for integrated control of ribosome biogenesis that has implications for understanding how this process is dysregulated in cancer. PMID:27385002
Directory of Open Access Journals (Sweden)
Liang Y
2018-03-01
Full Text Available Yayun Liang,1 Benford Mafuvadze,1 Cynthia Besch-Williford,2 Salman M Hyder1 1Deparment of Biomedical Sciences and Dalton Cardiovascular Research Center, Columbia, MO, USA; 2IDEXX BioResearch, Columbia, MO, USA Background: Between 30 and 40% of human breast cancers express a defective tumor suppressor p53 gene. Wild-type p53 tumor suppressor protein promotes cell-cycle arrest and apoptosis and inhibits vascular endothelial growth factor–dependent angiogenesis, whereas mutant p53 protein (mtp53 lacks these functions, resulting in tumor cell survival and metastasis. Restoration of p53 function is therefore a promising drug-targeted strategy for combating mtp53-expressing breast cancer. Methods: In this study, we sought to determine whether administration of APR-246, a small-molecule drug that restores p53 function, in combination with 2aG4, an antibody that targets phosphatidylserine residues on tumor blood vessels and disrupts tumor vasculature, effectively inhibits advanced hormone-dependent breast cancer tumor growth. Results: APR-246 reduced cell viability in mtp53-expressing BT-474 and T47-D human breast cancer cells in vitro, and significantly induced apoptosis in a dose-dependent manner. However, APR-246 did not reduce cell viability in MCF-7 breast cancer cells, which express wild-type p53. We next examined APR-246’s anti-tumor effects in vivo using BT-474 and T47-D tumor xenografts established in female nude mice. Tumor-bearing mice were treated with APR-246 and/or 2aG4 and tumor volume followed over time. Tumor growth was more effectively suppressed by combination treatment than by either agent alone, and combination therapy completely eradicated some tumors. Immunohistochemistry analysis of tumor tissue sections demonstrated that combination therapy more effectively induced apoptosis and reduced cell proliferation in tumor xenografts than either agent alone. Importantly, combination therapy dramatically reduced the density of blood
Wang, Lin; Pang, Xiao-Cong; Yu, Zi-Ru; Yang, Sheng-Qian; Liu, Ai-Lin; Wang, Jin-Hua; Du, Guan-Hua
2017-06-01
The aim of this study is to investigate the synergism of low dose of actinomycin D (LDActD) to the cytotoxicity of cisplatin (CDDP) on KB cells. The role of P53 reactivation by LDActD in the synergism and its mechanism were further studied. Cell viability was determined by MTT assay. Apoptosis was determined by AnnexinV-FITC/PI staining. Mitochondrial membrane potential (MMP) was detected by JC-1 staining. Expression of proteins was detected by Western blotting (WB) and/or immunofluorescence (IF). Molecular docking of actinomycin D (ACTD) to Mouse double minute 2 homolog (MDM2) and Mouse double minute 2 homolog X (MDMX). MDMX was analyzed by Discovery Studio. The content of P53-MDM2 complex was detected by ELISA assay. The cytotoxicity of CDDP was increased by the combination of LDActD in kinds of cancer cells. Molecular docking showed strong interaction between ACTD and MDM2/MDMX. Meanwhile, LDActD significantly decreased P53-MDM2 complex. Significant increase of the apoptotic activity by the combination therapy in KB cells is P53 upregulated modulator of apoptosis (PUMA) dependent. In addition to the decrease in MMP, LDActD increased P53 regulated protein and decreased BCL-XL in KB cells. LDActD efficiently enhanced the cytotoxicity of CDDP in cancer cells and induced P53-PUMA-dependent and mitochondria-mediated apoptosis in KB cells. The reactivation of P53 was probably achieved by disturbing the interaction of P53 and MDM2/MDMX.
Distinct HIC1-SIRT1-p53 Loop Deregulation in Lung Squamous Carcinoma and Adenocarcinoma Patients
Directory of Open Access Journals (Sweden)
Ruo-Chia Tseng
2009-08-01
Full Text Available A HIC1-SIRT1-p53 circular loop in which hypermethylation in cancer 1 (HIC1 represses the transcription of SIRT1 that deacetylates and inactivates p53 thus leading to HIC1 inactivation has been identified in cell and animal models. However, the alteration and prognostic effects of HIC1-SIRT1-p53 circular loop have never been demonstrated in human cancer patients. We examine the HIC1-SIRT1-p53 alterations in 118 lung cancer patients to define their etiological roles in tumorigenesis. We found that patients with lung squamous cell carcinoma with low p53 acetylation and SIRT1 expression mostly showed low HIC1 expression, confirming deregulation of HIC1-SIRT1-p53 circular loop in the clinical model. Interestingly, the expression of deleted in breast cancer 1 (DBC1, which blocks the interaction between SIRT1 deacetylase and p53, led to acetylated p53 in patients with lung adenocarcinoma. However, epigenetic alteration of HIC1 promoter by posttranslational modifications of histones and promoter hypermethylation favoring the compacted chromatin production attenuated the transcriptional induction by acetylated p53. Importantly, lung cancer patients with altered HIC1-SIRT1-p53 circular regulation showed poor prognosis. Our data show the first valid clinical evidence of the deregulation of HIC1-SIRT1-p53 loop in lung tumorigenesis and prognosis. Distinct status of p53 acetylation/deacetylation and HIC1 alteration mechanism result from different SIRT1-DBC1 control and epigenetic alteration in lung squamous cell carcinoma and lung adenocarcinoma.
Rieber, Manuel; Strasberg-Rieber, Mary
2014-03-15
Most breast cancers express the estrogen receptor alpha (ERα(+)), harbor wt TP53, depend on estrogen/ERK signalling for proliferation, and respond to anti-estrogens. However, concomittant activation of the epidermal growth factor receptor (EGFR)/MEK pathway promotes resistance by decreasing estrogen dependence. Previously, we showed that retroviral transduction of mutant p53 R175H into wt TP53 ERα(+) MCF-7 cells induces epidermal growth factor (EGF)-independent proliferation, activation of the EGF receptor (p-EGFR) and some characteristics of epithelial-mesenchymal transition (EMT). To investigate whether p53 inactivation augments ERα(+) cell proliferation in response to restrictive estradiol, chemical MEK inhibition or metabolic inhibitors. Introduction of mutant p53 R175H lowered expression of p53-dependent PUMA and p21WAF1, decreased E-cadherin and cytokeratin 18 associated with EMT, but increased the % of proliferating ERα(+)/Ki67 cells, diminishing estrogen dependence. These cells also exhibited higher proliferation in the presence of MEK-inhibitor UO126, reciprocally correlating with preferential susceptibility to the pyruvate analog 3-bromopyruvate (3-BrPA) without a comparable response to 2-deoxyglucose. p53 siRNA silencing by electroporation in wt TP53 MCF-7 cells also decreased estrogen dependence and response to MEK inhibition, while also conferring susceptibility to 3-BrPA. (a) ERα(+) breast cancer cells dysfunctional for TP53 which proliferate irrespective of low estrogen and chemical MEK inhibition are likely to increase metabolic consumption becoming increasingly susceptible to 3-BrPA; (b) targeting the pyruvate pathway may improve response to endocrine therapy in ERα(+) breast cancer with p53 dysfunction. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
Qing, Xiaoyu; De Weerdt, Ami; De Maeyer, Marc; Steenackers, Hans; Voet, Arnout
2018-01-01
The response regulator PhoP, which is part of the PhoP/PhoQ two-component system, regulates the expression of multiple genes involved in controlling virulence in Salmonella enterica serovar Typhimurium and other species of Gram-negative bacteria. Modulating the phosphorylation-mediated dimerization in the receiver domain may interfere with the transcriptional function of PhoP. In this study, we analyzed the therapeutic potential of the PhoP receiver domain by exploring it as a potential target for drug design. The structural information was then applied to identify the first hit compounds from commercial chemical libraries by combining pharmacophore modelling and docking methods with a GFP (Green Fluorescent Protein)-based promoter-fusion bioassay. In total, one hundred and forty compounds were selected, purchased, and tested for biological activity. Several novel scaffolds showed acceptable potency to modulate the transcriptional function of PhoP, either by enhancing or inhibiting the expression of PhoP-dependent genes. These compounds may be used as the starting point for developing modulators that target the protein-protein interface of the PhoP protein as an alternative strategy against antibiotic resistance. Copyright © 2017 Elsevier Inc. All rights reserved.
Benatti, Paolo; Basile, Valentina; Dolfini, Diletta; Belluti, Silvia; Tomei, Margherita; Imbriano, Carol
2016-01-01
The expression of the high risk HPV18 E6 and E7 oncogenic proteins induces the transformation of epithelial cells, through the disruption of p53 and Rb function. The binding of cellular transcription factors to cis-regulatory elements in the viral Upstream Regulatory Region (URR) stimulates E6/E7 transcription. Here, we demonstrate that the CCAAT-transcription factor NF-Y binds to a non-canonical motif within the URR and activates viral gene expression. In addition, NF-Y indirectly up-regulat...
Directory of Open Access Journals (Sweden)
Jonathan Krell
Full Text Available The growth arrest-specific transcript 5 gene (GAS5 encodes a long noncoding RNA (lncRNA and hosts a number of small nucleolar RNAs (snoRNAs that have recently been implicated in multiple cellular processes and cancer. Here, we investigate the relationship between DNA damage, p53, and the GAS5 snoRNAs to gain further insight into the potential role of this locus in cell survival and oncogenesis both in vivo and in vitro.We used quantitative techniques to analyse the effect of DNA damage on GAS5 snoRNA expression and to assess the relationship between p53 and the GAS5 snoRNAs in cancer cell lines and in normal, pre-malignant, and malignant human colorectal tissue and used biological techniques to suggest potential roles for these snoRNAs in the DNA damage response.GAS5-derived snoRNA expression was induced by DNA damage in a p53-dependent manner in colorectal cancer cell lines and their levels were not affected by DICER. Furthermore, p53 levels strongly correlated with GAS5-derived snoRNA expression in colorectal tissue.In aggregate, these data suggest that the GAS5-derived snoRNAs are under control of p53 and that they have an important role in mediating the p53 response to DNA damage, which may not relate to their function in the ribosome. We suggest that these snoRNAs are not processed by DICER to form smaller snoRNA-derived RNAs with microRNA (miRNA-like functions, but their precise role requires further evaluation. Furthermore, since GAS5 host snoRNAs are often used as endogenous controls in qPCR quantifications we show that their use as housekeeping genes in DNA damage experiments can lead to inaccurate results.
Directory of Open Access Journals (Sweden)
Pathi Satya
2011-08-01
Full Text Available Abstract Background Betulinic acid (BA inhibits growth of several cancer cell lines and tumors and the effects of BA have been attributed to its mitochondriotoxicity and inhibition of multiple pro-oncogenic factors. Previous studies show that BA induces proteasome-dependent degradation of specificity protein (Sp transcription factors Sp1, Sp3 and Sp4 in prostate cancer cells and this study focused on the mechanism of action of BA in colon cancer cells. Methods The effects of BA on colon cancer cell proliferation and apoptosis and tumor growth in vivo were determined using standardized assays. The effects of BA on Sp proteins and Sp-regulated gene products were analyzed by western blots, and real time PCR was used to determine microRNA-27a (miR-27a and ZBTB10 mRNA expression. Results BA inhibited growth and induced apoptosis in RKO and SW480 colon cancer cells and inhibited tumor growth in athymic nude mice bearing RKO cells as xenograft. BA also decreased expression of Sp1, Sp3 and Sp4 transcription factors which are overexpressed in colon cancer cells and decreased levels of several Sp-regulated genes including survivin, vascular endothelial growth factor, p65 sub-unit of NFκB, epidermal growth factor receptor, cyclin D1, and pituitary tumor transforming gene-1. The mechanism of action of BA was dependent on cell context, since BA induced proteasome-dependent and proteasome-independent downregulation of Sp1, Sp3 and Sp4 in SW480 and RKO cells, respectively. In RKO cells, the mechanism of BA-induced repression of Sp1, Sp3 and Sp4 was due to induction of reactive oxygen species (ROS, ROS-mediated repression of microRNA-27a, and induction of the Sp repressor gene ZBTB10. Conclusions These results suggest that the anticancer activity of BA in colon cancer cells is due, in part, to downregulation of Sp1, Sp3 and Sp4 transcription factors; however, the mechanism of this response is cell context-dependent.
International Nuclear Information System (INIS)
Chintharlapalli, Sudhakar; Papineni, Sabitha; Lei, Ping; Pathi, Satya; Safe, Stephen
2011-01-01
Betulinic acid (BA) inhibits growth of several cancer cell lines and tumors and the effects of BA have been attributed to its mitochondriotoxicity and inhibition of multiple pro-oncogenic factors. Previous studies show that BA induces proteasome-dependent degradation of specificity protein (Sp) transcription factors Sp1, Sp3 and Sp4 in prostate cancer cells and this study focused on the mechanism of action of BA in colon cancer cells. The effects of BA on colon cancer cell proliferation and apoptosis and tumor growth in vivo were determined using standardized assays. The effects of BA on Sp proteins and Sp-regulated gene products were analyzed by western blots, and real time PCR was used to determine microRNA-27a (miR-27a) and ZBTB10 mRNA expression. BA inhibited growth and induced apoptosis in RKO and SW480 colon cancer cells and inhibited tumor growth in athymic nude mice bearing RKO cells as xenograft. BA also decreased expression of Sp1, Sp3 and Sp4 transcription factors which are overexpressed in colon cancer cells and decreased levels of several Sp-regulated genes including survivin, vascular endothelial growth factor, p65 sub-unit of NFκB, epidermal growth factor receptor, cyclin D1, and pituitary tumor transforming gene-1. The mechanism of action of BA was dependent on cell context, since BA induced proteasome-dependent and proteasome-independent downregulation of Sp1, Sp3 and Sp4 in SW480 and RKO cells, respectively. In RKO cells, the mechanism of BA-induced repression of Sp1, Sp3 and Sp4 was due to induction of reactive oxygen species (ROS), ROS-mediated repression of microRNA-27a, and induction of the Sp repressor gene ZBTB10. These results suggest that the anticancer activity of BA in colon cancer cells is due, in part, to downregulation of Sp1, Sp3 and Sp4 transcription factors; however, the mechanism of this response is cell context-dependent
Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit
2017-01-01
Abstract p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3′UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3′UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3′UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3′UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3′UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3′UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3′UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. PMID:28973454
Cereseto, A; Diella, F; Mulloy, J C; Cara, A; Michieli, P; Grassmann, R; Franchini, G; Klotman, M E
1996-09-01
Human T-cell lymphotropic/leukemia virus type I (HTLV-I) is associated with T-cell transformation both in vivo and in vitro. Although some of the mechanisms responsible for transformation remain unknown, increasing evidence supports a direct role of viral as well as dysregulated cellular proteins in transformation. We investigated the potential role of the tumor suppressor gene p53 and of the p53-regulated gene, p21waf1/cip1 (wild-type p53 activated fragment 1/cycling dependent kinases [cdks] interacting protein 1), in HTLV-I-infected T cells. We have found that the majority of HTLV-I-infected T cells have the wild-type p53 gene. However, its function in HTLV-I-transformed cells appears to be impaired, as shown by the lack of appropriate p53-mediated responses to ionizing radiation (IR). Interestingly, the expression of the p53 inducible gene, p21waf1/cip1, is elevated at the messenger ribonucleic acid and protein levels in all HTLV-I-infected T-cell lines examined as well as in Taxl-1, a human T-cell line stably expressing Tax. Additionally, Tax induces upregulation of a p21waf1/cip1 promoter-driven luciferase gene in p53 null cells, and increases p21waf1/cip1 expression in Jurkat T cells. These findings suggest that the Tax protein is at least partially responsible for the p53-independent expression of p21waf1/cip1 in HTLV-I-infected cells. Dysregulation of p53 and p21waf1/cip1 proteins regulating cell-cycle progression, may represent an important step in HTLV-I-induced T-cell transformation.
DREAM Controls the On/Off Switch of Specific Activity-Dependent Transcription Pathways
Mellström, Britt; Sahún, Ignasi; Ruiz-Nuño, Ana; Murtra, Patricia; Gomez-Villafuertes, Rosa; Savignac, Magali; Oliveros, Juan C.; Gonzalez, Paz; Kastanauskaite, Asta; Knafo, Shira; Zhuo, Min; Higuera-Matas, Alejandro; Errington, Michael L.; Maldonado, Rafael; DeFelipe, Javier; Jefferys, John G. R.; Bliss, Tim V. P.; Dierssen, Mara
2014-01-01
Changes in nuclear Ca2+ homeostasis activate specific gene expression programs and are central to the acquisition and storage of information in the brain. DREAM (downstream regulatory element antagonist modulator), also known as calsenilin/KChIP-3 (K+ channel interacting protein 3), is a Ca2+-binding protein that binds DNA and represses transcription in a Ca2+-dependent manner. To study the function of DREAM in the brain, we used transgenic mice expressing a Ca2+-insensitive/CREB-independent dominant active mutant DREAM (daDREAM). Using genome-wide analysis, we show that DREAM regulates the expression of specific activity-dependent transcription factors in the hippocampus, including Npas4, Nr4a1, Mef2c, JunB, and c-Fos. Furthermore, DREAM regulates its own expression, establishing an autoinhibitory feedback loop to terminate activity-dependent transcription. Ablation of DREAM does not modify activity-dependent transcription because of gene compensation by the other KChIP family members. The expression of daDREAM in the forebrain resulted in a complex phenotype characterized by loss of recurrent inhibition and enhanced long-term potentiation (LTP) in the dentate gyrus and impaired learning and memory. Our results indicate that DREAM is a major master switch transcription factor that regulates the on/off status of specific activity-dependent gene expression programs that control synaptic plasticity, learning, and memory. PMID:24366545
Zhao, Carolyn Ying; Szekely, Laszlo; Bao, Wenjie; Selivanova, Galina
2010-04-15
Proteasomal degradation of p53 by human papilloma virus (HPV) E6 oncoprotein plays a pivotal role in the survival of cervical carcinoma cells. Abrogation of HPV-E6-dependent p53 destruction can therefore be a good strategy to combat cervical carcinomas. Here, we show that a small-molecule reactivation of p53 and induction of tumor cell apoptosis (RITA) is able to induce the accumulation of p53 and rescue its tumor suppressor function in cells containing high-risk HPV16 and HPV18 by inhibiting HPV-E6-mediated proteasomal degradation. RITA blocks p53 ubiquitination by preventing p53 interaction with E6-associated protein, required for HPV-E6-mediated degradation. RITA activates the transcription of proapoptotic p53 targets Noxa, PUMA, and BAX, and repressed the expression of pro-proliferative factors CyclinB1, CDC2, and CDC25C, resulting in p53-dependent apoptosis and cell cycle arrest. Importantly, RITA showed substantial suppression of cervical carcinoma xenografts in vivo. These results provide a proof of principle for the treatment of cervical cancer in a p53-dependent manner by using small molecules that target p53. (c)2010 AACR.
Autonomous feedback loop of RUNX1-p53-CBFB in acute myeloid leukemia cells.
Morita, Ken; Noura, Mina; Tokushige, Chieko; Maeda, Shintaro; Kiyose, Hiroki; Kashiwazaki, Gengo; Taniguchi, Junichi; Bando, Toshikazu; Yoshida, Kenichi; Ozaki, Toshifumi; Matsuo, Hidemasa; Ogawa, Seishi; Liu, Pu Paul; Nakahata, Tatsutoshi; Sugiyama, Hiroshi; Adachi, Souichi; Kamikubo, Yasuhiko
2017-11-30
Although runt-related transcription factor 1 (RUNX1) and its associating core binding factor-β (CBFB) play pivotal roles in leukemogenesis, and inhibition of RUNX1 has now been widely recognized as a novel strategy for anti-leukemic therapies, it has been elusive how leukemic cells could acquire the serious resistance against RUNX1-inhibition therapies and also whether CBFB could participate in this process. Here, we show evidence that p53 (TP53) and CBFB are sequentially up-regulated in response to RUNX1 depletion, and their mutual interaction causes the physiological resistance against chemotherapy for acute myeloid leukemia (AML) cells. Mechanistically, p53 induced by RUNX1 gene silencing directly binds to CBFB promoter and stimulates its transcription as well as its translation, which in turn acts as a platform for the stabilization of RUNX1, thereby creating a compensative RUNX1-p53-CBFB feedback loop. Indeed, AML cells derived from relapsed cases exhibited higher CBFB expression levels compared to those from primary AML cells at diagnosis, and these CBFB expressions were positively correlated to those of p53. Our present results underscore the importance of RUNX1-p53-CBFB regulatory loop in the development and/or maintenance of AML cells, which could be targeted at any sides of this triangle in strategizing anti-leukemia therapies.
Activation of SAT1 engages polyamine metabolism with p53-mediated ferroptotic responses.
Ou, Yang; Wang, Shang-Jui; Li, Dawei; Chu, Bo; Gu, Wei
2016-11-01
Although p53-mediated cell-cycle arrest, senescence, and apoptosis remain critical barriers to cancer development, the emerging role of p53 in cell metabolism, oxidative responses, and ferroptotic cell death has been a topic of great interest. Nevertheless, it is unclear how p53 orchestrates its activities in multiple metabolic pathways into tumor suppressive effects. Here, we identified the SAT1 (spermidine/spermine N 1 -acetyltransferase 1) gene as a transcription target of p53. SAT1 is a rate-limiting enzyme in polyamine catabolism critically involved in the conversion of spermidine and spermine back to putrescine. Surprisingly, we found that activation of SAT1 expression induces lipid peroxidation and sensitizes cells to undergo ferroptosis upon reactive oxygen species (ROS)-induced stress, which also leads to suppression of tumor growth in xenograft tumor models. Notably, SAT1 expression is down-regulated in human tumors, and CRISPR-cas9-mediated knockout of SAT1 expression partially abrogates p53-mediated ferroptosis. Moreover, SAT1 induction is correlated with the expression levels of arachidonate 15-lipoxygenase (ALOX15), and SAT1-induced ferroptosis is significantly abrogated in the presence of PD146176, a specific inhibitor of ALOX15. Thus, our findings uncover a metabolic target of p53 involved in ferroptotic cell death and provide insight into the regulation of polyamine metabolism and ferroptosis-mediated tumor suppression.
Cyclin-dependent kinases regulate apoptosis of intestinal epithelial cells
Bhattacharya, Sujoy; Ray, Ramesh M.; Johnson, Leonard R.
2014-01-01
Homeostasis of the gastrointestinal epithelium is dependent upon a balance between cell proliferation and apoptosis. Cyclin-dependent kinases (Cdks) are well known for their role in cell proliferation. Previous studies from our group have shown that polyamine-depletion of intestinal epithelial cells (IEC-6) decreases cyclin-dependent kinase 2 (Cdk2) activity, increases p53 and p21Cip1 protein levels, induces G1 arrest, and protects cells from camptothecin (CPT)-induced apoptosis. Although emerging evidence suggests that members of the Cdk family are involved in the regulation of apoptosis, their roles directing apoptosis of IEC-6 cells are not known. In this study, we report that inhibition of Cdk1, 2, and 9 (with the broad range Cdk inhibitor, AZD5438) in proliferating IEC-6 cells triggered DNA damage, activated p53 signaling, inhibited proliferation, and induced apoptosis. By contrast, inhibition of Cdk2 (with NU6140) increased p53 protein and activity, inhibited proliferation, but had no effect on apoptosis. Notably, AZD5438 sensitized, whereas, NU6140 rescued proliferating IEC-6 cells from CPT-induced apoptosis. However, in colon carcinoma (Caco2) cells with mutant p53, treatment with either AZD5438 or NU6140 blocked proliferation, albeit more robustly with AZD5438. Both Cdk inhibitors induced apoptosis in Caco2 cells in a p53-independent manner. In serum starved quiescent IEC-6 cells, both AZD5438 and NU6140 decreased TNF- /CPT-induced activation of p53 and, consequently, rescued cells from apoptosis, indicating that sustained Cdk activity is required for apoptosis of quiescent cells. Furthermore, AZD5438 partially reversed the protective effect of polyamine depletion whereas NU6140 had no effect. Together, these results demonstrate that Cdks possess opposing roles in the control of apoptosis in quiescent and proliferating cells. In addition, Cdk inhibitors uncouple proliferation from apoptosis in a p53-dependent manner. PMID:24242917
MicroRNA-dependent regulation of transcription in non-small cell lung cancer.
Directory of Open Access Journals (Sweden)
Sonia Molina-Pinelo
Full Text Available Squamous cell lung cancer (SCC and adenocarcinoma are the most common histological subtypes of non-small cell lung cancer (NSCLC, and have been traditionally managed in the clinic as a single entity. Increasing evidence, however, illustrates the biological diversity of these two histological subgroups of lung cancer, and supports the need to improve our understanding of the molecular basis beyond the different phenotypes if we aim to develop more specific and individualized targeted therapy. The purpose of this study was to identify microRNA (miRNA-dependent transcriptional regulation differences between SCC and adenocarcinoma histological lung cancer subtypes. In this work, paired miRNA (667 miRNAs by TaqMan Low Density Arrays (TLDA and mRNA profiling (Whole Genome 44 K array G112A, Agilent was performed in tumor samples of 44 NSCLC patients. Nine miRNAs and 56 mRNAs were found to be differentially expressed in SCC versus adenocarcinoma samples. Eleven of these 56 mRNA were predicted as targets of the miRNAs identified to be differently expressed in these two histological conditions. Of them, 6 miRNAs (miR-149, miR-205, miR-375, miR-378, miR-422a and miR-708 and 9 target genes (CEACAM6, CGN, CLDN3, ABCC3, MLPH, ACSL5, TMEM45B, MUC1 were validated by quantitative PCR in an independent cohort of 41 lung cancer patients. Furthermore, the inverse correlation between mRNAs and microRNAs expression was also validated. These results suggest miRNA-dependent transcriptional regulation differences play an important role in determining key hallmarks of NSCLC, and may provide new biomarkers for personalized treatment strategies.
Oliveira, Tatiane R; Longhi, Mariana T; Gonçales, Amane P; de Morais, Zenaide M; Vasconcellos, Silvio A; Nascimento, Ana L T O
2010-03-01
The regulation of gene expression by environmental signals, such as temperature and osmolarity, has been correlated with virulence. In this study, we characterize the protein LipL53 from Leptospira interrogans, previously shown to react with serum sample of individual diagnosed with leptospirosis and to be up-regulated by shift to physiological osmolarity. The recombinant protein was expressed in Escherichia coli system, in insoluble form, recovered by urea solubilization and further refolded by decreasing the denaturing agent concentration during the purification procedure. The secondary structure content of the recombinant LipL53, as assessed by circular dichroism, showed a mixture of beta-strands and alpha-helix. The presence of LipL53 transcript at 28 degrees C was only detected within the virulent strains. However, upon shifted of attenuated cultures of pathogenic strains from 28 degrees C to 37 degrees C and to 39 degrees C, this transcript could also be observed. LipL53 binds laminin, collagen IV, cellular and plasma fibronectin in dose-dependent and saturable manner. Animal challenge studies showed that LipL53, although immunogenic, elicited only partial protection in hamsters. LipL53 is probably surface exposed as seen through immunofluorescence confocal microscopy. Our results suggest that LipL53 is a novel temperature regulated adhesin of L. interrogans that may be relevant in the leptospiral pathogenesis. Copyright 2009 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Momoko Ishimine
2018-01-01
Full Text Available Irinotecan (CPT-11 is an anticancer prodrug that is activated by the carboxylesterase CES2 and has been approved for the treatment of many types of solid tumors, including colorectal cancer. Recent studies with cell lines show that CES2 expression is regulated by the tumor suppressor protein p53. However, clinical evidence for this regulatory mechanism in cancer is lacking. In this study, we examined the relationship between TP53 gene status and CES2 expression in human colorectal cancer. Most colorectal cancer specimens (70%; 26 of 37 showed lower CES2 mRNA levels (≥1.5-fold lower than the adjacent normal tissue, and only 30% (12 of 37 showed similar (<1.5-fold lower or higher CES2 mRNA levels. However, TP53 gene sequencing revealed no relationship between CES2 downregulation and TP53 mutational status. Moreover, while colorectal cancer cells expressing wild-type p53 exhibited p53-dependent upregulation of CES2, PRIMA-1MET, a drug that restores the transcriptional activity of mutant p53, failed to upregulate CES2 expression in cells with TP53 missense mutations. These results, taken together, suggest that CES2 mRNA expression is decreased in human colorectal cancer independently of p53.
Directory of Open Access Journals (Sweden)
Xiaoli Li
2018-02-01
Full Text Available Summary: Overactive p53 has been proposed as an important pathophysiological factor for bone marrow failure syndromes, including Fanconi anemia (FA. Here, we report a p53-dependent effect on hematopoietic stem and progenitor cell (HSPC proliferation in mice deficient for the FA gene Fanca. Deletion of p53 in Fanca−/− mice leads to replicative exhaustion of the hematopoietic stem cell (HSC in transplant recipients. Using Fanca−/− HSCs expressing the separation-of-function mutant p53515C transgene, which selectively impairs the p53 function in apoptosis but keeps its cell-cycle checkpoint activities intact, we show that the p53 cell-cycle function is specifically required for the regulation of Fanca−/− HSC proliferation. Our results demonstrate that p53 plays a compensatory role in preventing FA HSCs from replicative exhaustion and suggest a cautious approach to manipulating p53 signaling as a therapeutic utility in FA. : In this article, Pang and colleagues demonstrate a p53-dependent HSPC proliferation regulation in mice deficient for the Fanca gene in the Fanconi anemia (FA pathway. They show that the p53 cell-cycle function is specifically required for the regulation of FA HSC proliferation. These results suggest that overactive p53 may represent a compensatory checkpoint mechanism for FA HSC proliferation. Keywords: p53, bone marrow failure, Fanconi anemia, hematopoietic stem and progenitor cells, apoptosis, cell cycle, proliferation
p53-Dependent radiation-induced apoptosis in vivo: relationship to Bcl-2 and Bax expression
International Nuclear Information System (INIS)
Hasegawa, Masatoshi; Suzuki, Yoshiyuki; Furuta, Masaya; Yamakawa, Michitaka; Maebayashi, Katsuya; Hayakawa, Kayoko; Saito, Yoshihiro; Mitsuhashi, Norio; Niibe, Hideo
1997-01-01
Purpose: A close correlation between p53 protein expression and radiation-induced apoptosis has already been reported, however, Bcl-2 and Bax expression and the ratio of Bcl-2 to Bax have been also suggested to play an important role in the regulation of apoptotic cell death. In this study, we investigated the relationship between p53-dependent radiation-induced apoptosis and expression of Bcl-2 and Bax by using human tumors transplanted into nude mice. Materials and Methods: Three human tumors (an ependymoblastoma, a glioblastoma, and a small cell lung cancer) were subcutaneously transplanted into nude mice and irradiated with single doses of 1, 2, 5, or 10 Gy. The tumors were excised 1, 3, 6, 12, 24, and 48 hours after irradiation, fixed in 10% formalin for 24 hours, and embedded in paraffin. Slides were stained with hematoxylin and eosin for morphologic examination. Immunohistochemical studies were performed with mouse monoclonal antibodies to demonstrate p53, p21 (WAF-1), Bcl-2, and Bax expression. TdT-mediated dUTP-biotin nick-end labeling (TUNEL) and electron microscopic studies were performed to identify apoptosis, and PCR-SSCP analysis was used to evaluate p53 gene mutation. Results: All of the tumors showed only a few cells undergoing apoptosis before irradiation. Beginning several hours after irradiation, only the ependymoblastoma showed a large increase in the number of cells undergoing apoptosis, peaking at 6 hours after irradiation, and there was a clear dose-effect relationship. In contrast, the other tumors showed much less change following irradiation, and the dose-effect relationship was not as clear as in the ependymoblastoma. Immunohistochemically, the non-irradiated ependymoblastoma was negative for p53, p21, Bcl-2, and Bax. Following irradiation, however, many of the tumor cells became positive for p53 and p21, and a few cells became positive for bcl-2. In contrast, the glioblastoma and the small cell lung cancer were positive for p53 and Bcl-2
Ogino, S; Kawasaki, T; Kirkner, G J; Ogawa, A; Dorfman, I; Loda, M; Fuchs, C S
2006-10-01
p21 (CDKN1A/CIP1/WAF1), one of the cyclin-dependent kinase inhibitors, plays a key role in regulating the cell cycle and is transcriptionally regulated by p53. Down-regulation of p21 is caused by TP53 mutations in colorectal cancer. CpG island methylator phenotype (CIMP) appears to be a distinct subtype of colorectal cancer with concordant methylation of multiple gene promoters and is associated with a high degree of microsatellite instability (MSI-H) and BRAF mutations. However, no study to date has evaluated the relationship between p21 expression and CIMP in colorectal cancer. The purpose of this study was to examine the inter-relationships between p21, p53, CIMP, MSI and KRAS/BRAF status in colorectal cancer. We utilized 737 relatively unbiased samples of colorectal cancers from two large prospective cohort studies. Using quantitative real-time PCR (MethyLight), we measured DNA methylation in five CIMP-specific gene promoters [CACNA1G, CDKN2A (p16/INK4A), CRABP1, MLH1 and NEUROG1]. CIMP-high (>or=4/5 methylated promoters) was diagnosed in 118 (16%) of the 737 tumours. We also assessed expression of p21 and p53 by immunohistochemistry. Among the 737 tumours, 371 (50%) showed p21 loss. Both p21 loss and p53 positivity were inversely associated with CIMP-high, MSI-H and BRAF mutations. The associations of p21 with these molecular features were still present after tumours were stratified by p53 status. In contrast, the associations of p53 positivity with the molecular features were no longer present after tumours were stratified by p21 status. When CIMP-high and non-CIMP-high tumours were stratified by MSI or KRAS/BRAF status, CIMP-high and MSI-H (but not BRAF mutations) were still inversely associated with p21 loss. In conclusion, down-regulation of p21 is inversely correlated with CIMP-high and MSI-H in colorectal cancer, independent of TP53 and BRAF status.
Directory of Open Access Journals (Sweden)
2006-01-01
Full Text Available Herpesvirus-associated ubiquitin-specific protease (HAUSP, also known as USP7, a deubiquitylating enzyme of the ubiquitin-specific processing protease family, specifically deubiquitylates both p53 and MDM2, hence playing an important yet enigmatic role in the p53-MDM2 pathway. Here we demonstrate that both p53 and MDM2 specifically recognize the N-terminal tumor necrosis factor-receptor associated factor (TRAF-like domain of HAUSP in a mutually exclusive manner. HAUSP preferentially forms a stable HAUSP-MDM2 complex even in the presence of excess p53. The HAUSP-binding elements were mapped to a peptide fragment in the carboxy-terminus of p53 and to a short-peptide region preceding the acidic domain of MDM2. The crystal structures of the HAUSP TRAF-like domain in complex with p53 and MDM2 peptides, determined at 2.3-A and 1.7-A resolutions, respectively, reveal that the MDM2 peptide recognizes the same surface groove in HAUSP as that recognized by p53 but mediates more extensive interactions. Structural comparison led to the identification of a consensus peptide-recognition sequence by HAUSP. These results, together with the structure of a combined substrate-binding-and-deubiquitylation domain of HAUSP, provide important insights into regulation of the p53-MDM2 pathway by HAUSP.
Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.
Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine
2009-06-17
P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.
Borodkina, Aleksandra V; Shatrova, Alla N; Deryabin, Pavel I; Grukova, Anastasiya A; Nikolsky, Nikolay N; Burova, Elena B
2016-01-01
Previously we demonstrated that endometrium-derived human mesenchymal stem cells (hMESCs) via activation of the ATM/p53/p21/Rb pathway enter the premature senescence in response to oxidative stress. Down regulation effects of the key components of this signaling pathway, particularly ATM and p53, on a fate of stressed hMESCs have not yet been investigated. In the present study by using the specific inhibitors Ku55933 and Pifithrin-α, we confirmed implication of both ATM and p53 in H(2)O(2)-induced senescence of hMESCs. ATM or p53 down regulation was shown to modulate differently the cellular fate of H(2)O(2)-treated hMESCs. ATM inhibition allowed H(2)O(2)-stimulated hMESCs to escape the permanent cell cycle arrest due to loss of the functional ATM/p53/p21/Rb pathway, and induced bypass of mitosis and re-entry into S phase, resulting in tetraploid cells. On the contrary, suppression of the p53 transcriptional activity caused a pronounced cell death of H(2)O(2)-treated hMESCs via autophagy induction. The obtained data clearly demonstrate that down regulation of ATM or p53 shifts senescence of human endometrial stem cells toward tetraploidization or autophagy.
Merrick, David; Chapin, Hannah; Baggs, Julie E.; Yu, Zhiheng; Somlo, Stefan; Sun, Zhaoxia; Hogenesch, John B.; Caplan, Michael
2011-01-01
Summary Mutations in Pkd1, encoding polycystin-1 (PC1), cause Autosomal Dominant Polycystic Kidney Disease (ADPKD). We show that the carboxy-terminal tail (CTT) of PC1 is released by γ-secretase-mediated cleavage and regulates the Wnt and CHOP pathways by binding the transcription factors TCF and CHOP, disrupting their interaction with the common transcriptional co-activator p300. Loss of PC1 causes increased proliferation and apoptosis, while reintroducing PC1-CTT into cultured Pkd1 null cells reestablishes normal growth rate, suppresses apoptosis, and prevents cyst formation. Inhibition of γ-secretase activity impairs the ability of PC1 to suppress growth and apoptosis, and leads to cyst formation in cultured renal epithelial cells. Expression of the PC1-CTT is sufficient to rescue the dorsal body curvature phenotype in zebrafish embryos resulting from either γ-secretase inhibition or suppression of Pkd1 expression. Thus, γ-secretase-dependent release of the PC1-CTT creates a protein fragment whose expression is sufficient to suppress ADPKD-related phenotypes in vitro and in vivo. PMID:22178500
Mediator MED23 regulates basal transcription in vivo via an interaction with P-TEFb.
Wang, Wei; Yao, Xiao; Huang, Yan; Hu, Xiangming; Liu, Runzhong; Hou, Dongming; Chen, Ruichuan; Wang, Gang
2013-01-01
The Mediator is a multi-subunit complex that transduces regulatory information from transcription regulators to the RNA polymerase II apparatus. Growing evidence suggests that Mediator plays roles in multiple stages of eukaryotic transcription, including elongation. However, the detailed mechanism by which Mediator regulates elongation remains elusive. In this study, we demonstrate that Mediator MED23 subunit controls a basal level of transcription by recruiting elongation factor P-TEFb, via an interaction with its CDK9 subunit. The mRNA level of Egr1, a MED23-controlled model gene, is reduced 4-5 fold in Med23 (-/-) ES cells under an unstimulated condition, but Med23-deficiency does not alter the occupancies of RNAP II, GTFs, Mediator complex, or activator ELK1 at the Egr1 promoter. Instead, Med23 depletion results in a significant decrease in P-TEFb and RNAP II (Ser2P) binding at the coding region, but no changes for several other elongation regulators, such as DSIF and NELF. ChIP-seq revealed that Med23-deficiency partially reduced the P-TEFb occupancy at a set of MED23-regulated gene promoters. Further, we demonstrate that MED23 interacts with CDK9 in vivo and in vitro. Collectively, these results provide the mechanistic insight into how Mediator promotes RNAP II into transcription elongation.
Directory of Open Access Journals (Sweden)
Sabine Herold
Full Text Available Multiple Sclerosis (MS is a chronic autoimmune inflammatory disease of the central nervous system (CNS. Histopathological and radiological analysis revealed that neurodegeneration occurs early in the disease course. However, the pathological mechanisms involved in neurodegeneration are poorly understood. Myelin oligodendrocyte glycoprotein (MOG-induced experimental autoimmune encephalomyelitis (EAE in Brown Norway rats (BN-rats is a well-established animal model, especially of the neurodegenerative aspects of MS. Previous studies in this animal model indicated that loss of retinal ganglion cells (RGCs, the neurons that form the axons of the optic nerve, occurs in the preclinical phase of the disease and is in part independent of overt histopathological changes of the optic nerve. Therefore, the aim of this study was to identify genes which are involved in neuronal cell loss at different disease stages of EAE. Furthermore, genes that are highly specific for autoimmune-driven neurodegeneration were compared to those regulated in RGCs after optic nerve axotomy at corresponding time points. Using laser capture micro dissection we isolated RNA from unfixed RGCs and performed global transcriptome analysis of retinal neurons. In total, we detected 582 genes sequentially expressed in the preclinical phase and 1150 genes in the clinical manifest EAE (P 1.5. Furthermore, using ingenuity pathway analysis (IPA, we identified amyloid precursor protein (APP as a potential upstream regulator of changes in gene expression in the preclinical EAE but neither in clinical EAE, nor at any time point after optic nerve transection. Therefore, the gene pathway analysis lead to the hypothesis that altered cleavage of APP in neurons in the preclinical phase of EAE leads to the enhanced production of APP intracellular domain (AICD, which in turn acts as a transcriptional regulator and thereby initiates an apoptotic signaling cascade via up-regulation of the target gene p
Divergent evolution of human p53 binding sites: cell cycle versus apoptosis.
Directory of Open Access Journals (Sweden)
Monica M Horvath
2007-07-01
Full Text Available The p53 tumor suppressor is a sequence-specific pleiotropic transcription factor that coordinates cellular responses to DNA damage and stress, initiating cell-cycle arrest or triggering apoptosis. Although the human p53 binding site sequence (or response element [RE] is well characterized, some genes have consensus-poor REs that are nevertheless both necessary and sufficient for transactivation by p53. Identification of new functional gene regulatory elements under these conditions is problematic, and evolutionary conservation is often employed. We evaluated the comparative genomics approach for assessing evolutionary conservation of putative binding sites by examining conservation of 83 experimentally validated human p53 REs against mouse, rat, rabbit, and dog genomes and detected pronounced conservation differences among p53 REs and p53-regulated pathways. Bona fide NRF2 (nuclear factor [erythroid-derived 2]-like 2 nuclear factor and NFkappaB (nuclear factor of kappa light chain gene enhancer in B cells binding sites, which direct oxidative stress and innate immunity responses, were used as controls, and both exhibited high interspecific conservation. Surprisingly, the average p53 RE was not significantly more conserved than background genomic sequence, and p53 REs in apoptosis genes as a group showed very little conservation. The common bioinformatics practice of filtering RE predictions by 80% rodent sequence identity would not only give a false positive rate of approximately 19%, but miss up to 57% of true p53 REs. Examination of interspecific DNA base substitutions as a function of position in the p53 consensus sequence reveals an unexpected excess of diversity in apoptosis-regulating REs versus cell-cycle controlling REs (rodent comparisons: p < 1.0 e-12. While some p53 REs show relatively high levels of conservation, REs in many genes such as BAX, FAS, PCNA, CASP6, SIVA1, and P53AIP1 show little if any homology to rodent sequences. This
Contribution to the investigation of the p53 in vivo and in vitro trans-activation activity
International Nuclear Information System (INIS)
Meiller, A.
2004-03-01
Among the body's defence mechanisms, the programmed cellular death or apoptosis is an important safeguard way which allows the body to get rid of the injured cells before they acquire steady genetic modifications leading to an anarchistic multiplication. As p53 tumor suppressor gene plays a predominant role within this process, this research report first presents the p53 protein, its structure, its activities as a transcription factor, its modifications and the implications on its functional activities, its biological activities, and describes the p53 intracellular rate regulation and the use of this protein in radiology, particularly in 'in vivo' investigations on irradiated mice. It also presents the p53 family. Then, the author reports experimental investigations on possible other genes which could be trans-activated by p53. A gene is identified as a new target gene. She also demonstrates a new p53 activation path induced by another member of the p53 family, the p73 alpha protein
Impact of the p53 status of tumor cells on extrinsic and intrinsic apoptosis signaling.
Wachter, Franziska; Grunert, Michaela; Blaj, Cristina; Weinstock, David M; Jeremias, Irmela; Ehrhardt, Harald
2013-04-17
The p53 protein is the best studied target in human cancer. For decades, p53 has been believed to act mainly as a tumor suppressor and by transcriptional regulation. Only recently, the complex and diverse function of p53 has attracted more attention. Using several molecular approaches, we studied the impact of different p53 variants on extrinsic and intrinsic apoptosis signaling. We reproduced the previously published results within intrinsic apoptosis induction: while wild-type p53 promoted cell death, different p53 mutations reduced apoptosis sensitivity. The prediction of the impact of the p53 status on the extrinsic cell death induction was much more complex. The presence of p53 in tumor cell lines and primary xenograft tumor cells resulted in either augmented, unchanged or reduced cell death. The substitution of wild-type p53 by mutant p53 did not affect the extrinsic apoptosis inducing capacity. In summary, we have identified a non-expected impact of p53 on extrinsic cell death induction. We suggest that the impact of the p53 status of tumor cells on extrinsic apoptosis signaling should be studied in detail especially in the context of therapeutic approaches that aim to restore p53 function to facilitate cell death via the extrinsic apoptosis pathway.
Directory of Open Access Journals (Sweden)
Ye Cheng
Full Text Available AS1411 binds nucleolin (NCL and is the first oligodeoxynucleotide aptamer to reach phase I and II clinical trials for the treatment of several cancers. However, the mechanisms by which AS1411 targets and kills glioma cells and tissues remain unclear. Here we report that AS1411 induces cell apoptosis and cycle arrest, and inhibits cell viability by up-regulation of p53 and down-regulation of Bcl-2 and Akt1 in human glioma cells. NCL was overexpressed in both nucleus and cytoplasm in human glioma U87, U251 and SHG44 cells compared to normal human astrocytes (NHA. AS1411 bound NCL and inhibited the proliferation of glioma cells but not NHA, which was accompanied with up-regulation of p53 and down-regulation of Bcl-2 and Akt1. Moreover, AS1411 treatment resulted in the G2/M cell cycle arrest in glioma cells, which was however abolished by overexpression of NCL. Further, AS1411 induced cell apoptosis, which was prevented by silencing of p53 and overexpression of Bcl-2. In addition, AS1411 inhibited the migration and invasion of glioma cells in an Akt1-dependent manner. Importantly, AS1411 inhibited the growth of glioma xenograft and prolonged the survival time of glioma tumor-bearing mice. These results revealed a promising treatment of glioma by oligodeoxynucleotide aptamer.
Directory of Open Access Journals (Sweden)
Walker M Andrew
2010-07-01
Full Text Available Abstract Background Plant cytochrome P450 monooxygenases (CYP mediate synthesis and metabolism of many physiologically important primary and secondary compounds that are related to plant defense against a range of pathogenic microbes and insects. To determine if cytochrome P450 monooxygenases are involved in defense response to Xylella fastidiosa (Xf infection, we investigated expression and regulatory mechanisms of the cytochrome P450 monooxygenase CYP736B gene in both disease resistant and susceptible grapevines. Results Cloning of genomic DNA and cDNA revealed that the CYP736B gene was composed of two exons and one intron with GT as a donor site and AG as an acceptor site. CYP736B transcript was up-regulated in PD-resistant plants and down-regulated in PD-susceptible plants 6 weeks after Xf inoculation. However, CYP736B expression was very low in stem tissues at all evaluated time points. 5'RACE and 3'RACE sequence analyses revealed that there were three candidate transcription start sites (TSS in the upstream region and three candidate polyadenylation (PolyA sites in the downstream region of CYP736B. Usage frequencies of each transcription initiation site and each polyadenylation site varied depending on plant genotype, developmental stage, tissue, and treatment. These results demonstrate that expression of CYP736B is regulated developmentally and in response to Xf infection at both transcriptional and post-transcriptional levels. Multiple transcription start and polyadenylation sites contribute to regulation of CYP736B expression. Conclusions This report provides evidence that the cytochrome P450 monooxygenase CYP736B gene is involved in defense response at a specific stage of Xf infection in grapevines; multiple transcription initiation and polyadenylation sites exist for CYP736B in grapevine; and coordinative and selective use of transcription initiation and polyadenylation sites play an important role in regulation of CYP736B expression
Directory of Open Access Journals (Sweden)
Steven N Reuland
Full Text Available Metastatic melanoma has poor prognosis and is refractory to most conventional chemotherapies. The alkylating agent temozolomide (TMZ is commonly used in treating melanoma but has a disappointing response rate. Agents that can act cooperatively with TMZ and improve its efficacy are thus highly sought after. The BH3 mimetic ABT-737, which can induce apoptosis by targeting pro-survival Bcl-2 family members, has been found to enhance the efficacy of many conventional chemotherapeutic agents in multiple cancers. We found that combining TMZ and ABT-737 induced strong synergistic apoptosis in multiple human melanoma cell lines. When the drugs were used in combination in a mouse xenograft model, they drastically reduced tumor growth at concentrations where each individual drug had no significant effect. We found that TMZ treatment elevated p53 levels, and that the pro-apoptotic protein Noxa was elevated in TMZ/ABT-737 treated cells. Experiments with shRNA demonstrated that the synergistic effect of TMZ and ABT-737 was largely dependent on Noxa. Experiments with nutlin-3, a p53 inducer, demonstrated that p53 induction was sufficient for synergistic cell death with ABT-737 in a Noxa-dependent fashion. However, p53 was not necessary for TMZ/ABT-737 synergy as demonstrated by a p53-null line, indicating that TMZ and ABT-737 together induce Noxa in a p53-independent fashion. These results demonstrate that targeting anti-apoptotic Bcl-2 members is a promising method for treating metastatic melanoma, and that clinical trials with TMZ and Bcl-2 inhibitors are warranted.
Zeng, Ke-Wu; Liao, Li-Xi; Zhao, Ming-Bo; Song, Fang-Jiao; Yu, Qian; Jiang, Yong; Tu, Peng-Fei
2015-03-15
Protosappanin B (PTB) is a bioactive dibenzoxocin derivative isolated from Caesalpinia sappan L. Here, we investigated the neuroprotective effects and the potential mechanisms of PTB on oxygen-glucose deprivation (OGD)-injured PC12 cells. Results showed that PTB significantly increased cell viability, inhibited cell apoptosis and up-regulated the expression of growth-associated protein 43 (a marker of neural outgrowth). Moreover, our study revealed that PTB effectively maintained mitochondrial homeostasis by up-regulation of mitochondrial membrane potential (MMP), inhibition of cytochrome c release from mitochondria and inactivation of mitochondrial caspase-9/3 apoptosis pathway. Further study showed that PTB significantly promoted cytoplasmic component degradation of p53 protein, a key negative regulator for mitochondrial function, resulting in a release of Bcl-2 from p53-Bcl-2 complex and an enhancing translocation of Bcl-2 to mitochondrial outer membrane. Finally, we found the degradation of p53 protein was induced by PTB via activation of a MDM2-dependent ubiquitination process. Taken together, our findings provided a new viewpoint of neuronal protection strategy for anoxia and ischemic injury with natural small molecular dibenzoxocin derivative by activating ubiquitin-dependent p53 protein degradation as well as increasing mitochondrial function. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Alicja Sznarkowska
2010-08-01
Full Text Available A powerful tumor suppressor – p53 protein is a transcription factor which plays a critical role in eliciting cellular responses to a variety of stress signals, including DNA damage, hypoxia and aberrant proliferative signals, such as oncogene activation. Since its discovery thirty one years ago, p53 has been connected to tumorigenesis as it accumulates in the transformed tumor cells. Cellular stress induces stabilization of p53 and promotes, depending on the stress level, cell cycle arrest or apoptosis in the irreversibly damaged cells. The p53 protein is found inactive in more than 50�0of human tumors either by enhanced proteasomal degradation or due to the inactivating point mutations in its gene. Numerous data indicate that low molecular weight compounds, identified by molecular modeling or in the functional, cell-based assays, efficiently activate non-mutated p53 in cancer cells which in consequence leads to their elimination due to p53-dependent apoptosis. In this work we describe the structure and cellular function of p53 as well as the latest discoveries on the compounds with high anti-tumor activities aiming at reactivation of the tumor suppressor function of p53.
Gao, Li; Ji, Yue; Lu, Yan; Qiu, Ming; Shen, Yejiao; Wang, Yaqing; Kong, Xiangqing; Shao, Yongfeng; Sheng, Yanhui; Sun, Wei
2018-03-09
The most frequently used oral anti-coagulant warfarin has been implicated in inducing calcification of aortic valve interstitial cells (AVICs), whereas the mechanism is not fully understood. The low-level activation of p53 is found to be involved in osteogenic transdifferentiation and calcification of AVICs. Whether p53 participates in warfarin-induced AVIC calcification remains unknown. In this study, we investigated the role of low-level p53 overexpression in warfarin-induced porcine AVIC (pAVIC) calcification. Immunostaining, quantitative PCR, and Western blotting revealed that p53 was expressed in human and pAVICs and that p53 expression was slightly increased in calcific human aortic valves compared with non-calcific valves. Terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling staining indicated that apoptosis slightly increased in calcific aortic valves than in non-calcific valves. Warfarin treatment led to a low-level increase of p53 mRNA and protein in both pAVICs and mouse aortic valves. Low-level overexpression of p53 in pAVICs via an adenovirus vector did not affect pAVIC apoptosis but promoted warfarin-induced calcium deposition and expression of osteogenic markers. shRNA-mediated p53 knockdown attenuated the pAVIC calcium deposition and osteogenic marker expression. Moreover, ChIP and luciferase assays showed that p53 was recruited to the slug promoter and activated slug expression in calcific pAVICs. Of note, overexpression of Slug increased osteogenic marker Runx2 expression, but not pAVIC calcium deposition, and Slug knockdown attenuated pAVIC calcification and p53-mediated pAVIC calcium deposition and expression of osteogenic markers. In conclusion, we found that p53 plays an important role in warfarin induced pAVIC calcification, and increased slug transcription by p53 is required for p53-mediated pAVIC calcification. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Marialaura ePetroni
2012-10-01
Full Text Available The p53 oncosuppressor is very seldom mutated in neuroblastoma, but several mechanisms cooperate to its functional inactivation in this tumor. Increased MDM2 levels, due to genetic amplification or constitutive inhibition of p14ARF, significantly contribute to this event highlighting p53 reactivation as an attractive perspective for neuroblastoma treatment.In addition to its role in tumorigenesis, MYCN sensitizes untransformed and cancer cells to apoptosis. This is associated to a fine modulation of the MDM2-p53 pathway. Indeed MYCN induces p53 and MDM2 transcription, and, by evoking a DNA damage response (DDR, it stabilizes p53 and its proapoptotic kinase HIPK2. Through the regulation of the HIPK2-p53 inhibitor HMGA1 and the homeobox proteins BMI-1 and TWIST-1, MYCN establishes a delicate balance between pro- and anti-apoptotic molecules that might be easily perturbed by a variety of insults, leading to cell death. MDM2-p53 antagonists, such as Nutlin-3, are strikingly prone to inducing death in MYCN-amplified neuroblastoma, by further pushing on HIPK2 accumulation. Here we discuss implications and caveats of exploiting this pathway and its connections to MYCN-induced DDR for a tailored therapy of MYCN-amplified neuroblastoma.
Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage
Directory of Open Access Journals (Sweden)
Rolletschek Alexandra
2009-06-01
Full Text Available Abstract Background P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. Results In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. Conclusion In embryonic stem cells where (anti-proliferative p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.
Directory of Open Access Journals (Sweden)
Sutcliffe Margaret
2011-04-01
Full Text Available Abstract Background Humans and mice with loss of function mutations in GPR54 (KISS1R or kisspeptin do not progress through puberty, caused by a failure to release GnRH. The transcriptional networks regulated by these proteins in the hypothalamus have yet to be explored by genome-wide methods. Results We show here, using 1 million exon mouse arrays (Exon 1.0 Affymetrix and quantitative polymerase chain reaction (QPCR validation to analyse microdissected hypothalamic tissue from Gpr54 and Kiss1 knockout mice, the extent of transcriptional regulation in the hypothalamus. The sensitivity to detect important transcript differences in microdissected RNA was confirmed by the observation of counter-regulation of Kiss1 expression in Gpr54 knockouts and confirmed by immunohistochemistry (IHC. Since Gpr54 and Kiss1 knockout animals are effectively pre-pubertal with low testosterone (T levels, we also determined which of the validated transcripts were T-responsive and which varied according to genotype alone. We observed four types of transcriptional regulation (i genotype only dependent regulation, (ii T only dependent regulation, (iii genotype and T-dependent regulation with interaction between these variables, (iv genotype and T-dependent regulation with no interaction between these variables. The results implicate for the first time several transcription factors (e.g. Npas4, Esr2, proteases (Klk1b22, and the orphan 10-transmembrane transporter TMEM144 in the biology of GPR54/kisspeptin function in the hypothalamus. We show for the neuronal activity regulated transcription factor NPAS4, that distinct protein over-expression is seen in the hypothalamus and hippocampus in Gpr54 knockout mice. This links for the first time the hypothalamic-gonadal axis with this important regulator of inhibitory synapse formation. Similarly we confirm TMEM144 up-regulation in the hypothalamus by RNA in situ hybridization and western blot. Conclusions Taken together, global
Evidence for the interaction of the regulatory protein Ki-1/57 with p53 and its interacting proteins
International Nuclear Information System (INIS)
Nery, Flavia C.; Rui, Edmilson; Kuniyoshi, Tais M.; Kobarg, Joerg
2006-01-01
Ki-1/57 is a cytoplasmic and nuclear phospho-protein of 57 kDa and interacts with the adaptor protein RACK1, the transcription factor MEF2C, and the chromatin remodeling factor CHD3, suggesting that it might be involved in the regulation of transcription. Here, we describe yeast two-hybrid studies that identified a total of 11 proteins interacting with Ki-1/57, all of which interact or are functionally associated with p53 or other members of the p53 family of proteins. We further found that Ki-1/57 is able to interact with p53 itself in the yeast two-hybrid system when the interaction was tested directly. This interaction could be confirmed by pull down assays with purified proteins in vitro and by reciprocal co-immunoprecipitation assays from the human Hodgkin analogous lymphoma cell line L540. Furthermore, we found that the phosphorylation of p53 by PKC abolishes its interaction with Ki-1/57 in vitro
International Nuclear Information System (INIS)
Moss, Patrice E.; Lyles, Besstina E.; Stewart, LaMonica V.
2010-01-01
The androgen receptor (AR) regulates growth and progression of androgen-dependent as well as androgen-independent prostate cancer cells. Peroxisome proliferator-activated receptor gamma (PPARγ) agonists have been reported to reduce AR activation in androgen-dependent LNCaP prostate cancer cells. To determine whether PPARγ ligands are equally effective at inhibiting AR activity in androgen-independent prostate cancer, we examined the effect of the PPARγ ligands ciglitazone and rosiglitazone on C4-2 cells, an androgen- independent derivative of the LNCaP cell line. Luciferase-based reporter assays and Western blot analysis demonstrated that PPARγ ligand reduced dihydrotestosterone (DHT)-induced increases in AR activity in LNCaP cells. However, in C4-2 cells, these compounds increased DHT-induced AR driven luciferase activity. In addition, ciglitazone did not significantly alter DHT-mediated increases in prostate specific antigen (PSA) protein or mRNA levels within C4-2 cells. siRNA-based experiments demonstrated that the ciglitazone-induced regulation of AR activity observed in C4-2 cells was dependent on the presence of PPARγ. Furthermore, overexpression of the AR corepressor cyclin D1 inhibited the ability of ciglitazone to induce AR luciferase activity in C4-2 cells. Thus, our data suggest that both PPARγ and cyclin D1 levels influence the ability of ciglitazone to differentially regulate AR signaling in androgen-independent C4-2 prostate cancer cells.
Drosten, Matthias; Sum, Eleanor Y. M.; Lechuga, Carmen G.; Simón-Carrasco, Lucía; Jacob, Harrys K. C.; García-Medina, Raquel; Huang, Sidong; Beijersbergen, Roderick L.; Bernards, Rene; Barbacid, Mariano
2014-01-01
The Ras family of small GTPases constitutes a central node in the transmission of mitogenic stimuli to the cell cycle machinery. The ultimate receptor of these mitogenic signals is the retinoblastoma (Rb) family of pocket proteins, whose inactivation is a required step to license cell proliferation. However, little is known regarding the molecular events that connect Ras signaling with the cell cycle. Here, we provide genetic evidence to illustrate that the p53/p21 Cdk-interacting protein 1 (Cip1)/Rb axis is an essential component of the Ras signaling pathway. Indeed, knockdown of p53, p21Cip1, or Rb restores proliferative properties in cells arrested by ablation of the three Ras loci, H-, N- and K-Ras. Ras signaling selectively inactivates p53-mediated induction of p21Cip1 expression by inhibiting acetylation of specific lysine residues in the p53 DNA binding domain. Proliferation of cells lacking both Ras proteins and p53 can be prevented by reexpression of the human p53 ortholog, provided that it retains an active DNA binding domain and an intact lysine residue at position 164. These results unveil a previously unidentified role for p53 in preventing cell proliferation under unfavorable mitogenic conditions. Moreover, we provide evidence that cells lacking Ras and p53 proteins owe their proliferative properties to the unexpected retroactivation of the Raf/Mek/Erk cascade by a Ras-independent mechanism. PMID:25288756
Increased sensitivity of p53-deficient cells to anticancer agents due to loss of Pms2
Fedier, A; Ruefenacht, U B; Schwarz, V A; Haller, U; Fink, D
2002-01-01
A large fraction of human tumours carries mutations in the p53 gene. p53 plays a central role in controlling cell cycle checkpoint regulation, DNA repair, transcription, and apoptosis upon genotoxic stress. Lack of p53 function impairs these cellular processes, and this may be the basis of resistance to chemotherapeutic regimens. By virtue of the involvement of DNA mismatch repair in modulating cytotoxic pathways in response to DNA damaging agents, we investigated the effects of loss of Pms2 on the sensitivity to a panel of widely used anticancer agents in E1A/Ha-Ras-transformed p53-null mouse fibroblasts either proficient or deficient in Pms2. We report that lack of the Pms2 gene is associated with an increased sensitivity, ranging from 2–6-fold, to some types of anticancer agents including the topoisomerase II poisons doxorubicin, etoposide and mitoxantrone, the platinum compounds cisplatin and oxaliplatin, the taxanes docetaxel and paclitaxel, and the antimetabolite gemcitabine. In contrast, no change in sensitivity was found after treatment with 5-fluorouracil. Cell cycle analysis revealed that both, Pms2-deficient and -proficient cells, retain the ability to arrest at the G2/M upon cisplatin treatment. The data indicate that the concomitant loss of Pms2 function chemosensitises p53-deficient cells to some types of anticancer agents, that Pms2 positively modulates cell survival by mechanisms independent of p53, and that increased cytotoxicity is paralleled by increased apoptosis. Tumour-targeted functional inhibition of Pms2 may be a valuable strategy for increasing the efficacy of anticancer agents in the treatment of p53-mutant cancers. British Journal of Cancer (2002) 87, 1027–1033. doi:10.1038/sj.bjc.6600599 www.bjcancer.com © 2002 Cancer Research UK PMID:12434296
Liu, Chen; Sun, Bin; An, Ni; Tan, Weifeng; Cao, Lu; Luo, Xiangji; Yu, Yong; Feng, Feiling; Li, Bin; Wu, Mengchao; Su, Changqing; Jiang, Xiaoqing
2011-12-01
Gene therapy has become an important strategy for treatment of malignancies, but problems remains concerning the low gene transferring efficiency, poor transgene expression and limited targeting specific tumors, which have greatly hampered the clinical application of tumor gene therapy. Gallbladder cancer is characterized by rapid progress, poor prognosis, and aberrantly high expression of Survivin. In the present study, we used a human tumor-specific Survivin promoter-regulated oncolytic adenovirus vector carrying P53 gene, whose anti-cancer effect has been widely confirmed, to construct a wide spectrum, specific, safe, effective gene-viral therapy system, AdSurp-P53. Examining expression of enhanced green fluorecent protein (EGFP), E1A and the target gene P53 in the oncolytic adenovirus system validated that Survivin promoter-regulated oncolytic adenovirus had high proliferation activity and high P53 expression in Survivin-positive gallbladder cancer cells. Our in vitro cytotoxicity experiment demonstrated that AdSurp-P53 possessed a stronger cytotoxic effect against gallbladder cancer cells and hepatic cancer cells. The survival rate of EH-GB1 cells was lower than 40% after infection of AdSurp-P53 at multiplicity of infection (MOI) = 1 pfu/cell, while the rate was higher than 90% after infection of Ad-P53 at the same MOI, demonstrating that AdSurp-P53 has a potent cytotoxicity against EH-GB1 cells. The tumor growth was greatly inhibited in nude mice bearing EH-GB1 xenografts when the total dose of AdSurp-P53 was 1 × 10(9) pfu, and terminal dUTP nick end-labeling (TUNEL) revealed that the apoptotic rate of cancer cells was (33.4 ± 8.4)%. This oncolytic adenovirus system overcomes the long-standing shortcomings of gene therapy: poor transgene expression and targeting of only specific tumors, with its therapeutic effect better than the traditional Ad-P53 therapy regimen already on market; our system might be used for patients with advanced gallbladder cancer and
miR-339-5p regulates the p53 tumor-suppressor pathway by targeting MDM2
DEFF Research Database (Denmark)
Jansson, M D; Djodji Damas, Nkerorema; Lees, M
2014-01-01
MicroRNAs (miRNAs) regulate many key cancer-relevant pathways and may themselves possess oncogenic or tumor-suppressor functions. Consequently, miRNA dysregulation has been shown to be a prominent feature in many human cancers. The p53 tumor suppressor acts as a negative regulator of cell prolife...... tumor cells. Furthermore, we show that a negative correlation between miR-339-5p and MDM2 expression exists in human cancer, implying that the interaction is important for cancer development.Oncogene advance online publication, 2 June 2014; doi:10.1038/onc.2014.130....
TFIIS-Dependent Non-coding Transcription Regulates Developmental Genome Rearrangements.
Directory of Open Access Journals (Sweden)
Kamila Maliszewska-Olejniczak
2015-07-01
Full Text Available Because of their nuclear dimorphism, ciliates provide a unique opportunity to study the role of non-coding RNAs (ncRNAs in the communication between germline and somatic lineages. In these unicellular eukaryotes, a new somatic nucleus develops at each sexual cycle from a copy of the zygotic (germline nucleus, while the old somatic nucleus degenerates. In the ciliate Paramecium tetraurelia, the genome is massively rearranged during this process through the reproducible elimination of repeated sequences and the precise excision of over 45,000 short, single-copy Internal Eliminated Sequences (IESs. Different types of ncRNAs resulting from genome-wide transcription were shown to be involved in the epigenetic regulation of genome rearrangements. To understand how ncRNAs are produced from the entire genome, we have focused on a homolog of the TFIIS elongation factor, which regulates RNA polymerase II transcriptional pausing. Six TFIIS-paralogs, representing four distinct families, can be found in P. tetraurelia genome. Using RNA interference, we showed that TFIIS4, which encodes a development-specific TFIIS protein, is essential for the formation of a functional somatic genome. Molecular analyses and high-throughput DNA sequencing upon TFIIS4 RNAi demonstrated that TFIIS4 is involved in all kinds of genome rearrangements, including excision of ~48% of IESs. Localization of a GFP-TFIIS4 fusion revealed that TFIIS4 appears specifically in the new somatic nucleus at an early developmental stage, before IES excision. RT-PCR experiments showed that TFIIS4 is necessary for the synthesis of IES-containing non-coding transcripts. We propose that these IES+ transcripts originate from the developing somatic nucleus and serve as pairing substrates for germline-specific short RNAs that target elimination of their homologous sequences. Our study, therefore, connects the onset of zygotic non coding transcription to the control of genome plasticity in Paramecium
The expanding regulatory universe of p53 in gastrointestinal cancer [version 1; referees: 2 approved
Directory of Open Access Journals (Sweden)
Andrew Fesler
2016-04-01
Full Text Available Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs through direct binding to the promoter region of these miRNAs. Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs. Like miRNA, lncRNAs have been found to play important roles in cancer biology. With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.
Directory of Open Access Journals (Sweden)
Limor Raz
Full Text Available Recent studies demonstrate that acetylation of the transcription factor, p53 on lysine(373 leads to its enhanced stabilization/activity and increased susceptibility of cells to stress. However, it is not known whether acetylation of p53 is altered in the hippocampus following global cerebral ischemia (GCI or is regulated by the hormone, 17β-estradiol (17β-E(2, and thus, this study examined these issues.The study revealed that Acetyl p53-Lysine(373 levels were markedly increased in the hippocampal CA1 region after GCI at 3 h, 6 h and 24 h after reperfusion, an effect strongly attenuated by 17β-E(2. 17β-E(2 also enhanced interaction of p53 with the ubiquitin ligase, Mdm2, increased ubiquitination of p53, and induced its down-regulation, as well as attenuated elevation of the p53 transcriptional target, Puma. We also observed enhanced acetylation of p53 at a different lysine (Lys(382 at 3 h after reperfusion, and 17β-E(2 also markedly attenuated this effect. Furthermore, administration of an inhibitor of CBP/p300 acetyltransferase, which acetylates p53, was strongly neuroprotective of the CA1 region following GCI. In long-term estrogen deprived (LTED animals, the ability of 17β-E(2 to attenuate p53 acetylation was lost, and intriguingly, Acetyl p53-Lysine(373 levels were markedly elevated in sham (non-ischemic LTED animals. Finally, intracerebroventricular injections of Gp91ds-Tat, a specific NADPH oxidase (NOX2 inhibitor, but not the scrambled tat peptide control (Sc-Tat, attenuated acetylation of p53 and reduced levels of Puma following GCI.The studies demonstrate that p53 undergoes enhanced acetylation in the hippocampal CA1 region following global cerebral ischemia, and that the neuroprotective agent, 17β-E(2, markedly attenuates the ischemia-induced p53 acetylation. Furthermore, following LTED, the suppressive effect of 17β-E(2 on p53 acetylation is lost, and p53 acetylation increases in the hippocampus, which may explain previous
Glycerol restores the p53 function in human lingual cancer cells bearing mutant p53
International Nuclear Information System (INIS)
Ota, Ichiro; Yane, Katsunari; Yuki, Kazue; Kanata, Hirokazu; Hosoi, Hiroshi; Miyahara, Hiroshi
2001-01-01
Mutations in p53, tumor suppressor gene, have recently been shown to have an impact on the clinical course of several human tumors, including head and neck cancers. The genetic status of the p53 gene has been focused on as the most important candidate among various cancer-related genes for prognosis-predictive assays of cancer therapy. We examined the restoration of radiation- or cisplatin (CDDP)-induced p53-dependent apoptosis in human lingual cancer cells. The results suggest that glycerol is effective in inducing a conformational change of p53 and restoring normal function of mutant p53, leading to enhanced radiosensitivity or chemosensitivity through the induction of apoptosis. We have also represented the same results in vivo as in vitro. Thus, this novel tool for enhancement of radiosensitivity or chemosensitivity in cancer cells bearing m p53 may be applicable for p53-targeted cancer therapy. (author)
The p53 inhibitor, pifithrin-α, suppresses self-renewal of embryonic stem cells
International Nuclear Information System (INIS)
Abdelalim, Essam Mohamed; Tooyama, Ikuo
2012-01-01
Highlights: ► We determine the role of p53 in ES cells under unstressful conditions. ► PFT-α suppresses ES cell proliferation. ► PFT-α induces ES cell cycle arrest. ► PFT-α downregulates Nanog and cyclin D1. -- Abstract: Recent studies have reported the role of p53 in suppressing the pluripotency of embryonic stem (ES) cells after DNA damage and blocking the reprogramming of somatic cells into induced pluripotent stem (iPS) cells. However, to date no evidence has been presented to support the function of p53 in unstressed ES cells. In this study, we investigated the effect of pifithrin (PFT)-α, an inhibitor of p53-dependent transcriptional activation, on self-renewal of ES cells. Our results revealed that treatment of ES cells with PFT-α resulted in the inhibition of ES cell propagation in a dose-dependent manner, as indicated by a marked reduction in the cell number and colony size. Also, PFT-α caused a cell cycle arrest and significant reduction in DNA synthesis. In addition, inhibition of p53 activity reduced the expression levels of cyclin D1 and Nanog. These findings indicate that p53 pathway in ES cells rather than acting as an inactive gene, is required for ES cell proliferation and self-renewal under unstressful conditions.
