WorldWideScience

Sample records for region sequences electronic

  1. Region segmentation along image sequence

    International Nuclear Information System (INIS)

    Monchal, L.; Aubry, P.

    1995-01-01

    A method to extract regions in sequence of images is proposed. Regions are not matched from one image to the following one. The result of a region segmentation is used as an initialization to segment the following and image to track the region along the sequence. The image sequence is exploited as a spatio-temporal event. (authors). 12 refs., 8 figs

  2. Quantum-Sequencing: Fast electronic single DNA molecule sequencing

    Science.gov (United States)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  3. Optimization of sequence alignment for simple sequence repeat regions

    Directory of Open Access Journals (Sweden)

    Ogbonnaya Francis C

    2011-07-01

    Full Text Available Abstract Background Microsatellites, or simple sequence repeats (SSRs, are tandemly repeated DNA sequences, including tandem copies of specific sequences no longer than six bases, that are distributed in the genome. SSR has been used as a molecular marker because it is easy to detect and is used in a range of applications, including genetic diversity, genome mapping, and marker assisted selection. It is also very mutable because of slipping in the DNA polymerase during DNA replication. This unique mutation increases the insertion/deletion (INDELs mutation frequency to a high ratio - more than other types of molecular markers such as single nucleotide polymorphism (SNPs. SNPs are more frequent than INDELs. Therefore, all designed algorithms for sequence alignment fit the vast majority of the genomic sequence without considering microsatellite regions, as unique sequences that require special consideration. The old algorithm is limited in its application because there are many overlaps between different repeat units which result in false evolutionary relationships. Findings To overcome the limitation of the aligning algorithm when dealing with SSR loci, a new algorithm was developed using PERL script with a Tk graphical interface. This program is based on aligning sequences after determining the repeated units first, and the last SSR nucleotides positions. This results in a shifting process according to the inserted repeated unit type. When studying the phylogenic relations before and after applying the new algorithm, many differences in the trees were obtained by increasing the SSR length and complexity. However, less distance between different linage had been observed after applying the new algorithm. Conclusions The new algorithm produces better estimates for aligning SSR loci because it reflects more reliable evolutionary relations between different linages. It reduces overlapping during SSR alignment, which results in a more realistic

  4. Downshift of electron plasma oscillations in the electron foreshock region

    International Nuclear Information System (INIS)

    Fuselier, S.A.; Gurnett, D.A.; Fitzenreiter, R.J.; NASA, Goddard Space Flight Center, Greenbelt, MD)

    1985-01-01

    Electron plasma oscillations in the earth's electron foreshock region are observed to shift above and below the local electron plasma frequency. As plasma oscillations shift downward from the plasma frequency, their bandwidth increases and their wavelength decreases. Observations of plasma oscillations well below the plasma frequency are correlated with times when ISEE 1 is far downstream of the electron foreshock boundary. Although wavelengths of plasma oscillations below the plasma frequency satisfy k x lambda-De approximately 1 the Doppler shift due to the motion of the solar wind is not sufficient to produce the observed frequency shifts. A beam-plasma interaction with beam velocities on the order of the electron thermal velocity is suggested as an explanation for plasma oscillations above and below the plasma frequency. Frequency, bandwidth, and wavelength changes predicted from the beam-plasma interaction are in good agreement with the observed characteristics of plasma oscillations in the foreshock region. 28 references

  5. Downshift of electron plasma oscillations in the electron foreshock region

    International Nuclear Information System (INIS)

    Fuselier, S.A.

    1984-01-01

    Electron plasma oscillations in the Earth's electron foreshock region are observed to shift above and below the local electron plasma frequency. As plasma oscillations shift from the plasma frequency, their bandwidth increases and their wavelength decreases. Observations of plasma oscillations well below the plasma frequency are correlated with times when ISEE-I is far downstream of the electron foreshock boundary. Although wavelengths of plasma oscillations below the plasma frequency satisfy klambda/sub De/ approx. = 1, the Doppler shift due to the motion of the solar wind is not sufficient to produce the observed frequency shifts. A beam-plasma interaction with beam velocities on the order of the electron thermal velocity is suggested as an explanation for plasma oscillations above and below the plasma frequency. Frequency, bandwidth, and wavelength changes predicted from the beam-plasma interaction are in good agreement with the observed characteristics of plasma oscillations in the foreshock region

  6. Ballooning mode second stability region for sequences of tokamak equilibria

    International Nuclear Information System (INIS)

    Sugiyama, L.; Mark, J.W.K.

    A numerical study of several sequences of tokamak equilibria derived from two flux conserving sequences confirms the tendency of high n ideal MHD ballooning modes to stabilize for values of the plasma beta greater than a second critical beta, for sufficiently favorable equilibria. The major stabilizing effect of increasing the inverse rotational transform profile q(Psi) for equilibria with the same flux surface geometry is shown. The unstable region shifts toward larger shear d ln q/d ln γ and the width of the region measured in terms of the poloidal beta or a pressure gradient parameter, for fixed shear, decreases. The smaller aspect ratio sequences are more sensitive to changes in q and have less stringent limits on the attainable value of the plasma beta in the high beta stable region. Finally, the disconnected mode approximation is shown to provide a reasonable description of the second high beta stability boundary

  7. Using a sequence characterized amplified region (SCAR) marker for ...

    African Journals Online (AJOL)

    GREGORY

    2010-09-13

    Sep 13, 2010 ... This work used sequence characterized amplified region (SCAR) marker to detect the Bacillus cereus strain in strawberry fields. The purpose was to develop an effective molecular method for detecting the functional target microorganisms applied in agricultural fields. A 3×109. CFU/ml vegetative cell.

  8. Targeted sequencing of large genomic regions with CATCH-Seq.

    Directory of Open Access Journals (Sweden)

    Kenneth Day

    Full Text Available Current target enrichment systems for large-scale next-generation sequencing typically require synthetic oligonucleotides used as capture reagents to isolate sequences of interest. The majority of target enrichment reagents are focused on gene coding regions or promoters en masse. Here we introduce development of a customizable targeted capture system using biotinylated RNA probe baits transcribed from sheared bacterial artificial chromosome clone templates that enables capture of large, contiguous blocks of the genome for sequencing applications. This clone adapted template capture hybridization sequencing (CATCH-Seq procedure can be used to capture both coding and non-coding regions of a gene, and resolve the boundaries of copy number variations within a genomic target site. Furthermore, libraries constructed with methylated adapters prior to solution hybridization also enable targeted bisulfite sequencing. We applied CATCH-Seq to diverse targets ranging in size from 125 kb to 3.5 Mb. Our approach provides a simple and cost effective alternative to other capture platforms because of template-based, enzymatic probe synthesis and the lack of oligonucleotide design costs. Given its similarity in procedure, CATCH-Seq can also be performed in parallel with commercial systems.

  9. An ongoing earthquake sequence near Dhaka, Bangladesh, from regional recordings

    Science.gov (United States)

    Howe, M.; Mondal, D. R.; Akhter, S. H.; Kim, W.; Seeber, L.; Steckler, M. S.

    2013-12-01

    Earthquakes in and around the syntaxial region between the continent-continent collision of the Himalayan arc and oceanic subduction of the Sunda arc result primarily from the convergence of India and Eurasia-Sunda plates along two fronts. The northern front, the convergence of the Indian and Eurasian plates, has produced the Himalayas. The eastern front, the convergence of the Indian and Sunda plates, ranges from ocean-continent subduction at the Andaman Arc and Burma Arc, and transitions to continent-continent collision to the north at the Assam Syntaxis in northeast India. The India-Sunda convergence at the Burma Arc is extremely oblique. The boundary-normal convergence rate is ~17 mm/yr while the boundary-parallel rate is ~45 mm/yr including the well-known Sagaing strike-slip fault, which accommodates about half the shear component. This heterogeneous tectonic setting produces multiple earthquake sources that need to be considered when assessing seismic hazard and risk in this region. The largest earthquakes, just as in other subduction systems, are expected to be interplate events that occur on the low-angle megathrusts, such as the Mw 9.2 2004 Sumatra-Andaman earthquake and the 1762 earthquake along the Arakan margin. These earthquakes are known to produce large damage over vast areas, but since they account for large fault motions they are relatively rare. The majority of current seismicity in the study area is intraplate. Most of the seismicity associated with the Burma Arc subduction system is in the down-going slab, including the shallow-dipping part below the megathrust flooring the accretionary wedge. The strike of the wedge is ~N-S and Dhaka lies at its outer limit. One particular source relevant to seismic risk in Dhaka is illuminated by a multi-year sequence of earthquakes in Bangladesh less than 100 km southeast of Dhaka. The population in Dhaka (now at least 15 million) has been increasing dramatically due to rapid urbanization. The vulnerability

  10. Acceleration of electrons at wakefield excitation by a sequence of relativistic electron bunches in dielectric resonator

    International Nuclear Information System (INIS)

    Kiselev, V.A.; Linnik, A.F.; Mirnyj, V.I.; Onishchenko, I.N.; Uskov, V.V.

    2009-01-01

    Method is proposed to divide a regular sequence of electron bunches into parts of bunches driving wakefield and witness bunches, which should be accelerated. It allows to avoid the necessity of additional electron accelerator for witness bunches producing and the necessity of precision short time techniques of injection phase adjusting. The idea concludes to the frequency detuning between bunches repetition frequency and the frequency of the fundamental mode of excited wakefield. Experiments were carried out on the linear resonant accelerator 'Almaz-2', which injected in the dielectric resonator a sequence of 6000 short bunches of relativistic electrons with energy 4.5 MeV, charge 0.16 nC and duration 60 psec each, the repetition interval 360 ps. Frequency detuning was entered by change of frequency of the master generator of the klystron within the limits of one percent so that the phase taper on the length of bunches sequence achieved 2π. Energy spectra of electrons of bunches sequence, which have been propagated through the dielectric resonator are measured and analyzed

  11. Time Separation Between Events in a Sequence: a Regional Property?

    Science.gov (United States)

    Muirwood, R.; Fitzenz, D. D.

    2013-12-01

    Earthquake sequences are loosely defined as events occurring too closely in time and space to appear unrelated. Depending on the declustering method, several, all, or no event(s) after the first large event might be recognized as independent mainshocks. It can therefore be argued that a probabilistic seismic hazard assessment (PSHA, traditionally dealing with mainshocks only) might already include the ground shaking effects of such sequences. Alternatively all but the largest event could be classified as an ';aftershock' and removed from the earthquake catalog. While in PSHA the question is only whether to keep or remove the events from the catalog, for Risk Management purposes, the community response to the earthquakes, as well as insurance risk transfer mechanisms, can be profoundly affected by the actual timing of events in such a sequence. In particular the repetition of damaging earthquakes over a period of weeks to months can lead to businesses closing and families evacuating from the region (as happened in Christchurch, New Zealand in 2011). Buildings that are damaged in the first earthquake may go on to be damaged again, even while they are being repaired. Insurance also functions around a set of critical timeframes - including the definition of a single 'event loss' for reinsurance recoveries within the 192 hour ';hours clause', the 6-18 month pace at which insurance claims are settled, and the annual renewal of insurance and reinsurance contracts. We show how temporal aspects of earthquake sequences need to be taken into account within models for Risk Management, and what time separation between events are most sensitive, both in terms of the modeled disruptions to lifelines and business activity as well as in the losses to different parties (such as insureds, insurers and reinsurers). We also explore the time separation between all events and between loss causing events for a collection of sequences from across the world and we point to the need to

  12. Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

    DEFF Research Database (Denmark)

    Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie

    2014-01-01

    The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sec...

  13. Colorectal Cancer Genetic Heterogeneity Delineated by Multi-Region Sequencing.

    Directory of Open Access Journals (Sweden)

    You-Wang Lu

    Full Text Available Intratumor heterogeneity (ITH leads to an underestimation of the mutational landscape portrayed by a single needle biopsy and consequently affects treatment precision. The extent of colorectal cancer (CRC genetic ITH is not well understood in Chinese patients. Thus, we conducted deep sequencing by using the OncoGxOne™ Plus panel, targeting 333 cancer-specific genes in multi-region biopsies of primary and liver metastatic tumors from three Chinese CRC patients. We determined that the extent of ITH varied among the three cases. On average, 65% of all the mutations detected were common within individual tumors. KMT2C aberrations and the NCOR1 mutation were the only ubiquitous events. Subsequent phylogenetic analysis showed that the tumors evolved in a branched manner. Comparison of the primary and metastatic tumors revealed that PPP2R1A (E370X, SETD2 (I1608V, SMAD4 (G382T, and AR splicing site mutations may be specific to liver metastatic cancer. These mutations might contribute to the initiation and progression of distant metastasis. Collectively, our analysis identified a substantial level of genetic ITH in CRC, which should be considered for personalized therapeutic strategies.

  14. The complementarity-determining region sequences in IgY antivenom hypervariable regions

    Directory of Open Access Journals (Sweden)

    David Gitirana da Rocha

    2017-08-01

    Full Text Available The data presented in this article are related to the research article entitled "Development of IgY antibodies against anti-snake toxins endowed with highly lethal neutralizing activity" (da Rocha et al., 2017 [1]. Complementarity-determining region (CDR sequences are variable antibody (Ab sequences that respond with specificity, duration and strength to identify and bind to antigen (Ag epitopes. B lymphocytes isolated from hens immunized with Bitis arietans (Ba and anti-Crotalus durissus terrificus (Cdt venoms and expressing high specificity, affinity and toxicity neutralizing antibody titers were used as DNA sources. The VLF1, CDR1, CDR2, VLR1 and CDR3 sequences were validated by BLASTp, and values corresponding to IgY VL and VH anti-Ba or anti-Cdt venoms were identified, registered [Gallus gallus IgY Fv Light chain (GU815099/Gallus gallus IgY Fv Heavy chain (GU815098] and used for molecular modeling of IgY scFv anti-Ba. The resulting CDR1, CDR2 and CDR3 sequences were combined to construct the three - dimensional structure of the Ab paratope.

  15. Functional region prediction with a set of appropriate homologous sequences-an index for sequence selection by integrating structure and sequence information with spatial statistics

    Science.gov (United States)

    2012-01-01

    Background The detection of conserved residue clusters on a protein structure is one of the effective strategies for the prediction of functional protein regions. Various methods, such as Evolutionary Trace, have been developed based on this strategy. In such approaches, the conserved residues are identified through comparisons of homologous amino acid sequences. Therefore, the selection of homologous sequences is a critical step. It is empirically known that a certain degree of sequence divergence in the set of homologous sequences is required for the identification of conserved residues. However, the development of a method to select homologous sequences appropriate for the identification of conserved residues has not been sufficiently addressed. An objective and general method to select appropriate homologous sequences is desired for the efficient prediction of functional regions. Results We have developed a novel index to select the sequences appropriate for the identification of conserved residues, and implemented the index within our method to predict the functional regions of a protein. The implementation of the index improved the performance of the functional region prediction. The index represents the degree of conserved residue clustering on the tertiary structure of the protein. For this purpose, the structure and sequence information were integrated within the index by the application of spatial statistics. Spatial statistics is a field of statistics in which not only the attributes but also the geometrical coordinates of the data are considered simultaneously. Higher degrees of clustering generate larger index scores. We adopted the set of homologous sequences with the highest index score, under the assumption that the best prediction accuracy is obtained when the degree of clustering is the maximum. The set of sequences selected by the index led to higher functional region prediction performance than the sets of sequences selected by other sequence

  16. THEMIS Observations of the Magnetopause Electron Diffusion Region: Large Amplitude Waves and Heated Electrons

    Science.gov (United States)

    Tang, Xiangwei; Cattell, Cynthia; Dombeck, John; Dai, Lei; Wilson, Lynn B. III; Breneman, Aaron; Hupack, Adam

    2013-01-01

    We present the first observations of large amplitude waves in a well-defined electron diffusion region based on the criteria described by Scudder et al at the subsolar magnetopause using data from one Time History of Events and Macroscale Interactions during Substorms (THEMIS) satellite. These waves identified as whistler mode waves, electrostatic solitary waves, lower hybrid waves, and electrostatic electron cyclotron waves, are observed in the same 12 s waveform capture and in association with signatures of active magnetic reconnection. The large amplitude waves in the electron diffusion region are coincident with abrupt increases in electron parallel temperature suggesting strong wave heating. The whistler mode waves, which are at the electron scale and which enable us to probe electron dynamics in the diffusion region were analyzed in detail. The energetic electrons (approx. 30 keV) within the electron diffusion region have anisotropic distributions with T(sub e(right angle))/T(sub e(parallel)) > 1 that may provide the free energy for the whistler mode waves. The energetic anisotropic electrons may be produced during the reconnection process. The whistler mode waves propagate away from the center of the "X-line" along magnetic field lines, suggesting that the electron diffusion region is a possible source region of the whistler mode waves.

  17. The Regulation of electronic money institutions in the SADC region ...

    African Journals Online (AJOL)

    It looks in particular at how the institutions that issue new electronic money products are regulated ... This development has become global and involves both developed and developing countries, including regions such as the SADC. ... regulatory challenges that came about with the development of electronic money and to ...

  18. The Downshift of Electron Plasma Oscillations in the Electron Foreshock Region.

    Science.gov (United States)

    1984-10-10

    Ii D-Ai50 52 THE DOWNSHIFT OF ELECTRON PLASMA OSCILLATIONS IN THE i/1. ELECTRON FORESHOCK R.. (U) I0MM UNIV 10MM CITY DEPT OF PHYSICS AND ASTRONOMY 5...OSCILLATIONS 0 IN THE ELECTRON FORESHOCK REGION In by S. A. Fuselierl, D. A. Gurnett 1 , Ace NTI 0. and R. J. Fitzenreiter 2 DTI I ,3WERSflY o. 06UNDED ISAI...geleasel Ditibto Unlimited 02 1 16 U. of Iowa 84-21 THE DOWNSHIFT OF ELECTRON PLASMA OSCILLATIONSJ / IN THE ELECTRON FORESHOCK REGION t - by Z I S. A

  19. Regional Educational Laboratory Electronic Network Phase 2 System

    Science.gov (United States)

    Cradler, John

    1995-01-01

    The Far West Laboratory in collaboration with the other regional educational laboratories is establishing a regionally coordinated telecommunication network to electronically interconnect each of the ten regional laboratories with educators and education stakeholders from the school to the state level. For the national distributed information database, each lab is working with mid-level networks to establish a common interface for networking throughout the country and include topics of importance to education reform as assessment and technology planning.

  20. Fast discovery and visualization of conserved regions in DNA sequences using quasi-alignment.

    Science.gov (United States)

    Nagar, Anurag; Hahsler, Michael

    2013-01-01

    Next Generation Sequencing techniques are producing enormous amounts of biological sequence data and analysis becomes a major computational problem. Currently, most analysis, especially the identification of conserved regions, relies heavily on Multiple Sequence Alignment and its various heuristics such as progressive alignment, whose run time grows with the square of the number and the length of the aligned sequences and requires significant computational resources. In this work, we present a method to efficiently discover regions of high similarity across multiple sequences without performing expensive sequence alignment. The method is based on approximating edit distance between segments of sequences using p-mer frequency counts. Then, efficient high-throughput data stream clustering is used to group highly similar segments into so called quasi-alignments. Quasi-alignments have numerous applications such as identifying species and their taxonomic class from sequences, comparing sequences for similarities, and, as in this paper, discovering conserved regions across related sequences. In this paper, we show that quasi-alignments can be used to discover highly similar segments across multiple sequences from related or different genomes efficiently and accurately. Experiments on a large number of unaligned 16S rRNA sequences obtained from the Greengenes database show that the method is able to identify conserved regions which agree with known hypervariable regions in 16S rRNA. Furthermore, the experiments show that the proposed method scales well for large data sets with a run time that grows only linearly with the number and length of sequences, whereas for existing multiple sequence alignment heuristics the run time grows super-linearly. Quasi-alignment-based algorithms can detect highly similar regions and conserved areas across multiple sequences. Since the run time is linear and the sequences are converted into a compact clustering model, we are able to

  1. Characterization of Campylobacter jejuni applying flaA short variable region sequencing, multilocus sequencing and Fourier transform infrared spectroscopy

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann; Bonnichsen, Lise; Larsson, Jonas

    flaA short variable region sequencing and phenetic Fourier transform infrared (FTIR) spectroscopy was applied on a collection of 102 Campylobacter jejuni isolated from continuous sampling of organic, free range geese and chickens. FTIR has been shown to serve as a valuable tool in typing...

  2. Intra-Genomic Internal Transcribed Spacer Region Sequence Heterogeneity and Molecular Diagnosis in Clinical Microbiology.

    Science.gov (United States)

    Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Cheng, Jingwei; Xu, Yingchun; Lau, Susanna K P; Woo, Patrick C Y

    2015-10-22

    Internal transcribed spacer region (ITS) sequencing is the most extensively used technology for accurate molecular identification of fungal pathogens in clinical microbiology laboratories. Intra-genomic ITS sequence heterogeneity, which makes fungal identification based on direct sequencing of PCR products difficult, has rarely been reported in pathogenic fungi. During the process of performing ITS sequencing on 71 yeast strains isolated from various clinical specimens, direct sequencing of the PCR products showed ambiguous sequences in six of them. After cloning the PCR products into plasmids for sequencing, interpretable sequencing electropherograms could be obtained. For each of the six isolates, 10-49 clones were selected for sequencing and two to seven intra-genomic ITS copies were detected. The identities of these six isolates were confirmed to be Candida glabrata (n=2), Pichia (Candida) norvegensis (n=2), Candida tropicalis (n=1) and Saccharomyces cerevisiae (n=1). Multiple sequence alignment revealed that one to four intra-genomic ITS polymorphic sites were present in the six isolates, and all these polymorphic sites were located in the ITS1 and/or ITS2 regions. We report and describe the first evidence of intra-genomic ITS sequence heterogeneity in four different pathogenic yeasts, which occurred exclusively in the ITS1 and ITS2 spacer regions for the six isolates in this study.

  3. Search for Fermi shuttle mechanisms in electron emission from atomic collision sequences

    International Nuclear Information System (INIS)

    Suarez, S.; Jung, M.; Rothard, H.; Schosnig, M.; Maier, R.; Clouvas, A.; Groeneveld, K.O.

    1994-01-01

    In electron spectra induced by slow heavy ion bombardment of solids a high energy tail can be observed, which is suggested to be explained by multiple collision sequences. In order to find those multiple collision effects like the ''Fermi shuttle'' acceleration mechanism we measured doubly differential electron emission cross sections for H + (33.5-700 keV) impact on different targets (He, Ne, C and Au) as a function of projectile energy and electron emission angle. We observed a surprising target dependence of the electron emission within the range of electron energies close to that of the binary encounter electrons for all observed angles of emission. (orig.)

  4. Martian Electron Temperatures in the Sub Solar Region.

    Science.gov (United States)

    Fowler, C. M.; Peterson, W. K.; Andersson, L.; Thiemann, E.; Mayyasi, M.; Yelle, R. V.; Benna, M.; Espley, J. R.

    2017-12-01

    Observations from Viking, and MAVEN have shown that the observed ionospheric electron temperatures are systematically higher than those predicted by many models. Because electron temperature is a balance between heating, cooling, and heat transport, we systematically compare the magnitude of electron heating from photoelectrons, electron cooling and heat transport, as a function of altitude within 30 degrees of the sub solar point. MAVEN observations of electron temperature and density, EUV irradiance, neutral and ion composition are used to evaluate terms in the heat equation following the framework of Matta et al. (Icarus, 2014, doi:10.1016/j.icarus.2013.09.006). Our analysis is restricted to inbound orbits where the magnetic field is within 30 degrees of horizontal. MAVEN sampled the sub solar region in May 2015 and again in May 2017, in near northern spring equinoctial conditions. Solar activity was higher and the spacecraft sampled altitudes down to 120 km in 2015, compared to 160 km in 2017. We find that between 160 and 200 km the Maven electron temperatures are in thermal equilibrium, in the sub solar region, on field lines inclined less than 30 degrees to the horizontal. Above 200km the data suggest that heating from other sources, such as wave heating are significant. Below 160 km some of the discrepancy comes from measurement limitations. This is because the MAVEN instrument cannot resolve the lowest electron temperatures, and because some cooling rates scale as the difference between the electron and neutral temperatures.

  5. Regions of low electron density in the Earth plasmasphere

    International Nuclear Information System (INIS)

    Grigor'eva, V.P.; Pisareva, V.V.

    1987-01-01

    Regions with low electron density N e were detected in night, morning and evening hours according to observations of natural noise, made on board ''Prognos-5'' satellite from January till June, 1977 in the plasmasphere for the southern Earth semisphere. The largest regions with low N e values were located in the region of the Brazil magnetic anomaly in the range of geographic latitudes ∼ ± 30 deg from the equator and longitudes from 100 up to 240 deg E, as well as in the latitudes near-by the geomagnetic equator and in the regions with slight shift from it to the winter hemisphere

  6. Electron streaking in the autoionization region of H2

    International Nuclear Information System (INIS)

    Palacios, Alicia; González-Castrillo, Alberto; Martín, Fernando

    2015-01-01

    We use a UV-pump/IR-probe scheme, combining a single attosecond UV pulse and a 750 nm IR pulse, to explore laser-assisted photoionization of the hydrogen molecule in the autoionization region. The electron energy distributions exhibit unusual streaking patterns that are explored for different angles of the electron ejection with respect to the polarization vector and the molecular axis. Moreover, by controlling the time delay between the pulses, we observe that one can suppress the autoionization channel. (paper)

  7. Exome sequencing generates high quality data in non-target regions

    Directory of Open Access Journals (Sweden)

    Guo Yan

    2012-05-01

    Full Text Available Abstract Background Exome sequencing using next-generation sequencing technologies is a cost efficient approach to selectively sequencing coding regions of human genome for detection of disease variants. A significant amount of DNA fragments from the capture process fall outside target regions, and sequence data for positions outside target regions have been mostly ignored after alignment. Result We performed whole exome sequencing on 22 subjects using Agilent SureSelect capture reagent and 6 subjects using Illumina TrueSeq capture reagent. We also downloaded sequencing data for 6 subjects from the 1000 Genomes Project Pilot 3 study. Using these data, we examined the quality of SNPs detected outside target regions by computing consistency rate with genotypes obtained from SNP chips or the Hapmap database, transition-transversion (Ti/Tv ratio, and percentage of SNPs inside dbSNP. For all three platforms, we obtained high-quality SNPs outside target regions, and some far from target regions. In our Agilent SureSelect data, we obtained 84,049 high-quality SNPs outside target regions compared to 65,231 SNPs inside target regions (a 129% increase. For our Illumina TrueSeq data, we obtained 222,171 high-quality SNPs outside target regions compared to 95,818 SNPs inside target regions (a 232% increase. For the data from the 1000 Genomes Project, we obtained 7,139 high-quality SNPs outside target regions compared to 1,548 SNPs inside target regions (a 461% increase. Conclusions These results demonstrate that a significant amount of high quality genotypes outside target regions can be obtained from exome sequencing data. These data should not be ignored in genetic epidemiology studies.

  8. Sequence analysis of mitochondrial DNA hypervariable region III of ...

    African Journals Online (AJOL)

    The aims of this research were to study mitochondrial DNA hypervariable region III and establish the degree of variation characteristic of a fragment. The mitochondrial DNA (mtDNA) is a small circular genome located within the mitochondria in the cytoplasm of the cell and a smaller 1.2 kb pair fragment, called the control ...

  9. Evaluation of a target region capture sequencing platform using monogenic diabetes as a study-model

    DEFF Research Database (Denmark)

    Gao, Rui; Liu, Yanxia; Gjesing, Anette Marianne Prior

    2014-01-01

    Monogenic diabetes is a genetic disease often caused by mutations in genes involved in beta-cell function. Correct sub-categorization of the disease is a prerequisite for appropriate treatment and genetic counseling. Target-region capture sequencing is a combination of genomic region enrichment...... and next generation sequencing which might be used as an efficient way to diagnose various genetic disorders. We aimed to develop a target-region capture sequencing platform to screen 117 selected candidate genes involved in metabolism for mutations and to evaluate its performance using monogenic diabetes...

  10. Magnetic nanoparticle imaging using multiple electron paramagnetic resonance activation sequences

    International Nuclear Information System (INIS)

    Coene, A.; Dupré, L.; Crevecoeur, G.

    2015-01-01

    Magnetic nanoparticles play an important role in several biomedical applications such as hyperthermia, drug targeting, and disease detection. To realize an effective working of these applications, the spatial distribution of the particles needs to be accurately known, in a non-invasive way. Electron Paramagnetic Resonance (EPR) is a promising and sensitive measurement technique for recovering these distributions. In the conventional approach, EPR is applied with a homogeneous magnetic field. In this paper, we employ different heterogeneous magnetic fields that allow to stabilize the solution of the associated inverse problem and to obtain localized spatial information. A comparison is made between the two approaches and our novel adaptation shows an average increase in reconstruction quality by 5% and is 12 times more robust towards noise. Furthermore, our approach allows to speed up the EPR measurements while still obtaining reconstructions with an improved accuracy and noise robustness compared to homogeneous EPR

  11. Regional Platform on Personal Computer Electronic Waste in Latin ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Regional Platform on Personal Computer Electronic Waste in Latin America and the Caribbean. Donation of ... This project aims to identify environmentally responsible and sustainable solutions to the problem of e-waste. ... Policy in Focus publishes a special issue profiling evidence to empower women in the labour market.

  12. Spectral density of electron concentration fluctuations in ionospheric D region

    International Nuclear Information System (INIS)

    Martynenko, S.I.

    1989-01-01

    Expression for spectral density of electron concentration fluctuations in D-region with regard to the effect of ionization-recombination proceses and negative ions is obtained in terms of atmospheric turbulence model which obeys Kolmogorov-Obukhov 2/3 law

  13. Electron scattering from CO in the 2Pi resonance region

    International Nuclear Information System (INIS)

    Buckman, S.J.; Lohmann, B.

    1986-01-01

    The total cross section for electron scattering from CO in the energy range 0.5--5 eV has been measured with use of a time-of-flight spectrometer. This energy region encompasses the 2 π shape resonance, and a comparison is made with other experimental and theoretical results with regard to the magnitude and position of this structure

  14. AlignMiner: a Web-based tool for detection of divergent regions in multiple sequence alignments of conserved sequences

    Directory of Open Access Journals (Sweden)

    Claros M Gonzalo

    2010-06-01

    Full Text Available Abstract Background Multiple sequence alignments are used to study gene or protein function, phylogenetic relations, genome evolution hypotheses and even gene polymorphisms. Virtually without exception, all available tools focus on conserved segments or residues. Small divergent regions, however, are biologically important for specific quantitative polymerase chain reaction, genotyping, molecular markers and preparation of specific antibodies, and yet have received little attention. As a consequence, they must be selected empirically by the researcher. AlignMiner has been developed to fill this gap in bioinformatic analyses. Results AlignMiner is a Web-based application for detection of conserved and divergent regions in alignments of conserved sequences, focusing particularly on divergence. It accepts alignments (protein or nucleic acid obtained using any of a variety of algorithms, which does not appear to have a significant impact on the final results. AlignMiner uses different scoring methods for assessing conserved/divergent regions, Entropy being the method that provides the highest number of regions with the greatest length, and Weighted being the most restrictive. Conserved/divergent regions can be generated either with respect to the consensus sequence or to one master sequence. The resulting data are presented in a graphical interface developed in AJAX, which provides remarkable user interaction capabilities. Users do not need to wait until execution is complete and can.even inspect their results on a different computer. Data can be downloaded onto a user disk, in standard formats. In silico and experimental proof-of-concept cases have shown that AlignMiner can be successfully used to designing specific polymerase chain reaction primers as well as potential epitopes for antibodies. Primer design is assisted by a module that deploys several oligonucleotide parameters for designing primers "on the fly". Conclusions AlignMiner can be used

  15. Tandemly repeated sequence in 5'end of mtDNA control region of ...

    African Journals Online (AJOL)

    Extensive length variability was observed in 5' end sequence of the mitochondrial DNA control region of the Japanese Spanish mackerel (Scomberomorus niphonius). This length variability was due to the presence of varying numbers of a 56-bp tandemly repeated sequence and a 46-bp insertion/deletion (indel).

  16. The Development Model Electronic Commerce of Regional Agriculture

    Science.gov (United States)

    Kang, Jun; Cai, Lecai; Li, Hongchan

    With the developing of the agricultural information, it is inevitable trend of the development of agricultural electronic commercial affairs. On the basis of existing study on the development application model of e-commerce, combined with the character of the agricultural information, compared with the developing model from the theory and reality, a new development model electronic commerce of regional agriculture base on the government is put up, and such key issues as problems of the security applications, payment mode, sharing mechanisms, and legal protection are analyzed, etc. The among coordination mechanism of the region is discussed on, it is significance for regulating the development of agricultural e-commerce and promoting the regional economical development.

  17. Detection of genomic variation by selection of a 9 mb DNA region and high throughput sequencing.

    Directory of Open Access Journals (Sweden)

    Sergey I Nikolaev

    Full Text Available Detection of the rare polymorphisms and causative mutations of genetic diseases in a targeted genomic area has become a major goal in order to understand genomic and phenotypic variability. We have interrogated repeat-masked regions of 8.9 Mb on human chromosomes 21 (7.8 Mb and 7 (1.1 Mb from an individual from the International HapMap Project (NA12872. We have optimized a method of genomic selection for high throughput sequencing. Microarray-based selection and sequencing resulted in 260-fold enrichment, with 41% of reads mapping to the target region. 83% of SNPs in the targeted region had at least 4-fold sequence coverage and 54% at least 15-fold. When assaying HapMap SNPs in NA12872, our sequence genotypes are 91.3% concordant in regions with coverage > or = 4-fold, and 97.9% concordant in regions with coverage > or = 15-fold. About 81% of the SNPs recovered with both thresholds are listed in dbSNP. We observed that regions with low sequence coverage occur in close proximity to low-complexity DNA. Validation experiments using Sanger sequencing were performed for 46 SNPs with 15-20 fold coverage, with a confirmation rate of 96%, suggesting that DNA selection provides an accurate and cost-effective method for identifying rare genomic variants.

  18. Tracking TCRβ sequence clonotype expansions during antiviral therapy using high-throughput sequencing of the hypervariable region

    Directory of Open Access Journals (Sweden)

    Mark W Robinson

    2016-04-01

    Full Text Available To maintain a persistent infection viruses such as hepatitis C virus (HCV employ a range of mechanisms that subvert protective T cell responses. The suppression of antigen-specific T cell responses by HCV hinders efforts to profile T cell responses during chronic infection and antiviral therapy. Conventional methods of detecting antigen-specific T cells utilise either antigen stimulation (e.g. ELISpot, proliferation assays, cytokine production or antigen-loaded tetramer staining. This limits the ability to profile T cell responses during chronic infection due to suppressed effector function and the requirement for prior knowledge of antigenic viral peptide sequences. Recently high-throughput sequencing (HTS technologies have been developed for the analysis of T cell repertoires. In the present study we have assessed the feasibility of HTS of the TCRβ complementarity determining region (CDR3 to track T cell expansions in an antigen-independent manner. Using sequential blood samples from HCV-infected individuals undergoing anti-viral therapy we were able to measure the population frequencies of >35,000 TCRβ sequence clonotypes in each individual over the course of 12 weeks. TRBV/TRBJ gene segment usage varied markedly between individuals but remained relatively constant within individuals across the course of therapy. Despite this stable TRBV/TRBJ gene segment usage, a number of TCRβ sequence clonotypes showed dramatic changes in read frequency. These changes could not be linked to therapy outcomes in the present study however the TCRβ CDR3 sequences with the largest fold changes did include sequences with identical TRBV/TRBJ gene segment usage and high joining region homology to previously published CDR3 sequences from HCV-specific T cells targeting the HLA-B*0801-restricted 1395HSKKKCDEL1403 and HLA-A*0101–restricted 1435ATDALMTGY1443 epitopes. The pipeline developed in this proof of concept study provides a platform for the design of

  19. The electronic register patients with hypertensia in Tomsk Region

    Directory of Open Access Journals (Sweden)

    O. S. Kobyakova

    2012-01-01

    Full Text Available Within the limits of the regional program «Prevention and treatment of an arterial hypertension for the period of 2004—2008» the electronic register of the patients with hypertensia inTomskRegion has been created.The electronic register is a two-level system where interaction of two kinds of databases is carried out: the first level is the databases of separate medical organization; the second level is the central integrated database.The basic information for the electronic register are documents confirmed by the Health service Ministry of the Russian Federation, that is the coupon of the out-patient patient and a card of dynamic supervision over the patient with hypertensia.All the data about the patients, included in the register are subdivided into unchangeable and changeable ones.The electronic register is an effective control system providing local leading of health service bodies with qualitative and high-grade information in processes of preparation of decision-making and measure taken for prevention and treatment of hypertensia.The electronic register is an effective monitoring system, providing medical authority of important information for taking decisions establishment measures for prevention and treatment of hypertensia.

  20. Sequence analysis of the canine mitochondrial DNA control region from shed hair samples in criminal investigations.

    Science.gov (United States)

    Berger, C; Berger, B; Parson, W

    2012-01-01

    In recent years, evidence from domestic dogs has increasingly been analyzed by forensic DNA testing. Especially, canine hairs have proved most suitable and practical due to the high rate of hair transfer occurring between dogs and humans. Starting with the description of a contamination-free sample handling procedure, we give a detailed workflow for sequencing hypervariable segments (HVS) of the mtDNA control region from canine evidence. After the hair material is lysed and the DNA extracted by Phenol/Chloroform, the amplification and sequencing strategy comprises the HVS I and II of the canine control region and is optimized for DNA of medium-to-low quality and quantity. The sequencing procedure is based on the Sanger Big-dye deoxy-terminator method and the separation of the sequencing reaction products is performed on a conventional multicolor fluorescence detection capillary electrophoresis platform. Finally, software-aided base calling and sequence interpretation are addressed exemplarily.

  1. Wakefield excitation in plasma resonator by a sequence of relativistic electron bunches

    International Nuclear Information System (INIS)

    Kiselev, V.A.; Linnik, A.F.; Mirny, V.I.; Onishchenko, I.N.; Uskov, V.V.

    2008-01-01

    Wakefield excitation in a plasma resonator by a sequence of relativistic electron bunches with the purpose to increase excited field amplitude in comparison to waveguide case is experimentally investigated. A sequence of short electron bunches is produced by the linear resonant accelerator. Plasma resonator is formed at the beam-plasma discharge in rectangular metal waveguide filled with gas and closed by metal foil at entrance and movable short-circuited plunger at exit. Measurements of wakefield amplitude are performed showing considerably higher wakefield amplitude for resonator case

  2. Sequencing analysis reveals a unique gene organization in the gyrB region of Mycoplasma hominis

    DEFF Research Database (Denmark)

    Ladefoged, Søren; Christiansen, Gunna

    1994-01-01

    of which showed similarity to that which encodes the LicA protein of Haemophilus influenzae. The organization of the genes in the region showed no resemblance to that in the corresponding regions of other bacteria sequenced so far. The gyrA gene was mapped 35 kb downstream from the gyrB gene.......The homolog of the gyrB gene, which has been reported to be present in the vicinity of the initiation site of replication in bacteria, was mapped on the Mycoplasma hominis genome, and the region was subsequently sequenced. Five open reading frames were identified flanking the gyrB gene, one...

  3. Protein sequences and redox titrations indicate that the electron acceptors in reaction centers from heliobacteria are similar to Photosystem I

    Science.gov (United States)

    Trost, J. T.; Brune, D. C.; Blankenship, R. E.

    1992-01-01

    Photosynthetic reaction centers isolated from Heliobacillus mobilis exhibit a single major protein on SDS-PAGE of 47 000 Mr. Attempts to sequence the reaction center polypeptide indicated that the N-terminus is blocked. After enzymatic and chemical cleavage, four peptide fragments were sequenced from the Heliobacillus mobilis apoprotein. Only one of these sequences showed significant specific similarity to any of the protein and deduced protein sequences in the GenBank data base. This fragment is identical with 56% of the residues, including both cysteines, found in highly conserved region that is proposed to bind iron-sulfur center Fx in the Photosystem I reaction center peptide that is the psaB gene product. The similarity to the psaA gene product in this region is 48%. Redox titrations of laser-flash-induced photobleaching with millisecond decay kinetics on isolated reaction centers from Heliobacterium gestii indicate a midpoint potential of -414 mV with n = 2 titration behavior. In membranes, the behavior is intermediate between n = 1 and n = 2, and the apparent midpoint potential is -444 mV. This is compared to the behavior in Photosystem I, where the intermediate electron acceptor A1, thought to be a phylloquinone molecule, has been proposed to undergo a double reduction at low redox potentials in the presence of viologen redox mediators. These results strongly suggest that the acceptor side electron transfer system in reaction centers from heliobacteria is indeed analogous to that found in Photosystem I. The sequence similarities indicate that the divergence of the heliobacteria from the Photosystem I line occurred before the gene duplication and subsequent divergence that lead to the heterodimeric protein core of the Photosystem I reaction center.

  4. ELECTRONIC RETAILING IN MACEDONIA-CASE STUDY OF OHRID REGION

    Directory of Open Access Journals (Sweden)

    MARGARITA JANESKA

    2017-04-01

    Full Text Available With electronic retailing that offers the possibility of direct sales, is no longer need expensive business premises, or paying high rents, or employing a number of vendors. There is also the possibility of selling to final consumers in any geographical region in different countries of the world by establishing instant communication, through presenting an interactive multimedia catalog that can offer numerous information то the customers. However, on the other hand, sales through the Internet can appear certain problems. Many potential buyers in the world still do not use the Internet, others don't have fast connections, others do not speak good English, also it requires the existence of trust between both parties, buyer and seller, as well as security in the execution of transactions. The aim of this paper is to treat electronic retailing in Macedonia which is becoming more popular as worldwide, especially in developed parts of the world like the US and Europe. Macedonian companies are increasingly applying electronic method of sale and communication with customers. The number of Internet users and on-line purchase is rapidly expanding what undoubtedly indicates that there is potential for advancement in this field. Also in this paper will be presented a case study where will be analyzed the current state for development of electronic retailing in Macedonia, especially region of Ohrid.

  5. Evaluation of exome variants using the Ion Proton Platform to sequence error-prone regions.

    Science.gov (United States)

    Seo, Heewon; Park, Yoomi; Min, Byung Joo; Seo, Myung Eui; Kim, Ju Han

    2017-01-01

    The Ion Proton sequencer from Thermo Fisher accurately determines sequence variants from target regions with a rapid turnaround time at a low cost. However, misleading variant-calling errors can occur. We performed a systematic evaluation and manual curation of read-level alignments for the 675 ultrarare variants reported by the Ion Proton sequencer from 27 whole-exome sequencing data but that are not present in either the 1000 Genomes Project and the Exome Aggregation Consortium. We classified positive variant calls into 393 highly likely false positives, 126 likely false positives, and 156 likely true positives, which comprised 58.2%, 18.7%, and 23.1% of the variants, respectively. We identified four distinct error patterns of variant calling that may be bioinformatically corrected when using different strategies: simplicity region, SNV cluster, peripheral sequence read, and base inversion. Local de novo assembly successfully corrected 201 (38.7%) of the 519 highly likely or likely false positives. We also demonstrate that the two sequencing kits from Thermo Fisher (the Ion PI Sequencing 200 kit V3 and the Ion PI Hi-Q kit) exhibit different error profiles across different error types. A refined calling algorithm with better polymerase may improve the performance of the Ion Proton sequencing platform.

  6. Evaluation of exome variants using the Ion Proton Platform to sequence error-prone regions.

    Directory of Open Access Journals (Sweden)

    Heewon Seo

    Full Text Available The Ion Proton sequencer from Thermo Fisher accurately determines sequence variants from target regions with a rapid turnaround time at a low cost. However, misleading variant-calling errors can occur. We performed a systematic evaluation and manual curation of read-level alignments for the 675 ultrarare variants reported by the Ion Proton sequencer from 27 whole-exome sequencing data but that are not present in either the 1000 Genomes Project and the Exome Aggregation Consortium. We classified positive variant calls into 393 highly likely false positives, 126 likely false positives, and 156 likely true positives, which comprised 58.2%, 18.7%, and 23.1% of the variants, respectively. We identified four distinct error patterns of variant calling that may be bioinformatically corrected when using different strategies: simplicity region, SNV cluster, peripheral sequence read, and base inversion. Local de novo assembly successfully corrected 201 (38.7% of the 519 highly likely or likely false positives. We also demonstrate that the two sequencing kits from Thermo Fisher (the Ion PI Sequencing 200 kit V3 and the Ion PI Hi-Q kit exhibit different error profiles across different error types. A refined calling algorithm with better polymerase may improve the performance of the Ion Proton sequencing platform.

  7. Electron microscopic comparison of the sequences of single-stranded genomes of mammalian parvoviruses by heteroduplex mapping

    Energy Technology Data Exchange (ETDEWEB)

    Banerjee, P.T.; Olson, W.H.; Allison, D.P.; Bates, R.C.; Snyder, C.E.; Mitra, S.

    1983-01-01

    The sequence homologies among the linear single-stranded genomes of several mammalian parvoviruses have been studied by electron microscopic analysis of tthe heteroduplexes produced by reannealing the complementary strands of their DNAs. The genomes of Kilham rat virus, H-1, minute virus of ice and LuIII, which are antigenically distinct non-defective parvoviruses, have considerable homology: about 70% of their sequences are conserved. The homologous regions map at similar locations in the left halves (from the 3' ends) of the genomes. No sequence homology, however, is observed between the DNAs of these nondefective parvoviruses and that of bovine parvovirus, another non-defective virus, or that of defective adenoassociated virus, nor between the genomes of bovine parvovirus and adenoassociated virus. This suggests that only very short, if any, homologous regions are present. From these results, an evolutionary relationship among Kilham rat virus, H-1, minute virus of mice and LuIII is predicted. It is interesting to note that, although LuIII was originally isolated from a human cell line and is specific for human cells in vitro, its genome has sequences in common only with the rodent viruses Kilham rat virus, minute virus of mice and H-1, and not with the other two mammalian parvoviruses tested.

  8. Sequence Ready Characterization of the Pericentromeric Region of 19p12

    Energy Technology Data Exchange (ETDEWEB)

    Evan E. Eichler

    2006-08-31

    Current mapping and sequencing strategies have been inadequate within the proximal portion of 19p12 due, in part, to the presence of a recently expanded ZNF (zinc-finger) gene family and the presence of large (25-50 kb) inverted beta-satellite repeat structures which bracket this tandemly duplicated gene family. The virtual of absence of classically defined “unique” sequence within the region has hampered efforts to identify and characterize a suitable minimal tiling path of clones which can be used as templates required for finished sequencing of the region. The goal of this proposal is to develop and implement a novel sequence-anchor strategy to generate a contiguous BAC map of the most proximal portion of chromosome 19p12 for the purpose of complete sequence characterization. The target region will be an estimated 4.5 Mb of DNA extending from STS marker D19S450 (the beginning of the ZNF gene cluster) to the centromeric (alpha-satellite) junction of 19p11. The approach will entail 1) pre-selection of 19p12 BAC and cosmid clones (NIH approved library) utilizing both 19p12 -unique and 19p12-SPECIFIC repeat probes (Eichler et al., 1998); 2) the generation of a BAC/cosmid end-sequence map across the region with a density of one marker every 8kb; 3) the development of a second-generation of STS (sequence tagged sites) which will be used to identify and verify clonal overlap at the level of the sequence; 4) incorporation of these sequence-anchored overlapping clones into existing cosmid/BAC restriction maps developed at Livermore National Laboratory; and 5) validation of the organization of this region utilizing high-resolution FISH techniques (extended chromatin analysis) on monochromosomal 19 somatic cell hybrids and parental cell lines of source material. The data generated will be used in the selection of the most parsimonious tiling path of BAC clones to be sequenced as part of the JGI effort on chromosome 19 and should serve as a model for the sequence

  9. THE 'MAIN SEQUENCE' OF EXPLOSIVE SOLAR ACTIVE REGIONS: DISCOVERY AND INTERPRETATION

    Energy Technology Data Exchange (ETDEWEB)

    Falconer, David A; Moore, Ronald L; Adams, Mitzi [Space Science Office, VP62, Marshall Space Flight Center, Huntsville, AL 35812 (United States); Gary, G. Allen [Center for Space Plasma and Aeronomic Research, University of Alabama in Huntsville, Huntsville, AL 35899 (United States)], E-mail: David.falconer@msfc.nasa.gov

    2009-08-01

    We examine the location and distribution of the production of coronal mass ejections (CMEs) and major flares by sunspot active regions in the phase space of two whole-active-region magnetic quantities measured from 1897 SOHO/MDI magnetograms. These magnetograms track the evolution of 44 active regions across the central disk of radius 0.5 R {sub Sun}. The two quantities are {sup L}WL{sub SG}, a gauge of the total free energy in an active region's magnetic field, and {sup L}{phi}, a measure of the active region's total magnetic flux. From these data and each active region's history of production of CMEs, X flares, and M flares, we find (1) that CME/flare-productive active regions are concentrated in a straight-line 'main sequence' in (log {sup L}WL{sub SG}, log {sup L}{phi}) space, (2) that main-sequence active regions have nearly their maximum attainable free magnetic energy, and (3) evidence that this arrangement plausibly results from equilibrium between input of free energy to an explosive active region's magnetic field in the chromosphere and corona by contortion of the field via convection in and below the photosphere and loss of free energy via CMEs, flares, and coronal heating, an equilibrium between energy gain and loss that is analogous to that of the main sequence of hydrogen-burning stars in (mass, luminosity) space.

  10. THE 'MAIN SEQUENCE' OF EXPLOSIVE SOLAR ACTIVE REGIONS: DISCOVERY AND INTERPRETATION

    International Nuclear Information System (INIS)

    Falconer, David A.; Moore, Ronald L.; Adams, Mitzi; Gary, G. Allen

    2009-01-01

    We examine the location and distribution of the production of coronal mass ejections (CMEs) and major flares by sunspot active regions in the phase space of two whole-active-region magnetic quantities measured from 1897 SOHO/MDI magnetograms. These magnetograms track the evolution of 44 active regions across the central disk of radius 0.5 R Sun . The two quantities are L WL SG , a gauge of the total free energy in an active region's magnetic field, and L Φ, a measure of the active region's total magnetic flux. From these data and each active region's history of production of CMEs, X flares, and M flares, we find (1) that CME/flare-productive active regions are concentrated in a straight-line 'main sequence' in (log L WL SG , log L Φ) space, (2) that main-sequence active regions have nearly their maximum attainable free magnetic energy, and (3) evidence that this arrangement plausibly results from equilibrium between input of free energy to an explosive active region's magnetic field in the chromosphere and corona by contortion of the field via convection in and below the photosphere and loss of free energy via CMEs, flares, and coronal heating, an equilibrium between energy gain and loss that is analogous to that of the main sequence of hydrogen-burning stars in (mass, luminosity) space.

  11. DNA sequence analysis of the photosynthesis region of Rhodobacter sphaeroides 2.4.1T

    OpenAIRE

    Choudhary, M.; Kaplan, Samuel

    2000-01-01

    This paper describes the DNA sequence of the photosynthesis region of Rhodobacter sphaeroides 2.4.1T. The photosynthesis gene cluster is located within a ~73 kb AseI genomic DNA fragment containing the puf, puhA, cycA and puc operons. A total of 65 open reading frames (ORFs) have been identified, of which 61 showed significant similarity to genes/proteins of other organisms while only four did not reveal any significant sequence similarity to any gene/protein sequences in the database. The da...

  12. Taxonomy and phylogeny of the genus citrus based on the nuclear ribosomal dna its region sequence

    International Nuclear Information System (INIS)

    Sun, Y.L.

    2015-01-01

    The genus Citrus (Aurantioideae, Rutaceae) is the sole source of the citrus fruits of commerce showing high economic values. In this study, the taxonomy and phylogeny of Citrus species is evaluated using sequence analysis of the ITS region of nrDNA. This study is based on 26 plants materials belonging to 22 Citrus species having wild, domesticated, and cultivated species. Through DNA alignment of the ITS sequence, ITS1 and ITS2 regions showed relatively high variations of sequence length and nucleotide among these Citrus species. According to previous six-tribe discrimination theory by Swingle and Reece, the grouping in our ITS phylogenetic tree reconstructed by ITS sequences was not related to tribe discrimination but species discrimination. However, the molecular analysis could provide more information on citrus taxonomy. Combined with ITS sequences of other subgenera in then true citrus fruit tree group, the ITS phylogenetic tree indicated subgenera Citrus was monophyletic and nearer to Fortunella, Poncirus, and Clymenia compared to Microcitrus and Eremocitrus. Abundant sequence variations of the ITS region shown in this study would help species identification and tribe differentiation of the genus Citrus. (author)

  13. Multi-region and single-cell sequencing reveal variable genomic heterogeneity in rectal cancer.

    Science.gov (United States)

    Liu, Mingshan; Liu, Yang; Di, Jiabo; Su, Zhe; Yang, Hong; Jiang, Beihai; Wang, Zaozao; Zhuang, Meng; Bai, Fan; Su, Xiangqian

    2017-11-23

    Colorectal cancer is a heterogeneous group of malignancies with complex molecular subtypes. While colon cancer has been widely investigated, studies on rectal cancer are very limited. Here, we performed multi-region whole-exome sequencing and single-cell whole-genome sequencing to examine the genomic intratumor heterogeneity (ITH) of rectal tumors. We sequenced nine tumor regions and 88 single cells from two rectal cancer patients with tumors of the same molecular classification and characterized their mutation profiles and somatic copy number alterations (SCNAs) at the multi-region and the single-cell levels. A variable extent of genomic heterogeneity was observed between the two patients, and the degree of ITH increased when analyzed on the single-cell level. We found that major SCNAs were early events in cancer development and inherited steadily. Single-cell sequencing revealed mutations and SCNAs which were hidden in bulk sequencing. In summary, we studied the ITH of rectal cancer at regional and single-cell resolution and demonstrated that variable heterogeneity existed in two patients. The mutational scenarios and SCNA profiles of two patients with treatment naïve from the same molecular subtype are quite different. Our results suggest each tumor possesses its own architecture, which may result in different diagnosis, prognosis, and drug responses. Remarkable ITH exists in the two patients we have studied, providing a preliminary impression of ITH in rectal cancer.

  14. Prediction of flexible/rigid regions from protein sequences using k-spaced amino acid pairs

    Directory of Open Access Journals (Sweden)

    Ruan Jishou

    2007-04-01

    Full Text Available Abstract Background Traditionally, it is believed that the native structure of a protein corresponds to a global minimum of its free energy. However, with the growing number of known tertiary (3D protein structures, researchers have discovered that some proteins can alter their structures in response to a change in their surroundings or with the help of other proteins or ligands. Such structural shifts play a crucial role with respect to the protein function. To this end, we propose a machine learning method for the prediction of the flexible/rigid regions of proteins (referred to as FlexRP; the method is based on a novel sequence representation and feature selection. Knowledge of the flexible/rigid regions may provide insights into the protein folding process and the 3D structure prediction. Results The flexible/rigid regions were defined based on a dataset, which includes protein sequences that have multiple experimental structures, and which was previously used to study the structural conservation of proteins. Sequences drawn from this dataset were represented based on feature sets that were proposed in prior research, such as PSI-BLAST profiles, composition vector and binary sequence encoding, and a newly proposed representation based on frequencies of k-spaced amino acid pairs. These representations were processed by feature selection to reduce the dimensionality. Several machine learning methods for the prediction of flexible/rigid regions and two recently proposed methods for the prediction of conformational changes and unstructured regions were compared with the proposed method. The FlexRP method, which applies Logistic Regression and collocation-based representation with 95 features, obtained 79.5% accuracy. The two runner-up methods, which apply the same sequence representation and Support Vector Machines (SVM and Naïve Bayes classifiers, obtained 79.2% and 78.4% accuracy, respectively. The remaining considered methods are

  15. Synchronization and sequencing of data acquisition and control electronics at the European X-ray free electron laser

    International Nuclear Information System (INIS)

    Gessler, Patrick

    2015-11-01

    The 3.5 km long European X-Ray Free Electron Laser, currently under construction in northern Germany, will deliver bursts of up to 2700 short X-ray pulses every 100 ms, providing wavelengths between 0.05 and 6 nm, and a repetition rate of 4.5 MHz to several experiment stations. It allows in-depth research in various scientific fields. In order to set-up the beam, position samples and capture the measured variables, information from the accelerator, diagnostic devices and detectors have to be digitized, converted, processed, transferred, concentrated, distributed, reorganized, controlled and saved. All these steps have to be accurately synchronized and sequenced relative to the actual electron bunch or photon pulse in order to guarantee correct data acquisition timings and unique identification of each bunch passing the beamlines. This document provides a complete description of the planning, design, realization and evaluation of the European XFEL Timing System, which implements the synchronization and sequencing of the data acquisition and control electronics for the European X-Ray Free-Electron Laser Facility.

  16. Integration services to enable regional shared electronic health records.

    Science.gov (United States)

    Oliveira, Ilídio C; Cunha, João P S

    2011-01-01

    eHealth is expected to integrate a comprehensive set of patient data sources into a coherent continuum, but implementations vary and Portugal is still lacking on electronic patient data sharing. In this work, we present a clinical information hub to aggregate multi-institution patient data and bridge the information silos. This integration platform enables a coherent object model, services-oriented applications development and a trust framework. It has been instantiated in the Rede Telemática de Saúde (www.RTSaude.org) to support a regional Electronic Health Record approach, fed dynamically from production systems at eight partner institutions, providing access to more than 11,000,000 care episodes, relating to over 350,000 citizens. The network has obtained the necessary clearance from the Portuguese data protection agency.

  17. Electron temperature in the E-region of the ionosphere

    International Nuclear Information System (INIS)

    Zalpuri, K.S.; Oyama, K.-I.

    1991-06-01

    Various heating and cooling mechanisms which are operative in the lower E-region are discussed and their relative importance in different altitude range is shown. These heating and cooling rates are then used to derive the electron temperature T e . The calculated values of electron temperature are found to be higher than neutral temperature through out the altitude range 100 ∼ 150 km, with the difference increasing with increase in altitude. However, compared to observed values of T e , the calculated values are still smaller below about 130 km. Above this altitude, the calculated values become larger. Estimation of T e for different, suggested values of heating efficiency due to dissociative recombination, show that T e profile obtained even be assuming a constant value of 1.3 eV is in fairly good agreement with those derived based on variable values of this parameter. (author)

  18. Design of the large hadron electron collider interaction region

    Science.gov (United States)

    Cruz-Alaniz, E.; Newton, D.; Tomás, R.; Korostelev, M.

    2015-11-01

    The large hadron electron collider (LHeC) is a proposed upgrade of the Large Hadron Collider (LHC) within the high luminosity LHC (HL-LHC) project, to provide electron-nucleon collisions and explore a new regime of energy and luminosity for deep inelastic scattering. The design of an interaction region for any collider is always a challenging task given that the beams are brought into crossing with the smallest beam sizes in a region where there are tight detector constraints. In this case integrating the LHeC into the existing HL-LHC lattice, to allow simultaneous proton-proton and electron-proton collisions, increases the difficulty of the task. A nominal design was presented in the the LHeC conceptual design report in 2012 featuring an optical configuration that focuses one of the proton beams of the LHC to β*=10 cm in the LHeC interaction point to reach the desired luminosity of L =1033 cm-2 s-1 . This value is achieved with the aid of a new inner triplet of quadrupoles at a distance L*=10 m from the interaction point. However the chromatic beta beating was found intolerable regarding machine protection issues. An advanced chromatic correction scheme was required. This paper explores the feasibility of the extension of a novel optical technique called the achromatic telescopic squeezing scheme and the flexibility of the interaction region design, in order to find the optimal solution that would produce the highest luminosity while controlling the chromaticity, minimizing the synchrotron radiation power and maintaining the dynamic aperture required for stability.

  19. Design of the large hadron electron collider interaction region

    Directory of Open Access Journals (Sweden)

    E. Cruz-Alaniz

    2015-11-01

    Full Text Available The large hadron electron collider (LHeC is a proposed upgrade of the Large Hadron Collider (LHC within the high luminosity LHC (HL-LHC project, to provide electron-nucleon collisions and explore a new regime of energy and luminosity for deep inelastic scattering. The design of an interaction region for any collider is always a challenging task given that the beams are brought into crossing with the smallest beam sizes in a region where there are tight detector constraints. In this case integrating the LHeC into the existing HL-LHC lattice, to allow simultaneous proton-proton and electron-proton collisions, increases the difficulty of the task. A nominal design was presented in the the LHeC conceptual design report in 2012 featuring an optical configuration that focuses one of the proton beams of the LHC to β^{*}=10  cm in the LHeC interaction point to reach the desired luminosity of L=10^{33}  cm^{-2} s^{-1}. This value is achieved with the aid of a new inner triplet of quadrupoles at a distance L^{*}=10  m from the interaction point. However the chromatic beta beating was found intolerable regarding machine protection issues. An advanced chromatic correction scheme was required. This paper explores the feasibility of the extension of a novel optical technique called the achromatic telescopic squeezing scheme and the flexibility of the interaction region design, in order to find the optimal solution that would produce the highest luminosity while controlling the chromaticity, minimizing the synchrotron radiation power and maintaining the dynamic aperture required for stability.

  20. DVCS in the fragmentation region of polarized electron

    International Nuclear Information System (INIS)

    Akushevich, I.; Kuraev, E.A.; Nikolaev, N.N.

    2000-01-01

    For the kinematical region when a hard photon is emitted predominantly close to the direction of motion of a longitudinally polarized initial electron and relatively small momentum transfer to a proton we calculate the azimuthal asymmetry of a photon emission. It arises from the interference of the Bethe-Heitler amplitude and those which are described by a heavy photon impact factor. The azimuthal asymmetry does not decrease in the limit of infinite cms energy. The lowest order expression for the impact factor of a heavy photon is presented

  1. Characterization of race 65 of Colletotrichum lindemuthianum by sequencing ITS regions

    Directory of Open Access Journals (Sweden)

    Marcela Coelho

    2016-09-01

    Full Text Available The present work aimed characterize isolates of C. lindemuthianum race 65 from different regions in Brazil by ITS sequencing. A total of 17 isolates of race 65, collected in the states of Mato Grosso, Minas Gerais, Paraná, Santa Catarina and São Paulo, were studied. Analysis of the sequences of isolates 8, 9, 12, 14 and 15 revealed the presence of two single nucleotide polymorphisms (SNPs in the ITS1 region at the same positions. These isolates, when analyzed together with the sequence of isolate 17, revealed a SNP in the ITS2 region. The highest genetic dissimilarity, observed between isolates 11 and  3 and between isolates 11 and 10, was 0.772. In turn, isolates 7 and 2 were the most similar, with a value of 0.002 for genetic distance. The phylogenetic tree obtained based on the sequences of the ITS1 and ITS2 regions revealed the formation of two groups, one with a subgroup. The results reveal high molecular variability among isolates of race 65 of C. lindemuthianum.

  2. A Novel Low Energy Electron Microscope for DNA Sequencing and Surface Analysis

    Science.gov (United States)

    Mankos, M.; Shadman, K.; Persson, H.H.J.; N’Diaye, A.T.; Schmid, A.K.; Davis, R.W.

    2014-01-01

    Monochromatic, aberration-corrected, dual-beam low energy electron microscopy (MAD-LEEM) is a novel technique that is directed towards imaging nanostructures and surfaces with sub-nanometer resolution. The technique combines a monochromator, a mirror aberration corrector, an energy filter, and dual beam illumination in a single instrument. The monochromator reduces the energy spread of the illuminating electron beam, which significantly improves spectroscopic and spatial resolution. Simulation results predict that the novel aberration corrector design will eliminate the second rank chromatic and third and fifth order spherical aberrations, thereby improving the resolution into the sub-nanometer regime at landing energies as low as one hundred electron-Volts. The energy filter produces a beam that can extract detailed information about the chemical composition and local electronic states of non-periodic objects such as nanoparticles, interfaces, defects, and macromolecules. The dual flood illumination eliminates charging effects that are generated when a conventional LEEM is used to image insulating specimens. A potential application for MAD-LEEM is in DNA sequencing, which requires high resolution to distinguish the individual bases and high speed to reduce the cost. The MAD-LEEM approach images the DNA with low electron impact energies, which provides nucleobase contrast mechanisms without organometallic labels. Furthermore, the micron-size field of view when combined with imaging on the fly provides long read lengths, thereby reducing the demand on assembling the sequence. Experimental results from bulk specimens with immobilized single-base oligonucleotides demonstrate that base specific contrast is available with reflected, photo-emitted, and Auger electrons. Image contrast simulations of model rectangular features mimicking the individual nucleotides in a DNA strand have been developed to translate measurements of contrast on bulk DNA to the detectability of

  3. A novel low energy electron microscope for DNA sequencing and surface analysis.

    Science.gov (United States)

    Mankos, M; Shadman, K; Persson, H H J; N'Diaye, A T; Schmid, A K; Davis, R W

    2014-10-01

    Monochromatic, aberration-corrected, dual-beam low energy electron microscopy (MAD-LEEM) is a novel technique that is directed towards imaging nanostructures and surfaces with sub-nanometer resolution. The technique combines a monochromator, a mirror aberration corrector, an energy filter, and dual beam illumination in a single instrument. The monochromator reduces the energy spread of the illuminating electron beam, which significantly improves spectroscopic and spatial resolution. Simulation results predict that the novel aberration corrector design will eliminate the second rank chromatic and third and fifth order spherical aberrations, thereby improving the resolution into the sub-nanometer regime at landing energies as low as one hundred electron-Volts. The energy filter produces a beam that can extract detailed information about the chemical composition and local electronic states of non-periodic objects such as nanoparticles, interfaces, defects, and macromolecules. The dual flood illumination eliminates charging effects that are generated when a conventional LEEM is used to image insulating specimens. A potential application for MAD-LEEM is in DNA sequencing, which requires high resolution to distinguish the individual bases and high speed to reduce the cost. The MAD-LEEM approach images the DNA with low electron impact energies, which provides nucleobase contrast mechanisms without organometallic labels. Furthermore, the micron-size field of view when combined with imaging on the fly provides long read lengths, thereby reducing the demand on assembling the sequence. Experimental results from bulk specimens with immobilized single-base oligonucleotides demonstrate that base specific contrast is available with reflected, photo-emitted, and Auger electrons. Image contrast simulations of model rectangular features mimicking the individual nucleotides in a DNA strand have been developed to translate measurements of contrast on bulk DNA to the detectability of

  4. F region electron density irregularity spectra near Auroral acceleration and shear regions

    International Nuclear Information System (INIS)

    Basu, S.; Basu, S.; MacKenzie, E.; Coley, W.R.; Hanson, W.B.; Lin, C.S.

    1984-01-01

    Spectral characteristics of auroral F region irregularities were studied by the use of high-resolution (approx.35 m) density measurements made by the retarding potential analyzer (RPA) on board the Atmosphere Explorer D (AE-D) satellite during two orbits when the satellite was traversing the high-latitude ionosphere in the evening sector. Coordinated DMSP passes provided synoptic coverage of auroral activity. The auroral energy input was estimated by intergrating the low-energy electron (LEE) data on AE-D. It was found that the one-dimensional in situ spectral index (p 1 ) of the irregularities at scale lengths of 1 values of approx.-3. This is interpreted as resulting from the effects of E region conductivity on the F region irregularity structure. The regions in between the precipitation structures, where presumably the E region conductivity was small, were generally associated with large shears in the horizontal E-W drifts and large velocities, as measured by the ion drift meter on board AE-D. The maximum drifts measured were approx.2 km s -1 , corresponding to an electric field of 100 mV m -1 . The large-velocity regions were also associated with substantial ion heating and electron density depletions. The largest shear magnitudes observed were approx.80 m s -1 km -1 , and the shear gradient scale lengths were approx.10 km, which was approximately the resolution of the ion drift meter data set used. The spectral characteristics of irregularities in the large, variable flow regions were very different, with p 1 being approx.-1

  5. Depletion region surface effects in electron beam induced current measurements

    Energy Technology Data Exchange (ETDEWEB)

    Haney, Paul M.; Zhitenev, Nikolai B. [Center for Nanoscale Science and Technology, National Institute of Standards and Technology, Gaithersburg, Maryland 20899 (United States); Yoon, Heayoung P. [Department of Electrical and Computer Engineering, University of Utah, Salt Lake City, Utah 84112 (United States); Gaury, Benoit [Center for Nanoscale Science and Technology, National Institute of Standards and Technology, Gaithersburg, Maryland 20899 (United States); Maryland NanoCenter, University of Maryland, College Park, Maryland 20742 (United States)

    2016-09-07

    Electron beam induced current (EBIC) is a powerful characterization technique which offers the high spatial resolution needed to study polycrystalline solar cells. Current models of EBIC assume that excitations in the p-n junction depletion region result in perfect charge collection efficiency. However, we find that in CdTe and Si samples prepared by focused ion beam (FIB) milling, there is a reduced and nonuniform EBIC lineshape for excitations in the depletion region. Motivated by this, we present a model of the EBIC response for excitations in the depletion region which includes the effects of surface recombination from both charge-neutral and charged surfaces. For neutral surfaces, we present a simple analytical formula which describes the numerical data well, while the charged surface response depends qualitatively on the location of the surface Fermi level relative to the bulk Fermi level. We find that the experimental data on FIB-prepared Si solar cells are most consistent with a charged surface and discuss the implications for EBIC experiments on polycrystalline materials.

