THE 'MAIN SEQUENCE' OF EXPLOSIVE SOLAR ACTIVE REGIONS: DISCOVERY AND INTERPRETATION

International Nuclear Information System (INIS)

Falconer, David A.; Moore, Ronald L.; Adams, Mitzi; Gary, G. Allen

2009-01-01

We examine the location and distribution of the production of coronal mass ejections (CMEs) and major flares by sunspot active regions in the phase space of two whole-active-region magnetic quantities measured from 1897 SOHO/MDI magnetograms. These magnetograms track the evolution of 44 active regions across the central disk of radius 0.5 R Sun . The two quantities are L WL SG , a gauge of the total free energy in an active region's magnetic field, and L Φ, a measure of the active region's total magnetic flux. From these data and each active region's history of production of CMEs, X flares, and M flares, we find (1) that CME/flare-productive active regions are concentrated in a straight-line 'main sequence' in (log L WL SG , log L Φ) space, (2) that main-sequence active regions have nearly their maximum attainable free magnetic energy, and (3) evidence that this arrangement plausibly results from equilibrium between input of free energy to an explosive active region's magnetic field in the chromosphere and corona by contortion of the field via convection in and below the photosphere and loss of free energy via CMEs, flares, and coronal heating, an equilibrium between energy gain and loss that is analogous to that of the main sequence of hydrogen-burning stars in (mass, luminosity) space.

Wakefield excitation in plasma resonator by a sequence of relativistic electron bunches

International Nuclear Information System (INIS)

Kiselev, V.A.; Linnik, A.F.; Mirny, V.I.; Onishchenko, I.N.; Uskov, V.V.

2008-01-01

Wakefield excitation in a plasma resonator by a sequence of relativistic electron bunches with the purpose to increase excited field amplitude in comparison to waveguide case is experimentally investigated. A sequence of short electron bunches is produced by the linear resonant accelerator. Plasma resonator is formed at the beam-plasma discharge in rectangular metal waveguide filled with gas and closed by metal foil at entrance and movable short-circuited plunger at exit. Measurements of wakefield amplitude are performed showing considerably higher wakefield amplitude for resonator case

Protein sequences and redox titrations indicate that the electron acceptors in reaction centers from heliobacteria are similar to Photosystem I

Science.gov (United States)

Trost, J. T.; Brune, D. C.; Blankenship, R. E.

1992-01-01

Photosynthetic reaction centers isolated from Heliobacillus mobilis exhibit a single major protein on SDS-PAGE of 47 000 Mr. Attempts to sequence the reaction center polypeptide indicated that the N-terminus is blocked. After enzymatic and chemical cleavage, four peptide fragments were sequenced from the Heliobacillus mobilis apoprotein. Only one of these sequences showed significant specific similarity to any of the protein and deduced protein sequences in the GenBank data base. This fragment is identical with 56% of the residues, including both cysteines, found in highly conserved region that is proposed to bind iron-sulfur center Fx in the Photosystem I reaction center peptide that is the psaB gene product. The similarity to the psaA gene product in this region is 48%. Redox titrations of laser-flash-induced photobleaching with millisecond decay kinetics on isolated reaction centers from Heliobacterium gestii indicate a midpoint potential of -414 mV with n = 2 titration behavior. In membranes, the behavior is intermediate between n = 1 and n = 2, and the apparent midpoint potential is -444 mV. This is compared to the behavior in Photosystem I, where the intermediate electron acceptor A1, thought to be a phylloquinone molecule, has been proposed to undergo a double reduction at low redox potentials in the presence of viologen redox mediators. These results strongly suggest that the acceptor side electron transfer system in reaction centers from heliobacteria is indeed analogous to that found in Photosystem I. The sequence similarities indicate that the divergence of the heliobacteria from the Photosystem I line occurred before the gene duplication and subsequent divergence that lead to the heterodimeric protein core of the Photosystem I reaction center.

Synchronization and sequencing of data acquisition and control electronics at the European X-ray free electron laser

International Nuclear Information System (INIS)

Gessler, Patrick

2015-11-01

The 3.5 km long European X-Ray Free Electron Laser, currently under construction in northern Germany, will deliver bursts of up to 2700 short X-ray pulses every 100 ms, providing wavelengths between 0.05 and 6 nm, and a repetition rate of 4.5 MHz to several experiment stations. It allows in-depth research in various scientific fields. In order to set-up the beam, position samples and capture the measured variables, information from the accelerator, diagnostic devices and detectors have to be digitized, converted, processed, transferred, concentrated, distributed, reorganized, controlled and saved. All these steps have to be accurately synchronized and sequenced relative to the actual electron bunch or photon pulse in order to guarantee correct data acquisition timings and unique identification of each bunch passing the beamlines. This document provides a complete description of the planning, design, realization and evaluation of the European XFEL Timing System, which implements the synchronization and sequencing of the data acquisition and control electronics for the European X-Ray Free-Electron Laser Facility.

Genome-Based Identification of Active Prophage Regions by Next Generation Sequencing in Bacillus licheniformis DSM13

Science.gov (United States)

Hertel, Robert; Rodríguez, David Pintor; Hollensteiner, Jacqueline; Dietrich, Sascha; Leimbach, Andreas; Hoppert, Michael; Liesegang, Heiko; Volland, Sonja

2015-01-01

Prophages are viruses, which have integrated their genomes into the genome of a bacterial host. The status of the prophage genome can vary from fully intact with the potential to form infective particles to a remnant state where only a few phage genes persist. Prophages have impact on the properties of their host and are therefore of great interest for genomic research and strain design. Here we present a genome- and next generation sequencing (NGS)-based approach for identification and activity evaluation of prophage regions. Seven prophage or prophage-like regions were identified in the genome of Bacillus licheniformis DSM13. Six of these regions show similarity to members of the Siphoviridae phage family. The remaining region encodes the B. licheniformis orthologue of the PBSX prophage from Bacillus subtilis. Analysis of isolated phage particles (induced by mitomycin C) from the wild-type strain and prophage deletion mutant strains revealed activity of the prophage regions BLi_Pp2 (PBSX-like), BLi_Pp3 and BLi_Pp6. In contrast to BLi_Pp2 and BLi_Pp3, neither phage DNA nor phage particles of BLi_Pp6 could be visualized. However, the ability of prophage BLi_Pp6 to generate particles could be confirmed by sequencing of particle-protected DNA mapping to prophage locus BLi_Pp6. The introduced NGS-based approach allows the investigation of prophage regions and their ability to form particles. Our results show that this approach increases the sensitivity of prophage activity analysis and can complement more conventional approaches such as transmission electron microscopy (TEM). PMID:25811873

AlignMiner: a Web-based tool for detection of divergent regions in multiple sequence alignments of conserved sequences

Directory of Open Access Journals (Sweden)

Claros M Gonzalo

2010-06-01

Full Text Available Abstract Background Multiple sequence alignments are used to study gene or protein function, phylogenetic relations, genome evolution hypotheses and even gene polymorphisms. Virtually without exception, all available tools focus on conserved segments or residues. Small divergent regions, however, are biologically important for specific quantitative polymerase chain reaction, genotyping, molecular markers and preparation of specific antibodies, and yet have received little attention. As a consequence, they must be selected empirically by the researcher. AlignMiner has been developed to fill this gap in bioinformatic analyses. Results AlignMiner is a Web-based application for detection of conserved and divergent regions in alignments of conserved sequences, focusing particularly on divergence. It accepts alignments (protein or nucleic acid obtained using any of a variety of algorithms, which does not appear to have a significant impact on the final results. AlignMiner uses different scoring methods for assessing conserved/divergent regions, Entropy being the method that provides the highest number of regions with the greatest length, and Weighted being the most restrictive. Conserved/divergent regions can be generated either with respect to the consensus sequence or to one master sequence. The resulting data are presented in a graphical interface developed in AJAX, which provides remarkable user interaction capabilities. Users do not need to wait until execution is complete and can.even inspect their results on a different computer. Data can be downloaded onto a user disk, in standard formats. In silico and experimental proof-of-concept cases have shown that AlignMiner can be successfully used to designing specific polymerase chain reaction primers as well as potential epitopes for antibodies. Primer design is assisted by a module that deploys several oligonucleotide parameters for designing primers "on the fly". Conclusions AlignMiner can be used

Intra-Genomic Internal Transcribed Spacer Region Sequence Heterogeneity and Molecular Diagnosis in Clinical Microbiology.

Science.gov (United States)

Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Cheng, Jingwei; Xu, Yingchun; Lau, Susanna K P; Woo, Patrick C Y

2015-10-22

Internal transcribed spacer region (ITS) sequencing is the most extensively used technology for accurate molecular identification of fungal pathogens in clinical microbiology laboratories. Intra-genomic ITS sequence heterogeneity, which makes fungal identification based on direct sequencing of PCR products difficult, has rarely been reported in pathogenic fungi. During the process of performing ITS sequencing on 71 yeast strains isolated from various clinical specimens, direct sequencing of the PCR products showed ambiguous sequences in six of them. After cloning the PCR products into plasmids for sequencing, interpretable sequencing electropherograms could be obtained. For each of the six isolates, 10-49 clones were selected for sequencing and two to seven intra-genomic ITS copies were detected. The identities of these six isolates were confirmed to be Candida glabrata (n=2), Pichia (Candida) norvegensis (n=2), Candida tropicalis (n=1) and Saccharomyces cerevisiae (n=1). Multiple sequence alignment revealed that one to four intra-genomic ITS polymorphic sites were present in the six isolates, and all these polymorphic sites were located in the ITS1 and/or ITS2 regions. We report and describe the first evidence of intra-genomic ITS sequence heterogeneity in four different pathogenic yeasts, which occurred exclusively in the ITS1 and ITS2 spacer regions for the six isolates in this study.

An ongoing earthquake sequence near Dhaka, Bangladesh, from regional recordings

Science.gov (United States)

Howe, M.; Mondal, D. R.; Akhter, S. H.; Kim, W.; Seeber, L.; Steckler, M. S.

2013-12-01

Earthquakes in and around the syntaxial region between the continent-continent collision of the Himalayan arc and oceanic subduction of the Sunda arc result primarily from the convergence of India and Eurasia-Sunda plates along two fronts. The northern front, the convergence of the Indian and Eurasian plates, has produced the Himalayas. The eastern front, the convergence of the Indian and Sunda plates, ranges from ocean-continent subduction at the Andaman Arc and Burma Arc, and transitions to continent-continent collision to the north at the Assam Syntaxis in northeast India. The India-Sunda convergence at the Burma Arc is extremely oblique. The boundary-normal convergence rate is ~17 mm/yr while the boundary-parallel rate is ~45 mm/yr including the well-known Sagaing strike-slip fault, which accommodates about half the shear component. This heterogeneous tectonic setting produces multiple earthquake sources that need to be considered when assessing seismic hazard and risk in this region. The largest earthquakes, just as in other subduction systems, are expected to be interplate events that occur on the low-angle megathrusts, such as the Mw 9.2 2004 Sumatra-Andaman earthquake and the 1762 earthquake along the Arakan margin. These earthquakes are known to produce large damage over vast areas, but since they account for large fault motions they are relatively rare. The majority of current seismicity in the study area is intraplate. Most of the seismicity associated with the Burma Arc subduction system is in the down-going slab, including the shallow-dipping part below the megathrust flooring the accretionary wedge. The strike of the wedge is ~N-S and Dhaka lies at its outer limit. One particular source relevant to seismic risk in Dhaka is illuminated by a multi-year sequence of earthquakes in Bangladesh less than 100 km southeast of Dhaka. The population in Dhaka (now at least 15 million) has been increasing dramatically due to rapid urbanization. The vulnerability

The practice of electronic petitions to regional political agenda-setting

Directory of Open Access Journals (Sweden)

O. M. Kuzhman

2016-05-01

Proved that electronic petitions as a special form of collective appeals, in fact, represent electronic (national, regional, local – depending on the level of government initiatives which the conditions of collecting the required number of signatures in his support are urgently considered relevant authority. For it must necessarily be made or decision given in a public way motivated refusal. It was determined that the regional feeder electronic petitions is very effective because it allows you to identify the pressing issues of interest to residents of a region, and respond to them. Thus, through electronic petition very quickly established regional political agenda.

A Novel Low Energy Electron Microscope for DNA Sequencing and Surface Analysis

Science.gov (United States)

Mankos, M.; Shadman, K.; Persson, H.H.J.; N’Diaye, A.T.; Schmid, A.K.; Davis, R.W.

2014-01-01

Monochromatic, aberration-corrected, dual-beam low energy electron microscopy (MAD-LEEM) is a novel technique that is directed towards imaging nanostructures and surfaces with sub-nanometer resolution. The technique combines a monochromator, a mirror aberration corrector, an energy filter, and dual beam illumination in a single instrument. The monochromator reduces the energy spread of the illuminating electron beam, which significantly improves spectroscopic and spatial resolution. Simulation results predict that the novel aberration corrector design will eliminate the second rank chromatic and third and fifth order spherical aberrations, thereby improving the resolution into the sub-nanometer regime at landing energies as low as one hundred electron-Volts. The energy filter produces a beam that can extract detailed information about the chemical composition and local electronic states of non-periodic objects such as nanoparticles, interfaces, defects, and macromolecules. The dual flood illumination eliminates charging effects that are generated when a conventional LEEM is used to image insulating specimens. A potential application for MAD-LEEM is in DNA sequencing, which requires high resolution to distinguish the individual bases and high speed to reduce the cost. The MAD-LEEM approach images the DNA with low electron impact energies, which provides nucleobase contrast mechanisms without organometallic labels. Furthermore, the micron-size field of view when combined with imaging on the fly provides long read lengths, thereby reducing the demand on assembling the sequence. Experimental results from bulk specimens with immobilized single-base oligonucleotides demonstrate that base specific contrast is available with reflected, photo-emitted, and Auger electrons. Image contrast simulations of model rectangular features mimicking the individual nucleotides in a DNA strand have been developed to translate measurements of contrast on bulk DNA to the detectability of

A novel low energy electron microscope for DNA sequencing and surface analysis.

Science.gov (United States)

Mankos, M; Shadman, K; Persson, H H J; N'Diaye, A T; Schmid, A K; Davis, R W

2014-10-01

Monochromatic, aberration-corrected, dual-beam low energy electron microscopy (MAD-LEEM) is a novel technique that is directed towards imaging nanostructures and surfaces with sub-nanometer resolution. The technique combines a monochromator, a mirror aberration corrector, an energy filter, and dual beam illumination in a single instrument. The monochromator reduces the energy spread of the illuminating electron beam, which significantly improves spectroscopic and spatial resolution. Simulation results predict that the novel aberration corrector design will eliminate the second rank chromatic and third and fifth order spherical aberrations, thereby improving the resolution into the sub-nanometer regime at landing energies as low as one hundred electron-Volts. The energy filter produces a beam that can extract detailed information about the chemical composition and local electronic states of non-periodic objects such as nanoparticles, interfaces, defects, and macromolecules. The dual flood illumination eliminates charging effects that are generated when a conventional LEEM is used to image insulating specimens. A potential application for MAD-LEEM is in DNA sequencing, which requires high resolution to distinguish the individual bases and high speed to reduce the cost. The MAD-LEEM approach images the DNA with low electron impact energies, which provides nucleobase contrast mechanisms without organometallic labels. Furthermore, the micron-size field of view when combined with imaging on the fly provides long read lengths, thereby reducing the demand on assembling the sequence. Experimental results from bulk specimens with immobilized single-base oligonucleotides demonstrate that base specific contrast is available with reflected, photo-emitted, and Auger electrons. Image contrast simulations of model rectangular features mimicking the individual nucleotides in a DNA strand have been developed to translate measurements of contrast on bulk DNA to the detectability of

Search for Fermi shuttle mechanisms in electron emission from atomic collision sequences

International Nuclear Information System (INIS)

Suarez, S.; Jung, M.; Rothard, H.; Schosnig, M.; Maier, R.; Clouvas, A.; Groeneveld, K.O.

1994-01-01

In electron spectra induced by slow heavy ion bombardment of solids a high energy tail can be observed, which is suggested to be explained by multiple collision sequences. In order to find those multiple collision effects like the ''Fermi shuttle'' acceleration mechanism we measured doubly differential electron emission cross sections for H + (33.5-700 keV) impact on different targets (He, Ne, C and Au) as a function of projectile energy and electron emission angle. We observed a surprising target dependence of the electron emission within the range of electron energies close to that of the binary encounter electrons for all observed angles of emission. (orig.)

Multi-region and single-cell sequencing reveal variable genomic heterogeneity in rectal cancer.

Science.gov (United States)

Liu, Mingshan; Liu, Yang; Di, Jiabo; Su, Zhe; Yang, Hong; Jiang, Beihai; Wang, Zaozao; Zhuang, Meng; Bai, Fan; Su, Xiangqian

2017-11-23

Colorectal cancer is a heterogeneous group of malignancies with complex molecular subtypes. While colon cancer has been widely investigated, studies on rectal cancer are very limited. Here, we performed multi-region whole-exome sequencing and single-cell whole-genome sequencing to examine the genomic intratumor heterogeneity (ITH) of rectal tumors. We sequenced nine tumor regions and 88 single cells from two rectal cancer patients with tumors of the same molecular classification and characterized their mutation profiles and somatic copy number alterations (SCNAs) at the multi-region and the single-cell levels. A variable extent of genomic heterogeneity was observed between the two patients, and the degree of ITH increased when analyzed on the single-cell level. We found that major SCNAs were early events in cancer development and inherited steadily. Single-cell sequencing revealed mutations and SCNAs which were hidden in bulk sequencing. In summary, we studied the ITH of rectal cancer at regional and single-cell resolution and demonstrated that variable heterogeneity existed in two patients. The mutational scenarios and SCNA profiles of two patients with treatment naïve from the same molecular subtype are quite different. Our results suggest each tumor possesses its own architecture, which may result in different diagnosis, prognosis, and drug responses. Remarkable ITH exists in the two patients we have studied, providing a preliminary impression of ITH in rectal cancer.

Tracking TCRβ sequence clonotype expansions during antiviral therapy using high-throughput sequencing of the hypervariable region

Directory of Open Access Journals (Sweden)

Mark W Robinson

2016-04-01

Full Text Available To maintain a persistent infection viruses such as hepatitis C virus (HCV employ a range of mechanisms that subvert protective T cell responses. The suppression of antigen-specific T cell responses by HCV hinders efforts to profile T cell responses during chronic infection and antiviral therapy. Conventional methods of detecting antigen-specific T cells utilise either antigen stimulation (e.g. ELISpot, proliferation assays, cytokine production or antigen-loaded tetramer staining. This limits the ability to profile T cell responses during chronic infection due to suppressed effector function and the requirement for prior knowledge of antigenic viral peptide sequences. Recently high-throughput sequencing (HTS technologies have been developed for the analysis of T cell repertoires. In the present study we have assessed the feasibility of HTS of the TCRβ complementarity determining region (CDR3 to track T cell expansions in an antigen-independent manner. Using sequential blood samples from HCV-infected individuals undergoing anti-viral therapy we were able to measure the population frequencies of >35,000 TCRβ sequence clonotypes in each individual over the course of 12 weeks. TRBV/TRBJ gene segment usage varied markedly between individuals but remained relatively constant within individuals across the course of therapy. Despite this stable TRBV/TRBJ gene segment usage, a number of TCRβ sequence clonotypes showed dramatic changes in read frequency. These changes could not be linked to therapy outcomes in the present study however the TCRβ CDR3 sequences with the largest fold changes did include sequences with identical TRBV/TRBJ gene segment usage and high joining region homology to previously published CDR3 sequences from HCV-specific T cells targeting the HLA-B*0801-restricted 1395HSKKKCDEL1403 and HLA-A*0101–restricted 1435ATDALMTGY1443 epitopes. The pipeline developed in this proof of concept study provides a platform for the design of

Evaluation of a target region capture sequencing platform using monogenic diabetes as a study-model

DEFF Research Database (Denmark)

Gao, Rui; Liu, Yanxia; Gjesing, Anette Marianne Prior

2014-01-01

Monogenic diabetes is a genetic disease often caused by mutations in genes involved in beta-cell function. Correct sub-categorization of the disease is a prerequisite for appropriate treatment and genetic counseling. Target-region capture sequencing is a combination of genomic region enrichment...... and next generation sequencing which might be used as an efficient way to diagnose various genetic disorders. We aimed to develop a target-region capture sequencing platform to screen 117 selected candidate genes involved in metabolism for mutations and to evaluate its performance using monogenic diabetes...

Tandemly repeated sequence in 5'end of mtDNA control region of ...

African Journals Online (AJOL)

Extensive length variability was observed in 5' end sequence of the mitochondrial DNA control region of the Japanese Spanish mackerel (Scomberomorus niphonius). This length variability was due to the presence of varying numbers of a 56-bp tandemly repeated sequence and a 46-bp insertion/deletion (indel).

Using a sequence characterized amplified region (SCAR) marker for ...

African Journals Online (AJOL)

GREGORY

2010-09-13

Sep 13, 2010 ... This work used sequence characterized amplified region (SCAR) marker to detect the Bacillus cereus strain in strawberry fields. The purpose was to develop an effective molecular method for detecting the functional target microorganisms applied in agricultural fields. A 3×109. CFU/ml vegetative cell.

Prediction of flexible/rigid regions from protein sequences using k-spaced amino acid pairs

Directory of Open Access Journals (Sweden)

Ruan Jishou

2007-04-01

Full Text Available Abstract Background Traditionally, it is believed that the native structure of a protein corresponds to a global minimum of its free energy. However, with the growing number of known tertiary (3D protein structures, researchers have discovered that some proteins can alter their structures in response to a change in their surroundings or with the help of other proteins or ligands. Such structural shifts play a crucial role with respect to the protein function. To this end, we propose a machine learning method for the prediction of the flexible/rigid regions of proteins (referred to as FlexRP; the method is based on a novel sequence representation and feature selection. Knowledge of the flexible/rigid regions may provide insights into the protein folding process and the 3D structure prediction. Results The flexible/rigid regions were defined based on a dataset, which includes protein sequences that have multiple experimental structures, and which was previously used to study the structural conservation of proteins. Sequences drawn from this dataset were represented based on feature sets that were proposed in prior research, such as PSI-BLAST profiles, composition vector and binary sequence encoding, and a newly proposed representation based on frequencies of k-spaced amino acid pairs. These representations were processed by feature selection to reduce the dimensionality. Several machine learning methods for the prediction of flexible/rigid regions and two recently proposed methods for the prediction of conformational changes and unstructured regions were compared with the proposed method. The FlexRP method, which applies Logistic Regression and collocation-based representation with 95 features, obtained 79.5% accuracy. The two runner-up methods, which apply the same sequence representation and Support Vector Machines (SVM and Naïve Bayes classifiers, obtained 79.2% and 78.4% accuracy, respectively. The remaining considered methods are

Detection of genomic variation by selection of a 9 mb DNA region and high throughput sequencing.

Directory of Open Access Journals (Sweden)

Sergey I Nikolaev

Full Text Available Detection of the rare polymorphisms and causative mutations of genetic diseases in a targeted genomic area has become a major goal in order to understand genomic and phenotypic variability. We have interrogated repeat-masked regions of 8.9 Mb on human chromosomes 21 (7.8 Mb and 7 (1.1 Mb from an individual from the International HapMap Project (NA12872. We have optimized a method of genomic selection for high throughput sequencing. Microarray-based selection and sequencing resulted in 260-fold enrichment, with 41% of reads mapping to the target region. 83% of SNPs in the targeted region had at least 4-fold sequence coverage and 54% at least 15-fold. When assaying HapMap SNPs in NA12872, our sequence genotypes are 91.3% concordant in regions with coverage > or = 4-fold, and 97.9% concordant in regions with coverage > or = 15-fold. About 81% of the SNPs recovered with both thresholds are listed in dbSNP. We observed that regions with low sequence coverage occur in close proximity to low-complexity DNA. Validation experiments using Sanger sequencing were performed for 46 SNPs with 15-20 fold coverage, with a confirmation rate of 96%, suggesting that DNA selection provides an accurate and cost-effective method for identifying rare genomic variants.

A novel low energy electron microscope for DNA sequencing and surface analysis

Energy Technology Data Exchange (ETDEWEB)

Mankos, M., E-mail: marian@electronoptica.com [Electron Optica Inc., 1000 Elwell Court #110, Palo Alto, CA 94303 (United States); Shadman, K. [Electron Optica Inc., 1000 Elwell Court #110, Palo Alto, CA 94303 (United States); Persson, H.H.J. [Stanford Genome Technology Center, Stanford University School of Medicine, 855 California Avenue, Palo Alto, CA 94304 (United States); N’Diaye, A.T. [Electron Optica Inc., 1000 Elwell Court #110, Palo Alto, CA 94303 (United States); NCEM, Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, CA 94720 (United States); Schmid, A.K. [NCEM, Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, CA 94720 (United States); Davis, R.W. [Stanford Genome Technology Center, Stanford University School of Medicine, 855 California Avenue, Palo Alto, CA 94304 (United States)

2014-10-15

Monochromatic, aberration-corrected, dual-beam low energy electron microscopy (MAD-LEEM) is a novel technique that is directed towards imaging nanostructures and surfaces with sub-nanometer resolution. The technique combines a monochromator, a mirror aberration corrector, an energy filter, and dual beam illumination in a single instrument. The monochromator reduces the energy spread of the illuminating electron beam, which significantly improves spectroscopic and spatial resolution. Simulation results predict that the novel aberration corrector design will eliminate the second rank chromatic and third and fifth order spherical aberrations, thereby improving the resolution into the sub-nanometer regime at landing energies as low as one hundred electron-Volts. The energy filter produces a beam that can extract detailed information about the chemical composition and local electronic states of non-periodic objects such as nanoparticles, interfaces, defects, and macromolecules. The dual flood illumination eliminates charging effects that are generated when a conventional LEEM is used to image insulating specimens. A potential application for MAD-LEEM is in DNA sequencing, which requires high resolution to distinguish the individual bases and high speed to reduce the cost. The MAD-LEEM approach images the DNA with low electron impact energies, which provides nucleobase contrast mechanisms without organometallic labels. Furthermore, the micron-size field of view when combined with imaging on the fly provides long read lengths, thereby reducing the demand on assembling the sequence. Experimental results from bulk specimens with immobilized single-base oligonucleotides demonstrate that base specific contrast is available with reflected, photo-emitted, and Auger electrons. Image contrast simulations of model rectangular features mimicking the individual nucleotides in a DNA strand have been developed to translate measurements of contrast on bulk DNA to the detectability of

The Development Model Electronic Commerce of Regional Agriculture

Science.gov (United States)

Kang, Jun; Cai, Lecai; Li, Hongchan

With the developing of the agricultural information, it is inevitable trend of the development of agricultural electronic commercial affairs. On the basis of existing study on the development application model of e-commerce, combined with the character of the agricultural information, compared with the developing model from the theory and reality, a new development model electronic commerce of regional agriculture base on the government is put up, and such key issues as problems of the security applications, payment mode, sharing mechanisms, and legal protection are analyzed, etc. The among coordination mechanism of the region is discussed on, it is significance for regulating the development of agricultural e-commerce and promoting the regional economical development.

Defining Electron Bifurcation in the Electron-Transferring Flavoprotein Family.

Science.gov (United States)

Garcia Costas, Amaya M; Poudel, Saroj; Miller, Anne-Frances; Schut, Gerrit J; Ledbetter, Rhesa N; Fixen, Kathryn R; Seefeldt, Lance C; Adams, Michael W W; Harwood, Caroline S; Boyd, Eric S; Peters, John W

2017-11-01

Electron bifurcation is the coupling of exergonic and endergonic redox reactions to simultaneously generate (or utilize) low- and high-potential electrons. It is the third recognized form of energy conservation in biology and was recently described for select electron-transferring flavoproteins (Etfs). Etfs are flavin-containing heterodimers best known for donating electrons derived from fatty acid and amino acid oxidation to an electron transfer respiratory chain via Etf-quinone oxidoreductase. Canonical examples contain a flavin adenine dinucleotide (FAD) that is involved in electron transfer, as well as a non-redox-active AMP. However, Etfs demonstrated to bifurcate electrons contain a second FAD in place of the AMP. To expand our understanding of the functional variety and metabolic significance of Etfs and to identify amino acid sequence motifs that potentially enable electron bifurcation, we compiled 1,314 Etf protein sequences from genome sequence databases and subjected them to informatic and structural analyses. Etfs were identified in diverse archaea and bacteria, and they clustered into five distinct well-supported groups, based on their amino acid sequences. Gene neighborhood analyses indicated that these Etf group designations largely correspond to putative differences in functionality. Etfs with the demonstrated ability to bifurcate were found to form one group, suggesting that distinct conserved amino acid sequence motifs enable this capability. Indeed, structural modeling and sequence alignments revealed that identifying residues occur in the NADH- and FAD-binding regions of bifurcating Etfs. Collectively, a new classification scheme for Etf proteins that delineates putative bifurcating versus nonbifurcating members is presented and suggests that Etf-mediated bifurcation is associated with surprisingly diverse enzymes. IMPORTANCE Electron bifurcation has recently been recognized as an electron transfer mechanism used by microorganisms to maximize

Time Separation Between Events in a Sequence: a Regional Property?

Science.gov (United States)

Muirwood, R.; Fitzenz, D. D.

2013-12-01

Earthquake sequences are loosely defined as events occurring too closely in time and space to appear unrelated. Depending on the declustering method, several, all, or no event(s) after the first large event might be recognized as independent mainshocks. It can therefore be argued that a probabilistic seismic hazard assessment (PSHA, traditionally dealing with mainshocks only) might already include the ground shaking effects of such sequences. Alternatively all but the largest event could be classified as an ';aftershock' and removed from the earthquake catalog. While in PSHA the question is only whether to keep or remove the events from the catalog, for Risk Management purposes, the community response to the earthquakes, as well as insurance risk transfer mechanisms, can be profoundly affected by the actual timing of events in such a sequence. In particular the repetition of damaging earthquakes over a period of weeks to months can lead to businesses closing and families evacuating from the region (as happened in Christchurch, New Zealand in 2011). Buildings that are damaged in the first earthquake may go on to be damaged again, even while they are being repaired. Insurance also functions around a set of critical timeframes - including the definition of a single 'event loss' for reinsurance recoveries within the 192 hour ';hours clause', the 6-18 month pace at which insurance claims are settled, and the annual renewal of insurance and reinsurance contracts. We show how temporal aspects of earthquake sequences need to be taken into account within models for Risk Management, and what time separation between events are most sensitive, both in terms of the modeled disruptions to lifelines and business activity as well as in the losses to different parties (such as insureds, insurers and reinsurers). We also explore the time separation between all events and between loss causing events for a collection of sequences from across the world and we point to the need to

Evaluation of exome variants using the Ion Proton Platform to sequence error-prone regions.

Science.gov (United States)

Seo, Heewon; Park, Yoomi; Min, Byung Joo; Seo, Myung Eui; Kim, Ju Han

2017-01-01

The Ion Proton sequencer from Thermo Fisher accurately determines sequence variants from target regions with a rapid turnaround time at a low cost. However, misleading variant-calling errors can occur. We performed a systematic evaluation and manual curation of read-level alignments for the 675 ultrarare variants reported by the Ion Proton sequencer from 27 whole-exome sequencing data but that are not present in either the 1000 Genomes Project and the Exome Aggregation Consortium. We classified positive variant calls into 393 highly likely false positives, 126 likely false positives, and 156 likely true positives, which comprised 58.2%, 18.7%, and 23.1% of the variants, respectively. We identified four distinct error patterns of variant calling that may be bioinformatically corrected when using different strategies: simplicity region, SNV cluster, peripheral sequence read, and base inversion. Local de novo assembly successfully corrected 201 (38.7%) of the 519 highly likely or likely false positives. We also demonstrate that the two sequencing kits from Thermo Fisher (the Ion PI Sequencing 200 kit V3 and the Ion PI Hi-Q kit) exhibit different error profiles across different error types. A refined calling algorithm with better polymerase may improve the performance of the Ion Proton sequencing platform.

Evaluation of exome variants using the Ion Proton Platform to sequence error-prone regions.

Directory of Open Access Journals (Sweden)

Heewon Seo

Full Text Available The Ion Proton sequencer from Thermo Fisher accurately determines sequence variants from target regions with a rapid turnaround time at a low cost. However, misleading variant-calling errors can occur. We performed a systematic evaluation and manual curation of read-level alignments for the 675 ultrarare variants reported by the Ion Proton sequencer from 27 whole-exome sequencing data but that are not present in either the 1000 Genomes Project and the Exome Aggregation Consortium. We classified positive variant calls into 393 highly likely false positives, 126 likely false positives, and 156 likely true positives, which comprised 58.2%, 18.7%, and 23.1% of the variants, respectively. We identified four distinct error patterns of variant calling that may be bioinformatically corrected when using different strategies: simplicity region, SNV cluster, peripheral sequence read, and base inversion. Local de novo assembly successfully corrected 201 (38.7% of the 519 highly likely or likely false positives. We also demonstrate that the two sequencing kits from Thermo Fisher (the Ion PI Sequencing 200 kit V3 and the Ion PI Hi-Q kit exhibit different error profiles across different error types. A refined calling algorithm with better polymerase may improve the performance of the Ion Proton sequencing platform.

Martian Electron Temperatures in the Sub Solar Region.

Science.gov (United States)

Fowler, C. M.; Peterson, W. K.; Andersson, L.; Thiemann, E.; Mayyasi, M.; Yelle, R. V.; Benna, M.; Espley, J. R.

2017-12-01

Observations from Viking, and MAVEN have shown that the observed ionospheric electron temperatures are systematically higher than those predicted by many models. Because electron temperature is a balance between heating, cooling, and heat transport, we systematically compare the magnitude of electron heating from photoelectrons, electron cooling and heat transport, as a function of altitude within 30 degrees of the sub solar point. MAVEN observations of electron temperature and density, EUV irradiance, neutral and ion composition are used to evaluate terms in the heat equation following the framework of Matta et al. (Icarus, 2014, doi:10.1016/j.icarus.2013.09.006). Our analysis is restricted to inbound orbits where the magnetic field is within 30 degrees of horizontal. MAVEN sampled the sub solar region in May 2015 and again in May 2017, in near northern spring equinoctial conditions. Solar activity was higher and the spacecraft sampled altitudes down to 120 km in 2015, compared to 160 km in 2017. We find that between 160 and 200 km the Maven electron temperatures are in thermal equilibrium, in the sub solar region, on field lines inclined less than 30 degrees to the horizontal. Above 200km the data suggest that heating from other sources, such as wave heating are significant. Below 160 km some of the discrepancy comes from measurement limitations. This is because the MAVEN instrument cannot resolve the lowest electron temperatures, and because some cooling rates scale as the difference between the electron and neutral temperatures.

DNA Barcoding: Amplification and sequence analysis of rbcl and matK genome regions in three divergent plant species

Directory of Open Access Journals (Sweden)

Javed Iqbal Wattoo

2016-11-01

Full Text Available Background: DNA barcoding is a novel method of species identification based on nucleotide diversity of conserved sequences. The establishment and refining of plant DNA barcoding systems is more challenging due to high genetic diversity among different species. Therefore, targeting the conserved nuclear transcribed regions would be more reliable for plant scientists to reveal genetic diversity, species discrimination and phylogeny. Methods: In this study, we amplified and sequenced the chloroplast DNA regions (matk+rbcl of Solanum nigrum, Euphorbia helioscopia and Dalbergia sissoo to study the functional annotation, homology modeling and sequence analysis to allow a more efficient utilization of these sequences among different plant species. These three species represent three families; Solanaceae, Euphorbiaceae and Fabaceae respectively. Biological sequence homology and divergence of amplified sequences was studied using Basic Local Alignment Tool (BLAST. Results: Both primers (matk+rbcl showed good amplification in three species. The sequenced regions reveled conserved genome information for future identification of different medicinal plants belonging to these species. The amplified conserved barcodes revealed different levels of biological homology after sequence analysis. The results clearly showed that the use of these conserved DNA sequences as barcode primers would be an accurate way for species identification and discrimination. Conclusion: The amplification and sequencing of conserved genome regions identified a novel sequence of matK in native species of Solanum nigrum. The findings of the study would be applicable in medicinal industry to establish DNA based identification of different medicinal plant species to monitor adulteration.

F region electron density irregularity spectra near Auroral acceleration and shear regions

International Nuclear Information System (INIS)

Basu, S.; Basu, S.; MacKenzie, E.; Coley, W.R.; Hanson, W.B.; Lin, C.S.

1984-01-01

Spectral characteristics of auroral F region irregularities were studied by the use of high-resolution (approx.35 m) density measurements made by the retarding potential analyzer (RPA) on board the Atmosphere Explorer D (AE-D) satellite during two orbits when the satellite was traversing the high-latitude ionosphere in the evening sector. Coordinated DMSP passes provided synoptic coverage of auroral activity. The auroral energy input was estimated by intergrating the low-energy electron (LEE) data on AE-D. It was found that the one-dimensional in situ spectral index (p 1 ) of the irregularities at scale lengths of 1 values of approx.-3. This is interpreted as resulting from the effects of E region conductivity on the F region irregularity structure. The regions in between the precipitation structures, where presumably the E region conductivity was small, were generally associated with large shears in the horizontal E-W drifts and large velocities, as measured by the ion drift meter on board AE-D. The maximum drifts measured were approx.2 km s -1 , corresponding to an electric field of 100 mV m -1 . The large-velocity regions were also associated with substantial ion heating and electron density depletions. The largest shear magnitudes observed were approx.80 m s -1 km -1 , and the shear gradient scale lengths were approx.10 km, which was approximately the resolution of the ion drift meter data set used. The spectral characteristics of irregularities in the large, variable flow regions were very different, with p 1 being approx.-1

OPAL: prediction of MoRF regions in intrinsically disordered protein sequences.

Science.gov (United States)

Sharma, Ronesh; Raicar, Gaurav; Tsunoda, Tatsuhiko; Patil, Ashwini; Sharma, Alok

2018-06-01

Intrinsically disordered proteins lack stable 3-dimensional structure and play a crucial role in performing various biological functions. Key to their biological function are the molecular recognition features (MoRFs) located within long disordered regions. Computationally identifying these MoRFs from disordered protein sequences is a challenging task. In this study, we present a new MoRF predictor, OPAL, to identify MoRFs in disordered protein sequences. OPAL utilizes two independent sources of information computed using different component predictors. The scores are processed and combined using common averaging method. The first score is computed using a component MoRF predictor which utilizes composition and sequence similarity of MoRF and non-MoRF regions to detect MoRFs. The second score is calculated using half-sphere exposure (HSE), solvent accessible surface area (ASA) and backbone angle information of the disordered protein sequence, using information from the amino acid properties of flanks surrounding the MoRFs to distinguish MoRF and non-MoRF residues. OPAL is evaluated using test sets that were previously used to evaluate MoRF predictors, MoRFpred, MoRFchibi and MoRFchibi-web. The results demonstrate that OPAL outperforms all the available MoRF predictors and is the most accurate predictor available for MoRF prediction. It is available at http://www.alok-ai-lab.com/tools/opal/. ashwini@hgc.jp or alok.sharma@griffith.edu.au. Supplementary data are available at Bioinformatics online.

Taxonomy and phylogeny of the genus citrus based on the nuclear ribosomal dna its region sequence

International Nuclear Information System (INIS)

Sun, Y.L.

2015-01-01

The genus Citrus (Aurantioideae, Rutaceae) is the sole source of the citrus fruits of commerce showing high economic values. In this study, the taxonomy and phylogeny of Citrus species is evaluated using sequence analysis of the ITS region of nrDNA. This study is based on 26 plants materials belonging to 22 Citrus species having wild, domesticated, and cultivated species. Through DNA alignment of the ITS sequence, ITS1 and ITS2 regions showed relatively high variations of sequence length and nucleotide among these Citrus species. According to previous six-tribe discrimination theory by Swingle and Reece, the grouping in our ITS phylogenetic tree reconstructed by ITS sequences was not related to tribe discrimination but species discrimination. However, the molecular analysis could provide more information on citrus taxonomy. Combined with ITS sequences of other subgenera in then true citrus fruit tree group, the ITS phylogenetic tree indicated subgenera Citrus was monophyletic and nearer to Fortunella, Poncirus, and Clymenia compared to Microcitrus and Eremocitrus. Abundant sequence variations of the ITS region shown in this study would help species identification and tribe differentiation of the genus Citrus. (author)

Designing a Bioengine for Detection and Analysis of Base String on an Affected Sequence in High-Concentration Regions

Directory of Open Access Journals (Sweden)

Debnath Bhattacharyya

2013-01-01

Full Text Available We design an Algorithm for bioengine. As a program are enable optimal alignments searching between two sequences, the host sequence (normal plant as well as query sequence (virus. Searching for homologues has become a routine operation of biological sequences in 4 × 4 combination with different subsequence (word size. This program takes the advantage of the high degree of homology between such sequences to construct an alignment of the matching regions. There is a main aim which is to detect the overlapping reading frames. This program also enables to find out the highly infected colones selection highest matching region with minimum gap or mismatch zones and unique virus colones matches. This is a small, portable, interactive, front-end program intended to be used to find out the regions of matching between host sequence and query subsequences. All the operations are carried out in fraction of seconds, depending on the required task and on the sequence length.

Designing a Bioengine for Detection and Analysis of Base String on an Affected Sequence in High-Concentration Regions

Science.gov (United States)

Mandal, Bijoy Kumar; Kim, Tai-hoon

2013-01-01

We design an Algorithm for bioengine. As a program are enable optimal alignments searching between two sequences, the host sequence (normal plant) as well as query sequence (virus). Searching for homologues has become a routine operation of biological sequences in 4 × 4 combination with different subsequence (word size). This program takes the advantage of the high degree of homology between such sequences to construct an alignment of the matching regions. There is a main aim which is to detect the overlapping reading frames. This program also enables to find out the highly infected colones selection highest matching region with minimum gap or mismatch zones and unique virus colones matches. This is a small, portable, interactive, front-end program intended to be used to find out the regions of matching between host sequence and query subsequences. All the operations are carried out in fraction of seconds, depending on the required task and on the sequence length. PMID:24000321

An integrated tool to study MHC region: accurate SNV detection and HLA genes typing in human MHC region using targeted high-throughput sequencing.

Directory of Open Access Journals (Sweden)

Hongzhi Cao

Full Text Available The major histocompatibility complex (MHC is one of the most variable and gene-dense regions of the human genome. Most studies of the MHC, and associated regions, focus on minor variants and HLA typing, many of which have been demonstrated to be associated with human disease susceptibility and metabolic pathways. However, the detection of variants in the MHC region, and diagnostic HLA typing, still lacks a coherent, standardized, cost effective and high coverage protocol of clinical quality and reliability. In this paper, we presented such a method for the accurate detection of minor variants and HLA types in the human MHC region, using high-throughput, high-coverage sequencing of target regions. A probe set was designed to template upon the 8 annotated human MHC haplotypes, and to encompass the 5 megabases (Mb of the extended MHC region. We deployed our probes upon three, genetically diverse human samples for probe set evaluation, and sequencing data show that ∼97% of the MHC region, and over 99% of the genes in MHC region, are covered with sufficient depth and good evenness. 98% of genotypes called by this capture sequencing prove consistent with established HapMap genotypes. We have concurrently developed a one-step pipeline for calling any HLA type referenced in the IMGT/HLA database from this target capture sequencing data, which shows over 96% typing accuracy when deployed at 4 digital resolution. This cost-effective and highly accurate approach for variant detection and HLA typing in the MHC region may lend further insight into immune-mediated diseases studies, and may find clinical utility in transplantation medicine research. This one-step pipeline is released for general evaluation and use by the scientific community.

Characterization of Campylobacter jejuni applying flaA short variable region sequencing, multilocus sequencing and Fourier transform infrared spectroscopy

DEFF Research Database (Denmark)

Josefsen, Mathilde Hartmann; Bonnichsen, Lise; Larsson, Jonas

flaA short variable region sequencing and phenetic Fourier transform infrared (FTIR) spectroscopy was applied on a collection of 102 Campylobacter jejuni isolated from continuous sampling of organic, free range geese and chickens. FTIR has been shown to serve as a valuable tool in typing...

Nucleotide sequence of a cDNA coding for the amino-terminal region of human prepro. alpha. 1(III) collagen

Energy Technology Data Exchange (ETDEWEB)

Toman, P D; Ricca, G A [Rorer Biotechnology, Inc., Springfield, VA (USA); de Crombrugghe, B [National Institutes of Health, Bethesda, MD (USA)

1988-07-25

Type III Collagen is synthesized in a variety of tissues as a precursor macromolecule containing a leader sequence, a N-propeptide, a N-telopeptide, the triple helical region, a C-telopeptide, and C-propeptide. To further characterize the human type III collagen precursor, a human placental cDNA library was constructed in gt11 using an oligonucleotide derived from a partial cDNA sequence corresponding to the carboxy-terminal part of the 1(III) collagen. A cDNA was identified which contains the leader sequence, the N-propeptide and N-telopeptide regions. The DNA sequence of these regions are presented here. The triple helical, C-telopeptide and C-propeptide amino acid sequence for human type III collagen has been determined previously. A comparison of the human amino acid sequence with mouse, chicken, and calf sequence shows 81%, 81%, and 92% similarity, respectively. At the DNA level, the sequence similarity between human and mouse or chicken type III collagen sequences in this area is 82% and 77%, respectively.

Sequencing analysis reveals a unique gene organization in the gyrB region of Mycoplasma hominis

DEFF Research Database (Denmark)

Ladefoged, Søren; Christiansen, Gunna

1994-01-01

of which showed similarity to that which encodes the LicA protein of Haemophilus influenzae. The organization of the genes in the region showed no resemblance to that in the corresponding regions of other bacteria sequenced so far. The gyrA gene was mapped 35 kb downstream from the gyrB gene.......The homolog of the gyrB gene, which has been reported to be present in the vicinity of the initiation site of replication in bacteria, was mapped on the Mycoplasma hominis genome, and the region was subsequently sequenced. Five open reading frames were identified flanking the gyrB gene, one...

Regional Educational Laboratory Electronic Network Phase 2 System

Science.gov (United States)

Cradler, John

1995-01-01

The Far West Laboratory in collaboration with the other regional educational laboratories is establishing a regionally coordinated telecommunication network to electronically interconnect each of the ten regional laboratories with educators and education stakeholders from the school to the state level. For the national distributed information database, each lab is working with mid-level networks to establish a common interface for networking throughout the country and include topics of importance to education reform as assessment and technology planning.

Sequence organization and control of transcription in the bacteriophage T4 tRNA region.

Science.gov (United States)

Broida, J; Abelson, J

1985-10-05

Bacteriophage T4 contains genes for eight transfer RNAs and two stable RNAs of unknown function. These are found in two clusters at 70 X 10(3) base-pairs on the T4 genetic map. To understand the control of transcription in this region we have completed the sequencing of 5000 base-pairs in this region. The sequence contains a part of gene 3, gene 1, gene 57, internal protein I, the tRNA genes and five open reading frames which most likely code for heretofore unidentified proteins. We have used subclones of the region to investigate the kinetics of transcription in vivo. The results show that transcription in this region consists of overlapping early, middle and late transcripts. Transcription is directed from two early promoters, one or two middle promoters and perhaps two late promoters. This region contains all of the features that are seen in T4 transcription and as such is a good place to study the phenomenon in more detail.

Electron Currents and Heating in the Ion Diffusion Region of Asymmetric Reconnection

Science.gov (United States)

Graham, D. B.; Khotyaintsev, Yu. V.; Norgren, C.; Vaivads, A.; Andre, M.; Lindqvist, P. A.; Marklund, G. T.; Ergun, R. E.; Paterson, W. R.; Gershman, D. J.;

The electronic register patients with hypertensia in Tomsk Region

Directory of Open Access Journals (Sweden)

O. S. Kobyakova

2012-01-01

Full Text Available Within the limits of the regional program «Prevention and treatment of an arterial hypertension for the period of 2004—2008» the electronic register of the patients with hypertensia inTomskRegion has been created.The electronic register is a two-level system where interaction of two kinds of databases is carried out: the first level is the databases of separate medical organization; the second level is the central integrated database.The basic information for the electronic register are documents confirmed by the Health service Ministry of the Russian Federation, that is the coupon of the out-patient patient and a card of dynamic supervision over the patient with hypertensia.All the data about the patients, included in the register are subdivided into unchangeable and changeable ones.The electronic register is an effective control system providing local leading of health service bodies with qualitative and high-grade information in processes of preparation of decision-making and measure taken for prevention and treatment of hypertensia.The electronic register is an effective monitoring system, providing medical authority of important information for taking decisions establishment measures for prevention and treatment of hypertensia.

WeederH: an algorithm for finding conserved regulatory motifs and regions in homologous sequences

Directory of Open Access Journals (Sweden)

Pesole Graziano

2007-02-01

Full Text Available Abstract Background This work addresses the problem of detecting conserved transcription factor binding sites and in general regulatory regions through the analysis of sequences from homologous genes, an approach that is becoming more and more widely used given the ever increasing amount of genomic data available. Results We present an algorithm that identifies conserved transcription factor binding sites in a given sequence by comparing it to one or more homologs, adapting a framework we previously introduced for the discovery of sites in sequences from co-regulated genes. Differently from the most commonly used methods, the approach we present does not need or compute an alignment of the sequences investigated, nor resorts to descriptors of the binding specificity of known transcription factors. The main novel idea we introduce is a relative measure of conservation, assuming that true functional elements should present a higher level of conservation with respect to the rest of the sequence surrounding them. We present tests where we applied the algorithm to the identification of conserved annotated sites in homologous promoters, as well as in distal regions like enhancers. Conclusion Results of the tests show how the algorithm can provide fast and reliable predictions of conserved transcription factor binding sites regulating the transcription of a gene, with better performances than other available methods for the same task. We also show examples on how the algorithm can be successfully employed when promoter annotations of the genes investigated are missing, or when regulatory sites and regions are located far away from the genes.

Electron Energization and Mixing Observed by MMS in the Vicinity of an Electron Diffusion Region During Magnetopause Reconnection

Science.gov (United States)

Chen, Li-Jen; Hesse, Michael; Wang, Shan; Gershman, Daniel; Ergun, Robert; Pollock, Craig; Torbert, Roy; Bessho, Naoki; Daughton, William; Dorelli, John;

Characterization of Pseudomonas chlororaphis myovirus 201φ2-1 via genomic sequencing, mass spectrometry, and electron microscopy

International Nuclear Information System (INIS)

Thomas, Julie A.; Rolando, Mandy R.; Carroll, Christopher A.; Shen, Peter S.; Belnap, David M.; Weintraub, Susan T.; Serwer, Philip; Hardies, Stephen C.

2008-01-01

Pseudomonas chlororaphis phage 201φ2-1 is a relative of Pseudomonas aeruginosa myovirus φKZ. Phage 201φ2-1 was examined by complete genomic sequencing (316,674 bp), by a comprehensive mass spectrometry survey of its virion proteins and by electron microscopy. Seventy-six proteins, of which at least 69 have homologues in φKZ, were identified by mass spectrometry. Eight proteins, in addition to the major head, tail sheath and tail tube proteins, are abundant in the virion. Electron microscopy of 201φ2-1 revealed a multitude of long, fine fibers apparently decorating the tail sheath protein. Among the less abundant virion proteins are three homologues to RNA polymerase β or β' subunits. Comparison between the genomes of 201φ2-1 and φKZ revealed substantial conservation of the genome plan, and a large region with an especially high rate of gene replacement. The φKZ-like phages exhibited a two-fold higher rate of divergence than for T4-like phages or host genomes

A new method for detecting signal regions in ordered sequences of real numbers, and application to viral genomic data.

Science.gov (United States)

Gog, Julia R; Lever, Andrew M L; Skittrall, Jordan P

2018-01-01

We present a fast, robust and parsimonious approach to detecting signals in an ordered sequence of numbers. Our motivation is in seeking a suitable method to take a sequence of scores corresponding to properties of positions in virus genomes, and find outlying regions of low scores. Suitable statistical methods without using complex models or making many assumptions are surprisingly lacking. We resolve this by developing a method that detects regions of low score within sequences of real numbers. The method makes no assumptions a priori about the length of such a region; it gives the explicit location of the region and scores it statistically. It does not use detailed mechanistic models so the method is fast and will be useful in a wide range of applications. We present our approach in detail, and test it on simulated sequences. We show that it is robust to a wide range of signal morphologies, and that it is able to capture multiple signals in the same sequence. Finally we apply it to viral genomic data to identify regions of evolutionary conservation within influenza and rotavirus.

Sequence analysis of the canine mitochondrial DNA control region from shed hair samples in criminal investigations.

Science.gov (United States)

Berger, C; Berger, B; Parson, W

2012-01-01

In recent years, evidence from domestic dogs has increasingly been analyzed by forensic DNA testing. Especially, canine hairs have proved most suitable and practical due to the high rate of hair transfer occurring between dogs and humans. Starting with the description of a contamination-free sample handling procedure, we give a detailed workflow for sequencing hypervariable segments (HVS) of the mtDNA control region from canine evidence. After the hair material is lysed and the DNA extracted by Phenol/Chloroform, the amplification and sequencing strategy comprises the HVS I and II of the canine control region and is optimized for DNA of medium-to-low quality and quantity. The sequencing procedure is based on the Sanger Big-dye deoxy-terminator method and the separation of the sequencing reaction products is performed on a conventional multicolor fluorescence detection capillary electrophoresis platform. Finally, software-aided base calling and sequence interpretation are addressed exemplarily.

Electron density in the emission-line region of Wolf-Rayet stars

International Nuclear Information System (INIS)

Varshni, Y.P.