The p53 inhibitor, pifithrin-{alpha}, suppresses self-renewal of embryonic stem cells
Energy Technology Data Exchange (ETDEWEB)
Abdelalim, Essam Mohamed, E-mail: essam_abdelalim@yahoo.com [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia 41522 (Egypt); Tooyama, Ikuo [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan)
2012-04-13
Highlights: Black-Right-Pointing-Pointer We determine the role of p53 in ES cells under unstressful conditions. Black-Right-Pointing-Pointer PFT-{alpha} suppresses ES cell proliferation. Black-Right-Pointing-Pointer PFT-{alpha} induces ES cell cycle arrest. Black-Right-Pointing-Pointer PFT-{alpha} downregulates Nanog and cyclin D1. -- Abstract: Recent studies have reported the role of p53 in suppressing the pluripotency of embryonic stem (ES) cells after DNA damage and blocking the reprogramming of somatic cells into induced pluripotent stem (iPS) cells. However, to date no evidence has been presented to support the function of p53 in unstressed ES cells. In this study, we investigated the effect of pifithrin (PFT)-{alpha}, an inhibitor of p53-dependent transcriptional activation, on self-renewal of ES cells. Our results revealed that treatment of ES cells with PFT-{alpha} resulted in the inhibition of ES cell propagation in a dose-dependent manner, as indicated by a marked reduction in the cell number and colony size. Also, PFT-{alpha} caused a cell cycle arrest and significant reduction in DNA synthesis. In addition, inhibition of p53 activity reduced the expression levels of cyclin D1 and Nanog. These findings indicate that p53 pathway in ES cells rather than acting as an inactive gene, is required for ES cell proliferation and self-renewal under unstressful conditions.
Shahi, Shermineh; Fokkens, Like; Houterman, Petra M; Rep, Martijn
2016-10-01
Heterokaryon formation is an essential step in asexual recombination in Fusarium oxysporum. Filamentous fungi have an elaborate nonself recognition machinery to prevent formation and proliferation of heterokaryotic cells, called heterokaryon incompatibility (HI). In F. oxysporum the regulation of this machinery is not well understood. In Neurospora crassa, Vib-1, a putative transcription factor of the p53-like Ndt80 family of transcription factors, has been identified as global regulator of HI. In this study we investigated the role of the F. oxysporum homolog of Vib-1, called Suf, in vegetative hyphal and conidial anastomosis tube (CAT) fusion and HI. We identified a novel function for an Ndt80 homolog as a nutrient-dependent regulator of anastomosis. Strains carrying the SUF deletion mutation display a hyper-fusion phenotype during vegetative growth as well as germling development. In addition, conidial paring of incompatible SUF deletion strains led to more heterokaryon formation, which is independent of suppression of HI. Our data provides further proof for the divergence in the functions of different members Ndt80 family. We propose that Ndt80 homologs mediate responses to nutrient quality and quantity, with specific responses varying between species. Copyright © 2016 Elsevier Inc. All rights reserved.
The role of p53 in the response to mitotic spindle damage
International Nuclear Information System (INIS)
Meek, D.W.
2000-01-01
The p53 tumour suppressor protein has defined roles in G1/S and G2/M cell cycle checkpoint in response to a range of cellular stresses including DNA damage, dominant oncogene expression, hypoxia, metabolic changes and viral infection. In addition to these responses, p53 can also be activated when damage occurs to the mitotic spindle. Initially, spindle damage activates a p53-independent checkpoint which functions at the metaphase-anaphase transition and prevents cells from progressing through mitosis until the completion of spindle formation. Cells eventually escape from this block (a process termed 'mitotic slippage'), and an aberrant mitosis ensues in which sister chromatids fail to segregate properly. After a delay period, p53 responds to this mitotic failure by instituting a G1-like growth arrest, with an intact nucleus containing 4N DNA, but without the cells undergoing division. Cells lacking wild-type p53 are still able to arrest transiently at mitosis, and also fail to undergo division, underscoring that the delay in mitosis is p53-independent. However, these cells are not prevented from re-entering the cell cycle and can reduplicate their DNA unchecked, leading to polyploidy. Additionally, p53-null cells which experience spindle failure often show the appearance of micronuclei arising from poorly segregated chromosomes which have de-condensed and been enclosed in a nuclear envelope. The ability of p53 to prevent their formation suggests an additional G2 involvement which prevents nuclear breakdown prior to mitosis. The molecular mechanism by which p53 is able to sense mitotic failure is still unknown, but may be linked to the ability of p53 to regulate duplication of the centrosome, the organelle which nucleates spindle formation. (authors)
Bechill, John; Zhong, Rong; Zhang, Chen; Solomaha, Elena; Spiotto, Michael T
2016-01-01
p53 function is frequently inhibited in cancer either through mutations or by increased degradation via MDM2 and/or E6AP E3-ubiquitin ligases. Most agents that restore p53 expression act by binding MDM2 or E6AP to prevent p53 degradation. However, fewer compounds directly bind to and activate p53. Here, we identified compounds that shared a core structure that bound p53, caused nuclear localization of p53 and caused cell death. To identify these compounds, we developed a novel cell-based screen to redirect p53 degradation to the Skip-Cullin-F-box (SCF) ubiquitin ligase complex in cells expressing high levels of p53. In a multiplexed assay, we coupled p53 targeted degradation with Rb1 targeted degradation in order to identify compounds that prevented p53 degradation while not inhibiting degradation through the SCF complex or other proteolytic machinery. High-throughput screening identified several leads that shared a common 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that stabilized p53. Surface plasmon resonance analysis indicated that these compounds bound p53 with a KD of 200 ± 52 nM. Furthermore, these compounds increased p53 nuclear localization and transcription of the p53 target genes PUMA, BAX, p21 and FAS in cancer cells. Although p53-null cells had a 2.5±0.5-fold greater viability compared to p53 wild type cells after treatment with core compounds, loss of p53 did not completely rescue cell viability suggesting that compounds may target both p53-dependent and p53-independent pathways to inhibit cell proliferation. Thus, we present a novel, cell-based high-throughput screen to identify a 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that bound to p53 and increased p53 activity in cancer cells. These compounds may serve as anti-neoplastic agents in part by targeting p53 as well as other potential pathways.
Directory of Open Access Journals (Sweden)
Fendt Sarah-Maria
2010-02-01
Full Text Available Abstract Background Depending on the carbon source, Saccharomyces cerevisiae displays various degrees of respiration. These range from complete respiration as in the case of ethanol, to almost complete fermentation, and thus very low degrees of respiration on glucose. While many key regulators are known for these extreme cases, we focus here on regulators that are relevant at intermediate levels of respiration. Results We address this question by linking the functional degree of respiration to transcriptional regulation via enzyme abundances. Specifically, we investigated aerobic batch cultures with the differently repressive carbon sources glucose, mannose, galactose and pyruvate. Based on 13C flux analysis, we found that the respiratory contribution to cellular energy production was largely absent on glucose and mannose, intermediate on galactose and highest on pyruvate. In vivo abundances of 40 respiratory enzymes were quantified by GFP-fusions under each condition. During growth on the partly and fully respired substrates galactose and pyruvate, several TCA cycle and respiratory chain enzymes were significantly up-regulated. From these enzyme levels and the known regulatory network structure, we determined the probability for a given transcription factor to cause the coordinated expression changes. The most probable transcription factors to regulate the different degrees of respiration were Gcr1p, Cat8p, the Rtg-proteins and the Hap-complex. For the latter three ones we confirmed their importance for respiration by quantifying the degree of respiration and biomass yields in the corresponding deletion strains. Conclusions Cat8p is required for wild-type like respiration, independent of its known activation of gluconeogenic genes. The Rtg-proteins and the Hap-complex are essential for wild-type like respiration under partially respiratory conditions. Under fully respiratory conditions, the Hap-complex, but not the Rtg-proteins are essential
Fendt, Sarah-Maria; Sauer, Uwe
2010-02-18
Depending on the carbon source, Saccharomyces cerevisiae displays various degrees of respiration. These range from complete respiration as in the case of ethanol, to almost complete fermentation, and thus very low degrees of respiration on glucose. While many key regulators are known for these extreme cases, we focus here on regulators that are relevant at intermediate levels of respiration. We address this question by linking the functional degree of respiration to transcriptional regulation via enzyme abundances. Specifically, we investigated aerobic batch cultures with the differently repressive carbon sources glucose, mannose, galactose and pyruvate. Based on 13C flux analysis, we found that the respiratory contribution to cellular energy production was largely absent on glucose and mannose, intermediate on galactose and highest on pyruvate. In vivo abundances of 40 respiratory enzymes were quantified by GFP-fusions under each condition. During growth on the partly and fully respired substrates galactose and pyruvate, several TCA cycle and respiratory chain enzymes were significantly up-regulated. From these enzyme levels and the known regulatory network structure, we determined the probability for a given transcription factor to cause the coordinated expression changes. The most probable transcription factors to regulate the different degrees of respiration were Gcr1p, Cat8p, the Rtg-proteins and the Hap-complex. For the latter three ones we confirmed their importance for respiration by quantifying the degree of respiration and biomass yields in the corresponding deletion strains. Cat8p is required for wild-type like respiration, independent of its known activation of gluconeogenic genes. The Rtg-proteins and the Hap-complex are essential for wild-type like respiration under partially respiratory conditions. Under fully respiratory conditions, the Hap-complex, but not the Rtg-proteins are essential for respiration.
Directory of Open Access Journals (Sweden)
Young me Yoon
2016-11-01
Full Text Available Our mechanistic understanding of Fanconi anemia (FA pathway function in hematopoietic stem and progenitor cells (HSPCs owes much to their role in experimentally induced DNA crosslink lesion repair. In bone marrow HSPCs, unresolved stress confers p53-dependent apoptosis and progressive cell attrition. The role of FA proteins during hematopoietic development, in the face of physiological replicative demand, remains elusive. Here, we reveal a fetal HSPC pool in Fancd2−/− mice with compromised clonogenicity and repopulation. Without experimental manipulation, fetal Fancd2−/− HSPCs spontaneously accumulate DNA strand breaks and RAD51 foci, associated with a broad transcriptional DNA-damage response, and constitutive activation of ATM as well as p38 stress kinase. Remarkably, the unresolved stress during rapid HSPC pool expansion does not trigger p53 activation and apoptosis; rather, it constrains proliferation. Collectively our studies point to a role for the FA pathway during hematopoietic development and provide a new model for studying the physiological function of FA proteins.
Butein activates p53 in hepatocellular carcinoma cells via blocking MDM2-mediated ubiquitination
Directory of Open Access Journals (Sweden)
Zhou Y
2018-04-01
Full Text Available Yuanfeng Zhou,1,2 Kuifeng Wang,2 Ni Zhou,2 Tingting Huang,2 Jiansheng Zhu,2 Jicheng Li1 1Institute of Cell Biology, Zhejiang University, Hangzhou, People’s Republic of China; 2Department of Infectious Diseases, Affiliated Taizhou Hospital of Wenzhou Medical University, Taizhou, People’s Republic of China Introduction: In this study, we aimed to investigate the effect of butein on p53 in hepatocellular carcinoma (HCC cells and the related molecular mechanisms by which p53 was activated. Methods: MTS assay and clonogenic survival assay were used to examine the antitumor activity of butein in vitro. Reporter gene assay was adopted to evaluate p53 transcriptional activity. Flow cytometry and western blotting were performed to study apoptosis induction and protein expression respectively. Xenograft model was applied to determine the in vivo efficacy and the expression of p53 in tumor tissue was detected by immunohistochemistry. Results: HCC cell proliferation and clonogenic survival were significantly inhibited after butein treatment. With the activation of cleaved-PARP and capsase-3, butein induced apoptosis in HCC cells in a dose-dependent manner. The transcriptional activity of p53 was substantially promoted by butein, and the expression of p53-targeted gene was increased accordingly. Mechanism studies demonstrated that the interaction between MDM2 and p53 was blocked by butein and MDM2-mediated p53 ubiquitination was substantially decreased. Short-hairpin RNA experiment results showed that the sensitivity of HCC cells to butein was substantially impaired after p53 was knocked down and butein-induced apoptosis was dramatically decreased. In vivo experiments validated substantial antitumor efficacy of butein against HepG2 xenograft growth, and the expression of p53 in butein-treated tumor tissue was significantly increased. Conclusion: Butein demonstrated potent antitumor activities in HCC by activating p53, and butein or its analogs had
Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.
Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino
2015-10-01
The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.
p73 regulates basal and starvation-induced liver metabolism in vivo
He, Zhaoyue; Agostini, Massimiliano; Liu, He; Melino, Gerry; Simon, Hans-Uwe
2015-01-01
As a member of the p53 gene family, p73 regulates cell cycle arrest, apoptosis, neurogenesis, immunity and inflammation. Recently, p73 has been shown to transcriptionally regulate selective metabolic enzymes, such as cytochrome c oxidase subunit IV isoform 1, glucose 6-phosphate dehydrogenase and glutaminase-2, resulting in significant effects on metabolism, including hepatocellular lipid metabolism, glutathione homeostasis and the pentose phosphate pathway. In order to further investigate th...
Directory of Open Access Journals (Sweden)
Bianca M Sirbu
Full Text Available Homologous recombination (HR is required for the restart of collapsed DNA replication forks and error-free repair of DNA double-strand breaks (DSB. However, unscheduled or hyperactive HR may lead to genomic instability and promote cancer development. The cellular factors that restrict HR processes in mammalian cells are only beginning to be elucidated. The tumor suppressor p53 has been implicated in the suppression of HR though it has remained unclear why p53, as the guardian of the genome, would impair an error-free repair process. Here, we show for the first time that p53 downregulates foci formation of the RAD51 recombinase in response to replicative stress in H1299 lung cancer cells in a manner that is independent of its role as a transcription factor. We find that this downregulation of HR is not only completely dependent on the binding site of p53 with replication protein A but also the ATR/ATM serine 15 phosphorylation site. Genetic analysis suggests that ATR but not ATM kinase modulates p53's function in HR. The suppression of HR by p53 can be bypassed under experimental conditions that cause DSB either directly or indirectly, in line with p53's role as a guardian of the genome. As a result, transactivation-inactive p53 does not compromise the resistance of H1299 cells to the interstrand crosslinking agent mitomycin C. Altogether, our data support a model in which p53 plays an anti-recombinogenic role in the ATR-dependent mammalian replication checkpoint but does not impair a cell's ability to use HR for the removal of DSB induced by cytotoxic agents.
BAK overexpression mediates p53-independent apoptosis inducing effects on human gastric cancer cells
Directory of Open Access Journals (Sweden)
Liu Jun
2004-07-01
Full Text Available Abstract Background BAK (Bcl-2 homologous antagonist/killer is a novel pro-apoptotic gene of the Bcl-2 family. It has been reported that gastric tumors have reduced BAK levels when compared with the normal mucosa. Moreover, mutations of the BAK gene have been identified in human gastrointestinal cancers, suggesting that a perturbation of BAK-mediated apoptosis may contribute to the pathogenesis of gastric cancer. In this study, we explored the therapeutic effects of gene transfer mediated elevations in BAK expression on human gastric cancer cells in vitro. Methods Eukaryotic expression vector for the BAK gene was constructed and transferred into gastric cancer cell lines, MKN-45 (wild-type p53 and MKN-28 (mutant-type p53. RT-PCR and Western Blotting detected cellular BAK gene expression. Cell growth activities were detected by MTT colorimetry and flow cytometry, while apoptosis was assayed by electronic microscopy and TUNEL. Western Blotting and colorimetry investigated cellular caspase-3 activities. Results BAK gene transfer could result in significant BAK overexpression, decreased in vitro growth, cell cycle G0/G1 arrest, and induced apoptosis in gastric cancer cells. In transferred cells, inactive caspase-3 precursor was cleaved into the active subunits p20 and p17, during BAK overexpression-induced apoptosis. In addition, this process occurred equally well in p53 wild-type (MKN-45, or in p53 mutant-type (MKN-28 gastric cancer cells. Conclusions The data presented suggests that overexpression of the BAK gene can lead to apoptosis of gastric cancer cells in vitro, which does not appear to be dependent on p53 status. The action mechanism of BAK mediated apoptosis correlates with activation of caspase-3. This could be served as a potential strategy for further development of gastric cancer therapies.
BAK overexpression mediates p53-independent apoptosis inducing effects on human gastric cancer cells
International Nuclear Information System (INIS)
Tong, Qiang-Song; Zheng, Li-Duan; Wang, Liang; Liu, Jun; Qian, Wei
2004-01-01
BAK (Bcl-2 homologous antagonist/killer) is a novel pro-apoptotic gene of the Bcl-2 family. It has been reported that gastric tumors have reduced BAK levels when compared with the normal mucosa. Moreover, mutations of the BAK gene have been identified in human gastrointestinal cancers, suggesting that a perturbation of BAK-mediated apoptosis may contribute to the pathogenesis of gastric cancer. In this study, we explored the therapeutic effects of gene transfer mediated elevations in BAK expression on human gastric cancer cells in vitro. Eukaryotic expression vector for the BAK gene was constructed and transferred into gastric cancer cell lines, MKN-45 (wild-type p53) and MKN-28 (mutant-type p53). RT-PCR and Western Blotting detected cellular BAK gene expression. Cell growth activities were detected by MTT colorimetry and flow cytometry, while apoptosis was assayed by electronic microscopy and TUNEL. Western Blotting and colorimetry investigated cellular caspase-3 activities. BAK gene transfer could result in significant BAK overexpression, decreased in vitro growth, cell cycle G 0 /G 1 arrest, and induced apoptosis in gastric cancer cells. In transferred cells, inactive caspase-3 precursor was cleaved into the active subunits p20 and p17, during BAK overexpression-induced apoptosis. In addition, this process occurred equally well in p53 wild-type (MKN-45), or in p53 mutant-type (MKN-28) gastric cancer cells. The data presented suggests that overexpression of the BAK gene can lead to apoptosis of gastric cancer cells in vitro, which does not appear to be dependent on p53 status. The action mechanism of BAK mediated apoptosis correlates with activation of caspase-3. This could be served as a potential strategy for further development of gastric cancer therapies
p53-dependent non-coding RNA networks in chronic lymphocytic leukemia
Blume, C. J.; Hotz-Wagenblatt, A.; Hüllein, J.; Sellner, L.; Jethwa, A.; Stolz, T.; Slabicki, M.; Lee, K.; Sharathchandra, A.; Benner, A.; Dietrich, S.; Oakes, C. C.; Dreger, P.; te Raa, D.; Kater, A. P.; Jauch, A.; Merkel, O.; Oren, M.; Hielscher, T.; Zenz, T.
2015-01-01
Mutations of the tumor suppressor p53 lead to chemotherapy resistance and a dismal prognosis in chronic lymphocytic leukemia (CLL). Whereas p53 targets are used to identify patient subgroups with impaired p53 function, a comprehensive assessment of non-coding RNA targets of p53 in CLL is missing. We
Lagunas-Martínez, Alfredo; García-Villa, Enrique; Arellano-Gaytán, Magaly; Contreras-Ochoa, Carla O; Dimas-González, Jisela; López-Arellano, María E; Madrid-Marina, Vicente; Gariglio, Patricio
2017-01-01
The E6 oncoprotein can interfere with the ability of infected cells to undergo programmed cell death through the proteolytic degradation of proapoptotic proteins such as p53, employing the proteasome pathway. Therefore, inactivation of the proteasome through MG132 should restore the activity of several proapoptotic proteins. We investigated whether in HPV16 E6-expressing keratinocytes (KE6 cells), the restoration of p53 levels mediated by MG132 and/or activation of the CD95 pathway through apoptosis antigen-1 (APO-1) antibody are responsible for the induction of apoptosis. We found that KE6 cells underwent apoptosis mainly after incubation for 24 h with MG132 alone or APO-1 plus MG132. Both treatments activated the extrinsic and intrinsic apoptosis pathways. Autophagy was also activated, principally by APO-1 plus MG132. Inhibition of E6-mediated p53 proteasomal degradation by MG132 resulted in the elevation of p53 protein levels and its phosphorylation in Ser46 and Ser20; the p53 protein was localized mainly at nucleus after treatment with MG132 or APO-1 plus MG132. In addition, induction of its transcriptional target genes such as p21, Bax and TP53INP was observed 3 and 6 h after treatment. Also, LC3 mRNA was induced after 3 and 6 h, which correlates with lipidation of LC3B protein and induction of autophagy. Finally, using pifithrin alpha we observed a decrease in apoptosis induced by MG132, and by APO-1 plus MG132, suggesting that restoration of APO-1 sensitivity occurs in part through an increase in both the levels and the activity of p53. The use of small molecules to inhibit the proteasome pathway might permit the activation of cell death, providing new opportunities for CC treatment.
Che-1 gene silencing induces osteosarcoma cell apoptosis by inhibiting mutant p53 expression
Energy Technology Data Exchange (ETDEWEB)
Liu, Ming; Wang, Dan, E-mail: danwangwdd@163.com; Li, Ning
2016-04-22
The transcriptional cofactor Che-1 is an RNA polymerase II (Pol II) which is involved in tumorigenesis, such as breast cancer and multiple myeloma. Che-1 can also regulate mutant p53 expression, which plays roles in many types of cancer. In this study, we aimed to investigate the effects and specific mechanism of Che-1 in the regulation of osteosarcoma (OS) cell growth. We found that Che-1 is highly expressed in several kinds of OS cells compared with osteoblast hFOB1.19 cells. MTT and flow cytometry assays showed that Che-1 depletion by siRNA markedly suppressed MG-63 and U2OS cell proliferation and promoted apoptosis. The chromatin immunoprecipitation (ChIP) assay verified the presence of Che-1 on the p53 promoter in MG-63 and U2OS cells carrying mutant p53. Further studies showed that Che-1 depletion inhibited mutant p53 expression. Notably, our study showed that the loss of Che-1 inhibits proliferation and promotes apoptosis in MG-63 cells by decreasing the level of mutant p53. Therefore, these findings open the possibility that silencing of Che-1 will have therapeutic benefit in OS. - Highlights: • Che-1 is highly expressed in several kinds of OS cells. • Che-1 depletion suppressed MG-63 and U2OS cell growth. • Che-1 is existed in the p53 promoter in MG-63 and U2OS cells. • Che-1 depletion inhibited mutant p53 expression. • Che-1 depletion inhibits cell growth by decreasing the level of mutant p53.
Hannemann, Holger; Rosenke, Kyle; O'Dowd, John M; Fortunato, Elizabeth A
2009-05-01
Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunocompromised and immunosuppressed individuals. During infection, HCMV is known to employ host transcription factors to facilitate viral gene expression. To further understand the previously observed delay in viral replication and protein expression in p53 knockout cells, we conducted microarray analyses of p53(+/+) and p53(-/-) immortalized fibroblast cell lines. At a multiplicity of infection (MOI) of 1 at 24 h postinfection (p.i.), the expression of 22 viral genes was affected by the absence of p53. Eleven of these 22 genes (group 1) were examined by real-time reverse transcriptase, or quantitative, PCR (q-PCR). Additionally, five genes previously determined to have p53 bound to their nearest p53-responsive elements (group 2) and three control genes without p53 binding sites in their upstream sequences (group 3) were also examined. At an MOI of 1, >3-fold regulation was found for five group 1 genes. The expression of group 2 and 3 genes was not changed. At an MOI of 5, all genes from group 1 and four of five genes from group 2 were found to be regulated. The expression of control genes from group 3 remained unchanged. A q-PCR time course of four genes revealed that p53 influences viral gene expression most at immediate-early and early times p.i., suggesting a mechanism for the reduced and delayed production of virions in p53(-/-) cells.
Witt, Kristine L; Hsieh, Jui-Hua; Smith-Roe, Stephanie L; Xia, Menghang; Huang, Ruili; Zhao, Jinghua; Auerbach, Scott S; Hur, Junguk; Tice, Raymond R
2017-08-01
Genotoxicity potential is a critical component of any comprehensive toxicological profile. Compounds that induce DNA or chromosomal damage often activate p53, a transcription factor essential to cell cycle regulation. Thus, within the US Tox21 Program, we screened a library of ∼10,000 (∼8,300 unique) environmental compounds and drugs for activation of the p53-signaling pathway using a quantitative high-throughput screening assay employing HCT-116 cells (p53 +/+ ) containing a stably integrated β-lactamase reporter gene under control of the p53 response element (p53RE). Cells were exposed (-S9) for 16 hr at 15 concentrations (generally 1.2 nM to 92 μM) three times, independently. Excluding compounds that failed analytical chemistry analysis or were suspected of inducing assay interference, 365 (4.7%) of 7,849 unique compounds were concluded to activate p53. As part of an in-depth characterization of our results, we first compared them with results from traditional in vitro genotoxicity assays (bacterial mutation, chromosomal aberration); ∼15% of known, direct-acting genotoxicants in our library activated the p53RE. Mining the Comparative Toxicogenomics Database revealed that these p53 actives were significantly associated with increased expression of p53 downstream genes involved in DNA damage responses. Furthermore, 53 chemical substructures associated with genotoxicity were enriched in certain classes of p53 actives, for example, anthracyclines (antineoplastics) and vinca alkaloids (tubulin disruptors). Interestingly, the tubulin disruptors manifested unusual nonmonotonic concentration response curves suggesting activity through a unique p53 regulatory mechanism. Through the analysis of our results, we aim to define a role for this assay as one component of a comprehensive toxicological characterization of large compound libraries. Environ. Mol. Mutagen. 58:494-507, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
ARF and ATM/ATR cooperate in p53-mediated apoptosis upon oncogenic stress
International Nuclear Information System (INIS)
Pauklin, Siim; Kristjuhan, Arnold; Maimets, Toivo; Jaks, Viljar
2005-01-01
Induction of apoptosis is pivotal for eliminating cells with damaged DNA or deregulated proliferation. We show that tumor suppressor ARF and ATM/ATR kinase pathways cooperate in the induction of apoptosis in response to elevated expression of c-myc, β-catenin or human papilloma virus E7 oncogenes. Overexpression of oncogenes leads to the formation of phosphorylated H2AX foci, induction of Rad51 protein levels and ATM/ATR-dependent phosphorylation of p53. Inhibition of ATM/ATR kinases abolishes both induction of Rad51 and phosphorylation of p53, and remarkably reduces the level of apoptosis induced by co-expression of oncogenes and ARF. However, the induction of apoptosis is downregulated in p53-/- cells and does not depend on activities of ATM/ATR kinases, indicating that efficient induction of apoptosis by oncogene activation depends on coordinated action of ARF and ATM/ATR pathways in the regulation of p53
DEFF Research Database (Denmark)
Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice
2016-01-01
The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion...... in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically...... associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell...
Vadrot, Nathalie; Ghanem, Sarita; Braut, Françoise; Gavrilescu, Laura; Pilard, Nathalie; Mansouri, Abdellah; Moreau, Richard; Reyl-Desmars, Florence
2012-01-01
During chronic liver inflammation, up-regulated Tumor Necrosis Factor alpha (TNF-α) targets hepatocytes and induces abnormal reactive oxygen species (ROS) production responsible for mitochondrial DNA (mtDNA) alterations. The serine/threonine Glycogen Synthase Kinase 3 beta (GSK3β) plays a pivotal role during inflammation but its involvement in the maintenance of mtDNA remains unknown. The aim of this study was to investigate its involvement in TNF-α induced mtDNA depletion and its interrelationship with p53 a protein known to maintain mtDNA copy numbers. Using quantitative polymerase chain reaction (qPCR) we found that at 30 min in human hepatoma HepG2 cells TNF-α induced 0.55±0.10 mtDNA lesions per 10 Kb and a 52.4±2.8% decrease in mtDNA content dependent on TNF-R1 receptor and ROS production. Both lesions and depletion returned to baseline from 1 to 6 h after TNF-α exposure. Luminol-amplified chemiluminescence (LAC) was used to measure the rapid (10 min) and transient TNF-α induced increase in ROS production (168±15%). A transient 8-oxo-dG level of 1.4±0.3 ng/mg DNA and repair of abasic sites were also measured by ELISA assays. Translocation of p53 to mitochondria was observed by Western Blot and co-immunoprecipitations showed that TNF-α induced p53 binding to GSK3β and mitochondrial transcription factor A (TFAM). In addition, mitochondrial D-loop immunoprecipitation (mtDIP) revealed that TNF-α induced p53 binding to the regulatory D-loop region of mtDNA. The knockdown of p53 by siRNAs, inhibition by the phosphoSer(15)p53 antibody or transfection of human mutant active GSK3βS9A pcDNA3 plasmid inhibited recovery of mtDNA content while blockade of GSK3β activity by SB216763 inhibitor or knockdown by siRNAs suppressed mtDNA depletion. This study is the first to report the involvement of GSK3β in TNF-α induced mtDNA depletion. We suggest that p53 binding to GSK3β, TFAM and D-loop could induce recovery of mtDNA content through mtDNA repair.
Directory of Open Access Journals (Sweden)
Nathalie Vadrot
Full Text Available During chronic liver inflammation, up-regulated Tumor Necrosis Factor alpha (TNF-α targets hepatocytes and induces abnormal reactive oxygen species (ROS production responsible for mitochondrial DNA (mtDNA alterations. The serine/threonine Glycogen Synthase Kinase 3 beta (GSK3β plays a pivotal role during inflammation but its involvement in the maintenance of mtDNA remains unknown. The aim of this study was to investigate its involvement in TNF-α induced mtDNA depletion and its interrelationship with p53 a protein known to maintain mtDNA copy numbers. Using quantitative polymerase chain reaction (qPCR we found that at 30 min in human hepatoma HepG2 cells TNF-α induced 0.55±0.10 mtDNA lesions per 10 Kb and a 52.4±2.8% decrease in mtDNA content dependent on TNF-R1 receptor and ROS production. Both lesions and depletion returned to baseline from 1 to 6 h after TNF-α exposure. Luminol-amplified chemiluminescence (LAC was used to measure the rapid (10 min and transient TNF-α induced increase in ROS production (168±15%. A transient 8-oxo-dG level of 1.4±0.3 ng/mg DNA and repair of abasic sites were also measured by ELISA assays. Translocation of p53 to mitochondria was observed by Western Blot and co-immunoprecipitations showed that TNF-α induced p53 binding to GSK3β and mitochondrial transcription factor A (TFAM. In addition, mitochondrial D-loop immunoprecipitation (mtDIP revealed that TNF-α induced p53 binding to the regulatory D-loop region of mtDNA. The knockdown of p53 by siRNAs, inhibition by the phosphoSer(15p53 antibody or transfection of human mutant active GSK3βS9A pcDNA3 plasmid inhibited recovery of mtDNA content while blockade of GSK3β activity by SB216763 inhibitor or knockdown by siRNAs suppressed mtDNA depletion. This study is the first to report the involvement of GSK3β in TNF-α induced mtDNA depletion. We suggest that p53 binding to GSK3β, TFAM and D-loop could induce recovery of mtDNA content through mtDNA repair.
Phenotype specific analyses reveal distinct regulatory mechanism for chronically activated p53.
Directory of Open Access Journals (Sweden)
Kristina Kirschner
2015-03-01
Full Text Available The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage and chronically activated (in senescent or pro-apoptotic conditions p53. Compared to the classical 'acute' p53 binding profile, 'chronic' p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory 'p53 hubs' where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the 'lipogenic phenotype', a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms.
Directory of Open Access Journals (Sweden)
Mandar Dave
2017-12-01
Full Text Available The differential expression of two closelyassociated cyclooxygenase isozymes, COX-1 and COX-2, exhibited functions beyond eicosanoid metabolism. We hypothesized that COX-1 or COX-2 knockout lung fibroblasts may display altered protein profiles which may allow us to further differentiate the functional roles of these isozymes at the molecular level. Proteomic analysis shows constitutive production of macrophage migration inhibitory factor (MIF in lung fibroblasts derived from COX-2−/− but not wild-type (WT or COX-1−/− mice. MIF was spontaneously released in high levels into the extracellular milieu of COX2−/− fibroblasts seemingly from the preformed intracellular stores, with no change in the basal gene expression of MIF. The secretion and regulation of MIF in COX-2−/− was “prostaglandin-independent.” GO analysis showed that concurrent with upregulation of MIF, there is a significant surge in expression of genes related to fibroblast growth, FK506 binding proteins, and isomerase activity in COX-2−/− cells. Furthermore, COX-2−/− fibroblasts also exhibit a significant increase in transcriptional activity of various regulators, antagonists, and co-modulators of p53, as well as in the expression of oncogenes and related transcripts. Integrative Oncogenomics Cancer Browser (IntroGen analysis shows downregulation of COX-2 and amplification of MIF and/or p53 activity during development of glioblastomas, ependymoma, and colon adenomas. These data indicate the functional role of the MIF-COX-p53 axis in inflammation and cancer at the genomic and proteomic levels in COX-2-ablated cells. This systematic analysis not only shows the proinflammatory state but also unveils a molecular signature of a pro-oncogenic state of COX-1 in COX-2 ablated cells.