  6. Genome-Based Identification of Active Prophage Regions by Next Generation Sequencing in Bacillus licheniformis DSM13

    Science.gov (United States)

    Hertel, Robert; Rodríguez, David Pintor; Hollensteiner, Jacqueline; Dietrich, Sascha; Leimbach, Andreas; Hoppert, Michael; Liesegang, Heiko; Volland, Sonja

    2015-01-01

    Prophages are viruses, which have integrated their genomes into the genome of a bacterial host. The status of the prophage genome can vary from fully intact with the potential to form infective particles to a remnant state where only a few phage genes persist. Prophages have impact on the properties of their host and are therefore of great interest for genomic research and strain design. Here we present a genome- and next generation sequencing (NGS)-based approach for identification and activity evaluation of prophage regions. Seven prophage or prophage-like regions were identified in the genome of Bacillus licheniformis DSM13. Six of these regions show similarity to members of the Siphoviridae phage family. The remaining region encodes the B. licheniformis orthologue of the PBSX prophage from Bacillus subtilis. Analysis of isolated phage particles (induced by mitomycin C) from the wild-type strain and prophage deletion mutant strains revealed activity of the prophage regions BLi_Pp2 (PBSX-like), BLi_Pp3 and BLi_Pp6. In contrast to BLi_Pp2 and BLi_Pp3, neither phage DNA nor phage particles of BLi_Pp6 could be visualized. However, the ability of prophage BLi_Pp6 to generate particles could be confirmed by sequencing of particle-protected DNA mapping to prophage locus BLi_Pp6. The introduced NGS-based approach allows the investigation of prophage regions and their ability to form particles. Our results show that this approach increases the sensitivity of prophage activity analysis and can complement more conventional approaches such as transmission electron microscopy (TEM). PMID:25811873

  7. Low-Energy Electron-Induced Strand Breaks in Telomere-Derived DNA Sequences-Influence of DNA Sequence and Topology.

    Science.gov (United States)

    Rackwitz, Jenny; Bald, Ilko

    2018-03-26

    During cancer radiation therapy high-energy radiation is used to reduce tumour tissue. The irradiation produces a shower of secondary low-energy (DNA very efficiently by dissociative electron attachment. Recently, it was suggested that low-energy electron-induced DNA strand breaks strongly depend on the specific DNA sequence with a high sensitivity of G-rich sequences. Here, we use DNA origami platforms to expose G-rich telomere sequences to low-energy (8.8 eV) electrons to determine absolute cross sections for strand breakage and to study the influence of sequence modifications and topology of telomeric DNA on the strand breakage. We find that the telomeric DNA 5'-(TTA GGG) 2 is more sensitive to low-energy electrons than an intermixed sequence 5'-(TGT GTG A) 2 confirming the unique electronic properties resulting from G-stacking. With increasing length of the oligonucleotide (i.e., going from 5'-(GGG ATT) 2 to 5'-(GGG ATT) 4 ), both the variety of topology and the electron-induced strand break cross sections increase. Addition of K + ions decreases the strand break cross section for all sequences that are able to fold G-quadruplexes or G-intermediates, whereas the strand break cross section for the intermixed sequence remains unchanged. These results indicate that telomeric DNA is rather sensitive towards low-energy electron-induced strand breakage suggesting significant telomere shortening that can also occur during cancer radiation therapy. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Digital Sequences and a Time Reversal-Based Impact Region Imaging and Localization Method

    Science.gov (United States)

    Qiu, Lei; Yuan, Shenfang; Mei, Hanfei; Qian, Weifeng

    2013-01-01

    To reduce time and cost of damage inspection, on-line impact monitoring of aircraft composite structures is needed. A digital monitor based on an array of piezoelectric transducers (PZTs) is developed to record the impact region of impacts on-line. It is small in size, lightweight and has low power consumption, but there are two problems with the impact alarm region localization method of the digital monitor at the current stage. The first one is that the accuracy rate of the impact alarm region localization is low, especially on complex composite structures. The second problem is that the area of impact alarm region is large when a large scale structure is monitored and the number of PZTs is limited which increases the time and cost of damage inspections. To solve the two problems, an impact alarm region imaging and localization method based on digital sequences and time reversal is proposed. In this method, the frequency band of impact response signals is estimated based on the digital sequences first. Then, characteristic signals of impact response signals are constructed by sinusoidal modulation signals. Finally, the phase synthesis time reversal impact imaging method is adopted to obtain the impact region image. Depending on the image, an error ellipse is generated to give out the final impact alarm region. A validation experiment is implemented on a complex composite wing box of a real aircraft. The validation results show that the accuracy rate of impact alarm region localization is approximately 100%. The area of impact alarm region can be reduced and the number of PZTs needed to cover the same impact monitoring region is reduced by more than a half. PMID:24084123

  9. A novel low energy electron microscope for DNA sequencing and surface analysis

    Energy Technology Data Exchange (ETDEWEB)

    Mankos, M., E-mail: marian@electronoptica.com [Electron Optica Inc., 1000 Elwell Court #110, Palo Alto, CA 94303 (United States); Shadman, K. [Electron Optica Inc., 1000 Elwell Court #110, Palo Alto, CA 94303 (United States); Persson, H.H.J. [Stanford Genome Technology Center, Stanford University School of Medicine, 855 California Avenue, Palo Alto, CA 94304 (United States); N’Diaye, A.T. [Electron Optica Inc., 1000 Elwell Court #110, Palo Alto, CA 94303 (United States); NCEM, Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, CA 94720 (United States); Schmid, A.K. [NCEM, Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, CA 94720 (United States); Davis, R.W. [Stanford Genome Technology Center, Stanford University School of Medicine, 855 California Avenue, Palo Alto, CA 94304 (United States)

    2014-10-15

    Monochromatic, aberration-corrected, dual-beam low energy electron microscopy (MAD-LEEM) is a novel technique that is directed towards imaging nanostructures and surfaces with sub-nanometer resolution. The technique combines a monochromator, a mirror aberration corrector, an energy filter, and dual beam illumination in a single instrument. The monochromator reduces the energy spread of the illuminating electron beam, which significantly improves spectroscopic and spatial resolution. Simulation results predict that the novel aberration corrector design will eliminate the second rank chromatic and third and fifth order spherical aberrations, thereby improving the resolution into the sub-nanometer regime at landing energies as low as one hundred electron-Volts. The energy filter produces a beam that can extract detailed information about the chemical composition and local electronic states of non-periodic objects such as nanoparticles, interfaces, defects, and macromolecules. The dual flood illumination eliminates charging effects that are generated when a conventional LEEM is used to image insulating specimens. A potential application for MAD-LEEM is in DNA sequencing, which requires high resolution to distinguish the individual bases and high speed to reduce the cost. The MAD-LEEM approach images the DNA with low electron impact energies, which provides nucleobase contrast mechanisms without organometallic labels. Furthermore, the micron-size field of view when combined with imaging on the fly provides long read lengths, thereby reducing the demand on assembling the sequence. Experimental results from bulk specimens with immobilized single-base oligonucleotides demonstrate that base specific contrast is available with reflected, photo-emitted, and Auger electrons. Image contrast simulations of model rectangular features mimicking the individual nucleotides in a DNA strand have been developed to translate measurements of contrast on bulk DNA to the detectability of

  10. Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

    Science.gov (United States)

    Wyszyńska-Koko, J; Kurył, J

    2004-01-01

    MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

  11. High Sequence Variations in Mitochondrial DNA Control Region among Worldwide Populations of Flathead Mullet Mugil cephalus

    Directory of Open Access Journals (Sweden)

    Brian Wade Jamandre

    2014-01-01

    Full Text Available The sequence and structure of the complete mtDNA control region (CR of M. cephalus from African, Pacific, and Atlantic populations are presented in this study to assess its usefulness in phylogeographic studies of this species. The mtDNA CR sequence variations among M. cephalus populations largely exceeded intraspecific polymorphisms that are generally observed in other vertebrates. The length of CR sequence varied among M. cephalus populations due to the presence of indels and variable number of tandem repeats at the 3′ hypervariable domain. The high evolutionary rate of the CR in this species probably originated from these mutations. However, no excessive homoplasic mutations were noticed. Finally, the star shaped tree inferred from the CR polymorphism stresses a rapid radiation worldwide, in this species. The CR still appears as a good marker for phylogeographic investigations and additional worldwide samples are warranted to further investigate the genetic structure and evolution in M. cephalus.

  12. Hydraulic fracturing and the Crooked Lake Sequences: Insights gleaned from regional seismic networks

    Science.gov (United States)

    Schultz, Ryan; Stern, Virginia; Novakovic, Mark; Atkinson, Gail; Gu, Yu Jeffrey

    2015-04-01

    Within central Alberta, Canada, a new sequence of earthquakes has been recognized as of 1 December 2013 in a region of previous seismic quiescence near Crooked Lake, ~30 km west of the town of Fox Creek. We utilize a cross-correlation detection algorithm to detect more than 160 events to the end of 2014, which is temporally distinguished into five subsequences. This observation is corroborated by the uniqueness of waveforms clustered by subsequence. The Crooked Lake Sequences have come under scrutiny due to its strong temporal correlation (>99.99%) to the timing of hydraulic fracturing operations in the Duvernay Formation. We assert that individual subsequences are related to fracturing stimulation and, despite adverse initial station geometry, double-difference techniques allow us to spatially relate each cluster back to a unique horizontal well. Overall, we find that seismicity in the Crooked Lake Sequences is consistent with first-order observations of hydraulic fracturing induced seismicity.

  13. Two dimensional molecular electronics spectroscopy for molecular fingerprinting, DNA sequencing, and cancerous DNA recognition.

    Science.gov (United States)

    Rajan, Arunkumar Chitteth; Rezapour, Mohammad Reza; Yun, Jeonghun; Cho, Yeonchoo; Cho, Woo Jong; Min, Seung Kyu; Lee, Geunsik; Kim, Kwang S

    2014-02-25

    Laser-driven molecular spectroscopy of low spatial resolution is widely used, while electronic current-driven molecular spectroscopy of atomic scale resolution has been limited because currents provide only minimal information. However, electron transmission of a graphene nanoribbon on which a molecule is adsorbed shows molecular fingerprints of Fano resonances, i.e., characteristic features of frontier orbitals and conformations of physisorbed molecules. Utilizing these resonance profiles, here we demonstrate two-dimensional molecular electronics spectroscopy (2D MES). The differential conductance with respect to bias and gate voltages not only distinguishes different types of nucleobases for DNA sequencing but also recognizes methylated nucleobases which could be related to cancerous cell growth. This 2D MES could open an exciting field to recognize single molecule signatures at atomic resolution. The advantages of the 2D MES over the one-dimensional (1D) current analysis can be comparable to those of 2D NMR over 1D NMR analysis.

  14. WeederH: an algorithm for finding conserved regulatory motifs and regions in homologous sequences

    Directory of Open Access Journals (Sweden)

    Pesole Graziano

    2007-02-01

    Full Text Available Abstract Background This work addresses the problem of detecting conserved transcription factor binding sites and in general regulatory regions through the analysis of sequences from homologous genes, an approach that is becoming more and more widely used given the ever increasing amount of genomic data available. Results We present an algorithm that identifies conserved transcription factor binding sites in a given sequence by comparing it to one or more homologs, adapting a framework we previously introduced for the discovery of sites in sequences from co-regulated genes. Differently from the most commonly used methods, the approach we present does not need or compute an alignment of the sequences investigated, nor resorts to descriptors of the binding specificity of known transcription factors. The main novel idea we introduce is a relative measure of conservation, assuming that true functional elements should present a higher level of conservation with respect to the rest of the sequence surrounding them. We present tests where we applied the algorithm to the identification of conserved annotated sites in homologous promoters, as well as in distal regions like enhancers. Conclusion Results of the tests show how the algorithm can provide fast and reliable predictions of conserved transcription factor binding sites regulating the transcription of a gene, with better performances than other available methods for the same task. We also show examples on how the algorithm can be successfully employed when promoter annotations of the genes investigated are missing, or when regulatory sites and regions are located far away from the genes.

  15. Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation

    International Nuclear Information System (INIS)

    Maat, J.

    1978-01-01

    A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)

  16. Designing a Bioengine for Detection and Analysis of Base String on an Affected Sequence in High-Concentration Regions

    Directory of Open Access Journals (Sweden)

    Debnath Bhattacharyya

    2013-01-01

    Full Text Available We design an Algorithm for bioengine. As a program are enable optimal alignments searching between two sequences, the host sequence (normal plant as well as query sequence (virus. Searching for homologues has become a routine operation of biological sequences in 4 × 4 combination with different subsequence (word size. This program takes the advantage of the high degree of homology between such sequences to construct an alignment of the matching regions. There is a main aim which is to detect the overlapping reading frames. This program also enables to find out the highly infected colones selection highest matching region with minimum gap or mismatch zones and unique virus colones matches. This is a small, portable, interactive, front-end program intended to be used to find out the regions of matching between host sequence and query subsequences. All the operations are carried out in fraction of seconds, depending on the required task and on the sequence length.

  17. Designing a Bioengine for Detection and Analysis of Base String on an Affected Sequence in High-Concentration Regions

    Science.gov (United States)

    Mandal, Bijoy Kumar; Kim, Tai-hoon

    2013-01-01

    We design an Algorithm for bioengine. As a program are enable optimal alignments searching between two sequences, the host sequence (normal plant) as well as query sequence (virus). Searching for homologues has become a routine operation of biological sequences in 4 × 4 combination with different subsequence (word size). This program takes the advantage of the high degree of homology between such sequences to construct an alignment of the matching regions. There is a main aim which is to detect the overlapping reading frames. This program also enables to find out the highly infected colones selection highest matching region with minimum gap or mismatch zones and unique virus colones matches. This is a small, portable, interactive, front-end program intended to be used to find out the regions of matching between host sequence and query subsequences. All the operations are carried out in fraction of seconds, depending on the required task and on the sequence length. PMID:24000321

  18. Sequence organization and control of transcription in the bacteriophage T4 tRNA region.

    Science.gov (United States)

    Broida, J; Abelson, J

    1985-10-05

    Bacteriophage T4 contains genes for eight transfer RNAs and two stable RNAs of unknown function. These are found in two clusters at 70 X 10(3) base-pairs on the T4 genetic map. To understand the control of transcription in this region we have completed the sequencing of 5000 base-pairs in this region. The sequence contains a part of gene 3, gene 1, gene 57, internal protein I, the tRNA genes and five open reading frames which most likely code for heretofore unidentified proteins. We have used subclones of the region to investigate the kinetics of transcription in vivo. The results show that transcription in this region consists of overlapping early, middle and late transcripts. Transcription is directed from two early promoters, one or two middle promoters and perhaps two late promoters. This region contains all of the features that are seen in T4 transcription and as such is a good place to study the phenomenon in more detail.

  19. ELECTRON CLOUD AT COLLIMATOR AND INJECTION REGION OF THE SPALLATION NEUTRON SOURCE ACCUMULATOR RING

    International Nuclear Information System (INIS)

    WANG, L.; HSEUH, H.-C.; LEE, Y.Y.; RAPARIA, D.; WEI, J.; COUSINEAU, S.

    2005-01-01

    The beam loss along the Spallation Neutron Source's accumulator ring is mainly located at the collimator region and injection region. This paper studied the electron cloud build-up at these two regions with the three-dimension program CLOUDLAND

  20. Progress toward an aberration-corrected low energy electron microscope for DNA sequencing and surface analysis.

    Science.gov (United States)

    Mankos, Marian; Shadman, Khashayar; N'diaye, Alpha T; Schmid, Andreas K; Persson, Henrik H J; Davis, Ronald W

    2012-11-01

    Monochromatic, aberration-corrected, dual-beam low energy electron microscopy (MAD-LEEM) is a novel imaging technique aimed at high resolution imaging of macromolecules, nanoparticles, and surfaces. MAD-LEEM combines three innovative electron-optical concepts in a single tool: a monochromator, a mirror aberration corrector, and dual electron beam illumination. The monochromator reduces the energy spread of the illuminating electron beam, which significantly improves spectroscopic and spatial resolution. The aberration corrector is needed to achieve subnanometer resolution at landing energies of a few hundred electronvolts. The dual flood illumination approach eliminates charging effects generated when a conventional, single-beam LEEM is used to image insulating specimens. The low landing energy of electrons in the range of 0 to a few hundred electronvolts is also critical for avoiding radiation damage, as high energy electrons with kilo-electron-volt kinetic energies cause irreversible damage to many specimens, in particular biological molecules. The performance of the key electron-optical components of MAD-LEEM, the aberration corrector combined with the objective lens and a magnetic beam separator, was simulated. Initial results indicate that an electrostatic electron mirror has negative spherical and chromatic aberration coefficients that can be tuned over a large parameter range. The negative aberrations generated by the electron mirror can be used to compensate the aberrations of the LEEM objective lens for a range of electron energies and provide a path to achieving subnanometer spatial resolution. First experimental results on characterizing DNA molecules immobilized on Au substrates in a LEEM are presented. Images obtained in a spin-polarized LEEM demonstrate that high contrast is achievable at low electron energies in the range of 1-10 eV and show that small changes in landing energy have a strong impact on the achievable contrast. The MAD-LEEM approach

  1. Sequence specific electronic conduction through polyion-stabilized double-stranded DNA in nanoscale break junctions

    International Nuclear Information System (INIS)

    Mahapatro, Ajit K; Jeong, Kyung J; Lee, Gil U; Janes, David B

    2007-01-01

    This paper presents a study of sequence specific electronic conduction through short (15-base-pair) double-stranded (ds) DNA molecules, measured by immobilizing 3 ' -thiol-derivatized DNAs in nanometre scale gaps between gold electrodes. The polycation spermidine was used to stabilize the ds-DNA structure, allowing electrical measurements to be performed in a dry state. For specific sequences, the conductivity was observed to scale with the surface density of immobilized DNA, which can be controlled by the buffer concentration. A series of 15-base DNA oligonucleotide pairs, in which the centre sequence of five base pairs was changed from G:C to A:T pairs, has been studied. The conductivity per molecule is observed to decrease exponentially with the number of adjacent A:T pairs replacing G:C pairs, consistent with a barrier at the A:T sites. Conductance-based devices for short DNA sequences could provide sensing approaches with direct electrical readout, as well as label-free detection

  2. DNA Barcoding: Amplification and sequence analysis of rbcl and matK genome regions in three divergent plant species

    Directory of Open Access Journals (Sweden)

    Javed Iqbal Wattoo

    2016-11-01

    Full Text Available Background: DNA barcoding is a novel method of species identification based on nucleotide diversity of conserved sequences. The establishment and refining of plant DNA barcoding systems is more challenging due to high genetic diversity among different species. Therefore, targeting the conserved nuclear transcribed regions would be more reliable for plant scientists to reveal genetic diversity, species discrimination and phylogeny. Methods: In this study, we amplified and sequenced the chloroplast DNA regions (matk+rbcl of Solanum nigrum, Euphorbia helioscopia and Dalbergia sissoo to study the functional annotation, homology modeling and sequence analysis to allow a more efficient utilization of these sequences among different plant species. These three species represent three families; Solanaceae, Euphorbiaceae and Fabaceae respectively. Biological sequence homology and divergence of amplified sequences was studied using Basic Local Alignment Tool (BLAST. Results: Both primers (matk+rbcl showed good amplification in three species. The sequenced regions reveled conserved genome information for future identification of different medicinal plants belonging to these species. The amplified conserved barcodes revealed different levels of biological homology after sequence analysis. The results clearly showed that the use of these conserved DNA sequences as barcode primers would be an accurate way for species identification and discrimination. Conclusion: The amplification and sequencing of conserved genome regions identified a novel sequence of matK in native species of Solanum nigrum. The findings of the study would be applicable in medicinal industry to establish DNA based identification of different medicinal plant species to monitor adulteration.

  3. Electron Energization and Mixing Observed by MMS in the Vicinity of an Electron Diffusion Region During Magnetopause Reconnection

    Science.gov (United States)

    Chen, Li-Jen; Hesse, Michael; Wang, Shan; Gershman, Daniel; Ergun, Robert; Pollock, Craig; Torbert, Roy; Bessho, Naoki; Daughton, William; Dorelli, John; hide

    2016-01-01

    Measurements from the Magnetospheric Multiscale (MMS) mission are reported to show distinct features of electron energization and mixing in the diffusion region of the terrestrial magnetopause reconnection. At the ion jet and magnetic field reversals, distribution functions exhibiting signatures of accelerated meandering electrons are observed at an electron out-of-plane flow peak. The meandering signatures manifested as triangular and crescent structures are established features of the electron diffusion region (EDR). Effects of meandering electrons on the electric field normal to the reconnection layer are detected. Parallel acceleration and mixing of the inflowing electrons with exhaust electrons shape the exhaust flow pattern. In the EDR vicinity, the measured distribution functions indicate that locally, the electron energization and mixing physics is captured by two-dimensional reconnection, yet to account for the simultaneous four-point measurements, translational invariant in the third dimension must be violated on the ion-skin-depth scale.

  4. Sequence analysis and typing of Saprolegnia strains isolated from freshwater fish from Southern Chinese regions

    Directory of Open Access Journals (Sweden)

    Siya Liu

    2017-09-01

    Full Text Available Saprolegniasis, caused by Saprolegnia infection, is one of the most common diseases in freshwater fish. Our study aimed to determine the epidemiological characteristics of saprolegniasis in Chinese regions of high incidence. Saprolegnia were isolated and identified by morphological and molecular methods targeting the internal transcribed spacer (ITS ribosomal DNA (rDNA and building neighbor-joining (NJ and maximum parsimony (MP phylogenetic trees. The ITS sequences of eight isolated strains were compared with GenBank sequences and all strains fell into three clades: CLADE1 (02, LP, 04 and 14, CLADE2 (S1, and CLADE3 (CP, S2, L5 and the reference ATCC200013. Isolates 02 and LP shared 80% sequence similarity with S. diclina, S. longicaulis, S. ferax, S. mixta, and S. anomalies. Further, isolates 04 and 14 shared 80% similarity with S. bulbosa and S. oliviae. Finally, extremely high ITS sequence similarities were identified between isolates S1 and S. australis (100%; CP and S. hypogyna (96%; and S2, L5, ATCC200013 and S. salmonis (98%. This research provides insights into the identification, prevention and control of saprolegniasis pathogens and the potential development of effective drugs.

  5. Face processing regions are sensitive to distinct aspects of temporal sequence in facial dynamics.

    Science.gov (United States)

    Reinl, Maren; Bartels, Andreas

    2014-11-15

    Facial movement conveys important information for social interactions, yet its neural processing is poorly understood. Computational models propose that shape- and temporal sequence sensitive mechanisms interact in processing dynamic faces. While face processing regions are known to respond to facial movement, their sensitivity to particular temporal sequences has barely been studied. Here we used fMRI to examine the sensitivity of human face-processing regions to two aspects of directionality in facial movement trajectories. We presented genuine movie recordings of increasing and decreasing fear expressions, each of which were played in natural or reversed frame order. This two-by-two factorial design matched low-level visual properties, static content and motion energy within each factor, emotion-direction (increasing or decreasing emotion) and timeline (natural versus artificial). The results showed sensitivity for emotion-direction in FFA, which was timeline-dependent as it only occurred within the natural frame order, and sensitivity to timeline in the STS, which was emotion-direction-dependent as it only occurred for decreased fear. The occipital face area (OFA) was sensitive to the factor timeline. These findings reveal interacting temporal sequence sensitive mechanisms that are responsive to both ecological meaning and to prototypical unfolding of facial dynamics. These mechanisms are temporally directional, provide socially relevant information regarding emotional state or naturalness of behavior, and agree with predictions from modeling and predictive coding theory. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  6. OPAL: prediction of MoRF regions in intrinsically disordered protein sequences.

    Science.gov (United States)

    Sharma, Ronesh; Raicar, Gaurav; Tsunoda, Tatsuhiko; Patil, Ashwini; Sharma, Alok

    2018-06-01

    Intrinsically disordered proteins lack stable 3-dimensional structure and play a crucial role in performing various biological functions. Key to their biological function are the molecular recognition features (MoRFs) located within long disordered regions. Computationally identifying these MoRFs from disordered protein sequences is a challenging task. In this study, we present a new MoRF predictor, OPAL, to identify MoRFs in disordered protein sequences. OPAL utilizes two independent sources of information computed using different component predictors. The scores are processed and combined using common averaging method. The first score is computed using a component MoRF predictor which utilizes composition and sequence similarity of MoRF and non-MoRF regions to detect MoRFs. The second score is calculated using half-sphere exposure (HSE), solvent accessible surface area (ASA) and backbone angle information of the disordered protein sequence, using information from the amino acid properties of flanks surrounding the MoRFs to distinguish MoRF and non-MoRF residues. OPAL is evaluated using test sets that were previously used to evaluate MoRF predictors, MoRFpred, MoRFchibi and MoRFchibi-web. The results demonstrate that OPAL outperforms all the available MoRF predictors and is the most accurate predictor available for MoRF prediction. It is available at http://www.alok-ai-lab.com/tools/opal/. ashwini@hgc.jp or alok.sharma@griffith.edu.au. Supplementary data are available at Bioinformatics online.

  7. A unique genomic sequence in the Wolf-Hirschhorn syndrome [WHS] region of humans is conserved in the great apes.

    Science.gov (United States)

    Tarzami, S T; Kringstein, A M; Conte, R A; Verma, R S

    1996-10-01

    The Wolf-Hirschhorn syndrome (WHS) is caused by a partial deletion in the short arm of chromosome 4 band 16.3 (4p 16.3). A unique-sequence human DNA probe (39 kb) localized within this region has been used to search for sequence homology in the apes' equivalent chromosome 3 by FISH-technique. The WHS loci are conserved in higher primates at the expected position. Nevertheless, a control probe, which detects alphoid sequences of the pericentromeric region of humans, is diverged in chimpanzee, gorilla, and orangutan. The conservation of WHS loci and divergence of DNA alphoid sequences have further added to the controversy concerning human descent.

  8. Genetic structure of Florida green turtle rookeries as indicated by mitochondrial DNA control region sequences

    Science.gov (United States)

    Shamblin, Brian M.; Bagley, Dean A.; Ehrhart, Llewellyn M.; Desjardin, Nicole A.; Martin, R. Erik; Hart, Kristen M.; Naro-Maciel, Eugenia; Rusenko, Kirt; Stiner, John C.; Sobel, Debra; Johnson, Chris; Wilmers, Thomas; Wright, Laura J.; Nairn, Campbell J.

    2014-01-01

    Green turtle (Chelonia mydas) nesting has increased dramatically in Florida over the past two decades, ranking the Florida nesting aggregation among the largest in the Greater Caribbean region. Individual beaches that comprise several hundred kilometers of Florida’s east coast and Keys support tens to thousands of nests annually. These beaches encompass natural to highly developed habitats, and the degree of demographic partitioning among rookeries was previously unresolved. We characterized the genetic structure of ten Florida rookeries from Cape Canaveral to the Dry Tortugas through analysis of 817 base pair mitochondrial DNA (mtDNA) control region sequences from 485 nesting turtles. Two common haplotypes, CM-A1.1 and CM-A3.1, accounted for 87 % of samples, and the haplotype frequencies were strongly partitioned by latitude along Florida’s Atlantic coast. Most genetic structure occurred between rookeries on either side of an apparent genetic break in the vicinity of the St. Lucie Inlet that separates Hutchinson Island and Jupiter Island, representing the finest scale at which mtDNA structure has been documented in marine turtle rookeries. Florida and Caribbean scale analyses of population structure support recognition of at least two management units: central eastern Florida and southern Florida. More thorough sampling and deeper sequencing are necessary to better characterize connectivity among Florida green turtle rookeries as well as between the Florida nesting aggregation and others in the Greater Caribbean region.

  9. The practice of electronic petitions to regional political agenda-setting

    Directory of Open Access Journals (Sweden)

    O. M. Kuzhman

    2016-05-01

    Proved that electronic petitions as a special form of collective appeals, in fact, represent electronic (national, regional, local – depending on the level of government initiatives which the conditions of collecting the required number of signatures in his support are urgently considered relevant authority. For it must necessarily be made or decision given in a public way motivated refusal. It was determined that the regional feeder electronic petitions is very effective because it allows you to identify the pressing issues of interest to residents of a region, and respond to them. Thus, through electronic petition very quickly established regional political agenda.

  10. The 2012 Ferrara seismic sequence: Regional crustal structure, earthquake sources, and seismic hazard

    Science.gov (United States)

    Malagnini, Luca; Herrmann, Robert B.; Munafò, Irene; Buttinelli, Mauro; Anselmi, Mario; Akinci, Aybige; Boschi, E.

    2012-10-01

    Inadequate seismic design codes can be dangerous, particularly when they underestimate the true hazard. In this study we use data from a sequence of moderate-sized earthquakes in northeast Italy to validate and test a regional wave propagation model which, in turn, is used to understand some weaknesses of the current design spectra. Our velocity model, while regionalized and somewhat ad hoc, is consistent with geophysical observations and the local geology. In the 0.02-0.1 Hz band, this model is validated by using it to calculate moment tensor solutions of 20 earthquakes (5.6 ≥ MW ≥ 3.2) in the 2012 Ferrara, Italy, seismic sequence. The seismic spectra observed for the relatively small main shock significantly exceeded the design spectra to be used in the area for critical structures. Observations and synthetics reveal that the ground motions are dominated by long-duration surface waves, which, apparently, the design codes do not adequately anticipate. In light of our results, the present seismic hazard assessment in the entire Pianura Padana, including the city of Milan, needs to be re-evaluated.

  11. [Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis].

    Science.gov (United States)

    Chen, Suiqing; Lu, Xiaolei; Wang, Lili

    2011-05-01

    To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.

  12. Quick regional centroid moment tensor solutions for the Emilia 2012 (northern Italy seismic sequence

    Directory of Open Access Journals (Sweden)

    Silvia Pondrelli

    2012-10-01

    Full Text Available In May 2012, a seismic sequence struck the Emilia region (northern Italy. The mainshock, of Ml 5.9, occurred on May 20, 2012, at 02:03 UTC. This was preceded by a smaller Ml 4.1 foreshock some hours before (23:13 UTC on May 19, 2012 and followed by more than 2,500 earthquakes in the magnitude range from Ml 0.7 to 5.2. In addition, on May 29, 2012, three further strong earthquakes occurred, all with magnitude Ml ≥5.2: a Ml 5.8 earthquake in the morning (07:00 UTC, followed by two events within just 5 min of each other, one at 10:55 UTC (Ml 5.3 and the second at 11:00 UTC (Ml 5.2. For all of the Ml ≥4.0 earthquakes in Italy and for all of the Ml ≥4.5 in the Mediterranean area, an automatic procedure for the computation of a regional centroid moment tensor (RCMT is triggered by an email alert. Within 1 h of the event, a manually revised quick RCMT (QRCMT can be published on the website if the solution is considered stable. In particular, for the Emilia seismic sequence, 13 QRCMTs were determined and for three of them, those with M >5.5, the automatically computed QRCMTs fitted the criteria for publication without manual revision. Using this seismic sequence as a test, we can then identify the magnitude threshold for automatic publication of our QRCMTs.

  13. Characterization of Pseudomonas chlororaphis myovirus 201φ2-1 via genomic sequencing, mass spectrometry, and electron microscopy

    International Nuclear Information System (INIS)

    Thomas, Julie A.; Rolando, Mandy R.; Carroll, Christopher A.; Shen, Peter S.; Belnap, David M.; Weintraub, Susan T.; Serwer, Philip; Hardies, Stephen C.

    2008-01-01

    Pseudomonas chlororaphis phage 201φ2-1 is a relative of Pseudomonas aeruginosa myovirus φKZ. Phage 201φ2-1 was examined by complete genomic sequencing (316,674 bp), by a comprehensive mass spectrometry survey of its virion proteins and by electron microscopy. Seventy-six proteins, of which at least 69 have homologues in φKZ, were identified by mass spectrometry. Eight proteins, in addition to the major head, tail sheath and tail tube proteins, are abundant in the virion. Electron microscopy of 201φ2-1 revealed a multitude of long, fine fibers apparently decorating the tail sheath protein. Among the less abundant virion proteins are three homologues to RNA polymerase β or β' subunits. Comparison between the genomes of 201φ2-1 and φKZ revealed substantial conservation of the genome plan, and a large region with an especially high rate of gene replacement. The φKZ-like phages exhibited a two-fold higher rate of divergence than for T4-like phages or host genomes

  14. Draft genome sequences of three virulent Streptococcus thermophilus bacteriophages isolated from the dairy environment in the Veneto region of Italy

    DEFF Research Database (Denmark)

    Duarte, Viní­cius da Silva; Giaretta, Sabrina; Treu, Laura

    2018-01-01

    Streptococcus thermophilus, a very important dairy species, is constantly threatened by phage infection. We report the genome sequences of three S. thermophilus bacteriophages isolated from a dairy environment in the Veneto region of Italy. These sequences will be used for the development of new ...

  15. The male-specific region of the human Y chromosome is a mosaic of discrete sequence classes

    NARCIS (Netherlands)

    Skaletsky, Helen; Kuroda-Kawaguchi, Tomoko; Minx, Patrick J.; Cordum, Holland S.; Hillier, LaDeana; Brown, Laura G.; Repping, Sjoerd; Pyntikova, Tatyana; Ali, Johar; Bieri, Tamberlyn; Chinwalla, Asif; Delehaunty, Andrew; Delehaunty, Kim; Du, Hui; Fewell, Ginger; Fulton, Lucinda; Fulton, Robert; Graves, Tina; Hou, Shun-Fang; Latrielle, Philip; Leonard, Shawn; Mardis, Elaine; Maupin, Rachel; McPherson, John; Miner, Tracie; Nash, William; Nguyen, Christine; Ozersky, Philip; Pepin, Kymberlie; Rock, Susan; Rohlfing, Tracy; Scott, Kelsi; Schultz, Brian; Strong, Cindy; Tin-Wollam, Aye; Yang, Shiaw-Pyng; Waterston, Robert H.; Wilson, Richard K.; Rozen, Steve; Page, David C.

    2003-01-01

    The male-specific region of the Y chromosome, the MSY, differentiates the sexes and comprises 95% of the chromosome's length. Here, we report that the MSY is a mosaic of heterochromatic sequences and three classes of euchromatic sequences: X-transposed, X-degenerate and ampliconic. These classes

  16. Optical properties and electronic transitions of DNA oligonucleotides as a function of composition and stacking sequence.

    Science.gov (United States)

    Schimelman, Jacob B; Dryden, Daniel M; Poudel, Lokendra; Krawiec, Katherine E; Ma, Yingfang; Podgornik, Rudolf; Parsegian, V Adrian; Denoyer, Linda K; Ching, Wai-Yim; Steinmetz, Nicole F; French, Roger H

    2015-02-14

    The role of base pair composition and stacking sequence in the optical properties and electronic transitions of DNA is of fundamental interest. We present and compare the optical properties of DNA oligonucleotides (AT)10, (AT)5(GC)5, and (AT-GC)5 using both ab initio methods and UV-vis molar absorbance measurements. Our data indicate a strong dependence of both the position and intensity of UV absorbance features on oligonucleotide composition and stacking sequence. The partial densities of states for each oligonucleotide indicate that the valence band edge arises from a feature associated with the PO4(3-) complex anion, and the conduction band edge arises from anti-bonding states in DNA base pairs. The results show a strong correspondence between the ab initio and experimentally determined optical properties. These results highlight the benefit of full spectral analysis of DNA, as opposed to reductive methods that consider only the 260 nm absorbance (A260) or simple purity ratios, such as A260/A230 or A260/A280, and suggest that the slope of the absorption edge onset may provide a useful metric for the degree of base pair stacking in DNA. These insights may prove useful for applications in biology, bioelectronics, and mesoscale self-assembly.

  17. Production of accelerated electrons near an electron source in the plasma resonance region

    International Nuclear Information System (INIS)

    Fedorov, V.A.

    1989-01-01

    Conditions of generation of plasma electrons accelerated and their characteristics in the vicinity of an electron source are determined. The electron source isolated electrically with infinitely conducting surface, being in unrestricted collisionless plasma ω 0 >>ν, where ω 0 - plasma frequency of nonperturbated plasma, ν - frequency of plasma electron collisions with other plasma particles, is considered. Spherically symmetric injection of electrons, which rates are simulated by ω frequency, occurs from the source surface. When describing phenomena in the vicinity of the electron source, one proceeds from the quasihydrodynamic equation set

  18. Chronology of Eocene-Miocene sequences on the New Jersey shallow shelf: implications for regional, interregional, and global correlations

    Science.gov (United States)

    Browning, James V.; Miller, Kenneth G.; Sugarman, Peter J.; Barron, John; McCarthy, Francine M.G.; Kulhanek, Denise K.; Katz, Miriam E.; Feigenson, Mark D.

    2013-01-01

    Integrated Ocean Drilling Program Expedition 313 continuously cored and logged latest Eocene to early-middle Miocene sequences at three sites (M27, M28, and M29) on the inner-middle continental shelf offshore New Jersey, providing an opportunity to evaluate the ages, global correlations, and significance of sequence boundaries. We provide a chronology for these sequences using integrated strontium isotopic stratigraphy and biostratigraphy (primarily calcareous nannoplankton, diatoms, and dinocysts [dinoflagellate cysts]). Despite challenges posed by shallow-water sediments, age resolution is typically ±0.5 m.y. and in many sequences is as good as ±0.25 m.y. Three Oligocene sequences were sampled at Site M27 on sequence bottomsets. Fifteen early to early-middle Miocene sequences were dated at Sites M27, M28, and M29 across clinothems in topsets, foresets (where the sequences are thickest), and bottomsets. A few sequences have coarse (∼1 m.y.) or little age constraint due to barren zones; we constrain the age estimates of these less well dated sequences by applying the principle of superposition, i.e., sediments above sequence boundaries in any site are younger than the sediments below the sequence boundaries at other sites. Our age control provides constraints on the timing of deposition in the clinothem; sequences on the topsets are generally the youngest in the clinothem, whereas the bottomsets generally are the oldest. The greatest amount of time is represented on foresets, although we have no evidence for a correlative conformity. Our chronology provides a baseline for regional and interregional correlations and sea-level reconstructions: (1) we correlate a major increase in sedimentation rate precisely with the timing of the middle Miocene climate changes associated with the development of a permanent East Antarctic Ice Sheet; and (2) the timing of sequence boundaries matches the deep-sea oxygen isotopic record, implicating glacioeustasy as a major driver

  19. Selection of mRNA 5'-untranslated region sequence with high translation efficiency through ribosome display

    International Nuclear Information System (INIS)

    Mie, Masayasu; Shimizu, Shun; Takahashi, Fumio; Kobatake, Eiry

    2008-01-01

    The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, only mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library

  20. Reference voltage calculation method based on zero-sequence component optimisation for a regional compensation DVR

    Science.gov (United States)

    Jian, Le; Cao, Wang; Jintao, Yang; Yinge, Wang

    2018-04-01

    This paper describes the design of a dynamic voltage restorer (DVR) that can simultaneously protect several sensitive loads from voltage sags in a region of an MV distribution network. A novel reference voltage calculation method based on zero-sequence voltage optimisation is proposed for this DVR to optimise cost-effectiveness in compensation of voltage sags with different characteristics in an ungrounded neutral system. Based on a detailed analysis of the characteristics of voltage sags caused by different types of faults and the effect of the wiring mode of the transformer on these characteristics, the optimisation target of the reference voltage calculation is presented with several constraints. The reference voltages under all types of voltage sags are calculated by optimising the zero-sequence component, which can reduce the degree of swell in the phase-to-ground voltage after compensation to the maximum extent and can improve the symmetry degree of the output voltages of the DVR, thereby effectively increasing the compensation ability. The validity and effectiveness of the proposed method are verified by simulation and experimental results.

  1. Free electron lasers for the XUV spectral region

    Energy Technology Data Exchange (ETDEWEB)

    Murphy, J.B.; Pellegrini, C.

    1984-01-01

    Using the system described, an electron storage ring with an undulator in a special bypass section, we can obtain high intensity coherent radiation by sending the beam through the undulator and using the FEL collective instability to produce radiation. Compared to other systems, such as an FEL oscillator or a transverse optical klystron, this system has the advantage that it does not

  2. Middle-energy electron anisotropies in the auroral region

    Directory of Open Access Journals (Sweden)

    P. Janhunen

    2004-01-01

    Full Text Available Field-aligned anisotropic electron distribution functions of T > T type are observed on auroral field lines at both low and high altitudes. We show that typically the anisotropy is limited to a certain range of energies, often below 1keV, although sometimes extending to slightly higher energies as well. Almost always there is simultaneously an isotropic electron distribution at higher energies. Often the anisotropies are up/down symmetrical, although cases with net upward or downward electron flow also occur. For a statistical analysis of the anisotropies we divide the energy range into low (below 100eV, middle (100eV–1keV and high (above 1keV energies and develop a measure of anisotropy expressed in density units. The statistical magnetic local time and invariant latitude distribution of the middle-energy anisotropies obeys that of the average auroral oval, whereas the distributions of the low and high energy anisotropies are more irregular. This suggests that it is specifically the middle-energy anisotropies that have something to do with auroral processes. The anisotropy magnitude decreases monotonically with altitude, as one would expect, because electrons have high mobility along the magnetic field and thus, the anisotropy properties spread rapidly to different altitudes.

    Key words. Magnetospheric physics (auroral phenomena. Space plasma physics (wave-particle interactions; changed particle motion and acceleration

  3. Genomic region operation kit for flexible processing of deep sequencing data.

    Science.gov (United States)

    Ovaska, Kristian; Lyly, Lauri; Sahu, Biswajyoti; Jänne, Olli A; Hautaniemi, Sampsa

    2013-01-01

    Computational analysis of data produced in deep sequencing (DS) experiments is challenging due to large data volumes and requirements for flexible analysis approaches. Here, we present a mathematical formalism based on set algebra for frequently performed operations in DS data analysis to facilitate translation of biomedical research questions to language amenable for computational analysis. With the help of this formalism, we implemented the Genomic Region Operation Kit (GROK), which supports various DS-related operations such as preprocessing, filtering, file conversion, and sample comparison. GROK provides high-level interfaces for R, Python, Lua, and command line, as well as an extension C++ API. It supports major genomic file formats and allows storing custom genomic regions in efficient data structures such as red-black trees and SQL databases. To demonstrate the utility of GROK, we have characterized the roles of two major transcription factors (TFs) in prostate cancer using data from 10 DS experiments. GROK is freely available with a user guide from >http://csbi.ltdk.helsinki.fi/grok/.

  4. Sequence polymorphism data of the hypervariable regions of mitochondrial DNA in the Yadav population of Haryana.

    Science.gov (United States)

    Verma, Kapil; Sharma, Sapna; Sharma, Arun; Dalal, Jyoti; Bhardwaj, Tapeshwar

    2018-06-01

    Genetic variations among humans occur both within and among populations and range from single nucleotide changes to multiple-nucleotide variants. These multiple-nucleotide variants are useful for studying the relationships among individuals or various population groups. The study of human genetic variations can help scientists understand how different population groups are biologically related to one another. Sequence analysis of hypervariable regions of human mitochondrial DNA (mtDNA) has been successfully used for the genetic characterization of different population groups for forensic purposes. It is well established that different ethnic or population groups differ significantly in their mtDNA distributions. In the last decade, very little research has been conducted on mtDNA variations in the Indian population, although such data would be useful for elucidating the history of human population expansion across the world. Moreover, forensic studies on mtDNA variations in the Indian subcontinent are also scarce, particularly in the northern part of India. In this report, variations in the hypervariable regions of mtDNA were analyzed in the Yadav population of Haryana. Different molecular diversity indices were computed. Further, the obtained haplotypes were classified into different haplogroups and the phylogenetic relationship between different haplogroups was inferred.

  5. Sequence evolution of the hypervariable region in the putative envelope region E2/NS1 of hepatitis C virus is correlated with specific humoral immune responses.

    OpenAIRE

    van Doorn, L J; Capriles, I; Maertens, G; DeLeys, R; Murray, K; Kos, T; Schellekens, H; Quint, W

    1995-01-01

    Sequence evolution of the hypervariable region 1 (HVR1) in the N terminus of E2/NS1 of hepatitis C virus (HCV) was studied retrospectively in six chimpanzees inoculated with the same genotype 1b strain, containing a unique predominant HVR1 sequence. Immediately after inoculation, all animals contained the same HVR predominant sequence. Two animals developed an acute self-limiting infection. Anti-HVR1 immunoglobulin G (IgG) was produced 40 to 60 days after inoculation and rapidly disappeared a...

  6. A new method for detecting signal regions in ordered sequences of real numbers, and application to viral genomic data.

    Science.gov (United States)

    Gog, Julia R; Lever, Andrew M L; Skittrall, Jordan P

    2018-01-01

    We present a fast, robust and parsimonious approach to detecting signals in an ordered sequence of numbers. Our motivation is in seeking a suitable method to take a sequence of scores corresponding to properties of positions in virus genomes, and find outlying regions of low scores. Suitable statistical methods without using complex models or making many assumptions are surprisingly lacking. We resolve this by developing a method that detects regions of low score within sequences of real numbers. The method makes no assumptions a priori about the length of such a region; it gives the explicit location of the region and scores it statistically. It does not use detailed mechanistic models so the method is fast and will be useful in a wide range of applications. We present our approach in detail, and test it on simulated sequences. We show that it is robust to a wide range of signal morphologies, and that it is able to capture multiple signals in the same sequence. Finally we apply it to viral genomic data to identify regions of evolutionary conservation within influenza and rotavirus.

  7. Highly conserved intragenic HSV-2 sequences: Results from next-generation sequencing of HSV-2 UL and US regions from genital swabs collected from 3 continents.

    Science.gov (United States)

    Johnston, Christine; Magaret, Amalia; Roychoudhury, Pavitra; Greninger, Alexander L; Cheng, Anqi; Diem, Kurt; Fitzgibbon, Matthew P; Huang, Meei-Li; Selke, Stacy; Lingappa, Jairam R; Celum, Connie; Jerome, Keith R; Wald, Anna; Koelle, David M

    2017-10-01

    Understanding the variability in circulating herpes simplex virus type 2 (HSV-2) genomic sequences is critical to the development of HSV-2 vaccines. Genital lesion swabs containing ≥ 10 7 log 10 copies HSV DNA collected from Africa, the USA, and South America underwent next-generation sequencing, followed by K-mer based filtering and de novo genomic assembly. Sites of heterogeneity within coding regions in unique long and unique short (U L _U S ) regions were identified. Phylogenetic trees were created using maximum likelihood reconstruction. Among 46 samples from 38 persons, 1468 intragenic base-pair substitutions were identified. The maximum nucleotide distance between strains for concatenated U L_ U S segments was 0.4%. Phylogeny did not reveal geographic clustering. The most variable proteins had non-synonymous mutations in < 3% of amino acids. Unenriched HSV-2 DNA can undergo next-generation sequencing to identify intragenic variability. The use of clinical swabs for sequencing expands the information that can be gathered directly from these specimens. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Electron energy distribution function in a cathode fall region of DC-glow discharge

    International Nuclear Information System (INIS)

    Elakshar, F.F.; Garamoon, A.A.; Hassouba, M.A.

    1997-01-01

    Recently a substantial effort has been devoted towards the development of a quantitative microscopic measurements in the cathode fall region of the DC-glow discharge magnetron sputtering unit. The electron energy distribution function (EEDF) has been measured using a single Langmuir probe at the edge of the cathode fall. Two groups of electrons are observed in helium and argon gas discharges. The two groups have no chance to be thermalized since they leave the cathode fall region fast. The electron temperature measurements have been compared with spectroscopic determination. Plasma density has been computed and compared with probe measurements. Sources of the two groups of electrons are also discussed. (author)

  9. Plasma potential measurements in the edge region of the ISTTOK plasma, using electron emissive probes

    International Nuclear Information System (INIS)

    Ionita, C.; Balan, P.; Schrittwieser, R.; Cabral, J.A.; Fernandes, H.; Figueiredo, H. F.C.; Varandas, C.

    2001-01-01

    We have recently started to use electron-emissive probes for direct measurements of the plasma potential and its fluctuations in the edge region of the plasma ring in the tokamak ISTTOK in Lisbon, Portugal. This method is based on the fact that the electron emission current of such a probe is able to compensate electron temperature variations and electron drifts, which can occur in the edge plasma region of magnetized fusion devices, and which are making measurements with cold probes prone to errors. In this contribution we present some of the first results of our investigations in ISTTOK.(author)

  10. Identifications of Captive and Wild Tilapia Species Existing in Hawaii by Mitochondrial DNA Control Region Sequence

    Science.gov (United States)

    Wu, Liang; Yang, Jinzeng

    2012-01-01

    Background The tilapia family of the Cichlidae includes many fish species, which live in freshwater and saltwater environments. Several species, such as O. niloticus, O. aureus, and O. mossambicus, are excellent for aquaculture because these fish are easily reproduced and readily adapt to diverse environments. Historically, tilapia species, including O. mossambicus, S. melanotheron, and O. aureus, were introduced to Hawaii many decades ago, and the state of Hawaii uses the import permit policy to prevent O. niloticus from coming into the islands. However, hybrids produced from O. niloticus may already be present in the freshwater and marine environments of the islands. The purpose of this study was to identify tilapia species that exist in Hawaii using mitochondrial DNA analysis. Methodology/Principal Findings In this study, we analyzed 382 samples collected from 13 farm (captive) and wild tilapia populations in Oahu and the Hawaii Islands. Comparison of intraspecies variation between the mitochondrial DNA control region (mtDNA CR) and cytochrome c oxidase I (COI) gene from five populations indicated that mtDNA CR had higher nucleotide diversity than COI. A phylogenetic tree of all sampled tilapia was generated using mtDNA CR sequences. The neighbor-joining tree analysis identified seven distinctive tilapia species: O. aureus, O. mossambicus, O. niloticus, S. melanotheron, O. urolepies, T. redalli, and a hybrid of O. massambicus and O. niloticus. Of all the populations examined, 10 populations consisting of O. aureus, O. mossambicus, O. urolepis, and O. niloticus from the farmed sites were relatively pure, whereas three wild populations showed some degree of introgression and hybridization. Conclusions/Significance This DNA-based tilapia species identification is the first report that confirmed tilapia species identities in the wild and captive populations in Hawaii. The DNA sequence comparisons of mtDNA CR appear to be a valid method for tilapia species

  11. An integrated tool to study MHC region: accurate SNV detection and HLA genes typing in human MHC region using targeted high-throughput sequencing.

    Directory of Open Access Journals (Sweden)

    Hongzhi Cao

    Full Text Available The major histocompatibility complex (MHC is one of the most variable and gene-dense regions of the human genome. Most studies of the MHC, and associated regions, focus on minor variants and HLA typing, many of which have been demonstrated to be associated with human disease susceptibility and metabolic pathways. However, the detection of variants in the MHC region, and diagnostic HLA typing, still lacks a coherent, standardized, cost effective and high coverage protocol of clinical quality and reliability. In this paper, we presented such a method for the accurate detection of minor variants and HLA types in the human MHC region, using high-throughput, high-coverage sequencing of target regions. A probe set was designed to template upon the 8 annotated human MHC haplotypes, and to encompass the 5 megabases (Mb of the extended MHC region. We deployed our probes upon three, genetically diverse human samples for probe set evaluation, and sequencing data show that ∼97% of the MHC region, and over 99% of the genes in MHC region, are covered with sufficient depth and good evenness. 98% of genotypes called by this capture sequencing prove consistent with established HapMap genotypes. We have concurrently developed a one-step pipeline for calling any HLA type referenced in the IMGT/HLA database from this target capture sequencing data, which shows over 96% typing accuracy when deployed at 4 digital resolution. This cost-effective and highly accurate approach for variant detection and HLA typing in the MHC region may lend further insight into immune-mediated diseases studies, and may find clinical utility in transplantation medicine research. This one-step pipeline is released for general evaluation and use by the scientific community.

  12. [Sequence polymorphisms of the mitochondrial DNA HVR I and HVR II regions in the Deng populations from Tibet in China].

    Science.gov (United States)

    Kang, Longli; Zhang, Xiaofeng; Liu, Kai; Zhao, Jianmin

    2009-12-01

    To analyze the sequence polymorphisms of the mitochondrial DNA hypervariable regions I (HVR I) and HVR II in the Deng population in Linzhi area of Tibet. mtDNAs obtained from 119 unrelated individuals were amplified and directly sequenced. One hundred and ten variable sites were identified, including nucleotide transitions, transversions, and insertions. In the HVR I region (nt16024-nt16365), 68 polymorphic sites and 119 haplotypes were observed, the genetic diversity was 0.9916. In the HVR II (nt73-nt340) region, 42 polymorphic sites and 113 haplotypes were observed, and the genetic diversity was 0.9907. The random match probability of the HVR I and HVR II regions were 0.0084 and 0.0093, respectively. When combining the HVR I and HVR II regions, 119 different haplotypes were found. The combined match probability of two unrelated persons having the same sequence was 0.0084. There are some unique polymorphic loci in the Deng population. There are different genetic structures between Chinese and other Asian populations in the mitochondrial DNA D-loop region. Sequence polymorphism of mitochondrial DNA HVR I and HVR II can be used as a genetic marker for forensic individual identification and genetic analysis.

  13. Identification of Dendrobium species by a candidate DNA barcode sequence: the chloroplast psbA-trnH intergenic region.

    Science.gov (United States)

    Yao, Hui; Song, Jing-Yuan; Ma, Xin-Ye; Liu, Chang; Li, Ying; Xu, Hong-Xi; Han, Jian-Ping; Duan, Li-Sheng; Chen, Shi-Lin

    2009-05-01

    DNA barcoding is a novel technology that uses a standard DNA sequence to facilitate species identification. Although a consensus has not been reached regarding which DNA sequences can be used as the best plant barcodes, the psbA-trnH spacer region has been tested extensively in recent years. In this study, we hypothesize that the psbA-trnH spacer regions are also effective barcodes for Dendrobium species. We have sequenced the chloroplast psbA-trnH intergenic spacers of 17 Dendrobium species to test this hypothesis. The sequences were found to be significantly different from those of other species, with percentages of variation ranging from 0.3 % to 2.3 % and an average of 1.2 %. In contrast, the intraspecific variation among the Dendrobium species studied ranged from 0 % to 0.1 %. The sequence difference between the psbA-trnH sequences of 17 Dendrobium species and one Bulbophyllum odoratissimum ranged from 2.0 % to 3.1 %, with an average of 2.5 %. Our results support the notion that the psbA-trnH intergenic spacer region could be used as a barcode to distinguish various Dendrobium species and to differentiate Dendrobium species from other adulterating species. Copyright Georg Thieme Verlag KG Stuttgart. New York.

  14. Evolution and strengthening of the Calabrian Regional Seismic Network during the Pollino sequence

    Science.gov (United States)

    D'Alessandro, Antonino; Gervasi, Anna; Guerra, Ignazio

    2013-04-01

    In the last three years the Calabria-Lucania border area is affected by an intense seismic activity generated by the activation of geological structures which be seat of clusters of microearthquakes, with energy release sufficient to be felt and to generate alarm and bother. Besides to the historical memory of the inhabitants of Mormanno (the town most affected of macroseismic effects) there are some historical documents that indicate the occurrence of a similar seismic crisis in 1888. A more recent seismic sequence, the first monitored by seismic instruments, occurred in 1973-1974. In the last case, the activity started in early 2010 and is still ongoing. The two shocks of ML = 4.3 and 5.0 and the the very long time duration differs this crisis from the previous ones. Given this background, in 1981 was installed at Mormanno a seismic station (MMN) belonging to Regional Seismic Network of the University of Calabria (RSRC), now also a station of the Italian National Seismic Network of the Istituto Nazionale di Geofisica Vulcanolgia (INSN-INGV). This seismic station made it possible to follow the evolution of seismicity in this area and in particular the progressive increase in seismic activity started in 2010. Since 2010, some 3D stand-alone, was installed by the University of Calabria. Further stations of INGV were installed in November 2011 after a sharp increase of the energy release and subsequently by the INGV and the GeoForschungsZentrum (Potsdam) after the main shock of the whole sequence. Seismic networks are powerful tools for understanding active tectonic processes in a monitored seismically active region. However, the optimal monitoring of a seismic region requires the assessment of the seismic network capabilities to identify seismogenic areas that are not adequately covered and to quantify measures that will allow the network improvement. In this paper we examine in detail the evolution and the strengthening of the RSRC in the last years analyzing the

  15. Aloe vera in active and passive regions of electronic devices towards a sustainable development

    Science.gov (United States)

    Lim, Zhe Xi; Sreenivasan, Sasidharan; Wong, Yew Hoong; Cheong, Kuan Yew

    2017-07-01

    The increasing awareness towards sustainable development of electronics has driven the search for natural bio-organic materials in place of conventional electronic materials. The concept of using natural bio-organic materials in electronics provides not only an effective solution to address global electronic waste crisis, but also a compelling template for sustainable electronics manufacturing. This paper attempts to provide an overview of using Aloe vera gel as a natural bio-organic material for various electronic applications. Important concepts such as responses of living Aloe vera plant towards electrical stimuli and demonstrations of Aloe vera films as passive and active regions of electronic devices are highlighted in chronological order. The biodegradability and biocompatibility of Aloe vera can bring the world a step closer towards the ultimate goal of sustainable development of electronic devices from "all-natural" materials.

  16. Electron Currents and Heating in the Ion Diffusion Region of Asymmetric Reconnection

    Science.gov (United States)

    Graham, D. B.; Khotyaintsev, Yu. V.; Norgren, C.; Vaivads, A.; Andre, M.; Lindqvist, P. A.; Marklund, G. T.; Ergun, R. E.; Paterson, W. R.; Gershman, D. J.; hide

    2016-01-01

    In this letter the structure of the ion diffusion region of magnetic reconnection at Earths magnetopause is investigated using the Magnetospheric Multiscale (MMS) spacecraft. The ion diffusion region is characterized by a strong DC electric field, approximately equal to the Hall electric field, intense currents, and electron heating parallel to the background magnetic field. Current structures well below ion spatial scales are resolved, and the electron motion associated with lower hybrid drift waves is shown to contribute significantly to the total current density. The electron heating is shown to be consistent with large-scale parallel electric fields trapping and accelerating electrons, rather than wave-particle interactions. These results show that sub-ion scale processes occur in the ion diffusion region and are important for understanding electron heating and acceleration.

  17. Mechanism of electron density reduction in the region of stable subauroral red arcs

    International Nuclear Information System (INIS)

    Pavlov, A.V.

    1993-01-01

    For geomagnetic storm on 18.12.71 are fulfilled calculations of electron density N e and temperature Te and intensity of the atmosphere luminescence at 630 nm in the region of the subauroral red are and outside its

  18. Improvement of dose distributions in abutment regions of intensity modulated radiation therapy and electron fields

    International Nuclear Information System (INIS)

    Dogan, Nesrin; Leybovich, Leonid B.; Sethi, Anil; Emami, Bahman

    2002-01-01

    In recent years, intensity modulated radiation therapy (IMRT) is used to radiate tumors that are in close proximity to vital organs. Targets consisting of a deep-seated region followed by a superficial one may be treated with abutting photon and electron fields. However, no systematic study regarding matching of IMRT and electron beams was reported. In this work, a study of dose distributions in the abutment region between tomographic and step-and-shoot IMRT and electron fields was carried out. A method that significantly improves dose homogeneity between abutting tomographic IMRT and electron fields was developed and tested. In this method, a target region that is covered by IMRT was extended into the superficial target area by ∼2.0 cm. The length and shape of IMRT target extension was chosen such that high isodose lines bent away from the region treated by the electrons. This reduced the magnitude of hot spots caused by the 'bulging effect' of electron field penumbra. To account for the uncertainties in positioning of the IMRT and electron fields, electron field penumbra was modified using conventional (photon) multileaf collimator (MLC). The electron beam was delivered in two steps: half of the dose delivered with MLCs in retracted position and another half with MLCs extended to the edge of electron field that abuts tomographic IMRT field. The experimental testing of this method using film dosimetry has demonstrated that the magnitude of the hot spots was reduced from ∼45% to ∼5% of the prescription dose. When an error of ±1.5 mm in field positioning was introduced, the dose inhomogeneity in the abutment region did not exceed ±15% of the prescription dose. With step-and-shoot IMRT, the most homogeneous dose distribution was achieved when there was a 3 mm gap between the IMRT and electron fields

  19. Term structure of 4d-electron configurations and calculated spectrum in Sn-isonuclear sequence

    International Nuclear Information System (INIS)

    Al-Rabban, Moza M.

    2006-01-01

    Theoretical calculations of term structure are carried out for the ground configurations 4d w , of atomic ions in the Sn isonuclear sequence. Atomic computations are performed to give a detailed account of the transitions in Sn +6 to Sn +13 ions. The spectrum is calculated for the most important excited configurations 4p 5 4d n+1 , 4d n-1 4f 1 , and 4d n-1 5p 1 with respect to the ground configuration 4d n , with n=8-1, respectively. The importance of 4p-4d, 4d-4f, and 4d-5p transitions is stressed, as well as the need for the configuration-interaction CI treatment of the Δn=0 transitions. In the region of importance for extreme ultraviolet (EUV) lithography around 13.4nm, the strongest lines were expected to be 4d n -4p 5 4d n+1 and 4d n -4d n-1 4f 1

  20. Electron density in the emission-line region of Wolf-Rayet stars

    International Nuclear Information System (INIS)

    Varshni, Y.P.

    1978-01-01

    The Inglis-Teller relation, generalized for a hydrogen-like or alkali-like ion with an arbitrary core charge, is used to estimate the electron density in the emission-like region of Wolf-Rayet stars. It is found that the electron density in the region which gives rise to He II emission lines is approximately = 4 x 10 14 cm -3 . (Auth.)

  1. Rapid sequence divergence rates in the 5 prime regulatory regions of young Drosophila melanogaster duplicate gene pairs

    Directory of Open Access Journals (Sweden)

    Michael H. Kohn

    2008-01-01

    Full Text Available While it remains a matter of some debate, rapid sequence evolution of the coding sequences of duplicate genes is characteristic for early phases past duplication, but long established duplicates generally evolve under constraint, much like the rest of the coding genome. As for coding sequences, it may be possible to infer evolutionary rate, selection, and constraint via contrasts between duplicate gene divergence in the 5 prime regions and in the corresponding synonymous site divergence in the coding regions. Finding elevated rates for the 5 prime regions of duplicated genes, in addition to the coding regions, would enable statements regarding the early processes of duplicate gene evolution. Here, 1 kb of each of the 5 prime regulatory regions of Drosophila melanogaster duplicate gene pairs were mapped onto one another to isolate shared sequence blocks. Genetic distances within shared sequence blocks (d5’ were found to increase as a function of synonymous (dS, and to a lesser extend, amino-acid (dA site divergence between duplicates. The rate d5’/dS was found to rapidly decay from values > 1 in young duplicate pairs (dS 0.8. Such rapid rates of 5 prime evolution exceeding 1 (~neutral predominantly were found to occur in duplicate pairs with low amino-acid site divergence and that tended to be co-regulated when assayed on microarrays. Conceivably, functional redundancy and relaxation of selective constraint facilitates subsequent positive selection on the 5 prime regions of young duplicate genes. This might promote the evolution of new functions (neofunctionalization or division of labor among duplicate genes (subfunctionalization. In contrast, similar to the vast portion of the non-coding genome, the 5 prime regions of long-established gene duplicates appear to evolve under selective constraint, indicating that these long-established gene duplicates have assumed critical functions.

  2. Pooled-DNA sequencing identifies genomic regions of selection in Nigerian isolates of Plasmodium falciparum.

    Science.gov (United States)

    Oyebola, Kolapo M; Idowu, Emmanuel T; Olukosi, Yetunde A; Awolola, Taiwo S; Amambua-Ngwa, Alfred

    2017-06-29

    The burden of falciparum malaria is especially high in sub-Saharan Africa. Differences in pressure from host immunity and antimalarial drugs lead to adaptive changes responsible for high level of genetic variations within and between the parasite populations. Population-specific genetic studies to survey for genes under positive or balancing selection resulting from drug pressure or host immunity will allow for refinement of interventions. We performed a pooled sequencing (pool-seq) of the genomes of 100 Plasmodium falciparum isolates from Nigeria. We explored allele-frequency based neutrality test (Tajima's D) and integrated haplotype score (iHS) to identify genes under selection. Fourteen shared iHS regions that had at least 2 SNPs with a score > 2.5 were identified. These regions code for genes that were likely to have been under strong directional selection. Two of these genes were the chloroquine resistance transporter (CRT) on chromosome 7 and the multidrug resistance 1 (MDR1) on chromosome 5. There was a weak signature of selection in the dihydrofolate reductase (DHFR) gene on chromosome 4 and MDR5 genes on chromosome 13, with only 2 and 3 SNPs respectively identified within the iHS window. We observed strong selection pressure attributable to continued chloroquine and sulfadoxine-pyrimethamine use despite their official proscription for the treatment of uncomplicated malaria. There was also a major selective sweep on chromosome 6 which had 32 SNPs within the shared iHS region. Tajima's D of circumsporozoite protein (CSP), erythrocyte-binding antigen (EBA-175), merozoite surface proteins - MSP3 and MSP7, merozoite surface protein duffy binding-like (MSPDBL2) and serine repeat antigen (SERA-5) were 1.38, 1.29, 0.73, 0.84 and 0.21, respectively. We have demonstrated the use of pool-seq to understand genomic patterns of selection and variability in P. falciparum from Nigeria, which bears the highest burden of infections. This investigation identified known

  3. Multifractal Detrended Fluctuation Analysis of Regional Precipitation Sequences Based on the CEEMDAN-WPT

    Science.gov (United States)

    Liu, Dong; Cheng, Chen; Fu, Qiang; Liu, Chunlei; Li, Mo; Faiz, Muhammad Abrar; Li, Tianxiao; Khan, Muhammad Imran; Cui, Song

    2018-03-01

    In this paper, the complete ensemble empirical mode decomposition with the adaptive noise (CEEMDAN) algorithm is introduced into the complexity research of precipitation systems to improve the traditional complexity measure method specific to the mode mixing of the Empirical Mode Decomposition (EMD) and incomplete decomposition of the ensemble empirical mode decomposition (EEMD). We combined the CEEMDAN with the wavelet packet transform (WPT) and multifractal detrended fluctuation analysis (MF-DFA) to create the CEEMDAN-WPT-MFDFA, and used it to measure the complexity of the monthly precipitation sequence of 12 sub-regions in Harbin, Heilongjiang Province, China. The results show that there are significant differences in the monthly precipitation complexity of each sub-region in Harbin. The complexity of the northwest area of Harbin is the lowest and its predictability is the best. The complexity and predictability of the middle and Midwest areas of Harbin are about average. The complexity of the southeast area of Harbin is higher than that of the northwest, middle, and Midwest areas of Harbin and its predictability is worse. The complexity of Shuangcheng is the highest and its predictability is the worst of all the studied sub-regions. We used terrain and human activity as factors to analyze the causes of the complexity of the local precipitation. The results showed that the correlations between the precipitation complexity and terrain are obvious, and the correlations between the precipitation complexity and human influence factors vary. The distribution of the precipitation complexity in this area may be generated by the superposition effect of human activities and natural factors such as terrain, general atmospheric circulation, land and sea location, and ocean currents. To evaluate the stability of the algorithm, the CEEMDAN-WPT-MFDFA was compared with the equal probability coarse graining LZC algorithm, fuzzy entropy, and wavelet entropy. The results show

  4. Comparison of variable region 3 sequences of human immunodeficiency virus type 1 from infected children with the RNA and DNA sequences of the virus populations of their mothers.

    Science.gov (United States)

    Scarlatti, G; Leitner, T; Halapi, E; Wahlberg, J; Marchisio, P; Clerici-Schoeller, M A; Wigzell, H; Fenyö, E M; Albert, J; Uhlén, M

    1993-01-01

    We have compared the variable region 3 sequences from 10 human immunodeficiency virus type 1 (HIV-1)-infected infants to virus sequences from the corresponding mothers. The sequences were derived from DNA of uncultured peripheral blood mononuclear cells (PBMC), DNA of cultured PBMC, and RNA from serum collected at or shortly after delivery. The infected infants, in contrast to the mothers, harbored homogeneous virus populations. Comparison of sequences from the children and clones derived from DNA of the corresponding mothers showed that the transmitted virus represented either a minor or a major virus population of the mother. In contrast to an earlier study, we found no evidence of selection of minor virus variants during transmission. Furthermore, the transmitted virus variant did not show any characteristic molecular features. In some cases the transmitted virus was more related to the virus RNA population of the mother and in other cases it was more related to the virus DNA population. This suggests that either cell-free or cell-associated virus may be transmitted. These data will help AIDS researchers to understand the mechanism of transmission and to plan strategies for prevention of transmission. PMID:8446584

  5. Electron Distribution Functions in the Diffusion Region of Asymmetric Magnetic Reconnection

    Science.gov (United States)

    Bessho, N.; Chen, L.-J.; Hesse, M.

    2016-01-01

    We study electron distribution functions in a diffusion region of antiparallel asymmetric reconnection by means of particle-in-cell simulations and analytical theory. At the electron stagnation point, the electron distribution comprises a crescent-shaped population and a core component. The crescent-shaped distribution is due to electrons coming from the magnetosheath toward the stagnation point and accelerated mainly by electric field normal to the current sheet. Only a part of magnetosheath electrons can reach the stagnation point and form the crescent-shaped distribution that has a boundary of a parabolic curve. The penetration length of magnetosheath electrons into the magnetosphere is derived. We expect that satellite observations can detect crescent-shaped electron distributions during magnetopause reconnection.

  6. Possible interaction between thermal electrons and vibrationally excited N2 in the lower E-region

    Directory of Open Access Journals (Sweden)

    K.-I. Oyama

    2011-03-01

    Full Text Available As one of the tasks to find the energy source(s of thermal electrons, which elevate(s electron temperature higher than neutral temperature in the lower ionosphere E-region, energy distribution function of thermal electron was measured with a sounding rocket at the heights of 93–131 km by the applying second harmonic method. The energy distribution function showed a clear hump at the energy of ~0.4 eV. In order to find the reason of the hump, we conducted laboratory experiment. We studied difference of the energy distribution functions of electrons in thermal energy range, which were measured with and without EUV radiation to plasma of N2/Ar and N2/O2 gas mixture respectively. For N2/Ar gas mixture plasma, the hump is not clearly identified in the energy distribution of thermal electrons. On the other hand for N2/O2 gas mixture, which contains vibrationally excited N2, a clear hump is found when irradiated by EUV. The laboratory experiment seems to suggest that the hump is produced as a result of interaction between vibrationally excited N2 and thermal electrons, and this interaction is the most probable heating source for the electrons of thermal energy range in the lower E-region. It is also suggested that energy distribution of the electrons in high energy part may not be Maxwellian, and DC probe measures the electrons which are non Maxwellian, and therefore "electron temperature" is calculated higher.

  7. Genetic characterization of UCS region of Pneumocystis jirovecii and construction of allelic profiles of Indian isolates based on sequence typing at three regions.

    Science.gov (United States)

    Gupta, Rashmi; Mirdha, Bijay Ranjan; Guleria, Randeep; Kumar, Lalit; Luthra, Kalpana; Agarwal, Sanjay Kumar; Sreenivas, Vishnubhatla

    2013-01-01

    Pneumocystis jirovecii is an opportunistic pathogen that causes severe pneumonia in immunocompromised patients. To study the genetic diversity of P. jirovecii in India the upstream conserved sequence (UCS) region of Pneumocystis genome was amplified, sequenced and genotyped from a set of respiratory specimens obtained from 50 patients with a positive result for nested mitochondrial large subunit ribosomal RNA (mtLSU rRNA) PCR during the years 2005-2008. Of these 50 cases, 45 showed a positive PCR for UCS region. Variations in the tandem repeats in UCS region were characterized by sequencing all the positive cases. Of the 45 cases, one case showed five repeats, 11 cases showed four repeats, 29 cases showed three repeats and four cases showed two repeats. By running amplified DNA from all these cases on a high-resolution gel, mixed infection was observed in 12 cases (26.7%, 12/45). Forty three of 45 cases included in this study had previously been typed at mtLSU rRNA and internal transcribed spacer (ITS) region by our group. In the present study, the genotypes at those two regions were combined with UCS repeat patterns to construct allelic profiles of 43 cases. A total of 36 allelic profiles were observed in 43 isolates indicating high genetic variability. A statistically significant association was observed between mtLSU rRNA genotype 1, ITS type Ea and UCS repeat pattern 4. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Implementing targeted region capture sequencing for the clinical detection of Alagille syndrome: An efficient and cost‑effective method.

    Science.gov (United States)

    Huang, Tianhong; Yang, Guilin; Dang, Xiao; Ao, Feijian; Li, Jiankang; He, Yizhou; Tang, Qiyuan; He, Qing

    2017-11-01

    Alagille syndrome (AGS) is a highly variable, autosomal dominant disease that affects multiple structures including the liver, heart, eyes, bones and face. Targeted region capture sequencing focuses on a panel of known pathogenic genes and provides a rapid, cost‑effective and accurate method for molecular diagnosis. In a Chinese family, this method was used on the proband and Sanger sequencing was applied to validate the candidate mutation. A de novo heterozygous mutation (c.3254_3255insT p.Leu1085PhefsX24) of the jagged 1 gene was identified as the potential disease‑causing gene mutation. In conclusion, the present study suggested that target region capture sequencing is an efficient, reliable and accurate approach for the clinical diagnosis of AGS. Furthermore, these results expand on the understanding of the pathogenesis of AGS.