1978-01-01

The Inglis-Teller relation, generalized for a hydrogen-like or alkali-like ion with an arbitrary core charge, is used to estimate the electron density in the emission-like region of Wolf-Rayet stars. It is found that the electron density in the region which gives rise to He II emission lines is approximately = 4 x 10 14 cm -3 . (Auth.)

DNA sequence analysis of the photosynthesis region of Rhodobacter sphaeroides 2.4.1T

OpenAIRE

Choudhary, M.; Kaplan, Samuel

2000-01-01

This paper describes the DNA sequence of the photosynthesis region of Rhodobacter sphaeroides 2.4.1T. The photosynthesis gene cluster is located within a ~73 kb AseI genomic DNA fragment containing the puf, puhA, cycA and puc operons. A total of 65 open reading frames (ORFs) have been identified, of which 61 showed significant similarity to genes/proteins of other organisms while only four did not reveal any significant sequence similarity to any gene/protein sequences in the database. The da...

Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region

Energy Technology Data Exchange (ETDEWEB)

Miyamoto, M.M.; Slightom, J.L.; Goodman, M.

1987-10-16

Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee are more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.

Rapid sequence divergence rates in the 5 prime regulatory regions of young Drosophila melanogaster duplicate gene pairs

Directory of Open Access Journals (Sweden)

Michael H. Kohn

2008-01-01

Full Text Available While it remains a matter of some debate, rapid sequence evolution of the coding sequences of duplicate genes is characteristic for early phases past duplication, but long established duplicates generally evolve under constraint, much like the rest of the coding genome. As for coding sequences, it may be possible to infer evolutionary rate, selection, and constraint via contrasts between duplicate gene divergence in the 5 prime regions and in the corresponding synonymous site divergence in the coding regions. Finding elevated rates for the 5 prime regions of duplicated genes, in addition to the coding regions, would enable statements regarding the early processes of duplicate gene evolution. Here, 1 kb of each of the 5 prime regulatory regions of Drosophila melanogaster duplicate gene pairs were mapped onto one another to isolate shared sequence blocks. Genetic distances within shared sequence blocks (d5’ were found to increase as a function of synonymous (dS, and to a lesser extend, amino-acid (dA site divergence between duplicates. The rate d5’/dS was found to rapidly decay from values > 1 in young duplicate pairs (dS 0.8. Such rapid rates of 5 prime evolution exceeding 1 (~neutral predominantly were found to occur in duplicate pairs with low amino-acid site divergence and that tended to be co-regulated when assayed on microarrays. Conceivably, functional redundancy and relaxation of selective constraint facilitates subsequent positive selection on the 5 prime regions of young duplicate genes. This might promote the evolution of new functions (neofunctionalization or division of labor among duplicate genes (subfunctionalization. In contrast, similar to the vast portion of the non-coding genome, the 5 prime regions of long-established gene duplicates appear to evolve under selective constraint, indicating that these long-established gene duplicates have assumed critical functions.

Digital Sequences and a Time Reversal-Based Impact Region Imaging and Localization Method

Science.gov (United States)

Qiu, Lei; Yuan, Shenfang; Mei, Hanfei; Qian, Weifeng

2013-01-01

To reduce time and cost of damage inspection, on-line impact monitoring of aircraft composite structures is needed. A digital monitor based on an array of piezoelectric transducers (PZTs) is developed to record the impact region of impacts on-line. It is small in size, lightweight and has low power consumption, but there are two problems with the impact alarm region localization method of the digital monitor at the current stage. The first one is that the accuracy rate of the impact alarm region localization is low, especially on complex composite structures. The second problem is that the area of impact alarm region is large when a large scale structure is monitored and the number of PZTs is limited which increases the time and cost of damage inspections. To solve the two problems, an impact alarm region imaging and localization method based on digital sequences and time reversal is proposed. In this method, the frequency band of impact response signals is estimated based on the digital sequences first. Then, characteristic signals of impact response signals are constructed by sinusoidal modulation signals. Finally, the phase synthesis time reversal impact imaging method is adopted to obtain the impact region image. Depending on the image, an error ellipse is generated to give out the final impact alarm region. A validation experiment is implemented on a complex composite wing box of a real aircraft. The validation results show that the accuracy rate of impact alarm region localization is approximately 100%. The area of impact alarm region can be reduced and the number of PZTs needed to cover the same impact monitoring region is reduced by more than a half. PMID:24084123

Mechanisms of the electron density depletion in the SAR arc region

Directory of Open Access Journals (Sweden)

A. V. Pavlov

1996-02-01

Full Text Available This study compares the measurements of electron density and temperature and the integral airglow intensity at 630 nm in the SAR arc region and slightly south of this (obtained by the Isis 2 spacecraft during the 18 December 1971 magnetic storm, with the model results obtained using the time dependent one-dimensional mathematical model of the Earth\\'s ionosphere and plasmasphere. The explicit expression in the third Enskog approximation for the electron thermal conductivity coefficient in the multicomponent mixture of ionized gases and a simplified calculation method for this coefficient presents an opportunity to calculate more exactly the electron temperature and density and 630 nm emission within SAR arc region are used in the model. Collisions between N2 and hot thermal electrons in the SAR arc region produce vibrationally excited nitrogen molecules. It appears that the loss rate of O+(4S due to reactions with the vibrationally excited nitrogen is enough to explain electron density depression by a factor of two at F-region heights and the topside ionosphere density variations within the SAR arc if the erosion of plasma within geomagnetic field tubes, during the main phase of the geomagnetic storm and subsequent filling of geomagnetic tubes during the recovery phase, are considered. To explain the disagreement by a factor 1.5 between the observed and modeled SAR arc electron densities an additional plasma drift velocity ~–30 m s–1 in the ion continuity equations is needed during the recovery phase. This additional plasma drift velocity is likely caused by the transition from convecting to corotating flux tubes on the equatorward wall of the trough. The electron densities and temperatures and 630 nm integral intensity at the SAR arc and slightly south of this region as measured for the 18 December 1971 magnetic storm were correctly described by the model without perpendicular electric fields. Within this model framework the effect of the

Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation

International Nuclear Information System (INIS)

Maat, J.

1978-01-01

A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)

The Regulation of electronic money institutions in the SADC region ...

African Journals Online (AJOL)

It looks in particular at how the institutions that issue new electronic money products are regulated ... This development has become global and involves both developed and developing countries, including regions such as the SADC. ... regulatory challenges that came about with the development of electronic money and to ...

Natural selection in a population of Drosophila melanogaster explained by changes in gene expression caused by sequence variation in core promoter regions.

Science.gov (United States)

Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado

2016-02-09

Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning

Sequence specific electronic conduction through polyion-stabilized double-stranded DNA in nanoscale break junctions

International Nuclear Information System (INIS)

Mahapatro, Ajit K; Jeong, Kyung J; Lee, Gil U; Janes, David B

2007-01-01

This paper presents a study of sequence specific electronic conduction through short (15-base-pair) double-stranded (ds) DNA molecules, measured by immobilizing 3 ' -thiol-derivatized DNAs in nanometre scale gaps between gold electrodes. The polycation spermidine was used to stabilize the ds-DNA structure, allowing electrical measurements to be performed in a dry state. For specific sequences, the conductivity was observed to scale with the surface density of immobilized DNA, which can be controlled by the buffer concentration. A series of 15-base DNA oligonucleotide pairs, in which the centre sequence of five base pairs was changed from G:C to A:T pairs, has been studied. The conductivity per molecule is observed to decrease exponentially with the number of adjacent A:T pairs replacing G:C pairs, consistent with a barrier at the A:T sites. Conductance-based devices for short DNA sequences could provide sensing approaches with direct electrical readout, as well as label-free detection

Mechanisms of the electron density depletion in the SAR arc region

Directory of Open Access Journals (Sweden)

A. V. Pavlov

Full Text Available This study compares the measurements of electron density and temperature and the integral airglow intensity at 630 nm in the SAR arc region and slightly south of this (obtained by the Isis 2 spacecraft during the 18 December 1971 magnetic storm, with the model results obtained using the time dependent one-dimensional mathematical model of the Earth's ionosphere and plasmasphere. The explicit expression in the third Enskog approximation for the electron thermal conductivity coefficient in the multicomponent mixture of ionized gases and a simplified calculation method for this coefficient presents an opportunity to calculate more exactly the electron temperature and density and 630 nm emission within SAR arc region are used in the model. Collisions between N₂ and hot thermal electrons in the SAR arc region produce vibrationally excited nitrogen molecules. It appears that the loss rate of O⁺(⁴S due to reactions with the vibrationally excited nitrogen is enough to explain electron density depression by a factor of two at F-region heights and the topside ionosphere density variations within the SAR arc if the erosion of plasma within geomagnetic field tubes, during the main phase of the geomagnetic storm and subsequent filling of geomagnetic tubes during the recovery phase, are considered. To explain the disagreement by a factor 1.5 between the observed and modeled SAR arc electron densities an additional plasma drift velocity ~–30 m s^–1 in the ion continuity equations is needed during the recovery phase. This additional plasma drift velocity is likely caused by the transition from convecting to corotating flux tubes on the equatorward wall of the trough. The electron densities and temperatures and 630 nm integral intensity at the SAR arc and slightly south of this region as measured for the 18 December 1971 magnetic storm were correctly described by the model without perpendicular electric fields

The male-specific region of the human Y chromosome is a mosaic of discrete sequence classes

NARCIS (Netherlands)

Skaletsky, Helen; Kuroda-Kawaguchi, Tomoko; Minx, Patrick J.; Cordum, Holland S.; Hillier, LaDeana; Brown, Laura G.; Repping, Sjoerd; Pyntikova, Tatyana; Ali, Johar; Bieri, Tamberlyn; Chinwalla, Asif; Delehaunty, Andrew; Delehaunty, Kim; Du, Hui; Fewell, Ginger; Fulton, Lucinda; Fulton, Robert; Graves, Tina; Hou, Shun-Fang; Latrielle, Philip; Leonard, Shawn; Mardis, Elaine; Maupin, Rachel; McPherson, John; Miner, Tracie; Nash, William; Nguyen, Christine; Ozersky, Philip; Pepin, Kymberlie; Rock, Susan; Rohlfing, Tracy; Scott, Kelsi; Schultz, Brian; Strong, Cindy; Tin-Wollam, Aye; Yang, Shiaw-Pyng; Waterston, Robert H.; Wilson, Richard K.; Rozen, Steve; Page, David C.

2003-01-01

The male-specific region of the Y chromosome, the MSY, differentiates the sexes and comprises 95% of the chromosome's length. Here, we report that the MSY is a mosaic of heterochromatic sequences and three classes of euchromatic sequences: X-transposed, X-degenerate and ampliconic. These classes

Identification of Dendrobium species by a candidate DNA barcode sequence: the chloroplast psbA-trnH intergenic region.

Science.gov (United States)

Yao, Hui; Song, Jing-Yuan; Ma, Xin-Ye; Liu, Chang; Li, Ying; Xu, Hong-Xi; Han, Jian-Ping; Duan, Li-Sheng; Chen, Shi-Lin

2009-05-01

DNA barcoding is a novel technology that uses a standard DNA sequence to facilitate species identification. Although a consensus has not been reached regarding which DNA sequences can be used as the best plant barcodes, the psbA-trnH spacer region has been tested extensively in recent years. In this study, we hypothesize that the psbA-trnH spacer regions are also effective barcodes for Dendrobium species. We have sequenced the chloroplast psbA-trnH intergenic spacers of 17 Dendrobium species to test this hypothesis. The sequences were found to be significantly different from those of other species, with percentages of variation ranging from 0.3 % to 2.3 % and an average of 1.2 %. In contrast, the intraspecific variation among the Dendrobium species studied ranged from 0 % to 0.1 %. The sequence difference between the psbA-trnH sequences of 17 Dendrobium species and one Bulbophyllum odoratissimum ranged from 2.0 % to 3.1 %, with an average of 2.5 %. Our results support the notion that the psbA-trnH intergenic spacer region could be used as a barcode to distinguish various Dendrobium species and to differentiate Dendrobium species from other adulterating species. Copyright Georg Thieme Verlag KG Stuttgart. New York.

Genetic characterization of UCS region of Pneumocystis jirovecii and construction of allelic profiles of Indian isolates based on sequence typing at three regions.

Science.gov (United States)

Gupta, Rashmi; Mirdha, Bijay Ranjan; Guleria, Randeep; Kumar, Lalit; Luthra, Kalpana; Agarwal, Sanjay Kumar; Sreenivas, Vishnubhatla

2013-01-01

Pneumocystis jirovecii is an opportunistic pathogen that causes severe pneumonia in immunocompromised patients. To study the genetic diversity of P. jirovecii in India the upstream conserved sequence (UCS) region of Pneumocystis genome was amplified, sequenced and genotyped from a set of respiratory specimens obtained from 50 patients with a positive result for nested mitochondrial large subunit ribosomal RNA (mtLSU rRNA) PCR during the years 2005-2008. Of these 50 cases, 45 showed a positive PCR for UCS region. Variations in the tandem repeats in UCS region were characterized by sequencing all the positive cases. Of the 45 cases, one case showed five repeats, 11 cases showed four repeats, 29 cases showed three repeats and four cases showed two repeats. By running amplified DNA from all these cases on a high-resolution gel, mixed infection was observed in 12 cases (26.7%, 12/45). Forty three of 45 cases included in this study had previously been typed at mtLSU rRNA and internal transcribed spacer (ITS) region by our group. In the present study, the genotypes at those two regions were combined with UCS repeat patterns to construct allelic profiles of 43 cases. A total of 36 allelic profiles were observed in 43 isolates indicating high genetic variability. A statistically significant association was observed between mtLSU rRNA genotype 1, ITS type Ea and UCS repeat pattern 4. Copyright © 2012 Elsevier B.V. All rights reserved.

Re-annotation of the physical map of Glycine max for polyploid-like regions by BAC end sequence driven whole genome shotgun read assembly

Directory of Open Access Journals (Sweden)

Shultz Jeffry

2008-07-01

Full Text Available Abstract Background Many of the world's most important food crops have either polyploid genomes or homeologous regions derived from segmental shuffling following polyploid formation. The soybean (Glycine max genome has been shown to be composed of approximately four thousand short interspersed homeologous regions with 1, 2 or 4 copies per haploid genome by RFLP analysis, microsatellite anchors to BACs and by contigs formed from BAC fingerprints. Despite these similar regions,, the genome has been sequenced by whole genome shotgun sequence (WGS. Here the aim was to use BAC end sequences (BES derived from three minimum tile paths (MTP to examine the extent and homogeneity of polyploid-like regions within contigs and the extent of correlation between the polyploid-like regions inferred from fingerprinting and the polyploid-like sequences inferred from WGS matches. Results Results show that when sequence divergence was 1–10%, the copy number of homeologous regions could be identified from sequence variation in WGS reads overlapping BES. Homeolog sequence variants (HSVs were single nucleotide polymorphisms (SNPs; 89% and single nucleotide indels (SNIs 10%. Larger indels were rare but present (1%. Simulations that had predicted fingerprints of homeologous regions could be separated when divergence exceeded 2% were shown to be false. We show that a 5–10% sequence divergence is necessary to separate homeologs by fingerprinting. BES compared to WGS traces showed polyploid-like regions with less than 1% sequence divergence exist at 2.3% of the locations assayed. Conclusion The use of HSVs like SNPs and SNIs to characterize BACs wil improve contig building methods. The implications for bioinformatic and functional annotation of polyploid and paleopolyploid genomes show that a combined approach of BAC fingerprint based physical maps, WGS sequence and HSV-based partitioning of BAC clones from homeologous regions to separate contigs will allow reliable de

Cloning and sequence of the human adrenodoxin reductase gene

International Nuclear Information System (INIS)

Lin, Dong; Shi, Y.; Miller, W.L.

1990-01-01

Adrenodoxin reductase is a flavoprotein mediating electron transport to all mitochondrial forms of cytochrome P450. The authors cloned the human adrenodoxin reductase gene and characterized it by restriction endonuclease mapping and DNA sequencing. The entire gene is approximately 12 kilobases long and consists of 12 exons. The first exon encodes the first 26 of the 32 amino acids of the signal peptide, and the second exon encodes the remainder of signal peptide and the apparent FAD binding site. The remaining 10 exons are clustered in a region of only 4.3 kilobases, separated from the first two exons by a large intron of about 5.6 kilobases. Two forms of human adrenodoxin reductase mRNA, differing by the presence or absence of 18 bases in the middle of the sequence, arise from alternate splicing at the 5' end of exon 7. This alternately spliced region is directly adjacent to the NADPH binding site, which is entirely contained in exon 6. The immediate 5' flanking region lacks TATA and CAAT boxes; however, this region is rich in G+C and contains six copies of the sequence GGGCGGG, resembling promoter sequences of housekeeping genes. RNase protection experiments show that transcription is initiated from multiple sites in the 5' flanking region, located about 21-91 base pairs upstream from the AUG translational initiation codon

Where should MMS look for the electron and ion diffusion regions?

Science.gov (United States)

Lapenta, G.; Goldman, M. V.; Newman, D. L.; Olshevsky, V.

2015-12-01

Our message is that if we think of reconnection with the usual cartoon, the MMS mission should follow the advice of Indiana Jones: X never marks the spot. Based on 3D fully kinetic simulations started with a well defined x-line, we observe that reconnection transitions towards a more chaotic regime. Two fronts develop downstream of the x-line where the outflow meets the pre-existing plasma. In the fronts an instability develops caused by the local gradients of the density. The consequence is the break up of the fronts in a fashion similar to the classical fluid Rayleigh-Taylor instability with the formation of "fingers" of plasma and embedded magnetic fields. These fingers interact and produce secondary reconnection sites. We present several different diagnostics that prove the existence of these secondary reconnection sites. Each site is surrounded by its own electron diffusion region.At the fronts the ions are generally not magnetized and considerable ion slippage is present. The discovery we present is that electrons are also slipping, forming localized diffusion regions near secondary reconnection sites [1].The consequence of this discovery is twofold. First, the instability in the fronts has strong energetic implications. We observe that the energy transfer locally is very strong, an order of magnitude stronger than in the "X" line. However, this energy transfer is of both signs as it is natural for a wavy rippling with regions of magnetic to kinetic and regions of kinetic to magnetic energy conversion.Second, and most important for this session, is that MMS should not limit the search for electron diffusion regions to the location marked with X in all reconnection cartoons. Our simulations predict more numerous and perhaps more easily measurable electron diffusion regions in the fronts. [1] Lapenta, G et al., Nature Physics 11, 690-695 (2015)

Highly conserved intragenic HSV-2 sequences: Results from next-generation sequencing of HSV-2 UL and US regions from genital swabs collected from 3 continents.

Science.gov (United States)

Johnston, Christine; Magaret, Amalia; Roychoudhury, Pavitra; Greninger, Alexander L; Cheng, Anqi; Diem, Kurt; Fitzgibbon, Matthew P; Huang, Meei-Li; Selke, Stacy; Lingappa, Jairam R; Celum, Connie; Jerome, Keith R; Wald, Anna; Koelle, David M

2017-10-01

Understanding the variability in circulating herpes simplex virus type 2 (HSV-2) genomic sequences is critical to the development of HSV-2 vaccines. Genital lesion swabs containing ≥ 10 7 log 10 copies HSV DNA collected from Africa, the USA, and South America underwent next-generation sequencing, followed by K-mer based filtering and de novo genomic assembly. Sites of heterogeneity within coding regions in unique long and unique short (U L _U S ) regions were identified. Phylogenetic trees were created using maximum likelihood reconstruction. Among 46 samples from 38 persons, 1468 intragenic base-pair substitutions were identified. The maximum nucleotide distance between strains for concatenated U L_ U S segments was 0.4%. Phylogeny did not reveal geographic clustering. The most variable proteins had non-synonymous mutations in < 3% of amino acids. Unenriched HSV-2 DNA can undergo next-generation sequencing to identify intragenic variability. The use of clinical swabs for sequencing expands the information that can be gathered directly from these specimens. Copyright © 2017 Elsevier Inc. All rights reserved.

Regions of low electron density in the Earth plasmasphere

International Nuclear Information System (INIS)

Grigor'eva, V.P.; Pisareva, V.V.

1987-01-01

Regions with low electron density N e were detected in night, morning and evening hours according to observations of natural noise, made on board ''Prognos-5'' satellite from January till June, 1977 in the plasmasphere for the southern Earth semisphere. The largest regions with low N e values were located in the region of the Brazil magnetic anomaly in the range of geographic latitudes ∼ ± 30 deg from the equator and longitudes from 100 up to 240 deg E, as well as in the latitudes near-by the geomagnetic equator and in the regions with slight shift from it to the winter hemisphere

Sequence based polymorphic (SBP marker technology for targeted genomic regions: its application in generating a molecular map of the Arabidopsis thaliana genome

Directory of Open Access Journals (Sweden)

Sahu Binod B

2012-01-01

Full Text Available Abstract Background Molecular markers facilitate both genotype identification, essential for modern animal and plant breeding, and the isolation of genes based on their map positions. Advancements in sequencing technology have made possible the identification of single nucleotide polymorphisms (SNPs for any genomic regions. Here a sequence based polymorphic (SBP marker technology for generating molecular markers for targeted genomic regions in Arabidopsis is described. Results A ~3X genome coverage sequence of the Arabidopsis thaliana ecotype, Niederzenz (Nd-0 was obtained by applying Illumina's sequencing by synthesis (Solexa technology. Comparison of the Nd-0 genome sequence with the assembled Columbia-0 (Col-0 genome sequence identified putative single nucleotide polymorphisms (SNPs throughout the entire genome. Multiple 75 base pair Nd-0 sequence reads containing SNPs and originating from individual genomic DNA molecules were the basis for developing co-dominant SBP markers. SNPs containing Col-0 sequences, supported by transcript sequences or sequences from multiple BAC clones, were compared to the respective Nd-0 sequences to identify possible restriction endonuclease enzyme site variations. Small amplicons, PCR amplified from both ecotypes, were digested with suitable restriction enzymes and resolved on a gel to reveal the sequence based polymorphisms. By applying this technology, 21 SBP markers for the marker poor regions of the Arabidopsis map representing polymorphisms between Col-0 and Nd-0 ecotypes were generated. Conclusions The SBP marker technology described here allowed the development of molecular markers for targeted genomic regions of Arabidopsis. It should facilitate isolation of co-dominant molecular markers for targeted genomic regions of any animal or plant species, whose genomic sequences have been assembled. This technology will particularly facilitate the development of high density molecular marker maps, essential for

A unique genomic sequence in the Wolf-Hirschhorn syndrome [WHS] region of humans is conserved in the great apes.

Science.gov (United States)

Tarzami, S T; Kringstein, A M; Conte, R A; Verma, R S

1996-10-01

The Wolf-Hirschhorn syndrome (WHS) is caused by a partial deletion in the short arm of chromosome 4 band 16.3 (4p 16.3). A unique-sequence human DNA probe (39 kb) localized within this region has been used to search for sequence homology in the apes' equivalent chromosome 3 by FISH-technique. The WHS loci are conserved in higher primates at the expected position. Nevertheless, a control probe, which detects alphoid sequences of the pericentromeric region of humans, is diverged in chimpanzee, gorilla, and orangutan. The conservation of WHS loci and divergence of DNA alphoid sequences have further added to the controversy concerning human descent.

[Sequence polymorphisms of the mitochondrial DNA HVR I and HVR II regions in the Deng populations from Tibet in China].

Science.gov (United States)

Kang, Longli; Zhang, Xiaofeng; Liu, Kai; Zhao, Jianmin

2009-12-01

To analyze the sequence polymorphisms of the mitochondrial DNA hypervariable regions I (HVR I) and HVR II in the Deng population in Linzhi area of Tibet. mtDNAs obtained from 119 unrelated individuals were amplified and directly sequenced. One hundred and ten variable sites were identified, including nucleotide transitions, transversions, and insertions. In the HVR I region (nt16024-nt16365), 68 polymorphic sites and 119 haplotypes were observed, the genetic diversity was 0.9916. In the HVR II (nt73-nt340) region, 42 polymorphic sites and 113 haplotypes were observed, and the genetic diversity was 0.9907. The random match probability of the HVR I and HVR II regions were 0.0084 and 0.0093, respectively. When combining the HVR I and HVR II regions, 119 different haplotypes were found. The combined match probability of two unrelated persons having the same sequence was 0.0084. There are some unique polymorphic loci in the Deng population. There are different genetic structures between Chinese and other Asian populations in the mitochondrial DNA D-loop region. Sequence polymorphism of mitochondrial DNA HVR I and HVR II can be used as a genetic marker for forensic individual identification and genetic analysis.

Sequences within the 5' untranslated region regulate the levels of a kinetoplast DNA topoisomerase mRNA during the cell cycle.

Science.gov (United States)

Pasion, S G; Hines, J C; Ou, X; Mahmood, R; Ray, D S

1996-12-01

Gene expression in trypanosomatids appears to be regulated largely at the posttranscriptional level and involves maturation of mRNA precursors by trans splicing of a 39-nucleotide miniexon sequence to the 5' end of the mRNA and cleavage and polyadenylation at the 3' end of the mRNA. To initiate the identification of sequences involved in the periodic expression of DNA replication genes in trypanosomatids, we have mapped splice acceptor sites in the 5' flanking region of the TOP2 gene, which encodes the kinetoplast DNA topoisomerase, and have carried out deletion analysis of this region on a plasmid-encoded TOP2 gene. Block deletions within the 5' untranslated region (UTR) identified two regions (-608 to -388 and -387 to -186) responsible for periodic accumulation of the mRNA. Deletion of one or the other of these sequences had no effect on periodic expression of the mRNA, while deletion of both regions resulted in constitutive expression of the mRNA throughout the cell cycle. Subcloning of these sequences into the 5' UTR of a construct lacking both regions of the TOP2 5' UTR has shown that an octamer consensus sequence present in the 5' UTR of the TOP2, RPA1, and DHFR-TS mRNAs is required for normal cycling of the TOP2 mRNA. Mutation of the consensus octamer sequence in the TOP2 5' UTR in a plasmid construct containing only a single consensus octamer and that shows normal cycling of the plasmid-encoded TOP2 mRNA resulted in substantial reduction of the cycling of the mRNA level. These results imply a negative regulation of TOP2 mRNA during the cell cycle by a mechanism involving redundant elements containing one or more copies of a conserved octamer sequence within the 5' UTR of TOP2 mRNA.

Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

Science.gov (United States)

Wyszyńska-Koko, J; Kurył, J

2004-01-01

MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

ELECTRONIC RETAILING IN MACEDONIA-CASE STUDY OF OHRID REGION

Directory of Open Access Journals (Sweden)

MARGARITA JANESKA

2017-04-01

Full Text Available With electronic retailing that offers the possibility of direct sales, is no longer need expensive business premises, or paying high rents, or employing a number of vendors. There is also the possibility of selling to final consumers in any geographical region in different countries of the world by establishing instant communication, through presenting an interactive multimedia catalog that can offer numerous information то the customers. However, on the other hand, sales through the Internet can appear certain problems. Many potential buyers in the world still do not use the Internet, others don't have fast connections, others do not speak good English, also it requires the existence of trust between both parties, buyer and seller, as well as security in the execution of transactions. The aim of this paper is to treat electronic retailing in Macedonia which is becoming more popular as worldwide, especially in developed parts of the world like the US and Europe. Macedonian companies are increasingly applying electronic method of sale and communication with customers. The number of Internet users and on-line purchase is rapidly expanding what undoubtedly indicates that there is potential for advancement in this field. Also in this paper will be presented a case study where will be analyzed the current state for development of electronic retailing in Macedonia, especially region of Ohrid.

Electron Distribution Functions in the Diffusion Region of Asymmetric Magnetic Reconnection

Science.gov (United States)

Bessho, N.; Chen, L.-J.; Hesse, M.

2016-01-01

We study electron distribution functions in a diffusion region of antiparallel asymmetric reconnection by means of particle-in-cell simulations and analytical theory. At the electron stagnation point, the electron distribution comprises a crescent-shaped population and a core component. The crescent-shaped distribution is due to electrons coming from the magnetosheath toward the stagnation point and accelerated mainly by electric field normal to the current sheet. Only a part of magnetosheath electrons can reach the stagnation point and form the crescent-shaped distribution that has a boundary of a parabolic curve. The penetration length of magnetosheath electrons into the magnetosphere is derived. We expect that satellite observations can detect crescent-shaped electron distributions during magnetopause reconnection.

Electron streaking in the autoionization region of H2

International Nuclear Information System (INIS)

Palacios, Alicia; González-Castrillo, Alberto; Martín, Fernando

2015-01-01

We use a UV-pump/IR-probe scheme, combining a single attosecond UV pulse and a 750 nm IR pulse, to explore laser-assisted photoionization of the hydrogen molecule in the autoionization region. The electron energy distributions exhibit unusual streaking patterns that are explored for different angles of the electron ejection with respect to the polarization vector and the molecular axis. Moreover, by controlling the time delay between the pulses, we observe that one can suppress the autoionization channel. (paper)

Electron energy distribution function in a cathode fall region of DC-glow discharge

International Nuclear Information System (INIS)

Elakshar, F.F.; Garamoon, A.A.; Hassouba, M.A.

1997-01-01

Recently a substantial effort has been devoted towards the development of a quantitative microscopic measurements in the cathode fall region of the DC-glow discharge magnetron sputtering unit. The electron energy distribution function (EEDF) has been measured using a single Langmuir probe at the edge of the cathode fall. Two groups of electrons are observed in helium and argon gas discharges. The two groups have no chance to be thermalized since they leave the cathode fall region fast. The electron temperature measurements have been compared with spectroscopic determination. Plasma density has been computed and compared with probe measurements. Sources of the two groups of electrons are also discussed. (author)

Sequencing of a QTL-rich region of the Theobroma cacao genome using pooled BACs and the identification of trait specific candidate genes

Directory of Open Access Journals (Sweden)

Blackmon Barbara P

2011-07-01

Full Text Available Abstract Background BAC-based physical maps provide for sequencing across an entire genome or a selected sub-genomic region of biological interest. Such a region can be approached with next-generation whole-genome sequencing and assembly as if it were an independent small genome. Using the minimum tiling path as a guide, specific BAC clones representing the prioritized genomic interval are selected, pooled, and used to prepare a sequencing library. Results This pooled BAC approach was taken to sequence and assemble a QTL-rich region, of ~3 Mbp and represented by twenty-seven BACs, on linkage group 5 of the Theobroma cacao cv. Matina 1-6 genome. Using various mixtures of read coverages from paired-end and linear 454 libraries, multiple assemblies of varied quality were generated. Quality was assessed by comparing the assembly of 454 reads with a subset of ten BACs individually sequenced and assembled using Sanger reads. A mixture of reads optimal for assembly was identified. We found, furthermore, that a quality assembly suitable for serving as a reference genome template could be obtained even with a reduced depth of sequencing coverage. Annotation of the resulting assembly revealed several genes potentially responsible for three T. cacao traits: black pod disease resistance, bean shape index, and pod weight. Conclusions Our results, as with other pooled BAC sequencing reports, suggest that pooling portions of a minimum tiling path derived from a BAC-based physical map is an effective method to target sub-genomic regions for sequencing. While we focused on a single QTL region, other QTL regions of importance could be similarly sequenced allowing for biological discovery to take place before a high quality whole-genome assembly is completed.

Experimental study of the Hall effect and electron diffusion region during magnetic reconnection in a laboratory plasma

International Nuclear Information System (INIS)

Ren Yang; Yamada, Masaaki; Ji Hantao; Dorfman, Seth; Gerhardt, Stefan P.; Kulsrud, Russel

2008-01-01

The Hall effect during magnetic reconnection without an external guide field has been extensively studied in the laboratory plasma of the Magnetic Reconnection Experiment [M. Yamada et al., Phys. Plasmas 4, 1936 (1997)] by measuring its key signature, an out-of-plane quadrupole magnetic field, with magnetic probe arrays whose spatial resolution is on the order of the electron skin depth. The in-plane electron flow is deduced from out-of-plane magnetic field measurements. The measured in-plane electron flow and numerical results are in good agreement. The electron diffusion region is identified by measuring the electron outflow channel. The width of the electron diffusion region scales with the electron skin depth (∼5.5-7.5c/ω pe ) and the peak electron outflow velocity scales with the electron Alfven velocity (∼0.12-0.16V eA ), independent of ion mass. The measured width of the electron diffusion region is much wider and the observed electron outflow is much slower than those obtained in 2D numerical simulations. It is found that the classical and anomalous dissipation present in the experiment can broaden the electron diffusion region and slow the electron outflow. As a consequence, the electron outflow flux remains consistent with numerical simulations. The ions, as measured by a Mach probe, have a much wider outflow channel than the electrons, and their outflow is much slower than the electron outflow everywhere in the electron diffusion region

Nucleotide sequence of soybean chloroplast DNA regions which contain the psb A and trn H genes and cover the ends of the large single copy region and one end of the inverted repeats.

Science.gov (United States)

Spielmann, A; Stutz, E

1983-10-25

The soybean chloroplast psb A gene (photosystem II thylakoid membrane protein of Mr 32 000, lysine-free) and the trn H gene (tRNAHisGUG), which both map in the large single copy region adjacent to one of the inverted repeat structures (IR1), have been sequenced including flanking regions. The psb A gene shows in its structural part 92% sequence homology with the corresponding genes of spinach and N. debneyi and contains also an open reading frame for 353 aminoacids. The aminoacid sequence of a potential primary translation product (calculated Mr, 38 904, no lysine) diverges from that of spinach and N. debneyi in only two positions in the C-terminal part. The trn H gene has the same polarity as the psb A gene and the coding region is located at the very end of the large single copy region. The deduced sequence of the soybean chloroplast tRNAHisGUG is identical with that of Zea mays chloroplasts. Both ends of the large single copy region were sequenced including a small segment of the adjacent IR1 and IR2.

Improvement of dose distributions in abutment regions of intensity modulated radiation therapy and electron fields

International Nuclear Information System (INIS)

Dogan, Nesrin; Leybovich, Leonid B.; Sethi, Anil; Emami, Bahman

2002-01-01

In recent years, intensity modulated radiation therapy (IMRT) is used to radiate tumors that are in close proximity to vital organs. Targets consisting of a deep-seated region followed by a superficial one may be treated with abutting photon and electron fields. However, no systematic study regarding matching of IMRT and electron beams was reported. In this work, a study of dose distributions in the abutment region between tomographic and step-and-shoot IMRT and electron fields was carried out. A method that significantly improves dose homogeneity between abutting tomographic IMRT and electron fields was developed and tested. In this method, a target region that is covered by IMRT was extended into the superficial target area by ∼2.0 cm. The length and shape of IMRT target extension was chosen such that high isodose lines bent away from the region treated by the electrons. This reduced the magnitude of hot spots caused by the 'bulging effect' of electron field penumbra. To account for the uncertainties in positioning of the IMRT and electron fields, electron field penumbra was modified using conventional (photon) multileaf collimator (MLC). The electron beam was delivered in two steps: half of the dose delivered with MLCs in retracted position and another half with MLCs extended to the edge of electron field that abuts tomographic IMRT field. The experimental testing of this method using film dosimetry has demonstrated that the magnitude of the hot spots was reduced from ∼45% to ∼5% of the prescription dose. When an error of ±1.5 mm in field positioning was introduced, the dose inhomogeneity in the abutment region did not exceed ±15% of the prescription dose. With step-and-shoot IMRT, the most homogeneous dose distribution was achieved when there was a 3 mm gap between the IMRT and electron fields

Design of the large hadron electron collider interaction region

Science.gov (United States)

Cruz-Alaniz, E.; Newton, D.; Tomás, R.; Korostelev, M.

2015-11-01

The large hadron electron collider (LHeC) is a proposed upgrade of the Large Hadron Collider (LHC) within the high luminosity LHC (HL-LHC) project, to provide electron-nucleon collisions and explore a new regime of energy and luminosity for deep inelastic scattering. The design of an interaction region for any collider is always a challenging task given that the beams are brought into crossing with the smallest beam sizes in a region where there are tight detector constraints. In this case integrating the LHeC into the existing HL-LHC lattice, to allow simultaneous proton-proton and electron-proton collisions, increases the difficulty of the task. A nominal design was presented in the the LHeC conceptual design report in 2012 featuring an optical configuration that focuses one of the proton beams of the LHC to β*=10 cm in the LHeC interaction point to reach the desired luminosity of L =1033 cm-2 s-1 . This value is achieved with the aid of a new inner triplet of quadrupoles at a distance L*=10 m from the interaction point. However the chromatic beta beating was found intolerable regarding machine protection issues. An advanced chromatic correction scheme was required. This paper explores the feasibility of the extension of a novel optical technique called the achromatic telescopic squeezing scheme and the flexibility of the interaction region design, in order to find the optimal solution that would produce the highest luminosity while controlling the chromaticity, minimizing the synchrotron radiation power and maintaining the dynamic aperture required for stability.

ICME-driven sheath regions deplete the outer radiation belt electrons

Science.gov (United States)

Hietala, H.; Kilpua, E. K.; Turner, D. L.

2013-12-01

It is an outstanding question in space weather and solar wind-magnetosphere interaction studies, why some storms result in an increase of the outer radiation belt electron fluxes, while others deplete them or produce no change. One approach to this problem is to look at differences in the storm drivers. Traditionally drivers have been classified to Stream Interaction Regions (SIRs) and Interplanetary Coronal Mass Ejections (ICMEs). However, an 'ICME event' is a complex structure: The core is a magnetic cloud (MC; a clear flux rope structure). If the mass ejection is fast enough, it can drive a shock in front of it. This leads to the formation of a sheath region between the interplanetary shock and the leading edge of the MC. While both the sheath and the MC feature elevated solar wind speed, their other properties are very different. For instance, the sheath region has typically a much higher dynamic pressure than the magnetic cloud. Moreover, the sheath region has a high power in magnetic field and dynamic pressure Ultra Low Frequency (ULF) range fluctuations, while the MC is characterised by an extremely smooth magnetic field. Magnetic clouds have been recognised as important drivers magnetospheric activity since they can comprise long periods of very large southward Interplanetary Magnetic Field (IMF). Nevertheless, previous studies have shown that sheath regions can also act as storm drivers. In this study, we analyse the effects of ICME-driven sheath regions on the relativistic electron fluxes observed by GOES satellites on the geostationary orbit. We perform a superposed epoch analysis of 31 sheath regions from solar cycle 23. Our results show that the sheaths cause an approximately one order of magnitude decrease in the 24h-averaged electron fluxes. Typically the fluxes also stay below the pre-event level for more than two days. Further analysis reveals that the decrease does not depend on, e.g., whether the sheath interval contains predominantly northward

Regional Platform on Personal Computer Electronic Waste in Latin ...

International Development Research Centre (IDRC) Digital Library (Canada)

Regional Platform on Personal Computer Electronic Waste in Latin America and the Caribbean. Donation of ... This project aims to identify environmentally responsible and sustainable solutions to the problem of e-waste. ... Policy in Focus publishes a special issue profiling evidence to empower women in the labour market.

Capillary electrophoresis of Big-Dye terminator sequencing reactions for human mtDNA Control Region haplotyping in the identification of human remains.

Science.gov (United States)

Montesino, Marta; Prieto, Lourdes

2012-01-01

Cycle sequencing reaction with Big-Dye terminators provides the methodology to analyze mtDNA Control Region amplicons by means of capillary electrophoresis. DNA sequencing with ddNTPs or terminators was developed by (1). The progressive automation of the method by combining the use of fluorescent-dye terminators with cycle sequencing has made it possible to increase the sensibility and efficiency of the method and hence has allowed its introduction into the forensic field. PCR-generated mitochondrial DNA products are the templates for sequencing reactions. Different set of primers can be used to generate amplicons with different sizes according to the quality and quantity of the DNA extract providing sequence data for different ranges inside the Control Region.

Sequence analysis of the breakpoint regions of an X;5 translocation in a female with Duchenne muscular dystrophy

Energy Technology Data Exchange (ETDEWEB)

Bakel, I. van; Holt, S.; Craig, I. [Univ. of Oxford (United Kingdom)] [and others

1995-08-01

X;autosome translocations in females with Duchenne muscular dystrophy (DMD) provide an opportunity to study the mechanisms responsible for chromosomal rearrangements that occur in the germ line. We describe here a detailed molecular analysis of the translocation breakpoints of an X;autosome reciprocal translocation, t(X;5) (p21;q31.1), in a female with DMD. Cosmid clones that contained the X-chromosome breakpoint region were identified, and subclones that hybridized to the translocation junction fragment in restriction digests of the patient`s DNA were isolated and sequenced. Primers designed from the X-chromosomal sequence were used to obtain the junction fragments on the der(X) and the der(5) by inverse PCR. The resultant clones were also cloned and sequenced, and this information used to isolate the chromosome 5 breakpoint region. Comparison of the DNA sequences of the junction fragments with those of the breakpoint regions on chromosomes X and 5 revealed that the translocation arose by nonhomologous recombination with an imprecise reciprocal exchange. Four and six base pairs of unknown origin are inserted at the exchange points of the der(X) and der(5), respectively, and three nucleotides are deleted from the X-chromosome sequence. Two features were found that may have played a role in the generation of the translocation. These were (1) a repeat motif with an internal homopyrimidine stretch 10 bp upstream from the X-chromosome breakpoint and (2) a 9-bp sequence of 78% homology located near the breakpoints on chromosomes 5 and X. 32 refs., 4 figs., 2 tabs.

The 2012 Ferrara seismic sequence: Regional crustal structure, earthquake sources, and seismic hazard

Science.gov (United States)

Malagnini, Luca; Herrmann, Robert B.; Munafò, Irene; Buttinelli, Mauro; Anselmi, Mario; Akinci, Aybige; Boschi, E.

2012-10-01

Inadequate seismic design codes can be dangerous, particularly when they underestimate the true hazard. In this study we use data from a sequence of moderate-sized earthquakes in northeast Italy to validate and test a regional wave propagation model which, in turn, is used to understand some weaknesses of the current design spectra. Our velocity model, while regionalized and somewhat ad hoc, is consistent with geophysical observations and the local geology. In the 0.02-0.1 Hz band, this model is validated by using it to calculate moment tensor solutions of 20 earthquakes (5.6 ≥ MW ≥ 3.2) in the 2012 Ferrara, Italy, seismic sequence. The seismic spectra observed for the relatively small main shock significantly exceeded the design spectra to be used in the area for critical structures. Observations and synthetics reveal that the ground motions are dominated by long-duration surface waves, which, apparently, the design codes do not adequately anticipate. In light of our results, the present seismic hazard assessment in the entire Pianura Padana, including the city of Milan, needs to be re-evaluated.

Electron Energization and Structure of the Diffusion Region During Asymmetric Reconnection

Science.gov (United States)

Chen, Li-Jen; Hesse, Michael; Wang, Shan; Bessho, Naoki; Daughton, William

2016-01-01

Results from particle-in-cell simulations of reconnection with asymmetric upstream conditions are reported to elucidate electron energization and structure of the electron diffusion region (EDR). Acceleration of unmagnetized electrons results in discrete structures in the distribution functions and supports the intense current and perpendicular heating in the EDR. The accelerated electrons are cyclotron turned by the reconnected magnetic field to produce the outflow jets, and as such, the acceleration by the reconnection electric field is limited, leading to resistivity without particle-particle or particle-wave collisions. A map of electron distributions is constructed, and its spatial evolution is compared with quantities previously proposed to be EDR identifiers to enable effective identifications of the EDR in terrestrial magnetopause reconnection.

Design of the large hadron electron collider interaction region

Directory of Open Access Journals (Sweden)

E. Cruz-Alaniz

2015-11-01

Full Text Available The large hadron electron collider (LHeC is a proposed upgrade of the Large Hadron Collider (LHC within the high luminosity LHC (HL-LHC project, to provide electron-nucleon collisions and explore a new regime of energy and luminosity for deep inelastic scattering. The design of an interaction region for any collider is always a challenging task given that the beams are brought into crossing with the smallest beam sizes in a region where there are tight detector constraints. In this case integrating the LHeC into the existing HL-LHC lattice, to allow simultaneous proton-proton and electron-proton collisions, increases the difficulty of the task. A nominal design was presented in the the LHeC conceptual design report in 2012 featuring an optical configuration that focuses one of the proton beams of the LHC to β^{*}=10  cm in the LHeC interaction point to reach the desired luminosity of L=10^{33}  cm^{-2} s^{-1}. This value is achieved with the aid of a new inner triplet of quadrupoles at a distance L^{*}=10  m from the interaction point. However the chromatic beta beating was found intolerable regarding machine protection issues. An advanced chromatic correction scheme was required. This paper explores the feasibility of the extension of a novel optical technique called the achromatic telescopic squeezing scheme and the flexibility of the interaction region design, in order to find the optimal solution that would produce the highest luminosity while controlling the chromaticity, minimizing the synchrotron radiation power and maintaining the dynamic aperture required for stability.

Hydraulic fracturing and the Crooked Lake Sequences: Insights gleaned from regional seismic networks

Science.gov (United States)

Schultz, Ryan; Stern, Virginia; Novakovic, Mark; Atkinson, Gail; Gu, Yu Jeffrey

2015-04-01

Within central Alberta, Canada, a new sequence of earthquakes has been recognized as of 1 December 2013 in a region of previous seismic quiescence near Crooked Lake, ~30 km west of the town of Fox Creek. We utilize a cross-correlation detection algorithm to detect more than 160 events to the end of 2014, which is temporally distinguished into five subsequences. This observation is corroborated by the uniqueness of waveforms clustered by subsequence. The Crooked Lake Sequences have come under scrutiny due to its strong temporal correlation (>99.99%) to the timing of hydraulic fracturing operations in the Duvernay Formation. We assert that individual subsequences are related to fracturing stimulation and, despite adverse initial station geometry, double-difference techniques allow us to spatially relate each cluster back to a unique horizontal well. Overall, we find that seismicity in the Crooked Lake Sequences is consistent with first-order observations of hydraulic fracturing induced seismicity.

Spectral density of electron concentration fluctuations in ionospheric D region

International Nuclear Information System (INIS)

Martynenko, S.I.

1989-01-01

Expression for spectral density of electron concentration fluctuations in D-region with regard to the effect of ionization-recombination proceses and negative ions is obtained in terms of atmospheric turbulence model which obeys Kolmogorov-Obukhov 2/3 law

Sequence evolution of the hypervariable region in the putative envelope region E2/NS1 of hepatitis C virus is correlated with specific humoral immune responses.

OpenAIRE

van Doorn, L J; Capriles, I; Maertens, G; DeLeys, R; Murray, K; Kos, T; Schellekens, H; Quint, W

1995-01-01

Sequence evolution of the hypervariable region 1 (HVR1) in the N terminus of E2/NS1 of hepatitis C virus (HCV) was studied retrospectively in six chimpanzees inoculated with the same genotype 1b strain, containing a unique predominant HVR1 sequence. Immediately after inoculation, all animals contained the same HVR predominant sequence. Two animals developed an acute self-limiting infection. Anti-HVR1 immunoglobulin G (IgG) was produced 40 to 60 days after inoculation and rapidly disappeared a...

Implementing targeted region capture sequencing for the clinical detection of Alagille syndrome: An efficient and cost‑effective method.

Science.gov (United States)

Huang, Tianhong; Yang, Guilin; Dang, Xiao; Ao, Feijian; Li, Jiankang; He, Yizhou; Tang, Qiyuan; He, Qing

2017-11-01

Alagille syndrome (AGS) is a highly variable, autosomal dominant disease that affects multiple structures including the liver, heart, eyes, bones and face. Targeted region capture sequencing focuses on a panel of known pathogenic genes and provides a rapid, cost‑effective and accurate method for molecular diagnosis. In a Chinese family, this method was used on the proband and Sanger sequencing was applied to validate the candidate mutation. A de novo heterozygous mutation (c.3254_3255insT p.Leu1085PhefsX24) of the jagged 1 gene was identified as the potential disease‑causing gene mutation. In conclusion, the present study suggested that target region capture sequencing is an efficient, reliable and accurate approach for the clinical diagnosis of AGS. Furthermore, these results expand on the understanding of the pathogenesis of AGS.

On the Electron Diffusion Region in Asymmetric Reconnection with a Guide Magnetic Field

Science.gov (United States)

Hesse, Michael; Liu, Yi-Hsin; Chen, Li-Jen; Bessho, Naoki; Kuznetsova, Masha; Birn, Joachim; Burch, James L.

2016-01-01

Particle-in-cell simulations in a 2.5-D geometry and analytical theory are employed to study the electron diffusion region in asymmetric reconnection with a guide magnetic field. The analysis presented here demonstrates that similar to the case without guide field, in-plane flow stagnation and null of the in-plane magnetic field are well separated. In addition, it is shown that the electric field at the local magnetic X point is again dominated by inertial effects, whereas it remains dominated by nongyrotropic pressure effects at the in-plane flow stagnation point. A comparison between local electron Larmor radii and the magnetic gradient scale lengths predicts that distribution should become nongyrotropic in a region enveloping both field reversal and flow stagnation points. This prediction is verified by an analysis of modeled electron distributions, which show clear evidence of mixing in the critical region.

Comparative In silico Study of Sex-Determining Region Y (SRY) Protein Sequences Involved in Sex-Determining.

Science.gov (United States)

Vakili Azghandi, Masoume; Nasiri, Mohammadreza; Shamsa, Ali; Jalali, Mohsen; Shariati, Mohammad Mahdi

2016-04-01

The SRY gene (SRY) provides instructions for making a transcription factor called the sex-determining region Y protein. The sex-determining region Y protein causes a fetus to develop as a male. In this study, SRY of 15 spices included of human, chimpanzee, dog, pig, rat, cattle, buffalo, goat, sheep, horse, zebra, frog, urial, dolphin and killer whale were used for determine of bioinformatic differences. Nucleotide sequences of SRY were retrieved from the NCBI databank. Bioinformatic analysis of SRY is done by CLC Main Workbench version 5.5 and ClustalW (http:/www.ebi.ac.uk/clustalw/) and MEGA6 softwares. The multiple sequence alignment results indicated that SRY protein sequences from Orcinus orca (killer whale) and Tursiopsaduncus (dolphin) have least genetic distance of 0.33 in these 15 species and are 99.67% identical at the amino acid level. Homosapiens and Pantroglodytes (chimpanzee) have the next lowest genetic distance of 1.35 and are 98.65% identical at the amino acid level. These findings indicate that the SRY proteins are conserved in the 15 species, and their evolutionary relationships are similar.

Vertical and longitudinal electron density structures of equatorial E- and F-regions

Directory of Open Access Journals (Sweden)

P. S. Brahmanandam

2011-01-01

Full Text Available From global soundings of ionospheric electron density made with FORMOSAT 3/COSMIC satellites for September 2006–August 2009, day-night variations in vertical and longitudinal structures of the electron densities in equatorial E- and F-regions for different seasons are investigated for the first time. The results reveal that the wavenumber-3 and wavenumber-4 patterns dominated the nighttime (22:00–04:00 LT F-region longitudinal structures in solstice and in equinox seasons, respectively. In daytime (08:00–18:00 LT F-region, the wavenumber-4 patterns governed the longitudinal structures in the September equinox and December solstice, and wavenumber-3 in March equinox and June solstice respectively. A comparison of the daytime and nighttime longitudinal electron density structures indicates that they are approximately 180° out of phase with each other. It is believed that this out of phase relation is very likely the result of the opposite phase relation between daytime and nighttime nonmigrating diurnal tidal winds that modulate background E-region dynamo electric field at different places, leading to the day-night change in the locations of the equatorial plasma fountains that are responsible for the formation of the F-region longitudinal structures. Further, a good consistency between the locations of the density structures in the same seasons of the different years for both daytime and nighttime epochs has been noticed indicating that the source mechanism for these structures could be the same.

Two dimensional molecular electronics spectroscopy for molecular fingerprinting, DNA sequencing, and cancerous DNA recognition.

Science.gov (United States)

Rajan, Arunkumar Chitteth; Rezapour, Mohammad Reza; Yun, Jeonghun; Cho, Yeonchoo; Cho, Woo Jong; Min, Seung Kyu; Lee, Geunsik; Kim, Kwang S

2014-02-25

Laser-driven molecular spectroscopy of low spatial resolution is widely used, while electronic current-driven molecular spectroscopy of atomic scale resolution has been limited because currents provide only minimal information. However, electron transmission of a graphene nanoribbon on which a molecule is adsorbed shows molecular fingerprints of Fano resonances, i.e., characteristic features of frontier orbitals and conformations of physisorbed molecules. Utilizing these resonance profiles, here we demonstrate two-dimensional molecular electronics spectroscopy (2D MES). The differential conductance with respect to bias and gate voltages not only distinguishes different types of nucleobases for DNA sequencing but also recognizes methylated nucleobases which could be related to cancerous cell growth. This 2D MES could open an exciting field to recognize single molecule signatures at atomic resolution. The advantages of the 2D MES over the one-dimensional (1D) current analysis can be comparable to those of 2D NMR over 1D NMR analysis.

Self-reinforcing process of the reconnection electric field in the electron diffusion region and onset of collisionless magnetic reconnection

International Nuclear Information System (INIS)

Lu Quanming; Lu San; Huang Can; Wu Mingyu; Wang Shui

2013-01-01

The onset of collisionless magnetic reconnection is considered to be controlled by electron dynamics in the electron diffusion region, where the reconnection electric field is balanced mainly by the off-diagonal electron pressure tensor term. Two-dimensional particle-in-cell simulations are employed in this paper to investigate the self-reinforcing process of the reconnection electric field in the electron diffusion region, which is found to grow exponentially. A theoretical model is proposed to demonstrate such a process in the electron diffusion region. In addition the reconnection electric field in the pileup region, which is balanced mainly by the electromotive force term, is also found to grow exponentially and its growth rate is twice that in the electron diffusion region. (paper)

Plasma potential measurements in the edge region of the ISTTOK plasma, using electron emissive probes

International Nuclear Information System (INIS)

Ionita, C.; Balan, P.; Schrittwieser, R.; Cabral, J.A.; Fernandes, H.; Figueiredo, H. F.C.; Varandas, C.