The role of p53 molecule in radiation and hyperthermic therapies
International Nuclear Information System (INIS)
Yasumoto, Jun-ichi; Takahashi, Akihisa; Ohnishi, Ken; Ohnishi, Takeo
2003-01-01
In recent years, cancer-related genes have been analyzed at the molecular level as predictive indicators for cancer therapy. Among those genes, the tumor suppressor gene p53 is worthy of notice in cancer therapy, because the p53 molecule prevents the malignant degeneration of non-cancer cells by regulating cell-cycle arrest, apoptosis, and DNA repair. An abnormality of the p53 gene introduces a genetic instability and increases the incidence of carcinogenesis and teratogenesis. Therefore, p53 is called a guardian of the genome. Mutations of p53 are observed at a high frequency in human tumors, and are recognized in about half of all malignant tumors in human head and neck cancers. We previously reported that radio- and heat-sensitivities of human cultured tongue squamous cell carcinoma cells are p53-dependent, and are closely correlated with the induction of apoptosis. In a human cell culture system, the interactive hyperthermic enhancement of radiosensitivity was observed in wild-type p53 cells, but not in mutated p53 cells. In a transplanted tumor system, the combination therapies of radiation and hyperthermia induced efficient tumor growth depression and apoptosis in the wild-type p53 tumors. In this review, we discuss the p53 activation signaling pathways through the modification of p53 molecules, such as phosphorylation after radiation and hyperthermia treatments. (author)
Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.
Saha, Manujendra N; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D; Qiu, Lugui; Chang, Hong
2012-01-01
The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK
Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.
Directory of Open Access Journals (Sweden)
Manujendra N Saha
Full Text Available The low frequency of p53 alterations e.g., mutations/deletions (∼10% in multiple myeloma (MM makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP analysis showed that activated c-Jun binds to the activator protein-1 (AP-1 binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with
G9a stimulates CRC growth by inducing p53 Lys373 dimethylation-dependent activation of Plk1.
Zhang, Jie; Wang, Yafang; Shen, Yanyan; He, Pengxing; Ding, Jian; Chen, Yi
2018-01-01
Rationale: G9a is genetically deregulated in various tumor types and is important for cell proliferation; however, the mechanism underlying G9a-induced carcinogenesis, especially in colorectal cancer (CRC), is unclear. Here, we investigated if G9a exerts oncogenic effects in CRC by increasing polo-like kinase 1 (Plk1) expression. Thus, we further characterized the detailed molecular mechanisms. Methods: The role of Plk1 in G9a aberrant CRC was determined by performing different in vitro and in vivo assays, including assessment of cell growth by performing cell viability assay and assessment of signaling transduction profiles by performing immunoblotting, in the cases of pharmacological inhibition or short RNA interference-mediated suppression of G9a. Detailed molecular mechanisms underlying the effect of G9a on Plk1 expression were determined by performing point mutation analysis, chromatin immunoprecipitation analysis, and luciferase reporter assay. Correlation between G9a and Plk1 expression was determined by analyzing clinical samples of patients with CRC by performing immunohistochemistry. Results: Our study is the first to report a significant positive correlation between G9a and Plk1 levels in 89 clinical samples of patients with CRC. Moreover, G9a depletion decreased Plk1 expression and suppressed CRC cell growth both in vitro and in vivo , thus confirming the significant correlation between G9a and Plk1 levels. Further, we observed that G9a-induced Plk1 regulation depended on p53 inhibition. G9a dimethylated p53 at lysine 373, which in turn increased Plk1 expression and promoted CRC cell growth. Conclusions: These results indicate that G9a-induced and p53-dependent epigenetic programing stimulates the growth of colon cancer, which also suggests that G9a inhibitors that restore p53 activity are promising therapeutic agents for treating colon cancer, especially for CRC expressing wild-type p53.
Directory of Open Access Journals (Sweden)
Giulio Donati
2013-07-01
Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.
Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George
2013-07-11
Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Petroni, Marialaura; Veschi, Veronica; Gulino, Alberto; Giannini, Giuseppe
2012-01-01
The p53 oncosuppressor is very seldom mutated in neuroblastoma, but several mechanisms cooperate to its functional inactivation in this tumor. Increased MDM2 levels, due to genetic amplification or constitutive inhibition of p14 ARF , significantly contribute to this event highlighting p53 reactivation as an attractive perspective for neuroblastoma treatment. In addition to its role in tumorigenesis, MYCN sensitizes untransformed and cancer cells to apoptosis. This is associated to a fine modulation of the MDM2–p53 pathway. Indeed MYCN induces p53 and MDM2 transcription, and, by evoking a DNA damage response (DDR), it stabilizes p53 and its proapoptotic kinase Homeodomain Interacting Protein Kinase 2 (HIPK2). Through the regulation of the HIPK2-p53 inhibitor High Mobility Group protein A1 (HMGA1) and the homeobox proteins BMI-1 and TWIST-1, MYCN establishes a delicate balance between pro- and antiapoptotic molecules that might be easily perturbed by a variety of insults, leading to cell death. MDM2–p53 antagonists, such as Nutlin-3, are strikingly prone to inducing death in MYCN-amplified neuroblastoma, by further pushing on HIPK2 accumulation. Here we discuss implications and caveats of exploiting this pathway and its connections to MYCN-induced DDR for a tailored therapy of MYCN-amplified neuroblastoma.
Energy Technology Data Exchange (ETDEWEB)
Petroni, Marialaura; Veschi, Veronica; Gulino, Alberto; Giannini, Giuseppe, E-mail: giuseppe.giannini@uniroma1.it [Department of Molecular Medicine, University “La Sapienza”, Rome (Italy)
2012-10-12
The p53 oncosuppressor is very seldom mutated in neuroblastoma, but several mechanisms cooperate to its functional inactivation in this tumor. Increased MDM2 levels, due to genetic amplification or constitutive inhibition of p14{sup ARF}, significantly contribute to this event highlighting p53 reactivation as an attractive perspective for neuroblastoma treatment. In addition to its role in tumorigenesis, MYCN sensitizes untransformed and cancer cells to apoptosis. This is associated to a fine modulation of the MDM2–p53 pathway. Indeed MYCN induces p53 and MDM2 transcription, and, by evoking a DNA damage response (DDR), it stabilizes p53 and its proapoptotic kinase Homeodomain Interacting Protein Kinase 2 (HIPK2). Through the regulation of the HIPK2-p53 inhibitor High Mobility Group protein A1 (HMGA1) and the homeobox proteins BMI-1 and TWIST-1, MYCN establishes a delicate balance between pro- and antiapoptotic molecules that might be easily perturbed by a variety of insults, leading to cell death. MDM2–p53 antagonists, such as Nutlin-3, are strikingly prone to inducing death in MYCN-amplified neuroblastoma, by further pushing on HIPK2 accumulation. Here we discuss implications and caveats of exploiting this pathway and its connections to MYCN-induced DDR for a tailored therapy of MYCN-amplified neuroblastoma.
Garcia, Patrick Vianna; Seiva, Fábio Rodrigues Ferreira; Carniato, Amanda Pocol; de Mello Júnior, Wilson; Duran, Nelson; Macedo, Alda Maria; de Oliveira, Alexandre Gabarra; Romih, Rok; Nunes, Iseu da Silva; Nunes, Odilon da Silva; Fávaro, Wagner José
2016-07-07
The new modalities for treating patients with non-muscle invasive bladder cancer (NMIBC) for whom BCG (Bacillus Calmette-Guerin) has failed or is contraindicated are recently increasing due to the development of new drugs. Although agents like mitomycin C and BCG are routinely used, there is a need for more potent and/or less-toxic agents. In this scenario, a new perspective is represented by P-MAPA (Protein Aggregate Magnesium-Ammonium Phospholinoleate-Palmitoleate Anhydride), developed by Farmabrasilis (non-profit research network). This study detailed and characterized the mechanisms of action of P-MAPA based on activation of mediators of Toll-like Receptors (TLRs) 2 and 4 signaling pathways and p53 in regulating angiogenesis and apoptosis in an animal model of NMIBC, as well as, compared these mechanisms with BCG treatment. Our results demonstrated the activation of the immune system by BCG (MyD88-dependent pathway) resulted in increased inflammatory cytokines. However, P-MAPA intravesical immunotherapy led to distinct activation of TLRs 2 and 4-mediated innate immune system, resulting in increased interferons signaling pathway (TRIF-dependent pathway), which was more effective in the NMIBC treatment. Interferon signaling pathway activation induced by P-MAPA led to increase of iNOS protein levels, resulting in apoptosis and histopathological recovery. Additionally, P-MAPA immunotherapy increased wild-type p53 protein levels. The increased wild-type p53 protein levels were fundamental to NO-induced apoptosis and the up-regulation of BAX. Furthermore, interferon signaling pathway induction and increased p53 protein levels by P-MAPA led to important antitumor effects, not only suppressing abnormal cell proliferation, but also by preventing continuous expansion of tumor mass through suppression of angiogenesis, which was characterized by decreased VEGF and increased endostatin protein levels. Thus, P-MAPA immunotherapy could be considered an important therapeutic
C26 cancer-induced muscle wasting is IKKβ-dependent and NF-kappaB-independent.
Directory of Open Access Journals (Sweden)
Evangeline W Cornwell
Full Text Available Existing data suggest that NF-kappaB signaling is a key regulator of cancer-induced skeletal muscle wasting. However, identification of the components of this signaling pathway and of the NF-κB transcription factors that regulate wasting is far from complete. In muscles of C26 tumor bearing mice, overexpression of dominant negative (d.n. IKKβ blocked muscle wasting by 69% and the IκBα-super repressor blocked wasting by 41%. In contrast, overexpression of d.n. IKKα or d.n. NIK did not block C26-induced wasting. Surprisingly, overexpression of d.n. p65 or d.n. c-Rel did not significantly affect muscle wasting. Genome-wide mRNA expression arrays showed upregulation of many genes previously implicated in muscle atrophy. To test if these upregulated genes were direct targets of NF-κB transcription factors, we compared genome-wide p65 binding to DNA in control and cachectic muscle using ChIP-sequencing. Bioinformatic analysis of ChIP-sequencing data from control and C26 muscles showed very little p65 binding to genes in cachexia and little to suggest that upregulated p65 binding influences the gene expression associated with muscle based cachexia. The p65 ChIP-seq data are consistent with our finding of no significant change in protein binding to an NF-κB oligonucleotide in a gel shift assay, no activation of a NF-κB-dependent reporter, and no effect of d.n.p65 overexpression in muscles of tumor bearing mice. Taken together, these data support the idea that although inhibition of IκBα, and particularly IKKβ, blocks cancer-induced wasting, the alternative NF-κB signaling pathway is not required. In addition, the downstream NF-κB transcription factors, p65 and c-Rel do not appear to regulate the transcriptional changes induced by the C26 tumor. These data are consistent with the growing body of literature showing that there are NF-κB-independent substrates of IKKβ and IκBα that regulate physiological processes.
p53 Dependent Centrosome Clustering Prevents Multipolar Mitosis in Tetraploid Cells
Yi, Qiyi; Zhao, Xiaoyu; Huang, Yun; Ma, Tieliang; Zhang, Yingyin; Hou, Heli; Cooke, Howard J.; Yang, Da-Qing; Wu, Mian; Shi, Qinghua
2011-01-01
Background p53 abnormality and aneuploidy often coexist in human tumors, and tetraploidy is considered as an intermediate between normal diploidy and aneuploidy. The purpose of this study was to investigate whether and how p53 influences the transformation from tetraploidy to aneuploidy. Principal Findings Live cell imaging was performed to determine the fates and mitotic behaviors of several human and mouse tetraploid cells with different p53 status, and centrosome and spindle immunostaining was used to investigate centrosome behaviors. We found that p53 dominant-negative mutation, point mutation, or knockout led to a 2∼ 33-fold increase of multipolar mitosis in N/TERT1, 3T3 and mouse embryonic fibroblasts (MEFs), while mitotic entry and cell death were not significantly affected. In p53-/- tetraploid MEFs, the ability of centrosome clustering was compromised, while centrosome inactivation was not affected. Suppression of RhoA/ROCK activity by specific inhibitors in p53-/- tetraploid MEFs enhanced centrosome clustering, decreased multipolar mitosis from 38% to 20% and 16% for RhoA and ROCK, respectively, while expression of constitutively active RhoA in p53+/+ tetraploid 3T3 cells increased the frequency of multipolar mitosis from 15% to 35%. Conclusions p53 could not prevent tetraploid cells entering mitosis or induce tetraploid cell death. However, p53 abnormality impaired centrosome clustering and lead to multipolar mitosis in tetraploid cells by modulating the RhoA/ROCK signaling pathway. PMID:22076149
Limited role of murine ATM in oncogene-induced senescence and p53-dependent tumor suppression.
Directory of Open Access Journals (Sweden)
Alejo Efeyan
Full Text Available Recent studies in human fibroblasts have provided a new general paradigm of tumor suppression according to which oncogenic signaling produces DNA damage and this, in turn, results in ATM/p53-dependent cellular senescence. Here, we have tested this model in a variety of murine experimental systems. Overexpression of oncogenic Ras in murine fibroblasts efficiently induced senescence but this occurred in the absence of detectable DNA damage signaling, thus suggesting a fundamental difference between human and murine cells. Moreover, lung adenomas initiated by endogenous levels of oncogenic K-Ras presented abundant senescent cells, but undetectable DNA damage signaling. Accordingly, K-Ras-driven adenomas were also senescent in Atm-null mice, and the tumorigenic progression of these lesions was only modestly accelerated by Atm-deficiency. Finally, we have examined chemically-induced fibrosarcomas, which possess a persistently activated DNA damage response and are highly sensitive to the activity of p53. We found that the absence of Atm favored genomic instability in the resulting tumors, but did not affect the persistent DNA damage response and did not impair p53-dependent tumor suppression. All together, we conclude that oncogene-induced senescence in mice may occur in the absence of a detectable DNA damage response. Regarding murine Atm, our data suggest that it plays a minor role in oncogene-induced senescence or in p53-dependent tumor suppression, being its tumor suppressive activity probably limited to the maintenance of genomic stability.
GTPBP4 Promotes Gastric Cancer Progression via Regulating P53 Activity
Directory of Open Access Journals (Sweden)
Li Li
2018-01-01
Full Text Available Background/Aims: gastric cancer is a serious health concern with high morbidity and mortality. Therefore, it is urgent to find novel targets for gastric cancer diagnosis and treatment. Methods: qRT-PCR and immunohistochemistry assays were used to detect GTPBP4 expression in gastric cancer tissues, and gastric cancer and gastric epithelial cells. Lentivirus infection was used to construct GTPBP4 stable knockdown cells. Annexin V/PI apoptosis, CCK8, EdU incorporation and cell clone formation analysis were performed to evaluate the effects of GTPBP4 on gastric cancer cell proliferation and apoptosis. Further RNA-based high-throughput sequencing and co-IP assays were constructed to explore the related mechanisms contributing to GTPBP4-mediated effects. Results: GTPBP4 expression was significantly increased in gastric cancer tissues compared with that in adjacent normal tissues, and positively correlated with gastric cancer stages. Meanwhile, GTPBP4 level was markedly upregulated in gastric cancer cells than in gastric epithelial cells. Additionaly, stable knockdown of GTPBP4 inhibited cell proliferation and promoted cell apoptosis. Mechanistically, p53 and its related signaling were significantly activated in GTPBP4 stable knockdown cells. And GTPBP4 interacted with p53 in gastric cancer cells. Conclusions: our results provide insights into mechanistic regulation and linkage of the GTPBP4-p53 in gastric cancer, and also a valuable potential target for gastric cancer.
Energy Technology Data Exchange (ETDEWEB)
Moss, Patrice E.; Lyles, Besstina E.; Stewart, LaMonica V., E-mail: lstewart@mmc.edu
2010-12-10
The androgen receptor (AR) regulates growth and progression of androgen-dependent as well as androgen-independent prostate cancer cells. Peroxisome proliferator-activated receptor gamma (PPAR{gamma}) agonists have been reported to reduce AR activation in androgen-dependent LNCaP prostate cancer cells. To determine whether PPAR{gamma} ligands are equally effective at inhibiting AR activity in androgen-independent prostate cancer, we examined the effect of the PPAR{gamma} ligands ciglitazone and rosiglitazone on C4-2 cells, an androgen- independent derivative of the LNCaP cell line. Luciferase-based reporter assays and Western blot analysis demonstrated that PPAR{gamma} ligand reduced dihydrotestosterone (DHT)-induced increases in AR activity in LNCaP cells. However, in C4-2 cells, these compounds increased DHT-induced AR driven luciferase activity. In addition, ciglitazone did not significantly alter DHT-mediated increases in prostate specific antigen (PSA) protein or mRNA levels within C4-2 cells. siRNA-based experiments demonstrated that the ciglitazone-induced regulation of AR activity observed in C4-2 cells was dependent on the presence of PPAR{gamma}. Furthermore, overexpression of the AR corepressor cyclin D1 inhibited the ability of ciglitazone to induce AR luciferase activity in C4-2 cells. Thus, our data suggest that both PPAR{gamma} and cyclin D1 levels influence the ability of ciglitazone to differentially regulate AR signaling in androgen-independent C4-2 prostate cancer cells.
P53 status influences regulation of HSPs and ribosomal proteins by PDTC and radiation
International Nuclear Information System (INIS)
Thompson, John S.; Asmis, Reto; Glass, Judith; Liu Hua; Wilson, Colin; Nelson, Brandy; Brown, Stephen A.; Stromberg, Arnold J.
2006-01-01
Pyrrolidine dithiocarbamate (PDTC) is a thiol-containing compound that can act under varying conditions as an anti-oxidant or pro-oxidant. Utilizing microarrays, we determined the effect of PDTC +/- ionizing radiation (IR) on the expression of heat shock protein (HSP) genes in isolated B6/129 wild-type (WT) and p53-/- spleen cells. Extremely significant microarrays demonstrated that PDTC, but not IR, markedly up-regulated the expression of the majority of detectable HSP genes in WT and many to a significantly greater degree in p53-/- deficient cells. Determination of the glutathione/glutathione disulfide ratio indicated that PDTC was acting as a pro-oxidant under these conditions. From these data we conclude that the clinical use of 'antioxidants' with radiotherapy or chemotherapy must be very carefully based on knowledge of the p53 status of their intended normal and tumor target cells
Shi, Ming; Du, Libin; Liu, Dan; Qian, Lu; Hu, Meiru; Yu, Ming; Yang, Zhengyan; Zhao, Mingzhen; Chen, Changguo; Guo, Liang; Wang, Lina; Song, Lun; Ma, Yuanfang; Guo, Ning
2012-10-01
Glucocorticoids are stress-responsive neuroendocrine mediators and play an important role in malignant progression, especially in solid tumours. We demonstrate a novel mechanism by which glucocorticoids modulate p53-dependent miR-145 expression in HPV-positive cervical cancer cells through induction of E6 proteins. We found that expression of miR-145 was reduced in cervical cancer tissues. Cortisol induced HPV-E6 expression and suppressed p53 and miR-145 in cervical cancer cells. MiR-145 expression in cervical cancer cells was wild-type p53-dependent, and cortisol-induced down-regulation of miR-145 expression prevented chemotherapy-induced apoptosis, whereas over-expression of miR-145 enhanced sensitivity to mitomycin and reversed the chemoresistance induced by glucocorticoids. We also show that miR-145 augments the effects of p53 by suppressing the inhibitors of p53 in cervical cancer cells, suggesting that miR-145 plays a role in p53 tumour suppression. Finally, we demonstrate that miR-145 inhibits both the motility and invasion of cervical cancer cells. Our findings identify a novel pathway through which the neuroendocrine macroenvironment affects cervical tumour growth, invasion and therapy resistance and show that miR-145 may serve as a target for cervical cancer therapy. Copyright © 2012 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2012 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Lars Poulsen
Full Text Available Acid formation in Aspergillus niger is known to be subjected to tight regulation, and the acid production profiles are fine-tuned to respond to the ambient pH. Based on transcriptome data, putative trans-acting pH responding transcription factors were listed and through knock out studies, mutants exhibiting an oxalate overproducing phenotype were identified. The yield of oxalate was increased up to 158% compared to the wild type and the corresponding transcription factor was therefore entitled Oxalic Acid repression Factor, OafA. Detailed physiological characterization of one of the ΔoafA mutants, compared to the wild type, showed that both strains produced substantial amounts of gluconic acid, but the mutant strain was more efficient in re-uptake of gluconic acid and converting it to oxalic acid, particularly at high pH (pH 5.0. Transcriptional profiles showed that 241 genes were differentially expressed due to the deletion of oafA and this supported the argument of OafA being a trans-acting transcription factor. Furthermore, expression of two phosphoketolases was down-regulated in the ΔoafA mutant, one of which has not previously been described in fungi. It was argued that the observed oxalate overproducing phenotype was a consequence of the efficient re-uptake of gluconic acid and thereby a higher flux through glycolysis. This results in a lower flux through the pentose phosphate pathway, demonstrated by the down-regulation of the phosphoketolases. Finally, the physiological data, in terms of the specific oxygen consumption, indicated a connection between the oxidative phosphorylation and oxalate production and this was further substantiated through transcription analysis.
International Nuclear Information System (INIS)
Suzuki, Katsura; Inageda, Kiyoshi; Nishitai, Gen; Matsuoka, Masato
2007-01-01
When A549 cells were exposed to sodium metavanadate (NaVO 3 ), the pentavalent species of vanadium (vanadate), phosphorylation of p53 protein at Ser15 was found in a time (8-48 h)- and dose (10-200 μM)-dependent manner. After the incubation with 50 or 100 μM NaVO 3 for 48 h, accumulation of p53 protein was accompanied with Ser15 phosphorylation. Among serines in p53 protein immunoprecipitated from A549 cells treated with 100 μM NaVO 3 for 48 h, only Ser15 was markedly phosphorylated. Treatment with other vanadate compounds, sodium orthovanadate (Na 3 VO 4 ) and ammonium metavanadate (NH 4 VO 3 ), also induced Ser15 phosphorylation and accumulation of p53 protein. While phosphorylation of extracellular signal-regulated protein kinase (ERK) was found in cells treated with NaVO 3 , treatment with U0126 did not suppress Ser15 phosphorylation. On the other hand, treatment with wortmannin or caffeine, the inhibitors to phosphatidylinositol 3-kinase related kinases (PIKKs), suppressed both NaVO 3 -induced Ser15 phosphorylation and accumulation of p53 protein. The silencing of ataxia telangiectasia mutated (ATM) expression using short-interference RNA resulted in the marked suppression of Ser15 phosphorylation in A549 cells exposed to NaVO 3 . However, treatment with antioxidants such as catalase and N-acetylcysteine did not suppress NaVO 3 -induced Ser15 phosphorylation. Transcriptional activation of p53 and DNA fragmentation in A549 cells treated with NaVO 3 were suppressed only slightly by S15A mutation, suggesting that Ser15 phosphorylation is not essential for these responses. The present results showed that vanadate induces the phosphorylation of p53 at Ser15 depending on ATM, one of the members of PIKK family, in this human pulmonary epithelial cell line
Concentration and length dependence of DNA looping in transcriptional regulation.
Directory of Open Access Journals (Sweden)
Lin Han
2009-05-01
Full Text Available In many cases, transcriptional regulation involves the binding of transcription factors at sites on the DNA that are not immediately adjacent to the promoter of interest. This action at a distance is often mediated by the formation of DNA loops: Binding at two or more sites on the DNA results in the formation of a loop, which can bring the transcription factor into the immediate neighborhood of the relevant promoter. These processes are important in settings ranging from the historic bacterial examples (bacterial metabolism and the lytic-lysogeny decision in bacteriophage, to the modern concept of gene regulation to regulatory processes central to pattern formation during development of multicellular organisms. Though there have been a variety of insights into the combinatorial aspects of transcriptional control, the mechanism of DNA looping as an agent of combinatorial control in both prokaryotes and eukaryotes remains unclear. We use single-molecule techniques to dissect DNA looping in the lac operon. In particular, we measure the propensity for DNA looping by the Lac repressor as a function of the concentration of repressor protein and as a function of the distance between repressor binding sites. As with earlier single-molecule studies, we find (at least two distinct looped states and demonstrate that the presence of these two states depends both upon the concentration of repressor protein and the distance between the two repressor binding sites. We find that loops form even at interoperator spacings considerably shorter than the DNA persistence length, without the intervention of any other proteins to prebend the DNA. The concentration measurements also permit us to use a simple statistical mechanical model of DNA loop formation to determine the free energy of DNA looping, or equivalently, the for looping.
Grison, Alice; Mantovani, Fiamma; Comel, Anna; Agostoni, Elena; Gustincich, Stefano; Persichetti, Francesca; Del Sal, Giannino
2011-11-01
Huntington disease (HD) is a neurodegenerative disorder caused by a CAG repeat expansion in the gene coding for huntingtin protein. Several mechanisms have been proposed by which mutant huntingtin (mHtt) may trigger striatal neurodegeneration, including mitochondrial dysfunction, oxidative stress, and apoptosis. Furthermore, mHtt induces DNA damage and activates a stress response. In this context, p53 plays a crucial role in mediating mHtt toxic effects. Here we have dissected the pathway of p53 activation by mHtt in human neuronal cells and in HD mice, with the aim of highlighting critical nodes that may be pharmacologically manipulated for therapeutic intervention. We demonstrate that expression of mHtt causes increased phosphorylation of p53 on Ser46, leading to its interaction with phosphorylation-dependent prolyl isomerase Pin1 and consequent dissociation from the apoptosis inhibitor iASPP, thereby inducing the expression of apoptotic target genes. Inhibition of Ser46 phosphorylation by targeting homeodomain-interacting protein kinase 2 (HIPK2), PKCδ, or ataxia telangiectasia mutated kinase, as well as inhibition of the prolyl isomerase Pin1, prevents mHtt-dependent apoptosis of neuronal cells. These results provide a rationale for the use of small-molecule inhibitors of stress-responsive protein kinases and Pin1 as a potential therapeutic strategy for HD treatment.
SV40 large T-p53 complex: evidence for the presence of two immunologically distinct forms of p53
International Nuclear Information System (INIS)
Milner, J.; Gamble, J.
1985-01-01
The transforming protein of SV40 is the large T antigen. Large T binds a cellular protein, p53, which is potentially oncogenic by virtue of its functional involvement in the control of cell proliferation. This raises the possibility that p53 may mediate, in part, the transforming function of SV40 large T. Two immunologically distinct forms of p53 have been identified in normal cells: the forms are cell-cycle dependent, one being restricted to nondividing cells (p53-Go) and the second to dividing cells (p53-G divided by). The authors have now dissociated and probed the multimeric complex of SV40 large T-p53 for the presence of immunologically distinct forms of p53. Here they present evidence for the presence of p53-Go and p53-G divided by complexed with SV40 large T
IGF-I enhances cellular senescence via the reactive oxygen species-p53 pathway
Energy Technology Data Exchange (ETDEWEB)
Handayaningsih, Anastasia-Evi; Takahashi, Michiko; Fukuoka, Hidenori; Iguchi, Genzo; Nishizawa, Hitoshi; Yamamoto, Masaaki; Suda, Kentaro [Division of Diabetes and Endocrinology, Department of Internal Medicine, Kobe University Graduate School of Medicine, Kobe (Japan); Takahashi, Yutaka, E-mail: takahash@med.kobe-u.ac.jp [Division of Diabetes and Endocrinology, Department of Internal Medicine, Kobe University Graduate School of Medicine, Kobe (Japan)
2012-08-24
Highlights: Black-Right-Pointing-Pointer Cellular senescence plays an important role in tumorigenesis and aging process. Black-Right-Pointing-Pointer We demonstrated IGF-I enhanced cellular senescence in primary confluent cells. Black-Right-Pointing-Pointer IGF-I enhanced cellular senescence in the ROS and p53-dependent manner. Black-Right-Pointing-Pointer These results may explain the underlying mechanisms of IGF-I involvement in tumorigenesis and in regulation of aging. -- Abstract: Cellular senescence is characterized by growth arrest, enlarged and flattened cell morphology, the expression of senescence-associated {beta}-galactosidase (SA-{beta}-gal), and by activation of tumor suppressor networks. Insulin-like growth factor-I (IGF-I) plays a critical role in cellular growth, proliferation, tumorigenesis, and regulation of aging. In the present study, we show that IGF-I enhances cellular senescence in mouse, rat, and human primary cells in the confluent state. IGF-I induced expression of a DNA damage marker, {gamma}H2AX, the increased levels of p53 and p21 proteins, and activated SA-{beta}-gal. In the confluent state, an altered downstream signaling of IGF-I receptor was observed. Treatment with a reactive oxygen species (ROS) scavenger, N-acetylcystein (NAC) significantly suppressed induction of these markers, indicating that ROS are involved in the induction of cellular senescence by IGF-I. In p53-null mouse embryonic fibroblasts, the IGF-I-induced augmentation of SA-{beta}-gal and p21 was inhibited, demonstrating that p53 is required for cellular senescence induced by IGF-I. Thus, these data reveal a novel pathway whereby IGF-I enhances cellular senescence in the ROS and p53-dependent manner and may explain the underlying mechanisms of IGF-I involvement in tumorigenesis and in regulation of aging.
IGF-I enhances cellular senescence via the reactive oxygen species–p53 pathway
International Nuclear Information System (INIS)
Handayaningsih, Anastasia-Evi; Takahashi, Michiko; Fukuoka, Hidenori; Iguchi, Genzo; Nishizawa, Hitoshi; Yamamoto, Masaaki; Suda, Kentaro; Takahashi, Yutaka
2012-01-01
Highlights: ► Cellular senescence plays an important role in tumorigenesis and aging process. ► We demonstrated IGF-I enhanced cellular senescence in primary confluent cells. ► IGF-I enhanced cellular senescence in the ROS and p53-dependent manner. ► These results may explain the underlying mechanisms of IGF-I involvement in tumorigenesis and in regulation of aging. -- Abstract: Cellular senescence is characterized by growth arrest, enlarged and flattened cell morphology, the expression of senescence-associated β-galactosidase (SA-β-gal), and by activation of tumor suppressor networks. Insulin-like growth factor-I (IGF-I) plays a critical role in cellular growth, proliferation, tumorigenesis, and regulation of aging. In the present study, we show that IGF-I enhances cellular senescence in mouse, rat, and human primary cells in the confluent state. IGF-I induced expression of a DNA damage marker, γH2AX, the increased levels of p53 and p21 proteins, and activated SA-β-gal. In the confluent state, an altered downstream signaling of IGF-I receptor was observed. Treatment with a reactive oxygen species (ROS) scavenger, N-acetylcystein (NAC) significantly suppressed induction of these markers, indicating that ROS are involved in the induction of cellular senescence by IGF-I. In p53-null mouse embryonic fibroblasts, the IGF-I-induced augmentation of SA-β-gal and p21 was inhibited, demonstrating that p53 is required for cellular senescence induced by IGF-I. Thus, these data reveal a novel pathway whereby IGF-I enhances cellular senescence in the ROS and p53-dependent manner and may explain the underlying mechanisms of IGF-I involvement in tumorigenesis and in regulation of aging.
PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage.
Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C
2012-12-13
p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments.
Directory of Open Access Journals (Sweden)
Zölzer Friedo
2014-12-01
Full Text Available Background. Many pathways seem to be involved in the regulation of the intra-S-phase checkpoint after exposure to ionizing radiation, but the role of p53 has proven to be rather elusive. Here we have a closer look at the progression of irradiated cells through S-phase in dependence of their p53 status.
Epstein-Barr virus nuclear antigen 3C stabilizes Gemin3 to block p53-mediated apoptosis.
Directory of Open Access Journals (Sweden)
Qiliang Cai
2011-12-01
Full Text Available The Epstein-Barr nuclear antigen 3C (EBNA3C, one of the essential latent antigens for Epstein-Barr virus (EBV-induced immortalization of primary human B lymphocytes in vitro, has been implicated in regulating cell proliferation and anti-apoptosis via interaction with several cellular and viral factors. Gemin3 (also named DDX20 or DP103 is a member of DEAD RNA helicase family which exhibits diverse cellular functions including DNA transcription, recombination and repair, and RNA metabolism. Gemin3 was initially identified as a binding partner to EBNA2 and EBNA3C. However, the mechanism by which EBNA3C regulates Gemin3 function remains unclear. Here, we report that EBNA3C directly interacts with Gemin3 through its C-terminal domains. This interaction results in increased stability of Gemin3 and its accumulation in both B lymphoma cells and EBV transformed lymphoblastoid cell lines (LCLs. Moreover, EBNA3C promotes formation of a complex with p53 and Gemin3 which blocks the DNA-binding affinity of p53. Small hairpin RNA based knockdown of Gemin3 in B lymphoma or LCL cells remarkably attenuates the ability of EBNA3C to inhibit the transcription activity of p53 on its downstream genes p21 and Bax, as well as apoptosis. These findings provide the first evidence that Gemin3 may be a common target of oncogenic viruses for driving cell proliferation and anti-apoptotic activities.
p53-Dependent suppression of genome instability in germ cells
Energy Technology Data Exchange (ETDEWEB)
Otozai, Shinji [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Ishikawa-Fujiwara, Tomoko [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Oda, Shoji [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Kamei, Yasuhiro [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ryo, Haruko [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Sato, Ayuko [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Nomura, Taisei [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Mitani, Hiroshi [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Tsujimura, Tohru [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Inohara, Hidenori [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Todo, Takeshi, E-mail: todo@radbio.med.osaka-u.ac.jp [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)
2014-02-15
Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2{sup −/−} fish had a high frequency of spontaneous MSI. • p53{sup −/−} fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2{sup −/−} males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2{sup −/−} and wild-type fish. By contrast, irradiated p53{sup −/−} fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2{sup −/−} fish, but negligible levels in p53{sup −/−} fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells.
p53-Dependent suppression of genome instability in germ cells
International Nuclear Information System (INIS)
Otozai, Shinji; Ishikawa-Fujiwara, Tomoko; Oda, Shoji; Kamei, Yasuhiro; Ryo, Haruko; Sato, Ayuko; Nomura, Taisei; Mitani, Hiroshi; Tsujimura, Tohru; Inohara, Hidenori; Todo, Takeshi
2014-01-01
Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2 −/− fish had a high frequency of spontaneous MSI. • p53 −/− fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2 −/− males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2 −/− and wild-type fish. By contrast, irradiated p53 −/− fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2 −/− fish, but negligible levels in p53 −/− fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells
Energy Technology Data Exchange (ETDEWEB)
Langland, Gregory T.; Yannone, Steven M.; Langland, Rachel A.; Nakao, Aki; Guan, Yinghui; Long, Sydney B.T.; Vonguyen, Lien; Chen, David J.; Gray, Joe W; Chen, Fanqing
2009-09-07
The variability of radiation responses in ovarian tumors and tumor-derived cell lines is poorly understood. Since both DNA repair capacity and p53 status can significantly alter radiation sensitivity, we evaluated these factors along with radiation sensitivity in a panel of sporadic human ovarian carcinoma cell lines. We observed a gradation of radiation sensitivity among these sixteen lines, with a five-fold difference in the LD50 between the most radiosensitive and the most radioresistant cells. The DNA-dependent protein kinase (DNA-PK) is essential for the repair of radiation induced DNA double-strand breaks in human somatic cells. Therefore, we measured gene copy number, expression levels, protein abundance, genomic copy and kinase activity for DNA-PK in all of our cell lines. While there were detectable differences in DNA-PK between the cell lines, there was no clear correlation with any of these differences and radiation sensitivity. In contrast, p53 function as determined by two independent methods, correlated well with radiation sensitivity, indicating p53 mutant ovarian cancer cells are typically radioresistant relative to p53 wild-type lines. These data suggest that the activity of regulatory molecules such as p53 may be better indicators of radiation sensitivity than DNA repair enzymes such as DNAPK in ovarian cancer.