  9. Genetic Diversity of Toxoplasma gondii Strains from Different Hosts and Geographical Regions by Sequence Analysis of GRA20 Gene.

    Science.gov (United States)

    Ning, Hong-Rui; Huang, Si-Yang; Wang, Jin-Lei; Xu, Qian-Ming; Zhu, Xing-Quan

    2015-06-01

    Toxoplasma gondii is a eukaryotic parasite of the phylum Apicomplexa, which infects all warm-blood animals, including humans. In the present study, we examined sequence variation in dense granule 20 (GRA20) genes among T. gondii isolates collected from different hosts and geographical regions worldwide. The complete GRA20 genes were amplified from 16 T. gondii isolates using PCR, sequence were analyzed, and phylogenetic reconstruction was analyzed by maximum parsimony (MP) and maximum likelihood (ML) methods. The results showed that the complete GRA20 gene sequence was 1,586 bp in length among all the isolates used in this study, and the sequence variations in nucleotides were 0-7.9% among all strains. However, removing the type III strains (CTG, VEG), the sequence variations became very low, only 0-0.7%. These results indicated that the GRA20 sequence in type III was more divergence. Phylogenetic analysis of GRA20 sequences using MP and ML methods can differentiate 2 major clonal lineage types (type I and type III) into their respective clusters, indicating the GRA20 gene may represent a novel genetic marker for intraspecific phylogenetic analyses of T. gondii.

  10. Identification and verification of hybridoma-derived monoclonal antibody variable region sequences using recombinant DNA technology and mass spectrometry

    Science.gov (United States)

    Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibo...

  11. UBV(RI)sub(c) photometry of some standard sequences in the Harvard F regions and in the Magellanic Clouds

    International Nuclear Information System (INIS)

    Menzies, J.W.; Laing, J.D.

    1988-01-01

    This paper presents the results of a photometric programme aimed at improving the UBV(RI)sub(c) standard sequences in the Harvard F regions and in the Small and Large Magellanic Clouds. Magnitudes and colours are given for 99 stars, and they are compared with the current values which were obtained or compiled by a previous author. (author)

  12. Pitch Angle Scattering of Upgoing Electron Beams in Jupiter's Polar Regions by Whistler Mode Waves

    Science.gov (United States)

    Elliott, S. S.; Gurnett, D. A.; Kurth, W. S.; Clark, G.; Mauk, B. H.; Bolton, S. J.; Connerney, J. E. P.; Levin, S. M.

    2018-02-01

    The Juno spacecraft's Jupiter Energetic-particle Detector Instrument has observed field-aligned, unidirectional (upgoing) electron beams throughout most of Jupiter's entire polar cap region. The Waves instrument detected intense broadband whistler mode emissions occurring in the same region. In this paper, we investigate the pitch angle scattering of the upgoing electron beams due to interactions with the whistler mode waves. Profiles of intensity versus pitch angle for electron beams ranging from 2.53 to 7.22 Jovian radii show inconsistencies with the expected adiabatic invariant motion of the electrons. It is believed that the observed whistler mode waves perturb the electron motion and scatter them away from the magnetic field line. The diffusion equation has been solved by using diffusion coefficients which depend on the magnetic intensity of the whistler mode waves.

  13. SEQATOMS: a web tool for identifying missing regions in PDB in sequence context

    NARCIS (Netherlands)

    Brandt, B.W.; Heringa, J.; Leunissen, J.A.M.

    2008-01-01

    With over 46 000 proteins, the Protein Data Bank (PDB) is the most important database with structural information of biological macromolecules. PDB files contain sequence and coordinate information. Residues present in the sequence can be absent from the coordinate section, which means their

  14. Sequences of the joining region genes for immunoglobulin heavy chains and their role in generation of antibody diversity.

    OpenAIRE

    Gough, N M; Bernard, O

    1981-01-01

    To assess the contribution to immunoglobulin heavy chain diversity made by recombination between variable region (VH) genes and joining region (JH) genes, we have determined the sequence of about 2000 nucleotides spanning the rearranged JH gene cluster associated with the VH gene expressed in plasmacytoma HPC76. The active VH76 gene has recombined with the second germ-line JH gene. The region we have studied contains two other JH genes, designated JH3 and JH4. No other JH gene was found withi...

  15. Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region

    Energy Technology Data Exchange (ETDEWEB)

    Miyamoto, M.M.; Slightom, J.L.; Goodman, M.

    1987-10-16

    Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee are more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.

  16. An electron cooling device in the one MeV energy region

    International Nuclear Information System (INIS)

    Busso, L.; Tecchio, L.; Tosello, F.

    1987-01-01

    The project of an electron cooling device at 700 KeV electron energy is reported. The single parts of the device is described in detail. Electron beam diagnostics and technical problems is discussed. The electron gun, the accelerating/decelerating column and the collector have been studied by menas of the Herrmannsfeldt's program and at present are under construction. The high voltage system and the electron cooling magnet are also under construction. Vacuum tests with both hot and cold cathodes have demonstrated that the vacuum requirements can be attained by the use of non-evaporable getter (NEG) pumps between gun, collector and the cooling region. Both kinds of diagnostic for longitudinal and transversal electron temperature measurements are in progress. A first prototype of the synchronous picj-up was successfully tested at CERN SPS. At present the diagnostic with laser beam is in preparation. During the next year the device will be assembled and the laboratory test will be started

  17. Sequence analysis of the breakpoint regions of an X;5 translocation in a female with Duchenne muscular dystrophy

    Energy Technology Data Exchange (ETDEWEB)

    Bakel, I. van; Holt, S.; Craig, I. [Univ. of Oxford (United Kingdom)] [and others

    1995-08-01

    X;autosome translocations in females with Duchenne muscular dystrophy (DMD) provide an opportunity to study the mechanisms responsible for chromosomal rearrangements that occur in the germ line. We describe here a detailed molecular analysis of the translocation breakpoints of an X;autosome reciprocal translocation, t(X;5) (p21;q31.1), in a female with DMD. Cosmid clones that contained the X-chromosome breakpoint region were identified, and subclones that hybridized to the translocation junction fragment in restriction digests of the patient`s DNA were isolated and sequenced. Primers designed from the X-chromosomal sequence were used to obtain the junction fragments on the der(X) and the der(5) by inverse PCR. The resultant clones were also cloned and sequenced, and this information used to isolate the chromosome 5 breakpoint region. Comparison of the DNA sequences of the junction fragments with those of the breakpoint regions on chromosomes X and 5 revealed that the translocation arose by nonhomologous recombination with an imprecise reciprocal exchange. Four and six base pairs of unknown origin are inserted at the exchange points of the der(X) and der(5), respectively, and three nucleotides are deleted from the X-chromosome sequence. Two features were found that may have played a role in the generation of the translocation. These were (1) a repeat motif with an internal homopyrimidine stretch 10 bp upstream from the X-chromosome breakpoint and (2) a 9-bp sequence of 78% homology located near the breakpoints on chromosomes 5 and X. 32 refs., 4 figs., 2 tabs.

  18. Identification and verification of hybridoma-derived monoclonal antibody variable region sequences using recombinant DNA technology and mass spectrometry.

    Science.gov (United States)

    Babrak, Lmar; McGarvey, Jeffery A; Stanker, Larry H; Hnasko, Robert

    2017-10-01

    Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibodies (rAb). This determination can be achieved by sequence analysis of immunoglobulin (Ig) transcripts obtained from a monoclonal antibody (MAb) producing hybridoma and subsequent expression of a rAb. However the polyploidy nature of a hybridoma cell often results in the added expression of aberrant immunoglobulin-like transcripts or even production of anomalous antibodies which can confound production of rAb. An incorrect VR sequence will result in a non-functional rAb and de novo assembly of Ig primary structure without a sequence map is challenging. To address these problems, we have developed a methodology which combines: 1) selective PCR amplification of VR from both the heavy and light chain IgG from hybridoma, 2) molecular cloning and DNA sequence analysis and 3) tandem mass spectrometry (MS/MS) on enzyme digests obtained from the purified IgG. Peptide analysis proceeds by evaluating coverage of the predicted primary protein sequence provided by the initial DNA maps for the VR. This methodology serves to both identify and verify the primary structure of the MAb VR for production as rAb. Published by Elsevier Ltd.

  19. [Sequence of the ITS region of nuclear ribosomal DNA(nrDNA) in Xinjiang wild Dianthus and its phylogenetic relationship].

    Science.gov (United States)

    Zhang, Lu; Cai, You-Ming; Zhuge, Qiang; Zou, Hui-Yu; Huang, Min-Ren

    2002-06-01

    Xinjiang is a center of distribution and differentiation of genus Dianthus in China, and has a great deal of species resources. The sequences of ITS region (including ITS-1, 5.8S rDNA and ITS-2) of nuclear ribosomal DNA from 8 species of genus Dianthus wildly distributed in Xinjiang were determined by direct sequencing of PCR products. The result showed that the size of the ITS of Dianthus is from 617 to 621 bp, and the length variation is only 4 bp. There are very high homogeneous (97.6%-99.8%) sequences between species, and about 80% homogeneous sequences between genus Dianthus and outgroup. The sequences of ITS in genus Dianthus are relatively conservative. In general, there are more conversion than transition in the variation sites among genus Dianthus. The conversion rates are relatively high, and the ratios of conversion/transition are 1.0-3.0. On the basis of phylogenetic analysis of nucleotide sequences the species of Dianthus in China would be divided into three sections. There is a distant relationship between sect. Barbulatum Williams and sect. Dianthus and between sect. Barbulatum Williams and sect. Fimbriatum Williams, and there is a close relationship between sect. Dianthus and sect. Fimbriatum Williams. From the phylogenetic tree of ITS it was found that the origin of sect. Dianthusis is earlier than that of sect. Fimbriatum Williams and sect. Barbulatum Williams.

  20. Tandemly repeated sequence in 5'end of mtDNA control region of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-12-17

    Dec 17, 2008 ... chain reaction (PCR). Japanese Spanish ... mainly covered general ecology and fishery biology. No study concerning the ... Conserved sequence blocks and the repeat units are indicated by boxes. performed using the exact ...

  1. New tool to assemble repetitive regions using next-generation sequencing data

    Science.gov (United States)

    Kuśmirek, Wiktor; Nowak, Robert M.; Neumann, Łukasz

    2017-08-01

    The next generation sequencing techniques produce a large amount of sequencing data. Some part of the genome are composed of repetitive DNA sequences, which are very problematic for the existing genome assemblers. We propose a modification of the algorithm for a DNA assembly, which uses the relative frequency of reads to properly reconstruct repetitive sequences. The new approach was implemented and tested, as a demonstration of the capability of our software we present some results for model organisms. The new implementation, using a three-layer software architecture was selected, where the presentation layer, data processing layer, and data storage layer were kept separate. Source code as well as demo application with web interface and the additional data are available at project web-page: http://dnaasm.sourceforge.net.

  2. Unique Trichomonas vaginalis gene sequences identified in multinational regions of Northwest China.

    Science.gov (United States)

    Liu, Jun; Feng, Meng; Wang, Xiaolan; Fu, Yongfeng; Ma, Cailing; Cheng, Xunjia

    2017-07-24

    Trichomonas vaginalis (T. vaginalis) is a flagellated protozoan parasite that infects humans worldwide. This study determined the sequence of the 18S ribosomal RNA gene of T. vaginalis infecting both females and males in Xinjiang, China. Samples from 73 females and 28 males were collected and confirmed for infection with T. vaginalis, a total of 110 sequences were identified when the T. vaginalis 18S ribosomal RNA gene was sequenced. These sequences were used to prepare a phylogenetic network. The rooted network comprised three large clades and several independent branches. Most of the Xinjiang sequences were in one group. Preliminary results suggest that Xinjiang T. vaginalis isolates might be genetically unique, as indicated by the sequence of their 18S ribosomal RNA gene. Low migration rate of local people in this province may contribute to a genetic conservativeness of T. vaginalis. The unique genetic feature of our isolates may suggest a different clinical presentation of trichomoniasis, including metronidazole susceptibility, T. vaginalis virus or Mycoplasma co-infection characteristics. The transmission and evolution of Xinjiang T. vaginalis is of interest and should be studied further. More attention should be given to T. vaginalis infection in both females and males in Xinjiang.

  3. Sequence variation of koala retrovirus transmembrane protein p15E among koalas from different geographic regions

    Science.gov (United States)

    Ishida, Yasuko; McCallister, Chelsea; Nikolaidis, Nikolas; Tsangaras, Kyriakos; Helgen, Kristofer M.; Greenwood, Alex D.; Roca, Alfred L.

    2014-01-01

    The koala retrovirus (KoRV), which is transitioning from an exogenous to an endogenous form, has been associated with high mortality in koalas. For other retroviruses, the envelope protein p15E has been considered a candidate for vaccine development. We therefore examined proviral sequence variation of KoRV p15E in a captive Queensland and three wild southern Australian koalas. We generated 163 sequences with intact open reading frames, which grouped into 39 distinct haplotypes. Sixteen distinct haplotypes comprising 139 of the sequences (85%) coded for the same polypeptide. Among the remaining 23 haplotypes, 22 were detected only once among the sequences, and each had 1 or 2 non-synonymous differences from the majority sequence. Several analyses suggested that p15E was under purifying selection. Important epitopes and domains were highly conserved across the p15E sequences and in previously reported exogenous KoRVs. Overall, these results support the potential use of p15E for KoRV vaccine development. PMID:25462343

  4. Empirical Fit to Inelastic Electron-Deuteron and Electron-Neutron Resonance Region Transverse Cross Sections

    International Nuclear Information System (INIS)

    Peter Bosted; M. E. Christy

    2007-01-01

    An empirical fit is described to measurements of inclusive inelastic electron-deuteron cross sections in the kinematic range of four-momentum transfer 0 (le) Q 2 2 and final state invariant mass 1.2 p of longitudinal to transverse cross sections for the proton, and the assumption R p =R n . The underlying fit parameters describe the average cross section for proton and neutron, with a plane-wave impulse approximation (PWIA) used to fit to the deuteron data. Pseudo-data from MAID 2007 were used to constrain the average nucleon cross sections for W<1.2 GeV. The mean deviation of data from the fit is 3%, with less than 5% of the data points deviating from the fit by more than 10%

  5. Empirical fit to inelastic electron-deuteron and electron-neutron resonance region transverse cross sections

    International Nuclear Information System (INIS)

    Bosted, P. E.; Christy, M. E.

    2008-01-01

    An empirical fit is described to measurements of inclusive inelastic electron-deuteron cross sections in the kinematic range of four-momentum transfer 0≤Q 2 2 and final state invariant mass 1.1 p of longitudinal to transverse cross sections for the proton, and the assumption R p =R n . The underlying fit parameters describe the average cross section for a free proton and a free neutron, with a plane-wave impulse approximation used to fit to the deuteron data. Additional fit parameters are used to fill in the dip between the quasi-elastic peak and the Δ(1232) resonance. The mean deviation of data from the fit is 3%, with less than 4% of the data points deviating from the fit by more than 10%

  6. Experimental study of the Hall effect and electron diffusion region during magnetic reconnection in a laboratory plasma

    International Nuclear Information System (INIS)

    Ren Yang; Yamada, Masaaki; Ji Hantao; Dorfman, Seth; Gerhardt, Stefan P.; Kulsrud, Russel

    2008-01-01

    The Hall effect during magnetic reconnection without an external guide field has been extensively studied in the laboratory plasma of the Magnetic Reconnection Experiment [M. Yamada et al., Phys. Plasmas 4, 1936 (1997)] by measuring its key signature, an out-of-plane quadrupole magnetic field, with magnetic probe arrays whose spatial resolution is on the order of the electron skin depth. The in-plane electron flow is deduced from out-of-plane magnetic field measurements. The measured in-plane electron flow and numerical results are in good agreement. The electron diffusion region is identified by measuring the electron outflow channel. The width of the electron diffusion region scales with the electron skin depth (∼5.5-7.5c/ω pe ) and the peak electron outflow velocity scales with the electron Alfven velocity (∼0.12-0.16V eA ), independent of ion mass. The measured width of the electron diffusion region is much wider and the observed electron outflow is much slower than those obtained in 2D numerical simulations. It is found that the classical and anomalous dissipation present in the experiment can broaden the electron diffusion region and slow the electron outflow. As a consequence, the electron outflow flux remains consistent with numerical simulations. The ions, as measured by a Mach probe, have a much wider outflow channel than the electrons, and their outflow is much slower than the electron outflow everywhere in the electron diffusion region

  7. On the Electron Diffusion Region in Asymmetric Reconnection with a Guide Magnetic Field

    Science.gov (United States)

    Hesse, Michael; Liu, Yi-Hsin; Chen, Li-Jen; Bessho, Naoki; Kuznetsova, Masha; Birn, Joachim; Burch, James L.

    2016-01-01

    Particle-in-cell simulations in a 2.5-D geometry and analytical theory are employed to study the electron diffusion region in asymmetric reconnection with a guide magnetic field. The analysis presented here demonstrates that similar to the case without guide field, in-plane flow stagnation and null of the in-plane magnetic field are well separated. In addition, it is shown that the electric field at the local magnetic X point is again dominated by inertial effects, whereas it remains dominated by nongyrotropic pressure effects at the in-plane flow stagnation point. A comparison between local electron Larmor radii and the magnetic gradient scale lengths predicts that distribution should become nongyrotropic in a region enveloping both field reversal and flow stagnation points. This prediction is verified by an analysis of modeled electron distributions, which show clear evidence of mixing in the critical region.

  8. Mechanisms of the electron density depletion in the SAR arc region

    OpenAIRE

    A. V. Pavlov

    1996-01-01

    This study compares the measurements of electron density and temperature and the integral airglow intensity at 630 nm in the SAR arc region and slightly south of this (obtained by the Isis 2 spacecraft during the 18 December 1971 magnetic storm), with the model results obtained using the time dependent one-dimensional mathematical model of the Earth's ionosphere and plasmasphere. The explicit expression in the third Enskog approximation for the electron thermal conductivity coefficient i...

  9. Identification of new polymorphic regions and differentiation of cultivated olives (Olea europaea L.) through plastome sequence comparison

    Science.gov (United States)

    2010-01-01

    Background The cultivated olive (Olea europaea L.) is the most agriculturally important species of the Oleaceae family. Although many studies have been performed on plastid polymorphisms to evaluate taxonomy, phylogeny and phylogeography of Olea subspecies, only few polymorphic regions discriminating among the agronomically and economically important olive cultivars have been identified. The objective of this study was to sequence the entire plastome of olive and analyze many potential polymorphic regions to develop new inter-cultivar genetic markers. Results The complete plastid genome of the olive cultivar Frantoio was determined by direct sequence analysis using universal and novel PCR primers designed to amplify all overlapping regions. The chloroplast genome of the olive has an organisation and gene order that is conserved among numerous Angiosperm species and do not contain any of the inversions, gene duplications, insertions, inverted repeat expansions and gene/intron losses that have been found in the chloroplast genomes of the genera Jasminum and Menodora, from the same family as Olea. The annotated sequence was used to evaluate the content of coding genes, the extent, and distribution of repeated and long dispersed sequences and the nucleotide composition pattern. These analyses provided essential information for structural, functional and comparative genomic studies in olive plastids. Furthermore, the alignment of the olive plastome sequence to those of other varieties and species identified 30 new organellar polymorphisms within the cultivated olive. Conclusions In addition to identifying mutations that may play a functional role in modifying the metabolism and adaptation of olive cultivars, the new chloroplast markers represent a valuable tool to assess the level of olive intercultivar plastome variation for use in population genetic analysis, phylogenesis, cultivar characterisation and DNA food tracking. PMID:20868482

  10. Electron Energization and Structure of the Diffusion Region During Asymmetric Reconnection

    Science.gov (United States)

    Chen, Li-Jen; Hesse, Michael; Wang, Shan; Bessho, Naoki; Daughton, William

    2016-01-01

    Results from particle-in-cell simulations of reconnection with asymmetric upstream conditions are reported to elucidate electron energization and structure of the electron diffusion region (EDR). Acceleration of unmagnetized electrons results in discrete structures in the distribution functions and supports the intense current and perpendicular heating in the EDR. The accelerated electrons are cyclotron turned by the reconnected magnetic field to produce the outflow jets, and as such, the acceleration by the reconnection electric field is limited, leading to resistivity without particle-particle or particle-wave collisions. A map of electron distributions is constructed, and its spatial evolution is compared with quantities previously proposed to be EDR identifiers to enable effective identifications of the EDR in terrestrial magnetopause reconnection.

  11. Utilization of a cloned alphoid repeating sequence of human DNA in the study of polymorphism of chromosomal heterochromatin regions

    International Nuclear Information System (INIS)

    Kruminya, A.R.; Kroshkina, V.G.; Yurov, Yu.B.; Aleksandrov, I.A.; Mitkevich, S.P.; Gindilis, V.M.

    1988-01-01

    The chromosomal distribution of the cloned PHS05 fragment of human alphoid DNA was studied by in situ hybridization in 38 individuals. It was shown that this DNA fraction is primarily localized in the pericentric regions of practically all chromosomes of the set. Significant interchromosomal differences and a weakly expressed interindividual polymorphism were discovered in the copying ability of this class of repeating DNA sequences; associations were not found between the results of hybridization and the pattern of Q-polymorphism

  12. Sequence analysis of the its-2 region: a tool to identify strains of Scenedesmus (Chlorophyceae)

    NARCIS (Netherlands)

    Van Hannen, E.J.; Lürling, M.; Van Donk, E.

    2000-01-01

    The genetic distances between several strains of Senedesmus obliquus (Turp,) Kutz,, S, acutus Hortobagyi, and S, naegelii Chod. calculated from ITS-2 sequences were found to be smaller than the genetic distances within other strains of Scenedesmus-that is, in S, acuminatus (Lagerh,) Chod, and S,

  13. Sequencing the CHO DXB11 genome reveals regional variations in genomic stability and haploidy

    DEFF Research Database (Denmark)

    Kaas, Christian Schrøder; Kristensen, Claus; Betenbaugh, Michael J.

    2015-01-01

    Background: The DHFR negative CHO DXB11 cell line (also known as DUX-B11 and DUKX) was historically the first CHO cell line to be used for large scale production of heterologous proteins and is still used for production of a number of complex proteins.  Results: Here we present the genomic sequence...... of the CHO DXB11 genome sequenced to a depth of 33x. Overall a significant genomic drift was seen favoring GC -> AT point mutations in line with the chemical mutagenesis strategy used for generation of the cell line. The sequencing depth for each gene in the genome revealed distinct peaks at sequencing...... in eight additional analyzed CHO genomes (15-20% haploidy) but not in the genome of the Chinese hamster. The dhfr gene is confirmed to be haploid in CHO DXB11; transcriptionally active and the remaining allele contains a G410C point mutation causing a Thr137Arg missense mutation. We find similar to 2...

  14. An atlas of over 90.000 conserved noncoding sequences provides insight into crucifer regulatory regions

    NARCIS (Netherlands)

    Haudry, A.; Platts, A.E.; Vello, E.; Hoen, D.R.; Leclerq, M.; Williamson, R.J.; Forczek, E.; Joly-Lopez, Z.; Steffen, J.G.; Hazzouri, K.M.; Dewar, K.; Stinchcombe, J.R.; Schoen, D.J.; Wang, X.; Schmutz, J.; Town, C.D.; Edger, P.P.; Pires, J.C.; Schumaker, K.S.; Jarvis, D.E.; Mandakova, T.; Lysak, M.; Bergh, van den E.; Schranz, M.E.; Harrison, P.M.

    2013-01-01

    Despite the central importance of noncoding DNA to gene regulation and evolution, understanding of the extent of selection on plant noncoding DNA remains limited compared to that of other organisms. Here we report sequencing of genomes from three Brassicaceae species (Leavenworthia alabamica,

  15. Upstream region, foreshock and bow shock wave at Halley's Comet from plasma electron measurements

    International Nuclear Information System (INIS)

    Anderson, K.A.; Carlson, C.W.; Curtis, D.W.

    1986-01-01

    Halley plasma electron parameters from 2.7 million km from the comet nucleus to the bow shock wave at 1.1 million km and beyond are surveyed. The features of the electron foreshock lying outside the shock to a distance of 230,000 km are described. It is a region of intense solar wind-comet plasma interaction in which energetic electrons are prominent. Several spikes of electrons whose energies extend to 2.5 keV appear in front of the shock. These energetic electrons may be accelerated in the same way electrons are accelerated at the Earth's bow shock to energies of 1 to 10 keV. The direction of the electron bulk flow direction changes abruptly between 1920 and 1922 UT, and the flow speed begins a sharp decline at the same time. It is suggested that the spacecraft entered the bow shock wave between 1920 and 1922 UT. Electron density variations at Halley are very much smaller than those at Giacobini-Zinner

  16. A Statistical Study of Eiscat Electron and Ion Temperature Measurements In The E-region

    Science.gov (United States)

    Hussey, G.; Haldoupis, C.; Schlegel, K.; Bösinger, T.

    Motivated by the large EISCAT data base, which covers over 15 years of common programme operation, and previous statistical work with EISCAT data (e.g., C. Hal- doupis, K. Schlegel, and G. Hussey, Auroral E-region electron density gradients mea- sured with EISCAT, Ann. Geopshysicae, 18, 1172-1181, 2000), a detailed statistical analysis of electron and ion EISCAT temperature measurements has been undertaken. This study was specifically concerned with the statistical dependence of heating events with other ambient parameters such as the electric field and electron density. The re- sults showed previously reported dependences such as the electron temperature being directly correlated with the ambient electric field and inversely related to the electron density. However, these correlations were found to be also dependent upon altitude. There was also evidence of the so called "Schlegel effect" (K. Schlegel, Reduced effective recombination coefficient in the disturbed polar E-region, J. Atmos. Terr. Phys., 44, 183-185, 1982); that is, the heated electron gas leads to increases in elec- tron density through a reduction in the recombination rate. This paper will present the statistical heating results and attempt to offer physical explanations and interpretations of the findings.

  17. Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

    International Nuclear Information System (INIS)

    Steenbergh, P.H.

    1979-01-01

    The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

  18. Vertical and longitudinal electron density structures of equatorial E- and F-regions

    Directory of Open Access Journals (Sweden)

    P. S. Brahmanandam

    2011-01-01

    Full Text Available From global soundings of ionospheric electron density made with FORMOSAT 3/COSMIC satellites for September 2006–August 2009, day-night variations in vertical and longitudinal structures of the electron densities in equatorial E- and F-regions for different seasons are investigated for the first time. The results reveal that the wavenumber-3 and wavenumber-4 patterns dominated the nighttime (22:00–04:00 LT F-region longitudinal structures in solstice and in equinox seasons, respectively. In daytime (08:00–18:00 LT F-region, the wavenumber-4 patterns governed the longitudinal structures in the September equinox and December solstice, and wavenumber-3 in March equinox and June solstice respectively. A comparison of the daytime and nighttime longitudinal electron density structures indicates that they are approximately 180° out of phase with each other. It is believed that this out of phase relation is very likely the result of the opposite phase relation between daytime and nighttime nonmigrating diurnal tidal winds that modulate background E-region dynamo electric field at different places, leading to the day-night change in the locations of the equatorial plasma fountains that are responsible for the formation of the F-region longitudinal structures. Further, a good consistency between the locations of the density structures in the same seasons of the different years for both daytime and nighttime epochs has been noticed indicating that the source mechanism for these structures could be the same.

  19. Modelling of the electron density height profiles in the mid-latitude ionospheric D-region

    Directory of Open Access Journals (Sweden)

    P. Y. Mukhtarov

    1996-06-01

    Full Text Available A new mid-latitude D-region (50-105 km model of the electron density is presented obtained on the basis of a full wave theory and by a trial-and-error inversion method. Daytime (at different solar zenith angles absorption measurements by A3-technique made in Bulgaria yielded data with the aid of which the seasonal and diurnal courses of the Ne(h-profiles were derived. Special attention is drawn to the event diurnal asymmetry, or uneven formation of the ionosphere as a function of insulation. The latter is probably connected with the influence of the diurnal fluctuations in the local temperature on the chemistry involved in the electron loss rate, as well as the diurnal variations of the main ionizing agent (NO in the D-region. That is why the Ne(h-profiles in the midlatitude D-region are modelled separately for morning and afternoon hours.

  20. Where should MMS look for the electron and ion diffusion regions?

    Science.gov (United States)

    Lapenta, G.; Goldman, M. V.; Newman, D. L.; Olshevsky, V.

    2015-12-01

    Our message is that if we think of reconnection with the usual cartoon, the MMS mission should follow the advice of Indiana Jones: X never marks the spot. Based on 3D fully kinetic simulations started with a well defined x-line, we observe that reconnection transitions towards a more chaotic regime. Two fronts develop downstream of the x-line where the outflow meets the pre-existing plasma. In the fronts an instability develops caused by the local gradients of the density. The consequence is the break up of the fronts in a fashion similar to the classical fluid Rayleigh-Taylor instability with the formation of "fingers" of plasma and embedded magnetic fields. These fingers interact and produce secondary reconnection sites. We present several different diagnostics that prove the existence of these secondary reconnection sites. Each site is surrounded by its own electron diffusion region.At the fronts the ions are generally not magnetized and considerable ion slippage is present. The discovery we present is that electrons are also slipping, forming localized diffusion regions near secondary reconnection sites [1].The consequence of this discovery is twofold. First, the instability in the fronts has strong energetic implications. We observe that the energy transfer locally is very strong, an order of magnitude stronger than in the "X" line. However, this energy transfer is of both signs as it is natural for a wavy rippling with regions of magnetic to kinetic and regions of kinetic to magnetic energy conversion.Second, and most important for this session, is that MMS should not limit the search for electron diffusion regions to the location marked with X in all reconnection cartoons. Our simulations predict more numerous and perhaps more easily measurable electron diffusion regions in the fronts. [1] Lapenta, G et al., Nature Physics 11, 690-695 (2015)

  1. Mechanisms of the electron density depletion in the SAR arc region

    Directory of Open Access Journals (Sweden)

    A. V. Pavlov

    1996-02-01

    Full Text Available This study compares the measurements of electron density and temperature and the integral airglow intensity at 630 nm in the SAR arc region and slightly south of this (obtained by the Isis 2 spacecraft during the 18 December 1971 magnetic storm, with the model results obtained using the time dependent one-dimensional mathematical model of the Earth\\'s ionosphere and plasmasphere. The explicit expression in the third Enskog approximation for the electron thermal conductivity coefficient in the multicomponent mixture of ionized gases and a simplified calculation method for this coefficient presents an opportunity to calculate more exactly the electron temperature and density and 630 nm emission within SAR arc region are used in the model. Collisions between N2 and hot thermal electrons in the SAR arc region produce vibrationally excited nitrogen molecules. It appears that the loss rate of O+(4S due to reactions with the vibrationally excited nitrogen is enough to explain electron density depression by a factor of two at F-region heights and the topside ionosphere density variations within the SAR arc if the erosion of plasma within geomagnetic field tubes, during the main phase of the geomagnetic storm and subsequent filling of geomagnetic tubes during the recovery phase, are considered. To explain the disagreement by a factor 1.5 between the observed and modeled SAR arc electron densities an additional plasma drift velocity ~–30 m s–1 in the ion continuity equations is needed during the recovery phase. This additional plasma drift velocity is likely caused by the transition from convecting to corotating flux tubes on the equatorward wall of the trough. The electron densities and temperatures and 630 nm integral intensity at the SAR arc and slightly south of this region as measured for the 18 December 1971 magnetic storm were correctly described by the model without perpendicular electric fields. Within this model framework the effect of the

  2. Mechanisms of the electron density depletion in the SAR arc region

    Directory of Open Access Journals (Sweden)

    A. V. Pavlov

    Full Text Available This study compares the measurements of electron density and temperature and the integral airglow intensity at 630 nm in the SAR arc region and slightly south of this (obtained by the Isis 2 spacecraft during the 18 December 1971 magnetic storm, with the model results obtained using the time dependent one-dimensional mathematical model of the Earth's ionosphere and plasmasphere. The explicit expression in the third Enskog approximation for the electron thermal conductivity coefficient in the multicomponent mixture of ionized gases and a simplified calculation method for this coefficient presents an opportunity to calculate more exactly the electron temperature and density and 630 nm emission within SAR arc region are used in the model. Collisions between N2 and hot thermal electrons in the SAR arc region produce vibrationally excited nitrogen molecules. It appears that the loss rate of O+(4S due to reactions with the vibrationally excited nitrogen is enough to explain electron density depression by a factor of two at F-region heights and the topside ionosphere density variations within the SAR arc if the erosion of plasma within geomagnetic field tubes, during the main phase of the geomagnetic storm and subsequent filling of geomagnetic tubes during the recovery phase, are considered. To explain the disagreement by a factor 1.5 between the observed and modeled SAR arc electron densities an additional plasma drift velocity ~–30 m s–1 in the ion continuity equations is needed during the recovery phase. This additional plasma drift velocity is likely caused by the transition from convecting to corotating flux tubes on the equatorward wall of the trough. The electron densities and temperatures and 630 nm integral intensity at the SAR arc and slightly south of this region as measured for the 18 December 1971 magnetic storm were correctly described by the model without perpendicular electric fields

  3. Hot electron formation in thermal barrier region of tandem mirror GAMMA 10

    International Nuclear Information System (INIS)

    Katanuma, I.; Kiwamoto, Y.; Sawada, K.; Miyoshi, S.

    1987-01-01

    We have studied the hot electron build-up by the second harmonic electron cyclotron resonance heating in the thermal barrier region of tandem mirror GAMMA 10 by using a Fokker-Planck code with self-consistent potential profile taken into account. We have found two phases in the evolution of hot electron population and the potential profile. In the first phase where the RF diffusion is dominant quick increase of the hot electron density and that of the mean energy are observed. No further increase in the mean energy is observed thereafter. The potential is the deepest during the first phase. The second phase starts in the mean-free-time of the pitch angle scattering of hot electrons on cold electrons and ions. In this phase the hot electron population increases in the rate of the pitch angle scattering. The potential dip shallows due to the accumulation of pitch angle scattered passing ions. This observation indicates the necessity of the ion pumping for maintaining the negative potential at the thermal barrier. (author)

  4. Molecular Identification of Isolated Fungi from Unopened Containers of Greek Yogurt by DNA Sequencing of Internal Transcribed Spacer Region

    Directory of Open Access Journals (Sweden)

    Irshad M. Sulaiman

    2014-06-01

    Full Text Available In our previous study, we described the development of an internal transcribed spacer (ITS1 sequencing method, and used this protocol in species-identification of isolated fungi collected from the manufacturing areas of a compounding company known to have caused the multistate fungal meningitis outbreak in the United States. In this follow-up study, we have analyzed the unopened vials of Greek yogurt from the recalled batch to determine the possible cause of microbial contamination in the product. A total of 15 unopened vials of Greek yogurt belonging to the recalled batch were examined for the detection of fungi in these samples known to cause foodborne illness following conventional microbiological protocols. Fungi were isolated from all of the 15 Greek yogurt samples analyzed. The isolated fungi were genetically typed by DNA sequencing of PCR-amplified ITS1 region of rRNA gene. Analysis of data confirmed all of the isolated fungal isolates from the Greek yogurt to be Rhizomucor variabilis. The generated ITS1 sequences matched 100% with the published sequences available in GenBank. In addition, these yogurt samples were also tested for the presence of five types of bacteria (Salmonella, Listeria, Staphylococcus, Bacillus and Escherichia coli causing foodborne disease in humans, and found negative for all of them.

  5. Draft genome sequence of bitter gourd (Momordica charantia), a vegetable and medicinal plant in tropical and subtropical regions.

    Science.gov (United States)

    Urasaki, Naoya; Takagi, Hiroki; Natsume, Satoshi; Uemura, Aiko; Taniai, Naoki; Miyagi, Norimichi; Fukushima, Mai; Suzuki, Shouta; Tarora, Kazuhiko; Tamaki, Moritoshi; Sakamoto, Moriaki; Terauchi, Ryohei; Matsumura, Hideo

    2017-02-01

    Bitter gourd (Momordica charantia) is an important vegetable and medicinal plant in tropical and subtropical regions globally. In this study, the draft genome sequence of a monoecious bitter gourd inbred line, OHB3-1, was analyzed. Through Illumina sequencing and de novo assembly, scaffolds of 285.5 Mb in length were generated, corresponding to ∼84% of the estimated genome size of bitter gourd (339 Mb). In this draft genome sequence, 45,859 protein-coding gene loci were identified, and transposable elements accounted for 15.3% of the whole genome. According to synteny mapping and phylogenetic analysis of conserved genes, bitter gourd was more related to watermelon (Citrullus lanatus) than to cucumber (Cucumis sativus) or melon (C. melo). Using RAD-seq analysis, 1507 marker loci were genotyped in an F2 progeny of two bitter gourd lines, resulting in an improved linkage map, comprising 11 linkage groups. By anchoring RAD tag markers, 255 scaffolds were assigned to the linkage map. Comparative analysis of genome sequences and predicted genes determined that putative trypsin-inhibitor and ribosome-inactivating genes were distinctive in the bitter gourd genome. These genes could characterize the bitter gourd as a medicinal plant. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  6. Comparative In silico Study of Sex-Determining Region Y (SRY) Protein Sequences Involved in Sex-Determining.

    Science.gov (United States)

    Vakili Azghandi, Masoume; Nasiri, Mohammadreza; Shamsa, Ali; Jalali, Mohsen; Shariati, Mohammad Mahdi

    2016-04-01

    The SRY gene (SRY) provides instructions for making a transcription factor called the sex-determining region Y protein. The sex-determining region Y protein causes a fetus to develop as a male. In this study, SRY of 15 spices included of human, chimpanzee, dog, pig, rat, cattle, buffalo, goat, sheep, horse, zebra, frog, urial, dolphin and killer whale were used for determine of bioinformatic differences. Nucleotide sequences of SRY were retrieved from the NCBI databank. Bioinformatic analysis of SRY is done by CLC Main Workbench version 5.5 and ClustalW (http:/www.ebi.ac.uk/clustalw/) and MEGA6 softwares. The multiple sequence alignment results indicated that SRY protein sequences from Orcinus orca (killer whale) and Tursiopsaduncus (dolphin) have least genetic distance of 0.33 in these 15 species and are 99.67% identical at the amino acid level. Homosapiens and Pantroglodytes (chimpanzee) have the next lowest genetic distance of 1.35 and are 98.65% identical at the amino acid level. These findings indicate that the SRY proteins are conserved in the 15 species, and their evolutionary relationships are similar.

  7. Comparative In silico Study of Sex-Determining Region Y (SRY Protein Sequences Involved in Sex-Determining

    Directory of Open Access Journals (Sweden)

    Masoume Vakili Azghandi

    2016-05-01

    Full Text Available Background: The SRY gene (SRY provides instructions for making a transcription factor called the sex-determining region Y protein. The sex-determining region Y protein causes a fetus to develop as a male. In this study, SRY of 15 spices included of human, chimpanzee, dog, pig, rat, cattle, buffalo, goat, sheep, horse, zebra, frog, urial, dolphin and killer whale were used for determine of bioinformatic differences. Methods: Nucleotide sequences of SRY were retrieved from the NCBI databank. Bioinformatic analysis of SRY is done by CLC Main Workbench version 5.5 and ClustalW (http:/www.ebi.ac.uk/clustalw/ and MEGA6 softwares. Results: The multiple sequence alignment results indicated that SRY protein sequences from Orcinus orca (killer whale and Tursiopsaduncus (dolphin have least genetic distance of 0.33 in these 15 species and are 99.67% identical at the amino acid level. Homosapiens and Pantroglodytes (chimpanzee have the next lowest genetic distance of 1.35 and are 98.65% identical at the amino acid level. Conclusion: These findings indicate that the SRY proteins are conserved in the 15 species, and their evolutionary relationships are similar.

  8. Sequence Analysis of How Disability Influenced Life Trajectories in a Past Population from the Nineteenth-Century Sundsvall Region, Sweden

    Directory of Open Access Journals (Sweden)

    Lotta Vikström

    2017-05-01

    Full Text Available Historically, little is known about whether and to what extent disabled people found work and formed families. To fill this gap, this study analyses the life course trajectories of both disabled and non-disabled individuals, between the ages of 15 and 33, from the Sundsvall region in Sweden during the nineteenth century. Having access to micro-data that report disabilities in a population of 8,874 individuals from the parish registers digitised by the Demographic Data Base, Umeå University, we employ sequence analysis on a series of events that are expected to occur in life of young adults: getting a job, marrying and becoming a parent, while also taking into account out-migration and death. Through this method we obtain a holistic picture of the life course of disabled people. Main findings show that their trajectories did not include work or family to the same extent as those of non-disabled people. Secondary findings concerning migration and mortality indicate that the disabled rarely out-migrated from the region, and they suffered from premature deaths. To our knowledge this is the first study to employ sequence analysis on a substantially large number of cases to provide demographic evidence of how disability shaped human trajectories in the past during an extended period of life. Accordingly, we detail our motivation for this method, describe our analytical approach, and discuss the advantages and disadvantages associated with sequence analysis for our case study.

  9. Characterization of the genomic organization of the region bordering the centromere of chromosome V of Podospora anserina by direct sequencing.

    Science.gov (United States)

    Silar, Philippe; Barreau, Christian; Debuchy, Robert; Kicka, Sébastien; Turcq, Béatrice; Sainsard-Chanet, Annie; Sellem, Carole H; Billault, Alain; Cattolico, Laurence; Duprat, Simone; Weissenbach, Jean

    2003-08-01

    A Podospora anserina BAC library of 4800 clones has been constructed in the vector pBHYG allowing direct selection in fungi. Screening of the BAC collection for centromeric sequences of chromosome V allowed the recovery of clones localized on either sides of the centromere, but no BAC clone was found to contain the centromere. Seven BAC clones containing 322,195 and 156,244bp from either sides of the centromeric region were sequenced and annotated. One 5S rRNA gene, 5 tRNA genes, and 163 putative coding sequences (CDS) were identified. Among these, only six CDS seem specific to P. anserina. The gene density in the centromeric region is approximately one gene every 2.8kb. Extrapolation of this gene density to the whole genome of P. anserina suggests that the genome contains about 11,000 genes. Synteny analyses between P. anserina and Neurospora crassa show that co-linearity extends at the most to a few genes, suggesting rapid genome rearrangements between these two species.

  10. Sequence analysis of the internal transcribed spacer (ITS) region reveals a novel clade of Ichthyophonus sp. from rainbow trout.

    Science.gov (United States)

    Rasmussen, C; Purcell, M K; Gregg, J L; LaPatra, S E; Winton, J R; Hershberger, P K

    2010-03-09

    The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of approximately 740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).

  11. Identification of similar regions of protein structures using integrated sequence and structure analysis tools

    Directory of Open Access Journals (Sweden)

    Heiland Randy

    2006-03-01

    Full Text Available Abstract Background Understanding protein function from its structure is a challenging problem. Sequence based approaches for finding homology have broad use for annotation of both structure and function. 3D structural information of protein domains and their interactions provide a complementary view to structure function relationships to sequence information. We have developed a web site http://www.sblest.org/ and an API of web services that enables users to submit protein structures and identify statistically significant neighbors and the underlying structural environments that make that match using a suite of sequence and structure analysis tools. To do this, we have integrated S-BLEST, PSI-BLAST and HMMer based superfamily predictions to give a unique integrated view to prediction of SCOP superfamilies, EC number, and GO term, as well as identification of the protein structural environments that are associated with that prediction. Additionally, we have extended UCSF Chimera and PyMOL to support our web services, so that users can characterize their own proteins of interest. Results Users are able to submit their own queries or use a structure already in the PDB. Currently the databases that a user can query include the popular structural datasets ASTRAL 40 v1.69, ASTRAL 95 v1.69, CLUSTER50, CLUSTER70 and CLUSTER90 and PDBSELECT25. The results can be downloaded directly from the site and include function prediction, analysis of the most conserved environments and automated annotation of query proteins. These results reflect both the hits found with PSI-BLAST, HMMer and with S-BLEST. We have evaluated how well annotation transfer can be performed on SCOP ID's, Gene Ontology (GO ID's and EC Numbers. The method is very efficient and totally automated, generally taking around fifteen minutes for a 400 residue protein. Conclusion With structural genomics initiatives determining structures with little, if any, functional characterization

  12. Sequence based polymorphic (SBP marker technology for targeted genomic regions: its application in generating a molecular map of the Arabidopsis thaliana genome

    Directory of Open Access Journals (Sweden)

    Sahu Binod B

    2012-01-01

    Full Text Available Abstract Background Molecular markers facilitate both genotype identification, essential for modern animal and plant breeding, and the isolation of genes based on their map positions. Advancements in sequencing technology have made possible the identification of single nucleotide polymorphisms (SNPs for any genomic regions. Here a sequence based polymorphic (SBP marker technology for generating molecular markers for targeted genomic regions in Arabidopsis is described. Results A ~3X genome coverage sequence of the Arabidopsis thaliana ecotype, Niederzenz (Nd-0 was obtained by applying Illumina's sequencing by synthesis (Solexa technology. Comparison of the Nd-0 genome sequence with the assembled Columbia-0 (Col-0 genome sequence identified putative single nucleotide polymorphisms (SNPs throughout the entire genome. Multiple 75 base pair Nd-0 sequence reads containing SNPs and originating from individual genomic DNA molecules were the basis for developing co-dominant SBP markers. SNPs containing Col-0 sequences, supported by transcript sequences or sequences from multiple BAC clones, were compared to the respective Nd-0 sequences to identify possible restriction endonuclease enzyme site variations. Small amplicons, PCR amplified from both ecotypes, were digested with suitable restriction enzymes and resolved on a gel to reveal the sequence based polymorphisms. By applying this technology, 21 SBP markers for the marker poor regions of the Arabidopsis map representing polymorphisms between Col-0 and Nd-0 ecotypes were generated. Conclusions The SBP marker technology described here allowed the development of molecular markers for targeted genomic regions of Arabidopsis. It should facilitate isolation of co-dominant molecular markers for targeted genomic regions of any animal or plant species, whose genomic sequences have been assembled. This technology will particularly facilitate the development of high density molecular marker maps, essential for

  13. Energetic electron precipitation in weak to moderate corotating interaction region-driven storms

    Science.gov (United States)

    Ødegaard, Linn-Kristine Glesnes; Tyssøy, Hilde Nesse; Søraas, Finn; Stadsnes, Johan; Sandanger, Marit Irene

    2017-03-01

    High-energy electron precipitation from the radiation belts can penetrate deep into the mesosphere and increase the production rate of NOx and HOx, which in turn will reduce ozone in catalytic processes. The mechanisms for acceleration and loss of electrons in the radiation belts are not fully understood, and most of the measurements of the precipitating flux into the atmosphere have been insufficient for estimating the loss cone flux. In the present study the electron flux measured by the NOAA POES Medium Energy Proton and Electron Detectors 0° and 90° detectors is combined together with theory of pitch angle diffusion by wave-particle interaction to quantify the electron flux lost below 120 km altitude. Using this method, 41 weak and moderate geomagnetic storms caused by corotating interaction regions during 2006-2010 are studied. The dependence of the energetic electron precipitation fluxes upon solar wind parameters and geomagnetic indices is investigated. Nine storms give increased precipitation of >˜750 keV electrons. Nineteen storms increase the precipitation of >˜300 keV electrons, but not the >˜750 keV population. Thirteen storms either do not change or deplete the fluxes at those energies. Storms that have an increase in the flux of electrons with energy >˜300 keV are characterized by an elevated solar wind velocity for a longer period compared to the storms that do not. Storms with increased precipitation of >˜750 keV flux are distinguished by higher-energy input from the solar wind quantified by the ɛ parameter and corresponding higher geomagnetic activity.

  14. Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, S; Drusiani, E; Battini, R; Fregni, M

    1988-01-11

    Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.

  15. Self-reinforcing process of the reconnection electric field in the electron diffusion region and onset of collisionless magnetic reconnection

    International Nuclear Information System (INIS)

    Lu Quanming; Lu San; Huang Can; Wu Mingyu; Wang Shui

    2013-01-01

    The onset of collisionless magnetic reconnection is considered to be controlled by electron dynamics in the electron diffusion region, where the reconnection electric field is balanced mainly by the off-diagonal electron pressure tensor term. Two-dimensional particle-in-cell simulations are employed in this paper to investigate the self-reinforcing process of the reconnection electric field in the electron diffusion region, which is found to grow exponentially. A theoretical model is proposed to demonstrate such a process in the electron diffusion region. In addition the reconnection electric field in the pileup region, which is balanced mainly by the electromotive force term, is also found to grow exponentially and its growth rate is twice that in the electron diffusion region. (paper)

  16. Numerical modeling of block structure dynamics: Application to the Vrancea region and study of earthquakes sequences in the synthetic catalogs

    International Nuclear Information System (INIS)

    Soloviev, A.A.; Vorobieva, I.A.

    1995-08-01

    A seismically active region is represented as a system of absolutely rigid blocks divided by infinitely thin plane faults. The interaction of the blocks along the fault planes and with the underlying medium is viscous-elastic. The system of blocks moves as a consequence of prescribed motion of boundary blocks and the underlying medium. When for some part of a fault plane the stress surpasses a certain strength level a stress-drop (''a failure'') occurs. It can cause a failure for other parts of fault planes. The failures are considered as earthquakes. As a result of the numerical simulation a synthetic earthquake catalogue is produced. This procedure is applied for numerical modeling of dynamics of the block structure approximating the tectonic structure of the Vrancea region. By numerical experiments the values of the model parameters were obtained which supplied the synthetic earthquake catalog with the space distribution of epicenters close to the real distribution of the earthquake epicenters in the Vrancea region. The frequency-magnitude relations (Gutenberg-Richter curves) obtained for the synthetic and real catalogs have some common features. The sequences of earthquakes arising in the model are studied for some artificial structures. It is found that ''foreshocks'', ''main shocks'', and ''aftershocks'' could be detected among earthquakes forming the sequences. The features of aftershocks, foreshocks, and catalogs of main shocks are analysed. (author). 5 refs, 12 figs, 16 tabs

  17. Minding the gap: Frequency of indels in mtDNA control region sequence data and influence on population genetic analyses

    Science.gov (United States)

    Pearce, J.M.

    2006-01-01

    Insertions and deletions (indels) result in sequences of various lengths when homologous gene regions are compared among individuals or species. Although indels are typically phylogenetically informative, occurrence and incorporation of these characters as gaps in intraspecific population genetic data sets are rarely discussed. Moreover, the impact of gaps on estimates of fixation indices, such as FST, has not been reviewed. Here, I summarize the occurrence and population genetic signal of indels among 60 published studies that involved alignments of multiple sequences from the mitochondrial DNA (mtDNA) control region of vertebrate taxa. Among 30 studies observing indels, an average of 12% of both variable and parsimony-informative sites were composed of these sites. There was no consistent trend between levels of population differentiation and the number of gap characters in a data block. Across all studies, the average influence on estimates of ??ST was small, explaining only an additional 1.8% of among population variance (range 0.0-8.0%). Studies most likely to observe an increase in ??ST with the inclusion of gap characters were those with control region DNA appears small, dependent upon total number of variable sites in the data block, and related to species-specific characteristics and the spatial distribution of mtDNA lineages that contain indels. ?? 2006 Blackwell Publishing Ltd.

  18. Sequencing Larger Intact Proteins (30-70 kDa) with Activated Ion Electron Transfer Dissociation

    Science.gov (United States)

    Riley, Nicholas M.; Westphall, Michael S.; Coon, Joshua J.

    2018-01-01

    The analysis of intact proteins via mass spectrometry can offer several benefits to proteome characterization, although the majority of top-down experiments focus on proteoforms in a relatively low mass range (AI-ETD) to proteins in the 30-70 kDa range. AI-ETD leverages infrared photo-activation concurrent to ETD reactions to improve sequence-informative product ion generation. This method generates more product ions and greater sequence coverage than conventional ETD, higher-energy collisional dissociation (HCD), and ETD combined with supplemental HCD activation (EThcD). Importantly, AI-ETD provides the most thorough protein characterization for every precursor ion charge state investigated in this study, making it suitable as a universal fragmentation method in top-down experiments. Additionally, we highlight several acquisition strategies that can benefit characterization of larger proteins with AI-ETD, including combination of spectra from multiple ETD reaction times for a given precursor ion, multiple spectral acquisitions of the same precursor ion, and combination of spectra from two different dissociation methods (e.g., AI-ETD and HCD). In all, AI-ETD shows great promise as a method for dissociating larger intact protein ions as top-down proteomics continues to advance into larger mass ranges. [Figure not available: see fulltext.

  19. Electronic excitation of some silicium compounds in the vacuum ultravi olet region

    International Nuclear Information System (INIS)

    Rocco, M.L.M.

    1986-01-01

    Angle-resolved electron energy-loss spectra have been measured for the tetramethylsilane, trimethylchlorosilane and dimethyldichloresilane molecules in the 5 - 300 eV energy range. The spectra have been obtained at 1 KeV incident energy, with an energy resolution of about 0.5 eV (valense region) and 0.8 eV (inner-shell region). Both the valence and core-level excitation bands can be as associated to transitions to Rydber and valence states. No dipole-allowed transition has been observed in the spectra measured in the angular range of 1 to 9 degrees (valence region) and 3 to 7 degrees (inner-shell region). (Author) [pt

  20. Identification of genomic regions associated with female fertility in Danish Jersey using whole genome sequence data

    DEFF Research Database (Denmark)

    Höglund, Johanna; Guldbrandtsen, Bernt; Lund, Mogens Sandø

    2015-01-01

    6 QTL were detected for FTI: one QTL on each of BTA7, BTA20, BTA23, BTA25, and two QTL on BTA9 (QTL9–1 and QTL9–2). In the second step, ICF showed association with the QTL regions on BTA7, QTL9–2 QTL2 on BTA9, and BTA25, AIS for cows on BTA20 and BTA23, AIS for heifers on QTL9–2 on BTA9, IFL...... for cows on BTA20, BTA23 and BTA25, IFL for heifers on BTA7 and QTL9-2 on BTA9, NRR for heifers on BTA7 and BTA23, and NRR for cows on BTA23. Conclusion: The genome wide association study presented here revealed 6 genomic regions associated with FTI. Screening these 6 QTL regions for the underlying female...... quantitative trait locus regions were re-analyzed using a linear mixed model (animal model) for both FTI and its component traits AIS, NRR, IFL and ICF. The underlying traits were analyzed separately for heifers (first parity cows) and cows (later parity cows) for AIS, NRR, and IFL. Results: In the first step...

  1. A modification to the SCAR (Sequence Characterized Amplified Region method provides phylogenetic insights within Ceratozamia (Zamiaceae Una modificación al método SCAR (Sequence Characterized Amplified Region aporta entendimiento filogenético en Ceratozamia (Zamiaceae

    Directory of Open Access Journals (Sweden)

    Dolores González

    2012-12-01

    Full Text Available Phylogenetic relationships among closely related plant species are still problematic. DNA intergenic regions often are insufficiently variable to provide desired resolution or support. In this study, a modification to the Sequence Characterized Amplified Region (SCAR method was used to find polymorphic loci for phylogenetic analyses within Ceratozamia. RAPD markers were first used to detect variation in 5 species. Then, equal length fragments found in 2 or more species were excised from the gel, purified and digested with frequent cutter restriction enzymes for isolating both ends, which have the same primer site. Digested fragments were sequenced with the RAPD primer. Variable sequences were used to design specific primers for amplifying and sequencing in all species for phylogenetic analyses. Our results confirmed the previously known high genome sequence resemblance within this genus that contrasts with its high morphological variation. Only 7 parsimony informative characters were found with this approach. Nonetheless, the Digested-SCAR (D-SCAR method provided some phylogenetic insights. Four main clades consistent with distribution ranges of the species were detected. The approach presented here was effective to solve some relationships within the genus and can potentially be implemented in other organisms to find polymorphic loci for phylogenetic studies at any taxonomic level.Las relaciones filogenéticas entre especies de plantas cercanamente relacionadas es aún problemático. Las regiones intergénicas del ADN son a menudo insuficientemente variables para proveer los niveles de resolución y soporte deseados. En este estudio, se usó una modificación al método Sequence Characterized Amplified Region (SCAR para encontrar loci polimórficos para análisis filogenéticos en Ceratozamia. Primero se usaron marcadores RAPD para detectar variación en 5 especies; luego, se cortaron del gel los fragmentos de la misma longitud en 2 o m

  2. Diversity analysis of Bemisia tabaci biotypes: RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region

    OpenAIRE

    Rabello, Aline R.; Queiroz, Paulo R.; Simões, Kenya C.C.; Hiragi, Cássia O.; Lima, Luzia H.C.; Oliveira, Maria Regina V.; Mehta, Angela

    2008-01-01

    The Bemisia tabaci complex is formed by approximately 41 biotypes, two of which (B and BR) occur in Brazil. In this work we aimed at obtaining genetic markers to assess the genetic diversity of the different biotypes. In order to do that we analyzed Bemisia tabaci biotypes B, BR, Q and Cassava using molecular techniques including RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region. The analyses revealed a high similarity between the individuals of the B and Q biotypes, which could be distin...

  3. Deep inelastic scattering of electrons on 12C in the δ(1236) region

    International Nuclear Information System (INIS)

    Meziani, Zein-Eddine.

    1982-06-01

    An experiment involving inclusive deep inelastic scattering of 700 MeV electrons on 12 C is presented. A broad energy transfer region (20 to 500 MeV) was examined enabling various different reaction mechanisms occurring in the nucleus to be studied. Attention was given to electroproduction processes in the δ(1236) resonance region. Measurements of deep inelastic scattering cross sections and radiative correction problems are discussed. A theoretical treatment of the cross section in the framework of a virtual photon exchange approximation is presented [fr

  4. Estimates of Terms in Ohm's Law During an Encounter with an Electron Diffusion Region

    Science.gov (United States)

    Torbert, R. B.; Burch, J. L.; Giles, B. L.; Gershman, D.; Pollock, C. J.; Dorelli, J.; Avanov, L. A.; Argall, M.; Shuster, J.; Strangeway, R.; hide

    2016-01-01

    We present measurements from the Magnetospheric Multiscale (MMS) mission taken during a reconnection event on the dayside magnetopause which includes a passage through an electron diffusion region (EDR). The four MMS satellites were separated by about 10 km such that estimates of gradients and divergences allow a reasonable estimate of terms in the generalized Ohm's law, which is key to investigating the energy dissipation during reconnection. The strength and character of dissipation mechanisms determines how magnetic energy is released. We show that both electron pressure gradients and electron inertial effects are important, but not the only participants in reconnection near EDRs, since there are residuals of a few mVm (approximately 30-50%) of E+ U(sub e) x B (from the sum of these two terms) during the encounters. These results are compared to a simulation, which exhibits many of the observed features, but where relatively little residual is present.

  5. High-effective position time spectrometer in actual measurements of low intensity region of electron spectra

    International Nuclear Information System (INIS)

    Babenkov, M.I.; Zhdanov, V.S.

    2002-01-01

    Magnetic position-time spectrometer was proposed in previous work, where not only electron coordinates in focal plane are measured by position sensitive detector (PSD) but places of their birth in beta source plane of a large area are fixed using another PSD, situated behind it, by quick effects, accompanying radioactive decay. PSD on the basis of macro-channel plates are used. It is succeeded in position-time spectrometer to combine beta sources of a large area with multichannel registration for a wide energy interval, that efficiency of measurements was two orders of magnitude increase d in comparison magnetic apparatus having PSD only in focal plane. Owing to two detectors' switching on coincidence the relation effect/background in increased minimum on two orders of magnitude in comparison with the same apparatus. At some complication of mathematical analysis it was obtained, that high characteristics of position-time spectrometer are kept during the use the magnetic field, providing double focusing. Owning to this focusing the gain the efficiency of measurements will make one more order of magnitude. Presented high-effective position-time spectrometer is supposed to use in the measurements of low-intensity region of electron spectra, which are important for development of fundamental physics. This is the first of all estimation of electron anti-neutrino mass by the form of beta spectrum of tritium in the region of boundary energy. Recently here there was problem of non physical negative values. This problem can be solved by using in measurement of different in principle high-effective spectrometers, which possess improved background properties. A position-time spectrometers belongs to these apparatus, which provides the best background conditions at very large effectiveness of the measurements of tritium beta spectrum in the region of boundary energy with acceptable high resolution. An important advantage of position-time spectrometer is the possibility of

  6. The Evolution of the Electronics Industry in the SIJORI Cross-border Region

    OpenAIRE

    van Grunsven, Leo; Hutchinson, F.

    2014-01-01

    In the early 1990s, Singapore, the Malaysian state of Johor, and the Indonesian island of Batam sought to leverage their proximity, differing comparative advantages, and good logistics connections to market themselves as an integrated unit. After an initial phase of enthusiasm and considerable investment from electronics multinationals, attention regarding the cross-border region waned in the wake of the Asian Financial Crisis. Using data from investment authorities in Indonesia and Malaysia,...

  7. Global view of F-region electron density and temperature at solar maximum

    International Nuclear Information System (INIS)

    Brace, L.H.; Theis, R.F.; Hoegy, W.R.

    1982-01-01

    Dynamics Explorer-2 is permitting the first measurements of the global structure of the F-regions at very high levels of solar activity (S>200). Selected full orbits of Langmuir probe measurements of electron temperature, T/sub e/, and density, N/sub e/, are shown to illustrate this global structure and some of the ionospheric features that are the topic of other papers in this issue. The ionospheric thermal structure is of particular interest because T/sub e/ is a sensitive indicator of the coupling of magnetospheric energy into the upper atmosphere. A comparison of these heating effects with those observed at solar minimum shows that the magnetospheric sources are more important at solar maximum, as might have been expected. Heating at the cusp, the auroral oval and the plasma-pause is generally both greater and more variable. Electron cooling rate calculations employing low latitude measurements indicate that solar extreme ultraviolet heating of the F region at solar maximum is enhanced by a factor that is greater than the increase in solar flux. Some of this enhanced electron heating arises from the increase in electron heating efficiency at the higher N/sub e/ of solar maximum, but this appears insufficient to completely resolve the discrepancy

  8. Neuropeptide processing in regional brain slices: Effect of conformation and sequence

    Energy Technology Data Exchange (ETDEWEB)

    Li, Z.W.; Bijl, W.A.; van Nispen, J.W.; Brendel, K.; Davis, T.P. (Univ. of Arizona, Tucson (USA))

    1990-05-01

    The central enzymatic stability of des-enkephalin-gamma-endorphin and its synthetic analogs (cycloN alpha 6, C delta 11)beta-endorphin-(6-17) and (Pro7, Lys(Ac)9)-beta-endorphin(6-17) was studied in vitro using a newly developed, regionally dissected rat brain slice, time course incubation procedure. Tissue slice viability was estimated as the ability of the brain slice to take up or release gamma-(3H)aminobutyric acid after high K+ stimulation. Results demonstrated stability of uptake/release up to 5 hr of incubation, suggesting tissue viability over this period. The estimated half-life of peptides based on the results obtained in our incubation protocol suggest that the peptides studied are metabolized at different rates in the individual brain regions tested. A good correlation exists between the high enzyme activity of neutral endopeptidase and the rapid degradation of des-enkephalin-gamma-endorphin and (cycloN alpha 6, C delata 11)beta-endorphin-(6-17) in caudate putamen. Proline substitution combined with lysine acetylation appears to improve resistance to enzymatic metabolism in caudate putamen and hypothalamus. However, cyclization of des-enkephalin-gamma-endorphin forming an amide bond between the alpha-NH2 of the N-terminal threonine and the gamma-COOH of glutamic acid did not improve peptide stability in any brain region tested. The present study has shown that the brain slice technique is a valid and unique approach to study neuropeptide metabolism in small, discrete regions of rat brain where peptides, peptidases and receptors are colocalized and that specific structural modifications can improve peptide stability.

  9. ICME-driven sheath regions deplete the outer radiation belt electrons

    Science.gov (United States)

    Hietala, H.; Kilpua, E. K.; Turner, D. L.

    2013-12-01

    It is an outstanding question in space weather and solar wind-magnetosphere interaction studies, why some storms result in an increase of the outer radiation belt electron fluxes, while others deplete them or produce no change. One approach to this problem is to look at differences in the storm drivers. Traditionally drivers have been classified to Stream Interaction Regions (SIRs) and Interplanetary Coronal Mass Ejections (ICMEs). However, an 'ICME event' is a complex structure: The core is a magnetic cloud (MC; a clear flux rope structure). If the mass ejection is fast enough, it can drive a shock in front of it. This leads to the formation of a sheath region between the interplanetary shock and the leading edge of the MC. While both the sheath and the MC feature elevated solar wind speed, their other properties are very different. For instance, the sheath region has typically a much higher dynamic pressure than the magnetic cloud. Moreover, the sheath region has a high power in magnetic field and dynamic pressure Ultra Low Frequency (ULF) range fluctuations, while the MC is characterised by an extremely smooth magnetic field. Magnetic clouds have been recognised as important drivers magnetospheric activity since they can comprise long periods of very large southward Interplanetary Magnetic Field (IMF). Nevertheless, previous studies have shown that sheath regions can also act as storm drivers. In this study, we analyse the effects of ICME-driven sheath regions on the relativistic electron fluxes observed by GOES satellites on the geostationary orbit. We perform a superposed epoch analysis of 31 sheath regions from solar cycle 23. Our results show that the sheaths cause an approximately one order of magnitude decrease in the 24h-averaged electron fluxes. Typically the fluxes also stay below the pre-event level for more than two days. Further analysis reveals that the decrease does not depend on, e.g., whether the sheath interval contains predominantly northward

  10. Electron backstream to the source plasma region in an ion source

    International Nuclear Information System (INIS)

    Ohara, Y.; Akiba, M.; Arakawa, Y.; Okumura, Y.; Sakuraba, J.

    1980-01-01

    The flux of backstream electrons to the source plasma region increases significantly with the acceleration voltage of an ion beam, so that the back plate in the arc chamber should be broken for quasi-dc operation. The flux of backstream electrons is estimated at the acceleration voltage of 50--100 kV for a proton beam with the aid of ion beam simulation code. The power flux of backstream electrons is up to about 7% of the total beam output at the acceleration voltage of 75 kV. It is pointed out that the conventional ion sources such as the duoPIGatron or the bucket source which use a magnetic field for source plasma production are not suitable for quasi-dc and high-energy ion sources, because the surface heat flux of the back plate is increased by the focusing of backstream electrons and the removal of it is quite difficult. A new ion source which has an electron beam dump in the arc chamber is proposed

  11. Simulated East-west differences in F-region peak electron density at Far East mid-latitude region

    Science.gov (United States)

    Ren, Z.; Wan, W.

    2017-12-01

    In the present work, using Three-Dimensional Theoretical Ionospheric Model of the Earth in Institute of Geology and Geophysics, Chinese Academy of Sciences (TIME3D-IGGCAS), we simulated the east-west differences in Fregion peak electron density (NmF2) at Far East mid-latitude region.We found that, after removing the longitudinal variations of neutral parameters, TIME3D-IGGCAS can better represent the observed relative east-west difference (Rew) features. Rew is mainly negative (West NmF2 > East NmF2) at noon and positive (East NmF2 >West NmF2) at evening-night. The magnitude of daytime negative Rew is weak at local winter and strong at local summer, and the daytime Rew show two negative peaks around two equinoxes. With the increasing of solar flux level, the magnitude of Rew mainly become larger, and two daytime negative peaks slight shifts to June Solstice. With the decreasing of geographical latitude, Rew mainly become positive, and two daytime negative peaks slight shifts to June Solstice. Our simulation also suggested that the thermospheric zonal wind combined with the geomagnetic field configuration play a pivotal role in the formation of the ionospheric east-west differences at Far East midlatitude region.

  12. Phylogenetic relationships of Malaysia's pig-tailed macaque Macaca nemestrina based on D-loop region sequences

    Science.gov (United States)

    Abdul-Latiff M. A., B.; Ampeng, A.; Yaakop, S.; Md-Zain B., M.

    2014-09-01

    Phylogenetic relationships among Malaysian pig-tailed macaques have never been established even though the data are crucial in aiding conservation plan for the species. The aims of this study is to establish the phylogenetic relationships of Macaca nemestrina in Malaysia. A total of 21 genetic samples of M. nemestrina yielding 458 bp of D-loop sequences were used in phylogenetic analyses, in addition to one sample of M. fascicularis which was used as an outgroup. Sequence character analysis revealed that D-loop locus contains 23% parsimony informative character detected among the ingroups. Further analysis indicated a clear separation between populations originating from different regions; the Malay Peninsula populations are separated from Borneo Insular population; and Perak population formed a distinctive clade within Peninsular Malaysia populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo population was distinguished from Peninsula population (100% bootstrap value in the NJ, MP, 1.00 posterior probability in Bayesian trees). Perak's population was separated from other Peninsula populations (100% in NJ, 99% in MP and 1.00 in Bayesian). D-loop region of mtDNA is proven to be a suitable locus in studying the separation of M. nemestrina at population level. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations in Malaysia.

  13. Distorted-wave calculations of electron impact ionisation in the Ni isonuclear sequence

    Energy Technology Data Exchange (ETDEWEB)

    Griffin, D C; Pindzola, M S

    1988-10-14

    Electron impact ionisation cross sections for Ni/sup +/, Ni/sup 3+/, Ni/sup 5+/, Ni/sup 6+/, Ni/sup 7+/, Ni/sup 8+/, Ni/sup 12+/, Ni/sup 14+/, and Ni/sup 16+/ are calculated in the distorted-wave approximation. These calculations include contributions from direct ionisation and inner-shell excitation followed by autoionisation. For Ni/sup 12+/, Ni/sup 14+/, and Ni/sup 16+/ we report not only on ionisation cross sections from the ground states but also from the metastable states of these ions. Experimental cross section measurements exist for all ions reported here, except Ni/sup 16+/. The agreement between experiment and theory is reasonably good and improves with ionisation stage.

  14. [Using exon combined target region capture sequencing chip to detect the disease-causing genes of retinitis pigmentosa].

    Science.gov (United States)

    Rong, Weining; Chen, Xuejuan; Li, Huiping; Liu, Yani; Sheng, Xunlun

    2014-06-01

    To detect the disease-causing genes of 10 retinitis pigmentosa pedigrees by using exon combined target region capture sequencing chip. Pedigree investigation study. From October 2010 to December 2013, 10 RP pedigrees were recruited for this study in Ningxia Eye Hospital. All the patients and family members received complete ophthalmic examinations. DNA was abstracted from patients, family members and controls. Using exon combined target region capture sequencing chip to screen the candidate disease-causing mutations. Polymerase chain reaction (PCR) and direct sequencing were used to confirm the disease-causing mutations. Seventy patients and 23 normal family members were recruited from 10 pedigrees. Among 10 RP pedigrees, 1 was autosomal dominant pedigrees and 9 were autosomal recessive pedigrees. 7 mutations related to 5 genes of 5 pedigrees were detected. A frameshift mutation on BBS7 gene was detected in No.2 pedigree, the patients of this pedigree combined with central obesity, polydactyly and mental handicap. No.2 pedigree was diagnosed as Bardet-Biedl syndrome finally. A missense mutation was detected in No.7 and No.10 pedigrees respectively. Because the patients suffered deafness meanwhile, the final diagnosis was Usher syndrome. A missense mutation on C3 gene related to age-related macular degeneration was also detected in No. 7 pedigrees. A nonsense mutation and a missense mutation on CRB1 gene were detected in No. 1 pedigree and a splicesite mutation on PROM1 gene was detected in No. 5 pedigree. Retinitis pigmentosa is a kind of genetic eye disease with diversity clinical phenotypes. Rapid and effective genetic diagnosis technology combined with clinical characteristics analysis is helpful to improve the level of clinical diagnosis of RP.