2001-01-01

We have recently started to use electron-emissive probes for direct measurements of the plasma potential and its fluctuations in the edge region of the plasma ring in the tokamak ISTTOK in Lisbon, Portugal. This method is based on the fact that the electron emission current of such a probe is able to compensate electron temperature variations and electron drifts, which can occur in the edge plasma region of magnetized fusion devices, and which are making measurements with cold probes prone to errors. In this contribution we present some of the first results of our investigations in ISTTOK.(author)

Identification of new polymorphic regions and differentiation of cultivated olives (Olea europaea L.) through plastome sequence comparison

Science.gov (United States)

2010-01-01

Background The cultivated olive (Olea europaea L.) is the most agriculturally important species of the Oleaceae family. Although many studies have been performed on plastid polymorphisms to evaluate taxonomy, phylogeny and phylogeography of Olea subspecies, only few polymorphic regions discriminating among the agronomically and economically important olive cultivars have been identified. The objective of this study was to sequence the entire plastome of olive and analyze many potential polymorphic regions to develop new inter-cultivar genetic markers. Results The complete plastid genome of the olive cultivar Frantoio was determined by direct sequence analysis using universal and novel PCR primers designed to amplify all overlapping regions. The chloroplast genome of the olive has an organisation and gene order that is conserved among numerous Angiosperm species and do not contain any of the inversions, gene duplications, insertions, inverted repeat expansions and gene/intron losses that have been found in the chloroplast genomes of the genera Jasminum and Menodora, from the same family as Olea. The annotated sequence was used to evaluate the content of coding genes, the extent, and distribution of repeated and long dispersed sequences and the nucleotide composition pattern. These analyses provided essential information for structural, functional and comparative genomic studies in olive plastids. Furthermore, the alignment of the olive plastome sequence to those of other varieties and species identified 30 new organellar polymorphisms within the cultivated olive. Conclusions In addition to identifying mutations that may play a functional role in modifying the metabolism and adaptation of olive cultivars, the new chloroplast markers represent a valuable tool to assess the level of olive intercultivar plastome variation for use in population genetic analysis, phylogenesis, cultivar characterisation and DNA food tracking. PMID:20868482

ELECTRON CLOUD AT COLLIMATOR AND INJECTION REGION OF THE SPALLATION NEUTRON SOURCE ACCUMULATOR RING

International Nuclear Information System (INIS)

WANG, L.; HSEUH, H.-C.; LEE, Y.Y.; RAPARIA, D.; WEI, J.; COUSINEAU, S.

2005-01-01

The beam loss along the Spallation Neutron Source's accumulator ring is mainly located at the collimator region and injection region. This paper studied the electron cloud build-up at these two regions with the three-dimension program CLOUDLAND

An electron cooling device in the one MeV energy region

International Nuclear Information System (INIS)

Busso, L.; Tecchio, L.; Tosello, F.

1987-01-01

The project of an electron cooling device at 700 KeV electron energy is reported. The single parts of the device is described in detail. Electron beam diagnostics and technical problems is discussed. The electron gun, the accelerating/decelerating column and the collector have been studied by menas of the Herrmannsfeldt's program and at present are under construction. The high voltage system and the electron cooling magnet are also under construction. Vacuum tests with both hot and cold cathodes have demonstrated that the vacuum requirements can be attained by the use of non-evaporable getter (NEG) pumps between gun, collector and the cooling region. Both kinds of diagnostic for longitudinal and transversal electron temperature measurements are in progress. A first prototype of the synchronous picj-up was successfully tested at CERN SPS. At present the diagnostic with laser beam is in preparation. During the next year the device will be assembled and the laboratory test will be started

The effects of alignment quality, distance calculation method, sequence filtering, and region on the analysis of 16S rRNA gene-based studies.

Directory of Open Access Journals (Sweden)

Patrick D Schloss

Full Text Available Pyrosequencing of PCR-amplified fragments that target variable regions within the 16S rRNA gene has quickly become a powerful method for analyzing the membership and structure of microbial communities. This approach has revealed and introduced questions that were not fully appreciated by those carrying out traditional Sanger sequencing-based methods. These include the effects of alignment quality, the best method of calculating pairwise genetic distances for 16S rRNA genes, whether it is appropriate to filter variable regions, and how the choice of variable region relates to the genetic diversity observed in full-length sequences. I used a diverse collection of 13,501 high-quality full-length sequences to assess each of these questions. First, alignment quality had a significant impact on distance values and downstream analyses. Specifically, the greengenes alignment, which does a poor job of aligning variable regions, predicted higher genetic diversity, richness, and phylogenetic diversity than the SILVA and RDP-based alignments. Second, the effect of different gap treatments in determining pairwise genetic distances was strongly affected by the variation in sequence length for a region; however, the effect of different calculation methods was subtle when determining the sample's richness or phylogenetic diversity for a region. Third, applying a sequence mask to remove variable positions had a profound impact on genetic distances by muting the observed richness and phylogenetic diversity. Finally, the genetic distances calculated for each of the variable regions did a poor job of correlating with the full-length gene. Thus, while it is tempting to apply traditional cutoff levels derived for full-length sequences to these shorter sequences, it is not advisable. Analysis of beta-diversity metrics showed that each of these factors can have a significant impact on the comparison of community membership and structure. Taken together, these results

[Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis].

Science.gov (United States)

Chen, Suiqing; Lu, Xiaolei; Wang, Lili

2011-05-01

To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.

Face processing regions are sensitive to distinct aspects of temporal sequence in facial dynamics.

Science.gov (United States)

Reinl, Maren; Bartels, Andreas

2014-11-15

Facial movement conveys important information for social interactions, yet its neural processing is poorly understood. Computational models propose that shape- and temporal sequence sensitive mechanisms interact in processing dynamic faces. While face processing regions are known to respond to facial movement, their sensitivity to particular temporal sequences has barely been studied. Here we used fMRI to examine the sensitivity of human face-processing regions to two aspects of directionality in facial movement trajectories. We presented genuine movie recordings of increasing and decreasing fear expressions, each of which were played in natural or reversed frame order. This two-by-two factorial design matched low-level visual properties, static content and motion energy within each factor, emotion-direction (increasing or decreasing emotion) and timeline (natural versus artificial). The results showed sensitivity for emotion-direction in FFA, which was timeline-dependent as it only occurred within the natural frame order, and sensitivity to timeline in the STS, which was emotion-direction-dependent as it only occurred for decreased fear. The occipital face area (OFA) was sensitive to the factor timeline. These findings reveal interacting temporal sequence sensitive mechanisms that are responsive to both ecological meaning and to prototypical unfolding of facial dynamics. These mechanisms are temporally directional, provide socially relevant information regarding emotional state or naturalness of behavior, and agree with predictions from modeling and predictive coding theory. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Quick regional centroid moment tensor solutions for the Emilia 2012 (northern Italy seismic sequence

Directory of Open Access Journals (Sweden)

Silvia Pondrelli

2012-10-01

Full Text Available In May 2012, a seismic sequence struck the Emilia region (northern Italy. The mainshock, of Ml 5.9, occurred on May 20, 2012, at 02:03 UTC. This was preceded by a smaller Ml 4.1 foreshock some hours before (23:13 UTC on May 19, 2012 and followed by more than 2,500 earthquakes in the magnitude range from Ml 0.7 to 5.2. In addition, on May 29, 2012, three further strong earthquakes occurred, all with magnitude Ml ≥5.2: a Ml 5.8 earthquake in the morning (07:00 UTC, followed by two events within just 5 min of each other, one at 10:55 UTC (Ml 5.3 and the second at 11:00 UTC (Ml 5.2. For all of the Ml ≥4.0 earthquakes in Italy and for all of the Ml ≥4.5 in the Mediterranean area, an automatic procedure for the computation of a regional centroid moment tensor (RCMT is triggered by an email alert. Within 1 h of the event, a manually revised quick RCMT (QRCMT can be published on the website if the solution is considered stable. In particular, for the Emilia seismic sequence, 13 QRCMTs were determined and for three of them, those with M >5.5, the automatically computed QRCMTs fitted the criteria for publication without manual revision. Using this seismic sequence as a test, we can then identify the magnitude threshold for automatic publication of our QRCMTs.

Comparative In silico Study of Sex-Determining Region Y (SRY Protein Sequences Involved in Sex-Determining

Directory of Open Access Journals (Sweden)

Masoume Vakili Azghandi

2016-05-01

Full Text Available Background: The SRY gene (SRY provides instructions for making a transcription factor called the sex-determining region Y protein. The sex-determining region Y protein causes a fetus to develop as a male. In this study, SRY of 15 spices included of human, chimpanzee, dog, pig, rat, cattle, buffalo, goat, sheep, horse, zebra, frog, urial, dolphin and killer whale were used for determine of bioinformatic differences. Methods: Nucleotide sequences of SRY were retrieved from the NCBI databank. Bioinformatic analysis of SRY is done by CLC Main Workbench version 5.5 and ClustalW (http:/www.ebi.ac.uk/clustalw/ and MEGA6 softwares. Results: The multiple sequence alignment results indicated that SRY protein sequences from Orcinus orca (killer whale and Tursiopsaduncus (dolphin have least genetic distance of 0.33 in these 15 species and are 99.67% identical at the amino acid level. Homosapiens and Pantroglodytes (chimpanzee have the next lowest genetic distance of 1.35 and are 98.65% identical at the amino acid level. Conclusion: These findings indicate that the SRY proteins are conserved in the 15 species, and their evolutionary relationships are similar.

Mechanisms of the electron density depletion in the SAR arc region

OpenAIRE

A. V. Pavlov

1996-01-01

This study compares the measurements of electron density and temperature and the integral airglow intensity at 630 nm in the SAR arc region and slightly south of this (obtained by the Isis 2 spacecraft during the 18 December 1971 magnetic storm), with the model results obtained using the time dependent one-dimensional mathematical model of the Earth's ionosphere and plasmasphere. The explicit expression in the third Enskog approximation for the electron thermal conductivity coefficient i...

Genomic region operation kit for flexible processing of deep sequencing data.

Science.gov (United States)

Ovaska, Kristian; Lyly, Lauri; Sahu, Biswajyoti; Jänne, Olli A; Hautaniemi, Sampsa

2013-01-01

Computational analysis of data produced in deep sequencing (DS) experiments is challenging due to large data volumes and requirements for flexible analysis approaches. Here, we present a mathematical formalism based on set algebra for frequently performed operations in DS data analysis to facilitate translation of biomedical research questions to language amenable for computational analysis. With the help of this formalism, we implemented the Genomic Region Operation Kit (GROK), which supports various DS-related operations such as preprocessing, filtering, file conversion, and sample comparison. GROK provides high-level interfaces for R, Python, Lua, and command line, as well as an extension C++ API. It supports major genomic file formats and allows storing custom genomic regions in efficient data structures such as red-black trees and SQL databases. To demonstrate the utility of GROK, we have characterized the roles of two major transcription factors (TFs) in prostate cancer using data from 10 DS experiments. GROK is freely available with a user guide from >http://csbi.ltdk.helsinki.fi/grok/.

"Diffusion" region of magnetic reconnection: electron orbits and the phase space mixing

Science.gov (United States)

Kropotkin, Alexey P.

2018-05-01

The nonlinear dynamics of electrons in the vicinity of magnetic field neutral lines during magnetic reconnection, deep inside the diffusion region where the electron motion is nonadiabatic, has been numerically analyzed. Test particle orbits are examined in that vicinity, for a prescribed planar two-dimensional magnetic field configuration and with a prescribed uniform electric field in the neutral line direction. On electron orbits, a strong particle acceleration occurs due to the reconnection electric field. Local instability of orbits in the neighborhood of the neutral line is pointed out. It combines with finiteness of orbits due to particle trapping by the magnetic field, and this should lead to the effect of mixing in the phase space, and the appearance of dynamical chaos. The latter may presumably be viewed as a mechanism producing finite conductivity in collisionless plasma near the neutral line. That conductivity is necessary to provide violation of the magnetic field frozen-in condition, i.e., for magnetic reconnection to occur in that region.

Pitch Angle Scattering of Upgoing Electron Beams in Jupiter's Polar Regions by Whistler Mode Waves

Science.gov (United States)

Elliott, S. S.; Gurnett, D. A.; Kurth, W. S.; Clark, G.; Mauk, B. H.; Bolton, S. J.; Connerney, J. E. P.; Levin, S. M.

2018-02-01

The Juno spacecraft's Jupiter Energetic-particle Detector Instrument has observed field-aligned, unidirectional (upgoing) electron beams throughout most of Jupiter's entire polar cap region. The Waves instrument detected intense broadband whistler mode emissions occurring in the same region. In this paper, we investigate the pitch angle scattering of the upgoing electron beams due to interactions with the whistler mode waves. Profiles of intensity versus pitch angle for electron beams ranging from 2.53 to 7.22 Jovian radii show inconsistencies with the expected adiabatic invariant motion of the electrons. It is believed that the observed whistler mode waves perturb the electron motion and scatter them away from the magnetic field line. The diffusion equation has been solved by using diffusion coefficients which depend on the magnetic intensity of the whistler mode waves.

Advantages of genome sequencing by long-read sequencer using SMRT technology in medical area.

Science.gov (United States)

Nakano, Kazuma; Shiroma, Akino; Shimoji, Makiko; Tamotsu, Hinako; Ashimine, Noriko; Ohki, Shun; Shinzato, Misuzu; Minami, Maiko; Nakanishi, Tetsuhiro; Teruya, Kuniko; Satou, Kazuhito; Hirano, Takashi

2017-07-01

PacBio RS II is the first commercialized third-generation DNA sequencer able to sequence a single molecule DNA in real-time without amplification. PacBio RS II's sequencing technology is novel and unique, enabling the direct observation of DNA synthesis by DNA polymerase. PacBio RS II confers four major advantages compared to other sequencing technologies: long read lengths, high consensus accuracy, a low degree of bias, and simultaneous capability of epigenetic characterization. These advantages surmount the obstacle of sequencing genomic regions such as high/low G+C, tandem repeat, and interspersed repeat regions. Moreover, PacBio RS II is ideal for whole genome sequencing, targeted sequencing, complex population analysis, RNA sequencing, and epigenetics characterization. With PacBio RS II, we have sequenced and analyzed the genomes of many species, from viruses to humans. Herein, we summarize and review some of our key genome sequencing projects, including full-length viral sequencing, complete bacterial genome and almost-complete plant genome assemblies, and long amplicon sequencing of a disease-associated gene region. We believe that PacBio RS II is not only an effective tool for use in the basic biological sciences but also in the medical/clinical setting.

Development of novel low-voltage free-electron lasers in the 5-500GHz region

International Nuclear Information System (INIS)

Zhong, Xiehe

2002-01-01

The electromagnetic spectrum from 5GHz to 500GHz is important for many industrial, commercial, and scientific applications. In particular for the 100 - 500GHz region, free electron lasers (FELs) are usually the only viable radiation sources with sizeable output power and as such are an attractive enabling technology for many applications. One major issue for widespread application of free electron lasers is to reduce their cost and size. This is particularly challenging because of the expensive electron accelerator system they employ. To make it significantly more attractive economically for many important applications, the electron energy has to be reduced to below 300keV. In this thesis two novel electron-energy-reduction techniques are investigated for FEL systems operated in the spectrum from 5GHz to 500GHz with the development of a suite of suitable FEL codes. In the microwave to millimetre-wave region, a novel energy reduction technique based on second harmonic waveguide FELs is studied. It is shown that the required electron voltage is approximately half of what is normally required for comparable conventional waveguide FELs. Effect of electron energy spread is studied for second harmonic waveguide FELs both in microwave and millimetre-wave regions. It is shown that strong wiggler field enhances electron hunching thereby increasing the small-signal gain as well as the insusceptibility to electron voltage spread. Saturation behaviour of second harmonic waveguide FELs is also studied because it is important for evaluation of output power. For FEL generation above 300GHz, it is found that second harmonic waveguide FELs need to increase electron energy above 300keV. To this end, a second energy reduction technique is considered based on a novel quasiperiodic wiggler. It is established that by changing the initial phase angle between the two component wigglers, strong radiation can be generated near 1THz with electron energy below 300keV. (author)

Effect of electron correlations and Breit interactions on ground-state fine-structures along the nitrogen-like isoelectronic sequence

International Nuclear Information System (INIS)

Wang Xiaolu; Lu Wenlai; Gao Xiang; Li Jiaming

2009-01-01

The accurate atomic data of nitrogen and nitrogen-like ions have an importance role in fusion plasma studies and astrophysics studies. The precise calculation of fine-structures is required to obtain such atomic data. Along the whole nitrogen isoelectronic sequence, the contributions of the electron correlations, the Breit interactions and the quantum electrodynamics corrections on the ground-state fine-structures are elucidated. When Z is low, the electron correlations are important, and the Breit interactions, which cannot be neglected cause interesting anomalous fine-structure splittings. When Z is high, the electron correlations are less important, and the Breit interactions are important in addition to spin-orbit interactions for precise calculations. (authors)

Draft genome sequences of three virulent Streptococcus thermophilus bacteriophages isolated from the dairy environment in the Veneto region of Italy

DEFF Research Database (Denmark)

Duarte, Viní­cius da Silva; Giaretta, Sabrina; Treu, Laura

2018-01-01

Streptococcus thermophilus, a very important dairy species, is constantly threatened by phage infection. We report the genome sequences of three S. thermophilus bacteriophages isolated from a dairy environment in the Veneto region of Italy. These sequences will be used for the development of new ...

Electron backstream to the source plasma region in an ion source

International Nuclear Information System (INIS)

Ohara, Y.; Akiba, M.; Arakawa, Y.; Okumura, Y.; Sakuraba, J.

1980-01-01

The flux of backstream electrons to the source plasma region increases significantly with the acceleration voltage of an ion beam, so that the back plate in the arc chamber should be broken for quasi-dc operation. The flux of backstream electrons is estimated at the acceleration voltage of 50--100 kV for a proton beam with the aid of ion beam simulation code. The power flux of backstream electrons is up to about 7% of the total beam output at the acceleration voltage of 75 kV. It is pointed out that the conventional ion sources such as the duoPIGatron or the bucket source which use a magnetic field for source plasma production are not suitable for quasi-dc and high-energy ion sources, because the surface heat flux of the back plate is increased by the focusing of backstream electrons and the removal of it is quite difficult. A new ion source which has an electron beam dump in the arc chamber is proposed

DVCS in the fragmentation region of polarized electron

International Nuclear Information System (INIS)

Akushevich, I.; Kuraev, E.A.; Nikolaev, N.N.

2000-01-01

For the kinematical region when a hard photon is emitted predominantly close to the direction of motion of a longitudinally polarized initial electron and relatively small momentum transfer to a proton we calculate the azimuthal asymmetry of a photon emission. It arises from the interference of the Bethe-Heitler amplitude and those which are described by a heavy photon impact factor. The azimuthal asymmetry does not decrease in the limit of infinite cms energy. The lowest order expression for the impact factor of a heavy photon is presented

A Statistical Study of Eiscat Electron and Ion Temperature Measurements In The E-region

Science.gov (United States)

Hussey, G.; Haldoupis, C.; Schlegel, K.; Bösinger, T.

Motivated by the large EISCAT data base, which covers over 15 years of common programme operation, and previous statistical work with EISCAT data (e.g., C. Hal- doupis, K. Schlegel, and G. Hussey, Auroral E-region electron density gradients mea- sured with EISCAT, Ann. Geopshysicae, 18, 1172-1181, 2000), a detailed statistical analysis of electron and ion EISCAT temperature measurements has been undertaken. This study was specifically concerned with the statistical dependence of heating events with other ambient parameters such as the electric field and electron density. The re- sults showed previously reported dependences such as the electron temperature being directly correlated with the ambient electric field and inversely related to the electron density. However, these correlations were found to be also dependent upon altitude. There was also evidence of the so called "Schlegel effect" (K. Schlegel, Reduced effective recombination coefficient in the disturbed polar E-region, J. Atmos. Terr. Phys., 44, 183-185, 1982); that is, the heated electron gas leads to increases in elec- tron density through a reduction in the recombination rate. This paper will present the statistical heating results and attempt to offer physical explanations and interpretations of the findings.

Electron scattering from CO in the 2Pi resonance region

International Nuclear Information System (INIS)

Buckman, S.J.; Lohmann, B.

1986-01-01

The total cross section for electron scattering from CO in the energy range 0.5--5 eV has been measured with use of a time-of-flight spectrometer. This energy region encompasses the 2 π shape resonance, and a comparison is made with other experimental and theoretical results with regard to the magnitude and position of this structure

Integration services to enable regional shared electronic health records.

Science.gov (United States)

Oliveira, Ilídio C; Cunha, João P S

2011-01-01

eHealth is expected to integrate a comprehensive set of patient data sources into a coherent continuum, but implementations vary and Portugal is still lacking on electronic patient data sharing. In this work, we present a clinical information hub to aggregate multi-institution patient data and bridge the information silos. This integration platform enables a coherent object model, services-oriented applications development and a trust framework. It has been instantiated in the Rede Telemática de Saúde (www.RTSaude.org) to support a regional Electronic Health Record approach, fed dynamically from production systems at eight partner institutions, providing access to more than 11,000,000 care episodes, relating to over 350,000 citizens. The network has obtained the necessary clearance from the Portuguese data protection agency.

Global view of F-region electron density and temperature at solar maximum

International Nuclear Information System (INIS)

Brace, L.H.; Theis, R.F.; Hoegy, W.R.

1982-01-01

Dynamics Explorer-2 is permitting the first measurements of the global structure of the F-regions at very high levels of solar activity (S>200). Selected full orbits of Langmuir probe measurements of electron temperature, T/sub e/, and density, N/sub e/, are shown to illustrate this global structure and some of the ionospheric features that are the topic of other papers in this issue. The ionospheric thermal structure is of particular interest because T/sub e/ is a sensitive indicator of the coupling of magnetospheric energy into the upper atmosphere. A comparison of these heating effects with those observed at solar minimum shows that the magnetospheric sources are more important at solar maximum, as might have been expected. Heating at the cusp, the auroral oval and the plasma-pause is generally both greater and more variable. Electron cooling rate calculations employing low latitude measurements indicate that solar extreme ultraviolet heating of the F region at solar maximum is enhanced by a factor that is greater than the increase in solar flux. Some of this enhanced electron heating arises from the increase in electron heating efficiency at the higher N/sub e/ of solar maximum, but this appears insufficient to completely resolve the discrepancy

Introduction of the Python script STRinNGS for analysis of STR regions in FASTQ or BAM files and expansion of the Danish STR sequence database to 11 STRs

DEFF Research Database (Denmark)

Friis, Susanne L; Buchard, Anders; Rockenbauer, Eszter

2016-01-01

This work introduces the in-house developed Python application STRinNGS for analysis of STR sequence elements in BAM or FASTQ files. STRinNGS identifies sequence reads with STR loci by their flanking sequences, it analyses the STR sequence and the flanking regions, and generates a report with the......This work introduces the in-house developed Python application STRinNGS for analysis of STR sequence elements in BAM or FASTQ files. STRinNGS identifies sequence reads with STR loci by their flanking sequences, it analyses the STR sequence and the flanking regions, and generates a report...

Fast electron microscopy via compressive sensing

Science.gov (United States)

Larson, Kurt W; Anderson, Hyrum S; Wheeler, Jason W

2014-12-09

Various technologies described herein pertain to compressive sensing electron microscopy. A compressive sensing electron microscope includes a multi-beam generator and a detector. The multi-beam generator emits a sequence of electron patterns over time. Each of the electron patterns can include a plurality of electron beams, where the plurality of electron beams is configured to impart a spatially varying electron density on a sample. Further, the spatially varying electron density varies between each of the electron patterns in the sequence. Moreover, the detector collects signals respectively corresponding to interactions between the sample and each of the electron patterns in the sequence.

ASAP: Amplification, sequencing & annotation of plastomes

Directory of Open Access Journals (Sweden)

Folta Kevin M

2005-12-01

Full Text Available Abstract Background Availability of DNA sequence information is vital for pursuing structural, functional and comparative genomics studies in plastids. Traditionally, the first step in mining the valuable information within a chloroplast genome requires sequencing a chloroplast plasmid library or BAC clones. These activities involve complicated preparatory procedures like chloroplast DNA isolation or identification of the appropriate BAC clones to be sequenced. Rolling circle amplification (RCA is being used currently to amplify the chloroplast genome from purified chloroplast DNA and the resulting products are sheared and cloned prior to sequencing. Herein we present a universal high-throughput, rapid PCR-based technique to amplify, sequence and assemble plastid genome sequence from diverse species in a short time and at reasonable cost from total plant DNA, using the large inverted repeat region from strawberry and peach as proof of concept. The method exploits the highly conserved coding regions or intergenic regions of plastid genes. Using an informatics approach, chloroplast DNA sequence information from 5 available eudicot plastomes was aligned to identify the most conserved regions. Cognate primer pairs were then designed to generate ~1 – 1.2 kb overlapping amplicons from the inverted repeat region in 14 diverse genera. Results 100% coverage of the inverted repeat region was obtained from Arabidopsis, tobacco, orange, strawberry, peach, lettuce, tomato and Amaranthus. Over 80% coverage was obtained from distant species, including Ginkgo, loblolly pine and Equisetum. Sequence from the inverted repeat region of strawberry and peach plastome was obtained, annotated and analyzed. Additionally, a polymorphic region identified from gel electrophoresis was sequenced from tomato and Amaranthus. Sequence analysis revealed large deletions in these species relative to tobacco plastome thus exhibiting the utility of this method for structural and

The ITS1-5.8S-ITS2 sequence region in the Musaceae: structure, diversity and use in molecular phylogeny.

Directory of Open Access Journals (Sweden)

Eva Hřibová

2011-03-01

Full Text Available Genes coding for 45S ribosomal RNA are organized in tandem arrays of up to several thousand copies and contain 18S, 5.8S and 26S rRNA units separated by internal transcribed spacers ITS1 and ITS2. While the rRNA units are evolutionary conserved, ITS show high level of interspecific divergence and have been used frequently in genetic diversity and phylogenetic studies. In this work we report on the structure and diversity of the ITS region in 87 representatives of the family Musaceae. We provide the first detailed information on ITS sequence diversity in the genus Musa and describe the presence of more than one type of ITS sequence within individual species. Both Sanger sequencing of amplified ITS regions and whole genome 454 sequencing lead to similar phylogenetic inferences. We show that it is necessary to identify putative pseudogenic ITS sequences, which may have negative effect on phylogenetic reconstruction at lower taxonomic levels. Phylogenetic reconstruction based on ITS sequence showed that the genus Musa is divided into two distinct clades--Callimusa and Australimusa and Eumusa and Rhodochlamys. Most of the intraspecific banana hybrids analyzed contain conserved parental ITS sequences, indicating incomplete concerted evolution of rDNA loci. Independent evolution of parental rDNA in hybrids enables determination of genomic constitution of hybrids using ITS. The observation of only one type of ITS sequence in some of the presumed interspecific hybrid clones warrants further study to confirm their hybrid origin and to unravel processes leading to evolution of their genomes.

A modification to the SCAR (Sequence Characterized Amplified Region method provides phylogenetic insights within Ceratozamia (Zamiaceae Una modificación al método SCAR (Sequence Characterized Amplified Region aporta entendimiento filogenético en Ceratozamia (Zamiaceae

Directory of Open Access Journals (Sweden)

Dolores González

2012-12-01

Full Text Available Phylogenetic relationships among closely related plant species are still problematic. DNA intergenic regions often are insufficiently variable to provide desired resolution or support. In this study, a modification to the Sequence Characterized Amplified Region (SCAR method was used to find polymorphic loci for phylogenetic analyses within Ceratozamia. RAPD markers were first used to detect variation in 5 species. Then, equal length fragments found in 2 or more species were excised from the gel, purified and digested with frequent cutter restriction enzymes for isolating both ends, which have the same primer site. Digested fragments were sequenced with the RAPD primer. Variable sequences were used to design specific primers for amplifying and sequencing in all species for phylogenetic analyses. Our results confirmed the previously known high genome sequence resemblance within this genus that contrasts with its high morphological variation. Only 7 parsimony informative characters were found with this approach. Nonetheless, the Digested-SCAR (D-SCAR method provided some phylogenetic insights. Four main clades consistent with distribution ranges of the species were detected. The approach presented here was effective to solve some relationships within the genus and can potentially be implemented in other organisms to find polymorphic loci for phylogenetic studies at any taxonomic level.Las relaciones filogenéticas entre especies de plantas cercanamente relacionadas es aún problemático. Las regiones intergénicas del ADN son a menudo insuficientemente variables para proveer los niveles de resolución y soporte deseados. En este estudio, se usó una modificación al método Sequence Characterized Amplified Region (SCAR para encontrar loci polimórficos para análisis filogenéticos en Ceratozamia. Primero se usaron marcadores RAPD para detectar variación en 5 especies; luego, se cortaron del gel los fragmentos de la misma longitud en 2 o m

Electronic excitation of some silicium compounds in the vacuum ultravi olet region

International Nuclear Information System (INIS)

Rocco, M.L.M.

1986-01-01

Angle-resolved electron energy-loss spectra have been measured for the tetramethylsilane, trimethylchlorosilane and dimethyldichloresilane molecules in the 5 - 300 eV energy range. The spectra have been obtained at 1 KeV incident energy, with an energy resolution of about 0.5 eV (valense region) and 0.8 eV (inner-shell region). Both the valence and core-level excitation bands can be as associated to transitions to Rydber and valence states. No dipole-allowed transition has been observed in the spectra measured in the angular range of 1 to 9 degrees (valence region) and 3 to 7 degrees (inner-shell region). (Author) [pt

Hot electron formation in thermal barrier region of tandem mirror GAMMA 10

International Nuclear Information System (INIS)

Katanuma, I.; Kiwamoto, Y.; Sawada, K.; Miyoshi, S.

1987-01-01

We have studied the hot electron build-up by the second harmonic electron cyclotron resonance heating in the thermal barrier region of tandem mirror GAMMA 10 by using a Fokker-Planck code with self-consistent potential profile taken into account. We have found two phases in the evolution of hot electron population and the potential profile. In the first phase where the RF diffusion is dominant quick increase of the hot electron density and that of the mean energy are observed. No further increase in the mean energy is observed thereafter. The potential is the deepest during the first phase. The second phase starts in the mean-free-time of the pitch angle scattering of hot electrons on cold electrons and ions. In this phase the hot electron population increases in the rate of the pitch angle scattering. The potential dip shallows due to the accumulation of pitch angle scattered passing ions. This observation indicates the necessity of the ion pumping for maintaining the negative potential at the thermal barrier. (author)

Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

Science.gov (United States)

de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

2015-01-01

The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Sequences of the joining region genes for immunoglobulin heavy chains and their role in generation of antibody diversity.

OpenAIRE

Gough, N M; Bernard, O

1981-01-01

To assess the contribution to immunoglobulin heavy chain diversity made by recombination between variable region (VH) genes and joining region (JH) genes, we have determined the sequence of about 2000 nucleotides spanning the rearranged JH gene cluster associated with the VH gene expressed in plasmacytoma HPC76. The active VH76 gene has recombined with the second germ-line JH gene. The region we have studied contains two other JH genes, designated JH3 and JH4. No other JH gene was found withi...

Sequence analysis and typing of Saprolegnia strains isolated from freshwater fish from Southern Chinese regions

Directory of Open Access Journals (Sweden)

Siya Liu

2017-09-01

Full Text Available Saprolegniasis, caused by Saprolegnia infection, is one of the most common diseases in freshwater fish. Our study aimed to determine the epidemiological characteristics of saprolegniasis in Chinese regions of high incidence. Saprolegnia were isolated and identified by morphological and molecular methods targeting the internal transcribed spacer (ITS ribosomal DNA (rDNA and building neighbor-joining (NJ and maximum parsimony (MP phylogenetic trees. The ITS sequences of eight isolated strains were compared with GenBank sequences and all strains fell into three clades: CLADE1 (02, LP, 04 and 14, CLADE2 (S1, and CLADE3 (CP, S2, L5 and the reference ATCC200013. Isolates 02 and LP shared 80% sequence similarity with S. diclina, S. longicaulis, S. ferax, S. mixta, and S. anomalies. Further, isolates 04 and 14 shared 80% similarity with S. bulbosa and S. oliviae. Finally, extremely high ITS sequence similarities were identified between isolates S1 and S. australis (100%; CP and S. hypogyna (96%; and S2, L5, ATCC200013 and S. salmonis (98%. This research provides insights into the identification, prevention and control of saprolegniasis pathogens and the potential development of effective drugs.

Electron temperature in the E-region of the ionosphere

International Nuclear Information System (INIS)

Zalpuri, K.S.; Oyama, K.-I.

1991-06-01

Various heating and cooling mechanisms which are operative in the lower E-region are discussed and their relative importance in different altitude range is shown. These heating and cooling rates are then used to derive the electron temperature T e . The calculated values of electron temperature are found to be higher than neutral temperature through out the altitude range 100 ∼ 150 km, with the difference increasing with increase in altitude. However, compared to observed values of T e , the calculated values are still smaller below about 130 km. Above this altitude, the calculated values become larger. Estimation of T e for different, suggested values of heating efficiency due to dissociative recombination, show that T e profile obtained even be assuming a constant value of 1.3 eV is in fairly good agreement with those derived based on variable values of this parameter. (author)

Genetic structure of Florida green turtle rookeries as indicated by mitochondrial DNA control region sequences

Science.gov (United States)

Shamblin, Brian M.; Bagley, Dean A.; Ehrhart, Llewellyn M.; Desjardin, Nicole A.; Martin, R. Erik; Hart, Kristen M.; Naro-Maciel, Eugenia; Rusenko, Kirt; Stiner, John C.; Sobel, Debra; Johnson, Chris; Wilmers, Thomas; Wright, Laura J.; Nairn, Campbell J.

2014-01-01

Green turtle (Chelonia mydas) nesting has increased dramatically in Florida over the past two decades, ranking the Florida nesting aggregation among the largest in the Greater Caribbean region. Individual beaches that comprise several hundred kilometers of Florida’s east coast and Keys support tens to thousands of nests annually. These beaches encompass natural to highly developed habitats, and the degree of demographic partitioning among rookeries was previously unresolved. We characterized the genetic structure of ten Florida rookeries from Cape Canaveral to the Dry Tortugas through analysis of 817 base pair mitochondrial DNA (mtDNA) control region sequences from 485 nesting turtles. Two common haplotypes, CM-A1.1 and CM-A3.1, accounted for 87 % of samples, and the haplotype frequencies were strongly partitioned by latitude along Florida’s Atlantic coast. Most genetic structure occurred between rookeries on either side of an apparent genetic break in the vicinity of the St. Lucie Inlet that separates Hutchinson Island and Jupiter Island, representing the finest scale at which mtDNA structure has been documented in marine turtle rookeries. Florida and Caribbean scale analyses of population structure support recognition of at least two management units: central eastern Florida and southern Florida. More thorough sampling and deeper sequencing are necessary to better characterize connectivity among Florida green turtle rookeries as well as between the Florida nesting aggregation and others in the Greater Caribbean region.

Aloe vera in active and passive regions of electronic devices towards a sustainable development

Science.gov (United States)

Lim, Zhe Xi; Sreenivasan, Sasidharan; Wong, Yew Hoong; Cheong, Kuan Yew

2017-07-01

The increasing awareness towards sustainable development of electronics has driven the search for natural bio-organic materials in place of conventional electronic materials. The concept of using natural bio-organic materials in electronics provides not only an effective solution to address global electronic waste crisis, but also a compelling template for sustainable electronics manufacturing. This paper attempts to provide an overview of using Aloe vera gel as a natural bio-organic material for various electronic applications. Important concepts such as responses of living Aloe vera plant towards electrical stimuli and demonstrations of Aloe vera films as passive and active regions of electronic devices are highlighted in chronological order. The biodegradability and biocompatibility of Aloe vera can bring the world a step closer towards the ultimate goal of sustainable development of electronic devices from "all-natural" materials.

Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences.

Science.gov (United States)

Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E

2016-09-01

Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. © 2016 Blackwell Verlag GmbH.

Improved annotation of 3' untranslated regions and complex loci by combination of strand-specific direct RNA sequencing, RNA-Seq and ESTs.

Directory of Open Access Journals (Sweden)

Nicholas J Schurch

Full Text Available The reference annotations made for a genome sequence provide the framework for all subsequent analyses of the genome. Correct and complete annotation in addition to the underlying genomic sequence is particularly important when interpreting the results of RNA-seq experiments where short sequence reads are mapped against the genome and assigned to genes according to the annotation. Inconsistencies in annotations between the reference and the experimental system can lead to incorrect interpretation of the effect on RNA expression of an experimental treatment or mutation in the system under study. Until recently, the genome-wide annotation of 3' untranslated regions received less attention than coding regions and the delineation of intron/exon boundaries. In this paper, data produced for samples in Human, Chicken and A. thaliana by the novel single-molecule, strand-specific, Direct RNA Sequencing technology from Helicos Biosciences which locates 3' polyadenylation sites to within +/- 2 nt, were combined with archival EST and RNA-Seq data. Nine examples are illustrated where this combination of data allowed: (1 gene and 3' UTR re-annotation (including extension of one 3' UTR by 5.9 kb; (2 disentangling of gene expression in complex regions; (3 clearer interpretation of small RNA expression and (4 identification of novel genes. While the specific examples displayed here may become obsolete as genome sequences and their annotations are refined, the principles laid out in this paper will be of general use both to those annotating genomes and those seeking to interpret existing publically available annotations in the context of their own experimental data.

Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags

Science.gov (United States)

de Souza, Sandro J.; Camargo, Anamaria A.; Briones, Marcelo R. S.; Costa, Fernando F.; Nagai, Maria Aparecida; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; de Fátima Sonati, Maria; Tajara, Eloiza H.; Valentini, Sandro R.; Acencio, Marcio; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Bengtson, Mário Henrique; Carraro, Dirce M.; Carvalho, Alex F.; Carvalho, Lúcia Helena; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Costa, Maria Cristina R.; Curcio, Cyntia; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Leite, Luciana C. C.; Maia, Gustavo; Majumder, Paromita; Marins, Mozart; Matsukuma, Adriana; Melo, Analy S. A.; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana Gilbert; Rahal, Paula; Rainho, Claudia A.; da Ro's, Nancy; de Sá, Renata G.; Sales, Magaly M.; da Silva, Neusa P.; Silva, Tereza C.; da Silva, Wilson; Simão, Daniel F.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Zalcberg, Heloisa; Brentani, Ricardo R.; Reis, Luis F. L.; Dias-Neto, Emmanuel; Simpson, Andrew J. G.

2000-01-01

Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central coding regions of the resulting transcripts. They are termed ORF expressed sequence tags (ORESTES). The 250,000 ORESTES were assembled into 81,429 contigs. Of these, 1,181 (1.45%) were found to match sequences in chromosome 22 with at least one ORESTES contig for 162 (65.6%) of the 247 known genes, for 67 (44.6%) of the 150 related genes, and for 45 of the 148 (30.4%) EST-predicted genes on this chromosome. Using a set of stringent criteria to validate our sequences, we identified a further 219 previously unannotated transcribed sequences on chromosome 22. Of these, 171 were in fact also defined by EST or full length cDNA sequences available in GenBank but not utilized in the initial annotation of the first human chromosome sequence. Thus despite representing less than 15% of all expressed human sequences in the public databases at the time of the present analysis, ORESTES sequences defined 48 transcribed sequences on chromosome 22 not defined by other sequences. All of the transcribed sequences defined by ORESTES coincided with DNA regions predicted as encoding exons by genscan. (http://genes.mit.edu/GENSCAN.html). PMID:11070084

Progress toward an aberration-corrected low energy electron microscope for DNA sequencing and surface analysis.

Science.gov (United States)

Mankos, Marian; Shadman, Khashayar; N'diaye, Alpha T; Schmid, Andreas K; Persson, Henrik H J; Davis, Ronald W

2012-11-01

Monochromatic, aberration-corrected, dual-beam low energy electron microscopy (MAD-LEEM) is a novel imaging technique aimed at high resolution imaging of macromolecules, nanoparticles, and surfaces. MAD-LEEM combines three innovative electron-optical concepts in a single tool: a monochromator, a mirror aberration corrector, and dual electron beam illumination. The monochromator reduces the energy spread of the illuminating electron beam, which significantly improves spectroscopic and spatial resolution. The aberration corrector is needed to achieve subnanometer resolution at landing energies of a few hundred electronvolts. The dual flood illumination approach eliminates charging effects generated when a conventional, single-beam LEEM is used to image insulating specimens. The low landing energy of electrons in the range of 0 to a few hundred electronvolts is also critical for avoiding radiation damage, as high energy electrons with kilo-electron-volt kinetic energies cause irreversible damage to many specimens, in particular biological molecules. The performance of the key electron-optical components of MAD-LEEM, the aberration corrector combined with the objective lens and a magnetic beam separator, was simulated. Initial results indicate that an electrostatic electron mirror has negative spherical and chromatic aberration coefficients that can be tuned over a large parameter range. The negative aberrations generated by the electron mirror can be used to compensate the aberrations of the LEEM objective lens for a range of electron energies and provide a path to achieving subnanometer spatial resolution. First experimental results on characterizing DNA molecules immobilized on Au substrates in a LEEM are presented. Images obtained in a spin-polarized LEEM demonstrate that high contrast is achievable at low electron energies in the range of 1-10 eV and show that small changes in landing energy have a strong impact on the achievable contrast. The MAD-LEEM approach

Characterization of the genomic organization of the region bordering the centromere of chromosome V of Podospora anserina by direct sequencing.

Science.gov (United States)

Silar, Philippe; Barreau, Christian; Debuchy, Robert; Kicka, Sébastien; Turcq, Béatrice; Sainsard-Chanet, Annie; Sellem, Carole H; Billault, Alain; Cattolico, Laurence; Duprat, Simone; Weissenbach, Jean

2003-08-01

A Podospora anserina BAC library of 4800 clones has been constructed in the vector pBHYG allowing direct selection in fungi. Screening of the BAC collection for centromeric sequences of chromosome V allowed the recovery of clones localized on either sides of the centromere, but no BAC clone was found to contain the centromere. Seven BAC clones containing 322,195 and 156,244bp from either sides of the centromeric region were sequenced and annotated. One 5S rRNA gene, 5 tRNA genes, and 163 putative coding sequences (CDS) were identified. Among these, only six CDS seem specific to P. anserina. The gene density in the centromeric region is approximately one gene every 2.8kb. Extrapolation of this gene density to the whole genome of P. anserina suggests that the genome contains about 11,000 genes. Synteny analyses between P. anserina and Neurospora crassa show that co-linearity extends at the most to a few genes, suggesting rapid genome rearrangements between these two species.

Possible interaction between thermal electrons and vibrationally excited N2 in the lower E-region

Directory of Open Access Journals (Sweden)

K.-I. Oyama

2011-03-01

Full Text Available As one of the tasks to find the energy source(s of thermal electrons, which elevate(s electron temperature higher than neutral temperature in the lower ionosphere E-region, energy distribution function of thermal electron was measured with a sounding rocket at the heights of 93–131 km by the applying second harmonic method. The energy distribution function showed a clear hump at the energy of ~0.4 eV. In order to find the reason of the hump, we conducted laboratory experiment. We studied difference of the energy distribution functions of electrons in thermal energy range, which were measured with and without EUV radiation to plasma of N2/Ar and N2/O2 gas mixture respectively. For N2/Ar gas mixture plasma, the hump is not clearly identified in the energy distribution of thermal electrons. On the other hand for N2/O2 gas mixture, which contains vibrationally excited N2, a clear hump is found when irradiated by EUV. The laboratory experiment seems to suggest that the hump is produced as a result of interaction between vibrationally excited N2 and thermal electrons, and this interaction is the most probable heating source for the electrons of thermal energy range in the lower E-region. It is also suggested that energy distribution of the electrons in high energy part may not be Maxwellian, and DC probe measures the electrons which are non Maxwellian, and therefore "electron temperature" is calculated higher.

High Sequence Variations in Mitochondrial DNA Control Region among Worldwide Populations of Flathead Mullet Mugil cephalus

Directory of Open Access Journals (Sweden)

Brian Wade Jamandre

2014-01-01

Full Text Available The sequence and structure of the complete mtDNA control region (CR of M. cephalus from African, Pacific, and Atlantic populations are presented in this study to assess its usefulness in phylogeographic studies of this species. The mtDNA CR sequence variations among M. cephalus populations largely exceeded intraspecific polymorphisms that are generally observed in other vertebrates. The length of CR sequence varied among M. cephalus populations due to the presence of indels and variable number of tandem repeats at the 3′ hypervariable domain. The high evolutionary rate of the CR in this species probably originated from these mutations. However, no excessive homoplasic mutations were noticed. Finally, the star shaped tree inferred from the CR polymorphism stresses a rapid radiation worldwide, in this species. The CR still appears as a good marker for phylogeographic investigations and additional worldwide samples are warranted to further investigate the genetic structure and evolution in M. cephalus.

Electron energy distribution function in the divertor region of the COMPASS tokamak during neutral beam injection heating

Science.gov (United States)

Hasan, E.; Dimitrova, M.; Havlicek, J.; Mitošinková, K.; Stöckel, J.; Varju, J.; Popov, Tsv K.; Komm, M.; Dejarnac, R.; Hacek, P.; Panek, R.; the COMPASS Team

2018-02-01

This paper presents the results from swept probe measurements in the divertor region of the COMPASS tokamak in D-shaped, L-mode discharges, with toroidal magnetic field BT = 1.15 T, plasma current Ip = 180 kA and line-average electron densities varying from 2 to 8×1019 m-3. Using neutral beam injection heating, the electron energy distribution function is studied before and during the application of the beam. The current-voltage characteristics data are processed using the first-derivative probe technique. This technique allows one to evaluate the plasma potential and the real electron energy distribution function (respectively, the electron temperatures and densities). At the low average electron density of 2×1019 m-3, the electron energy distribution function is bi-Maxwellian with a low-energy electron population with temperatures 4-6 eV and a high-energy electron group 12-25 eV. As the line-average electron density is increased, the electron temperatures decrease. At line-average electron densities above 7×1019 m-3, the electron energy distribution function is found to be Maxwellian with a temperature of 6-8.5 eV. The effect of the neutral beam injection heating power in the divertor region is also studied.

F-region electron density and Te / Ti measurements using incoherent scatter power data collected at ALTAIR

Directory of Open Access Journals (Sweden)

M. Milla

2006-07-01

Full Text Available The ALTAIR UHF radar was used in an incoherent scatter experiment to observe the low-latitude ionosphere during the Equis 2 rocket campaign. The measurements provided the first high-resolution electron density maps of the low-latitude D- and E-region in the Pacific sector and also extended into the F-region and topside ionosphere. Although the sampling frequency was well below the Nyquist frequency of F-region returns, we were able to estimate Te / Ti ratio and infer unbiased electron density estimates using a regularized inversion technique described here. The technique exploits magnetic aspect angle dependence of ISR cross-section for Te>Ti.

Modelling of the electron density height profiles in the mid-latitude ionospheric D-region

Directory of Open Access Journals (Sweden)

P. Y. Mukhtarov

1996-06-01

Full Text Available A new mid-latitude D-region (50-105 km model of the electron density is presented obtained on the basis of a full wave theory and by a trial-and-error inversion method. Daytime (at different solar zenith angles absorption measurements by A3-technique made in Bulgaria yielded data with the aid of which the seasonal and diurnal courses of the Ne(h-profiles were derived. Special attention is drawn to the event diurnal asymmetry, or uneven formation of the ionosphere as a function of insulation. The latter is probably connected with the influence of the diurnal fluctuations in the local temperature on the chemistry involved in the electron loss rate, as well as the diurnal variations of the main ionizing agent (NO in the D-region. That is why the Ne(h-profiles in the midlatitude D-region are modelled separately for morning and afternoon hours.

Genetic Diversity of Toxoplasma gondii Strains from Different Hosts and Geographical Regions by Sequence Analysis of GRA20 Gene.

Science.gov (United States)

Ning, Hong-Rui; Huang, Si-Yang; Wang, Jin-Lei; Xu, Qian-Ming; Zhu, Xing-Quan

2015-06-01

Toxoplasma gondii is a eukaryotic parasite of the phylum Apicomplexa, which infects all warm-blood animals, including humans. In the present study, we examined sequence variation in dense granule 20 (GRA20) genes among T. gondii isolates collected from different hosts and geographical regions worldwide. The complete GRA20 genes were amplified from 16 T. gondii isolates using PCR, sequence were analyzed, and phylogenetic reconstruction was analyzed by maximum parsimony (MP) and maximum likelihood (ML) methods. The results showed that the complete GRA20 gene sequence was 1,586 bp in length among all the isolates used in this study, and the sequence variations in nucleotides were 0-7.9% among all strains. However, removing the type III strains (CTG, VEG), the sequence variations became very low, only 0-0.7%. These results indicated that the GRA20 sequence in type III was more divergence. Phylogenetic analysis of GRA20 sequences using MP and ML methods can differentiate 2 major clonal lineage types (type I and type III) into their respective clusters, indicating the GRA20 gene may represent a novel genetic marker for intraspecific phylogenetic analyses of T. gondii.

Quantum-Sequencing: Biophysics of quantum tunneling through nucleic acids

Science.gov (United States)

Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

2014-03-01

Tunneling microscopy and spectroscopy has extensively been used in physical surface sciences to study quantum tunneling to measure electronic local density of states of nanomaterials and to characterize adsorbed species. Quantum-Sequencing (Q-Seq) is a new method based on tunneling microscopy for electronic sequencing of single molecule of nucleic acids. A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free single-molecule sequencing method. Here, we present the unique ``electronic fingerprints'' for all nucleotides on DNA and RNA using Q-Seq along their intrinsic biophysical parameters. We have analyzed tunneling spectra for the nucleotides at different pH conditions and analyzed the HOMO, LUMO and energy gap for all of them. In addition we show a number of biophysical parameters to further characterize all nucleobases (electron and hole transition voltage and energy barriers). These results highlight the robustness of Q-Seq as a technique for next-generation sequencing.

Sequencing intractable DNA to close microbial genomes.

Directory of Open Access Journals (Sweden)

Richard A Hurt

Full Text Available Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled "intractable" resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such problematic regions in the "non-contiguous finished" Desulfovibrio desulfuricans ND132 genome (6 intractable gaps and the Desulfovibrio africanus genome (1 intractable gap. The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. The developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.

Sequencing Intractable DNA to Close Microbial Genomes

Energy Technology Data Exchange (ETDEWEB)

Hurt, Jr., Richard Ashley [ORNL; Brown, Steven D [ORNL; Podar, Mircea [ORNL; Palumbo, Anthony Vito [ORNL; Elias, Dwayne A [ORNL

2012-01-01

Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled intractable resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such difficult regions in the non-contiguous finished Desulfovibrio desulfuricans ND132 genome (6 intractable gaps) and the Desulfovibrio africanus genome (1 intractable gap). The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. These developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.

Identification and verification of hybridoma-derived monoclonal antibody variable region sequences using recombinant DNA technology and mass spectrometry

Science.gov (United States)

Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibo...

Upstream region, foreshock and bow shock wave at Halley's Comet from plasma electron measurements

International Nuclear Information System (INIS)

Anderson, K.A.; Carlson, C.W.; Curtis, D.W.

1986-01-01

Halley plasma electron parameters from 2.7 million km from the comet nucleus to the bow shock wave at 1.1 million km and beyond are surveyed. The features of the electron foreshock lying outside the shock to a distance of 230,000 km are described. It is a region of intense solar wind-comet plasma interaction in which energetic electrons are prominent. Several spikes of electrons whose energies extend to 2.5 keV appear in front of the shock. These energetic electrons may be accelerated in the same way electrons are accelerated at the Earth's bow shock to energies of 1 to 10 keV. The direction of the electron bulk flow direction changes abruptly between 1920 and 1922 UT, and the flow speed begins a sharp decline at the same time. It is suggested that the spacecraft entered the bow shock wave between 1920 and 1922 UT. Electron density variations at Halley are very much smaller than those at Giacobini-Zinner

Constraining controls on carbonate sequences with high-resolution chronostratigraphy: Upper Miocene, Cabo de Gata region, SE Spain

Science.gov (United States)

Montgomery, P.; Farr, M.R.; Franseen, E.K.; Goldstein, R.H.

2001-01-01

A high-resolution chronostratigraphy has been developed for Miocene shallow-water carbonate strata in the Cabo de Gata region of SE Spain for evaluation of local, regional and global factors that controlled platform architecture prior to and during the Messinian salinity crisis. Paleomagnetic data were collected from strata at three localities. Mean natural remanent magnetization (NRM) ranges between 1.53 ?? 10-8 and 5.2 ?? 10-3 Am2/kg. Incremental thermal and alternating field demagnetization isolated the characteristic remanent magnetization (ChRM). Rock magnetic studies show that the dominant magnetic mineral is magnetite, but mixtures of magnetite and hematite occur. A composite chronostratigraphy was derived from five stratigraphic sections. Regional stratigraphic data, biostratigraphic data, and an 40Ar/39Ar date of 8.5 ?? 0.1 Ma, for an interbedded volcanic flow, place the strata in geomagnetic polarity Chrons C4r to C3r. Sequence-stratigraphic and diagenetic evidence indicate a major unconformity at the base of depositional sequence (DS)3 that contains a prograding reef complex, suggesting that approximately 250 000 yr of record (Subchrons C3Br.2r to 3Br.1r) are missing near the Messinian-Tortonian boundary. Correlation to the GPTS shows that the studied strata represent five third- to fourth-order DSs. Basal units are temperate to subtropical ramps (DS1A, DS1B, DS2); these are overlain by subtropical to tropical reefal platforms (DS3), which are capped by subtropical to tropical cyclic carbonates (Terminal Carbonate Complex, TCC). Correlation of the Cabo de Gata record to the Melilla area of Morocco, and the Sorbas basin of Spain indicate that early - Late Tortonian ramp strata from these areas are partially time-equivalent. Similar strata are extensively developed in the Western Mediterranean and likely were influenced by a cool climate or influx of nutrients during an overall rise in global sea-level. After ramp deposition, a sequence boundary (SB3) in

Chronology of Eocene-Miocene sequences on the New Jersey shallow shelf: implications for regional, interregional, and global correlations

Science.gov (United States)

Browning, James V.; Miller, Kenneth G.; Sugarman, Peter J.; Barron, John; McCarthy, Francine M.G.; Kulhanek, Denise K.; Katz, Miriam E.; Feigenson, Mark D.