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
Zhang, Qingyu; Liu, Jie; Liu, Bin; Xia, Juan; Chen, Nianping; Chen, Xiaofeng; Cao, Yi; Zhang, Chen; Lu, Caijie; Li, Mingyi; Zhu, Runzhi
2014-04-01
The development of antitumor chemotherapy drugs remains a key goal for oncologists, and natural products provide a vast resource for anti-cancer drug discovery. In the current study, we found that the flavonoid dihydromyricetin (DHM) exhibited antitumor activity against liver cancer cells, including primary cells obtained from hepatocellular carcinoma (HCC) patients. In contrast, DHM was not cytotoxic to immortalized normal liver cells. Furthermore, DHM treatment resulted in the growth inhibition and remission of xenotransplanted tumors in nude mice. Our results further demonstrated that this antitumor activity was caused by the activation of the p53-dependent apoptosis pathway via p53 phosphorylation at serine (15Ser). Moreover, our results showed that DHM plays a dual role in the induction of cell death when administered in combination with cisplatin, a common clinical drug that kills primary hepatoma cells but not normal liver cells.
Wang, H; Ma, L; Li, Y; Cho, C H
2000-04-01
Cigarette smoking is a major risk factor for gastric cancer and peptic ulcer. The aim of our study was to investigate the relationship between exposure to cigarette smoke and apoptosis in the rat gastric mucosa and the mechanism involved. Rats were exposed to different concentrations of cigarette smoke (0, 2, and 4%) once daily for a different number of 1 h periods (1, 3, 6, and 9 d). Apoptosis was identified by the terminal deoxy-transferase (TdT)-mediated dUTP-biotin nick end labeling (TUNEL) method and caspase-3 activity. The mucosal xanthine oxidase (XO) activity and p53 level were also measured. The results showed that exposure to cigarette smoke produced a time- and concentration-dependent increase in apoptosis in the rat gastric mucosa that was accompanied by an increase in XO activity. The increased apoptosis and XO activity could be detected after even a single exposure. In contrast, the level of p53 was elevated only in the later stage of cigarette smoke exposure. The apoptotic effect could be blocked by pretreatment with an XO inhibitor (allopurinol, 20 mg/kg intraperitoneally) or a hydroxyl free radical scavenger (DMSO, 0.2%, 1 ml/kg intravenously). However, neither of these treatments had any effect on the p53 level of the mucosa. In summary, we conclude that exposure to cigarette smoke can increase apoptosis in the rat gastric mucosa through a reactive oxygen species- (ROS) mediated and a p53-independent pathway.
Targeting the p53 Pathway in Ewing Sarcoma
Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.
2011-01-01
The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471
TLR4 has a TP53-dependent dual role in regulating breast cancer cell growth.
Haricharan, Svasti; Brown, Powel
2015-06-23
Breast cancer is a leading cause of cancer-related death, and it is important to understand pathways that drive the disease to devise effective therapeutic strategies. Our results show that Toll-like receptor 4 (TLR4) drives breast cancer cell growth differentially based on the presence of TP53, a tumor suppressor. TP53 is mutationally inactivated in most types of cancer and is mutated in 30-50% of diagnosed breast tumors. We demonstrate that TLR4 activation inhibits growth of TP53 wild-type cells, but promotes growth of TP53 mutant breast cancer cells by regulating proliferation. This differential effect is mediated by changes in tumor cell cytokine secretion. Whereas TLR4 activation in TP53 mutant breast cancer cells increases secretion of progrowth cytokines, TLR4 activation in TP53 wild-type breast cancer cells increases type I IFN (IFN-γ) secretion, which is both necessary and sufficient for mediating TLR4-induced growth inhibition. This study identifies a novel dichotomous role for TLR4 as a growth regulator and a modulator of tumor microenvironment in breast tumors. These results have translational relevance, demonstrating that TP53 mutant breast tumor growth can be suppressed by pharmacologic TLR4 inhibition, whereas TLR4 inhibitors may in fact promote growth of TP53 wild-type tumors. Furthermore, using data generated by The Cancer Genome Atlas consortium, we demonstrate that the effect of TP53 mutational status on TLR4 activity may extend to ovarian, colon, and lung cancers, among others, suggesting that the viability of TLR4 as a therapeutic target depends on TP53 status in many different tumor types.
Contreras, Esteban G; Sierralta, Jimena; Glavic, Alvaro
2018-01-01
Animal growth is influenced by the genetic background and the environmental circumstances. How genes promote growth and coordinate adaptation to nutrient availability is still an open question. p53 is a transcription factor that commands the cellular response to different types of stresses. In adult Drosophila melanogaster, p53 regulates the metabolic adaptation to nutrient restriction that supports fly viability. Furthermore, the larval brain is protected from nutrient restriction in a phenomenon called 'brain sparing'. Therefore, we hypothesised that p53 may regulate brain growth and show a protective role over brain development under nutrient restriction. Here, we studied the function of p53 during brain growth in normal conditions and in animals subjected to developmental nutrient restriction. We showed that p53 loss of function reduced animal growth and larval brain size. Endogenous p53 was expressed in larval neural stem cells, but its levels and activity were not affected by nutritional stress. Interestingly, p53 knockdown only in neural stem cells was sufficient to decrease larval brain growth. Finally, we showed that in p53 mutant larvae under nutrient restriction, the energy storage levels were not altered, and these larvae generated adults with brains of similar size than wild-type animals. Using genetic approaches, we demonstrate that p53 is required for proper growth of the larval brain. This developmental role of p53 does not have an impact on animal resistance to nutritional stress since brain growth in p53 mutants under nutrient restriction is similar to control animals.
Bioluminescence Detection of Cells Having Stabilized p53 in Response to a Genotoxic Event
Directory of Open Access Journals (Sweden)
Alnawaz Rehemtulla
2004-01-01
Full Text Available Inactivation of p53 is one of the most frequent molecular events in neoplastic transformation. Approximately 60% of all human tumors have mutations in both p53 alleles. Wild-type p53 activity is regulated in large part by the proteosome-dependent degradation of p53, resulting in a short p53 half-life in unstressed and untransformed cells. Activation of p53 by a variety of stimuli, including DNA damage induced by genotoxic drugs or radiation, is accomplished by stabilization of wild-type p53. The stabilized and active p53 can result in either cell-cycle arrest or apoptosis. Surprisingly, the majority of tumor-associated, inactivating p53 mutations also result in p53 accumulation. Thus, constitutive elevation of p53 levels in cells is a reliable measure of p53 inactivation, whereas transiently increased p53 levels reflect a recent genotoxic stress. In order to facilitate noninvasive imaging of p53 accumulation, we here describe the construction of a p53-luciferase fusion protein. Induction of DNA damage in cells expressing the fusion protein resulted in a time-dependent accumulation of the fusion that was noninvasively detected using bioluminescence imaging and validated by Western blot analysis. The p53-Luc protein retains p53 function because its expression in HCT116 cells lacking functional p53 resulted in activation of p21 expression as well as induction of apoptosis in response to a DNA damaging event. Employed in a transgenic animal model, the proposed p53-reporter fusion protein will be useful for studying p53 activation in response to exposure to DNA-damaging carcinogenic agents. It could also be used to study p53 stabilization as a result of inactivating p53 mutations. Such studies will further our understanding of p53's role as the “guardian of the genome” and its function in tumorigenesis.
He, Ronglin; Ma, Lijuan; Li, Chen; Jia, Wendi; Li, Demao; Zhang, Dongyuan; Chen, Shulin
2014-12-01
Fungi grow over a relatively wide pH range and adapt to extracellular pH through a genetic regulatory system mediated by a key component PacC, which is a pH transcription regulator. The cellulase production of the filamentous fungi Trichoderma reesei is sensitive to ambient pH. To investigate the connection between cellulase expression regulation and ambient pH, an ortholog of Aspergillus nidulans pacC, Trpac1, was identified and functionally characterized using a target gene deletion strategy. Deleting Trpac1 dramatically increased the cellulase production and the transcription levels of the major cellulase genes at neutral pH, which suggested Trpac1 is involved in the regulation of cellulase production. It was further observed that the expression levels of transcription factors xyr1 and ace2 also increased in the ΔTrpac1 mutant at neutral pH. In addition, the ΔTrpac1 mutant exhibited conidiation defects under neutral and alkaline pH. These results implied that Trpac1 in involved in growth and development process and cellulase gene expression in T. reesei. Copyright © 2014 Elsevier Inc. All rights reserved.
Kerchev, Pavel I; Pellny, Till K; Vivancos, Pedro Diaz; Kiddle, Guy; Hedden, Peter; Driscoll, Simon; Vanacker, Hélène; Verrier, Paul; Hancock, Robert D; Foyer, Christine H
2011-09-01
Cellular redox homeostasis is a hub for signal integration. Interactions between redox metabolism and the ABSCISIC ACID-INSENSITIVE-4 (ABI4) transcription factor were characterized in the Arabidopsis thaliana vitamin c defective1 (vtc1) and vtc2 mutants, which are defective in ascorbic acid synthesis and show a slow growth phenotype together with enhanced abscisic acid (ABA) levels relative to the wild type (Columbia-0). The 75% decrease in the leaf ascorbate pool in the vtc2 mutants was not sufficient to adversely affect GA metabolism. The transcriptome signatures of the abi4, vtc1, and vtc2 mutants showed significant overlap, with a large number of transcription factors or signaling components similarly repressed or induced. Moreover, lincomycin-dependent changes in LIGHT HARVESTING CHLOROPHYLL A/B BINDING PROTEIN 1.1 expression were comparable in these mutants, suggesting overlapping participation in chloroplast to nucleus signaling. The slow growth phenotype of vtc2 was absent in the abi4 vtc2 double mutant, as was the sugar-insensitive phenotype of the abi4 mutant. Octadecanoid derivative-responsive AP2/ERF-domain transcription factor 47 (ORA47) and AP3 (an ABI5 binding factor) transcripts were enhanced in vtc2 but repressed in abi4 vtc2, suggesting that ABI4 and ascorbate modulate growth and defense gene expression through jasmonate signaling. We conclude that low ascorbate triggers ABA- and jasmonate-dependent signaling pathways that together regulate growth through ABI4. Moreover, cellular redox homeostasis exerts a strong influence on sugar-dependent growth regulation.
Loss of Geminin induces rereplication in the presence of functional p53
DEFF Research Database (Denmark)
Melixetian, Marina; Ballabeni, Andrea; Masiero, Laura
2004-01-01
nuclear foci. Abrogation of the checkpoint leads to abortive mitosis and death of rereplicated cells. In addition, we demonstrate that the induction of rereplication is dependent on the replication initiation factors CDT1 and CDC6, and independent of the functional status of p53. These data show...
p53 represses autophagy in a cell cycle-dependent fashion.
Tasdemir, Ezgi; Maiuri, Maria Chiara; Orhon, Idil; Kepp, Oliver; Morselli, Eugenia; Criollo, Alfredo; Kroemer, Guido
2008-10-01
Autophagy is one of the principal mechanisms of cellular defense against nutrient depletion and damage to cytoplasmic organelles. When p53 is inhibited by a pharmacological antagonist (cyclic pifithrin-alpha), depleted by a specific small interfering RNA (siRNA) or deleted by homologous recombination, multiple signs of autophagy are induced. Here, we show by epistatic analysis that p53 inhibition results in a maximum level of autophagy that cannot be further enhanced by a variety of different autophagy inducers including lithium, tunicamycin-induced stress of the endoplasmic reticulum (ER) or inhibition of Bcl-2 and Bcl-X(L) with the BH3 mimetic ABT737. Chemical inducers of autophagy (including rapamycin, lithium, tunicamycin and ABT737) induced rapid depletion of the p53 protein. The absence or the inhibition of p53 caused autophagy mostly in the G(1) phase, less so in the S phase and spares the G(2)/M phase of the cell cycle. The possible pathophysiological implications of these findings are discussed.
The transcription factor Foxc1 is necessary for Ihh-Gli2-regulated endochondral ossification.
Yoshida, Michiko; Hata, Kenji; Takashima, Rikako; Ono, Koichiro; Nakamura, Eriko; Takahata, Yoshifumi; Murakami, Tomohiko; Iseki, Sachiko; Takano-Yamamoto, Teruko; Nishimura, Riko; Yoneda, Toshiyuki
2015-03-26
Indian hedgehog (Ihh) regulates endochondral ossification in both a parathyroid hormone-related protein (PTHrP)-dependent and -independent manner by activating transcriptional mediator Gli2. However, the molecular mechanisms underlying these processes remain elusive. Here by using in vivo microarray analysis, we identify forkhead box C1 (Foxc1) as a transcriptional partner of Gli2. Foxc1 stimulates expression of Ihh target genes, including PTHrP and Col10a1, through its physical and functional interaction with Gli2. Conversely, a dominant negative Foxc1 inhibits the Ihh target gene expression. In a spontaneous loss of Foxc1 function mouse (Foxc1(ch/ch)), endochondral ossification is delayed and the expression of Ihh target genes inhibited. Moreover, the pathological Foxc1 missense mutation observed in the Axenfeld-Rieger syndrome impairs Gli2-Foxc1 association as well as Ihh function. Our findings suggest that Foxc1 is an important transcriptional partner of Ihh-Gli2 signalling during endochondral ossification, and that disruption of the Foxc1-Gli2 interaction causes skeletal abnormalities observed in the Axenfeld-Rieger syndrome.
International Nuclear Information System (INIS)
Garcia, Patrick Vianna; Seiva, Fábio Rodrigues Ferreira; Carniato, Amanda Pocol; Mello Júnior, Wilson de; Duran, Nelson; Macedo, Alda Maria; Oliveira, Alexandre Gabarra de; Romih, Rok; Nunes, Iseu da Silva; Nunes, Odilon da Silva; Fávaro, Wagner José
2016-01-01
The new modalities for treating patients with non-muscle invasive bladder cancer (NMIBC) for whom BCG (Bacillus Calmette-Guerin) has failed or is contraindicated are recently increasing due to the development of new drugs. Although agents like mitomycin C and BCG are routinely used, there is a need for more potent and/or less-toxic agents. In this scenario, a new perspective is represented by P-MAPA (Protein Aggregate Magnesium-Ammonium Phospholinoleate-Palmitoleate Anhydride), developed by Farmabrasilis (non-profit research network). This study detailed and characterized the mechanisms of action of P-MAPA based on activation of mediators of Toll-like Receptors (TLRs) 2 and 4 signaling pathways and p53 in regulating angiogenesis and apoptosis in an animal model of NMIBC, as well as, compared these mechanisms with BCG treatment. Our results demonstrated the activation of the immune system by BCG (MyD88-dependent pathway) resulted in increased inflammatory cytokines. However, P-MAPA intravesical immunotherapy led to distinct activation of TLRs 2 and 4-mediated innate immune system, resulting in increased interferons signaling pathway (TRIF-dependent pathway), which was more effective in the NMIBC treatment. Interferon signaling pathway activation induced by P-MAPA led to increase of iNOS protein levels, resulting in apoptosis and histopathological recovery. Additionally, P-MAPA immunotherapy increased wild-type p53 protein levels. The increased wild-type p53 protein levels were fundamental to NO-induced apoptosis and the up-regulation of BAX. Furthermore, interferon signaling pathway induction and increased p53 protein levels by P-MAPA led to important antitumor effects, not only suppressing abnormal cell proliferation, but also by preventing continuous expansion of tumor mass through suppression of angiogenesis, which was characterized by decreased VEGF and increased endostatin protein levels. Thus, P-MAPA immunotherapy could be considered an important therapeutic
Integral analysis of p53 and its value as prognostic factor in sporadic colon cancer
International Nuclear Information System (INIS)
Fariña Sarasqueta, Arantza; Morreau, Hans; Forte, Giusi; Corver, Wim E; Miranda, Noel F de; Ruano, Dina; Eijk, Ronald van; Oosting, Jan; Tollenaar, Rob AEM; Wezel, Tom van
2013-01-01
p53 (encoded by TP53) is involved in DNA damage repair, cell cycle regulation, apoptosis, aging and cellular senescence. TP53 is mutated in around 50% of human cancers. Nevertheless, the consequences of p53 inactivation in colon cancer outcome remain unclear. Recently, a new role of p53 together with CSNK1A1 in colon cancer invasiveness has been described in mice. By combining data on different levels of p53 inactivation, we aimed to predict p53 functionality and to determine its effects on colon cancer outcome. Moreover, survival effects of CSNK1A1 together with p53 were also studied. Eighty-three formalin fixed paraffin embedded colon tumors were enriched for tumor cells using flow sorting, the extracted DNA was used in a custom SNP array to determine chr17p13-11 allelic state; p53 immunostaining, TP53 exons 5, 6, 7 and 8 mutations were determined in combination with mRNA expression analysis on frozen tissue. Patients with a predicted functional p53 had a better prognosis than patients with non functional p53 (Log Rank p=0.009). Expression of CSNK1A1 modified p53 survival effects. Patients with low CSNK1A1 expression and non-functional p53 had a very poor survival both in the univariate (Log Rank p<0.001) and in the multivariate survival analysis (HR=4.74 95% CI 1.45 – 15.3 p=0.009). The combination of mutational, genomic, protein and downstream transcriptional activity data predicted p53 functionality which is shown to have a prognostic effect on colon cancer patients. This effect was specifically modified by CSKN1A1 expression
Transcriptional regulation of hepatic lipogenesis.
Wang, Yuhui; Viscarra, Jose; Kim, Sun-Joong; Sul, Hei Sook
2015-11-01
Fatty acid and fat synthesis in the liver is a highly regulated metabolic pathway that is important for very low-density lipoprotein (VLDL) production and thus energy distribution to other tissues. Having common features at their promoter regions, lipogenic genes are coordinately regulated at the transcriptional level. Transcription factors, such as upstream stimulatory factors (USFs), sterol regulatory element-binding protein 1C (SREBP1C), liver X receptors (LXRs) and carbohydrate-responsive element-binding protein (ChREBP) have crucial roles in this process. Recently, insights have been gained into the signalling pathways that regulate these transcription factors. After feeding, high blood glucose and insulin levels activate lipogenic genes through several pathways, including the DNA-dependent protein kinase (DNA-PK), atypical protein kinase C (aPKC) and AKT-mTOR pathways. These pathways control the post-translational modifications of transcription factors and co-regulators, such as phosphorylation, acetylation or ubiquitylation, that affect their function, stability and/or localization. Dysregulation of lipogenesis can contribute to hepatosteatosis, which is associated with obesity and insulin resistance.
Zhao, Yi; Yao, Yun-hong; Li, Li; An, Wei-fang; Chen, Hong-zen; Sun, Li-ping; Kang, Hai-xian; Wang, Sen; Hu, Xin-rong
2014-12-01
Pokemon has been showed to directly suppress p14(ARF) expression and also to overexpress in multiple cancers. However, p14(ARF)-MDM2-p53 pathway is usually aberrant in colorectal cancer (CRC). The aim is to confirm whether Pokemon plays a role in CRC and explore whether Pokemon works through p14(ARF)-MDM2-p53 pathway in CRC. Immunohistochemistry for Pokemon, p14(ARF) and Mtp53 protein was applied to 45 colorectal epitheliums (CREs), 42 colorectal adenomas (CRAs) and 66 CRCs. Pokemon was knocked down with RNAi technique in CRC cell line Lovo to detect mRNA expression of p14(ARF) with qRT-PCR, cell proliferation with CCK8 assay, and cell cycle and apoptosis with flowcytometry analysis. The protein expression rates were significantly higher in CRC (75.8%) than in CRE (22.2 %) or CRA (38.1%) for Pokemon and higher in CRC (53.0%) than in CRE (0) or CRA (4.8%) for Mtp53, but not significantly different in CRC (86.4 %) versus CRE (93.3%) or CRA (90.5 %) for p14(ARF). Higher expression rate of Pokemon was associated with lymph node metastasis and higher Duke's stage. After knockdown of Pokemon in Lovo cells, the mRNA level of p14(ARF) was not significantly changed, the cell proliferation ability was decreased by 20.6%, cell cycle was arrested by 55.7% in G0/G1 phase, and apoptosis rate was increased by 19.0%. Pokemon enhanced the oncogenesis of CRC by promoting proliferation, cell cycle progression and anti-apoptosis activity of CRC cells independently of p14(ARF)-MDM2-p53 pathway. This finding provided a novel idea for understanding and further studying the molecular mechanism of Pokemon on carcinogenesis of CRC.
Directory of Open Access Journals (Sweden)
Miriam Sansó
Full Text Available Transcript elongation by RNA polymerase II (RNAPII is accompanied by conserved patterns of histone modification. Whereas histone modifications have established roles in transcription initiation, their functions during elongation are not understood. Mono-ubiquitylation of histone H2B (H2Bub1 plays a key role in coordinating co-transcriptional histone modification by promoting site-specific methylation of histone H3. H2Bub1 also regulates gene expression through an unidentified, methylation-independent mechanism. Here we reveal bidirectional communication between H2Bub1 and Cdk9, the ortholog of metazoan positive transcription elongation factor b (P-TEFb, in the fission yeast Schizosaccharomyces pombe. Chemical and classical genetic analyses indicate that lowering Cdk9 activity or preventing phosphorylation of its substrate, the transcription processivity factor Spt5, reduces H2Bub1 in vivo. Conversely, mutations in the H2Bub1 pathway impair Cdk9 recruitment to chromatin and decrease Spt5 phosphorylation. Moreover, an Spt5 phosphorylation-site mutation, combined with deletion of the histone H3 Lys4 methyltransferase Set1, phenocopies morphologic and growth defects due to H2Bub1 loss, suggesting independent, partially redundant roles for Cdk9 and Set1 downstream of H2Bub1. Surprisingly, mutation of the histone H2B ubiquitin-acceptor residue relaxes the Cdk9 activity requirement in vivo, and cdk9 mutations suppress cell-morphology defects in H2Bub1-deficient strains. Genome-wide analyses by chromatin immunoprecipitation also demonstrate opposing effects of Cdk9 and H2Bub1 on distribution of transcribing RNAPII. Therefore, whereas mutual dependence of H2Bub1 and Spt5 phosphorylation indicates positive feedback, mutual suppression by cdk9 and H2Bub1-pathway mutations suggests antagonistic functions that must be kept in balance to regulate elongation. Loss of H2Bub1 disrupts that balance and leads to deranged gene expression and aberrant cell
Zellmer, Sebastian; Schmidt-Heck, Wolfgang; Godoy, Patricio; Weng, Honglei; Meyer, Christoph; Lehmann, Thomas; Sparna, Titus; Schormann, Wiebke; Hammad, Seddik; Kreutz, Clemens; Timmer, Jens; von Weizsäcker, Fritz; Thürmann, Petra A; Merfort, Irmgard; Guthke, Reinhard; Dooley, Steven; Hengstler, Jan G; Gebhardt, Rolf
2010-12-01
The cellular basis of liver regeneration has been intensely investigated for many years. However, the mechanisms initiating hepatocyte "plasticity" and priming for proliferation are not yet fully clear. We investigated alterations in gene expression patterns during the first 72 hours of C57BL/6N mouse hepatocyte culture on collagen monolayers (CM), which display a high basal frequency of proliferation in the absence of cytokines. Although many metabolic genes were down-regulated, genes related to mitogen-activated protein kinase (MAPK) signaling and cell cycle were up-regulated. The latter genes showed an overrepresentation of transcription factor binding sites (TFBS) for ETF (TEA domain family member 2), E2F1 (E2F transcription factor 1), and SP-1 (Sp1 transcription factor) (P ETF, E2F1, and SP-1 and displayed increased expression of E2F1. Cultivation of murine hepatocytes on CM primes cells for proliferation through cytokine-independent activation of MAPK signaling. The transcription factors ETF, E2F1, and SP-1 seem to play a pronounced role in mediating proliferation-dependent differential gene expression. Similar events, but on a shorter time-scale, occur very early after liver damage in vivo. Copyright © 2010 American Association for the Study of Liver Diseases.
International Nuclear Information System (INIS)
Tsutsui, Shinichi; Yasuda, Kazuhiro; Suzuki, Kosuke; Takeuchi, Hideya; Nishizaki, Takashi; Higashi, Hidefumi; Era, Shoichi
2006-01-01
Recent experimental studies have shown that Bcl-2, which has been established as a key player in the control of apoptosis, plays a role in regulating the cell cycle and proliferation. The aim of this study was to investigate the relationship between Bcl-2 and p27 protein expression, p53 protein expression and the proliferation activity as defined by the MIB-1 counts. The prognostic implication of Bcl-2 protein expression in relation to p27 and p53 protein expressions and MIB-1 counts for breast cancer was also evaluated. The immunohistochemical expression of Bcl-2 protein was evaluated in a series of 249 invasive ductal carcinomas of the breast, in which p27 and p53 protein expressions and MIB-1 counts had been determined previously. The Bcl-2 protein expression was found to be decreased in 105 (42%) cases. A decreased Bcl-2 protein expression was significantly correlated with a nuclear grade of III, a negative estrogen receptor, a decreased p27 protein expression, a positive p53 protein expression, positive MIB-1 counts and a positive HER2 protein expression. The incidence of a nuclear grade of III and positive MIB-1 counts increased as the number of abnormal findings of Bcl-2, p27 and p53 protein expressions increased. A univariate analysis indicated a decreased Bcl-2 protein expression to be significantly (p = 0.0089) associated with a worse disease free survival (DFS), while a multivariate analysis indicated the lymph node status and MIB-1 counts to be independently significant prognostic factors for the DFS. The Bcl-2 protein expression has a close correlation with p27 and p53 protein expressions and the proliferation activity determined by MIB-1 counts in invasive ductal carcinoma of the breast. The prognostic value of Bcl-2 as well as p27 and p53 protein expressions was dependent on the proliferation activity in breast cancer
Directory of Open Access Journals (Sweden)
Nishizaki Takashi
2006-07-01
Full Text Available Abstract Background Recent experimental studies have shown that Bcl-2, which has been established as a key player in the control of apoptosis, plays a role in regulating the cell cycle and proliferation. The aim of this study was to investigate the relationship between Bcl-2 and p27 protein expression, p53 protein expression and the proliferation activity as defined by the MIB-1 counts. The prognostic implication of Bcl-2 protein expression in relation to p27 and p53 protein expressions and MIB-1 counts for breast cancer was also evaluated. Methods The immunohistochemical expression of Bcl-2 protein was evaluated in a series of 249 invasive ductal carcinomas of the breast, in which p27 and p53 protein expressions and MIB-1 counts had been determined previously. Results The Bcl-2 protein expression was found to be decreased in 105 (42% cases. A decreased Bcl-2 protein expression was significantly correlated with a nuclear grade of III, a negative estrogen receptor, a decreased p27 protein expression, a positive p53 protein expression, positive MIB-1 counts and a positive HER2 protein expression. The incidence of a nuclear grade of III and positive MIB-1 counts increased as the number of abnormal findings of Bcl-2, p27 and p53 protein expressions increased. A univariate analysis indicated a decreased Bcl-2 protein expression to be significantly (p = 0.0089 associated with a worse disease free survival (DFS, while a multivariate analysis indicated the lymph node status and MIB-1 counts to be independently significant prognostic factors for the DFS. Conclusion The Bcl-2 protein expression has a close correlation with p27 and p53 protein expressions and the proliferation activity determined by MIB-1 counts in invasive ductal carcinoma of the breast. The prognostic value of Bcl-2 as well as p27 and p53 protein expressions was dependent on the proliferation activity in breast cancer.
Drosha regulates gene expression independently of RNA cleavage function
DEFF Research Database (Denmark)
Gromak, Natalia; Dienstbier, Martin; Macias, Sara
2013-01-01
Drosha is the main RNase III-like enzyme involved in the process of microRNA (miRNA) biogenesis in the nucleus. Using whole-genome ChIP-on-chip analysis, we demonstrate that, in addition to miRNA sequences, Drosha specifically binds promoter-proximal regions of many human genes in a transcription......-dependent manner. This binding is not associated with miRNA production or RNA cleavage. Drosha knockdown in HeLa cells downregulated nascent gene transcription, resulting in a reduction of polyadenylated mRNA produced from these gene regions. Furthermore, we show that this function of Drosha is dependent on its N......-terminal protein-interaction domain, which associates with the RNA-binding protein CBP80 and RNA Polymerase II. Consequently, we uncover a previously unsuspected RNA cleavage-independent function of Drosha in the regulation of human gene expression....
Chemical Variations on the p53 Reactivation Theme
Directory of Open Access Journals (Sweden)
Carlos J. A. Ribeiro
2016-05-01
Full Text Available Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX. Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented.
Choi, Tae Gyu; Nguyen, Minh Nam; Kim, Jieun; Jo, Yong Hwa; Jang, Miran; Nguyen, Ngoc Ngo Yen; Yun, Hyeong Rok; Choe, Wonchae; Kang, Insug; Ha, Joohun; Tang, Dean G; Kim, Sung Soo
2018-06-06
Colorectal cancer (CRC) is one of the leading causes of cancer-related deaths worldwide. Chemoresistance is a major problem for effective therapy in CRC. Here, we investigated the mechanism by which peptidylprolyl isomerase B (PPIB; cyclophilin B, CypB) regulates chemoresistance in CRC. We found that CypB is a novel wild type p53 (p53WT)-inducible gene but a negative regulator of p53WT in response to oxaliplatin treatment. Overexpression of CypB shortens the half-life of p53WT and inhibits oxaliplatin-induced apoptosis in CRC cells, whereas knockdown of CypB lengthens the half-life of p53WT and stimulates p53WT dependent apoptosis. CypB interacts directly with MDM2, and enhances MDM2-dependent p53WT ubiquitination and degradation. Furthermore, we firmly validated using bioinformatics analyses that overexpression of CypB is associated with poor prognosis in CRC progression and chemoresistance. Hence, we suggest a novel mechanism of chemoresistance caused by overexpressed CypB, which may help to develop new anti-cancer drugs. We also propose that CypB may be utilized as a predictive biomarker in CRC patients. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Qiu, Weihua; Zhou, Bingsen; Darwish, Dana; Shao, Jimin; Yen, Yun
2006-02-10
Ribonucleotide reductase (RR) is a highly regulated enzyme in the deoxyribonucleotide synthesis pathway. RR is responsible for the de novo conversion of ribonucleoside diphosphates to deoxyribonucleoside diphosphates, which are essential for DNA synthesis and repair. Besides two subunits, hRRM1 and hRRM2, p53R2 is a newly identified member of RR family that is induced by ultraviolet light in a p53-dependent manner. To understand the molecular interaction of RR subunits, we employed a eukaryotic expression system to express and purify all three subunits. After in vitro reconstitution, the results of [(3)H]CDP reduction assay showed that both eukaryotic recombinant hRRM2 and p53R2 proteins could interact with hRRM1 to form functional RR holoenzyme. The reconstituted RR activity was time-dependent and the reaction rate reached the plateau phase after 40min incubation. No matter the concentration, RR holoenzyme reconstituted from p53R2 and hRRM1 could only achieve about 40-75% kinetic activity of that from hRRM2 and hRRM1. The synthetic C-terminal heptapeptide competition assays confirmed that hRRM2 and p53R2 share the same binding site on hRRM1, but the binding site on hRRM1 demonstrated higher affinity for hRRM2 than for p53R2. In allosteric regulation assay, the effect of activation or inhibition of hRRM1 with ATP or dATP suggested that these effectors could regulate RR activity independent of different RR small subunits. Taken together, the eukaryotic expression system RR holoenzyme will provide a very useful tool to understand the molecular mechanisms of RR activity and the interactions of its subunits.
Ma-Lauer, Yue; Carbajo-Lozoya, Javier; Müller, Marcel A.; Deng, Wen; Lei, Jian; Meyer, Benjamin; Kusov, Yuri; von Brunn, Brigitte; Bairad, Dev Raj; Hünten, Sabine; Drosten, Christian; Hermeking, Heiko; Leonhardt, Heinrich; Mann, Matthias; Hilgenfeld, Rolf; von Brunn, Albrecht
2016-01-01
Highly pathogenic severe acute respiratory syndrome coronavirus (SARS-CoV) has developed strategies to inhibit host immune recognition. We identify cellular E3 ubiquitin ligase ring-finger and CHY zinc-finger domain-containing 1 (RCHY1) as an interacting partner of the viral SARS-unique domain (SUD) and papain-like protease (PLpro), and, as a consequence, the involvement of cellular p53 as antagonist of coronaviral replication. Residues 95–144 of RCHY1 and 389–652 of SUD (SUD-NM) subdomains are crucial for interaction. Association with SUD increases the stability of RCHY1 and augments RCHY1-mediated ubiquitination as well as degradation of p53. The calcium/calmodulin-dependent protein kinase II delta (CAMK2D), which normally influences RCHY1 stability by phosphorylation, also binds to SUD. In vivo phosphorylation shows that SUD does not regulate phosphorylation of RCHY1 via CAMK2D. Similarly to SUD, the PLpros from SARS-CoV, MERS-CoV, and HCoV-NL63 physically interact with and stabilize RCHY1, and thus trigger degradation of endogenous p53. The SARS-CoV papain-like protease is encoded next to SUD within nonstructural protein 3. A SUD–PLpro fusion interacts with RCHY1 more intensively and causes stronger p53 degradation than SARS-CoV PLpro alone. We show that p53 inhibits replication of infectious SARS-CoV as well as of replicons and human coronavirus NL63. Hence, human coronaviruses antagonize the viral inhibitor p53 via stabilizing RCHY1 and promoting RCHY1-mediated p53 degradation. SUD functions as an enhancer to strengthen interaction between RCHY1 and nonstructural protein 3, leading to a further increase in in p53 degradation. The significance of these findings is that down-regulation of p53 as a major player in antiviral innate immunity provides a long-sought explanation for delayed activities of respective genes. PMID:27519799
Madan, Esha; Gogna, Rajan; Kuppusamy, Periannan; Bhatt, Madan; Mahdi, Abbas Ali; Pati, Uttam
2013-04-01
p53 prevents cancer via cell cycle arrest, apoptosis, and the maintenance of genome stability. p53 also regulates energy-generating metabolic pathways such as oxidative phosphorylation (OXPHOS) and glycolysis via transcriptional regulation of SCO2 and TIGAR. SCO2, a cytochrome c oxidase assembly factor, is a metallochaperone which is involved in the biogenesis of cytochrome c oxidase subunit II. Here we have shown that SCO2 functions as an apoptotic protein in tumor xenografts, thus providing an alternative pathway for p53-mediated apoptosis. SCO2 increases the generation of reactive oxygen species (ROS) and induces dissociation of the protein complex between apoptosis signal-regulating kinase 1 (ASK-1) (mitogen-activated protein kinase kinase kinase [MAPKKK]) and its cellular inhibitor, the redox-active protein thioredoxin (Trx). Furthermore, SCO2 induces phosphorylation of ASK-1 at the Thr(845) residue, resulting in the activation of the ASK-1 kinase pathway. The phosphorylation of ASK-1 induces the activation of mitogen-activated protein kinase kinases 4 and 7 (MAP2K4/7) and MAP2K3/6, which switches the c-Jun N-terminal protein kinase (JNK)/p38-dependent apoptotic cascades in cancer cells. Exogenous addition of the SCO2 gene to hypoxic cancer cells and hypoxic tumors induces apoptosis and causes significant regression of tumor xenografts. We have thus discovered a novel apoptotic function of SCO2, which activates the ASK-1 kinase pathway in switching "on" an alternate mode of p53-mediated apoptosis. We propose that SCO2 might possess a novel tumor suppressor function via the ROS-ASK-1 kinase pathway and thus could be an important candidate for anticancer gene therapy.
