WorldWideScience

Sample records for recombination dependent dna

  1. Cre-dependent DNA recombination activates a STING-dependent innate immune response

    Science.gov (United States)

    Pépin, Geneviève; Ferrand, Jonathan; Höning, Klara; Jayasekara, W. Samantha N.; Cain, Jason E.; Behlke, Mark A.; Gough, Daniel J.; G. Williams, Bryan R.; Hornung, Veit

    2016-01-01

    Abstract Gene-recombinase technologies, such as Cre/loxP-mediated DNA recombination, are important tools in the study of gene function, but have potential side effects due to damaging activity on DNA. Here we show that DNA recombination by Cre instigates a robust antiviral response in mammalian cells, independent of legitimate loxP recombination. This is due to the recruitment of the cytosolic DNA sensor STING, concurrent with Cre-dependent DNA damage and the accumulation of cytoplasmic DNA. Importantly, we establish a direct interplay between this antiviral response and cell–cell interactions, indicating that low cell densities in vitro could be useful to help mitigate these effects of Cre. Taking into account the wide range of interferon stimulated genes that may be induced by the STING pathway, these results have broad implications in fields such as immunology, cancer biology, metabolism and stem cell research. Further, this study sets a precedent in the field of gene-engineering, possibly applicable to other enzymatic-based genome editing technologies. PMID:27166376

  2. Promotion of BRCA2-Dependent Homologous Recombination by DSS1 via RPA Targeting and DNA Mimicry.

    Science.gov (United States)

    Zhao, Weixing; Vaithiyalingam, Sivaraja; San Filippo, Joseph; Maranon, David G; Jimenez-Sainz, Judit; Fontenay, Gerald V; Kwon, Youngho; Leung, Stanley G; Lu, Lucy; Jensen, Ryan B; Chazin, Walter J; Wiese, Claudia; Sung, Patrick

    2015-07-16

    The tumor suppressor BRCA2 is thought to facilitate the handoff of ssDNA from replication protein A (RPA) to the RAD51 recombinase during DNA break and replication fork repair by homologous recombination. However, we find that RPA-RAD51 exchange requires the BRCA2 partner DSS1. Biochemical, structural, and in vivo analyses reveal that DSS1 allows the BRCA2-DSS1 complex to physically and functionally interact with RPA. Mechanistically, DSS1 acts as a DNA mimic to attenuate the affinity of RPA for ssDNA. A mutation in the solvent-exposed acidic domain of DSS1 compromises the efficacy of RPA-RAD51 exchange. Thus, by targeting RPA and mimicking DNA, DSS1 functions with BRCA2 in a two-component homologous recombination mediator complex in genome maintenance and tumor suppression. Our findings may provide a paradigm for understanding the roles of DSS1 in other biological processes. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Functional intersection of ATM and DNA-dependent protein kinase catalytic subunit in coding end joining during V(D)J recombination

    DEFF Research Database (Denmark)

    Lee, Baeck-Seung; Gapud, Eric J; Zhang, Shichuan

    2013-01-01

    V(D)J recombination is initiated by the RAG endonuclease, which introduces DNA double-strand breaks (DSBs) at the border between two recombining gene segments, generating two hairpin-sealed coding ends and two blunt signal ends. ATM and DNA-dependent protein kinase catalytic subunit (DNA-PKcs) ar......V(D)J recombination is initiated by the RAG endonuclease, which introduces DNA double-strand breaks (DSBs) at the border between two recombining gene segments, generating two hairpin-sealed coding ends and two blunt signal ends. ATM and DNA-dependent protein kinase catalytic subunit (DNA......-PKcs) are serine-threonine kinases that orchestrate the cellular responses to DNA DSBs. During V(D)J recombination, ATM and DNA-PKcs have unique functions in the repair of coding DNA ends. ATM deficiency leads to instability of postcleavage complexes and the loss of coding ends from these complexes. DNA...... when ATM is present and its kinase activity is intact. The ability of ATM to compensate for DNA-PKcs kinase activity depends on the integrity of three threonines in DNA-PKcs that are phosphorylation targets of ATM, suggesting that ATM can modulate DNA-PKcs activity through direct phosphorylation of DNA...

  4. Bacteriophage T5 encodes a homolog of the eukaryotic transcription coactivator PC4 implicated in recombination-dependent DNA replication.

    Science.gov (United States)

    Steigemann, Birthe; Schulz, Annina; Werten, Sebastiaan

    2013-11-15

    The RNA polymerase II cofactor PC4 globally regulates transcription of protein-encoding genes through interactions with unwinding DNA, the basal transcription machinery and transcription activators. Here, we report the surprising identification of PC4 homologs in all sequenced representatives of the T5 family of bacteriophages, as well as in an archaeon and seven phyla of eubacteria. We have solved the crystal structure of the full-length T5 protein at 1.9Å, revealing a striking resemblance to the characteristic single-stranded DNA (ssDNA)-binding core domain of PC4. Intriguing novel structural features include a potential regulatory region at the N-terminus and a C-terminal extension of the homodimerisation interface. The genome organisation of T5-related bacteriophages points at involvement of the PC4 homolog in recombination-dependent DNA replication, strongly suggesting that the protein corresponds to the hitherto elusive replicative ssDNA-binding protein of the T5 family. Our findings imply that PC4-like factors intervene in multiple unwinding-related processes by acting as versatile modifiers of nucleic acid conformation and raise the possibility that the eukaryotic transcription coactivator derives from ancestral DNA replication, recombination and repair factors. © 2013.

  5. Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

    Science.gov (United States)

    Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

    2018-01-01

    Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion

  6. Recent advances in DNA repair and recombination.

    Science.gov (United States)

    Iwanejko, L A; Jones, N J

    1998-09-11

    The subjects of the talks at this 1-day DNA Repair Network meeting, held at City University, London on December 15, 1997, encompassed a range of topics and reflected some of the current areas of research in the United Kingdom. Topics included DNA double-strand break repair, V(D)J recombination, DNA ligases, the RecQ family of helicases and Bloom's syndrome, UVB and immunosuppression, the repair of oxidative damage and mismatch repair mechanisms.

  7. Single Molecule Study of DNA Organization and Recombination

    Science.gov (United States)

    Xiao, Botao

    We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force

  8. Transcription and recombination: when RNA meets DNA.

    Science.gov (United States)

    Aguilera, Andrés; Gaillard, Hélène

    2014-08-01

    A particularly relevant phenomenon in cell physiology and proliferation is the fact that spontaneous mitotic recombination is strongly enhanced by transcription. The most accepted view is that transcription increases the occurrence of double-strand breaks and/or single-stranded DNA gaps that are repaired by recombination. Most breaks would arise as a consequence of the impact that transcription has on replication fork progression, provoking its stalling and/or breakage. Here, we discuss the mechanisms responsible for the cross talk between transcription and recombination, with emphasis on (1) the transcription-replication conflicts as the main source of recombinogenic DNA breaks, and (2) the formation of cotranscriptional R-loops as a major cause of such breaks. The new emerging questions and perspectives are discussed on the basis of the interference between transcription and replication, as well as the way RNA influences genome dynamics. Copyright © 2014 Cold Spring Harbor Laboratory Press; all rights reserved.

  9. RecO protein initiates DNA recombination and strand annealing through two alternative DNA binding mechanisms.

    Science.gov (United States)

    Ryzhikov, Mikhail; Gupta, Richa; Glickman, Michael; Korolev, Sergey

    2014-10-17

    Recombination mediator proteins (RMPs) are important for genome stability in all organisms. Several RMPs support two alternative reactions: initiation of homologous recombination and DNA annealing. We examined mechanisms of RMPs in both reactions with Mycobacterium smegmatis RecO (MsRecO) and demonstrated that MsRecO interacts with ssDNA by two distinct mechanisms. Zinc stimulates MsRecO binding to ssDNA during annealing, whereas the recombination function is zinc-independent and is regulated by interaction with MsRecR. Thus, different structural motifs or conformations of MsRecO are responsible for interaction with ssDNA during annealing and recombination. Neither annealing nor recombinase loading depends on MsRecO interaction with the conserved C-terminal tail of single-stranded (ss) DNA-binding protein (SSB), which is known to bind Escherichia coli RecO. However, similarly to E. coli proteins, MsRecO and MsRecOR do not dismiss SSB from ssDNA, suggesting that RMPs form a complex with SSB-ssDNA even in the absence of binding to the major protein interaction motif. We propose that alternative conformations of such complexes define the mechanism by which RMPs initiate the repair of stalled replication and support two different functions during recombinational repair of DNA breaks. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Recombinant DNA. Rifkin's regulatory revivalism runs riot.

    Science.gov (United States)

    David, P

    Jeremy Rifkin, activist opponent of genetic engineering, has adopted tactics of litigation, persuasion, and confrontation in his campaign to halt genetic experimentation. The Recombinant DNA Advisory Committee of the National Institutes of Health has often been the target of his criticism, most recently for its failure to prepare an environmental risk assessment for some DNA tests it approved. Rifkin has won support for his position from religious organizations in the United States, and in June 1983 persuaded an ecumenical group of religious leaders to ask Congress to ban genetic experiments that would affect the human germ line.

  11. Prevention of DNA Rereplication Through a Meiotic Recombination Checkpoint Response

    Directory of Open Access Journals (Sweden)

    Nicole A. Najor

    2016-12-01

    Full Text Available In the budding yeast Saccharomyces cerevisiae, unnatural stabilization of the cyclin-dependent kinase inhibitor Sic1 during meiosis can trigger extra rounds of DNA replication. When programmed DNA double-strand breaks (DSBs are generated but not repaired due to absence of DMC1, a pathway involving the checkpoint gene RAD17 prevents this DNA rereplication. Further genetic analysis has now revealed that prevention of DNA rereplication also requires MEC1, which encodes a protein kinase that serves as a central checkpoint regulator in several pathways including the meiotic recombination checkpoint response. Downstream of MEC1, MEK1 is required through its function to inhibit repair between sister chromatids. By contrast, meiotic recombination checkpoint effectors that regulate gene expression and cyclin-dependent kinase activity are not necessary. Phosphorylation of histone H2A, which is catalyzed by Mec1 and the related Tel1 protein kinase in response to DSBs, and can help coordinate activation of the Rad53 checkpoint protein kinase in the mitotic cell cycle, is required for the full checkpoint response. Phosphorylation sites that are targeted by Rad53 in a mitotic S phase checkpoint response are also involved, based on the behavior of cells containing mutations in the DBF4 and SLD3 DNA replication genes. However, RAD53 does not appear to be required, nor does RAD9, which encodes a mediator of Rad53, consistent with their lack of function in the recombination checkpoint pathway that prevents meiotic progression. While this response is similar to a checkpoint mechanism that inhibits initiation of DNA replication in the mitotic cell cycle, the evidence points to a new variation on DNA replication control.

  12. Recombinational DNA repair and human disease

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, Larry H.; Schild, David

    2002-11-30

    We review the genes and proteins related to the homologous recombinational repair (HRR) pathway that are implicated in cancer through either genetic disorders that predispose to cancer through chromosome instability or the occurrence of somatic mutations that contribute to carcinogenesis. Ataxia telangiectasia (AT), Nijmegen breakage syndrome (NBS), and an ataxia-like disorder (ATLD), are chromosome instability disorders that are defective in the ataxia telangiectasia mutated (ATM), NBS, and Mre11 genes, respectively. These genes are critical in maintaining cellular resistance to ionizing radiation (IR), which kills largely by the production of double-strand breaks (DSBs). Bloom syndrome involves a defect in the BLM helicase, which seems to play a role in restarting DNA replication forks that are blocked at lesions, thereby promoting chromosome stability. The Werner syndrome gene (WRN) helicase, another member of the RecQ family like BLM, has very recently been found to help mediate homologous recombination. Fanconi anemia (FA) is a genetically complex chromosomal instability disorder involving seven or more genes, one of which is BRCA2. FA may be at least partially caused by the aberrant production of reactive oxidative species. The breast cancer-associated BRCA1 and BRCA2 proteins are strongly implicated in HRR; BRCA2 associates with Rad51 and appears to regulate its activity. We discuss in detail the phenotypes of the various mutant cell lines and the signaling pathways mediated by the ATM kinase. ATM's phosphorylation targets can be grouped into oxidative stress-mediated transcriptional changes, cell cycle checkpoints, and recombinational repair. We present the DNA damage response pathways by using the DSB as the prototype lesion, whose incorrect repair can initiate and augment karyotypic abnormalities.

  13. Recombinational DNA repair and human disease

    International Nuclear Information System (INIS)

    Thompson, Larry H.; Schild, David

    2002-01-01

    We review the genes and proteins related to the homologous recombinational repair (HRR) pathway that are implicated in cancer through either genetic disorders that predispose to cancer through chromosome instability or the occurrence of somatic mutations that contribute to carcinogenesis. Ataxia telangiectasia (AT), Nijmegen breakage syndrome (NBS), and an ataxia-like disorder (ATLD), are chromosome instability disorders that are defective in the ataxia telangiectasia mutated (ATM), NBS, and Mre11 genes, respectively. These genes are critical in maintaining cellular resistance to ionizing radiation (IR), which kills largely by the production of double-strand breaks (DSBs). Bloom syndrome involves a defect in the BLM helicase, which seems to play a role in restarting DNA replication forks that are blocked at lesions, thereby promoting chromosome stability. The Werner syndrome gene (WRN) helicase, another member of the RecQ family like BLM, has very recently been found to help mediate homologous recombination. Fanconi anemia (FA) is a genetically complex chromosomal instability disorder involving seven or more genes, one of which is BRCA2. FA may be at least partially caused by the aberrant production of reactive oxidative species. The breast cancer-associated BRCA1 and BRCA2 proteins are strongly implicated in HRR; BRCA2 associates with Rad51 and appears to regulate its activity. We discuss in detail the phenotypes of the various mutant cell lines and the signaling pathways mediated by the ATM kinase. ATM's phosphorylation targets can be grouped into oxidative stress-mediated transcriptional changes, cell cycle checkpoints, and recombinational repair. We present the DNA damage response pathways by using the DSB as the prototype lesion, whose incorrect repair can initiate and augment karyotypic abnormalities

  14. Mutations affecting RNA polymerase I-stimulated exchange and rDNA recombination in yeast

    International Nuclear Information System (INIS)

    Lin, Y.H.; Keil, R.L.

    1991-01-01

    HOT1 is a cis-acting recombination-stimulatory sequence isolated from the rDNA repeat unit of yeast. The ability of HOT1 to stimulate mitotic exchange appears to depend on its ability to promote high levels of RNA polymerase I transcription. A qualitative colony color sectoring assay was developed to screen for trans-acting mutations that alter the activity of HOT1. Both hypo-recombination and hyper-recombination mutants were isolated. Genetic analysis of seven HOT1 recombination mutants (hrm) that decrease HOT1 activity shows that they behave as recessive nuclear mutations and belong to five linkage groups. Three of these mutations, hrm1, hrm2, and hrm3, also decrease rDNA exchange but do not alter recombination in the absence of HOT1. Another mutation, hrm4, decreases HOT1-stimulated recombination but does not affect rDNA recombination or exchange in the absence of HOT1. Two new alleles of RAD52 were also isolated using this screen. With regard to HOT1 activity, rad52 is epistatic to all four hrm mutations indicating that the products of the HRM genes and of RAD52 mediate steps in the same recombination pathway. Finding mutations that decrease both the activity of HOT1 and exchange in the rDNA supports the hypothesis that HOT1 plays a role in rDNA recombination

  15. RPA homologs and ssDNA processing during meiotic recombination.

    Science.gov (United States)

    Ribeiro, Jonathan; Abby, Emilie; Livera, Gabriel; Martini, Emmanuelle

    2016-06-01

    Meiotic homologous recombination is a specialized process that involves homologous chromosome pairing and strand exchange to guarantee proper chromosome segregation and genetic diversity. The formation and repair of DNA double-strand breaks (DSBs) during meiotic recombination differs from those during mitotic recombination in that the homologous chromosome rather than the sister chromatid is the preferred repair template. The processing of single-stranded DNA (ssDNA) formed on intermediate recombination structures is central to driving the specific outcomes of DSB repair during meiosis. Replication protein A (RPA) is the main ssDNA-binding protein complex involved in DNA metabolism. However, the existence of RPA orthologs in plants and the recent discovery of meiosis specific with OB domains (MEIOB), a widely conserved meiosis-specific RPA1 paralog, strongly suggest that multiple RPA complexes evolved and specialized to subdivide their roles during DNA metabolism. Here we review ssDNA formation and maturation during mitotic and meiotic recombination underlying the meiotic specific features. We describe and discuss the existence and properties of MEIOB and multiple RPA subunits in plants and highlight how they can provide meiosis-specific fates to ssDNA processing during homologous recombination. Understanding the functions of these RPA homologs and how they interact with the canonical RPA subunits is of major interest in the fields of meiosis and DNA repair.

  16. Examining a DNA Replication Requirement for Bacteriophage λ Red- and Rac Prophage RecET-Promoted Recombination in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Lynn C. Thomason

    2016-09-01

    Full Text Available Recombineering, in vivo genetic engineering with bacteriophage homologous recombination systems, is a powerful technique for making genetic modifications in bacteria. Two systems widely used in Escherichia coli are the Red system from phage λ and RecET from the defective Rac prophage. We investigated the in vivo dependence of recombineering on DNA replication of the recombining substrate using plasmid targets. For λ Red recombination, when DNA replication of a circular target plasmid is prevented, recombination with single-stranded DNA oligonucleotides is greatly reduced compared to that under replicating conditions. For RecET recombination, when DNA replication of the targeted plasmid is prevented, the recombination frequency is also reduced, to a level identical to that seen for the Red system in the absence of replication. The very low level of oligonucleotide recombination observed in the absence of any phage recombination functions is the same in the presence or absence of DNA replication. In contrast, both the Red and RecET systems recombine a nonreplicating linear dimer plasmid with high efficiency to yield a circular monomer. Therefore, the DNA replication requirement is substrate dependent. Our data are consistent with recombination by both the Red and RecET systems occurring predominately by single-strand annealing rather than by strand invasion.

  17. Recent advances in yeast molecular biology: recombinant DNA. [Lead abstract

    Energy Technology Data Exchange (ETDEWEB)

    1982-09-01

    Separate abstracts were prepared for the 25 papers presented at a workshop focusing on chromosomal structure, gene regulation, recombination, DNA repair, and cell type control, that have been obtained by experimental approaches incorporating the new technologies of yeast DNA transformation, molecular cloning, and DNA sequence analysis. (KRM)

  18. Recent advances in yeast molecular biology: recombinant DNA

    International Nuclear Information System (INIS)

    1982-09-01

    Separate abstracts were prepared for the 25 papers presented at a workshop focusing on chromosomal structure, gene regulation, recombination, DNA repair, and cell type control, that have been obtained by experimental approaches incorporating the new technologies of yeast DNA transformation, molecular cloning, and DNA sequence analysis

  19. Rogue athletes and recombinant DNA technology: challenges for doping control.

    Science.gov (United States)

    Azzazy, Hassan M E; Mansour, Mai M H

    2007-10-01

    The quest for athletic excellence holds no limit for some athletes, and the advances in recombinant DNA technology have handed these athletes the ultimate doping weapons: recombinant proteins and gene doping. Some detection methods are now available for several recombinant proteins that are commercially available as pharmaceuticals and being abused by dopers. However, researchers are struggling to come up with efficient detection methods in preparation for the imminent threat of gene doping, expected in the 2008 Olympics. This Forum article presents the main detection strategies for recombinant proteins and the forthcoming detection strategies for gene doping as well as the prime analytical challenges facing them.

  20. Recombinant DNA production of spider silk proteins.

    Science.gov (United States)

    Tokareva, Olena; Michalczechen-Lacerda, Valquíria A; Rech, Elíbio L; Kaplan, David L

    2013-11-01

    Spider dragline silk is considered to be the toughest biopolymer on Earth due to an extraordinary combination of strength and elasticity. Moreover, silks are biocompatible and biodegradable protein-based materials. Recent advances in genetic engineering make it possible to produce recombinant silks in heterologous hosts, opening up opportunities for large-scale production of recombinant silks for various biomedical and material science applications. We review the current strategies to produce recombinant spider silks. © 2013 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  1. Construction of recombinant DNA clone for bovine viral diarrhea virus

    International Nuclear Information System (INIS)

    Yeo, S.G.; Cho, H.J.; Masri, S.A.

    1992-01-01

    Molecular cloning was carried out on the Danish strain of bovine viral diarrhea virus (BVDV) to construct strategy for the diagnostic tools and effective vaccine of BVD afterwards. A recombinant DNA clone (No. 29) was established successfully from cDNA for viral RNA tailed with adenine homopolymer at 3 -end. 32 P-labeled DNA probes of 300~1, 800bp fragments, originating from the clone 29, directed specific DNA-RNA hybridization results with BVDV RNA. Recombinant DNA of the clone 29 was about 5,200bp representing 41.6% of the full length of Danish strain's RNA, and restriction sites were recognized for EooR I, Sst I, Hind III and Pst I restriction enzymes in the DNA fragment

  2. Exploring optimization parameters to increase ssDNA recombineering in Lactococcus lactis and Lactobacillus reuteri.

    Science.gov (United States)

    Van Pijkeren, Jan-Peter; Neoh, Kar Mun; Sirias, Denise; Findley, Anthony S; Britton, Robert A

    2012-01-01

    Single-stranded DNA (ssDNA) recombineering is a technology which is used to make subtle changes in the chromosome of several bacterial genera. Cells which express a single-stranded DNA binding protein (RecT or Bet) are transformed with an oligonucleotide which is incorporated via an annealing and replication-dependent mechanism. By in silico analysis we identified ssDNA binding protein homologs in the genus Lactobacillus and Lactococcus lactis. To assess whether we could further improve the recombineering efficiency in Lactobacillus reuteri ATCC PTA 6475 we expressed several RecT homologs in this strain. RecT derived from Enterococcus faecalis CRMEN 19 yielded comparable efficiencies compared with a native RecT protein, but none of the other proteins further increased the recombineering efficiency. We successfully improved recombineering efficiency 10-fold in L. lactis by increasing oligonucleotide concentration combined with the use of oligonucleotides containing phosphorothioate-linkages (PTOs). Surprisingly, neither increased oligonucleotide concentration nor PTO linkages enhanced recombineering in L. reuteri 6475. To emphasize the utility of this technology in improving probiotic features we modified six bases in a transcriptional regulatory element region of the pdu-operon of L. reuteri 6475, yielding a 3-fold increase in the production of the antimicrobial compound reuterin. Directed genetic modification of lactic acid bacteria through ssDNA recombineering will simplify strain improvement in a way that, when mutating a single base, is genetically indistinguishable from strains obtained through directed evolution.

  3. Density dependence of dielectronic recombination in selenium

    International Nuclear Information System (INIS)

    Hagelstein, P.L.; Rosen, M.D.; Jacobs, V.L.

    1986-01-01

    Dielectronic recombination has been found to be the dominant recombination process in the determination of the ionization balance of selenium near the Ne-like sequence under conditions relevant to the exploding-foil EUV laser plasmas. The dielectronic recombination process tends to populate excited levels, and these levels in turn are more susceptible to subsequent excitation and ionization than are the ground-state ions. If one defines an effective recombination rate which includes, in addition to the primary recombination, the subsequent excitation and ionization of the additional excited-state population due to the primary recombination, then this effective recombination rate can be density-sensitive at relatively low electron density. We present results for this effective dielectronic recombination rate at an electron density of 3 x 10/sup 20/ electrons/cm 3 for recombination from Ne-like to Na-like selenium and from F-like to Ne-like selenium. In the former case, the effective recombination rate coefficient is found to be 1.8 x 10/sup -11/ cm 3 /sec at 1.0 keV, which is to be compared with the zero-density value of 2.8 x 10/sup -11/ cm 3 /sec. In the latter case (F-like to Ne-like), the effective recombination rate coefficient is found to be 1.3 x 10/sup -11/ cm 3 /sec, which is substantially reduced from the zero-density result of 3.3 x 10/sup -11/ cm 3 /sec. We have examined the effects of dielectronic recombination on the laser gain of the dominant Ne-like 3p-3s transitions and have compared our results with those presented by Whitten et al. [Phys. Rev. A 33, 2171 (1986)

  4. Examining a DNA Replication Requirement for Bacteriophage λ Red- and Rac Prophage RecET-Promoted Recombination in Escherichia coli.

    Science.gov (United States)

    Thomason, Lynn C; Costantino, Nina; Court, Donald L

    2016-09-13

    Recombineering, in vivo genetic engineering with bacteriophage homologous recombination systems, is a powerful technique for making genetic modifications in bacteria. Two systems widely used in Escherichia coli are the Red system from phage λ and RecET from the defective Rac prophage. We investigated the in vivo dependence of recombineering on DNA replication of the recombining substrate using plasmid targets. For λ Red recombination, when DNA replication of a circular target plasmid is prevented, recombination with single-stranded DNA oligonucleotides is greatly reduced compared to that under replicating conditions. For RecET recombination, when DNA replication of the targeted plasmid is prevented, the recombination frequency is also reduced, to a level identical to that seen for the Red system in the absence of replication. The very low level of oligonucleotide recombination observed in the absence of any phage recombination functions is the same in the presence or absence of DNA replication. In contrast, both the Red and RecET systems recombine a nonreplicating linear dimer plasmid with high efficiency to yield a circular monomer. Therefore, the DNA replication requirement is substrate dependent. Our data are consistent with recombination by both the Red and RecET systems occurring predominately by single-strand annealing rather than by strand invasion. Bacteriophage homologous recombination systems are widely used for in vivo genetic engineering in bacteria. Single- or double-stranded linear DNA substrates containing short flanking homologies to chromosome targets are used to generate precise and accurate genetic modifications when introduced into bacteria expressing phage recombinases. Understanding the molecular mechanism of these recombination systems will facilitate improvements in the technology. Here, two phage-specific systems are shown to require exposure of complementary single-strand homologous targets for efficient recombination; these single

  5. DNA fragmentation and cytotoxicity by recombinant human tumor necrosis factor in L929 fibroblast cells

    International Nuclear Information System (INIS)

    Kosaka, T.; Kuwabara, M.; Koide, F.