  15. Solar Wind 0.1-1 keV Electrons in the Corotating Interaction Regions

    Science.gov (United States)

    Wang, L.; Tao, J.; Li, G.; Wimmer-Schweingruber, R. F.; Jian, L. K.; He, J.; Tu, C.; Tian, H.; Bale, S. D.

    2017-12-01

    Here we present a statistical study of the 0.1-1 keV suprathermal electrons in the undisturbed and compressed slow/fast solar wind, for the 71 corotating interaction regions (CIRs) with good measurements from the WIND 3DP and MFI instruments from 1995 to 1997. For each of these CIRs, we separate the strahl and halo electrons based on their different behaviors in pitch angle distributions in the undisturbed and compressed solar wind. We fit both the strahl and halo energy spectra to a kappa function with an index κ index and effective temperature Teff, and calculate the pitch-angle width at half-maximum (PAHM) of the strahl population. We also integrate the electron measurements between 0.1 and 1.0 keV to obtain the number density n and average energy Eavg for the strahl and halo populations. We find that for both the strahl and halo populations within and around these CIRs, the fitted κ index strongly correlates with Teff, similar to the quiet-time solar wind (Tao et al., ApJ, 2016). The number density of both the strahl and halo shows a strong positive correlation with the electron core temperature. The strahl number density ns is correlated with the magnitude of interplanetary magnetic field, and the strahl PAHM width is anti-correlated with the solar wind speed. These results suggest that the origin of strahl electrons from the solar corona is likely related to the electron core temperature and magnetic field strength, while the production of halo electrons in the interplanetary medium could depend on the solar wind velocity.

  16. Nucleotide sequence of a cDNA coding for the amino-terminal region of human prepro. alpha. 1(III) collagen

    Energy Technology Data Exchange (ETDEWEB)

    Toman, P D; Ricca, G A [Rorer Biotechnology, Inc., Springfield, VA (USA); de Crombrugghe, B [National Institutes of Health, Bethesda, MD (USA)

    1988-07-25

    Type III Collagen is synthesized in a variety of tissues as a precursor macromolecule containing a leader sequence, a N-propeptide, a N-telopeptide, the triple helical region, a C-telopeptide, and C-propeptide. To further characterize the human type III collagen precursor, a human placental cDNA library was constructed in gt11 using an oligonucleotide derived from a partial cDNA sequence corresponding to the carboxy-terminal part of the 1(III) collagen. A cDNA was identified which contains the leader sequence, the N-propeptide and N-telopeptide regions. The DNA sequence of these regions are presented here. The triple helical, C-telopeptide and C-propeptide amino acid sequence for human type III collagen has been determined previously. A comparison of the human amino acid sequence with mouse, chicken, and calf sequence shows 81%, 81%, and 92% similarity, respectively. At the DNA level, the sequence similarity between human and mouse or chicken type III collagen sequences in this area is 82% and 77%, respectively.

  17. Sequencing and association analysis of the type 1 diabetes – linked region on chromosome 10p12-q11

    Directory of Open Access Journals (Sweden)

    Barratt Bryan J

    2007-05-01

    Full Text Available Abstract Background In an effort to locate susceptibility genes for type 1 diabetes (T1D several genome-wide linkage scans have been undertaken. A chromosomal region designated IDDM10 retained genome-wide significance in a combined analysis of the main linkage scans. Here, we studied sequence polymorphisms in 23 Mb on chromosome 10p12-q11, including the putative IDDM10 region, to identify genes associated with T1D. Results Initially, we resequenced the functional candidate genes, CREM and SDF1, located in this region, genotyped 13 tag single nucleotide polymorphisms (SNPs and found no association with T1D. We then undertook analysis of the whole 23 Mb region. We constructed and sequenced a contig tile path from two bacterial artificial clone libraries. By comparison with a clone library from an unrelated person used in the Human Genome Project, we identified 12,058 SNPs. We genotyped 303 SNPs and 25 polymorphic microsatellite markers in 765 multiplex T1D families and followed up 22 associated polymorphisms in up to 2,857 families. We found nominal evidence of association in six loci (P = 0.05 – 0.0026, located near the PAPD1 gene. Therefore, we resequenced 38.8 kb in this region, found 147 SNPs and genotyped 84 of them in the T1D families. We also tested 13 polymorphisms in the PAPD1 gene and in five other loci in 1,612 T1D patients and 1,828 controls from the UK. Overall, only the D10S193 microsatellite marker located 28 kb downstream of PAPD1 showed nominal evidence of association in both T1D families and in the case-control sample (P = 0.037 and 0.03, respectively. Conclusion We conclude that polymorphisms in the CREM and SDF1 genes have no major effect on T1D. The weak T1D association that we detected in the association scan near the PAPD1 gene may be either false or due to a small genuine effect, and cannot explain linkage at the IDDM10 region.

  18. Electron-impact excitation-autoionization in the cadmium isoelectronic sequence: A case of target term dependence in scattering theory

    International Nuclear Information System (INIS)

    Pindzola, M.S.; Griffin, D.C.; Bottcher, C.

    1983-01-01

    Excitation-autoionization contributions to electron-impact ionization are calculated for several atomic ions in the cadmium isoelectronic sequence. We calculate excitation cross sections in the distorted-wave approximation and compare them in one case to a calculation in the close-coupling approximation. We focus attention on the 4d 10 5s 2 →4d 9 5s 2 nf inner-shell excitations in In + , Sb 3+ , and Xe 6+ . Hartree-Fock atomic structure calculations for the 4d 9 5s 2 nf configurations are found to be highly term dependent. Thus our predictions for the total ionization cross section from the 5s subshell for these ions exhibit strong target term dependence. Our Xe 6+ results are found to be in excellent agreement with the recent experimental crossed-beam measurements of Gregory and Crandall

  19. Genetic distance of Malaysian mousedeer based on mitochondrial DNA cytochrome oxidase I (COI) and D-loop region sequences

    Science.gov (United States)

    Bakar, Mohamad-Azam Akmal Abu; Rovie-Ryan, Jeffrine Japning; Ampeng, Ahmad; Yaakop, Salmah; Nor, Shukor Md; Md-Zain, Badrul Munir

    2018-04-01

    Mousedeer is one of the primitive mammals that can be found mainly in Southeast-Asia region. There are two species of mousedeer in Malaysia which are Tragulus kanchil and Tragulus napu. Both species can be distinguish by size, coat coloration, and throat pattern but clear diagnosis still cannot be found. The objective of the study is to show the genetic distance relationship between T. kanchil and T. napu and their population based on mitochondrial DNA (mtDNA) cytochrome oxidase I (COI) and D-loop region. There are 42 sample of mousedeer were used in this study collected by PERHILITAN from different locality. Another 29 D-loop sequence were retrieved from Genbank for comparative analysis. All sample were amplified using universal primer and species-specific primer for COI and D-loop genes via PCR process. The amplified sequences were analyzed to determine genetic distance of T. kanchil and T. napu. From the analysis, the average genetic distance between T. kanchil and T. napu based on locus COI and D-loop were 0.145 and 0.128 respectively. The genetic distance between populations of T. kanchil based on locus COI was between 0.003-0.013. For locus D-loop, genetic distance analysis showed distance in relationship between west-coast populations to east-coast population of T. kanchil. COI and D-loop mtDNA region provided a clear picture on the relationship within the mousedeer species. Last but not least, conservation effort toward protecting this species can be done by study the molecular genetics and prevent the extinction of this species.

  20. Natural selection in a population of Drosophila melanogaster explained by changes in gene expression caused by sequence variation in core promoter regions.

    Science.gov (United States)

    Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado

    2016-02-09

    Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning

  1. "Diffusion" region of magnetic reconnection: electron orbits and the phase space mixing

    Science.gov (United States)

    Kropotkin, Alexey P.

    2018-05-01

    The nonlinear dynamics of electrons in the vicinity of magnetic field neutral lines during magnetic reconnection, deep inside the diffusion region where the electron motion is nonadiabatic, has been numerically analyzed. Test particle orbits are examined in that vicinity, for a prescribed planar two-dimensional magnetic field configuration and with a prescribed uniform electric field in the neutral line direction. On electron orbits, a strong particle acceleration occurs due to the reconnection electric field. Local instability of orbits in the neighborhood of the neutral line is pointed out. It combines with finiteness of orbits due to particle trapping by the magnetic field, and this should lead to the effect of mixing in the phase space, and the appearance of dynamical chaos. The latter may presumably be viewed as a mechanism producing finite conductivity in collisionless plasma near the neutral line. That conductivity is necessary to provide violation of the magnetic field frozen-in condition, i.e., for magnetic reconnection to occur in that region.

  2. The Regulation Of Electronic Money Institutions In The SADC Region: Some Lessons From The EU

    Directory of Open Access Journals (Sweden)

    Mmaphuti David Tuba

    2014-12-01

    Full Text Available This article analyses the different approaches adopted for the regulation of payment systems in a variety of legislative instruments by the European Union (EU. It looks in particular at how the institutions that issue new electronic money products are regulated and supervised by the relevant authorities in the EU, in comparison with existing institutions such as banks. It analyses some of the lessons that may be learned by the South African Development Corporation (SADC from the regulatory approaches for electronic money institutions adopted by the EU. The article asks if the approach adopted by the EU may be useful for the future regulation of electronic money institutions in the SADC. The proliferation of electronic devices that arrived with the invention of the Internet has sparked some regulatory challenges. This development has become global and involves both developed and developing countries, including regions such as the SADC. It is asked if these technological developments should be addressed by means of a concrete regulatory framework while they continue to develop, instead of the regulators waiting to observe and acquaint themselves with the relevant regulatory challenges that underpin the innovations. The EU has attempted to address the anticipated regulatory challenges that came about with the development of electronic money and to align its regulatory approach with other payment systems. This article discusses the regulatory approaches adopted in the EU and provides an overview that the SADC may use in order to adopt an effective regulatory framework for electronic money and the institutions that issue these methods of payment. It analyses both the achievements and the challenges that the EU faced (and continues to face in developing the regulation of e-money, and recommends some possible approaches derived from the lessons learned.

  3. Sequencing of a QTL-rich region of the Theobroma cacao genome using pooled BACs and the identification of trait specific candidate genes

    Directory of Open Access Journals (Sweden)

    Blackmon Barbara P

    2011-07-01

    Full Text Available Abstract Background BAC-based physical maps provide for sequencing across an entire genome or a selected sub-genomic region of biological interest. Such a region can be approached with next-generation whole-genome sequencing and assembly as if it were an independent small genome. Using the minimum tiling path as a guide, specific BAC clones representing the prioritized genomic interval are selected, pooled, and used to prepare a sequencing library. Results This pooled BAC approach was taken to sequence and assemble a QTL-rich region, of ~3 Mbp and represented by twenty-seven BACs, on linkage group 5 of the Theobroma cacao cv. Matina 1-6 genome. Using various mixtures of read coverages from paired-end and linear 454 libraries, multiple assemblies of varied quality were generated. Quality was assessed by comparing the assembly of 454 reads with a subset of ten BACs individually sequenced and assembled using Sanger reads. A mixture of reads optimal for assembly was identified. We found, furthermore, that a quality assembly suitable for serving as a reference genome template could be obtained even with a reduced depth of sequencing coverage. Annotation of the resulting assembly revealed several genes potentially responsible for three T. cacao traits: black pod disease resistance, bean shape index, and pod weight. Conclusions Our results, as with other pooled BAC sequencing reports, suggest that pooling portions of a minimum tiling path derived from a BAC-based physical map is an effective method to target sub-genomic regions for sequencing. While we focused on a single QTL region, other QTL regions of importance could be similarly sequenced allowing for biological discovery to take place before a high quality whole-genome assembly is completed.

  4. Ion and electron parameters in the alcator C tokamak scrape-off region

    International Nuclear Information System (INIS)

    Wan, A.S.H.

    1986-05-01

    Janus is a bi-directional, multi-functional edge probe used to diagnose the ion and electron parameters in the Alcator C tokamak scrape-off region. Two mirror image sets of diagnostics are aligned to face the electron and ion sides along magnetic field lines. Each set of diagnostics consists of a retarding-field energy analyzer (RFEA), a Langmuir probe, and a calorimeter. The RFEA can alternatively sample both the ion and electron parallel energy distribution functions during a tokamak discharge. From the Langmuir probe, one can infer electron temperature, density, and the plasma floating potential. Simple Langmuir probe theory is found to yield the best agreement between the measured Langmuir probe characteristics and the RFEA-inferred T/sub e/. The calorimeter independently detects the total parallel heat flux incident to an electrically floating plate. The measured sheath transmission coefficient, however, is typically lower than the theoretically predicted value by a factor of approx.3. Together these diagnostics enable detailed, localized edge plasma characterization on Alcator C

  5. Nonlinear Right-Hand Polarized Wave in Plasma in the Electron Cyclotron Resonance Region

    Science.gov (United States)

    Krasovitskiy, V. B.; Turikov, V. A.

    2018-05-01

    The propagation of a nonlinear right-hand polarized wave along an external magnetic field in subcritical plasma in the electron cyclotron resonance region is studied using numerical simulations. It is shown that a small-amplitude plasma wave excited in low-density plasma is unstable against modulation instability with a modulation period equal to the wavelength of the excited wave. The modulation amplitude in this case increases with decreasing detuning from the resonance frequency. The simulations have shown that, for large-amplitude waves of the laser frequency range propagating in plasma in a superstrong magnetic field, the maximum amplitude of the excited longitudinal electric field increases with the increasing external magnetic field and can reach 30% of the initial amplitude of the electric field in the laser wave. In this case, the energy of plasma electrons begins to substantially increase already at magnetic fields significantly lower than the resonance value. The laser energy transferred to plasma electrons in a strong external magnetic field is found to increase severalfold compared to that in isotropic plasma. It is shown that this mechanism of laser radiation absorption depends only slightly on the electron temperature.

  6. Mapping and validation of the major sex-determining region in Nile tilapia (Oreochromis niloticus L. Using RAD sequencing.

    Directory of Open Access Journals (Sweden)

    Christos Palaiokostas

    Full Text Available Sex in Oreochromis niloticus (Nile tilapia is principally determined by an XX/XY locus but other genetic and environmental factors also influence sex ratio. Restriction Associated DNA (RAD sequencing was used in two families derived from crossing XY males with females from an isogenic clonal line, in order to identify Single Nucleotide Polymorphisms (SNPs and map the sex-determining region(s. We constructed a linkage map with 3,802 SNPs, which corresponded to 3,280 informative markers, and identified a major sex-determining region on linkage group 1, explaining nearly 96% of the phenotypic variance. This sex-determining region was mapped in a 2 cM interval, corresponding to approximately 1.2 Mb in the O. niloticus draft genome. In order to validate this, a diverse family (4 families; 96 individuals in total and population (40 broodstock individuals test panel were genotyped for five of the SNPs showing the highest association with phenotypic sex. From the expanded data set, SNPs Oni23063 and Oni28137 showed the highest association, which persisted both in the case of family and population data. Across the entire dataset all females were found to be homozygous for these two SNPs. Males were heterozygous, with the exception of five individuals in the population and two in the family dataset. These fish possessed the homozygous genotype expected of females. Progeny sex ratios (over 95% females from two of the males with the "female" genotype indicated that they were neomales (XX males. Sex reversal induced by elevated temperature during sexual differentiation also resulted in phenotypic males with the "female" genotype. This study narrows down the region containing the main sex-determining locus, and provides genetic markers tightly linked to this locus, with an association that persisted across the population. These markers will be of use in refining the production of genetically male O. niloticus for aquaculture.

  7. Capillary electrophoresis of Big-Dye terminator sequencing reactions for human mtDNA Control Region haplotyping in the identification of human remains.

    Science.gov (United States)

    Montesino, Marta; Prieto, Lourdes

    2012-01-01

    Cycle sequencing reaction with Big-Dye terminators provides the methodology to analyze mtDNA Control Region amplicons by means of capillary electrophoresis. DNA sequencing with ddNTPs or terminators was developed by (1). The progressive automation of the method by combining the use of fluorescent-dye terminators with cycle sequencing has made it possible to increase the sensibility and efficiency of the method and hence has allowed its introduction into the forensic field. PCR-generated mitochondrial DNA products are the templates for sequencing reactions. Different set of primers can be used to generate amplicons with different sizes according to the quality and quantity of the DNA extract providing sequence data for different ranges inside the Control Region.

  8. Re-annotation of the physical map of Glycine max for polyploid-like regions by BAC end sequence driven whole genome shotgun read assembly

    Directory of Open Access Journals (Sweden)

    Shultz Jeffry

    2008-07-01

    Full Text Available Abstract Background Many of the world's most important food crops have either polyploid genomes or homeologous regions derived from segmental shuffling following polyploid formation. The soybean (Glycine max genome has been shown to be composed of approximately four thousand short interspersed homeologous regions with 1, 2 or 4 copies per haploid genome by RFLP analysis, microsatellite anchors to BACs and by contigs formed from BAC fingerprints. Despite these similar regions,, the genome has been sequenced by whole genome shotgun sequence (WGS. Here the aim was to use BAC end sequences (BES derived from three minimum tile paths (MTP to examine the extent and homogeneity of polyploid-like regions within contigs and the extent of correlation between the polyploid-like regions inferred from fingerprinting and the polyploid-like sequences inferred from WGS matches. Results Results show that when sequence divergence was 1–10%, the copy number of homeologous regions could be identified from sequence variation in WGS reads overlapping BES. Homeolog sequence variants (HSVs were single nucleotide polymorphisms (SNPs; 89% and single nucleotide indels (SNIs 10%. Larger indels were rare but present (1%. Simulations that had predicted fingerprints of homeologous regions could be separated when divergence exceeded 2% were shown to be false. We show that a 5–10% sequence divergence is necessary to separate homeologs by fingerprinting. BES compared to WGS traces showed polyploid-like regions with less than 1% sequence divergence exist at 2.3% of the locations assayed. Conclusion The use of HSVs like SNPs and SNIs to characterize BACs wil improve contig building methods. The implications for bioinformatic and functional annotation of polyploid and paleopolyploid genomes show that a combined approach of BAC fingerprint based physical maps, WGS sequence and HSV-based partitioning of BAC clones from homeologous regions to separate contigs will allow reliable de

  9. Investigation of Electron Density Profile in the ionospheric D and E region by Kagoshima rocket experiment

    Science.gov (United States)

    Ashihara, Y.; Ishisaka, K.; Miyake, T.; Okada, T.; Nagano, I.; Abe, T.; Ono, T.

    2007-12-01

    The radio wave propagation characteristic in the lower ionosphere is important because of its effect on commercial radio communication, navigation, and broadcast services. The electron density is of primary interest in this region because the high ion-neutral collision frequencies result in radio wave absorption. In order to investigate the ionization structure in the ionospheric D and E region by using the propagation characteristics of MF-band and LF-band radio waves, S-310-37 and S-520-23 sounding rocket experiments have been carried out at Uchinoura Space Center (USC). S-310-37 sounding rocket was launched at 11:20 LT on January 16, 2007. The apex of rocket trajectory was about 138 km. Then S-520-23 sounding rocket was launched at 19:20 LT on September 2, 2007. The apex was about 279 km. As a common measurement, these sounding rockets measure the fields intensities and the waveform of radio waves from NHK Kumamoto broadcasting station (873kHz, 500kW) and JJY signals from Haganeyama LF radio station (60kHz, 50kW). The approximate electron density profile can be determined from the comparison between these experimental results and propagation characteristics calculated by the full wave method. We will get the most probable electron density profile in the ionosphere. In presentation, we will show the propagation characteristic of LF/MF radio waves measured by two sounding rocket experiments. Then we will discuss the analysis method and the estimated electron density profile in the ionosphere.

  10. DNA-PK dependent targeting of DNA-ends to a protein complex assembled on matrix attachment region DNA sequences

    International Nuclear Information System (INIS)

    Mauldin, S.K.; Getts, R.C.; Perez, M.L.; DiRienzo, S.; Stamato, T.D.

    2003-01-01

    Full text: We find that nuclear protein extracts from mammalian cells contain an activity that allows DNA ends to associate with circular pUC18 plasmid DNA. This activity requires the catalytic subunit of DNA-PK (DNA-PKcs) and Ku since it was not observed in mutants lacking Ku or DNA-PKcs but was observed when purified Ku/DNA-PKcs was added to these mutant extracts. Competition experiments between pUC18 and pUC18 plasmids containing various nuclear matrix attachment region (MAR) sequences suggest that DNA ends preferentially associate with plasmids containing MAR DNA sequences. At a 1:5 mass ratio of MAR to pUC18, approximately equal amounts of DNA end binding to the two plasmids were observed, while at a 1:1 ratio no pUC18 end-binding was observed. Calculation of relative binding activities indicates that DNA-end binding activities to MAR sequences was 7 to 21 fold higher than pUC18. Western analysis of proteins bound to pUC18 and MAR plasmids indicates that XRCC4, DNA ligase IV, scaffold attachment factor A, topoisomerase II, and poly(ADP-ribose) polymerase preferentially associate with the MAR plasmid in the absence or presence of DNA ends. In contrast, Ku and DNA-PKcs were found on the MAR plasmid only in the presence of DNA ends. After electroporation of a 32P-labeled DNA probe into human cells and cell fractionation, 87% of the total intercellular radioactivity remained in nuclei after a 0.5M NaCl extraction suggesting the probe was strongly bound in the nucleus. The above observations raise the possibility that DNA-PK targets DNA-ends to a repair and/or DNA damage signaling complex which is assembled on MAR sites in the nucleus

  11. Geographic structure and demographic history of Iranian brown bear (Ursus arctos based on mtDNA control region sequences

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Ashrafzadeh

    2015-12-01

    Full Text Available In recent years, the brown bear's range has declined and its populations in some areas have faced extinction. Therefore, to have a comprehensive picture of genetic diversity and geographic structure of populations is essential for effective conservation strategies. In this research, we sequenced a 271bp segment of mtDNA control region of seven Iranian brown bears, where a total dataset of 467 sequences (brown and polar bears were used in analyses. Overall, 113 different haplotypes and 77 polymorphic sites were identified within the segment. Based on phylogenetic analyses, Iranian brown bears were not nested in any other clades. The low values of Nm (range=0.014-0.187 and high values of Fst (range=0.728-0.972 among Iranian bears and others revealed a genetically significant differentiation. We aren't found any significant signal of demographic reduction in Iranian bears. The time to the most recent common ancestor of Iranian brown bears (Northern Iran was found to be around 19000 BP.

  12. Rapid profiling of the antigen regions recognized by serum antibodies using massively parallel sequencing of antigen-specific libraries.

    KAUST Repository

    Domina, Maria; Lanza Cariccio, Veronica; Benfatto, Salvatore; D'Aliberti, Deborah; Venza, Mario; Borgogni, Erica; Castellino, Flora; Biondo, Carmelo; D'Andrea, Daniel; Grassi, Luigi; Tramontano, Anna; Teti, Giuseppe; Felici, Franco; Beninati, Concetta

    2014-01-01

    There is a need for techniques capable of identifying the antigenic epitopes targeted by polyclonal antibody responses during deliberate or natural immunization. Although successful, traditional phage library screening is laborious and can map only some of the epitopes. To accelerate and improve epitope identification, we have employed massive sequencing of phage-displayed antigen-specific libraries using the Illumina MiSeq platform. This enabled us to precisely identify the regions of a model antigen, the meningococcal NadA virulence factor, targeted by serum antibodies in vaccinated individuals and to rank hundreds of antigenic fragments according to their immunoreactivity. We found that next generation sequencing can significantly empower the analysis of antigen-specific libraries by allowing simultaneous processing of dozens of library/serum combinations in less than two days, including the time required for antibody-mediated library selection. Moreover, compared with traditional plaque picking, the new technology (named Phage-based Representation OF Immuno-Ligand Epitope Repertoire or PROFILER) provides superior resolution in epitope identification. PROFILER seems ideally suited to streamline and guide rational antigen design, adjuvant selection, and quality control of newly produced vaccines. Furthermore, this method is also susceptible to find important applications in other fields covered by traditional quantitative serology.

  13. Identification of a nuclear matrix attachment region like sequence in the last intron of PI3Kγ

    International Nuclear Information System (INIS)

    Dai Bingbing; Ying Lei; Cai Rong; Li Ying; Zhang Xingqian; Lu Jian; Qian Guanxiang

    2006-01-01

    MARs are not only the structure bases of chromatin higher order structure but also have much biological significance. In this study, the whole sequence of about 100 kb in length from BAC clone of GS1-223D4 (GI: 5931478), in which human PI3Kγ gene is localized, was analyzed by two online-based computer programs, MARFinder and SMARTest. A strong potential MAR was predicted in the last and largest intron of PI3Kγ. The predicted 2 kb MAR, we refer to PIMAR, was further analyzed through biochemical methods in vitro and in vivo. The results showed that the PIMAR could be associated with nuclear matrices from HeLa cells both in vitro and in vivo. Further reporter gene analysis showed that in the transient transfection the expression of reporter gene linked with reversed PIMAR was repressed slightly, while in stably integrated state, the luciferase reporter both linked with reversed and orientated PIMAR was enhanced greatly in NIH-3T3 and K-562. These results suggest that the PIMAR maybe has the capacity of shielding integrated heterogeneous gene from chromatin position effect. Through combination of computer program analysis with confirmation by biochemical methods, we identified, for First time, a 2 kb matrix attachment region like sequence in the last intron of human PI3Kγ

  14. Rapid profiling of the antigen regions recognized by serum antibodies using massively parallel sequencing of antigen-specific libraries.

    Directory of Open Access Journals (Sweden)

    Maria Domina

    Full Text Available There is a need for techniques capable of identifying the antigenic epitopes targeted by polyclonal antibody responses during deliberate or natural immunization. Although successful, traditional phage library screening is laborious and can map only some of the epitopes. To accelerate and improve epitope identification, we have employed massive sequencing of phage-displayed antigen-specific libraries using the Illumina MiSeq platform. This enabled us to precisely identify the regions of a model antigen, the meningococcal NadA virulence factor, targeted by serum antibodies in vaccinated individuals and to rank hundreds of antigenic fragments according to their immunoreactivity. We found that next generation sequencing can significantly empower the analysis of antigen-specific libraries by allowing simultaneous processing of dozens of library/serum combinations in less than two days, including the time required for antibody-mediated library selection. Moreover, compared with traditional plaque picking, the new technology (named Phage-based Representation OF Immuno-Ligand Epitope Repertoire or PROFILER provides superior resolution in epitope identification. PROFILER seems ideally suited to streamline and guide rational antigen design, adjuvant selection, and quality control of newly produced vaccines. Furthermore, this method is also susceptible to find important applications in other fields covered by traditional quantitative serology.

  15. Rapid profiling of the antigen regions recognized by serum antibodies using massively parallel sequencing of antigen-specific libraries.

    KAUST Repository

    Domina, Maria

    2014-12-04

    There is a need for techniques capable of identifying the antigenic epitopes targeted by polyclonal antibody responses during deliberate or natural immunization. Although successful, traditional phage library screening is laborious and can map only some of the epitopes. To accelerate and improve epitope identification, we have employed massive sequencing of phage-displayed antigen-specific libraries using the Illumina MiSeq platform. This enabled us to precisely identify the regions of a model antigen, the meningococcal NadA virulence factor, targeted by serum antibodies in vaccinated individuals and to rank hundreds of antigenic fragments according to their immunoreactivity. We found that next generation sequencing can significantly empower the analysis of antigen-specific libraries by allowing simultaneous processing of dozens of library/serum combinations in less than two days, including the time required for antibody-mediated library selection. Moreover, compared with traditional plaque picking, the new technology (named Phage-based Representation OF Immuno-Ligand Epitope Repertoire or PROFILER) provides superior resolution in epitope identification. PROFILER seems ideally suited to streamline and guide rational antigen design, adjuvant selection, and quality control of newly produced vaccines. Furthermore, this method is also susceptible to find important applications in other fields covered by traditional quantitative serology.

  16. Spatiotemporal reconstruction of the Aquilegia rapid radiation through next-generation sequencing of rapidly evolving cpDNA regions.

    Science.gov (United States)

    Fior, Simone; Li, Mingai; Oxelman, Bengt; Viola, Roberto; Hodges, Scott A; Ometto, Lino; Varotto, Claudio

    2013-04-01

    Aquilegia is a well-known model system in the field of evolutionary biology, but obtaining a resolved and well-supported phylogenetic reconstruction for the genus has been hindered by its recent and rapid diversification. Here, we applied 454 next-generation sequencing to PCR amplicons of 21 of the most rapidly evolving regions of the plastome to generate c. 24 kb of sequences from each of 84 individuals from throughout the genus. The resulting phylogeny has well-supported resolution of the main lineages of the genus, although recent diversification such as in the European taxa remains unresolved. By producing a chronogram of the whole Ranunculaceae family based on published data, we inferred calibration points for dating the Aquilegia radiation. The genus originated in the upper Miocene c. 6.9 million yr ago (Ma) in Eastern Asia, and diversification occurred c. 4.8 Ma with the split of two main clades, one colonizing North America, and the other Western Eurasia through the mountains of Central Asia. This was followed by a back-to-Asia migration, originating from the European stock using a North Asian route. These results provide the first backbone phylogeny and spatiotemporal reconstruction of the Aquilegia radiation, and constitute a robust framework to address the adaptative nature of speciation within the group. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

  17. Physics in the GeV region with polarized targets in electron storage rings

    International Nuclear Information System (INIS)

    Holt, R.J.

    1988-01-01

    There is evidence from the D(γ,p)n reaction that the meson-exchange model is failing in the GeV region. Surprisingly, it appears that the new (Dγ,p)n data favor the energy dependence of the nuclear chromodynamics model rather that of the meson-exchange model. Application of the polarization method to electron scattering studies is in its infancy, and it is potentially a very powerful technique. The internal target method coupled with laser-driven polarized targets should represent an important tool for nuclear physics

  18. Region-wide and ecotype-specific differences in demographic histories of threespine stickleback populations, estimated from whole genome sequences.

    Science.gov (United States)

    Liu, Shenglin; Hansen, Michael M; Jacobsen, Magnus W

    2016-10-01

    We analysed 81 whole genome sequences of threespine sticklebacks from Pacific North America, Greenland and Northern Europe, representing 16 populations. Principal component analysis of nuclear SNPs grouped populations according to geographical location, with Pacific populations being more divergent from each other relative to European and Greenlandic populations. Analysis of mitogenome sequences showed Northern European populations to represent a single phylogeographical lineage, whereas Greenlandic and particularly Pacific populations showed admixture between lineages. We estimated demographic history using a genomewide coalescence with recombination approach. The Pacific populations showed gradual population expansion starting >100 Kya, possibly reflecting persistence in cryptic refuges near the present distributional range, although we do not rule out possible influence of ancient admixture. Sharp population declines ca. 14-15 Kya were suggested to reflect founding of freshwater populations by marine ancestors. In Greenland and Northern Europe, demographic expansion started ca. 20-25 Kya coinciding with the end of the Last Glacial Maximum. In both regions, marine and freshwater populations started to show different demographic trajectories ca. 8-9 Kya, suggesting that this was the time of recolonization. In Northern Europe, this estimate was surprisingly late, but found support in subfossil evidence for presence of several freshwater fish species but not sticklebacks 12 Kya. The results demonstrate distinctly different demographic histories across geographical regions with potential consequences for adaptive processes. They also provide empirical support for previous assumptions about freshwater populations being founded independently from large, coherent marine populations, a key element in the Transporter Hypothesis invoked to explain the widespread occurrence of parallel evolution across freshwater stickleback populations. © 2016 John Wiley & Sons Ltd.

  19. Electron beam asymmetry measurements from exclusive pi0 electroproduction in the Delta(1232) resonance region

    Energy Technology Data Exchange (ETDEWEB)

    K. Joo

    2003-05-01

    The polarized longitudinal-transverse structure function sigma_LT'in the p(e,e'p)pi^0 reaction has been measured for the first time in the Delta(1232) resonance region for invariant mass W = 1.1 - 1.3 GeV and at four-momentum transfer Q^2 = 0.40 and 0.65 GeV^2. Data were taken at the Thomas Jefferson National Accelerator Facility with the CEBAF Large Acceptance Spectrometer (CLAS) using longitudinally polarized electrons at an energy of 1.515 GeV. This newly measured sigma_LT' provides new and unique information on the interference between resonant and non-resonant amplitudes in the Delta(1232) resonance region. The comparison to recent phenomenological calculations shows sensitivity to the description of non-resonant amplitudes and higher resonances.

  20. Reconstructing Regional Ionospheric Electron Density: A Combined Spherical Slepian Function and Empirical Orthogonal Function Approach

    Science.gov (United States)

    Farzaneh, Saeed; Forootan, Ehsan

    2018-03-01

    The computerized ionospheric tomography is a method for imaging the Earth's ionosphere using a sounding technique and computing the slant total electron content (STEC) values from data of the global positioning system (GPS). The most common approach for ionospheric tomography is the voxel-based model, in which (1) the ionosphere is divided into voxels, (2) the STEC is then measured along (many) satellite signal paths, and finally (3) an inversion procedure is applied to reconstruct the electron density distribution of the ionosphere. In this study, a computationally efficient approach is introduced, which improves the inversion procedure of step 3. Our proposed method combines the empirical orthogonal function and the spherical Slepian base functions to describe the vertical and horizontal distribution of electron density, respectively. Thus, it can be applied on regional and global case studies. Numerical application is demonstrated using the ground-based GPS data over South America. Our results are validated against ionospheric tomography obtained from the constellation observing system for meteorology, ionosphere, and climate (COSMIC) observations and the global ionosphere map estimated by international centers, as well as by comparison with STEC derived from independent GPS stations. Using the proposed approach, we find that while using 30 GPS measurements in South America, one can achieve comparable accuracy with those from COSMIC data within the reported accuracy (1 × 1011 el/cm3) of the product. Comparisons with real observations of two GPS stations indicate an absolute difference is less than 2 TECU (where 1 total electron content unit, TECU, is 1016 electrons/m2).

  1. Constraining controls on carbonate sequences with high-resolution chronostratigraphy: Upper Miocene, Cabo de Gata region, SE Spain

    Science.gov (United States)

    Montgomery, P.; Farr, M.R.; Franseen, E.K.; Goldstein, R.H.

    2001-01-01

    A high-resolution chronostratigraphy has been developed for Miocene shallow-water carbonate strata in the Cabo de Gata region of SE Spain for evaluation of local, regional and global factors that controlled platform architecture prior to and during the Messinian salinity crisis. Paleomagnetic data were collected from strata at three localities. Mean natural remanent magnetization (NRM) ranges between 1.53 ?? 10-8 and 5.2 ?? 10-3 Am2/kg. Incremental thermal and alternating field demagnetization isolated the characteristic remanent magnetization (ChRM). Rock magnetic studies show that the dominant magnetic mineral is magnetite, but mixtures of magnetite and hematite occur. A composite chronostratigraphy was derived from five stratigraphic sections. Regional stratigraphic data, biostratigraphic data, and an 40Ar/39Ar date of 8.5 ?? 0.1 Ma, for an interbedded volcanic flow, place the strata in geomagnetic polarity Chrons C4r to C3r. Sequence-stratigraphic and diagenetic evidence indicate a major unconformity at the base of depositional sequence (DS)3 that contains a prograding reef complex, suggesting that approximately 250 000 yr of record (Subchrons C3Br.2r to 3Br.1r) are missing near the Messinian-Tortonian boundary. Correlation to the GPTS shows that the studied strata represent five third- to fourth-order DSs. Basal units are temperate to subtropical ramps (DS1A, DS1B, DS2); these are overlain by subtropical to tropical reefal platforms (DS3), which are capped by subtropical to tropical cyclic carbonates (Terminal Carbonate Complex, TCC). Correlation of the Cabo de Gata record to the Melilla area of Morocco, and the Sorbas basin of Spain indicate that early - Late Tortonian ramp strata from these areas are partially time-equivalent. Similar strata are extensively developed in the Western Mediterranean and likely were influenced by a cool climate or influx of nutrients during an overall rise in global sea-level. After ramp deposition, a sequence boundary (SB3) in

  2. Electron energy distribution function in the divertor region of the COMPASS tokamak during neutral beam injection heating

    Science.gov (United States)

    Hasan, E.; Dimitrova, M.; Havlicek, J.; Mitošinková, K.; Stöckel, J.; Varju, J.; Popov, Tsv K.; Komm, M.; Dejarnac, R.; Hacek, P.; Panek, R.; the COMPASS Team

    2018-02-01

    This paper presents the results from swept probe measurements in the divertor region of the COMPASS tokamak in D-shaped, L-mode discharges, with toroidal magnetic field BT = 1.15 T, plasma current Ip = 180 kA and line-average electron densities varying from 2 to 8×1019 m-3. Using neutral beam injection heating, the electron energy distribution function is studied before and during the application of the beam. The current-voltage characteristics data are processed using the first-derivative probe technique. This technique allows one to evaluate the plasma potential and the real electron energy distribution function (respectively, the electron temperatures and densities). At the low average electron density of 2×1019 m-3, the electron energy distribution function is bi-Maxwellian with a low-energy electron population with temperatures 4-6 eV and a high-energy electron group 12-25 eV. As the line-average electron density is increased, the electron temperatures decrease. At line-average electron densities above 7×1019 m-3, the electron energy distribution function is found to be Maxwellian with a temperature of 6-8.5 eV. The effect of the neutral beam injection heating power in the divertor region is also studied.

  3. The effects of alignment quality, distance calculation method, sequence filtering, and region on the analysis of 16S rRNA gene-based studies.

    Directory of Open Access Journals (Sweden)

    Patrick D Schloss

    Full Text Available Pyrosequencing of PCR-amplified fragments that target variable regions within the 16S rRNA gene has quickly become a powerful method for analyzing the membership and structure of microbial communities. This approach has revealed and introduced questions that were not fully appreciated by those carrying out traditional Sanger sequencing-based methods. These include the effects of alignment quality, the best method of calculating pairwise genetic distances for 16S rRNA genes, whether it is appropriate to filter variable regions, and how the choice of variable region relates to the genetic diversity observed in full-length sequences. I used a diverse collection of 13,501 high-quality full-length sequences to assess each of these questions. First, alignment quality had a significant impact on distance values and downstream analyses. Specifically, the greengenes alignment, which does a poor job of aligning variable regions, predicted higher genetic diversity, richness, and phylogenetic diversity than the SILVA and RDP-based alignments. Second, the effect of different gap treatments in determining pairwise genetic distances was strongly affected by the variation in sequence length for a region; however, the effect of different calculation methods was subtle when determining the sample's richness or phylogenetic diversity for a region. Third, applying a sequence mask to remove variable positions had a profound impact on genetic distances by muting the observed richness and phylogenetic diversity. Finally, the genetic distances calculated for each of the variable regions did a poor job of correlating with the full-length gene. Thus, while it is tempting to apply traditional cutoff levels derived for full-length sequences to these shorter sequences, it is not advisable. Analysis of beta-diversity metrics showed that each of these factors can have a significant impact on the comparison of community membership and structure. Taken together, these results

  4. Introduction of the Python script STRinNGS for analysis of STR regions in FASTQ or BAM files and expansion of the Danish STR sequence database to 11 STRs

    DEFF Research Database (Denmark)

    Friis, Susanne L; Buchard, Anders; Rockenbauer, Eszter

    2016-01-01

    This work introduces the in-house developed Python application STRinNGS for analysis of STR sequence elements in BAM or FASTQ files. STRinNGS identifies sequence reads with STR loci by their flanking sequences, it analyses the STR sequence and the flanking regions, and generates a report with the......This work introduces the in-house developed Python application STRinNGS for analysis of STR sequence elements in BAM or FASTQ files. STRinNGS identifies sequence reads with STR loci by their flanking sequences, it analyses the STR sequence and the flanking regions, and generates a report...

  5. Rocket observation of electron density irregularities in the lower E region

    International Nuclear Information System (INIS)

    Watanabe, Yuzo; Nakamura, Yoshiharu; Amemiya, Hiroshi.

    1990-01-01

    Local ionospheric electron density irregularities in the scale size of 3 m to 300 m have been measured on the ascending path from 74 km to 93 km by a fix biased Langmuir probe on board the S-310-16 sounding rocket. The rocket was launched at 22:40:00 on February 1, 1986 from Kagoshima Space Center in Japan. It is found from frequency analysis of the data that the spectral index of the irregularities is 0.9 to 1.8 and the irregularity amplitude is 1 to 15 %. The altitude where the amplitude reaches its maximum is 88 km. The generation mechanism of these irregularities is explained by the neutral turbulence theory, which indicates that the spectral index is 5/3 and has been confirmed by a chemical release experiment using rockets over India to be valid up to about 110 km. From frequency analysis of the data observed during the descent in the lower E region, we have found that the rocket-wake effect becomes larger when the probe is situated near the edge of the rocket-wake, and that this is also the case even when the rocket-wake effect does not clearly appear in the DC current signal which approximately changes in proportion to the electron density, where the probe is completely situated inside the rocket-wake region. (author)

  6. Identification and systematical studies of the electron-capture delayed fission (ECDF) in the lead region

    CERN Multimedia

    Pauwels, D B; Lane, J

    2008-01-01

    In our recent experiment (March 2007) at the velocity filter SHIP(GSI) we observed the electron-capture delayed fission of the odd-odd isotope $^{194}$At. This is the first unambiguous identification of this phenomenon in the very neutron-deficient nuclei in the vicinity of the proton shell closure at Z=82. In addition, the total kinetic energy (TKE) for the daughter nuclide $^{194}$Po was measured, despite the fact that this isotope does not decay via spontaneous fission. Semi-empirical analysis of the electron-capture Q$_{EC}$ values and fission barriers B$_{f}$ shows that a relatively broad island of ECDF must exist in this region of the Nuclide Chart, with some of the nuclei having unusually high ECDF probabilities. Therefore, this Proposal is intended to initiate the systematic identification and study of $\\beta$-delayed fission at ISOLDE in the very neutron-deficient lead region. Our aim is to provide unique low-energy fission data (e.g. probabilities, TKE release, fission barriers and their isospin dep...

  7. Evolution of electron pitch angle distributions across Saturn's middle magnetospheric region from MIMI/LEMMS

    Science.gov (United States)

    Clark, G.; Paranicas, C.; Santos-Costa, D.; Livi, S.; Krupp, N.; Mitchell, D. G.; Roussos, E.; Tseng, W.-L.

    2014-12-01

    We provide a global view of ~20 to 800 keV electron pitch angle distributions (PADs) close to Saturn's current sheet using observations from the Cassini MIMI/LEMMS instrument. Previous work indicated that the nature of pitch angle distributions in Saturn's inner to middle magnetosphere changes near the radial distance of 10RS. This work confirms the existence of a PAD transition region. Here we go further and develop a new technique to statistically quantify the spatial profile of butterfly PADs as well as present new spatial trends on the isotropic PAD. Additionally, we perform a case study analysis and show the PADs exhibit strong energy dependent features throughout this transition region. We also present a diffusion theory model based on adiabatic transport, Coulomb interactions with Saturn's neutral gas torus, and an energy dependent radial diffusion coefficient. A data-model comparison reveals that adiabatic transport is the dominant transport mechanism between ~8 to 12RS, however interactions with Saturn's neutral gas torus become dominant inside ~7RS and govern the flux level of ~20 to 800 keV electrons. We have also found that field-aligned fluxes were not well reproduced by our modeling approach. We suggest that wave-particle interactions and/or a polar source of the energetic particles needs further investigation.

  8. Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

    Science.gov (United States)

    de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

    2015-01-01

    The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  9. Observation of electron biteout regions below sporadic E layers at polar latitudes

    Directory of Open Access Journals (Sweden)

    G. A. Lehmacher

    2015-03-01

    Full Text Available The descent of a narrow sporadic E layer near 95 km altitude over Poker Flat Research Range in Alaska was observed with electron probes on two consecutive sounding rockets and with incoherent scatter radar during a 2 h period near magnetic midnight. A series of four trimethyl aluminum chemical releases demonstrated that the Es layer remained just slightly above the zonal wind node, which was slowly descending due to propagating long-period gravity waves. The location of the layer is consistent with the equilibrium position due to combined action of the wind shear and electric fields. Although the horizontal electric field could not be measured directly, we estimate that it was ~ 2 mV m−1 southward, consistent with modeling the vertical ion drift, and compatible with extremely quiet conditions. Both electron probes observed deep biteout regions just below the Es enhancements, which also descended with the sporadic layers. We discuss several possibilities for the cause of these depletions; one possibility is the presence of negatively charged, nanometer-sized mesospheric smoke particles. Such particles have recently been detected in the upper mesosphere, but not yet in immediate connection with sporadic E. Our observations of electron depletions suggest a new process associated with sporadic E.

  10. Evaluation of Maxim Module-Integrated Electronics at the DOE Regional Test Centers: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Deline, C.; Sekulic, B.; Stein, J.; Barkaszi, S.; Yang, J.; Kahn, S.

    2014-07-01

    Module-embedded power electronics developed by Maxim Integrated are under evaluation through a partnership with the Department of Energy's Regional Test Center (RTC) program. Field deployments of both conventional modules and electronics-enhanced modules are designed to quantify the performance advantage of Maxim's products under different amounts of inter-row shading, and their ability to be deployed at a greater ground-coverage-ratio than conventional modules. Simulations in PVSYST have quantified the predicted performance difference between conventional modules and Maxim's modules from inter-row shading. Initial performance results have identified diffuse irradiance losses at tighter row spacing for both the Maxim and conventional modules. Comparisons with published models show good agreement with models predicting the greatest diffuse irradiance losses. At tighter row spacing, all of the strings equipped with embedded power electronics outperformed their conventional peers. An even greater performance advantage is predicted to occur in the winter months when the amount of inter-row shading mismatch is at a maximum.

  11. Genetic relatedness among indigenous rice varieties in the Eastern Himalayan region based on nucleotide sequences of the Waxy gene.

    Science.gov (United States)

    Choudhury, Baharul I; Khan, Mohammed L; Dayanandan, Selvadurai

    2014-12-29

    Indigenous rice varieties in the Eastern Himalayan region of Northeast India are traditionally classified into sali, boro and jum ecotypes based on geographical locality and the season of cultivation. In this study, we used DNA sequence data from the Waxy (Wx) gene to infer the genetic relatedness among indigenous rice varieties in Northeast India and to assess the genetic distinctiveness of ecotypes. The results of all three analyses (Bayesian, Maximum Parsimony and Neighbor Joining) were congruent and revealed two genetically distinct clusters of rice varieties in the region. The large group comprised several varieties of sali and boro ecotypes, and all agronomically improved varieties. The small group consisted of only traditionally cultivated indigenous rice varieties, which included one boro, few sali and all jum varieties. The fixation index analysis revealed a very low level of differentiation between sali and boro (F(ST) = 0.005), moderate differentiation between sali and jum (F(ST) = 0.108) and high differentiation between jum and boro (F(ST) = 0.230) ecotypes. The genetic relatedness analyses revealed that sali, boro and jum ecotypes are genetically heterogeneous, and the current classification based on cultivation type is not congruent with the genetic background of rice varieties. Indigenous rice varieties chosen from genetically distinct clusters could be used in breeding programs to improve genetic gain through heterosis, while maintaining high genetic diversity.

  12. Sequence requirements of the HIV-1 protease flap region determined by saturation mutagenesis and kinetic analysis of flap mutants

    Science.gov (United States)

    Shao, Wei; Everitt, Lorraine; Manchester, Marianne; Loeb, Daniel D.; Hutchison, Clyde A.; Swanstrom, Ronald

    1997-01-01

    The retroviral proteases (PRs) have a structural feature called the flap, which consists of a short antiparallel β-sheet with a turn. The flap extends over the substrate binding cleft and must be flexible to allow entry and exit of the polypeptide substrates and products. We analyzed the sequence requirements of the amino acids within the flap region (positions 46–56) of the HIV-1 PR. The phenotypes of 131 substitution mutants were determined using a bacterial expression system. Four of the mutant PRs with mutations in different regions of the flap were selected for kinetic analysis. Our phenotypic analysis, considered in the context of published structures of the HIV-1 PR with a bound substrate analogs, shows that: (i) Met-46 and Phe-53 participate in hydrophobic interactions on the solvent-exposed face of the flap; (ii) Ile-47, Ile-54, and Val-56 participate in hydrophobic interactions on the inner face of the flap; (iii) Ile-50 has hydrophobic interactions at the distance of both the δ and γ carbons; (iv) the three glycine residues in the β-turn of the flap are virtually intolerant of substitutions. Among these mutant PRs, we have identified changes in both kcat and Km. These results establish the nature of the side chain requirements at each position in the flap and document a role for the flap in both substrate binding and catalysis. PMID:9122179

  13. Genetic relationships among some subspecies of the Peregrine Falcon (Falco peregrinus L.), inferred from mitochondrial DNA control-region sequences

    Science.gov (United States)

    White, Clayton M.; Sonsthagen, Sarah A.; Sage, George K.; Anderson, Clifford; Talbot, Sandra L.

    2013-01-01

    The ability to successfully colonize and persist in diverse environments likely requires broad morphological and behavioral plasticity and adaptability, and this may partly explain why the Peregrine Falcon (Falco peregrinus) exhibits a large range of morphological characteristics across their global distribution. Regional and local differences within Peregrine Falcons were sufficiently variable that ∼75 subspecies have been described; many were subsumed, and currently 19 are generally recognized. We used sequence information from the control region of the mitochondrial genome to test for concordance between genetic structure and representatives of 12 current subspecies and from two areas where subspecies distributions overlap. Haplotypes were broadly shared among subspecies, and all geographic locales shared a widely distributed common haplotype (FalconCR2). Haplotypes were distributed in a star-like phylogeny, consistent with rapid expansion of a recently derived species, with observed genetic patterns congruent with incomplete lineage sorting and/or differential rates of evolution on morphology and neutral genetic characters. Hierarchical analyses of molecular variance did not uncover genetic partitioning at the continental level, despite strong population-level structure (FST = 0.228). Similar analyses found weak partitioning, albeit significant, among subspecies (FCT = 0.138). All reconstructions placed the hierofalcons' (Gyrfalcon [F. rusticolus] and Saker Falcon [F. cherrug]) haplotypes in a well-supported clade either basal or unresolved with respect to the Peregrine Falcon. In addition, haplotypes representing Taita Falcon (F. fasciinucha) were placed within the Peregrine Falcon clade.

  14. Consensus coding sequence (CCDS) database: a standardized set of human and mouse protein-coding regions supported by expert curation.

    Science.gov (United States)

    Pujar, Shashikant; O'Leary, Nuala A; Farrell, Catherine M; Loveland, Jane E; Mudge, Jonathan M; Wallin, Craig; Girón, Carlos G; Diekhans, Mark; Barnes, If; Bennett, Ruth; Berry, Andrew E; Cox, Eric; Davidson, Claire; Goldfarb, Tamara; Gonzalez, Jose M; Hunt, Toby; Jackson, John; Joardar, Vinita; Kay, Mike P; Kodali, Vamsi K; Martin, Fergal J; McAndrews, Monica; McGarvey, Kelly M; Murphy, Michael; Rajput, Bhanu; Rangwala, Sanjida H; Riddick, Lillian D; Seal, Ruth L; Suner, Marie-Marthe; Webb, David; Zhu, Sophia; Aken, Bronwen L; Bruford, Elspeth A; Bult, Carol J; Frankish, Adam; Murphy, Terence; Pruitt, Kim D

    2018-01-04

    The Consensus Coding Sequence (CCDS) project provides a dataset of protein-coding regions that are identically annotated on the human and mouse reference genome assembly in genome annotations produced independently by NCBI and the Ensembl group at EMBL-EBI. This dataset is the product of an international collaboration that includes NCBI, Ensembl, HUGO Gene Nomenclature Committee, Mouse Genome Informatics and University of California, Santa Cruz. Identically annotated coding regions, which are generated using an automated pipeline and pass multiple quality assurance checks, are assigned a stable and tracked identifier (CCDS ID). Additionally, coordinated manual review by expert curators from the CCDS collaboration helps in maintaining the integrity and high quality of the dataset. The CCDS data are available through an interactive web page (https://www.ncbi.nlm.nih.gov/CCDS/CcdsBrowse.cgi) and an FTP site (ftp://ftp.ncbi.nlm.nih.gov/pub/CCDS/). In this paper, we outline the ongoing work, growth and stability of the CCDS dataset and provide updates on new collaboration members and new features added to the CCDS user interface. We also present expert curation scenarios, with specific examples highlighting the importance of an accurate reference genome assembly and the crucial role played by input from the research community. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

  15. Sequences within the 5' untranslated region regulate the levels of a kinetoplast DNA topoisomerase mRNA during the cell cycle.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Ou, X; Mahmood, R; Ray, D S

    1996-12-01

    Gene expression in trypanosomatids appears to be regulated largely at the posttranscriptional level and involves maturation of mRNA precursors by trans splicing of a 39-nucleotide miniexon sequence to the 5' end of the mRNA and cleavage and polyadenylation at the 3' end of the mRNA. To initiate the identification of sequences involved in the periodic expression of DNA replication genes in trypanosomatids, we have mapped splice acceptor sites in the 5' flanking region of the TOP2 gene, which encodes the kinetoplast DNA topoisomerase, and have carried out deletion analysis of this region on a plasmid-encoded TOP2 gene. Block deletions within the 5' untranslated region (UTR) identified two regions (-608 to -388 and -387 to -186) responsible for periodic accumulation of the mRNA. Deletion of one or the other of these sequences had no effect on periodic expression of the mRNA, while deletion of both regions resulted in constitutive expression of the mRNA throughout the cell cycle. Subcloning of these sequences into the 5' UTR of a construct lacking both regions of the TOP2 5' UTR has shown that an octamer consensus sequence present in the 5' UTR of the TOP2, RPA1, and DHFR-TS mRNAs is required for normal cycling of the TOP2 mRNA. Mutation of the consensus octamer sequence in the TOP2 5' UTR in a plasmid construct containing only a single consensus octamer and that shows normal cycling of the plasmid-encoded TOP2 mRNA resulted in substantial reduction of the cycling of the mRNA level. These results imply a negative regulation of TOP2 mRNA during the cell cycle by a mechanism involving redundant elements containing one or more copies of a conserved octamer sequence within the 5' UTR of TOP2 mRNA.

  16. Isolation of the Drosophila melanogaster dunce chromosomal region and recombinational mapping of dunce sequences with restriction site polymorphisms as genetic markers

    OpenAIRE

    Davis, Ronald L.; Davidson, Norman

    1984-01-01

    Using the method of chromosomal walking, we have isolated a contiguous region of the Drosophila melanogaster X chromosome which corresponds to salivary gland chromosome bands 3C12 to 3D4. This five-band region contains approximately 100 kilobases of DNA, including those sequences comprising dunce, a gene which functions in memory and cyclic nucleotide metabolism. Genome blots of DNA from flies carrying several different chromosomal aberrations with breakpoints in the region have been probed w...

  17. Inclusive electron scattering from nuclei in the quasielastic region at large momentum transfer

    Energy Technology Data Exchange (ETDEWEB)

    Fomin, Nadia [California Inst. of Technology (CalTech), Pasadena, CA (United States)

    2008-12-01

    Experiment E02-019, performed in Hall C at the Thomas Jefferson National Accelerator Facility (TJNAF), was a measurement of inclusive electron cross sections for several nuclei (2H,3He, 4He, 9Be,12C, 63Cu, and 197Au) in the quasielastic region at high momentum transfer. In the region of low energy transfer, the cross sections were analyzed in terms of the reduced response, F(y), by examining its y-scaling behavior. The data were also examined in terms of the nuclear structure function νWA 2 and its behavior in x and the Nachtmann variable ξ. The data show approximate scaling of νWA 2 in ξ for all targets at all kinematics, unlike scaling in x, which is confined to the DIS regime. However, y-scaling observations are limited to the kinematic region dominated by the quasielastic response (y <0), where some scaling violations arising from FSIs are observed.

  18. [Population genetic differentiation of Phrynocephalus axillaris in east of Xinjiang Uygur Autonomous Region based on sequence variation of mitochondrial ND4-tRNALeu gene].

    Science.gov (United States)

    Li, Jun; Guo, Xian-Guang; Wang, Yue-Zhao

    2010-08-01

    A 838 bp fragment of mtDNA ND4-tRNALeu gene was sequenced for 66 individuals from five populations (DB: Dabancheng, TU: Turpan, SS: Shanshan, HL: Liushuquan, HD: East district of Hami) of Phrynocephalus axillaris distributed in east of Xinjiang Uygur Autonomous Region. Seventeen haplotypes were identified from 29 nucleotide polymorphic sites in the aligned 838 bp sequence. Excluding DB, there were relatively high haplotype diversity [(0.600+/-0.113)oscillation since Pleistocene and genetic drift.

  19. Sequencing the GRHL3 Coding Region Reveals Rare Truncating Mutations and a Common Susceptibility Variant for Nonsyndromic Cleft Palate

    Science.gov (United States)

    Mangold, Elisabeth; Böhmer, Anne C.; Ishorst, Nina; Hoebel, Ann-Kathrin; Gültepe, Pinar; Schuenke, Hannah; Klamt, Johanna; Hofmann, Andrea; Gölz, Lina; Raff, Ruth; Tessmann, Peter; Nowak, Stefanie; Reutter, Heiko; Hemprich, Alexander; Kreusch, Thomas; Kramer, Franz-Josef; Braumann, Bert; Reich, Rudolf; Schmidt, Gül; Jäger, Andreas; Reiter, Rudolf; Brosch, Sibylle; Stavusis, Janis; Ishida, Miho; Seselgyte, Rimante; Moore, Gudrun E.; Nöthen, Markus M.; Borck, Guntram; Aldhorae, Khalid A.; Lace, Baiba; Stanier, Philip; Knapp, Michael; Ludwig, Kerstin U.

    2016-01-01

    Nonsyndromic cleft lip with/without cleft palate (nsCL/P) and nonsyndromic cleft palate only (nsCPO) are the most frequent subphenotypes of orofacial clefts. A common syndromic form of orofacial clefting is Van der Woude syndrome (VWS) where individuals have CL/P or CPO, often but not always associated with lower lip pits. Recently, ∼5% of VWS-affected individuals were identified with mutations in the grainy head-like 3 gene (GRHL3). To investigate GRHL3 in nonsyndromic clefting, we sequenced its coding region in 576 Europeans with nsCL/P and 96 with nsCPO. Most strikingly, nsCPO-affected individuals had a higher minor allele frequency for rs41268753 (0.099) than control subjects (0.049; p = 1.24 × 10−2). This association was replicated in nsCPO/control cohorts from Latvia, Yemen, and the UK (pcombined = 2.63 × 10−5; ORallelic = 2.46 [95% CI 1.6–3.7]) and reached genome-wide significance in combination with imputed data from a GWAS in nsCPO triads (p = 2.73 × 10−9). Notably, rs41268753 is not associated with nsCL/P (p = 0.45). rs41268753 encodes the highly conserved p.Thr454Met (c.1361C>T) (GERP = 5.3), which prediction programs denote as deleterious, has a CADD score of 29.6, and increases protein binding capacity in silico. Sequencing also revealed four novel truncating GRHL3 mutations including two that were de novo in four families, where all nine individuals harboring mutations had nsCPO. This is important for genetic counseling: given that VWS is rare compared to nsCPO, our data suggest that dominant GRHL3 mutations are more likely to cause nonsyndromic than syndromic CPO. Thus, with rare dominant mutations and a common risk variant in the coding region, we have identified an important contribution for GRHL3 in nsCPO. PMID:27018475

  20. Recombination in the 5' leader of murine leukemia virus is accurate and influenced by sequence identity with a strong bias toward the kissing-loop dimerization region

    DEFF Research Database (Denmark)

    Mikkelsen, J G; Lund, Anders Henrik; Duch, M

    1998-01-01

    during minus-strand DNA synthesis occurred within defined areas of the genome and did not lead to misincorporations at the crossover site. The nonrandom distribution of recombination sites did not reflect a bias for specific sites due to selection at the level of marker gene expression. We address...... whether template switching is affected by the length of sequence identity, by palindromic sequences, and/or by putative stem-loop structures. Sixteen of 24 sites of recombination colocalized with the kissing-loop dimerization region, and we propose that RNA-RNA interactions between palindromic sequences...

  1. Sequence analysis of the 3’-untranslated region of HSP70 (type I genes in the genus Leishmania: its usefulness as a molecular marker for species identification

    Directory of Open Access Journals (Sweden)

    Requena Jose M

    2012-04-01

    Full Text Available Abstract Background The Leishmaniases are a group of clinically diverse diseases caused by parasites of the genus Leishmania. To distinguish between species is crucial for correct diagnosis and prognosis as well as for treatment decisions. Recently, sequencing of the HSP70 coding region has been applied in phylogenetic studies and for identifying of Leishmania species with excellent results. Methods In the present study, we analyzed the 3’-untranslated region (UTR of Leishmania HSP70-type I gene from 24 strains representing eleven Leishmania species in the belief that this non-coding region would have a better discriminatory capacity for species typing than coding regions. Results It was observed that there was a remarkable degree of sequence conservation in this region, even between species of the subgenus Leishmania and Viannia. In addition, the presence of many microsatellites was a common feature of the 3´-UTR of HSP70-I genes in the Leishmania genus. Finally, we constructed dendrograms based on global sequence alignments of the analyzed Leishmania species and strains, the results indicated that this particular region of HSP70 genes might be useful for species (or species complex typing, improving for particular species the discrimination capacity of phylogenetic trees based on HSP70 coding sequences. Given the large size variation of the analyzed region between the Leishmania and Viannia subgenera, direct visualization of the PCR amplification product would allow discrimination between subgenera, and a HaeIII-PCR-RFLP analysis might be used for differentiating some species within each subgenera. Conclusions Sequence and phylogenetic analyses indicated that this region, which is readily amplified using a single pair of primers from both Old and New World Leishmania species, might be useful as a molecular marker for species discrimination.

  2. Thermal equilibrium of pure electron plasmas across a central region of magnetic surfaces

    Science.gov (United States)

    Hahn, Michael; Pedersen, Thomas Sunn

    2009-06-01

    Measurements of the equilibria of plasmas created by emission from a biased filament located off the magnetic axis in the Columbia Non-neutral Torus (CNT) [T. S. Pedersen, J. P. Kremer, R. G. Lefrancois et al., Fusion Sci. Technol. 50, 372 (2006)] show that such plasmas have equilibrium properties consistent with the inner surfaces being in a state of cross-surface thermal equilibrium. Numerical solutions to the equilibrium equation were used to fit the experimental data and demonstrate consistency with cross-surface thermal equilibrium. Previous experiments in CNT showed that constant temperatures across magnetic surfaces are characteristic of CNT plasmas, implying thermal confinement times much less than particle confinement times. These results show that when emitting off axis there is a volume of inner surfaces where diffusion into that region is balanced by outward transport, producing a Boltzmann distribution of electrons. When combined with the low thermal energy confinement time this is a cross-surface thermal equilibrium.

  3. Thermal equilibrium of pure electron plasmas across a central region of magnetic surfaces

    International Nuclear Information System (INIS)

    Hahn, Michael; Pedersen, Thomas Sunn

    2009-01-01

    Measurements of the equilibria of plasmas created by emission from a biased filament located off the magnetic axis in the Columbia Non-neutral Torus (CNT) [T. S. Pedersen, J. P. Kremer, R. G. Lefrancois et al., Fusion Sci. Technol. 50, 372 (2006)] show that such plasmas have equilibrium properties consistent with the inner surfaces being in a state of cross-surface thermal equilibrium. Numerical solutions to the equilibrium equation were used to fit the experimental data and demonstrate consistency with cross-surface thermal equilibrium. Previous experiments in CNT showed that constant temperatures across magnetic surfaces are characteristic of CNT plasmas, implying thermal confinement times much less than particle confinement times. These results show that when emitting off axis there is a volume of inner surfaces where diffusion into that region is balanced by outward transport, producing a Boltzmann distribution of electrons. When combined with the low thermal energy confinement time this is a cross-surface thermal equilibrium.

  4. Trans-Regional technologies and the Lapita problem: characterisation of volcanic glass inclusions by electron microprobe

    International Nuclear Information System (INIS)

    Grave, P.; Nockolds, C.; White, P.

    1997-01-01

    Full text: Analysis of pre-modern pottery of the Pacific has long attempted to formulate measures independent of style for constructing archaeologically meaningful groups. However, the variable character of fabrics and the longevity of production (Lapita and post-Lapita wares from 3000 years ago to the present) have tended to obscure differences due to changes in production practices and resources through time and differences relating to the exchange of ceramics between islands or regions. In this poster we outline a preliminary study that employs an economical and robust technique to distinguish both within- and between-region groups. This is achieved with electron microprobe analysis of small volcanic glass fragments present in wares tempered with volcanic sands, and interpretation based on Principal Components Analysis. The method builds on the chemical groupings for glass from different volcanic complexes in the Pacific established through high energy ion beam (PIXE-PIGME) analysis. The purpose of this study is to characterise a selection of samples of pottery from the Duke of York's peninsula using electron microprobe analysis of very small glass fragments in the sections that ranged in size from around 0.05 mm to 1 mm.. The study involved the identification and elemental characterisation of individual fragments of glass in a section. Principal Component Analysis was used to identify structure latent in the dataset. The results of the study show that clear characterisation is possible to enable the wider application of the technique to Lapita and post Lapita ceramics produced originating in volcanic areas of the Pacific

  5. Pedological and mineralogical investigations on a soil-paleosoil sequence within Andosols in the Western Cordillera of the Peruvian Andes (region Laramate, 14.5S)

    Science.gov (United States)

    Leceta Gobitz, Fernando; Mächtle, Bertil; Schukraft, Gerd; Meyer, Hans-Peter; Eitel, Bernhard

    2016-04-01

    An integrated research project of environmental sciences focuses on a group of four Andosol profiles in Western flank of the Peruvian southern Andes. Aim of this study is to contribute to the reconstruction of the paleo environmental conditions in the Western Cordillera of the Peruvian Andes. Standard pedological and sedimentological analysis has been conducted in order to identify morphological and geochemical features generated by climatic variations during the middle and late Holocene. Though a provenance analysis of sediments, all potential lithological sources around the town of Laramate are being examined under the scanning electron microscope, in order to find significant mineralogical associations downward the soil-profile. Preliminary results reveal two edaphic cycles within a soil-paleo soil-sequence: a relative poor developed "Ah" topsoil, mostly composed by fine grain sediments, is underlain by a well preserved "2Ah" paleo soil; a "2Bwt" subsoil exhibits signs of alteration and clay translocation; parent material in slight weathered statement at "2C" culminates the sequence. Mineralogical analytical data supports the premise, that materials in the uppermost horizons are relatable to distal geological units of the Western and Eastern Cordillera, therefore also related to other described aeolian archives from the region: "Desert Margin Loess" at the Andean foot-zone and "Mixed Loess" in the Puna grassland. The amphibole varieties Actinolite, Mg-Hornblende and Edenite could be only distinguished within the soil sediments. The fluvial transport to its current position is excluded, insofar mentioned varieties stem from the granodiorites of Coastal Batholite (downstream the study area), and the vulcanites of the Anta und Andahuaylas Formation (eastward the continental divide). References: Eitel, B., et al. (2005). "Geoarchaeological evidence from desert loess in the Nazca-Palpa region, southern Peru : Palaeoenvironmental changes and their impact on Pre

  6. Electron precipitation burst in the nighttime slot region measured simultaneously from two satellites

    International Nuclear Information System (INIS)

    Imhof, W.L.; Voss, H.D.; Mobilla, J.; Gaines, E.E.; Evans, D.S.

    1987-01-01

    Based on data acquired in 1982 with the Stimulated Emission of Energetic Particles payload on the low-altitude (170--280 km) S81-1 spacecraft and the Space Environment Monitor instrumentation on the NOAA 6 satellite (800--830 km), a study has been made of short-duration nighttime electron precipitation bursts at L = 2.0--35. From 54 passes of each satellite across the slot region simultaneously in time, 21 bursts were observed on the NOAA 6 spacecraft, and 76 on the S81-1 satellite. Five events, probably associated with lightning, were observed simultaneously from the two spacecraft within 1.2 s, providing a measure of the spatial extent of the bursts. This limited sample indicates that the intensity of precipitation events falls off with width in longitude and L shell but individual events extend as much as 5 0 in invariant latitude and 43 0 in longitude. The number of events above a given flux observed in each satellite was found to be approximately inversely proportional to the flux. The time average energy input to the atmosphere over the longitude range 180 0 E to 360 0 E at a local time of 2230 directly from short-duration bursts spanning a wide range of intensity enhancements was estimated to be about 6 x 10/sup -6/ ergs/cm 2 s in the northern hemisphere and about 1.5 x 10/sup -5/ ergs/cm 2 s in the southern hemisphere. In the south, this energy precipitation rate is lower than that from electrons in the drift loss cone by about 2 orders of magnitude. However, on the basis of these data alone we cannot discount weak bursts from being a major contributor to populating the drift loss cone with electrons which ultimately precipitate into the atmosphere. copyrightAmerican Geophysical Union 1987

  7. THE ELECTRON DENSITY IN EXPLOSIVE TRANSITION REGION EVENTS OBSERVED BY IRIS

    Energy Technology Data Exchange (ETDEWEB)

    Doschek, G. A.; Warren, H. P. [Space Science Division, Naval Research Laboratory, 4555 Overlook Avenue, SW, Washington, DC 20375 (United States); Young, P. R. [College of Science, George Mason University, 4400 University Drive, Fairfax, VA 22030 (United States)

    2016-11-20

    We discuss the intensity ratio of the O iv line at 1401.16 Å to the Si iv line at 1402.77 Å in Interface Region Imaging Spectrograph ( IRIS ) spectra. This intensity ratio is important if it can be used to measure high electron densities that cannot be measured using line intensity ratios of two different O iv lines from the multiplet within the IRIS wavelength range. Our discussion is in terms of considerably earlier observations made from the Skylab manned space station and other spectrometers on orbiting spacecraft. The earlier data on the O iv and Si iv ratio and other intersystem line ratios not available to IRIS are complementary to IRIS data. In this paper, we adopt a simple interpretation based on electron density. We adopt a set of assumptions and calculate the electron density as a function of velocity in the Si iv line profiles of two explosive events. At zero velocity the densities are about 2–3 × 10{sup 11} cm{sup -3}, and near 200 km s{sup -1} outflow speed the densities are about 10{sup 12} cm{sup -3}. The densities increase with outflow speed up to about 150 km s{sup -1} after which they level off. Because of the difference in the temperature of formation of the two lines and other possible effects such as non-ionization equilibrium, these density measurements do not have the precision that would be available if there were some additional lines near the formation temperature of O iv.