Combination of Heavy-ion radiotherapy and p53-gene therapy by radio-sensitizing promoter for glioma
International Nuclear Information System (INIS)
Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie
2005-01-01
In this study we have investigated the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing promoter-E9ns-2/CMV chimeric promoter (Scott et al:2003) in p53-gene therapy. First, EGFP reporter gene with E9ns-2/CMV chimeric promoter was transfected in C6 rat glioma cell-line and the transfected-cell bulk was irradiated at dose of 3, 5, 10 Gy respectively with charged carbon particle (290 MeV/nucleon). The light upregulation of EGFP was observed in 24 hours after 5 Gy irradiation. On the basis of this result, p53 gene with E9ns-2/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 5 Gy. There was, however, no obvious p53-upregulation at any time-point, so far. Further investigation is needed to clarify the appropriate experimental system. (author)
International Nuclear Information System (INIS)
Alphonse, Gersende; Maalouf, Mira; Battiston-Montagne, Priscillia; Ardail, Dominique; Beuve, Michaël; Rousson, Robert; Taucher-Scholz, Gisela; Fournier, Claudia; Rodriguez-Lafrasse, Claire
2013-01-01
To determine whether ceramide is responsible for the induction of p53-independent early or late apoptosis in response to high- and low-Linear-Energy-Transfer (LET) irradiation. Four cell lines displaying different radiosensitivities and p53-protein status were irradiated with photons or 33.4 or 184 keV/μm carbon ions. The kinetics of ceramide production was quantified by fluorescent microscopy or High-Performance-Liquid-Chromatogaphy and the sequence of events leading to apoptosis by flow cytometry. Regardless of the p53-status, both low and high-LET irradiation induced an early ceramide production in radiosensitive cells and late in the radioresistant. This production strongly correlated with the level of early apoptosis in radiosensitive cells and delayed apoptosis in the radioresistant ones, regardless of radiation quality, tumor type, radiosensitivity, or p53-status. Inhibition of caspase activity or ceramide production showed that, for both types of radiation, ceramide is essential for the initiation of early apoptosis in radiosensitive cells and late apoptosis following mitotic catastrophe in radioresistant cells. Ceramide is a determining factor in the onset of early and late apoptosis after low and high-LET irradiation and is the mediator of the p53-independent-apoptotic pathway. We propose that ceramide is the molecular bridge between mitotic catastrophe and the commitment phase of delayed apoptosis in response to irradiation
Phosphorylation-dependent and -independent functions of p130 cooperate to evoke a sustained G1 block
DEFF Research Database (Denmark)
Hansen, Klaus; Farkas, T; Lukas, J
2001-01-01
The retinoblastoma (pRb)-related p130 pocket protein is a regulator of cell growth and differentiation, and a candidate tumour suppressor. Both pRb and p130 operate through interactions with cellular proteins, including the E2F transcription factors. While such interactions are controlled...
Restriction of human herpesvirus 6B replication by p53
DEFF Research Database (Denmark)
Øster, Bodil; Kofod-Olsen, Emil; Bundgaard, Bettina
2008-01-01
Human herpesvirus 6B (HHV-6B) induces significant accumulation of p53 in both the nucleus and cytoplasm during infection. Activation of p53 by DNA damage is known to induce either growth arrest or apoptosis; nevertheless, HHV-6B-infected cells are arrested in their cell cycle independently of p53...
Expression of Egr1 and p53 in human carotid plaques and apoptosis induced by 7-oxysterol or p53.
Miah, Sayem; Zadeh, Shahram Nour Mohammad; Yuan, Xi-Ming; Li, Wei
2013-07-01
Egr-1 and p53 are involved in pathology of both atherosclerosis and cancer. However, it is unknown whether p53 and Egr1 are interactively involved in apoptosis in atherosclerosis. We found that in human carotid plaques, the expression of p53 was inversely correlated with Egr1. In U937 cells, 7β-hydroxycholesterol and 7-ketocholesterol induced production of reactive oxygen species (ROS), transient up-regulation of Egr1 followed by late induction of p53 and apoptosis. Cells with nuclear fragmentation induced by 7-oxysterol or p53 showed increased levels of p53, but decreased levels of Egr1. In conclusion, ROS induced by 7-oxysterols may function as an early initiator of Egr1 expression. The late induced p53 by 7-oxysterols contributes to apoptotic cell death and is linked to the reduction of Egr1 levels, which resembles the differential expression of p53 and Egr1 in human atheroma progression. Copyright © 2012 Elsevier GmbH. All rights reserved.
The p53-reactivating small molecule RITA induces senescence in head and neck cancer cells.
Chuang, Hui-Ching; Yang, Liang Peng; Fitzgerald, Alison L; Osman, Abdullah; Woo, Sang Hyeok; Myers, Jeffrey N; Skinner, Heath D
2014-01-01
TP53 is the most commonly mutated gene in head and neck cancer (HNSCC), with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis), a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1) inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC.
Pu-erh Tea Inhibits Tumor Cell Growth by Down-Regulating Mutant p53
Zhao, Lanjun; Jia, Shuting; Tang, Wenru; Sheng, Jun; Luo, Ying
2011-01-01
Pu-erh tea is a kind of fermented tea with the incorporation of microorganisms’ metabolites. Unlike green tea, the chemical characteristics and bioactivities of Pu-erh tea are still not well understood. Using water extracts of Pu-erh tea, we analyzed the tumor cell growth inhibition activities on several genetically engineered mouse tumor cell lines. We found that at the concentration that did not affect wild type mouse embryo fibroblasts (MEFs) growth, Pu-erh tea extracts could inhibit tumor cell growth by down-regulated S phase and cause G1 or G2 arrest. Further study showed that Pu-erh tea extracts down-regulated the expression of mutant p53 in tumor cells at the protein level as well as mRNA level. The same concentration of Pu-erh tea solution did not cause p53 stabilization or activation of its downstream pathways in wild type cells. We also found that Pu-erh tea treatment could slightly down-regulate both HSP70 and HSP90 protein levels in tumor cells. These data revealed the action of Pu-erh tea on tumor cells and provided the possible mechanism for Pu-erh tea action, which explained its selectivity in inhibiting tumor cells without affecting wild type cells. Our data sheds light on the application of Pu-erh tea as an anti-tumor agent with low side effects. PMID:22174618
Wang, Yan; Liu, Fei; Wang, Liuqing; Wang, Qi; Selvaraj, Jonathan Nimal; Zhao, Yueju; Wang, Yun; Xing, Fuguo; Liu, Yang
2018-05-02
In Aspergillus and Penicillium species, an essential pH-response transcription factor pacC is involved in growth, pathogenicity, and toxigenicity. To investigate the connection between ochratoxin A (OTA) biosynthesis and ambient pH, the AopacC in Aspergillus ochraceus was functionally characterized using a loss-of-function mutant. The mycelium growth was inhibited under pH 4.5 and 10.0, while the sporulation increased under alkaline condition. A reduction of mycelium growth and an elevation of sporulation was observed in Δ AopacC mutant. Compared to neutral condition, OTA contents were respectively reduced by 71.6 and 79.8% under acidic and alkaline conditions. The expression of AopacC increased with the elevated pH, and deleting AopacC dramatically decreased OTA production and biosynthetic genes Aopks expression. Additionally, the Δ AopacC mutant exhibited attenuated infection ability toward pear fruits. These results suggest that AopacC is an alkaline-induced regulator responsible for growth and OTA biosynthesis in A. ochraceus and this regulatory mechanism might be pH-dependent.
Directory of Open Access Journals (Sweden)
Stacey L Lehman
2015-06-01
Full Text Available Multiple transcripts encode for the cell cycle inhibitor p21(Cip1. These transcripts produce identical proteins but differ in their 5' untranslated regions (UTRs. Although several stresses that induce p21 have been characterized, the mechanisms regulating the individual transcript variants and their functional significance are unknown. Here we demonstrate through (35S labeling, luciferase reporter assays, and polysome transcript profiling that activation of the Integrated Stress Response (ISR kinase GCN2 selectively upregulates the translation of a p21 transcript variant containing 5' upstream open reading frames (uORFs through phosphorylation of the eukaryotic translation initiation factor eIF2α. Mutational analysis reveals that the uORFs suppress translation under basal conditions, but promote translation under stress. Functionally, ablation of p21 ameliorates G1/S arrest and reduces cell survival in response to GCN2 activation. These findings uncover a novel mechanism of p21 post-transcriptional regulation, offer functional significance for the existence of multiple p21 transcripts, and support a key role for GCN2 in regulating the cell cycle under stress.
Tichy, Elisia D; Stephan, Zachary A; Osterburg, Andrew; Noel, Greg; Stambrook, Peter J
2013-05-01
Embryonic stem cells (ESCs) are hypersensitive to many DNA damaging agents and can rapidly undergo cell death or cell differentiation following exposure. Treatment of mouse ESCs (mESCs) with etoposide (ETO), a topoisomerase II poison, followed by a recovery period resulted in massive cell death with characteristics of a programmed cell death pathway (PCD). While cell death was both caspase- and necroptosis-independent, it was partially dependent on the activity of lysosomal proteases. A role for autophagy in the cell death process was eliminated, suggesting that ETO induces a novel PCD pathway in mESCs. Inhibition of p53 either as a transcription factor by pifithrin α or in its mitochondrial role by pifithrin μ significantly reduced ESC death levels. Finally, EndoG was newly identified as a protease participating in the DNA fragmentation observed during ETO-induced PCD. We coined the term charontosis after Charon, the ferryman of the dead in Greek mythology, to refer to the PCD signaling events induced by ETO in mESCs. Copyright © 2013 Elsevier B.V. All rights reserved.
Design, Synthesis and Evaluation of 2,5-Diketopiperazines as Inhibitors of the MDM2-p53 Interaction.
Directory of Open Access Journals (Sweden)
Mariell Pettersson
Full Text Available The transcription factor p53 is the main tumour suppressor in cells and many cancer types have p53 mutations resulting in a loss of its function. In tumours that retain wild-type p53 function, p53 activity is down-regulated by MDM2 (human murine double minute 2 via a direct protein-protein interaction. We have designed and synthesised two series of 2,5-diketopiperazines as inhibitors of the MDM2-p53 interaction. The first set was designed to directly mimic the α-helical region of the p53 peptide, containing key residues in the i, i+4 and i+7 positions of a natural α-helix. Conformational analysis indicated that 1,3,6-trisubstituted 2,5-diketopiperazines were able to place substituents in the same spatial orientation as an α-helix template. The key step of the synthesis involved the cyclisation of substituted dipeptides. The other set of tetrasubstituted 2,5-diketopiperazines were designed based on structure-based docking studies and the Ugi multicomponent reaction was used for the synthesis. This latter set comprised the most potent inhibitors which displayed micromolar IC50-values in a biochemical fluorescence polarisation assay.
Directory of Open Access Journals (Sweden)
Katja Merschbaecher
Full Text Available Learning induced changes in protein acetylation, mediated by histone acetyl transferases (HATs, and the antagonistic histone deacetylases (HDACs play a critical role in memory formation. The status of histone acetylation affects the interaction between the transcription-complex and DNA and thus regulates transcription-dependent processes required for long-term memory (LTM. While the majority of studies report on the role of elevated acetylation in memory facilitation, we address the impact of both, increased and decreased acetylation on formation of appetitive olfactory memory in honeybees. We show that learning-induced changes in the acetylation of histone H3 at aminoacid-positions H3K9 and H3K18 exhibit distinct and different dynamics depending on the training strength. A strong training that induces LTM leads to an immediate increase in acetylation at H3K18 that stays elevated for hours. A weak training, not sufficient to trigger LTM, causes an initial increase in acetylation at H3K18, followed by a strong reduction in acetylation at H3K18 below the control group level. Acetylation at position H3K9 is not affected by associative conditioning, indicating specific learning-induced actions on the acetylation machinery. Elevating acetylation levels by blocking HDACs after conditioning leads to an improved memory. While memory after strong training is enhanced for at least 2 days, the enhancement after weak training is restricted to 1 day. Reducing acetylation levels by blocking HAT activity after strong training leads to a suppression of transcription-dependent LTM. The memory suppression is also observed in case of weak training, which does not require transcription processes. Thus, our findings demonstrate that acetylation-mediated processes act as bidirectional regulators of memory formation that facilitate or suppress memory independent of its transcription-requirement.
The Hog1p kinase regulates Aft1p transcription factor to control iron accumulation.
Martins, Telma S; Pereira, Clara; Canadell, David; Vilaça, Rita; Teixeira, Vítor; Moradas-Ferreira, Pedro; de Nadal, Eulàlia; Posas, Francesc; Costa, Vítor
2018-01-01
Iron acquisition systems have to be tightly regulated to assure a continuous supply of iron, since it is essential for survival, but simultaneously to prevent iron overload that is toxic to the cells. In budding yeast, the low‑iron sensing transcription factor Aft1p is a master regulator of the iron regulon. Our previous work revealed that bioactive sphingolipids modulate iron homeostasis as yeast cells lacking the sphingomyelinase Isc1p exhibit an upregulation of the iron regulon. In this study, we show that Isc1p impacts on iron accumulation and localization. Notably, Aft1p is activated in isc1Δ cells due to a decrease in its phosphorylation and an increase in its nuclear levels. Consistently, the expression of a phosphomimetic version of Aft1p-S210/S224 that favours its nuclear export abolished iron accumulation in isc1Δ cells. Notably, the Hog1p kinase, homologue of mammalian p38, interacts with and directly phosphorylates Aft1p at residues S210 and S224. However, Hog1p-Aft1p interaction decreases in isc1Δ cells, which likely contributes to Aft1p dephosphorylation and consequently to Aft1p activation and iron overload in isc1Δ cells. These results suggest that alterations in sphingolipid composition in isc1Δ cells may impact on iron homeostasis by disturbing the regulation of Aft1p by Hog1p. To our knowledge, Hog1p is the first kinase reported to directly regulate Aft1p, impacting on iron homeostasis. Copyright © 2017 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Poulsen, Lars; Andersen, Mikael Rørdam; Lantz, Anna Eliasson
2012-01-01
exhibiting an oxalate overproducing phenotype were identified. The yield of oxalate was increased up to 158% compared to the wild type and the corresponding transcription factor was therefore entitled Oxalic Acid repression Factor, OafA. Detailed physiological characterization of one of the ΔoafA mutants......, compared to the wild type, showed that both strains produced substantial amounts of gluconic acid, but the mutant strain was more efficient in re-uptake of gluconic acid and converting it to oxalic acid, particularly at high pH (pH 5.0). Transcriptional profiles showed that 241 genes were differentially......Acid formation in Aspergillus niger is known to be subjected to tight regulation, and the acid production profiles are fine-tuned to respond to the ambient pH. Based on transcriptome data, putative trans-acting pH responding transcription factors were listed and through knock out studies, mutants...
Liang, Zhi-Kun; Pang, Rui; Dong, Yi; Sun, Zhong-Xiang; Ling, Yan; Zhang, Wen-Qing
2017-04-29
Cytochrome P450-mediated metabolic resistance is one of the major mechanisms involved in insecticide resistance. Although the up-regulation of cytochrome P450 plays a vital role in insecticide metabolism, the molecular basis for the transcriptional regulation of cytochrome P450 remains largely unknown. The P450 gene CYP6ER1, has been reported to confer imidacloprid resistance to the brown planthopper, Nilaparvata lugens. Here, we identified a novel alternative transcript of CYP6ER1 (transcript A2) that had different expression patterns between resistant and susceptible populations, and was more stable after insecticide induction. The promoter of this transcript was sequenced and multiple single nucleotide polymorphisms (SNPs) were detected in individuals from susceptible and resistant field-collected populations. Resistant alleles of four SNPs were found to significantly enhance the promoter activity of the CYP6ER1 transcript A2. Electrophoretic mobility shift assays (EMSAs) revealed that these SNPs might regulate the binding of transcription factors to the promoter. Our findings provide novel evidence regarding the transcriptional regulation of a metabolic resistance-related gene and may be useful to understand the resistance mechanism of N. lugens in the field. © 2017 Institute of Zoology, Chinese Academy of Sciences.
Buglioni, S; D'Agnano, I; Cosimelli, M; Vasselli, S; D'Angelo, C; Tedesco, M; Zupi, G; Mottolese, M
1999-12-22
About 40% of patients with colorectal carcinoma will develop local or distant tumour recurrences. Integrated analyses of bio-pathological markers, predictive of tumour aggressiveness, may offer a more rational approach to planning adjuvant therapy. To this end, we analysed the correlation between p53 accumulation, Bcl-2 expression, DNA ploidy, cell proliferation and conventional clinico-pathological parameters by testing the prognostic significance of these variables in a series of 171 colorectal carcinoma patients with long-term follow-up. The relationships among the various bio-pathological parameters, analysed by multiple correspondence analysis, showed 2 different clinico-biological profiles. The first, characterised by p53 negativity, Bcl-2 positivity, diploidy, low percentage of cells in S-phase (%S-phase), a low Ki-67 score, is associated with Dukes' A-B stage, well differentiated tumours and lack of relapse. The second, defined by p53 positivity, Bcl-2 negativity, aneuploidy, high %S-phase and elevated Ki-67 score, correlates with Dukes' C-D stage, poorly differentiated tumours and presence of relapse. When these parameters were examined according to Kaplan-Meier's method, significantly shorter disease-free (DFS) and overall survival (OS) were also observed in patients bearing p53 positive and Bcl-2 negative tumours, in Dukes' B stage. In multivariate analysis, p53 accumulation and Bcl-2 expression emerged as independent predictors of a worse and better clinical outcome, respectively. Our results indicate that, in colorectal adenocarcinomas, a biological profile, based on the combined evaluation of p53 and Bcl-2, may be useful for identifying high risk patients to be enrolled in an adjuvant setting, mainly in an early stage of the disease. Int. J. Cancer (Pred. Oncol.) 84:545-552, 1999. Copyright 1999 Wiley-Liss, Inc.
Wu, Chueh-Wei; Peng, Mei-Ling; Yeh, Ken-Tu; Tsai, Yi-Yu; Chiang, Chun-Chi; Cheng, Ya-Wen
2016-05-01
Loss of p53 function has been linked to progression of pterygium. MiR-200a is known to be controlled by p53. Here, we hypothesize that expression of miR-200a and downstream ZEB1/ZEB2 genes are regulated epithelial-mesenchymal transition (EMT) involved in the pathogenesis and recurrence of pterygium. For this study, 120 primary pterygial samples were collected. Immunohistochemistry and real-time RT-PCR were performed to determine the expression of p53, p53 down-stream EMT associated protein and miR-200a. The molecular correlation of p53, miR-200a and downstream genes were confirmed using primary pterygium cells (PECs). Expression of miR-200a in pterygium tissues was significantly lower than in conjunctiva controls (p = 0.015). Up-regulated miR-200a levels were positively correlated with and p53 protein expression (p influence miR-200a, resulting in ZEB1/ZEB2 up-regulation and EMT processing of pterygium. Therefore, we suggest that expression of miR-200a play an important role in EMT processing and recurrence of pterygium. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Petra Peters-Wendisch
2017-04-01
Full Text Available Corynebacterium glutamicum is a natural producer of the C50 carotenoid decaprenoxanthin. The crtEcg0722crtBIYEb operon comprises most of its genes for terpenoid biosynthesis. The MarR-type regulator encoded upstream and in divergent orientation of the carotenoid biosynthesis operon has not yet been characterized. This regulator, named CrtR in this study, is encoded in many actinobacterial genomes co-occurring with terpenoid biosynthesis genes. CrtR was shown to repress the crt operon of C. glutamicum since DNA microarray experiments revealed that transcript levels of crt operon genes were increased 10 to 70-fold in its absence. Transcriptional fusions of a promoter-less gfp gene with the crt operon and crtR promoters confirmed that CrtR represses its own gene and the crt operon. Gel mobility shift assays with purified His-tagged CrtR showed that CrtR binds to a region overlapping with the −10 and −35 promoter sequences of the crt operon. Isoprenoid pyrophosphates interfered with binding of CrtR to its target DNA, a so far unknown mechanism for regulation of carotenogenesis. The molecular details of protein-ligand interactions remain to be studied. Decaprenoxanthin synthesis by C. glutamicum wild type was enhanced 10 to 30-fold upon deletion of crtR and was decreased 5 to 6-fold as result of crtR overexpression. Moreover, deletion of crtR was shown as metabolic engineering strategy to improve production of native and non-native carotenoids including lycopene, β-carotene, C.p. 450 and sarcinaxanthin.
DEFF Research Database (Denmark)
Xu-Monette, Zijun Y; Zhang, Shanxiang; Li, Xin
2016-01-01
with a pan-p63-monoclonal antibody and correlated it with other clinicopathologic factors and clinical outcomes. p63 expression was observed in 42.5% of DLBCL, did not correlate with p53 levels, but correlated with p21, MDM2, p16INK4A, Ki-67, Bcl-6, IRF4/MUM-1 and CD30 expression, REL gains, and BCL6...... was likely due to the association of p63 expression with high-risk IPI, and potential presence of ∆Np63 isoform in TP63 rearranged patients (a mere speculation). Gene expression profiling suggested that p63 has both overlapping and distinct functions compared with p53, and that p63 and mutated p53 antagonize...
Innate immune responses: Crosstalk of signaling and regulation of gene transcription
International Nuclear Information System (INIS)
Zhong Bo; Tien Po; Shu Hongbing
2006-01-01
Innate immune responses to pathogens such as bacteria and viruses are triggered by recognition of specific structures of invading pathogens called pathogen-associated molecular patterns (PAMPs) by cellular pattern recognition receptors (PRRs) that are located at plasma membrane or inside cells. Stimulation of different PAMPs activates Toll-like receptor (TLR)-dependent and -independent signaling pathways that lead to activation of transcription factors nuclear factor-κB (NF-κB), interferon regulatory factor 3/7 (IRF3/7) and/or activator protein-1 (AP-1), which collaborate to induce transcription of a large number of downstream genes. This review focuses on the rapid progress that has recently improved our understanding of the crosstalk among the pathways and the precise regulation of transcription of the downstream genes
Human T-Cell Leukemia Virus I Tax Protein Sensitizes p53-Mutant Cells to DNA Damage
Mihaylova, Valia T.; Green, Allison M.; Khurgel, Moshe; Semmes, Oliver J.; Kupfer, Gary M.
2018-01-01
Mutations in p53 are a common cause of resistance of cancers to standard chemotherapy and, thus, treatment failure. Reports have shown that Tax, a human T-cell leukemia virus type I encoded protein that has been associated with genomic instability and perturbation of transcription and cell cycle, sensitizes HeLa cells to UV treatment. The extent to which Tax can sensitize cells and the mechanism by which it exerts its effect are unknown. In this study, we show that Tax sensitizes p53-mutant cells to a broad range of DNA-damaging agents, including mitomycin C, a bifunctional alkylator, etoposide, a topoisomerase II drug, and UV light, but not ionizing radiation, a double-strand break agent, or vinblastine, a tubulin poison. Tax caused hypersensitivity in all p53-deleted cell lines and several, but not all, mutant-expressed p53–containing cell lines, while unexpectedly being protective in p53 wild-type (wt) cells. The effect observed in p53-deleted lines could be reversed for this by transfection of wt p53. We also show that Tax activates a p53-independent proapoptotic program through decreased expression of the retinoblastoma protein and subsequent increased E2F1 expression. The expression of several proapoptotic proteins was also induced by Tax, including Puma and Noxa, culminating in a substantial increase in Bax dimerization. Our results show that Tax can sensitize p53-mutant cells to DNA damage while protecting p53 wt cells, a side benefit that might result in reduced toxicity in normal cells. Such studies hold the promise of a novel adjunctive therapy that could make cancer chemotherapy more effective. PMID:18559532
Impact of Alu repeats on the evolution of human p53 binding sites
Directory of Open Access Journals (Sweden)
Sirotin Michael V
2011-01-01
Full Text Available Abstract Background The p53 tumor suppressor protein is involved in a complicated regulatory network, mediating expression of ~1000 human genes. Recent studies have shown that many p53 in vivo binding sites (BSs reside in transposable repeats. The relationship between these BSs and functional p53 response elements (REs remains unknown, however. We sought to understand whether the p53 REs also reside in transposable elements and particularly in the most-abundant Alu repeats. Results We have analyzed ~160 functional p53 REs identified so far and found that 24 of them occur in repeats. More than half of these repeat-associated REs reside in Alu elements. In addition, using a position weight matrix approach, we found ~400,000 potential p53 BSs in Alu elements genome-wide. Importantly, these putative BSs are located in the same regions of Alu repeats as the functional p53 REs - namely, in the vicinity of Boxes A/A' and B of the internal RNA polymerase III promoter. Earlier nucleosome-mapping experiments showed that the Boxes A/A' and B have a different chromatin environment, which is critical for the binding of p53 to DNA. Here, we compare the Alu-residing p53 sites with the corresponding Alu consensus sequences and conclude that the p53 sites likely evolved through two different mechanisms - the sites overlapping with the Boxes A/A' were generated by CG → TG mutations; the other sites apparently pre-existed in the progenitors of several Alu subfamilies, such as AluJo and AluSq. The binding affinity of p53 to the Alu-residing sites generally correlates with the age of Alu subfamilies, so that the strongest sites are embedded in the 'relatively young' Alu repeats. Conclusions The primate-specific Alu repeats play an important role in shaping the p53 regulatory network in the context of chromatin. One of the selective factors responsible for the frequent occurrence of Alu repeats in introns may be related to the p53-mediated regulation of Alu
A surrogate p53 reporter in Drosophila reveals the interaction of eIF4E and p53
International Nuclear Information System (INIS)
Corujo, G.; Campagno, R.; Rivera Pomar, R.; Ferrero, P.; Lu, W.J.
2011-01-01
eIF4E promotes translation upon binding the mRNA 5'cap and it is required for cell proliferation. p53 is a proapoptotic protein which is activated in response to DNA damage. There is evidence that suggests that eIF4E and p53 are connected in a mechanism that regulates their function. We propose a model for that such a mechanism to explain the equilibrium between apoptosis and cell proliferation. Our data shows a correlation between the overexpression of eIF4E and the suppression of apoptosis triggered by the overexpression of p53 in Drosophila imaginal discs. We also studied a reporter transgene which expresses GFP in response to p53 activation by gamma radiation. We could confirm that this p53 surrogate works in imaginal discs as well as in embryos. This provided us a tool to quantify the effect on the GFP signal by overexpression of eIF4E to confirm how these two proteins could interact in vivo. Our results suggest that p53 and eIF4E are indeed in an equilibrium that decides if a cell shall proliferate or die. (authors)
Yoneshima, Yasuto; Abolhassani, Nona; Iyama, Teruaki; Sakumi, Kunihiko; Shiomi, Naoko; Mori, Masahiko; Shiomi, Tadahiro; Noda, Tetsuo; Tsuchimoto, Daisuke; Nakabeppu, Yusaku
2016-01-01
Deoxyinosine (dI) occurs in DNA either by oxidative deamination of a previously incorporated deoxyadenosine residue or by misincorporation of deoxyinosine triphosphate (dITP) from the nucleotide pool during replication. To exclude dITP from the pool, mammals possess specific hydrolysing enzymes, such as inosine triphosphatase (ITPA). Previous studies have shown that deficiency in ITPA results in cell growth suppression and DNA instability. To explore the mechanisms of these phenotypes, we analysed ITPA-deficient human and mouse cells. We found that both growth suppression and accumulation of single-strand breaks in nuclear DNA of ITPA-deficient cells depended on MLH1/PMS2. The cell growth suppression of ITPA-deficient cells also depended on p53, but not on MPG, ENDOV or MSH2. ITPA deficiency significantly increased the levels of p53 protein and p21 mRNA/protein, a well-known target of p53, in an MLH1-dependent manner. Furthermore, MLH1 may also contribute to cell growth arrest by increasing the basal level of p53 activity. PMID:27618981
Buglioni, S; D'Agnano, I; Vasselli, S; Perrone Donnorso, R; D'Angelo, C; Brenna, A; Benevolo, M; Cosimelli, M; Zupi, G; Mottolese, M
2001-09-01
To identify the prognostically highest risk patients, DNA content and p53 nuclear or cytoplasmic accumulation, evaluated by monoclonal antibody DO7 and polyclonal antibody CM1, were determined in 94 surgically resected stage II (Dukes B2) colorectal cancers, treated or not with adjuvant 5-fluorouracil-based chemotherapy. Sixty-one (65%) of the tumors were aneuploid, 16 (17%) of which had a multiploid DNA content; 50 (53%) displayed DO7 nuclear p53 accumulation, and 44 (47%) showed cytoplasmic CM1 positivity. In multivariate analysis, only multiploidy and p53 nuclear positivity emerged as independent prognostic indicators of a poorer outcome. Positivity for p53 was associated with shorter survival in 5-fluorouracil-treated and untreated patients. Therefore, in patients with Dukes B2 colorectal cancer, a biologic profile based on the combined evaluation of DNA multiploidy and p53 status can provide valuable prognostic information, identifying patients to be enrolled in alternative, more aggressive therapeutic trials.
Keogh, Ciara E; Scholz, Carsten C; Rodriguez, Javier; Selfridge, Andrew C; von Kriegsheim, Alexander; Cummins, Eoin P
2017-07-07
CO 2 is a physiological gas normally produced in the body during aerobic respiration. Hypercapnia (elevated blood pCO 2 >≈50 mm Hg) is a feature of several lung pathologies, e.g. chronic obstructive pulmonary disease. Hypercapnia is associated with increased susceptibility to bacterial infections and suppression of inflammatory signaling. The NF-κB pathway has been implicated in these effects; however, the molecular mechanisms underpinning cellular sensitivity of the NF-κB pathway to CO 2 are not fully elucidated. Here, we identify several novel CO 2 -dependent changes in the NF-κB pathway. NF-κB family members p100 and RelB translocate to the nucleus in response to CO 2 A cohort of RelB protein-protein interactions ( e.g. with Raf-1 and IκBα) are altered by CO 2 exposure, although others are maintained ( e.g. with p100). RelB is processed by CO 2 in a manner dependent on a key C-terminal domain located in its transactivation domain. Loss of the RelB transactivation domain alters NF-κB-dependent transcriptional activity, and loss of p100 alters sensitivity of RelB to CO 2 Thus, we provide molecular insight into the CO 2 sensitivity of the NF-κB pathway and implicate altered RelB/p100-dependent signaling in the CO 2 -dependent regulation of inflammatory signaling. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
System-based strategies for p53 recovery.
Azam, Muhammad Rizwan; Fazal, Sahar; Ullah, Mukhtar; Bhatti, Aamer I
2018-06-01
The authors have proposed a systems theory-based novel drug design approach for the p53 pathway. The pathway is taken as a dynamic system represented by ordinary differential equations-based mathematical model. Using control engineering practices, the system analysis and subsequent controller design is performed for the re-activation of wild-type p53. p53 revival is discussed for both modes of operation, i.e. the sustained and oscillatory. To define the problem in control system paradigm, modification in the existing mathematical model is performed to incorporate the effect of Nutlin. Attractor point analysis is carried out to select the suitable domain of attraction. A two-loop negative feedback control strategy is devised to drag the system trajectories to the attractor point and to regulate cellular concentration of Nutlin, respectively. An integrated framework is constituted to incorporate the pharmacokinetic effects of Nutlin in the cancerous cells. Bifurcation analysis is also performed on the p53 model to see the conditions for p53 oscillation.
OsWRKY53, a versatile switch in regulating herbivore-induced defense responses in rice
Hu, Lingfei; Ye, Meng; Li, Ran; Lou, Yonggen
2016-01-01
ABSTRACT WRKY proteins, which belong to a large family of plant-specific transcription factors, play important roles in plant defenses against pathogens and herbivores by regulating defense-related signaling pathways. Recently, a rice WRKY transcription factor OsWRKY53 has been reported to function as a negative feedback modulator of OsMPK3/OsMPK6 and thereby to control the size of the investment a rice plant makes to defend against a chewing herbivore, the striped stem borer Chilo suppressalis. We investigated the performance of a piecing-sucking herbivore, the brown planthopper (BPH) Nilaparvata lugens, on transgenic plants that silence or overexpress OsWRKY53, and found that OsWRKY53 activates rice defenses against BPH by activating an H2O2 burst and suppressing ethylene biosynthesis. These findings suggest that OsWRKY53 functions not only as a regulator of plants' investment in specific defenses, but also as a switch to initiate new defenses against other stresses, highlighting the versatility and importance of OsWRKY53 in herbivore-induced plant defenses. PMID:27031005
Neem oil limonoids induces p53-independent apoptosis and autophagy.
Srivastava, Pragya; Yadav, Neelu; Lella, Ravi; Schneider, Andrea; Jones, Anthony; Marlowe, Timothy; Lovett, Gabrielle; O'Loughlin, Kieran; Minderman, Hans; Gogada, Raghu; Chandra, Dhyan
2012-11-01
Azadirachta indica, commonly known as neem, has a wide range of medicinal properties. Neem extracts and its purified products have been examined for induction of apoptosis in multiple cancer cell types; however, its underlying mechanisms remain undefined. We show that neem oil (i.e., neem), which contains majority of neem limonoids including azadirachtin, induced apoptotic and autophagic cell death. Gene silencing demonstrated that caspase cascade was initiated by the activation of caspase-9, whereas caspase-8 was also activated late during neem-induced apoptosis. Pretreatment of cancer cells with pan caspase inhibitor, z-VAD inhibited activities of both initiator caspases (e.g., caspase-8 and -9) and executioner caspase-3. Neem induced the release of cytochrome c and apoptosis-inducing factor (AIF) from mitochondria, suggesting the involvement of both caspase-dependent and AIF-mediated apoptosis. p21 deficiency caused an increase in caspase activities at lower doses of neem, whereas p53 deficiency did not modulate neem-induced caspase activation. Additionally, neem treatment resulted in the accumulation of LC3-II in cancer cells, suggesting the involvement of autophagy in neem-induced cancer cell death. Low doses of autophagy inhibitors (i.e., 3-methyladenine and LY294002) did not prevent accumulation of neem-induced LC3-II in cancer cells. Silencing of ATG5 or Beclin-1 further enhanced neem-induced cell death. Phosphoinositide 3-kinase (PI3K) or autophagy inhibitors increased neem-induced caspase-3 activation and inhibition of caspases enhanced neem-induced autophagy. Together, for the first time, we demonstrate that neem induces caspase-dependent and AIF-mediated apoptosis, and autophagy in cancer cells.