    1992-01-01

    Induction of cell DNA fragmentation by treatment of recombinant human Tumor Necrosis Factor alpha (rhTNF alpha) was examined by using mouse L929 cells derived from mouse fibroblast cells. The amount of DNA fragments derived from rhTNF alpha-treated cells, detected by alkaline elution technique, was smaller than that derived from X-irradiated cells. The rhTNF alpha caused the DNA fragmentation depending on its incubation time and concentration. The DNA damage caused by rhTNF alpha treatment correlated with its cytotoxicity. This result suggested that the DNA fragmentation is one of causes of cell death. The treatment with proteinase K of DNA obtained from rhTNF alpha-treated cells did not increase the amount of DNA fragmentation, which indicates that rhTNF alpha causes DNA-fragmentation but not DNA-protein cross-linking

  6. Somatic DNA recombination yielding circular DNA and deletion of a genomic region in embryonic brain

    International Nuclear Information System (INIS)

    Maeda, Toyoki; Chijiiwa, Yoshiharu; Tsuji, Hideo; Sakoda, Saburo; Tani, Kenzaburo; Suzuki, Tomokazu

    2004-01-01

    In this study, a mouse genomic region is identified that undergoes DNA rearrangement and yields circular DNA in brain during embryogenesis. External region-directed inverse polymerase chain reaction on circular DNA extracted from late embryonic brain tissue repeatedly detected DNA of this region containing recombination joints. Wide-range genomic PCR and digestion-circularization PCR analysis showed this region underwent recombination accompanied with deletion of intervening sequences, including the circularized regions. This region was mapped by fluorescence in situ hybridization to C1 on mouse chromosome 16, where no gene and no physiological DNA rearrangement had been identified. DNA sequence in the region has segmental homology to an orthologous region on human chromosome 3q.13. These observations demonstrated somatic DNA recombination yielding genomic deletions in brain during embryogenesis

  7. Efficient preparation of shuffled DNA libraries through recombination (Gateway) cloning.

    Science.gov (United States)

    Lehtonen, Soili I; Taskinen, Barbara; Ojala, Elina; Kukkurainen, Sampo; Rahikainen, Rolle; Riihimäki, Tiina A; Laitinen, Olli H; Kulomaa, Markku S; Hytönen, Vesa P

    2015-01-01

    Efficient and robust subcloning is essential for the construction of high-diversity DNA libraries in the field of directed evolution. We have developed a more efficient method for the subcloning of DNA-shuffled libraries by employing recombination cloning (Gateway). The Gateway cloning procedure was performed directly after the gene reassembly reaction, without additional purification and amplification steps, thus simplifying the conventional DNA shuffling protocols. Recombination-based cloning, directly from the heterologous reassembly reaction, conserved the high quality of the library and reduced the time required for the library construction. The described method is generally compatible for the construction of DNA-shuffled gene libraries. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  8. Choreography of recombination proteins during the DNA damage response

    DEFF Research Database (Denmark)

    Lisby, Michael; Rothstein, Rodney

    2009-01-01

    Genome integrity is frequently challenged by DNA lesions from both endogenous and exogenous sources. A single DNA double-strand break (DSB) is lethal if unrepaired and may lead to loss of heterozygosity, mutations, deletions, genomic rearrangements and chromosome loss if repaired improperly. Such...... research. Here we review the cell biological response to DSBs in mitotically growing cells with an emphasis on homologous recombination pathways in yeast Saccharomyces cerevisiae and in mammalian cells....

  9. Single-Molecule Tethered Particle Motion: Stepwise Analyses of Site-Specific DNA Recombination

    Directory of Open Access Journals (Sweden)

    Hsiu-Fang Fan

    2018-05-01

    Full Text Available Tethered particle motion/microscopy (TPM is a biophysical tool used to analyze changes in the effective length of a polymer, tethered at one end, under changing conditions. The tether length is measured indirectly by recording the Brownian motion amplitude of a bead attached to the other end. In the biological realm, DNA, whose interactions with proteins are often accompanied by apparent or real changes in length, has almost exclusively been the subject of TPM studies. TPM has been employed to study DNA bending, looping and wrapping, DNA compaction, high-order DNA–protein assembly, and protein translocation along DNA. Our TPM analyses have focused on tyrosine and serine site-specific recombinases. Their pre-chemical interactions with DNA cause reversible changes in DNA length, detectable by TPM. The chemical steps of recombination, depending on the substrate and the type of recombinase, may result in a permanent length change. Single molecule TPM time traces provide thermodynamic and kinetic information on each step of the recombination pathway. They reveal how mechanistically related recombinases may differ in their early commitment to recombination, reversibility of individual steps, and in the rate-limiting step of the reaction. They shed light on the pre-chemical roles of catalytic residues, and on the mechanisms by which accessory proteins regulate recombination directionality.

  10. In vitro recombination of bacteriophage T7 DNA damaged by uv radiation

    International Nuclear Information System (INIS)

    Masker, W.E.; Kuemmerle, N.B.

    1980-01-01

    A system capable of in vitro packaging of exogenous bacteriophage T7 DNA has been used to monitor the biological activity of DNA replicated in vitro. This system has been used to follow the effects of uv radiation on in vitro replication and recombination. During the in vitro replication process, a considerable exchange of genetic information occurs between T7 DNA molecules present in the reaction mixture. This in vitro recombination is reflected in the genotype of the T7 phage produced after in vitro encapsulation; depending on the genetic markers selected, recombinants can comprise nearly 20% of the total phage production. When uv-irradiated DNA is incubated in this system, the amount of in vitro synthesis is reduced and the total amount of viable phage produced after in vitro packaging is diminished. In vitro recombination rates are also lower when the participating DNA molecules have been exposed to uv. However, biochemical and genetic measurements confirmed that there is little or no transfer of pyrimidine dimers from irradiated DNA into undamaged molecules

  11. Human DNA repair and recombination genes

    International Nuclear Information System (INIS)

    Thompson, L.H.; Weber, C.A.; Jones, N.J.

    1988-09-01

    Several genes involved in mammalian DNA repair pathways were identified by complementation analysis and chromosomal mapping based on hybrid cells. Eight complementation groups of rodent mutants defective in the repair of uv radiation damage are now identified. At least seven of these genes are probably essential for repair and at least six of them control the incision step. The many genes required for repair of DNA cross-linking damage show overlap with those involved in the repair of uv damage, but some of these genes appear to be unique for cross-link repair. Two genes residing on human chromosome 19 were cloned from genomic transformants using a cosmid vector, and near full-length cDNA clones of each gene were isolated and sequenced. Gene ERCC2 efficiently corrects the defect in CHO UV5, a nucleotide excision repair mutant. Gene XRCC1 normalizes repair of strand breaks and the excessive sister chromatid exchange in CHO mutant EM9. ERCC2 shows a remarkable /approximately/52% overall homology at both the amino acid and nucleotide levels with the yeast RAD3 gene. Evidence based on mutation induction frequencies suggests that ERCC2, like RAD3, might also be an essential gene for viability. 100 refs., 4 tabs

  12. Restoration of X-ray resistance and V(D)J recombination in mutant cells by Ku cDNA

    International Nuclear Information System (INIS)

    Smider, V.; Rathmell, W.K.; Chu, G.; Lieber, M.R.

    1994-01-01

    Three genetic complementation groups of rodent cells are defective for both repair of x-ray-induced double-strand breaks and V(D)J recombination. Cells from one group lack a DNA end-binding activity that is biochemically and antigenically similar to the Ku autoantigen. Transfection of complementary DNA (cDNA) that encoded the 86-kilodalton subunit of Ku rescued these mutant cells for DNA end-binding activity, x-ray resistance, and V(D)J recombination activity. These results establish a role for Ku in DNA repair and recombination. Furthermore, as a component of a DNA-dependent protein kinase, Ku may initiate a signaling pathway induced by DNA damage

  13. DNA repair and its relation to recombination-deficient and other mutations in Bacillus subtilis

    International Nuclear Information System (INIS)

    Ganesan, A.T.

    1975-01-01

    DNA repair processes operating in Bacillus subtilis are similar to other transformable bacterial systems. Radiation-sensitive, recombination-deficient mutants are blocked in distinct steps leading to recombination. DNA polymerase I is essential for the repair of x-ray-induced damage to DNA but not for recombination

  14. Genetic dependence of recombination in recD mutants of Escherichia coli

    International Nuclear Information System (INIS)

    Lovett, S.T.; Luisi-DeLuca, C.; Kolodner, R.D.

    1988-01-01

    RecBCD enzyme has multiple activities including helicase, exonuclease and endonuclease activities. Mutations in the genes recB or recC, encoding two subunits of the enzyme, reduce the frequency of many types of recombinational events. Mutations in recD, encoding the third subunit, do not reduce recombination even though most of the activities of the RecBCD enzyme are severely reduced. In this study, the genetic dependence of different types of recombination in recD mutants has been investigated. The effects of mutations in genes in the RecBCD pathway (recA and recC) as well as the genes specific for the RecF pathway (recF, recJ, recN, recO, recQ, ruv and lexA) were tested on conjugational, transductional and plasmid recombination, and on UV survival. recD mutants were hyper-recombinogenic for all the monitored recombination events, especially those involving plasmids, and all recombination events in recD strains required recA and recC. In addition, unlike recD+ strains, chromosomal recombination events and the repair of UV damage to DNA in recD strains were dependent on one RecF pathway gene, recJ. Only a subset of the tested recombination events were affected by ruv, recN, recQ, recO and lexA mutations

  15. Recombinational DNA repair is regulated by compartmentalization of DNA lesions at the nuclear pore complex

    DEFF Research Database (Denmark)

    Géli, Vincent; Lisby, Michael

    2015-01-01

    and colleagues shows that also physiological threats to genome integrity such as DNA secondary structure-forming triplet repeat sequences relocalize to the NPC during DNA replication. Mutants that fail to reposition the triplet repeat locus to the NPC cause repeat instability. Here, we review the types of DNA...... lesions that relocalize to the NPC, the putative mechanisms of relocalization, and the types of recombinational repair that are stimulated by the NPC, and present a model for NPC-facilitated repair....

  16. Jeremy Rifkin challenges recombinant DNA research: A rhetoric of heresy

    Energy Technology Data Exchange (ETDEWEB)

    Futrell, W.M.

    1992-01-01

    One significant issue to come before the public in recent years is recombinant DNA research or genetic engineering and its applications. An important spokesman on this issue is Jeremy Rifkin. Rifkin is of rhetorical interest because of his strategies to sustain the dialogue and define the parameters in which it occurs. This dissertation analyzes a broad range of Rifkin's rhetorical artifacts and those of scientists engaged in recombinant DNA research. They are examined against criteria developed to identify and understand heresy. The five areas of analysis are: the nearness/remoteness phenomenon, the social construction of heresy, the social consequences of heresy, the doctrinal consequences of heresy, and the heresy-hunt ritual. The first two criteria focus on the rhetorical strategies of the heretic. The last three concentrate on the rhetorical strategies of the defenders of the institutional orthodoxy. This dissertation examines the rhetorical strategies of a heretical challenge to the scientific establishment and the consequences of that challenge. This dissertation also analyzes the rhetorical strategies employed by the defenders of the scientific orthodoxy. Although an understanding of the rhetorical strategies employed on both sides of this conflict is important, the implications for the role of rhetoric in highly controversial issues such as recombinant DNA are even more critical.

  17. Cold Spring Harbor symposia on quantitative biology: Volume 49, Recombination at the DNA level

    International Nuclear Information System (INIS)

    1984-01-01

    This volume contains full papers prepared by the participants to the 1984 Cold Springs Harbor Symposia on Quantitative Biology. This year's theme is entitled Recombination at the DNA level. The volume consists of 93 articles grouped into subject areas entitled chromosome mechanics, yeast systems, mammalian homologous recombination, transposons, mu, plant transposons/T4 recombination, topoisomerase, resolvase and gyrase, Escherichia coli general recombination, RecA, repair, leukaryotic enzymes, integration and excision of bacteriophage, site-specific recombination, and recombination in vitro

  18. Differences in mutagenic and recombinational DNA repair in enterobacteria

    International Nuclear Information System (INIS)

    Sedgwick, S.G.; Goodwin, P.A.

    1985-01-01

    The incidence of recombinational DNA repair and inducible mutagenic DNA repair has been examined in Escherichia coli and 11 related species of enterobacteria. Recombinational repair was found to be a common feature of the DNA repair repertoire of at least 6 genera of enterobacteria. This conclusion is based on observations of (i) damage-induced synthesis of RecA-like proteins, (ii) nucleotide hybridization between E. coli recA sequences and some chromosomal DNAs, and (iii) recA-negative complementation by plasmids showing SOS-inducible expression of truncated E. coli recA genes. The mechanism of DNA damage-induced gene expression is therefore sufficiently conserved to allow non-E. coli regulatory elements to govern expression of these cloned truncated E. coli recA genes. In contrast, the process of mutagenic repair, which uses umuC+ umuD+ gene products in E. coli, appeared less widespread. Little ultraviolet light-induced mutagenesis to rifampicin resistance was detected outside the genus Escherichia, and even within the genus induced mutagenesis was detected in only 3 out of 6 species. Nucleotide hybridization showed that sequences like the E. coli umuCD+ gene are not found in these poorly mutable organisms. Evolutionary questions raised by the sporadic incidence of inducible mutagenic repair are discussed

  19. Interaction between HIV-1 Tat and DNA-PKcs modulates HIV transcription and class switch recombination.

    Science.gov (United States)

    Zhang, Shi-Meng; Zhang, He; Yang, Tian-Yi; Ying, Tian-Yi; Yang, Pei-Xiang; Liu, Xiao-Dan; Tang, Sheng-Jian; Zhou, Ping-Kun

    2014-01-01

    HIV-1 tat targets a variety of host cell proteins to facilitate viral transcription and disrupts host cellular immunity by inducing lymphocyte apoptosis, but whether it influences humoral immunity remains unclear. Previously, our group demonstrated that tat depresses expression of DNA-PKcs, a critical component of the non-homologous end joining pathway (NHEJ) of DNA double-strand breaks repair, immunoglobulin class switch recombination (CSR) and V(D)J recombination, and sensitizes cells to ionizing radiation. In this study, we demonstrated that HIV-1 Tat down-regulates DNA-PKcs expression by directly binding to the core promoter sequence. In addition, Tat interacts with and activates the kinase activity of DNA-PKcs in a dose-dependent and DNA independent manner. Furthermore, Tat inhibits class switch recombination (CSR) at low concentrations (≤ 4 µg/ml) and stimulates CSR at high concentrations (≥ 8 µg/ml). On the other hand, low protein level and high kinase activity of DNA-PKcs promotes HIV-1 transcription, while high protein level and low kinase activity inhibit HIV-1 transcription. Co-immunoprecipitation results revealed that DNA-PKcs forms a large complex comprised of Cyclin T1, CDK9 and Tat via direct interacting with CDK9 and Tat but not Cyclin T1. Taken together, our results provide new clues that Tat regulates host humoral immunity via both transcriptional depression and kinase activation of DNA-PKcs. We also raise the possibility that inhibitors and interventions directed towards DNA-PKcs may inhibit HIV-1 transcription in AIDS patients.

  20. Recombinant methods for screening human DNA excision repair proficiency

    International Nuclear Information System (INIS)

    Athas, W.F.

    1988-01-01

    A method for measuring DNA excision repair in response to ultraviolet radiation (UV)-induced DNA damage has been developed, validated, and field-tested in cultured human lymphocytes. The methodology is amenable to population-based screening and should facilitate future epidemiologic studies seeking to investigate associations between excision repair proficiency and cancer susceptibility. The impetus for such endeavors derives from the belief that the high incidence of skin cancer in the genetic disorder xeroderma pigmentosum (XP) primarily is a result of the reduced capacity of patients cells to repair UV-induced DNA damage. For assay, UV-irradiated non-replicating recombinant plasmid DNA harboring a chloramphenicol acetyltransferase (CAT) indicator gene is introduced into lymphocytes using DEAE-dextran short-term transfection conditions. Exposure to UV induces transcriptionally-inactivating DNA photoproducts in the plasmid DNA which inactivate CAT gene expression. Excision repair of the damaged CAT gene is monitored indirectly as a function of reactivated CAT enzyme activity following a 40 hour repair/expression incubation period

  1. Recombinant cells and organisms having persistent nonstandard amino acid dependence and methods of making them

    Science.gov (United States)

    Church, George M.; Mandell, Daniel J.; Lajoie, Marc J.

    2017-12-05

    Recombinant cells and recombinant organisms persistently expressing nonstandard amino acids (NSAAs) are provided. Methods of making recombinant cells and recombinant organisms dependent on persistently expressing NSAAs for survival are also provided. These methods may be used to make safe recombinant cells and recombinant organisms and/or to provide a selective pressure to maintain one or more reassigned codon functions in recombinant cells and recombinant organisms.

  2. Conformation-dependent DNA attraction

    Science.gov (United States)

    Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

    2014-05-01

    Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by

  3. Genomic analysis of murine DNA-dependent protein kinase

    International Nuclear Information System (INIS)

    Fujimori, A.; Abe, M.

    2003-01-01

    Full text: The gene of catalytic subunit of DNA dependent protein kinase is responsible gene for SCID mice. The molecules play a critical role in non-homologous end joining including the V(D)J recombination. Contribution of the molecules to the difference of radiosensitivity and the susceptibility to cancer has been suggested. Here we show the entire nucleotide sequence of approximately 193 kbp and 84 kbp genomic regions encoding the entire DNA-PKcs gene in the mouse and chicken respectively. Retroposon was found in the intron 51 of mouse genomic DNA-PKcs gene but in human and chicken. Comparative analysis of these two species strongly suggested that only two genes, DNA-PKcs and MCM4, exist in the region of both species. Several conserved sequences and cis elements, however, were predicted. Recently, the orthologous region for the human DNA-PKcs locus was completed. The results of further comparative study will be discussed

  4. Conformation-dependent DNA attraction.

    Science.gov (United States)

    Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

    2014-06-21

    Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg(2+) ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg(2+) or Na(+), benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg(2+) bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.

  5. Recombination Promoted by DNA Viruses: Phage λ to Herpes Simplex Virus

    Science.gov (United States)

    Weller, Sandra K.; Sawitzke, James A.

    2015-01-01

    The purpose of this review is to explore recombination strategies in DNA viruses. Homologous recombination is a universal genetic process that plays multiple roles in the biology of all organisms, including viruses. Recombination and DNA replication are interconnected, with recombination being essential for repairing DNA damage and supporting replication of the viral genome. Recombination also creates genetic diversity, and viral recombination mechanisms have important implications for understanding viral origins as well as the dynamic nature of viral-host interactions. Both bacteriophage λ and herpes simplex virus (HSV) display high rates of recombination, both utilizing their own proteins and commandeering cellular proteins to promote recombination reactions. We focus primarily on λ and HSV, as they have proven amenable to both genetic and biochemical analysis and have recently been shown to exhibit some surprising similarities that will guide future studies. PMID:25002096

  6. DNA-PK, ATM and ATR collaboratively regulate p53-RPA interaction to facilitate homologous recombination DNA repair.

    Science.gov (United States)

    Serrano, M A; Li, Z; Dangeti, M; Musich, P R; Patrick, S; Roginskaya, M; Cartwright, B; Zou, Y

    2013-05-09

    Homologous recombination (HR) and nonhomologous end joining (NHEJ) are two distinct DNA double-stranded break (DSB) repair pathways. Here, we report that DNA-dependent protein kinase (DNA-PK), the core component of NHEJ, partnering with DNA-damage checkpoint kinases ataxia telangiectasia mutated (ATM) and ATM- and Rad3-related (ATR), regulates HR repair of DSBs. The regulation was accomplished through modulation of the p53 and replication protein A (RPA) interaction. We show that upon DNA damage, p53 and RPA were freed from a p53-RPA complex by simultaneous phosphorylations of RPA at the N-terminus of RPA32 subunit by DNA-PK and of p53 at Ser37 and Ser46 in a Chk1/Chk2-independent manner by ATR and ATM, respectively. Neither the phosphorylation of RPA nor of p53 alone could dissociate p53 and RPA. Furthermore, disruption of the release significantly compromised HR repair of DSBs. Our results reveal a mechanism for the crosstalk between HR repair and NHEJ through the co-regulation of p53-RPA interaction by DNA-PK, ATM and ATR.

  7. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats

    Directory of Open Access Journals (Sweden)

    Daniël O. Warmerdam

    2016-03-01

    Full Text Available rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of breaks in 45S rDNA, and this results in repeat loss. We identify the structural maintenance of chromosomes protein 5 (SMC5 as contributing to recombination-mediated repair of rDNA breaks. Together, our data demonstrate that SMC5-mediated recombination can lead to error-prone repair of 45S rDNA repeats, resulting in their loss and thereby reducing cellular viability.

  8. Successful development of recombinant DNA-derived pharmaceuticals.

    Science.gov (United States)

    Werner, R G; Pommer, C H

    1990-11-01

    Successful development of recombinant DNA-derived pharmaceuticals, a new class of therapeutic agents, is determined by a variety of factors affecting the selection and positioning of the compound under development. For an efficient development it is of utmost importance that the mechanism of action of the compound selected be understood on a molecular level. The compound's potential therapeutical profile and a strong patent position are key positioning considerations, as well as vital elements in shortening the development phase and protecting innovation. Installation of an interdisciplinary project management team, along with a clear definition of team members' responsibilities, is required to avoid delays and improve communication during development. Selection of the organism to be used in production must take into consideration both the structure of the protein and the quality and safety of the final product. New technologies require a considerable investment in new manufacturing facilities and equipment. Often, the decision for such an investment must be made early and with a high degree of uncertainty. Desired product yield, expected dosage, and estimated market potential are the most important considerations in this decision. Following public disclosure of the plan to develop recombinant DNA-derived products, approval of the production plant and expansion or adaptation to the new process and technology may be delayed. For this reason, they should be considered as a critical step in the overall development phase. Recruitment of qualified staff is a time-consuming and critical element of the production process. Its impact on the product timeline should not be underestimated, especially if such technologies are new to the company. The entire production process must be validated in respect to identity, purity, and safety of the product to guarantee constant product quality, as well as for safety aspects in the environment. Adequate in-process and final product

  9. Competitive repair by naturally dispersed repetitive DNA during non-allelic homologous recombination

    Energy Technology Data Exchange (ETDEWEB)

    Hoang, Margaret L.; Tan, Frederick J.; Lai, David C.; Celniker, Sue E.; Hoskins, Roger A.; Dunham, Maitreya J.; Zheng, Yixian; Koshland, Douglas

    2010-08-27

    Genome rearrangements often result from non-allelic homologous recombination (NAHR) between repetitive DNA elements dispersed throughout the genome. Here we systematically analyze NAHR between Ty retrotransposons using a genome-wide approach that exploits unique features of Saccharomyces cerevisiae purebred and Saccharomyces cerevisiae/Saccharomyces bayanus hybrid diploids. We find that DNA double-strand breaks (DSBs) induce NAHR-dependent rearrangements using Ty elements located 12 to 48 kilobases distal to the break site. This break-distal recombination (BDR) occurs frequently, even when allelic recombination can repair the break using the homolog. Robust BDR-dependent NAHR demonstrates that sequences very distal to DSBs can effectively compete with proximal sequences for repair of the break. In addition, our analysis of NAHR partner choice between Ty repeats shows that intrachromosomal Ty partners are preferred despite the abundance of potential interchromosomal Ty partners that share higher sequence identity. This competitive advantage of intrachromosomal Tys results from the relative efficiencies of different NAHR repair pathways. Finally, NAHR generates deleterious rearrangements more frequently when DSBs occur outside rather than within a Ty repeat. These findings yield insights into mechanisms of repeat-mediated genome rearrangements associated with evolution and cancer.

  10. Competitive repair by naturally dispersed repetitive DNA during non-allelic homologous recombination.

    Directory of Open Access Journals (Sweden)

    Margaret L Hoang

    2010-12-01

    Full Text Available Genome rearrangements often result from non-allelic homologous recombination (NAHR between repetitive DNA elements dispersed throughout the genome. Here we systematically analyze NAHR between Ty retrotransposons using a genome-wide approach that exploits unique features of Saccharomyces cerevisiae purebred and Saccharomyces cerevisiae/Saccharomyces bayanus hybrid diploids. We find that DNA double-strand breaks (DSBs induce NAHR-dependent rearrangements using Ty elements located 12 to 48 kilobases distal to the break site. This break-distal recombination (BDR occurs frequently, even when allelic recombination can repair the break using the homolog. Robust BDR-dependent NAHR demonstrates that sequences very distal to DSBs can effectively compete with proximal sequences for repair of the break. In addition, our analysis of NAHR partner choice between Ty repeats shows that intrachromosomal Ty partners are preferred despite the abundance of potential interchromosomal Ty partners that share higher sequence identity. This competitive advantage of intrachromosomal Tys results from the relative efficiencies of different NAHR repair pathways. Finally, NAHR generates deleterious rearrangements more frequently when DSBs occur outside rather than within a Ty repeat. These findings yield insights into mechanisms of repeat-mediated genome rearrangements associated with evolution and cancer.

  11. A role for recombination junctions in the segregation of mitochondrial DNA in yeast.

    Science.gov (United States)

    Lockshon, D; Zweifel, S G; Freeman-Cook, L L; Lorimer, H E; Brewer, B J; Fangman, W L

    1995-06-16

    In S. cerevisiae, mitochondrial DNA (mtDNA) molecules, in spite of their high copy number, segregate as if there were a small number of heritable units. The rapid segregation of mitochondrial genomes can be analyzed using mtDNA deletion variants. These small, amplified genomes segregate preferentially from mixed zygotes relative to wild-type mtDNA. This segregation advantage is abolished by mutations in a gene, MGT1, that encodes a recombination junction-resolving enzyme. We show here that resolvase deficiency causes a larger proportion of molecules to be linked together by recombination junctions, resulting in the aggregation of mtDNA into a small number of cytological structures. This change in mtDNA structure can account for the increased mitotic loss of mtDNA and the altered pattern of mtDNA segregation from zygotes. We propose that the level of unresolved recombination junctions influences the number of heritable units of mtDNA.

  12. Evaluation of the efficiency and utility of recombinant enzyme-free seamless DNA cloning methods

    Directory of Open Access Journals (Sweden)

    Ken Motohashi

    2017-03-01

    Full Text Available Simple and low-cost recombinant enzyme-free seamless DNA cloning methods have recently become available. In vivo Escherichia coli cloning (iVEC can directly transform a mixture of insert and vector DNA fragments into E. coli, which are ligated by endogenous homologous recombination activity in the cells. Seamless ligation cloning extract (SLiCE cloning uses the endogenous recombination activity of E. coli cellular extracts in vitro to ligate insert and vector DNA fragments. An evaluation of the efficiency and utility of these methods is important in deciding the adoption of a seamless cloning method as a useful tool. In this study, both seamless cloning methods incorporated inserting DNA fragments into linearized DNA vectors through short (15–39 bp end homology regions. However, colony formation was 30–60-fold higher with SLiCE cloning in end homology regions between 15 and 29 bp than with the iVEC method using DH5α competent cells. E. coli AQ3625 strains, which harbor a sbcA gene mutation that activates the RecE homologous recombination pathway, can be used to efficiently ligate insert and vector DNA fragments with short-end homology regions in vivo. Using AQ3625 competent cells in the iVEC method improved the rate of colony formation, but the efficiency and accuracy of SLiCE cloning were still higher. In addition, the efficiency of seamless cloning methods depends on the intrinsic competency of E. coli cells. The competency of chemically competent AQ3625 cells was lower than that of competent DH5α cells, in all cases of chemically competent cell preparations using the three different methods. Moreover, SLiCE cloning permits the use of both homemade and commercially available competent cells because it can use general E. coli recA− strains such as DH5α as host cells for transformation. Therefore, between the two methods, SLiCE cloning provides both higher efficiency and better utility than the iVEC method for seamless DNA plasmid

  13. DNA Sequence-Mediated, Evolutionarily Rapid Redistribution of Meiotic Recombination Hotspots

    Science.gov (United States)

    Wahls, Wayne P.; Davidson, Mari K.

    2011-01-01

    Hotspots regulate the position and frequency of Spo11 (Rec12)-initiated meiotic recombination, but paradoxically they are suicidal and are somehow resurrected elsewhere in the genome. After the DNA sequence-dependent activation of hotspots was discovered in fission yeast, nearly two decades elapsed before the key realizations that (A) DNA site-dependent regulation is broadly conserved and (B) individual eukaryotes have multiple different DNA sequence motifs that activate hotspots. From our perspective, such findings provide a conceptually straightforward solution to the hotspot paradox and can explain other, seemingly complex features of meiotic recombination. We describe how a small number of single-base-pair substitutions can generate hotspots de novo and dramatically alter their distribution in the genome. This model also shows how equilibrium rate kinetics could maintain the presence of hotspots over evolutionary timescales, without strong selective pressures invoked previously, and explains why hotspots localize preferentially to intergenic regions and introns. The model is robust enough to account for all hotspots of humans and chimpanzees repositioned since their divergence from the latest common ancestor. PMID:22084420

  14. Recombinant DNA in Cambridge: lessons for nuclear energy

    International Nuclear Information System (INIS)

    Federow, H.