2013-01-01

Integrated Ocean Drilling Program Expedition 313 continuously cored and logged latest Eocene to early-middle Miocene sequences at three sites (M27, M28, and M29) on the inner-middle continental shelf offshore New Jersey, providing an opportunity to evaluate the ages, global correlations, and significance of sequence boundaries. We provide a chronology for these sequences using integrated strontium isotopic stratigraphy and biostratigraphy (primarily calcareous nannoplankton, diatoms, and dinocysts [dinoflagellate cysts]). Despite challenges posed by shallow-water sediments, age resolution is typically ±0.5 m.y. and in many sequences is as good as ±0.25 m.y. Three Oligocene sequences were sampled at Site M27 on sequence bottomsets. Fifteen early to early-middle Miocene sequences were dated at Sites M27, M28, and M29 across clinothems in topsets, foresets (where the sequences are thickest), and bottomsets. A few sequences have coarse (∼1 m.y.) or little age constraint due to barren zones; we constrain the age estimates of these less well dated sequences by applying the principle of superposition, i.e., sediments above sequence boundaries in any site are younger than the sediments below the sequence boundaries at other sites. Our age control provides constraints on the timing of deposition in the clinothem; sequences on the topsets are generally the youngest in the clinothem, whereas the bottomsets generally are the oldest. The greatest amount of time is represented on foresets, although we have no evidence for a correlative conformity. Our chronology provides a baseline for regional and interregional correlations and sea-level reconstructions: (1) we correlate a major increase in sedimentation rate precisely with the timing of the middle Miocene climate changes associated with the development of a permanent East Antarctic Ice Sheet; and (2) the timing of sequence boundaries matches the deep-sea oxygen isotopic record, implicating glacioeustasy as a major driver

Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.

Science.gov (United States)

Tan, M K

1991-08-01

A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.

Ion and electron parameters in the alcator C tokamak scrape-off region

International Nuclear Information System (INIS)

Wan, A.S.H.

1986-05-01

Janus is a bi-directional, multi-functional edge probe used to diagnose the ion and electron parameters in the Alcator C tokamak scrape-off region. Two mirror image sets of diagnostics are aligned to face the electron and ion sides along magnetic field lines. Each set of diagnostics consists of a retarding-field energy analyzer (RFEA), a Langmuir probe, and a calorimeter. The RFEA can alternatively sample both the ion and electron parallel energy distribution functions during a tokamak discharge. From the Langmuir probe, one can infer electron temperature, density, and the plasma floating potential. Simple Langmuir probe theory is found to yield the best agreement between the measured Langmuir probe characteristics and the RFEA-inferred T/sub e/. The calorimeter independently detects the total parallel heat flux incident to an electrically floating plate. The measured sheath transmission coefficient, however, is typically lower than the theoretically predicted value by a factor of approx.3. Together these diagnostics enable detailed, localized edge plasma characterization on Alcator C

Mechanism of electron density reduction in the region of stable subauroral red arcs

International Nuclear Information System (INIS)

Pavlov, A.V.

1993-01-01

For geomagnetic storm on 18.12.71 are fulfilled calculations of electron density N e and temperature Te and intensity of the atmosphere luminescence at 630 nm in the region of the subauroral red are and outside its

Colorectal Cancer Genetic Heterogeneity Delineated by Multi-Region Sequencing.

Directory of Open Access Journals (Sweden)

You-Wang Lu

Full Text Available Intratumor heterogeneity (ITH leads to an underestimation of the mutational landscape portrayed by a single needle biopsy and consequently affects treatment precision. The extent of colorectal cancer (CRC genetic ITH is not well understood in Chinese patients. Thus, we conducted deep sequencing by using the OncoGxOne™ Plus panel, targeting 333 cancer-specific genes in multi-region biopsies of primary and liver metastatic tumors from three Chinese CRC patients. We determined that the extent of ITH varied among the three cases. On average, 65% of all the mutations detected were common within individual tumors. KMT2C aberrations and the NCOR1 mutation were the only ubiquitous events. Subsequent phylogenetic analysis showed that the tumors evolved in a branched manner. Comparison of the primary and metastatic tumors revealed that PPP2R1A (E370X, SETD2 (I1608V, SMAD4 (G382T, and AR splicing site mutations may be specific to liver metastatic cancer. These mutations might contribute to the initiation and progression of distant metastasis. Collectively, our analysis identified a substantial level of genetic ITH in CRC, which should be considered for personalized therapeutic strategies.

Two‐phase designs for joint quantitative‐trait‐dependent and genotype‐dependent sampling in post‐GWAS regional sequencing

Science.gov (United States)

Espin‐Garcia, Osvaldo; Craiu, Radu V.

2017-01-01

ABSTRACT We evaluate two‐phase designs to follow‐up findings from genome‐wide association study (GWAS) when the cost of regional sequencing in the entire cohort is prohibitive. We develop novel expectation‐maximization‐based inference under a semiparametric maximum likelihood formulation tailored for post‐GWAS inference. A GWAS‐SNP (where SNP is single nucleotide polymorphism) serves as a surrogate covariate in inferring association between a sequence variant and a normally distributed quantitative trait (QT). We assess test validity and quantify efficiency and power of joint QT‐SNP‐dependent sampling and analysis under alternative sample allocations by simulations. Joint allocation balanced on SNP genotype and extreme‐QT strata yields significant power improvements compared to marginal QT‐ or SNP‐based allocations. We illustrate the proposed method and evaluate the sensitivity of sample allocation to sampling variation using data from a sequencing study of systolic blood pressure. PMID:29239496

Altitude distribution of electron concentration in ionospheric D-region in presence of time-varying solar radiation flux

International Nuclear Information System (INIS)

Nina, A.; Čadež, V.; Srećković, V.; Šulić, D.

2012-01-01

In this paper, we study the influence of solar flares on electron concentration in the terrestrial ionospheric D-region by analyzing the amplitude and phase time variations of very low frequency (VLF) radio waves emitted by DHO transmitter (Germany) and recorded by the AWESOME receiver in Belgrade (Serbia) in real time. The rise of photo-ionization rate in the ionospheric D-region is a typical consequence of solar flare activity as recorded by GOES-15 satellite for the event on March 24, 2011 between 12:01 UT and 12:11 UT. At altitudes around 70 km, the photo-ionization and recombination are the dominant electron gain and electron loss processes, respectively. We analyze the relative contribution of each of these two processes in the resulting electron concentration variation in perturbed ionosphere.

Altitude distribution of electron concentration in ionospheric D-region in presence of time-varying solar radiation flux

Energy Technology Data Exchange (ETDEWEB)

Nina, A., E-mail: sandrast@ipb.ac.rs [Institute of Physics, University of Belgrade, P.O. Box 57, Belgrade (Serbia); Cadez, V. [Astronomical Observatory, Volgina 7, 11060 Belgrade (Serbia); Sreckovic, V. [Institute of Physics, University of Belgrade, P.O. Box 57, Belgrade (Serbia); Sulic, D. [Faculty of Ecology and Environmental Protection, Union - Nikola Tesla University, Cara Dusana 62, 11000 Belgrade (Serbia)

2012-05-15

In this paper, we study the influence of solar flares on electron concentration in the terrestrial ionospheric D-region by analyzing the amplitude and phase time variations of very low frequency (VLF) radio waves emitted by DHO transmitter (Germany) and recorded by the AWESOME receiver in Belgrade (Serbia) in real time. The rise of photo-ionization rate in the ionospheric D-region is a typical consequence of solar flare activity as recorded by GOES-15 satellite for the event on March 24, 2011 between 12:01 UT and 12:11 UT. At altitudes around 70 km, the photo-ionization and recombination are the dominant electron gain and electron loss processes, respectively. We analyze the relative contribution of each of these two processes in the resulting electron concentration variation in perturbed ionosphere.

A positive correlation between energetic electron butterfly distributions and magnetosonic waves in the radiation belt slot region

International Nuclear Information System (INIS)

Yang, Chang; Su, Z.; Xiao, F.; Zheng, H.

2017-01-01

Energetic (hundreds of keV) electrons in the radiation belt slot region have been found to exhibit the butterfly pitch angle distributions. Resonant interactions with magnetosonic and whistler-mode waves are two potential mechanisms for the formation of these peculiar distributions. Here we perform a statistical study of energetic electron pitch angle distribution characteristics measured by Van Allen Probes in the slot region during a three-year period from May 2013 to May 2016. Our results show that electron butterfly distributions are closely related to magnetosonic waves rather than to whistlermode waves. Both electron butterfly distributions and magnetosonic waves occur more frequently at the geomagnetically active times than at the quiet times. In a statistical sense, more distinct butterfly distributions usually correspond to magnetosonic waves with larger amplitudes and vice versa. The averaged magnetosonic wave amplitude is less than 5 pT in the case of normal and flat-top distributions with a butterfly index BI = 1 but reaches ~ 35–95 pT in the case of distinct butterfly distributions with BI > 1:3. For magnetosonic waves with amplitudes > 50 pT, the occurrence rate of butterfly distribution is above 80%. Our study suggests that energetic electron butterfly distributions in the slot region are primarily caused by magnetosonic waves.

Sequencing of the Hepatitis C Virus: A Systematic Review.

Directory of Open Access Journals (Sweden)

Brendan Jacka

Full Text Available Since the identification of hepatitis C virus (HCV, viral sequencing has been important in understanding HCV classification, epidemiology, evolution, transmission clustering, treatment response and natural history. The length and diversity of the HCV genome has resulted in analysis of certain regions of the virus, however there has been little standardisation of protocols. This systematic review was undertaken to map the location and frequency of sequencing on the HCV genome in peer reviewed publications, with the aim to produce a database of sequencing primers and amplicons to inform future research. Medline and Scopus databases were searched for English language publications based on keyword/MeSH terms related to sequence analysis (9 terms or HCV (3 terms, plus "primer" as a general search term. Exclusion criteria included non-HCV research, review articles, duplicate records, and incomplete description of HCV sequencing methods. The PCR primer locations of accepted publications were noted, and purpose of sequencing was determined. A total of 450 studies were accepted from the 2099 identified, with 629 HCV sequencing amplicons identified and mapped on the HCV genome. The most commonly sequenced region was the HVR-1 region, often utilised for studies of natural history, clustering/transmission, evolution and treatment response. Studies related to genotyping/classification or epidemiology of HCV genotype generally targeted the 5'UTR, Core and NS5B regions, while treatment response/resistance was assessed mainly in the NS3-NS5B region with emphasis on the Interferon sensitivity determining region (ISDR region of NS5A. While the sequencing of HCV is generally constricted to certain regions of the HCV genome there is little consistency in the positioning of sequencing primers, with the exception of a few highly referenced manuscripts. This study demonstrates the heterogeneity of HCV sequencing, providing a comprehensive database of previously

ITS all right mama: investigating the formation of chimeric sequences in the ITS2 region by DNA metabarcoding analyses of fungal mock communities of different complexities.

Science.gov (United States)

Bjørnsgaard Aas, Anders; Davey, Marie Louise; Kauserud, Håvard

2017-07-01

The formation of chimeric sequences can create significant methodological bias in PCR-based DNA metabarcoding analyses. During mixed-template amplification of barcoding regions, chimera formation is frequent and well documented. However, profiling of fungal communities typically uses the more variable rDNA region ITS. Due to a larger research community, tools for chimera detection have been developed mainly for the 16S/18S markers. However, these tools are widely applied to the ITS region without verification of their performance. We examined the rate of chimera formation during amplification and 454 sequencing of the ITS2 region from fungal mock communities of different complexities. We evaluated the chimera detecting ability of two common chimera-checking algorithms: perseus and uchime. Large proportions of the chimeras reported were false positives. No false negatives were found in the data set. Verified chimeras accounted for only 0.2% of the total ITS2 reads, which is considerably less than what is typically reported in 16S and 18S metabarcoding analyses. Verified chimeric 'parent sequences' had significantly higher per cent identity to one another than to random members of the mock communities. Community complexity increased the rate of chimera formation. GC content was higher around the verified chimeric break points, potentially facilitating chimera formation through base pair mismatching in the neighbouring regions of high similarity in the chimeric region. We conclude that the hypervariable nature of the ITS region seems to buffer the rate of chimera formation in comparison with other, less variable barcoding regions, due to shorter regions of high sequence similarity. © 2016 John Wiley & Sons Ltd.

Energetic electron precipitation in weak to moderate corotating interaction region-driven storms

Science.gov (United States)

Ødegaard, Linn-Kristine Glesnes; Tyssøy, Hilde Nesse; Søraas, Finn; Stadsnes, Johan; Sandanger, Marit Irene

2017-03-01

High-energy electron precipitation from the radiation belts can penetrate deep into the mesosphere and increase the production rate of NOx and HOx, which in turn will reduce ozone in catalytic processes. The mechanisms for acceleration and loss of electrons in the radiation belts are not fully understood, and most of the measurements of the precipitating flux into the atmosphere have been insufficient for estimating the loss cone flux. In the present study the electron flux measured by the NOAA POES Medium Energy Proton and Electron Detectors 0° and 90° detectors is combined together with theory of pitch angle diffusion by wave-particle interaction to quantify the electron flux lost below 120 km altitude. Using this method, 41 weak and moderate geomagnetic storms caused by corotating interaction regions during 2006-2010 are studied. The dependence of the energetic electron precipitation fluxes upon solar wind parameters and geomagnetic indices is investigated. Nine storms give increased precipitation of >˜750 keV electrons. Nineteen storms increase the precipitation of >˜300 keV electrons, but not the >˜750 keV population. Thirteen storms either do not change or deplete the fluxes at those energies. Storms that have an increase in the flux of electrons with energy >˜300 keV are characterized by an elevated solar wind velocity for a longer period compared to the storms that do not. Storms with increased precipitation of >˜750 keV flux are distinguished by higher-energy input from the solar wind quantified by the ɛ parameter and corresponding higher geomagnetic activity.

Sequence analysis of the 3’-untranslated region of HSP70 (type I genes in the genus Leishmania: its usefulness as a molecular marker for species identification

Directory of Open Access Journals (Sweden)

Requena Jose M

2012-04-01

Full Text Available Abstract Background The Leishmaniases are a group of clinically diverse diseases caused by parasites of the genus Leishmania. To distinguish between species is crucial for correct diagnosis and prognosis as well as for treatment decisions. Recently, sequencing of the HSP70 coding region has been applied in phylogenetic studies and for identifying of Leishmania species with excellent results. Methods In the present study, we analyzed the 3’-untranslated region (UTR of Leishmania HSP70-type I gene from 24 strains representing eleven Leishmania species in the belief that this non-coding region would have a better discriminatory capacity for species typing than coding regions. Results It was observed that there was a remarkable degree of sequence conservation in this region, even between species of the subgenus Leishmania and Viannia. In addition, the presence of many microsatellites was a common feature of the 3´-UTR of HSP70-I genes in the Leishmania genus. Finally, we constructed dendrograms based on global sequence alignments of the analyzed Leishmania species and strains, the results indicated that this particular region of HSP70 genes might be useful for species (or species complex typing, improving for particular species the discrimination capacity of phylogenetic trees based on HSP70 coding sequences. Given the large size variation of the analyzed region between the Leishmania and Viannia subgenera, direct visualization of the PCR amplification product would allow discrimination between subgenera, and a HaeIII-PCR-RFLP analysis might be used for differentiating some species within each subgenera. Conclusions Sequence and phylogenetic analyses indicated that this region, which is readily amplified using a single pair of primers from both Old and New World Leishmania species, might be useful as a molecular marker for species discrimination.

Depletion region surface effects in electron beam induced current measurements

Energy Technology Data Exchange (ETDEWEB)

Haney, Paul M.; Zhitenev, Nikolai B. [Center for Nanoscale Science and Technology, National Institute of Standards and Technology, Gaithersburg, Maryland 20899 (United States); Yoon, Heayoung P. [Department of Electrical and Computer Engineering, University of Utah, Salt Lake City, Utah 84112 (United States); Gaury, Benoit [Center for Nanoscale Science and Technology, National Institute of Standards and Technology, Gaithersburg, Maryland 20899 (United States); Maryland NanoCenter, University of Maryland, College Park, Maryland 20742 (United States)

2016-09-07

Electron beam induced current (EBIC) is a powerful characterization technique which offers the high spatial resolution needed to study polycrystalline solar cells. Current models of EBIC assume that excitations in the p-n junction depletion region result in perfect charge collection efficiency. However, we find that in CdTe and Si samples prepared by focused ion beam (FIB) milling, there is a reduced and nonuniform EBIC lineshape for excitations in the depletion region. Motivated by this, we present a model of the EBIC response for excitations in the depletion region which includes the effects of surface recombination from both charge-neutral and charged surfaces. For neutral surfaces, we present a simple analytical formula which describes the numerical data well, while the charged surface response depends qualitatively on the location of the surface Fermi level relative to the bulk Fermi level. We find that the experimental data on FIB-prepared Si solar cells are most consistent with a charged surface and discuss the implications for EBIC experiments on polycrystalline materials.

Development of taxon-specific sequence characterized amplified region (SCAR) markers based on actin sequences and DNA amplification fingerprinting (DAF): a case study in the Phoma exigua species complex.

Science.gov (United States)

Aveskamp, Maikel M; Woudenberg, Joyce H C; de Gruyter, Johannes; Turco, Elena; Groenewald, Johannes Z; Crous, Pedro W

2009-05-01

Phoma exigua is considered to be an assemblage of at least nine varieties that are mainly distinguished on the basis of host specificity and pathogenicity. However, these varieties are also reported to be weak pathogens and secondary invaders on non-host tissue. In practice, it is difficult to distinguish P. exigua from its close relatives and to correctly identify isolates up to the variety level, because of their low genetic variation and high morphological similarity. Because of quarantine issues and phytosanitary measures, a robust DNA-based tool is required for accurate and rapid identification of the separate taxa in this species complex. The present study therefore aims to develop such a tool based on unique nucleotide sequence identifiers. More than 60 strains of P. exigua and related species were compared in terms of partial actin gene sequences, or analysed using DNA amplification fingerprinting (DAF) with short, arbitrary, mini-hairpin primers. Fragments in the fingerprint unique to a single taxon were identified, purified and sequenced. Alignment of the sequence data and subsequent primer trials led to the identification of taxon-specific sequence characterized amplified regions (SCARs), and to a set of specific oligonucleotide combinations that can be used to identify these organisms in plant quarantine inspections.

Phylogenetic relationships of Malaysia's pig-tailed macaque Macaca nemestrina based on D-loop region sequences

Science.gov (United States)

Abdul-Latiff M. A., B.; Ampeng, A.; Yaakop, S.; Md-Zain B., M.

2014-09-01

Phylogenetic relationships among Malaysian pig-tailed macaques have never been established even though the data are crucial in aiding conservation plan for the species. The aims of this study is to establish the phylogenetic relationships of Macaca nemestrina in Malaysia. A total of 21 genetic samples of M. nemestrina yielding 458 bp of D-loop sequences were used in phylogenetic analyses, in addition to one sample of M. fascicularis which was used as an outgroup. Sequence character analysis revealed that D-loop locus contains 23% parsimony informative character detected among the ingroups. Further analysis indicated a clear separation between populations originating from different regions; the Malay Peninsula populations are separated from Borneo Insular population; and Perak population formed a distinctive clade within Peninsular Malaysia populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo population was distinguished from Peninsula population (100% bootstrap value in the NJ, MP, 1.00 posterior probability in Bayesian trees). Perak's population was separated from other Peninsula populations (100% in NJ, 99% in MP and 1.00 in Bayesian). D-loop region of mtDNA is proven to be a suitable locus in studying the separation of M. nemestrina at population level. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations in Malaysia.

Identification and verification of hybridoma-derived monoclonal antibody variable region sequences using recombinant DNA technology and mass spectrometry.

Science.gov (United States)

Babrak, Lmar; McGarvey, Jeffery A; Stanker, Larry H; Hnasko, Robert

2017-10-01

Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibodies (rAb). This determination can be achieved by sequence analysis of immunoglobulin (Ig) transcripts obtained from a monoclonal antibody (MAb) producing hybridoma and subsequent expression of a rAb. However the polyploidy nature of a hybridoma cell often results in the added expression of aberrant immunoglobulin-like transcripts or even production of anomalous antibodies which can confound production of rAb. An incorrect VR sequence will result in a non-functional rAb and de novo assembly of Ig primary structure without a sequence map is challenging. To address these problems, we have developed a methodology which combines: 1) selective PCR amplification of VR from both the heavy and light chain IgG from hybridoma, 2) molecular cloning and DNA sequence analysis and 3) tandem mass spectrometry (MS/MS) on enzyme digests obtained from the purified IgG. Peptide analysis proceeds by evaluating coverage of the predicted primary protein sequence provided by the initial DNA maps for the VR. This methodology serves to both identify and verify the primary structure of the MAb VR for production as rAb. Published by Elsevier Ltd.

Phylogenetic relationships in Solanaceae and related species based on cpDNA sequence from plastid trnE-trnT region

Directory of Open Access Journals (Sweden)

Danila Montewka Melotto-Passarin

2008-01-01

Full Text Available Intergenic spacers of chloroplast DNA (cpDNA are very useful in phylogenetic and population genetic studiesof plant species, to study their potential integration in phylogenetic analysis. The non-coding trnE-trnT intergenic spacer ofcpDNA was analyzed to assess the nucleotide sequence polymorphism of 16 Solanaceae species and to estimate its ability tocontribute to the resolution of phylogenetic studies of this group. Multiple alignments of DNA sequences of trnE-trnT intergenicspacer made the identification of nucleotide variability in this region possible and the phylogeny was estimated by maximumparsimony and rooted with Convolvulaceae Ipomoea batatas, the most closely related family. Besides, this intergenic spacerwas tested for the phylogenetic ability to differentiate taxonomic levels. For this purpose, species from four other families wereanalyzed and compared with Solanaceae species. Results confirmed polymorphism in the trnE-trnT region at different taxonomiclevels.

Sequence analysis of the internal transcribed spacer (ITS) region reveals a novel clade of Ichthyophonus sp. from rainbow trout.

Science.gov (United States)

Rasmussen, C; Purcell, M K; Gregg, J L; LaPatra, S E; Winton, J R; Hershberger, P K

2010-03-09

The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of approximately 740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).

Deep inelastic scattering of electrons on 12C in the δ(1236) region

International Nuclear Information System (INIS)

Meziani, Zein-Eddine.

1982-06-01

An experiment involving inclusive deep inelastic scattering of 700 MeV electrons on 12 C is presented. A broad energy transfer region (20 to 500 MeV) was examined enabling various different reaction mechanisms occurring in the nucleus to be studied. Attention was given to electroproduction processes in the δ(1236) resonance region. Measurements of deep inelastic scattering cross sections and radiative correction problems are discussed. A theoretical treatment of the cross section in the framework of a virtual photon exchange approximation is presented [fr

Three-dimentional imaging of dentomaxillofacial region using electron beam tomography

International Nuclear Information System (INIS)

Tanaka, Takemasa; Kanda, Shigenobu; Muranaka, Toru

1998-01-01

Authors reported their results of the 3-D imaging of dentomaxillofacial region mainly for jaw deformity with electron beam tomography (EBT). The EBT apparatus used was Imatron C-100 (Imatron Corp.), with which, using bremsstrahlung radiation generated from the electron beam, CT is possible with rapid scanning rate at <0.1 sec. Imaging was done with those conditions as tube voltage: 130 kV, current: 610 mA, scanning rate: 0.1 sec/slice whose thickness was 1.5 mm, feeding rate: 1.5 mm and number of slices: 40-170. Patients were 15 cases with jaw deformity. Data were processed for 3-D image by Scribe Imaging Workstation (Multi-dimensional Imaging Inc.) which giving surface rendering and further by Power Macintosh 8500 (Apple Computer Inc.) with VoxBlast 1.1.0 (VayTec Inc.) software which giving volume rendering or with Image 1.60 (NIH) which allowing multi-planar reconstruction and re-analog projection. These actual images were presented in the report. (K.H.)

Molecular dissection of a contiguous gene syndrome: Frequent submicroscopic deletions, evolutionarily conserved sequences, and a hypomethylated island in the Miller-Dieker chromosome region

International Nuclear Information System (INIS)

Ledbetter, D.H.; Ledbetter, S.A.; vanTuinen, P.

1989-01-01

The Miller-Dieker syndrome (MDS), composed of characteristic facial abnormalities and a severe neuronal migration disorder affecting the cerebral cortex, is caused by visible or submicroscopic deletions of chromosome band 17p13. Twelve anonymous DNA markers were tested against a panel of somatic cell hybrids containing 17p deletions from seven MDS patients. All patients, including three with normal karyotypes, are deleted for a variable set of 5-12 markers. Two highly polymorphic VNTR (variable number of tandem repeats) probes, YNZ22 and YNH37, are codeleted in all patients tested and make molecular diagnosis for this disorder feasible. By pulsed-field gel electrophoresis, YNZ22 and YNH37 were shown to be within 30 kilobases (kb) of each other. Cosmid clones containing both VNTR sequences were identified, and restriction mapping showed them to be 100 kb were completely deleted in all patients, providing a minimum estimate of the size of the MDS critical region. A hypomethylated island and evolutionarily conserved sequences were identified within this 100-kb region, indications of the presence of one or more expressed sequences potentially involved in the pathophysiology of this disorder. The conserved sequences were mapped to mouse chromosome 11 by using mouse-rat somatic cell hybrids, extending the remarkable homology between human chromosome 17 and mouse chromosome 11 by 30 centimorgans, into the 17p telomere region

Isolation of the Drosophila melanogaster dunce chromosomal region and recombinational mapping of dunce sequences with restriction site polymorphisms as genetic markers

OpenAIRE

Davis, Ronald L.; Davidson, Norman

1984-01-01

Using the method of chromosomal walking, we have isolated a contiguous region of the Drosophila melanogaster X chromosome which corresponds to salivary gland chromosome bands 3C12 to 3D4. This five-band region contains approximately 100 kilobases of DNA, including those sequences comprising dunce, a gene which functions in memory and cyclic nucleotide metabolism. Genome blots of DNA from flies carrying several different chromosomal aberrations with breakpoints in the region have been probed w...

Comparison of variable region 3 sequences of human immunodeficiency virus type 1 from infected children with the RNA and DNA sequences of the virus populations of their mothers.

Science.gov (United States)

Scarlatti, G; Leitner, T; Halapi, E; Wahlberg, J; Marchisio, P; Clerici-Schoeller, M A; Wigzell, H; Fenyö, E M; Albert, J; Uhlén, M

1993-01-01

We have compared the variable region 3 sequences from 10 human immunodeficiency virus type 1 (HIV-1)-infected infants to virus sequences from the corresponding mothers. The sequences were derived from DNA of uncultured peripheral blood mononuclear cells (PBMC), DNA of cultured PBMC, and RNA from serum collected at or shortly after delivery. The infected infants, in contrast to the mothers, harbored homogeneous virus populations. Comparison of sequences from the children and clones derived from DNA of the corresponding mothers showed that the transmitted virus represented either a minor or a major virus population of the mother. In contrast to an earlier study, we found no evidence of selection of minor virus variants during transmission. Furthermore, the transmitted virus variant did not show any characteristic molecular features. In some cases the transmitted virus was more related to the virus RNA population of the mother and in other cases it was more related to the virus DNA population. This suggests that either cell-free or cell-associated virus may be transmitted. These data will help AIDS researchers to understand the mechanism of transmission and to plan strategies for prevention of transmission. PMID:8446584

Development of a Geomagnetic Storm Correction to the International Reference Ionosphere E-Region Electron Densities Using TIMED/SABER Observations

Science.gov (United States)

Mertens, C. J.; Xu, X.; Fernandez, J. R.; Bilitza, D.; Russell, J. M., III; Mlynczak, M. G.

2009-01-01

Auroral infrared emission observed from the TIMED/SABER broadband 4.3 micron channel is used to develop an empirical geomagnetic storm correction to the International Reference Ionosphere (IRI) E-region electron densities. The observation-based proxy used to develop the storm model is SABER-derived NO+(v) 4.3 micron volume emission rates (VER). A correction factor is defined as the ratio of storm-time NO+(v) 4.3 micron VER to a quiet-time climatological averaged NO+(v) 4.3 micron VER, which is linearly fit to available geomagnetic activity indices. The initial version of the E-region storm model, called STORM-E, is most applicable within the auroral oval region. The STORM-E predictions of E-region electron densities are compared to incoherent scatter radar electron density measurements during the Halloween 2003 storm events. Future STORM-E updates will extend the model outside the auroral oval.

Spin currents in a normal two-dimensional electron gas in contact with a spin-orbit interaction region

International Nuclear Information System (INIS)

Sukhanov, Aleksei A; Sablikov, Vladimir A; Tkach, Yurii Ya

2009-01-01

Spin effects in a normal two-dimensional (2D) electron gas in lateral contact with a 2D region with spin-orbit interaction are studied. The peculiarity of this system is the presence of spin-dependent scattering of electrons from the interface. This results in an equilibrium edge spin current and nontrivial spin responses to a particle current. We investigate the spatial distribution of the spin currents and spin density under non-equilibrium conditions caused by a ballistic electron current flowing normal or parallel to the interface. The parallel electron current is found to generate a spin density near the interface and to change the edge spin current. The perpendicular electron current changes the edge spin current proportionally to the electron current and produces a bulk spin current penetrating deep into the normal region. This spin current has two components, one of which is directed normal to the interface and polarized parallel to it, and the second is parallel to the interface and is polarized in the plane perpendicular to the contact line. Both spin currents have a high degree of polarization (∼40-60%).

Phylogenetic relationships of Scomberomorus commerson using sequence analysis of the mtDNA D-loop region in the Persian Gulf, Oman Sea and Arabian Sea

Directory of Open Access Journals (Sweden)

Ana Mansourkiaei

2016-04-01

Full Text Available Abstract Narrow-barred Spanish mackerel, Scomberomorus commerson, is an epipelagic and migratory species of family Scombridae which have a significant role in terms of ecology and fishery. 100 samples were collected from the Persian Gulf, Oman Sea and Arabian Sea. Part of their dorsal fins was snipped and transferred to micro-tubes containing ethanol; then, DNAs were extracted and HRM-Real Time PCR was performed to designate representative specimens for sequencing. Phylogenetic relationships of S. commerson from Persian Gulf, Oman Sea and Arabian Sea were investigated using sequence data of mitochondrial DNA D-loop region. None clustered Neighbor Joining tree indicated the proximity amid S. commerson in four sites. As numbers demonstrated in sequence analyses of mitochondrial DNA D-Loop region a sublimely high degree of genetic similarity among S. commerson from the Persian Gulf and Oman Sea were perceived, thereafter, having one stock structure of S. commerson in four regions were proved, and this approximation can be merely justified by their migration process along the coasts of Oman Sea and Persian Gulf. Therefore, the assessment of distribution patterns of 20 haplotypes in the constructed phylogenetic tree using mtDNA D-Loop sequences ascertained that no significant clustering according to the sampling sites was concluded.

Using Markov chains of nucleotide sequences as a possible precursor to predict functional roles of human genome: a case study on inactive chromatin regions.

Science.gov (United States)

Lee, K-E; Lee, E-J; Park, H-S

2016-08-30

Recent advances in computational epigenetics have provided new opportunities to evaluate n-gram probabilistic language models. In this paper, we describe a systematic genome-wide approach for predicting functional roles in inactive chromatin regions by using a sequence-based Markovian chromatin map of the human genome. We demonstrate that Markov chains of sequences can be used as a precursor to predict functional roles in heterochromatin regions and provide an example comparing two publicly available chromatin annotations of large-scale epigenomics projects: ENCODE project consortium and Roadmap Epigenomics consortium.

Two unusual hepatitis C virus subtypes, 2j and 2q, in Spain: Identification by nested-PCR and sequencing of a NS5B region.

Science.gov (United States)

Margall, N; March, F; Español, M; Torras, X; Gallego, A; Coll, P

2015-10-01

Many studies have reported the use of the NS5B gene to subtype hepatitis C virus (HCV). Other HCV genes, such as HCV-5' UTR, Core (C) and E1, have also been used. In some studies, NS5B have been used together with 5'-UTR or C genes to improve genotyping results obtained using commercial procedures. Only two studies in Spain have compared molecular techniques versus commercial procedures regarding the efficacy of HCV subtyping. The aim of this study was to determine whether nested PCR and sequencing of a NS5B region was more reliable than commercial procedures to subtype HCV. We analyzed the results of HCV genotyping in [726] serum specimens collected from 2001 to 2013. From 2001 to 2011, we used PCR and INNO-LiPA hybridization or its new version Versant HCV Genotype 2.0 assay (471 samples). From 2012 to 2013, we used nested PCR and sequencing of a NS5B region (255 cases). This method used two pairs of primers to amplify the RNA of the sample converted to DNA by retrotranscription. The amplification product of 270 base pairs was further sequenced. To identify the subtype, the sequences obtained were compared to those in the international database: http://hcv.lanl.gov./content/sequence/, HCV/ToolsOutline.html and Geno2pheno[hcv] http://hcv.bioinf.mpi-inf.mpg.de/index.php. Nested PCR of a NS5B region and sequencing identified all but one subtype (0.4%, 1/255), differentiated all 1a subtypes from 1b subtypes, and characterized all HCV 2-4 subtypes. This approach also distinguished two subtypes, 2j and 2q, that had rarely been detected previously in Spain. However, commercial procedures failed to subtype 12.7% (60/471) of samples and to genotype 0.6% of specimens (3/471). Nested PCR and sequencing of a NS5B region improved the subtyping of HCV in comparison with classical procedures and identified two rare subtypes in Spain: 2j and 2q. However, full length genome sequencing is recommended to confirm HCV 2j and 2q subtypes. Copyright © 2015. Published by Elsevier B.V.

Genomic DNA Enrichment Using Sequence Capture Microarrays: a Novel Approach to Discover Sequence Nucleotide Polymorphisms (SNP) in Brassica napus L

Science.gov (United States)

Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.

2013-01-01

Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619

Electrons identification in the forward region of the ATLAS electromagnetic calorimeter at the LHC and first data analysis

International Nuclear Information System (INIS)

Chareyre, E.

2010-09-01

The start up of the ATLAS experiment at the CERN LHC has been done during the autumn 2009. During the construction and integration of the detector, combined beam tests grouping several subsystems have been carried out. In the forward region of the detector (η > 2.5), a combined beam test with electromagnetic and hadronic calorimeters has been done, whose data (pions and electrons) has been analyzed. Identification of electrons in this region can be used to study decays of Z and W bosons and also to develop some tools to understand the background noises. A method to estimate rejection of pions and electrons identification efficiency is presented using a discriminant analysis based on the methods of Fisher discriminant and on Boosted Decision Trees. It is shown that a pion rejection higher than 200 with an efficiency of electron identification of 50% can be obtained. Moreover the tools and methods developed during the beam tests have been applied on the first data of the LHC with collisions at 7 TeV. Since the present luminosity of the LHC is not yet sufficient to study precisely production of Z and W bosons by using data, a study using the Pythia generator has been done on electrons physics in the forward region. (author)

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Energy Technology Data Exchange (ETDEWEB)

Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

2014-04-25

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

Formation of universal and diffusion regions of non-linear spectra of relativistic electrons in spatially limited sources

International Nuclear Information System (INIS)

Kontorovich, V.M.; Kochanov, A.E.

1980-01-01

It is demonstrated that in the case of hard injection of relativistic electrons accompanied by the joint action of synchrotron (Compton) losses and energy-dependent spatial diffusion, a spectrum with 'breaks' is formed containing universal (with index γ = 2) and diffusion regions, both independent of the injection spectrum. The effect from non-linearity of the electron spectrum is considered in averaged electromagnetic spectra for various geometries of sources (sphere, disk, arm). It is shown that an universal region (with index α = 0.5) can occur in the radiation spectrum. (orig.)

High-effective position time spectrometer in actual measurements of low intensity region of electron spectra

International Nuclear Information System (INIS)

Babenkov, M.I.; Zhdanov, V.S.

2002-01-01

Magnetic position-time spectrometer was proposed in previous work, where not only electron coordinates in focal plane are measured by position sensitive detector (PSD) but places of their birth in beta source plane of a large area are fixed using another PSD, situated behind it, by quick effects, accompanying radioactive decay. PSD on the basis of macro-channel plates are used. It is succeeded in position-time spectrometer to combine beta sources of a large area with multichannel registration for a wide energy interval, that efficiency of measurements was two orders of magnitude increase d in comparison magnetic apparatus having PSD only in focal plane. Owing to two detectors' switching on coincidence the relation effect/background in increased minimum on two orders of magnitude in comparison with the same apparatus. At some complication of mathematical analysis it was obtained, that high characteristics of position-time spectrometer are kept during the use the magnetic field, providing double focusing. Owning to this focusing the gain the efficiency of measurements will make one more order of magnitude. Presented high-effective position-time spectrometer is supposed to use in the measurements of low-intensity region of electron spectra, which are important for development of fundamental physics. This is the first of all estimation of electron anti-neutrino mass by the form of beta spectrum of tritium in the region of boundary energy. Recently here there was problem of non physical negative values. This problem can be solved by using in measurement of different in principle high-effective spectrometers, which possess improved background properties. A position-time spectrometers belongs to these apparatus, which provides the best background conditions at very large effectiveness of the measurements of tritium beta spectrum in the region of boundary energy with acceptable high resolution. An important advantage of position-time spectrometer is the possibility of

R.F. heating-influence of the magnetic field B0 on electron heating by ECRH

International Nuclear Information System (INIS)

Cunha Raposo, C. da; Aihara, S.; Sakanaka, P.H.

The results obtained in a series of experiments in the mirror machine 'LISA' are reported. A sequence of pulses of 2.45 GHz, 600 watts at a rate of 60 pulses/sec is applied to the plasma. The sequence is controlled by a self-reset system. Plasma parameters are studied as a function of the external magnetic field, B 0 , in two different configurations, large and small resonance space regions. For each region the mapping of magnetic field B 0 was made B sub(z) (r,z) axial and B sub(r) (r,z) radial distributions. These data were submitted to spatial and orbital distribution of the particles as well as flight and energy. Applying the microwave at the electron cyclotron frequency, electron temperature and density (T sub(e), n sub(e)), floating potential (V sub(f)), collision time, conductivity and confiment time are measured. The diagnostic is made with electrostatic probe, diamagnetic coil spectrograph, Hall probe and magnetometer. (L.C.) [pt

Immunoglobulin variable region sequences of two human monoclonal antibodies directed to an onco-developmental carbohydrate antigen, lactotetraosylceramide (LcOse4Cer).

Science.gov (United States)

Yago, K; Zenita, K; Ohwaki, I; Harada, R; Nozawa, S; Tsukazaki, K; Iwamori, M; Endo, N; Yasuda, N; Okuma, M

1993-11-01

A human monoclonal antibody, 11-50, was generated and was shown to recognize an onco-developmental carbohydrate antigen, LcOse4Cer. The isotype of this antibody was IgM, lambda, similar to the previously known human anti-LcOse4 antibodies, such as IgMWOO and HMST-1. We raised a murine anti-idiotypic antibody G3 (IgG1, kappa) against 11-50, and tested its reactivity towards the affinity purified human polyclonal anti-LcOse4 antibodies prepared from pooled human sera using a Gal beta 1-->3GlcNAc beta-immobilized column. The results indicated that at least a part of the human polyclonal anti-LcOse4 antibodies shared the G3 idiotype with 11-50. We further analyzed the sequence of variable regions of the two anti-LcOse4 antibodies, 11-50 and HMST-1. Sequence analysis of the heavy chain variable regions indicated that the VH regions of these two antibodies were highly homologous to each other (93.5% at the nucleic acid level), and these antibodies utilized the germline genes VH1.9III and hv3005f3 as the VH segments, which are closely related germline genes of the VHIII family. It was noted that these germline VH genes are frequently utilized in fetal B cells. The JH region of both antibodies was encoded by the JH4 gene. For the light chain, the V lambda segments of the two antibodies were 96.3% homologous to each other at the nucleic acid level. The V lambda segments of both antibodies showed the highest homology to the rearranged V lambda gene called V lambda II.DS among reported V lambda genes, while the exact germline V lambda genes encoding the two antibodies were not yet registered in available sequence databanks. The amino acid sequences of the J lambda segments of both antibodies were identical. These results indicate that the two human antibodies recognizing the onco-developmental carbohydrate antigen Lc4 are encoded by the same or very homologous germline genes.

Genetic variation among the Mapuche Indians from the Patagonian region of Argentina: mitochondrial DNA sequence variation and allele frequencies of several nuclear genes.

Science.gov (United States)

Ginther, C; Corach, D; Penacino, G A; Rey, J A; Carnese, F R; Hutz, M H; Anderson, A; Just, J; Salzano, F M; King, M C

1993-01-01

DNA samples from 60 Mapuche Indians, representing 39 maternal lineages, were genetically characterized for (1) nucleotide sequences of the mtDNA control region; (2) presence or absence of a nine base duplication in mtDNA region V; (3) HLA loci DRB1 and DQA1; (4) variation at three nuclear genes with short tandem repeats; and (5) variation at the polymorphic marker D2S44. The genetic profile of the Mapuche population was compared to other Amerinds and to worldwide populations. Two highly polymorphic portions of the mtDNA control region, comprising 650 nucleotides, were amplified by the polymerase chain reaction (PCR) and directly sequenced. The 39 maternal lineages were defined by two or three generation families identified by the Mapuches. These 39 lineages included 19 different mtDNA sequences that could be grouped into four classes. The same classes of sequences appear in other Amerinds from North, Central, and South American populations separated by thousands of miles, suggesting that the origin of the mtDNA patterns predates the migration to the Americas. The mtDNA sequence similarity between Amerind populations suggests that the migration throughout the Americas occurred rapidly relative to the mtDNA mutation rate. HLA DRB1 alleles 1602 and 1402 were frequent among the Mapuches. These alleles also occur at high frequency among other Amerinds in North and South America, but not among Spanish, Chinese or African-American populations. The high frequency of these alleles throughout the Americas, and their specificity to the Americas, supports the hypothesis that Mapuches and other Amerind groups are closely related.(ABSTRACT TRUNCATED AT 250 WORDS)

Rocket observation of electron density irregularities in the lower E region

International Nuclear Information System (INIS)

Watanabe, Yuzo; Nakamura, Yoshiharu; Amemiya, Hiroshi.

1990-01-01

Local ionospheric electron density irregularities in the scale size of 3 m to 300 m have been measured on the ascending path from 74 km to 93 km by a fix biased Langmuir probe on board the S-310-16 sounding rocket. The rocket was launched at 22:40:00 on February 1, 1986 from Kagoshima Space Center in Japan. It is found from frequency analysis of the data that the spectral index of the irregularities is 0.9 to 1.8 and the irregularity amplitude is 1 to 15 %. The altitude where the amplitude reaches its maximum is 88 km. The generation mechanism of these irregularities is explained by the neutral turbulence theory, which indicates that the spectral index is 5/3 and has been confirmed by a chemical release experiment using rockets over India to be valid up to about 110 km. From frequency analysis of the data observed during the descent in the lower E region, we have found that the rocket-wake effect becomes larger when the probe is situated near the edge of the rocket-wake, and that this is also the case even when the rocket-wake effect does not clearly appear in the DC current signal which approximately changes in proportion to the electron density, where the probe is completely situated inside the rocket-wake region. (author)

[Sequence of the ITS region of nuclear ribosomal DNA(nrDNA) in Xinjiang wild Dianthus and its phylogenetic relationship].

Science.gov (United States)

Zhang, Lu; Cai, You-Ming; Zhuge, Qiang; Zou, Hui-Yu; Huang, Min-Ren

2002-06-01

Xinjiang is a center of distribution and differentiation of genus Dianthus in China, and has a great deal of species resources. The sequences of ITS region (including ITS-1, 5.8S rDNA and ITS-2) of nuclear ribosomal DNA from 8 species of genus Dianthus wildly distributed in Xinjiang were determined by direct sequencing of PCR products. The result showed that the size of the ITS of Dianthus is from 617 to 621 bp, and the length variation is only 4 bp. There are very high homogeneous (97.6%-99.8%) sequences between species, and about 80% homogeneous sequences between genus Dianthus and outgroup. The sequences of ITS in genus Dianthus are relatively conservative. In general, there are more conversion than transition in the variation sites among genus Dianthus. The conversion rates are relatively high, and the ratios of conversion/transition are 1.0-3.0. On the basis of phylogenetic analysis of nucleotide sequences the species of Dianthus in China would be divided into three sections. There is a distant relationship between sect. Barbulatum Williams and sect. Dianthus and between sect. Barbulatum Williams and sect. Fimbriatum Williams, and there is a close relationship between sect. Dianthus and sect. Fimbriatum Williams. From the phylogenetic tree of ITS it was found that the origin of sect. Dianthusis is earlier than that of sect. Fimbriatum Williams and sect. Barbulatum Williams.

Front-End Electron Transfer Dissociation Coupled to a 21 Tesla FT-ICR Mass Spectrometer for Intact Protein Sequence Analysis

Science.gov (United States)

Weisbrod, Chad R.; Kaiser, Nathan K.; Syka, John E. P.; Early, Lee; Mullen, Christopher; Dunyach, Jean-Jacques; English, A. Michelle; Anderson, Lissa C.; Blakney, Greg T.; Shabanowitz, Jeffrey; Hendrickson, Christopher L.; Marshall, Alan G.; Hunt, Donald F.

2017-09-01

High resolution mass spectrometry is a key technology for in-depth protein characterization. High-field Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR MS) enables high-level interrogation of intact proteins in the most detail to date. However, an appropriate complement of fragmentation technologies must be paired with FTMS to provide comprehensive sequence coverage, as well as characterization of sequence variants, and post-translational modifications. Here we describe the integration of front-end electron transfer dissociation (FETD) with a custom-built 21 tesla FT-ICR mass spectrometer, which yields unprecedented sequence coverage for proteins ranging from 2.8 to 29 kDa, without the need for extensive spectral averaging (e.g., 60% sequence coverage for apo-myoglobin with four averaged acquisitions). The system is equipped with a multipole storage device separate from the ETD reaction device, which allows accumulation of multiple ETD fragment ion fills. Consequently, an optimally large product ion population is accumulated prior to transfer to the ICR cell for mass analysis, which improves mass spectral signal-to-noise ratio, dynamic range, and scan rate. We find a linear relationship between protein molecular weight and minimum number of ETD reaction fills to achieve optimum sequence coverage, thereby enabling more efficient use of instrument data acquisition time. Finally, real-time scaling of the number of ETD reactions fills during method-based acquisition is shown, and the implications for LC-MS/MS top-down analysis are discussed. [Figure not available: see fulltext.

Minding the gap: Frequency of indels in mtDNA control region sequence data and influence on population genetic analyses

Science.gov (United States)

Pearce, J.M.

2006-01-01

Insertions and deletions (indels) result in sequences of various lengths when homologous gene regions are compared among individuals or species. Although indels are typically phylogenetically informative, occurrence and incorporation of these characters as gaps in intraspecific population genetic data sets are rarely discussed. Moreover, the impact of gaps on estimates of fixation indices, such as FST, has not been reviewed. Here, I summarize the occurrence and population genetic signal of indels among 60 published studies that involved alignments of multiple sequences from the mitochondrial DNA (mtDNA) control region of vertebrate taxa. Among 30 studies observing indels, an average of 12% of both variable and parsimony-informative sites were composed of these sites. There was no consistent trend between levels of population differentiation and the number of gap characters in a data block. Across all studies, the average influence on estimates of ??ST was small, explaining only an additional 1.8% of among population variance (range 0.0-8.0%). Studies most likely to observe an increase in ??ST with the inclusion of gap characters were those with control region DNA appears small, dependent upon total number of variable sites in the data block, and related to species-specific characteristics and the spatial distribution of mtDNA lineages that contain indels. ?? 2006 Blackwell Publishing Ltd.

Low-pass shotgun sequencing of the barley genome facilitates rapid identification of genes, conserved non-coding sequences and novel repeats

Directory of Open Access Journals (Sweden)

Graner Andreas

2008-10-01

Full Text Available Abstract Background Barley has one of the largest and most complex genomes of all economically important food crops. The rise of new short read sequencing technologies such as Illumina/Solexa permits such large genomes to be effectively sampled at relatively low cost. Based on the corresponding sequence reads a Mathematically Defined Repeat (MDR index can be generated to map repetitive regions in genomic sequences. Results We have generated 574 Mbp of Illumina/Solexa sequences from barley total genomic DNA, representing about 10% of a genome equivalent. From these sequences we generated an MDR index which was then used to identify and mark repetitive regions in the barley genome. Comparison of the MDR plots with expert repeat annotation drawing on the information already available for known repetitive elements revealed a significant correspondence between the two methods. MDR-based annotation allowed for the identification of dozens of novel repeat sequences, though, which were not recognised by hand-annotation. The MDR data was also used to identify gene-containing regions by masking of repetitive sequences in eight de-novo sequenced bacterial artificial chromosome (BAC clones. For half of the identified candidate gene islands indeed gene sequences could be identified. MDR data were only of limited use, when mapped on genomic sequences from the closely related species Triticum monococcum as only a fraction of the repetitive sequences was recognised. Conclusion An MDR index for barley, which was obtained by whole-genome Illumina/Solexa sequencing, proved as efficient in repeat identification as manual expert annotation. Circumventing the labour-intensive step of producing a specific repeat library for expert annotation, an MDR index provides an elegant and efficient resource for the identification of repetitive and low-copy (i.e. potentially gene-containing sequences regions in uncharacterised genomic sequences. The restriction that a particular

[Using exon combined target region capture sequencing chip to detect the disease-causing genes of retinitis pigmentosa].

Science.gov (United States)

Rong, Weining; Chen, Xuejuan; Li, Huiping; Liu, Yani; Sheng, Xunlun

2014-06-01

To detect the disease-causing genes of 10 retinitis pigmentosa pedigrees by using exon combined target region capture sequencing chip. Pedigree investigation study. From October 2010 to December 2013, 10 RP pedigrees were recruited for this study in Ningxia Eye Hospital. All the patients and family members received complete ophthalmic examinations. DNA was abstracted from patients, family members and controls. Using exon combined target region capture sequencing chip to screen the candidate disease-causing mutations. Polymerase chain reaction (PCR) and direct sequencing were used to confirm the disease-causing mutations. Seventy patients and 23 normal family members were recruited from 10 pedigrees. Among 10 RP pedigrees, 1 was autosomal dominant pedigrees and 9 were autosomal recessive pedigrees. 7 mutations related to 5 genes of 5 pedigrees were detected. A frameshift mutation on BBS7 gene was detected in No.2 pedigree, the patients of this pedigree combined with central obesity, polydactyly and mental handicap. No.2 pedigree was diagnosed as Bardet-Biedl syndrome finally. A missense mutation was detected in No.7 and No.10 pedigrees respectively. Because the patients suffered deafness meanwhile, the final diagnosis was Usher syndrome. A missense mutation on C3 gene related to age-related macular degeneration was also detected in No. 7 pedigrees. A nonsense mutation and a missense mutation on CRB1 gene were detected in No. 1 pedigree and a splicesite mutation on PROM1 gene was detected in No. 5 pedigree. Retinitis pigmentosa is a kind of genetic eye disease with diversity clinical phenotypes. Rapid and effective genetic diagnosis technology combined with clinical characteristics analysis is helpful to improve the level of clinical diagnosis of RP.

Artificial E-region field-aligned plasma irregularities generated at pump frequencies near the second electron gyroharmonic

Directory of Open Access Journals (Sweden)

D. L. Hysell

2009-07-01

Full Text Available E region ionospheric modification experiments have been performed at HAARP using pump frequencies about 50 kHz above and below the second electron gyroharmonic frequency. Artificial E region field-aligned plasma density irregularities (FAIs were created and observed using the imaging coherent scatter radar near Homer, Alaska. Echoes from FAIs generated with pump frequencies above and below 2Ωe did not appear to differ significantly in experiments conducted on summer afternoons in 2008, and the resonance instability seemed to be at work in either case. We argue that upper hybrid wave trapping and resonance instability at pump frequencies below the second electron gyroharmonic frequency are permitted theoretically when the effects of finite parallel wavenumbers are considered. Echoes from a sporadic E layer were observed to be somewhat weaker when the pump frequency was 50 kHz below the second electron gyroharmonic frequency. This may indicate that finite parallel wavenumbers are inconsistent with wave trapping in thin sporadic E ionization layers.