Neem oil limonoids induces p53-independent apoptosis and autophagy
Chandra, Dhyan
2012-01-01
Azadirachta indica, commonly known as neem, has a wide range of medicinal properties. Neem extracts and its purified products have been examined for induction of apoptosis in multiple cancer cell types; however, its underlying mechanisms remain undefined. We show that neem oil (i.e., neem), which contains majority of neem limonoids including azadirachtin, induced apoptotic and autophagic cell death. Gene silencing demonstrated that caspase cascade was initiated by the activation of caspase-9, whereas caspase-8 was also activated late during neem-induced apoptosis. Pretreatment of cancer cells with pan caspase inhibitor, z-VAD inhibited activities of both initiator caspases (e.g., caspase-8 and -9) and executioner caspase-3. Neem induced the release of cytochrome c and apoptosis-inducing factor (AIF) from mitochondria, suggesting the involvement of both caspase-dependent and AIF-mediated apoptosis. p21 deficiency caused an increase in caspase activities at lower doses of neem, whereas p53 deficiency did not modulate neem-induced caspase activation. Additionally, neem treatment resulted in the accumulation of LC3-II in cancer cells, suggesting the involvement of autophagy in neem-induced cancer cell death. Low doses of autophagy inhibitors (i.e., 3-methyladenine and LY294002) did not prevent accumulation of neem-induced LC3-II in cancer cells. Silencing of ATG5 or Beclin-1 further enhanced neem-induced cell death. Phosphoinositide 3-kinase (PI3K) or autophagy inhibitors increased neem-induced caspase-3 activation and inhibition of caspases enhanced neem-induced autophagy. Together, for the first time, we demonstrate that neem induces caspase-dependent and AIF-mediated apoptosis, and autophagy in cancer cells. PMID:22915764
Kerchev, Pavel I.; Pellny, Till K.; Vivancos, Pedro Diaz; Kiddle, Guy; Hedden, Peter; Driscoll, Simon; Vanacker, Hélène; Verrier, Paul; Hancock, Robert D.; Foyer, Christine H.
2011-01-01
Cellular redox homeostasis is a hub for signal integration. Interactions between redox metabolism and the ABSCISIC ACID-INSENSITIVE-4 (ABI4) transcription factor were characterized in the Arabidopsis thaliana vitamin c defective1 (vtc1) and vtc2 mutants, which are defective in ascorbic acid synthesis and show a slow growth phenotype together with enhanced abscisic acid (ABA) levels relative to the wild type (Columbia-0). The 75% decrease in the leaf ascorbate pool in the vtc2 mutants was not sufficient to adversely affect GA metabolism. The transcriptome signatures of the abi4, vtc1, and vtc2 mutants showed significant overlap, with a large number of transcription factors or signaling components similarly repressed or induced. Moreover, lincomycin-dependent changes in LIGHT HARVESTING CHLOROPHYLL A/B BINDING PROTEIN 1.1 expression were comparable in these mutants, suggesting overlapping participation in chloroplast to nucleus signaling. The slow growth phenotype of vtc2 was absent in the abi4 vtc2 double mutant, as was the sugar-insensitive phenotype of the abi4 mutant. Octadecanoid derivative-responsive AP2/ERF-domain transcription factor 47 (ORA47) and AP3 (an ABI5 binding factor) transcripts were enhanced in vtc2 but repressed in abi4 vtc2, suggesting that ABI4 and ascorbate modulate growth and defense gene expression through jasmonate signaling. We conclude that low ascorbate triggers ABA- and jasmonate-dependent signaling pathways that together regulate growth through ABI4. Moreover, cellular redox homeostasis exerts a strong influence on sugar-dependent growth regulation. PMID:21926335
Tumor hypoxia, p53, and prognosis in cervical cancers
International Nuclear Information System (INIS)
Haensgen, Gabriele; Krause, Ulf; Becker, Axel; Stadler, Peter; Lautenschlaeger, Christine; Wohlrab, Wolfgang; Rath, Friedrich W.; Molls, Michael; Dunst, Juergen
2001-01-01
Background: The p53 protein is involved in the regulation of initiation of apoptosis. In vitro, p53-deficient cells do not respond to hypoxia with apoptosis as do p53-normal cells, and this may lead to a relative growth advantage of cells without a functioning p53 under hypoxia. On the basis of this hypothesis, a selection of cells with a functionally inactive p53 may occur in hypoxic tumors. The development of uterine cervical carcinomas is closely associated with infections of human papilloma viruses, which may cause a degradation of the tumor suppressor gene p53, resulting in a restriction of apoptosis. Thus, cervical cancers have often a functionally inactive p53. The purpose of our clinical study was therefore to investigate the association between p53, hypoxia, and prognosis in cervical cancers in which the oxygenation status can be determined by clinical methods. Material and Methods: Seventy patients with locally advanced squamous cell cervical cancer Stages IIB (n=14), IIIB (n=49), and IVA (n=7) were investigated in the period from 1996 through 1999. All were treated with definitive radiotherapy with curative intent by a combination of external radiotherapy plus high-dose-rate afterloading. Before therapy, tumor oxygenation was measured with a needle probe polarographically using the Eppendorf histograph. Hypoxic tumors were defined as those with pO 2 measurements below 5 mm Hg (HF5). Pretreatment biopsies were taken and analyzed immunohistologically for p53 protein expression with the DO-7 antibody. The DNA index was measured by flow cytometry. The statistical data analysis was done with SPSS 9.0 for Windows. Results: The 3-year overall survival was 55% for the whole group of patients. Clinical prognostic factors in a multivariate analysis were pretreatment hemoglobin level (3-year survival 62% for patients with a pretreatment hemoglobin ≥11 g/dl vs. 27% for hemoglobin <11 g/dl, p=0.006) and FIGO stage (Stage IIB: 65%; Stage IIIB: 60%; Stage IVA: 29%, p
Nucleolus-derived mediators in oncogenic stress response and activation of p53-dependent pathways.
Stępiński, Dariusz
2016-08-01
Rapid growth and division of cells, including tumor ones, is correlated with intensive protein biosynthesis. The output of nucleoli, organelles where translational machineries are formed, depends on a rate of particular stages of ribosome production and on accessibility of elements crucial for their effective functioning, including substrates, enzymes as well as energy resources. Different factors that induce cellular stress also often lead to nucleolar dysfunction which results in ribosome biogenesis impairment. Such nucleolar disorders, called nucleolar or ribosomal stress, usually affect cellular functioning which in fact is a result of p53-dependent pathway activation, elicited as a response to stress. These pathways direct cells to new destinations such as cell cycle arrest, damage repair, differentiation, autophagy, programmed cell death or aging. In the case of impaired nucleolar functioning, nucleolar and ribosomal proteins mediate activation of the p53 pathways. They are also triggered as a response to oncogenic factor overexpression to protect tissues and organs against extensive proliferation of abnormal cells. Intentional impairment of any step of ribosome biosynthesis which would direct the cells to these destinations could be a strategy used in anticancer therapy. This review presents current knowledge on a nucleolus, mainly in relation to cancer biology, which is an important and extremely sensitive element of the mechanism participating in cellular stress reaction mediating activation of the p53 pathways in order to counteract stress effects, especially cancer development.
Santangelo, G M; Tornow, J
1997-12-01
As part of an effort to identify random carbon-source-regulated promoters in the Saccharomyces cerevisiae genome, we discovered that a mitochondrial DNA fragment is capable of directing glucose-repressible expression of a reporter gene. This fragment (CR24) originated from the mitochondrial genome adjacent to a transcription initiation site. Mutational analyses identified a GC cluster within the fragment that is required for transcriptional induction. Repression of nuclear CR24-driven transcription required Reg1p, indicating that this mitochondrially derived promoter is a member of a large group of glucose-repressible nuclear promoters that are similarly regulated by Reg1p. In vivo and in vitro binding assays indicated the presence of factors, located within the nucleus and the mitochondria, that bind to the GC cluster. One or more of these factors may provide a regulatory link between the nucleus and mitochondria.
A Chimeric Protein PTEN-L-p53 Enters U251 Cells to Repress Proliferation and Invasion.
Xiao, Man; An, Yang; Wang, Fengling; Yao, Chao; Zhang, Chu; Xin, Junfang; Duan, Yongjian; Zhao, Xiaofang; Fang, Na; Ji, Shaoping
2018-05-23
PTEN, a well-known tumor suppressor, dephosphorylates PIP3 and inhibits AKT activity. A translational variant of PTEN has been identified and termed PTEN-Long (PTEN-L). The additional 173 amino acids (PTEN-L leader) at the N-terminal constitute a potential signal peptide. Differing from canonical PTEN, PTEN-L is secreted into the extracellular fluid and re-enters recipient cells, playing the similar roles as PTEN in vivo and in vitro. This character confers the PTEN-L a therapeutic ability via directly protein delivering instead of traditional DNA and RNA vector options. In the present study, we employed PTEN-L leader to assemble a fusion protein, PTEN-L-p53, inosculated with the transcriptional regulator TP53, which is another powerful tumor suppressor. We overexpressed PTEN-L-p53 in HEK293T cells and detected it in both the cytoplasm and nucleus. Subsequently, we found that PTEN-L-p53 was secreted outside of the cells and detected in the culture media by immunoblotting. Furthermore, we demonstrated that PTEN-L-p53 freely entered the cells and suppressed the viability of U251cells (p53 R273H , a cell line with p53 R273H-mutation). PTEN-L-p53 is composed of endogenous protein/peptide bearing low immunogenicity, and only the junction region between PTEN-L leader and p53 can act as a new immune epitope. Accordingly, this fusion protein can potentially be used as a therapeutic option for TP53-abnormality cancers. Copyright © 2018. Published by Elsevier Inc.
Petibone, Dayton M; Mustafa, Thikra; Bourdo, Shawn E; Lafont, Andersen; Ding, Wei; Karmakar, Alokita; Nima, Zeid A; Watanabe, Fumiya; Casciano, Daniel; Morris, Suzanne M; Dobrovolsky, Vasily N; Biris, Alexandru S
2017-11-01
Due to the distinctive physical, electrical, and chemical properties of graphene nanomaterials, numerous efforts pursuing graphene-based biomedical and industrial applications are underway. Oxidation of pristine graphene surfaces mitigates its otherwise hydrophobic characteristic thereby improving its biocompatibility and functionality. Yet, the potential widespread use of oxidized graphene derivatives raises concern about adverse impacts on human health. The p53 tumor suppressor protein maintains cellular and genetic stability after toxic exposures. Here, we show that p53 functional status correlates with oxygen functionalized graphene (f-G) cytotoxicity and genotoxicity in vitro. The f-G exposed p53-competent cells, but not p53-deficient cells, initiated G 0 /G 1 phase cell cycle arrest, suppressed reactive oxygen species, and entered apoptosis. There was p53-dependent f-G genotoxicity evident as increased structural chromosome damage, but not increased gene mutation or chromatin loss. In conclusion, the cytotoxic and genotoxic potential for f-G in exposed cells was dependent on the p53 functional status. These findings have broad implications for the safe and effective implementation of oxidized graphene derivatives into biomedical and industrial applications. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.
Regulation of transcription in hyperthermophilic archaea
Brinkman, A.B.
2002-01-01
<p>The aim of the research presented here was to insight in the mechanisms by which transcription in hyperthermophilic archaea is regulated. To accomplish this, we have aimed (I) to identify transcriptional regulatory proteins from hyperthermophilic archaea, (II) to characterize these
The p53-reactivating small molecule RITA induces senescence in head and neck cancer cells.
Directory of Open Access Journals (Sweden)
Hui-Ching Chuang
Full Text Available TP53 is the most commonly mutated gene in head and neck cancer (HNSCC, with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis, a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1 inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC.
International Nuclear Information System (INIS)
Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie
2006-01-01
In this study we have started to investigate the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing E 9ns-2 /cytomegalovirus (CMV) chimeric promoter (Scott et al: 2003) in p53-gene therapy. Our study in the first year, however, suggested the uselessness of E 9ns-2 /CMV chimeric promoter. Then we applied E 9ns-2 /Epo5/CMV-radio and hypoxia-sensitizing chimeric promoter to amplify p53 gene exopression. P53 gene with E 9ns2 /Epo5/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 1 Gy of high linear energy transfer (LET)-carbon ion beam or low-LET X-ray under various hypoxic conditions. The result suggested the possible role of 1 Gy of high LET-carbon ion beam as a ''useful trigger'' to enhance a selective anti-tumor effect toward glioma under hypoxic condition through amplification of p53 gene expression. (author)
Method to determine transcriptional regulation pathways in organisms
Gardner, Timothy S.; Collins, James J.; Hayete, Boris; Faith, Jeremiah
2012-11-06
The invention relates to computer-implemented methods and systems for identifying regulatory relationships between expressed regulating polypeptides and targets of the regulatory activities of such regulating polypeptides. More specifically, the invention provides a new method for identifying regulatory dependencies between biochemical species in a cell. In particular embodiments, provided are computer-implemented methods for identifying a regulatory interaction between a transcription factor and a gene target of the transcription factor, or between a transcription factor and a set of gene targets of the transcription factor. Further provided are genome-scale methods for predicting regulatory interactions between a set of transcription factors and a corresponding set of transcriptional target substrates thereof.
Motohashi, Satoru; Koizumi, Karen; Honda, Reika; Maruyama, Atsuko; Palmer, Helen E F; Mashima, Keisuke
2014-01-01
Aggregation of the high-affinity IgE receptor (FcεRI) in mast cells leads to degranulation and production of numerous cytokines and lipid mediators that promote allergic inflammation. Tyrosine phosphorylation of proteins in response to FcεRI aggregation has been implicated in mast cell activation. Here, we determined the role of PTP-PEST (encoded by PTPN12) in the regulation of mast cell activation using the RBL-2H3 rat basophilic leukemia cell line as a model. PTP-PEST expression was significantly induced upon FcεRI-crosslinking, and aggregation of FcεRI induced the phosphorylation of PTP-PEST at Ser39, thus resulting in the suppression of PTP activity. By overexpressing a phosphatase-dead mutant (PTP-PEST CS) and a constitutively active mutant (PTP-PEST SA) in RBL-2H3 cells, we showed that PTP-PEST decreased degranulation and enhanced IL-4 and IL-13 transcription in FcεRI-crosslinked RBL-2H3 cells, but PTP activity of PTP-PEST was not necessary for this regulation. However, FcεRI-induced TNF-α transcription was increased by the overexpression of PTP-PEST SA and suppressed by the overexpression of PTP-PEST CS. Taken together, these results suggest that PTP-PEST is involved in the regulation of FcεRI-mediated mast cell activation through at least two different processes represented by PTP activity-dependent and -independent pathways. Copyright © 2014 Elsevier Inc. All rights reserved.
Path dependence and independent utility regulation
DEFF Research Database (Denmark)
Ibsen, Christian Lyhne; Skovgaard Poulsen, Lauge
2007-01-01
The establishment of the Danish independent regulatory authorities for the energy and telecommunications sectors was based upon EU directives as part of their liberalisation process. Following the concepts of transaction costs and path dependency this article analyses differences in independence...... between the two authorities - the Danish Energy Regulatory Authority (Energitilsynet) and the National IT and Telecommunications Agency (IT- og Telestyrelsen) respectively. We find that the state's negligible interest in the energy sector until the 1970s formed the basis for strong energy companies...
Directory of Open Access Journals (Sweden)
Eugene B. Chang
2013-01-01
Full Text Available Compound K (20-O-beta-D-glucopyranosyl-20(S-protopanaxadiol, CK, an intestinal bacterial metabolite of ginseng protopanaxadiol saponins, has been shown to inhibit cell growth in a variety of cancers. However, the mechanisms are not completely understood, especially in colorectal cancer (CRC. A xenograft tumor model was used first to examine the anti-CRC effect of CK in vivo. Then, multiple in vitro assays were applied to investigate the anticancer effects of CK including antiproliferation, apoptosis and cell cycle distribution. In addition, a qPCR array and western blot analysis were executed to screen and validate the molecules and pathways involved. We observed that CK significantly inhibited the growth of HCT-116 tumors in an athymic nude mouse xenograft model. CK significantly inhibited the proliferation of human CRC cell lines HCT-116, SW-480, and HT-29 in a dose- and time-dependent manner. We also observed that CK induced cell apoptosis and arrested the cell cycle in the G1 phase in HCT-116 cells. The processes were related to the upregulation of p53/p21, FoxO3a-p27/p15 and Smad3, and downregulation of cdc25A, CDK4/6 and cyclin D1/3. The major regulated targets of CK were cyclin dependent inhibitors, including p21, p27, and p15. These results indicate that CK inhibits transcriptional activation of multiple tumor-promoting pathways in CRC, suggesting that CK could be an active compound in the prevention or treatment of CRC.
International Nuclear Information System (INIS)
Wang, Bing; Ohyama, Harumi; Nose, Masako; Yukawa, Osami; Yamada, Takeshi; Hayata, Isamu
2003-01-01
In the past 5 years, a series of study was done at our institute to investigate radiation effects on the embryogenesis in mice with an emphasis on mechanisms involved in the radiation-induced adaptive response and the role of radiation-induced apoptosis played in teratogenesis in the late period of organogenesis. Using the limb bud system, we first found that radiation-induced apoptosis is involved in malformations, namely, radiation-induced apoptosis in the predigital regions of embryonic limb buds is responsible for digital defects in ICR mice. Examination of embryonic C57BL/6J mice with different p53 status led to further finding that susceptibility to the radiation-induced apoptosis and digital defects depends on both the p53 status and the radiation dose. p53 wild-type mice appeared to be the most sensitive, while p53 knockout mice were the most resistant. These results indicate that p53-dependent apoptosis mediates radiation-induced digital defects. The existence of a radioadaptive response in fetuses, i.e., the priming dose significantly decreases the apoptosis induction, prenatal death, and digital defects in the living fetuses induced by the challenging dose, was found first in ICR strain mice and later confirmed again in C57BL/6J mice. p53 heterozygous embryos did not show the radioadaptive response, indicating the involvement of p53 in the radioadaptive response. (author)
Kim, Jong-Sik; Baek, Seung Joon; Bottone, Frank G; Sali, Tina; Eling, Thomas E
2005-09-01
To investigate the function of 15-lipoxygenase-1 (15-LOX-1) in human colorectal cancer, we overexpressed 15-LOX-1 in HCT-116 human colorectal cancer cells. Clones expressing the highest levels of 15-LOX-1 displayed reduced viability compared with the HCT-116-Vector control cells. Further, by cell cycle gene array analyses, the cyclin-dependent kinase inhibitor p21WAF1/CIP1 and MDM2 genes were up-regulated in 15-LOX-1-overexpressing cells. The induction of p21(WAF1/CIP1) and MDM2 were linked to activation of p53 by 15-LOX-1, as there was a dramatic induction of phosphorylated p53 (Ser15) in 15-LOX-1-overesxpressing cells. However, the 15-LOX-1 metabolites 13(S)-hydroxyoctadecadienoic acid and 15(S)-hydroxyeicosatetraenoic acid failed to induce phosphorylation of p53 at Ser15, and the 15-LOX-1 inhibitor PD146176 did not inhibit the phosphorylation of p53 at Ser15 in 15-LOX-1-overexpressing cells. Nonetheless, the growth-inhibitory effects of 15-LOX-1 were p53 dependent, as 15-LOX-1 overexpression had no effect on cell growth in p53 (-/-) HCT-116 cells. Finally, treatment of HCT-116-15-LOX-1 cells with different kinase inhibitors suggested that the effects of 15-LOX-1 on p53 phosphorylation and activation were due to effects on DNA-dependent protein kinase. Collectively, these findings suggest a new mechanism to explain the biological activity of 15-LOX-1, where 15-LOX plays a stoichiometric role in activating a DNA-dependent protein kinase-dependent pathway that leads to p53-dependent growth arrest.
Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos
2015-01-01
Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947
Brighenti, E; Calabrese, C; Liguori, G; Giannone, F A; Trerè, D; Montanaro, L; Derenzini, M
2014-01-01
Chronic inflammation is an established risk factor for the onset of cancer, and the inflammatory cytokine IL-6 has a role in tumorigenesis by enhancing proliferation and hindering apoptosis. As factors stimulating proliferation also downregulate p53 expression by enhancing ribosome biogenesis, we hypothesized that IL-6 may cause similar changes in inflamed tissues, thus activating a mechanism that favors neoplastic transformation. Here, we showed that IL-6 downregulated the expression and activity of p53 in transformed and untransformed human cell lines. This was the consequence of IL-6-dependent stimulation of c-MYC mRNA translation, which was responsible for the upregulation of rRNA transcription. The enhanced rRNA transcription stimulated the MDM2-mediated proteasomal degradation of p53, by reducing the availability of ribosome proteins for MDM2 binding. The p53 downregulation induced the acquisition of cellular phenotypic changes characteristic of epithelial–mesenchymal transition, such as a reduced level of E-cadherin expression, increased cell invasiveness and a decreased response to cytotoxic stresses. We found that these changes also occurred in colon epithelial cells of patients with ulcerative colitis, a very representative example of chronic inflammation at high risk for tumor development. Histochemical and immunohistochemical analysis of colon biopsy samples showed an upregulation of ribosome biogenesis, a reduced expression of p53, together with a focal reduction or absence of E-cadherin expression in chronic colitis in comparison with normal mucosa samples. These changes disappeared after treatment with anti-inflammatory drugs. Taken together, the present results highlight a new mechanism that may link chronic inflammation to cancer, based on p53 downregulation, which is activated by the enhancement of rRNA transcription upon IL-6 exposure. PMID:24531714
Absence of p53 in Clara cells favours multinucleation and loss of cell cycle arrest
Directory of Open Access Journals (Sweden)
Clarke Alan R
2002-11-01
Full Text Available Abstract Background The p53 oncosuppressor protein is a critical mediator of the response to injury in mammalian cells and is mutationally inactivated in the majority of lung malignancies. In this analysis, the effects of p53-deficiency were investigated in short-term primary cultures of murine bronchiolar Clara cells. Clara cells, isolated from gene-targeted p53-deficient mice, were compared to cells derived from wild type littermates. Results p53 null cultures displayed abnormal morphology; specifically, a high incidence of multinucleation, which increased with time in culture. Multinucleated cells were proficient in S phase DNA synthesis, as determined by BrdU incorporation. However, multinucleation did not reflect altered rates of S phase synthesis, which were similar between wild type and p53-/- cultures. Nucleation defects in p53-/- Clara cells associated with increased centrosome number, as determined by confocal microscopy of pericentrin-stained cultures, and may highlight a novel role of p53 in preserving genomic integrity in lung epithelial cells. Effects of p53-deficiency were also studied following exposure to DNA damage. A p53-dependent reduction in the BrdU index was observed in Clara cells following ionizing radiation. The reduction in BrdU index in wild type cells displayed serum-dependency, and occurred only in the absence of serum. Taken together, these findings demonstrate that in murine primary Clara cell culture, cell cycle arrest is a p53-mediated response to DNA damage, and that extracellular factors, such as serum, influence this response. Conclusion These findings highlight functions of wild type p53 protein in bipolar spindle formation, centrosome regulation, and growth control in bronchiolar Clara cells.
Directory of Open Access Journals (Sweden)
Samuel A Shelburne
2010-03-01
Full Text Available Transcriptional regulatory networks are fundamental to how microbes alter gene expression in response to environmental stimuli, thereby playing a critical role in bacterial pathogenesis. However, understanding how bacterial transcriptional regulatory networks function during host-pathogen interaction is limited. Recent studies in group A Streptococcus (GAS suggested that the transcriptional regulator catabolite control protein A (CcpA influences many of the same genes as the control of virulence (CovRS two-component gene regulatory system. To provide new information about the CcpA and CovRS networks, we compared the CcpA and CovR transcriptomes in a serotype M1 GAS strain. The transcript levels of several of the same genes encoding virulence factors and proteins involved in basic metabolic processes were affected in both DeltaccpA and DeltacovR isogenic mutant strains. Recombinant CcpA and CovR bound with high-affinity to the promoter regions of several co-regulated genes, including those encoding proteins involved in carbohydrate and amino acid metabolism. Compared to the wild-type parental strain, DeltaccpA and DeltacovRDeltaccpA isogenic mutant strains were significantly less virulent in a mouse myositis model. Inactivation of CcpA and CovR alone and in combination led to significant alterations in the transcript levels of several key GAS virulence factor encoding genes during infection. Importantly, the transcript level alterations in the DeltaccpA and DeltacovRDeltaccpA isogenic mutant strains observed during infection were distinct from those occurring during growth in laboratory medium. These data provide new knowledge regarding the molecular mechanisms by which pathogenic bacteria respond to environmental signals to regulate virulence factor production and basic metabolic processes during infection.
The tumor suppressors pRB and p53 as regulators of adipocyte differentiation and function
DEFF Research Database (Denmark)
Hallenborg, Philip; Feddersen, Søren; Madsen, Lise
2009-01-01
BACKGROUND: The retinoblastoma protein (pRB) and p53 are crucial members of regulatory networks controlling the cell cycle and apoptosis, and a hallmark of virtually all cancers is dysregulation of expression or function of pRB or p53. Although they are best known for their role in cancer...
International Nuclear Information System (INIS)
Yang, Shan; Kawamura, Kiyoko; Okamoto, Shinya; Yamauchi, Suguru; Shingyoji, Masato; Sekine, Ikuo; Kobayashi, Hiroshi; Tada, Yuji; Tatsumi, Koichiro; Hiroshima, Kenzo; Shimada, Hideaki; Tagawa, Masatoshi
2015-01-01
Improvement of transduction and augmentation of cytotoxicity are crucial for adenoviruses (Ad)-mediated gene therapy for cancer. Down-regulated expression of type 5 Ad (Ad5) receptors on human tumors hampered Ad-mediated transduction. Furthermore, a role of the p53 pathways in cytotoxicity mediated by replication-competent Ad remained uncharacterized. We constructed replication-competent Ad5 of which the E1 region genes were activated by a transcriptional regulatory region of the midkine or the survivin gene, which is expressed preferentially in human tumors. We also prepared replication-competent Ad5 which were regulated by the same region but had a fiber-knob region derived from serotype 35 (AdF35). We examined the cytotoxicity of these Ad and a possible combinatory use of the replication-competent AdF35 and Ad5 expressing the wild-type p53 gene (Ad5/p53) in esophageal carcinoma cells. Expression levels of molecules involved in cell death, anti-tumor effects in vivo and production of viral progenies were also investigated. Replication-competent AdF35 in general achieved greater cytotoxic effects to esophageal carcinoma cells than the corresponding replication-competent Ad5. Infection with the AdF35 induced cleavages of caspases and increased sub-G1 fractions, but did not activate the autophagy pathway. Transduction with Ad5/p53 in combination with the replication-competent AdF35 further enhanced the cytotoxicity in a synergistic manner. We also demonstrated the combinatory effects in an animal model. Transduction with Ad5/p53 however suppressed production of replication-competent AdF35 progenies, but the combination augmented Ad5/p53-mediated p53 expression levels and the downstream pathways. Combination of replication-competent AdF35 and Ad5/p53 achieved synergistic cytotoxicity due to enhanced p53-mediated apoptotic pathways. The online version of this article (doi:10.1186/s12885-015-1482-8) contains supplementary material, which is available to authorized
Miles, Wayne O; Korenjak, Michael; Griffiths, Lyra M; Dyer, Michael A; Provero, Paolo; Dyson, Nicholas J
2014-10-01
Inactivation of the retinoblastoma tumor suppressor (pRb) is a common oncogenic event that alters the expression of genes important for cell cycle progression, senescence, and apoptosis. However, in many contexts, the properties of pRb-deficient cells are similar to wild-type cells suggesting there may be processes that counterbalance the transcriptional changes associated with pRb inactivation. Therefore, we have looked for sets of evolutionary conserved, functionally related genes that are direct targets of pRb/E2F proteins. We show that the expression of NANOS, a key facilitator of the Pumilio (PUM) post-transcriptional repressor complex, is directly repressed by pRb/E2F in flies and humans. In both species, NANOS expression increases following inactivation of pRb/RBF1 and becomes important for tissue homeostasis. By analyzing datasets from normal retinal tissue and pRb-null retinoblastomas, we find a strong enrichment for putative PUM substrates among genes de-regulated in tumors. These include pro-apoptotic genes that are transcriptionally down-regulated upon pRb loss, and we characterize two such candidates, MAP2K3 and MAP3K1, as direct PUM substrates. Our data suggest that NANOS increases in importance in pRb-deficient cells and helps to maintain homeostasis by repressing the translation of transcripts containing PUM Regulatory Elements (PRE). © 2014 The Authors.
Directory of Open Access Journals (Sweden)
Margaret E Katz
2013-03-01
Full Text Available The Aspergillus nidulans xprG gene encodes a putative transcriptional activator that is a member of the Ndt80 family in the p53-like superfamily of proteins. Previous studies have shown that XprG controls the production of extracellular proteases in response to starvation. We undertook transcriptional profiling to investigate whether XprG has a wider role as a global regulator of the carbon nutrient stress response. Our microarray data showed that the expression of a large number of genes, including genes involved in secondary metabolism, development, high-affinity glucose uptake and autolysis, were altered in an xprGΔ null mutant. Many of these genes are known to be regulated in response to carbon starvation. We confirmed that sterigmatocystin and penicillin production is reduced in xprG- mutants. The loss of fungal mass and secretion of pigments that accompanies fungal autolysis in response to nutrient depletion was accelerated in an xprG1 gain-of-function mutant and decreased or absent in an xprG- mutant. The results support the hypothesis that XprG plays a major role in the response to carbon limitation and that nutrient sensing may represent one of the ancestral roles for the p53-like superfamily. Disruption of the AN6015 gene, which encodes a second Ndt80-like protein, showed that it is required for sexual reproduction in A. nidulans.
Energy Technology Data Exchange (ETDEWEB)
Saquib, Quaiser [Department of Zoology, College of Science, King Saud University, Riyadh (Saudi Arabia); Attia, Sabry M. [Department of Pharmacology, College of Pharmacy, King Saud University, Riyadh (Saudi Arabia); Siddiqui, Maqsood A. [Department of Zoology, College of Science, King Saud University, Riyadh (Saudi Arabia); Aboul-Soud, Mourad A.M. [Department of Zoology, College of Science, King Saud University, Riyadh (Saudi Arabia); Biochemistry Department, Faculty of Agriculture, Cairo University, 12613 Giza (Egypt); Al-Khedhairy, Abdulaziz A. [Department of Zoology, College of Science, King Saud University, Riyadh (Saudi Arabia); Giesy, John P. [Department of Zoology, College of Science, King Saud University, Riyadh (Saudi Arabia); Department of Biomedical and Veterinary Biosciences and Toxicology Centre, University of Saskatchewan, Saskatoon, Canada S7N 5B3 (Canada); Zoology Department and Center for Integrative Toxicology, Michigan State University, East Lansing 48824 (United States); Musarrat, Javed, E-mail: musarratj1@yahoo.com [Department of Zoology, College of Science, King Saud University, Riyadh (Saudi Arabia); Department of Microbiology, Faculty of Agricultural Sciences, AMU, Aligarh (India)
2012-02-15
Male Wistar rats exposed to a systemic organophosphorus insecticide, phorate [O,O-diethyl S-[(ethylthio) methyl] phosphorothioate] at varying oral doses of 0.046, 0.092 or 0.184 mg phorate/kg bw for 14 days, exhibited substantial oxidative stress, cellular DNA damage and activation of apoptosis-related p53, caspase 3 and 9 genes. The histopathological changes including the pyknotic nuclei, inflammatory leukocyte infiltrations, renal necrosis, and cardiac myofiber degeneration were observed in the liver, kidney and heart tissues. Biochemical analysis of catalase and glutathione revealed significantly lesser activities of antioxidative enzymes and lipid peroxidation in tissues of phorate exposed rats. Furthermore, generation of intracellular reactive oxygen species and reduced mitochondrial membrane potential in bone marrow cells confirmed phorate-induced oxidative stress. Significant DNA damage was measured through comet assay in terms of the Olive tail moment in bone marrow cells of treated animals as compared to control. Cell cycle analysis also demonstrated the G{sub 2}/M arrest and appearance of a distinctive SubG{sub 1} peak, which signified induction of apoptosis. Up-regulation of tumor suppressor p53 and caspase 3 and 9 genes, determined by quantitative real-time PCR and enzyme-linked immunosorbent assay, elucidated the activation of intrinsic apoptotic pathways in response to cellular stress. Overall, the results suggest that phorate induces genetic alterations and cellular toxicity, which can adversely affect the normal cellular functioning in rats. -- Highlights: ► This is the first report on molecular toxicity of phorate in an in vivo test system. ► Phorate induces biochemical and histological changes in liver, kidney and heart. ► Rats treated with phorate exhibited DNA damage in bone marrow cells. ► Phorate induces apoptosis, oxidative stress and alters mitochondrial fluorescence. ► Phorate induces transcriptional changes and enhanced
International Nuclear Information System (INIS)
Saquib, Quaiser; Attia, Sabry M.; Siddiqui, Maqsood A.; Aboul-Soud, Mourad A.M.; Al-Khedhairy, Abdulaziz A.; Giesy, John P.; Musarrat, Javed
2012-01-01
Male Wistar rats exposed to a systemic organophosphorus insecticide, phorate [O,O-diethyl S-[(ethylthio) methyl] phosphorothioate] at varying oral doses of 0.046, 0.092 or 0.184 mg phorate/kg bw for 14 days, exhibited substantial oxidative stress, cellular DNA damage and activation of apoptosis-related p53, caspase 3 and 9 genes. The histopathological changes including the pyknotic nuclei, inflammatory leukocyte infiltrations, renal necrosis, and cardiac myofiber degeneration were observed in the liver, kidney and heart tissues. Biochemical analysis of catalase and glutathione revealed significantly lesser activities of antioxidative enzymes and lipid peroxidation in tissues of phorate exposed rats. Furthermore, generation of intracellular reactive oxygen species and reduced mitochondrial membrane potential in bone marrow cells confirmed phorate-induced oxidative stress. Significant DNA damage was measured through comet assay in terms of the Olive tail moment in bone marrow cells of treated animals as compared to control. Cell cycle analysis also demonstrated the G 2 /M arrest and appearance of a distinctive SubG 1 peak, which signified induction of apoptosis. Up-regulation of tumor suppressor p53 and caspase 3 and 9 genes, determined by quantitative real-time PCR and enzyme-linked immunosorbent assay, elucidated the activation of intrinsic apoptotic pathways in response to cellular stress. Overall, the results suggest that phorate induces genetic alterations and cellular toxicity, which can adversely affect the normal cellular functioning in rats. -- Highlights: ► This is the first report on molecular toxicity of phorate in an in vivo test system. ► Phorate induces biochemical and histological changes in liver, kidney and heart. ► Rats treated with phorate exhibited DNA damage in bone marrow cells. ► Phorate induces apoptosis, oxidative stress and alters mitochondrial fluorescence. ► Phorate induces transcriptional changes and enhanced activities of
International Nuclear Information System (INIS)
Chi, Yayun; Hong, Yi; Zong, Hongliang; Wang, Yanlin; Zou, Weiying; Yang, Junwu; Kong, Xiangfei; Yun, Xiaojing; Gu, Jianxin
2009-01-01
Vitamin D receptor (VDR) is a member of the nuclear receptor superfamily and regulates transcription of target genes. In this study, we identified CDK11 p58 as a novel protein involved in the regulation of VDR. CDK11 p58 , a member of the large family of p34cdc2-related kinases, is associated with cell cycle progression, tumorigenesis, and apoptotic signaling. Our study demonstrated that CDK11 p58 interacted with VDR and repressed VDR-dependent transcriptional activation. Furthermore, overexpression of CDK11 p58 decreased the stability of VDR through promoting its ubiquitin-proteasome-mediated degradation. Taken together, these results suggest that CDK11 p58 is involved in the negative regulation of VDR.