    1977-09-01

    The 1976 experience of Cambridge, Massachusetts, in settling the recombinant DNA research issue is unique in recent history as the first instance of essentially lay panels judging the conduct of scientific research. Furthermore, because the panel was composed of citizens who would be affected by the research, the experience suggests a model for conflict resolution in other areas of public controversy. With one of these, nuclear energy, the controversy has two important points in common: although the primary burden of any accident would be borne by the local community, benefits of the DNA research or reactor operation accrue to a much broader range of people; and in both issues there is a need to resolve the question, ''How safe is safe enough.'' It is therefore proposed that a panel similar to the Cambridge one could be established to deal with the controversy surrounding a proposed nuclear plant. In any community where there was such controversy, a panel could be convened to assess whether the plant was acceptable to that community. Such a panel would be composed of members of the community who were not affected directly by the plant. It would also have to have a restricted range of inquiry, oriented toward the specifics of the proposed plant. Such a plant review panel, under properly designed procedures, could change the licensing process to one concerned solely with safety and provide an appropriate forum for issues concerning the acceptability of nuclear power

  15. Context dependent DNA evolutionary models

    DEFF Research Database (Denmark)

    Jensen, Jens Ledet

    This paper is about stochastic models for the evolution of DNA. For a set of aligned DNA sequences, connected in a phylogenetic tree, the models should be able to explain - in probabilistic terms - the differences seen in the sequences. From the estimates of the parameters in the model one can...... start to make biologically interpretations and conclusions concerning the evolutionary forces at work. In parallel with the increase in computing power, models have become more complex. Starting with Markov processes on a space with 4 states, and extended to Markov processes with 64 states, we are today...... studying models on spaces with 4n (or 64n) number of states with n well above one hundred, say. For such models it is no longer possible to calculate the transition probability analytically, and often Markov chain Monte Carlo is used in connection with likelihood analysis. This is also the approach taken...

  16. Mechanism of Homologous Recombination and Implications for Aging-Related Deletions in Mitochondrial DNA

    Science.gov (United States)

    2013-01-01

    SUMMARY Homologous recombination is a universal process, conserved from bacteriophage to human, which is important for the repair of double-strand DNA breaks. Recombination in mitochondrial DNA (mtDNA) was documented more than 4 decades ago, but the underlying molecular mechanism has remained elusive. Recent studies have revealed the presence of a Rad52-type recombination system of bacteriophage origin in mitochondria, which operates by a single-strand annealing mechanism independent of the canonical RecA/Rad51-type recombinases. Increasing evidence supports the notion that, like in bacteriophages, mtDNA inheritance is a coordinated interplay between recombination, repair, and replication. These findings could have profound implications for understanding the mechanism of mtDNA inheritance and the generation of mtDNA deletions in aging cells. PMID:24006472

  17. Temperature dependence of acceptor-hole recombination in germanium

    International Nuclear Information System (INIS)

    Darken, L.S.; Jellison, G.E. Jr.

    1989-01-01

    The recombination kinetics of several centers (Zn - , Cu - , B - , CuH - 2 , CuH - x , Zn = , Cu = , and CuH = x ) in high-purity Ge have been measured as a function of temperature from 8 to 160 K by transient capacitance techniques and are significantly faster than expected from cascade theory. The cascade theory also gives the wrong temperature dependence, and the wrong z dependence. Instead, the data are generally fit by the expression N v /4pτ c congruent kT/h (p and τ c are, respectively, the free-hole concentration in the sample and the experimental mean capture time for a center)

  18. The Mitochondrial DNA (mtDNA)-Associated Protein SWIB5 Influences mtDNA Architecture and Homologous Recombination

    KAUST Repository

    Blomme, Jonas

    2017-04-19

    In addition to the nucleus, mitochondria and chloroplasts in plant cells also contain genomes. Efficient DNA repair pathways are crucial in these organelles to fix damage resulting from endogenous and exogenous factors. Plant organellar genomes are complex compared with their animal counterparts, and although several plant-specific mediators of organelle DNA repair have been reported, many regulators remain to be identified. Here, we show that a mitochondrial SWI/SNF (nucleosome remodeling) complex B protein, SWIB5, is capable of associating with mitochondrial DNA (mtDNA) in Arabidopsis thaliana. Gainand loss-of-function mutants provided evidence for a role of SWIB5 in influencing mtDNA architecture and homologous recombination at specific intermediate-sized repeats both under normal and genotoxic conditions. SWIB5 interacts with other mitochondrial SWIB proteins. Gene expression and mutant phenotypic analysis of SWIB5 and SWIB family members suggests a link between organellar genome maintenance and cell proliferation. Taken together, our work presents a protein family that influences mtDNA architecture and homologous recombination in plants and suggests a link between organelle functioning and plant development.

  19. Evidence of animal mtDNA recombination between divergent populations of the potato cyst nematode Globodera pallida.

    Science.gov (United States)

    Hoolahan, Angelique H; Blok, Vivian C; Gibson, Tracey; Dowton, Mark

    2012-03-01

    Recombination is typically assumed to be absent in animal mitochondrial genomes (mtDNA). However, the maternal mode of inheritance means that recombinant products are indistinguishable from their progenitor molecules. The majority of studies of mtDNA recombination assess past recombination events, where patterns of recombination are inferred by comparing the mtDNA of different individuals. Few studies assess contemporary mtDNA recombination, where recombinant molecules are observed as direct mosaics of known progenitor molecules. Here we use the potato cyst nematode, Globodera pallida, to investigate past and contemporary recombination. Past recombination was assessed within and between populations of G. pallida, and contemporary recombination was assessed in the progeny of experimental crosses of these populations. Breeding of genetically divergent organisms may cause paternal mtDNA leakage, resulting in heteroplasmy and facilitating the detection of recombination. To assess contemporary recombination we looked for evidence of recombination between the mtDNA of the parental populations within the mtDNA of progeny. Past recombination was detected between a South American population and several UK populations of G. pallida, as well as between two South American populations. This suggests that these populations may have interbred, paternal mtDNA leakage occurred, and the mtDNA of these populations subsequently recombined. This evidence challenges two dogmas of animal mtDNA evolution; no recombination and maternal inheritance. No contemporary recombination between the parental populations was detected in the progeny of the experimental crosses. This supports current arguments that mtDNA recombination events are rare. More sensitive detection methods may be required to adequately assess contemporary mtDNA recombination in animals.

  20. Escherichia coli ArgR mutants defective in cer/Xer recombination, but not in DNA binding.

    Science.gov (United States)

    Sénéchal, Hélène; Delesques, Jérémy; Szatmari, George

    2010-04-01

    The Escherichia coli arginine repressor (ArgR) is an L-arginine-dependent DNA-binding protein that controls the expression of the arginine biosynthetic genes and is required as an accessory factor for Xer site-specific recombination at cer and related recombination sites in plasmids. We used the technique of pentapeptide scanning mutagenesis to isolate a series of ArgR mutants that were considerably reduced in cer recombination, but were still able to repress an argA::lacZ fusion. DNA sequence analysis showed that all of the mutants mapped to the same nucleotide, resulting in a five amino acid insertion between residues 149 and 150 of ArgR, corresponding to the end of the alpha6 helix. A truncated ArgR containing a stop codon at residue 150 displayed the same phenotype as the protein with the five amino acid insertion, and both mutants displayed sequence-specific DNA-binding activity that was L-arginine dependent. These results show that the C-terminus of ArgR is more important in cer/Xer site-specific recombination than in DNA binding.

  1. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats

    OpenAIRE

    Warmerdam, Daniël O.; van den Berg, Jeroen; Medema, René H.

    2016-01-01

    rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of b...

  2. Bicarbonate-dependent secretion and proteolytic processing of recombinant myocilin.

    Directory of Open Access Journals (Sweden)

    José-Daniel Aroca-Aguilar

    Full Text Available Myocilin is an extracellular glycoprotein of poorly understood function. Mutations of this protein are involved in glaucoma, an optic neuropathy characterized by a progressive and irreversible visual loss and frequently associated with elevated intraocular pressure. We previously showed that recombinant myocilin undergoes an intracellular proteolytic processing by calpain II which cleaves the central region of the protein, releasing one N- and one C-terminal fragment. Myocilin cleavage is reduced by glaucoma mutations and it has been proposed to participate in intraocular pressure modulation. To identify possible factors regulating the proteolytic processing of recombinant myocilin, we used a cellular model in which we analyzed how different culture medium parameters (i.e., culture time, cell density, pH, bicarbonate concentration, etc. affect the presence of the extracellular C-terminal fragment. Extracellular bicarbonate depletion associated with culture medium acidification produced a reversible intracellular accumulation of full-length recombinant myocilin and incremented its intracellular proteolytic processing, raising the extracellular C-terminal fragment percentage. It was also determined that myocilin intracellular accumulation depends on its N-terminal region. These data suggest that aqueous humor bicarbonate variations could also modulate the secretion and cleavage of myocilin present in ocular tissues.

  3. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats

    NARCIS (Netherlands)

    Warmerdam, Daniel O.; van den Berg, Jeroen; Medema, Rene H.

    2016-01-01

    rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded

  4. FBH1 influences DNA replication fork stability and homologous recombination through ubiquitylation of RAD51

    DEFF Research Database (Denmark)

    Chu, Wai Kit; Payne, Miranda J; Beli, Petra

    2015-01-01

    Unscheduled homologous recombination (HR) can lead to genomic instability, which greatly increases the threat of neoplastic transformation in humans. The F-box DNA helicase 1 (FBH1) is a 3'-5' DNA helicase with a putative function as a negative regulator of HR. It is the only known DNA helicase t...

  5. AID-induced decrease in topoisomerase 1 induces DNA structural alteration and DNA cleavage for class switch recombination.

    Science.gov (United States)

    Kobayashi, Maki; Aida, Masatoshi; Nagaoka, Hitoshi; Begum, Nasim A; Kitawaki, Yoko; Nakata, Mikiyo; Stanlie, Andre; Doi, Tomomitsu; Kato, Lucia; Okazaki, Il-mi; Shinkura, Reiko; Muramatsu, Masamichi; Kinoshita, Kazuo; Honjo, Tasuku

    2009-12-29

    To initiate class switch recombination (CSR) activation-induced cytidine deaminase (AID) induces staggered nick cleavage in the S region, which lies 5' to each Ig constant region gene and is rich in palindromic sequences. Topoisomerase 1 (Top1) controls the supercoiling of DNA by nicking, rotating, and religating one strand of DNA. Curiously, Top1 reduction or AID overexpression causes the genomic instability. Here, we report that the inactivation of Top1 by its specific inhibitor camptothecin drastically blocked both the S region cleavage and CSR, indicating that Top1 is responsible for the S region cleavage in CSR. Surprisingly, AID expression suppressed Top1 mRNA translation and reduced its protein level. In addition, the decrease in the Top1 protein by RNA-mediated knockdown augmented the AID-dependent S region cleavage, as well as CSR. Furthermore, Top1 reduction altered DNA structure of the Smu region. Taken together, AID-induced Top1 reduction alters S region DNA structure probably to non-B form, on which Top1 can introduce nicks but cannot religate, resulting in S region cleavage.

  6. Senataxin plays an essential role with DNA damage response proteins in meiotic recombination and gene silencing.

    Directory of Open Access Journals (Sweden)

    Olivier J Becherel

    2013-04-01

    Full Text Available Senataxin, mutated in the human genetic disorder ataxia with oculomotor apraxia type 2 (AOA2, plays an important role in maintaining genome integrity by coordination of transcription, DNA replication, and the DNA damage response. We demonstrate that senataxin is essential for spermatogenesis and that it functions at two stages in meiosis during crossing-over in homologous recombination and in meiotic sex chromosome inactivation (MSCI. Disruption of the Setx gene caused persistence of DNA double-strand breaks, a defect in disassembly of Rad51 filaments, accumulation of DNA:RNA hybrids (R-loops, and ultimately a failure of crossing-over. Senataxin localised to the XY body in a Brca1-dependent manner, and in its absence there was incomplete localisation of DNA damage response proteins to the XY chromosomes and ATR was retained on the axial elements of these chromosomes, failing to diffuse out into chromatin. Furthermore persistence of RNA polymerase II activity, altered ubH2A distribution, and abnormal XY-linked gene expression in Setx⁻/⁻ revealed an essential role for senataxin in MSCI. These data support key roles for senataxin in coordinating meiotic crossing-over with transcription and in gene silencing to protect the integrity of the genome.

  7. The PCNA-associated protein PARI negatively regulates homologous recombination via the inhibition of DNA repair synthesis

    DEFF Research Database (Denmark)

    Burkovics, Peter; Dome, Lili; Juhasz, Szilvia

    2016-01-01

    to inhibit homologous recombination (HR) events. Here, we describe a biochemical mechanism in which PARI functions as an HR regulator after replication fork stalling and during double-strand break repair. In our reconstituted biochemical system, we show that PARI inhibits DNA repair synthesis during...... recombination events in a PCNA interaction-dependent way but independently of its UvrD-like helicase domain. In accordance, we demonstrate that PARI inhibits HR in vivo, and its knockdown suppresses the UV sensitivity of RAD18-depleted cells. Our data reveal a novel human regulatory mechanism that limits...

  8. 75 FR 31795 - Office of Biotechnology Activities; Recombinant DNA Research: Amended Notice of Meeting

    Science.gov (United States)

    2010-06-04

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health Office of Biotechnology Activities; Recombinant DNA Research: Amended Notice of Meeting ACTION: Notice of cancellation of... information. Dated: May 26, 2010. Jacqueline Corrigan-Curay, Acting Director, Office of Biotechnology...

  9. SAMHD1 Promotes DNA End Resection to Facilitate DNA Repair by Homologous Recombination

    Directory of Open Access Journals (Sweden)

    Waaqo Daddacha

    2017-08-01

    Full Text Available DNA double-strand break (DSB repair by homologous recombination (HR is initiated by CtIP/MRN-mediated DNA end resection to maintain genome integrity. SAMHD1 is a dNTP triphosphohydrolase, which restricts HIV-1 infection, and mutations are associated with Aicardi-Goutières syndrome and cancer. We show that SAMHD1 has a dNTPase-independent function in promoting DNA end resection to facilitate DSB repair by HR. SAMHD1 deficiency or Vpx-mediated degradation causes hypersensitivity to DSB-inducing agents, and SAMHD1 is recruited to DSBs. SAMHD1 complexes with CtIP via a conserved C-terminal domain and recruits CtIP to DSBs to facilitate end resection and HR. Significantly, a cancer-associated mutant with impaired CtIP interaction, but not dNTPase-inactive SAMHD1, fails to rescue the end resection impairment of SAMHD1 depletion. Our findings define a dNTPase-independent function for SAMHD1 in HR-mediated DSB repair by facilitating CtIP accrual to promote DNA end resection, providing insight into how SAMHD1 promotes genome integrity.

  10. Genetic recombination in escherichia coli and its relationship with DNA replication

    International Nuclear Information System (INIS)

    Siddiqui, O.

    1974-01-01

    Relationship of DNA replication with genetic recombination in Escherichia Coli was investigated by mating Hfr donors labelled with H 3 -thymine, C 13 and N 15 to C 13 N 15 labelled recipients. The DNA extracted from the zygotes was analysed on CsCl density gradients. The results show that all of the biparentally labelled DNA arises from the single strand insertions of the donor DNA. (M.G.B.)

  11. Establishment of Cre-mediated HBV recombinant cccDNA (rcccDNA) cell line for cccDNA biology and antiviral screening assays.

    Science.gov (United States)

    Wu, Min; Li, Jin; Yue, Lei; Bai, Lu; Li, Yaming; Chen, Jieliang; Zhang, Xiaonan; Yuan, Zhenghong

    2018-04-01

    Hepatitis B virus (HBV) covalently closed circular DNA (cccDNA), existing in hepatocyte nuclei as a stable minichromosome, plays a central role in the life cycle of the virus and permits the persistence of infection. Despite being essential for HBV infection, little is known about the molecular mechanisms of cccDNA formation, regulation and degradation, and there is no therapeutic agents directly targeting cccDNA, fore mostly due to the lack of robust, reliable and quantifiable HBV cccDNA models. In this study, combined the Cre/loxP and sleeping beauty transposons system, we established HepG2-derived cell lines integrated with 2-60 copies of monomeric HBV genome flanked by loxP sites (HepG2-HBV/loxP). After Cre expression via adenoviral transduction, 3.3-kb recombinant cccDNA (rcccDNA) bearing a chimeric intron can be produced in the nuclei of these HepG2-HBV/loxP cells. The rcccDNA could be accurately quantified by quantitative PCR using specific primers and cccDNA pool generated in this model could be easily detected by Southern blotting using the digoxigenin probe system. We demonstrated that the rcccDNA was epigenetically organized as the natural minichromosome and served as the template supporting pgRNA transcription and viral replication. As the expression of HBV S antigen (HBsAg) is dependent on the newly generated cccDNA, HBsAg is the surrogate marker of cccDNA. Additionally, the efficacies of 3 classes of anti-HBV agents were evaluated in HepG2-HBV/loxP cells and antiviral activities with different mechanisms were confirmed. These data collectively suggested that HepG2-HBV/loxP cell system will be powerful platform for studying cccDNA related biological mechanisms and developing novel cccDNA targeting drugs. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  12. DNA secondary structures are associated with recombination in major Plasmodium falciparum variable surface antigen gene families

    DEFF Research Database (Denmark)

    Sander, Adam F.; Lavstsen, Thomas; Rask, Thomas Salhøj

    2014-01-01

    falciparum-erythrocyte membrane protein 1 class on the infected erythrocyte surface. Recombination clearly generates var diversity, but the nature and control of the genetic exchanges involved remain unclear. By experimental and bioinformatic identification of recombination events and genome...... of recombination during DNA replication in P. falciparum sexual stages, and that these DSS-regulated genetic exchanges generate functional and diverse P. falciparum adhesion antigens. DSS-induced recombination may represent a common mechanism for optimizing the evolvability of virulence gene families in pathogens....

  13. Quantification and persistence of recombinant DNA of Roundup Ready corn and soybean in rotation.

    Science.gov (United States)

    Lerat, Sylvain; Gulden, Robert H; Hart, Miranda M; Powell, Jeff R; England, Laura S; Pauls, K Peter; Swanton, Clarence J; Klironomos, John N; Trevors, Jack T

    2007-12-12

    The presence of the recombinant cp4 epsps gene from Roundup Ready (RR) corn and RR soybean was quantified using real-time PCR in soil samples from a field experiment growing RR and conventional corn and soybean in rotation. RR corn and RR soybean cp4 epsps persisted in soil for up to 1 year after seeding. The concentration of recombinant DNA in soil peaked in July and August in RR corn and RR soybean plots, respectively. A small fraction of soil samples from plots seeded with conventional crops contained recombinant DNA, suggesting transgene dispersal by means of natural process or agricultural practices. This research will aid in the understanding of the persistence of recombinant DNA in agricultural cropping systems.

  14. Self-regulation of recombinant DNA technology in Japan in the 1970s.

    Science.gov (United States)

    Nagai, Hiroyuki; Nukaga, Yoshio; Saeki, Koji; Akabayashi, Akira

    2009-07-01

    Recombinant DNA technology was developed in the United States in the early 1970s. Leading scientists held an international Asilomar Conference in 1975 to examine the self regulation of recombinant DNA technology, followed by the U.S. National Institutes of Health drafting the Recombinant DNA Research Guidelines in 1976. The result of this conference significantly affected many nations, including Japan. However, there have been few historical studies on the self-regulation of recombinant technologies conducted by scientists and government officials in Japan. The purpose of this paper is to analyze how the Science Council of Japan, the Ministry of Education, Science adn Culture, and the Science and Technology Agency developed self-regulation policies for recombinant DNA technology in Japan in the 1970s. Groups of molecular biologist and geneticists played a key role in establishing guidelines in cooperation with government officials. Our findings suggest that self-regulation policies on recombinant DNA technology have influenced safety management for the life sciences and establishment of institutions for review in Japan.

  15. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats.

    Science.gov (United States)

    Warmerdam, Daniël O; van den Berg, Jeroen; Medema, René H

    2016-03-22

    rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of breaks in 45S rDNA, and this results in repeat loss. We identify the structural maintenance of chromosomes protein 5 (SMC5) as contributing to recombination-mediated repair of rDNA breaks. Together, our data demonstrate that SMC5-mediated recombination can lead to error-prone repair of 45S rDNA repeats, resulting in their loss and thereby reducing cellular viability. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Overproduction of single-stranded-DNA-binding protein specifically inhibits recombination of UV-irradiated bacteriophage DNA in Escherichia coli

    International Nuclear Information System (INIS)

    Moreau, P.L.

    1988-01-01

    Overproduction of single-stranded DNA (ssDNA)-binding protein (SSB) in uvr Escherichia coli mutants results in a wide range of altered phenotypes. (i) Cell survival after UV irradiation is decreased; (ii) expression of the recA-lexA regulon is slightly reduced after UV irradiation, whereas it is increased without irradiation; and (iii) recombination of UV-damaged lambda DNA is inhibited, whereas recombination of nonirradiated DNA is unaffected. These results are consistent with the idea that in UV-damaged bacteria, SSB is first required to allow the formation of short complexes of RecA protein and ssDNA that mediate cleavage of the LexA protein. However, in a second stage, SSB should be displaced from ssDNA to permit the production of longer RecA-ssDNA nucleoprotein filaments that are required for strand pairing and, hence, recombinational repair. Since bacteria overproducing SSB appear identical in physiological respects to recF mutant bacteria, it is suggested that the RecF protein (alone or with other proteins of the RecF pathway) may help RecA protein to release SSB from ssDNA

  17. DNA degradation and reduced recombination following UV irradiation during meiosis in yeast (Saccharomyces cerevisiae)

    International Nuclear Information System (INIS)

    Salts, Y.; Pinon, R.; Simchen, G.

    1976-01-01

    Irradiation of meiotic yeast cells with moderate doses of ultraviolet irradiation (1,600 erg/mm 2 ) leads to the arrest of premeiotic DNA synthesis, massive (5-40%) DNA degradation, and a 40-50% loss of cell viability. In contrast, such doses of UV irradiation had a minor effect on viability (15-20% loss) of logarithmically growing cells, and no comparable DNA degradation was observed in irradiated synchronized vegetative cells. Meiotic recombination is also affected by UV irradiation. When administered at a stage comparable to meiotic prophase, low doses of irradiation result in a reduction in recombination frequency without significantly affecting cell viability. (orig.) [de

  18. Inhibitors of the proteasome suppress homologous DNA recombination in mammalian cells.

    Science.gov (United States)

    Murakawa, Yasuhiro; Sonoda, Eiichiro; Barber, Louise J; Zeng, Weihua; Yokomori, Kyoko; Kimura, Hiroshi; Niimi, Atsuko; Lehmann, Alan; Zhao, Guang Yu; Hochegger, Helfrid; Boulton, Simon J; Takeda, Shunichi

    2007-09-15

    Proteasome inhibitors are novel antitumor agents against multiple myeloma and other malignancies. Despite the increasing clinical application, the molecular basis of their antitumor effect has been poorly understood due to the involvement of the ubiquitin-proteasome pathway in multiple cellular metabolisms. Here, we show that treatment of cells with proteasome inhibitors has no significant effect on nonhomologous end joining but suppresses homologous recombination (HR), which plays a key role in DNA double-strand break (DSB) repair. In this study, we treat human cells with proteasome inhibitors and show that the inhibition of the proteasome reduces the efficiency of HR-dependent repair of an artificial HR substrate. We further show that inhibition of the proteasome interferes with the activation of Rad51, a key factor for HR, although it does not affect the activation of ATM, gammaH2AX, or Mre11. These data show that the proteasome-mediated destruction is required for the promotion of HR at an early step. We suggest that the defect in HR-mediated DNA repair caused by proteasome inhibitors contributes to antitumor effect, as HR plays an essential role in cellular proliferation. Moreover, because HR plays key roles in the repair of DSBs caused by chemotherapeutic agents such as cisplatin and by radiotherapy, proteasome inhibitors may enhance the efficacy of these treatments through the suppression of HR-mediated DNA repair pathways.

  19. Spin dependent surface recombination in silicon p-n junctions: the effect of irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Kaplan, D [Laboratoire Central de Recherches, 91 - Corbeville par Orsay (France); Pepper, M [Cambridge Univ. (UK). Cavendish Lab.

    1980-06-01

    The results are presented of an investigation of spin dependent recombination in (100) oriented, gate controlled Si diodes irradiated by 30 keV electrons. After irradiation, recombination at the Si-SiO/sub 2/ interface is increased, and saturation of the spin resonance increases the diode forward current by 5 parts in 10/sup 4/. The results cannot be described by a conventional Shockley-Read recombination model. An alternative picture is proposed involving recombination between trapped electrons and trapped holes.

  20. An att site-based recombination reporter system for genome engineering and synthetic DNA assembly.

    Science.gov (United States)

    Bland, Michael J; Ducos-Galand, Magaly; Val, Marie-Eve; Mazel, Didier

    2017-07-14

    Direct manipulation of the genome is a widespread technique for genetic studies and synthetic biology applications. The tyrosine and serine site-specific recombination systems of bacteriophages HK022 and ΦC31 are widely used for stable directional exchange and relocation of DNA sequences, making them valuable tools in these contexts. We have developed site-specific recombination tools that allow the direct selection of recombination events by embedding the attB site from each system within the β-lactamase resistance coding sequence (bla). The HK and ΦC31 tools were developed by placing the attB sites from each system into the signal peptide cleavage site coding sequence of bla. All possible open reading frames (ORFs) were inserted and tested for recombination efficiency and bla activity. Efficient recombination was observed for all tested ORFs (3 for HK, 6 for ΦC31) as shown through a cointegrate formation assay. The bla gene with the embedded attB site was functional for eight of the nine constructs tested. The HK/ΦC31 att-bla system offers a simple way to directly select recombination events, thus enhancing the use of site-specific recombination systems for carrying out precise, large-scale DNA manipulation, and adding useful tools to the genetics toolbox. We further show the power and flexibility of bla to be used as a reporter for recombination.

  1. ATP-dependent chromatin remodeling in the DNA-damage response

    Directory of Open Access Journals (Sweden)

    Lans Hannes

    2012-01-01

    Full Text Available Abstract The integrity of DNA is continuously challenged by metabolism-derived and environmental genotoxic agents that cause a variety of DNA lesions, including base alterations and breaks. DNA damage interferes with vital processes such as transcription and replication, and if not repaired properly, can ultimately lead to premature aging and cancer. Multiple DNA pathways signaling for DNA repair and DNA damage collectively safeguard the integrity of DNA. Chromatin plays a pivotal role in regulating DNA-associated processes, and is itself subject to regulation by the DNA-damage response. Chromatin influences access to DNA, and often serves as a docking or signaling site for repair and signaling proteins. Its structure can be adapted by post-translational histone modifications and nucleosome remodeling, catalyzed by the activity of ATP-dependent chromatin-remodeling complexes. In recent years, accumulating evidence has suggested that ATP-dependent chromatin-remodeling complexes play important, although poorly characterized, roles in facilitating the effectiveness of the DNA-damage response. In this review, we summarize the current knowledge on the involvement of ATP-dependent chromatin remodeling in three major DNA repair pathways: nucleotide excision repair, homologous recombination, and non-homologous end-joining. This shows that a surprisingly large number of different remodeling complexes display pleiotropic functions during different stages of the DNA-damage response. Moreover, several complexes seem to have multiple functions, and are implicated in various mechanistically distinct repair pathways.