  8. Three-dimentional imaging of dentomaxillofacial region using electron beam tomography

    International Nuclear Information System (INIS)

    Tanaka, Takemasa; Kanda, Shigenobu; Muranaka, Toru

    1998-01-01

    Authors reported their results of the 3-D imaging of dentomaxillofacial region mainly for jaw deformity with electron beam tomography (EBT). The EBT apparatus used was Imatron C-100 (Imatron Corp.), with which, using bremsstrahlung radiation generated from the electron beam, CT is possible with rapid scanning rate at <0.1 sec. Imaging was done with those conditions as tube voltage: 130 kV, current: 610 mA, scanning rate: 0.1 sec/slice whose thickness was 1.5 mm, feeding rate: 1.5 mm and number of slices: 40-170. Patients were 15 cases with jaw deformity. Data were processed for 3-D image by Scribe Imaging Workstation (Multi-dimensional Imaging Inc.) which giving surface rendering and further by Power Macintosh 8500 (Apple Computer Inc.) with VoxBlast 1.1.0 (VayTec Inc.) software which giving volume rendering or with Image 1.60 (NIH) which allowing multi-planar reconstruction and re-analog projection. These actual images were presented in the report. (K.H.)

  9. Nucleotide sequence of soybean chloroplast DNA regions which contain the psb A and trn H genes and cover the ends of the large single copy region and one end of the inverted repeats.

    Science.gov (United States)

    Spielmann, A; Stutz, E

    1983-10-25

    The soybean chloroplast psb A gene (photosystem II thylakoid membrane protein of Mr 32 000, lysine-free) and the trn H gene (tRNAHisGUG), which both map in the large single copy region adjacent to one of the inverted repeat structures (IR1), have been sequenced including flanking regions. The psb A gene shows in its structural part 92% sequence homology with the corresponding genes of spinach and N. debneyi and contains also an open reading frame for 353 aminoacids. The aminoacid sequence of a potential primary translation product (calculated Mr, 38 904, no lysine) diverges from that of spinach and N. debneyi in only two positions in the C-terminal part. The trn H gene has the same polarity as the psb A gene and the coding region is located at the very end of the large single copy region. The deduced sequence of the soybean chloroplast tRNAHisGUG is identical with that of Zea mays chloroplasts. Both ends of the large single copy region were sequenced including a small segment of the adjacent IR1 and IR2.

  10. Using Markov chains of nucleotide sequences as a possible precursor to predict functional roles of human genome: a case study on inactive chromatin regions.

    Science.gov (United States)

    Lee, K-E; Lee, E-J; Park, H-S

    2016-08-30

    Recent advances in computational epigenetics have provided new opportunities to evaluate n-gram probabilistic language models. In this paper, we describe a systematic genome-wide approach for predicting functional roles in inactive chromatin regions by using a sequence-based Markovian chromatin map of the human genome. We demonstrate that Markov chains of sequences can be used as a precursor to predict functional roles in heterochromatin regions and provide an example comparing two publicly available chromatin annotations of large-scale epigenomics projects: ENCODE project consortium and Roadmap Epigenomics consortium.

  11. Inferring Invasion History of Red Swamp Crayfish (Procambarus clarkii) in China from Mitochondrial Control Region and Nuclear Intron Sequences

    Science.gov (United States)

    Li, Yanhe; Guo, Xianwu; Chen, Liping; Bai, Xiaohui; Wei, Xinlan; Zhou, Xiaoyun; Huang, Songqian; Wang, Weimin

    2015-01-01

    Identifying the dispersal pathways of an invasive species is useful for adopting the appropriate strategies to prevent and control its spread. However, these processes are exceedingly complex. So, it is necessary to apply new technology and collect representative samples for analysis. This study used Approximate Bayesian Computation (ABC) in combination with traditional genetic tools to examine extensive sample data and historical records to infer the invasion history of the red swamp crayfish, Procambarus clarkii, in China. The sequences of the mitochondrial control region and the proPOx intron in the nuclear genome of samples from 37 sites (35 in China and one each in Japan and the USA) were analyzed. The results of combined scenarios testing and historical records revealed a much more complex invasion history in China than previously believed. P. clarkii was most likely originally introduced into China from Japan from an unsampled source, and the species then expanded its range primarily into the middle and lower reaches and, to a lesser extent, into the upper reaches of the Changjiang River in China. No transfer was observed from the upper reaches to the middle and lower reaches of the Changjiang River. Human-mediated jump dispersal was an important dispersal pathway for P. clarkii. The results provide a better understanding of the evolutionary scenarios involved in the rapid invasion of P. clarkii in China. PMID:26132567

  12. Inferring Invasion History of Red Swamp Crayfish (Procambarus clarkii in China from Mitochondrial Control Region and Nuclear Intron Sequences

    Directory of Open Access Journals (Sweden)

    Yanhe Li

    2015-06-01

    Full Text Available Identifying the dispersal pathways of an invasive species is useful for adopting the appropriate strategies to prevent and control its spread. However, these processes are exceedingly complex. So, it is necessary to apply new technology and collect representative samples for analysis. This study used Approximate Bayesian Computation (ABC in combination with traditional genetic tools to examine extensive sample data and historical records to infer the invasion history of the red swamp crayfish, Procambarus clarkii, in China. The sequences of the mitochondrial control region and the proPOx intron in the nuclear genome of samples from 37 sites (35 in China and one each in Japan and the USA were analyzed. The results of combined scenarios testing and historical records revealed a much more complex invasion history in China than previously believed. P. clarkii was most likely originally introduced into China from Japan from an unsampled source, and the species then expanded its range primarily into the middle and lower reaches and, to a lesser extent, into the upper reaches of the Changjiang River in China. No transfer was observed from the upper reaches to the middle and lower reaches of the Changjiang River. Human-mediated jump dispersal was an important dispersal pathway for P. clarkii. The results provide a better understanding of the evolutionary scenarios involved in the rapid invasion of P. clarkii in China.

  13. Dependence of electron inelastic mean free paths on electron energy and materials at low energy region, 1

    International Nuclear Information System (INIS)

    Tanuma, Shigeo; Powell, C.J.; Penn, D.R.

    1990-01-01

    We have proposed a general formula of electron inelastic mean free path (IMFP) to describe the calculated IMFPs over the 50-2000 eV energy range based on the Inokuti's modified Bethe formula for the inelastic scattering cross section. The IMFPs for 50-2000 eV electrons in 27 elements were calculated using Penn's algorithm. The IMFP dependence on electron energy in the range 50-200 eV varies considerably from material to material. These variations are associated with substantial differences in the electron energy-loss functions amongst the material. We also found that the modified Bethe formula by Inokuti could be fitted to the calculated IMFPs in the range 50-2000 eV within 3% relative error. (author)

  14. ITS all right mama: investigating the formation of chimeric sequences in the ITS2 region by DNA metabarcoding analyses of fungal mock communities of different complexities.

    Science.gov (United States)

    Bjørnsgaard Aas, Anders; Davey, Marie Louise; Kauserud, Håvard

    2017-07-01

    The formation of chimeric sequences can create significant methodological bias in PCR-based DNA metabarcoding analyses. During mixed-template amplification of barcoding regions, chimera formation is frequent and well documented. However, profiling of fungal communities typically uses the more variable rDNA region ITS. Due to a larger research community, tools for chimera detection have been developed mainly for the 16S/18S markers. However, these tools are widely applied to the ITS region without verification of their performance. We examined the rate of chimera formation during amplification and 454 sequencing of the ITS2 region from fungal mock communities of different complexities. We evaluated the chimera detecting ability of two common chimera-checking algorithms: perseus and uchime. Large proportions of the chimeras reported were false positives. No false negatives were found in the data set. Verified chimeras accounted for only 0.2% of the total ITS2 reads, which is considerably less than what is typically reported in 16S and 18S metabarcoding analyses. Verified chimeric 'parent sequences' had significantly higher per cent identity to one another than to random members of the mock communities. Community complexity increased the rate of chimera formation. GC content was higher around the verified chimeric break points, potentially facilitating chimera formation through base pair mismatching in the neighbouring regions of high similarity in the chimeric region. We conclude that the hypervariable nature of the ITS region seems to buffer the rate of chimera formation in comparison with other, less variable barcoding regions, due to shorter regions of high sequence similarity. © 2016 John Wiley & Sons Ltd.

  15. Development of novel low-voltage free-electron lasers in the 5-500GHz region

    International Nuclear Information System (INIS)

    Zhong, Xiehe

    2002-01-01

    The electromagnetic spectrum from 5GHz to 500GHz is important for many industrial, commercial, and scientific applications. In particular for the 100 - 500GHz region, free electron lasers (FELs) are usually the only viable radiation sources with sizeable output power and as such are an attractive enabling technology for many applications. One major issue for widespread application of free electron lasers is to reduce their cost and size. This is particularly challenging because of the expensive electron accelerator system they employ. To make it significantly more attractive economically for many important applications, the electron energy has to be reduced to below 300keV. In this thesis two novel electron-energy-reduction techniques are investigated for FEL systems operated in the spectrum from 5GHz to 500GHz with the development of a suite of suitable FEL codes. In the microwave to millimetre-wave region, a novel energy reduction technique based on second harmonic waveguide FELs is studied. It is shown that the required electron voltage is approximately half of what is normally required for comparable conventional waveguide FELs. Effect of electron energy spread is studied for second harmonic waveguide FELs both in microwave and millimetre-wave regions. It is shown that strong wiggler field enhances electron hunching thereby increasing the small-signal gain as well as the insusceptibility to electron voltage spread. Saturation behaviour of second harmonic waveguide FELs is also studied because it is important for evaluation of output power. For FEL generation above 300GHz, it is found that second harmonic waveguide FELs need to increase electron energy above 300keV. To this end, a second energy reduction technique is considered based on a novel quasiperiodic wiggler. It is established that by changing the initial phase angle between the two component wigglers, strong radiation can be generated near 1THz with electron energy below 300keV. (author)

  16. Rapid allopolyploid radiation of moonwort ferns (Botrychium; Ophioglossaceae) revealed by PacBio sequencing of homologous and homeologous nuclear regions.

    Science.gov (United States)

    Dauphin, Benjamin; Grant, Jason R; Farrar, Donald R; Rothfels, Carl J

    2018-03-01

    Polyploidy is a major speciation process in vascular plants, and is postulated to be particularly important in shaping the diversity of extant ferns. However, limitations in the availability of bi-parental markers for ferns have greatly limited phylogenetic investigation of polyploidy in this group. With a large number of allopolyploid species, the genus Botrychium is a classic example in ferns where recurrent polyploidy is postulated to have driven frequent speciation events. Here, we use PacBio sequencing and the PURC bioinformatics pipeline to capture all homeologous or allelic copies of four long (∼1 kb) low-copy nuclear regions from a sample of 45 specimens (25 diploids and 20 polyploids) representing 37 Botrychium taxa, and three outgroups. This sample includes most currently recognized Botrychium species in Europe and North America, and the majority of our specimens were genotyped with co-dominant nuclear allozymes to ensure species identification. We analyzed the sequence data using maximum likelihood (ML) and Bayesian inference (BI) concatenated-data ("gene tree") approaches to explore the relationships among Botrychium species. Finally, we estimated divergence times among Botrychium lineages and inferred the multi-labeled polyploid species tree showing the origins of the polyploid taxa, and their relationships to each other and to their diploid progenitors. We found strong support for the monophyly of the major lineages within Botrychium and identified most of the parental donors of the polyploids; these results largely corroborate earlier morphological and allozyme-based investigations. Each polyploid had at least two distinct homeologs, indicating that all sampled polyploids are likely allopolyploids (rather than autopolyploids). Our divergence-time analyses revealed that these allopolyploid lineages originated recently-within the last two million years-and thus that the genus has undergone a recent radiation, correlated with multiple independent

  17. Minimal and contributing sequence determinants of the cis-acting locus of transfer (clt) of streptomycete plasmid pIJ101 occur within an intrinsically curved plasmid region.

    Science.gov (United States)

    Ducote, M J; Prakash, S; Pettis, G S

    2000-12-01

    Efficient interbacterial transfer of streptomycete plasmid pIJ101 requires the pIJ101 tra gene, as well as a cis-acting plasmid function known as clt. Here we show that the minimal pIJ101 clt locus consists of a sequence no greater than 54 bp in size that includes essential inverted-repeat and direct-repeat sequences and is located in close proximity to the 3' end of the korB regulatory gene. Evidence that sequences extending beyond the minimal locus and into the korB open reading frame influence clt transfer function and demonstration that clt-korB sequences are intrinsically curved raise the possibility that higher-order structuring of DNA and protein within this plasmid region may be an inherent feature of efficient pIJ101 transfer.

  18. Genetic diversity of the captive Asian tapir population in Thailand, based on mitochondrial control region sequence data and the comparison of its nucleotide structure with Brazilian tapir.

    Science.gov (United States)

    Muangkram, Yuttamol; Amano, Akira; Wajjwalku, Worawidh; Pinyopummintr, Tanu; Thongtip, Nikorn; Kaolim, Nongnid; Sukmak, Manakorn; Kamolnorranath, Sumate; Siriaroonrat, Boripat; Tipkantha, Wanlaya; Maikaew, Umaporn; Thomas, Warisara; Polsrila, Kanda; Dongsaard, Kwanreaun; Sanannu, Saowaphang; Wattananorrasate, Anuwat

    2017-07-01

    The Asian tapir (Tapirus indicus) has been classified as Endangered on the IUCN Red List of Threatened Species (2008). Genetic diversity data provide important information for the management of captive breeding and conservation of this species. We analyzed mitochondrial control region (CR) sequences from 37 captive Asian tapirs in Thailand. Multiple alignments of the full-length CR sequences sized 1268 bp comprised three domains as described in other mammal species. Analysis of 16 parsimony-informative variable sites revealed 11 haplotypes. Furthermore, the phylogenetic analysis using median-joining network clearly showed three clades correlated with our earlier cytochrome b gene study in this endangered species. The repetitive motif is located between first and second conserved sequence blocks, similar to the Brazilian tapir. The highest polymorphic site was located in the extended termination associated sequences domain. The results could be applied for future genetic management based in captivity and wild that shows stable populations.

  19. Evolutionary history of Phakopsora pachyrhizi (the Asian soybean rust in Brazil based on nucleotide sequences of the internal transcribed spacer region of the nuclear ribosomal DNA

    Directory of Open Access Journals (Sweden)

    Maíra C. M. Freire

    2008-01-01

    Full Text Available Phakopsora pachyrhizi has dispersed globally and brought severe economic losses to soybean growers. The fungus has been established in Brazil since 2002 and is found nationwide. To gather information on the temporal and spatial patterns of genetic variation in P. pachyrhizi , we sequenced the nuclear internal transcribed spacer regions (ITS1 and ITS2. Total genomic DNA was extracted using either lyophilized urediniospores or lesions removed from infected leaves sampled from 26 soybean fields in Brazil and one field in South Africa. Cloning prior to sequencing was necessary because direct sequencing of PCR amplicons gave partially unreadable electrophoretograms with peak displacements suggestive of multiple sequences with length polymorphism. Sequences were determined from four clones per field. ITS sequences from African or Asian isolates available from the GenBank were included in the analyses. Independent sequence alignments of the ITS1 and ITS2 datasets identified 27 and 19 ribotypes, respectively. Molecular phylogeographic analyses revealed that ribotypes of widespread distribution in Brazil displayed characteristics of ancestrality and were shared with Africa and Asia, while ribotypes of rare occurrence in Brazil were indigenous. The results suggest P. pachyrhizi found in Brazil as originating from multiple, independent long-distance dispersal events.

  20. Sequence variations in C9orf72 downstream of the hexanucleotide repeat region and its effect on repeat-primed PCR interpretation

    DEFF Research Database (Denmark)

    Nordin, Angelica; Akimoto, Chizuru; Wuolikainen, Anna

    2017-01-01

    A large GGGGCC-repeat expansion mutation (HREM) in C9orf72 is the most common known cause of ALS and FTD in European populations. Sequence variations immediately downstream of the HREM region have previously been observed and have been suggested to be one reason for difficulties in interpreting R...

  1. The ITS1-5.8S-ITS2 sequence region in the Musaceae: structure, diversity and use in molecular phylogeny.

    Directory of Open Access Journals (Sweden)

    Eva Hřibová

    2011-03-01

    Full Text Available Genes coding for 45S ribosomal RNA are organized in tandem arrays of up to several thousand copies and contain 18S, 5.8S and 26S rRNA units separated by internal transcribed spacers ITS1 and ITS2. While the rRNA units are evolutionary conserved, ITS show high level of interspecific divergence and have been used frequently in genetic diversity and phylogenetic studies. In this work we report on the structure and diversity of the ITS region in 87 representatives of the family Musaceae. We provide the first detailed information on ITS sequence diversity in the genus Musa and describe the presence of more than one type of ITS sequence within individual species. Both Sanger sequencing of amplified ITS regions and whole genome 454 sequencing lead to similar phylogenetic inferences. We show that it is necessary to identify putative pseudogenic ITS sequences, which may have negative effect on phylogenetic reconstruction at lower taxonomic levels. Phylogenetic reconstruction based on ITS sequence showed that the genus Musa is divided into two distinct clades--Callimusa and Australimusa and Eumusa and Rhodochlamys. Most of the intraspecific banana hybrids analyzed contain conserved parental ITS sequences, indicating incomplete concerted evolution of rDNA loci. Independent evolution of parental rDNA in hybrids enables determination of genomic constitution of hybrids using ITS. The observation of only one type of ITS sequence in some of the presumed interspecific hybrid clones warrants further study to confirm their hybrid origin and to unravel processes leading to evolution of their genomes.

  2. Altitude distribution of electron concentration in ionospheric D-region in presence of time-varying solar radiation flux

    International Nuclear Information System (INIS)

    Nina, A.; Čadež, V.; Srećković, V.; Šulić, D.

    2012-01-01

    In this paper, we study the influence of solar flares on electron concentration in the terrestrial ionospheric D-region by analyzing the amplitude and phase time variations of very low frequency (VLF) radio waves emitted by DHO transmitter (Germany) and recorded by the AWESOME receiver in Belgrade (Serbia) in real time. The rise of photo-ionization rate in the ionospheric D-region is a typical consequence of solar flare activity as recorded by GOES-15 satellite for the event on March 24, 2011 between 12:01 UT and 12:11 UT. At altitudes around 70 km, the photo-ionization and recombination are the dominant electron gain and electron loss processes, respectively. We analyze the relative contribution of each of these two processes in the resulting electron concentration variation in perturbed ionosphere.

  3. Altitude distribution of electron concentration in ionospheric D-region in presence of time-varying solar radiation flux

    Energy Technology Data Exchange (ETDEWEB)

    Nina, A., E-mail: sandrast@ipb.ac.rs [Institute of Physics, University of Belgrade, P.O. Box 57, Belgrade (Serbia); Cadez, V. [Astronomical Observatory, Volgina 7, 11060 Belgrade (Serbia); Sreckovic, V. [Institute of Physics, University of Belgrade, P.O. Box 57, Belgrade (Serbia); Sulic, D. [Faculty of Ecology and Environmental Protection, Union - Nikola Tesla University, Cara Dusana 62, 11000 Belgrade (Serbia)

    2012-05-15

    In this paper, we study the influence of solar flares on electron concentration in the terrestrial ionospheric D-region by analyzing the amplitude and phase time variations of very low frequency (VLF) radio waves emitted by DHO transmitter (Germany) and recorded by the AWESOME receiver in Belgrade (Serbia) in real time. The rise of photo-ionization rate in the ionospheric D-region is a typical consequence of solar flare activity as recorded by GOES-15 satellite for the event on March 24, 2011 between 12:01 UT and 12:11 UT. At altitudes around 70 km, the photo-ionization and recombination are the dominant electron gain and electron loss processes, respectively. We analyze the relative contribution of each of these two processes in the resulting electron concentration variation in perturbed ionosphere.

  4. Changes in electron precipitation inferred from spectra deduced from D region electron densities during a post--magnetic storm effect

    International Nuclear Information System (INIS)

    Montbriand, L.E.; Belrose, J.S.

    1976-01-01

    The occurrence of enhanced ionization after geomagnetic storms, commonly referred to as storm aftereffect, is investigated on the hypothesis that the enhancement is due to a 'drizzle' of energetic electrons from the radiation belts. The study utilized electron density-height profiles obtained from the partial reflection experiment at Ottawa and available information on the height profile of the steady state loss coefficient for energetic electron events in combination with the ion pair production treatments of Ress (1963) and Berger et al. (1974) to deduce two-component differential energy spectra of the electron drizzle. The period studied, December 13--20, 1970, was unique for examining poststorm effects in that the geomagnetic storm on December 14--15 was intense and brief, and it was preceded and followed by periods of geomagnetic calm. The results indicate that the drizzle deduced was minimal before the storm and on the storm day and maximized 2--3 days after the peak of the storm at a time when geomagnetic activity had returned to calm. The results also suggest that the spectrum was hardest shortly after the drizzle maximized. No satisfactory source for the enhanced ionization during the poststorm other than particle drizzle could be found that would produce both the magnitude and the diurnal variation of the effect observed, a conclusion which establishes the validity of the hypothesis made

  5. Development of taxon-specific sequence characterized amplified region (SCAR) markers based on actin sequences and DNA amplification fingerprinting (DAF): a case study in the Phoma exigua species complex.

    Science.gov (United States)

    Aveskamp, Maikel M; Woudenberg, Joyce H C; de Gruyter, Johannes; Turco, Elena; Groenewald, Johannes Z; Crous, Pedro W

    2009-05-01

    Phoma exigua is considered to be an assemblage of at least nine varieties that are mainly distinguished on the basis of host specificity and pathogenicity. However, these varieties are also reported to be weak pathogens and secondary invaders on non-host tissue. In practice, it is difficult to distinguish P. exigua from its close relatives and to correctly identify isolates up to the variety level, because of their low genetic variation and high morphological similarity. Because of quarantine issues and phytosanitary measures, a robust DNA-based tool is required for accurate and rapid identification of the separate taxa in this species complex. The present study therefore aims to develop such a tool based on unique nucleotide sequence identifiers. More than 60 strains of P. exigua and related species were compared in terms of partial actin gene sequences, or analysed using DNA amplification fingerprinting (DAF) with short, arbitrary, mini-hairpin primers. Fragments in the fingerprint unique to a single taxon were identified, purified and sequenced. Alignment of the sequence data and subsequent primer trials led to the identification of taxon-specific sequence characterized amplified regions (SCARs), and to a set of specific oligonucleotide combinations that can be used to identify these organisms in plant quarantine inspections.

  6. Formation of universal and diffusion regions of non-linear spectra of relativistic electrons in spatially limited sources

    International Nuclear Information System (INIS)

    Kontorovich, V.M.; Kochanov, A.E.

    1980-01-01

    It is demonstrated that in the case of hard injection of relativistic electrons accompanied by the joint action of synchrotron (Compton) losses and energy-dependent spatial diffusion, a spectrum with 'breaks' is formed containing universal (with index γ = 2) and diffusion regions, both independent of the injection spectrum. The effect from non-linearity of the electron spectrum is considered in averaged electromagnetic spectra for various geometries of sources (sphere, disk, arm). It is shown that an universal region (with index α = 0.5) can occur in the radiation spectrum. (orig.)

  7. Quantitative explanation of some electron temperature profiles measured in situ in the high latitude ionospheric E-region

    International Nuclear Information System (INIS)

    Schlegel, K.; Oyama, Koh-ichiro; Hirao, Kunio

    1983-01-01

    E region electron temperature profiles obtained with a rocket experiment in the Antarctica are compared to theoretical electron temperatures calculated from a model. The main heat source in this model is the heating of the electron gas by unstable plasma waves. Very good agreement between both temperatures is obtained between 105 and 115 km altitude, where this heating mechanism is effective. The agreement is also good below this altitude range, after a refinement of the data analysis procedure for the measured temperatures. Several important consequences of the good agreement are pointed out. (author)

  8. GPS scintillations and total electron content climatology in the southern low, middle and high latitude regions

    Directory of Open Access Journals (Sweden)

    Luca Spogli

    2013-06-01

    Full Text Available In recent years, several groups have installed high-frequency sampling receivers in the southern middle and high latitude regions, to monitor ionospheric scintillations and the total electron content (TEC changes. Taking advantage of the archive of continuous and systematic observations of the ionosphere on L-band by means of signals from the Global Positioning System (GPS, we present the first attempt at ionospheric scintillation and TEC mapping from Latin America to Antarctica. The climatology of the area considered is derived through Ground-Based Scintillation Climatology, a method that can identify ionospheric sectors in which scintillations are more likely to occur. This study also introduces the novel ionospheric scintillation 'hot-spot' analysis. This analysis first identifies the crucial areas of the ionosphere in terms of enhanced probability of scintillation occurrence, and then it studies the seasonal variation of the main scintillation and TEC-related parameters. The results produced by this sophisticated analysis give significant indications of the spatial/ temporal recurrences of plasma irregularities, which contributes to the extending of current knowledge of the mechanisms that cause scintillations, and consequently to the development of efficient tools to forecast space-weather-related ionospheric events.

  9. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  10. Sequence differences in the diagnostic region of the cysteine protease 8 gene of Tritrichomonas foetus parasites of cats and cattle.

    Science.gov (United States)

    Sun, Zichen; Stack, Colin; Šlapeta, Jan

    2012-05-25

    In order to investigate the genetic variation between Tritrichomonas foetus from bovine and feline origins, cysteine protease 8 (CP8) coding sequence was selected as the polymorphic DNA marker. Direct sequencing of CP8 coding sequence of T. foetus from four feline isolates and two bovine isolates with polymerase chain reaction successfully revealed conserved nucleotide polymorphisms between feline and bovine isolates. These results provide useful information for CP8-based molecular differentiation of T. foetus genotypes. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Regional geological assessment of the Devonian-Mississippian shale sequence of the Appalachian, Illinois, and Michigan basins relative to potential storage/disposal of radioactive wastes

    Energy Technology Data Exchange (ETDEWEB)

    Lomenick, T.F.; Gonzales, S.; Johnson, K.S.; Byerly, D.

    1983-01-01

    The thick and regionally extensive sequence of shales and associated clastic sedimentary rocks of Late Devonian and Early Mississippian age has been considered among the nonsalt geologies for deep subsurface containment of high-level radioactive wastes. This report examines some of the regional and basin-specific characteristics of the black and associated nonblack shales of this sequence within the Appalachian, Illinois, and Michigan basins of the north-central and eastern United States. Principal areas where the thickness and depth of this shale sequence are sufficient to warrant further evaluation are identified, but no attempt is made to identify specific storage/disposal sites. Also identified are other areas with less promise for further study because of known potential conflicts such as geologic-hydrologic factors, competing subsurface priorities involving mineral resources and groundwater, or other parameters. Data have been compiled for each basin in an effort to indicate thickness, distribution, and depth relationships for the entire shale sequence as well as individual shale units in the sequence. Included as parts of this geologic assessment are isopach, depth information, structure contour, tectonic elements, and energy-resource maps covering the three basins. Summary evaluations are given for each basin as well as an overall general evaluation of the waste storage/disposal potential of the Devonian-Mississippian shale sequence,including recommendations for future studies to more fully characterize the shale sequence for that purpose. Based on data compiled in this cursory investigation, certain rock units have reasonable promise for radioactive waste storage/disposal and do warrant additional study.

  12. Regional geological assessment of the Devonian-Mississippian shale sequence of the Appalachian, Illinois, and Michigan basins relative to potential storage/disposal of radioactive wastes

    International Nuclear Information System (INIS)

    Lomenick, T.F.; Gonzales, S.; Johnson, K.S.; Byerly, D.

    1983-01-01

    The thick and regionally extensive sequence of shales and associated clastic sedimentary rocks of Late Devonian and Early Mississippian age has been considered among the nonsalt geologies for deep subsurface containment of high-level radioactive wastes. This report examines some of the regional and basin-specific characteristics of the black and associated nonblack shales of this sequence within the Appalachian, Illinois, and Michigan basins of the north-central and eastern United States. Principal areas where the thickness and depth of this shale sequence are sufficient to warrant further evaluation are identified, but no attempt is made to identify specific storage/disposal sites. Also identified are other areas with less promise for further study because of known potential conflicts such as geologic-hydrologic factors, competing subsurface priorities involving mineral resources and groundwater, or other parameters. Data have been compiled for each basin in an effort to indicate thickness, distribution, and depth relationships for the entire shale sequence as well as individual shale units in the sequence. Included as parts of this geologic assessment are isopach, depth information, structure contour, tectonic elements, and energy-resource maps covering the three basins. Summary evaluations are given for each basin as well as an overall general evaluation of the waste storage/disposal potential of the Devonian-Mississippian shale sequence,including recommendations for future studies to more fully characterize the shale sequence for that purpose. Based on data compiled in this cursory investigation, certain rock units have reasonable promise for radioactive waste storage/disposal and do warrant additional study

  13. Molecular dissection of a contiguous gene syndrome: Frequent submicroscopic deletions, evolutionarily conserved sequences, and a hypomethylated island in the Miller-Dieker chromosome region

    International Nuclear Information System (INIS)

    Ledbetter, D.H.; Ledbetter, S.A.; vanTuinen, P.

    1989-01-01

    The Miller-Dieker syndrome (MDS), composed of characteristic facial abnormalities and a severe neuronal migration disorder affecting the cerebral cortex, is caused by visible or submicroscopic deletions of chromosome band 17p13. Twelve anonymous DNA markers were tested against a panel of somatic cell hybrids containing 17p deletions from seven MDS patients. All patients, including three with normal karyotypes, are deleted for a variable set of 5-12 markers. Two highly polymorphic VNTR (variable number of tandem repeats) probes, YNZ22 and YNH37, are codeleted in all patients tested and make molecular diagnosis for this disorder feasible. By pulsed-field gel electrophoresis, YNZ22 and YNH37 were shown to be within 30 kilobases (kb) of each other. Cosmid clones containing both VNTR sequences were identified, and restriction mapping showed them to be 100 kb were completely deleted in all patients, providing a minimum estimate of the size of the MDS critical region. A hypomethylated island and evolutionarily conserved sequences were identified within this 100-kb region, indications of the presence of one or more expressed sequences potentially involved in the pathophysiology of this disorder. The conserved sequences were mapped to mouse chromosome 11 by using mouse-rat somatic cell hybrids, extending the remarkable homology between human chromosome 17 and mouse chromosome 11 by 30 centimorgans, into the 17p telomere region

  14. Phylogenetic relationships of Scomberomorus commerson using sequence analysis of the mtDNA D-loop region in the Persian Gulf, Oman Sea and Arabian Sea

    Directory of Open Access Journals (Sweden)

    Ana Mansourkiaei

    2016-04-01

    Full Text Available Abstract Narrow-barred Spanish mackerel, Scomberomorus commerson, is an epipelagic and migratory species of family Scombridae which have a significant role in terms of ecology and fishery. 100 samples were collected from the Persian Gulf, Oman Sea and Arabian Sea. Part of their dorsal fins was snipped and transferred to micro-tubes containing ethanol; then, DNAs were extracted and HRM-Real Time PCR was performed to designate representative specimens for sequencing. Phylogenetic relationships of S. commerson from Persian Gulf, Oman Sea and Arabian Sea were investigated using sequence data of mitochondrial DNA D-loop region. None clustered Neighbor Joining tree indicated the proximity amid S. commerson in four sites. As numbers demonstrated in sequence analyses of mitochondrial DNA D-Loop region a sublimely high degree of genetic similarity among S. commerson from the Persian Gulf and Oman Sea were perceived, thereafter, having one stock structure of S. commerson in four regions were proved, and this approximation can be merely justified by their migration process along the coasts of Oman Sea and Persian Gulf. Therefore, the assessment of distribution patterns of 20 haplotypes in the constructed phylogenetic tree using mtDNA D-Loop sequences ascertained that no significant clustering according to the sampling sites was concluded.

  15. Genome sequence of the acid-tolerant Desulfovibrio sp. DV isolated from the sediments of a Pb-Zn mine tailings dam in the Chita region, Russia

    Directory of Open Access Journals (Sweden)

    Anastasiia Kovaliova

    2017-03-01

    Full Text Available Here we report the draft genome sequence of the acid-tolerant Desulfovibrio sp. DV isolated from the sediments of a Pb-Zn mine tailings dam in the Chita region, Russia. The draft genome has a size of 4.9 Mb and encodes multiple K+-transporters and proton-consuming decarboxylases. The phylogenetic analysis based on concatenated ribosomal proteins revealed that strain DV clusters together with the acid-tolerant Desulfovibrio sp. TomC and Desulfovibrio magneticus. The draft genome sequence and annotation have been deposited at GenBank under the accession number MLBG00000000.

  16. Two unusual hepatitis C virus subtypes, 2j and 2q, in Spain: Identification by nested-PCR and sequencing of a NS5B region.

    Science.gov (United States)

    Margall, N; March, F; Español, M; Torras, X; Gallego, A; Coll, P

    2015-10-01

    Many studies have reported the use of the NS5B gene to subtype hepatitis C virus (HCV). Other HCV genes, such as HCV-5' UTR, Core (C) and E1, have also been used. In some studies, NS5B have been used together with 5'-UTR or C genes to improve genotyping results obtained using commercial procedures. Only two studies in Spain have compared molecular techniques versus commercial procedures regarding the efficacy of HCV subtyping. The aim of this study was to determine whether nested PCR and sequencing of a NS5B region was more reliable than commercial procedures to subtype HCV. We analyzed the results of HCV genotyping in [726] serum specimens collected from 2001 to 2013. From 2001 to 2011, we used PCR and INNO-LiPA hybridization or its new version Versant HCV Genotype 2.0 assay (471 samples). From 2012 to 2013, we used nested PCR and sequencing of a NS5B region (255 cases). This method used two pairs of primers to amplify the RNA of the sample converted to DNA by retrotranscription. The amplification product of 270 base pairs was further sequenced. To identify the subtype, the sequences obtained were compared to those in the international database: http://hcv.lanl.gov./content/sequence/, HCV/ToolsOutline.html and Geno2pheno[hcv] http://hcv.bioinf.mpi-inf.mpg.de/index.php. Nested PCR of a NS5B region and sequencing identified all but one subtype (0.4%, 1/255), differentiated all 1a subtypes from 1b subtypes, and characterized all HCV 2-4 subtypes. This approach also distinguished two subtypes, 2j and 2q, that had rarely been detected previously in Spain. However, commercial procedures failed to subtype 12.7% (60/471) of samples and to genotype 0.6% of specimens (3/471). Nested PCR and sequencing of a NS5B region improved the subtyping of HCV in comparison with classical procedures and identified two rare subtypes in Spain: 2j and 2q. However, full length genome sequencing is recommended to confirm HCV 2j and 2q subtypes. Copyright © 2015. Published by Elsevier B.V.

  17. Comparison of PCR-RFLP pattern with sequencing analysis of the ITS region of Hyrcanain\\'s Tilia

    Directory of Open Access Journals (Sweden)

    Hamed Yousefzadeh

    2014-01-01

    T. hyrcana and T. rubra from Hyrcanian's origin, but it could not separate T. begonifloia from the other hyrcanian species. In this respect, derived results were similar to sequencing one. In conclusion, with regard to less expensive and less time consuming PCR-RFLP technique and high similarity between its result with sequencing, we recommend this method as a simple and economical method with relatively high efficiency studding plant phylogeny.

  18. Extended region of nodulation genes in Rhizobium meliloti 1021. II. Nucleotide sequence, transcription start sites and protein products

    International Nuclear Information System (INIS)

    Fisher, R.F.; Swanson, J.A.; Mulligan, J.T.; Long, S.R.

    1987-01-01

    The authors have established the DNA sequence and analyzed the transcription and translation products of a series of putative nodulation (nod) genes in Rhizobium meliloti strain 1021. Four loci have been designated nodF, nodE, nodG and nodH. The correlation of transposon insertion positions with phenotypes and open reading frames was confirmed by sequencing the insertion junctions of the transposons. The protein products of these nod genes were visualized by in vitro expression of cloned DNA segments in a R. meliloti transcription-translation system. In addition, the sequence for nodG was substantiated by creating translational fusions in all three reading frames at several points in the sequence; the resulting fusions were expressed in vitro in both E. coli and R. meliloti transcription-translation systems. A DNA segment bearing several open reading frames downstream of nodG corresponds to the putative nod gene mutated in strain nod-216. The transcription start sites of nodF and nodH were mapped by primer extension of RNA from cells induced with the plant flavone, luteolin. Initiation of transcription occurs approximately 25 bp downstream from the conserved sequence designated the nod box, suggesting that this conserved sequence acts as an upstream regulator of inducible nod gene expression. Its distance from the transcription start site is more suggestive of an activator binding site rather than an RNA polymerase binding site

  19. A positive correlation between energetic electron butterfly distributions and magnetosonic waves in the radiation belt slot region

    International Nuclear Information System (INIS)

    Yang, Chang; Su, Z.; Xiao, F.; Zheng, H.

    2017-01-01

    Energetic (hundreds of keV) electrons in the radiation belt slot region have been found to exhibit the butterfly pitch angle distributions. Resonant interactions with magnetosonic and whistler-mode waves are two potential mechanisms for the formation of these peculiar distributions. Here we perform a statistical study of energetic electron pitch angle distribution characteristics measured by Van Allen Probes in the slot region during a three-year period from May 2013 to May 2016. Our results show that electron butterfly distributions are closely related to magnetosonic waves rather than to whistlermode waves. Both electron butterfly distributions and magnetosonic waves occur more frequently at the geomagnetically active times than at the quiet times. In a statistical sense, more distinct butterfly distributions usually correspond to magnetosonic waves with larger amplitudes and vice versa. The averaged magnetosonic wave amplitude is less than 5 pT in the case of normal and flat-top distributions with a butterfly index BI = 1 but reaches ~ 35–95 pT in the case of distinct butterfly distributions with BI > 1:3. For magnetosonic waves with amplitudes > 50 pT, the occurrence rate of butterfly distribution is above 80%. Our study suggests that energetic electron butterfly distributions in the slot region are primarily caused by magnetosonic waves.

  20. Electrons identification in the forward region of the ATLAS electromagnetic calorimeter at the LHC and first data analysis

    International Nuclear Information System (INIS)

    Chareyre, E.

    2010-09-01

    The start up of the ATLAS experiment at the CERN LHC has been done during the autumn 2009. During the construction and integration of the detector, combined beam tests grouping several subsystems have been carried out. In the forward region of the detector (η > 2.5), a combined beam test with electromagnetic and hadronic calorimeters has been done, whose data (pions and electrons) has been analyzed. Identification of electrons in this region can be used to study decays of Z and W bosons and also to develop some tools to understand the background noises. A method to estimate rejection of pions and electrons identification efficiency is presented using a discriminant analysis based on the methods of Fisher discriminant and on Boosted Decision Trees. It is shown that a pion rejection higher than 200 with an efficiency of electron identification of 50% can be obtained. Moreover the tools and methods developed during the beam tests have been applied on the first data of the LHC with collisions at 7 TeV. Since the present luminosity of the LHC is not yet sufficient to study precisely production of Z and W bosons by using data, a study using the Pythia generator has been done on electrons physics in the forward region. (author)

  1. Analysis of the effect of the Electron-Beam welding sequence for a fixed manufacturing route using finite element simulations applied to ITER vacuum vessel manufacture

    Energy Technology Data Exchange (ETDEWEB)

    Martín-Menéndez, Cristina, E-mail: cristina@natec-ingenieros.com [Numerical Analysis Technologies, S.L. Marqués de San Esteban No. 52, 33206 Gijón (Spain); Rodríguez, Eduardo [Department of Mechanical Engineering, University of Oviedo, Campus de Gijón, 33203 Gijón (Spain); Ottolini, Marco [Ansaldo Nucleare S.p.A., Corso Perrone 25, 16152 Genova (Italy); Caixas, Joan [F4E, c/Josep Pla, n.2, Torres Diagonal Litoral, Edificio B3, E-08019 Barcelona (Spain); Guirao, Julio [Numerical Analysis Technologies, S.L. Marqués de San Esteban No. 52, 33206 Gijón (Spain)

    2016-03-15

    Highlights: • The simulation methodology employed in this paper is able to adapt inside a complex manufacturing route. • The effect of the sequence is lower in a highly constrained assembly than in a lowly constrained one. • The most relevant influence on the distortions is the jigs design, instead of the welding sequence. • The welding distortion analysis should be used as a guidance to design and improve the manufacturing strategy. - Abstract: The ITER Vacuum Vessel Sectors have very tight tolerances and high density of welding. Therefore, prediction and reduction of welding distortion are critical to allow the final assembly with the other Vacuum Vessel Sectors without the production of a full scale prototype. In this paper, the effect of the welding sequence in the distortions inside a fixed manufacturing route and in a highly constrained assembly is studied in the poloidal segment named inboard (PS1). This is one of the four poloidal segments (PS) assembled for the sector. Moreover, some restrictions and limitations in the welding sequence related to the manufacturing process are explained. The results obtained show that the effect of the sequence is lower in a highly constrained assembly than in a low constrained one. A prototype manufactured by AMW consortium (PS1 mock-up) is used in order to validate the finite element method welding simulation employed. The obtained results confirmed that for Electron-Beam welds, both the welding simulation and the mock-up show a low value of distortions.

  2. Critical frequency and maximum electron density of F2 region over four stations in the North American sector

    Czech Academy of Sciences Publication Activity Database

    Ezquer, R. G.; Cabrera, M. A.; López, J. L.; Albornoz, M. R.; Mosert, M.; Marcó, P.; Burešová, Dalia

    2011-01-01

    Roč. 73, č. 4 (2011), s. 420-429 ISSN 1364-6826 Institutional research plan: CEZ:AV0Z30420517 Keywords : Ionosphere * F2 region * Critical frequency * Electron density * Model Subject RIV: DG - Athmosphere Sciences, Meteorology Impact factor: 1.596, year: 2011 http://www.sciencedirect.com/science/article/pii/S1364682610002786

  3. Radiation dosimetry for residents of the Chernobyl region: a comparison of cytogenetic and electron spin resonance methods

    Energy Technology Data Exchange (ETDEWEB)

    Serezhenkov, V A; Mordvintcev, P I; Vanin, A F; Voevodskaya, N V [AN SSSR, Moscow (Russian Federation). Inst. Fizicheskoj Khimii; Domracheva, E V; Kulikov, S M; Kuznetsov, S A; Schklovsky-Kordi, N E; Vorobiev, A I [National Center for Haematology, Moscow (Russian Federation); Klevezal, G A; Sukhovskaya, L I [Russian Academy of Science, Moscow (Russian Federation). Inst. of Developmental Biology

    1992-01-01

    Persons from the Gomel region of Byelorussia who were irradiated by the Chernobyl reactor accident have been studied. Estimations of their radiation doses using electron spin resonance spectrometry of dental enamel showed good agreement with dosimetry by chromosomal analysis of blood lymphocytes. (author).

  4. Spin currents in a normal two-dimensional electron gas in contact with a spin-orbit interaction region

    International Nuclear Information System (INIS)

    Sukhanov, Aleksei A; Sablikov, Vladimir A; Tkach, Yurii Ya

    2009-01-01

    Spin effects in a normal two-dimensional (2D) electron gas in lateral contact with a 2D region with spin-orbit interaction are studied. The peculiarity of this system is the presence of spin-dependent scattering of electrons from the interface. This results in an equilibrium edge spin current and nontrivial spin responses to a particle current. We investigate the spatial distribution of the spin currents and spin density under non-equilibrium conditions caused by a ballistic electron current flowing normal or parallel to the interface. The parallel electron current is found to generate a spin density near the interface and to change the edge spin current. The perpendicular electron current changes the edge spin current proportionally to the electron current and produces a bulk spin current penetrating deep into the normal region. This spin current has two components, one of which is directed normal to the interface and polarized parallel to it, and the second is parallel to the interface and is polarized in the plane perpendicular to the contact line. Both spin currents have a high degree of polarization (∼40-60%).

  5. A pilot study on the views of elderly regional Australians of personally controlled electronic health records.

    Science.gov (United States)

    Kerai, Paresh; Wood, Pene; Martin, Mary

    2014-03-01

    Australia introduced its version of personal health records in July 2012. Success of the personally controlled electronic health record (PCEHR) relies on acceptance during the early stages. The main aim of this study was to investigate the views of a sample of elderly people in a non-metropolitan region in Australia on the PCEHR, and to assess their acceptance levels of this concept. A self-administered questionnaire was distributed to a non-probability convenience sample of respondents recruited from meetings of Probus, a community club for active business and professional retirees. Approximately three-quarters of the respondents had computer and Internet access at home. If not accessed at home a computer at a general practitioner's practice was seen as beneficial in accessing the PCEHR. Respondents felt that access to their health record would help them make decisions about their own health and improve their communication with healthcare providers. The majority of respondents were in favour of the PCEHR although some expressed concerns about the security of their PCEHR. There was mixed opinion surrounding the access by health professionals to an individual's PCEHR. This study has revealed important information about views of the PCEHR. While the respondents were generally in favour of the concept, there were still some concerns about the security of the PCEHR suggesting further reassurance may be required. The study also highlighted some measures, in particular provision of General Practitioner computer access points and print-out facilities that may need to be considered during these initial implementation stages in order to improve adoption rates once the technology is fully available. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  6. Variations of total electron content in the equatorial anomaly region in Thailand

    Science.gov (United States)

    Chowdhary, V. Rajesh; Tripathi, N. K.; Arunpold, Sanit; Raju, Durairaju Kumaran

    2015-01-01

    This paper presents the first results of total electron content (TEC), derived by analyzing dual frequency Novatel GSV4004 GPS receiver's data which were installed by the SCINDA project, located at the Asian Institute of Technology, Bangkok (AITB, 14.079N, 100.612E) and Chiang Mai University, Chiang Mai (CHGM, 18.480N, 98.570E) with magnetic latitude of 4.13°N and 8.61°N respectively in Thailand, for the year 2011. These two stations are separated by 657 km in the equatorial anomaly region. The highest TEC values occurred from 1500 to 1900 LT throughout the study period. The diurnal, monthly and seasonal GPS-TEC have been plotted and analyzed. The diurnal peaks in GPS-TEC is observed to be maximum during equinoctial months (March, April, September and October) and minimum in solstice months (January, February, June, July and December). These high TEC values have been attributed to the solar extreme ultra-violet ionization coupled with the upward vertical E × B drift. A comparison of both station's TEC has been carried out and found that CHGM station experiences higher values of TEC than AITB station, due to formation of ionization crest over the CHGM station. Also, TEC values have shown increasing trend due to approaching solar maximum. These results from both stations were also compared with the TEC derived from the International Reference Ionosphere's (IRI) recently released, IRI-2012 model. Results have shown positive correlation with IRI-2012 model. Although, IRI-model does not show any response to geomagnetic activity, the IRI model normally remains smooth and underestimates TEC during a storm.

  7. Two‐phase designs for joint quantitative‐trait‐dependent and genotype‐dependent sampling in post‐GWAS regional sequencing

    Science.gov (United States)

    Espin‐Garcia, Osvaldo; Craiu, Radu V.

    2017-01-01

    ABSTRACT We evaluate two‐phase designs to follow‐up findings from genome‐wide association study (GWAS) when the cost of regional sequencing in the entire cohort is prohibitive. We develop novel expectation‐maximization‐based inference under a semiparametric maximum likelihood formulation tailored for post‐GWAS inference. A GWAS‐SNP (where SNP is single nucleotide polymorphism) serves as a surrogate covariate in inferring association between a sequence variant and a normally distributed quantitative trait (QT). We assess test validity and quantify efficiency and power of joint QT‐SNP‐dependent sampling and analysis under alternative sample allocations by simulations. Joint allocation balanced on SNP genotype and extreme‐QT strata yields significant power improvements compared to marginal QT‐ or SNP‐based allocations. We illustrate the proposed method and evaluate the sensitivity of sample allocation to sampling variation using data from a sequencing study of systolic blood pressure. PMID:29239496

  8. Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

    Science.gov (United States)

    Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

    1998-01-01

    Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

  9. Effect of electron correlations and Breit interactions on ground-state fine-structures along the nitrogen-like isoelectronic sequence

    International Nuclear Information System (INIS)

    Wang Xiaolu; Lu Wenlai; Gao Xiang; Li Jiaming

    2009-01-01

    The accurate atomic data of nitrogen and nitrogen-like ions have an importance role in fusion plasma studies and astrophysics studies. The precise calculation of fine-structures is required to obtain such atomic data. Along the whole nitrogen isoelectronic sequence, the contributions of the electron correlations, the Breit interactions and the quantum electrodynamics corrections on the ground-state fine-structures are elucidated. When Z is low, the electron correlations are important, and the Breit interactions, which cannot be neglected cause interesting anomalous fine-structure splittings. When Z is high, the electron correlations are less important, and the Breit interactions are important in addition to spin-orbit interactions for precise calculations. (authors)

  10. F-region electron density and Te / Ti measurements using incoherent scatter power data collected at ALTAIR

    Directory of Open Access Journals (Sweden)

    M. Milla

    2006-07-01

    Full Text Available The ALTAIR UHF radar was used in an incoherent scatter experiment to observe the low-latitude ionosphere during the Equis 2 rocket campaign. The measurements provided the first high-resolution electron density maps of the low-latitude D- and E-region in the Pacific sector and also extended into the F-region and topside ionosphere. Although the sampling frequency was well below the Nyquist frequency of F-region returns, we were able to estimate Te / Ti ratio and infer unbiased electron density estimates using a regularized inversion technique described here. The technique exploits magnetic aspect angle dependence of ISR cross-section for Te>Ti.

  11. Genetic variation among the Mapuche Indians from the Patagonian region of Argentina: mitochondrial DNA sequence variation and allele frequencies of several nuclear genes.

    Science.gov (United States)

    Ginther, C; Corach, D; Penacino, G A; Rey, J A; Carnese, F R; Hutz, M H; Anderson, A; Just, J; Salzano, F M; King, M C

    1993-01-01

    DNA samples from 60 Mapuche Indians, representing 39 maternal lineages, were genetically characterized for (1) nucleotide sequences of the mtDNA control region; (2) presence or absence of a nine base duplication in mtDNA region V; (3) HLA loci DRB1 and DQA1; (4) variation at three nuclear genes with short tandem repeats; and (5) variation at the polymorphic marker D2S44. The genetic profile of the Mapuche population was compared to other Amerinds and to worldwide populations. Two highly polymorphic portions of the mtDNA control region, comprising 650 nucleotides, were amplified by the polymerase chain reaction (PCR) and directly sequenced. The 39 maternal lineages were defined by two or three generation families identified by the Mapuches. These 39 lineages included 19 different mtDNA sequences that could be grouped into four classes. The same classes of sequences appear in other Amerinds from North, Central, and South American populations separated by thousands of miles, suggesting that the origin of the mtDNA patterns predates the migration to the Americas. The mtDNA sequence similarity between Amerind populations suggests that the migration throughout the Americas occurred rapidly relative to the mtDNA mutation rate. HLA DRB1 alleles 1602 and 1402 were frequent among the Mapuches. These alleles also occur at high frequency among other Amerinds in North and South America, but not among Spanish, Chinese or African-American populations. The high frequency of these alleles throughout the Americas, and their specificity to the Americas, supports the hypothesis that Mapuches and other Amerind groups are closely related.(ABSTRACT TRUNCATED AT 250 WORDS)

  12. Improved annotation of 3' untranslated regions and complex loci by combination of strand-specific direct RNA sequencing, RNA-Seq and ESTs.

    Directory of Open Access Journals (Sweden)

    Nicholas J Schurch

    Full Text Available The reference annotations made for a genome sequence provide the framework for all subsequent analyses of the genome. Correct and complete annotation in addition to the underlying genomic sequence is particularly important when interpreting the results of RNA-seq experiments where short sequence reads are mapped against the genome and assigned to genes according to the annotation. Inconsistencies in annotations between the reference and the experimental system can lead to incorrect interpretation of the effect on RNA expression of an experimental treatment or mutation in the system under study. Until recently, the genome-wide annotation of 3' untranslated regions received less attention than coding regions and the delineation of intron/exon boundaries. In this paper, data produced for samples in Human, Chicken and A. thaliana by the novel single-molecule, strand-specific, Direct RNA Sequencing technology from Helicos Biosciences which locates 3' polyadenylation sites to within +/- 2 nt, were combined with archival EST and RNA-Seq data. Nine examples are illustrated where this combination of data allowed: (1 gene and 3' UTR re-annotation (including extension of one 3' UTR by 5.9 kb; (2 disentangling of gene expression in complex regions; (3 clearer interpretation of small RNA expression and (4 identification of novel genes. While the specific examples displayed here may become obsolete as genome sequences and their annotations are refined, the principles laid out in this paper will be of general use both to those annotating genomes and those seeking to interpret existing publically available annotations in the context of their own experimental data.

  13. Sequence analysis of the Epstein-Barr virus (EBV) latent membrane protein-1 gene and promoter region

    DEFF Research Database (Denmark)

    Sandvej, Kristian; Gratama, J W; Munch, M

    1997-01-01

    Sequence variations in the Epstein-Barr virus (EBV) encoded latent membrane protein-1 (LMP-1) gene have been described in a Chinese nasopharyngeal carcinoma-derived isolate (CAO), and in viral isolates from various EBV-associated tumors. It has been suggested that these genetic changes, which...... include loss of a Xho I restriction site (position 169425) and a C-terminal 30-base pair (bp) deletion (position 168287-168256), define EBV genotypes associated with increased tumorigenicity or with disease among particular geographic populations. To determine the frequency of LMP-1 variations in European...... wild-type virus isolates, we sequenced the LMP-1 promoter and gene in EBV from lymphoblastoid cell lines from healthy carriers and patients without EBV-associated disease. Sequence changes were often present, and defined at least four main groups of viral isolates, which we designate Groups A through D...

  14. Sequencing analysis of ghrelin gene 5' flanking region: relations between the sequence variants, fasting plasma total ghrelin concentrations, and body mass index.

    Science.gov (United States)

    Vartiainen, Johanna; Kesäniemi, Y Antero; Ukkola, Olavi

    2006-10-01

    Ghrelin is a 28-amino-acid peptide with several functions linked to energy metabolism. Low ghrelin plasma concentrations are associated with obesity, hypertension, and type 2 diabetes mellitus, whereas high concentrations reflect states of negative energy balance. Several studies addressing the hormonal and neural regulation of ghrelin gene expression have been carried out, but the role of genetic factors in the regulation of ghrelin plasma levels remains unclear. To elucidate the role of genetic factors in the regulation of ghrelin expression, we screened 1657 nucleotides of the ghrelin gene 5' flanking region (promoter and possible regulatory sites) for new sequential variations from patient samples with low (n = 50) and high (n = 50) fasting plasma total ghrelin concentrations (low- and high-ghrelin groups). Eleven single nucleotide polymorphisms (SNPs), 3 of which were rare variants (allelic frequency less than 1%) were found in our population. The genotype distribution patterns of the SNPs did not differ between the study groups, except for SNP-501A>C (P = .039). In addition, the SNP-01A>C was associated with body mass index (BMI) (P = .018). This variant was studied further in our large and well-defined Oulu Project Elucidating Risk for Atherosclerosis (OPERA) cohort (n = 1045) by the restriction fragment length polymorphism (RFLP) technique. No significant association of SNP-501A>C genotypes with fasting ghrelin plasma concentrations was found in the whole OPERA population. However, the association of this SNP with BMI and with waist circumference reached statistical significance in OPERA (P = .047 and .049, respectively), remaining of borderline significance for BMI after adjustments (P = .055). The results indicate that factors other than the 11 SNPs found in this study in the 5' flanking region of ghrelin gene are the main determinants of ghrelin plasma levels. However, SNP-501 A>C genotype distribution seems to be different in subjects having the highest

  15. Comparison of Nucleotide Sequence of P2C Region in Diabetogenic and Non-Diabetogenic Coxsackie Virus B5 Isolates

    Directory of Open Access Journals (Sweden)

    Cheng-Chong Chou

    2004-11-01

    Full Text Available Enteroviruses are environmental triggers in the pathogenesis of type 1 diabetes mellitus (DM. A sequence of six identical amino acids (PEVKEK is shared by the 2C protein of Coxsackie virus B and the glutamic acid decarboxylase (GAD molecules. Between 1995 and 2002, we investigated 22 Coxsackie virus B5 (CVB5 isolates from southern Taiwan. Four of these isolates were obtained from four new-onset type 1 DM patients with diabetic ketoacidosis. We compared a 300 nucleotide sequence in the 2C protein gene (p2C in 24 CVB5 isolates (4 diabetogenic, 18 non-diabetogenic and 2 prototype. We found 0.3-10% nucleotide differences. In the four isolates from type 1 DM patients, there was only 2.4-3.4% nucleotide difference, and there was only 1.7-7.1% nucleotide difference between type 1 DM isolates and non-diabetogenic isolates. Comparison of the nucleotide sequence between prototype virus and 22 CVB5 isolates revealed 18.4-24.1% difference. Twenty-one CVB5 isolates from type 1 DM and non-type 1 DM patients contained the PEVKEK sequence, as shown by the p2C nucleotide sequence. Our data showed that the viral p2C sequence with homology with GAD is highly conserved in CVB5 isolates. There was no difference between diabetogenic and non-diabetogenic CVB5 isolates. All four type 1 DM patients had at least one of the genetic susceptibility alleles HLA-DR, DQA1, DQB1. Other genetic and autoimmune factors such as HLA genetic susceptibility and GAD may also play important roles in the pathogenesis in type 1 DM.

  16. Sequence analysis of the L protein of the Ebola 2014 outbreak: Insight into conserved regions and mutations.

    Science.gov (United States)

    Ayub, Gohar; Waheed, Yasir

    2016-06-01

    The 2014 Ebola outbreak was one of the largest that have occurred; it started in Guinea and spread to Nigeria, Liberia and Sierra Leone. Phylogenetic analysis of the current virus species indicated that this outbreak is the result of a divergent lineage of the Zaire ebolavirus. The L protein of Ebola virus (EBOV) is the catalytic subunit of the RNA‑dependent RNA polymerase complex, which, with VP35, is key for the replication and transcription of viral RNA. Earlier sequence analysis demonstrated that the L protein of all non‑segmented negative‑sense (NNS) RNA viruses consists of six domains containing conserved functional motifs. The aim of the present study was to analyze the presence of these motifs in 2014 EBOV isolates, highlight their function and how they may contribute to the overall pathogenicity of the isolates. For this purpose, 81 2014 EBOV L protein sequences were aligned with 475 other NNS RNA viruses, including Paramyxoviridae and Rhabdoviridae viruses. Phylogenetic analysis of all EBOV outbreak L protein sequences was also performed. Analysis of the amino acid substitutions in the 2014 EBOV outbreak was conducted using sequence analysis. The alignment demonstrated the presence of previously conserved motifs in the 2014 EBOV isolates and novel residues. Notably, all the mutations identified in the 2014 EBOV isolates were tolerant, they were pathogenic with certain examples occurring within previously determined functional conserved motifs, possibly altering viral pathogenicity, replication and virulence. The phylogenetic analysis demonstrated that all sequences with the exception of the 2014 EBOV sequences were clustered together. The 2014 EBOV outbreak has acquired a great number of mutations, which may explain the reasons behind this unprecedented outbreak. Certain residues critical to the function of the polymerase remain conserved and may be targets for the development of antiviral therapeutic agents.

  17. Phylogenetic relationships in Solanaceae and related species based on cpDNA sequence from plastid trnE-trnT region

    Directory of Open Access Journals (Sweden)

    Danila Montewka Melotto-Passarin

    2008-01-01

    Full Text Available Intergenic spacers of chloroplast DNA (cpDNA are very useful in phylogenetic and population genetic studiesof plant species, to study their potential integration in phylogenetic analysis. The non-coding trnE-trnT intergenic spacer ofcpDNA was analyzed to assess the nucleotide sequence polymorphism of 16 Solanaceae species and to estimate its ability tocontribute to the resolution of phylogenetic studies of this group. Multiple alignments of DNA sequences of trnE-trnT intergenicspacer made the identification of nucleotide variability in this region possible and the phylogeny was estimated by maximumparsimony and rooted with Convolvulaceae Ipomoea batatas, the most closely related family. Besides, this intergenic spacerwas tested for the phylogenetic ability to differentiate taxonomic levels. For this purpose, species from four other families wereanalyzed and compared with Solanaceae species. Results confirmed polymorphism in the trnE-trnT region at different taxonomiclevels.

  18. Comparison of sequences of hypervariable region (HVR subunit S-1 gene of field isolate I-37 infectious bronchitis virus with Connecticut serotype

    Directory of Open Access Journals (Sweden)

    N.L.P Indi Dharmayanti

    2003-06-01

    Full Text Available Infectious Bronchitis is a contagious and acute respiratory disease in chickens caused by infectious bronchitis virus (IBV.Antigenic differences in IBV are associated with changes in the sequence of the spike glycoprotein (S. The subunit S1 which demonstrates more sequence variability than S-2 have been identified as hypervariable region (HVR-1 and 2. There were several IB virus field isolates included I-37 have been identified in Indonesia by serum neutralization method. However, gene sequence variation in HVR subunit S-1 had not yet been identified. Isolate I-37 was close to the serotype Connecticut 46 (Conn 46. The aim of this study is to identify sequence variation of HVR subunit S-1 gene of isolate I-37 produced by Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR and sequencing. Several procedures were carried out in the study including virus titration, propagation and was concentrated from the allantoic fluid infected with IBV. Then, RNA was extracted for RTPCR. urther the product was sequnced and its homology with IBV references from GenBank was compared by GenMac version 8.0. Result showed that isolate I-37 produced 515 bp of amplification product. Isolate I-37 and Conn 46 are same serotype, yet their HVR subunit S-1 nucleotides and amino acids (protein differ by 6.9% and 15.6% respectively. It might be concluded that isolate I-37 was variant of Conn 46.

  19. Phylogenetic relationships within the cyst-forming nematodes (Nematoda, Heteroderidae) based on analysis of sequences from the ITS regions of ribosomal DNA.

    Science.gov (United States)

    Subbotin, S A; Vierstraete, A; De Ley, P; Rowe, J; Waeyenberge, L; Moens, M; Vanfleteren, J R

    2001-10-01

    The ITS1, ITS2, and 5.8S gene sequences of nuclear ribosomal DNA from 40 taxa of the family Heteroderidae (including the genera Afenestrata, Cactodera, Heterodera, Globodera, Punctodera, Meloidodera, Cryphodera, and Thecavermiculatus) were sequenced and analyzed. The ITS regions displayed high levels of sequence divergence within Heteroderinae and compared to outgroup taxa. Unlike recent findings in root knot nematodes, ITS sequence polymorphism does not appear to complicate phylogenetic analysis of cyst nematodes. Phylogenetic analyses with maximum-parsimony, minimum-evolution, and maximum-likelihood methods were performed with a range of computer alignments, including elision and culled alignments. All multiple alignments and phylogenetic methods yielded similar basic structure for phylogenetic relationships of Heteroderidae. The cyst-forming nematodes are represented by six main clades corresponding to morphological characters and host specialization, with certain clades assuming different positions depending on alignment procedure and/or method of phylogenetic inference. Hypotheses of monophyly of Punctoderinae and Heteroderinae are, respectively, strongly and moderately supported by the ITS data across most alignments. Close relationships were revealed between the Avenae and the Sacchari groups and between the Humuli group and the species H. salixophila within Heteroderinae. The Goettingiana group occupies a basal position within this subfamily. The validity of the genera Afenestrata and Bidera was tested and is discussed based on molecular data. We conclude that ITS sequence data are appropriate for studies of relationships within the different species groups and less so for recovery of more ancient speciations within Heteroderidae. Copyright 2001 Academic Press.

  20. Population genetic structure of skipjack tuna Katsuwonus pelamis from the Indian coast using sequence analysis of the mitochondrial DNA D-loop region

    Digital Repository Service at National Institute of Oceanography (India)

    Menezes, M.R.; Kumar, G.; Kunal, S.P.

    Biology (2012) 80, 2198–2212 doi:10.1111/j.1095-8649.2012.03270.x, available online at wileyonlinelibrary.com Population genetic structure of skipjack tuna Katsuwonus pelamis from the Indian coast using sequence analysis of the mitochondrial DNA D...-loop region M. R. Menezes*, G. Kumar and S. P. Kunal Biological Oceanography Division, National Institute of Oceanography (CSIR), Dona Paula, Goa 403 004, India (Received 26 May 2011, Accepted 14 February 2012) Genetic structure of skipjack tuna Katsuwonus...

  1. Three genetic stocks of frigate tuna Auxis thazard thazard (Lacepede, 1800) along the Indian coast revealed from sequence analyses of mitochondrial DNA D-loop region

    Digital Repository Service at National Institute of Oceanography (India)

    GirishKumar; Kunal, S.P.; Menezes, M.R.; Meena, R.M.

    revealed from sequence analyses of mitochondrial DNA D-loop region Name of authors: 1. Girish Kumar* Biological Oceanography Division (BOD) National Institute of Oceanography (NIO) Dona Paula, Goa 403004, India. Email: girishkumar....nio@gmail.com Tel: +919766548060 2. Swaraj Priyaranjan Kunal Biological Oceanography Division (BOD) National Institute of Oceanography (NIO) Dona Paula, Goa 403004, India. Email: swar.mbt@gmail.com 3. Maria Rosalia Menezes Biological Oceanography...

  2. Ionospheric electron acceleration by electromagnetic waves near regions of plasma resonances

    International Nuclear Information System (INIS)

    Villalon, E.

    1989-01-01

    Electron acceleration by electromagnetic fields propagating in the inhomogeneous ionospheric plasma is investigated. It is found that high-amplitude short wavelength electrostatic waves are generated by the incident electromagnetic fields that penetrate the radio window. These waves can very efficiently transfer their energy to the electrons if the incident frequency is near the second harmonic of the cyclotron frequency

  3. Problems in Learning of Electronic Filing at Vocational School in Yogyakarta Special Region, Indonesia

    Science.gov (United States)

    Sutirman; Muhyadi; Surjono, Herman Dwi

    2017-01-01

    This study aims to investigate the learning implementation of electronic filing and problems faced by teachers in learning implementing of electronic filing. This study is a descriptive research with qualitative approach. Collecting data used interview and documentation techniques. The research subjects consisted of 29 teachers who teach Filing…

  4. [Cloning and sequence analysis of the DHBV genome of the brown ducks in Guilin region and establishment of the quantitative method for detecting DHBV].

    Science.gov (United States)

    Su, He-Ling; Huang, Ri-Dong; He, Song-Qing; Xu, Qing; Zhu, Hua; Mo, Zhi-Jing; Liu, Qing-Bo; Liu, Yong-Ming

    2013-03-01

    Brown ducks carrying DHBV were widely used as hepatitis B animal model in the research of the activity and toxicity of anti-HBV dugs. Studies showed that the ratio of DHBV carriers in the brown ducks in Guilin region was relatively high. Nevertheless, the characters of the DHBV genome of Guilin brown duck remain unknown. Here we report the cloning of the genome of Guilin brown duck DHBV and the sequence analysis of the genome. The full length of the DHBV genome of Guilin brown duck was 3 027bp. Analysis using ORF finder found that there was an ORF for an unknown peptide other than S-ORF, PORF and C-ORF in the genome of the DHBV. Vector NTI 8. 0 analysis revealed that the unknown peptide contained a motif which binded to HLA * 0201. Aligning with the DHBV sequences from different countries and regions indicated that there were no obvious differences of regional distribution among the sequences. A fluorescence quantitative PCR for detecting DHBV was establishment based on the recombinant plasmid pGEM-DHBV-S constructed. This study laid the groundwork for using Guilin brown duck as a hepatitis B animal model.

  5. Sequencing of 15622 gene-bearing BACs clarifies the gene-dense regions of the barley genome

    Czech Academy of Sciences Publication Activity Database

    Munoz-Amatriain, M.; Lonardi, S.; Luo, M.C.; Madishetty, K.; Svensson, J.T.; Moscou, M. J.; Wanamaker, S.; Kudrna, D.; Zheng, J.; Šimková, Hana; Doležel, Jaroslav; Grimwood, J.; Mammadov, J.; Close, T.J.

    2015-01-01

    Roč. 84, č. 1 (2015), s. 216-227 ISSN 0960-7412 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : Barley * Hordeum vulgare L * BAC sequencing Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.468, year: 2015

  6. Population structure of the African savannah elephant inferred from mitochondrial control region sequences and nuclear microsatellite loci

    DEFF Research Database (Denmark)

    Nyakaana, S; Arctander, P; Siegismund, H R

    2002-01-01

    Two hundred and thirty-six mitochondrial DNA nucleotide sequences were used in combination with polymorphism at four nuclear microsatellite loci to assess the amount and distribution of genetic variation within and between African savannah elephants. They were sampled from 11 localities in easter...

  7. Identification of genome-wide non-canonical spliced regions and analysis of biological functions for spliced sequences using Read-Split-Fly.

    Science.gov (United States)

    Bai, Yongsheng; Kinne, Jeff; Ding, Lizhong; Rath, Ethan C; Cox, Aaron; Naidu, Siva Dharman

    2017-10-03

    It is generally thought that most canonical or non-canonical splicing events involving U2- and U12 spliceosomes occur within nuclear pre-mRNAs. However, the question of whether at least some U12-type splicing occurs in the cytoplasm is still unclear. In recent years next-generation sequencing technologies have revolutionized the field. The "Read-Split-Walk" (RSW) and "Read-Split-Run" (RSR) methods were developed to identify genome-wide non-canonical spliced regions including special events occurring in cytoplasm. As the significant amount of genome/transcriptome data such as, Encyclopedia of DNA Elements (ENCODE) project, have been generated, we have advanced a newer more memory-efficient version of the algorithm, "Read-Split-Fly" (RSF), which can detect non-canonical spliced regions with higher sensitivity and improved speed. The RSF algorithm also outputs the spliced sequences for further downstream biological function analysis. We used open access ENCODE project RNA-Seq data to search spliced intron sequences against the U12-type spliced intron sequence database to examine whether some events could occur as potential signatures of U12-type splicing. The check was performed by searching spliced sequences against 5'ss and 3'ss sequences from the well-known orthologous U12-type spliceosomal intron database U12DB. Preliminary results of searching 70 ENCODE samples indicated that the presence of 5'ss with U12-type signature is more frequent than U2-type and prevalent in non-canonical junctions reported by RSF. The selected spliced sequences have also been further studied using miRBase to elucidate their functionality. Preliminary results from 70 samples of ENCODE datasets show that several miRNAs are prevalent in studied ENCODE samples. Two of these are associated with many diseases as suggested in the literature. Specifically, hsa-miR-1273 and hsa-miR-548 are associated with many diseases and cancers. Our RSF pipeline is able to detect many possible junctions

  8. D-region electron density and effective recombination coefficients during twilight – experimental data and modelling during solar proton events

    Directory of Open Access Journals (Sweden)

    A. Osepian

    2009-10-01

    Full Text Available Accurate measurements of electron density in the lower D-region (below 70 km altitude are rarely made. This applies both with regard to measurements by ground-based facilities and by sounding rockets, and during both quiet conditions and conditions of energetic electron precipitation. Deep penetration into the atmosphere of high-energy solar proton fluxes (during solar proton events, SPE produces extra ionisation in the whole D-region, including the lower altitudes, which gives favourable conditions for accurate measurements using ground-based facilities. In this study we show that electron densities measured with two ground-based facilities at almost the same latitude but slightly different longitudes, provide a valuable tool for validation of model computations. The two techniques used are incoherent scatter of radio waves (by the EISCAT 224 MHz radar in Tromsø, Norway, 69.6° N, 19.3° E, and partial reflection of radio-waves (by the 2.8 MHz radar near Murmansk, Russia, 69.0° N, 35.7° E. Both radars give accurate electron density values during SPE, from heights 57–60 km and upward with the EISCAT radar and between 55–70 km with the partial reflection technique. Near noon, there is little difference in the solar zenith angle between the two locations and both methods give approximately the same values of electron density at the overlapping heights. During twilight, when the difference in solar zenith angles increases, electron density values diverge. When both radars are in night conditions (solar zenith angle >99° electron densities at the overlapping altitudes again become equal. We use the joint measurements to validate model computations of the ionospheric parameters f+, λ, αeff and their variations during solar proton events. These parameters are important characteristics of the lower ionosphere structure which cannot be determined by other methods.