Directory of Open Access Journals (Sweden)
O. A. Gonchar
2017-12-01
Full Text Available The intensity of oxidative stress, protein expression of antiapoptotic Bcl-2 as well as antioxidant enzymes manganese superoxide dismutase (MnSOD and glutathione peroxidase (GPx and their regulator p53 were studied in the mitochondria of rat heart. Sessions of repeated hypoxia/reoxygenation ((H/R, 5 cycles of 10 min hypoxia (5.5% O2 in N2 alternated with 10 min normoxia, daily were performed in our study. It was shown that short-term sessions of H/R (during 1-3 days caused a significant increase in the oxidative stress markers (ROS formation and lipid peroxidation, mitochondrial p53 translocation, a decrease in MnSOD protein expression/activity and Bcl-2 protein content, but up-regulated GPx. We have demonstrated that prolonged H/R (7-14 days induced myocardial tolerance to fluctuation in oxygen levels that was associated with the reduction in mitochondrial p53 protein content, elevation of mitochondrial Bcl-2 protein level, and increase in antioxidant capacity. A close correlation between the mitochondrial p53 accumulation and ROS formation as well as the activity and protein content of MnSOD and GPx allowed us to assume that p53 took an active part in the regulation of prooxidant/antioxidant balance in mitochondria of rat heart during repeated H/R.
Badal, Brateil; Solovyov, Alexander; Di Cecilia, Serena; Chan, Joseph Minhow; Chang, Li-Wei; Iqbal, Ramiz; Aydin, Iraz T.; Rajan, Geena S.; Chen, Chen; Abbate, Franco; Arora, Kshitij S.; Tanne, Antoine; Gruber, Stephen B.; Johnson, Timothy M.; Fullen, Douglas R.; Phelps, Robert; Bhardwaj, Nina; Bernstein, Emily; Ting, David T.; Brunner, Georg; Schadt, Eric E.; Greenbaum, Benjamin D.; Celebi, Julide Tok
2017-01-01
BACKGROUND. Melanoma is a heterogeneous malignancy. We set out to identify the molecular underpinnings of high-risk melanomas, those that are likely to progress rapidly, metastasize, and result in poor outcomes. METHODS. We examined transcriptome changes from benign states to early-, intermediate-, and late-stage tumors using a set of 78 treatment-naive melanocytic tumors consisting of primary melanomas of the skin and benign melanocytic lesions. We utilized a next-generation sequencing platform that enabled a comprehensive analysis of protein-coding and -noncoding RNA transcripts. RESULTS. Gene expression changes unequivocally discriminated between benign and malignant states, and a dual epigenetic and immune signature emerged defining this transition. To our knowledge, we discovered previously unrecognized melanoma subtypes. A high-risk primary melanoma subset was distinguished by a 122-epigenetic gene signature (“epigenetic” cluster) and TP53 family gene deregulation (TP53, TP63, and TP73). This subtype associated with poor overall survival and showed enrichment of cell cycle genes. Noncoding repetitive element transcripts (LINEs, SINEs, and ERVs) that can result in immunostimulatory signals recapitulating a state of “viral mimicry” were significantly repressed. The high-risk subtype and its poor predictive characteristics were validated in several independent cohorts. Additionally, primary melanomas distinguished by specific immune signatures (“immune” clusters) were identified. CONCLUSION. The TP53 family of genes and genes regulating the epigenetic machinery demonstrate strong prognostic and biological relevance during progression of early disease. Gene expression profiling of protein-coding and -noncoding RNA transcripts may be a better predictor for disease course in melanoma. This study outlines the transcriptional interplay of the cancer cell’s epigenome with the immune milieu with potential for future therapeutic targeting. FUNDING
Functions of MDMX in the Modulation of the p53-Response
Directory of Open Access Journals (Sweden)
Kristiaan Lenos
2011-01-01
Full Text Available The MDM family proteins MDM2 and MDMX are two critical regulators of the p53 tumor suppressor protein. Expression of both proteins is necessary for allowing the embryonal development by keeping the activity of p53 in check. Upon stresses that need to activate p53 to perform its function as guardian of the genome, p53 has to be liberated from these two inhibitors. In this review, we will discuss the various mechanisms by which MDMX protein levels are downregulated upon various types of stress, including posttranslational modifications of the MDMX protein and the regulation of mdmx mRNA expression, including alternative splicing. In addition, the putative function(s of the described MDMX splice variants, particularly in tumor development, will be discussed. Lastly, in contrast to common belief, we have recently shown the existence of a p53-MDMX feedback loop, which is important for dampening the p53-response at later phases after genotoxic stress.
Increased Arf/p53 activity in stem cells, aging and cancer.
Carrasco-Garcia, Estefania; Moreno, Manuel; Moreno-Cugnon, Leire; Matheu, Ander
2017-04-01
Arf/p53 pathway protects the cells against DNA damage induced by acute stress. This characteristic is the responsible for its tumor suppressor activity. Moreover, it regulates the chronic type of stress associated with aging. This is the basis of its anti-aging activity. Indeed, increased gene dosage of Arf/p53 displays elongated longevity and delayed aging. At a cellular level, it has been recently shown that increased dosage of Arf/p53 delays age-associated stem cell exhaustion and the subsequent decline in tissue homeostasis and regeneration. However, p53 can also promote aging if constitutively activated. In this context, p53 reduces tissue regeneration, which correlates with premature exhaustion of stem cells. We discuss here the current evidence linking the Arf/p53 pathway to the processes of aging and cancer through stem cell regulation. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Archana D Siddam
2018-03-01
Full Text Available Opacification of the ocular lens, termed cataract, is a common cause of blindness. To become transparent, lens fiber cells undergo degradation of their organelles, including their nuclei, presenting a fundamental question: does signaling/transcription sufficiently explain differentiation of cells progressing toward compromised transcriptional potential? We report that a conserved RNA-binding protein Celf1 post-transcriptionally controls key genes to regulate lens fiber cell differentiation. Celf1-targeted knockout mice and celf1-knockdown zebrafish and Xenopus morphants have severe eye defects/cataract. Celf1 spatiotemporally down-regulates the cyclin-dependent kinase (Cdk inhibitor p27Kip1 by interacting with its 5' UTR and mediating translation inhibition. Celf1 deficiency causes ectopic up-regulation of p21Cip1. Further, Celf1 directly binds to the mRNA of the nuclease Dnase2b to maintain its high levels. Together these events are necessary for Cdk1-mediated lamin A/C phosphorylation to initiate nuclear envelope breakdown and DNA degradation in fiber cells. Moreover, Celf1 controls alternative splicing of the membrane-organization factor beta-spectrin and regulates F-actin-crosslinking factor Actn2 mRNA levels, thereby controlling fiber cell morphology. Thus, we illustrate new Celf1-regulated molecular mechanisms in lens development, suggesting that post-transcriptional regulatory RNA-binding proteins have evolved conserved functions to control vertebrate oculogenesis.
Lifescience Database Archive (English)
Full Text Available 15075353 Post-transcriptional regulation of proinflammatory proteins. Anderson P, P...l) (.csml) Show Post-transcriptional regulation of proinflammatory proteins. PubmedID 15075353 Title Post-tr...anscriptional regulation of proinflammatory proteins. Authors Anderson P, Phillip
Mutant Mice Lacking the p53 C-Terminal Domain Model Telomere Syndromes
Directory of Open Access Journals (Sweden)
Iva Simeonova
2013-06-01
Full Text Available Mutations in p53, although frequent in human cancers, have not been implicated in telomere-related syndromes. Here, we show that homozygous mutant mice expressing p53Δ31, a p53 lacking the C-terminal domain, exhibit increased p53 activity and suffer from aplastic anemia and pulmonary fibrosis, hallmarks of syndromes caused by short telomeres. Indeed, p53Δ31/Δ31 mice had short telomeres and other phenotypic traits associated with the telomere disease dyskeratosis congenita and its severe variant the Hoyeraal-Hreidarsson syndrome. Heterozygous p53+/Δ31 mice were only mildly affected, but decreased levels of Mdm4, a negative regulator of p53, led to a dramatic aggravation of their symptoms. Importantly, several genes involved in telomere metabolism were downregulated in p53Δ31/Δ31 cells, including Dyskerin, Rtel1, and Tinf2, which are mutated in dyskeratosis congenita, and Terf1, which is implicated in aplastic anemia. Together, these data reveal that a truncating mutation can activate p53 and that p53 plays a major role in the regulation of telomere metabolism.
Directory of Open Access Journals (Sweden)
Suryani Lukman
Full Text Available The transcription factor p53 regulates cellular integrity in response to stress. p53 is mutated in more than half of cancerous cells, with a majority of the mutations localized to the DNA binding domain (DBD. In order to map the structural and dynamical features of the DBD, we carried out multiple copy molecular dynamics simulations (totaling 0.8 μs. Simulations show the loop 1 to be the most dynamic element among the DNA-contacting loops (loops 1-3. Loop 1 occupies two major conformational states: extended and recessed; the former but not the latter displays correlations in atomic fluctuations with those of loop 2 (~24 Å apart. Since loop 1 binds to the major groove whereas loop 2 binds to the minor groove of DNA, our results begin to provide some insight into the possible mechanism underpinning the cooperative nature of DBD binding to DNA. We propose (1 a novel mechanism underlying the dynamics of loop 1 and the possible tread-milling of p53 on DNA and (2 possible mutations on loop 1 residues to restore the transcriptional activity of an oncogenic mutation at a distant site.
Stress-specific response of the p53-Mdm2 feedback loop
Directory of Open Access Journals (Sweden)
Jensen Mogens H
2010-07-01
Full Text Available Abstract Background The p53 signalling pathway has hundreds of inputs and outputs. It can trigger cellular senescence, cell-cycle arrest and apoptosis in response to diverse stress conditions, including DNA damage, hypoxia and nutrient deprivation. Signals from all these inputs are channeled through a single node, the transcription factor p53. Yet, the pathway is flexible enough to produce different downstream gene expression patterns in response to different stresses. Results We construct a mathematical model of the negative feedback loop involving p53 and its inhibitor, Mdm2, at the core of this pathway, and use it to examine the effect of different stresses that trigger p53. In response to DNA damage, hypoxia, etc., the model exhibits a wide variety of specific output behaviour - steady states with low or high levels of p53 and Mdm2, as well as spiky oscillations with low or high average p53 levels. Conclusions We show that even a simple negative feedback loop is capable of exhibiting the kind of flexible stress-specific response observed in the p53 system. Further, our model provides a framework for predicting the differences in p53 response to different stresses and single nucleotide polymorphisms.
Transcriptional dynamics with time-dependent reaction rates
Nandi, Shubhendu; Ghosh, Anandamohan
2015-02-01
Transcription is the first step in the process of gene regulation that controls cell response to varying environmental conditions. Transcription is a stochastic process, involving synthesis and degradation of mRNAs, that can be modeled as a birth-death process. We consider a generic stochastic model, where the fluctuating environment is encoded in the time-dependent reaction rates. We obtain an exact analytical expression for the mRNA probability distribution and are able to analyze the response for arbitrary time-dependent protocols. Our analytical results and stochastic simulations confirm that the transcriptional machinery primarily act as a low-pass filter. We also show that depending on the system parameters, the mRNA levels in a cell population can show synchronous/asynchronous fluctuations and can deviate from Poisson statistics.
Transcriptional dynamics with time-dependent reaction rates
International Nuclear Information System (INIS)
Nandi, Shubhendu; Ghosh, Anandamohan
2015-01-01
Transcription is the first step in the process of gene regulation that controls cell response to varying environmental conditions. Transcription is a stochastic process, involving synthesis and degradation of mRNAs, that can be modeled as a birth–death process. We consider a generic stochastic model, where the fluctuating environment is encoded in the time-dependent reaction rates. We obtain an exact analytical expression for the mRNA probability distribution and are able to analyze the response for arbitrary time-dependent protocols. Our analytical results and stochastic simulations confirm that the transcriptional machinery primarily act as a low-pass filter. We also show that depending on the system parameters, the mRNA levels in a cell population can show synchronous/asynchronous fluctuations and can deviate from Poisson statistics. (paper)
Directory of Open Access Journals (Sweden)
Wang MS
2017-10-01
Full Text Available Ming-Shan Wang,1 Liang Chen,2 Ya-Qiong Xiong,2 Jing Xu,2 Ji-Peng Wang,2 Zi-Li Meng2 1Department of Oncology, Huaiyin Hospital of Huai’an City, Huai’an, China; 2Department of Respiration, Huai’an First People’s Hospital, Nanjing Medical University, Huai’an, China Abstract: Actein (AT is a triterpene glycoside isolated from the rhizomes of Cimicifuga foetida that has been investigated for its antitumor effects. AT treatment leads to apoptosis in various cell types, including breast cancer cells, by regulating different signaling pathways. Iron oxide (Fe3O4 magnetic nanoparticles (MNPs are nanomaterials with biocompatible activity and low toxicity. In the present study, the possible benefits of AT in combination with MNPs on non-small-cell lung cancer (NSCLC were explored in in vitro and in vivo studies. AT-MNP treatment contributed to apoptosis in NSCLC cells, as evidenced by activation of the caspase 3-signaling pathway, which was accompanied by downregulation of the antiapoptotic proteins Bcl2 and BclXL, and upregulation of the proapoptotic signals Bax and Bad. The death receptors of TRAIL were also elevated following AT-MNP treatment in a p53-dependent manner. Furthermore, a mouse xenograft model in vivo revealed that AT-MNP treatment exhibited no toxicity and suppressed NSCLC growth compared to either AT or MNP monotherapies. In conclusion, this study suggests a novel therapy to induce apoptosis in suppressing NSCLC growth in a p53-dependent manner by combining AT with Fe3O4 MNPs. Keywords: actein, Fe3O4 magnetic nanoparticles, NSCLC, apoptosis, p53
Fukushi, Saori; Yoshino, Hironori; Yoshizawa, Atsushi; Kashiwakura, Ikuo
2016-07-25
We recently demonstrated the cytotoxicity of liquid crystal precursors (hereafter referred to as "mesogenic compounds") in the human non-small cell lung cancer (NSCLC) cell line A549 which carry wild-type p53. p53 mutations are observed in 50 % of NSCLC and contribute to their resistance to chemotherapy. To develop more effective and cancer-specific agents, in this study, we investigated the structure-activity relationships of mesogenic compounds with cytotoxic effects against multiple NSCLC cells. The pharmacological effects of mesogenic compounds were examined in human NSCLC cells (A549, LU99, EBC-1, and H1299) and normal WI-38 human fibroblast. Analyses of the cell cycle, cell-death induction, and capsases expression were performed. The 3-ring compounds possessing terminal alkyl and hydroxyl groups (compounds C1-C5) showed cytotoxicity in NSCLC cells regardless of the p53 status. The compounds C1 and C3, which possess a pyrimidine at the center of the core, induced G2/M arrest, while the compounds without a pyrimidine (C2, C4, and C5) caused G1 arrest; all compounds produced caspase-mediated cell death. These events occurred in a p53-independent manner. Furthermore, it was suggested that compounds induced cell death through p53-independent DNA damage-signaling pathway. Compounds C2, C4, and C5 did not show strong cytotoxicity in WI-38 cells, whereas C1 and C3 did. However, the cytotoxicity of compound C1 against WI-38 cells was improved by modulating the terminal alkyl chain lengths of the compound. We showed the p53-indepdent structure-activity relationships of mesogenic compounds related to the cytotoxic effects. These structure-activity relationships will be helpful in the development of more effective and cancer-specific agents.
Wang, Yiping; Wong, Matthew Man-Kin; Zhang, Xiaojian; Chiu, Sung-Kay
2015-11-15
When cells are grown to confluence, cell-cell contact inhibition occurs and drives the cells to enter reversible quiescence rather than senescence. Confluent retinal pigment epithelial (RPE) cells exhibiting contact inhibition was used as a model in this study to examine the role of overexpression of transcription factor AP4, a highly expressed transcription factor in many types of cancer, in these cells during long-term culture. We generated stable inducible RPE cell clones expressing AP4 or AP4 without the DNA binding domain (DN-AP4) and observed that, when cultured for 24 days, RPE cells with a high level of AP4 exhibit a large, flattened morphology and even cease proliferating; these changes were not observed in DN-AP4-expressing cells or non-induced cells. In addition, AP4-expressing cells exhibited senescence-associated β-galactosidase activity and the senescence-associated secretory phenotype. We demonstrated that the induced cellular senescence was mediated by enhanced p53 expression and that AP4 regulates the p53 gene by binding directly to two of the three E-boxes present on the promoter of the p53 gene. Moreover, we showed that serum is essential for AP4 in inducing p53-associated cellular senescence. Collectively, we showed that overexpression of AP4 mediates cellular senescence involving in activation of p53 in long-term post-confluent RPE cells. Copyright © 2015 Elsevier Inc. All rights reserved.
Hydrogen peroxide sensing, signaling and regulation of transcription factors
Directory of Open Access Journals (Sweden)
H. Susana Marinho
2014-01-01
Full Text Available The regulatory mechanisms by which hydrogen peroxide (H2O2 modulates the activity of transcription factors in bacteria (OxyR and PerR, lower eukaryotes (Yap1, Maf1, Hsf1 and Msn2/4 and mammalian cells (AP-1, NRF2, CREB, HSF1, HIF-1, TP53, NF-κB, NOTCH, SP1 and SCREB-1 are reviewed. The complexity of regulatory networks increases throughout the phylogenetic tree, reaching a high level of complexity in mammalians. Multiple H2O2 sensors and pathways are triggered converging in the regulation of transcription factors at several levels: (1 synthesis of the transcription factor by upregulating transcription or increasing both mRNA stability and translation; (ii stability of the transcription factor by decreasing its association with the ubiquitin E3 ligase complex or by inhibiting this complex; (iii cytoplasm–nuclear traffic by exposing/masking nuclear localization signals, or by releasing the transcription factor from partners or from membrane anchors; and (iv DNA binding and nuclear transactivation by modulating transcription factor affinity towards DNA, co-activators or repressors, and by targeting specific regions of chromatin to activate individual genes. We also discuss how H2O2 biological specificity results from diverse thiol protein sensors, with different reactivity of their sulfhydryl groups towards H2O2, being activated by different concentrations and times of exposure to H2O2. The specific regulation of local H2O2 concentrations is also crucial and results from H2O2 localized production and removal controlled by signals. Finally, we formulate equations to extract from typical experiments quantitative data concerning H2O2 reactivity with sensor molecules. Rate constants of 140 M−1 s−1 and ≥1.3 × 103 M−1 s−1 were estimated, respectively, for the reaction of H2O2 with KEAP1 and with an unknown target that mediates NRF2 protein synthesis. In conclusion, the multitude of H2O2 targets and mechanisms provides an opportunity for
Energy Technology Data Exchange (ETDEWEB)
Lin, Chien-Ju [Graduate Institute of Medical Sciences, Taipei Medical University, Taipei, Taiwan (China); Comprehensive Cancer Center, Taipei Medical University, Taipei, Taiwan (China); Chen, Ta-Liang [Anesthetics and Toxicology Research Center, Taipei Medical University Hospital, Taipei, Taiwan (China); Department of Anesthesiology, Taipei Medical University Hospital, Taipei, Taiwan (China); Tseng, Yuan-Yun [Department of Neurosurgery, Shuang-Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Wu, Gong-Jhe [Department of Anesthesiology, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Hsieh, Ming-Hui [Anesthetics and Toxicology Research Center, Taipei Medical University Hospital, Taipei, Taiwan (China); Department of Anesthesiology, Taipei Medical University Hospital, Taipei, Taiwan (China); Lin, Yung-Wei [Brain Disease Research Center, Taipei Medical University Wan-Fang Hospital, Taipei, Taiwan (China); Chen, Ruei-Ming, E-mail: rmchen@tmu.edu.tw [Graduate Institute of Medical Sciences, Taipei Medical University, Taipei, Taiwan (China); Anesthetics and Toxicology Research Center, Taipei Medical University Hospital, Taipei, Taiwan (China); Brain Disease Research Center, Taipei Medical University Wan-Fang Hospital, Taipei, Taiwan (China); Comprehensive Cancer Center, Taipei Medical University, Taipei, Taiwan (China)
2016-08-01
Honokiol, an active constituent extracted from the bark of Magnolia officinalis, possesses anticancer effects. Apoptosis is classified as type I programmed cell death, while autophagy is type II programmed cell death. We previously proved that honokiol induces cell cycle arrest and apoptosis of U87 MG glioma cells. Subsequently in this study, we evaluated the effect of honokiol on autophagy of glioma cells and examined the molecular mechanisms. Administration of honokiol to mice with an intracranial glioma increased expressions of cleaved caspase 3 and light chain 3 (LC3)-II. Exposure of U87 MG cells to honokiol also induced autophagy in concentration- and time-dependent manners. Results from the addition of 3-methyladenine, an autophagy inhibitor, and rapamycin, an autophagy inducer confirmed that honokiol-induced autophagy contributed to cell death. Honokiol decreased protein levels of PI3K, phosphorylated (p)-Akt, and p-mammalian target of rapamycin (mTOR) in vitro and in vivo. Pretreatment with a p53 inhibitor or transfection with p53 small interfering (si)RNA suppressed honokiol-induced autophagy by reversing downregulation of p-Akt and p-mTOR expressions. In addition, honokiol caused generation of reactive oxygen species (ROS), which was suppressed by the antioxidant, vitamin C. Vitamin C also inhibited honokiol-induced autophagic and apoptotic cell death. Concurrently, honokiol-induced alterations in levels of p-p53, p53, p-Akt, and p-mTOR were attenuated following vitamin C administration. Taken together, our data indicated that honokiol induced ROS-mediated autophagic cell death through regulating the p53/PI3K/Akt/mTOR signaling pathway. - Highlights: • Exposure of mice with intracranial gliomas to honokiol induces cell apoptosis and autophagy. • Honokiol triggers autophagy of human glioma cells via the PISK/AKT/mTOR signaling pathway. • P53 induces autophagy via regulating the AKT/mTOR pathway in honokiol-treated glioma cells. • ROS participates
Dorado, Beatriz; Area, Estela; Akman, Hasan O; Hirano, Michio
2011-01-01
Deficiency of thymidine kinase 2 (TK2) is a frequent cause of isolated myopathy or encephalomyopathy in children with mitochondrial DNA (mtDNA) depletion. To determine the bases of disease onset, organ specificity and severity of TK2 deficiency, we have carefully characterized Tk2 H126N knockin mice (Tk2-/-). Although normal until postnatal day 8, Tk2-/- mice rapidly develop fatal encephalomyopathy between postnatal days 10 and 13. We have observed that wild-type Tk2 activity is constant in the second week of life, while Tk1 activity decreases significantly between postnatal days 8 and 13. The down-regulation of Tk1 activity unmasks Tk2 deficiency in Tk2-/- mice and correlates with the onset of mtDNA depletion in the brain and the heart. Resistance to pathology in Tk2 mutant organs depends on compensatory mechanisms to the reduced mtDNA level. Our analyses at postnatal day 13 have revealed that Tk2-/- heart significantly increases mitochondrial transcript levels relative to the mtDNA content. This transcriptional compensation allows the heart to maintain normal levels of mtDNA-encoded proteins. The up-regulation in mitochondrial transcripts is not due to increased expression of the master mitochondrial biogenesis regulators peroxisome proliferator-activated receptor-gamma coactivator 1 alpha and nuclear respiratory factors 1 and 2, or to enhanced expression of the mitochondrial transcription factors A, B1 or B2. Instead, Tk2-/- heart compensates for mtDNA depletion by down-regulating the expression of the mitochondrial transcriptional terminator transcription factor 3 (MTERF3). Understanding the molecular mechanisms that allow Tk2 mutant organs to be spared may help design therapies for Tk2 deficiency.
International Nuclear Information System (INIS)
Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.
1988-01-01
Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)
Mutant p53 protein localized in the cytoplasm inhibits autophagy.
Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido
2008-10-01
The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.
Directory of Open Access Journals (Sweden)
Kateřina Cetkovská
Full Text Available Williams-Beuren syndrome-associated transcription factor TFII-I plays a critical regulatory role in bone and neural tissue development and in immunity, in part by regulating cell proliferation in response to mitogens. Mdm2, a cellular oncogene responsible for the loss of p53 tumor suppressor activity in a significant proportion of human cancers, was identified in this study as a new binding partner for TFII-I and a negative regulator of TFII-I-mediated transcription. These findings suggest a new p53-independent mechanism by which increased Mdm2 levels found in human tumors could influence cancer cells. In addition to that, we present data indicating that TFII-I is an important cellular regulator of transcription from the immediate-early promoter of human cytomegalovirus, a promoter sequence frequently used in mammalian expression vectors, including vectors for gene therapy. Our observation that Mdm2 over-expression can decrease the ability of TFII-I to activate the CMV promoter might have implications for the efficiency of experimental gene therapy based on CMV promoter-derived vectors in cancers with Mdm2 gene amplification.
Directory of Open Access Journals (Sweden)
Yuen Ngan Fan
Full Text Available Chemotherapeutic drug resistance and relapse remains a major challenge for paediatric (medulloblastoma and adult (glioblastoma brain tumour treatment. Medulloblastoma tumours and cell lines with mutations in the p53 signalling pathway have been shown to be specifically insensitive to DNA damaging agents. The aim of this study was to investigate the potential of triggering cell death in p53 mutated medulloblastoma cells by a direct activation of pro-death signalling downstream of p53 activation. Since non-coding microRNAs (miRNAs have the ability to fine tune the expression of a variety of target genes, orchestrating multiple downstream effects, we hypothesised that triggering the expression of a p53 target miRNA could induce cell death in chemo-resistant cells. Treatment with etoposide, increased miR-34a levels in a p53-dependent fashion and the level of miR-34a transcription was correlated with the cell sensitivity to etoposide. miR-34a activity was validated by measuring the expression levels of one of its well described target: the NADH dependent sirtuin1 (SIRT1. Whilst drugs directly targeting SIRT1, were potent to trigger cell death at high concentrations only, introduction of synthetic miR-34a mimics was able to induce cell death in p53 mutated medulloblastoma and glioblastoma cell lines. Our results show that the need of a functional p53 signaling pathway can be bypassed by direct activation of miR-34a in brain tumour cells.
E2F-dependent induction of p14ARF during cell cycle re-entry in human T cells
DEFF Research Database (Denmark)
del Arroyo, Ana Gutierrez; El Messaoudi, Selma; Clark, Paula A
2007-01-01
The ARF protein, encoded by alternate exon usage within the CDKN2A locus, provides a link between the retinoblastoma (pRb) and p53 tumor suppressor pathways. Agents that disable pRb or otherwise impinge on the E2F family of transcription factors induce expression of ARF, resulting in stabilization...... of p53 and activation of p53-regulated genes. However, in some cell types ARF is not induced upon cell cycle re-entry, as expected of a conventional E2F target gene, leading to the suggestion that the ARF promoter only responds to supra-physiological or aberrant levels of E2F. These properties have...
Ozaki, Toshinori; Nakamura, Mizuyo; Ogata, Takehiro; Sang, Meijie; Yoda, Hiroyuki; Hiraoka, Kiriko; Sang, Meixiang; Shimozato, Osamu
2016-11-01
Recently, we have described that siRNA-mediated silencing of runt-related transcription factor 2 (RUNX2) improves anti-cancer drug gemcitabine (GEM) sensitivity of p53-deficient human pancreatic cancer AsPC-1 cells through the augmentation of p53 family TAp63-dependent cell death pathway. In this manuscript, we have extended our study to p53-mutated human pancreatic cancer Panc-1 cells. According to our present results, knockdown of mutant p53 alone had a marginal effect on GEM-mediated cell death of Panc-1 cells. We then sought to deplete RUNX2 using siRNA in Panc-1 cells and examined its effect on GEM sensitivity. Under our experimental conditions, RUNX2 knockdown caused a significant enhancement of GEM sensitivity of Panc-1 cells. Notably, GEM-mediated induction of TAp63 but not of TAp73 was further stimulated in RUNX2-depleted Panc-1 cells, indicating that, like AsPC-1 cells, TAp63 might play a pivotal role in the regulation of GEM sensitivity of Panc-1 cells. Consistent with this notion, forced expression of TAp63α in Panc-1 cells promoted cell cycle arrest and/or cell death, and massively increased luciferase activities driven by TAp63-target gene promoters such as p21WAF1 and NOXA. In addition, immunoprecipitation experiments indicated that RUNX2 forms a complex with TAp63 in Panc-1 cells. Taken together, our current observations strongly suggest that depletion of RUNX2 enhances the cytotoxic effect of GEM on p53-mutated Panc-1 cells through the stimulation of TAp63-dependent cell death pathway even in the presence of a large amount of pro-oncogenic mutant p53, and might provide an attractive strategy to treat pancreatic cancer patients with p53 mutations.
Zhang, Cen; Liu, Juan; Zhao, Yuhan; Yue, Xuetian; Zhu, Yu; Wang, Xiaolong; Wu, Hao; Blanco, Felix; Li, Shaohua; Bhanot, Gyan; Haffty, Bruce G; Hu, Wenwei; Feng, Zhaohui
2016-01-01
Glutaminase (GLS) isoenzymes GLS1 and GLS2 are key enzymes for glutamine metabolism. Interestingly, GLS1 and GLS2 display contrasting functions in tumorigenesis with elusive mechanism; GLS1 promotes tumorigenesis, whereas GLS2 exhibits a tumor-suppressive function. In this study, we found that GLS2 but not GLS1 binds to small GTPase Rac1 and inhibits its interaction with Rac1 activators guanine-nucleotide exchange factors, which in turn inhibits Rac1 to suppress cancer metastasis. This function of GLS2 is independent of GLS2 glutaminase activity. Furthermore, decreased GLS2 expression is associated with enhanced metastasis in human cancer. As a p53 target, GLS2 mediates p53’s function in metastasis suppression through inhibiting Rac1. In summary, our results reveal that GLS2 is a novel negative regulator of Rac1, and uncover a novel function and mechanism whereby GLS2 suppresses metastasis. Our results also elucidate a novel mechanism that contributes to the contrasting functions of GLS1 and GLS2 in tumorigenesis. DOI: http://dx.doi.org/10.7554/eLife.10727.001 PMID:26751560
He, Mingyuan; Dong, Chen; Konishi, Teruaki; Tu, Wenzhi; Liu, Weili; Shiomi, Naoko; Kobayashi, Alisa; Uchihori, Yukio; Furusawa, Yoshiya; Hei, Tom K.; Dang, Bingrong; Shao, Chunlin
2014-04-01
High LET particle irradiation has several potential advantages over γ-rays such as p53-independent response. The purpose of this work is to disclose the effect of p53 on the bystander effect induced by different LET irradiations and underlying mechanism. Lymphocyte cells of TK6 (wild type p53) and HMy2.CIR (mutated p53) were exposed to either low or high LET irradiation, then their mitochondrial dysfunction and ROS generation were detected. The micronuclei (MN) induction in HL-7702 hepatocytes co-cultured with irradiated lymphocytes was also measured. It was found that the mitochondrial dysfunction, p66Shc activation, and intracellular ROS were enhanced in TK6 but not in HMy2.CIR cells after γ-ray irradiation, but all of them were increased in both cell lines after carbon and iron irradiation. Consistently, the bystander effect of MN formation in HL-7702 cells was only triggered by γ-irradiated TK6 cells but not by γ-irradiated HMy2.CIR cells. But this bystander effect was induced by both lymphocyte cell lines after heavy ion irradiation. PFT-μ, an inhibitor of p53, only partly inhibited ROS generation and bystander effect induced by 30 keV/μm carbon-irradiated TK6 cells but failed to suppress the bystander effect induced by the TK6 cells irradiated with either 70 keV/μm carbon or 180 keV/μm iron. The mitochondrial inhibitors of rotenone and oligomycin eliminated heavy ion induced ROS generation in TK6 and HMy2.CIR cells and hence diminished the bystander effect on HL-7702 cells. These results clearly demonstrate that the bystander effect is p53-dependent for low LET irradiation, but it is p53-independent for high LET irradiation which may be because of p53-independent ROS generation due to mitochondrial dysfunction.
Knockout and transgenic mice of Trp53: what have we learned about p53 in breast cancer?
International Nuclear Information System (INIS)
Blackburn, Anneke C; Jerry, D Joseph
2002-01-01
The human p53 tumor suppressor gene TP53 is mutated at a high frequency in sporadic breast cancer, and Li-Fraumeni syndrome patients who carry germline mutations in one TP53 allele have a high incidence of breast cancer. In the 10 years since the first knockout of the mouse p53 tumor suppressor gene (designated Trp53) was published, much has been learned about the contribution of p53 to biology and tumor suppression in the breast through the use of p53 transgenic and knockout mice. The original mice deficient in p53 showed no mammary gland phenotype. However, studies using BALB/c-Trp53-deficient mice have demonstrated a delayed involution phenotype and a mammary tumor phenotype. Together with other studies of mutant p53 transgenes and p53 bitransgenics, a greater understanding has been gained of the role of p53 in involution, of the regulation of p53 activity by hormones, of the effect of mouse strain and modifier genes on tumor phenotype, and of the cooperation between p53 and other oncogenic pathways, chemical carcinogens and hormonal stimulation in mammary tumorigenesis. Both p53 transgenic and knockout mice are important in vivo tools for understanding breast cancer, and are yet to be exploited for developing therapeutic strategies in breast cancer
Markowitz, Joseph; Chen, Ijen; Gitti, Rossi; Baldisseri, Donna M; Pan, Yongping; Udan, Ryan; Carrier, France; MacKerell, Alexander D; Weber, David J
2004-10-07
The binding of S100B to p53 down-regulates wild-type p53 tumor suppressor activity in cancer cells such as malignant melanoma, so a search for small molecules that bind S100B and prevent S100B-p53 complex formation was undertaken. Chemical databases were computationally searched for potential inhibitors of S100B, and 60 compounds were selected for testing on the basis of energy scoring, commercial availability, and chemical similarity clustering. Seven of these compounds bound to S100B as determined by steady state fluorescence spectroscopy (1.0 microM model of one such inhibitor, pentamidine, bound to Ca(2+)-loaded S100B was calculated using intermolecular NOE data between S100B and the drug, and indicates that pentamidine binds into the p53 binding site on S100B defined by helices 3 and 4 and loop 2 (termed the hinge region).
The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.
Directory of Open Access Journals (Sweden)
Daniel Menendez
2011-03-01
Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.
Directory of Open Access Journals (Sweden)
Somayeh Khazaei
2017-01-01
Full Text Available Breast cancer is the second leading cause of cancer death among women and despite significant advances in therapy, it remains a critical health problem worldwide. Allium atroviolaceum is an herbaceous plant, with limited information about the therapeutic capability. We aimed to study the anticancer effect of flower extract and the mechanisms of action in MCF-7 and MDA-MB-231. The extract inhibits the proliferation of the cells in a time- and dose-dependent manner. The underlying mechanism involved the stimulation of S and G2/M phase arrest in MCF-7 and S phase arrest in MDA-MB-231 associated with decreased level of Cdk1, in a p53-independent pathway. Furthermore, the extract induces apoptosis in both cell lines, as indicated by the percentage of sub-G0 population, the morphological changes observed by phase contrast and fluorescent microscopy, and increase in Annexin-V-positive cells. The apoptosis induction was related to downregulation of Bcl-2 and also likely to be caspase-dependent. Moreover, the combination of the extract and tamoxifen exhibits synergistic effect, suggesting that it can complement current chemotherapy. LC-MS analysis displayed 17 major compounds in the extract which might be responsible for the observed effects. Overall, this study demonstrates the potential applications of Allium atroviolaceum extract as an anticancer drug for breast cancer treatment.