An AU-rich element in the 3{prime} untranslated region of the spinach chloroplast petD gene participates in sequence-specific RNA-protein complex formation

Energy Technology Data Exchange (ETDEWEB)

Chen, Qiuyun; Adams, C.C.; Usack, L. [Cornell Univ., Ithaca, NY (United States)] [and others

1995-04-01

In chloroplasts, the 3{prime} untranslated regions of most mRNAs contain a stem-loop-forming inverted repeat (IR) sequence that is required for mRNA stability and correct 3{prime}-end formation. The IR regions of several mRNAs are also known to bind chloroplast proteins, as judged from in vitro gel mobility shift and UV cross-linking assays, and these RNA-protein interactions may be involved in the regulation of chloroplast mRNA processing and/or stability. Here we describe in detail the RNA and protein components that are involved in 3{prime} IR-containing RNA (3{prime} IR-RNA)-protein complex formation for the spinach chloroplast petD gene, which encodes subunit IV of the cytochrome b{sub 6}/f complex. We show that the complex contains 55-, 41-, and 29-kDa RNA-binding proteins (ribonucleoproteins [RNPs]). These proteins together protect a 90-nucleotide segment of RNA from RNase T{sub 1} digestion; this RNA contains the IR and downstream flanking sequences. Competition experiments using 3{prime} IR-RNAs from the psbA or rbcL gene demonstrate that the RNPs have a strong specificity for the petD sequence. Site-directed mutagenesis was carried out to define the RNA sequence elements required for complex formation. These studies identified an 8-nucleotide AU-rich sequence downstream of the IR; mutations within this sequence had moderate to severe effects on RNA-protein complex formation. Although other similar sequences are present in the petD 3{prime} untranslated region, only a single copy, which we have termed box II, appears to be essential for in vivo protein binding. In addition, the IR itself is necessary for optimal complex formation. These two sequence elements together with an RNP complex may direct correct 3{prime}-end processing and/or influence the stability of petD mRNA in chloroplasts. 48 refs., 9 figs., 2 tabs.

Reference voltage calculation method based on zero-sequence component optimisation for a regional compensation DVR

Science.gov (United States)

Jian, Le; Cao, Wang; Jintao, Yang; Yinge, Wang

2018-04-01

This paper describes the design of a dynamic voltage restorer (DVR) that can simultaneously protect several sensitive loads from voltage sags in a region of an MV distribution network. A novel reference voltage calculation method based on zero-sequence voltage optimisation is proposed for this DVR to optimise cost-effectiveness in compensation of voltage sags with different characteristics in an ungrounded neutral system. Based on a detailed analysis of the characteristics of voltage sags caused by different types of faults and the effect of the wiring mode of the transformer on these characteristics, the optimisation target of the reference voltage calculation is presented with several constraints. The reference voltages under all types of voltage sags are calculated by optimising the zero-sequence component, which can reduce the degree of swell in the phase-to-ground voltage after compensation to the maximum extent and can improve the symmetry degree of the output voltages of the DVR, thereby effectively increasing the compensation ability. The validity and effectiveness of the proposed method are verified by simulation and experimental results.

Selection of mRNA 5'-untranslated region sequence with high translation efficiency through ribosome display

International Nuclear Information System (INIS)

Mie, Masayasu; Shimizu, Shun; Takahashi, Fumio; Kobatake, Eiry

2008-01-01

The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, only mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library

New tool to assemble repetitive regions using next-generation sequencing data

Science.gov (United States)

Kuśmirek, Wiktor; Nowak, Robert M.; Neumann, Łukasz

2017-08-01

The next generation sequencing techniques produce a large amount of sequencing data. Some part of the genome are composed of repetitive DNA sequences, which are very problematic for the existing genome assemblers. We propose a modification of the algorithm for a DNA assembly, which uses the relative frequency of reads to properly reconstruct repetitive sequences. The new approach was implemented and tested, as a demonstration of the capability of our software we present some results for model organisms. The new implementation, using a three-layer software architecture was selected, where the presentation layer, data processing layer, and data storage layer were kept separate. Source code as well as demo application with web interface and the additional data are available at project web-page: http://dnaasm.sourceforge.net.

SubClonal Hierarchy Inference from Somatic Mutations: Automatic Reconstruction of Cancer Evolutionary Trees from Multi-region Next Generation Sequencing.

Science.gov (United States)

Niknafs, Noushin; Beleva-Guthrie, Violeta; Naiman, Daniel Q; Karchin, Rachel

2015-10-01

Recent improvements in next-generation sequencing of tumor samples and the ability to identify somatic mutations at low allelic fractions have opened the way for new approaches to model the evolution of individual cancers. The power and utility of these models is increased when tumor samples from multiple sites are sequenced. Temporal ordering of the samples may provide insight into the etiology of both primary and metastatic lesions and rationalizations for tumor recurrence and therapeutic failures. Additional insights may be provided by temporal ordering of evolving subclones--cellular subpopulations with unique mutational profiles. Current methods for subclone hierarchy inference tightly couple the problem of temporal ordering with that of estimating the fraction of cancer cells harboring each mutation. We present a new framework that includes a rigorous statistical hypothesis test and a collection of tools that make it possible to decouple these problems, which we believe will enable substantial progress in the field of subclone hierarchy inference. The methods presented here can be flexibly combined with methods developed by others addressing either of these problems. We provide tools to interpret hypothesis test results, which inform phylogenetic tree construction, and we introduce the first genetic algorithm designed for this purpose. The utility of our framework is systematically demonstrated in simulations. For most tested combinations of tumor purity, sequencing coverage, and tree complexity, good power (≥ 0.8) can be achieved and Type 1 error is well controlled when at least three tumor samples are available from a patient. Using data from three published multi-region tumor sequencing studies of (murine) small cell lung cancer, acute myeloid leukemia, and chronic lymphocytic leukemia, in which the authors reconstructed subclonal phylogenetic trees by manual expert curation, we show how different configurations of our tools can identify either a single

SubClonal Hierarchy Inference from Somatic Mutations: Automatic Reconstruction of Cancer Evolutionary Trees from Multi-region Next Generation Sequencing.

Directory of Open Access Journals (Sweden)

Noushin Niknafs

2015-10-01

Full Text Available Recent improvements in next-generation sequencing of tumor samples and the ability to identify somatic mutations at low allelic fractions have opened the way for new approaches to model the evolution of individual cancers. The power and utility of these models is increased when tumor samples from multiple sites are sequenced. Temporal ordering of the samples may provide insight into the etiology of both primary and metastatic lesions and rationalizations for tumor recurrence and therapeutic failures. Additional insights may be provided by temporal ordering of evolving subclones--cellular subpopulations with unique mutational profiles. Current methods for subclone hierarchy inference tightly couple the problem of temporal ordering with that of estimating the fraction of cancer cells harboring each mutation. We present a new framework that includes a rigorous statistical hypothesis test and a collection of tools that make it possible to decouple these problems, which we believe will enable substantial progress in the field of subclone hierarchy inference. The methods presented here can be flexibly combined with methods developed by others addressing either of these problems. We provide tools to interpret hypothesis test results, which inform phylogenetic tree construction, and we introduce the first genetic algorithm designed for this purpose. The utility of our framework is systematically demonstrated in simulations. For most tested combinations of tumor purity, sequencing coverage, and tree complexity, good power (≥ 0.8 can be achieved and Type 1 error is well controlled when at least three tumor samples are available from a patient. Using data from three published multi-region tumor sequencing studies of (murine small cell lung cancer, acute myeloid leukemia, and chronic lymphocytic leukemia, in which the authors reconstructed subclonal phylogenetic trees by manual expert curation, we show how different configurations of our tools can

Identification of genome-wide non-canonical spliced regions and analysis of biological functions for spliced sequences using Read-Split-Fly.

Science.gov (United States)

Bai, Yongsheng; Kinne, Jeff; Ding, Lizhong; Rath, Ethan C; Cox, Aaron; Naidu, Siva Dharman

2017-10-03

It is generally thought that most canonical or non-canonical splicing events involving U2- and U12 spliceosomes occur within nuclear pre-mRNAs. However, the question of whether at least some U12-type splicing occurs in the cytoplasm is still unclear. In recent years next-generation sequencing technologies have revolutionized the field. The "Read-Split-Walk" (RSW) and "Read-Split-Run" (RSR) methods were developed to identify genome-wide non-canonical spliced regions including special events occurring in cytoplasm. As the significant amount of genome/transcriptome data such as, Encyclopedia of DNA Elements (ENCODE) project, have been generated, we have advanced a newer more memory-efficient version of the algorithm, "Read-Split-Fly" (RSF), which can detect non-canonical spliced regions with higher sensitivity and improved speed. The RSF algorithm also outputs the spliced sequences for further downstream biological function analysis. We used open access ENCODE project RNA-Seq data to search spliced intron sequences against the U12-type spliced intron sequence database to examine whether some events could occur as potential signatures of U12-type splicing. The check was performed by searching spliced sequences against 5'ss and 3'ss sequences from the well-known orthologous U12-type spliceosomal intron database U12DB. Preliminary results of searching 70 ENCODE samples indicated that the presence of 5'ss with U12-type signature is more frequent than U2-type and prevalent in non-canonical junctions reported by RSF. The selected spliced sequences have also been further studied using miRBase to elucidate their functionality. Preliminary results from 70 samples of ENCODE datasets show that several miRNAs are prevalent in studied ENCODE samples. Two of these are associated with many diseases as suggested in the literature. Specifically, hsa-miR-1273 and hsa-miR-548 are associated with many diseases and cancers. Our RSF pipeline is able to detect many possible junctions

Regional geological assessment of the Devonian-Mississippian shale sequence of the Appalachian, Illinois, and Michigan basins relative to potential storage/disposal of radioactive wastes

Energy Technology Data Exchange (ETDEWEB)

Lomenick, T.F.; Gonzales, S.; Johnson, K.S.; Byerly, D.

1983-01-01

The thick and regionally extensive sequence of shales and associated clastic sedimentary rocks of Late Devonian and Early Mississippian age has been considered among the nonsalt geologies for deep subsurface containment of high-level radioactive wastes. This report examines some of the regional and basin-specific characteristics of the black and associated nonblack shales of this sequence within the Appalachian, Illinois, and Michigan basins of the north-central and eastern United States. Principal areas where the thickness and depth of this shale sequence are sufficient to warrant further evaluation are identified, but no attempt is made to identify specific storage/disposal sites. Also identified are other areas with less promise for further study because of known potential conflicts such as geologic-hydrologic factors, competing subsurface priorities involving mineral resources and groundwater, or other parameters. Data have been compiled for each basin in an effort to indicate thickness, distribution, and depth relationships for the entire shale sequence as well as individual shale units in the sequence. Included as parts of this geologic assessment are isopach, depth information, structure contour, tectonic elements, and energy-resource maps covering the three basins. Summary evaluations are given for each basin as well as an overall general evaluation of the waste storage/disposal potential of the Devonian-Mississippian shale sequence,including recommendations for future studies to more fully characterize the shale sequence for that purpose. Based on data compiled in this cursory investigation, certain rock units have reasonable promise for radioactive waste storage/disposal and do warrant additional study.

Regional geological assessment of the Devonian-Mississippian shale sequence of the Appalachian, Illinois, and Michigan basins relative to potential storage/disposal of radioactive wastes

International Nuclear Information System (INIS)

Lomenick, T.F.; Gonzales, S.; Johnson, K.S.; Byerly, D.

1983-01-01

The thick and regionally extensive sequence of shales and associated clastic sedimentary rocks of Late Devonian and Early Mississippian age has been considered among the nonsalt geologies for deep subsurface containment of high-level radioactive wastes. This report examines some of the regional and basin-specific characteristics of the black and associated nonblack shales of this sequence within the Appalachian, Illinois, and Michigan basins of the north-central and eastern United States. Principal areas where the thickness and depth of this shale sequence are sufficient to warrant further evaluation are identified, but no attempt is made to identify specific storage/disposal sites. Also identified are other areas with less promise for further study because of known potential conflicts such as geologic-hydrologic factors, competing subsurface priorities involving mineral resources and groundwater, or other parameters. Data have been compiled for each basin in an effort to indicate thickness, distribution, and depth relationships for the entire shale sequence as well as individual shale units in the sequence. Included as parts of this geologic assessment are isopach, depth information, structure contour, tectonic elements, and energy-resource maps covering the three basins. Summary evaluations are given for each basin as well as an overall general evaluation of the waste storage/disposal potential of the Devonian-Mississippian shale sequence,including recommendations for future studies to more fully characterize the shale sequence for that purpose. Based on data compiled in this cursory investigation, certain rock units have reasonable promise for radioactive waste storage/disposal and do warrant additional study

[Cloning and sequence analysis of the DHBV genome of the brown ducks in Guilin region and establishment of the quantitative method for detecting DHBV].

Science.gov (United States)

Su, He-Ling; Huang, Ri-Dong; He, Song-Qing; Xu, Qing; Zhu, Hua; Mo, Zhi-Jing; Liu, Qing-Bo; Liu, Yong-Ming

2013-03-01

Brown ducks carrying DHBV were widely used as hepatitis B animal model in the research of the activity and toxicity of anti-HBV dugs. Studies showed that the ratio of DHBV carriers in the brown ducks in Guilin region was relatively high. Nevertheless, the characters of the DHBV genome of Guilin brown duck remain unknown. Here we report the cloning of the genome of Guilin brown duck DHBV and the sequence analysis of the genome. The full length of the DHBV genome of Guilin brown duck was 3 027bp. Analysis using ORF finder found that there was an ORF for an unknown peptide other than S-ORF, PORF and C-ORF in the genome of the DHBV. Vector NTI 8. 0 analysis revealed that the unknown peptide contained a motif which binded to HLA * 0201. Aligning with the DHBV sequences from different countries and regions indicated that there were no obvious differences of regional distribution among the sequences. A fluorescence quantitative PCR for detecting DHBV was establishment based on the recombinant plasmid pGEM-DHBV-S constructed. This study laid the groundwork for using Guilin brown duck as a hepatitis B animal model.

Mitochondrial transcription factor A (Tfam) gene sequencing and mitochondrial evaluation in inherited retinal dysplasia in miniature schnauzer dogs.

Science.gov (United States)

Bauer, Bianca S; Forsyth, George W; Sandmeyer, Lynne S; Grahn, Bruce H

2011-04-01

Mitochondrial transcription factor A (Tfam) has been implicated in the pathogenesis of retinal dysplasia in miniature schnauzer dogs and it has been proposed that affected dogs have altered mitochondrial numbers, size, and morphology. To test these hypotheses the Tfam gene of affected and normal miniature schnauzer dogs with retinal dysplasia was sequenced and lymphocyte mitochondria were quantified, measured, and the morphology was compared in normal and affected dogs using transmission electron microscopy. For Tfam sequencing, retina, retinal pigment epithelium (RPE), and whole blood samples were collected. Total RNA was isolated from the retina and RPE and reverse transcribed to make cDNA. Genomic DNA was extracted from white blood cell pellets obtained from the whole blood samples. The Tfam coding sequence, 5' promoter region, intron1 and the 3' non-coding sequence of normal and affected dogs were amplified using polymerase chain reaction (PCR), cloned and sequenced. For electron microscopy, lymphocytes from affected and normal dogs were photographed and the mitochondria within each cross-section were identified, quantified, and the mitochondrial area (μm²) per lymphocyte cross-section was calculated. Lastly, using a masked technique, mitochondrial morphology was compared between the 2 groups. Sequencing of the miniature schnauzer Tfam gene revealed no functional sequence variation between affected and normal dogs. Lymphocyte and mitochondrial area, mitochondrial quantification, and morphology assessment also revealed no significant difference between the 2 groups. Further investigation into other candidate genes or factors causing retinal dysplasia in the miniature schnauzer is warranted.

Draft genome sequence of bitter gourd (Momordica charantia), a vegetable and medicinal plant in tropical and subtropical regions.

Science.gov (United States)

Urasaki, Naoya; Takagi, Hiroki; Natsume, Satoshi; Uemura, Aiko; Taniai, Naoki; Miyagi, Norimichi; Fukushima, Mai; Suzuki, Shouta; Tarora, Kazuhiko; Tamaki, Moritoshi; Sakamoto, Moriaki; Terauchi, Ryohei; Matsumura, Hideo

2017-02-01

Bitter gourd (Momordica charantia) is an important vegetable and medicinal plant in tropical and subtropical regions globally. In this study, the draft genome sequence of a monoecious bitter gourd inbred line, OHB3-1, was analyzed. Through Illumina sequencing and de novo assembly, scaffolds of 285.5 Mb in length were generated, corresponding to ∼84% of the estimated genome size of bitter gourd (339 Mb). In this draft genome sequence, 45,859 protein-coding gene loci were identified, and transposable elements accounted for 15.3% of the whole genome. According to synteny mapping and phylogenetic analysis of conserved genes, bitter gourd was more related to watermelon (Citrullus lanatus) than to cucumber (Cucumis sativus) or melon (C. melo). Using RAD-seq analysis, 1507 marker loci were genotyped in an F2 progeny of two bitter gourd lines, resulting in an improved linkage map, comprising 11 linkage groups. By anchoring RAD tag markers, 255 scaffolds were assigned to the linkage map. Comparative analysis of genome sequences and predicted genes determined that putative trypsin-inhibitor and ribosome-inactivating genes were distinctive in the bitter gourd genome. These genes could characterize the bitter gourd as a medicinal plant. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

In silico Analysis of 3′-End-Processing Signals in Aspergillus oryzae Using Expressed Sequence Tags and Genomic Sequencing Data

Science.gov (United States)

Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya

2011-01-01

To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533

The Evolution of the Electronics Industry in the SIJORI Cross-border Region

OpenAIRE

van Grunsven, Leo; Hutchinson, F.

2014-01-01

In the early 1990s, Singapore, the Malaysian state of Johor, and the Indonesian island of Batam sought to leverage their proximity, differing comparative advantages, and good logistics connections to market themselves as an integrated unit. After an initial phase of enthusiasm and considerable investment from electronics multinationals, attention regarding the cross-border region waned in the wake of the Asian Financial Crisis. Using data from investment authorities in Indonesia and Malaysia,...

UBV(RI)sub(c) photometry of some standard sequences in the Harvard F regions and in the Magellanic Clouds

International Nuclear Information System (INIS)

Menzies, J.W.; Laing, J.D.

1988-01-01

This paper presents the results of a photometric programme aimed at improving the UBV(RI)sub(c) standard sequences in the Harvard F regions and in the Small and Large Magellanic Clouds. Magnitudes and colours are given for 99 stars, and they are compared with the current values which were obtained or compiled by a previous author. (author)

Development of D-region electron and ion densities under various auroral conditions during the Energy Budget Campaign (EBC)

International Nuclear Information System (INIS)

Brekke, A.; Holt, O.; Friedrich, M.; Hansen, T.; Stauning, P.; Thrane, E.V.

1985-01-01

D-region electron density profiles and time variations were obtained during the Energy Budget Campaign 1980 by a partial reflection radar at Ramfjordmoen, Tromso, located between the rocket ranges at Andoya and Kiruna. The observations were made under various geophysical conditions which are illustrated by riometer observations. The partial reflection measurements indicate that the rockets were launched into a relatively stable D-region on two occasions, while it was somewhat more disturbed on the third. A comparison between the electron density profiles derived by the partial reflection technique and rocket borne probes and Faraday rotation experiments does indicate fair agreement during the quiet conditions, but relatively large discrepancies during disturbed conditions. Simultaneously derived electron density profiles, by use of the Faraday technique, and ion density profiles, by gridded electrostatic spheres mounted on the rocket payload, have made it possible to estimate the negative ion to electron density ratio lambda versus height. These values of lambda are within the range of model calculations. (author)

Direct, rapid RNA sequence analysis

International Nuclear Information System (INIS)

Peattie, D.A.

1987-01-01

The original methods of RNA sequence analysis were based on enzymatic production and chromatographic separation of overlapping oligonucleotide fragments from within an RNA molecule followed by identification of the mononucleotides comprising the oligomer. Over the past decade the field of nucleic acid sequencing has changed dramatically, however, and RNA molecules now can be sequenced in a variety of more streamlined fashions. Most of the more recent advances in RNA sequencing have involved one-dimensional electrophoretic separation of 32 P-end-labeled oligoribonucleotides on polyacrylamide gels. In this chapter the author discusses two of these methods for determining the nucleotide sequences of RNA molecules rapidly: the chemical method and the enzymatic method. Both methods are direct and degradative, i.e., they rely on fragmatic and chemical approaches should be utilized. The single-strand-specific ribonucleases (A, T 1 , T 2 , and S 1 ) provide an efficient means to locate double-helical regions rapidly, and the chemical reactions provide a means to determine the RNA sequence within these regions. In addition, the chemical reactions allow one to assign interactions to specific atoms and to distinguish secondary interactions from tertiary ones. If the RNA molecule is small enough to be sequenced directly by the enzymatic or chemical method, the probing reactions can be done easily at the same time as sequencing reactions

Sequence Analysis of How Disability Influenced Life Trajectories in a Past Population from the Nineteenth-Century Sundsvall Region, Sweden

Directory of Open Access Journals (Sweden)

Lotta Vikström

2017-05-01

Full Text Available Historically, little is known about whether and to what extent disabled people found work and formed families. To fill this gap, this study analyses the life course trajectories of both disabled and non-disabled individuals, between the ages of 15 and 33, from the Sundsvall region in Sweden during the nineteenth century. Having access to micro-data that report disabilities in a population of 8,874 individuals from the parish registers digitised by the Demographic Data Base, Umeå University, we employ sequence analysis on a series of events that are expected to occur in life of young adults: getting a job, marrying and becoming a parent, while also taking into account out-migration and death. Through this method we obtain a holistic picture of the life course of disabled people. Main findings show that their trajectories did not include work or family to the same extent as those of non-disabled people. Secondary findings concerning migration and mortality indicate that the disabled rarely out-migrated from the region, and they suffered from premature deaths. To our knowledge this is the first study to employ sequence analysis on a substantially large number of cases to provide demographic evidence of how disability shaped human trajectories in the past during an extended period of life. Accordingly, we detail our motivation for this method, describe our analytical approach, and discuss the advantages and disadvantages associated with sequence analysis for our case study.

Tidying up international nucleotide sequence databases: ecological, geographical and sequence quality annotation of its sequences of mycorrhizal fungi.

Science.gov (United States)

Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas

2011-01-01

Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.

[Complete genome sequencing and sequence analysis of BCG Tice].

Science.gov (United States)

Wang, Zhiming; Pan, Yuanlong; Wu, Jun; Zhu, Baoli

2012-10-04

The objective of this study is to obtain the complete genome sequence of Bacillus Calmette-Guerin Tice (BCG Tice), in order to provide more information about the molecular biology of BCG Tice and design more reasonable vaccines to prevent tuberculosis. We assembled the data from high-throughput sequencing with SOAPdenovo software, with many contigs and scaffolds obtained. There are many sequence gaps and physical gaps remained as a result of regional low coverage and low quality. We designed primers at the end of contigs and performed PCR amplification in order to link these contigs and scaffolds. With various enzymes to perform PCR amplification, adjustment of PCR reaction conditions, and combined with clone construction to sequence, all the gaps were finished. We obtained the complete genome sequence of BCG Tice and submitted it to GenBank of National Center for Biotechnology Information (NCBI). The genome of BCG Tice is 4334064 base pairs in length, with GC content 65.65%. The problems and strategies during the finishing step of BCG Tice sequencing are illuminated here, with the hope of affording some experience to those who are involved in the finishing step of genome sequencing. The microarray data were verified by our results.

Evaluation of Maxim Module-Integrated Electronics at the DOE Regional Test Centers: Preprint

Energy Technology Data Exchange (ETDEWEB)

Deline, C.; Sekulic, B.; Stein, J.; Barkaszi, S.; Yang, J.; Kahn, S.

2014-07-01

Module-embedded power electronics developed by Maxim Integrated are under evaluation through a partnership with the Department of Energy's Regional Test Center (RTC) program. Field deployments of both conventional modules and electronics-enhanced modules are designed to quantify the performance advantage of Maxim's products under different amounts of inter-row shading, and their ability to be deployed at a greater ground-coverage-ratio than conventional modules. Simulations in PVSYST have quantified the predicted performance difference between conventional modules and Maxim's modules from inter-row shading. Initial performance results have identified diffuse irradiance losses at tighter row spacing for both the Maxim and conventional modules. Comparisons with published models show good agreement with models predicting the greatest diffuse irradiance losses. At tighter row spacing, all of the strings equipped with embedded power electronics outperformed their conventional peers. An even greater performance advantage is predicted to occur in the winter months when the amount of inter-row shading mismatch is at a maximum.

'Mitominis': multiplex PCR analysis of reduced size amplicons for compound sequence analysis of the entire mtDNA control region in highly degraded samples.

Science.gov (United States)

Eichmann, Cordula; Parson, Walther

2008-09-01

The traditional protocol for forensic mitochondrial DNA (mtDNA) analyses involves the amplification and sequencing of the two hypervariable segments HVS-I and HVS-II of the mtDNA control region. The primers usually span fragment sizes of 300-400 bp each region, which may result in weak or failed amplification in highly degraded samples. Here we introduce an improved and more stable approach using shortened amplicons in the fragment range between 144 and 237 bp. Ten such amplicons were required to produce overlapping fragments that cover the entire human mtDNA control region. These were co-amplified in two multiplex polymerase chain reactions and sequenced with the individual amplification primers. The primers were carefully selected to minimize binding on homoplasic and haplogroup-specific sites that would otherwise result in loss of amplification due to mis-priming. The multiplexes have successfully been applied to ancient and forensic samples such as bones and teeth that showed a high degree of degradation.

Production of accelerated electrons near an electron source in the plasma resonance region

International Nuclear Information System (INIS)

Fedorov, V.A.

1989-01-01

Conditions of generation of plasma electrons accelerated and their characteristics in the vicinity of an electron source are determined. The electron source isolated electrically with infinitely conducting surface, being in unrestricted collisionless plasma ω 0 >>ν, where ω 0 - plasma frequency of nonperturbated plasma, ν - frequency of plasma electron collisions with other plasma particles, is considered. Spherically symmetric injection of electrons, which rates are simulated by ω frequency, occurs from the source surface. When describing phenomena in the vicinity of the electron source, one proceeds from the quasihydrodynamic equation set

Nonlinear Right-Hand Polarized Wave in Plasma in the Electron Cyclotron Resonance Region

Science.gov (United States)

Krasovitskiy, V. B.; Turikov, V. A.

2018-05-01

The propagation of a nonlinear right-hand polarized wave along an external magnetic field in subcritical plasma in the electron cyclotron resonance region is studied using numerical simulations. It is shown that a small-amplitude plasma wave excited in low-density plasma is unstable against modulation instability with a modulation period equal to the wavelength of the excited wave. The modulation amplitude in this case increases with decreasing detuning from the resonance frequency. The simulations have shown that, for large-amplitude waves of the laser frequency range propagating in plasma in a superstrong magnetic field, the maximum amplitude of the excited longitudinal electric field increases with the increasing external magnetic field and can reach 30% of the initial amplitude of the electric field in the laser wave. In this case, the energy of plasma electrons begins to substantially increase already at magnetic fields significantly lower than the resonance value. The laser energy transferred to plasma electrons in a strong external magnetic field is found to increase severalfold compared to that in isotropic plasma. It is shown that this mechanism of laser radiation absorption depends only slightly on the electron temperature.

Comparing Whole-Genome Sequencing with Sanger Sequencing for spa Typing of Methicillin-Resistant Staphylococcus aureus

DEFF Research Database (Denmark)

Bartels, Mette Damkjaer; Petersen, Andreas; Worning, Peder

2014-01-01

spa typing of methicillin-resistant Staphylococcus aureus (MRSA) has traditionally been done by PCR amplification and Sanger sequencing of the spa repeat region. At Hvidovre Hospital, Denmark, whole-genome sequencing (WGS) of all MRSA isolates has been performed routinely since January 2013, and ...

Artificial E-region field-aligned plasma irregularities generated at pump frequencies near the second electron gyroharmonic

Directory of Open Access Journals (Sweden)

D. L. Hysell

2009-07-01

Full Text Available E region ionospheric modification experiments have been performed at HAARP using pump frequencies about 50 kHz above and below the second electron gyroharmonic frequency. Artificial E region field-aligned plasma density irregularities (FAIs were created and observed using the imaging coherent scatter radar near Homer, Alaska. Echoes from FAIs generated with pump frequencies above and below 2Ω_e did not appear to differ significantly in experiments conducted on summer afternoons in 2008, and the resonance instability seemed to be at work in either case. We argue that upper hybrid wave trapping and resonance instability at pump frequencies below the second electron gyroharmonic frequency are permitted theoretically when the effects of finite parallel wavenumbers are considered. Echoes from a sporadic E layer were observed to be somewhat weaker when the pump frequency was 50 kHz below the second electron gyroharmonic frequency. This may indicate that finite parallel wavenumbers are inconsistent with wave trapping in thin sporadic E ionization layers.

Murine mammary tumor virus pol-related sequences in human DNA: characterization and sequence comparison with the complete murine mammary tumor virus pol gene

International Nuclear Information System (INIS)

Deen, K.C.; Sweet, R.W.

1986-01-01

Sequences in the human genome with homology to the murine mammary tumor virus (MMTV) pol gene were isolated from a human phage library. Ten clones with extensive pol homology were shown to define five separate loci. These loci share common sequences immediately adjacent to the pol-like segments and, in addition, contain a related repeat element which bounds this region. This organization is suggestive of a proviral structure. The authors estimate that the human genome contains 30 to 40 copies of these pol-related sequences. The pol region of one of the cloned segments (HM16) and the complete MMTV pol gene were sequenced and compared. The nucleotide homology between these pol sequences is 52% and is concentrated in the terminal regions. The MMTV pol gene contains a single long open reading frame encoding 899 amino acids and is demarcated from the partially overlapping putative gag gene by termination codons and a shift in translational reading frame. The pol sequence of HM16 is multiply terminated but does contain open reading frames which encode 370, 105, and 112 amino acids residues in separate reading frames. The authors deduced a composite pol protein sequence for HM16 by aligning it to the MMTV pol gene and then compared these sequences with other retroviral pol protein sequences. Conserved sequences occur in both the amino and carboxyl regions which lie within the polymerase and endonuclease domains of pol, respectively

Sequences within both the 5' untranslated region and the Gag gene are important for efficient encapsidation of Mason-Pfizer monkey virus RNA

International Nuclear Information System (INIS)

Schmidt, Russell D.; Mustafa, Farah; Lew, Kathy A.; Browning, Mathew T.; Rizvi, Tahir A.

2003-01-01

It has previously been shown that the 5' untranslated leader region (UTR), including about 495 bp of the gag gene, is sufficient for the efficient encapsidation and propagation of Mason-Pfizer monkey virus (MPMV) based retroviral vectors. In addition, a deletion upstream of the major splice donor, SD, has been shown to adversely affect MPMV RNA packaging. However, the precise sequence requirement for the encapsidation of MPMV genomic RNA within the 5' UTR and gag remains largely unknown. In this study, we have used a systematic deletion analysis of the 5' UTR and gag gene to define the cis-acting sequences responsible for efficient MPMV RNA packaging. Using an in vivo packaging and transduction assay, our results reveal that the MPMV packaging signal is primarily found within the first 30 bp immediately downstream of the primer binding site. However, its function is dependent upon the presence of the last 23 bp of the 5' UTR and approximately the first 100 bp of the gag gene. Thus, sequences that affect MPMV RNA packaging seem to reside both upstream and downstream of the major splice donor with the downstream region responsible for the efficient functioning of the upstream primary packaging determinant

Global Coupled Model Studies of The Jovian Upper Atmosphere In Response To Electron Precipitation and Ionospheric Convection Within The Auroral Region.

Science.gov (United States)

Millward, G. H.; Miller, S.; Aylward, A. D.

The Jovian Ionospheric Model (JIM) is a global three-dimensional model of Jupiter's coupled ionosphere and thermosphere, developed at University College London. Re- cently, the model has been used to investigate the atmospheric response to electron precipitation within the high-latitude auroral region. A series of simulations have been performed in which the model atmosphere is subjected to monochromatic precipitat- ing electrons of varying number flux and initial energy and, in addition, to various degrees of ionospheric convection. The auroral ionospheric conductivity which re- sults is shown to be strongly non-linear with respect to the incoming electron energy, with a maximum observed for incident particles of initial energy 60 KeV. Electrons with higher energies penetrate the thermospheric region completely, whilst electrons of lower energy (say 10 keV) produce ionisation at higher levels in the atmosphere which are less less condusive to the creation of ionospheric conductivity. Studies of the thermospheric winds with the auroral region show that zonal winds (around the auroral oval) can attain values of around 70% of the driving zonal ion velocity. Also the results show that these large neutral winds are limited in vertical extent to the region of large ionospheric conductivity, tailing off markedly at altitudes above this. The latest results from this work will be presented, and the implications for Jovian magnetospheric-ionospheric coupling will be discussed.

Genetic distance of Malaysian mousedeer based on mitochondrial DNA cytochrome oxidase I (COI) and D-loop region sequences

Science.gov (United States)

Bakar, Mohamad-Azam Akmal Abu; Rovie-Ryan, Jeffrine Japning; Ampeng, Ahmad; Yaakop, Salmah; Nor, Shukor Md; Md-Zain, Badrul Munir

2018-04-01

Mousedeer is one of the primitive mammals that can be found mainly in Southeast-Asia region. There are two species of mousedeer in Malaysia which are Tragulus kanchil and Tragulus napu. Both species can be distinguish by size, coat coloration, and throat pattern but clear diagnosis still cannot be found. The objective of the study is to show the genetic distance relationship between T. kanchil and T. napu and their population based on mitochondrial DNA (mtDNA) cytochrome oxidase I (COI) and D-loop region. There are 42 sample of mousedeer were used in this study collected by PERHILITAN from different locality. Another 29 D-loop sequence were retrieved from Genbank for comparative analysis. All sample were amplified using universal primer and species-specific primer for COI and D-loop genes via PCR process. The amplified sequences were analyzed to determine genetic distance of T. kanchil and T. napu. From the analysis, the average genetic distance between T. kanchil and T. napu based on locus COI and D-loop were 0.145 and 0.128 respectively. The genetic distance between populations of T. kanchil based on locus COI was between 0.003-0.013. For locus D-loop, genetic distance analysis showed distance in relationship between west-coast populations to east-coast population of T. kanchil. COI and D-loop mtDNA region provided a clear picture on the relationship within the mousedeer species. Last but not least, conservation effort toward protecting this species can be done by study the molecular genetics and prevent the extinction of this species.

Chaotic generation of PN sequences : a VLSI implementation

NARCIS (Netherlands)

Dornbusch, A.; Pineda de Gyvez, J.

1999-01-01

Generation of repeatable pseudo-random sequences with chaotic analog electronics is not feasible using standard circuit topologies. Component variation caused by imperfect fabrication causes the same divergence of output sequences as does varying initial conditions. By quantizing the output of a

Quantitative explanation of some electron temperature profiles measured in situ in the high latitude ionospheric E-region

International Nuclear Information System (INIS)

Schlegel, K.; Oyama, Koh-ichiro; Hirao, Kunio

1983-01-01

E region electron temperature profiles obtained with a rocket experiment in the Antarctica are compared to theoretical electron temperatures calculated from a model. The main heat source in this model is the heating of the electron gas by unstable plasma waves. Very good agreement between both temperatures is obtained between 105 and 115 km altitude, where this heating mechanism is effective. The agreement is also good below this altitude range, after a refinement of the data analysis procedure for the measured temperatures. Several important consequences of the good agreement are pointed out. (author)

Unique Trichomonas vaginalis gene sequences identified in multinational regions of Northwest China.

Science.gov (United States)

Liu, Jun; Feng, Meng; Wang, Xiaolan; Fu, Yongfeng; Ma, Cailing; Cheng, Xunjia

2017-07-24

Trichomonas vaginalis (T. vaginalis) is a flagellated protozoan parasite that infects humans worldwide. This study determined the sequence of the 18S ribosomal RNA gene of T. vaginalis infecting both females and males in Xinjiang, China. Samples from 73 females and 28 males were collected and confirmed for infection with T. vaginalis, a total of 110 sequences were identified when the T. vaginalis 18S ribosomal RNA gene was sequenced. These sequences were used to prepare a phylogenetic network. The rooted network comprised three large clades and several independent branches. Most of the Xinjiang sequences were in one group. Preliminary results suggest that Xinjiang T. vaginalis isolates might be genetically unique, as indicated by the sequence of their 18S ribosomal RNA gene. Low migration rate of local people in this province may contribute to a genetic conservativeness of T. vaginalis. The unique genetic feature of our isolates may suggest a different clinical presentation of trichomoniasis, including metronidazole susceptibility, T. vaginalis virus or Mycoplasma co-infection characteristics. The transmission and evolution of Xinjiang T. vaginalis is of interest and should be studied further. More attention should be given to T. vaginalis infection in both females and males in Xinjiang.

Solar Wind 0.1-1 keV Electrons in the Corotating Interaction Regions

Science.gov (United States)

Wang, L.; Tao, J.; Li, G.; Wimmer-Schweingruber, R. F.; Jian, L. K.; He, J.; Tu, C.; Tian, H.; Bale, S. D.

2017-12-01

Here we present a statistical study of the 0.1-1 keV suprathermal electrons in the undisturbed and compressed slow/fast solar wind, for the 71 corotating interaction regions (CIRs) with good measurements from the WIND 3DP and MFI instruments from 1995 to 1997. For each of these CIRs, we separate the strahl and halo electrons based on their different behaviors in pitch angle distributions in the undisturbed and compressed solar wind. We fit both the strahl and halo energy spectra to a kappa function with an index κ index and effective temperature Teff, and calculate the pitch-angle width at half-maximum (PAHM) of the strahl population. We also integrate the electron measurements between 0.1 and 1.0 keV to obtain the number density n and average energy Eavg for the strahl and halo populations. We find that for both the strahl and halo populations within and around these CIRs, the fitted κ index strongly correlates with Teff, similar to the quiet-time solar wind (Tao et al., ApJ, 2016). The number density of both the strahl and halo shows a strong positive correlation with the electron core temperature. The strahl number density ns is correlated with the magnitude of interplanetary magnetic field, and the strahl PAHM width is anti-correlated with the solar wind speed. These results suggest that the origin of strahl electrons from the solar corona is likely related to the electron core temperature and magnetic field strength, while the production of halo electrons in the interplanetary medium could depend on the solar wind velocity.

Evolution and strengthening of the Calabrian Regional Seismic Network during the Pollino sequence

Science.gov (United States)

D'Alessandro, Antonino; Gervasi, Anna; Guerra, Ignazio

2013-04-01

In the last three years the Calabria-Lucania border area is affected by an intense seismic activity generated by the activation of geological structures which be seat of clusters of microearthquakes, with energy release sufficient to be felt and to generate alarm and bother. Besides to the historical memory of the inhabitants of Mormanno (the town most affected of macroseismic effects) there are some historical documents that indicate the occurrence of a similar seismic crisis in 1888. A more recent seismic sequence, the first monitored by seismic instruments, occurred in 1973-1974. In the last case, the activity started in early 2010 and is still ongoing. The two shocks of ML = 4.3 and 5.0 and the the very long time duration differs this crisis from the previous ones. Given this background, in 1981 was installed at Mormanno a seismic station (MMN) belonging to Regional Seismic Network of the University of Calabria (RSRC), now also a station of the Italian National Seismic Network of the Istituto Nazionale di Geofisica Vulcanolgia (INSN-INGV). This seismic station made it possible to follow the evolution of seismicity in this area and in particular the progressive increase in seismic activity started in 2010. Since 2010, some 3D stand-alone, was installed by the University of Calabria. Further stations of INGV were installed in November 2011 after a sharp increase of the energy release and subsequently by the INGV and the GeoForschungsZentrum (Potsdam) after the main shock of the whole sequence. Seismic networks are powerful tools for understanding active tectonic processes in a monitored seismically active region. However, the optimal monitoring of a seismic region requires the assessment of the seismic network capabilities to identify seismogenic areas that are not adequately covered and to quantify measures that will allow the network improvement. In this paper we examine in detail the evolution and the strengthening of the RSRC in the last years analyzing the

ON THE NONTHERMAL κ-DISTRIBUTED ELECTRONS IN PLANETARY NEBULAE AND H ii REGIONS: THE κ INDEX AND ITS CORRELATIONS WITH OTHER NEBULAR PROPERTIES

Energy Technology Data Exchange (ETDEWEB)

Zhang, Yong [Space Astronomy Laboratory, Faculty of Science, The University of Hong Kong, Pokfulam Road, Hong Kong (China); Zhang, Bing; Liu, Xiao-Wei, E-mail: zhangy96@hku.hk [Department of Astronomy, Peking University, Beijing 100871 (China)

2016-01-20

Recently, a suspicion arose that the free electrons in planetary nebulae (PNs) and H ii regions might have nonthermal energy distributions. In this scenario, a κ index is introduced to characterize the electron energy distributions, with smaller κ values indicating larger deviations from Maxwell–Boltzmann distributions. Assuming that this is the case, we determine the κ values for a sample of PNs and H ii regions by comparing the intensities of [O iii] collisionally excited lines and the hydrogen Balmer jump. We find the average κ indices of PNs and H ii regions to be 27 and 32, respectively. Correlations between the resultant κ values and various physical properties of the nebulae are examined to explore the potential origin of nonthermal electrons in photoionized gaseous nebulae. However, no positive result is obtained. Thus, the current analysis does not lend support to the idea that κ-distributed electrons are present in PNs and H ii regions.

Molecular Identification of Isolated Fungi from Unopened Containers of Greek Yogurt by DNA Sequencing of Internal Transcribed Spacer Region

Directory of Open Access Journals (Sweden)

Irshad M. Sulaiman

2014-06-01

Full Text Available In our previous study, we described the development of an internal transcribed spacer (ITS1 sequencing method, and used this protocol in species-identification of isolated fungi collected from the manufacturing areas of a compounding company known to have caused the multistate fungal meningitis outbreak in the United States. In this follow-up study, we have analyzed the unopened vials of Greek yogurt from the recalled batch to determine the possible cause of microbial contamination in the product. A total of 15 unopened vials of Greek yogurt belonging to the recalled batch were examined for the detection of fungi in these samples known to cause foodborne illness following conventional microbiological protocols. Fungi were isolated from all of the 15 Greek yogurt samples analyzed. The isolated fungi were genetically typed by DNA sequencing of PCR-amplified ITS1 region of rRNA gene. Analysis of data confirmed all of the isolated fungal isolates from the Greek yogurt to be Rhizomucor variabilis. The generated ITS1 sequences matched 100% with the published sequences available in GenBank. In addition, these yogurt samples were also tested for the presence of five types of bacteria (Salmonella, Listeria, Staphylococcus, Bacillus and Escherichia coli causing foodborne disease in humans, and found negative for all of them.

Identification and systematical studies of the electron-capture delayed fission (ECDF) in the lead region

CERN Multimedia

Pauwels, D B; Lane, J

2008-01-01

In our recent experiment (March 2007) at the velocity filter SHIP(GSI) we observed the electron-capture delayed fission of the odd-odd isotope $^{194}$At. This is the first unambiguous identification of this phenomenon in the very neutron-deficient nuclei in the vicinity of the proton shell closure at Z=82. In addition, the total kinetic energy (TKE) for the daughter nuclide $^{194}$Po was measured, despite the fact that this isotope does not decay via spontaneous fission. Semi-empirical analysis of the electron-capture Q$_{EC}$ values and fission barriers B$_{f}$ shows that a relatively broad island of ECDF must exist in this region of the Nuclide Chart, with some of the nuclei having unusually high ECDF probabilities. Therefore, this Proposal is intended to initiate the systematic identification and study of $\\beta$-delayed fission at ISOLDE in the very neutron-deficient lead region. Our aim is to provide unique low-energy fission data (e.g. probabilities, TKE release, fission barriers and their isospin dep...

Optical properties and electronic transitions of DNA oligonucleotides as a function of composition and stacking sequence.

Science.gov (United States)

Schimelman, Jacob B; Dryden, Daniel M; Poudel, Lokendra; Krawiec, Katherine E; Ma, Yingfang; Podgornik, Rudolf; Parsegian, V Adrian; Denoyer, Linda K; Ching, Wai-Yim; Steinmetz, Nicole F; French, Roger H

2015-02-14

The role of base pair composition and stacking sequence in the optical properties and electronic transitions of DNA is of fundamental interest. We present and compare the optical properties of DNA oligonucleotides (AT)10, (AT)5(GC)5, and (AT-GC)5 using both ab initio methods and UV-vis molar absorbance measurements. Our data indicate a strong dependence of both the position and intensity of UV absorbance features on oligonucleotide composition and stacking sequence. The partial densities of states for each oligonucleotide indicate that the valence band edge arises from a feature associated with the PO4(3-) complex anion, and the conduction band edge arises from anti-bonding states in DNA base pairs. The results show a strong correspondence between the ab initio and experimentally determined optical properties. These results highlight the benefit of full spectral analysis of DNA, as opposed to reductive methods that consider only the 260 nm absorbance (A260) or simple purity ratios, such as A260/A230 or A260/A280, and suggest that the slope of the absorption edge onset may provide a useful metric for the degree of base pair stacking in DNA. These insights may prove useful for applications in biology, bioelectronics, and mesoscale self-assembly.

DNA watermarks in non-coding regulatory sequences

Directory of Open Access Journals (Sweden)

Pyka Martin

2009-07-01

Full Text Available Abstract Background DNA watermarks can be applied to identify the unauthorized use of genetically modified organisms. It has been shown that coding regions can be used to encrypt information into living organisms by using the DNA-Crypt algorithm. Yet, if the sequence of interest presents a non-coding DNA sequence, either the function of a resulting functional RNA molecule or a regulatory sequence, such as a promoter, could be affected. For our studies we used the small cytoplasmic RNA 1 in yeast and the lac promoter region of Escherichia coli. Findings The lac promoter was deactivated by the integrated watermark. In addition, the RNA molecules displayed altered configurations after introducing a watermark, but surprisingly were functionally intact, which has been verified by analyzing the growth characteristics of both wild type and watermarked scR1 transformed yeast cells. In a third approach we introduced a second overlapping watermark into the lac promoter, which did not affect the promoter activity. Conclusion Even though the watermarked RNA and one of the watermarked promoters did not show any significant differences compared to the wild type RNA and wild type promoter region, respectively, it cannot be generalized that other RNA molecules or regulatory sequences behave accordingly. Therefore, we do not recommend integrating watermark sequences into regulatory regions.

Estimates of Terms in Ohm's Law During an Encounter with an Electron Diffusion Region

Science.gov (United States)

Torbert, R. B.; Burch, J. L.; Giles, B. L.; Gershman, D.; Pollock, C. J.; Dorelli, J.; Avanov, L. A.; Argall, M.; Shuster, J.; Strangeway, R.;

Short sequence motifs, overrepresented in mammalian conservednon-coding sequences

Energy Technology Data Exchange (ETDEWEB)

Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna

2007-02-21

Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by

Numerical modeling of block structure dynamics: Application to the Vrancea region and study of earthquakes sequences in the synthetic catalogs

International Nuclear Information System (INIS)

Soloviev, A.A.; Vorobieva, I.A.

1995-08-01

A seismically active region is represented as a system of absolutely rigid blocks divided by infinitely thin plane faults. The interaction of the blocks along the fault planes and with the underlying medium is viscous-elastic. The system of blocks moves as a consequence of prescribed motion of boundary blocks and the underlying medium. When for some part of a fault plane the stress surpasses a certain strength level a stress-drop (''a failure'') occurs. It can cause a failure for other parts of fault planes. The failures are considered as earthquakes. As a result of the numerical simulation a synthetic earthquake catalogue is produced. This procedure is applied for numerical modeling of dynamics of the block structure approximating the tectonic structure of the Vrancea region. By numerical experiments the values of the model parameters were obtained which supplied the synthetic earthquake catalog with the space distribution of epicenters close to the real distribution of the earthquake epicenters in the Vrancea region. The frequency-magnitude relations (Gutenberg-Richter curves) obtained for the synthetic and real catalogs have some common features. The sequences of earthquakes arising in the model are studied for some artificial structures. It is found that ''foreshocks'', ''main shocks'', and ''aftershocks'' could be detected among earthquakes forming the sequences. The features of aftershocks, foreshocks, and catalogs of main shocks are analysed. (author). 5 refs, 12 figs, 16 tabs

Sequence Capture versus Restriction Site Associated DNA Sequencing for Shallow Systematics.

Science.gov (United States)

Harvey, Michael G; Smith, Brian Tilston; Glenn, Travis C; Faircloth, Brant C; Brumfield, Robb T

2016-09-01

Sequence capture and restriction site associated DNA sequencing (RAD-Seq) are two genomic enrichment strategies for applying next-generation sequencing technologies to systematics studies. At shallow timescales, such as within species, RAD-Seq has been widely adopted among researchers, although there has been little discussion of the potential limitations and benefits of RAD-Seq and sequence capture. We discuss a series of issues that may impact the utility of sequence capture and RAD-Seq data for shallow systematics in non-model species. We review prior studies that used both methods, and investigate differences between the methods by re-analyzing existing RAD-Seq and sequence capture data sets from a Neotropical bird (Xenops minutus). We suggest that the strengths of RAD-Seq data sets for shallow systematics are the wide dispersion of markers across the genome, the relative ease and cost of laboratory work, the deep coverage and read overlap at recovered loci, and the high overall information that results. Sequence capture's benefits include flexibility and repeatability in the genomic regions targeted, success using low-quality samples, more straightforward read orthology assessment, and higher per-locus information content. The utility of a method in systematics, however, rests not only on its performance within a study, but on the comparability of data sets and inferences with those of prior work. In RAD-Seq data sets, comparability is compromised by low overlap of orthologous markers across species and the sensitivity of genetic diversity in a data set to an interaction between the level of natural heterozygosity in the samples examined and the parameters used for orthology assessment. In contrast, sequence capture of conserved genomic regions permits interrogation of the same loci across divergent species, which is preferable for maintaining comparability among data sets and studies for the purpose of drawing general conclusions about the impact of

Sequence diversity of hepatitis C virus 6a within the extended interferon sensitivity-determining region correlates with interferon-alpha/ribavirin treatment outcomes.

Science.gov (United States)

Zhou, Daniel X M; Chan, Paul K S; Zhang, Tiejun; Tully, Damien C; Tam, John S

2010-10-01

Studies on the association between sequence variability of the interferon sensitivity-determining region (ISDR) of hepatitis C virus and the outcome of treatment have reached conflicting results. In this study, 25 patients infected with HCV 6a who had received interferon-alpha/ribavirin combination treatment were analyzed for the sequence variations. 14 of them had the full genome sequences obtained from a previous study, whereas the other 11 samples were sequenced for the extended ISDR (eISDR). This eISDR fragment covers 192 bp (64 amino acids) upstream and 201 bp (67 amino acids) downstream from the ISDR previously defined for HCV 1b. The comparison between interferon-alpha resistance and response groups for the amino acid mutations located in the full genome (6 and 8 patients respectively) as well as the mutations located in the eISDR (10 and 15 patients respectively) showed that the mutations I2160V, I2256V, V2292I (Pc) 2010 Elsevier B.V. All rights reserved.

Yeast genome sequencing:

DEFF Research Database (Denmark)

Piskur, Jure; Langkjær, Rikke Breinhold

2004-01-01

For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

Rapid Polymer Sequencer

Science.gov (United States)

Stolc, Viktor (Inventor); Brock, Matthew W (Inventor)

2013-01-01

Method and system for rapid and accurate determination of each of a sequence of unknown polymer components, such as nucleic acid components. A self-assembling monolayer of a selected substance is optionally provided on an interior surface of a pipette tip, and the interior surface is immersed in a selected liquid. A selected electrical field is impressed in a longitudinal direction, or in a transverse direction, in the tip region, a polymer sequence is passed through the tip region, and a change in an electrical current signal is measured as each polymer component passes through the tip region. Each of the measured changes in electrical current signals is compared with a database of reference electrical change signals, with each reference signal corresponding to an identified polymer component, to identify the unknown polymer component with a reference polymer component. The nanopore preferably has a pore inner diameter of no more than about 40 nm and is prepared by heating and pulling a very small section of a glass tubing.

Ti-6Al-4V electron beam weld qualification using laser scanning confocal microscopy

International Nuclear Information System (INIS)

Wanjara, P.; Brochu, M.; Jahazi, M.

2005-01-01

Processing conditions for manufacturing Ti-6Al-4V components by welding using an electron beam source are known to influence the transformation microstructure in the narrow fusion and heat-affected zones of the weld region. This work examined the effect of multiple-sequence welding on the characteristics of the transformed beta microstructure, using laser scanning confocal microscopy to resolve the Widmanstaetten alpha-beta structure in the fusion zone. The evolution in the alpha interlamellar spacing and plate thickness with processing was then related to microhardness measurements in the weld region

Complete plastid genome sequence of Primula sinensis (Primulaceae: structure comparison, sequence variation and evidence for accD transfer to nucleus

Directory of Open Access Journals (Sweden)

Tong-Jian Liu

2016-06-01

Full Text Available Species-rich genus Primula L. is a typical plant group with which to understand genetic variance between species in different levels of relationships. Chloroplast genome sequences are used to be the information resource for quantifying this difference and reconstructing evolutionary history. In this study, we reported the complete chloroplast genome sequence of Primula sinensis and compared it with other related species. This genome of chloroplast showed a typical circular quadripartite structure with 150,859 bp in sequence length consisting of 37.2% GC base. Two inverted repeated regions (25,535 bp were separated by a large single-copy region (82,064 bp and a small single-copy region (17,725 bp. The genome consists of 112 genes, including 78 protein-coding genes, 30 tRNA genes and four rRNA genes. Among them, seven coding genes, seven tRNA genes and four rRNA genes have two copies due to their locations in the IR regions. The accD and infA genes lacking intact open reading frames (ORF were identified as pseudogenes. SSR and sequence variation analyses were also performed on the plastome of Primula sinensis, comparing with another available plastome of P. poissonii. The four most variable regions, rpl36–rps8, rps16–trnQ, trnH–psbA and ndhC–trnV, were identified. Phylogenetic relationship estimates using three sub-datasets extracted from a matrix of 57 protein-coding gene sequences showed the identical result that was consistent with previous studies. A transcript found from P. sinensis transcriptome showed a high similarity to plastid accD functional region and was identified as a putative plastid transit peptide at the N-terminal region. The result strongly suggested that plastid accD has been functionally transferred to the nucleus in P. sinensis.