  2. Methotrexate induces DNA damage and inhibits homologous recombination repair in choriocarcinoma cells

    Directory of Open Access Journals (Sweden)

    Xie L

    2016-11-01

    Full Text Available Lisha Xie,1,* Tiancen Zhao,1,2,* Jing Cai,1 You Su,1 Zehua Wang,1 Weihong Dong1 1Department of Obstetrics and Gynecology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, 2Department of Obstetrics and Gynecology, Central Hospital of Wuhan, Wuhan, China *These authors contributed equally to this work Objective: The objective of this study was to investigate the mechanism of sensitivity to methotrexate (MTX in human choriocarcinoma cells regarding DNA damage response. Methods: Two choriocarcinoma cancer cell lines, JAR and JEG-3, were utilized in this study. An MTX-sensitive osteosarcoma cell line MG63, an MTX-resistant epithelial ovarian cancer cell line A2780 and an MTX-resistant cervical adenocarcinoma cell line Hela served as controls. Cell viability assay was carried out to assess MTX sensitivity of cell lines. MTX-induced DNA damage was evaluated by comet assay. Quantitative reverse transcription polymerase chain reaction was used to detect the mRNA levels of BRCA1, BRCA2, RAD51 and RAD52. The protein levels of γH2AX, RAD 51 and p53 were analyzed by Western blot. Results: Remarkable DNA strand breaks were observed in MTX-sensitive cell lines (JAR, JEG-3 and MG63 but not in MTX-resistant cancer cells (A2780 and Hela after 48 h of MTX treatment. Only in the choriocarcinoma cells, the expression of homologous recombination (HR repair gene RAD51 was dramatically suppressed by MTX in a dose- and time-dependent manner, accompanied with the increase in p53. Conclusion: The MTX-induced DNA strand breaks accompanied by deficiencies in HR repair may contribute to the hypersensitivity to chemotherapy in choriocarcinoma. Keywords: choriocarcinoma, chemotherapy hypersensitivity, DNA double-strand break, RAD51, p53

  3. The cell pole: the site of cross talk between the DNA uptake and genetic recombination machinery.

    Science.gov (United States)

    Kidane, Dawit; Ayora, Silvia; Sweasy, Joann B; Graumann, Peter L; Alonso, Juan C

    2012-01-01

    Natural transformation is a programmed mechanism characterized by binding of free double-stranded (ds) DNA from the environment to the cell pole in rod-shaped bacteria. In Bacillus subtilis some competence proteins, which process the dsDNA and translocate single-stranded (ss) DNA into the cytosol, recruit a set of recombination proteins mainly to one of the cell poles. A subset of single-stranded binding proteins, working as "guardians", protects ssDNA from degradation and limit the RecA recombinase loading. Then, the "mediators" overcome the inhibitory role of guardians, and recruit RecA onto ssDNA. A RecA·ssDNA filament searches for homology on the chromosome and, in a process that is controlled by "modulators", catalyzes strand invasion with the generation of a displacement loop (D-loop). A D-loop resolvase or "resolver" cleaves this intermediate, limited DNA replication restores missing information and a DNA ligase seals the DNA ends. However, if any step fails, the "rescuers" will repair the broken end to rescue chromosomal transformation. If the ssDNA does not share homology with resident DNA, but it contains information for autonomous replication, guardian and mediator proteins catalyze plasmid establishment after inhibition of RecA. DNA replication and ligation reconstitute the molecule (plasmid transformation). In this review, the interacting network that leads to a cross talk between proteins of the uptake and genetic recombination machinery will be placed into prospective.

  4. Recombination at DNA replication fork barriers is not universal and is differentially regulated by Swi1.

    Science.gov (United States)

    Pryce, David W; Ramayah, Soshila; Jaendling, Alessa; McFarlane, Ramsay J

    2009-03-24

    DNA replication stress has been implicated in the etiology of genetic diseases, including cancers. It has been proposed that genomic sites that inhibit or slow DNA replication fork progression possess recombination hotspot activity and can form potential fragile sites. Here we used the fission yeast, Schizosaccharomyces pombe, to demonstrate that hotspot activity is not a universal feature of replication fork barriers (RFBs), and we propose that most sites within the genome that form RFBs do not have recombination hotspot activity under nonstressed conditions. We further demonstrate that Swi1, the TIMELESS homologue, differentially controls the recombination potential of RFBs, switching between being a suppressor and an activator of recombination in a site-specific fashion.

  5. Regulatory Control of the Resolution of DNA Recombination Intermediates during Meiosis and Mitosis

    OpenAIRE

    Matos, Joao; Blanco, Miguel G.; Maslen, Sarah; Skehel, J. Mark; West, Stephen C.

    2011-01-01

    The efficient and timely resolution of DNA recombination intermediates is essential for bipolar chromosome segregation. Here, we show that the specialized chromosome segregation patterns of meiosis and mitosis, which require the coordination of recombination with cell-cycle progression, are achieved by regulating the timing of activation of two crossover-promoting endonucleases. In yeast meiosis, Mus81-Mms4 and Yen1 are controlled by phosphorylation events that lead to their sequential activa...

  6. DNA hybrids suggesting a recombination process repairing radiation-induced DNA double-strand breaks in Ehrlich Ascites tumor cells

    International Nuclear Information System (INIS)

    Barthel, H.R.

    1984-01-01

    The results presented suggest the possibility of repair of DNA double-strand breaks by recombination, at least in the S and G 2 -phases of the cell cycle, in mammalian cells. Further experiments with synchronized cell cultures will have to show whether this process may also occur in the G 1 -phase of the cell cycle. (orig./AJ) [de

  7. Role of teh Rad52 Amino-terminal DNA Binding Activity in DNA Strand Capture in Homologous Recombination

    DEFF Research Database (Denmark)

    Shi, Idina; Hallwyl, Swee Chuang Lim; Seong, Changhyun

    2009-01-01

    Saccharomyces cerevisiae Rad52 protein promotes homologous recombination by nucleating the Rad51 recombinase onto replication protein A-coated single-stranded DNA strands and also by directly annealing such strands. We show that the purified rad52-R70A mutant protein, with a compromised amino-ter...

  8. The role of DNA dependent protein kinase in synapsis of DNA ends

    NARCIS (Netherlands)

    E.P.W.C. Weterings (Eric); N.S. Verkaik (Nicole); H.T. Brüggenwirth (Hennie); D.C. van Gent (Dik); J.H.J. Hoeijmakers (Jan)

    2003-01-01

    textabstractDNA dependent protein kinase (DNA-PK) plays a central role in the non-homologous end-joining pathway of DNA double strand break repair. Its catalytic subunit (DNA-PK(CS)) functions as a serine/threonine protein kinase. We show that DNA-PK forms a stable complex at DNA termini that blocks

  9. Room temperature electrocompetent bacterial cells improve DNA transformation and recombineering efficiency.

    Science.gov (United States)

    Tu, Qiang; Yin, Jia; Fu, Jun; Herrmann, Jennifer; Li, Yuezhong; Yin, Yulong; Stewart, A Francis; Müller, Rolf; Zhang, Youming

    2016-04-20

    Bacterial competent cells are essential for cloning, construction of DNA libraries, and mutagenesis in every molecular biology laboratory. Among various transformation methods, electroporation is found to own the best transformation efficiency. Previous electroporation methods are based on washing and electroporating the bacterial cells in ice-cold condition that make them fragile and prone to death. Here we present simple temperature shift based methods that improve DNA transformation and recombineering efficiency in E. coli and several other gram-negative bacteria thereby economizing time and cost. Increased transformation efficiency of large DNA molecules is a significant advantage that might facilitate the cloning of large fragments from genomic DNA preparations and metagenomics samples.

  10. Analysis of the mycoplasma genome by recombinant DNA technology

    DEFF Research Database (Denmark)

    Christiansen, C; Frydenberg, Jane; Christiansen, G

    1984-01-01

    A library of DNA fragments from Mycoplasma sp. strain PG50 has been made in the vector pBR325. Analysis in Escherichia coli minicells of randomly picked clones from this library demonstrated that many plasmids can promote synthesis of mycoplasma protein in the E. coli genetic background. Screening....... The DNA sequence of 16S rRNA and the surrounding control regions has been determined....

  11. MEIOB targets single-strand DNA and is necessary for meiotic recombination.

    Directory of Open Access Journals (Sweden)

    Benoit Souquet

    Full Text Available Meiotic recombination is a mandatory process for sexual reproduction. We identified a protein specifically implicated in meiotic homologous recombination that we named: meiosis specific with OB domain (MEIOB. This protein is conserved among metazoan species and contains single-strand DNA binding sites similar to those of RPA1. Our studies in vitro revealed that both recombinant and endogenous MEIOB can be retained on single-strand DNA. Those in vivo demonstrated the specific expression of Meiob in early meiotic germ cells and the co-localization of MEIOB protein with RPA on chromosome axes. MEIOB localization in Dmc1 (-/- spermatocytes indicated that it accumulates on resected DNA. Homologous Meiob deletion in mice caused infertility in both sexes, due to a meiotic arrest at a zygotene/pachytene-like stage. DNA double strand break repair and homologous chromosome synapsis were impaired in Meiob (-/- meiocytes. Interestingly MEIOB appeared to be dispensable for the initial loading of recombinases but was required to maintain a proper number of RAD51 and DMC1 foci beyond the zygotene stage. In light of these findings, we propose that RPA and this new single-strand DNA binding protein MEIOB, are essential to ensure the proper stabilization of recombinases which is required for successful homology search and meiotic recombination.

  12. Homologous Recombination DNA Repair Genes Play a Critical Role in Reprogramming to a Pluripotent State

    Directory of Open Access Journals (Sweden)

    Federico González

    2013-03-01

    Full Text Available Induced pluripotent stem cells (iPSCs hold great promise for personalized regenerative medicine. However, recent studies show that iPSC lines carry genetic abnormalities, suggesting that reprogramming may be mutagenic. Here, we show that the ectopic expression of reprogramming factors increases the level of phosphorylated histone H2AX, one of the earliest cellular responses to DNA double-strand breaks (DSBs. Additional mechanistic studies uncover a direct role of the homologous recombination (HR pathway, a pathway essential for error-free repair of DNA DSBs, in reprogramming. This role is independent of the use of integrative or nonintegrative methods in introducing reprogramming factors, despite the latter being considered a safer approach that circumvents genetic modifications. Finally, deletion of the tumor suppressor p53 rescues the reprogramming phenotype in HR-deficient cells primarily through the restoration of reprogramming-dependent defects in cell proliferation and apoptosis. These mechanistic insights have important implications for the design of safer approaches to creating iPSCs.

  13. DNA homologous recombination factor SFR1 physically and functionally interacts with estrogen receptor alpha.

    Directory of Open Access Journals (Sweden)

    Yuxin Feng

    Full Text Available Estrogen receptor alpha (ERα, a ligand-dependent transcription factor, mediates the expression of its target genes by interacting with corepressors and coactivators. Since the first cloning of SRC1, more than 280 nuclear receptor cofactors have been identified, which orchestrate target gene transcription. Aberrant activity of ER or its accessory proteins results in a number of diseases including breast cancer. Here we identified SFR1, a protein involved in DNA homologous recombination, as a novel binding partner of ERα. Initially isolated in a yeast two-hybrid screen, the interaction of SFR1 and ERα was confirmed in vivo by immunoprecipitation and mammalian one-hybrid assays. SFR1 co-localized with ERα in the nucleus, potentiated ER's ligand-dependent and ligand-independent transcriptional activity, and occupied the ER binding sites of its target gene promoters. Knockdown of SFR1 diminished ER's transcriptional activity. Manipulating SFR1 expression by knockdown and overexpression revealed a role for SFR1 in ER-dependent and -independent cancer cell proliferation. SFR1 differs from SRC1 by the lack of an intrinsic activation function. Taken together, we propose that SFR1 is a novel transcriptional modulator for ERα and a potential target in breast cancer therapy.

  14. Resistance to radiation, recombination, repair of DNA and chromosome organisation

    International Nuclear Information System (INIS)

    Fletcher, H.L.

    1981-01-01

    The model advanced here proposes that death is caused by destructive lesions, mainly double-strand breaks, in all the inter-repairable copies so close together that recombination repair cannot function. Death is related to the exponential of dose where r is the number of copies of the genome. A graph of ln(-ln survival) against ln dose is used to produce a linear dose-survival relationship, the slope of which gives the number of inter-repairable copies of the genome (= number of hits per lethal event). In Ustilago maydis it seems that unless all the chromatids are broken within a few thousand base pairs all ds breaks are repaired. The size of this critical target is similar to the size of a gene. Meiotic pairing in fungi starts outside the genes, and it is therefore suggested that specific pairing sites between genes define the ends of the targets. The model also describes the radiation-induced death of Micrococcus radiodurans and Sacchromyces cerevisiae. Cultured mammalian cells also show a linear ln(-ln survival)/ln dose relationship with a slope of 1.5 showing that both 1st and 2nd order killing occured. Sublethal radiation induces recombination in heterozygous diploid U. maydis proportional to the square of the dose. Sister-chromatid repair is preferred. Polyploid yeast can only use pairs of chromosomes for repair, showing that chromosome pairing is required for recombination repair, and mitotic pairing is restricted to bivalents in the same way that meiotic pairing is. (orig./AJ)

  15. Resistance to radiation, recombination, repair of DNA and chromosome organisation

    Energy Technology Data Exchange (ETDEWEB)

    Fletcher, H L [East Anglia Univ., Norwich (UK). School of Biological Sciences

    1981-01-01

    The model advanced here proposes that death is caused by destructive lesions, mainly double-strand breaks, in all the inter-repairable copies so close together that recombination repair cannot function. Death is related to the exponential of dose where r is the number of copies of the genome. A graph of ln(-ln survival) against ln dose is used to produce a linear dose-survival relationship, the slope of which gives the number of inter-repairable copies of the genome (= number of hits per lethal event). In Ustilago maydis it seems that unless all the chromatids are broken within a few thousand base pairs all ds breaks are repaired. The size of this critical target is similar to the size of a gene. Meiotic pairing in fungi starts outside the genes, and it is therefore suggested that specific pairing sites between genes define the ends of the targets. The model also describes the radiation-induced death of Micrococcus radiodurans and Sacchromyces cerevisiae. Cultured mammalian cells also show a linear ln(-ln survival)/ln dose relationship with a slope of 1.5 showing that both 1st and 2nd order killing occured. Sublethal radiation induces recombination in heterozygous diploid U. maydis proportional to the square of the dose. Sister-chromatid repair is preferred. Polyploid yeast can only use pairs of chromosomes for repair, showing that chromosome pairing is required for recombination repair, and mitotic pairing is restricted to bivalents in the same way that meiotic pairing is.

  16. Development of a recombinant DNA assay system for the detection of genetic change in astronauts' cells

    International Nuclear Information System (INIS)

    Atchley, S.V.; Chen, D.J.C.; Strniste, G.F.; Walters, R.A.; Moyzis, R.K.

    1984-01-01

    We are developing a new recombinant DNA system for the detection and measurement of genetic change in humans caused by exposure to low level ionizing radiation. A unique feature of the method is the use of cloned repetitive DNA probes to assay human DNA for structural changes during or after irradiation. Repetitive sequences exist in different families. Collectively they constitute over 25% of the DNA in a human cell. Repeat families have between 10 and 500,000 members. We have constructed repetitive DNA sequence libraries using recombinant DNA techniques. From these libraries we have isolated and characterized individual repeats comprising 75 to 90% of the mass of human repetitive DNA. Repeats used in our assay system exist in tandem arrays in the genome. Perturbation of these sequences in a cell, followed by detection with a repeat probe, produces a new, multimeric ''ladder'' pattern on an autoradiogram. The repeat probe used in our initial study is complementary to 1% of human DNA. Therefore, the sensitivity of this method is several orders of magnitude better than existing assays. Preliminary evidence from human skin cells exposed to acute, low-dose x-ray treatments indicates that DNA is affected at a dose as low as 5R. The radiation doses used in this system are well within the range of doses received by astronauts during spaceflight missions. Due to its small material requirements, this technique could easily be adapted for use in space. 16 refs., 1 fig

  17. Recombiner

    International Nuclear Information System (INIS)

    Kikuchi, Nobuo.

    1983-01-01

    Purpose: To shorten the pre-heating time for a recombiner and obtain a uniform temperature distribution for the charged catalyst layer in a BWR type reactor. Constitution: A pre-heating heater is disposed to the outer periphery of a vessel for a recombiner packed with catalysts for recombining hydrogen and oxygen in gases flowing through a radioactive gaseous wastes processing system. Heat pipes for transmitting the heat applied to said container to the catalyst are disposed vertically and horizontally within the container. Different length of the heat pipes are combined. In this way, pre-heating time for the recombiner before the operation start and before the system switching can be shortened and the uniform pre-heating for the inside of the recombiner is also made possible. Further, heater control in the pre-heating can be carried out effectively and with ease. (Moriyama, K.)

  18. Temperature and carrier-density dependence of Auger and radiative recombination in nitride optoelectronic devices

    International Nuclear Information System (INIS)

    Kioupakis, Emmanouil; Yan, Qimin; Steiauf, Daniel; Van de Walle, Chris G

    2013-01-01

    Nitride light-emitting diodes are a promising solution for efficient solid-state lighting, but their performance at high power is affected by the efficiency-droop problem. Previous experimental and theoretical work has identified Auger recombination, a three-particle nonradiative carrier recombination mechanism, as the likely cause of the droop. In this work, we use first-principles calculations to elucidate the dependence of the radiative and Auger recombination rates on temperature, carrier density and quantum-well confinement. Our calculated data for the temperature dependence of the recombination coefficients are in good agreement with experiment and provide further validation on the role of Auger recombination in the efficiency reduction. Polarization fields and phase-space filling negatively impact device efficiency because they increase the operating carrier density at a given current density and increase the fraction of carriers lost to Auger recombination. (paper)

  19. Selection of LNA-containing DNA aptamers against recombinant human CD73

    DEFF Research Database (Denmark)

    Elle, Ida C; Karlsen, Kasper K; Terp, Mikkel G

    2015-01-01

    tested by surface plasmon resonance. Truncated variants of these aptamers and variants where the LNA nucleotides were substituted for the DNA equivalent also exhibited affinity for the recombinant CD73 in the low nanomolar range. In enzyme inhibition assays with recombinant CD73 the aptamer sequences......LNA-containing DNA aptamers against CD73 (human ecto-5'-nucleotidase), a protein frequently overexpressed in solid tumours, were isolated by SELEX. A pre-defined stem-loop library, containing LNA in the forward primer region, was enriched with CD73 binding sequences through six rounds of SELEX...... with recombinant his-tagged CD73 immobilised on anti-his plates. Enriched pools isolated from rounds one, three and six were subjected to next-generation sequencing and analysed for enrichment using custom bioinformatics software. The software identified aptamer sequences via the primers and then performed several...

  20. Are High School Students Ready for Recombinant DNA?: The UOP Experience.

    Science.gov (United States)

    Minch, Michael J.

    1989-01-01

    Discusses a three-week summer college honors course for talented high school juniors with three exams, lab six days a week, a research paper, field trips, and student panel discussions. Presents an overview of the course. Describes the lab which uses "E. coli" for DNA recombination. (MVL)

  1. The "Frankenplasmid" Lab: An Investigative Exercise for Teaching Recombinant DNA Methods

    Science.gov (United States)

    Dean, Derek M.; Wilder, Jason A.

    2011-01-01

    We describe an investigative laboratory module designed to give college undergraduates strong practical and theoretical experience with recombinant DNA methods within 3 weeks. After deducing restriction enzyme maps for two different plasmids, students ligate the plasmids together in the same reaction, transform "E. coli" with this mixture of…

  2. A simple DNA recombination screening method by RT-PCR as an alternative to Southern blot

    DEFF Research Database (Denmark)

    Albers, Eliene; Sbroggiò, Mauro; Martin Gonzalez, Javier

    2017-01-01

    The generation of genetically engineered mouse models (GEMMs), including knock-out (KO) and knock-in (KI) models, often requires genomic screening of many mouse ES cell (mESC) clones by Southern blot. The use of large targeting constructs facilitates the recombination of exogenous DNA in a specific...

  3. ATP- and NAD+-dependent DNA ligases share an essential function in the halophilic archaeon Haloferax volcanii

    DEFF Research Database (Denmark)

    Zhao, A.; Gray, F. C; MacNeill, S. A.

    2006-01-01

    DNA ligases join the ends of DNA molecules during replication, repair and recombination. ATP-dependent ligases are found predominantly in the eukarya and archaea whereas NAD+-dependent DNA ligases are found only in the eubacteria and in entomopoxviruses. Using the genetically tractable halophile....... volcanii also encodes an NAD+-dependent DNA ligase family member, LigN, the first such enzyme to be identified in the archaea, and present phylogenetic analysis indicating that the gene encoding this protein has been acquired by lateral gene transfer (LGT) from eubacteria. As with LigA, we show that Lig...

  4. Failure to induce a DNA repair gene, RAD54, in Saccharomyces cerevisiae does not affect DNA repair or recombination phenotypes

    International Nuclear Information System (INIS)

    Cole, G.M.; Mortimer, R.K.

    1989-01-01

    The Saccharomyces cerevisiae RAD54 gene is transcriptionally regulated by a broad spectrum of DNA-damaging agents. Induction of RAD54 by DNA-damaging agents is under positive control. Sequences responsible for DNA damage induction (the DRS element) lie within a 29-base-pair region from -99 to -70 from the most proximal transcription start site. This inducible promoter element is functionally separable from a poly(dA-dT) region immediately downstream which is required for constitutive expression. Deletions which eliminate induction of RAD54 transcription by DNA damage but do not affect constitutive expression have no effect on growth or survival of noninducible strains relative to wild-type strains in the presence of DNA-damaging agents. The DRS element is also not required for homothallic mating type switching, transcriptional induction of RAD54 during meiosis, meiotic recombination, or spontaneous or X-ray-induced mitotic recombination. We find no phenotype for a lack of induction of RAD54 message via the damage-inducible DRS, which raises significant questions about the physiology of DNA damage induction in S. cerevisiae

  5. Recombiner

    International Nuclear Information System (INIS)

    Osumi, Morimichi.

    1979-01-01

    Purpose: To provide a recombiner which is capable of converting hydrogen gas into water by use of high-frequency heating at comparatively low temperatures and is safe and cheap in cost. Constitution: Hydrogen gas is introduced from an outer pipeline to the main structure of a recombiner, and when it passes through the vicinity of the central part of the recombiner, it is reacted with copper oxide (CuO 2 ) heated to a temperature more than 300 0 C by a high-frequency heater, and converted gently into water by reduction operation (2H 2 + CuO 2 → Cu + 2H 2 O). The thus prepared water is exhausted through the outer pipeline to a suppression pool. A part of hydrogen gas which has not been converted completely into water by the reaction and is remaining as hydrogen is recovered through exhaust nozzles and again introduced into the main structure of the recombiner. (Yoshino, Y.)

  6. Characterization of DNA binding, transcriptional activation, and regulated nuclear association of recombinant human NFATp

    Directory of Open Access Journals (Sweden)

    Seto Anita G

    2000-11-01

    Full Text Available Abstract Background NFATp is one member of a family of transcriptional activators whose nuclear accumulation and hence transcriptional activity is regulated in mammalian cells. Human NFATp exists as a phosphoprotein in the cytoplasm of naive T cells. Upon antigen stimulation, NFATp is dephosphorylated, accumulates in nuclei, and functions to regulate transcription of genes including those encoding cytokines. While the properties of the DNA binding domain of NFATp have been investigated in detail, biochemical studies of the transcriptional activation and regulated association with nuclei have remained unexplored because of a lack of full length, purified recombinant NFATp. Results We developed methods for expressing and purifying full length recombinant human NFATp that has all of the properties known to be associated with native NFATp. The recombinant NFATp binds DNA on its own and cooperatively with AP-1 proteins, activates transcription in vitro, is phosphorylated, can be dephosphorylated by calcineurin, and exhibits regulated association with nuclei in vitro. Importantly, activation by recombinant NFATp in a reconstituted transcription system required regions of the protein outside of the central DNA binding domain. Conclusions We conclude that NFATp is a bona fide transcriptional activator. Moreover, the reagents and methods that we developed will facilitate future studies on the mechanisms of transcriptional activation and nuclear accumulation by NFATp, a member of an important family of transcriptional regulatory proteins.

  7. Expression of human DNA polymerase β in Escherichia coli and characterization of the recombinant enzyme

    International Nuclear Information System (INIS)

    Abbotts, J.; SenGupta, D.N.; Zmudzka, B.; Widen, S.G.; Notario, V.; Wilson, S.H.

    1988-01-01

    The coding region of a human β-polymerase cDNA, predicting a 335 amino acid protein, was subcloned in the Escherichia coli expression plasmid pRC23. After induction of transformed cells, the crude soluble extract was found to contain a new protein immunoreactive with β-polymerase antibody and corresponding in size to the protein deduced from the cDNA. This protein was purified in a yield of 1-2 mg/50 g of cells. The recombinant protein had about the same DNA polymerase specific activity as β-polymerase purified from mammalian tissues, and template-primer specificity and immunological properties of the recombinant polymerase were similar to those of natural β-polymerases. The purified enzyme was free of nuclease activity. The authors studied detailed catalytic properties of the recombinant β-polymerase using defined template-primer systems. The results indicate that this β-polymerase is essentially identical with natural β-polymerases. The recombinant enzyme is distributive in mode of synthesis and is capable of detecting changes in the integrity of the single-stranded template, such as methylated bases and a double-stranded region. The enzyme recognizes a template region four to seven bases downstream of the primer 3' end and utilizes alternative primers if this downstream template region is double stranded. The enzyme is unable to synthesize past methylated bases N 3 -methyl-dT or O 6 -methyl-dG

  8. Heterogeneous nuclear ribonucleoprotein B1 protein impairs DNA repair mediated through the inhibition of DNA-dependent protein kinase activity

    International Nuclear Information System (INIS)

    Iwanaga, Kentaro; Sueoka, Naoko; Sato, Akemi; Hayashi, Shinichiro; Sueoka, Eisaburo

    2005-01-01

    Heterogeneous nuclear ribonucleoprotein B1, an RNA binding protein, is overexpressed from the early stage of lung cancers; it is evident even in bronchial dysplasia, a premalignant lesion. We evaluated the proteins bound with hnRNP B1 and found that hnRNP B1 interacted with DNA-dependent protein kinase (DNA-PK) complex, and recombinant hnRNP B1 protein dose-dependently inhibited DNA-PK activity in vitro. To test the effect of hnRNP B1 on DNA repair, we performed comet assay after irradiation, using normal human bronchial epithelial (HBE) cells treated with siRNA for hnRNP A2/B1: reduction of hnRNP B1 treated with siRNA for hnRNP A2/B1 induced faster DNA repair in normal HBE cells. Considering these results, we assume that overexpression of hnRNP B1 occurring in the early stage of carcinogenesis inhibits DNA-PK activity, resulting in subsequent accumulation of erroneous rejoining of DNA double-strand breaks, causing tumor progression

  9. DNA-dependent protein kinase (DAN-PK), a key enzyme in the re-ligation of DNA double-strand breaks

    International Nuclear Information System (INIS)

    Hennequin, C.; Averbeck, D.