  9. 77 FR 22760 - Proposed Information Collection; Comment Request; Southeast Region Gulf of Mexico Electronic...

    Science.gov (United States)

    2012-04-17

    ... electronic logbook memory chip will be removed from the unit and downloaded at the contractor site in College Station, Texas. A new logbook memory chip will replace the removed memory chip, a process taking less than...

  10. The Magnetic Local Time Distribution of Energetic Electrons in the Radiation Belt Region

    Science.gov (United States)

    Allison, H. J.

    2017-12-01

    Using fourteen years of electron flux data from the National Oceanic and Atmospheric Administration Polar Operational Environmental Satellites (POES), a statistical study of the magnetic local time (MLT) distribution of the electron population is performed across a range of activity levels, defined by AE, AE*, Kp, solar wind velocity (Vsw), and VswBz. Three electron energies (>30, >100, and >300 keV) are considered. Dawn-dusk flux asymmetries larger than order of magnitude were observed for >30 and >100 keV electrons. For >300 keV electrons, dawn-dusk asymmetries were primarily due to a decrease in the average dusk-side flux beyond L* ˜ 4.5 that arose with increasing activity. For the >30 keV population, substorm injections enhance the dawn-side flux, which may not reach the dusk-side as the electrons can be on open drift paths and lost to the magnetopause. The asymmetries in the >300 keV population are attributed to the combination of magnetopause shadowing and >300 keV electron injections by large electric fields. We suggest that 3D radiation belt models could set the minimum energy boundary (Emin) to 30 keV or above at L* ˜6 during periods of low activity. However, for more moderate conditions, Emin should be larger than 100 keV and, for very extreme activities, ˜300 keV. Our observations show the extent that in-situ electron flux readings may vary during active periods due to the MLT of the satellite and highlight the importance of 4D radiation belt models to fully understand radiation belt processes.

  11. Materials of the Regional Training Course on Validation and Process Control for Electron Beam Radiation Processing

    International Nuclear Information System (INIS)

    Kaluska, I.; Gluszewski, W.

    2007-01-01

    Irradiation with electron beams is used in the polymer industry, food, pharmaceutical and medical device industries for sterilization of surfaces. About 20 lectures presented during the Course were devoted to all aspects of control and validation of low energy electron beam processes. They should help the product manufacturers better understand the application of the ANSI/AAMI/ISO 11137 norm, which defines the requirements and standard practices for validation of the irradiation process and the process controls required during routine processing

  12. Spin degrees of freedom in electron nucleon scattering in the resonance region

    International Nuclear Information System (INIS)

    Burkert, V.D.

    1987-01-01

    Some aspects of using polarized electrons and/or polarized targets in electron-nucleon scattering experiments are discussed. Polarization measurements can be used to extend the knowledge of nucleon form-factor measurements to higher Q 2 and are indispensable for a model-independent extraction of the helicity amplitudes of exclusive meson production. Measurements of polarization asymmetries may also help in revealing the excitation of weaker resonances

  13. Analysis of HIV-1 intersubtype recombination breakpoints suggests region with high pairing probability may be a more fundamental factor than sequence similarity affecting HIV-1 recombination.

    Science.gov (United States)

    Jia, Lei; Li, Lin; Gui, Tao; Liu, Siyang; Li, Hanping; Han, Jingwan; Guo, Wei; Liu, Yongjian; Li, Jingyun

    2016-09-21

    With increasing data on HIV-1, a more relevant molecular model describing mechanism details of HIV-1 genetic recombination usually requires upgrades. Currently an incomplete structural understanding of the copy choice mechanism along with several other issues in the field that lack elucidation led us to perform an analysis of the correlation between breakpoint distributions and (1) the probability of base pairing, and (2) intersubtype genetic similarity to further explore structural mechanisms. Near full length sequences of URFs from Asia, Europe, and Africa (one sequence/patient), and representative sequences of worldwide CRFs were retrieved from the Los Alamos HIV database. Their recombination patterns were analyzed by jpHMM in detail. Then the relationships between breakpoint distributions and (1) the probability of base pairing, and (2) intersubtype genetic similarities were investigated. Pearson correlation test showed that all URF groups and the CRF group exhibit the same breakpoint distribution pattern. Additionally, the Wilcoxon two-sample test indicated a significant and inexplicable limitation of recombination in regions with high pairing probability. These regions have been found to be strongly conserved across distinct biological states (i.e., strong intersubtype similarity), and genetic similarity has been determined to be a very important factor promoting recombination. Thus, the results revealed an unexpected disagreement between intersubtype similarity and breakpoint distribution, which were further confirmed by genetic similarity analysis. Our analysis reveals a critical conflict between results from natural HIV-1 isolates and those from HIV-1-based assay vectors in which genetic similarity has been shown to be a very critical factor promoting recombination. These results indicate the region with high-pairing probabilities may be a more fundamental factor affecting HIV-1 recombination than sequence similarity in natural HIV-1 infections. Our

  14. Intracellular diversity of the V4 and V9 regions of the 18S rRNA in marine protists (radiolarians) assessed by high-throughput sequencing.

    Science.gov (United States)

    Decelle, Johan; Romac, Sarah; Sasaki, Eriko; Not, Fabrice; Mahé, Frédéric

    2014-01-01

    Metabarcoding is a powerful tool for exploring microbial diversity in the environment, but its accurate interpretation is impeded by diverse technical (e.g. PCR and sequencing errors) and biological biases (e.g. intra-individual polymorphism) that remain poorly understood. To help interpret environmental metabarcoding datasets, we investigated the intracellular diversity of the V4 and V9 regions of the 18S rRNA gene from Acantharia and Nassellaria (radiolarians) using 454 pyrosequencing. Individual cells of radiolarians were isolated, and PCRs were performed with generalist primers to amplify the V4 and V9 regions. Different denoising procedures were employed to filter the pyrosequenced raw amplicons (Acacia, AmpliconNoise, Linkage method). For each of the six isolated cells, an average of 541 V4 and 562 V9 amplicons assigned to radiolarians were obtained, from which one numerically dominant sequence and several minor variants were found. At the 97% identity, a diversity metrics commonly used in environmental surveys, up to 5 distinct OTUs were detected in a single cell. However, most amplicons grouped within a single OTU whereas other OTUs contained very few amplicons. Different analytical methods provided evidence that most minor variants forming different OTUs correspond to PCR and sequencing artifacts. Duplicate PCR and sequencing from the same DNA extract of a single cell had only 9 to 16% of unique amplicons in common, and alignment visualization of V4 and V9 amplicons showed that most minor variants contained substitutions in highly-conserved regions. We conclude that intracellular variability of the 18S rRNA in radiolarians is very limited despite its multi-copy nature and the existence of multiple nuclei in these protists. Our study recommends some technical guidelines to conservatively discard artificial amplicons from metabarcoding datasets, and thus properly assess the diversity and richness of protists in the environment.

  15. Oligo-Miocene reservoir sequence characterization and structuring in the Sisseb El Alem-Kalaa Kebira regions (Northeastern Tunisia)

    Science.gov (United States)

    Houatmia, Faten; Khomsi, Sami; Bédir, Mourad

    2015-11-01

    The Sisseb El Alem-Enfidha basin is located in the northeastern Tunisia, It is borded by Nadhour - Saouaf syncline to the north, Kairouan plain to the south, the Mediterranean Sea to the east and Tunisian Atlassic "dorsale" to the west. Oligocene and Miocene deltaic deposits present the main potential deep aquifers in this basin with high porosity (25%-30%). The interpretation of twenty seismic reflection profiles, calibrated by wire line logging data of twelve oil wells, hydraulic wells and geologic field sections highlighted the impact of tectonics on the structuring geometry of Oligo-Miocene sandstones reservoirs and their distribution in raised structures and subsurface depressions. Miocene seismostratigraphy analysis from Ain Ghrab Formation (Langhian) to the Segui Formation (Quaternary) showed five third-order seismic sequence deposits and nine extended lenticular sandy bodies reservoirs limited by toplap and downlap surfaces unconformities, Oligocene deposits presented also five third- order seismic sequences with five extended lenticular sandy bodies reservoirs. The Depth and the thickness maps of these sequence reservoir packages exhibited the structuring of this basin in sub-basins characterized by important lateral and vertical geometric and thichness variations. Petroleum wells wire line logging correlation with clay volume calculation showed an heterogeneous multilayer reservoirs of Oligocene and Miocene formed by the arrangement of fourteen sandstone bodies being able to be good reservoirs, separated by impermeable clay packages and affected by faults. Reservoirs levels correspond mainly to the lower system tract (LST) of sequences. Intensive fracturing by deep seated faults bounding the different sub-basins play a great role for water surface recharge and inter-layer circulations between affected reservoirs. The total pore volume of the Oligo-Miocene reservoir sandy bodies in the study area, is estimated to about 4 × 1012 m3 and equivalent to 4

  16. Sequencing and assembly of low copy and genic regions of isolated Triticum aestivum chromosome arm 7DS

    Czech Academy of Sciences Publication Activity Database

    Berkman, O. J.; Skarshewski, A.; Lorenc, M. T.; Kubaláková, Marie; Šimková, Hana; Batley, J.; Doležel, Jaroslav; Edwards, D.

    2011-01-01

    Roč. 9, č. 7 (2011), s. 768-775 ISSN 1467-7644 R&D Projects: GA ČR GA521/07/1573; GA MŠk ED0007/01/01 Institutional research plan: CEZ:AV0Z50380511 Keywords : wheat genome sequence * chromosome 7 * genome assembly Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.442, year: 2011

  17. Characterization of the HLA-DRβ1 third hypervariable region amino acid sequence according to charge and parental inheritance in systemic sclerosis.

    Science.gov (United States)

    Gentil, Coline A; Gammill, Hilary S; Luu, Christine T; Mayes, Maureen D; Furst, Dan E; Nelson, J Lee

    2017-03-07

    Specific HLA class II alleles are associated with systemic sclerosis (SSc) risk, clinical characteristics, and autoantibodies. HLA nomenclature initially developed with antibodies as typing reagents defining DRB1 allele groups. However, alleles from different DRB1 allele groups encode the same third hypervariable region (3rd HVR) sequence, the primary T-cell recognition site, and 3rd HVR charge differences can affect interactions with T cells. We considered 3rd HVR sequences (amino acids 67-74) irrespective of the allele group and analyzed parental inheritance considered according to the 3rd HVR charge, comparing SSc patients with controls. In total, 306 families (121 SSc and 185 controls) were HLA genotyped and parental HLA-haplotype origin was determined. Analysis was conducted according to DRβ1 3rd HVR sequence, charge, and parental inheritance. The distribution of 3rd HVR sequences differed in SSc patients versus controls (p = 0.007), primarily due to an increase of specific DRB1*11 alleles, in accord with previous observations. The 3rd HVR sequences were next analyzed according to charge and parental inheritance. Paternal transmission of DRB1 alleles encoding a +2 charge 3rd HVR was significantly reduced in SSc patients compared with maternal transmission (p = 0.0003, corrected for analysis of four charge categories p = 0.001). To a lesser extent, paternal transmission was increased when charge was 0 (p = 0.021, corrected for multiple comparisons p = 0.084). In contrast, paternal versus maternal inheritance was similar in controls. SSc patients differed from controls when DRB1 alleles were categorized according to 3rd HVR sequences. Skewed parental inheritance was observed in SSc patients but not in controls when the DRβ1 3rd HVR was considered according to charge. These observations suggest that epigenetic modulation of HLA merits investigation in SSc.

  18. Progenitor-derivative relationships of Hordeum polyploids (Poaceae, Triticeae inferred from sequences of TOPO6, a nuclear low-copy gene region.

    Directory of Open Access Journals (Sweden)

    Jonathan Brassac

    Full Text Available Polyploidization is a major mechanism of speciation in plants. Within the barley genus Hordeum, approximately half of the taxa are polyploids. While for diploid species a good hypothesis of phylogenetic relationships exists, there is little information available for the polyploids (4×, 6× of Hordeum. Relationships among all 33 diploid and polyploid Hordeum species were analyzed with the low-copy nuclear marker region TOPO6 for 341 Hordeum individuals and eight outgroup species. PCR products were either directly sequenced or cloned and on average 12 clones per individual were included in phylogenetic analyses. In most diploid Hordeum species TOPO6 is probably a single-copy locus. Most sequences found in polyploid individuals phylogenetically cluster together with sequences derived from diploid species and thus allow the identification of parental taxa of polyploids. Four groups of sequences occurring only in polyploid taxa are interpreted as footprints of extinct diploid taxa, which contributed to allopolyploid evolution. Our analysis identifies three key species involved in the evolution of the American polyploids of the genus. (i All but one of the American tetraploids have a TOPO6 copy originating from the Central Asian diploid H. roshevitzii, the second copy clustering with different American diploid species. (ii All hexaploid species from the New World have a copy of an extinct close relative of H. californicum and (iii possess the TOPO6 sequence pattern of tetraploid H. jubatum, each with an additional copy derived from different American diploids. Tetraploid H. bulbosum is an autopolyploid, while the assumed autopolyploid H. brevisubulatum (4×, 6× was identified as allopolyploid throughout most of its distribution area. The use of a proof-reading DNA polymerase in PCR reduced the proportion of chimerical sequences in polyploids in comparison to Taq polymerase.

  19. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    Science.gov (United States)

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  20. Simulation of electron density disturbances of the ionospheric D region produced by high-energy particle fluxes

    International Nuclear Information System (INIS)

    Martynenko, S.I.

    1989-01-01

    Using the large-scale tim expansion analytical solutions of electron concentration balance equation in D-region of the ionosphere for pulsed and periodic changes in the rate of ion formatin under the effect of fluxes of precipitating high-energy particles are obtained. Possible effect of disturbances of temperature of nutrals is taken into account. On the basis of model representations the space-time structure of emerging ionospheric disturbances is discussed

  1. A method for finding D-region electron density distributions from lf broadband pulse measurements. Telecommunications research and engineering report

    International Nuclear Information System (INIS)

    Wieder, B.; Espeland, R.H.

    1972-11-01

    A Loran-C transmitter is used as the signal source for the experiment. In the experiment, both the normal and abnormal components of the pulses reflected from the ionosphere are measured, and the reflection coeffeicients are determined as a function of frequency through Fourier analysis of both the groundwave and the skywave signals. The resultant data are then compared with reflection coefficients calculated from a series of test D-region electron density profiles

  2. Front-End Electron Transfer Dissociation Coupled to a 21 Tesla FT-ICR Mass Spectrometer for Intact Protein Sequence Analysis

    Science.gov (United States)

    Weisbrod, Chad R.; Kaiser, Nathan K.; Syka, John E. P.; Early, Lee; Mullen, Christopher; Dunyach, Jean-Jacques; English, A. Michelle; Anderson, Lissa C.; Blakney, Greg T.; Shabanowitz, Jeffrey; Hendrickson, Christopher L.; Marshall, Alan G.; Hunt, Donald F.

    2017-09-01

    High resolution mass spectrometry is a key technology for in-depth protein characterization. High-field Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR MS) enables high-level interrogation of intact proteins in the most detail to date. However, an appropriate complement of fragmentation technologies must be paired with FTMS to provide comprehensive sequence coverage, as well as characterization of sequence variants, and post-translational modifications. Here we describe the integration of front-end electron transfer dissociation (FETD) with a custom-built 21 tesla FT-ICR mass spectrometer, which yields unprecedented sequence coverage for proteins ranging from 2.8 to 29 kDa, without the need for extensive spectral averaging (e.g., 60% sequence coverage for apo-myoglobin with four averaged acquisitions). The system is equipped with a multipole storage device separate from the ETD reaction device, which allows accumulation of multiple ETD fragment ion fills. Consequently, an optimally large product ion population is accumulated prior to transfer to the ICR cell for mass analysis, which improves mass spectral signal-to-noise ratio, dynamic range, and scan rate. We find a linear relationship between protein molecular weight and minimum number of ETD reaction fills to achieve optimum sequence coverage, thereby enabling more efficient use of instrument data acquisition time. Finally, real-time scaling of the number of ETD reactions fills during method-based acquisition is shown, and the implications for LC-MS/MS top-down analysis are discussed. [Figure not available: see fulltext.

  3. Sequence diversity of hepatitis C virus 6a within the extended interferon sensitivity-determining region correlates with interferon-alpha/ribavirin treatment outcomes.

    Science.gov (United States)

    Zhou, Daniel X M; Chan, Paul K S; Zhang, Tiejun; Tully, Damien C; Tam, John S

    2010-10-01

    Studies on the association between sequence variability of the interferon sensitivity-determining region (ISDR) of hepatitis C virus and the outcome of treatment have reached conflicting results. In this study, 25 patients infected with HCV 6a who had received interferon-alpha/ribavirin combination treatment were analyzed for the sequence variations. 14 of them had the full genome sequences obtained from a previous study, whereas the other 11 samples were sequenced for the extended ISDR (eISDR). This eISDR fragment covers 192 bp (64 amino acids) upstream and 201 bp (67 amino acids) downstream from the ISDR previously defined for HCV 1b. The comparison between interferon-alpha resistance and response groups for the amino acid mutations located in the full genome (6 and 8 patients respectively) as well as the mutations located in the eISDR (10 and 15 patients respectively) showed that the mutations I2160V, I2256V, V2292I (Pc) 2010 Elsevier B.V. All rights reserved.

  4. Computational Model of D-Region Ion Production Caused by Energetic Electron Precipitations Based on General Monte Carlo Transport Calculations

    Science.gov (United States)

    Kouznetsov, A.; Cully, C. M.

    2017-12-01

    During enhanced magnetic activities, large ejections of energetic electrons from radiation belts are deposited in the upper polar atmosphere where they play important roles in its physical and chemical processes, including VLF signals subionospheric propagation. Electron deposition can affect D-Region ionization, which are estimated based on ionization rates derived from energy depositions. We present a model of D-region ion production caused by an arbitrary (in energy and pitch angle) distribution of fast (10 keV - 1 MeV) electrons. The model relies on a set of pre-calculated results obtained using a general Monte Carlo approach with the latest version of the MCNP6 (Monte Carlo N-Particle) code for the explicit electron tracking in magnetic fields. By expressing those results using the ionization yield functions, the pre-calculated results are extended to cover arbitrary magnetic field inclinations and atmospheric density profiles, allowing ionization rate altitude profile computations in the range of 20 and 200 km at any geographic point of interest and date/time by adopting results from an external atmospheric density model (e.g. NRLMSISE-00). The pre-calculated MCNP6 results are stored in a CDF (Common Data Format) file, and IDL routines library is written to provide an end-user interface to the model.

  5. Electronic health record use in an affluent region in India: Findings from a survey of Chandigarh hospitals.

    Science.gov (United States)

    Powell, Adam C; Ludhar, Jasmine K; Ostrovsky, Yuri

    2017-07-01

    To characterize the electronic health record (EHR) systems in use in an affluent region of India in order to understand the state-of-the-art within the Indian market. A survey on EHR features was created by combining an instrument developed by the Organisation for International Cooperation and Development and an instrument developed by an American team of researchers. An interviewer directly administered the survey to leaders from hospitals in greater Chandigarh which possessed electronic health information systems. Summary statistics from the survey are reported. 24 hospitals offering multi-specialty inpatient care were identified in greater Chandigarh. 18 of these hospitals had electronic health information systems, 17 of which were interviewed. Of the hospitals with systems, 17 (100%) could access patient demographic information internally, but 12 (71%) could not access vital sign, allergy, or immunization data internally. 11 (65%) of the systems were capable of sharing patient summaries internally, but 13 (76%) could not send electronic referrals internally. Among organizations which have adopted systems, major barriers tend to have been around financial and staff matters. Concerns over interoperability, privacy, and security were infrequently cited as barriers to adoption. EHRs are ubiquitous in at least one region of India. Systems are more likely to have capabilities for intra-organizational information sharing than for inter-organizational information sharing. The availability of EHR data may foster clinical research. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Characteristics of pitch angle distributions of hundreds of keV electrons in the slot region and inner radiation belt

    Science.gov (United States)

    Zhao, H.; Li, X.; Blake, J. B.; Fennell, J. F.; Claudepierre, S. G.; Baker, D. N.; Jaynes, A. N.; Malaspina, D. M.

    2014-12-01

    The pitch angle distribution (PAD) of energetic electrons in the slot region and inner radiation belt received little attention in the past decades due to the lack of quality measurements. Using the state-of-the-art pitch angle-resolved data from the Magnetic Electron Ion Spectrometer instrument onboard the Van Allen Probes, a detailed analysis of hundreds of keV electron PADs below L = 4 is performed, in which the PADs are categorized into three types: normal (flux peaking at 90°), cap (exceedingly peaking narrowly around 90°), and 90° minimum (lower flux at 90°) PADs. By examining the characteristics of the PADs of ˜460 keV electrons for over a year, we find that the 90° minimum PADs are generally present in the inner belt (Lpitch angle scattering of hiss waves. Fitting the normal PADs into sinnα form, the parameter n is much higher below L = 3 than that in the outer belt and relatively constant in the inner belt but changes significantly in the slot region (2 mechanism can hardly explain the formation of 90° minimum PADs at the center of inner belt.

  7. Development of D-region electron and ion densities under various auroral conditions during the Energy Budget Campaign (EBC)

    International Nuclear Information System (INIS)

    Brekke, A.; Holt, O.; Friedrich, M.; Hansen, T.; Stauning, P.; Thrane, E.V.

    1985-01-01

    D-region electron density profiles and time variations were obtained during the Energy Budget Campaign 1980 by a partial reflection radar at Ramfjordmoen, Tromso, located between the rocket ranges at Andoya and Kiruna. The observations were made under various geophysical conditions which are illustrated by riometer observations. The partial reflection measurements indicate that the rockets were launched into a relatively stable D-region on two occasions, while it was somewhat more disturbed on the third. A comparison between the electron density profiles derived by the partial reflection technique and rocket borne probes and Faraday rotation experiments does indicate fair agreement during the quiet conditions, but relatively large discrepancies during disturbed conditions. Simultaneously derived electron density profiles, by use of the Faraday technique, and ion density profiles, by gridded electrostatic spheres mounted on the rocket payload, have made it possible to estimate the negative ion to electron density ratio lambda versus height. These values of lambda are within the range of model calculations. (author)

  8. Prevalence of Hepatitis C Virus Subgenotypes 1a and 1b in Japanese Patients: Ultra-Deep Sequencing Analysis of HCV NS5B Genotype-Specific Region

    Science.gov (United States)

    Wu, Shuang; Kanda, Tatsuo; Nakamoto, Shingo; Jiang, Xia; Miyamura, Tatsuo; Nakatani, Sueli M.; Ono, Suzane Kioko; Takahashi-Nakaguchi, Azusa; Gonoi, Tohru; Yokosuka, Osamu

    2013-01-01

    Background Hepatitis C virus (HCV) subgenotypes 1a and 1b have different impacts on the treatment response to peginterferon plus ribavirin with direct-acting antivirals (DAAs) against patients infected with HCV genotype 1, as the emergence rates of resistance mutations are different between these two subgenotypes. In Japan, almost all of HCV genotype 1 belongs to subgenotype 1b. Methods and Findings To determine HCV subgenotype 1a or 1b in Japanese patients infected with HCV genotype 1, real-time PCR-based method and Sanger method were used for the HCV NS5B region. HCV subgenotypes were determined in 90% by real-time PCR-based method. We also analyzed the specific probe regions for HCV subgenotypes 1a and 1b using ultra-deep sequencing, and uncovered mutations that could not be revealed using direct-sequencing by Sanger method. We estimated the prevalence of HCV subgenotype 1a as 1.2-2.5% of HCV genotype 1 patients in Japan. Conclusions Although real-time PCR-based HCV subgenotyping method seems fair for differentiating HCV subgenotypes 1a and 1b, it may not be sufficient for clinical practice. Ultra-deep sequencing is useful for revealing the resistant strain(s) of HCV before DAA treatment as well as mixed infection with different genotypes or subgenotypes of HCV. PMID:24069214

  9. Sequences within both the 5' untranslated region and the Gag gene are important for efficient encapsidation of Mason-Pfizer monkey virus RNA

    International Nuclear Information System (INIS)

    Schmidt, Russell D.; Mustafa, Farah; Lew, Kathy A.; Browning, Mathew T.; Rizvi, Tahir A.

    2003-01-01

    It has previously been shown that the 5' untranslated leader region (UTR), including about 495 bp of the gag gene, is sufficient for the efficient encapsidation and propagation of Mason-Pfizer monkey virus (MPMV) based retroviral vectors. In addition, a deletion upstream of the major splice donor, SD, has been shown to adversely affect MPMV RNA packaging. However, the precise sequence requirement for the encapsidation of MPMV genomic RNA within the 5' UTR and gag remains largely unknown. In this study, we have used a systematic deletion analysis of the 5' UTR and gag gene to define the cis-acting sequences responsible for efficient MPMV RNA packaging. Using an in vivo packaging and transduction assay, our results reveal that the MPMV packaging signal is primarily found within the first 30 bp immediately downstream of the primer binding site. However, its function is dependent upon the presence of the last 23 bp of the 5' UTR and approximately the first 100 bp of the gag gene. Thus, sequences that affect MPMV RNA packaging seem to reside both upstream and downstream of the major splice donor with the downstream region responsible for the efficient functioning of the upstream primary packaging determinant

  10. Is the extraction by Whatman FTA filter matrix technology and sequencing of large ribosomal subunit D1-D2 region sufficient for identification of clinical fungi?

    Science.gov (United States)

    Kiraz, Nuri; Oz, Yasemin; Aslan, Huseyin; Erturan, Zayre; Ener, Beyza; Akdagli, Sevtap Arikan; Muslumanoglu, Hamza; Cetinkaya, Zafer

    2015-10-01

    Although conventional identification of pathogenic fungi is based on the combination of tests evaluating their morphological and biochemical characteristics, they can fail to identify the less common species or the differentiation of closely related species. In addition these tests are time consuming, labour-intensive and require experienced personnel. We evaluated the feasibility and sufficiency of DNA extraction by Whatman FTA filter matrix technology and DNA sequencing of D1-D2 region of the large ribosomal subunit gene for identification of clinical isolates of 21 yeast and 160 moulds in our clinical mycology laboratory. While the yeast isolates were identified at species level with 100% homology, 102 (63.75%) clinically important mould isolates were identified at species level, 56 (35%) isolates at genus level against fungal sequences existing in DNA databases and two (1.25%) isolates could not be identified. Consequently, Whatman FTA filter matrix technology was a useful method for extraction of fungal DNA; extremely rapid, practical and successful. Sequence analysis strategy of D1-D2 region of the large ribosomal subunit gene was found considerably sufficient in identification to genus level for the most clinical fungi. However, the identification to species level and especially discrimination of closely related species may require additional analysis. © 2015 Blackwell Verlag GmbH.

  11. Method of measuring directed electron velocities in flowing plasma using the incoherent regions of laser scattering

    International Nuclear Information System (INIS)

    Jacoby, B.A.; York, T.M.

    1979-02-01

    With the presumption that a shifted Maxwellian velocity distribution adequately describes the electrons in a flowing plasma, the details of a method to measure their directed velocity are described. The system consists of a ruby laser source and two detectors set 180 0 from each other and both set at 90 0 with respect to the incident laser beam. The lowest velocity that can be determined by this method depends on the electron thermal velocity. The application of this diagnostic to the measurement of flow velocities in plasma being lost from the ends of theta-pinch devices is described

  12. Genomic relationships of Actinobacillus pleuropneumoniae serotype 2 strains evaluated by ribotyping, sequence analysis of ribosomal intergenic regions, and pulsed-field gel electrophoresis

    DEFF Research Database (Denmark)

    Fussing, V.

    1998-01-01

    The aim of the present study was to examine the genomic relationship among 112 Actinobacillus pleuropneumoniae serotype 2 strains obtained throughout Europe and North America. HindIII ribotyping of the strains resulted in five ribotypes of high similarity (87-98%). Sequence analysis of the riboso......The aim of the present study was to examine the genomic relationship among 112 Actinobacillus pleuropneumoniae serotype 2 strains obtained throughout Europe and North America. HindIII ribotyping of the strains resulted in five ribotypes of high similarity (87-98%). Sequence analysis...... of the ribosomal intergenic region of strains representing each ribotype and each country showed no differences. A common ribotype was further characterized by PFGE of 12 strains representing all countries. The resultant five PFGE patterns of European strains showed a similarity of more than 91%, to which the two...

  13. Variations of electron fluxes in the outer radiation belt near the boundary of a trapping region during substorms

    International Nuclear Information System (INIS)

    Ginzburg, E.A.; Malyshev, A.B.

    1979-01-01

    Variations of electron fluxes with the energy Esub(e) > 0.7 MeV have been investigated near the high-latitude boundary of electron trapping region in the night and day sections of the magnetosphere. It is found that during substorms the natural changes of the structure of electron fluxes take place. On the night side of the magnetosphere after the flux boundary drift to the equator at the preliminary phase, its sharp drift to the pole at the explosion phase takes place with further slow ( during 1-2 hours) shift to the initial position. The boundary position reconstruction period coincide by duration with the life time of negative bays at magnetograms of the night section stations. On the day side the boundary of electron fluxes recorded drifts to the pole in 30-60 min after the beginning of the substorm exposion phase. The results obtained are interpreted within the framework of the theory of adiabatic drift of trapped electrons and their pitch-angular diffusion under the effect of very low frequency waves

  14. Sequence-Stratigraphic Analysis of the Regional Observation Monitoring Program (ROMP) 29A Test Corehole and Its Relation to Carbonate Porosity and Regional Transmissivity in the Floridan Aquifer System, Highlands County, Florida

    Science.gov (United States)

    Ward, W. C.; Cunningham, K.J.; Renken, R.A.; Wacker, M.A.; Carlson, J.I.

    2003-01-01

    An analysis was made to describe and interpret the lithology of a part of the Upper Floridan aquifer penetrated by the Regional Observation Monitoring Program (ROMP) 29A test corehole in Highlands County, Florida. This information was integrated into a one-dimensional hydrostratigraphic model that delineates candidate flow zones and confining units in the context of sequence stratigraphy. Results from this test corehole will serve as a starting point to build a robust three-dimensional sequence-stratigraphic framework of the Floridan aquifer system. The ROMP 29A test corehole penetrated the Avon Park Formation, Ocala Limestone, Suwannee Limestone, and Hawthorn Group of middle Eocene to Pliocene age. The part of the Avon Park Formation penetrated in the ROMP 29A test corehole contains two composite depositional sequences. A transgressive systems tract and a highstand systems tract were interpreted for the upper composite sequence; however, only a highstand systems tract was interpreted for the lower composite sequence of the deeper Avon Park stratigraphic section. The composite depositional sequences are composed of at least five high-frequency depositional sequences. These sequences contain high-frequency cycle sets that are an amalgamation of vertically stacked high-frequency cycles. Three types of high-frequency cycles have been identified in the Avon Park Formation: peritidal, shallow subtidal, and deeper subtidal high-frequency cycles. The vertical distribution of carbonate-rock diffuse flow zones within the Avon Park Formation is heterogeneous. Porous vuggy intervals are less than 10 feet, and most are much thinner. The volumetric arrangement of the diffuse flow zones shows that most occur in the highstand systems tract of the lower composite sequence of the Avon Park Formation as compared to the upper composite sequence, which contains both a backstepping transgressive systems tract and a prograding highstand systems tract. Although the porous and permeable

  15. Genetic diversity and population structure of Anastrepha striata (Diptera: Tephritidae) in three natural regions of southwestern Colombia using mitochondrial sequences.

    Science.gov (United States)

    Gallo-Franco, Jenny Johana; Velasco-Cuervo, Sandra Marcela; Aguirre-Ramirez, Elkin; González Obando, Ranulfo; Carrejo, Nancy Soraya; Toro-Perea, Nelson

    2017-02-01

    Anastrepha striata is widely distributed across the Americas and is a pest of economically important crops, especially crops of the Myrtaceae family. Insect population structures can be influenced by the presence of physical barriers or characteristics associated with habitat differences. This study evaluated the effect of the Western Andes on the population structure of A. striata. Individuals were collected from Psidium guajava fruits from three natural regions of southwestern Colombia (Pacific Coast, mountainous region and the inter-Andean valley of the Cauca River). Based on a 1318 bp concatenated of the genes Cytochrome Oxidase subunit I (COI) and NADH dehydrogenase subunit 6 (ND6), 14 haplotypes with few changes among them (between 1 and 3) were found. There was only one dominant haplotype in all three regions. No genetic structure associated with the three eco-geographical regions of the study was found. Moreover, the Western Andes are not an effective barrier for the genetic isolation of the populations from the Pacific Coast compared with the inter-Andean valley populations. This genetic homogeneity could be partially due to anthropogenic intervention, which acts as a dispersal agent of infested fruits. Another hypothesis to explain the lack of structure would be the relatively recent arrival of A. striata to the region, as indicated by an analysis of the demographic history, which reveals a process of population expansion. This study represents the first attempt to understand the population genetics of A. striata in Colombia and could contribute to the integral management of this pest.

  16. Precipitation regions on the Earth of high energy electrons, injected by a point source moving along a circular Earth orbit

    Science.gov (United States)

    Kolesnikov, E. K.; Klyushnikov, G. N.

    2018-05-01

    In the paper we continue the study of precipitation regions of high-energy charged particles, carried out by the authors since 2002. In contrast to previous papers, where a stationary source of electrons was considered, it is assumed that the source moves along a low circular near-earth orbit with a constant velocity. The orbit position is set by the inclination angle of the orbital plane to the equatorial plane and the longitude of the ascending node. The total number of injected electrons is determined by the source strength and the number of complete revolutions that the source makes along the circumference. Construction of precipitation regions is produced using the computational algorithm based on solving of the system of ordinary differential equations. The features of the precipitation regions structure for the dipole approximation of the geomagnetic field and the symmetrical arrangement of the orbit relative to the equator are noted. The dependencies of the precipitation regions on different orbital parametres such as the incline angle, the ascending node position and kinetic energy of injected particles have been considered.

  17. Studies of Interfacial Regions by Sum-Frequency Generation with a Free-Electron Laser

    NARCIS (Netherlands)

    Eliel, E. R.; van der Ham, E. W. M.; Vrehen, Q. H. F.; Thooft, G. W.; Barmentlo, M.; Auerhammer, J. M.; van der Meer, A. F. G.; van Amersfoort, P. W.

    1995-01-01

    The use of a Free-Electron Laser (FEL) allows the study of (non)linear optical properties of materials over unsurpassed large spectral intervals. As an example, we report on the use of a FEL as the infrared source in spectroscopic infrared-visible Sum-Frequency Generation (SFG). Employing the

  18. 'Mitominis': multiplex PCR analysis of reduced size amplicons for compound sequence analysis of the entire mtDNA control region in highly degraded samples.

    Science.gov (United States)

    Eichmann, Cordula; Parson, Walther

    2008-09-01

    The traditional protocol for forensic mitochondrial DNA (mtDNA) analyses involves the amplification and sequencing of the two hypervariable segments HVS-I and HVS-II of the mtDNA control region. The primers usually span fragment sizes of 300-400 bp each region, which may result in weak or failed amplification in highly degraded samples. Here we introduce an improved and more stable approach using shortened amplicons in the fragment range between 144 and 237 bp. Ten such amplicons were required to produce overlapping fragments that cover the entire human mtDNA control region. These were co-amplified in two multiplex polymerase chain reactions and sequenced with the individual amplification primers. The primers were carefully selected to minimize binding on homoplasic and haplogroup-specific sites that would otherwise result in loss of amplification due to mis-priming. The multiplexes have successfully been applied to ancient and forensic samples such as bones and teeth that showed a high degree of degradation.

  19. Functional anthology of intrinsic disorder. 2. Cellular components, domains, technical terms, developmental processes, and coding sequence diversities correlated with long disordered regions.

    Science.gov (United States)

    Vucetic, Slobodan; Xie, Hongbo; Iakoucheva, Lilia M; Oldfield, Christopher J; Dunker, A Keith; Obradovic, Zoran; Uversky, Vladimir N

    2007-05-01

    Biologically active proteins without stable ordered structure (i.e., intrinsically disordered proteins) are attracting increased attention. Functional repertoires of ordered and disordered proteins are very different, and the ability to differentiate whether a given function is associated with intrinsic disorder or with a well-folded protein is crucial for modern protein science. However, there is a large gap between the number of proteins experimentally confirmed to be disordered and their actual number in nature. As a result, studies of functional properties of confirmed disordered proteins, while helpful in revealing the functional diversity of protein disorder, provide only a limited view. To overcome this problem, a bioinformatics approach for comprehensive study of functional roles of protein disorder was proposed in the first paper of this series (Xie, H.; Vucetic, S.; Iakoucheva, L. M.; Oldfield, C. J.; Dunker, A. K.; Obradovic, Z.; Uversky, V. N. Functional anthology of intrinsic disorder. 1. Biological processes and functions of proteins with long disordered regions. J. Proteome Res. 2007, 5, 1882-1898). Applying this novel approach to Swiss-Prot sequences and functional keywords, we found over 238 and 302 keywords to be strongly positively or negatively correlated, respectively, with long intrinsically disordered regions. This paper describes approximately 90 Swiss-Prot keywords attributed to the cellular components, domains, technical terms, developmental processes, and coding sequence diversities possessing strong positive and negative correlation with long disordered regions.

  20. Functional Anthology of Intrinsic Disorder. II. Cellular Components, Domains, Technical Terms, Developmental Processes and Coding Sequence Diversities Correlated with Long Disordered Regions

    Science.gov (United States)

    Vucetic, Slobodan; Xie, Hongbo; Iakoucheva, Lilia M.; Oldfield, Christopher J.; Dunker, A. Keith; Obradovic, Zoran; Uversky, Vladimir N.

    2008-01-01

    Biologically active proteins without stable ordered structure (i.e., intrinsically disordered proteins) are attracting increased attention. Functional repertoires of ordered and disordered proteins are very different, and the ability to differentiate whether a given function is associated with intrinsic disorder or with a well-folded protein is crucial for modern protein science. However, there is a large gap between the number of proteins experimentally confirmed to be disordered and their actual number in nature. As a result, studies of functional properties of confirmed disordered proteins, while helpful in revealing the functional diversity of protein disorder, provide only a limited view. To overcome this problem, a bioinformatics approach for comprehensive study of functional roles of protein disorder was proposed in the first paper of this series (Xie H., Vucetic S., Iakoucheva L.M., Oldfield C.J., Dunker A.K., Obradovic Z., Uversky V.N. (2006) Functional anthology of intrinsic disorder. I. Biological processes and functions of proteins with long disordered regions. J. Proteome Res.). Applying this novel approach to Swiss-Prot sequences and functional keywords, we found over 238 and 302 keywords to be strongly positively or negatively correlated, respectively, with long intrinsically disordered regions. This paper describes ~90 Swiss-Prot keywords attributed to the cellular components, domains, technical terms, developmental processes and coding sequence diversities possessing strong positive and negative correlation with long disordered regions. PMID:17391015

  1. ProteinSplit: splitting of multi-domain proteins using prediction of ordered and disordered regions in protein sequences for virtual structural genomics

    International Nuclear Information System (INIS)

    Wyrwicz, Lucjan S; Koczyk, Grzegorz; Rychlewski, Leszek; Plewczynski, Dariusz

    2007-01-01

    The annotation of protein folds within newly sequenced genomes is the main target for semi-automated protein structure prediction (virtual structural genomics). A large number of automated methods have been developed recently with very good results in the case of single-domain proteins. Unfortunately, most of these automated methods often fail to properly predict the distant homology between a given multi-domain protein query and structural templates. Therefore a multi-domain protein should be split into domains in order to overcome this limitation. ProteinSplit is designed to identify protein domain boundaries using a novel algorithm that predicts disordered regions in protein sequences. The software utilizes various sequence characteristics to assess the local propensity of a protein to be disordered or ordered in terms of local structure stability. These disordered parts of a protein are likely to create interdomain spacers. Because of its speed and portability, the method was successfully applied to several genome-wide fold annotation experiments. The user can run an automated analysis of sets of proteins or perform semi-automated multiple user projects (saving the results on the server). Additionally the sequences of predicted domains can be sent to the Bioinfo.PL Protein Structure Prediction Meta-Server for further protein three-dimensional structure and function prediction. The program is freely accessible as a web service at http://lucjan.bioinfo.pl/proteinsplit together with detailed benchmark results on the critical assessment of a fully automated structure prediction (CAFASP) set of sequences. The source code of the local version of protein domain boundary prediction is available upon request from the authors

  2. Electronics

    Science.gov (United States)

    2001-01-01

    International Acer Incorporated, Hsin Chu, Taiwan Aerospace Industrial Development Corporation, Taichung, Taiwan American Institute of Taiwan, Taipei, Taiwan...Singapore and Malaysia .5 - 4 - The largest market for semiconductor products is the high technology consumer electronics industry that consumes up...Singapore, and Malaysia . A new semiconductor facility costs around $3 billion to build and takes about two years to become operational

  3. Segmented seismicity of the Mw 6.2 Baladeh earthquake sequence (Alborz mountains, Iran) revealed from regional moment tensors

    DEFF Research Database (Denmark)

    Donner, Stefanie; Rössler, Dirk; Krüger, Frank

    2013-01-01

    The M w 6.2 Baladeh earthquake occurred on 28 May 2004 in the Alborz Mountains, northern Iran. This earthquake was the first strong shock in this intracontinental orogen for which digital regional broadband data are available. The Baladeh event provides a rare opportunity to study fault geometry...... model, regional waveform data of the mainshock and larger aftershocks (M w  ≥3.3) were inverted for moment tensors. For the Baladeh mainshock, this included inversion for kinematic parameters. All analysed earthquakes show dominant thrust mechanisms at depths between 14 and 26 km, with NW–SE striking...

  4. The evolutionary rates of HCV estimated with subtype 1a and 1b sequences over the ORF length and in different genomic regions.

    Directory of Open Access Journals (Sweden)

    Manqiong Yuan

    Full Text Available Considerable progress has been made in the HCV evolutionary analysis, since the software BEAST was released. However, prior information, especially the prior evolutionary rate, which plays a critical role in BEAST analysis, is always difficult to ascertain due to various uncertainties. Providing a proper prior HCV evolutionary rate is thus of great importance.176 full-length sequences of HCV subtype 1a and 144 of 1b were assembled by taking into consideration the balance of the sampling dates and the even dispersion in phylogenetic trees. According to the HCV genomic organization and biological functions, each dataset was partitioned into nine genomic regions and two routinely amplified regions. A uniform prior rate was applied to the BEAST analysis for each region and also the entire ORF. All the obtained posterior rates for 1a are of a magnitude of 10(-3 substitutions/site/year and in a bell-shaped distribution. Significantly lower rates were estimated for 1b and some of the rate distribution curves resulted in a one-sided truncation, particularly under the exponential model. This indicates that some of the rates for subtype 1b are less accurate, so they were adjusted by including more sequences to improve the temporal structure.Among the various HCV subtypes and genomic regions, the evolutionary patterns are dissimilar. Therefore, an applied estimation of the HCV epidemic history requires the proper selection of the rate priors, which should match the actual dataset so that they can fit for the subtype, the genomic region and even the length. By referencing the findings here, future evolutionary analysis of the HCV subtype 1a and 1b datasets may become more accurate and hence prove useful for tracing their patterns.

  5. Quantitative controls on location and architecture of carbonate depositional sequences: upper miocene, cabo de gata region, se Spain

    Science.gov (United States)

    Franseen, E.K.; Goldstein, R.H.; Farr, M.R.

    1998-01-01

    Sequence stratigraphy, pinning-point relative sea-level curves, and magnetostratigraphy provide the quantitative data necessary to understand how rates of sea-level change and different substrate paleoslopes are dominant controls on accumulation rate, carbonate depositional sequence location, and internal architecture. Five third-order (1-10 my) and fourth-order (0.1-1.0 my) upper Miocene carbonate depositional sequences (DS1A, DS1B, DS2, DS3, TCC) formed with superimposed higher-frequency sea-level cycles in an archipelago setting in SE Spain. Overall, our study indicates when areas of high substrate slope (> 15??) are in shallow water, independent of climate, the location and internal architecture of carbonate deposits are not directly linked to sea-level position but, instead, are controlled by location of gently sloping substrates and processes of bypass. In contrast, if carbonate sediments are generated where substrates of low slope ( 15.6 cm/ky to ??? 2 cm/ky and overall relative sea level rose at rates of 17-21.4 cm/ky. Higher frequency sea-level rates were about 111 to more than 260 cm/ky, producing onlapping, fining- (deepening-) upward cycles. Decreasing accumulation rates resulted from decreasing surface area for shallow-water sediment production, drowning of shallow-water substrates, and complex sediment dispersal related to the archipelago setting. Typical systems tract and parasequence development should not be expected in "bypass ramp" settings; facies of onlapping strata do not track base level and are likely to be significantly different compared to onlapping strata associated with coastal onlap. Basal and upper DS2 reef megabreccias (indicating the transition from cool to warmer climatic conditions) were eroded from steep upslope positions and redeposited downslope onto areas of gentle substrate during rapid sea-level falls (> 22.7 cm/ky) of short duration. Such rapid sea-level falls and presence of steep slopes are not conducive to formation of

  6. X-ray sources in regions of star formation. II. The pre-main-sequence G star HDE 283572

    International Nuclear Information System (INIS)

    Walter, F.M.; Brown, A.; Linsky, J.L.; Rydgren, A.E.; Vrba, F.; Joint Institute for Laboratory Astrophysics, Boulder, CO; Computer Sciences Corp., El Segundo, CA; Naval Observatory, Flagstaff, AZ)

    1987-01-01

    This paper reports the detection of HDE 283572, a ninth-magnitude G star 8 arcmin south of RY Tau, as a bright X-ray source. The observations reveal this object to be a fairly massive (about 2 solar masses) pre-main-sequence star associated with the Taurus-Auriga star formation complex. It exhibits few of the characteristics of the classical T Tauri stars and is a good example of a naked T Tauri star. The star is a mid-G subgiant, of about three solar radii and rotates with a period of 1.5 d. The coronal and chromospheric surface fluxes are similar to those of the most active late type stars (excluding T Tauri stars). The X-ray and UV lines most likely arise in different atmospheric structures. Radiative losses are some 1000 times the quiet solar value and compare favorably with those of T Tauri stars. 49 references

  7. Immunoglobulin variable region sequences of two human monoclonal antibodies directed to an onco-developmental carbohydrate antigen, lactotetraosylceramide (LcOse4Cer).

    Science.gov (United States)

    Yago, K; Zenita, K; Ohwaki, I; Harada, R; Nozawa, S; Tsukazaki, K; Iwamori, M; Endo, N; Yasuda, N; Okuma, M

    1993-11-01

    A human monoclonal antibody, 11-50, was generated and was shown to recognize an onco-developmental carbohydrate antigen, LcOse4Cer. The isotype of this antibody was IgM, lambda, similar to the previously known human anti-LcOse4 antibodies, such as IgMWOO and HMST-1. We raised a murine anti-idiotypic antibody G3 (IgG1, kappa) against 11-50, and tested its reactivity towards the affinity purified human polyclonal anti-LcOse4 antibodies prepared from pooled human sera using a Gal beta 1-->3GlcNAc beta-immobilized column. The results indicated that at least a part of the human polyclonal anti-LcOse4 antibodies shared the G3 idiotype with 11-50. We further analyzed the sequence of variable regions of the two anti-LcOse4 antibodies, 11-50 and HMST-1. Sequence analysis of the heavy chain variable regions indicated that the VH regions of these two antibodies were highly homologous to each other (93.5% at the nucleic acid level), and these antibodies utilized the germline genes VH1.9III and hv3005f3 as the VH segments, which are closely related germline genes of the VHIII family. It was noted that these germline VH genes are frequently utilized in fetal B cells. The JH region of both antibodies was encoded by the JH4 gene. For the light chain, the V lambda segments of the two antibodies were 96.3% homologous to each other at the nucleic acid level. The V lambda segments of both antibodies showed the highest homology to the rearranged V lambda gene called V lambda II.DS among reported V lambda genes, while the exact germline V lambda genes encoding the two antibodies were not yet registered in available sequence databanks. The amino acid sequences of the J lambda segments of both antibodies were identical. These results indicate that the two human antibodies recognizing the onco-developmental carbohydrate antigen Lc4 are encoded by the same or very homologous germline genes.

  8. Comparison of sequencing the D2 region of the large subunit ribosomal RNA gene (MicroSEQ®) versus the internal transcribed spacer (ITS) regions using two public databases for identification of common and uncommon clinically relevant fungal species.

    Science.gov (United States)

    Arbefeville, S; Harris, A; Ferrieri, P

    2017-09-01

    Fungal infections cause considerable morbidity and mortality in immunocompromised patients. Rapid and accurate identification of fungi is essential to guide accurately targeted antifungal therapy. With the advent of molecular methods, clinical laboratories can use new technologies to supplement traditional phenotypic identification of fungi. The aims of the study were to evaluate the sole commercially available MicroSEQ® D2 LSU rDNA Fungal Identification Kit compared to the in-house developed internal transcribed spacer (ITS) regions assay in identifying moulds, using two well-known online public databases to analyze sequenced data. 85 common and uncommon clinically relevant fungi isolated from clinical specimens were sequenced for the D2 region of the large subunit (LSU) of ribosomal RNA (rRNA) gene with the MicroSEQ® Kit and the ITS regions with the in house developed assay. The generated sequenced data were analyzed with the online GenBank and MycoBank public databases. The D2 region of the LSU rRNA gene identified 89.4% or 92.9% of the 85 isolates to the genus level and the full ITS region (f-ITS) 96.5% or 100%, using GenBank or MycoBank, respectively, when compared to the consensus ID. When comparing species-level designations to the consensus ID, D2 region of the LSU rRNA gene aligned with 44.7% (38/85) or 52.9% (45/85) of these isolates in GenBank or MycoBank, respectively. By comparison, f-ITS possessed greater specificity, followed by ITS1, then ITS2 regions using GenBank or MycoBank. Using GenBank or MycoBank, D2 region of the LSU rRNA gene outperformed phenotypic based ID at the genus level. Comparing rates of ID between D2 region of the LSU rRNA gene and the ITS regions in GenBank or MycoBank at the species level against the consensus ID, f-ITS and ITS2 exceeded performance of the D2 region of the LSU rRNA gene, but ITS1 had similar performance to the D2 region of the LSU rRNA gene using MycoBank. Our results indicated that the MicroSEQ® D2 LSU r

  9. Portable regional cerebral blood flow system based on IBM PC/AT and microprocessor electronics

    International Nuclear Information System (INIS)

    Mun, S.K.; Mun, I.K.; Petite, J.; Cohan, S.L.; Fahey, F.H.

    1986-01-01

    A portable 16-channel reginal cerebral blood flow (rCBF) measuring system has been developed using an IBM PC/AT and new microelectronics to improve processing speed and portability. The detector electronics were developed by Scan Detectronics A/S of Denmark. The counter module contains 18 16-bit counters, each programmable in four different modes. The rate meter has three independent microprocessor controllers for rate meter functions, window controller, and channel controller. The detector electronics and detection parameters can be fully controlled by the host PC/AT. The menu-driven system (Better Basic) assists the operator at each step. The collected data from 16 channels can be processed automatically or postprocessed using more flexible and sophisticated techniques within 20 minutes. The headgear holding 16 sodium iodide detectors is fabricated by modifying a motorcycle helmet

  10. Bacterial communities in haloalkaliphilic sulfate-reducing bioreactors under different electron donors revealed by 16S rRNA MiSeq sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Jiemin [National Key Laboratory of Biochemical Engineering, Institute of Process Engineering, Chinese Academy of Sciences, P.O. Box 353, Beijing 100190 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Zhou, Xuemei; Li, Yuguang [101 Institute, Ministry of Civil Affairs, Beijing 100070 (China); Xing, Jianmin, E-mail: jmxing@ipe.ac.cn [National Key Laboratory of Biochemical Engineering, Institute of Process Engineering, Chinese Academy of Sciences, P.O. Box 353, Beijing 100190 (China)

    2015-09-15

    Highlights: • Bacterial communities of haloalkaliphilic bioreactors were investigated. • MiSeq was first used in analysis of communities of haloalkaliphilic bioreactors. • Electron donors had significant effect on bacterial communities. - Abstract: Biological technology used to treat flue gas is useful to replace conventional treatment, but there is sulfide inhibition. However, no sulfide toxicity effect was observed in haloalkaliphilic bioreactors. The performance of the ethanol-fed bioreactor was better than that of lactate-, glucose-, and formate-fed bioreactor, respectively. To support this result strongly, Illumina MiSeq paired-end sequencing of 16S rRNA gene was applied to investigate the bacterial communities. A total of 389,971 effective sequences were obtained and all of them were assigned to 10,220 operational taxonomic units (OTUs) at a 97% similarity. Bacterial communities in the glucose-fed bioreactor showed the greatest richness and evenness. The highest relative abundance of sulfate-reducing bacteria (SRB) was found in the ethanol-fed bioreactor, which can explain why the performance of the ethanol-fed bioreactor was the best. Different types of SRB, sulfur-oxidizing bacteria, and sulfur-reducing bacteria were detected, indicating that sulfur may be cycled among these microorganisms. Because high-throughput 16S rRNA gene paired-end sequencing has improved resolution of bacterial community analysis, many rare microorganisms were detected, such as Halanaerobium, Halothiobacillus, Desulfonatronum, Syntrophobacter, and Fusibacter. 16S rRNA gene sequencing of these bacteria would provide more functional and phylogenetic information about the bacterial communities.

  11. Post-glacial recolonization of the Great Lakes region by the common gartersnake (Thamnophis sirtalis) inferred from mtDNA sequences.

    Science.gov (United States)

    Placyk, John S; Burghardt, Gordon M; Small, Randall L; King, Richard B; Casper, Gary S; Robinson, Jace W

    2007-05-01

    Pleistocene events played an important role in the differentiation of North American vertebrate populations. Michigan, in particular, and the Great Lakes region, in general, were greatly influenced by the last glaciation. While several hypotheses regarding the recolonization of this region have been advanced, none have been strongly supported. We generated 148 complete ND2 mitochondrial DNA (mtDNA) sequences from common gartersnake (Thamnophis sirtalis) populations throughout the Great Lakes region to evaluate phylogeographic patterns and population structure and to determine whether the distribution of haplotypic variants is related to the post-Pleistocene retreat of the Wisconsinan glacier. The common gartersnake was utilized, as it is believed to have been one of the primary vertebrate invaders of the Great Lakes region following the most recent period of glacial retreat and because it has been a model species for a variety of evolutionary, ecological, behavioral, and physiological studies. Several genetically distinct evolutionary lineages were supported by both genealogical and molecular population genetic analyses, although to different degrees. The geographic distribution of the majority of these lineages is interpreted as reflecting post-glacial recolonization dynamics during the late Pleistocene. These findings generally support previous hypotheses of range expansion in this region.

  12. Artificial E-region field-aligned plasma irregularities generated at pump frequencies near the second electron gyroharmonic

    Directory of Open Access Journals (Sweden)

    D. L. Hysell

    2009-07-01

    Full Text Available E region ionospheric modification experiments have been performed at HAARP using pump frequencies about 50 kHz above and below the second electron gyroharmonic frequency. Artificial E region field-aligned plasma density irregularities (FAIs were created and observed using the imaging coherent scatter radar near Homer, Alaska. Echoes from FAIs generated with pump frequencies above and below 2Ωe did not appear to differ significantly in experiments conducted on summer afternoons in 2008, and the resonance instability seemed to be at work in either case. We argue that upper hybrid wave trapping and resonance instability at pump frequencies below the second electron gyroharmonic frequency are permitted theoretically when the effects of finite parallel wavenumbers are considered. Echoes from a sporadic E layer were observed to be somewhat weaker when the pump frequency was 50 kHz below the second electron gyroharmonic frequency. This may indicate that finite parallel wavenumbers are inconsistent with wave trapping in thin sporadic E ionization layers.

  13. Artificial E-region field-aligned plasma irregularities generated at pump frequencies near the second electron gyroharmonic

    Directory of Open Access Journals (Sweden)

    D. L. Hysell

    2009-07-01

    Full Text Available E region ionospheric modification experiments have been performed at HAARP using pump frequencies about 50 kHz above and below the second electron gyroharmonic frequency. Artificial E region field-aligned plasma density irregularities (FAIs were created and observed using the imaging coherent scatter radar near Homer, Alaska. Echoes from FAIs generated with pump frequencies above and below 2Ωe did not appear to differ significantly in experiments conducted on summer afternoons in 2008, and the resonance instability seemed to be at work in either case. We argue that upper hybrid wave trapping and resonance instability at pump frequencies below the second electron gyroharmonic frequency are permitted theoretically when the effects of finite parallel wavenumbers are considered. Echoes from a sporadic E layer were observed to be somewhat weaker when the pump frequency was 50 kHz below the second electron gyroharmonic frequency. This may indicate that finite parallel wavenumbers are inconsistent with wave trapping in thin sporadic E ionization layers.

  14. Wakefield excitation by a sequence of relativistic electron bunches in dielectric waveguides of rectangular cross-section of various configurations

    International Nuclear Information System (INIS)

    Kiselev, V.A.; Linnik, A.F.; Mirnyj, V.I.; Onishchenko, I.N.; Sotnikov, G.V.; Uskov, V.V.

    2008-01-01

    The possibility to enhance the efficiency of wake wave excitation in dielectric waveguides of rectangular cross-section was investigated by increase of electron bunches coupling with excited wakefield that was achieved by decrease of transit channel cross-section. At that for each configuration the required changes of dielectric plates size were made to for maintain the coincidence concurrence of bunch repetition frequency and frequency of the principal transverse mode of the corresponding dielectric waveguide. It is established, the decrease of transit channel leading to essential changing of topography of total field excited wake wave

  15. Temporal transcription of the lactococcal temperate phage TP901-1 and DNA sequence of the early promoter region

    DEFF Research Database (Denmark)

    Madsen, Hans Peter Lynge; Hammer, Karin

    1998-01-01

    to a phage repressor, a single-stranded DNA-binding protein, a topoisomerase, a Cro-like protein and two other phage proteins of unknown function were detected. The gene arrangement in the early transcribed region of TP901-1 thus consists of two transcriptional units: one from PR containing four genes......, of which at least two (the integrase gene and putative repressor) are needed for lysogeny, and the divergent and longer transcriptional unit from PL, presumably encoding functions required for the lytic life cycle. ORFs with homology to proteins involved in DNA replication were identified on the latter......Transcriptional analysis by Northern blotting identified clusters of early, middle and late transcribed regions of the temperate lactococcal bacteriophage TP901-1 during one-step growth experiments. The latent period was found to be 65 min and the burst size 40 +/- 10. The eight early transcripts...

  16. Phylogenetic Analysis of a ?Jewel Orchid? Genus Goodyera (Orchidaceae) Based on DNA Sequence Data from Nuclear and Plastid Regions

    OpenAIRE

    Hu, Chao; Tian, Huaizhen; Li, Hongqing; Hu, Aiqun; Xing, Fuwu; Bhattacharjee, Avishek; Hsu, Tianchuan; Kumar, Pankaj; Chung, Shihwen

    2016-01-01

    A molecular phylogeny of Asiatic species of Goodyera (Orchidaceae, Cranichideae, Goodyerinae) based on the nuclear ribosomal internal transcribed spacer (ITS) region and two chloroplast loci (matK and trnL-F) was presented. Thirty-five species represented by 132 samples of Goodyera were analyzed, along with other 27 genera/48 species, using Pterostylis longifolia and Chloraea gaudichaudii as outgroups. Bayesian inference, maximum parsimony and maximum likelihood methods were used to reveal th...

  17. Sequence diversity of the C-terminal region of Plasmodium falciparum merozoite surface protein 1 in southern Iran.

    Science.gov (United States)

    Zamani, Zahra; Razavi, Mohammad Reza; Sadeghi, Sedigheh; Naddaf, Saeed; Pourfallah, Fatemeh; Mirkhani, Fatemeh; Arjmand, Mohammad; Feizhaddad, Hossein; Rad, Mina Ebrahimi; Ebrahimi Rad, Mina; Tameemi, Marzieh; Assmar, Mehdi

    2009-01-01

    The C-terminal region of the merozoite surface protein 1 (MSP-1) of Plasmodium falciparum is a strong vaccine candidate as it is associated with immunity to the parasite. This corresponds approximately to the conserved 17th block of the gene and is composed of two EGF- like domains. These domains exhibit only four single amino acid substitutions which show several potential variants in this region of the gene. As the variations might be important for a regional vaccine design, a study was carried out to determine the variations present in P. falciparum isolates from southern Iran. Besides the usual E-T-S-R-L and the Q-K-N-G-F types, we found Q-T-S-R-L, E-K-N-G-F, E-T-S-G-L, Z-T-S-G-L and Z-T-S-R-L types, where Z was E or Q signifying the presence of mixed clones in single isolates.

  18. Localization of the endpoints of deletions in the 5' region of the Duchenne gene using a sequence isolated by chromosome jumping

    Energy Technology Data Exchange (ETDEWEB)

    Kenwrick, S.J.; Smith, T.J.; England, S.; Collins, F.; Davies, K.E.

    1988-02-25

    The authors have used chromosome jumping technology to move from within a large intron sequence in the Duchenne muscular dystrophy (DMD) gene to a region adjacent to exons of the gene. The single copy jump clone, HH1, was used to characterize deletions in patients previously shown to be deleted for DNA markers in the 5' end of the gene. 12 out of 15 such patients have breakpoints which lie between HH1 and the genomic locus J-47. Thus the vast majority of the deletions in these patients have proximal breakpoints in a similar region distal to the 5'end of the gene. HH1 was mapped with respect to the X;1 translocation in a DMD female and was shown to lie at least 80 kb from the starting point of the chromosome jump, HIP25.

  19. Localization of the endpoints of deletions in the 5' region of the Duchenne gene using a sequence isolated by chromosome jumping

    Energy Technology Data Exchange (ETDEWEB)

    Kenwrick, S J; Smith, T J; England, S; Collins, F; Davies, K E

    1988-02-25

    The authors have used chromosome jumping technology to move from within a large intron sequence in the Duchenne muscular dystrophy (DMD) gene to a region adjacent to exons of the gene. The single copy jump clone, HH1, was used to characterize deletions in patients previously shown to be deleted for DNA markers in the 5' end of the gene. 12 out of 15 such patients have breakpoints which lie between HH1 and the genomic locus J-47. Thus the vast majority of the deletions in these patients have proximal breakpoints in a similar region distal to the 5'end of the gene. HH1 was mapped with respect to the X;1 translocation in a DMD female and was shown to lie at least 80 kb from the starting point of the chromosome jump, HIP25.

  20. Complete re-sequencing of a 2Mb topological domain encompassing the FTO/IRXB genes identifies a novel obesity-associated region upstream of IRX5

    DEFF Research Database (Denmark)

    Hunt, Lilian E; Noyvert, Boris; Bhaw-Rosun, Leena

    2015-01-01

    BACKGROUND: Association studies have identified a number of loci that contribute to an increased body mass index (BMI), the strongest of which is in the first intron of the FTO gene on human chromosome 16q12.2. However, this region is both non-coding and under strong linkage disequilibrium, making...... it recalcitrant to functional interpretation. Furthermore, the FTO gene is located within a complex cis-regulatory landscape defined by a topologically associated domain that includes the IRXB gene cluster, a trio of developmental regulators. Consequently, at least three genes in this interval have been...... implicated in the aetiology of obesity. METHODS: Here, we sequence a 2 Mb region encompassing the FTO, RPGRIP1L and IRXB cluster genes in 284 individuals from a well-characterised study group of Danish men containing extremely overweight young adults and controls. We further replicate our findings both...

  1. Elucidation of the electronic states in polyethylene glycol by attenuated Total reflectance spectroscopy in the far-ultraviolet region

    Science.gov (United States)

    Ueno, Nami; Wakabayashi, Tomonari; Morisawa, Yusuke

    2018-05-01

    We measured the attenuated total reflectance-far ultraviolet (ATR-FUV) spectra of poly(ethylene glycol) (PEG; average molecular weights of 200, 300, and 400) and related materials in the liquid state in the 145-200-nm wavelength region. For appropriately assigning the absorption bands, we also performed theoretical simulation of the unit-number dependent electronic spectra. The FUV spectra of PEGs contain three bands, which are assigned to the transitions between n(CH2OCH2)-3s Rydberg state (176 nm), n(CH2OCH2)-3p Rydberg state (163 nm), and n(OH)-3p Rydberg state (153 nm). Since the contribution of n(OH) decreases compared to n(CH2OCH2) with increase in the number of units, the ratios of the molar absorption coefficients, ε, at 153 nm relative to 163 nm, decrease. On the other hand, the ratio of ε at 176 nm to that at 163 nm increases with increase in the number of units, because of the difference in the number of unoccupied orbitals in the transitions. The calculated results suggest that n orbitals form two electronic bands. In the upper band, the electrons expand over the ether chain, whereas in the lower band, the electrons are localized in the terminal OH in the PEGs.

  2. Improvement of photoneutron spectrum measurement produced by bombardment of 2 GeV electrons above giant dipole resonance region

    International Nuclear Information System (INIS)

    Lee, H. S.; Park, J. S.; Choi, H. D.; Sato, Tatsuhiko; Shin, Kasuo; Ban, Syuichi

    2000-01-01

    Above the Giant Dipole Resonance (GDR) region, high energy photoneutron spectra produced by irradiation of 2.04 GeV electrons into Pb target were measured by Time-of-Flight (TOF) technique. The differential photoneutron yields were obtained at a fixed angle of 90 degrees to the electron beam direction. The TOF system consists of Pilot-U plastic scintillation detector, which has fast response time, and the high speed multiscaler or CAMAC TDC. In the improvement of experimental setup to extend the flight distance to 10.4 m lead to make the measurable energy to 500 MeV from 300 MeV. And using the TDC based electronics lead to use a veto counter. The results were compared with the calculated one by using EGS4 and Modified PICA95. The characteristics of this TOF system was introduced in this paper and the results for several measuring conditions, which are flight distance, TOF electronics, and type of neutron detector, were discussed to improve the accuracy of this measurement

  3. Seismic sequence stratigraphy and platform to basin reservoir structuring of Lower Cretaceous deposits in the Sidi Aïch-Majoura region (Central Tunisia)

    Science.gov (United States)

    Azaïez, Hajer; Bédir, Mourad; Tanfous, Dorra; Soussi, Mohamed

    2007-05-01

    In central Tunisia, Lower Cretaceous deposits represent carbonate and sandstone reservoir series that correspond to proven oil fields. The main problems for hydrocarbon exploration of these levels are their basin tectonic configuration and their sequence distribution in addition to the source rock availability. The Central Atlas of Tunisia is characterized by deep seated faults directed northeast-southwest, northwest-southeast and north-south. These faults limit inherited tectonic blocks and show intruded Triassic salt domes. Lower Cretaceous series outcropping in the region along the anticline flanks present platform deposits. The seismic interpretation has followed the Exxon methodologies in the 26th A.A.P.G. Memoir. The defined Lower Cretaceous seismic units were calibrated with petroleum well data and tied to stratigraphic sequences established by outcrop studies. This allows the subsurface identification of subsiding zones and thus sequence deposit distribution. Seismic mapping of these units boundary shows a structuring from a platform to basin blocks zones and helps to understand the hydrocarbon reservoir systems-tract and horizon distribution around these domains.

  4. Whole-exome sequencing reveals genetic variants associated with chronic kidney disease characterized by tubulointerstitial damages in North Central Region, Sri Lanka.

    Science.gov (United States)

    Nanayakkara, Shanika; Senevirathna, S T M L D; Parahitiyawa, Nipuna B; Abeysekera, Tilak; Chandrajith, Rohana; Ratnatunga, Neelakanthi; Hitomi, Toshiaki; Kobayashi, Hatasu; Harada, Kouji H; Koizumi, Akio

    2015-09-01

    The familial clustering observed in chronic kidney disease of uncertain etiology (CKDu) characterized by tubulointerstitial damages in the North Central Region of Sri Lanka strongly suggests the involvement of genetic factors in its pathogenesis. The objective of the present study is to use whole-exome sequencing to identify the genetic variants associated with CKDu. Whole-exome sequencing of eight CKDu cases and eight controls was performed, followed by direct sequencing of candidate loci in 301 CKDu cases and 276 controls. Association study revealed rs34970857 (c.658G > A/p.V220M) located in the KCNA10 gene encoding a voltage-gated K channel as the most promising SNP with the highest odds ratio of 1.74. Four rare variants were identified in gene encoding Laminin beta2 (LAMB2) which is known to cause congenital nephrotic syndrome. Three out of four variants in LAMB2 were novel variants found exclusively in cases. Genetic investigations provide strong evidence on the presence of genetic susceptibility for CKDu. Possibility of presence of several rare variants associated with CKDu in this population is also suggested.

  5. Cytoplasmic protein binding to highly conserved sequences in the 3' untranslated region of mouse protamine 2 mRNA, a translationally regulated transcript of male germ cells

    International Nuclear Information System (INIS)

    Kwon, Y.K.; Hecht, N.B.

    1991-01-01

    The expression of the protamines, the predominant nuclear proteins of mammalian spermatozoa, is regulated translationally during male germ-cell development. The 3' untranslated region (UTR) of protamine 1 mRNA has been reported to control its time of translation. To understand the mechanisms controlling translation of the protamine mRNAs, we have sought to identify cis elements of the 3' UTR of protamine 2 mRNA that are recognized by cytoplasmic factors. From gel retardation assays, two sequence elements are shown to form specific RNA-protein complexes. Protein binding sites of the two complexes were determined by RNase T1 mapping, by blocking the putative binding sites with antisense oligonucleotides, and by competition assays. The sequences of these elements, located between nucleotides + 537 and + 572 in protamine 2 mRNA, are highly conserved among postmeiotic translationally regulated nuclear proteins of the mammalian testis. Two closely linked protein binding sites were detected. UV-crosslinking studies revealed that a protein of about 18 kDa binds to one of the conserved sequences. These data demonstrate specific protein binding to a highly conserved 3' UTR of translationally regulated testicular mRNA

  6. Chloroplast DNA analysis of Tunisian cork oak populations (Quercus suber L.): sequence variations and molecular evolution of the trnL (UAA)-trnF (GAA) region.