Observation of electron biteout regions below sporadic E layers at polar latitudes

Directory of Open Access Journals (Sweden)

G. A. Lehmacher

2015-03-01

Full Text Available The descent of a narrow sporadic E layer near 95 km altitude over Poker Flat Research Range in Alaska was observed with electron probes on two consecutive sounding rockets and with incoherent scatter radar during a 2 h period near magnetic midnight. A series of four trimethyl aluminum chemical releases demonstrated that the Es layer remained just slightly above the zonal wind node, which was slowly descending due to propagating long-period gravity waves. The location of the layer is consistent with the equilibrium position due to combined action of the wind shear and electric fields. Although the horizontal electric field could not be measured directly, we estimate that it was ~ 2 mV m−1 southward, consistent with modeling the vertical ion drift, and compatible with extremely quiet conditions. Both electron probes observed deep biteout regions just below the Es enhancements, which also descended with the sporadic layers. We discuss several possibilities for the cause of these depletions; one possibility is the presence of negatively charged, nanometer-sized mesospheric smoke particles. Such particles have recently been detected in the upper mesosphere, but not yet in immediate connection with sporadic E. Our observations of electron depletions suggest a new process associated with sporadic E.

Two sequence-ready contigs spanning the two copies of a 200-kb duplication on human 21q: partial sequence and polymorphisms.

Science.gov (United States)

Potier, M; Dutriaux, A; Orti, R; Groet, J; Gibelin, N; Karadima, G; Lutfalla, G; Lynn, A; Van Broeckhoven, C; Chakravarti, A; Petersen, M; Nizetic, D; Delabar, J; Rossier, J

1998-08-01

Physical mapping across a duplication can be a tour de force if the region is larger than the size of a bacterial clone. This was the case of the 170- to 275-kb duplication present on the long arm of chromosome 21 in normal human at 21q11.1 (proximal region) and at 21q22.1 (distal region), which we described previously. We have constructed sequence-ready contigs of the two copies of the duplication of which all the clones are genuine representatives of one copy or the other. This required the identification of four duplicon polymorphisms that are copy-specific and nonallelic variations in the sequence of the STSs. Thirteen STSs were mapped inside the duplicated region and 5 outside but close to the boundaries. Among these STSs 10 were end clones from YACs, PACs, or cosmids, and the average interval between two markers in the duplicated region was 16 kb. Eight PACs and cosmids showing minimal overlaps were selected in both copies of the duplication. Comparative sequence analysis along the duplication showed three single-basepair changes between the two copies over 659 bp sequenced (4 STSs), suggesting that the duplication is recent (less than 4 mya). Two CpG islands were located in the duplication, but no genes were identified after a 36-kb cosmid from the proximal copy of the duplication was sequenced. The homology of this chromosome 21 duplicated region with the pericentromeric regions of chromosomes 13, 2, and 18 suggests that the mechanism involved is probably similar to pericentromeric-directed mechanisms described in interchromosomal duplications. Copyright 1998 Academic Press.

Sequencing of BAC pools by different next generation sequencing platforms and strategies

Directory of Open Access Journals (Sweden)

Scholz Uwe

2011-10-01

Full Text Available Abstract Background Next generation sequencing of BACs is a viable option for deciphering the sequence of even large and highly repetitive genomes. In order to optimize this strategy, we examined the influence of read length on the quality of Roche/454 sequence assemblies, to what extent Illumina/Solexa mate pairs (MPs improve the assemblies by scaffolding and whether barcoding of BACs is dispensable. Results Sequencing four BACs with both FLX and Titanium technologies revealed similar sequencing accuracy, but showed that the longer Titanium reads produce considerably less misassemblies and gaps. The 454 assemblies of 96 barcoded BACs were improved by scaffolding 79% of the total contig length with MPs from a non-barcoded library. Assembly of the unmasked 454 sequences without separation by barcodes revealed chimeric contig formation to be a major problem, encompassing 47% of the total contig length. Masking the sequences reduced this fraction to 24%. Conclusion Optimal BAC pool sequencing should be based on the longest available reads, with barcoding essential for a comprehensive assessment of both repetitive and non-repetitive sequence information. When interest is restricted to non-repetitive regions and repeats are masked prior to assembly, barcoding is non-essential. In any case, the assemblies can be improved considerably by scaffolding with non-barcoded BAC pool MPs.

[Population genetic differentiation of Phrynocephalus axillaris in east of Xinjiang Uygur Autonomous Region based on sequence variation of mitochondrial ND4-tRNALeu gene].

Science.gov (United States)

Li, Jun; Guo, Xian-Guang; Wang, Yue-Zhao

2010-08-01

A 838 bp fragment of mtDNA ND4-tRNALeu gene was sequenced for 66 individuals from five populations (DB: Dabancheng, TU: Turpan, SS: Shanshan, HL: Liushuquan, HD: East district of Hami) of Phrynocephalus axillaris distributed in east of Xinjiang Uygur Autonomous Region. Seventeen haplotypes were identified from 29 nucleotide polymorphic sites in the aligned 838 bp sequence. Excluding DB, there were relatively high haplotype diversity [(0.600+/-0.113)oscillation since Pleistocene and genetic drift.

Sequencing genes in silico using single nucleotide polymorphisms

Directory of Open Access Journals (Sweden)

Zhang Xinyi

2012-01-01

Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

Radiation-induced electron migration in nucleic acids

International Nuclear Information System (INIS)

Fuciarelli, A.F.; Sisk, E.C.; Miller, J.H.; Zimbrick, J.D.

1994-01-01

Radiation-induced electron migration along DNA is a mechanism by which randomly produced stochastic energy deposition events can lead to non-random types of damage along DNA manifested distal to the sites of the initial energy deposition. Radiation-induced electron migration in nucleic acids has been examined using oligonucleotides containing 5-bromouracil (5-BrU). Interaction of 5-BrU with solvated electrons results in release of bromide ions and formation of uracil-5-yl radicals. Monitoring either bromide ion release or uracil formation provides an opportunity to study electron migration processes in model nucleic acid systems. Using this approach we have discovered that electron migration along oligonucleotides is significantly influenced by the base sequence and strandedness. Migration along 7 base pairs in oligonucleotides containing guanine bases was observed for oligonucleotides irradiated in solution, which compares with mean migration distances of 6-10 bp for Escherichia coli DNA irradiated in solution and 5.5 bp for E. coli DNA irradiated in cells. Evidence also suggests that electron migration can occur preferentially in the 5' to 3' direction along a double-stranded oligonucleotide containing a region of purine bases adjacent to the 5-BrU moiety. Our continued efforts will provide information regarding the contribution of electron transfer along DNA to formation of locally multiply damaged sites created in DNA by exposure to ionizing radiation. (Author)

Recombination in the 5' leader of murine leukemia virus is accurate and influenced by sequence identity with a strong bias toward the kissing-loop dimerization region

DEFF Research Database (Denmark)

Mikkelsen, J G; Lund, Anders Henrik; Duch, M

1998-01-01

during minus-strand DNA synthesis occurred within defined areas of the genome and did not lead to misincorporations at the crossover site. The nonrandom distribution of recombination sites did not reflect a bias for specific sites due to selection at the level of marker gene expression. We address...... whether template switching is affected by the length of sequence identity, by palindromic sequences, and/or by putative stem-loop structures. Sixteen of 24 sites of recombination colocalized with the kissing-loop dimerization region, and we propose that RNA-RNA interactions between palindromic sequences...

Bacterial communities in haloalkaliphilic sulfate-reducing bioreactors under different electron donors revealed by 16S rRNA MiSeq sequencing

Energy Technology Data Exchange (ETDEWEB)

Zhou, Jiemin [National Key Laboratory of Biochemical Engineering, Institute of Process Engineering, Chinese Academy of Sciences, P.O. Box 353, Beijing 100190 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Zhou, Xuemei; Li, Yuguang [101 Institute, Ministry of Civil Affairs, Beijing 100070 (China); Xing, Jianmin, E-mail: jmxing@ipe.ac.cn [National Key Laboratory of Biochemical Engineering, Institute of Process Engineering, Chinese Academy of Sciences, P.O. Box 353, Beijing 100190 (China)

2015-09-15

Highlights: • Bacterial communities of haloalkaliphilic bioreactors were investigated. • MiSeq was first used in analysis of communities of haloalkaliphilic bioreactors. • Electron donors had significant effect on bacterial communities. - Abstract: Biological technology used to treat flue gas is useful to replace conventional treatment, but there is sulfide inhibition. However, no sulfide toxicity effect was observed in haloalkaliphilic bioreactors. The performance of the ethanol-fed bioreactor was better than that of lactate-, glucose-, and formate-fed bioreactor, respectively. To support this result strongly, Illumina MiSeq paired-end sequencing of 16S rRNA gene was applied to investigate the bacterial communities. A total of 389,971 effective sequences were obtained and all of them were assigned to 10,220 operational taxonomic units (OTUs) at a 97% similarity. Bacterial communities in the glucose-fed bioreactor showed the greatest richness and evenness. The highest relative abundance of sulfate-reducing bacteria (SRB) was found in the ethanol-fed bioreactor, which can explain why the performance of the ethanol-fed bioreactor was the best. Different types of SRB, sulfur-oxidizing bacteria, and sulfur-reducing bacteria were detected, indicating that sulfur may be cycled among these microorganisms. Because high-throughput 16S rRNA gene paired-end sequencing has improved resolution of bacterial community analysis, many rare microorganisms were detected, such as Halanaerobium, Halothiobacillus, Desulfonatronum, Syntrophobacter, and Fusibacter. 16S rRNA gene sequencing of these bacteria would provide more functional and phylogenetic information about the bacterial communities.

Sequencing and association analysis of the type 1 diabetes – linked region on chromosome 10p12-q11

Directory of Open Access Journals (Sweden)

Barratt Bryan J

2007-05-01

Full Text Available Abstract Background In an effort to locate susceptibility genes for type 1 diabetes (T1D several genome-wide linkage scans have been undertaken. A chromosomal region designated IDDM10 retained genome-wide significance in a combined analysis of the main linkage scans. Here, we studied sequence polymorphisms in 23 Mb on chromosome 10p12-q11, including the putative IDDM10 region, to identify genes associated with T1D. Results Initially, we resequenced the functional candidate genes, CREM and SDF1, located in this region, genotyped 13 tag single nucleotide polymorphisms (SNPs and found no association with T1D. We then undertook analysis of the whole 23 Mb region. We constructed and sequenced a contig tile path from two bacterial artificial clone libraries. By comparison with a clone library from an unrelated person used in the Human Genome Project, we identified 12,058 SNPs. We genotyped 303 SNPs and 25 polymorphic microsatellite markers in 765 multiplex T1D families and followed up 22 associated polymorphisms in up to 2,857 families. We found nominal evidence of association in six loci (P = 0.05 – 0.0026, located near the PAPD1 gene. Therefore, we resequenced 38.8 kb in this region, found 147 SNPs and genotyped 84 of them in the T1D families. We also tested 13 polymorphisms in the PAPD1 gene and in five other loci in 1,612 T1D patients and 1,828 controls from the UK. Overall, only the D10S193 microsatellite marker located 28 kb downstream of PAPD1 showed nominal evidence of association in both T1D families and in the case-control sample (P = 0.037 and 0.03, respectively. Conclusion We conclude that polymorphisms in the CREM and SDF1 genes have no major effect on T1D. The weak T1D association that we detected in the association scan near the PAPD1 gene may be either false or due to a small genuine effect, and cannot explain linkage at the IDDM10 region.

Comparison of sequencing the D2 region of the large subunit ribosomal RNA gene (MicroSEQ®) versus the internal transcribed spacer (ITS) regions using two public databases for identification of common and uncommon clinically relevant fungal species.

Science.gov (United States)

Arbefeville, S; Harris, A; Ferrieri, P

2017-09-01

Fungal infections cause considerable morbidity and mortality in immunocompromised patients. Rapid and accurate identification of fungi is essential to guide accurately targeted antifungal therapy. With the advent of molecular methods, clinical laboratories can use new technologies to supplement traditional phenotypic identification of fungi. The aims of the study were to evaluate the sole commercially available MicroSEQ® D2 LSU rDNA Fungal Identification Kit compared to the in-house developed internal transcribed spacer (ITS) regions assay in identifying moulds, using two well-known online public databases to analyze sequenced data. 85 common and uncommon clinically relevant fungi isolated from clinical specimens were sequenced for the D2 region of the large subunit (LSU) of ribosomal RNA (rRNA) gene with the MicroSEQ® Kit and the ITS regions with the in house developed assay. The generated sequenced data were analyzed with the online GenBank and MycoBank public databases. The D2 region of the LSU rRNA gene identified 89.4% or 92.9% of the 85 isolates to the genus level and the full ITS region (f-ITS) 96.5% or 100%, using GenBank or MycoBank, respectively, when compared to the consensus ID. When comparing species-level designations to the consensus ID, D2 region of the LSU rRNA gene aligned with 44.7% (38/85) or 52.9% (45/85) of these isolates in GenBank or MycoBank, respectively. By comparison, f-ITS possessed greater specificity, followed by ITS1, then ITS2 regions using GenBank or MycoBank. Using GenBank or MycoBank, D2 region of the LSU rRNA gene outperformed phenotypic based ID at the genus level. Comparing rates of ID between D2 region of the LSU rRNA gene and the ITS regions in GenBank or MycoBank at the species level against the consensus ID, f-ITS and ITS2 exceeded performance of the D2 region of the LSU rRNA gene, but ITS1 had similar performance to the D2 region of the LSU rRNA gene using MycoBank. Our results indicated that the MicroSEQ® D2 LSU r

Stochastic modelling of daily rainfall sequences

NARCIS (Netherlands)

Buishand, T.A.

1977-01-01

Rainfall series of different climatic regions were analysed with the aim of generating daily rainfall sequences. A survey of the data is given in I, 1. When analysing daily rainfall sequences one must be aware of the following points:
a. Seasonality. Because of seasonal variation

Secondary mineralization in carious lesions of human dentin. Electron-probe, electron microscope, and electron diffraction studies

Energy Technology Data Exchange (ETDEWEB)

Ogiwara, H [Tokyo Dental Coll. (Japan)

1975-02-01

Dentinal carious lesions having a remineralized surface layer were studied by means electron-probe microanalysis, electron microscopy, electron diffraction. As the results of electron-probe study, F, Mg, and Na were found to be distributed mainly in the remineralized surface layer and S in the decalcified region where decreases in Ca, P, and Mg concentration were usually observed. The decrease in Mg concentration always started earlier than that of Ca and P concentration. Electron microscope and electron diffraction studies revealed that apatic crystals in the remineralized surface layer were much larger than those in the intact dentin. Although they were less conspicuous, crystals in the decalcified region also were larger than those in the intact region. Dentinal tubules, occluded by many crystals, were frequently seen during the observations. Crystals in the tubules varied in morphology, showing granular, needle, rhomboid, and tabular shapes. By means of electron diffraction, the granular- or needle-shaped crystals were identified as apatite and the rhomboid-shaped crystals as whitlockite. Some of the tabular-shaped crystals appeared to be cotacalcium phosphate.

Simulated East-west differences in F-region peak electron density at Far East mid-latitude region

Science.gov (United States)

Ren, Z.; Wan, W.

2017-12-01

In the present work, using Three-Dimensional Theoretical Ionospheric Model of the Earth in Institute of Geology and Geophysics, Chinese Academy of Sciences (TIME3D-IGGCAS), we simulated the east-west differences in Fregion peak electron density (NmF2) at Far East mid-latitude region.We found that, after removing the longitudinal variations of neutral parameters, TIME3D-IGGCAS can better represent the observed relative east-west difference (Rew) features. Rew is mainly negative (West NmF2 > East NmF2) at noon and positive (East NmF2 >West NmF2) at evening-night. The magnitude of daytime negative Rew is weak at local winter and strong at local summer, and the daytime Rew show two negative peaks around two equinoxes. With the increasing of solar flux level, the magnitude of Rew mainly become larger, and two daytime negative peaks slight shifts to June Solstice. With the decreasing of geographical latitude, Rew mainly become positive, and two daytime negative peaks slight shifts to June Solstice. Our simulation also suggested that the thermospheric zonal wind combined with the geomagnetic field configuration play a pivotal role in the formation of the ionospheric east-west differences at Far East midlatitude region.

Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

Science.gov (United States)

Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

1998-01-01

Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

Post-glacial recolonization of the Great Lakes region by the common gartersnake (Thamnophis sirtalis) inferred from mtDNA sequences.

Science.gov (United States)

Placyk, John S; Burghardt, Gordon M; Small, Randall L; King, Richard B; Casper, Gary S; Robinson, Jace W

2007-05-01

Pleistocene events played an important role in the differentiation of North American vertebrate populations. Michigan, in particular, and the Great Lakes region, in general, were greatly influenced by the last glaciation. While several hypotheses regarding the recolonization of this region have been advanced, none have been strongly supported. We generated 148 complete ND2 mitochondrial DNA (mtDNA) sequences from common gartersnake (Thamnophis sirtalis) populations throughout the Great Lakes region to evaluate phylogeographic patterns and population structure and to determine whether the distribution of haplotypic variants is related to the post-Pleistocene retreat of the Wisconsinan glacier. The common gartersnake was utilized, as it is believed to have been one of the primary vertebrate invaders of the Great Lakes region following the most recent period of glacial retreat and because it has been a model species for a variety of evolutionary, ecological, behavioral, and physiological studies. Several genetically distinct evolutionary lineages were supported by both genealogical and molecular population genetic analyses, although to different degrees. The geographic distribution of the majority of these lineages is interpreted as reflecting post-glacial recolonization dynamics during the late Pleistocene. These findings generally support previous hypotheses of range expansion in this region.

Enhanced spin polarization of elastic electron scattering from alkaline-earth-metal atoms in Ramsauer-Townsend and low-lying shape resonance regions

International Nuclear Information System (INIS)

Yuan, J.; Zhang, Z.

1993-01-01

Spin polarizations (SP's) of elastic electron scattering from alkaline-earth-metal atoms in Ramsauer-Townsend (RT) and low-lying shape resonance (SR) regions are calculated using a relativistic method. The detailed SP distributions both with scattering angle and with electron energy are presented via the energy- and angle-dependent surfaces of SP parameters. It is shown that the SP effects of the collisions of electrons with Ca, Sr, and Ba atoms in the RT region are significant in a considerable area on the energy-angle plane and that the spin-orbit interaction is well increased around the low-lying p-wave SR states of Be and Mg and the d-wave SR states of Ca, Sr, and Ba

Characteristics of alternating current hopping conductivity in DNA sequences

Institute of Scientific and Technical Information of China (English)

Ma Song-Shan; Xu Hui; Wang Huan-You; Guo Rui

2009-01-01

This paper presents a model to describe alternating current (AC) conductivity of DNA sequences,in which DNA is considered as a one-dimensional (1D) disordered system,and electrons transport via hopping between localized states.It finds that AC conductivity in DNA sequences increases as the frequency of the external electric field rises,and it takes the form of σac(ω)～ω2 ln2(1/ω).Also AC conductivity of DNA sequences increases with the increase of temperature,this phenomenon presents characteristics of weak temperature-dependence.Meanwhile,the AC conductivity in an off diagonally correlated case is much larger than that in the uncorrelated case of the Anderson limit in low temperatures,which indicates that the off-diagonal correlations in DNA sequences have a great effect on the AC conductivity,while at high temperature the off-diagonal correlations no longer play a vital role in electric transport. In addition,the proportion of nucleotide pairs p also plays an important role in AC electron transport of DNA sequences.For p＜0.5,the conductivity of DNA sequence decreases with the increase of p,while for p ＞ 0.5,the conductivity increases with the increase of p.

Geographic structure and demographic history of Iranian brown bear (Ursus arctos based on mtDNA control region sequences

Directory of Open Access Journals (Sweden)

Mohammad Reza Ashrafzadeh

2015-12-01

Full Text Available In recent years, the brown bear's range has declined and its populations in some areas have faced extinction. Therefore, to have a comprehensive picture of genetic diversity and geographic structure of populations is essential for effective conservation strategies. In this research, we sequenced a 271bp segment of mtDNA control region of seven Iranian brown bears, where a total dataset of 467 sequences (brown and polar bears were used in analyses. Overall, 113 different haplotypes and 77 polymorphic sites were identified within the segment. Based on phylogenetic analyses, Iranian brown bears were not nested in any other clades. The low values of Nm (range=0.014-0.187 and high values of Fst (range=0.728-0.972 among Iranian bears and others revealed a genetically significant differentiation. We aren't found any significant signal of demographic reduction in Iranian bears. The time to the most recent common ancestor of Iranian brown bears (Northern Iran was found to be around 19000 BP.

Diversity analysis of Bemisia tabaci biotypes: RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region

OpenAIRE

Rabello, Aline R.; Queiroz, Paulo R.; Simões, Kenya C.C.; Hiragi, Cássia O.; Lima, Luzia H.C.; Oliveira, Maria Regina V.; Mehta, Angela

2008-01-01

The Bemisia tabaci complex is formed by approximately 41 biotypes, two of which (B and BR) occur in Brazil. In this work we aimed at obtaining genetic markers to assess the genetic diversity of the different biotypes. In order to do that we analyzed Bemisia tabaci biotypes B, BR, Q and Cassava using molecular techniques including RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region. The analyses revealed a high similarity between the individuals of the B and Q biotypes, which could be distin...

Digital Recovery Sequencer - Advanced Concept Ejection Seats

National Research Council Canada - National Science Library

Ross, David A; Cotter, Lee; Culhane, David; Press, Matthew J

2005-01-01

.... Continued usage of the Analog Sequencer is undesirable due to limitations with respect to its installed life, electronic component obsolescence, flexibility to accommodate seat safety improvements...

DNA Electronic Fingerprints by Local Spectroscopy on Graphene

Science.gov (United States)

Balatsky, Alexander

2013-03-01

Working and scalable alternatives to the conventional chemical methods of DNA sequencing that are based on electronic/ionic signatures would revolutionize the field of sequencing. The approach of a single molecule imaging and spectroscopy with unprecedented resolution, achieved by Scanning Tunneling Spectroscopy (STS) and nanopore electronics could enable this revolution. We use the data from our group and others in applying this local scanning tunneling microscopy and illustrate possibilities of electronic sequencing of freeze dried deposits on graphene. We will present two types of calculated fingerprints: first in Local Density of States (LDOS) of DNA nucleotide bases (A,C,G,T) deposited on graphene. Significant base-dependent features in the LDOS in an energy range within few eV of the Fermi level were found in our calculations. These features can serve as electronic fingerprints for the identification of individual bases in STS. In the second approach we present calculated base dependent electronic transverse conductance as DNA translocates through the graphene nanopore. Thus we argue that the fingerprints of DNA-graphene hybrid structures may provide an alternative route to DNA sequencing using STS. Work supported by US DOE, NORDITA.

Deconvolution of overlapping features in electron energy-loss spectra: the determination of absolute differential cross sections for electron-impact excitation of electronic states of molecules

International Nuclear Information System (INIS)

Campbell, L.; Brunger, M.J.; Teubner, O.J.P.; Mojarrabi, B.

1996-06-01

A set of three computer programs is reported which allow for the deconvolution of overlapping molecular electronic state structure in electron energy-loss spectra, even in highly perturbed systems. This procedure enables extraction of absolute differential cross sections for electron-impact excitation of electronic states of diatomic molecules from electron energy-loss spectra. The first code in the sequence uses the Rydberg-Klein-Rees procedure to generate potential energy curves from spectroscopic constants, while the second calculates Franck-Condon factors by numerical solution of the Schroedinger equation, given the potential energy curves. The third, given these Franck-Condon factors, the previously calculated relevant energies for the vibrational levels of the respective electronic states and the experimental energy-loss spectra, extracts the differential cross sections for each state. Each program can be run independently, or the three can run in sequence to determine these cross sections from the spectroscopic constants and the experimental energy-loss spectra. The application of these programs to the specific case of electron scattering from nitric oxide (NO) is demonstrated. 25 refs., 2 tabs., 2 figs

THE ELECTRON DENSITY IN EXPLOSIVE TRANSITION REGION EVENTS OBSERVED BY IRIS

Energy Technology Data Exchange (ETDEWEB)

Doschek, G. A.; Warren, H. P. [Space Science Division, Naval Research Laboratory, 4555 Overlook Avenue, SW, Washington, DC 20375 (United States); Young, P. R. [College of Science, George Mason University, 4400 University Drive, Fairfax, VA 22030 (United States)

2016-11-20

We discuss the intensity ratio of the O iv line at 1401.16 Å to the Si iv line at 1402.77 Å in Interface Region Imaging Spectrograph ( IRIS ) spectra. This intensity ratio is important if it can be used to measure high electron densities that cannot be measured using line intensity ratios of two different O iv lines from the multiplet within the IRIS wavelength range. Our discussion is in terms of considerably earlier observations made from the Skylab manned space station and other spectrometers on orbiting spacecraft. The earlier data on the O iv and Si iv ratio and other intersystem line ratios not available to IRIS are complementary to IRIS data. In this paper, we adopt a simple interpretation based on electron density. We adopt a set of assumptions and calculate the electron density as a function of velocity in the Si iv line profiles of two explosive events. At zero velocity the densities are about 2–3 × 10{sup 11} cm{sup -3}, and near 200 km s{sup -1} outflow speed the densities are about 10{sup 12} cm{sup -3}. The densities increase with outflow speed up to about 150 km s{sup -1} after which they level off. Because of the difference in the temperature of formation of the two lines and other possible effects such as non-ionization equilibrium, these density measurements do not have the precision that would be available if there were some additional lines near the formation temperature of O iv.

Inclusive electron scattering from nuclei in the quasielastic region at large momentum transfer

Energy Technology Data Exchange (ETDEWEB)

Fomin, Nadia [California Inst. of Technology (CalTech), Pasadena, CA (United States)

2008-12-01

Experiment E02-019, performed in Hall C at the Thomas Jefferson National Accelerator Facility (TJNAF), was a measurement of inclusive electron cross sections for several nuclei (²H,³He, ⁴He, ⁹Be,¹²C, ⁶³Cu, and ¹⁹⁷Au) in the quasielastic region at high momentum transfer. In the region of low energy transfer, the cross sections were analyzed in terms of the reduced response, F(y), by examining its y-scaling behavior. The data were also examined in terms of the nuclear structure function νW^A ₂ and its behavior in x and the Nachtmann variable ξ. The data show approximate scaling of νW^A ₂ in ξ for all targets at all kinematics, unlike scaling in x, which is confined to the DIS regime. However, y-scaling observations are limited to the kinematic region dominated by the quasielastic response (y <0), where some scaling violations arising from FSIs are observed.

Genomic multiple sequence alignments: refinement using a genetic algorithm

Directory of Open Access Journals (Sweden)

Lefkowitz Elliot J

2005-08-01

Full Text Available Abstract Background Genomic sequence data cannot be fully appreciated in isolation. Comparative genomics – the practice of comparing genomic sequences from different species – plays an increasingly important role in understanding the genotypic differences between species that result in phenotypic differences as well as in revealing patterns of evolutionary relationships. One of the major challenges in comparative genomics is producing a high-quality alignment between two or more related genomic sequences. In recent years, a number of tools have been developed for aligning large genomic sequences. Most utilize heuristic strategies to identify a series of strong sequence similarities, which are then used as anchors to align the regions between the anchor points. The resulting alignment is globally correct, but in many cases is suboptimal locally. We describe a new program, GenAlignRefine, which improves the overall quality of global multiple alignments by using a genetic algorithm to improve local regions of alignment. Regions of low quality are identified, realigned using the program T-Coffee, and then refined using a genetic algorithm. Because a better COFFEE (Consistency based Objective Function For alignmEnt Evaluation score generally reflects greater alignment quality, the algorithm searches for an alignment that yields a better COFFEE score. To improve the intrinsic slowness of the genetic algorithm, GenAlignRefine was implemented as a parallel, cluster-based program. Results We tested the GenAlignRefine algorithm by running it on a Linux cluster to refine sequences from a simulation, as well as refine a multiple alignment of 15 Orthopoxvirus genomic sequences approximately 260,000 nucleotides in length that initially had been aligned by Multi-LAGAN. It took approximately 150 minutes for a 40-processor Linux cluster to optimize some 200 fuzzy (poorly aligned regions of the orthopoxvirus alignment. Overall sequence identity increased only

Investigation of Electron Density Profile in the ionospheric D and E region by Kagoshima rocket experiment

Science.gov (United States)

Ashihara, Y.; Ishisaka, K.; Miyake, T.; Okada, T.; Nagano, I.; Abe, T.; Ono, T.

2007-12-01

The radio wave propagation characteristic in the lower ionosphere is important because of its effect on commercial radio communication, navigation, and broadcast services. The electron density is of primary interest in this region because the high ion-neutral collision frequencies result in radio wave absorption. In order to investigate the ionization structure in the ionospheric D and E region by using the propagation characteristics of MF-band and LF-band radio waves, S-310-37 and S-520-23 sounding rocket experiments have been carried out at Uchinoura Space Center (USC). S-310-37 sounding rocket was launched at 11:20 LT on January 16, 2007. The apex of rocket trajectory was about 138 km. Then S-520-23 sounding rocket was launched at 19:20 LT on September 2, 2007. The apex was about 279 km. As a common measurement, these sounding rockets measure the fields intensities and the waveform of radio waves from NHK Kumamoto broadcasting station (873kHz, 500kW) and JJY signals from Haganeyama LF radio station (60kHz, 50kW). The approximate electron density profile can be determined from the comparison between these experimental results and propagation characteristics calculated by the full wave method. We will get the most probable electron density profile in the ionosphere. In presentation, we will show the propagation characteristic of LF/MF radio waves measured by two sounding rocket experiments. Then we will discuss the analysis method and the estimated electron density profile in the ionosphere.

Characterization of promoter sequence of toll-like receptor genes in Vechur cattle

Directory of Open Access Journals (Sweden)

R. Lakshmi

2016-06-01

Full Text Available Aim: To analyze the promoter sequence of toll-like receptor (TLR genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases.

Evolution of electron pitch angle distributions across Saturn's middle magnetospheric region from MIMI/LEMMS

Science.gov (United States)

Clark, G.; Paranicas, C.; Santos-Costa, D.; Livi, S.; Krupp, N.; Mitchell, D. G.; Roussos, E.; Tseng, W.-L.

2014-12-01

We provide a global view of ~20 to 800 keV electron pitch angle distributions (PADs) close to Saturn's current sheet using observations from the Cassini MIMI/LEMMS instrument. Previous work indicated that the nature of pitch angle distributions in Saturn's inner to middle magnetosphere changes near the radial distance of 10RS. This work confirms the existence of a PAD transition region. Here we go further and develop a new technique to statistically quantify the spatial profile of butterfly PADs as well as present new spatial trends on the isotropic PAD. Additionally, we perform a case study analysis and show the PADs exhibit strong energy dependent features throughout this transition region. We also present a diffusion theory model based on adiabatic transport, Coulomb interactions with Saturn's neutral gas torus, and an energy dependent radial diffusion coefficient. A data-model comparison reveals that adiabatic transport is the dominant transport mechanism between ~8 to 12RS, however interactions with Saturn's neutral gas torus become dominant inside ~7RS and govern the flux level of ~20 to 800 keV electrons. We have also found that field-aligned fluxes were not well reproduced by our modeling approach. We suggest that wave-particle interactions and/or a polar source of the energetic particles needs further investigation.

Entropic fluctuations in DNA sequences

Science.gov (United States)

Thanos, Dimitrios; Li, Wentian; Provata, Astero

2018-03-01

The Local Shannon Entropy (LSE) in blocks is used as a complexity measure to study the information fluctuations along DNA sequences. The LSE of a DNA block maps the local base arrangement information to a single numerical value. It is shown that despite this reduction of information, LSE allows to extract meaningful information related to the detection of repetitive sequences in whole chromosomes and is useful in finding evolutionary differences between organisms. More specifically, large regions of tandem repeats, such as centromeres, can be detected based on their low LSE fluctuations along the chromosome. Furthermore, an empirical investigation of the appropriate block sizes is provided and the relationship of LSE properties with the structure of the underlying repetitive units is revealed by using both computational and mathematical methods. Sequence similarity between the genomic DNA of closely related species also leads to similar LSE values at the orthologous regions. As an application, the LSE covariance function is used to measure the evolutionary distance between several primate genomes.

Physics in the GeV region with polarized targets in electron storage rings

International Nuclear Information System (INIS)

Holt, R.J.

1988-01-01

There is evidence from the D(γ,p)n reaction that the meson-exchange model is failing in the GeV region. Surprisingly, it appears that the new (Dγ,p)n data favor the energy dependence of the nuclear chromodynamics model rather that of the meson-exchange model. Application of the polarization method to electron scattering studies is in its infancy, and it is potentially a very powerful technique. The internal target method coupled with laser-driven polarized targets should represent an important tool for nuclear physics

Characteristics of pitch angle distributions of hundreds of keV electrons in the slot region and inner radiation belt

Science.gov (United States)

Zhao, H.; Li, X.; Blake, J. B.; Fennell, J. F.; Claudepierre, S. G.; Baker, D. N.; Jaynes, A. N.; Malaspina, D. M.

2014-12-01

The pitch angle distribution (PAD) of energetic electrons in the slot region and inner radiation belt received little attention in the past decades due to the lack of quality measurements. Using the state-of-the-art pitch angle-resolved data from the Magnetic Electron Ion Spectrometer instrument onboard the Van Allen Probes, a detailed analysis of hundreds of keV electron PADs below L = 4 is performed, in which the PADs are categorized into three types: normal (flux peaking at 90°), cap (exceedingly peaking narrowly around 90°), and 90° minimum (lower flux at 90°) PADs. By examining the characteristics of the PADs of ˜460 keV electrons for over a year, we find that the 90° minimum PADs are generally present in the inner belt (Lpitch angle scattering of hiss waves. Fitting the normal PADs into sinnα form, the parameter n is much higher below L = 3 than that in the outer belt and relatively constant in the inner belt but changes significantly in the slot region (2 mechanism can hardly explain the formation of 90° minimum PADs at the center of inner belt.

Radiation dosimetry for residents of the Chernobyl region: a comparison of cytogenetic and electron spin resonance methods

Energy Technology Data Exchange (ETDEWEB)

Serezhenkov, V A; Mordvintcev, P I; Vanin, A F; Voevodskaya, N V [AN SSSR, Moscow (Russian Federation). Inst. Fizicheskoj Khimii; Domracheva, E V; Kulikov, S M; Kuznetsov, S A; Schklovsky-Kordi, N E; Vorobiev, A I [National Center for Haematology, Moscow (Russian Federation); Klevezal, G A; Sukhovskaya, L I [Russian Academy of Science, Moscow (Russian Federation). Inst. of Developmental Biology

1992-01-01

Persons from the Gomel region of Byelorussia who were irradiated by the Chernobyl reactor accident have been studied. Estimations of their radiation doses using electron spin resonance spectrometry of dental enamel showed good agreement with dosimetry by chromosomal analysis of blood lymphocytes. (author).

Full-length sequencing and identification of novel polymorphisms in ...

Indian Academy of Sciences (India)

The aim of this work was to sequence the entirecoding region of ACACA gene in Valle del Belice sheep breed to identify polymorphic sites. A total of 51 coding exons of ACACA gene were sequenced in 32 individuals of Valle del Belice sheep breed. Sequencing analysis and alignment of obtained sequences showed the ...

IRAS 18153-1651: an H II region with a possible wind bubble blown by a young main-sequence B star

Science.gov (United States)

Gvaramadze, V. V.; Mackey, J.; Kniazev, A. Y.; Langer, N.; Chené, A.-N.; Castro, N.; Haworth, T. J.; Grebel, E. K.

2017-04-01

We report the results of spectroscopic observations and numerical modelling of the H II region IRAS 18153-1651. Our study was motivated by the discovery of an optical arc and two main-sequence stars of spectral type B1 and B3 near the centre of IRAS 18153-1651. We interpret the arc as the edge of the wind bubble (blown by the B1 star), whose brightness is enhanced by the interaction with a photoevaporation flow from a nearby molecular cloud. This interpretation implies that we deal with a unique case of a young massive star (the most massive member of a recently formed low-mass star cluster) caught just tens of thousands of years after its stellar wind has begun to blow a bubble into the surrounding dense medium. Our 2D, radiation-hydrodynamics simulations of the wind bubble and the H II region around the B1 star provide a reasonable match to observations, both in terms of morphology and absolute brightness of the optical and mid-infrared emission, and verify the young age of IRAS 18153-1651. Taken together our results strongly suggest that we have revealed the first example of a wind bubble blown by a main-sequence B star.

1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

Science.gov (United States)

Liang, Feng; Lindsay, Stuart; Zhang, Peiming

2012-11-21

With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

New global electron density observations from GPS-RO in the D- and E-Region ionosphere

Science.gov (United States)

Wu, Dong L.

2018-06-01

A novel retrieval technique is developed for electron density (Ne) in the D- and E-region (80-120 km) using the high-quality 50-Hz GPS radio occultation (GPS-RO) phase measurements. The new algorithm assumes a slow, linear variation in the F-region background when the GPS-RO passes through the D- and E-region, and extracts the Ne profiles at 80-130 km from the phase advance signal caused by Ne. Unlike the conventional Abel function, the new approach produces a sharp Ne weighting function in the lower ionosphere, and the Ne retrievals are in good agreement with the IRI (International Reference Ionosphere) model in terms of monthly maps, zonal means and diurnal variations. The daytime GPS-RO Ne profiles can be well characterized by the α-Chapman function of three parameters (NmE, hmE and H), showing that the bottom of E-region is deepening and sharpening towards the summer pole. At high latitudes the monthly GPS-RO Ne maps at 80-120 km reveal clear enhancement in the auroral zones, more prominent at night, as a result of energetic electron precipitation (EEP) from the outer radiation belt. The D-/E-region auroral Ne is strongly correlated with Kp on a daily basis. The new Ne data allow further comprehensive analyses of the sporadic E (Es) phenomena in connection with the background Ne in the E-region. The layered (2-10 km) and fluctuated (Layer than Ne_Pert, are extracted with respect to the background Ne_Region on a profile-by-profile basis. The Ne_Layer component has a strong but highly-refined peak at ∼105 km, with an amplitude smaller than Ne_Region approximately by an order of magnitude. The Ne_Pert component, which was studied extensively in the past, is ∼2 orders of magnitude weaker than Ne_Layer. Both Ne_Layer and Ne_Pert are subject to significant diurnal and semidiurnal variations, showing downward progression with local time in amplitude. The 11-year solar cycle dominates the Ne interannual variations, showing larger Ne_Region and Ne_Layer but smaller

Progenitor-derivative relationships of Hordeum polyploids (Poaceae, Triticeae inferred from sequences of TOPO6, a nuclear low-copy gene region.

Directory of Open Access Journals (Sweden)

Jonathan Brassac

Full Text Available Polyploidization is a major mechanism of speciation in plants. Within the barley genus Hordeum, approximately half of the taxa are polyploids. While for diploid species a good hypothesis of phylogenetic relationships exists, there is little information available for the polyploids (4×, 6× of Hordeum. Relationships among all 33 diploid and polyploid Hordeum species were analyzed with the low-copy nuclear marker region TOPO6 for 341 Hordeum individuals and eight outgroup species. PCR products were either directly sequenced or cloned and on average 12 clones per individual were included in phylogenetic analyses. In most diploid Hordeum species TOPO6 is probably a single-copy locus. Most sequences found in polyploid individuals phylogenetically cluster together with sequences derived from diploid species and thus allow the identification of parental taxa of polyploids. Four groups of sequences occurring only in polyploid taxa are interpreted as footprints of extinct diploid taxa, which contributed to allopolyploid evolution. Our analysis identifies three key species involved in the evolution of the American polyploids of the genus. (i All but one of the American tetraploids have a TOPO6 copy originating from the Central Asian diploid H. roshevitzii, the second copy clustering with different American diploid species. (ii All hexaploid species from the New World have a copy of an extinct close relative of H. californicum and (iii possess the TOPO6 sequence pattern of tetraploid H. jubatum, each with an additional copy derived from different American diploids. Tetraploid H. bulbosum is an autopolyploid, while the assumed autopolyploid H. brevisubulatum (4×, 6× was identified as allopolyploid throughout most of its distribution area. The use of a proof-reading DNA polymerase in PCR reduced the proportion of chimerical sequences in polyploids in comparison to Taq polymerase.

Electronic health record use in an affluent region in India: Findings from a survey of Chandigarh hospitals.

Science.gov (United States)

Powell, Adam C; Ludhar, Jasmine K; Ostrovsky, Yuri

2017-07-01

To characterize the electronic health record (EHR) systems in use in an affluent region of India in order to understand the state-of-the-art within the Indian market. A survey on EHR features was created by combining an instrument developed by the Organisation for International Cooperation and Development and an instrument developed by an American team of researchers. An interviewer directly administered the survey to leaders from hospitals in greater Chandigarh which possessed electronic health information systems. Summary statistics from the survey are reported. 24 hospitals offering multi-specialty inpatient care were identified in greater Chandigarh. 18 of these hospitals had electronic health information systems, 17 of which were interviewed. Of the hospitals with systems, 17 (100%) could access patient demographic information internally, but 12 (71%) could not access vital sign, allergy, or immunization data internally. 11 (65%) of the systems were capable of sharing patient summaries internally, but 13 (76%) could not send electronic referrals internally. Among organizations which have adopted systems, major barriers tend to have been around financial and staff matters. Concerns over interoperability, privacy, and security were infrequently cited as barriers to adoption. EHRs are ubiquitous in at least one region of India. Systems are more likely to have capabilities for intra-organizational information sharing than for inter-organizational information sharing. The availability of EHR data may foster clinical research. Copyright © 2017 Elsevier B.V. All rights reserved.

Utilization of a cloned alphoid repeating sequence of human DNA in the study of polymorphism of chromosomal heterochromatin regions

International Nuclear Information System (INIS)

Kruminya, A.R.; Kroshkina, V.G.; Yurov, Yu.B.; Aleksandrov, I.A.; Mitkevich, S.P.; Gindilis, V.M.

1988-01-01

The chromosomal distribution of the cloned PHS05 fragment of human alphoid DNA was studied by in situ hybridization in 38 individuals. It was shown that this DNA fraction is primarily localized in the pericentric regions of practically all chromosomes of the set. Significant interchromosomal differences and a weakly expressed interindividual polymorphism were discovered in the copying ability of this class of repeating DNA sequences; associations were not found between the results of hybridization and the pattern of Q-polymorphism

Positron-acoustic waves in an electron-positron plasma with an electron beam

International Nuclear Information System (INIS)

Nejoh, Y.N.

1996-01-01

The nonlinear wave structures of large-amplitude positron-acoustic waves are studied in an electron-positron plasma in the presence of an electron beam with finite temperature and hot electrons and positrons. The region where positron-acoustic waves exist is presented by analysing the structure of the pseudopotential. The region depends sensitively on the positron density, the positron temperature and the electron beam temperature. It is shown that the maximum amplitude of the wave decreases as the positron temperature increases, and the region of positron-acoustic waves spreads as the positron temperature increases. 11 refs., 5 figs

Templated sequence insertion polymorphisms in the human genome

Science.gov (United States)

Onozawa, Masahiro; Aplan, Peter

2016-11-01

Templated Sequence Insertion Polymorphism (TSIP) is a recently described form of polymorphism recognized in the human genome, in which a sequence that is templated from a distant genomic region is inserted into the genome, seemingly at random. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; Class 1 TSIPs show features of insertions that are mediated via the LINE-1 ORF2 protein, including 1) target-site duplication (TSD), 2) polyadenylation 10-30 nucleotides downstream of a “cryptic” polyadenylation signal, and 3) preference for insertion at a 5’-TTTT/A-3’ sequence. In contrast, class 2 TSIPs show features consistent with repair of a DNA double-strand break via insertion of a DNA “patch” that is derived from a distant genomic region. Survey of a large number of normal human volunteers demonstrates that most individuals have 25-30 TSIPs, and that these TSIPs track with specific geographic regions. Similar to other forms of human polymorphism, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases.

Structural region

Indian Academy of Sciences (India)

First page Back Continue Last page Overview Graphics. Structural region. The two groups had 4 substitutions similar to Yawat strain. The Yawat strain had 5 unique mutations. 3 in the E2 region and 2 in the E1 region. The mutation, I702V (E2), though different from all the recent Indian and Reunion sequences was similar ...

Characteristics of alternating current hopping conductivity in DNA sequences

International Nuclear Information System (INIS)

Song-Shan, Ma; Hui, Xu; Huan-You, Wang; Rui, Guo

2009-01-01

This paper presents a model to describe alternating current (AC) conductivity of DNA sequences, in which DNA is considered as a one-dimensional (1D) disordered system, and electrons transport via hopping between localized states. It finds that AC conductivity in DNA sequences increases as the frequency of the external electric field rises, and it takes the form of ø ac (ω) ∼ ω 2 ln 2 (1/ω). Also AC conductivity of DNA sequences increases with the increase of temperature, this phenomenon presents characteristics of weak temperature-dependence. Meanwhile, the AC conductivity in an off-diagonally correlated case is much larger than that in the uncorrelated case of the Anderson limit in low temperatures, which indicates that the off-diagonal correlations in DNA sequences have a great effect on the AC conductivity, while at high temperature the off-diagonal correlations no longer play a vital role in electric transport. In addition, the proportion of nucleotide pairs p also plays an important role in AC electron transport of DNA sequences. For p < 0.5, the conductivity of DNA sequence decreases with the increase of p, while for p ≥ 0.5, the conductivity increases with the increase of p. (cross-disciplinary physics and related areas of science and technology)

Intracellular diversity of the V4 and V9 regions of the 18S rRNA in marine protists (radiolarians) assessed by high-throughput sequencing.

Science.gov (United States)

Decelle, Johan; Romac, Sarah; Sasaki, Eriko; Not, Fabrice; Mahé, Frédéric

2014-01-01

Metabarcoding is a powerful tool for exploring microbial diversity in the environment, but its accurate interpretation is impeded by diverse technical (e.g. PCR and sequencing errors) and biological biases (e.g. intra-individual polymorphism) that remain poorly understood. To help interpret environmental metabarcoding datasets, we investigated the intracellular diversity of the V4 and V9 regions of the 18S rRNA gene from Acantharia and Nassellaria (radiolarians) using 454 pyrosequencing. Individual cells of radiolarians were isolated, and PCRs were performed with generalist primers to amplify the V4 and V9 regions. Different denoising procedures were employed to filter the pyrosequenced raw amplicons (Acacia, AmpliconNoise, Linkage method). For each of the six isolated cells, an average of 541 V4 and 562 V9 amplicons assigned to radiolarians were obtained, from which one numerically dominant sequence and several minor variants were found. At the 97% identity, a diversity metrics commonly used in environmental surveys, up to 5 distinct OTUs were detected in a single cell. However, most amplicons grouped within a single OTU whereas other OTUs contained very few amplicons. Different analytical methods provided evidence that most minor variants forming different OTUs correspond to PCR and sequencing artifacts. Duplicate PCR and sequencing from the same DNA extract of a single cell had only 9 to 16% of unique amplicons in common, and alignment visualization of V4 and V9 amplicons showed that most minor variants contained substitutions in highly-conserved regions. We conclude that intracellular variability of the 18S rRNA in radiolarians is very limited despite its multi-copy nature and the existence of multiple nuclei in these protists. Our study recommends some technical guidelines to conservatively discard artificial amplicons from metabarcoding datasets, and thus properly assess the diversity and richness of protists in the environment.

A Case Study into Microbial Genome Assembly Gap Sequences and Finishing Strategies.

Science.gov (United States)

Utturkar, Sagar M; Klingeman, Dawn M; Hurt, Richard A; Brown, Steven D

2017-01-01

This study characterized regions of DNA which remained unassembled by either PacBio and Illumina sequencing technologies for seven bacterial genomes. Two genomes were manually finished using bioinformatics and PCR/Sanger sequencing approaches and regions not assembled by automated software were analyzed. Gaps present within Illumina assemblies mostly correspond to repetitive DNA regions such as multiple rRNA operon sequences. PacBio gap sequences were evaluated for several properties such as GC content, read coverage, gap length, ability to form strong secondary structures, and corresponding annotations. Our hypothesis that strong secondary DNA structures blocked DNA polymerases and contributed to gap sequences was not accepted. PacBio assemblies had few limitations overall and gaps were explained as cumulative effect of lower than average sequence coverage and repetitive sequences at contig termini. An important aspect of the present study is the compilation of biological features that interfered with assembly and included active transposons, multiple plasmid sequences, phage DNA integration, and large sequence duplication. Our targeted genome finishing approach and systematic evaluation of the unassembled DNA will be useful for others looking to close, finish, and polish microbial genome sequences.

Building the sequence map of the human pan-genome

DEFF Research Database (Denmark)

Li, Ruiqiang; Li, Yingrui; Zheng, Hancheng

2010-01-01

analysis of predicted genes indicated that the novel sequences contain potentially functional coding regions. We estimate that a complete human pan-genome would contain approximately 19-40 Mb of novel sequence not present in the extant reference genome. The extensive amount of novel sequence contributing...

Minimal and contributing sequence determinants of the cis-acting locus of transfer (clt) of streptomycete plasmid pIJ101 occur within an intrinsically curved plasmid region.

Science.gov (United States)

Ducote, M J; Prakash, S; Pettis, G S

2000-12-01

Efficient interbacterial transfer of streptomycete plasmid pIJ101 requires the pIJ101 tra gene, as well as a cis-acting plasmid function known as clt. Here we show that the minimal pIJ101 clt locus consists of a sequence no greater than 54 bp in size that includes essential inverted-repeat and direct-repeat sequences and is located in close proximity to the 3' end of the korB regulatory gene. Evidence that sequences extending beyond the minimal locus and into the korB open reading frame influence clt transfer function and demonstration that clt-korB sequences are intrinsically curved raise the possibility that higher-order structuring of DNA and protein within this plasmid region may be an inherent feature of efficient pIJ101 transfer.

Sequence variations in C9orf72 downstream of the hexanucleotide repeat region and its effect on repeat-primed PCR interpretation

DEFF Research Database (Denmark)

Nordin, Angelica; Akimoto, Chizuru; Wuolikainen, Anna

2017-01-01

A large GGGGCC-repeat expansion mutation (HREM) in C9orf72 is the most common known cause of ALS and FTD in European populations. Sequence variations immediately downstream of the HREM region have previously been observed and have been suggested to be one reason for difficulties in interpreting R...

Pedological and mineralogical investigations on a soil-paleosoil sequence within Andosols in the Western Cordillera of the Peruvian Andes (region Laramate, 14.5S)

Science.gov (United States)

Leceta Gobitz, Fernando; Mächtle, Bertil; Schukraft, Gerd; Meyer, Hans-Peter; Eitel, Bernhard

2016-04-01

An integrated research project of environmental sciences focuses on a group of four Andosol profiles in Western flank of the Peruvian southern Andes. Aim of this study is to contribute to the reconstruction of the paleo environmental conditions in the Western Cordillera of the Peruvian Andes. Standard pedological and sedimentological analysis has been conducted in order to identify morphological and geochemical features generated by climatic variations during the middle and late Holocene. Though a provenance analysis of sediments, all potential lithological sources around the town of Laramate are being examined under the scanning electron microscope, in order to find significant mineralogical associations downward the soil-profile. Preliminary results reveal two edaphic cycles within a soil-paleo soil-sequence: a relative poor developed "Ah" topsoil, mostly composed by fine grain sediments, is underlain by a well preserved "2Ah" paleo soil; a "2Bwt" subsoil exhibits signs of alteration and clay translocation; parent material in slight weathered statement at "2C" culminates the sequence. Mineralogical analytical data supports the premise, that materials in the uppermost horizons are relatable to distal geological units of the Western and Eastern Cordillera, therefore also related to other described aeolian archives from the region: "Desert Margin Loess" at the Andean foot-zone and "Mixed Loess" in the Puna grassland. The amphibole varieties Actinolite, Mg-Hornblende and Edenite could be only distinguished within the soil sediments. The fluvial transport to its current position is excluded, insofar mentioned varieties stem from the granodiorites of Coastal Batholite (downstream the study area), and the vulcanites of the Anta und Andahuaylas Formation (eastward the continental divide). References: Eitel, B., et al. (2005). "Geoarchaeological evidence from desert loess in the Nazca-Palpa region, southern Peru : Palaeoenvironmental changes and their impact on Pre

Functional anthology of intrinsic disorder. 2. Cellular components, domains, technical terms, developmental processes, and coding sequence diversities correlated with long disordered regions.

Science.gov (United States)

Vucetic, Slobodan; Xie, Hongbo; Iakoucheva, Lilia M; Oldfield, Christopher J; Dunker, A Keith; Obradovic, Zoran; Uversky, Vladimir N

2007-05-01

Biologically active proteins without stable ordered structure (i.e., intrinsically disordered proteins) are attracting increased attention. Functional repertoires of ordered and disordered proteins are very different, and the ability to differentiate whether a given function is associated with intrinsic disorder or with a well-folded protein is crucial for modern protein science. However, there is a large gap between the number of proteins experimentally confirmed to be disordered and their actual number in nature. As a result, studies of functional properties of confirmed disordered proteins, while helpful in revealing the functional diversity of protein disorder, provide only a limited view. To overcome this problem, a bioinformatics approach for comprehensive study of functional roles of protein disorder was proposed in the first paper of this series (Xie, H.; Vucetic, S.; Iakoucheva, L. M.; Oldfield, C. J.; Dunker, A. K.; Obradovic, Z.; Uversky, V. N. Functional anthology of intrinsic disorder. 1. Biological processes and functions of proteins with long disordered regions. J. Proteome Res. 2007, 5, 1882-1898). Applying this novel approach to Swiss-Prot sequences and functional keywords, we found over 238 and 302 keywords to be strongly positively or negatively correlated, respectively, with long intrinsically disordered regions. This paper describes approximately 90 Swiss-Prot keywords attributed to the cellular components, domains, technical terms, developmental processes, and coding sequence diversities possessing strong positive and negative correlation with long disordered regions.