    1999-01-01

    Repair pathways of DNA are now defined and some important findings have been discovered in the last few years. DNA non-homologous end-joining (NEH) is a crucial process in the repair of radiation-induced double-strand breaks (DSBs). NHEj implies at least three steps: the DNA free-ends must get closer, preparation of the free-ends by exonucleases and then a transient hybridization in a region of DNA with weak homology. DNA-dependent protein kinase (DNA-PK) is the key enzyme in this process. DNA-PK is a nuclear serine/threonine kinase that comprises three components: a catalytic subunit (DNA-PK cs ) and two regulatory subunits, DNA-binding proteins, Ku80 and Ku70. The severe combined immuno-deficient (scid) mice are deficient in DNA-PK cs : this protein is involved both in DNA repair and in the V(D)J recombination of immunoglobulin and T-cell receptor genes. It is a protein-kinase of the P13-kinase family and which can phosphorylate Ku proteins, p53 and probably some other proteins still unknown. DNA-PK is an important actor of DSBs repair (induced by ionising radiations or by drugs like etoposide), but obviously it is not the only mechanism existing in the cell for this function. Some others, like homologous recombination, seem also to have a great importance for cell survival. (authors)

  10. Comparative Genomics of DNA Recombination and Repair in Cyanobacteria: Biotechnological Implications

    Science.gov (United States)

    Cassier-Chauvat, Corinne; Veaudor, Théo; Chauvat, Franck

    2016-01-01

    Cyanobacteria are fascinating photosynthetic prokaryotes that are regarded as the ancestors of the plant chloroplast; the purveyors of oxygen and biomass for the food chain; and promising cell factories for an environmentally friendly production of chemicals. In colonizing most waters and soils of our planet, cyanobacteria are inevitably challenged by environmental stresses that generate DNA damages. Furthermore, many strains engineered for biotechnological purposes can use DNA recombination to stop synthesizing the biotechnological product. Hence, it is important to study DNA recombination and repair in cyanobacteria for both basic and applied research. This review reports what is known in a few widely studied model cyanobacteria and what can be inferred by mining the sequenced genomes of morphologically and physiologically diverse strains. We show that cyanobacteria possess many E. coli-like DNA recombination and repair genes, and possibly other genes not yet identified. E. coli-homolog genes are unevenly distributed in cyanobacteria, in agreement with their wide genome diversity. Many genes are extremely well conserved in cyanobacteria (mutMS, radA, recA, recFO, recG, recN, ruvABC, ssb, and uvrABCD), even in small genomes, suggesting that they encode the core DNA repair process. In addition to these core genes, the marine Prochlorococcus and Synechococcus strains harbor recBCD (DNA recombination), umuCD (mutational DNA replication), as well as the key SOS genes lexA (regulation of the SOS system) and sulA (postponing of cell division until completion of DNA reparation). Hence, these strains could possess an E. coli-type SOS system. In contrast, several cyanobacteria endowed with larger genomes lack typical SOS genes. For examples, the two studied Gloeobacter strains lack alkB, lexA, and sulA; and Synechococcus PCC7942 has neither lexA nor recCD. Furthermore, the Synechocystis PCC6803 lexA product does not regulate DNA repair genes. Collectively, these findings

  11. Construction of a trivalent candidate vaccine against Shigella species with DNA recombination

    Institute of Scientific and Technical Information of China (English)

    王恒樑; 冯尔玲; 林云; 廖翔; 金明; 黄留玉; 苏国富; 黄翠芬

    2002-01-01

    In this work asd gene of Shigella flexneri 2a strain T32 was replaced by Vibrio cholerae toxin B subunit (ctxB) gene with DNA recombination in vivo and in vitro. The resulting derivative of T32, designed as FWL01, could stably express CtxB, but its growth in LB medium depended on the presence of diaminopimelic acid (DAP). Then form I plasmid of Shigella sonnei strain S7 was labeled with strain T32 asd gene and mobilized into FWL01. Thus a trivalent candidate oral vaccine strain, designed as FSW01, was constructed. In this candidate strain, a balanced-lethal system was constituted between the host strain and the form I plasmid expressing S. sonnei O antigen. Therefore the candidate strain can express stably not only its own O antigen but also CtxB and O antigen of S. sonnei in the absence of any antibiotic. Experiments showed that FSW01 did not invade HeLa cells or cause keratoconjunctivitis in guinea pigs. However, rabbits immunized FSW01 can elicit significant immune responses. In mice and rhesus monkey models, vaccinated animals were protected against the challenges of wild S. flexneri 2a strain 2457T and S. sonnei strain S9.

  12. Excision of HIV-1 proviral DNA by recombinant cell permeable tre-recombinase.

    Directory of Open Access Journals (Sweden)

    Lakshmikanth Mariyanna

    Full Text Available Over the previous years, comprehensive studies on antiretroviral drugs resulted in the successful introduction of highly active antiretroviral therapy (HAART into clinical practice for treatment of HIV/AIDS. However, there is still need for new therapeutic approaches, since HAART cannot eradicate HIV-1 from the infected organism and, unfortunately, can be associated with long-term toxicity and the development of drug resistance. In contrast, novel gene therapy strategies may have the potential to reverse the infection by eradicating HIV-1. For example, expression of long terminal repeat (LTR-specific recombinase (Tre-recombinase has been shown to result in chromosomal excision of proviral DNA and, in consequence, in the eradication of HIV-1 from infected cell cultures. However, the delivery of Tre-recombinase currently depends on the genetic manipulation of target cells, a process that is complicating such therapeutic approaches and, thus, might be undesirable in a clinical setting. In this report we demonstrate that E.coli expressed Tre-recombinases, tagged either with the protein transduction domain (PTD from the HIV-1 Tat trans-activator or the translocation motif (TLM of the Hepatitis B virus PreS2 protein, were able to translocate efficiently into cells and showed significant recombination activity on HIV-1 LTR sequences. Tre activity was observed using episomal and stable integrated reporter constructs in transfected HeLa cells. Furthermore, the TLM-tagged enzyme was able to excise the full-length proviral DNA from chromosomal integration sites of HIV-1-infected HeLa and CEM-SS cells. The presented data confirm Tre-recombinase activity on integrated HIV-1 and provide the basis for the non-genetic transient application of engineered recombinases, which may be a valuable component of future HIV eradication strategies.

  13. Molecular mechanisms of mutagenesis determined by the recombinant DNA technology

    International Nuclear Information System (INIS)

    Lee, W.R.

    1985-01-01

    A study of the alteration of the DNA in the mutant gene can determine mechanisms of mutation by distinguishing between mutations induced by transition, transversion, frameshifts of a single base and deletions involving many base pairs. The association of a specific pattern of response with a mutagen will permit detecting mutants induced by the mutagen with a reduced background by removing mutations induced by other mechanisms from the pool of potential mutants. From analyses of studies that have been conducted, it is quite apparent that there are substantial differences among mutagens in their modes of action. Of 31 x-ray induced mutants, 20 were large deletions while only 3 showed normal Southern blots. Only one mutant produced a sub-unit polypeptide of normal molecular weight and charge in the in vivo test whereas in vitro synthesis produced a second one. In contrast, nine of thirteen EMS induced mutants produced cross-reacting proteins with sub-unit polypeptide molecular weights equivalent to wild type. Two of three ENU induced mutants recently analyzed in our laboratory produced protein with sub-unit polypeptide molecular weight and electrical charge similar to the wild type stock in which the mutants were induced. One ENU induced mutation is a large deletion. 21 refs., 1 fig

  14. Tomato protoplast DNA transformation : physical linkage and recombination of exogenous DNA sequences

    NARCIS (Netherlands)

    Jongsma, Maarten; Koornneef, Maarten; Zabel, Pim; Hille, Jacques

    1987-01-01

    Tomato protoplasts have been transformed with plasmid DNA's, containing a chimeric kanamycin resistance gene and putative tomato origins of replication. A calcium phosphate-DNA mediated transformation procedure was employed in combination with either polyethylene glycol or polyvinyl alcohol. There

  15. Specific modifications of histone tails, but not DNA methylation, mirror the temporal variation of mammalian recombination hotspots.

    Science.gov (United States)

    Zeng, Jia; Yi, Soojin V

    2014-10-16

    Recombination clusters nonuniformly across mammalian genomes at discrete genomic loci referred to as recombination hotspots. Despite their ubiquitous presence, individual hotspots rapidly lose their activities, and the molecular and evolutionary mechanisms underlying such frequent hotspot turnovers (the so-called "recombination hotspot paradox") remain unresolved. Even though some sequence motifs are significantly associated with hotspots, multiple lines of evidence indicate that factors other than underlying sequences, such as epigenetic modifications, may affect the evolution of recombination hotspots. Thus, identifying epigenetic factors that covary with recombination at fine-scale is a promising step for this important research area. It was previously reported that recombination rates correlate with indirect measures of DNA methylation in the human genome. Here, we analyze experimentally determined DNA methylation and histone modification of human sperms, and show that the correlation between DNA methylation and recombination in long-range windows does not hold with respect to the spatial and temporal variation of recombination at hotspots. On the other hand, two histone modifications (H3K4me3 and H3K27me3) overlap extensively with recombination hotspots. Similar trends were observed in mice. These results indicate that specific histone modifications rather than DNA methylation are associated with the rapid evolution of recombination hotspots. Furthermore, many human recombination hotspots occupy "bivalent" chromatin regions that harbor both active (H3K4me3) and repressive (H3K27me3) marks. This may explain why human recombination hotspots tend to occur in nongenic regions, in contrast to yeast and Arabidopsis hotspots that are characterized by generally active chromatins. Our results highlight the dynamic epigenetic underpinnings of recombination hotspot evolution. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for

  16. Hands on Group Work Paper Model for Teaching DNA Structure, Central Dogma and Recombinant DNA

    Science.gov (United States)

    Altiparmak, Melek; Nakiboglu Tezer, Mahmure

    2009-01-01

    Understanding life on a molecular level is greatly enhanced when students are given the opportunity to visualize the molecules. Especially understanding DNA structure and function is essential for understanding key concepts of molecular biology such as DNA, central dogma and the manipulation of DNA. Researches have shown that undergraduate…

  17. Rev1 Recruits Ung to Switch Regions and Enhances dU Glycosylation for Immunoglobulin Class Switch DNA Recombination

    Directory of Open Access Journals (Sweden)

    Hong Zan

    2012-11-01

    Full Text Available By diversifying the biological effector functions of antibodies, class switch DNA recombination (CSR plays a critical role in the maturation of the immune response. It is initiated by activation-induced cytidine deaminase (AID-mediated deoxycytosine deamination, yielding deoxyuridine (dU, and dU glycosylation by uracil DNA glycosylase (Ung in antibody switch (S region DNA. Here we showed that the translesion DNA synthesis polymerase Rev1 directly interacted with Ung and targeted in an AID-dependent and Ung-independent fashion the S regions undergoing CSR. Rev1−/− Ung+/+ B cells reduced Ung recruitment to S regions, DNA-dU glycosylation, and CSR. Together with an S region spectrum of mutations similar to that of Rev1+/+ Ung−/− B cells, this suggests that Rev1 operates in the same pathway as Ung, as emphasized by further decreased CSR in Rev1−/− Msh2−/− B cells. Rescue of CSR in Rev1−/− B cells by a catalytically inactive Rev1 mutant shows that the important role of Rev1 in CSR is mediated by Rev1’s scaffolding function, not its enzymatic function.

  18. Quantification and Sequencing of Crossover Recombinant Molecules from Arabidopsis Pollen DNA.

    Science.gov (United States)

    Choi, Kyuha; Yelina, Nataliya E; Serra, Heïdi; Henderson, Ian R

    2017-01-01

    During meiosis, homologous chromosomes undergo recombination, which can result in formation of reciprocal crossover molecules. Crossover frequency is highly variable across the genome, typically occurring in narrow hotspots, which has a significant effect on patterns of genetic diversity. Here we describe methods to measure crossover frequency in plants at the hotspot scale (bp-kb), using allele-specific PCR amplification from genomic DNA extracted from the pollen of F 1 heterozygous plants. We describe (1) titration methods that allow amplification, quantification and sequencing of single crossover molecules, (2) quantitative PCR methods to more rapidly measure crossover frequency, and (3) application of high-throughput sequencing for study of crossover distributions within hotspots. We provide detailed descriptions of key steps including pollen DNA extraction, prior identification of hotspot locations, allele-specific oligonucleotide design, and sequence analysis approaches. Together, these methods allow the rate and recombination topology of plant hotspots to be robustly measured and compared between varied genetic backgrounds and environmental conditions.

  19. Top3 processes recombination intermediates and modulates checkpoint activity after DNA damage

    DEFF Research Database (Denmark)

    Mankouri, Hocine W; Hickson, Ian D

    2006-01-01

    Mutation of TOP3 in Saccharomyces cerevisiae causes poor growth, hyperrecombination, and a failure to fully activate DNA damage checkpoints in S phase. Here, we report that overexpression of a dominant-negative allele of TOP3, TOP3(Y356F), which lacks the catalytic (decatenation) activity of Top3......, the catalytic activity of Top3 is not required for DNA damage checkpoint activation, but it is required for normal S-phase progression after DNA damage. We also present evidence that the checkpoint-mediated cell cycle delay and persistence of X-shaped DNA molecules resulting from overexpression of TOP3(Y356F......) are downstream of Rad51 function. We propose that Top3 functions in S phase to both process homologous recombination intermediates and modulate checkpoint activity....

  20. The use of recombinant DNA technology for the development of a bluetongue virus subunit vaccine

    International Nuclear Information System (INIS)

    Huismans, H.

    1985-01-01

    The double-standed RNA gene coding for the surface antigen responsible for inducing neutralising anti-bodies has been isolated, converted to DNA, and cloned in the plasmid pBR322. So far, only plasmids containing inserts smaller than the gene have been obtained. The recombinant plasmids were isolated by screening for specific antibiotic resistance markers and characterized by size, restriction enzymes and hybridization with a 32 P-labelled DNA probe made with BTV-m RNA as template. Possible strategies for the development of a bluetongue virus submit vaccine are discussed

  1. Formation of (DNA)2-LNA triplet with recombinant base recognition: A quantum mechanical study

    Science.gov (United States)

    Mall, Vijaya Shri; Tiwari, Rakesh Kumar

    2018-05-01

    The formation of DNA triple helix offers the verity of new possibilities in molecular biology. However its applications are limited to purine and pyrimidine rich sequences recognized by forming Hoogsteen/Reverse Hoogsteen triplets in major groove sites of DNA duplex. To overcome this drawback modification in bases backbone and glucose of nucleotide unit of DNA have been proposed so that the third strand base recognized by both the bases of DNA duplex by forming Recombinant type(R-type) of bonding in mixed sequences. Here we performed Quanrum Mechanical (Hartree-Fock and DFT) methodology on natural DNA and Locked Nucleic Acids(LNA) triplets using 6-31G and some other new advance basis sets. Study suggests energetically stable conformation has been observed for recombinant triplets in order of G-C*G > A-T*A > G-C*C > T-A*T for both type of triplets. Interestingly LNA leads to more stable conformation in all set of triplets, clearly suggests an important biological tool to overcome above mentioned drawbacks.

  2. Recombiner

    International Nuclear Information System (INIS)

    Saalfrank, H.

    1985-01-01

    Air containing hydrogen can be oxidized by heating in a container called a recombiner, in order to avoid the collection of hydrogen. The container is long and a large number of straight heating bars are arranged in parallel in it and they are flanged to a lid. The heating bars are surrounded by tubes, in order to obtain good heat transfer by a narrow annular gap. (orig.) [de

  3. Efficient generation of recombinant RNA viruses using targeted recombination-mediated mutagenesis of bacterial artificial chromosomes containing full-length cDNA

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Risager, Peter Christian; Fahnøe, Ulrik

    2013-01-01

    Background Infectious cDNA clones are a prerequisite for directed genetic manipulation of RNA viruses. Here, a strategy to facilitate manipulation and rescue of classical swine fever viruses (CSFVs) from full-length cDNAs present within bacterial artificial chromosomes (BACs) is described....... This strategy allows manipulation of viral cDNA by targeted recombination-mediated mutagenesis within bacteria. Results A new CSFV-BAC (pBeloR26) derived from the Riems vaccine strain has been constructed and subsequently modified in the E2 coding sequence, using the targeted recombination strategy to enable...

  4. A BAC-bacterial recombination method to generate physically linked multiple gene reporter DNA constructs

    Directory of Open Access Journals (Sweden)

    Gong Shiaochin

    2009-03-01

    Full Text Available Abstract Background Reporter gene mice are valuable animal models for biological research providing a gene expression readout that can contribute to cellular characterization within the context of a developmental process. With the advancement of bacterial recombination techniques to engineer reporter gene constructs from BAC genomic clones and the generation of optically distinguishable fluorescent protein reporter genes, there is an unprecedented capability to engineer more informative transgenic reporter mouse models relative to what has been traditionally available. Results We demonstrate here our first effort on the development of a three stage bacterial recombination strategy to physically link multiple genes together with their respective fluorescent protein (FP reporters in one DNA fragment. This strategy uses bacterial recombination techniques to: (1 subclone genes of interest into BAC linking vectors, (2 insert desired reporter genes into respective genes and (3 link different gene-reporters together. As proof of concept, we have generated a single DNA fragment containing the genes Trap, Dmp1, and Ibsp driving the expression of ECFP, mCherry, and Topaz FP reporter genes, respectively. Using this DNA construct, we have successfully generated transgenic reporter mice that retain two to three gene readouts. Conclusion The three stage methodology to link multiple genes with their respective fluorescent protein reporter works with reasonable efficiency. Moreover, gene linkage allows for their common chromosomal integration into a single locus. However, the testing of this multi-reporter DNA construct by transgenesis does suggest that the linkage of two different genes together, despite their large size, can still create a positional effect. We believe that gene choice, genomic DNA fragment size and the presence of endogenous insulator elements are critical variables.

  5. A BAC-bacterial recombination method to generate physically linked multiple gene reporter DNA constructs.

    Science.gov (United States)

    Maye, Peter; Stover, Mary Louise; Liu, Yaling; Rowe, David W; Gong, Shiaochin; Lichtler, Alexander C

    2009-03-13

    Reporter gene mice are valuable animal models for biological research providing a gene expression readout that can contribute to cellular characterization within the context of a developmental process. With the advancement of bacterial recombination techniques to engineer reporter gene constructs from BAC genomic clones and the generation of optically distinguishable fluorescent protein reporter genes, there is an unprecedented capability to engineer more informative transgenic reporter mouse models relative to what has been traditionally available. We demonstrate here our first effort on the development of a three stage bacterial recombination strategy to physically link multiple genes together with their respective fluorescent protein (FP) reporters in one DNA fragment. This strategy uses bacterial recombination techniques to: (1) subclone genes of interest into BAC linking vectors, (2) insert desired reporter genes into respective genes and (3) link different gene-reporters together. As proof of concept, we have generated a single DNA fragment containing the genes Trap, Dmp1, and Ibsp driving the expression of ECFP, mCherry, and Topaz FP reporter genes, respectively. Using this DNA construct, we have successfully generated transgenic reporter mice that retain two to three gene readouts. The three stage methodology to link multiple genes with their respective fluorescent protein reporter works with reasonable efficiency. Moreover, gene linkage allows for their common chromosomal integration into a single locus. However, the testing of this multi-reporter DNA construct by transgenesis does suggest that the linkage of two different genes together, despite their large size, can still create a positional effect. We believe that gene choice, genomic DNA fragment size and the presence of endogenous insulator elements are critical variables.

  6. Construction of recombinant adenovirus with Egr-1 promoter and Smad7 cDNA and study of the Egr-1 promoter's biological activity

    International Nuclear Information System (INIS)

    Cai Xuwei; Fu Xiaolong; Yang Jian; Song Houyan

    2005-01-01

    Objective: To construct a recombinant replication-defective adenovirus containing Egr-1 promoter and Smad7 cDNA, then to evaluate the biological activity of Egr-1 promoter. Methods: Based on Adeno- X TM expression system, CMV promoter of the pShuttle vector was replaced by Egr-1 promoter, and the Smad7 cDNA was subcloned into the MCS(multiple cloning site) of pShuttle. The recombinant pShuttle was then sub-cloned into the Adeno-X TM genome, which was transformed into E. coli to get recombinant Adeno-X TM plasmid DNA. The recombinant adenovirus was packaged and amplified in the transfected HEK293 cells before it was purified and tested for viral titer. The fibroblasts (3T6 cells) infected by the recombinant adenovirus were irradiated , and the activity of Egr-1 promoter was quantitively determined by the amount of Smad7 protein expressed in the 3T6 cells using Western blot. Results: Identified by restriction endonuclease analysis and PCR, the recombinant adenovirus containing Egr-1 promoter and Smad7 cDNA was constructed successfully, with a viral titer of 1.0 x 10 11 TCID 50 /ml. The expressed amount of Smad7 protein varied at different dose levels and different time points post-irradiation in the 3T6 cells infected with the recombinant adenovirus. The amount of Smad7 protein increased along with the rising of the irradiation dose, and remained at a high expression level from 8 Gy to 15 Gy. The amount of Smad7 protein started to increase at 2 hours post-irradiation, and maintained a relatively high level for the next 5 hours before it descended, which was not observed in the control 3T6 cells. Conclusions: With the aid of Adeno-X TM expression system and molecular cloning techniques, construction of recombinant adenovirus could be quick and efficient. The recombined Egr-1 promoter has the activity of regulating the expression of downstream Smad7 cDNA. The increase in Smad7 expression under control of Egr-1 promoter induced by ionizing radiation is time- and dose-dependent

  7. Active site electrostatics protect genome integrity by blocking abortive hydrolysis during DNA recombination

    Science.gov (United States)

    Ma, Chien-Hui; Rowley, Paul A; Macieszak, Anna; Guga, Piotr; Jayaram, Makkuni

    2009-01-01

    Water, acting as a rogue nucleophile, can disrupt transesterification steps of important phosphoryl transfer reactions in DNA and RNA. We have unveiled this risk, and identified safeguards instituted against it, during strand cleavage and joining by the tyrosine site-specific recombinase Flp. Strand joining is threatened by a latent Flp endonuclease activity (type I) towards the 3′-phosphotyrosyl intermediate resulting from strand cleavage. This risk is not alleviated by phosphate electrostatics; neutralizing the negative charge on the scissile phosphate through methylphosphonate (MeP) substitution does not stimulate type I endonuclease. Rather, protection derives from the architecture of the recombination synapse and conformational dynamics within it. Strand cleavage is protected against water by active site electrostatics. Replacement of the catalytic Arg-308 of Flp by alanine, along with MeP substitution, elicits a second Flp endonuclease activity (type II) that directly targets the scissile phosphodiester bond in DNA. MeP substitution, combined with appropriate active site mutations, will be useful in revealing anti-hydrolytic mechanisms engendered by systems that mediate DNA relaxation, DNA transposition, site-specific recombination, telomere resolution, RNA splicing and retrohoming of mobile introns. PMID:19440204

  8. RPA accumulation during class switch recombination represents 5'-3' DNA-end resection during the S-G2/M phase of the cell cycle.

    Science.gov (United States)

    Yamane, Arito; Robbiani, Davide F; Resch, Wolfgang; Bothmer, Anne; Nakahashi, Hirotaka; Oliveira, Thiago; Rommel, Philipp C; Brown, Eric J; Nussenzweig, Andre; Nussenzweig, Michel C; Casellas, Rafael

    2013-01-31

    Activation-induced cytidine deaminase (AID) promotes chromosomal translocations by inducing DNA double-strand breaks (DSBs) at immunoglobulin (Ig) genes and oncogenes in the G1 phase. RPA is a single-stranded DNA (ssDNA)-binding protein that associates with resected DSBs in the S phase and facilitates the assembly of factors involved in homologous repair (HR), such as Rad51. Notably, RPA deposition also marks sites of AID-mediated damage, but its role in Ig gene recombination remains unclear. Here, we demonstrate that RPA associates asymmetrically with resected ssDNA in response to lesions created by AID, recombination-activating genes (RAG), or other nucleases. Small amounts of RPA are deposited at AID targets in G1 in an ATM-dependent manner. In contrast, recruitment in the S-G2/M phase is extensive, ATM independent, and associated with Rad51 accumulation. In the S-G2/M phase, RPA increases in nonhomologous-end-joining-deficient lymphocytes, where there is more extensive DNA-end resection. Thus, most RPA recruitment during class switch recombination represents salvage of unrepaired breaks by homology-based pathways during the S-G2/M phase of the cell cycle. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Characterization of a bacteriophage T4 mutant lacking DNA-dependent ATPase

    International Nuclear Information System (INIS)

    Behme, M.T.; Ebisuzaki, K.

    1975-01-01

    A DNA-dependent ATPase has previously been purified from bacteriophage T4-infected Escherichia coli. A mutant phage strain lacking this enzyme has been isolated and characterized. Although the mutant strain produced no detectable DNA-dependent ATPase, growth properties were not affected. Burst sizes were similar for the mutant phage and T4D in polAl, recB, recC, uvrA, uvrB, uvrC, and various DNA-negative E. coli. UV sensitivity and genetic recombination were normal in a variety of E. coli hosts. Mapping data indicate that the genetic locus controlling the mutant occurs near gene 56. The nonessential nature of this gene is discussed

  10. A PHF8 homolog in C. elegans promotes DNA repair via homologous recombination.

    Directory of Open Access Journals (Sweden)

    Changrim Lee

    Full Text Available PHF8 is a JmjC domain-containing histone demethylase, defects in which are associated with X-linked mental retardation. In this study, we examined the roles of two PHF8 homologs, JMJD-1.1 and JMJD-1.2, in the model organism C. elegans in response to DNA damage. A deletion mutation in either of the genes led to hypersensitivity to interstrand DNA crosslinks (ICLs, while only mutation of jmjd-1.1 resulted in hypersensitivity to double-strand DNA breaks (DSBs. In response to ICLs, JMJD-1.1 did not affect the focus formation of FCD-2, a homolog of FANCD2, a key protein in the Fanconi anemia pathway. However, the dynamic behavior of RPA-1 and RAD-51 was affected by the mutation: the accumulations of both proteins at ICLs appeared normal, but their subsequent disappearance was retarded, suggesting that later steps of homologous recombination were defective. Similar changes in the dynamic behavior of RPA-1 and RAD-51 were seen in response to DSBs, supporting a role of JMJD-1.1 in homologous recombination. Such a role was also supported by our finding that the hypersensitivity of jmjd-1.1 worms to ICLs was rescued by knockdown of lig-4, a homolog of Ligase 4 active in nonhomologous end-joining. The hypersensitivity of jmjd-1.1 worms to ICLs was increased by rad-54 knockdown, suggesting that JMJD-1.1 acts in parallel with RAD-54 in modulating chromatin structure. Indeed, the level of histone H3 Lys9 tri-methylation, a marker of heterochromatin, was higher in jmjd-1.1 cells than in wild-type cells. We conclude that the histone demethylase JMJD-1.1 influences homologous recombination either by relaxing heterochromatin structure or by indirectly regulating the expression of multiple genes affecting DNA repair.

  11. Xrcc1-dependent and Ku-dependent DNA double-strand break repair kinetics in Arabidopsis plants.

    Science.gov (United States)

    Charbonnel, Cyril; Gallego, Maria E; White, Charles I

    2010-10-01

    Double-strand breakage (DSB) of DNA involves loss of information on the two strands of the DNA fibre and thus cannot be repaired by simple copying of the complementary strand which is possible with single-strand DNA damage. Homologous recombination (HR) can precisely repair DSB using another copy of the genome as template and non-homologous recombination (NHR) permits repair of DSB with little or no dependence on DNA sequence homology. In addition to the well-characterised Ku-dependent non-homologous end-joining (NHEJ) pathway, much recent attention has been focused on Ku-independent NHR. The complex interrelationships and regulation of NHR pathways remain poorly understood, even more so in the case of plants, and we present here an analysis of Ku-dependent and Ku-independent repair of DSB in Arabidopsis thaliana. We have characterised an Arabidopsis xrcc1 mutant and developed quantitative analysis of the kinetics of appearance and loss of γ-H2AX foci as a tool to measure DSB repair in dividing root tip cells of γ-irradiated plants in vivo. This approach has permitted determination of DSB repair kinetics in planta following a short pulse of γ-irradiation, establishing the existence of a Ku-independent, Xrcc1-dependent DSB repair pathway. Furthermore, our data show a role for Ku80 during the first minutes post-irradiation and that Xrcc1 also plays such a role, but only in the absence of Ku. The importance of Xrcc1 is, however, clearly visible at later times in the presence of Ku, showing that alternative end-joining plays an important role in DSB repair even in the presence of active NHEJ. © 2010 The Authors. Journal compilation © 2010 Blackwell Publishing Ltd.

  12. The use of recombinant DNA techniques to study radiation-induced damage, repair and genetic change in mammalian cells

    International Nuclear Information System (INIS)

    Thacker, J.