    Science.gov (United States)

    Abdessamad, A; Baraket, G; Sakka, H; Ammari, Y; Ksontini, M; Hannachi, A Salhi

    2016-10-24

    Sequences of the trnL-trnF spacer and combined trnL-trnF region in chloroplast DNA of cork oak (Quercus suber L.) were analyzed to detect polymorphisms and to elucidate molecular evolution and demographic history. The aligned sequences varied in length and nucleotide composition. The overall ratio of transition/transversion (ti/tv) of 0.724 for the intergenic spacer and 0.258 for the pooled sequences were estimated, and indicated that transversions are more frequent than transitions. The molecular evolution and demographic history of Q. suber were investigated. Neutrality tests (Tajima's D and Fu and Li) ruled out the null hypothesis of a strictly neutral model, and Fu's Fs and Ramos-Onsins and Rozas' R2 confirmed the recent expansion of cork oak trees, validating its persistency in North Africa since the last glaciation during the Quaternary. The observed uni-modal mismatch distribution and the Harpending's raggedness index confirmed the demographic history model for cork oak. A phylogenetic dendrogram showed that the distribution of Q. suber trees occurs independently of geographical origin, the relief of the population site, and the bioclimatic stages. The molecular history and cytoplasmic diversity suggest that in situ and ex situ conservation strategies can be recommended for preserving landscape value and facing predictable future climatic changes.

  7. Investigating electronic portfolio in pre-service teacher education in the Gulf Region

    NARCIS (Netherlands)

    Alhammar, A.

    2006-01-01

    Keeping its higher education systems competitive in the 21st century, the technology era, is the vital task of higher education in the Gulf Region as well as throughout the world (Abdullah, 2001; Alaasemi, 2003; Al-Nagim, 2002; Watson, 2001). The use of the Internet and Web-based tools and support

  8. SubClonal Hierarchy Inference from Somatic Mutations: Automatic Reconstruction of Cancer Evolutionary Trees from Multi-region Next Generation Sequencing.

    Directory of Open Access Journals (Sweden)

    Noushin Niknafs

    2015-10-01

    Full Text Available Recent improvements in next-generation sequencing of tumor samples and the ability to identify somatic mutations at low allelic fractions have opened the way for new approaches to model the evolution of individual cancers. The power and utility of these models is increased when tumor samples from multiple sites are sequenced. Temporal ordering of the samples may provide insight into the etiology of both primary and metastatic lesions and rationalizations for tumor recurrence and therapeutic failures. Additional insights may be provided by temporal ordering of evolving subclones--cellular subpopulations with unique mutational profiles. Current methods for subclone hierarchy inference tightly couple the problem of temporal ordering with that of estimating the fraction of cancer cells harboring each mutation. We present a new framework that includes a rigorous statistical hypothesis test and a collection of tools that make it possible to decouple these problems, which we believe will enable substantial progress in the field of subclone hierarchy inference. The methods presented here can be flexibly combined with methods developed by others addressing either of these problems. We provide tools to interpret hypothesis test results, which inform phylogenetic tree construction, and we introduce the first genetic algorithm designed for this purpose. The utility of our framework is systematically demonstrated in simulations. For most tested combinations of tumor purity, sequencing coverage, and tree complexity, good power (≥ 0.8 can be achieved and Type 1 error is well controlled when at least three tumor samples are available from a patient. Using data from three published multi-region tumor sequencing studies of (murine small cell lung cancer, acute myeloid leukemia, and chronic lymphocytic leukemia, in which the authors reconstructed subclonal phylogenetic trees by manual expert curation, we show how different configurations of our tools can

  9. SubClonal Hierarchy Inference from Somatic Mutations: Automatic Reconstruction of Cancer Evolutionary Trees from Multi-region Next Generation Sequencing.

    Science.gov (United States)

    Niknafs, Noushin; Beleva-Guthrie, Violeta; Naiman, Daniel Q; Karchin, Rachel

    2015-10-01

    Recent improvements in next-generation sequencing of tumor samples and the ability to identify somatic mutations at low allelic fractions have opened the way for new approaches to model the evolution of individual cancers. The power and utility of these models is increased when tumor samples from multiple sites are sequenced. Temporal ordering of the samples may provide insight into the etiology of both primary and metastatic lesions and rationalizations for tumor recurrence and therapeutic failures. Additional insights may be provided by temporal ordering of evolving subclones--cellular subpopulations with unique mutational profiles. Current methods for subclone hierarchy inference tightly couple the problem of temporal ordering with that of estimating the fraction of cancer cells harboring each mutation. We present a new framework that includes a rigorous statistical hypothesis test and a collection of tools that make it possible to decouple these problems, which we believe will enable substantial progress in the field of subclone hierarchy inference. The methods presented here can be flexibly combined with methods developed by others addressing either of these problems. We provide tools to interpret hypothesis test results, which inform phylogenetic tree construction, and we introduce the first genetic algorithm designed for this purpose. The utility of our framework is systematically demonstrated in simulations. For most tested combinations of tumor purity, sequencing coverage, and tree complexity, good power (≥ 0.8) can be achieved and Type 1 error is well controlled when at least three tumor samples are available from a patient. Using data from three published multi-region tumor sequencing studies of (murine) small cell lung cancer, acute myeloid leukemia, and chronic lymphocytic leukemia, in which the authors reconstructed subclonal phylogenetic trees by manual expert curation, we show how different configurations of our tools can identify either a single

  10. In situ optical sequencing and structure analysis of a trinucleotide repeat genome region by localization microscopy after specific COMBO-FISH nano-probing

    Science.gov (United States)

    Stuhlmüller, M.; Schwarz-Finsterle, J.; Fey, E.; Lux, J.; Bach, M.; Cremer, C.; Hinderhofer, K.; Hausmann, M.; Hildenbrand, G.

    2015-10-01

    Trinucleotide repeat expansions (like (CGG)n) of chromatin in the genome of cell nuclei can cause neurological disorders such as for example the Fragile-X syndrome. Until now the mechanisms are not clearly understood as to how these expansions develop during cell proliferation. Therefore in situ investigations of chromatin structures on the nanoscale are required to better understand supra-molecular mechanisms on the single cell level. By super-resolution localization microscopy (Spectral Position Determination Microscopy; SPDM) in combination with nano-probing using COMBO-FISH (COMBinatorial Oligonucleotide FISH), novel insights into the nano-architecture of the genome will become possible. The native spatial structure of trinucleotide repeat expansion genome regions was analysed and optical sequencing of repetitive units was performed within 3D-conserved nuclei using SPDM after COMBO-FISH. We analysed a (CGG)n-expansion region inside the 5' untranslated region of the FMR1 gene. The number of CGG repeats for a full mutation causing the Fragile-X syndrome was found and also verified by Southern blot. The FMR1 promotor region was similarly condensed like a centromeric region whereas the arrangement of the probes labelling the expansion region seemed to indicate a loop-like nano-structure. These results for the first time demonstrate that in situ chromatin structure measurements on the nanoscale are feasible. Due to further methodological progress it will become possible to estimate the state of trinucleotide repeat mutations in detail and to determine the associated chromatin strand structural changes on the single cell level. In general, the application of the described approach to any genome region will lead to new insights into genome nano-architecture and open new avenues for understanding mechanisms and their relevance in the development of heredity diseases.

  11. Effective electron recombination coefficient in ionospheric D-region during the relaxation regime after solar flare from February 18, 2011

    Energy Technology Data Exchange (ETDEWEB)

    Nina, A. [Institute of Physics, University of Belgrade, P.O. Box 57, Belgrade (Serbia); Cadez, V. [Astronomical Observatory, Volgina 7, 11060 Belgrade (Serbia); Sulic, D., E-mail: dsulic@ipb.ac.rs [Faculty of Ecology and Environmental Protection, Union - Nikola Tesla University, Cara Dusana 62, 11000 Belgrade (Serbia); Sreckovic, V. [Institute of Physics, University of Belgrade, P.O. Box 57, Belgrade (Serbia); Zigman, V. [University of Nova Gorica, Vipavska 13, Rona Dolina, SI-5000 Nova Gorica (Slovenia)

    2012-05-15

    In this paper, we present a model for determination of a weakly time dependent effective recombination coefficient for the perturbed terrestrial ionospheric D-region plasma. We study consequences of a class M1.0 X-ray solar flare, recorded by GOES-15 satellite on February 18, 2011 between 14:00 and 14:15 UT, by analyzing the amplitude and phase real time variations of very low frequency (VLF) radio waves emitted by transmitter DHO (located in Germany) at frequency 23.4 kHz and recorded by the AWESOME receiver in Belgrade (Serbia). Our analysis is limited to ionospheric perturbations localized at altitudes around 70 km where the dominant electron gain and electron loss processes are the photo-ionization and recombination, respectively.

  12. Effective electron recombination coefficient in ionospheric D-region during the relaxation regime after solar flare from February 18, 2011

    International Nuclear Information System (INIS)

    Nina, A.; Čadež, V.; Šulić, D.; Srećković, V.; Žigman, V.

    2012-01-01

    In this paper, we present a model for determination of a weakly time dependent effective recombination coefficient for the perturbed terrestrial ionospheric D-region plasma. We study consequences of a class M1.0 X-ray solar flare, recorded by GOES-15 satellite on February 18, 2011 between 14:00 and 14:15 UT, by analyzing the amplitude and phase real time variations of very low frequency (VLF) radio waves emitted by transmitter DHO (located in Germany) at frequency 23.4 kHz and recorded by the AWESOME receiver in Belgrade (Serbia). Our analysis is limited to ionospheric perturbations localized at altitudes around 70 km where the dominant electron gain and electron loss processes are the photo-ionization and recombination, respectively.

  13. Velo-Cardio-Facial syndrome and DiGeorge sequence with meningomyelocele and deletions of the 22q11 region

    Energy Technology Data Exchange (ETDEWEB)

    Nickel, R.E.; Pillers, D.M.; Merkens, M.; Magenis, R.E.; Zonana, J. [Oregon Health Sciences Univ., Portland, OR (United States); Driscoll, D.A.; Emanuel, B.S. [Univ. of Pennsylvania Medical Center, Philadelphia, PA (United States)

    1994-10-01

    Approximately 5% of children with neural tube defects (NTDs) have a congenital heart defect and/or cleft lip and palate. The cause of isolated meningomyelocele, congenital heart defects, or cleft lip and palate has been largely thought to be multifactorial. However, chromosomal, teratogenic, and single gene causes of combinations of NTDs with congenital heart defects and/or cleft lip and palate have been reported. We report on 3 patients with meningomyelocele, congenital heart defects, and 22q11 deletions. Two of the children had the clinical diagnosis of velo-cardio-facial syndrome (VCFS); both have bifid uvula. The third child had DiGeorge sequence (DGS). The association of NTDs with 22q11 deletion has not been reported previously. An accurate diagnosis of the 22q11 deletion is critical as this micro-deletion and its associated clinical problems is transmitted as an autosomal dominant trait due to the inheritance of the deletion-bearing chromosome. We recommend that all children with NTDs and congenital heart defects, with or without cleft palate, have cytogenetic and molecular studies performed to detect 22q11 deletions. 31 refs., 3 figs.

  14. Use of DNA sequences to identify forensically important fly species and their distribution in the coastal region of Central California.

    Science.gov (United States)

    Nakano, Angie; Honda, Jeff

    2015-08-01

    Forensic entomology has gained prominence in recent years, as improvements in DNA technology and molecular methods have allowed insect and other arthropod evidence to become increasingly useful in criminal and civil investigations. However, comprehensive faunal inventories are still needed, including cataloging local DNA sequences for forensically significant Diptera. This multi-year fly-trapping study was built upon and expanded a previous survey of these flies in Santa Clara County, including the addition of genetic barcoding data from collected species of flies. Flies from the families Calliphoridae, Sarcophagidae, and Muscidae were trapped in meat-baited traps set in a variety of locations throughout the county. Flies were identified using morphological features and confirmed by molecular analysis. A total of 16 calliphorid species, 11 sarcophagid species, and four muscid species were collected and differentiated. This study found more species of flies than previous area surveys and established new county records for two calliphorid species: Cynomya cadaverina and Chrysomya rufifacies. Differences were found in fly fauna in different areas of the county, indicating the importance of microclimates in the distribution of these flies. Molecular analysis supported the use of DNA barcoding as an effective method of identifying cryptic fly species. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  15. Geometry of the diffusive propagation region in the August 14, 1982 solar electron event

    Science.gov (United States)

    Evenson, P. A.

    1985-01-01

    On August 14, 1982, relativistic electrons arrived promptly after an impulsive gamma ray flare, indicating that very little scattering was taking place in interplanetary space. By ignoring anisotropy data the time profile of the event is well described by interplanetary diffusion except for the derived particle injection time. This discrepancy provides independent evidence that the particles are diffusing in a volume close to the Sun rather than in interplanetary space. The flux at maximum method of determining the number of particles produced is still a good approximation when appropriately applied.

  16. Empirical Fit to Precision Inclusive Electron-Proton Cross Sections in the Resonance Region

    International Nuclear Information System (INIS)

    M.E. Christy; Peter Bosted

    2007-01-01

    An empirical fit is described to measurements of inclusive inelastic electron-proton cross sections in the kinematic range of four-momentum transfer 0 (le) Q 2 2 and final state invariant mass 1.1 2 ∼ 7.5 GeV 2 , and photoproduction data at Q 2 = 0. Compared to previous fits, the present fit covers a wider kinematic range, fits both transverse and longitudinal cross sections, and features smooth transitions to the photoproduction data at Q 2 =0 and DIS data at high Q 2 and W

  17. IRAS 18153-1651: an H II region with a possible wind bubble blown by a young main-sequence B star

    Science.gov (United States)

    Gvaramadze, V. V.; Mackey, J.; Kniazev, A. Y.; Langer, N.; Chené, A.-N.; Castro, N.; Haworth, T. J.; Grebel, E. K.

    2017-04-01

    We report the results of spectroscopic observations and numerical modelling of the H II region IRAS 18153-1651. Our study was motivated by the discovery of an optical arc and two main-sequence stars of spectral type B1 and B3 near the centre of IRAS 18153-1651. We interpret the arc as the edge of the wind bubble (blown by the B1 star), whose brightness is enhanced by the interaction with a photoevaporation flow from a nearby molecular cloud. This interpretation implies that we deal with a unique case of a young massive star (the most massive member of a recently formed low-mass star cluster) caught just tens of thousands of years after its stellar wind has begun to blow a bubble into the surrounding dense medium. Our 2D, radiation-hydrodynamics simulations of the wind bubble and the H II region around the B1 star provide a reasonable match to observations, both in terms of morphology and absolute brightness of the optical and mid-infrared emission, and verify the young age of IRAS 18153-1651. Taken together our results strongly suggest that we have revealed the first example of a wind bubble blown by a main-sequence B star.

  18. Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin.

    Science.gov (United States)

    Roy, M; Lee, R W; Kaarsholm, N C; Thøgersen, H; Brange, J; Dunn, M F

    1990-06-12

    The aromatic region of the 1H-FT-NMR spectrum of the biologically fully-potent, monomeric human insulin mutant, B9 Ser----Asp, B27 Thr----Glu has been investigated in D2O. At 1 to 5 mM concentrations, this mutant insulin is monomeric above pH 7.5. Coupling and amino acid classification of all aromatic signals is established via a combination of homonuclear one- and two-dimensional methods, including COSY, multiple quantum filters, selective spin decoupling and pH titrations. By comparisons with other insulin mutants and with chemically modified native insulins, all resonances in the aromatic region are given sequence-specific assignments without any reliance on the various crystal structures reported for insulin. These comparisons also give the sequence-specific assignments of most of the aromatic resonances of the mutant insulins B16 Tyr----Glu, B27 Thr----Glu and B25 Phe----Asp and the chemically modified species des-(B23-B30) insulin and monoiodo-Tyr A14 insulin. Chemical dispersion of the assigned resonances, ring current perturbations and comparisons at high pH have made possible the assignment of the aromatic resonances of human insulin, and these studies indicate that the major structural features of the human insulin monomer (including those critical to biological function) are also present in the monomeric mutant.

  19. Phylogenetic and Genetic Analysis of D-loop and Cyt-b Region of mtDNA Sequence in Iranian Sistani, Sarabi and Brown Swiss Cows

    Directory of Open Access Journals (Sweden)

    reza valizadeh

    2016-06-01

    Full Text Available Cattle have an important role in primary human civilization, so molecular studies for more accurate recognition of their origin are effective to identify unknown historical aspects. Cattle can be divided in to 2 main groups including Bos Tuarus and Bos Indicus. Both types of cattle can be found in Iran; therefore study of their origin has particular importance. The aim of this study was to investigate the nucleotide sequences of Cytochrome-b (Cyt-b and HVR1&2 loci of D-loop gene region in mitochondrial DNA of Sistani, Sarabi and Brown Swiss breeds of cattle. Twenty blood samples of each breed, from non-relative individuals were obtained from blood bank of animal science department of Faculty of Agriculture, Ferdowsi University of Mashhad. The DNA content of sample was extracted based on the guanidinium thiocianate-silicagel method. Polymerase Chain Reaction with specific designed primers was performed to amplify Cyt-b and HVR 1&2 loci with 751 and 701 bp lengths, respectively. Sequencing of amplified Cyt-b and HVR 1&2 loci were done based on Sanger method by automatic sequencer machine (ABI 3130. Nucleotide diversity in Brown Swiss, Sarabi and Sistani breeds were estimated 0.0037, 0.0024 and 0.0029, respectively. Sequences of Cyt-b and HVR 1&2 were register in National Center for Biotechnology Institute due to nucleotide differences. Results of phylogenetic test using UPGMA for both loci showed that Sarabi and Sistani breeds are belonging to first group and Brown Swiss breed to other group.

  20. Color differences among feral pigeons (Columba livia) are not attributable to sequence variation in the coding region of the melanocortin-1 receptor gene (MC1R)

    Science.gov (United States)

    2013-01-01

    Background Genetic variation at the melanocortin-1 receptor (MC1R) gene is correlated with melanin color variation in many birds. Feral pigeons (Columba livia) show two major melanin-based colorations: a red coloration due to pheomelanic pigment and a black coloration due to eumelanic pigment. Furthermore, within each color type, feral pigeons display continuous variation in the amount of melanin pigment present in the feathers, with individuals varying from pure white to a full dark melanic color. Coloration is highly heritable and it has been suggested that it is under natural or sexual selection, or both. Our objective was to investigate whether MC1R allelic variants are associated with plumage color in feral pigeons. Findings We sequenced 888 bp of the coding sequence of MC1R among pigeons varying both in the type, eumelanin or pheomelanin, and the amount of melanin in their feathers. We detected 10 non-synonymous substitutions and 2 synonymous substitution but none of them were associated with a plumage type. It remains possible that non-synonymous substitutions that influence coloration are present in the short MC1R fragment that we did not sequence but this seems unlikely because we analyzed the entire functionally important region of the gene. Conclusions Our results show that color differences among feral pigeons are probably not attributable to amino acid variation at the MC1R locus. Therefore, variation in regulatory regions of MC1R or variation in other genes may be responsible for the color polymorphism of feral pigeons. PMID:23915680

  1. Using regional moment tensors to constrain the kinematics and stress evolution of the 2010–2013 Canterbury earthquake sequence, South Island, New Zealand

    Science.gov (United States)

    Herman, Matthew W.; Herrmann, Robert B.; Benz, Harley M.; Furlong, Kevin P.

    2014-01-01

    On September 3, 2010, a MW 7.0 (U.S. Geological Survey moment magnitude) earthquake ruptured across the Canterbury Plains in South Island, New Zealand. Since then, New Zealand GNS Science has recorded over 10,000 aftershocks ML 2.0 and larger, including three destructive ~ MW 6.0 earthquakes near Christchurch. We treat the Canterbury earthquake sequence as an intraplate earthquake sequence, and compare its kinematics to an Andersonian model for fault slip in a uniform stress field. We determined moment magnitudes and double couple solutions for 150 earthquakes having MW 3.7 and larger through the use of a waveform inversion technique using data from broadband seismic stations on South Island, New Zealand. The majority (126) of these double couple solutions have strike-slip focal mechanisms, with right-lateral slip on ENE fault planes or equivalently left-lateral slip on SSE fault planes. The remaining focal mechanisms indicate reverse faulting, except for two normal faulting events. The strike-slip segments have compatible orientations for slip in a stress field with a horizontal σ1 oriented ~ N115°E, and horizontal σ3. The preference for right lateral strike-slip earthquakes suggests that these structures are inherited from previous stages of deformation. Reverse slip is interpreted to have occurred on previously existing structures in regions with an absence of existing structures optimally oriented for strike-slip deformation. Despite the variations in slip direction and faulting style, most aftershocks had nearly the same P-axis orientation, consistent with the regional σ1. There is no evidence for significant changes in these stress orientations throughout the Canterbury earthquake sequence.

  2. Interaction region for crab waist scheme of the Future Electron-Positron Collider (CERN)

    CERN Document Server

    Bogomyagkov, A

    2015-01-01

    Design study in CERN of the accelerator that would fit 80-100 km tunnel called Future Circular Colliders (FCC) includes high-luminosity $e^+ e^−$ collider (FCC-ee) with center-of-mass energy from 90 to 350 GeV to study Higgs boson properties and perform precise measurements at the electroweak scale [1–3]. Crab waist interaction region provides collisions with luminosity higher than 2 × 10$^{36}$ cm$^{−2}$ sec$^{−1}$ at beam energy of 45 GeV. The small values of the beta functions at the interaction point and distant final focus lenses are the reasons for high nonlinear chromaticity limiting energy acceptance of the whole ring. The paper describes interaction region for crab waist collision scheme in the FCC-ee, principles of tuning the chromaticity correction section in order to provide large energy acceptance.

  3. The High Degree of Sequence Plasticity of the Arenavirus Noncoding Intergenic Region (IGR) Enables the Use of a Nonviral Universal Synthetic IGR To Attenuate Arenaviruses.

    Science.gov (United States)

    Iwasaki, Masaharu; Cubitt, Beatrice; Sullivan, Brian M; de la Torre, Juan C

    2016-01-06

    Hemorrhagic fever arenaviruses (HFAs) pose important public health problems in regions where they are endemic. Concerns about human-pathogenic arenaviruses are exacerbated because of the lack of FDA-licensed arenavirus vaccines and because current antiarenaviral therapy is limited to an off-label use of ribavirin that is only partially effective. We have recently shown that the noncoding intergenic region (IGR) present in each arenavirus genome segment, the S and L segments (S-IGR and L-IGR, respectively), plays important roles in the control of virus protein expression and that this knowledge could be harnessed for the development of live-attenuated vaccine strains to combat HFAs. In this study, we further investigated the sequence plasticity of the arenavirus IGR. We demonstrate that recombinants of the prototypic arenavirus lymphocytic choriomeningitis virus (rLCMVs), whose S-IGRs were replaced by the S-IGR of Lassa virus (LASV) or an entirely nonviral S-IGR-like sequence (Ssyn), are viable, indicating that the function of S-IGR tolerates a high degree of sequence plasticity. In addition, rLCMVs whose L-IGRs were replaced by Ssyn or S-IGRs of the very distantly related reptarenavirus Golden Gate virus (GGV) were viable and severely attenuated in vivo but able to elicit protective immunity against a lethal challenge with wild-type LCMV. Our findings indicate that replacement of L-IGR by a nonviral Ssyn could serve as a universal molecular determinant of arenavirus attenuation. Hemorrhagic fever arenaviruses (HFAs) cause high rates of morbidity and mortality and pose important public health problems in regions where they are endemic. Implementation of live-attenuated vaccines (LAVs) will represent a major step to combat HFAs. Here we document that the arenavirus noncoding intergenic region (IGR) has a high degree of plasticity compatible with virus viability. This observation led us to generate recombinant LCMVs containing nonviral synthetic IGRs. These r

  4. Testing the existence of non-Maxwellian electron distributions in H II regions after assessing atomic data accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Mendoza, C. [Permanent address: Centro de Física, Instituto Venezolano de Investigaciones Científicas (IVIC), P.O. Box 20632, Caracas 1020A, Venezuela. (Venezuela, Bolivarian Republic of); Bautista, M. A., E-mail: claudio.mendozaguardia@wmich.edu, E-mail: manuel.bautista@wmich.edu [Department of Physics, Western Michigan University, Kalamazoo, MI 49008 (United States)

    2014-04-20

    The classic optical nebular diagnostics [N II], [O II], [O III], [S II], [S III], and [Ar III] are employed to search for evidence of non-Maxwellian electron distributions, namely κ distributions, in a sample of well-observed Galactic H II regions. By computing new effective collision strengths for all these systems and A-values when necessary (e.g., S II), and by comparing with previous collisional and radiative data sets, we have been able to obtain realistic estimates of the electron-temperature dispersion caused by the atomic data, which in most cases are not larger than ∼10%. If the uncertainties due to both observation and atomic data are then taken into account, it is plausible to determine for some nebulae a representative average temperature while in others there are at least two plasma excitation regions. For the latter, it is found that the diagnostic temperature differences in the high-excitation region, e.g., T{sub e} (O III), T{sub e} (S III), and T{sub e} (Ar III), cannot be conciliated by invoking κ distributions. For the low-excitation region, it is possible in some, but not all, cases to arrive at a common, lower temperature for [N II], [O II], and [S II] with κ ≈ 10, which would then lead to significant abundance enhancements for these ions. An analytic formula is proposed to generate accurate κ-averaged excitation rate coefficients (better than 10% for κ ≥ 5) from temperature tabulations of the Maxwell-Boltzmann effective collision strengths.

  5. Stenostomum cf. leucops (Platyhelminthes in Thailand: a surface observation using scanning electron microscopy and phylogenetic analysis based on 18S ribosomal DNA sequences

    Directory of Open Access Journals (Sweden)

    Arin Ngamniyom

    2016-02-01

    Full Text Available The genus Stenostomum contains small turbellaria that are widely distributed in freshwater environments worldwide. However, there are only rare reports or studies of this genus from Thailand. Therefore, the objective of this study was to report S. cf. leucops in Thailand collected from Pathum Thani Province. The worm morphology and surface topography using scanning electron microscopy were determined. Moreover, the phylogenetic tree of S. cf. leucops was analysed with 17 flatworms based on the 18S ribosomal DNA sequences. The phylogenetic relationship shared a common ancestry of Catenulida species, and S. cf. leucops displayed a monophyletic pattern within Stenostomum spp. The results of the morphological and molecular data are discussed. These results may increase the knowledge of freshwater microturbellarians in Thailand.

  6. Distribution of electrons in double photoionization of helium and heavier atoms in the asymptotic region

    International Nuclear Information System (INIS)

    Drukarev, E.G.

    1995-01-01

    This paper presents an analysis of the energy distribution of the outgoing electrons in the double ionization of helium by photons with energies much larger than the ionization potential. The analysis improves on the one carried out by Amusia et al. [J. Phys. B 8, 1248 (1975)] in the framework of the special model for the wave function of helium. Now the energy distribution is expressed through certain expectation values averaged over the initial state described by the wave function of the general form Ψ(r 1 ,r 2 ). A larger interval of values of photon energies is considered. The limit equations for the angular distribution are obtained. The general features of the process with heavier atoms are also analyzed

  7. Phylogenetic Analysis of a 'Jewel Orchid' Genus Goodyera (Orchidaceae) Based on DNA Sequence Data from Nuclear and Plastid Regions.

    Science.gov (United States)

    Hu, Chao; Tian, Huaizhen; Li, Hongqing; Hu, Aiqun; Xing, Fuwu; Bhattacharjee, Avishek; Hsu, Tianchuan; Kumar, Pankaj; Chung, Shihwen

    2016-01-01

    A molecular phylogeny of Asiatic species of Goodyera (Orchidaceae, Cranichideae, Goodyerinae) based on the nuclear ribosomal internal transcribed spacer (ITS) region and two chloroplast loci (matK and trnL-F) was presented. Thirty-five species represented by 132 samples of Goodyera were analyzed, along with other 27 genera/48 species, using Pterostylis longifolia and Chloraea gaudichaudii as outgroups. Bayesian inference, maximum parsimony and maximum likelihood methods were used to reveal the intrageneric relationships of Goodyera and its intergeneric relationships to related genera. The results indicate that: 1) Goodyera is not monophyletic; 2) Goodyera could be divided into four sections, viz., Goodyera, Otosepalum, Reticulum and a new section; 3) sect. Reticulum can be further divided into two subsections, viz., Reticulum and Foliosum, whereas sect. Goodyera can in turn be divided into subsections Goodyera and a new subsection.

  8. Phylogenetic Analysis of a 'Jewel Orchid' Genus Goodyera (Orchidaceae Based on DNA Sequence Data from Nuclear and Plastid Regions.

    Directory of Open Access Journals (Sweden)

    Chao Hu

    Full Text Available A molecular phylogeny of Asiatic species of Goodyera (Orchidaceae, Cranichideae, Goodyerinae based on the nuclear ribosomal internal transcribed spacer (ITS region and two chloroplast loci (matK and trnL-F was presented. Thirty-five species represented by 132 samples of Goodyera were analyzed, along with other 27 genera/48 species, using Pterostylis longifolia and Chloraea gaudichaudii as outgroups. Bayesian inference, maximum parsimony and maximum likelihood methods were used to reveal the intrageneric relationships of Goodyera and its intergeneric relationships to related genera. The results indicate that: 1 Goodyera is not monophyletic; 2 Goodyera could be divided into four sections, viz., Goodyera, Otosepalum, Reticulum and a new section; 3 sect. Reticulum can be further divided into two subsections, viz., Reticulum and Foliosum, whereas sect. Goodyera can in turn be divided into subsections Goodyera and a new subsection.

  9. A Regional GPS Receiver Network For Monitoring Mid-latitude Total Electron Content During Storms

    Science.gov (United States)

    Vernon, A.; Cander, Lj. R.

    A regional GPS receiver network has been used for monitoring mid-latitude total elec- tron content (TEC) during ionospheric storms at the current solar maximum. Differ- ent individual storms were examined to study how the temporal patterns of changes develop and how they are related to solar and geomagnetic activity for parameter de- scriptive of plasmaspheric-ionospheric ionisation. Use is then made of computer con- touring techniques to produce snapshot maps of TEC for different study cases. Com- parisons with the local ionosonde data at different phases of the storms enable the storm developments to be studied in detail.

  10. Existing and emerging detection technologies for DNA (Deoxyribonucleic Acid) finger printing, sequencing, bio- and analytical chips: a multidisciplinary development unifying molecular biology, chemical and electronics engineering.

    Science.gov (United States)

    Kumar Khanna, Vinod

    2007-01-01

    The current status and research trends of detection techniques for DNA-based analysis such as DNA finger printing, sequencing, biochips and allied fields are examined. An overview of main detectors is presented vis-à-vis these DNA operations. The biochip method is explained, the role of micro- and nanoelectronic technologies in biochip realization is highlighted, various optical and electrical detection principles employed in biochips are indicated, and the operational mechanisms of these detection devices are described. Although a diversity of biochips for diagnostic and therapeutic applications has been demonstrated in research laboratories worldwide, only some of these chips have entered the clinical market, and more chips are awaiting commercialization. The necessity of tagging is eliminated in refractive-index change based devices, but the basic flaw of indirect nature of most detection methodologies can only be overcome by generic and/or reagentless DNA sensors such as the conductance-based approach and the DNA-single electron transistor (DNA-SET) structure. Devices of the electrical detection-based category are expected to pave the pathway for the next-generation DNA chips. The review provides a comprehensive coverage of the detection technologies for DNA finger printing, sequencing and related techniques, encompassing a variety of methods from the primitive art to the state-of-the-art scenario as well as promising methods for the future.

  11. Time Sequence Spectroscopy of AW UMa. The 518 nm Mg i Triplet Region Analyzed With Broadening Functions

    Science.gov (United States)

    Rucinski, Slavek M.

    2015-02-01

    High-resolution spectroscopic observations of AW UMa, obtained on three consecutive nights with a median time resolution of 2.1 minutes, have been analyzed using the broadening function method in the spectral window of 22.75 nm around the 518 nm Mg i triplet region. Doppler images of the system reveal the presence of vigorous mass motions within the binary system; their presence puts into question the solid-body rotation assumption of the contact binary model. AW UMa appears to be a very tight, semi-detached binary; the mass transfer takes place from the more massive to the less massive component. The primary, a fast-rotating star with Vsin i=181.4+/- 2.5 km s-1, is covered with inhomogeneities: very slowly drifting spots and a dense network of ripples more closely participating in its rotation. The spectral lines of the primary show an additional broadening component (called the “pedestal”) that originates either in the equatorial regions, which rotate faster than the rest of the star by about 50 km s-1, or in an external disk-like structure. The secondary component appears to be smaller than predicted by the contact model. The radial velocity field around the secondary is dominated by accretion of matter transferred from (and possibly partly returned to) the primary component. The parameters of the binary are Asin i=2.73+/- 0.11 {{R}⊙ } and {{M}1}{{sin }3}i=1.29+/- 0.15 {{M}⊙ }, {{M}2}{{sin }3}i=0.128+/- 0.016 {{M}⊙ }. The mass ratio, {{q}sp}={{M}2}/{{M}1}=0.099+/- 0.003, while still the most uncertain among the spectroscopic elements, is substantially different from the previous numerous and mutually consistent photometric investigations which were based on the contact model. It should be studied why photometry and spectroscopy give such discrepant results and whether AW UMa is an unusual object or if only very high-quality spectroscopy can reveal the true nature of W UMa-type binaries. Based on observations obtained at the Canada

  12. Time sequence spectroscopy of AW UMa. The 518 nm Mg I triplet region analyzed with broadening functions

    International Nuclear Information System (INIS)

    Rucinski, Slavek M.

    2015-01-01

    High-resolution spectroscopic observations of AW UMa, obtained on three consecutive nights with a median time resolution of 2.1 minutes, have been analyzed using the broadening function method in the spectral window of 22.75 nm around the 518 nm Mg i triplet region. Doppler images of the system reveal the presence of vigorous mass motions within the binary system; their presence puts into question the solid-body rotation assumption of the contact binary model. AW UMa appears to be a very tight, semi-detached binary; the mass transfer takes place from the more massive to the less massive component. The primary, a fast-rotating star with Vsini=181.4±2.5 km s −1 , is covered with inhomogeneities: very slowly drifting spots and a dense network of ripples more closely participating in its rotation. The spectral lines of the primary show an additional broadening component (called the “pedestal”) that originates either in the equatorial regions, which rotate faster than the rest of the star by about 50 km s −1 , or in an external disk-like structure. The secondary component appears to be smaller than predicted by the contact model. The radial velocity field around the secondary is dominated by accretion of matter transferred from (and possibly partly returned to) the primary component. The parameters of the binary are Asini=2.73±0.11 R ⊙ and M 1 sin 3 i=1.29±0.15 M ⊙ , M 2 sin 3 i=0.128±0.016 M ⊙ . The mass ratio, q sp =M 2 /M 1 =0.099±0.003, while still the most uncertain among the spectroscopic elements, is substantially different from the previous numerous and mutually consistent photometric investigations which were based on the contact model. It should be studied why photometry and spectroscopy give such discrepant results and whether AW UMa is an unusual object or if only very high-quality spectroscopy can reveal the true nature of W UMa-type binaries.

  13. Shape resonances and the excitation of helium autoionising states by electrons in the 57-66 eV region

    International Nuclear Information System (INIS)

    Burgt, P.J.M. van der; Eck, J. van; Heideman, H.G.M.

    1986-01-01

    Optical excitation functions of singly excited helium states are presented, measured by detecting the yield of emitted photons as a function of the incident electron energy from 56 to 66 eV. Many structures are observed, which are caused by negative-ion resonances and by the decay of autoionising states followed by post-collision interaction. Some of the structures are interpreted as being caused by hitherto unknown shape resonances lying very close to the thresholds of a particular class of autoionising states. As these shape resonances almost exclusively decay to their respective parent (autoionising) states, thereby considerably enhancing the threshold excitation cross sections of these states, they can only be observed via the PCI effect on the excitation functions of (higher lying) singly excited states. Using the recently introduced supermultiplet classification for doubly excited states a selection rule for the near-threshold excitation of doubly excited states by electron impact is deduced from the measurements. Only states with large probabilities in the Wannier region of configuration space (where the two electrons are at nearly equal distances and on opposite sides of the nucleus) are strongly excited. It is pointed out that these states are precisely the states that can support the above mentioned shape resonances at their thresholds. (author)

  14. Photoelectron transport in the surface region of solids: universal analytical formalism for quantitative applications of electron spectroscopies

    International Nuclear Information System (INIS)

    Jablonski, A

    2015-01-01

    An advanced analytical theory describing electron transport in the surface region of solids may have accuracy comparable to Monte Carlo simulations of electron trajectories, however such an approach requires knowledge of a parameter called the single scattering albedo. This parameter is material dependent and can be calculated from the elastic mean free path and transport mean free path for signal electrons. An attempt is made to derive a simple expression that accurately describes the energy dependence of single scattering albedo in a wide energy range from 50 eV to 30 keV for 78 elemental solids. For these solids and the considered energy range, the mean percentage deviations between the reference values and values calculated from the fitted function were found to be generally well below 1%; the largest value of this deviation was equal to 0.86% (europium). Calculation of the single scattering albedo with high accuracy requires only five fitted coefficients for a given element. Recommendations are also given for calculations of this parameter for compounds. Different predictive formulas expressed in terms of the single scattering albedo are briefly discussed. (paper)

  15. ON THE NONTHERMAL κ-DISTRIBUTED ELECTRONS IN PLANETARY NEBULAE AND H ii REGIONS: THE κ INDEX AND ITS CORRELATIONS WITH OTHER NEBULAR PROPERTIES

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yong [Space Astronomy Laboratory, Faculty of Science, The University of Hong Kong, Pokfulam Road, Hong Kong (China); Zhang, Bing; Liu, Xiao-Wei, E-mail: zhangy96@hku.hk [Department of Astronomy, Peking University, Beijing 100871 (China)

    2016-01-20

    Recently, a suspicion arose that the free electrons in planetary nebulae (PNs) and H ii regions might have nonthermal energy distributions. In this scenario, a κ index is introduced to characterize the electron energy distributions, with smaller κ values indicating larger deviations from Maxwell–Boltzmann distributions. Assuming that this is the case, we determine the κ values for a sample of PNs and H ii regions by comparing the intensities of [O iii] collisionally excited lines and the hydrogen Balmer jump. We find the average κ indices of PNs and H ii regions to be 27 and 32, respectively. Correlations between the resultant κ values and various physical properties of the nebulae are examined to explore the potential origin of nonthermal electrons in photoionized gaseous nebulae. However, no positive result is obtained. Thus, the current analysis does not lend support to the idea that κ-distributed electrons are present in PNs and H ii regions.

  16. Observations in equatorial anomaly region of total electron content enhancements and depletions

    Directory of Open Access Journals (Sweden)

    N. Dashora

    2005-10-01

    Full Text Available A GSV 4004A GPS receiver has been operational near the crest of the equatorial anomaly at Udaipur, India for some time now. The receiver provides the line-of-sight total electron content (TEC, the phase and amplitude scintillation index, σφ and S4, respectively. This paper presents the first results on the nighttime TEC depletions associated with the equatorial spread F in the Indian zone. The TEC depletions are found to be very well correlated with the increased S4 index. A new feature of low-latitude TEC is also reported, concerning the observation of isolated and localized TEC enhancements in the nighttime low-latitude ionosphere. The TEC enhancements are not correlated with the S4 index. The TEC enhancements have also been observed along with the TEC depletions. The TEC enhancements have been interpreted as the manifestation of the plasma density enhancements reported by Le et al. (2003.

    Keywords. Ionosphere (Equatorial ionosphere; Ionospheric irregularities

  17. Genome sequence of foot-and-mouth disease virus outside the 3A region is also responsible for virus replication in bovine cells.

    Science.gov (United States)

    Ma, Xueqing; Li, Pinghua; Sun, Pu; Lu, Zengjun; Bao, Huifang; Bai, Xingwen; Fu, Yuanfang; Cao, Yimei; Li, Dong; Chen, Yingli; Qiao, Zilin; Liu, Zaixin

    2016-07-15

    The deletion of residues 93-102 in non-structure protein 3A of foot-and-mouth disease virus (FMDV) is associated with the inability of FMDV to grow in bovine cells and attenuated virulence in cattle.Whereas, a previously reported FMDV strain O/HKN/21/70 harboring 93-102 deletion in 3A protein grew equally well in bovine and swine cells. This suggests that changes inFMDV genome sequence, in addition to 93-102 deletion in 3A, may also affectthe viral growth phenotype in bovine cellsduring infection and replication.However, it is nuclear that changes in which region (inside or outside of 3A region) influences FMDV growth phenotype in bovine cells.In this study, to determine the region in FMDV genomeaffecting viral growth phenotype in bovine cells, we constructed chimeric FMDVs, rvGZSB-HKN3A and rvHN-HKN3A, by introducing the 3A coding region of O/HKN/21/70 into the context of O/SEA/Mya-98 strain O/GZSB/2011 and O Cathay topotype strain O/HN/CHA/93, respectively, since O/GZSB/2011 containing full-length 3A protein replicated well in bovine and swine cells, and O/HN/CHA/93 harboring 93-102 deletion in 3A protein grew poorly in bovine cells.The chimeric virusesrvGZSB-HKN3A and rvHN-HKN3A displayed growth properties and plaque phenotypes similar to those of the parental virus rvGZSB and rv-HN in BHK-21 and primary fetal porcine kidney (FPK) cells. However, rvHN-HKN3A and rv-HN replicated poorly in primary fetal bovine kidney (FBK) cells with no visible plaques, and rvGZSB-HKN3A exhibited lower growth rate and smaller plaque size phenotypes than those of the parental virus in FBK cells, but similar growth properties and plaque phenotypes to those of the recombinant viruses harboring 93-102 deletion in 3A. These results demonstrate that the difference present in FMDV genome sequence outside the 3A coding region also have influence on FMDV replication ability in bovine cells. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. THE CLUSTERED NATURE OF STAR FORMATION. PRE-MAIN-SEQUENCE CLUSTERS IN THE STAR-FORMING REGION NGC 602/N90 IN THE SMALL MAGELLANIC CLOUD

    International Nuclear Information System (INIS)

    Gouliermis, Dimitrios A.; Gennaro, Mario; Schmeja, Stefan; Dolphin, Andrew E.; Tognelli, Emanuele; Prada Moroni, Pier Giorgio

    2012-01-01

    Located at the tip of the wing of the Small Magellanic Cloud (SMC), the star-forming region NGC 602/N90 is characterized by the H II nebular ring N90 and the young cluster of pre-main-sequence (PMS) and early-type main-sequence stars NGC 602, located in the central area of the ring. We present a thorough cluster analysis of the stellar sample identified with Hubble Space Telescope/Advanced Camera for Surveys in the region. We show that apart from the central cluster low-mass PMS stars are congregated in 13 additional small, compact sub-clusters at the periphery of NGC 602, identified in terms of their higher stellar density with respect to the average background density derived from star counts. We find that the spatial distribution of the PMS stars is bimodal, with an unusually large fraction (∼60%) of the total population being clustered, while the remaining is diffusely distributed in the intercluster area, covering the whole central part of the region. From the corresponding color-magnitude diagrams we disentangle an age difference of ∼2.5 Myr between NGC 602 and the compact sub-clusters, which appear younger, on the basis of comparison of the brighter PMS stars with evolutionary models, which we accurately calculated for the metal abundance of the SMC. The diffuse PMS population appears to host stars as old as those in NGC 602. Almost all detected PMS sub-clusters appear to be centrally concentrated. When the complete PMS stellar sample, including both clustered and diffused stars, is considered in our cluster analysis, it appears as a single centrally concentrated stellar agglomeration, covering the whole central area of the region. Considering also the hot massive stars of the system, we find evidence that this agglomeration is hierarchically structured. Based on our findings, we propose a scenario according to which the region NGC 602/N90 experiences an active clustered star formation for the last ∼5 Myr. The central cluster NGC 602 was formed first

  19. New global electron density observations from GPS-RO in the D- and E-Region ionosphere

    Science.gov (United States)

    Wu, Dong L.

    2018-06-01

    A novel retrieval technique is developed for electron density (Ne) in the D- and E-region (80-120 km) using the high-quality 50-Hz GPS radio occultation (GPS-RO) phase measurements. The new algorithm assumes a slow, linear variation in the F-region background when the GPS-RO passes through the D- and E-region, and extracts the Ne profiles at 80-130 km from the phase advance signal caused by Ne. Unlike the conventional Abel function, the new approach produces a sharp Ne weighting function in the lower ionosphere, and the Ne retrievals are in good agreement with the IRI (International Reference Ionosphere) model in terms of monthly maps, zonal means and diurnal variations. The daytime GPS-RO Ne profiles can be well characterized by the α-Chapman function of three parameters (NmE, hmE and H), showing that the bottom of E-region is deepening and sharpening towards the summer pole. At high latitudes the monthly GPS-RO Ne maps at 80-120 km reveal clear enhancement in the auroral zones, more prominent at night, as a result of energetic electron precipitation (EEP) from the outer radiation belt. The D-/E-region auroral Ne is strongly correlated with Kp on a daily basis. The new Ne data allow further comprehensive analyses of the sporadic E (Es) phenomena in connection with the background Ne in the E-region. The layered (2-10 km) and fluctuated (Layer than Ne_Pert, are extracted with respect to the background Ne_Region on a profile-by-profile basis. The Ne_Layer component has a strong but highly-refined peak at ∼105 km, with an amplitude smaller than Ne_Region approximately by an order of magnitude. The Ne_Pert component, which was studied extensively in the past, is ∼2 orders of magnitude weaker than Ne_Layer. Both Ne_Layer and Ne_Pert are subject to significant diurnal and semidiurnal variations, showing downward progression with local time in amplitude. The 11-year solar cycle dominates the Ne interannual variations, showing larger Ne_Region and Ne_Layer but smaller

  20. Sudden post-midnight decrease in equatorial F-region electron densities associated with severe magnetic storms

    Directory of Open Access Journals (Sweden)

    D. R. Lakshmi

    1997-03-01

    Full Text Available A detailed analysis of the responses of the equatorial ionosphere to a large number of severe magnetic storms shows the rapid and remarkable collapse of F-region ionisation during post-midnight hours; this is at variance with the presently accepted general behaviour of the low-latitude ionosphere during magnetic storms. This paper discusses such responses as seen in the ionosonde data at Kodaikanal (Geomagn. Lat. 0.6 N. It is also observed that during magnetic storm periods the usual increase seen in the h'F at Kodaikanal during sunset hours is considerably suppressed and these periods are also characterised by increased foF2 values. It is suggested that the primary process responsible for these dramatic pre- and post-midnight changes in foF2 during magnetic storms could be due to changes in the magnitude as well as in the direction of usual equatorial electric fields. During the post-midnight periods the change in electric-field direction from westward to eastward for a short period causes an upward E × B plasma drift resulting in increased h'F and decreased electron densities in the equatorial region. In addition, it is also suggested that the enhanced storm-induced meridional winds in the thermosphere, from the poles towards the equator, may also cause the decreases in electron density seen during post-midnight hours by spatially transporting the F-region ionisation southwards away from Kodaikanal. The paper also includes a discussion on the effects of such decreases in ionisation on low-latitude HF communications.

  1. Allelic sequence variations in the hypervariable region of a T-cell receptor β chain: Correlation with restriction fragment length polymorphism in human families and populations

    International Nuclear Information System (INIS)

    Robinson, M.A.

    1989-01-01

    Direct sequence analysis of the human T-cell antigen receptor (TCR) V β1 variable gene identified a single base-pair allelic variation (C/G) located within the coding region. This change results in substitution of a histidine (CAC) for a glutamine (CAG) at position 48 of the TCR β chain, a position predicted to be in the TCR antigen binding site. The V β1 polymorphism was found by DNA sequence analysis of V β1 genes from seven unrelated individuals; V β1 genes were amplified by the polymerase chain reaction, the amplified fragments were cloned into M13 phage vectors, and sequences were determined. To determined the inheritance patterns of the V β1 substitution and to test correlation with V β1 restriction fragment length polymorphism detected with Pvu II and Taq I, allele-specific oligonucleotides were constructed and used to characterize amplified DNA samples. Seventy unrelated individuals and six families were tested for both restriction fragment length polymorphism and for the V β1 substitution. The correlation was also tested using amplified, size-selected, Pvu II- and Taq I-digested DNA samples from heterozygotes. Pvu II allele 1 (61/70) and Taq I allele 1 (66/70) were found to be correlated with the substitution giving rise to a histidine at position 48. Because there are exceptions to the correlation, the use of specific probes to characterize allelic forms of TCR variable genes will provide important tools for studies of basic TCR genetics and disease associations

  2. Development of dominant sequence characterized amplified region (SCAR marker linked with plume moth (Exelastis atomosa Walsingham 1886 resistance in pigeon-pea

    Directory of Open Access Journals (Sweden)

    Ramya R Mishra

    2015-12-01

    Full Text Available The mode of gene action governing resistance to plume moth (Exelastis atomosa Walsingham 1886 derived from pigeon-pea (Cajanus scarabaeoides (L. Thouars accession ICPW-94 has been determined and the resistance alleles have been designated as PPM1. The progenies of F2 population and F3 families derived from an interspecific cross C. cajan (L. Huth ('ICP-26' x C. scarabaeoides (accession ICPW-94 revealed monogenic gene action for resistance to plume moth, and the dominant control by single locus or cluster of tightly linked alleles. Bulked segregant analysis (BSA of 116 F2 progenies by using 143 parental polymorphic RAPD primers could identify a fragment OPA09(910 associated with plume moth resistance in coupling phase of linkage. Further single plant analysis of the 116 F2 mapping population revealed OPA09(910 was linked to PPMi locus conferring host resistance to plume moth with recombination fraction (rf value of 0.125 (12.7 cM of Kosambi function. The resistance specific fragment OPA09(910 was cloned, sequenced and converted into a sequence characterized amplified region (SCAR marker, SCOPA09(942, which was also closely associated (10.3 cM with the locus PPMl with rf value 0.102. BLAST analysis with pigeon-pea genome sequence also confirmed its occurrence in CcLG02 (Scafseq.LG_V5.0fa and contig 01597 (AFSP01.fsa1. This SCAR marker showed reasonable screening efficiency in the F2, F3, and BC1F1 lines, thus it can be used as genetic handle in marker-assisted introgression of the genomic fragment conferring plume moth resistance and screening of breeding lines in pigeon-pea.

  3. Development of SCAR (sequence-characterized amplified region) markers as a complementary tool for identification of ginger (Zingiber officinale Roscoe) from crude drugs and multicomponent formulations.

    Science.gov (United States)

    Chavan, Preeti; Warude, Dnyaneshwar; Joshi, Kalpana; Patwardhan, Bhushan

    2008-05-01

    Zingiber officinale Roscoe (common or culinary ginger) is an official drug in Ayurvedic, Indian herbal, Chinese, Japanese, African and British Pharmacopoeias. The objective of the present study was to develop DNA-based markers that can be applied for the identification and differentiation of the commercially important plant Z. officinale Roscoe from the closely related species Zingiber zerumbet (pinecone, bitter or 'shampoo' ginger) and Zingiber cassumunar [cassumunar or plai (Thai) ginger]. The rhizomes of the other two Zingiber species used in the present study are morphologically similar to that of Z. officinale Roscoe and can be used as its adulterants or contaminants. Various methods, including macroscopy, microscopy and chemoprofiling, have been reported for the quality control of crude ginger and its products. These methods are reported to have limitations in distinguishing Z. officinale from closely related species. Hence, newer complementary methods for correct identification of ginger are useful. In the present study, RAPD (random amplification of polymorphic DNA) analysis was used to identify putative species-specific amplicons for Z. officinale. These were further cloned and sequenced to develop SCAR (sequence-characterized amplified region) markers. The developed SCAR markers were tested in several non-Zingiber species commonly used in ginger-containing formulations. One of the markers, P3, was found to be specific for Z. officinale and was successfully applied for detection of Z. officinale from Trikatu, a multicomponent formulation.

  4. Provenance and depositional age of the neoproterozoic volcanometasedimentary sequence in the Santa Terezinha region, Goias based on U-Pb single zircon and Sm-Nd isotope data

    International Nuclear Information System (INIS)

    Dantas, Elton Luiz; Jost, Hardy; Fuck, Reinhardt A.; Pimentel, Marcio Martins; Brod, Jose Affonso

    2001-01-01

    Some of the volcano-sedimentary sequences of the Tocantins Province have been considered to be formed during the evolution of a Neoproterozoic intra oceanic island arc system (Pimentel et al., 2000). However, the interpretation of supra crustal rocks of some areas of the central portions of the Goias Massif, such as the region of Santa Terezinha de Goias, is still controversial. These rocks have been considered either as part of the Archean greenstone belts or as Paleoproterozoic sequences (Ribeiro Filho 1981, Souza and Le Neto 1981, Machado et al.1981, Ribeiro Filho and Lacerda Filho 1985, Biondi and Pidevin 1994, Arantes et al. 1991) rather than an extension of the Neoproterozoic Mara Rosa magmatic arc (Viana et al.1995, Pimentel et al. 1997). An area of about 800 km 2 near the town of Santa Terezinha de Goias was recently mapped on a 1:25.000 scale (Jost et al. 2001). Its northern part consists of Proterozoic supra crustal rocks in tectonic contact with Archean rocks in the south. We present new Sm-Nd and U-Pb zircon data for the supra crustal rocks that crop out in the northern part of the area and discuss their provenance and depositional age (au)

  5. 16S-23S rDNA intergenic spacer region polymorphism of Lactococcus garvieae, Lactococcus raffinolactis and Lactococcus lactis as revealed by PCR and nucleotide sequence analysis.

    Science.gov (United States)

    Blaiotta, Giuseppe; Pepe, Olimpia; Mauriello, Gianluigi; Villani, Francesco; Andolfi, Rosamaria; Moschetti, Giancarlo

    2002-12-01

    The intergenic spacer region (ISR) between the 16S and 23S rRNA genes was tested as a tool for differentiating lactococci commonly isolated in a dairy environment. 17 reference strains, representing 11 different species belonging to the genera Lactococcus, Streptococcus, Lactobacillus, Enterococcus and Leuconostoc, and 127 wild streptococcal strains isolated during the whole fermentation process of "Fior di Latte" cheese were analyzed. After 16S-23S rDNA ISR amplification by PCR, species or genus-specific patterns were obtained for most of the reference strains tested. Moreover, results obtained after nucleotide analysis show that the 16S-23S rDNA ISR sequences vary greatly, in size and sequence, among Lactococcus garvieae, Lactococcus raffinolactis, Lactococcus lactis as well as other streptococci from dairy environments. Because of the high degree of inter-specific polymorphism observed, 16S-23S rDNA ISR can be considered a good potential target for selecting species-specific molecular assays, such as PCR primer or probes, for a rapid and extremely reliable differentiation of dairy lactococcal isolates.

  6. Assessing Symbiodinium diversity in scleractinian corals via next-generation sequencing-based genotyping of the ITS2 rDNA region

    KAUST Repository

    Arif, Chatchanit; Daniels, Camille; Bayer, Till; Banguera Hinestroza, Eulalia; Barbrook, Adrian; Howe, Christopher J.; LaJeunesse, Todd C.; Voolstra, Christian R.

    2014-01-01

    The persistence of coral reef ecosystems relies on the symbiotic relationship between scleractinian corals and intracellular, photosynthetic dinoflagellates in the genus Symbiodinium. Genetic evidence indicates that these symbionts are biologically diverse and exhibit discrete patterns of environmental and host distribution. This makes the assessment of Symbiodinium diversity critical to understanding the symbiosis ecology of corals. Here, we applied pyrosequencing to the elucidation of Symbiodinium diversity via analysis of the internal transcribed spacer 2 (ITS2) region, a multicopy genetic marker commonly used to analyse Symbiodinium diversity. Replicated data generated from isoclonal Symbiodinium cultures showed that all genomes contained numerous, yet mostly rare, ITS2 sequence variants. Pyrosequencing data were consistent with more traditional denaturing gradient gel electrophoresis (DGGE) approaches to the screening of ITS2 PCR amplifications, where the most common sequences appeared as the most intense bands. Further, we developed an operational taxonomic unit (OTU)-based pipeline for Symbiodinium ITS2 diversity typing to provisionally resolve ecologically discrete entities from intragenomic variation. A genetic distance cut-off of 0.03 collapsed intragenomic ITS2 variants of isoclonal cultures into single OTUs. When applied to the analysis of field-collected coral samples, our analyses confirm that much of the commonly observed Symbiodinium ITS2 diversity can be attributed to intragenomic variation. We conclude that by analysing Symbiodinium populations in an OTU-based framework, we can improve objectivity, comparability and simplicity when assessing ITS2 diversity in field-based studies.

  7. Assessing Symbiodinium diversity in scleractinian corals via next-generation sequencing-based genotyping of the ITS2 rDNA region

    KAUST Repository

    Arif, Chatchanit

    2014-09-01

    The persistence of coral reef ecosystems relies on the symbiotic relationship between scleractinian corals and intracellular, photosynthetic dinoflagellates in the genus Symbiodinium. Genetic evidence indicates that these symbionts are biologically diverse and exhibit discrete patterns of environmental and host distribution. This makes the assessment of Symbiodinium diversity critical to understanding the symbiosis ecology of corals. Here, we applied pyrosequencing to the elucidation of Symbiodinium diversity via analysis of the internal transcribed spacer 2 (ITS2) region, a multicopy genetic marker commonly used to analyse Symbiodinium diversity. Replicated data generated from isoclonal Symbiodinium cultures showed that all genomes contained numerous, yet mostly rare, ITS2 sequence variants. Pyrosequencing data were consistent with more traditional denaturing gradient gel electrophoresis (DGGE) approaches to the screening of ITS2 PCR amplifications, where the most common sequences appeared as the most intense bands. Further, we developed an operational taxonomic unit (OTU)-based pipeline for Symbiodinium ITS2 diversity typing to provisionally resolve ecologically discrete entities from intragenomic variation. A genetic distance cut-off of 0.03 collapsed intragenomic ITS2 variants of isoclonal cultures into single OTUs. When applied to the analysis of field-collected coral samples, our analyses confirm that much of the commonly observed Symbiodinium ITS2 diversity can be attributed to intragenomic variation. We conclude that by analysing Symbiodinium populations in an OTU-based framework, we can improve objectivity, comparability and simplicity when assessing ITS2 diversity in field-based studies.

  8. Electronic memory devices based on the chalcone with negative electrostatic potential regions

    International Nuclear Information System (INIS)

    Yan, Bao-Long; Sun, Ru; Ge, Jian-Feng; Wang, Dong; Li, Hua; Lu, Jian-Mei

    2013-01-01

    The molecular electrostatic potential (ESP) properties were used for the explanation of organic electric memory ability. Several chalcone compounds, owning a negative ESP region locates at the oxygen atom, were selected in this paper to validate the selection of compounds for organic memory materials. The synthesis, characterization, fabrication of the organic memory devices and the electrical properties for them were reported, and they were shown as WORM (write once read many times) type memory devices. The molecular geometries were optimized by the addition of a changeable electric field in the x direction inside the molecules using FF-DFT (Finite Field-Density Functionary Theory) method. The relationship between ESP of the molecules under different electric field and the property was discussed, and the mechanisms associated with the memory effect were also elucidated from DFT calculation results. - Highlights: • The molecular electrostatic potential (ESP) properties were used. • The chalcone compounds were used for the WORM type device. • The molecular geometries were optimized by the addition of a changeable electric field in the x direction. • The structure–property relationship was discussed

  9. INTRODUCING ELECTRONIC MARITIME SINGLE WINDOW BY PORT COMMUNITIES IN THE ADRIATIC REGION

    Directory of Open Access Journals (Sweden)

    Bojan BEŠKOVNIK

    2015-12-01

    Full Text Available The article analysis specific fields of procedures for ship arrival and acceptance in the port, that are predefined by the Directive 2010/65/EU. The directive poses the framework for the Maritime Single Window (MSW development in EU. The article brings original and scientific contribution, as it presents the model for Slovenian MSW (SI MSW. The model covers the need of different groups of stakeholder from the local port community. The proposed MSW architecture unifies communication channels and reduces interfaces in business to port (B2P and business to administration (B2A operational processes for ship formalities. Consequently, the business to customer (B2C relationship benefits from lean operation procedures. The focus is also on information exchange standardization. The paper presents principal benefits of the model implementation in the Slovenian port community. The SI MSW model might be adopted also in other port communities in the Adriatic region or to be used as the main platform for further local improvement.

  10. Development and detection efficiency of sequence characterized amplified region markers for authentication of medicinal plant Ruta graveolens and its adulterant Euphorbia dracunculoides

    Directory of Open Access Journals (Sweden)

    Irum Gul

    2016-01-01

    Full Text Available Background: With the increase in demand of herbal medicines, adulteration in these drugs is also gaining momentum and remains an indispensable problem in domestic and export markets. Correct identification is the first step toward assuring quality, safety, and efficacy of indigenous herbal medicines. Materials and Methods: In this study, sequence characterized amplified region (SCAR markers were developed to discriminate Ruta graveolens from its adulterant Euphorbia dracunculoides. Random amplified polymorphic DNA (RAPD was performed and subsequently converted into SCAR markers. Results: After performing RAPD, SCAR primers were designed from the selected unique RAPD amplicons of the genuine drug as well as its adulterant. These primers produced 670 bp and 750 bp SCAR markers with genomic DNA sample of R. graveolens and E. dracunculoides, respectively. Conclusion: Development of these markers will help in the quality control of herbal drugs and monitoring widespread adulteration of these drugs by pharmaceutical industries and government agencies.

  11. Determination of the parametric region in which runaway electron energy losses are dominated by bremsstrahlung radiation in tokamaks

    International Nuclear Information System (INIS)

    Fernandez-Gomez, I.; Martin-Solis, J. R.; Sanchez, R.

    2007-01-01

    It has been recently argued that, at sufficiently large parallel electric fields, bremsstrahlung radiation can greatly reduce the maximum energy that runaway electrons can gain in tokamaks [M. Bakhtiari et al., Phys. Plasmas 12, 102503 (2005)]. In this contribution, the work of these authors is extended to show that the region where bremsstrahlung radiation dominate runaway energy losses is however more restricted than reported by them. Expressions will be provided for the limits of this region within the parameter space spanned by the background density and parallel electric field, as a function of the rest of the plasma parameters. It will be shown that the background density has to be above a certain critical value and that the parallel electric field must lie within a range of values, below and above which synchrotron radiation dominate the runaway energy losses. Finally, it will be demonstrated that typical disruption parameters lie within this region and, as a result, bremsstrahlung losses still play an important role in controlling the runaway energy

  12. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  13. Methodological Aspects of Strategic Development of Regional Socio-Economic System (Following the Example of Radio-Electronic Industry Enterprises in the Republic of Tatarstan)

    Science.gov (United States)

    Uraev, Nikolay N.; Mingaleev, Gaziz F.; Kushimov, Aleksandr T.; Kolesov, Nikolay A.

    2016-01-01

    This paper considers the methodological aspects of forming a development strategy for the regional socioeconomic system (by the example of radio-electronic enterprises in the Republic of Tatarstan). The paper suggests a conceptual scheme of the macro- and micro-factors' influence on the regional socioeconomic system. This scheme is based on the…

  14. Electronic health records and technical assistance to improve quality of primary care: Lessons for regional extension centers.

    Science.gov (United States)

    Boas, Samuel J; Bishop, Tara F; Ryan, Andrew M; Shih, Sarah C; Casalino, Lawrence P

    2014-07-01

    In 2009, the American Recovery and Reinvestment Act apportioned $643 million for a Health Information Technology Extension Program, which established Regional Extension Centers (RECs) to support the implementation and use of electronic health records (EHRs). Little is known, however, about how RECs should assist in EHR implementation and how they should structure ongoing support. The purpose of this paper is to describe physicians' experiences with the Primary Care Information Project (PCIP), an REC run by the New York City Department of Health and Mental Hygiene. We interviewed 17 physicians enrolled in PCIP to understand the role of the EHRon quality of care and their experience with technical assistance from PCIP. All physicians stated that they felt that the EHR improved the quality of care they delivered to their patients particularly because it helped them track patients. All the physicians found technical assistance helpful but most wanted ongoing assistance months or years after they adopted the EHR. © 2013 Published by Elsevier Inc.

  15. The Western New York regional electronic health record initiative: Healthcare informatics use from the registered nurse perspective.

    Science.gov (United States)

    Sackett, Kay M; Erdley, W Scott; Jones, Janice

    2006-01-01

    This paper describes a select population of Western New York (WNY) Registered Nurses' (RN) perspectives on the use of healthcare informatics and the adoption of a regional electronic health record (EHR). A three part class assignment on healthcare informatics used a Strengths, Weaknesses, Opportunities, Threats (SWOT) Analysis, and a Healthcare Informatics Schemata: A paradigm shift over time(c) timeline to determine RN perspectives about healthcare informatics use at their place of employment. Qualitative analysis of 41 RNs who completed the SWOT analysis provided positive and negative themes related to perceptions about healthcare informatics and EHR use at their place of employment. 29 healthcare organizations were aggregated by year on the timeline from 1950 through 2000. Information suggests that, RNs have the capacity to positively drive the adoption of EHRs and healthcare informatics in WNY.

  16. Origin of enhanced vibrational excitation in N2 by electron impact in the 15--35 eV region

    International Nuclear Information System (INIS)

    Dehmer, J.L.; Siegel, J.; Welch, J.; Dill, D.

    1980-01-01

    The authors calculate the integrated vibrational excitation cross section for e-N 2 scattering in the interval 0 --50 eV using the continuum multiple-scattering model with the Hara exchange approximation. Resonant enhancement is observed at 2.4 eV owing to the well-known π/sub g/ shape resonance. In addition, however, enhanced vibrational excitation is found centered at approx.26 eV, arising from a broad shape resonance in the sigma/sub u/ channel. The authors propose this one-electron feature as the main source of the enhanced vibrational excitation observed by Pavlovic et al. in the 15--35 eV region

  17. Broadband Amplification of Low-Terahertz Signals Using Axis-Encircling Electrons in a Helically Corrugated Interaction Region

    Science.gov (United States)

    He, W.; Donaldson, C. R.; Zhang, L.; Ronald, K.; Phelps, A. D. R.; Cross, A. W.

    2017-11-01

    Experimental results are presented of a broadband, high power, gyrotron traveling wave amplifier (gyro-TWA) operating in the (75-110)-GHz frequency band and based on a helically corrugated interaction region. The second harmonic cyclotron mode of a 55-keV, 1.5-A, axis-encircling electron beam is used to resonantly interact with a traveling TE21 -like eigenwave achieving broadband amplification. The gyro-TWA demonstrates a 3-dB gain bandwidth of at least 5.5 GHz in the experimental measurement with 9 GHz predicted for a wideband drive source with a measured unsaturated output power of 3.4 kW and gain of 36-38 dB. The approach may allow a gyro-TWA to operate at 1 THz.

  18. Structure and Dissipation Characteristics of an Electron Diffusion Region Observed by MMS During a Rapid, Normal-Incidence Magnetopause Crossing

    Science.gov (United States)

    Torbert, R. B.; Burch, J. L.; Argall, M. R.; Alm, L.; Farrugia, C. J.; Forbes, T. G.; Giles, B. L.; Rager, A.; Dorelli, J.; Strangeway, R. J.; Ergun, R. E.; Wilder, F. D.; Ahmadi, N.; Lindqvist, P.-A.; Khotyaintsev, Y.

    2017-12-01

    On 22 October 2016, the Magnetospheric Multiscale (MMS) spacecraft encountered the electron diffusion region (EDR) when the magnetosheath field was southward, and there were signatures of fast reconnection, including flow jets, Hall fields, and large power dissipation. One rapid, normal-incidence crossing, during which the EDR structure was almost stationary in the boundary frame, provided an opportunity to observe the spatial structure for the zero guide field case of magnetic reconnection. The reconnection electric field was determined unambiguously to be 2-3 mV/m. There were clear signals of fluctuating parallel electric fields, up to 6 mV/m on the magnetosphere side of the diffusion region, associated with a Hall-like parallel current feature on the electron scale. The width of the main EDR structure was determined to be 2 km (1.8 de). Although the MMS spacecraft were in their closest tetrahedral separation of 8 km, the divergences and curls for these thin current structures could therefore not be computed in the usual manner. A method is developed to determine these quantities on a much smaller scale and applied to compute the normal component of terms in the generalized Ohm's law for the positions of each individual spacecraft (not a barocentric average). Although the gradient pressure term has a qualitative dependence that follows the observed variation of E + Ve × B, the quantitative magnitude of these terms differs by more than a factor of 2, which is shown to be greater than the respective errors. Thus, future research is required to find the manner in which Ohm's law is balanced.

  19. Mass measurements of neutron rich isotopes in the Fe region and electron capture processes in neutron star crusts

    International Nuclear Information System (INIS)

    Estrade, Alfredo; Matos, M.; Schatz, Hendrik; Amthor, A.M.; Beard, Mary; Brown, Edward; Bazin, D.; Becerril, A.; Elliot, T.; Gade, A.; Galaviz, D.; Gupta, Sanjib; Hix, William Raphael; Lau, Rita; Moeller, Peter; Pereira, J.; Portillo, M.; Rogers, A.M.; Shapira, Dan; Smith, E.; Stolz, A.; Wallace, M.; Wiescher, Michael

    2011-01-01

    Experimental knowledge of nuclear masses of exotic nuclei is important for understanding nuclear structure far from the valley of stability, and as a direct input into astrophysical models. Electron capture processes in the crust of accreting neutron stars have been proposed as a heat source that can affect the thermal structure of the star. Nuclear masses of very neutron-rich nuclides are necessary inputs to model the electron capture process. The time-of-flight (TOF) mass measurement technique allows measurements on very short-lived nuclei. It has been effectively applied using the fast fragment beams produced at the National Superconducting Cyclotron Lab (NSCL) to reach masses very far from stability. Measurements were performed for neutron-rich isotopes in the region of the N=32 and N=40 subshells, which coincides with the mass range of carbon superburst ashes. We discuss reaction network calculations performed to investigate the impact of our new measurements and to compare the effect of using different global mass models in the calculations. It is observed that the process is sensitive to the differences in the odd-even mass staggering predicted by the mass models, and our new result for 66Mn has a significant impact on the distribution of heat sources in the crust.

  20. Piezo-Phototronic Effect on Selective Electron or Hole Transport through Depletion Region of Vis-NIR Broadband Photodiode.

    Science.gov (United States)

    Zou, Haiyang; Li, Xiaogan; Peng, Wenbo; Wu, Wenzhuo; Yu, Ruomeng; Wu, Changsheng; Ding, Wenbo; Hu, Fei; Liu, Ruiyuan; Zi, Yunlong; Wang, Zhong Lin

    2017-08-01

    Silicon underpins nearly all microelectronics today and will continue to do so for some decades to come. However, for silicon photonics, the indirect band gap of silicon and lack of adjustability severely limit its use in applications such as broadband photodiodes. Here, a high-performance p-Si/n-ZnO broadband photodiode working in a wide wavelength range from visible to near-infrared light with high sensitivity, fast response, and good stability is reported. The absorption of near-infrared wavelength light is significantly enhanced due to the nanostructured/textured top surface. The general performance of the broadband photodiodes can be further improved by the piezo-phototronic effect. The enhancement of responsivity can reach a maximum of 78% to 442 nm illumination, the linearity and saturation limit to 1060 nm light are also significantly increased by applying external strains. The photodiode is illuminated with different wavelength lights to selectively choose the photogenerated charge carriers (either electrons or holes) passing through the depletion region, to investigate the piezo-phototronic effect on electron or hole transport separately for the first time. This is essential for studying the basic principles in order to develop a full understanding about piezotronics and it also enables the development of the better performance of optoelectronics. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Microbial rRNA sequencing analysis of evaporative cooler indoor environments located in the Great Basin Desert region of the United States†

    Science.gov (United States)

    Lemons, Angela R.; Hogan, Mary Beth; Gault, Ruth A.; Holland, Kathleen; Sobek, Edward; Olsen-Wilson, Kimberly A.; Park, Yeonmi; Park, Ju-Hyeong; Gu, Ja Kook; Kashon, Michael L.; Green, Brett J.