Functional Anthology of Intrinsic Disorder. II. Cellular Components, Domains, Technical Terms, Developmental Processes and Coding Sequence Diversities Correlated with Long Disordered Regions

Science.gov (United States)

Vucetic, Slobodan; Xie, Hongbo; Iakoucheva, Lilia M.; Oldfield, Christopher J.; Dunker, A. Keith; Obradovic, Zoran; Uversky, Vladimir N.

2008-01-01

Biologically active proteins without stable ordered structure (i.e., intrinsically disordered proteins) are attracting increased attention. Functional repertoires of ordered and disordered proteins are very different, and the ability to differentiate whether a given function is associated with intrinsic disorder or with a well-folded protein is crucial for modern protein science. However, there is a large gap between the number of proteins experimentally confirmed to be disordered and their actual number in nature. As a result, studies of functional properties of confirmed disordered proteins, while helpful in revealing the functional diversity of protein disorder, provide only a limited view. To overcome this problem, a bioinformatics approach for comprehensive study of functional roles of protein disorder was proposed in the first paper of this series (Xie H., Vucetic S., Iakoucheva L.M., Oldfield C.J., Dunker A.K., Obradovic Z., Uversky V.N. (2006) Functional anthology of intrinsic disorder. I. Biological processes and functions of proteins with long disordered regions. J. Proteome Res.). Applying this novel approach to Swiss-Prot sequences and functional keywords, we found over 238 and 302 keywords to be strongly positively or negatively correlated, respectively, with long intrinsically disordered regions. This paper describes ~90 Swiss-Prot keywords attributed to the cellular components, domains, technical terms, developmental processes and coding sequence diversities possessing strong positive and negative correlation with long disordered regions. PMID:17391015

Winnowing sequences from a database search.

Science.gov (United States)

Berman, P; Zhang, Z; Wolf, Y I; Koonin, E V; Miller, W

2000-01-01

In database searches for sequence similarity, matches to a distinct sequence region (e.g., protein domain) are frequently obscured by numerous matches to another region of the same sequence. In order to cope with this problem, algorithms are developed to discard redundant matches. One model for this problem begins with a list of intervals, each with an associated score; each interval gives the range of positions in the query sequence that align to a database sequence, and the score is that of the alignment. If interval I is contained in interval J, and I's score is less than J's, then I is said to be dominated by J. The problem is then to identify each interval that is dominated by at least K other intervals, where K is a given level of "tolerable redundancy." An algorithm is developed to solve the problem in O(N log N) time and O(N*) space, where N is the number of intervals and N* is a precisely defined value that never exceeds N and is frequently much smaller. This criterion for discarding database hits has been implemented in the Blast program, as illustrated herein with examples. Several variations and extensions of this approach are also described.

Phylogenetic characterization of the ubiquitous electron transfer flavoprotein families ETF-alpha and ETF-beta.

Science.gov (United States)

Tsai, M H; Saier, M H

1995-06-01

Electron transfer flavoproteins (ETF) are alpha beta-heterodimers found in eukaryotic mitochondria and bacteria. We have identified currently sequenced protein members of the ETF-alpha and ETF-beta families. Members of these two families include (a) the ETF subunits of mammals and bacteria, (b) homologous pairs of proteins (FixB/FixA) that are essential for nitrogen fixation in some bacteria, and (c) a pair of carnitine-inducible proteins encoded by two open reading frames in Escherichia coli (YaaQ and YaaR). These three groups of proteins comprise three clusters on both the ETF-alpha and ETF-beta phylogenetic trees, separated from each other by comparable phylogenetic distances. This fact suggests that these two protein families evolved with similar overall rates of evolutionary divergence. Relative regions of sequence conservation are evaluated, and signature sequences for both families are derived.

The Release 6 reference sequence of the Drosophila melanogaster genome.

Science.gov (United States)

Hoskins, Roger A; Carlson, Joseph W; Wan, Kenneth H; Park, Soo; Mendez, Ivonne; Galle, Samuel E; Booth, Benjamin W; Pfeiffer, Barret D; George, Reed A; Svirskas, Robert; Krzywinski, Martin; Schein, Jacqueline; Accardo, Maria Carmela; Damia, Elisabetta; Messina, Giovanni; Méndez-Lago, María; de Pablos, Beatriz; Demakova, Olga V; Andreyeva, Evgeniya N; Boldyreva, Lidiya V; Marra, Marco; Carvalho, A Bernardo; Dimitri, Patrizio; Villasante, Alfredo; Zhimulev, Igor F; Rubin, Gerald M; Karpen, Gary H; Celniker, Susan E

2015-03-01

Drosophila melanogaster plays an important role in molecular, genetic, and genomic studies of heredity, development, metabolism, behavior, and human disease. The initial reference genome sequence reported more than a decade ago had a profound impact on progress in Drosophila research, and improving the accuracy and completeness of this sequence continues to be important to further progress. We previously described improvement of the 117-Mb sequence in the euchromatic portion of the genome and 21 Mb in the heterochromatic portion, using a whole-genome shotgun assembly, BAC physical mapping, and clone-based finishing. Here, we report an improved reference sequence of the single-copy and middle-repetitive regions of the genome, produced using cytogenetic mapping to mitotic and polytene chromosomes, clone-based finishing and BAC fingerprint verification, ordering of scaffolds by alignment to cDNA sequences, incorporation of other map and sequence data, and validation by whole-genome optical restriction mapping. These data substantially improve the accuracy and completeness of the reference sequence and the order and orientation of sequence scaffolds into chromosome arm assemblies. Representation of the Y chromosome and other heterochromatic regions is particularly improved. The new 143.9-Mb reference sequence, designated Release 6, effectively exhausts clone-based technologies for mapping and sequencing. Highly repeat-rich regions, including large satellite blocks and functional elements such as the ribosomal RNA genes and the centromeres, are largely inaccessible to current sequencing and assembly methods and remain poorly represented. Further significant improvements will require sequencing technologies that do not depend on molecular cloning and that produce very long reads. © 2015 Hoskins et al.; Published by Cold Spring Harbor Laboratory Press.

Discrete Ramanujan transform for distinguishing the protein coding regions from other regions.

Science.gov (United States)

Hua, Wei; Wang, Jiasong; Zhao, Jian

2014-01-01

Based on the study of Ramanujan sum and Ramanujan coefficient, this paper suggests the concepts of discrete Ramanujan transform and spectrum. Using Voss numerical representation, one maps a symbolic DNA strand as a numerical DNA sequence, and deduces the discrete Ramanujan spectrum of the numerical DNA sequence. It is well known that of discrete Fourier power spectrum of protein coding sequence has an important feature of 3-base periodicity, which is widely used for DNA sequence analysis by the technique of discrete Fourier transform. It is performed by testing the signal-to-noise ratio at frequency N/3 as a criterion for the analysis, where N is the length of the sequence. The results presented in this paper show that the property of 3-base periodicity can be only identified as a prominent spike of the discrete Ramanujan spectrum at period 3 for the protein coding regions. The signal-to-noise ratio for discrete Ramanujan spectrum is defined for numerical measurement. Therefore, the discrete Ramanujan spectrum and the signal-to-noise ratio of a DNA sequence can be used for distinguishing the protein coding regions from the noncoding regions. All the exon and intron sequences in whole chromosomes 1, 2, 3 and 4 of Caenorhabditis elegans have been tested and the histograms and tables from the computational results illustrate the reliability of our method. In addition, we have analyzed theoretically and gotten the conclusion that the algorithm for calculating discrete Ramanujan spectrum owns the lower computational complexity and higher computational accuracy. The computational experiments show that the technique by using discrete Ramanujan spectrum for classifying different DNA sequences is a fast and effective method. Copyright © 2014 Elsevier Ltd. All rights reserved.

Multifractal Detrended Fluctuation Analysis of Regional Precipitation Sequences Based on the CEEMDAN-WPT

Science.gov (United States)

Liu, Dong; Cheng, Chen; Fu, Qiang; Liu, Chunlei; Li, Mo; Faiz, Muhammad Abrar; Li, Tianxiao; Khan, Muhammad Imran; Cui, Song

2018-03-01

In this paper, the complete ensemble empirical mode decomposition with the adaptive noise (CEEMDAN) algorithm is introduced into the complexity research of precipitation systems to improve the traditional complexity measure method specific to the mode mixing of the Empirical Mode Decomposition (EMD) and incomplete decomposition of the ensemble empirical mode decomposition (EEMD). We combined the CEEMDAN with the wavelet packet transform (WPT) and multifractal detrended fluctuation analysis (MF-DFA) to create the CEEMDAN-WPT-MFDFA, and used it to measure the complexity of the monthly precipitation sequence of 12 sub-regions in Harbin, Heilongjiang Province, China. The results show that there are significant differences in the monthly precipitation complexity of each sub-region in Harbin. The complexity of the northwest area of Harbin is the lowest and its predictability is the best. The complexity and predictability of the middle and Midwest areas of Harbin are about average. The complexity of the southeast area of Harbin is higher than that of the northwest, middle, and Midwest areas of Harbin and its predictability is worse. The complexity of Shuangcheng is the highest and its predictability is the worst of all the studied sub-regions. We used terrain and human activity as factors to analyze the causes of the complexity of the local precipitation. The results showed that the correlations between the precipitation complexity and terrain are obvious, and the correlations between the precipitation complexity and human influence factors vary. The distribution of the precipitation complexity in this area may be generated by the superposition effect of human activities and natural factors such as terrain, general atmospheric circulation, land and sea location, and ocean currents. To evaluate the stability of the algorithm, the CEEMDAN-WPT-MFDFA was compared with the equal probability coarse graining LZC algorithm, fuzzy entropy, and wavelet entropy. The results show

Sequence-Stratigraphic Analysis of the Regional Observation Monitoring Program (ROMP) 29A Test Corehole and Its Relation to Carbonate Porosity and Regional Transmissivity in the Floridan Aquifer System, Highlands County, Florida

Science.gov (United States)

Ward, W. C.; Cunningham, K.J.; Renken, R.A.; Wacker, M.A.; Carlson, J.I.

2003-01-01

An analysis was made to describe and interpret the lithology of a part of the Upper Floridan aquifer penetrated by the Regional Observation Monitoring Program (ROMP) 29A test corehole in Highlands County, Florida. This information was integrated into a one-dimensional hydrostratigraphic model that delineates candidate flow zones and confining units in the context of sequence stratigraphy. Results from this test corehole will serve as a starting point to build a robust three-dimensional sequence-stratigraphic framework of the Floridan aquifer system. The ROMP 29A test corehole penetrated the Avon Park Formation, Ocala Limestone, Suwannee Limestone, and Hawthorn Group of middle Eocene to Pliocene age. The part of the Avon Park Formation penetrated in the ROMP 29A test corehole contains two composite depositional sequences. A transgressive systems tract and a highstand systems tract were interpreted for the upper composite sequence; however, only a highstand systems tract was interpreted for the lower composite sequence of the deeper Avon Park stratigraphic section. The composite depositional sequences are composed of at least five high-frequency depositional sequences. These sequences contain high-frequency cycle sets that are an amalgamation of vertically stacked high-frequency cycles. Three types of high-frequency cycles have been identified in the Avon Park Formation: peritidal, shallow subtidal, and deeper subtidal high-frequency cycles. The vertical distribution of carbonate-rock diffuse flow zones within the Avon Park Formation is heterogeneous. Porous vuggy intervals are less than 10 feet, and most are much thinner. The volumetric arrangement of the diffuse flow zones shows that most occur in the highstand systems tract of the lower composite sequence of the Avon Park Formation as compared to the upper composite sequence, which contains both a backstepping transgressive systems tract and a prograding highstand systems tract. Although the porous and permeable

Measuring the Electronic Properties of DNA-Specific Schottky Diodes Towards Detecting and Identifying Basidiomycetes DNA

Science.gov (United States)

Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa

2016-01-01

The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology. PMID:27435636

Term structure of 4d-electron configurations and calculated spectrum in Sn-isonuclear sequence

International Nuclear Information System (INIS)

Al-Rabban, Moza M.

2006-01-01

Theoretical calculations of term structure are carried out for the ground configurations 4d w , of atomic ions in the Sn isonuclear sequence. Atomic computations are performed to give a detailed account of the transitions in Sn +6 to Sn +13 ions. The spectrum is calculated for the most important excited configurations 4p 5 4d n+1 , 4d n-1 4f 1 , and 4d n-1 5p 1 with respect to the ground configuration 4d n , with n=8-1, respectively. The importance of 4p-4d, 4d-4f, and 4d-5p transitions is stressed, as well as the need for the configuration-interaction CI treatment of the Δn=0 transitions. In the region of importance for extreme ultraviolet (EUV) lithography around 13.4nm, the strongest lines were expected to be 4d n -4p 5 4d n+1 and 4d n -4d n-1 4f 1

Quantitative comparison between a multiecho sequence and a single-echo sequence for susceptibility-weighted phase imaging.

Science.gov (United States)

Gilbert, Guillaume; Savard, Geneviève; Bard, Céline; Beaudoin, Gilles

2012-06-01

The aim of this study was to investigate the benefits arising from the use of a multiecho sequence for susceptibility-weighted phase imaging using a quantitative comparison with a standard single-echo acquisition. Four healthy adult volunteers were imaged on a clinical 3-T system using a protocol comprising two different three-dimensional susceptibility-weighted gradient-echo sequences: a standard single-echo sequence and a multiecho sequence. Both sequences were repeated twice in order to evaluate the local noise contribution by a subtraction of the two acquisitions. For the multiecho sequence, the phase information from each echo was independently unwrapped, and the background field contribution was removed using either homodyne filtering or the projection onto dipole fields method. The phase information from all echoes was then combined using a weighted linear regression. R2 maps were also calculated from the multiecho acquisitions. The noise standard deviation in the reconstructed phase images was evaluated for six manually segmented regions of interest (frontal white matter, posterior white matter, globus pallidus, putamen, caudate nucleus and lateral ventricle). The use of the multiecho sequence for susceptibility-weighted phase imaging led to a reduction of the noise standard deviation for all subjects and all regions of interest investigated in comparison to the reference single-echo acquisition. On average, the noise reduction ranged from 18.4% for the globus pallidus to 47.9% for the lateral ventricle. In addition, the amount of noise reduction was found to be strongly inversely correlated to the estimated R2 value (R=-0.92). In conclusion, the use of a multiecho sequence is an effective way to decrease the noise contribution in susceptibility-weighted phase images, while preserving both contrast and acquisition time. The proposed approach additionally permits the calculation of R2 maps. Copyright © 2012 Elsevier Inc. All rights reserved.

Precipitation regions on the Earth of high energy electrons, injected by a point source moving along a circular Earth orbit

Science.gov (United States)

Kolesnikov, E. K.; Klyushnikov, G. N.

2018-05-01

In the paper we continue the study of precipitation regions of high-energy charged particles, carried out by the authors since 2002. In contrast to previous papers, where a stationary source of electrons was considered, it is assumed that the source moves along a low circular near-earth orbit with a constant velocity. The orbit position is set by the inclination angle of the orbital plane to the equatorial plane and the longitude of the ascending node. The total number of injected electrons is determined by the source strength and the number of complete revolutions that the source makes along the circumference. Construction of precipitation regions is produced using the computational algorithm based on solving of the system of ordinary differential equations. The features of the precipitation regions structure for the dipole approximation of the geomagnetic field and the symmetrical arrangement of the orbit relative to the equator are noted. The dependencies of the precipitation regions on different orbital parametres such as the incline angle, the ascending node position and kinetic energy of injected particles have been considered.

Computational Model of D-Region Ion Production Caused by Energetic Electron Precipitations Based on General Monte Carlo Transport Calculations

Science.gov (United States)

Kouznetsov, A.; Cully, C. M.

2017-12-01

During enhanced magnetic activities, large ejections of energetic electrons from radiation belts are deposited in the upper polar atmosphere where they play important roles in its physical and chemical processes, including VLF signals subionospheric propagation. Electron deposition can affect D-Region ionization, which are estimated based on ionization rates derived from energy depositions. We present a model of D-region ion production caused by an arbitrary (in energy and pitch angle) distribution of fast (10 keV - 1 MeV) electrons. The model relies on a set of pre-calculated results obtained using a general Monte Carlo approach with the latest version of the MCNP6 (Monte Carlo N-Particle) code for the explicit electron tracking in magnetic fields. By expressing those results using the ionization yield functions, the pre-calculated results are extended to cover arbitrary magnetic field inclinations and atmospheric density profiles, allowing ionization rate altitude profile computations in the range of 20 and 200 km at any geographic point of interest and date/time by adopting results from an external atmospheric density model (e.g. NRLMSISE-00). The pre-calculated MCNP6 results are stored in a CDF (Common Data Format) file, and IDL routines library is written to provide an end-user interface to the model.

SEQATOMS: a web tool for identifying missing regions in PDB in sequence context

NARCIS (Netherlands)

Brandt, B.W.; Heringa, J.; Leunissen, J.A.M.

2008-01-01

With over 46 000 proteins, the Protein Data Bank (PDB) is the most important database with structural information of biological macromolecules. PDB files contain sequence and coordinate information. Residues present in the sequence can be absent from the coordinate section, which means their

Sequence polymorphism data of the hypervariable regions of mitochondrial DNA in the Yadav population of Haryana.

Science.gov (United States)

Verma, Kapil; Sharma, Sapna; Sharma, Arun; Dalal, Jyoti; Bhardwaj, Tapeshwar

2018-06-01

Genetic variations among humans occur both within and among populations and range from single nucleotide changes to multiple-nucleotide variants. These multiple-nucleotide variants are useful for studying the relationships among individuals or various population groups. The study of human genetic variations can help scientists understand how different population groups are biologically related to one another. Sequence analysis of hypervariable regions of human mitochondrial DNA (mtDNA) has been successfully used for the genetic characterization of different population groups for forensic purposes. It is well established that different ethnic or population groups differ significantly in their mtDNA distributions. In the last decade, very little research has been conducted on mtDNA variations in the Indian population, although such data would be useful for elucidating the history of human population expansion across the world. Moreover, forensic studies on mtDNA variations in the Indian subcontinent are also scarce, particularly in the northern part of India. In this report, variations in the hypervariable regions of mtDNA were analyzed in the Yadav population of Haryana. Different molecular diversity indices were computed. Further, the obtained haplotypes were classified into different haplogroups and the phylogenetic relationship between different haplogroups was inferred.

Sudden post-midnight decrease in equatorial F-region electron densities associated with severe magnetic storms

Directory of Open Access Journals (Sweden)

D. R. Lakshmi

1997-03-01

Full Text Available A detailed analysis of the responses of the equatorial ionosphere to a large number of severe magnetic storms shows the rapid and remarkable collapse of F-region ionisation during post-midnight hours; this is at variance with the presently accepted general behaviour of the low-latitude ionosphere during magnetic storms. This paper discusses such responses as seen in the ionosonde data at Kodaikanal (Geomagn. Lat. 0.6 N. It is also observed that during magnetic storm periods the usual increase seen in the h'F at Kodaikanal during sunset hours is considerably suppressed and these periods are also characterised by increased foF2 values. It is suggested that the primary process responsible for these dramatic pre- and post-midnight changes in foF2 during magnetic storms could be due to changes in the magnitude as well as in the direction of usual equatorial electric fields. During the post-midnight periods the change in electric-field direction from westward to eastward for a short period causes an upward E × B plasma drift resulting in increased h'F and decreased electron densities in the equatorial region. In addition, it is also suggested that the enhanced storm-induced meridional winds in the thermosphere, from the poles towards the equator, may also cause the decreases in electron density seen during post-midnight hours by spatially transporting the F-region ionisation southwards away from Kodaikanal. The paper also includes a discussion on the effects of such decreases in ionisation on low-latitude HF communications.

Sequence of the amino-terminal region of rat liver ribosomal proteins S4, S6, S8, L6, L7a, L18, L27, L30, L37, L37a, and L39.

Science.gov (United States)

Wittmann-Liebold, B; Geissler, A W; Lin, A; Wool, I G

1979-01-01

The sequence of the amino-terminal region of eleven rat liver ribosomal proteins--S4, S6, S8, L6, L7a, L18, L27, L30, L37a, and L39--was determined. The analysis confirmed the homogeneity of the proteins and suggests that they are unique, since no extensive common sequences were found. The N-terminal regions of the rat liver proteins were compared with amino acid sequences in Saccharomyces cerevisiae and in Escherichia coli ribosomal proteins. It seems likely that the proteins L37 from rat liver and Y55 from yeast ribosomes are homologous. It is possible that rat liver L7a or L37a or both are related to S cerevisiae Y44, although the similar sequences are at the amino-terminus of the rat liver proteins and in an internal region of Y44. A number of similarities in the sequences of rat liver and E coli ribosomal proteins have been found; however, it is not yet possible to say whether they connote a common ancestry.

Model morphing and sequence assignment after molecular replacement.

Science.gov (United States)

Terwilliger, Thomas C; Read, Randy J; Adams, Paul D; Brunger, Axel T; Afonine, Pavel V; Hung, Li-Wei

2013-11-01

A procedure termed `morphing' for improving a model after it has been placed in the crystallographic cell by molecular replacement has recently been developed. Morphing consists of applying a smooth deformation to a model to make it match an electron-density map more closely. Morphing does not change the identities of the residues in the chain, only their coordinates. Consequently, if the true structure differs from the working model by containing different residues, these differences cannot be corrected by morphing. Here, a procedure that helps to address this limitation is described. The goal of the procedure is to obtain a relatively complete model that has accurate main-chain atomic positions and residues that are correctly assigned to the sequence. Residues in a morphed model that do not match the electron-density map are removed. Each segment of the resulting trimmed morphed model is then assigned to the sequence of the molecule using information about the connectivity of the chains from the working model and from connections that can be identified from the electron-density map. The procedure was tested by application to a recently determined structure at a resolution of 3.2 Å and was found to increase the number of correctly identified residues in this structure from the 88 obtained using phenix.resolve sequence assignment alone (Terwilliger, 2003) to 247 of a possible 359. Additionally, the procedure was tested by application to a series of templates with sequence identities to a target structure ranging between 7 and 36%. The mean fraction of correctly identified residues in these cases was increased from 33% using phenix.resolve sequence assignment to 47% using the current procedure. The procedure is simple to apply and is available in the Phenix software package.

D-region electron density and effective recombination coefficients during twilight – experimental data and modelling during solar proton events

Directory of Open Access Journals (Sweden)

A. Osepian

2009-10-01

Full Text Available Accurate measurements of electron density in the lower D-region (below 70 km altitude are rarely made. This applies both with regard to measurements by ground-based facilities and by sounding rockets, and during both quiet conditions and conditions of energetic electron precipitation. Deep penetration into the atmosphere of high-energy solar proton fluxes (during solar proton events, SPE produces extra ionisation in the whole D-region, including the lower altitudes, which gives favourable conditions for accurate measurements using ground-based facilities. In this study we show that electron densities measured with two ground-based facilities at almost the same latitude but slightly different longitudes, provide a valuable tool for validation of model computations. The two techniques used are incoherent scatter of radio waves (by the EISCAT 224 MHz radar in Tromsø, Norway, 69.6° N, 19.3° E, and partial reflection of radio-waves (by the 2.8 MHz radar near Murmansk, Russia, 69.0° N, 35.7° E. Both radars give accurate electron density values during SPE, from heights 57–60 km and upward with the EISCAT radar and between 55–70 km with the partial reflection technique. Near noon, there is little difference in the solar zenith angle between the two locations and both methods give approximately the same values of electron density at the overlapping heights. During twilight, when the difference in solar zenith angles increases, electron density values diverge. When both radars are in night conditions (solar zenith angle >99° electron densities at the overlapping altitudes again become equal. We use the joint measurements to validate model computations of the ionospheric parameters f+, λ, αeff and their variations during solar proton events. These parameters are important characteristics of the lower ionosphere structure which cannot be determined by other methods.

Spontaneous and stimulated emission induced by an electron, electron bunch, and electron beam in a plasma

International Nuclear Information System (INIS)

Kuzelev, M V; Rukhadze, A A

2008-01-01

Two fundamental mechanisms - the Cherenkov effect and anomalous Doppler effect - underlying the emission by an electron during its superluminal motion in medium are considered. Cherenkov emission induced by a single electron and a small electron bunch is spontaneous. In the course of spontaneous Cherenkov emission, the translational motion of an electron is slowed down and the radiation energy grows linearly with time. As the number of radiating electrons increases, Cherenkov emission becomes stimulated. Stimulated Cherenkov emission represents a resonance beam instability. This emission process is accompanied by longitudinal electron bunching in the beam or by the breaking of an electron bunch into smaller bunches, in which case the radiation energy grows exponentially with time. In terms of the longitudinal size L e of the electron bunch there is a transition region λ e 0 -1 between the spontaneous and stimulated Cherenkov effects, where λ is the average radiation wavelength, and δ 0 is the dimensionless (in units of the radiation frequency) growth rate of the Cherenkov beam instability. The range to the left of this region is dominated by spontaneous emission, whereas the range to the right of this region is dominated by stimulated emission. In contrast to the Vavilov-Cherenkov effect, the anomalous Doppler effect should always (even for a single electron) be considered as stimulated, because it can only be explained by accounting for the reverse action of the radiation field on the moving electron. During stimulated emission in conditions where anomalous Doppler effect shows itself, an electron is slowed down and spins up; in this case, the radiation energy grows exponentially with time. (reviews of topical problems)

Power electronics a first course

CERN Document Server

Mohan, Ned

2011-01-01

Author Ned Mohan has been a leader in EES education and research for decades. His three-book series on Power Electronics focuses on three essential topics in the power sequence based on applications relevant to this age of sustainable energy such as wind turbines and hybrid electric vehicles. The three topics include power electronics, power systems and electric machines. Key features in the first Edition build on Mohan's successful MNPERE texts; his systems approach which puts dry technical detail in the context of applications; and substantial pedagogical support including PPT's, video clips, animations, clicker questions and a lab manual. It follows a top-down systems-level approach to power electronics to highlight interrelationships between these sub-fields. It's intended to cover fundamental and practical design. This book also follows a building-block approach to power electronics that allows an in-depth discussion of several important topics that are usually left. Topics are carefully sequenced to mai...

Model morphing and sequence assignment after molecular replacement

Energy Technology Data Exchange (ETDEWEB)

Terwilliger, Thomas C., E-mail: terwilliger@lanl.gov [Los Alamos National Laboratory, Mail Stop M888, Los Alamos, NM 87545 (United States); Read, Randy J. [University of Cambridge, Cambridge Institute for Medical Research, Cambridge CB2 0XY (United Kingdom); Adams, Paul D. [Lawrence Berkeley National Laboratory, One Cyclotron Road, Bldg 64R0121, Berkeley, CA 94720 (United States); Brunger, Axel T. [Stanford University, 318 Campus Drive West, Stanford, CA 94305 (United States); Afonine, Pavel V. [Lawrence Berkeley National Laboratory, One Cyclotron Road, Bldg 64R0121, Berkeley, CA 94720 (United States); Hung, Li-Wei [Los Alamos National Laboratory, Mail Stop M888, Los Alamos, NM 87545 (United States)

2013-11-01

A procedure for model building is described that combines morphing a model to match a density map, trimming the morphed model and aligning the model to a sequence. A procedure termed ‘morphing’ for improving a model after it has been placed in the crystallographic cell by molecular replacement has recently been developed. Morphing consists of applying a smooth deformation to a model to make it match an electron-density map more closely. Morphing does not change the identities of the residues in the chain, only their coordinates. Consequently, if the true structure differs from the working model by containing different residues, these differences cannot be corrected by morphing. Here, a procedure that helps to address this limitation is described. The goal of the procedure is to obtain a relatively complete model that has accurate main-chain atomic positions and residues that are correctly assigned to the sequence. Residues in a morphed model that do not match the electron-density map are removed. Each segment of the resulting trimmed morphed model is then assigned to the sequence of the molecule using information about the connectivity of the chains from the working model and from connections that can be identified from the electron-density map. The procedure was tested by application to a recently determined structure at a resolution of 3.2 Å and was found to increase the number of correctly identified residues in this structure from the 88 obtained using phenix.resolve sequence assignment alone (Terwilliger, 2003 ▶) to 247 of a possible 359. Additionally, the procedure was tested by application to a series of templates with sequence identities to a target structure ranging between 7 and 36%. The mean fraction of correctly identified residues in these cases was increased from 33% using phenix.resolve sequence assignment to 47% using the current procedure. The procedure is simple to apply and is available in the Phenix software package.

Model morphing and sequence assignment after molecular replacement

International Nuclear Information System (INIS)

Terwilliger, Thomas C.; Read, Randy J.; Adams, Paul D.; Brunger, Axel T.; Afonine, Pavel V.; Hung, Li-Wei

2013-01-01

A procedure for model building is described that combines morphing a model to match a density map, trimming the morphed model and aligning the model to a sequence. A procedure termed ‘morphing’ for improving a model after it has been placed in the crystallographic cell by molecular replacement has recently been developed. Morphing consists of applying a smooth deformation to a model to make it match an electron-density map more closely. Morphing does not change the identities of the residues in the chain, only their coordinates. Consequently, if the true structure differs from the working model by containing different residues, these differences cannot be corrected by morphing. Here, a procedure that helps to address this limitation is described. The goal of the procedure is to obtain a relatively complete model that has accurate main-chain atomic positions and residues that are correctly assigned to the sequence. Residues in a morphed model that do not match the electron-density map are removed. Each segment of the resulting trimmed morphed model is then assigned to the sequence of the molecule using information about the connectivity of the chains from the working model and from connections that can be identified from the electron-density map. The procedure was tested by application to a recently determined structure at a resolution of 3.2 Å and was found to increase the number of correctly identified residues in this structure from the 88 obtained using phenix.resolve sequence assignment alone (Terwilliger, 2003 ▶) to 247 of a possible 359. Additionally, the procedure was tested by application to a series of templates with sequence identities to a target structure ranging between 7 and 36%. The mean fraction of correctly identified residues in these cases was increased from 33% using phenix.resolve sequence assignment to 47% using the current procedure. The procedure is simple to apply and is available in the Phenix software package

Sequence-specific 1H-NMR assignments for the aromatic region of several biologically active, monomeric insulins including native human insulin.

Science.gov (United States)

Roy, M; Lee, R W; Kaarsholm, N C; Thøgersen, H; Brange, J; Dunn, M F

1990-06-12

The aromatic region of the 1H-FT-NMR spectrum of the biologically fully-potent, monomeric human insulin mutant, B9 Ser----Asp, B27 Thr----Glu has been investigated in D2O. At 1 to 5 mM concentrations, this mutant insulin is monomeric above pH 7.5. Coupling and amino acid classification of all aromatic signals is established via a combination of homonuclear one- and two-dimensional methods, including COSY, multiple quantum filters, selective spin decoupling and pH titrations. By comparisons with other insulin mutants and with chemically modified native insulins, all resonances in the aromatic region are given sequence-specific assignments without any reliance on the various crystal structures reported for insulin. These comparisons also give the sequence-specific assignments of most of the aromatic resonances of the mutant insulins B16 Tyr----Glu, B27 Thr----Glu and B25 Phe----Asp and the chemically modified species des-(B23-B30) insulin and monoiodo-Tyr A14 insulin. Chemical dispersion of the assigned resonances, ring current perturbations and comparisons at high pH have made possible the assignment of the aromatic resonances of human insulin, and these studies indicate that the major structural features of the human insulin monomer (including those critical to biological function) are also present in the monomeric mutant.

ProteinSplit: splitting of multi-domain proteins using prediction of ordered and disordered regions in protein sequences for virtual structural genomics

International Nuclear Information System (INIS)

Wyrwicz, Lucjan S; Koczyk, Grzegorz; Rychlewski, Leszek; Plewczynski, Dariusz

2007-01-01

The annotation of protein folds within newly sequenced genomes is the main target for semi-automated protein structure prediction (virtual structural genomics). A large number of automated methods have been developed recently with very good results in the case of single-domain proteins. Unfortunately, most of these automated methods often fail to properly predict the distant homology between a given multi-domain protein query and structural templates. Therefore a multi-domain protein should be split into domains in order to overcome this limitation. ProteinSplit is designed to identify protein domain boundaries using a novel algorithm that predicts disordered regions in protein sequences. The software utilizes various sequence characteristics to assess the local propensity of a protein to be disordered or ordered in terms of local structure stability. These disordered parts of a protein are likely to create interdomain spacers. Because of its speed and portability, the method was successfully applied to several genome-wide fold annotation experiments. The user can run an automated analysis of sets of proteins or perform semi-automated multiple user projects (saving the results on the server). Additionally the sequences of predicted domains can be sent to the Bioinfo.PL Protein Structure Prediction Meta-Server for further protein three-dimensional structure and function prediction. The program is freely accessible as a web service at http://lucjan.bioinfo.pl/proteinsplit together with detailed benchmark results on the critical assessment of a fully automated structure prediction (CAFASP) set of sequences. The source code of the local version of protein domain boundary prediction is available upon request from the authors

Phylogenetic relationships within the cyst-forming nematodes (Nematoda, Heteroderidae) based on analysis of sequences from the ITS regions of ribosomal DNA.

Science.gov (United States)

Subbotin, S A; Vierstraete, A; De Ley, P; Rowe, J; Waeyenberge, L; Moens, M; Vanfleteren, J R

2001-10-01

The ITS1, ITS2, and 5.8S gene sequences of nuclear ribosomal DNA from 40 taxa of the family Heteroderidae (including the genera Afenestrata, Cactodera, Heterodera, Globodera, Punctodera, Meloidodera, Cryphodera, and Thecavermiculatus) were sequenced and analyzed. The ITS regions displayed high levels of sequence divergence within Heteroderinae and compared to outgroup taxa. Unlike recent findings in root knot nematodes, ITS sequence polymorphism does not appear to complicate phylogenetic analysis of cyst nematodes. Phylogenetic analyses with maximum-parsimony, minimum-evolution, and maximum-likelihood methods were performed with a range of computer alignments, including elision and culled alignments. All multiple alignments and phylogenetic methods yielded similar basic structure for phylogenetic relationships of Heteroderidae. The cyst-forming nematodes are represented by six main clades corresponding to morphological characters and host specialization, with certain clades assuming different positions depending on alignment procedure and/or method of phylogenetic inference. Hypotheses of monophyly of Punctoderinae and Heteroderinae are, respectively, strongly and moderately supported by the ITS data across most alignments. Close relationships were revealed between the Avenae and the Sacchari groups and between the Humuli group and the species H. salixophila within Heteroderinae. The Goettingiana group occupies a basal position within this subfamily. The validity of the genera Afenestrata and Bidera was tested and is discussed based on molecular data. We conclude that ITS sequence data are appropriate for studies of relationships within the different species groups and less so for recovery of more ancient speciations within Heteroderidae. Copyright 2001 Academic Press.

Electron-ion collisions

International Nuclear Information System (INIS)

Crandall, D.H.

1982-01-01

This discussion concentrates on basic physics aspects of inelastic processes of excitation, ionization, and recombination that occur during electron-ion collisions. Except for cases of illustration along isoelectronic sequences, only multicharged (at least +2) ions will be specifically discussed with some emphasis of unique physics aspects associated with ionic charge. The material presented will be discussed from a primarily experimental viewpoint with most attention to electron-ion interacting beams experiments

SDSS-IV MaNGA: Spatially Resolved Star Formation Main Sequence and LI(N)ER Sequence

Science.gov (United States)

Hsieh, B. C.; Lin, Lihwai; Lin, J. H.; Pan, H. A.; Hsu, C. H.; Sánchez, S. F.; Cano-Díaz, M.; Zhang, K.; Yan, R.; Barrera-Ballesteros, J. K.; Boquien, M.; Riffel, R.; Brownstein, J.; Cruz-González, I.; Hagen, A.; Ibarra, H.; Pan, K.; Bizyaev, D.; Oravetz, D.; Simmons, A.

2017-12-01

We present our study on the spatially resolved Hα and M * relation for 536 star-forming and 424 quiescent galaxies taken from the MaNGA survey. We show that the star formation rate surface density ({{{Σ }}}{SFR}), derived based on the Hα emissions, is strongly correlated with the M * surface density ({{{Σ }}}* ) on kiloparsec scales for star-forming galaxies and can be directly connected to the global star-forming sequence. This suggests that the global main sequence may be a consequence of a more fundamental relation on small scales. On the other hand, our result suggests that ∼20% of quiescent galaxies in our sample still have star formation activities in the outer region with lower specific star formation rate (SSFR) than typical star-forming galaxies. Meanwhile, we also find a tight correlation between {{{Σ }}}{{H}α } and {{{Σ }}}* for LI(N)ER regions, named the resolved “LI(N)ER” sequence, in quiescent galaxies, which is consistent with the scenario that LI(N)ER emissions are primarily powered by the hot, evolved stars as suggested in the literature.

Analysis of HIV-1 intersubtype recombination breakpoints suggests region with high pairing probability may be a more fundamental factor than sequence similarity affecting HIV-1 recombination.

Science.gov (United States)

Jia, Lei; Li, Lin; Gui, Tao; Liu, Siyang; Li, Hanping; Han, Jingwan; Guo, Wei; Liu, Yongjian; Li, Jingyun

2016-09-21

With increasing data on HIV-1, a more relevant molecular model describing mechanism details of HIV-1 genetic recombination usually requires upgrades. Currently an incomplete structural understanding of the copy choice mechanism along with several other issues in the field that lack elucidation led us to perform an analysis of the correlation between breakpoint distributions and (1) the probability of base pairing, and (2) intersubtype genetic similarity to further explore structural mechanisms. Near full length sequences of URFs from Asia, Europe, and Africa (one sequence/patient), and representative sequences of worldwide CRFs were retrieved from the Los Alamos HIV database. Their recombination patterns were analyzed by jpHMM in detail. Then the relationships between breakpoint distributions and (1) the probability of base pairing, and (2) intersubtype genetic similarities were investigated. Pearson correlation test showed that all URF groups and the CRF group exhibit the same breakpoint distribution pattern. Additionally, the Wilcoxon two-sample test indicated a significant and inexplicable limitation of recombination in regions with high pairing probability. These regions have been found to be strongly conserved across distinct biological states (i.e., strong intersubtype similarity), and genetic similarity has been determined to be a very important factor promoting recombination. Thus, the results revealed an unexpected disagreement between intersubtype similarity and breakpoint distribution, which were further confirmed by genetic similarity analysis. Our analysis reveals a critical conflict between results from natural HIV-1 isolates and those from HIV-1-based assay vectors in which genetic similarity has been shown to be a very critical factor promoting recombination. These results indicate the region with high-pairing probabilities may be a more fundamental factor affecting HIV-1 recombination than sequence similarity in natural HIV-1 infections. Our

Regulatory sequence of cupin family gene

Science.gov (United States)

Hood, Elizabeth; Teoh, Thomas

2017-07-25

This invention is in the field of plant biology and agriculture and relates to novel seed specific promoter regions. The present invention further provide methods of producing proteins and other products of interest and methods of controlling expression of nucleic acid sequences of interest using the seed specific promoter regions.

An electron storage ring as primary standard for the realization of radiation optical units from the infrared to the soft X-ray region

International Nuclear Information System (INIS)

Riehle, F.; Wende, B.

1987-01-01

The electron storage ring BESSY optimized for radiometry is shown to be a primary standard of spectral photon flux with a relative uncertainty increasing from 0.3% in the infrared (photon energy ≅ 1 eV) to 2% in the soft X-ray region (photon energy ≅ 5 keV). The small uncertainties at high photon energies were achieved by measuring the spatial and angular distributions of the electrons around the mean electron orbit and by calculating the corresponding distributions of the emitted synchrotron radiation. Results of various intercomparisons with other standards in the near infrared, visible, and soft X-ray region support the low uncertainties of this new primary standard. (orig.)

Sequence analysis of the MYC oncogene involved in the t(8;14)(q24;q11) chromosome translocation in a human leukemia T-cell line indicates that putative regulatory regions are not altered

International Nuclear Information System (INIS)

Finver, S.N.; Nishikura, K.; Finger, L.R.; Haluska, F.G.; Finan, J.; Nowell, P.C.; Croce, C.M.

1988-01-01

The authors cloned the translocation-associated and homologous normal MYC alleles from SKW-3, a leukemia T-cell line with the t(8; 14)(q24; q11) translocation, and determined the sequence of the MYC oncogene first exon and flanking 5' putative regulatory regions. S1 nuclease protection experiments utilizing a MYC first exon probe demonstrated transcriptional deregulation of the MYC gene associated with the T-cell receptor α locus on the 8q + chromosome of SKW-3 cells. Nucleotide sequence analysis of the translocation-associated (8q +) MYC allele identified a single base substitution within the upstream flanking region; the homologous nontranslocated allele contained an additional substitution and a two-base deletion. None of the deletions or substitutions localized to putative 5' regulatory regions. The MYC first exon sequence was germ line in both alleles. These results demonstrate that alterations within the putative 5' MYC regulatory regions are not necessarily involved in MYC deregulation in T-cell leukemias, and they show that juxtaposition of the T-cell receptor α locus to a germ-line MYC oncogene results in MYC deregulation

Third-Generation Sequencing and Analysis of Four Complete Pig Liver Esterase Gene Sequences in Clones Identified by Screening BAC Library.

Science.gov (United States)

Zhou, Qiongqiong; Sun, Wenjuan; Liu, Xiyan; Wang, Xiliang; Xiao, Yuncai; Bi, Dingren; Yin, Jingdong; Shi, Deshi

2016-01-01

Pig liver carboxylesterase (PLE) gene sequences in GenBank are incomplete, which has led to difficulties in studying the genetic structure and regulation mechanisms of gene expression of PLE family genes. The aim of this study was to obtain and analysis of complete gene sequences of PLE family by screening from a Rongchang pig BAC library and third-generation PacBio gene sequencing. After a number of existing incomplete PLE isoform gene sequences were analysed, primers were designed based on conserved regions in PLE exons, and the whole pig genome used as a template for Polymerase chain reaction (PCR) amplification. Specific primers were then selected based on the PCR amplification results. A three-step PCR screening method was used to identify PLE-positive clones by screening a Rongchang pig BAC library and PacBio third-generation sequencing was performed. BLAST comparisons and other bioinformatics methods were applied for sequence analysis. Five PLE-positive BAC clones, designated BAC-10, BAC-70, BAC-75, BAC-119 and BAC-206, were identified. Sequence analysis yielded the complete sequences of four PLE genes, PLE1, PLE-B9, PLE-C4, and PLE-G2. Complete PLE gene sequences were defined as those containing regulatory sequences, exons, and introns. It was found that, not only did the PLE exon sequences of the four genes show a high degree of homology, but also that the intron sequences were highly similar. Additionally, the regulatory region of the genes contained two 720bps reverse complement sequences that may have an important function in the regulation of PLE gene expression. This is the first report to confirm the complete sequences of four PLE genes. In addition, the study demonstrates that each PLE isoform is encoded by a single gene and that the various genes exhibit a high degree of sequence homology, suggesting that the PLE family evolved from a single ancestral gene. Obtaining the complete sequences of these PLE genes provides the necessary foundation for

Characterization of the HLA-DRβ1 third hypervariable region amino acid sequence according to charge and parental inheritance in systemic sclerosis.

Science.gov (United States)

Gentil, Coline A; Gammill, Hilary S; Luu, Christine T; Mayes, Maureen D; Furst, Dan E; Nelson, J Lee

2017-03-07

Specific HLA class II alleles are associated with systemic sclerosis (SSc) risk, clinical characteristics, and autoantibodies. HLA nomenclature initially developed with antibodies as typing reagents defining DRB1 allele groups. However, alleles from different DRB1 allele groups encode the same third hypervariable region (3rd HVR) sequence, the primary T-cell recognition site, and 3rd HVR charge differences can affect interactions with T cells. We considered 3rd HVR sequences (amino acids 67-74) irrespective of the allele group and analyzed parental inheritance considered according to the 3rd HVR charge, comparing SSc patients with controls. In total, 306 families (121 SSc and 185 controls) were HLA genotyped and parental HLA-haplotype origin was determined. Analysis was conducted according to DRβ1 3rd HVR sequence, charge, and parental inheritance. The distribution of 3rd HVR sequences differed in SSc patients versus controls (p = 0.007), primarily due to an increase of specific DRB1*11 alleles, in accord with previous observations. The 3rd HVR sequences were next analyzed according to charge and parental inheritance. Paternal transmission of DRB1 alleles encoding a +2 charge 3rd HVR was significantly reduced in SSc patients compared with maternal transmission (p = 0.0003, corrected for analysis of four charge categories p = 0.001). To a lesser extent, paternal transmission was increased when charge was 0 (p = 0.021, corrected for multiple comparisons p = 0.084). In contrast, paternal versus maternal inheritance was similar in controls. SSc patients differed from controls when DRB1 alleles were categorized according to 3rd HVR sequences. Skewed parental inheritance was observed in SSc patients but not in controls when the DRβ1 3rd HVR was considered according to charge. These observations suggest that epigenetic modulation of HLA merits investigation in SSc.

Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

Energy Technology Data Exchange (ETDEWEB)

Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

1988-09-26

The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

Comparison of sequences of hypervariable region (HVR subunit S-1 gene of field isolate I-37 infectious bronchitis virus with Connecticut serotype

Directory of Open Access Journals (Sweden)

N.L.P Indi Dharmayanti

2003-06-01

Full Text Available Infectious Bronchitis is a contagious and acute respiratory disease in chickens caused by infectious bronchitis virus (IBV.Antigenic differences in IBV are associated with changes in the sequence of the spike glycoprotein (S. The subunit S1 which demonstrates more sequence variability than S-2 have been identified as hypervariable region (HVR-1 and 2. There were several IB virus field isolates included I-37 have been identified in Indonesia by serum neutralization method. However, gene sequence variation in HVR subunit S-1 had not yet been identified. Isolate I-37 was close to the serotype Connecticut 46 (Conn 46. The aim of this study is to identify sequence variation of HVR subunit S-1 gene of isolate I-37 produced by Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR and sequencing. Several procedures were carried out in the study including virus titration, propagation and was concentrated from the allantoic fluid infected with IBV. Then, RNA was extracted for RTPCR. urther the product was sequnced and its homology with IBV references from GenBank was compared by GenMac version 8.0. Result showed that isolate I-37 produced 515 bp of amplification product. Isolate I-37 and Conn 46 are same serotype, yet their HVR subunit S-1 nucleotides and amino acids (protein differ by 6.9% and 15.6% respectively. It might be concluded that isolate I-37 was variant of Conn 46.

Evolutionary history of Phakopsora pachyrhizi (the Asian soybean rust in Brazil based on nucleotide sequences of the internal transcribed spacer region of the nuclear ribosomal DNA

Directory of Open Access Journals (Sweden)

Maíra C. M. Freire

2008-01-01

Full Text Available Phakopsora pachyrhizi has dispersed globally and brought severe economic losses to soybean growers. The fungus has been established in Brazil since 2002 and is found nationwide. To gather information on the temporal and spatial patterns of genetic variation in P. pachyrhizi , we sequenced the nuclear internal transcribed spacer regions (ITS1 and ITS2. Total genomic DNA was extracted using either lyophilized urediniospores or lesions removed from infected leaves sampled from 26 soybean fields in Brazil and one field in South Africa. Cloning prior to sequencing was necessary because direct sequencing of PCR amplicons gave partially unreadable electrophoretograms with peak displacements suggestive of multiple sequences with length polymorphism. Sequences were determined from four clones per field. ITS sequences from African or Asian isolates available from the GenBank were included in the analyses. Independent sequence alignments of the ITS1 and ITS2 datasets identified 27 and 19 ribotypes, respectively. Molecular phylogeographic analyses revealed that ribotypes of widespread distribution in Brazil displayed characteristics of ancestrality and were shared with Africa and Asia, while ribotypes of rare occurrence in Brazil were indigenous. The results suggest P. pachyrhizi found in Brazil as originating from multiple, independent long-distance dispersal events.

A new software routine that automates the fitting of protein X-ray crystallographic electron-density maps.

Science.gov (United States)

Levitt, D G

2001-07-01

The classical approach to building the amino-acid residues into the initial electron-density map requires days to weeks of a skilled investigator's time. Automating this procedure should not only save time, but has the potential to provide a more accurate starting model for input to refinement programs. The new software routine MAID builds the protein structure into the electron-density map in a series of sequential steps. The first step is the fitting of the secondary alpha-helix and beta-sheet structures. These 'fits' are then used to determine the local amino-acid sequence assignment. These assigned fits are then extended through the loop regions and fused with the neighboring sheet or helix. The program was tested on the unaveraged 2.5 A selenomethionine multiple-wavelength anomalous dispersion (SMAD) electron-density map that was originally used to solve the structure of the 291-residue protein human heart short-chain L-3-hydroxyacyl-CoA dehydrogenase (SHAD). Inputting just the map density and the amino-acid sequence, MAID fitted 80% of the residues with an r.m.s.d. error of 0.43 A for the main-chain atoms and 1.0 A for all atoms without any user intervention. When tested on a higher quality 1.9 A SMAD map, MAID correctly fitted 100% (418) of the residues. A major advantage of the MAID fitting procedure is that it maintains ideal bond lengths and angles and constrains phi/psi angles to the appropriate Ramachandran regions. Recycling the output of this new routine through a partial structure-refinement program may have the potential to completely automate the fitting of electron-density maps.

Global variation in the long-term seasonal changes observed in ionospheric F region data

Directory of Open Access Journals (Sweden)

C. J. Scott

2015-04-01

Full Text Available Long-term variability has previously been observed in the relative magnitude of annual and semi-annual variations in the critical frequency (related to the peak electron concentration of the ionospheric F2 layer (foF2. In this paper we investigate the global patterns in such variability by calculating the time varying power ratio of semi-annual to annual components seen in ionospheric foF2 data sequences from 77 ionospheric monitoring stations around the world. The temporal variation in power ratios observed at each station was then correlated with the same parameter calculated from similar epochs for the Slough/Chilton data set (for which there exists the longest continuous sequence of ionospheric data. This technique reveals strong regional variation in the data, which bears a striking similarity to the regional variation observed in long-term changes to the height of the ionospheric F2 layer. We argue that since both the height and peak density of the ionospheric F2 region are influenced by changes to thermospheric circulation and composition, the observed long-term and regional variability can be explained by such changes. In the absence of long-term measurements of thermospheric composition, detailed modelling work is required to investigate these processes.

Electronic properties and phase transitions in low-dimensional semiconductors

International Nuclear Information System (INIS)

Panich, A M

2008-01-01

We present the first review of the current state of the literature on electronic properties and phase transitions in TlX and TlMX 2 (M = Ga, In; X = Se, S, Te) compounds. These chalcogenides belong to a family of the low-dimensional semiconductors possessing chain or layered structure. They are of significant interest because of their highly anisotropic properties, semi- and photoconductivity, nonlinear effects in their I-V characteristics (including a region of negative differential resistance), switching and memory effects, second harmonic optical generation, relaxor behavior and potential applications for optoelectronic devices. We review the crystal structure of TlX and TlMX 2 compounds, their transport properties under ambient conditions, experimental and theoretical studies of the electronic structure, transport properties and semiconductor-metal phase transitions under high pressure, and sequences of temperature-induced structural phase transitions with intermediate incommensurate states. The electronic nature of the ferroelectric phase transitions in the above-mentioned compounds, as well as relaxor behavior, nanodomains and possible occurrence of quantum dots in doped and irradiated crystals is discussed. (topical review)

Region-wide and ecotype-specific differences in demographic histories of threespine stickleback populations, estimated from whole genome sequences.

Science.gov (United States)

Liu, Shenglin; Hansen, Michael M; Jacobsen, Magnus W

2016-10-01

We analysed 81 whole genome sequences of threespine sticklebacks from Pacific North America, Greenland and Northern Europe, representing 16 populations. Principal component analysis of nuclear SNPs grouped populations according to geographical location, with Pacific populations being more divergent from each other relative to European and Greenlandic populations. Analysis of mitogenome sequences showed Northern European populations to represent a single phylogeographical lineage, whereas Greenlandic and particularly Pacific populations showed admixture between lineages. We estimated demographic history using a genomewide coalescence with recombination approach. The Pacific populations showed gradual population expansion starting >100 Kya, possibly reflecting persistence in cryptic refuges near the present distributional range, although we do not rule out possible influence of ancient admixture. Sharp population declines ca. 14-15 Kya were suggested to reflect founding of freshwater populations by marine ancestors. In Greenland and Northern Europe, demographic expansion started ca. 20-25 Kya coinciding with the end of the Last Glacial Maximum. In both regions, marine and freshwater populations started to show different demographic trajectories ca. 8-9 Kya, suggesting that this was the time of recolonization. In Northern Europe, this estimate was surprisingly late, but found support in subfossil evidence for presence of several freshwater fish species but not sticklebacks 12 Kya. The results demonstrate distinctly different demographic histories across geographical regions with potential consequences for adaptive processes. They also provide empirical support for previous assumptions about freshwater populations being founded independently from large, coherent marine populations, a key element in the Transporter Hypothesis invoked to explain the widespread occurrence of parallel evolution across freshwater stickleback populations. © 2016 John Wiley & Sons Ltd.