    1986-01-01

    A brief introduction is given to appropriate elements of recombinant DNA techniques and applications to problems in radiobiology are reviewed with illustrative detail. Examples are included of studies with both 254 nm ultraviolet light and ionizing radiation and the review progresses from the molecular analysis of DNA damage in vitro through to the nature of consequent cellular responses. The review is dealt with under the following headings: Molecular distribution of DNA damage, The use of DNA-mediated gene transfer to assess damage and repair, The DNA double strand break: use of restriction endonucleases to model radiation damage, Identification and cloning of DNA repair genes, Analysis of radiation-induced genetic change. (UK)

  13. The role of DNA dependent protein kinase in synapsis of DNA ends.

    Science.gov (United States)

    Weterings, Eric; Verkaik, Nicole S; Brüggenwirth, Hennie T; Hoeijmakers, Jan H J; van Gent, Dik C

    2003-12-15

    DNA dependent protein kinase (DNA-PK) plays a central role in the non-homologous end-joining pathway of DNA double strand break repair. Its catalytic subunit (DNA-PK(CS)) functions as a serine/threonine protein kinase. We show that DNA-PK forms a stable complex at DNA termini that blocks the action of exonucleases and ligases. The DNA termini become accessible after autophosphorylation of DNA-PK(CS), which we demonstrate to require synapsis of DNA ends. Interestingly, the presence of DNA-PK prevents ligation of the two synapsed termini, but allows ligation to another DNA molecule. This alteration of the ligation route is independent of the type of ligase that we used, indicating that the intrinsic architecture of the DNA-PK complex itself is not able to support ligation of the synapsed DNA termini. We present a working model in which DNA-PK creates a stable molecular bridge between two DNA ends that is remodeled after DNA-PK autophosphorylation in such a way that the extreme termini become accessible without disrupting synapsis. We infer that joining of synapsed DNA termini would require an additional protein factor.

  14. Diversification of DnaA dependency for DNA replication in cyanobacterial evolution.

    Science.gov (United States)

    Ohbayashi, Ryudo; Watanabe, Satoru; Ehira, Shigeki; Kanesaki, Yu; Chibazakura, Taku; Yoshikawa, Hirofumi

    2016-05-01

    Regulating DNA replication is essential for all living cells. The DNA replication initiation factor DnaA is highly conserved in prokaryotes and is required for accurate initiation of chromosomal replication at oriC. DnaA-independent free-living bacteria have not been identified. The dnaA gene is absent in plastids and some symbiotic bacteria, although it is not known when or how DnaA-independent mechanisms were acquired. Here, we show that the degree of dependency of DNA replication on DnaA varies among cyanobacterial species. Deletion of the dnaA gene in Synechococcus elongatus PCC 7942 shifted DNA replication from oriC to a different site as a result of the integration of an episomal plasmid. Moreover, viability during the stationary phase was higher in dnaA disruptants than in wild-type cells. Deletion of dnaA did not affect DNA replication or cell growth in Synechocystis sp. PCC 6803 or Anabaena sp. PCC 7120, indicating that functional dependency on DnaA was already lost in some nonsymbiotic cyanobacterial lineages during diversification. Therefore, we proposed that cyanobacteria acquired DnaA-independent replication mechanisms before symbiosis and such an ancestral cyanobacterium was the sole primary endosymbiont to form a plastid precursor.

  15. Generating and repairing genetically programmed DNA breaks during immunoglobulin class switch recombination

    Science.gov (United States)

    Nicolas, Laura; Cols, Montserrat; Choi, Jee Eun; Chaudhuri, Jayanta; Vuong, Bao

    2018-01-01

    Adaptive immune responses require the generation of a diverse repertoire of immunoglobulins (Igs) that can recognize and neutralize a seemingly infinite number of antigens. V(D)J recombination creates the primary Ig repertoire, which subsequently is modified by somatic hypermutation (SHM) and class switch recombination (CSR). SHM promotes Ig affinity maturation whereas CSR alters the effector function of the Ig. Both SHM and CSR require activation-induced cytidine deaminase (AID) to produce dU:dG mismatches in the Ig locus that are transformed into untemplated mutations in variable coding segments during SHM or DNA double-strand breaks (DSBs) in switch regions during CSR. Within the Ig locus, DNA repair pathways are diverted from their canonical role in maintaining genomic integrity to permit AID-directed mutation and deletion of gene coding segments. Recently identified proteins, genes, and regulatory networks have provided new insights into the temporally and spatially coordinated molecular interactions that control the formation and repair of DSBs within the Ig locus. Unravelling the genetic program that allows B cells to selectively alter the Ig coding regions while protecting non-Ig genes from DNA damage advances our understanding of the molecular processes that maintain genomic integrity as well as humoral immunity. PMID:29744038

  16. Dependence of the quasiparticle recombination rate on the superconducting gap and TC

    Science.gov (United States)

    Carr, G. L.; Xi, Xiaoxiang; Hwang, J.; Tashiro, H.; Reitze, D. H.; Tanner, D. B.

    2010-03-01

    The relaxation of excess quasiparticles in a BCS superconductor is known to depend on quantities such as the quasiparticle & phonon density of states, and their coupling (Kaplan et al, Phys. Rev. B 14 4854, 1976). Disorder or an applied field can disrupt superconductivity, as evidenced by a reduced TC. We consider some simple modifications to the quasiparticle density of states consistent with a suppressed energy gap and TC, leading to changes in the intrinsic and effective (measured) rates for excess quasiparticles to recombine into pairs. We review some results for disordered MoGe and discuss the magnetic-field dependence of the recombination process.

  17. Construction of C35 gene bait recombinants and T47D cell cDNA library.

    Science.gov (United States)

    Yin, Kun; Xu, Chao; Zhao, Gui-Hua; Liu, Ye; Xiao, Ting; Zhu, Song; Yan, Ge

    2017-11-20

    C35 is a novel tumor biomarker associated with metastasis progression. To investigate the interaction factors of C35 in its high expressed breast cancer cell lines, we constructed bait recombinant plasmids of C35 gene and T47D cell cDNA library for yeast two-hybrid screening. Full length C35 sequences were subcloned using RT-PCR from cDNA template extracted from T47D cells. Based on functional domain analysis, the full-length C35 1-348bp was also truncated into two fragments C351-153bp and C35154-348bp to avoid auto-activation. The three kinds of C35 genes were successfully amplified and inserted into pGBKT7 to construct bait recombinant plasmids pGBKT7-C351-348bp, pGBKT7-C351-153bp and pGBKT7-C35154-348bp, then transformed into Y187 yeast cells by the lithium acetate method. Auto-activation and toxicity of C35 baits were detected using nutritional deficient medium and X-α-Gal assays. The T47D cell ds cDNA was generated by SMART TM technology and the library was constructed using in vivo recombination-mediated cloning in the AH109 yeast strain using a pGADT7-Rec plasmid. The transformed Y187/pGBKT7-C351-348bp line was intensively inhibited while the truncated Y187/pGBKT7-C35 lines had no auto-activation and toxicity in yeast cells. The titer of established cDNA library was 2 × 10 7 pfu/mL with high transformation efficiency of 1.4 × 10 6 , and the insert size of ds cDNA was distributed homogeneously between 0.5-2.0 kb. Our research generated a T47D cell cDNA library with high titer, and the constructed two C35 "baits" contained a respective functional immunoreceptor tyrosine based activation motif (ITAM) and the conserved last four amino acids Cys-Ile-Leu-Val (CILV) motif, and therefore laid a foundation for screening the C35 interaction factors in a BC cell line.

  18. A Novel Recombinant DNA System for High Efficiency Affinity Purification of Proteins in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Brian H. Carrick

    2016-03-01

    Full Text Available Isolation of endogenous proteins from Saccharomyces cerevisiae has been facilitated by inserting encoding polypeptide affinity tags at the C-termini of chromosomal open reading frames (ORFs using homologous recombination of DNA fragments. Tagged protein isolation is limited by a number of factors, including high cost of affinity resins for bulk isolation and low concentration of ligands on the resin surface, leading to low isolation efficiencies and trapping of contaminants. To address this, we have created a recombinant “CelTag” DNA construct from which PCR fragments can be created to easily tag C-termini of S. cerevisiae ORFs using selection for a nat1 marker. The tag has a C-terminal cellulose binding module to be used in the first affinity step. Microgranular cellulose is very inexpensive and has an effectively continuous ligand on its surface, allowing rapid, highly efficient purification with minimal background. Cellulose-bound proteins are released by specific cleavage of an included site for TEV protease, giving nearly pure product. The tag can be lifted from the recombinant DNA construct either with or without a 13x myc epitope tag between the target ORF and the TEV protease site. Binding of CelTag protein fusions to cellulose is stable to high salt, nonionic detergents, and 1 M urea, allowing stringent washing conditions to remove loosely associated components, as needed, before specific elution. It is anticipated that this reagent could allow isolation of protein complexes from large quantities of yeast extract, including soluble, membrane-bound, or nucleic acid-associated assemblies.

  19. Dual recombinant Lactococcus lactis for enhanced delivery of DNA vaccine reporter plasmid pPERDBY.

    Science.gov (United States)

    Yagnik, Bhrugu; Sharma, Drashya; Padh, Harish; Desai, Priti

    2017-04-01

    Food grade Lactococcus lactis has been widely used as an antigen and DNA delivery vehicle. We have previously reported the use of non-invasive L. lactis to deliver the newly constructed immunostimulatory DNA vaccine reporter plasmid, pPERDBY. In the present report, construction of dual recombinant L. lactis expressing internalin A of Listeria monocytogenes and harboring pPERDBY (LL InlA + pPERDBY) to enhance the efficiency of delivery of DNA by L. lactis is outlined. After confirmation and validation of LL InlA + pPERDBY, its DNA delivery potential was compared with previously developed non-invasive r- L. lactis::pPERDBY. The use of invasive L. lactis resulted in around threefold increases in the number of enhanced green fluorescent protein-expressing Caco-2 cells. These findings reinforce the prospective application of invasive strain of L. lactis for delivery of DNA/RNA and antigens. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

  20. DNA-PK inhibition causes a low level of H2AX phosphorylation and homologous recombination repair in Medaka (Oryzias latipes) cells

    International Nuclear Information System (INIS)

    Urushihara, Yusuke; Kobayashi, Junya; Matsumoto, Yoshihisa; Komatsu, Kenshi; Oda, Shoji; Mitani, Hiroshi

    2012-01-01

    Highlights: ► We investigated the effect of DNA-PK inhibition on DSB repair using fish cells. ► A radiation sensitive mutant RIC1 strain showed a low level of DNA-PK activity. ► DNA-PK dysfunction leads defects in HR repair and DNA-PKcs autophosphorylation. ► DNA-PK dysfunction leads a slight increase in the number of 53BP1 foci after DSBs. ► DNA-PK dysfunction leads an alternative NHEJ that depends on 53BP1. -- Abstract: Nonhomologous end joining (NHEJ) and homologous recombination (HR) are known as DNA double-strand break (DSB) repair pathways. It has been reported that DNA-PK, a member of PI3 kinase family, promotes NHEJ and aberrant DNA-PK causes NHEJ deficiency. However, in this study, we demonstrate that a wild-type cell line treated with DNA-PK inhibitor and a mutant cell line with dysfunctional DNA-PK showed decreased HR efficiency in fish cells (Medaka, Oryzias latipes). Previously, we reported that the radiation-sensitive mutant RIC1 strain has a defect in the Histone H2AX phosphorylation after γ-irradiation. Here, we showed that a DNA-PK inhibitor, NU7026, treatment resulted in significant reduction in the number of γH2AX foci after γ-irradiation in wild-type cells, but had no significant effect in RIC1 cells. In addition, RIC1 cells showed significantly lower levels of DNA-PK kinase activity compared with wild-type cells. We investigated NHEJ and HR efficiency after induction of DSBs. Wild-type cells treated with NU7026 and RIC1 cells showed decreased HR efficiency. These results indicated that aberrant DNA-PK causes the reduction in the number of γH2AX foci and HR efficiency in RIC1 cells. We performed phosphorylated DNA-PKcs (Thr2609) and 53BP1 focus assay after γ-irradiation. RIC1 cells showed significant reduction in the number of phosphorylated DNA-PKcs foci and no deference in the number of 53BP1 foci compared with wild-type cells. These results suggest that low level of DNA-PK activity causes aberrant DNA-PKcs autophosphorylation

  1. Probing Temperature-Dependent Recombination Kinetics in Polymer:Fullerene Solar Cells by Electric Noise Spectroscopy

    Directory of Open Access Journals (Sweden)

    Giovanni Landi

    2017-09-01

    Full Text Available The influence of solvent additives on the temperature behavior of both charge carrier transport and recombination kinetics in bulk heterojunction solar cells has been investigated by electric noise spectroscopy. The observed differences in charge carrier lifetime and mobility are attributed to a different film ordering and donor-acceptor phase segregation in the blend. The measured temperature dependence indicates that bimolecular recombination is the dominant loss mechanism in the active layer, affecting the device performance. Blend devices prepared with a high-boiling-point solvent additive show a decreased recombination rate at the donor-acceptor interface as compared to the ones prepared with the reference solvent. A clear correlation between the device performance and the morphological properties is discussed in terms of the temperature dependence of the mobility-lifetime product.

  2. [Effect of endonuclease G depletion on plasmid DNA uptake and levels of homologous recombination in hela cells].

    Science.gov (United States)

    Misic, V; El-Mogy, M; Geng, S; Haj-Ahmad, Y

    2016-01-01

    Endonuclease G (EndoG) is a mitochondrial apoptosis regulator that also has roles outside of programmed cell death. It has been implicated as a defence DNase involved in the degradation of exogenous DNA after transfection of mammalian cells and in homologous recombination of viral and endogenous DNA. In this study, we looked at the effect of EndoG depletion on plasmid DNA uptake and the levels of homologous recombination in HeLa cells. We show that the proposed defence role of EndoG against uptake of non-viral DNA vectors does not extend to the cervical carcinoma HeLa cells, as targeting of EndoG expression by RNA interference failed to increase intracellular plasmid DNA levels. However, reducing EndoG levels in HeLa cells resulted in a statistically significant reduction of homologous recombination between two plasmid DNA substrates. These findings suggest that non-viral DNA vectors are also substrates for EndoG in its role in homologous recombination.

  3. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Science.gov (United States)

    Hirsch, Matthew L; Fagan, B Matthew; Dumitru, Raluca; Bower, Jacquelyn J; Yadav, Swati; Porteus, Matthew H; Pevny, Larysa H; Samulski, R Jude

    2011-01-01

    Human embryonic stem cells (hESCs) are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV) single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  4. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  5. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H

    2012-02-22

    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  6. LDsplit: screening for cis-regulatory motifs stimulating meiotic recombination hotspots by analysis of DNA sequence polymorphisms.

    Science.gov (United States)

    Yang, Peng; Wu, Min; Guo, Jing; Kwoh, Chee Keong; Przytycka, Teresa M; Zheng, Jie

    2014-02-17

    As a fundamental genomic element, meiotic recombination hotspot plays important roles in life sciences. Thus uncovering its regulatory mechanisms has broad impact on biomedical research. Despite the recent identification of the zinc finger protein PRDM9 and its 13-mer binding motif as major regulators for meiotic recombination hotspots, other regulators remain to be discovered. Existing methods for finding DNA sequence motifs of recombination hotspots often rely on the enrichment of co-localizations between hotspots and short DNA patterns, which ignore the cross-individual variation of recombination rates and sequence polymorphisms in the population. Our objective in this paper is to capture signals encoded in genetic variations for the discovery of recombination-associated DNA motifs. Recently, an algorithm called "LDsplit" has been designed to detect the association between single nucleotide polymorphisms (SNPs) and proximal meiotic recombination hotspots. The association is measured by the difference of population recombination rates at a hotspot between two alleles of a candidate SNP. Here we present an open source software tool of LDsplit, with integrative data visualization for recombination hotspots and their proximal SNPs. Applying LDsplit on SNPs inside an established 7-mer motif bound by PRDM9 we observed that SNP alleles preserving the original motif tend to have higher recombination rates than the opposite alleles that disrupt the motif. Running on SNP windows around hotspots each containing an occurrence of the 7-mer motif, LDsplit is able to guide the established motif finding algorithm of MEME to recover the 7-mer motif. In contrast, without LDsplit the 7-mer motif could not be identified. LDsplit is a software tool for the discovery of cis-regulatory DNA sequence motifs stimulating meiotic recombination hotspots by screening and narrowing down to hotspot associated SNPs. It is the first computational method that utilizes the genetic variation of

  7. Sequence-dependent DNA deformability studied using molecular dynamics simulations.

    Science.gov (United States)

    Fujii, Satoshi; Kono, Hidetoshi; Takenaka, Shigeori; Go, Nobuhiro; Sarai, Akinori

    2007-01-01

    Proteins recognize specific DNA sequences not only through direct contact between amino acids and bases, but also indirectly based on the sequence-dependent conformation and deformability of the DNA (indirect readout). We used molecular dynamics simulations to analyze the sequence-dependent DNA conformations of all 136 possible tetrameric sequences sandwiched between CGCG sequences. The deformability of dimeric steps obtained by the simulations is consistent with that by the crystal structures. The simulation results further showed that the conformation and deformability of the tetramers can highly depend on the flanking base pairs. The conformations of xATx tetramers show the most rigidity and are not affected by the flanking base pairs and the xYRx show by contrast the greatest flexibility and change their conformations depending on the base pairs at both ends, suggesting tetramers with the same central dimer can show different deformabilities. These results suggest that analysis of dimeric steps alone may overlook some conformational features of DNA and provide insight into the mechanism of indirect readout during protein-DNA recognition. Moreover, the sequence dependence of DNA conformation and deformability may be used to estimate the contribution of indirect readout to the specificity of protein-DNA recognition as well as nucleosome positioning and large-scale behavior of nucleic acids.

  8. Obtaining classical swine fever virus E2 recombinant protein and DNA-vaccine on the basis of one subunit

    International Nuclear Information System (INIS)

    Deryabin, O.; Deryabina, O.; Verbitskiy, P.; Kordyum, V.

    2005-01-01

    Three forms of E2 recombinant protein were expressed in E. coli. Swine sera obtained against different forms of the recombinant protein were cross-studied with indirect ELISA. Using individual proteins as an antigen, only 15% of sera against other forms of protein reacted positively, while 100% of heterologous sera showed positive reaction with fused protein. Challenge experiments showed the existence of protective action only from the individual protein. Specificity and activity of sera obtained from the animals after control challenge was confirmed in a blocking variant of ELISA. Genetic construction used a eukaryotic vector that contained the E2 protein gene. Immunization of mice with the resulting DNA induced synthesis of specific antibodies, the titre of which increased considerably after additional single immunization with the E2 recombinant protein, expressed in E. coli. This demonstrated the effectiveness of animal priming by DNA vaccine, and the possibility of using the E2 recombinant protein in E. coli for booster vaccination. (author)

  9. Biotechnology and genetic engineering in the new drug development. Part I. DNA technology and recombinant proteins.

    Science.gov (United States)

    Stryjewska, Agnieszka; Kiepura, Katarzyna; Librowski, Tadeusz; Lochyński, Stanisław

    2013-01-01

    Pharmaceutical biotechnology has a long tradition and is rooted in the last century, first exemplified by penicillin and streptomycin as low molecular weight biosynthetic compounds. Today, pharmaceutical biotechnology still has its fundamentals in fermentation and bioprocessing, but the paradigmatic change affected by biotechnology and pharmaceutical sciences has led to an updated definition. The biotechnology revolution redrew the research, development, production and even marketing processes of drugs. Powerful new instruments and biotechnology related scientific disciplines (genomics, proteomics) make it possible to examine and exploit the behavior of proteins and molecules. Recombinant DNA (rDNA) technologies (genetic, protein, and metabolic engineering) allow the production of a wide range of peptides, proteins, and biochemicals from naturally nonproducing cells. This technology, now approximately 25 years old, is becoming one of the most important technologies developed in the 20(th) century. Pharmaceutical products and industrial enzymes were the first biotech products on the world market made by means of rDNA. Despite important advances regarding rDNA applications in mammalian cells, yeasts still represent attractive hosts for the production of heterologous proteins. In this review we describe these processes.

  10. Srs2 mediates PCNA-SUMO-dependent inhibition of DNA repair synthesis

    International Nuclear Information System (INIS)

    Burkovics, Peter; Sebesta, Marek; Kolesar, Peter; Sisakova, Alexandra; Marini, Victoria; Plault, Nicolas; Szukacsov, Valeria; Pinter, Lajos; Haracska, Lajos; Robert, Thomas; Kolesar, Peter; Gangloff, Serge; Krejci, Lumir

    2013-01-01

    Completion of DNA replication needs to be ensured even when challenged with fork progression problems or DNA damage. PCNA and its modifications constitute a molecular switch to control distinct repair pathways. In yeast, SUMOylated PCNA (S-PCNA) recruits Srs2 to sites of replication where Srs2 can disrupt Rad51 filaments and prevent homologous recombination (HR). We report here an unexpected additional mechanism by which S-PCNA and Srs2 block the synthesis-dependent extension of a recombination intermediate, thus limiting its potentially hazardous resolution in association with a cross-over. This new Srs2 activity requires the SUMO interaction motif at its C-terminus, but neither its translocase activity nor its interaction with Rad51. Srs2 binding to S-PCNA dissociates Polδ and Polη from the repair synthesis machinery, thus revealing a novel regulatory mechanism controlling spontaneous genome rearrangements. Our results suggest that cycling cells use the Siz1-dependent SUMOylation of PCNA to limit the extension of repair synthesis during template switch or HR and attenuate reciprocal DNA strand exchanges to maintain genome stability. (authors)

  11. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  12. The Mitochondrial DNA (mtDNA)-Associated Protein SWIB5 Influences mtDNA Architecture and Homologous Recombination

    KAUST Repository

    Blomme, Jonas; Van Aken, Olivier; Van Leene, Jelle; Jé gu, Teddy; De Rycke, Riet Maria; De Bruyne, Michiel; Vercruysse, Jasmien; Nolf, Jonah; Van Daele, Twiggy; De Milde, Liesbeth; Vermeersch, Mattias; Colas des Francs-Small, Catherine; De Jaeger, Geert; Benhamed, Moussa; Millar, A. Harvey; Inzé , Dirk; Gonzalez, Nathalie

    2017-01-01

    In addition to the nucleus, mitochondria and chloroplasts in plant cells also contain genomes. Efficient DNA repair pathways are crucial in these organelles to fix damage resulting from endogenous and exogenous factors. Plant organellar genomes

  13. Recombinant DNA derived monomeric insulin analogue: comparison with soluble human insulin in normal subjects.

    Science.gov (United States)

    Vora, J P; Owens, D R; Dolben, J; Atiea, J A; Dean, J D; Kang, S; Burch, A; Brange, J

    1988-11-12

    To compare the rate of absorption from subcutaneous tissue and the resulting hypoglycaemic effect of iodine-125 labelled soluble human insulin and a monomeric insulin analogue derived by recombinant DNA technology. Single blind randomised comparison of equimolar doses of 125I labelled soluble human insulin and insulin analogue. Study in normal people at a diabetes research unit and a university department of medical physics. Seven healthy male volunteers aged 20-39 not receiving any other drugs. After an overnight fast and a basal period of one hour two doses (0.05 and 0.1 U/kg) of 125I labelled soluble human insulin and insulin analogue were injected subcutaneously into the anterior abdominal wall on four separate days. To find a fast acting insulin for meal related requirements in insulin dependent diabetics. MEASUREMENTS and main results--Residual radioactivity at the injection site was measured continuously for the first two hours after injection of the 125I labelled preparations and thereafter for five minutes simultaneously with blood sampling. Frequent venous blood samples were obtained over six hours for determination of plasma immunoreactive insulin, insulin analogue, glucose, and glucagon values. Time to 50% of initial radioactivity at the injection site for the insulin analogue compared with soluble insulin was 61 v 135 minutes (p less than 0.05) with 0.05 U/kg and 67 v 145 minutes (p less than 0.001) with 0.1 U/kg. Concentrations in plasma increased faster after the insulin analogue compared with soluble insulin, resulting in higher plasma concentrations between 10 and 150 minutes (0.001 less than p less than 0.05) after 0.05 U/kg and between 40 and 360 minutes (0.001 less than p less than 0.05) after 0.1 U/kg. The hypoglycaemic response to insulin analogue was a plasma glucose nadir at 60 minutes with both doses compared with 90 and 120 minutes with soluble insulin at 0.5 and 0.1 U/kg respectively. The response of glucagon substantiated the earlier and

  14. RPA mediates recombination repair during replication stress and is displaced from DNA by checkpoint signalling in human cells

    DEFF Research Database (Denmark)

    Sleeth, Kate M; Sørensen, Claus Storgaard; Issaeva, Natalia

    2007-01-01

    The replication protein A (RPA) is involved in most, if not all, nuclear metabolism involving single-stranded DNA. Here, we show that RPA is involved in genome maintenance at stalled replication forks by the homologous recombination repair system in humans. Depletion of the RPA protein inhibited...... the formation of RAD51 nuclear foci after hydroxyurea-induced replication stalling leading to persistent unrepaired DNA double-strand breaks (DSBs). We demonstrate a direct role of RPA in homology directed recombination repair. We find that RPA is dispensable for checkpoint kinase 1 (Chk1) activation...... and that RPA directly binds RAD52 upon replication stress, suggesting a direct role in recombination repair. In addition we show that inhibition of Chk1 with UCN-01 decreases dissociation of RPA from the chromatin and inhibits association of RAD51 and RAD52 with DNA. Altogether, our data suggest a direct role...

  15. Effect of mutagens, chemotherapeutic agents and defects in DNA repair genes on recombination in F' partial diploid Escherichia coli

    International Nuclear Information System (INIS)

    Norin, A.J.; Goldschmidt, E.P.

    1979-01-01

    The ability of mutagenic agents, nonmutagenic substances and defects in DNA repair to alter the genotype of F' partial diploid (F30) Escherichia coli was determined. The frequency of auxotrophic mutants and histidine requiring (His - ) haploid colonies was increased by mutagen treatment but Hfr colonies were not detected in F30 E. coli even with specific selection techniques. Genotype changes due to nonreciprocal recombination were determined by measuring the frequency of His - homogenotes, eg. F' hisC780, hisI + /hisC780, hisI + , arising from a His + heterogenote, F' hisC780 hisI + /hisC + , his1903. At least 75% of the recombinants were homozygous for histidine alleles which were present on the F' plasmid (exogenote) of the parental hetergenote rather than for histidine alleles on the chromosome. Mutagens, chemotherapeutic agents which block DNA synthesis and a defective DNA polymerase I gene, polA1, were found to increase the frequency of nonreciprocal recombination. A defect in the ability to excise thymine dimers, uvrC34, did not increase spontaneous nonreciprocal recombination. However, UV irradiation but not methyl methanesulfonate (MMS) induced greater recombination in this excision-repair defective mutant than in DNA-repair-proficient strains. (Auth.)

  16. Mycobacterium smegmatis SftH exemplifies a distinctive clade of superfamily II DNA-dependent ATPases with 3′ to 5′ translocase and helicase activities

    OpenAIRE

    Yakovleva, Lyudmila; Shuman, Stewart

    2012-01-01

    Bacterial DNA helicases are nucleic acid-dependent NTPases that play important roles in DNA replication, recombination and repair. We are interested in the DNA helicases of Mycobacteria, a genus of the phylum Actinobacteria, which includes the human pathogen Mycobacterium tuberculosis and its avirulent relative Mycobacterium smegmatis. Here, we identify and characterize M. smegmatis SftH, a superfamily II helicase with a distinctive domain structure, comprising an N-terminal NTPase domain and...

  17. Heteroduplex DNA position defines the roles of the Sgs1, Srs2, and Mph1 helicases in promoting distinct recombination outcomes.