    2017-01-01

    Recent studies conducted in the Great Basin Desert region of the United States have shown that skin test reactivity to fungal and dust mite allergens are increased in children with asthma or allergy living in homes with evaporative coolers (EC). The objective of this study was to determine if the increased humidity previously reported in EC homes leads to varying microbial populations compared to homes with air conditioners (AC). Children with physician-diagnosed allergic rhinitis living in EC or AC environments were recruited into the study. Air samples were collected from the child's bedroom for genomic DNA extraction and metagenomic analysis of bacteria and fungi using the Illumina MiSeq sequencing platform. The analysis of bacterial populations revealed no major differences between EC and AC sampling environments. The fungal populations observed in EC homes differed from AC homes. The most prevalent species discovered in AC environments belonged to the genera Cryptococcus (20%) and Aspergillus (20%). In contrast, the most common fungi identified in EC homes belonged to the order Pleosporales and included Alternaria alternata (32%) and Phoma spp. (22%). The variations in fungal populations provide preliminary evidence of the microbial burden children may be exposed to within EC environments in this region. PMID:28091681

  2. Structural and mutational analyses of cis-acting sequences in the 5'-untranslated region of satellite RNA of bamboo mosaic potexvirus

    International Nuclear Information System (INIS)

    Annamalai, Padmanaban; Hsu, Y.-H.; Liu, Y.-P.; Tsai, C.-H.; Lin, N.-S.

    2003-01-01

    The satellite RNA of Bamboo mosaic virus (satBaMV) contains on open reading frame for a 20-kDa protein that is flanked by a 5'-untranslated region (UTR) of 159 nucleotides (nt) and a 3'-UTR of 129 nt. A secondary structure was predicted for the 5'-UTR of satBaMV RNA, which folds into a large stem-loop (LSL) and a small stem-loop. Enzymatic probing confirmed the existence of LSL (nt 8-138) in the 5'-UTR. The essential cis-acting sequences in the 5'-UTR required for satBaMV RNA replication were determined by deletion and substitution mutagenesis. Their replication efficiencies were analyzed in Nicotiana benthamiana protoplasts and Chenopodium quinoa plants coinoculated with helper BaMV RNA. All deletion mutants abolished the replication of satBaMV RNA, whereas mutations introduced in most of the loop regions and stems showed either no replication or a decreased replication efficiency. Mutations that affected the positive-strand satBaMV RNA accumulation also affected the accumulation of negative-strand RNA; however, the accumulation of genomic and subgenomic RNAs of BaMV were not affected. Moreover, covariation analyses of natural satBaMV variants provide substantial evidence that the secondary structure in the 5'-UTR of satBaMV is necessary for efficient replication

  3. Investigating the prehistory of Tungusic peoples of Siberia and the Amur-Ussuri region with complete mtDNA genome sequences and Y-chromosomal markers.

    Science.gov (United States)

    Duggan, Ana T; Whitten, Mark; Wiebe, Victor; Crawford, Michael; Butthof, Anne; Spitsyn, Victor; Makarov, Sergey; Novgorodov, Innokentiy; Osakovsky, Vladimir; Pakendorf, Brigitte

    2013-01-01

    Evenks and Evens, Tungusic-speaking reindeer herders and hunter-gatherers, are spread over a wide area of northern Asia, whereas their linguistic relatives the Udegey, sedentary fishermen and hunter-gatherers, are settled to the south of the lower Amur River. The prehistory and relationships of these Tungusic peoples are as yet poorly investigated, especially with respect to their interactions with neighbouring populations. In this study, we analyse over 500 complete mtDNA genome sequences from nine different Evenk and even subgroups as well as their geographic neighbours from Siberia and their linguistic relatives the Udegey from the Amur-Ussuri region in order to investigate the prehistory of the Tungusic populations. These data are supplemented with analyses of Y-chromosomal haplogroups and STR haplotypes in the Evenks, Evens, and neighbouring Siberian populations. We demonstrate that whereas the North Tungusic Evenks and Evens show evidence of shared ancestry both in the maternal and in the paternal line, this signal has been attenuated by genetic drift and differential gene flow with neighbouring populations, with isolation by distance further shaping the maternal genepool of the Evens. The Udegey, in contrast, appear quite divergent from their linguistic relatives in the maternal line, with a mtDNA haplogroup composition characteristic of populations of the Amur-Ussuri region. Nevertheless, they show affinities with the Evenks, indicating that they might be the result of admixture between local Amur-Ussuri populations and Tungusic populations from the north.

  4. Investigating the Prehistory of Tungusic Peoples of Siberia and the Amur-Ussuri Region with Complete mtDNA Genome Sequences and Y-chromosomal Markers

    Science.gov (United States)

    Duggan, Ana T.; Whitten, Mark; Wiebe, Victor; Crawford, Michael; Butthof, Anne; Spitsyn, Victor; Makarov, Sergey; Novgorodov, Innokentiy; Osakovsky, Vladimir; Pakendorf, Brigitte

    2013-01-01

    Evenks and Evens, Tungusic-speaking reindeer herders and hunter-gatherers, are spread over a wide area of northern Asia, whereas their linguistic relatives the Udegey, sedentary fishermen and hunter-gatherers, are settled to the south of the lower Amur River. The prehistory and relationships of these Tungusic peoples are as yet poorly investigated, especially with respect to their interactions with neighbouring populations. In this study, we analyse over 500 complete mtDNA genome sequences from nine different Evenk and even subgroups as well as their geographic neighbours from Siberia and their linguistic relatives the Udegey from the Amur-Ussuri region in order to investigate the prehistory of the Tungusic populations. These data are supplemented with analyses of Y-chromosomal haplogroups and STR haplotypes in the Evenks, Evens, and neighbouring Siberian populations. We demonstrate that whereas the North Tungusic Evenks and Evens show evidence of shared ancestry both in the maternal and in the paternal line, this signal has been attenuated by genetic drift and differential gene flow with neighbouring populations, with isolation by distance further shaping the maternal genepool of the Evens. The Udegey, in contrast, appear quite divergent from their linguistic relatives in the maternal line, with a mtDNA haplogroup composition characteristic of populations of the Amur-Ussuri region. Nevertheless, they show affinities with the Evenks, indicating that they might be the result of admixture between local Amur-Ussuri populations and Tungusic populations from the north. PMID:24349531

  5. Investigating the prehistory of Tungusic peoples of Siberia and the Amur-Ussuri region with complete mtDNA genome sequences and Y-chromosomal markers.

    Directory of Open Access Journals (Sweden)

    Ana T Duggan

    Full Text Available Evenks and Evens, Tungusic-speaking reindeer herders and hunter-gatherers, are spread over a wide area of northern Asia, whereas their linguistic relatives the Udegey, sedentary fishermen and hunter-gatherers, are settled to the south of the lower Amur River. The prehistory and relationships of these Tungusic peoples are as yet poorly investigated, especially with respect to their interactions with neighbouring populations. In this study, we analyse over 500 complete mtDNA genome sequences from nine different Evenk and even subgroups as well as their geographic neighbours from Siberia and their linguistic relatives the Udegey from the Amur-Ussuri region in order to investigate the prehistory of the Tungusic populations. These data are supplemented with analyses of Y-chromosomal haplogroups and STR haplotypes in the Evenks, Evens, and neighbouring Siberian populations. We demonstrate that whereas the North Tungusic Evenks and Evens show evidence of shared ancestry both in the maternal and in the paternal line, this signal has been attenuated by genetic drift and differential gene flow with neighbouring populations, with isolation by distance further shaping the maternal genepool of the Evens. The Udegey, in contrast, appear quite divergent from their linguistic relatives in the maternal line, with a mtDNA haplogroup composition characteristic of populations of the Amur-Ussuri region. Nevertheless, they show affinities with the Evenks, indicating that they might be the result of admixture between local Amur-Ussuri populations and Tungusic populations from the north.

  6. Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences.

    Science.gov (United States)

    Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E

    2016-09-01

    Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. © 2016 Blackwell Verlag GmbH.

  7. High sequence variations in the region containing genes encoding a cellular morphogenesis protein and the repressor of sexual development help to reveal origins of Aspergillus oryzae.

    Science.gov (United States)

    Chang, Perng-Kuang; Scharfenstein, Leslie L; Solorzano, Cesar D; Abbas, Hamed K; Hua, Sui-Sheng T; Jones, Walker A; Zablotowicz, Robert M

    2015-05-04

    Aspergillus oryzae and Aspergillus flavus are closely related fungal species. The A. flavus morphotype that produces numerous small sclerotia (S strain) and aflatoxin has a unique 1.5 kb deletion in the norB-cypA region of the aflatoxin gene cluster (i.e. the S genotype). Phylogenetic studies have indicated that an isolate of the nonaflatoxigenic A. flavus with the S genotype is the ancestor of A. oryzae. Genome sequence comparison between A. flavus NRRL3357, which produces large sclerotia (L strain), and S-strain A. flavus 70S identified a region (samA-rosA) that was highly variable in the two morphotypes. A third type of samA-rosA region was found in A. oryzae RIB40. The three samA-rosA types were later revealed to be commonly present in A. flavus L-strain populations. Of the 182 L-strain A. flavus field isolates examined, 46%, 15% and 39% had the samA-rosA type of NRRL3357, 70S and RIB40, respectively. The three types also were found in 18 S-strain A. flavus isolates with different proportions. For A. oryzae, however, the majority (80%) of the 16 strains examined had the RIB40 type and none had the NRRL3357 type. The results suggested that A. oryzae strains in the current culture collections were mostly derived from the samA-rosA/RIB40 lineage of the nonaflatoxigenic A. flavus with the S genotype. Published by Elsevier B.V.

  8. Determination of Spatio-Temporal Characteristics of D-region Electron Density during Annular Solar Eclipse from VLF Network Observations

    Science.gov (United States)

    Basak, T.; Hobara, Y.

    2015-12-01

    A major part of the path of the annular solar eclipse of May 20, 2012 (magnitude 0.9439) was over southern Japan. The D-region ionospheric changes associated with that eclipse, led to several degree of observable perturbations of sub-ionospheric very low frequency (VLF) radio signal. The University of Electro-Communications (UEC) operates VLF observation network over Japan. The solar eclipse associated signal changes were recorded in several receiving stations (Rx) simultaneously for the VLF signals coming from NWC/19.8kHz, JJI/22.2kHz, JJY/40.0kHz, NLK/24.8kHz and other VLF transmitters (Tx). These temporal dependences of VLF signal perturbation have been analyzed and the spatio-temporal characteristics of respective sub-ionospheric perturbations has already been studied by earlier workers using 2D-Finite Difference Time Domain method of simulation. In this work, we determine the spatial scale, depth and temporal dependence of lower ionospheric perturbation in consistence with umbral and penumbral motion. We considered the 2-parameter D-region ionospheric model with exponential electron density profile. To model the solar obscuration effect over it, we assumed a generalized space-time dependent 2-dimensional elliptical Gaussian distribution for ionospheric parameters, such as, effective reflection height (h') and sharpness factor (β). The depth (△hmax, △βmax), center of shadow (lato(t), lono(t)) and spatial scale (σlat,lon) of that Gaussian distribution are used as model parameters. In the vicinity of the eclipse zone, we compute the VLF signal perturbations using Long Wave Propagation Capability (LWPC) code for several signal propagation paths. The propagation path characteristics, such as, ground and water conductivity and geomagnetic effect on ionosphere are considered from standard LWPC prescriptions. The model parameters are tuned to set an optimum agreement between our computation and observed positive and negative type of VLF perturbations. Thus

  9. Comparison of Fecal Microbiota of Mongolian and Thoroughbred Horses by High-throughput Sequencing of the V4 Region of the 16S rRNA Gene.

    Science.gov (United States)

    Zhao, Yiping; Li, Bei; Bai, Dongyi; Huang, Jinlong; Shiraigo, Wunierfu; Yang, Lihua; Zhao, Qinan; Ren, Xiujuan; Wu, Jing; Bao, Wuyundalai; Dugarjaviin, Manglai

    2016-09-01

    The hindgut of horses is an anaerobic fermentative chamber for a complex and dynamic microbial population, which plays a critical role in health and energy requirements. Research on the gut microbiota of Mongolian horses has not been reported until now as far as we know. Mongolian horse is a major local breed in China. We performed high-throughput sequencing of the 16S rRNA genes V4 hypervariable regions from gut fecal material to characterize the gut microbiota of Mongolian horses and compare them to the microbiota in Thoroughbred horses. Fourteen Mongolian and 19 Thoroughbred horses were used in the study. A total of 593,678 sequence reads were obtained from 33 samples analyzed, which were found to belong to 16 phyla and 75 genera. The bacterial community compositions were similar for the two breeds. Firmicutes (56% in Mongolian horses and 53% in Thoroughbred horses) and Bacteroidetes (33% and 32% respectively) were the most abundant and predominant phyla followed by Spirochaete, Verrucomicrobia, Proteobacteria, and Fibrobacteres. Of these 16 phyla, five (Synergistetes, Planctomycetes, Proteobacteria, TM7, and Chloroflexi) were significantly different (phorses vs 29% in Thoroughbred horses), followed by Ruminococcus, Roseburia, Pseudobutyrivibrio, and Anaeroplasma, which were detected in higher distribution proportion in Mongolian horses than in Thoroughbred horses. In contrast, Oscillibacter, Fibrobacter, Methanocorpusculum, and Succinivibrio levels were lower in Mongolian horses. Among 75 genera, 30 genera were significantly different (phorse gut microbiota. These findings provide novel information about the gut microbiota of Mongolian horses and a foundation for future investigations of gut bacterial factors that may influence the development and progression of gastrointestinal disease in horses.

  10. Loss of genetic variability in a hatchery strain of Senegalese sole (Solea senegalensis revealed by sequence data of the mitochondrial DNA control region and microsatellite markers

    Directory of Open Access Journals (Sweden)

    Pablo Sánchez

    2012-06-01

    Full Text Available Comparisons of the levels of genetic variation within and between a hatchery F1 (FAR, n=116 of Senegalese sole, Solea senegalensis, and its wild donor population (ATL, n = 26, both native to the SW Atlantic coast of the Iberian peninsula, as well as between the wild donor population and a wild western Mediterranean sample (MED, n=18, were carried out by characterizing 412 base pairs of the nucleotide sequence of the mitochondrial DNA control region I, and six polymorphic microsatellite loci. FAR showed a substantial loss of genetic variability (haplotypic diversity, h=0.49±0.066; nucleotide diversity, π=0.006±0.004; private allelic richness, pAg=0.28 to its donor population ATL (h=0.69±0.114; π=0.009±0.006; pAg=1.21. Pairwise FST values of microsatellite data were highly significant (P < 0.0001 between FAR and ATL (0.053 and FAR and MED (0.055. The comparison of wild samples revealed higher values of genetic variability in MED than in ATL, but only with mtDNA CR-I sequence data (h=0.948±0.033; π=0.030±0.016. However, pairwise ΦST and FST values between ATL and MED were highly significant (P < 0.0001 with mtDNA CR-I (0.228 and with microsatellite data (0.095, respectively. While loss of genetic variability in FAR could be associated with the sampling error when the broodstock was established, the results of parental and sibship inference suggest that most of these losses can be attributed to a high variance in reproductive success among members of the broodstock, particularly among females.

  11. Study of the electron-positron annihilation in the galactic center region with the Integral/SPI spectrometer; Etude de l'annihilation electron-positon dans la region du centre galactique avec le spectrometre INTEGRAL/SPI

    Energy Technology Data Exchange (ETDEWEB)

    Sizun, P

    2007-04-15

    A spectral feature was detected in 1970 in the gamma-ray emission from the central regions of the Milky Way, during balloon flight observations. Located near 511 keV, this feature was soon attributed to the gamma-ray line tracing the annihilation of electrons with their anti-particles, positrons. However, none of the multiple astrophysical scenarios contemplated to explain the production of positrons in the Galactic bulge has been able to reproduce the high injection rate deduced from the flux of the 511 keV line, close to 10{sup 43} positrons per second. Launched in 2002, the European gamma-ray satellite INTEGRAL was provided with a spectrometer, SPI, whose unprecedented imaging and spectral capabilities in this energy range enable us to further study the source of the 511 keV line detected in the Galactic centre region. Indeed, a better determination of the spatial extent of the source, the intrinsic width of the line and the fraction of positrons annihilating in-flight, directly or via the formation of ortho-Positronium atoms would improve our knowledge of both the annihilation medium and the initial source of positrons, and could allow us to discriminate between the various explanatory scenarios. The first part of this thesis deals with a key ingredient in the extraction of the annihilation spectrum: the optimization of the instrumental background model. New data screening and tracer selection procedures are presented. Classical multi-linear models are compared to neural and Bayesian networks. Finally, three years of observation are used to constrain the width of the source and derive its spectrum. The second part of the thesis focuses on one of the possible scenarios explaining the high positron injection rate deduced from the flux of the 511 keV line: the annihilation of light dark matter particles into electron-positron pairs. The various radiation mechanisms involved are modeled and confronted to observations in order to set an upper limit on the injection

  12. Study of the electron-positron annihilation in the galactic center region with the Integral/SPI spectrometer

    International Nuclear Information System (INIS)

    Sizun, P.

    2007-04-01

    A spectral feature was detected in 1970 in the gamma-ray emission from the central regions of the Milky Way, during balloon flight observations. Located near 511 keV, this feature was soon attributed to the gamma-ray line tracing the annihilation of electrons with their anti-particles, positrons. However, none of the multiple astrophysical scenarios contemplated to explain the production of positrons in the Galactic bulge has been able to reproduce the high injection rate deduced from the flux of the 511 keV line, close to 10 43 positrons per second. Launched in 2002, the European gamma-ray satellite INTEGRAL was provided with a spectrometer, SPI, whose unprecedented imaging and spectral capabilities in this energy range enable us to further study the source of the 511 keV line detected in the Galactic centre region. Indeed, a better determination of the spatial extent of the source, the intrinsic width of the line and the fraction of positrons annihilating in-flight, directly or via the formation of ortho-Positronium atoms would improve our knowledge of both the annihilation medium and the initial source of positrons, and could allow us to discriminate between the various explanatory scenarios. The first part of this thesis deals with a key ingredient in the extraction of the annihilation spectrum: the optimization of the instrumental background model. New data screening and tracer selection procedures are presented. Classical multi-linear models are compared to neural and Bayesian networks. Finally, three years of observation are used to constrain the width of the source and derive its spectrum. The second part of the thesis focuses on one of the possible scenarios explaining the high positron injection rate deduced from the flux of the 511 keV line: the annihilation of light dark matter particles into electron-positron pairs. The various radiation mechanisms involved are modeled and confronted to observations in order to set an upper limit on the injection

  13. Non-equilibrium ionization by a periodic electron beam. II. Synthetic Si IV and O IV transition region spectra

    Science.gov (United States)

    Dzifčáková, Elena; Dudík, Jaroslav

    2018-03-01

    Context. Transition region (TR) spectra typically show the Si IV 1402.8 Å line to be enhanced by a factor of 5 or more compared to the neighboring O IV 1401.2 Å, contrary to predictions of ionization equilibrium models and the Maxwellian distribution of particle energies. Non-equilibrium effects in TR spectra are therefore expected. Aims: To investigate the combination of non-equilibrium ionization and high-energy particles, we apply the model of the periodic electron beam, represented by a κ-distribution that recurs at periods of several seconds, to plasma at chromospheric temperatures of 104 K. This simple model can approximate a burst of energy release involving accelerated particles. Methods: Instantaneous time-dependent charge states of silicon and oxygen were calculated and used to synthesize the instantaneous and period-averaged spectra of Si IV and O IV. Results: The electron beam drives the plasma out of equilibrium. At electron densities of Ne = 1010 cm-3, the plasma is out of ionization equilibrium at all times in all cases we considered, while for a higher density of Ne = 1011 cm-3, ionization equilibrium can be reached toward the end of each period, depending on the conditions. In turn, the character of the period-averaged synthetic spectra also depends on the properties of the beam. While the case of κ = 2 results in spectra with strong or even dominant O IV, higher values of κ can approximate a range of observed TR spectra. Spectra similar to typically observed spectra, with the Si IV 1402.8 Å line about a factor 5 higher than O IV 1401.2 Å, are obtained for κ = 3. An even higher value of κ = 5 results in spectra that are exclusively dominated by Si IV, with negligible O IV emission. This is a possible interpretation of the TR spectra of UV (Ellerman) bursts, although an interpretation that requires a density that is 1-3 orders of magnitude lower than for equilibrium estimates. Movies associated to Fig. A.1 are available at http://https://www.aanda.org

  14. Polymerase chain reaction assay for verifying the labeling of meat and commercial meat products from game birds targeting specific sequences from the mitochondrial D-loop region.

    Science.gov (United States)

    Rojas, M; González, I; Pavón, M A; Pegels, N; Hernández, P E; García, T; Martín, R

    2010-05-01

    A PCR assay was developed for the identification of meats and commercial meat products from quail (Coturnix coturnix), pheasant (Phasianus colchicus), partridge (Alectoris spp.), guinea fowl (Numida meleagris), pigeon (Columba spp.), Eurasian woodcock (Scolopax rusticola), and song thrush (Turdus philomelos) based on oligonucleotide primers targeting specific sequences from the mitochondrial D-loop region. The primers designed generated specific fragments of 96, 100, 104, 106, 147, 127, and 154 bp in length for quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock, and song thrush tissues, respectively. The specificity of each primer pair was tested against DNA from various game and domestic species. In this work, satisfactory amplification was accomplished in the analysis of experimentally pasteurized (72 degrees C for 30 min) and sterilized (121 degrees C for 20 min) meats, as well as in commercial meat products from the target species. The technique was also applied to raw and sterilized muscular binary mixtures, with a detection limit of 0.1% (wt/wt) for each of the targeted species. The proposed PCR assay represents a rapid and straightforward method for the detection of possible mislabeling in game bird meat products.

  15. The cytoplasmic domain close to the transmembrane region of the glucagon-like peptide-1 receptor contains sequence elements that regulate agonist-dependent internalisation.

    Science.gov (United States)

    Vázquez, Patricia; Roncero, Isabel; Blázquez, Enrique; Alvarez, Elvira

    2005-07-01

    In order to gain better insight into the molecular events involved in the signal transduction generated through glucagon-like peptide-1 (GLP-1) receptors, we tested the effect of deletions and point mutations within the cytoplasmic tail of this receptor with a view to establishing relationships between signal transduction desensitisation and receptor internalisation. Wild-type and truncated (deletion of the last 27 amino acids (GLPR 435R) and deletion of 44 amino acids (GLPR 418R)) GLP-1 receptors bound the agonist with similar affinity. Deletion of the last 27 amino acids decreased the internalisation rate by 78%, while deletion of 44 amino acids containing all the phosphorylation sites hitherto described in this receptor decreased the internalisation rate by only 47%. Binding of the ligand to both receptors stimulated adenylyl cyclase. In contrast, deletion of the region containing amino acids 419 to 435 (GLPR 419delta435) increased the internalisation rate by 268%, and the replacement of EVQ(408-410) by alanine (GLPR A(408-410)) increased this process to 296%. In both receptors, the efficacy in stimulating adenylate cyclase was decreased. All the receptors studied were internalised by coated pits, except for the receptor with a deletion of the last 44 amino acids, which also had a faster resensitisation rate. Our findings indicate that the neighbouring trans-membrane domain of the carboxyl-terminal tail of the GLP-1 receptor contains sequence elements that regulate agonist-dependent internalisation and transmembrane signalling.

  16. Global Coupled Model Studies of The Jovian Upper Atmosphere In Response To Electron Precipitation and Ionospheric Convection Within The Auroral Region.

    Science.gov (United States)

    Millward, G. H.; Miller, S.; Aylward, A. D.

    The Jovian Ionospheric Model (JIM) is a global three-dimensional model of Jupiter's coupled ionosphere and thermosphere, developed at University College London. Re- cently, the model has been used to investigate the atmospheric response to electron precipitation within the high-latitude auroral region. A series of simulations have been performed in which the model atmosphere is subjected to monochromatic precipitat- ing electrons of varying number flux and initial energy and, in addition, to various degrees of ionospheric convection. The auroral ionospheric conductivity which re- sults is shown to be strongly non-linear with respect to the incoming electron energy, with a maximum observed for incident particles of initial energy 60 KeV. Electrons with higher energies penetrate the thermospheric region completely, whilst electrons of lower energy (say 10 keV) produce ionisation at higher levels in the atmosphere which are less less condusive to the creation of ionospheric conductivity. Studies of the thermospheric winds with the auroral region show that zonal winds (around the auroral oval) can attain values of around 70% of the driving zonal ion velocity. Also the results show that these large neutral winds are limited in vertical extent to the region of large ionospheric conductivity, tailing off markedly at altitudes above this. The latest results from this work will be presented, and the implications for Jovian magnetospheric-ionospheric coupling will be discussed.

  17. Electron microscope mapping of the pericentric and intercalary heterochromatic regions of the polytene chromosomes of the mutant Suppressor of underreplication in Drosophila melanogaster.

    Science.gov (United States)

    Semeshin, F; Belyaeva, S; Zhimulev, F

    2001-12-01

    Breaks and ectopic contacts in the heterochromatic regions of Drosophila melanogaster polytene chromosomes are the manifestations of the cytological effects of DNA underreplication. Their appearance makes these regions difficult to map. The Su(UR)ES gene, which controls the phenomenon, has been described recently. Mutation of this locus gives rise to new blocks of material in the pericentric heterochromatic regions and causes the disappearance of breaks and ectopic contacts in the intercalary heterochromatic regions, thereby making the banding pattern distinct and providing better opportunities for mapping of the heterochromatic regions in polytene chromosomes. Here, we present the results of an electron microscope study of the heterochromatic regions. In the wild-type salivary glands, the pericentric regions correspond to the beta-heterochromatin and do not show the banding pattern. The most conspicuous cytological effect of the Su(UR)ES mutation is the formation of a large banded chromosome fragment comprising at least 25 bands at the site where the 3L and 3R proximal arms connect. In the other pericentric regions, 20CF, 40BF and 41BC, 15, 12 and 9 new bands were revealed, respectively. A large block of densely packed material appears in the most proximal part of the fourth chromosome. An electron microscope analysis of 26 polytene chromosome regions showing the characteristic features of intercalary heterochromatin was also performed. Suppression of DNA underreplication in the mutant transforms the bands with weak spots into large single bands.

  18. Arсhaeomineralogy of Ancient Nonferrous Metallurgy Pieces of the Perm Region: Experience of Usage of Electron Microprobe Analysis

    Directory of Open Access Journals (Sweden)

    I. I. Chaykovsky

    2016-12-01

    Full Text Available A series of archaeological features has been studied by means of the scanning electronic microscopy. It was shown that due to the oxidation process, the surface layer is enriched with some elements, which were present at unaltered metal (Ag, Pb and those included later (As, Zn, Pb. It imposes meaningful limitation for use of the X-ray fluorescence and spectral analysis, which allow obtaining only total (patina + metal composition. Sixteen minerals (oxides, carbonates, sulphates, chlorides, phosphates, sulfides and native phases are established in patina composition. Tin bronze structure contains the impurities, which may be an evidence of import to Perm Region of tin and silver possibly from Altai, tin and lead possibly from Karelia during "harinsky" and "rodanovsky" cultures respectively. Various composition of the alloys used for casting and filigree witnesses that ancient metallurgists had known about alloys handling. The presence of barium and fluorine can tell us about composition of the used furnacecharge. The obtained data may be the basis for chemical-metallurgical typification of pieces from nonferrous (and noble metals.

  19. Investigation of the Effects of Solar and Geomagnetic Changes on the Total Electron Content: Mid-Latitude Region

    Science.gov (United States)

    Ulukavak, Mustafa; Yalcinkaya, Mualla

    2016-04-01

    The Global Positioning System (GPS) is used as an important tool for ionosphere monitoring and obtaining the Total Electron Content (TEC). GPS satellites, positioned in the Earth's orbit, are used as sensors to investigate the space weather conditions. In this study, solar and geomagnetic activity variations were investigated between the dates 1 March-30 June 2015 for the mid-latitude region. GPS-TEC variations were calculated for each selected International GNSS Service (IGS) station in Europe. GNSS data was obtained from Crustal Dynamics Data and Information System (CDDIS) archive. Solar and geomagnetic activity indices (Kp, F10.7 ve Dst) were obtained from the Oceanic and Atmospheric Administration (NOAA), the Canadian Space Weather Forecast Centre (CSWFC) and Data Analysis Center for geomagnetism and Space Magnetism Graduate School of Science, Kyoto University (WDC) archives. GPS-TEC variations were determined for the quiet periods of the solar and geomagnetic activities. GPS-TEC changes were then compared with respect to the quiet periods of the solar and geomagnetic activities. Global Ionosphere Maps (GIM) IONEX files, obtained from the IGS analysis center, was used to check the robustness of the GPS-TEC variations. The investigations revealed that it is possible to use the GPS-TEC data for monitoring the ionospheric disturbances.

  20. Mass balance and life cycle assessment of the waste electrical and electronic equipment management system implemented in Lombardia Region (Italy)

    International Nuclear Information System (INIS)

    Biganzoli, L.; Falbo, A.; Forte, F.; Grosso, M.; Rigamonti, L.

    2015-01-01

    Waste electrical and electronic equipment (WEEE) is one of the fastest growing waste streams in Europe, whose content of hazardous substances as well as of valuable materials makes the study of the different management options particularly interesting. The present study investigates the WEEE management system in Lombardia Region (Italy) in the year 2011 by applying the life cycle assessment (LCA) methodology. An extensive collection of primary data was carried out to describe the main outputs and the energy consumptions of the treatment plants. Afterwards, the benefits and burdens associated with the treatment and recovery of each of the five categories in which WEEE is classified according to the Italian legislation (heaters and refrigerators — R1, large household appliances — R2, TV and monitors — R3, small household appliances — R4 and lighting equipment — R5) were evaluated. The mass balance of the treatment and recovery system of each of the five WEEE categories showed that steel and glass are the predominant streams of materials arising from the treatment; a non-negligible amount of plastic is also recovered, together with small amounts of precious metals. The LCA of the regional WEEE management system showed that the benefits associated with materials and energy recovery balance the burdens of the treatment processes, with the sole exception of two impact categories (human toxicity-cancer effects and freshwater ecotoxicity). The WEEE categories whose treatment and recovery resulted more beneficial for the environment and the human health are R3 and R5. The contribution analysis showed that overall the main benefits are associated with the recovery of metals, as well as of plastic and glass. Some suggestions for improving the performance of the system are given, as well as an indication for a more-in-depth analysis for the toxicity categories and a proposal for a new characterisation method for WEEE. - Highlights: • The WEEE management system in

  1. Mass balance and life cycle assessment of the waste electrical and electronic equipment management system implemented in Lombardia Region (Italy)

    Energy Technology Data Exchange (ETDEWEB)

    Biganzoli, L., E-mail: laura.biganzoli@mail.polimi.it; Falbo, A.; Forte, F.; Grosso, M.; Rigamonti, L.

    2015-08-15

    Waste electrical and electronic equipment (WEEE) is one of the fastest growing waste streams in Europe, whose content of hazardous substances as well as of valuable materials makes the study of the different management options particularly interesting. The present study investigates the WEEE management system in Lombardia Region (Italy) in the year 2011 by applying the life cycle assessment (LCA) methodology. An extensive collection of primary data was carried out to describe the main outputs and the energy consumptions of the treatment plants. Afterwards, the benefits and burdens associated with the treatment and recovery of each of the five categories in which WEEE is classified according to the Italian legislation (heaters and refrigerators — R1, large household appliances — R2, TV and monitors — R3, small household appliances — R4 and lighting equipment — R5) were evaluated. The mass balance of the treatment and recovery system of each of the five WEEE categories showed that steel and glass are the predominant streams of materials arising from the treatment; a non-negligible amount of plastic is also recovered, together with small amounts of precious metals. The LCA of the regional WEEE management system showed that the benefits associated with materials and energy recovery balance the burdens of the treatment processes, with the sole exception of two impact categories (human toxicity-cancer effects and freshwater ecotoxicity). The WEEE categories whose treatment and recovery resulted more beneficial for the environment and the human health are R3 and R5. The contribution analysis showed that overall the main benefits are associated with the recovery of metals, as well as of plastic and glass. Some suggestions for improving the performance of the system are given, as well as an indication for a more-in-depth analysis for the toxicity categories and a proposal for a new characterisation method for WEEE. - Highlights: • The WEEE management system in

  2. Sequence of the amino-terminal region of rat liver ribosomal proteins S4, S6, S8, L6, L7a, L18, L27, L30, L37, L37a, and L39.

    Science.gov (United States)

    Wittmann-Liebold, B; Geissler, A W; Lin, A; Wool, I G

    1979-01-01

    The sequence of the amino-terminal region of eleven rat liver ribosomal proteins--S4, S6, S8, L6, L7a, L18, L27, L30, L37a, and L39--was determined. The analysis confirmed the homogeneity of the proteins and suggests that they are unique, since no extensive common sequences were found. The N-terminal regions of the rat liver proteins were compared with amino acid sequences in Saccharomyces cerevisiae and in Escherichia coli ribosomal proteins. It seems likely that the proteins L37 from rat liver and Y55 from yeast ribosomes are homologous. It is possible that rat liver L7a or L37a or both are related to S cerevisiae Y44, although the similar sequences are at the amino-terminus of the rat liver proteins and in an internal region of Y44. A number of similarities in the sequences of rat liver and E coli ribosomal proteins have been found; however, it is not yet possible to say whether they connote a common ancestry.

  3. Film dosimetric investigations on the exposure of the eyes in radiation therapy of the head and the cervical region with fast electrons up to 17 MeV

    International Nuclear Information System (INIS)

    Stecher, M.; Eichler, R.

    1978-01-01

    Dose distributions in irradiating tumors of the head and the cervical region with 17 MeV electrons were determined in a phantom with films. From the isodoses obtained it can be derived how radiation reaches the eyes and how the dose to the eyes is influenced. Guidance is provided for the reduction of the dose to the eye. (author)

  4. Sub-grouping of Plasmodium falciparum 3D7 var genes based on sequence analysis of coding and non-coding regions

    DEFF Research Database (Denmark)

    Lavstsen, Thomas; Salanti, Ali; Jensen, Anja T R

    2003-01-01

    and organization of the 3D7 PfEMP1 repertoire was investigated on the basis of the complete genome sequence. METHODS: Using two tree-building methods we analysed the coding and non-coding sequences of 3D7 var and rif genes as well as var genes of other parasite strains. RESULTS: var genes can be sub...

  5. Variations of the Electron Fluxes in the Terrestrial Radiation Belts Due To the Impact of Corotating Interaction Regions and Interplanetary Coronal Mass Ejections

    Science.gov (United States)

    Benacquista, R.; Boscher, D.; Rochel, S.; Maget, V.

    2018-02-01

    In this paper, we study the variations of the radiation belts electron fluxes induced by the interaction of two types of solar wind structures with the Earth magnetosphere: the corotating interaction regions and the interplanetary coronal mass ejections. We use a statistical method based on the comparison of the preevent and postevent fluxes. Applied to the National Oceanic and Atmospheric Administration-Polar Operational Environmental Satellites data, this gives us the opportunity to extend previous studies focused on relativistic electrons at geosynchronous orbit. We enlighten how corotating interaction regions and Interplanetary Coronal Mass Ejections can impact differently the electron belts depending on the energy and the L shell. In addition, we provide a new insight concerning these variations by considering their amplitude. Finally, we show strong relations between the intensity of the magnetic storms related to the events and the variation of the flux. These relations concern both the capacity of the events to increase the flux and the deepness of these increases.

  6. Enhanced spin polarization of elastic electron scattering from alkaline-earth-metal atoms in Ramsauer-Townsend and low-lying shape resonance regions

    International Nuclear Information System (INIS)

    Yuan, J.; Zhang, Z.

    1993-01-01

    Spin polarizations (SP's) of elastic electron scattering from alkaline-earth-metal atoms in Ramsauer-Townsend (RT) and low-lying shape resonance (SR) regions are calculated using a relativistic method. The detailed SP distributions both with scattering angle and with electron energy are presented via the energy- and angle-dependent surfaces of SP parameters. It is shown that the SP effects of the collisions of electrons with Ca, Sr, and Ba atoms in the RT region are significant in a considerable area on the energy-angle plane and that the spin-orbit interaction is well increased around the low-lying p-wave SR states of Be and Mg and the d-wave SR states of Ca, Sr, and Ba

  7. An electron storage ring as primary standard for the realization of radiation optical units from the infrared to the soft X-ray region

    International Nuclear Information System (INIS)

    Riehle, F.; Wende, B.

    1987-01-01

    The electron storage ring BESSY optimized for radiometry is shown to be a primary standard of spectral photon flux with a relative uncertainty increasing from 0.3% in the infrared (photon energy ≅ 1 eV) to 2% in the soft X-ray region (photon energy ≅ 5 keV). The small uncertainties at high photon energies were achieved by measuring the spatial and angular distributions of the electrons around the mean electron orbit and by calculating the corresponding distributions of the emitted synchrotron radiation. Results of various intercomparisons with other standards in the near infrared, visible, and soft X-ray region support the low uncertainties of this new primary standard. (orig.)

  8. Multifractal analysis of vertical total electron content (VTEC at equatorial region and low latitude, during low solar activity

    Directory of Open Access Journals (Sweden)

    M. J. A. Bolzan

    2013-01-01

    Full Text Available This paper analyses the multifractal aspects of the GPS data (measured during a period of low solar activity obtained from two Brazilian stations: Belém (01.3° S, 48.3° W and São José dos Campos (SJC (23.2° S, 45.9° W. The results show that the respective geographic sites show important scaling differences as well as similarities when their multifractal signatures for vertical total electron content (VTEC are compared. The f(α spectra have a narrow shape for great scales, which indicates the predominance of deterministic phenomena, such as solar rotation (27 days over intermittent phenomena. Furthermore, the f(α spectra for both sites have a strong multifractality degree at small scales. This strong multifractality degree observed at small scales (1 to 12 h at both sites is because the ionosphere over Brazil is a non-equilibrium system. The differences found were that Belém presented a stronger multifractality at small scales (1 h to 12 h compared with SJC, particularly in 2006. The reason for this behaviour may be associated with the location of Belém, near the geomagnetic equator, where at this location the actions of X-rays, ultraviolet, and another wavelength from the Sun are more direct, strong, and constant throughout the whole year. Although the SJC site is near ionospheric equatorial anomaly (IEA peaks, this interpretation could explain the higher values found for the intermittent parameter μ for Belém compared with SJC. Belém also showed the presence of one or two flattening regions for f(α spectra at the same scales mentioned before. These differences and similarities also were interpreted in terms of the IEA content, where this phenomenon is an important source of intermittence due the presence of the VTEC peaks at ±20° geomagnetic latitudes.

  9. A gene-based high-resolution comparative radiation hybrid map as a framework for genome sequence assembly of a bovine chromosome 6 region associated with QTL for growth, body composition, and milk performance traits

    Directory of Open Access Journals (Sweden)

    Laurent Pascal

    2006-03-01

    Full Text Available Abstract Background A number of different quantitative trait loci (QTL for various phenotypic traits, including milk production, functional, and conformation traits in dairy cattle as well as growth and body composition traits in meat cattle, have been mapped consistently in the middle region of bovine chromosome 6 (BTA6. Dense genetic and physical maps and, ultimately, a fully annotated genome sequence as well as their mutual connections are required to efficiently identify genes and gene variants responsible for genetic variation of phenotypic traits. A comprehensive high-resolution gene-rich map linking densely spaced bovine markers and genes to the annotated human genome sequence is required as a framework to facilitate this approach for the region on BTA6 carrying the QTL. Results Therefore, we constructed a high-resolution radiation hybrid (RH map for the QTL containing chromosomal region of BTA6. This new RH map with a total of 234 loci including 115 genes and ESTs displays a substantial increase in loci density compared to existing physical BTA6 maps. Screening the available bovine genome sequence resources, a total of 73 loci could be assigned to sequence contigs, which were already identified as specific for BTA6. For 43 loci, corresponding sequence contigs, which were not yet placed on the bovine genome assembly, were identified. In addition, the improved potential of this high-resolution RH map for BTA6 with respect to comparative mapping was demonstrated. Mapping a large number of genes on BTA6 and cross-referencing them with map locations in corresponding syntenic multi-species chromosome segments (human, mouse, rat, dog, chicken achieved a refined accurate alignment of conserved segments and evolutionary breakpoints across the species included. Conclusion The gene-anchored high-resolution RH map (1 locus/300 kb for the targeted region of BTA6 presented here will provide a valuable platform to guide high-quality assembling and

  10. Effect of cooler electrons on a compressive ion acoustic solitary wave in a warm ion plasma — Forbidden regions, double layers, and supersolitons

    International Nuclear Information System (INIS)

    Ghosh, S. S.; Sekar Iyengar, A. N.

    2014-01-01

    It is observed that the presence of a minority component of cooler electrons in a three component plasma plays a deterministic role in the evolution of solitary waves, double layers, or the newly discovered structures called supersolitons. The inclusion of the cooler component of electrons in a single electron plasma produces sharp increase in nonlinearity in spite of a decrease in the overall energy of the system. The effect maximizes at certain critical value of the number density of the cooler component (typically 15%–20%) giving rise to a hump in the amplitude variation profile. For larger amplitudes, the hump leads to a forbidden region in the ambient cooler electron concentration which dissociates the overall existence domain of solitary wave solutions in two distinct parameter regime. It is observed that an inclusion of the cooler component of electrons as low as < 1% affects the plasma system significantly resulting in compressive double layers. The solution is further affected by the cold to hot electron temperature ratio. In an adequately hotter bulk plasma (i.e., moderately low cold to hot electron temperature ratio), the parameter domain of compressive double layers is bounded by a sharp discontinuity in the corresponding amplitude variation profile which may lead to supersolitons

  11. Effect of cooler electrons on a compressive ion acoustic solitary wave in a warm ion plasma — Forbidden regions, double layers, and supersolitons

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, S. S., E-mail: sukti@iigs.iigm.res.in [Indian Institute of Geomagnetism, New Panvel, Navi Mumbai 410218 (India); Sekar Iyengar, A. N. [Plasma Physics Division, Saha Institute of Nuclear Physics, Kolkata 700064 (India)

    2014-08-15

    It is observed that the presence of a minority component of cooler electrons in a three component plasma plays a deterministic role in the evolution of solitary waves, double layers, or the newly discovered structures called supersolitons. The inclusion of the cooler component of electrons in a single electron plasma produces sharp increase in nonlinearity in spite of a decrease in the overall energy of the system. The effect maximizes at certain critical value of the number density of the cooler component (typically 15%–20%) giving rise to a hump in the amplitude variation profile. For larger amplitudes, the hump leads to a forbidden region in the ambient cooler electron concentration which dissociates the overall existence domain of solitary wave solutions in two distinct parameter regime. It is observed that an inclusion of the cooler component of electrons as low as < 1% affects the plasma system significantly resulting in compressive double layers. The solution is further affected by the cold to hot electron temperature ratio. In an adequately hotter bulk plasma (i.e., moderately low cold to hot electron temperature ratio), the parameter domain of compressive double layers is bounded by a sharp discontinuity in the corresponding amplitude variation profile which may lead to supersolitons.

  12. Whole genome sequencing and assembly of Eukaryotic microbes isolated from ISS environmental surface Kirovograd region soil Chernobyl Nuclear Power Plant and Chernobyl Exclusion Zone

    Data.gov (United States)

    National Aeronautics and Space Administration — The whole-genome sequences of eight fungal strains that were selected for exposure to microgravity at the International Space Station are presented here. These...

  13. Distribution of Campylobacter jejuni isolates from turkey farms and different stages at slaughter using pulsed-field gel electrophoresis and flaA-short variable region sequencing.

    Science.gov (United States)

    Perko-Mäkelä, P; Alter, T; Isohanni, P; Zimmermann, S; Lyhs, U

    2011-09-01

    The aim of this study was to assess the diversity of thermotolerant Campylobacter spp. isolated from turkey flocks at six rearing farms 1-2 weeks prior to slaughter (360 faecal swab samples) and from 11 different stages at the slaughterhouse (636 caecal, environmental, neck skin and meat samples). A total of 121 Campylobacter isolates were identified to species level using a multiplex PCR assay and were typed by pulsed-field gel electrophoresis (PFGE) and flaA-short variable region (SVR) sequencing. All Campylobacter isolates were identified as Campylobacter jejuni. PFGE analysis with KpnI restriction enzyme resulted in 11 PFGE types (I-XI) and flaA SVR typing yielded in nine flaA-SVR alleles. The Campylobacter-positive turkey flocks A, C and E were colonized by a limited number of Campylobacter clones at the farm and slaughter. The present study confirms the traceability of flock-specific strains (PFGE types I, V and IX; flaA types 21, 36 and 161) from the farm along the entire processing line to meat cuts. It seems that stress factors such as high temperature of the defeathering water (54-56 °C), drying of the carcass skin during air chilling (24 h at 2 °C), and oxygen in the air could not eliminate Campylobacter completely. Campylobacter-negative flocks became contaminated during processing by the same subtypes of Campylobacter introduced into the slaughter house by preceeding positive flocks even if they were slaughtered on subsequent days. Proper and efficient cleaning and disinfection of slaughter and processing premises are needed to avoid cross-contamination, especially in countries with a low prevalence of Campylobacter spp. The majority of flaA SVR alleles displayed a distinct association with a specific PFGE type. However, a linear relationship for all strains among both typing methods could not be established. To specify genetic relatedness of strains, a combination of different genotyping methods, is needed. © 2011 Blackwell Verlag GmbH.

  14. Development of a Geomagnetic Storm Correction to the International Reference Ionosphere E-Region Electron Densities Using TIMED/SABER Observations

    Science.gov (United States)

    Mertens, C. J.; Xu, X.; Fernandez, J. R.; Bilitza, D.; Russell, J. M., III; Mlynczak, M. G.

    2009-01-01

    Auroral infrared emission observed from the TIMED/SABER broadband 4.3 micron channel is used to develop an empirical geomagnetic storm correction to the International Reference Ionosphere (IRI) E-region electron densities. The observation-based proxy used to develop the storm model is SABER-derived NO+(v) 4.3 micron volume emission rates (VER). A correction factor is defined as the ratio of storm-time NO+(v) 4.3 micron VER to a quiet-time climatological averaged NO+(v) 4.3 micron VER, which is linearly fit to available geomagnetic activity indices. The initial version of the E-region storm model, called STORM-E, is most applicable within the auroral oval region. The STORM-E predictions of E-region electron densities are compared to incoherent scatter radar electron density measurements during the Halloween 2003 storm events. Future STORM-E updates will extend the model outside the auroral oval.

  15. Phenomena induced by powerful HF pumping towards magnetic zenith with a frequency near the F-region critical frequency and the third electron gyro harmonic frequency

    Directory of Open Access Journals (Sweden)

    N. F. Blagoveshchenskaya

    2009-01-01

    Full Text Available Multi-instrument observational data from an experiment on 13 October 2006 at the EISCAT/HEATING facility at Tromsø, Norway are analysed. The experiment was carried out in the evening hours when the electron density in the F-region dropped, and the HF pump frequency fH was near and then above the critical frequency of the F2 layer. The distinctive feature of this experiment is that the pump frequency was just below the third electron gyro harmonic frequency, while both the HF pump beam and UHF radar beam were directed towards the magnetic zenith (MZ. The HF pump-induced phenomena were diagnosed with several instruments: the bi-static HF radio scatter on the London-Tromsø-St. Petersburg path, the CUTLASS radar in Hankasalmi (Finland, the European Incoherent Scatter (EISCAT UHF radar at Tromsø and the Tromsø ionosonde (dynasonde. The results show thermal electron excitation of the HF-induced striations seen simultaneously from HF bi-static scatter and CUTLASS radar observations, accompanied by increases of electron temperature when the heater frequency was near and then above the critical frequency of the F2 layer by up to 0.4 MHz. An increase of the electron density up to 25% accompanied by strong HF-induced electron heating was observed, only when the heater frequency was near the critical frequency and just below the third electron gyro harmonic frequency. It is concluded that the combined effect of upper hybrid resonance and gyro resonance at the same altitude gives rise to strong electron heating, the excitation of striations, HF ray trapping and extension of HF waves to altitudes where they can excite Langmuir turbulence and fluxes of electrons accelerated to energies that produce ionization.

  16. Phenomena induced by powerful HF pumping towards magnetic zenith with a frequency near the F-region critical frequency and the third electron gyro harmonic frequency

    Directory of Open Access Journals (Sweden)

    N. F. Blagoveshchenskaya

    2009-01-01

    Full Text Available Multi-instrument observational data from an experiment on 13 October 2006 at the EISCAT/HEATING facility at Tromsø, Norway are analysed. The experiment was carried out in the evening hours when the electron density in the F-region dropped, and the HF pump frequency fH was near and then above the critical frequency of the F2 layer. The distinctive feature of this experiment is that the pump frequency was just below the third electron gyro harmonic frequency, while both the HF pump beam and UHF radar beam were directed towards the magnetic zenith (MZ. The HF pump-induced phenomena were diagnosed with several instruments: the bi-static HF radio scatter on the London-Tromsø-St. Petersburg path, the CUTLASS radar in Hankasalmi (Finland, the European Incoherent Scatter (EISCAT UHF radar at Tromsø and the Tromsø ionosonde (dynasonde. The results show thermal electron excitation of the HF-induced striations seen simultaneously from HF bi-static scatter and CUTLASS radar observations, accompanied by increases of electron temperature when the heater frequency was near and then above the critical frequency of the F2 layer by up to 0.4 MHz. An increase of the electron density up to 25% accompanied by strong HF-induced electron heating was observed, only when the heater frequency was near the critical frequency and just below the third electron gyro harmonic frequency. It is concluded that the combined effect of upper hybrid resonance and gyro resonance at the same altitude gives rise to strong electron heating, the excitation of striations, HF ray trapping and extension of HF waves to altitudes where they can excite Langmuir turbulence and fluxes of electrons accelerated to energies that produce ionization.

  17. Structural region

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Structural region. The two groups had 4 substitutions similar to Yawat strain. The Yawat strain had 5 unique mutations. 3 in the E2 region and 2 in the E1 region. The mutation, I702V (E2), though different from all the recent Indian and Reunion sequences was similar ...

  18. Sequence analysis of the MYC oncogene involved in the t(8;14)(q24;q11) chromosome translocation in a human leukemia T-cell line indicates that putative regulatory regions are not altered

    International Nuclear Information System (INIS)

    Finver, S.N.; Nishikura, K.; Finger, L.R.; Haluska, F.G.; Finan, J.; Nowell, P.C.; Croce, C.M.

    1988-01-01

    The authors cloned the translocation-associated and homologous normal MYC alleles from SKW-3, a leukemia T-cell line with the t(8; 14)(q24; q11) translocation, and determined the sequence of the MYC oncogene first exon and flanking 5' putative regulatory regions. S1 nuclease protection experiments utilizing a MYC first exon probe demonstrated transcriptional deregulation of the MYC gene associated with the T-cell receptor α locus on the 8q + chromosome of SKW-3 cells. Nucleotide sequence analysis of the translocation-associated (8q +) MYC allele identified a single base substitution within the upstream flanking region; the homologous nontranslocated allele contained an additional substitution and a two-base deletion. None of the deletions or substitutions localized to putative 5' regulatory regions. The MYC first exon sequence was germ line in both alleles. These results demonstrate that alterations within the putative 5' MYC regulatory regions are not necessarily involved in MYC deregulation in T-cell leukemias, and they show that juxtaposition of the T-cell receptor α locus to a germ-line MYC oncogene results in MYC deregulation

  19. Distributions of /sup 35/S-sulfate and /sup 3/H-glucosamine in the angular region of the hamster: light and electron microscopic autoradiography

    Energy Technology Data Exchange (ETDEWEB)

    Ohnishi, Y.; Taniguchi, Y.

    1983-06-01

    The distribution of /sup 35/S-sulfate and /sup 3/H-glucosamine in the angular region of the hamster was studied by light and electron microscopic autoradiography following intraperitoneal injection of these compounds to hamsters. Exposed silver grains of /sup 35/S-sulfate were concentrated in the trabecular meshwork, sclera, and cornea, and grains of /sup 3/H-glucosamine were localized in the trabecular region. The radioactivity of both isotopes was observed in the Golgi apparatuses of the endothelial cells of the angular aqueous plexus and the trabecular meshwork. The grains were noted over the entire cytoplasm, except for the nucleus, and then were incorporated into the amorphous substance and collagen fibers in the region adjacent to the angular aqueous sinus. These results suggest that endothelial cells in the angular region synthesize and secrete the sulfated glycosaminoglycans and hyaluronic acid.

  20. Distributions of 35S-sulfate and 3H-glucosamine in the angular region of the hamster: light and electron microscopic autoradiography

    International Nuclear Information System (INIS)

    Ohnishi, Y.; Taniguchi, Y.

    1983-01-01

    The distribution of 35 S-sulfate and 3 H-glucosamine in the angular region of the hamster was studied by light and electron microscopic autoradiography following intraperitoneal injection of these compounds to hamsters. Exposed silver grains of 35 S-sulfate were concentrated in the trabecular meshwork, sclera, and cornea, and grains of 3 H-glucosamine were localized in the trabecular region. The radioactivity of both isotopes was observed in the Golgi apparatuses of the endothelial cells of the angular aqueous plexus and the trabecular meshwork. The grains were noted over the entire cytoplasm, except for the nucleus, and then were incorporated into the amorphous substance and collagen fibers in the region adjacent to the angular aqueous sinus. These results suggest that endothelial cells in the angular region synthesize and secrete the sulfated glycosaminoglycans and hyaluronic acid

  1. Keragaman Spesies Ikan Tuna di Pasar Ikan Kedonganan Bali dengan Analisis Sekuen Kontrol Daerah Mitokondria DNA (SPECIES DIVERSITY OF TUNA FISH USING MITOCHONDRIAL DNA CONTROL REGION SEQUENCE ANALYSIS AT KEDONGANAN FISH MARKET

    Directory of Open Access Journals (Sweden)

    Daud Steven Triyomi Hariyanto

    2015-10-01

    Full Text Available Tuna is an export commodity which has very high economic value. However, some tuna speciesare threatened with extinction. The purpose of this study was to identify the tuna species that aresold in Kedonganan Fish Market. The research method was polymerase chain reaction technique(PCR using the marker sequence mitochondrial DNA control region. Samples were obtained fromthe Fish Market tuna Kedonganan, Kuta, Badung, Bali. The total number of samples are 28specimens. Sequence from each sample was obtained through sequencing techniques. Sequencesobtained were run in BLAST (Basic Local Alignment Search Tool and subsequently analyzed withMEGA 5 for species confirmation. Three species of tuna that are identified in the Kedonganan FishMarket is: Thunnus albacares, T. obesus, and Katsuwonus pelamis. All three species have highgenetic variation HD = 1. This study needed to be continued with more number of samples todetermine the species of tuna sold in Kedonganan Fish Market.

  2. Complete genome sequence of a Chinese isolate of pepper vein yellows virus and evolutionary analysis based on the CP, MP and RdRp coding regions.

    Science.gov (United States)

    Liu, Maoyan; Liu, Xiangning; Li, Xun; Zhang, Deyong; Dai, Liangyin; Tang, Qianjun

    2016-03-01

    The genome sequence of pepper vein yellows virus (PeVYV) (PeVYV-HN, accession number KP326573), isolated from pepper plants (Capsicum annuum L.) grown at the Hunan Vegetables Institute (Changsha, Hunan, China), was determined by deep sequencing of small RNAs. The PeVYV-HN genome consists of 6244 nucleotides, contains six open reading frames (ORFs), and is similar to that of an isolate (AB594828) from Japan. Its genomic organization is similar to that of members of the genus Polerovirus. Sequence analysis revealed that PeVYV-HN shared 92% sequence identity with the Japanese PeVYV genome at both the nucleotide and amino acid levels. Evolutionary analysis based on the coat protein (CP), movement protein (MP), and RNA-dependent RNA polymerase (RdRP) showed that PeVYV could be divided into two major lineages corresponding to their geographical origins. The Asian isolates have a higher population expansion frequency than the African isolates. Negative selection and genetic drift (founder effect) were found to be the potential drivers of the molecular evolution of PeVYV. Moreover, recombination was not the distinct cause of PeVYV evolution. This is the first report of a complete genomic sequence of PeVYV in China.

  3. An AU-rich element in the 3{prime} untranslated region of the spinach chloroplast petD gene participates in sequence-specific RNA-protein complex formation

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Qiuyun; Adams, C.C.; Usack, L. [Cornell Univ., Ithaca, NY (United States)] [and others

    1995-04-01

    In chloroplasts, the 3{prime} untranslated regions of most mRNAs contain a stem-loop-forming inverted repeat (IR) sequence that is required for mRNA stability and correct 3{prime}-end formation. The IR regions of several mRNAs are also known to bind chloroplast proteins, as judged from in vitro gel mobility shift and UV cross-linking assays, and these RNA-protein interactions may be involved in the regulation of chloroplast mRNA processing and/or stability. Here we describe in detail the RNA and protein components that are involved in 3{prime} IR-containing RNA (3{prime} IR-RNA)-protein complex formation for the spinach chloroplast petD gene, which encodes subunit IV of the cytochrome b{sub 6}/f complex. We show that the complex contains 55-, 41-, and 29-kDa RNA-binding proteins (ribonucleoproteins [RNPs]). These proteins together protect a 90-nucleotide segment of RNA from RNase T{sub 1} digestion; this RNA contains the IR and downstream flanking sequences. Competition experiments using 3{prime} IR-RNAs from the psbA or rbcL gene demonstrate that the RNPs have a strong specificity for the petD sequence. Site-directed mutagenesis was carried out to define the RNA sequence elements required for complex formation. These studies identified an 8-nucleotide AU-rich sequence downstream of the IR; mutations within this sequence had moderate to severe effects on RNA-protein complex formation. Although other similar sequences are present in the petD 3{prime} untranslated region, only a single copy, which we have termed box II, appears to be essential for in vivo protein binding. In addition, the IR itself is necessary for optimal complex formation. These two sequence elements together with an RNP complex may direct correct 3{prime}-end processing and/or influence the stability of petD mRNA in chloroplasts. 48 refs., 9 figs., 2 tabs.

  4. Numerical simulation of electron-beam-induced current near a silicon grain boundary and impact of a p-n junction space charge region

    Energy Technology Data Exchange (ETDEWEB)

    Corkish, R.; Altermatt, P.P.; Heiser, G. [Photovoltaics Special Research Centre, University of New South Wales, 2052 Sydney (Australia)

    2001-01-01

    Three-dimensional numerical simulations of electron-beam-induced current (EBIC) near a vertical silicon grain boundary are demonstrated. They are compared with an analytical model which excludes the effect of carrier generation other than in the bulk base region of a solar cell structure. We demonstrate that in a wide range of solar cell structures recombination in the space charge region (SCR) significantly affects the EBIC results and hence needs to be included in the data evaluation. Apart from these findings, simulations of a realistic silicon solar cell structure (thick emitter, field-dependent mobility, etc.) are demonstrated.

  5. Localization of Daucus carota NMCP1 to the nuclear periphery: the role of the N-terminal region and an NLS-linked sequence motif, RYNLRR, in the tail domain

    Directory of Open Access Journals (Sweden)

    Yuta eKimura

    2014-02-01

    Full Text Available Recent ultrastructural studies revealed that a structure similar to the vertebrate nuclear lamina exists in the nuclei of higher plants. However, plant genomes lack genes for lamins and intermediate-type filament proteins, and this suggests that plant-specific nuclear coiled-coil proteins make up the lamina-like structure in plants. NMCP1 is a protein, first identified in Daucus carota cells, that localizes exclusively to the nuclear periphery in interphase cells. It has a tripartite structure comprised of head, rod, and tail domains, and includes putative nuclear localization signal (NLS motifs. We identified the functional NLS of DcNMCP1 (carrot NMCP1 and determined the protein regions required for localizing to the nuclear periphery using EGFP-fused constructs transiently expressed in Apium graveolens epidermal cells. Transcription was driven under a CaMV35S promoter, and the genes were introduced into the epidermal cells by a DNA-coated microprojectile delivery system. Of the NLS motifs, KRRRK and RRHK in the tail domain were highly functional for nuclear localization. Addition of the N-terminal 141 amino acids from DcNMCP1 shifted the localization of a region including these NLSs from the entire nucleus to the nuclear periphery. Using this same construct, the replacement of amino acids in RRHK or its preceding sequence, YNL, with alanine residues abolished localization to the nuclear periphery, while replacement of KRRRK did not affect localization. The sequence R/Q/HYNLRR/H, including YNL and the first part of the sequence of RRHK, is evolutionarily conserved in a subclass of NMCP1 sequences from many plant species. These results show that NMCP1 localizes to the nuclear periphery by a combined action of a sequence composed of R/Q/HYNLRR/H, NLS, and the N-terminal region including the head and a portion of the rod domain, suggesting that more than one binding site is implicated in localization of NMCP1.

  6. Complete nucleotide sequence and genome structure of a Japanese isolate of hibiscus latent Fort Pierce virus, a unique tobamovirus that contains an internal poly(A) region in its 3' end.

    Science.gov (United States)

    Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

    2014-11-01

    In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.

  7. Defining Electron Bifurcation in the Electron-Transferring Flavoprotein Family.

    Science.gov (United States)

    Garcia Costas, Amaya M; Poudel, Saroj; Miller, Anne-Frances; Schut, Gerrit J; Ledbetter, Rhesa N; Fixen, Kathryn R; Seefeldt, Lance C; Adams, Michael W W; Harwood, Caroline S; Boyd, Eric S; Peters, John W

    2017-11-01

    Electron bifurcation is the coupling of exergonic and endergonic redox reactions to simultaneously generate (or utilize) low- and high-potential electrons. It is the third recognized form of energy conservation in biology and was recently described for select electron-transferring flavoproteins (Etfs). Etfs are flavin-containing heterodimers best known for donating electrons derived from fatty acid and amino acid oxidation to an electron transfer respiratory chain via Etf-quinone oxidoreductase. Canonical examples contain a flavin adenine dinucleotide (FAD) that is involved in electron transfer, as well as a non-redox-active AMP. However, Etfs demonstrated to bifurcate electrons contain a second FAD in place of the AMP. To expand our understanding of the functional variety and metabolic significance of Etfs and to identify amino acid sequence motifs that potentially enable electron bifurcation, we compiled 1,314 Etf protein sequences from genome sequence databases and subjected them to informatic and structural analyses. Etfs were identified in diverse archaea and bacteria, and they clustered into five distinct well-supported groups, based on their amino acid sequences. Gene neighborhood analyses indicated that these Etf group designations largely correspond to putative differences in functionality. Etfs with the demonstrated ability to bifurcate were found to form one group, suggesting that distinct conserved amino acid sequence motifs enable this capability. Indeed, structural modeling and sequence alignments revealed that identifying residues occur in the NADH- and FAD-binding regions of bifurcating Etfs. Collectively, a new classification scheme for Etf proteins that delineates putative bifurcating versus nonbifurcating members is presented and suggests that Etf-mediated bifurcation is associated with surprisingly diverse enzymes. IMPORTANCE Electron bifurcation has recently been recognized as an electron transfer mechanism used by microorganisms to maximize

  8. Characteristics of Pitch Angle Distributions of 100s Kev Electrons in the Slot Region and Inner Radiation Belt­­­­­­­­

    Science.gov (United States)

    Zhao, H.; Li, X.; Blake, J. B.; Fennell, J.; Claudepierre, S. G.; Baker, D. N.; Jaynes, A. N.; Malaspina, D.

    2014-12-01

    The pitch angle distribution (PAD) of energetic electrons in the slot region and inner radiation belt received little attention in the past decades due to the lack of quality measurements. Using the state-of-art pitch-angle-resolved data from the Magnetic Electron Ion Spectrometer (MagEIS) instrument onboard the Van Allen Probes, a detailed analysis of 100s keV electron PADs below L =4 is performed, in which the PADs is categorized into three types: normal (flux peaking at 90°), cap (exceedingly peaking narrowly around 90°) and 90°-minimum (lower flux at 90°) PADs. By examining the characteristics of the PADs of 460 keV electrons for over a year, we find that the 90°-minimum PADs are generally present in the inner belt (Lpitch angle scattering of hiss waves. Fitting the normal PADs into sinnα form, the parameter n is much higher below L=3 than that in the outer belt and relatively constant in the inner belt but changes significantly in the slot region (2mechanism can hardly explain the formation of 90°-minimum PADs at the center of inner belt. These new and compelling observations, made possible by the high-quality measurements of MagEIS, present a challenge for the wave modelers, and future work is still needed to fully understand them.

  9. Study of energetic electrons in the outer radiation-belt regions using data obtained by the LLL spectrometer on OGO-5 in 1968

    International Nuclear Information System (INIS)

    West, H.I. Jr.; Buck, R.M.; Davidson, G.

    1979-01-01

    An account is given of measurements of electrons made by the LLL magnetic electron spectrometer (60 to 3000 keV in seven differential energy channels) on the Ogo-5 satellite in the earth's outer-belt regions during 1968 and early 1969. The data were analyzed specifically to determine pitch-angle diffusion lifetimes as a function of energy in the L-range 2 to 5. As a part of this effort, the general dynamics of these regions were studied in terms of the time-dependent energy spectra, and pitch-angle distributions for the seven energy groups were obtained as a function of L with representative values presented for L = 2.5 to 6. The pitch-angle-diffusion results were used to analyze the dynamics of the electrons injected following the intense storms on October 31 and November 1, 1968, in terms of radial diffusion; the derived diffusion coefficients provide a quite reasonable picture of electron transport in the radiation belts. Both the radial- and pitch-angle-diffusion results are compared with earlier results. 53 references

  10. Ambient-temperature diffusion and gettering of Pt atoms in GaN with surface defect region under 60Co gamma or MeV electron irradiation

    Science.gov (United States)

    Hou, Ruixiang; Li, Lei; Fang, Xin; Xie, Ziang; Li, Shuti; Song, Weidong; Huang, Rong; Zhang, Jicai; Huang, Zengli; Li, Qiangjie; Xu, Wanjing; Fu, Engang; Qin, G. G.

    2018-01-01

    Generally, the diffusion and gettering of impurities in GaN needs high temperature. Calculated with the ambient-temperature extrapolation value of the high temperature diffusivity of Pt atoms in GaN reported in literature, the time required for Pt atoms diffusing 1 nm in GaN at ambient temperature is about 19 years. Therefore, the ambient-temperature diffusion and gettering of Pt atoms in GaN can hardly be observed. In this work, the ambient-temperature diffusion and gettering of Pt atoms in GaN is reported for the first time. It is demonstrated by use of secondary ion mass spectroscopy that in the condition of introducing a defect region on the GaN film surface by plasma, and subsequently, irradiated by 60Co gamma-ray or 3 MeV electrons, the ambient-temperature diffusion and gettering of Pt atoms in GaN can be detected. It is more obvious with larger irradiation dose and higher plasma power. With a similar surface defect region, the ambient-temperature diffusion and gettering of Pt atoms in GaN stimulated by 3 MeV electron irradiation is more marked than that stimulated by gamma irradiation. The physical mechanism of ambient-temperature diffusion and gettering of Pt atoms in a GaN film with a surface defect region stimulated by gamma or MeV electron irradiation is discussed.

  11. Nucleotide sequences of the cDNAs encoding the V-regions of H- and L-chains of a human monoclonal antibody with broad reactivity to malignant tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Kishimoto, Toshimitsu; Okajima, Hideki; Okumoto, Takeki [Yoshitomi Pharmaceutical Industries, Ltd., Saitama (Japan); Taniguchi, Masaru [Chiba Univ. (Japan)

    1989-06-12

    The human monoclonal antibody secreted from 4G12 hybridoma cells has broad reactivity to malignant tumor cells, especially for lung squamous cell carcinomas, and recognizes a new tumor-associated and differentiation antigen. The antigen detected by 4G12 is a glycoprotein with MW 195,000 and MW 65,000 under nonreducing and reducing conditions, respectively. Screening of a 4G12 {lambda}gt10 cDNA library with constant region probes for human immunoglobulin yielded full length clones for H- and L-chains. Nucleotide sequences revealed that subtypes of the variable regions were V{sub HIII} and {lambda}{sub 1}, respectively.

  12. Length and nucleotide sequence polymorphism at the trnL and trnF non-coding regions of chloroplast genomes among Saccharum and Erianthus species

    Science.gov (United States)

    The aneupolyploidy genome of sugarcane (Saccharum hybrids spp.) and lack of a classical genetic linkage map make genetics research most difficult for sugarcane. Whole genome sequencing and genetic characterization of sugarcane and related taxa are far behind other crops. In this study, universal PCR...

  13. Comparison of the Sequences of the Internal Transcribed Spacer Regions and PbGP43 Genes of Paracoccidioides brasiliensis from Patients and Armadillos (Dasypus novemcinctus)

    Science.gov (United States)

    Hebeler-Barbosa, Flavia; Morais, Flavia V.; Montenegro, Mario R.; Kuramae, Eiko E.; Montes, Beatriz; McEwen, Juan G.; Bagagli, Eduardo; Puccia, Rosana

    2003-01-01

    Paracoccidioides brasiliensis isolates from 10 nine-banded armadillos (Dasypus novemcinctus) were comparable with 19 clinical isolates by sequence analysis of the PbGP43 gene and ribosomal internal transcribed spacer 1 (ITS1) and ITS2 and by random amplified polymorphic DNA. In this original ITS study, eight isolates differed by one or three sites among five total substitution sites. PMID:14662970

  14. Draft genome sequences of Escherichia coli O113:H21 strains recovered from a major produce-production region in California

    Science.gov (United States)

    Shiga toxin-producing Escherichia coli is a foodborne and waterborne pathogen and is responsible for outbreaks of human gastroenteritis. This report documents the draft genome sequences of seven O113:H21 strains recovered from livestock, wildlife, and soil samples collected in a major agricultural r...

  15. Microfacies, Depositional environment and Sequence Stratigraphy of Upper Carboniferous- Lower Permian rocks from Ozbak-Kuh region (Zaladou Section, East Central Iran

    Directory of Open Access Journals (Sweden)

    Ali Ahmadi

    2016-01-01

    Full Text Available Zaladou section is located in Ozbak-Kuh mountains in the nourthen part of Tabas block and consist of shale, limy sandstone, limestone and dolomite. Continous relationship of Upper Carboniferous and Lower Permian deposits, is quite evident in Zaladou section. The lower boundry of this section is located on the Absheni formation of Sardar Group with disconformity surface, and upper boundry’s is covered by disconformity surface and bauxite horizon of Bagh-e-Vang formation. According to the lithological Characters and microscopic studies, tidal flat, lagoon, bar, tidal inlet and open marine sub-environment are identified for Zaladou section. Results of this study show that Zaladou section was deposited in silisiclastic-carbonate mix homoclinal ramp in late Carboniferous and in carbonate homoclinal ramp in early Permian. Field study, microfacies and analysis through the sequence led to recognition of main sequence surface, such as: sequence boundry, maximum flooding surface, marine flooding surface, system tracts and two depositional sequences.