Conservation patterns in different functional sequence categoriesof divergent Drosophila species

Energy Technology Data Exchange (ETDEWEB)

Papatsenko, Dmitri; Kislyuk, Andrey; Levine, Michael; Dubchak, Inna

2005-10-01

We have explored the distributions of fully conservedungapped blocks in genome-wide pairwise alignments of recently completedspecies of Drosophila: D.yakuba, D.ananassae, D.pseudoobscura, D.virilisand D.mojavensis. Based on these distributions we have found that nearlyevery functional sequence category possesses its own distinctiveconservation pattern, sometimes independent of the overall sequenceconservation level. In the coding and regulatory regions, the ungappedblocks were longer than in introns, UTRs and non-functional sequences. Atthe same time, the blocks in the coding regions carried 3N+2 signaturecharacteristic to synonymic substitutions in the 3rd codon positions.Larger block sizes in transcription regulatory regions can be explainedby the presence of conserved arrays of binding sites for transcriptionfactors. We also have shown that the longest ungapped blocks, or'ultraconserved' sequences, are associated with specific gene groups,including those encoding ion channels and components of the cytoskeleton.We discussed how restrained conservation patterns may help in mappingfunctional sequence categories and improving genomeannotation.

Seismic sequence stratigraphy and platform to basin reservoir structuring of Lower Cretaceous deposits in the Sidi Aïch-Majoura region (Central Tunisia)

Science.gov (United States)

Azaïez, Hajer; Bédir, Mourad; Tanfous, Dorra; Soussi, Mohamed

2007-05-01

In central Tunisia, Lower Cretaceous deposits represent carbonate and sandstone reservoir series that correspond to proven oil fields. The main problems for hydrocarbon exploration of these levels are their basin tectonic configuration and their sequence distribution in addition to the source rock availability. The Central Atlas of Tunisia is characterized by deep seated faults directed northeast-southwest, northwest-southeast and north-south. These faults limit inherited tectonic blocks and show intruded Triassic salt domes. Lower Cretaceous series outcropping in the region along the anticline flanks present platform deposits. The seismic interpretation has followed the Exxon methodologies in the 26th A.A.P.G. Memoir. The defined Lower Cretaceous seismic units were calibrated with petroleum well data and tied to stratigraphic sequences established by outcrop studies. This allows the subsurface identification of subsiding zones and thus sequence deposit distribution. Seismic mapping of these units boundary shows a structuring from a platform to basin blocks zones and helps to understand the hydrocarbon reservoir systems-tract and horizon distribution around these domains.

Whole-exome sequencing reveals genetic variants associated with chronic kidney disease characterized by tubulointerstitial damages in North Central Region, Sri Lanka.

Science.gov (United States)

Nanayakkara, Shanika; Senevirathna, S T M L D; Parahitiyawa, Nipuna B; Abeysekera, Tilak; Chandrajith, Rohana; Ratnatunga, Neelakanthi; Hitomi, Toshiaki; Kobayashi, Hatasu; Harada, Kouji H; Koizumi, Akio

2015-09-01

The familial clustering observed in chronic kidney disease of uncertain etiology (CKDu) characterized by tubulointerstitial damages in the North Central Region of Sri Lanka strongly suggests the involvement of genetic factors in its pathogenesis. The objective of the present study is to use whole-exome sequencing to identify the genetic variants associated with CKDu. Whole-exome sequencing of eight CKDu cases and eight controls was performed, followed by direct sequencing of candidate loci in 301 CKDu cases and 276 controls. Association study revealed rs34970857 (c.658G > A/p.V220M) located in the KCNA10 gene encoding a voltage-gated K channel as the most promising SNP with the highest odds ratio of 1.74. Four rare variants were identified in gene encoding Laminin beta2 (LAMB2) which is known to cause congenital nephrotic syndrome. Three out of four variants in LAMB2 were novel variants found exclusively in cases. Genetic investigations provide strong evidence on the presence of genetic susceptibility for CKDu. Possibility of presence of several rare variants associated with CKDu in this population is also suggested.

Image registration method for medical image sequences

Science.gov (United States)

Gee, Timothy F.; Goddard, James S.

2013-03-26

Image registration of low contrast image sequences is provided. In one aspect, a desired region of an image is automatically segmented and only the desired region is registered. Active contours and adaptive thresholding of intensity or edge information may be used to segment the desired regions. A transform function is defined to register the segmented region, and sub-pixel information may be determined using one or more interpolation methods.

The Complete Sequence of a Human Parainfluenzavirus 4 Genome

Science.gov (United States)

Yea, Carmen; Cheung, Rose; Collins, Carol; Adachi, Dena; Nishikawa, John; Tellier, Raymond

2009-01-01

Although the human parainfluenza virus 4 (HPIV4) has been known for a long time, its genome, alone among the human paramyxoviruses, has not been completely sequenced to date. In this study we obtained the first complete genomic sequence of HPIV4 from a clinical isolate named SKPIV4 obtained at the Hospital for Sick Children in Toronto (Ontario, Canada). The coding regions for the N, P/V, M, F and HN proteins show very high identities (95% to 97%) with previously available partial sequences for HPIV4B. The sequence for the L protein and the non-coding regions represent new information. A surprising feature of the genome is its length, more than 17 kb, making it the longest genome within the genus Rubulavirus, although the length is well within the known range of 15 kb to 19 kb for the subfamily Paramyxovirinae. The availability of a complete genomic sequence will facilitate investigations on a respiratory virus that is still not completely characterized. PMID:21994536

The Complete Sequence of a Human Parainfluenzavirus 4 Genome

Directory of Open Access Journals (Sweden)

Carmen Yea

2009-06-01

Full Text Available Although the human parainfluenza virus 4 (HPIV4 has been known for a long time, its genome, alone among the human paramyxoviruses, has not been completely sequenced to date. In this study we obtained the first complete genomic sequence of HPIV4 from a clinical isolate named SKPIV4 obtained at the Hospital for Sick Children in Toronto (Ontario, Canada. The coding regions for the N, P/V, M, F and HN proteins show very high identities (95% to 97% with previously available partial sequences for HPIV4B. The sequence for the L protein and the non-coding regions represent new information. A surprising feature of the genome is its length, more than 17 kb, making it the longest genome within the genus Rubulavirus, although the length is well within the known range of 15 kb to 19 kb for the subfamily Paramyxovirinae. The availability of a complete genomic sequence will facilitate investigations on a respiratory virus that is still not completely characterized.

Testing the existence of non-Maxwellian electron distributions in H II regions after assessing atomic data accuracy

Energy Technology Data Exchange (ETDEWEB)

Mendoza, C. [Permanent address: Centro de Física, Instituto Venezolano de Investigaciones Científicas (IVIC), P.O. Box 20632, Caracas 1020A, Venezuela. (Venezuela, Bolivarian Republic of); Bautista, M. A., E-mail: claudio.mendozaguardia@wmich.edu, E-mail: manuel.bautista@wmich.edu [Department of Physics, Western Michigan University, Kalamazoo, MI 49008 (United States)

2014-04-20

The classic optical nebular diagnostics [N II], [O II], [O III], [S II], [S III], and [Ar III] are employed to search for evidence of non-Maxwellian electron distributions, namely κ distributions, in a sample of well-observed Galactic H II regions. By computing new effective collision strengths for all these systems and A-values when necessary (e.g., S II), and by comparing with previous collisional and radiative data sets, we have been able to obtain realistic estimates of the electron-temperature dispersion caused by the atomic data, which in most cases are not larger than ∼10%. If the uncertainties due to both observation and atomic data are then taken into account, it is plausible to determine for some nebulae a representative average temperature while in others there are at least two plasma excitation regions. For the latter, it is found that the diagnostic temperature differences in the high-excitation region, e.g., T{sub e} (O III), T{sub e} (S III), and T{sub e} (Ar III), cannot be conciliated by invoking κ distributions. For the low-excitation region, it is possible in some, but not all, cases to arrive at a common, lower temperature for [N II], [O II], and [S II] with κ ≈ 10, which would then lead to significant abundance enhancements for these ions. An analytic formula is proposed to generate accurate κ-averaged excitation rate coefficients (better than 10% for κ ≥ 5) from temperature tabulations of the Maxwell-Boltzmann effective collision strengths.

The evolutionary rates of HCV estimated with subtype 1a and 1b sequences over the ORF length and in different genomic regions.

Directory of Open Access Journals (Sweden)

Manqiong Yuan

Full Text Available Considerable progress has been made in the HCV evolutionary analysis, since the software BEAST was released. However, prior information, especially the prior evolutionary rate, which plays a critical role in BEAST analysis, is always difficult to ascertain due to various uncertainties. Providing a proper prior HCV evolutionary rate is thus of great importance.176 full-length sequences of HCV subtype 1a and 144 of 1b were assembled by taking into consideration the balance of the sampling dates and the even dispersion in phylogenetic trees. According to the HCV genomic organization and biological functions, each dataset was partitioned into nine genomic regions and two routinely amplified regions. A uniform prior rate was applied to the BEAST analysis for each region and also the entire ORF. All the obtained posterior rates for 1a are of a magnitude of 10(-3 substitutions/site/year and in a bell-shaped distribution. Significantly lower rates were estimated for 1b and some of the rate distribution curves resulted in a one-sided truncation, particularly under the exponential model. This indicates that some of the rates for subtype 1b are less accurate, so they were adjusted by including more sequences to improve the temporal structure.Among the various HCV subtypes and genomic regions, the evolutionary patterns are dissimilar. Therefore, an applied estimation of the HCV epidemic history requires the proper selection of the rate priors, which should match the actual dataset so that they can fit for the subtype, the genomic region and even the length. By referencing the findings here, future evolutionary analysis of the HCV subtype 1a and 1b datasets may become more accurate and hence prove useful for tracing their patterns.

Should abdominal sequences be included in prostate cancer MR staging studies?

International Nuclear Information System (INIS)

McEvoy, S.H.; Lavelle, L.P.; Purcell, Y.M.; Quinlan, D.M.; Skehan, S.J.; Collins, C.D.; McMahon, C.J.

2015-01-01

Highlights: • ESUR guideline that abdominal MR sequences are reserved for high-risk prostate cancer is tested. • Routine abdominal sequences are of low yield in prostate cancer MR staging. • Routine abdominal staging sequences frequently result in incidental findings. • Abdominal staging sequences should be reserved for high-risk prostate cancer cases. - Abstract: Objectives: Prostate cancer staging MR examinations commonly include abdominal sequences to assess for non-regional (common iliac or para-aortic) nodal metastasis. In our experience the diagnostic yield of this is limited, but incidental findings are frequent, often necessitating further investigations. The aim of this study is to assess the diagnostic utility of abdominal sequences in routine prostate cancer MR staging studies. Methods: Findings on abdominal sequences of consecutive MRI prostate studies performed for staging newly diagnosed prostate cancer between September 2011 and September 2013 were reviewed with respect to adenopathy and additional incidental findings. Results were correlated with Gleason grade and serum prostate-specific antigen (PSA) level in each case. Results: 355 MRI prostate examinations were reviewed. 4 (1.1%) showed enlarged non-regional lymph nodes. Incidental findings were found in 82(23.1%) cases, neccessitating further investigation in 45 (12.7%) cases. Enlarged non-regional nodes were associated with higher PSA level and Gleason grade (p = 0.007, p = 0.005 respectively). With a combined threshold of PSA > 20 ng/mL and/or Gleason grade ≥8 the sensitivity, specificity, PPV and NPV were 100, 60, 3 and 100% respectively for predicting the presence of non-regional adenopathy. Conclusions: Routine abdominal sequences are of very low yield in routine prostate cancer MR staging, frequently resulting in incidental findings requiring further work-up and should be reserved for high-risk cases. Our experience supports the use of an abdominal staging sequence in high

Nanopore Sequencing as a Rapidly Deployable Ebola Outbreak Tool.

Science.gov (United States)

Hoenen, Thomas; Groseth, Allison; Rosenke, Kyle; Fischer, Robert J; Hoenen, Andreas; Judson, Seth D; Martellaro, Cynthia; Falzarano, Darryl; Marzi, Andrea; Squires, R Burke; Wollenberg, Kurt R; de Wit, Emmie; Prescott, Joseph; Safronetz, David; van Doremalen, Neeltje; Bushmaker, Trenton; Feldmann, Friederike; McNally, Kristin; Bolay, Fatorma K; Fields, Barry; Sealy, Tara; Rayfield, Mark; Nichol, Stuart T; Zoon, Kathryn C; Massaquoi, Moses; Munster, Vincent J; Feldmann, Heinz

2016-02-01

Rapid sequencing of RNA/DNA from pathogen samples obtained during disease outbreaks provides critical scientific and public health information. However, challenges exist for exporting samples to laboratories or establishing conventional sequencers in remote outbreak regions. We successfully used a novel, pocket-sized nanopore sequencer at a field diagnostic laboratory in Liberia during the current Ebola virus outbreak.

Comprehensive assessment of sequence variation within the copy number variable defensin cluster on 8p23 by target enriched in-depth 454 sequencing

Directory of Open Access Journals (Sweden)

Zhang Xinmin

2011-05-01

Full Text Available Abstract Background In highly copy number variable (CNV regions such as the human defensin gene locus, comprehensive assessment of sequence variations is challenging. PCR approaches are practically restricted to tiny fractions, and next-generation sequencing (NGS approaches of whole individual genomes e.g. by the 1000 Genomes Project is confined by an affordable sequence depth. Combining target enrichment with NGS may represent a feasible approach. Results As a proof of principle, we enriched a ~850 kb section comprising the CNV defensin gene cluster DEFB, the invariable DEFA part and 11 control regions from two genomes by sequence capture and sequenced it by 454 technology. 6,651 differences to the human reference genome were found. Comparison to HapMap genotypes revealed sensitivities and specificities in the range of 94% to 99% for the identification of variations. Using error probabilities for rigorous filtering revealed 2,886 unique single nucleotide variations (SNVs including 358 putative novel ones. DEFB CN determinations by haplotype ratios were in agreement with alternative methods. Conclusion Although currently labor extensive and having high costs, target enriched NGS provides a powerful tool for the comprehensive assessment of SNVs in highly polymorphic CNV regions of individual genomes. Furthermore, it reveals considerable amounts of putative novel variations and simultaneously allows CN estimation.

A method for atomic spectroscopy of highly charged ions in the Pm isoelectronic sequence

International Nuclear Information System (INIS)

Andersson, Oe.

1995-08-01

The aim was to search for alkali-like spectra in the Promethium isoelectronic sequence. Pb 22+ ions were produced by means of an ECR-ion source and accelerated towards a target of He gas. Colliding with He atoms the Pb 22+ ions are likely to capture an electron, thus forming an excited Pm-like ion (Pb 21+ ). A 2 m grazing-incidence spectrometer was used for recording the spectra arising as the accelerated ions impinge on the target. No lines were recorded throughout the wavelength region where the spectrometer is sensitive. Further experiments are needed to make clear if this is due to experimental errors or not. 14 refs, 8 figs

Variations of electron fluxes in the outer radiation belt near the boundary of a trapping region during substorms

International Nuclear Information System (INIS)

Ginzburg, E.A.; Malyshev, A.B.

1979-01-01

Variations of electron fluxes with the energy Esub(e) > 0.7 MeV have been investigated near the high-latitude boundary of electron trapping region in the night and day sections of the magnetosphere. It is found that during substorms the natural changes of the structure of electron fluxes take place. On the night side of the magnetosphere after the flux boundary drift to the equator at the preliminary phase, its sharp drift to the pole at the explosion phase takes place with further slow ( during 1-2 hours) shift to the initial position. The boundary position reconstruction period coincide by duration with the life time of negative bays at magnetograms of the night section stations. On the day side the boundary of electron fluxes recorded drifts to the pole in 30-60 min after the beginning of the substorm exposion phase. The results obtained are interpreted within the framework of the theory of adiabatic drift of trapped electrons and their pitch-angular diffusion under the effect of very low frequency waves

Complete nucleotide sequence and genome structure of a Japanese isolate of hibiscus latent Fort Pierce virus, a unique tobamovirus that contains an internal poly(A) region in its 3' end.

Science.gov (United States)

Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

2014-11-01

In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.

Genome sequence of the acid-tolerant Desulfovibrio sp. DV isolated from the sediments of a Pb-Zn mine tailings dam in the Chita region, Russia

Directory of Open Access Journals (Sweden)

Anastasiia Kovaliova

2017-03-01

Full Text Available Here we report the draft genome sequence of the acid-tolerant Desulfovibrio sp. DV isolated from the sediments of a Pb-Zn mine tailings dam in the Chita region, Russia. The draft genome has a size of 4.9 Mb and encodes multiple K+-transporters and proton-consuming decarboxylases. The phylogenetic analysis based on concatenated ribosomal proteins revealed that strain DV clusters together with the acid-tolerant Desulfovibrio sp. TomC and Desulfovibrio magneticus. The draft genome sequence and annotation have been deposited at GenBank under the accession number MLBG00000000.

Genomic sequencing and analyses of HearMNPV—a new Multinucleocapsid nucleopolyhedrovirus isolated from Helicoverpa armigera

Directory of Open Access Journals (Sweden)

Tang Ping

2012-08-01

Full Text Available Abstract Background HearMNPV, a nucleopolyhedrovirus (NPV, which infects the cotton bollworm, Helicoverpa armigera, comprises multiple rod-shaped nucleocapsids in virion(as detected by electron microscopy. HearMNPV shows a different host range compared with H. armigera single-nucleocapsid NPV (HearSNPV. To better understand HearMNPV, the HearMNPV genome was sequenced and analyzed. Methods The morphology of HearMNPV was observed by electron microscope. The qPCR was used to determine the replication kinetics of HearMNPV infectious for H. armigera in vivo. A random genomic library of HearMNPV was constructed according to the “partial filling-in” method, the sequence and organization of the HearMNPV genome was analyzed and compared with sequence data from other baculoviruses. Results Real time qPCR showed that HearMNPV DNA replication included a decreasing phase, latent phase, exponential phase, and a stationary phase during infection of H. armigera. The HearMNPV genome consists of 154,196 base pairs, with a G + C content of 40.07%. 162 putative ORFs were detected in the HearMNPV genome, which represented 90.16% of the genome. The remaining 9.84% constitute four homologous regions and other non-coding regions. The gene content and gene arrangement in HearMNPV were most similar to those of Mamestra configurata NPV-B (MacoNPV-B, but was different to HearSNPV. Comparison of the genome of HearMNPV and MacoNPV-B suggested that HearMNPV has a deletion of a 5.4-kb fragment containing five ORFs. In addition, HearMNPV orf66, bro genes, and hrs are different to the corresponding parts of the MacoNPV-B genome. Conclusions HearMNPV can replicate in vivo in H. armigera and in vitro, and is a new NPV isolate distinguished from HearSNPV. HearMNPV is most closely related to MacoNPV-B, but has a distinct genomic structure, content, and organization.

Syringe injectable electronics

Science.gov (United States)

Hong, Guosong; Zhou, Tao; Jin, Lihua; Duvvuri, Madhavi; Jiang, Zhe; Kruskal, Peter; Xie, Chong; Suo, Zhigang; Fang, Ying; Lieber, Charles M.

2015-01-01

Seamless and minimally-invasive three-dimensional (3D) interpenetration of electronics within artificial or natural structures could allow for continuous monitoring and manipulation of their properties. Flexible electronics provide a means for conforming electronics to non-planar surfaces, yet targeted delivery of flexible electronics to internal regions remains difficult. Here, we overcome this challenge by demonstrating syringe injection and subsequent unfolding of submicrometer-thick, centimeter-scale macroporous mesh electronics through needles with a diameter as small as 100 micrometers. Our results show that electronic components can be injected into man-made and biological cavities, as well as dense gels and tissue, with > 90% device yield. We demonstrate several applications of syringe injectable electronics as a general approach for interpenetrating flexible electronics with 3D structures, including (i) monitoring of internal mechanical strains in polymer cavities, (ii) tight integration and low chronic immunoreactivity with several distinct regions of the brain, and (iii) in vivo multiplexed neural recording. Moreover, syringe injection enables delivery of flexible electronics through a rigid shell, delivery of large volume flexible electronics that can fill internal cavities and co-injection of electronics with other materials into host structures, opening up unique applications for flexible electronics. PMID:26053995

Demonstrating the use of high-volume electronic medical claims data to monitor local and regional influenza activity in the US.

Directory of Open Access Journals (Sweden)

Cécile Viboud

Full Text Available Fine-grained influenza surveillance data are lacking in the US, hampering our ability to monitor disease spread at a local scale. Here we evaluate the performances of high-volume electronic medical claims data to assess local and regional influenza activity.We used electronic medical claims data compiled by IMS Health in 480 US locations to create weekly regional influenza-like-illness (ILI time series during 2003-2010. IMS Health captured 62% of US outpatient visits in 2009. We studied the performances of IMS-ILI indicators against reference influenza surveillance datasets, including CDC-ILI outpatient and laboratory-confirmed influenza data. We estimated correlation in weekly incidences, peak timing and seasonal intensity across datasets, stratified by 10 regions and four age groups (<5, 5-29, 30-59, and 60+ years. To test IMS-Health performances at the city level, we compared IMS-ILI indicators to syndromic surveillance data for New York City. We also used control data on laboratory-confirmed Respiratory Syncytial Virus (RSV activity to test the specificity of IMS-ILI for influenza surveillance.Regional IMS-ILI indicators were highly synchronous with CDC's reference influenza surveillance data (Pearson correlation coefficients rho≥0.89; range across regions, 0.80-0.97, P<0.001. Seasonal intensity estimates were weakly correlated across datasets in all age data (rho≤0.52, moderately correlated among adults (rho≥0.64 and uncorrelated among school-age children. IMS-ILI indicators were more correlated with reference influenza data than control RSV indicators (rho = 0.93 with influenza v. rho = 0.33 with RSV, P<0.05. City-level IMS-ILI indicators were highly consistent with reference syndromic data (rho≥0.86.Medical claims-based ILI indicators accurately capture weekly fluctuations in influenza activity in all US regions during inter-pandemic and pandemic seasons, and can be broken down by age groups and fine geographical areas

Sequence of a cDNA encoding turtle high mobility group 1 protein.

Science.gov (United States)

Zheng, Jifang; Hu, Bi; Wu, Duansheng

2005-07-01

In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.

Reconstructing Regional Ionospheric Electron Density: A Combined Spherical Slepian Function and Empirical Orthogonal Function Approach

Science.gov (United States)

Farzaneh, Saeed; Forootan, Ehsan

2018-03-01

The computerized ionospheric tomography is a method for imaging the Earth's ionosphere using a sounding technique and computing the slant total electron content (STEC) values from data of the global positioning system (GPS). The most common approach for ionospheric tomography is the voxel-based model, in which (1) the ionosphere is divided into voxels, (2) the STEC is then measured along (many) satellite signal paths, and finally (3) an inversion procedure is applied to reconstruct the electron density distribution of the ionosphere. In this study, a computationally efficient approach is introduced, which improves the inversion procedure of step 3. Our proposed method combines the empirical orthogonal function and the spherical Slepian base functions to describe the vertical and horizontal distribution of electron density, respectively. Thus, it can be applied on regional and global case studies. Numerical application is demonstrated using the ground-based GPS data over South America. Our results are validated against ionospheric tomography obtained from the constellation observing system for meteorology, ionosphere, and climate (COSMIC) observations and the global ionosphere map estimated by international centers, as well as by comparison with STEC derived from independent GPS stations. Using the proposed approach, we find that while using 30 GPS measurements in South America, one can achieve comparable accuracy with those from COSMIC data within the reported accuracy (1 × 1011 el/cm3) of the product. Comparisons with real observations of two GPS stations indicate an absolute difference is less than 2 TECU (where 1 total electron content unit, TECU, is 1016 electrons/m2).

Estimating the annotation error rate of curated GO database sequence annotations

Directory of Open Access Journals (Sweden)

Brown Alfred L

2007-05-01

Full Text Available Abstract Background Annotations that describe the function of sequences are enormously important to researchers during laboratory investigations and when making computational inferences. However, there has been little investigation into the data quality of sequence function annotations. Here we have developed a new method of estimating the error rate of curated sequence annotations, and applied this to the Gene Ontology (GO sequence database (GOSeqLite. This method involved artificially adding errors to sequence annotations at known rates, and used regression to model the impact on the precision of annotations based on BLAST matched sequences. Results We estimated the error rate of curated GO sequence annotations in the GOSeqLite database (March 2006 at between 28% and 30%. Annotations made without use of sequence similarity based methods (non-ISS had an estimated error rate of between 13% and 18%. Annotations made with the use of sequence similarity methodology (ISS had an estimated error rate of 49%. Conclusion While the overall error rate is reasonably low, it would be prudent to treat all ISS annotations with caution. Electronic annotators that use ISS annotations as the basis of predictions are likely to have higher false prediction rates, and for this reason designers of these systems should consider avoiding ISS annotations where possible. Electronic annotators that use ISS annotations to make predictions should be viewed sceptically. We recommend that curators thoroughly review ISS annotations before accepting them as valid. Overall, users of curated sequence annotations from the GO database should feel assured that they are using a comparatively high quality source of information.

Evaluation of automatic time gain compensated in-vivo ultrasound sequences

DEFF Research Database (Denmark)

Axelsen, Martin Christian; Røeboe, Kristian Frostholm; Hemmsen, Martin Christian

2010-01-01

algorithm for automatic time gain compensation (TGC) on in-vivo ultrasound sequences. Forty ultrasound sequences were recorded from the abdomen of two healthy volunteers. Each sequence of 5 sec was recorded with 40 frames/sec. Post processing each frame, a mask is created wherein anechoic and hyper echoic...... regions are mapped. Near field hyper intensity and deep areas with low signal strength are also included in the mask. The algorithm uses this mask to create a parallel image where anechoic and hyper echoic regions are eliminated. From this, the mean power is calculated as a function of depth. The power...

Improvement of photoneutron spectrum measurement produced by bombardment of 2 GeV electrons above giant dipole resonance region

International Nuclear Information System (INIS)

Lee, H. S.; Park, J. S.; Choi, H. D.; Sato, Tatsuhiko; Shin, Kasuo; Ban, Syuichi

2000-01-01

Above the Giant Dipole Resonance (GDR) region, high energy photoneutron spectra produced by irradiation of 2.04 GeV electrons into Pb target were measured by Time-of-Flight (TOF) technique. The differential photoneutron yields were obtained at a fixed angle of 90 degrees to the electron beam direction. The TOF system consists of Pilot-U plastic scintillation detector, which has fast response time, and the high speed multiscaler or CAMAC TDC. In the improvement of experimental setup to extend the flight distance to 10.4 m lead to make the measurable energy to 500 MeV from 300 MeV. And using the TDC based electronics lead to use a veto counter. The results were compared with the calculated one by using EGS4 and Modified PICA95. The characteristics of this TOF system was introduced in this paper and the results for several measuring conditions, which are flight distance, TOF electronics, and type of neutron detector, were discussed to improve the accuracy of this measurement

Local repeat sequence organization of an intergenic spacer

Indian Academy of Sciences (India)

The amplification yielded the same uniquely ``sequence-scrambled” product, whether the template used for PCR was total cellular DNA, chloroplast DNA or a plasmid clone DNA corresponding to that region. The PCR product, a ``unique” new sequence, had lost the repetitive organization of the template genome where it ...

Evolved H II regions

International Nuclear Information System (INIS)

Churchwell, E.

1975-01-01

A probable evolutionary sequence of H II regions based on six distinct types of observed objects is suggested. Two examples which may deviate from this idealized sequence, are discussed. Even though a size-mean density relation of H II regions can be used as a rough indication of whether a nebula is very young or evolved, it is argued that such a relation is not likely to be useful for the quantitative assignment of ages to H II regions. Evolved H II regions appear to fit into one of four structural types: rings, core-halos, smooth structures, and irregular or filamentary structures. Examples of each type are given with their derived physical parameters. The energy balance in these nebulae is considered. The mass of ionized gas in evolved H II regions is in general too large to trace the nebula back to single compact H II regions. Finally, the morphological type of the Galaxy is considered from its H II region content. 2 tables, 2 figs., 29 refs

Electron beam asymmetry measurements from exclusive pi0 electroproduction in the Delta(1232) resonance region

Energy Technology Data Exchange (ETDEWEB)

K. Joo

2003-05-01

The polarized longitudinal-transverse structure function sigma_LT'in the p(e,e'p)pi^0 reaction has been measured for the first time in the Delta(1232) resonance region for invariant mass W = 1.1 - 1.3 GeV and at four-momentum transfer Q^2 = 0.40 and 0.65 GeV^2. Data were taken at the Thomas Jefferson National Accelerator Facility with the CEBAF Large Acceptance Spectrometer (CLAS) using longitudinally polarized electrons at an energy of 1.515 GeV. This newly measured sigma_LT' provides new and unique information on the interference between resonant and non-resonant amplitudes in the Delta(1232) resonance region. The comparison to recent phenomenological calculations shows sensitivity to the description of non-resonant amplitudes and higher resonances.

Analysis of a new strain of Euphorbia mosaic virus with distinct replication specificity unveils a lineage of begomoviruses with short Rep sequences in the DNA-B intergenic region

Directory of Open Access Journals (Sweden)

Argüello-Astorga Gerardo R

2010-10-01

Full Text Available Abstract Background Euphorbia mosaic virus (EuMV is a member of the SLCV clade, a lineage of New World begomoviruses that display distinctive features in their replication-associated protein (Rep and virion-strand replication origin. The first entirely characterized EuMV isolate is native from Yucatan Peninsula, Mexico; subsequently, EuMV was detected in weeds and pepper plants from another region of Mexico, and partial DNA-A sequences revealed significant differences in their putative replication specificity determinants with respect to EuMV-YP. This study was aimed to investigate the replication compatibility between two EuMV isolates from the same country. Results A new isolate of EuMV was obtained from pepper plants collected at Jalisco, Mexico. Full-length clones of both genomic components of EuMV-Jal were biolistically inoculated into plants of three different species, which developed symptoms indistinguishable from those induced by EuMV-YP. Pseudorecombination experiments with EuMV-Jal and EuMV-YP genomic components demonstrated that these viruses do not form infectious reassortants in Nicotiana benthamiana, presumably because of Rep-iteron incompatibility. Sequence analysis of the EuMV-Jal DNA-B intergenic region (IR led to the unexpected discovery of a 35-nt-long sequence that is identical to a segment of the rep gene in the cognate viral DNA-A. Similar short rep sequences ranging from 35- to 51-nt in length were identified in all EuMV isolates and in three distinct viruses from South America related to EuMV. These short rep sequences in the DNA-B IR are positioned downstream to a ~160-nt non-coding domain highly similar to the CP promoter of begomoviruses belonging to the SLCV clade. Conclusions EuMV strains are not compatible in replication, indicating that this begomovirus species probably is not a replicating lineage in nature. The genomic analysis of EuMV-Jal led to the discovery of a subgroup of SLCV clade viruses that contain in

Genomic sequence around butterfly wing development genes: annotation and comparative analysis.

Directory of Open Access Journals (Sweden)

Inês C Conceição

Full Text Available BACKGROUND: Analysis of genomic sequence allows characterization of genome content and organization, and access beyond gene-coding regions for identification of functional elements. BAC libraries, where relatively large genomic regions are made readily available, are especially useful for species without a fully sequenced genome and can increase genomic coverage of phylogenetic and biological diversity. For example, no butterfly genome is yet available despite the unique genetic and biological properties of this group, such as diversified wing color patterns. The evolution and development of these patterns is being studied in a few target species, including Bicyclus anynana, where a whole-genome BAC library allows targeted access to large genomic regions. METHODOLOGY/PRINCIPAL FINDINGS: We characterize ∼1.3 Mb of genomic sequence around 11 selected genes expressed in B. anynana developing wings. Extensive manual curation of in silico predictions, also making use of a large dataset of expressed genes for this species, identified repetitive elements and protein coding sequence, and highlighted an expansion of Alcohol dehydrogenase genes. Comparative analysis with orthologous regions of the lepidopteran reference genome allowed assessment of conservation of fine-scale synteny (with detection of new inversions and translocations and of DNA sequence (with detection of high levels of conservation of non-coding regions around some, but not all, developmental genes. CONCLUSIONS: The general properties and organization of the available B. anynana genomic sequence are similar to the lepidopteran reference, despite the more than 140 MY divergence. Our results lay the groundwork for further studies of new interesting findings in relation to both coding and non-coding sequence: 1 the Alcohol dehydrogenase expansion with higher similarity between the five tandemly-repeated B. anynana paralogs than with the corresponding B. mori orthologs, and 2 the high

A preferred region for recombinational patch repair in the 5' untranslated region of primer binding site-impaired murine leukemia virus vectors

DEFF Research Database (Denmark)

Mikkelsen, J G; Lund, Anders Henrik; Kristensen, K D

1996-01-01

, suggesting the involvement of a specific endogenous virus-like sequence in patch repair rescue of the primer binding site mutants. The putative recombination partner RNA was found in virions from psi-2 cells as detected by analysis of glutamine tRNA-initiated cDNA and by sequence analysis of regions...... site to allow correct second-strand transfer in reverse transcription. The system thereby selects for a reverse transcriptase-mediated recombination event in the 5' untranslated region. A panel of sequence differences between the recombination partners in this region has allowed mapping of the site...

Study of energetic electrons in the outer radiation-belt regions using data obtained by the LLL spectrometer on OGO-5 in 1968

International Nuclear Information System (INIS)

West, H.I. Jr.; Buck, R.M.; Davidson, G.

1979-01-01

An account is given of measurements of electrons made by the LLL magnetic electron spectrometer (60 to 3000 keV in seven differential energy channels) on the Ogo-5 satellite in the earth's outer-belt regions during 1968 and early 1969. The data were analyzed specifically to determine pitch-angle diffusion lifetimes as a function of energy in the L-range 2 to 5. As a part of this effort, the general dynamics of these regions were studied in terms of the time-dependent energy spectra, and pitch-angle distributions for the seven energy groups were obtained as a function of L with representative values presented for L = 2.5 to 6. The pitch-angle-diffusion results were used to analyze the dynamics of the electrons injected following the intense storms on October 31 and November 1, 1968, in terms of radial diffusion; the derived diffusion coefficients provide a quite reasonable picture of electron transport in the radiation belts. Both the radial- and pitch-angle-diffusion results are compared with earlier results. 53 references

A gene-based high-resolution comparative radiation hybrid map as a framework for genome sequence assembly of a bovine chromosome 6 region associated with QTL for growth, body composition, and milk performance traits

Directory of Open Access Journals (Sweden)

Laurent Pascal

2006-03-01

Full Text Available Abstract Background A number of different quantitative trait loci (QTL for various phenotypic traits, including milk production, functional, and conformation traits in dairy cattle as well as growth and body composition traits in meat cattle, have been mapped consistently in the middle region of bovine chromosome 6 (BTA6. Dense genetic and physical maps and, ultimately, a fully annotated genome sequence as well as their mutual connections are required to efficiently identify genes and gene variants responsible for genetic variation of phenotypic traits. A comprehensive high-resolution gene-rich map linking densely spaced bovine markers and genes to the annotated human genome sequence is required as a framework to facilitate this approach for the region on BTA6 carrying the QTL. Results Therefore, we constructed a high-resolution radiation hybrid (RH map for the QTL containing chromosomal region of BTA6. This new RH map with a total of 234 loci including 115 genes and ESTs displays a substantial increase in loci density compared to existing physical BTA6 maps. Screening the available bovine genome sequence resources, a total of 73 loci could be assigned to sequence contigs, which were already identified as specific for BTA6. For 43 loci, corresponding sequence contigs, which were not yet placed on the bovine genome assembly, were identified. In addition, the improved potential of this high-resolution RH map for BTA6 with respect to comparative mapping was demonstrated. Mapping a large number of genes on BTA6 and cross-referencing them with map locations in corresponding syntenic multi-species chromosome segments (human, mouse, rat, dog, chicken achieved a refined accurate alignment of conserved segments and evolutionary breakpoints across the species included. Conclusion The gene-anchored high-resolution RH map (1 locus/300 kb for the targeted region of BTA6 presented here will provide a valuable platform to guide high-quality assembling and

Linkage disequilibrium of evolutionarily conserved regions in the human genome

Directory of Open Access Journals (Sweden)

Johnson Todd A

2006-12-01

Full Text Available Abstract Background The strong linkage disequilibrium (LD recently found in genic or exonic regions of the human genome demonstrated that LD can be increased by evolutionary mechanisms that select for functionally important loci. This suggests that LD might be stronger in regions conserved among species than in non-conserved regions, since regions exposed to natural selection tend to be conserved. To assess this hypothesis, we used genome-wide polymorphism data from the HapMap project and investigated LD within DNA sequences conserved between the human and mouse genomes. Results Unexpectedly, we observed that LD was significantly weaker in conserved regions than in non-conserved regions. To investigate why, we examined sequence features that may distort the relationship between LD and conserved regions. We found that interspersed repeats, and not other sequence features, were associated with the weak LD tendency in conserved regions. To appropriately understand the relationship between LD and conserved regions, we removed the effect of repetitive elements and found that the high degree of sequence conservation was strongly associated with strong LD in coding regions but not with that in non-coding regions. Conclusion Our work demonstrates that the degree of sequence conservation does not simply increase LD as predicted by the hypothesis. Rather, it implies that purifying selection changes the polymorphic patterns of coding sequences but has little influence on the patterns of functional units such as regulatory elements present in non-coding regions, since the former are generally restricted by the constraint of maintaining a functional protein product across multiple exons while the latter may exist more as individually isolated units.

The Regulation Of Electronic Money Institutions In The SADC Region: Some Lessons From The EU

Directory of Open Access Journals (Sweden)

Mmaphuti David Tuba

2014-12-01

Full Text Available This article analyses the different approaches adopted for the regulation of payment systems in a variety of legislative instruments by the European Union (EU. It looks in particular at how the institutions that issue new electronic money products are regulated and supervised by the relevant authorities in the EU, in comparison with existing institutions such as banks. It analyses some of the lessons that may be learned by the South African Development Corporation (SADC from the regulatory approaches for electronic money institutions adopted by the EU. The article asks if the approach adopted by the EU may be useful for the future regulation of electronic money institutions in the SADC. The proliferation of electronic devices that arrived with the invention of the Internet has sparked some regulatory challenges. This development has become global and involves both developed and developing countries, including regions such as the SADC. It is asked if these technological developments should be addressed by means of a concrete regulatory framework while they continue to develop, instead of the regulators waiting to observe and acquaint themselves with the relevant regulatory challenges that underpin the innovations. The EU has attempted to address the anticipated regulatory challenges that came about with the development of electronic money and to align its regulatory approach with other payment systems. This article discusses the regulatory approaches adopted in the EU and provides an overview that the SADC may use in order to adopt an effective regulatory framework for electronic money and the institutions that issue these methods of payment. It analyses both the achievements and the challenges that the EU faced (and continues to face in developing the regulation of e-money, and recommends some possible approaches derived from the lessons learned.

Simulation of electron density disturbances of the ionospheric D region produced by high-energy particle fluxes

International Nuclear Information System (INIS)

Martynenko, S.I.

1989-01-01

Using the large-scale tim expansion analytical solutions of electron concentration balance equation in D-region of the ionosphere for pulsed and periodic changes in the rate of ion formatin under the effect of fluxes of precipitating high-energy particles are obtained. Possible effect of disturbances of temperature of nutrals is taken into account. On the basis of model representations the space-time structure of emerging ionospheric disturbances is discussed

A software pipeline for processing and identification of fungal ITS sequences

Directory of Open Access Journals (Sweden)

Kristiansson Erik

2009-01-01

Full Text Available Abstract Background Fungi from environmental samples are typically identified to species level through DNA sequencing of the nuclear ribosomal internal transcribed spacer (ITS region for use in BLAST-based similarity searches in the International Nucleotide Sequence Databases. These searches are time-consuming and regularly require a significant amount of manual intervention and complementary analyses. We here present software – in the form of an identification pipeline for large sets of fungal ITS sequences – developed to automate the BLAST process and several additional analysis steps. The performance of the pipeline was evaluated on a dataset of 350 ITS sequences from fungi growing as epiphytes on building material. Results The pipeline was written in Perl and uses a local installation of NCBI-BLAST for the similarity searches of the query sequences. The variable subregion ITS2 of the ITS region is extracted from the sequences and used for additional searches of higher sensitivity. Multiple alignments of each query sequence and its closest matches are computed, and query sequences sharing at least 50% of their best matches are clustered to facilitate the evaluation of hypothetically conspecific groups. The pipeline proved to speed up the processing, as well as enhance the resolution, of the evaluation dataset considerably, and the fungi were found to belong chiefly to the Ascomycota, with Penicillium and Aspergillus as the two most common genera. The ITS2 was found to indicate a different taxonomic affiliation than did the complete ITS region for 10% of the query sequences, though this figure is likely to vary with the taxonomic scope of the query sequences. Conclusion The present software readily assigns large sets of fungal query sequences to their respective best matches in the international sequence databases and places them in a larger biological context. The output is highly structured to be easy to process, although it still needs

Experimental white piedra: a robust approach to ultrastructural analysis, scanning electron microscopy and etiological discoveries.

Science.gov (United States)

Inácio, Cicero P; Rocha, Ana Paula S; Barbosa, Renan do N; Oliveira, Neiva T; Silva, Josineide C; de Lima-Neto, Reginaldo G; Macêdo, Danielle Patrícia C; Neves, Rejane P

2016-01-01

White piedra is a fungal infection characterized by nodules comprised of Trichosporon species and restricted to the extrafollicular portion of the hair shaft. The diagnosis is based on clinical and mycological characteristics, and must be confirmed with a precise identification of the etiological agent. This research aimed to develop an in vitro infection model of white piedra and analyze its morphological and ultra-structural aspects. In the process, hair infection was induced using eight isolates of the genus Trichosporon maintained in the Culture Collection Micoteca URM. The ITS and IGS1 regions were sequenced for taxonomic confirmation. Scanning Electron Microscope (SEM) was performed at the Strategic Center for Northeast Technologies (CETENE). The scanning electron microscope was equipped with an Energy Dispersion Spectrometer (EDS). The Trichosporon isolates were identified as Trichosporon asahii (6) and Trichosporon montevideense (2) by internal transcript spacer (ITS) region and intergenic spacer 1 region (IGS1) sequencing. All eight strains were used to induce the in vitro hair infection, and nodules formed after the incubation period. Temperature variations and high humidity were not observed to be related to the development of this hair disease. The main chemical constituents detected in the nodules were carbon, nitrogen and oxygen, as well as a low level of sulfur. The absence of calcium, combined with the low level of sulfur, might explain the soft nature of the white piedra nodules. This study demonstrated that several Trichosporon species may be responsible for causing white piedra. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Is the extraction by Whatman FTA filter matrix technology and sequencing of large ribosomal subunit D1-D2 region sufficient for identification of clinical fungi?

Science.gov (United States)

Kiraz, Nuri; Oz, Yasemin; Aslan, Huseyin; Erturan, Zayre; Ener, Beyza; Akdagli, Sevtap Arikan; Muslumanoglu, Hamza; Cetinkaya, Zafer

2015-10-01

Although conventional identification of pathogenic fungi is based on the combination of tests evaluating their morphological and biochemical characteristics, they can fail to identify the less common species or the differentiation of closely related species. In addition these tests are time consuming, labour-intensive and require experienced personnel. We evaluated the feasibility and sufficiency of DNA extraction by Whatman FTA filter matrix technology and DNA sequencing of D1-D2 region of the large ribosomal subunit gene for identification of clinical isolates of 21 yeast and 160 moulds in our clinical mycology laboratory. While the yeast isolates were identified at species level with 100% homology, 102 (63.75%) clinically important mould isolates were identified at species level, 56 (35%) isolates at genus level against fungal sequences existing in DNA databases and two (1.25%) isolates could not be identified. Consequently, Whatman FTA filter matrix technology was a useful method for extraction of fungal DNA; extremely rapid, practical and successful. Sequence analysis strategy of D1-D2 region of the large ribosomal subunit gene was found considerably sufficient in identification to genus level for the most clinical fungi. However, the identification to species level and especially discrimination of closely related species may require additional analysis. © 2015 Blackwell Verlag GmbH.

Critical frequency and maximum electron density of F2 region over four stations in the North American sector

Czech Academy of Sciences Publication Activity Database

Ezquer, R. G.; Cabrera, M. A.; López, J. L.; Albornoz, M. R.; Mosert, M.; Marcó, P.; Burešová, Dalia

2011-01-01

Roč. 73, č. 4 (2011), s. 420-429 ISSN 1364-6826 Institutional research plan: CEZ:AV0Z30420517 Keywords : Ionosphere * F2 region * Critical frequency * Electron density * Model Subject RIV: DG - Athmosphere Sciences, Meteorology Impact factor: 1.596, year: 2011 http://www.sciencedirect.com/science/article/pii/S1364682610002786

Localization of Daucus carota NMCP1 to the nuclear periphery: the role of the N-terminal region and an NLS-linked sequence motif, RYNLRR, in the tail domain

Directory of Open Access Journals (Sweden)

Yuta eKimura

2014-02-01

Full Text Available Recent ultrastructural studies revealed that a structure similar to the vertebrate nuclear lamina exists in the nuclei of higher plants. However, plant genomes lack genes for lamins and intermediate-type filament proteins, and this suggests that plant-specific nuclear coiled-coil proteins make up the lamina-like structure in plants. NMCP1 is a protein, first identified in Daucus carota cells, that localizes exclusively to the nuclear periphery in interphase cells. It has a tripartite structure comprised of head, rod, and tail domains, and includes putative nuclear localization signal (NLS motifs. We identified the functional NLS of DcNMCP1 (carrot NMCP1 and determined the protein regions required for localizing to the nuclear periphery using EGFP-fused constructs transiently expressed in Apium graveolens epidermal cells. Transcription was driven under a CaMV35S promoter, and the genes were introduced into the epidermal cells by a DNA-coated microprojectile delivery system. Of the NLS motifs, KRRRK and RRHK in the tail domain were highly functional for nuclear localization. Addition of the N-terminal 141 amino acids from DcNMCP1 shifted the localization of a region including these NLSs from the entire nucleus to the nuclear periphery. Using this same construct, the replacement of amino acids in RRHK or its preceding sequence, YNL, with alanine residues abolished localization to the nuclear periphery, while replacement of KRRRK did not affect localization. The sequence R/Q/HYNLRR/H, including YNL and the first part of the sequence of RRHK, is evolutionarily conserved in a subclass of NMCP1 sequences from many plant species. These results show that NMCP1 localizes to the nuclear periphery by a combined action of a sequence composed of R/Q/HYNLRR/H, NLS, and the N-terminal region including the head and a portion of the rod domain, suggesting that more than one binding site is implicated in localization of NMCP1.

Pairwise local structural alignment of RNA sequences with sequence similarity less than 40%

DEFF Research Database (Denmark)

Havgaard, Jakob Hull; Lyngsø, Rune B.; Stormo, Gary D.

2005-01-01

detect two genes with low sequence similarity, where the genes are part of a larger genomic region. Results: Here we present such an approach for pairwise local alignment which is based on FILDALIGN and the Sankoff algorithm for simultaneous structural alignment of multiple sequences. We include...... the ability to conduct mutual scans of two sequences of arbitrary length while searching for common local structural motifs of some maximum length. This drastically reduces the complexity of the algorithm. The scoring scheme includes structural parameters corresponding to those available for free energy....... The structure prediction performance for a family is typically around 0.7 using Matthews correlation coefficient. In case (2), the algorithm is successful at locating RNA families with an average sensitivity of 0.8 and a positive predictive value of 0.9 using a BLAST-like hit selection scheme. Availability...

Analysis of the effect of the Electron-Beam welding sequence for a fixed manufacturing route using finite element simulations applied to ITER vacuum vessel manufacture

Energy Technology Data Exchange (ETDEWEB)

Martín-Menéndez, Cristina, E-mail: cristina@natec-ingenieros.com [Numerical Analysis Technologies, S.L. Marqués de San Esteban No. 52, 33206 Gijón (Spain); Rodríguez, Eduardo [Department of Mechanical Engineering, University of Oviedo, Campus de Gijón, 33203 Gijón (Spain); Ottolini, Marco [Ansaldo Nucleare S.p.A., Corso Perrone 25, 16152 Genova (Italy); Caixas, Joan [F4E, c/Josep Pla, n.2, Torres Diagonal Litoral, Edificio B3, E-08019 Barcelona (Spain); Guirao, Julio [Numerical Analysis Technologies, S.L. Marqués de San Esteban No. 52, 33206 Gijón (Spain)

2016-03-15

Highlights: • The simulation methodology employed in this paper is able to adapt inside a complex manufacturing route. • The effect of the sequence is lower in a highly constrained assembly than in a lowly constrained one. • The most relevant influence on the distortions is the jigs design, instead of the welding sequence. • The welding distortion analysis should be used as a guidance to design and improve the manufacturing strategy. - Abstract: The ITER Vacuum Vessel Sectors have very tight tolerances and high density of welding. Therefore, prediction and reduction of welding distortion are critical to allow the final assembly with the other Vacuum Vessel Sectors without the production of a full scale prototype. In this paper, the effect of the welding sequence in the distortions inside a fixed manufacturing route and in a highly constrained assembly is studied in the poloidal segment named inboard (PS1). This is one of the four poloidal segments (PS) assembled for the sector. Moreover, some restrictions and limitations in the welding sequence related to the manufacturing process are explained. The results obtained show that the effect of the sequence is lower in a highly constrained assembly than in a low constrained one. A prototype manufactured by AMW consortium (PS1 mock-up) is used in order to validate the finite element method welding simulation employed. The obtained results confirmed that for Electron-Beam welds, both the welding simulation and the mock-up show a low value of distortions.

WildSpan: mining structured motifs from protein sequences

Directory of Open Access Journals (Sweden)

Chen Chien-Yu

2011-03-01

Full Text Available Abstract Background Automatic extraction of motifs from biological sequences is an important research problem in study of molecular biology. For proteins, it is desired to discover sequence motifs containing a large number of wildcard symbols, as the residues associated with functional sites are usually largely separated in sequences. Discovering such patterns is time-consuming because abundant combinations exist when long gaps (a gap consists of one or more successive wildcards are considered. Mining algorithms often employ constraints to narrow down the search space in order to increase efficiency. However, improper constraint models might degrade the sensitivity and specificity of the motifs discovered by computational methods. We previously proposed a new constraint model to handle large wildcard regions for discovering functional motifs of proteins. The patterns that satisfy the proposed constraint model are called W-patterns. A W-pattern is a structured motif that groups motif symbols into pattern blocks interleaved with large irregular gaps. Considering large gaps reflects the fact that functional residues are not always from a single region of protein sequences, and restricting motif symbols into clusters corresponds to the observation that short motifs are frequently present within protein families. To efficiently discover W-patterns for large-scale sequence annotation and function prediction, this paper first formally introduces the problem to solve and proposes an algorithm named WildSpan (sequential pattern mining across large wildcard regions that incorporates several pruning strategies to largely reduce the mining cost. Results WildSpan is shown to efficiently find W-patterns containing conserved residues that are far separated in sequences. We conducted experiments with two mining strategies, protein-based and family-based mining, to evaluate the usefulness of W-patterns and performance of WildSpan. The protein-based mining mode

Association of Amine-Receptor DNA Sequence Variants with Associative Learning in the Honeybee.

Science.gov (United States)

Lagisz, Malgorzata; Mercer, Alison R; de Mouzon, Charlotte; Santos, Luana L S; Nakagawa, Shinichi

2016-03-01

Octopamine- and dopamine-based neuromodulatory systems play a critical role in learning and learning-related behaviour in insects. To further our understanding of these systems and resulting phenotypes, we quantified DNA sequence variations at six loci coding octopamine-and dopamine-receptors and their association with aversive and appetitive learning traits in a population of honeybees. We identified 79 polymorphic sequence markers (mostly SNPs and a few insertions/deletions) located within or close to six candidate genes. Intriguingly, we found that levels of sequence variation in the protein-coding regions studied were low, indicating that sequence variation in the coding regions of receptor genes critical to learning and memory is strongly selected against. Non-coding and upstream regions of the same genes, however, were less conserved and sequence variations in these regions were weakly associated with between-individual differences in learning-related traits. While these associations do not directly imply a specific molecular mechanism, they suggest that the cross-talk between dopamine and octopamine signalling pathways may influence olfactory learning and memory in the honeybee.

Always look on both sides: phylogenetic information conveyed by simple sequence repeat allele sequences.

Directory of Open Access Journals (Sweden)

Stéphanie Barthe

Full Text Available Simple sequence repeat (SSR markers are widely used tools for inferences about genetic diversity, phylogeography and spatial genetic structure. Their applications assume that variation among alleles is essentially caused by an expansion or contraction of the number of repeats and that, accessorily, mutations in the target sequences follow the stepwise mutation model (SMM. Generally speaking, PCR amplicon sizes are used as direct indicators of the number of SSR repeats composing an allele with the data analysis either ignoring the extent of allele size differences or assuming that there is a direct correlation between differences in amplicon size and evolutionary distance. However, without precisely knowing the kind and distribution of polymorphism within an allele (SSR and the associated flanking region (FR sequences, it is hard to say what kind of evolutionary message is conveyed by such a synthetic descriptor of polymorphism as DNA amplicon size. In this study, we sequenced several SSR alleles in multiple populations of three divergent tree genera and disentangled the types of polymorphisms contained in each portion of the DNA amplicon containing an SSR. The patterns of diversity provided by amplicon size variation, SSR variation itself, insertions/deletions (indels, and single nucleotide polymorphisms (SNPs observed in the FRs were compared. Amplicon size variation largely reflected SSR repeat number. The amount of variation was as large in FRs as in the SSR itself. The former contributed significantly to the phylogenetic information and sometimes was the main source of differentiation among individuals and populations contained by FR and SSR regions of SSR markers. The presence of mutations occurring at different rates within a marker's sequence offers the opportunity to analyse evolutionary events occurring on various timescales, but at the same time calls for caution in the interpretation of SSR marker data when the distribution of within