    Directory of Open Access Journals (Sweden)

    Katrina Mitchel

    Full Text Available The contributions of the Sgs1, Mph1, and Srs2 DNA helicases during mitotic double-strand break (DSB repair in yeast were investigated using a gap-repair assay. A diverged chromosomal substrate was used as a repair template for the gapped plasmid, allowing mismatch-containing heteroduplex DNA (hDNA formed during recombination to be monitored. Overall DSB repair efficiencies and the proportions of crossovers (COs versus noncrossovers (NCOs were determined in wild-type and helicase-defective strains, allowing the efficiency of CO and NCO production in each background to be calculated. In addition, the products of individual NCO events were sequenced to determine the location of hDNA. Because hDNA position is expected to differ depending on whether a NCO is produced by synthesis-dependent-strand-annealing (SDSA or through a Holliday junction (HJ-containing intermediate, its position allows the underlying molecular mechanism to be inferred. Results demonstrate that each helicase reduces the proportion of CO recombinants, but that each does so in a fundamentally different way. Mph1 does not affect the overall efficiency of gap repair, and its loss alters the CO-NCO by promoting SDSA at the expense of HJ-containing intermediates. By contrast, Sgs1 and Srs2 are each required for efficient gap repair, strongly promoting NCO formation and having little effect on CO efficiency. hDNA analyses suggest that all three helicases promote SDSA, and that Sgs1 and Srs2 additionally dismantle HJ-containing intermediates. The hDNA data are consistent with the proposed role of Sgs1 in the dissolution of double HJs, and we propose that Srs2 dismantles nicked HJs.

  18. The ATM signaling cascade promotes recombination-dependent pachytene arrest in mouse spermatocytes.

    Directory of Open Access Journals (Sweden)

    Sarai Pacheco

    2015-03-01

    Full Text Available Most mutations that compromise meiotic recombination or synapsis in mouse spermatocytes result in arrest and apoptosis at the pachytene stage of the first meiotic prophase. Two main mechanisms are thought to trigger arrest: one independent of the double-strand breaks (DSBs that initiate meiotic recombination, and another activated by persistent recombination intermediates. Mechanisms underlying the recombination-dependent arrest response are not well understood, so we sought to identify factors involved by examining mutants deficient for TRIP13, a conserved AAA+ ATPase required for the completion of meiotic DSB repair. We find that spermatocytes with a hypomorphic Trip13 mutation (Trip13mod/mod arrest with features characteristic of early pachynema in wild type, namely, fully synapsed chromosomes without incorporation of the histone variant H1t into chromatin. These cells then undergo apoptosis, possibly in response to the arrest or in response to a defect in sex body formation. However, TRIP13-deficient cells that additionally lack the DSB-responsive kinase ATM progress further, reaching an H1t-positive stage (i.e., similar to mid/late pachynema in wild type despite the presence of unrepaired DSBs. TRIP13-deficient spermatocytes also progress to an H1t-positive stage if ATM activity is attenuated by hypomorphic mutations in Mre11 or Nbs1 or by elimination of the ATM-effector kinase CHK2. These mutant backgrounds nonetheless experience an apoptotic block to further spermatogenic progression, most likely caused by failure to form a sex body. DSB numbers are elevated in Mre11 and Nbs1 hypomorphs but not Chk2 mutants, thus delineating genetic requirements for the ATM-dependent negative feedback loop that regulates DSB numbers. The findings demonstrate for the first time that ATM-dependent signaling enforces the normal pachytene response to persistent recombination intermediates. Our work supports the conclusion that recombination defects trigger

  19. Alkyladenine DNA glycosylase (Aag) in somatic hypermutation and class switch recombination.

    Science.gov (United States)

    Longerich, Simonne; Meira, Lisiane; Shah, Dharini; Samson, Leona D; Storb, Ursula

    2007-12-01

    Somatic hypermutation (SHM) and class switch recombination (CSR) of immunoglobulin (Ig) genes require the cytosine deaminase AID, which deaminates cytosine to uracil in Ig gene DNA. Paradoxically, proteins involved normally in error-free base excision repair and mismatch repair, seem to be co-opted to facilitate SHM and CSR, by recruiting error-prone translesion polymerases to DNA sequences containing deoxy-uracils created by AID. Major evidence supports at least one mechanism whereby the uracil glycosylase Ung removes AID-generated uracils creating abasic sites which may be used either as uninformative templates for DNA synthesis, or processed to nicks and gaps that prime error-prone DNA synthesis. We investigated the possibility that deamination at adenines also initiates SHM. Adenosine deamination would generate hypoxanthine (Hx), a substrate for the alkyladenine DNA glycosylase (Aag). Aag would generate abasic sites which then are subject to error-prone repair as above for AID-deaminated cytosine processed by Ung. If the action of an adenosine deaminase followed by Aag were responsible for significant numbers of mutations at A, we would find a preponderance of A:T>G:C transition mutations during SHM in an Aag deleted background. However, this was not observed and we found that the frequencies of SHM and CSR were not significantly altered in Aag-/- mice. Paradoxically, we found that Aag is expressed in B lymphocytes undergoing SHM and CSR and that its activity is upregulated in activated B cells. Moreover, we did find a statistically significant, albeit low increase of T:A>C:G transition mutations in Aag-/- animals, suggesting that Aag may be involved in creating the SHM A>T bias seen in wild type mice.

  20. Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

    DEFF Research Database (Denmark)

    Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie

    2014-01-01

    The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sec...

  1. SV40 host-substituted variants: a new look at the monkey DNA inserts and recombinant junctions.

    Science.gov (United States)

    Singer, Maxine; Winocour, Ernest

    2011-04-10

    The available monkey genomic data banks were examined in order to determine the chromosomal locations of the host DNA inserts in 8 host-substituted SV40 variant DNAs. Five of the 8 variants contained more than one linked monkey DNA insert per tandem repeat unit and in all cases but one, the 19 monkey DNA inserts in the 8 variants mapped to different locations in the monkey genome. The 50 parental DNAs (32 monkey and 18 SV40 DNA segments) which spanned the crossover and flanking regions that participated in monkey/monkey and monkey/SV40 recombinations were characterized by substantial levels of microhomology of up to 8 nucleotides in length; the parental DNAs also exhibited direct and inverted repeats at or adjacent to the crossover sequences. We discuss how the host-substituted SV40 variants arose and the nature of the recombination mechanisms involved. Copyright © 2011 Elsevier Inc. All rights reserved.

  2. The Dependence of the Dose Response Supralinearity of Peak 5 in TLD-100 on Recombination Temperature

    International Nuclear Information System (INIS)

    Horowitz, Y.S.; Satinger, D.; Oster, L.

    1999-01-01

    Isothermal readout of LiF:Mg,Ti (TLD-700) has recently been used to study the dependence of the supralinearity of peak 5 on recombination temperature. The results were interpreted to be in conflict with earlier results which investigated the effect of readout heating rate on the supralinearity of peak 5 in TLD-100. In this work the two experiments are inspected in greater detail. It is illustrated that the isothermal decay data is not in conflict with the heating rate data. However, the heating rate results do apparently indicate a strong transition in the temperature dependence of the relative strengths of the recombination and competitive cross sections at approximately 235 deg. C, which requires further study and analysis. (author)

  3. Formulation, characterization, and expression of a recombinant MOMP Chlamydia trachomatis DNA vaccine encapsulated in chitosan nanoparticles

    Directory of Open Access Journals (Sweden)

    Cambridge CD

    2013-05-01

    Full Text Available Chino D Cambridge, Shree R Singh, Alain B Waffo, Stacie J Fairley, Vida A DennisCenter for NanoBiotechnology Research (CNBR, Alabama State University, Montgomery, AL, USAAbstract: Chlamydia trachomatis is a bacterial sexually transmitted infection affecting millions of people worldwide. Previous vaccination attempts have employed the recombinant major outer membrane protein (MOMP of C. trachomatis nonetheless, with limited success, perhaps, due to stability, degradation, and delivery issues. In this study we cloned C. trachomatis recombinant MOMP DNA (DMOMP and encapsulated it in chitosan nanoparticles (DMCNP using the complex coacervation technique. Physiochemical characterizations of DMCNP included transmission and scanning electron microcopy, Fourier transform infrared and ultraviolet-visible spectroscopy, and zeta potential. Encapsulated DMOMP was 167–250 nm, with a uniform spherical shape and homogenous morphology, and an encapsulation efficiency > 90%. A slow release pattern of encapsulated DMOMP, especially in acidic solution, was observed over 7 days. The zeta potential of DMCNP was ~8.80 mV, which indicated that it was highly stable. Toxicity studies of DMCNP (25–400 µg/mL to Cos-7 cells using the MTT assay revealed minimal toxicity over 24–72 hours with >90% viable cells. Ultra-violet visible (UV-vis spectra indicated encapsulated DMOMP protection by chitosan, whereas agarose gel electrophoresis verified its protection from enzymatic degradation. Expression of MOMP protein in DMCNP-transfected Cos-7 cells was demonstrated via Western blotting and immunofluorescence microscopy. Significantly, intramuscular injection of BALB/c mice with DMCNP confirmed the delivery of encapsulated DMOMP, and expression of the MOMP gene transcript in thigh muscles and spleens. Our data show that encapsulation of DMOMP in biodegradable chitosan nanoparticles imparts stability and protection from enzymatic digestion, and enhances delivery and

  4. [Improvement of thermal adaptability and fermentation of industrial ethanologenic yeast by genomic DNA mutagenesis-based genetic recombination].

    Science.gov (United States)

    Liu, Xiuying; He, Xiuping; Lu, Ying; Zhang, Borun

    2011-07-01

    Ethanol is an attractive alternative to fossil fuels. Saccharomyces cerevisiae is the most important ethanol producer. However, in the process of industrial production of ethanol, both cell growth and fermentation of ethanologenic S. cerevisiae are dramatically affected by environmental stresses, such as thermal stress. In this study, we improved both the thermotolerance and fermentation performance of industrial ethanologenic S. cerevisiae by combined usage of chemical mutagenesis and genomic DNA mutagenesis-based genetic recombination method. The recombinant S. cerevisiae strain T44-2 could grow at 44 degrees C, 3 degrees C higher than that of the original strain CE6. The survival rate of T44-2 was 1.84 and 1.87-fold of that of CE6 when heat shock at 48 degrees C and 52 degrees C for 1 h respectively. At temperature higher than 37 degrees C, recombinant strain T44-2 always gave higher cell growth and ethanol production than those of strain CE6. Meanwhile, from 30 degrees C to 40 degrees C, recombinant strain T44-2 produces 91.2-83.8 g/L of ethanol from 200 g/L of glucose, which indicated that the recombinant strain T44-2 had both thermotolerance and broad thermal adaptability. The work offers a novel method, called genomic DNA mutagenesis-based genetic recombination, to improve the physiological functions of S. cerevisiae.

  5. Spin-dependent recombination involving oxygen-vacancy complexes in silicon

    OpenAIRE

    Franke, David P.; Hoehne, Felix; Vlasenko, Leonid S.; Itoh, Kohei M.; Brandt, Martin S.

    2014-01-01

    Spin-dependent relaxation and recombination processes in $\\gamma$-irradiated $n$-type Czochralski-grown silicon are studied using continuous wave (cw) and pulsed electrically detected magnetic resonance (EDMR). Two processes involving the SL1 center, the neutral excited triplet state of the oxygen-vacancy complex, are observed which can be separated by their different dynamics. One of the processes is the relaxation of the excited SL1 state to the ground state of the oxygen-vacancy complex, t...

  6. Force-dependent melting of supercoiled DNA at thermophilic temperatures.

    Science.gov (United States)

    Galburt, E A; Tomko, E J; Stump, W T; Ruiz Manzano, A

    2014-01-01

    Local DNA opening plays an important role in DNA metabolism as the double-helix must be melted before the information contained within may be accessed. Cells finely tune the torsional state of their genomes to strike a balance between stability and accessibility. For example, while mesophilic life forms maintain negatively superhelical genomes, thermophilic life forms use unique mechanisms to maintain relaxed or even positively supercoiled genomes. Here, we use a single-molecule magnetic tweezers approach to quantify the force-dependent equilibrium between DNA melting and supercoiling at high temperatures populated by Thermophiles. We show that negatively supercoiled DNA denatures at 0.5 pN lower tension at thermophilic vs. mesophilic temperatures. This work demonstrates the ability to monitor DNA supercoiling at high temperature and opens the possibility to perform magnetic tweezers assays on thermophilic systems. The data allow for an estimation of the relative energies of base-pairing and DNA bending as a function of temperature and support speculation as to different general mechanisms of DNA opening in different environments. Lastly, our results imply that average in vivo DNA tensions range between 0.3 and 1.1 pN. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Concentration and length dependence of DNA looping in transcriptional regulation.

    Directory of Open Access Journals (Sweden)

    Lin Han

    2009-05-01

    Full Text Available In many cases, transcriptional regulation involves the binding of transcription factors at sites on the DNA that are not immediately adjacent to the promoter of interest. This action at a distance is often mediated by the formation of DNA loops: Binding at two or more sites on the DNA results in the formation of a loop, which can bring the transcription factor into the immediate neighborhood of the relevant promoter. These processes are important in settings ranging from the historic bacterial examples (bacterial metabolism and the lytic-lysogeny decision in bacteriophage, to the modern concept of gene regulation to regulatory processes central to pattern formation during development of multicellular organisms. Though there have been a variety of insights into the combinatorial aspects of transcriptional control, the mechanism of DNA looping as an agent of combinatorial control in both prokaryotes and eukaryotes remains unclear. We use single-molecule techniques to dissect DNA looping in the lac operon. In particular, we measure the propensity for DNA looping by the Lac repressor as a function of the concentration of repressor protein and as a function of the distance between repressor binding sites. As with earlier single-molecule studies, we find (at least two distinct looped states and demonstrate that the presence of these two states depends both upon the concentration of repressor protein and the distance between the two repressor binding sites. We find that loops form even at interoperator spacings considerably shorter than the DNA persistence length, without the intervention of any other proteins to prebend the DNA. The concentration measurements also permit us to use a simple statistical mechanical model of DNA loop formation to determine the free energy of DNA looping, or equivalently, the for looping.

  8. Yeast Tdh3 (glyceraldehyde 3-phosphate dehydrogenase is a Sir2-interacting factor that regulates transcriptional silencing and rDNA recombination.

    Directory of Open Access Journals (Sweden)

    Alison E Ringel

    Full Text Available Sir2 is an NAD(+-dependent histone deacetylase required to mediate transcriptional silencing and suppress rDNA recombination in budding yeast. We previously identified Tdh3, a glyceraldehyde 3-phosphate dehydrogenase (GAPDH, as a high expression suppressor of the lethality caused by Sir2 overexpression in yeast cells. Here we show that Tdh3 interacts with Sir2, localizes to silent chromatin in a Sir2-dependent manner, and promotes normal silencing at the telomere and rDNA. Characterization of specific TDH3 alleles suggests that Tdh3's influence on silencing requires nuclear localization but does not correlate with its catalytic activity. Interestingly, a genetic assay suggests that Tdh3, an NAD(+-binding protein, influences nuclear NAD(+ levels; we speculate that Tdh3 links nuclear Sir2 with NAD(+ from the cytoplasm.

  9. Construction, Expression, and Characterization of Recombinant Pfu DNA Polymerase in Escherichia coli.

    Science.gov (United States)

    Zheng, Wenjun; Wang, Qingsong; Bi, Qun

    2016-04-01

    Pfu DNA polymerase (Pfu) is a DNA polymerase isolated from the hyperthermophilic archaeon Pyrococcus furiosus. With its excellent thermostability and high fidelity, Pfu is well known as one of the enzymes widely used in the polymerase chain reaction. In this study, the recombinant plasmid pLysS His6-tagged Pfu-pET28a was constructed. His-tagged Pfu was expressed in Escherichia coli BL21 (DE3) competent cells and then successfully purified with the ÄKTAprime plus compact one-step purification system by Ni(2+) chelating affinity chromatography after optimization of the purification conditions. The authenticity of the purified Pfu was further confirmed by peptide mass fingerprinting. A bio-assay indicated that its activity in the polymerase chain reaction was equivalent to that of commercial Pfu and its isoelectric point was found to be between 6.85 and 7.35. These results will be useful for further studies on Pfu and its wide application in the future.

  10. DNA repair and recombination in higher plants: insights from comparative genomics of arabidopsis and rice

    Directory of Open Access Journals (Sweden)

    Choudhury Swarup

    2010-07-01

    Full Text Available Abstract Background The DNA repair and recombination (DRR proteins protect organisms against genetic damage, caused by environmental agents and other genotoxic agents, by removal of DNA lesions or helping to abide them. Results We identified genes potentially involved in DRR mechanisms in Arabidopsis and rice using similarity searches and conserved domain analysis against proteins known to be involved in DRR in human, yeast and E. coli. As expected, many of DRR genes are very similar to those found in other eukaryotes. Beside these eukaryotes specific genes, several prokaryotes specific genes were also found to be well conserved in plants. In Arabidopsis, several functionally important DRR gene duplications are present, which do not occur in rice. Among DRR proteins, we found that proteins belonging to the nucleotide excision repair pathway were relatively more conserved than proteins needed for the other DRR pathways. Sub-cellular localization studies of DRR gene suggests that these proteins are mostly reside in nucleus while gene drain in between nucleus and cell organelles were also found in some cases. Conclusions The similarities and dissimilarities in between plants and other organisms' DRR pathways are discussed. The observed differences broaden our knowledge about DRR in the plants world, and raises the potential question of whether differentiated functions have evolved in some cases. These results, altogether, provide a useful framework for further experimental studies in these organisms.

  11. DNA repair and recombination in higher plants: insights from comparative genomics of Arabidopsis and rice.

    Science.gov (United States)

    Singh, Sanjay K; Roy, Sujit; Choudhury, Swarup Roy; Sengupta, Dibyendu N

    2010-07-21

    The DNA repair and recombination (DRR) proteins protect organisms against genetic damage, caused by environmental agents and other genotoxic agents, by removal of DNA lesions or helping to abide them. We identified genes potentially involved in DRR mechanisms in Arabidopsis and rice using similarity searches and conserved domain analysis against proteins known to be involved in DRR in human, yeast and E. coli. As expected, many of DRR genes are very similar to those found in other eukaryotes. Beside these eukaryotes specific genes, several prokaryotes specific genes were also found to be well conserved in plants. In Arabidopsis, several functionally important DRR gene duplications are present, which do not occur in rice. Among DRR proteins, we found that proteins belonging to the nucleotide excision repair pathway were relatively more conserved than proteins needed for the other DRR pathways. Sub-cellular localization studies of DRR gene suggests that these proteins are mostly reside in nucleus while gene drain in between nucleus and cell organelles were also found in some cases. The similarities and dissimilarities in between plants and other organisms' DRR pathways are discussed. The observed differences broaden our knowledge about DRR in the plants world, and raises the potential question of whether differentiated functions have evolved in some cases. These results, altogether, provide a useful framework for further experimental studies in these organisms.

  12. Mixed infection of Sida jamaicensis in Jamaica reveals the presence of three recombinant begomovirus DNA A components.

    Science.gov (United States)

    Stewart, Cheryl; Kon, Tatsuya; Rojas, Maria; Graham, André; Martin, Darren; Gilbertson, Robert; Roye, Marcia

    2014-09-01

    Begomoviruses impose serious constraints on agriculture throughout the temperate, tropical and subtropical regions. Previously, we characterised a sida golden yellow vein virus isolate, SiGYVV-[JM:Lig2:08] (HQ009519-20) from a symptomatic Sida jamaicensis plant. With the aim of establishing whether it was hosting a mixed infection that could facilitate recombination, PCR-RFLP was done on DNA extracted from this plant, and the results suggested the presence of two additional genetically distinct DNA-A molecules. Sequence analysis of these two DNA-A molecules (relying on BLAST searches and the CLUSTAL V algorithm within the DNASTAR MegAlign module) revealed that they belonged to novel species, and we have tentatively named these viruses sida golden mosaic Braco virus-[Jamaica:Liguanea:2008] and sida golden mosaic Liguanea virus-[Jamaica:1:2008]. Using RDP4 (recombination detection program), we determined that all three viruses were recombinant, with bases ~10 to ~440 of both SiGMLigV-[JM:Lig:08] and SiGYVV-[JM:Lig2:08] having been derived from a relative of SiGMBV-[JM:Lig:08] (P<2.070×10(-7) for all seven of the recombination detection methods). SiGMBV-[JM:Lig:08] was itself a product of recombination, deriving bases ~490-1195 from a virus that was ~92% similar to malvastrum yellow mosaic Helshire virus. Phylogenetically, these DNA-A components are most closely related to those of malvaceous weed-infecting begomoviruses from Jamaica, Cuba, Florida and Mexico. The SiGMBV DNA-A was able to elicit symptomatic infection in N. benthamiana.

  13. Spin-dependent recombination involving oxygen-vacancy complexes in silicon

    Science.gov (United States)

    Franke, David P.; Hoehne, Felix; Vlasenko, Leonid S.; Itoh, Kohei M.; Brandt, Martin S.

    2014-05-01

    Spin-dependent relaxation and recombination processes in γ-irradiated n-type Czochralski-grown silicon are studied using continuous wave (cw) and pulsed electrically detected magnetic resonance (EDMR). Two processes involving the SL1 center, the neutral excited triplet state of the oxygen-vacancy complex, are observed which can be separated by their different dynamics. One of the processes is the relaxation of the excited SL1 state to the ground state of the oxygen-vacancy complex, the other a charge transfer between 31P donors and SL1 centers forming close pairs, as indicated by electrically detected electron double resonance. For both processes, the recombination dynamics is studied with pulsed EDMR techniques. We demonstrate the feasibility of true zero-field cw and pulsed EDMR for spin-1 systems and use this to measure the lifetimes of the different spin states of SL1 also at vanishing external magnetic field.

  14. IDN2 Interacts with RPA and Facilitates DNA Double-Strand Break Repair by Homologous Recombination in Arabidopsis.

    Science.gov (United States)

    Liu, Mingming; Ba, Zhaoqing; Costa-Nunes, Pedro; Wei, Wei; Li, Lanxia; Kong, Fansi; Li, Yan; Chai, Jijie; Pontes, Olga; Qi, Yijun

    2017-03-01

    Repair of DNA double-strand breaks (DSBs) is critical for the maintenance of genome integrity. We previously showed that DSB-induced small RNAs (diRNAs) facilitate homologous recombination-mediated DSB repair in Arabidopsis thaliana Here, we show that INVOLVED IN DE NOVO2 (IDN2), a double-stranded RNA binding protein involved in small RNA-directed DNA methylation, is required for DSB repair in Arabidopsis. We find that IDN2 interacts with the heterotrimeric replication protein A (RPA) complex. Depletion of IDN2 or the diRNA binding ARGONAUTE2 leads to increased accumulation of RPA at DSB sites and mislocalization of the recombination factor RAD51. These findings support a model in which IDN2 interacts with RPA and facilitates the release of RPA from single-stranded DNA tails and subsequent recruitment of RAD51 at DSB sites to promote DSB repair. © 2017 American Society of Plant Biologists. All rights reserved.

  15. Total DNA of Glycyrrhiza uralensis transformed into Hansenula anomala by ion implantation:Preparing Glycyrrhizic acid in recombined yeasts

    International Nuclear Information System (INIS)

    Jin Xiang; Mao Peihong; Lu Jie; Ma Yuan

    2010-01-01

    Glycyrrhizic acid (GA) in Glycyrrhiza uralensis (G. uralensis) is physiologically active. In this study, the total DNA of wild G. uralensis was randomly transformed into Hansenula anomaly by implantation of low-energy Ar + and N + , to produce five recombinant yeast strains relating to biological synthesis of the GA or Glycyrrhetinic acid (GAs). After culturing in liquid medium for 96 h, the resultant GA, 18α-GAs and 18β-Gas were determined by reversed-phase high performance liquid chromatography (RP-HPLC), and the corresponding concentrations were 114.49, 0.56, and 0.81 mg·L -1 . After one hundred primers were analyzed with random amplified polymorphic DNA (RAPD), the seven different DNA fragments were produced by the N7059 strain of recombined yeasts, and, the polymerase chain reaction (PCR) verified that one of them came from the genome of G. uralensis, indicating a successful transfer of genetic information by ion implantation. (authors)

  16. Mapping DNA damage-dependent genetic interactions in yeast via party mating and barcode fusion genetics.

    Science.gov (United States)

    Díaz-Mejía, J Javier; Celaj, Albi; Mellor, Joseph C; Coté, Atina; Balint, Attila; Ho, Brandon; Bansal, Pritpal; Shaeri, Fatemeh; Gebbia, Marinella; Weile, Jochen; Verby, Marta; Karkhanina, Anna; Zhang, YiFan; Wong, Cassandra; Rich, Justin; Prendergast, D'Arcy; Gupta, Gaurav; Öztürk, Sedide; Durocher, Daniel; Brown, Grant W; Roth, Frederick P

    2018-05-28

    Condition-dependent genetic interactions can reveal functional relationships between genes that are not evident under standard culture conditions. State-of-the-art yeast genetic interaction mapping, which relies on robotic manipulation of arrays of double-mutant strains, does not scale readily to multi-condition studies. Here, we describe barcode fusion genetics to map genetic interactions (BFG-GI), by which double-mutant strains generated via en masse "party" mating can also be monitored en masse for growth to detect genetic interactions. By using site-specific recombination to fuse two DNA barcodes, each representing a specific gene deletion, BFG-GI enables multiplexed quantitative tracking of double mutants via next-generation sequencing. We applied BFG-GI to a matrix of DNA repair genes under nine different conditions, including methyl methanesulfonate (MMS), 4-nitroquinoline 1-oxide (4NQO), bleomycin, zeocin, and three other DNA-damaging environments. BFG-GI recapitulated known genetic interactions and yielded new condition-dependent genetic interactions. We validated and further explored a subnetwork of condition-dependent genetic interactions involving MAG1 , SLX4, and genes encoding the Shu complex, and inferred that loss of the Shu complex leads to an increase in the activation of the checkpoint protein kinase Rad53. © 2018 The Authors. Published under the terms of the CC BY 4.0 license.

  17. DNA Binding in High Salt: Analysing the Salt Dependence of Replication Protein A3 from the Halophile Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Jody A. Winter

    2012-01-01

    Full Text Available Halophilic archaea maintain intracellular salt concentrations close to saturation to survive in high-salt environments and their cellular processes have adapted to function under these conditions. Little is known regarding halophilic adaptation of the DNA processing machinery, particularly intriguing since protein-DNA interactions are classically salt sensitive. To investigate such adaptation, we characterised the DNA-binding capabilities of recombinant RPA3 from Haloferax volcanii (HvRPA3. Under physiological salt conditions (3 M KCl, HvRPA3 is monomeric, binding 18 nucleotide ssDNA with nanomolar affinity, demonstrating that RPAs containing the single OB-fold/zinc finger architecture bind with broadly comparable affinity to two OB-fold/zinc finger RPAs. Reducing the salt concentration to 1 M KCl induces dimerisation of the protein, which retains its ability to bind DNA. On circular ssDNA, two concentration-dependent binding modes are observed. Conventionally, increased salt concentration adversely affects DNA binding but HvRPA3 does not bind DNA in 0.2 M KCl, although multimerisation may occlude the binding site. The single N-terminal OB-fold is competent to bind DNA in the absence of the C-terminal zinc finger, albeit with reduced affinity. This study represents the first quantitative characterisation of DNA binding in a halophilic protein in extreme salt concentrations.

  18. DNA template dependent accuracy variation of nucleotide selection in transcription.

    Directory of Open Access Journals (Sweden)

    Harriet Mellenius

    Full Text Available It has been commonly assumed that the effect of erroneous transcription of DNA genes into messenger RNAs on peptide sequence errors are masked by much more frequent errors of mRNA translation to protein. We present a theoretical model of transcriptional accuracy. It uses experimentally estimated standard free energies of double-stranded DNA and RNA/DNA hybrids and predicts a DNA template dependent transcriptional accuracy variation spanning several orders of magnitude. The model also identifies high-error as well a high-accuracy transcription motifs. The source of the large accuracy span is the context dependent variation of the stacking free energy of pairs of correct and incorrect base pairs in the ever moving transcription bubble. Our model predictions have direct experimental support from recent single molecule based identifications of transcriptional errors in the C. elegans transcriptome. Our conclusions challenge the general view that amino acid substitution errors in proteins are mainly caused by translational errors. It suggests instead that transcriptional error hotspots are the dominating source of peptide sequence errors in some DNA template contexts, while mRNA translation is the major cause of protein errors in other contexts.

  19. Histone dosage regulates DNA damage sensitivity in a checkpoint-independent manner by the homologous recombination pathway

    Science.gov (United States)

    Liang, Dun; Burkhart, Sarah Lyn; Singh, Rakesh Kumar; Kabbaj, Marie-Helene Miquel; Gunjan, Akash

    2012-01-01

    In eukaryotes, multiple genes encode histone proteins that package genomic deoxyribonucleic acid (DNA) and regulate its accessibility. Because of their positive charge, ‘free’ (non-chromatin associated) histones can bind non-specifically to the negatively charged DNA and affect its metabolism, including DNA repair. We have investigated the effect of altering histone dosage on DNA repair in budding yeast. An increase in histone gene dosage resulted in enhanced DNA damage sensitivity, whereas deletion of a H3–H4 gene pair resulted in reduced levels of free H3 and H4 concomitant with resistance to DNA damaging agents, even in mutants defective in the DNA damage checkpoint. Studies involving the repair of a HO endonuclease-mediated DNA double-strand break (DSB) at the MAT locus show enhanced repair efficiency by the homologous recombination (HR) pathway on a reduction in histone dosage. Cells with reduced histone dosage experience greater histone loss around a DSB, whereas the recruitment of HR factors is concomitantly enhanced. Further, free histones compete with the HR machinery for binding to DNA and associate with certain HR factors, potentially interfering with HR-mediated repair. Our findings may have important implications for DNA repair, genomic stability, carcinogenesis and aging in human cells that have dozens of histone genes. PMID:22850743

  20. Full mitochondrial genome sequences of two endemic Philippine hornbill species (Aves: Bucerotidae) provide evidence for pervasive mitochondrial DNA recombination.

    Science.gov (United States)

    Sammler, Svenja; Bleidorn, Christoph; Tiedemann, Ralph

    2011-01-14

    Although nowaday it is broadly accepted that mitochondrial DNA (mtDNA) may undergo recombination, the frequency of such recombination remains controversial. Its estimation is not straightforward, as recombination under homoplasmy (i.e., among identical mt genomes) is likely to be overlooked. In species with tandem duplications of large mtDNA fragments the detection of recombination can be facilitated, as it can lead to gene conversion among duplicates. Although the mechanisms for concerted evolution in mtDNA are not fully understood yet, recombination rates have been estimated from "one per speciation event" down to 850 years or even "during every replication cycle". Here we present the first complete mt genome of the avian family Bucerotidae, i.e., that of two Philippine hornbills, Aceros waldeni and Penelopides panini. The mt genomes are characterized by a tandemly duplicated region encompassing part of cytochrome b, 3 tRNAs, NADH6, and the control region. The duplicated fragments are identical to each other except for a short section in domain I and for the length of repeat motifs in domain III of the control region. Due to the heteroplasmy with regard to the number of these repeat motifs, there is some size variation in both genomes; with around 21,657 bp (A. waldeni) and 22,737 bp (P. panini), they significantly exceed the hitherto longest known avian mt genomes, that of the albatrosses. We discovered concerted evolution between the duplicated fragments within individuals. The existence of differences between individuals in coding genes as well as in the control region, which are maintained between duplicates, indicates that recombination apparently occurs frequently, i.e., in every generation. The homogenised duplicates are interspersed by a short fragment which shows no sign of recombination. We hypothesize that this region corresponds to the so-called Replication Fork Barrier (RFB), which has been described from the chicken mitochondrial genome. As this RFB

  1. Full mitochondrial genome sequences of two endemic Philippine hornbill species (Aves: Bucerotidae provide evidence for pervasive mitochondrial DNA recombination

    Directory of Open Access Journals (Sweden)

    Bleidorn Christoph

    2011-01-01

    Full Text Available Abstract Background Although nowaday it is broadly accepted that mitochondrial DNA (mtDNA may undergo recombination, the frequency of such recombination remains controversial. Its estimation is not straightforward, as recombination under homoplasmy (i.e., among identical mt genomes is likely to be overlooked. In species with tandem duplications of large mtDNA fragments the detection of recombination can be facilitated, as it can lead to gene conversion among duplicates. Although the mechanisms for concerted evolution in mtDNA are not fully understood yet, recombination rates have been estimated from "one per speciation event" down to 850 years or even "during every replication cycle". Results Here we present the first complete mt genome of the avian family Bucerotidae, i.e., that of two Philippine hornbills, Aceros waldeni and Penelopides panini. The mt genomes are characterized by a tandemly duplicated region encompassing part of cytochrome b, 3 tRNAs, NADH6, and the control region. The duplicated fragments are identical to each other except for a short section in domain I and for the length of repeat motifs in domain III of the control region. Due to the heteroplasmy with regard to the number of these repeat motifs, there is some size variation in both genomes; with around 21,657 bp (A. waldeni and 22,737 bp (P. panini, they significantly exceed the hitherto longest known avian mt genomes, that of the albatrosses. We discovered concerted evolution between the duplicated fragments within individuals. The existence of differences between individuals in coding genes as well as in the control region, which are maintained between duplicates, indicates that recombination apparently occurs frequently, i.e., in every generation. Conclusions The homogenised duplicates are interspersed by a short fragment which shows no sign of recombination. We hypothesize that this region corresponds to the so-called Replication Fork Barrier (RFB, which has been

  2. Meiotic recombination breakpoints are associated with open chromatin and enriched with repetitive DNA elements in potato

    Science.gov (United States)

    Meiotic recombination provides the framework for the genetic variation in natural and artificial populations of eukaryotes through the creation of novel haplotypes. Thus, determining the molecular characteristics of meiotic recombination remains essential for future plant breeding efforts, which hea...

  3. Deriving the coronal hole electron temperature: electron density dependent ionization / recombination considerations

    International Nuclear Information System (INIS)

    Doyle, John Gerard; Perez-Suarez, David; Singh, Avninda; Chapman, Steven; Bryans, Paul; Summers, Hugh; Savin, Daniel Wolf

    2010-01-01

    Comparison of appropriate theoretically derived line ratios with observational data can yield estimates of a plasma's physical parameters, such as electron density or temperature. The usual practice in the calculation of the line ratio is the assumption of excitation by electrons/protons followed by radiative decay. Furthermore, it is normal to use the so-called coronal approximation, i.e. one only considers ionization and recombination to and from the ground-state. A more accurate treatment is to include ionization/recombination to and from metastable levels. Here, we apply this to two lines from adjacent ionization stages, Mg IX 368 A and Mg X 625 A, which has been shown to be a very useful temperature diagnostic. At densities typical of coronal hole conditions, the difference between the electron temperature derived assuming the zero density limit compared with the electron density dependent ionization/recombination is small. This, however, is not the case for flares where the electron density is orders of magnitude larger. The derived temperature for the coronal hole at solar maximum is around 1.04 MK compared to just below 0.82 MK at solar minimum.

  4. BRIT1/MCPH1 is essential for mitotic and meiotic recombination DNA repair and maintaining genomic stability in mice.

    Directory of Open Access Journals (Sweden)

    Yulong Liang

    2010-01-01

    Full Text Available BRIT1 protein (also known as MCPH1 contains 3 BRCT domains which are conserved in BRCA1, BRCA2, and other important molecules involved in DNA damage signaling, DNA repair, and tumor suppression. BRIT1 mutations or aberrant expression are found in primary microcephaly patients as well as in cancer patients. Recent in vitro studies suggest that BRIT1/MCPH1 functions as a novel key regulator in the DNA damage response pathways. To investigate its physiological role and dissect the underlying mechanisms, we generated BRIT1(-/- mice and identified its essential roles in mitotic and meiotic recombination DNA repair and in maintaining genomic stability. Both BRIT1(-/- mice and mouse embryonic fibroblasts (MEFs were hypersensitive to gamma-irradiation. BRIT1(-/- MEFs and T lymphocytes exhibited severe chromatid breaks and reduced RAD51 foci formation after irradiation. Notably, BRIT1(-/- mice were infertile and meiotic homologous recombination was impaired. BRIT1-deficient spermatocytes exhibited a failure of chromosomal synapsis, and meiosis was arrested at late zygotene of prophase I accompanied by apoptosis. In mutant spermatocytes, DNA double-strand breaks (DSBs were formed, but localization of RAD51 or BRCA2 to meiotic chromosomes was severely impaired. In addition, we found that BRIT1 could bind to RAD51/BRCA2 complexes and that, in the absence of BRIT1, recruitment of RAD51 and BRCA2 to chromatin was reduced while their protein levels were not altered, indicating that BRIT1 is involved in mediating recruitment of RAD51/BRCA2 to the damage site. Collectively, our BRIT1-null mouse model demonstrates that BRIT1 is essential for maintaining genomic stability in vivo to protect the hosts from both programmed and irradiation-induced DNA damages, and its depletion causes a failure in both mitotic and meiotic recombination DNA repair via impairing RAD51/BRCA2's function and as a result leads to infertility and genomic instability in mice.

  5. Recombination-dependent replication and gene conversion homogenize repeat sequences and diversify plastid genome structure.

    Science.gov (United States)

    Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K

    2017-04-01

    There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.

  6. Is photocleavage of DNA by YOYO-1 using a synchrotron radiation light source sequence dependent?

    DEFF Research Database (Denmark)

    Gilroy, Emma L.; Hoffmann, Søren Vrønning; Jones, Nykola C.

    2011-01-01

    ) throughout the irradiation period. The dependence of LD signals on DNA sequences and on time in the intense light beam was explored and quantified for single-stranded poly(dA), poly[(dA-dT)2], calf thymus DNA (ctDNA) and Micrococcus luteus DNA (mlDNA). The DNA and ligand regions of the spectrum showed...

  7. Plant molecular biology and biotechnology research in the post-recombinant DNA era.

    Science.gov (United States)

    Tyagi, Akhilesh K; Khurana, Jitendra P

    2003-01-01

    After the beginning of the recombinant DNA era in the mid-1970s, researchers in India started to make use of the new technology to understand the structure of plant genes and regulation of their expression. The outcome started to appear in print in early the 1980s and genes for histones, tubulin, photosynthetic membrane proteins, phototransduction components, organelles and those regulated differentially by developmental and extrinsic signals were sequenced and characterized. Some genes of biotechnological importance like those encoding an interesting seed protein and the enzyme glyoxalase were also isolated. While work on the characterization of genome structure and organization was started quite early, it remained largely focused on the identification of DNA markers and genetic variability. In this context, the work on mustard, rice and wheat is worth mentioning. In the year 2000, India became a member of the international consortium to sequence entire rice genome. Several laboratories have also given attention to regulated expression of plastid and nuclear genes as well as to isolate target-specific promoters or design promoters with improved potential. Simultaneously, transgenic systems for crops like mustard, rice, wheat, cotton, legumes and several vegetables have been established. More recently, genes of agronomic importance like those for insect resistance, abiotic stress tolerance, nutritional improvement and male sterility, isolated in India or abroad, have been utilized for raising transgenics for crop improvement. Some of these transgenics have already shown their potential in containment facility or limited field trials conducted under the stipulated guidelines. Plant molecular biology and biotechnology are thus clearly poised to make an impact on research in basic biology and agriculture in the near future.

  8. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  9. Characterization of Recombinant Thermococcus kodakaraensis (KOD) DNA Polymerases Produced Using Silkworm-Baculovirus Expression Vector System

    KAUST Repository

    Yamashita, Mami; Xu, Jian; Morokuma, Daisuke; Hirata, Kazuma; Hino, Masato; Mon, Hiroaki; Takahashi, Masateru; Hamdan, Samir; Sakashita, Kosuke; Iiyama, Kazuhiro; Banno, Yutaka; Kusakabe, Takahiro; Lee, Jae Man

    2017-01-01

    The KOD DNA polymerase from Thermococcus kodakarensis (Tkod-Pol) has been preferred for PCR due to its rapid elongation rate, extreme thermostability and outstanding fidelity. Here in this study, we utilized silkworm-baculovirus expression vector system (silkworm-BEVS) to express the recombinant Tkod-Pol (rKOD) with N-terminal (rKOD-N) or C-terminal (rKOD-C) tandem fusion tags. By using BEVS, we produced functional rKODs with satisfactory yields, about 1.1 mg/larva for rKOD-N and 0.25 mg/larva for rKOD-C, respectively. Interestingly, we found that rKOD-C shows higher thermostability at 95 °C than that of rKOD-N, while that rKOD-N is significantly unstable after exposing to long period of heat-shock. We also assessed the polymerase activity as well as the fidelity of purified rKODs under various conditions. Compared with commercially available rKOD, which is expressed in E. coli expression system, rKOD-C exhibited almost the same PCR performance as the commercial rKOD did, while rKOD-N did lower performance. Taken together, our results suggested that silkworm-BEVS can be used to express and purify efficient rKOD in a commercial way.

  10. Characterization of Recombinant Thermococcus kodakaraensis (KOD) DNA Polymerases Produced Using Silkworm-Baculovirus Expression Vector System

    KAUST Repository

    Yamashita, Mami

    2017-05-08

    The KOD DNA polymerase from Thermococcus kodakarensis (Tkod-Pol) has been preferred for PCR due to its rapid elongation rate, extreme thermostability and outstanding fidelity. Here in this study, we utilized silkworm-baculovirus expression vector system (silkworm-BEVS) to express the recombinant Tkod-Pol (rKOD) with N-terminal (rKOD-N) or C-terminal (rKOD-C) tandem fusion tags. By using BEVS, we produced functional rKODs with satisfactory yields, about 1.1 mg/larva for rKOD-N and 0.25 mg/larva for rKOD-C, respectively. Interestingly, we found that rKOD-C shows higher thermostability at 95 °C than that of rKOD-N, while that rKOD-N is significantly unstable after exposing to long period of heat-shock. We also assessed the polymerase activity as well as the fidelity of purified rKODs under various conditions. Compared with commercially available rKOD, which is expressed in E. coli expression system, rKOD-C exhibited almost the same PCR performance as the commercial rKOD did, while rKOD-N did lower performance. Taken together, our results suggested that silkworm-BEVS can be used to express and purify efficient rKOD in a commercial way.

  11. Radiation induced asymmetries in mitotic recombination: evidence for a directional bias in the formation of asymmetric hybrid DNA in yeast

    International Nuclear Information System (INIS)

    Friedman, L.R.; Sobell, H.M.

    We have examined radiation-induced mitotic recombination using two alleles (his1-36, his1-49) in the his1 gene. When the haploid containing his1-36 is irradiated with varying doses of γ rays and then mated with the unirradiated strain containing his1-49, analyses of the selected prototrophs show them to be primarily + +/+ 49. If, on the other hand, the haploid strain containing his1-49 is the irradiated parent, the prototrophic diploids are primarily + +/36 +. In control experiments, where either both strains are irradiated or not irradiated, no such asymmetries are found. These data indicate that the irradiated haploid chromosome tends to be the recipient of genetic information. We interpret these results as indicating a directional bias in the formation of hybrid DNA in radiation-induced mitotic recombination, and discuss these results in terms of current models of genetic recombination

  12. Hybridization-based antibody cDNA recovery for the production of recombinant antibodies identified by repertoire sequencing.

    Science.gov (United States)

    Valdés-Alemán, Javier; Téllez-Sosa, Juan; Ovilla-Muñoz, Marbella; Godoy-Lozano, Elizabeth; Velázquez-Ramírez, Daniel; Valdovinos-Torres, Humberto; Gómez-Barreto, Rosa E; Martinez-Barnetche, Jesús

    2014-01-01

    High-throughput sequencing of the antibody repertoire is enabling a thorough analysis of B cell diversity and clonal selection, which may improve the novel antibody discovery process. Theoretically, an adequate bioinformatic analysis could allow identification of candidate antigen-specific antibodies, requiring their recombinant production for experimental validation of their specificity. Gene synthesis is commonly used for the generation of recombinant antibodies identified in silico. Novel strategies that bypass gene synthesis could offer more accessible antibody identification and validation alternatives. We developed a hybridization-based recovery strategy that targets the complementarity-determining region 3 (CDRH3) for the enrichment of cDNA of candidate antigen-specific antibody sequences. Ten clonal groups of interest were identified through bioinformatic analysis of the heavy chain antibody repertoire of mice immunized with hen egg white lysozyme (HEL). cDNA from eight of the targeted clonal groups was recovered efficiently, leading to the generation of recombinant antibodies. One representative heavy chain sequence from each clonal group recovered was paired with previously reported anti-HEL light chains to generate full antibodies, later tested for HEL-binding capacity. The recovery process proposed represents a simple and scalable molecular strategy that could enhance antibody identification and specificity assessment, enabling a more cost-efficient generation of recombinant antibodies.

  13. Spin-dependent tunneling recombination in heterostructures with a magnetic layer

    Energy Technology Data Exchange (ETDEWEB)

    Denisov, K. S., E-mail: denisokonstantin@gmail.com; Rozhansky, I. V.; Averkiev, N. S. [Russian Academy of Sciences, Ioffe Physical–Technical Institute (Russian Federation); Lähderanta, E. [Lappeenranta University of Technology (Finland)

    2017-01-15

    We propose a mechanism for the generation of spin polarization in semiconductor heterostructures with a quantum well and a magnetic impurity layer spatially separated from it. The spin polarization of carriers in a quantum well originates from spin-dependent tunneling recombination at impurity states in the magnetic layer, which is accompanied by a fast linear increase in the degree of circular polarization of photoluminescence from the quantum well. Two situations are theoretically considered. In the first case, resonant tunneling to the spin-split sublevels of the impurity center occurs and spin polarization is caused by different populations of resonance levels in the quantum well for opposite spin projections. In the second, nonresonant case, the spin-split impurity level lies above the occupied states of electrons in the quantum well and plays the role of an intermediate state in the two-stage coherent spin-dependent recombination of an electron from the quantum well and a hole in the impurity layer. The developed theory allows us to explain both qualitatively and quantitatively the kinetics of photoexcited electrons in experiments with photoluminescence with time resolution in Mn-doped InGaAs heterostructures.

  14. Genetic recombination induced by DNA double-strand break in bacteriophage T4: nature of the left/right bias.

    Science.gov (United States)

    Shcherbakov, Victor P; Shcherbakova, Tamara; Plugina, Lidiya; Sizova, Svetlana; Kudryashova, Elena; Granovsky, Igor

    2008-06-01

    The experimental system combining double-strand breaks (DSBs), produced site-specifically by SegC endonuclease, with the famous advantages of the bacteriophage T4 rII mutant recombination analysis was used here to elucidate the origin of the recombination bias on two sides of the DSB, especially pronounced in gene 39 (topoisomerase II) and gene 59 (41-helicase loader) mutants. Three sources were found to contribute to the bias: (1) the SegC endonuclease may remain bound to the end of the broken DNA and thus protect it from exonuclease degradation; (2) in heteroduplex heterozygotes (HHs), arising as the recombinant products in the left-hand crosses, the transcribed strands are of rII mutant phenotype, so they, in contrast to the right-hand HHs, do not produce plaques on the lawn of the lambda-lysogenic host; and (3) the intrinsic polarity of T4 chromosome, reflected in transcription, may be a cause for discrimination of promoter-proximal and promoter-distal DNA sequences. It is shown that the apparent recombination bias does not imply one-sidedness of the DSB repair but just reflects a different depth of the end processing. It is inferred that the cause, underlying the "intrinsic" bias, might be interference between strand exchange and transcription. Topoisomerase and helicase functions are necessary to turn the process in favor of strand exchange. The idea is substantiated that the double-stranded to single-stranded DNA transition edge (not ss-DNA tip) serves as an actual recombinogenic element.

  15. Use of homologous recombination in yeast to create chimeric bovine viral diarrhea virus cDNA clones

    Directory of Open Access Journals (Sweden)

    Sandra Arenhart

    Full Text Available Abstract The open reading frame of a Brazilian bovine viral diarrhea virus (BVDV strain, IBSP4ncp, was recombined with the untranslated regions of the reference NADL strain by homologous recombination in Saccharomyces cerevisiae, resulting in chimeric full-length cDNA clones of BVDV (chi-NADL/IBSP4ncp#2 and chi-NADL/IBSP4ncp#3. The recombinant clones were successfully recovered, resulting in viable viruses, having the kinetics of replication, focus size, and morphology similar to those of the parental virus, IBSP4ncp. In addition, the chimeric viruses remained stable for at least 10 passages in cell culture, maintaining their replication efficiency unaltered. Nucleotide sequencing revealed a few point mutations; nevertheless, the phenotype of the rescued viruses was nearly identical to that of the parental virus in all experiments. Thus, genetic stability of the chimeric clones and their phenotypic similarity to the parental virus confirm the ability of the yeast-based homologous recombination to maintain characteristics of the parental virus from which the recombinant viruses were derived. The data also support possible use of the yeast system for the manipulation of the BVDV genome.

  16. Quantitative real-time PCR technique for the identification of E. coli residual DNA in streptokinase recombinant product.

    Science.gov (United States)

    Fazelahi, Mansoureh; Kia, Vahid; Kaghazian, Hooman; Paryan, Mahdi

    2017-11-26

    Recombinant streptokinase is a biopharmaceutical which is usually produced in E. coli. Residual DNA as a contamination and risk factor may remain in the product. It is necessary to control the production procedure to exclude any possible contamination. The aim of the present study was to develop a highly specific and sensitive quantitative real-time PCR-based method to determine the amount of E. coli DNA in recombinant streptokinase. A specific primers and a probe was designed to detect all strains of E. coli. To determine the specificity, in addition to using NCBI BLASTn, 28 samples including human, bacterial, and viral genomes were used. The results confirmed that the assay detects no genomic DNA but E. coli's and the specificity was determined to be 100%. To determine the sensitivity and limit of detection of the assay, a 10-fold serial dilution (10 1 to 10 7 copies/µL) was tested in triplicate. The sensitivity of the test was determined to be 101 copies/µL or 35 fg/µL. Inter-assay and intra-assay were determined to be 0.86 and 1.69%, respectively. Based on the results, this assay can be used as an accurate method to evaluate the contamination of recombinant streptokinase in E. coli.

  17. Redundant function of DNA ligase 1 and 3 in alternative end-joining during immunoglobulin class switch recombination.

    Science.gov (United States)

    Masani, Shahnaz; Han, Li; Meek, Katheryn; Yu, Kefei

    2016-02-02

    Nonhomologous end-joining (NHEJ) is the major DNA double-strand break (DSB) repair pathway in mammals and resolves the DSBs generated during both V(D)J recombination in developing lymphocytes and class switch recombination (CSR) in antigen-stimulated B cells. In contrast to the absolute requirement for NHEJ to resolve DSBs associated with V(D)J recombination, DSBs associated with CSR can be resolved in NHEJ-deficient cells (albeit at a reduced level) by a poorly defined alternative end-joining (A-EJ) pathway. Deletion of DNA ligase IV (Lig4), a core component of the NHEJ pathway, reduces CSR efficiency in a mouse B-cell line capable of robust cytokine-stimulated CSR in cell culture. Here, we report that CSR levels are not further reduced by deletion of either of the two remaining DNA ligases (Lig1 and nuclear Lig3) in Lig4(-/-) cells. We conclude that in the absence of Lig4, Lig1, and Lig3 function in a redundant manner in resolving switch region DSBs during CSR.

  18. Time-dependent wave-packet study of the direct low-energy dissociative recombination of HD+

    International Nuclear Information System (INIS)

    Orel, A. E.

    2000-01-01

    Wave-packet methods involving the numerical solution of the time-dependent Schroedinger equation have been used with great success in the calculation of cross sections for dissociative recombination of molecular ions by electron impact in the high energy region where the ''boomerang'' model [L. Dube and A. Herzenberg, Phys. Rev. A 11, 1314 (1975)] is valid. We extend this method to study low-energy dissociative recombination where this approximation is no longer appropriate. We apply the method to the ''direct'' low-energy dissociative recombination of HD + . Our results are in excellent agreement with calculations using the multichannel quantum defect method. (c) 2000 The American Physical Society

  19. Direct and indirect control of the initiation of meiotic recombination by DNA damage checkpoint mechanisms in budding yeast.

    Directory of Open Access Journals (Sweden)

    Bilge Argunhan

    Full Text Available Meiotic recombination plays an essential role in the proper segregation of chromosomes at meiosis I in many sexually reproducing organisms. Meiotic recombination is initiated by the scheduled formation of genome-wide DNA double-strand breaks (DSBs. The timing of DSB formation is strictly controlled because unscheduled DSB formation is detrimental to genome integrity. Here, we investigated the role of DNA damage checkpoint mechanisms in the control of meiotic DSB formation using budding yeast. By using recombination defective mutants in which meiotic DSBs are not repaired, the effect of DNA damage checkpoint mutations on DSB formation was evaluated. The Tel1 (ATM pathway mainly responds to unresected DSB ends, thus the sae2 mutant background in which DSB ends remain intact was employed. On the other hand, the Mec1 (ATR pathway is primarily used when DSB ends are resected, thus the rad51 dmc1 double mutant background was employed in which highly resected DSBs accumulate. In order to separate the effect caused by unscheduled cell cycle progression, which is often associated with DNA damage checkpoint defects, we also employed the ndt80 mutation which permanently arrests the meiotic cell cycle at prophase I. In the absence of Tel1, DSB formation was reduced in larger chromosomes (IV, VII, II and XI whereas no significant reduction was found in smaller chromosomes (III and VI. On the other hand, the absence of Rad17 (a critical component of the ATR pathway lead to an increase in DSB formation (chromosomes VII and II were tested. We propose that, within prophase I, the Tel1 pathway facilitates DSB formation, especially in bigger chromosomes, while the Mec1 pathway negatively regulates DSB formation. We also identified prophase I exit, which is under the control of the DNA damage checkpoint machinery, to be a critical event associated with down-regulating meiotic DSB formation.

  20. Ensuring an exit strategy: RTEL1 restricts rogue recombination.

    Science.gov (United States)

    Villeneuve, Anne M

    2008-10-17

    Success of homologous recombination-based DNA repair depends not only on recombinases, which promote invasion of the homologous DNA duplex that serves as a template for repair, but also on antirecombinases, which dismantle recombination intermediates to allow completion of repair. In this issue, Barber et al. (2008) identify a previously elusive antirecombinase activity important for maintaining genome stability in animals.

  1. Recombinant VSV G proteins reveal a novel raft-dependent endocytic pathway in resorbing osteoclasts

    International Nuclear Information System (INIS)

    Mulari, Mika T.K.; Nars, Martin; Laitala-Leinonen, Tiina; Kaisto, Tuula; Metsikkoe, Kalervo; Sun Yi; Vaeaenaenen, H. Kalervo

    2008-01-01

    Transcytotic membrane flow delivers degraded bone fragments from the ruffled border to the functional secretory domain, FSD, in bone resorbing osteoclasts. Here we show that there is also a FSD-to-ruffled border trafficking pathway that compensates for the membrane loss during the matrix uptake process and that rafts are essential for this ruffled border-targeted endosomal pathway. Replacing the cytoplasmic tail of the vesicular stomatitis virus G protein with that of CD4 resulted in partial insolubility in Triton X-100 and retargeting from the peripheral non-bone facing plasma membrane to the FSD. Recombinant G proteins were subsequently endosytosed and delivered from the FSD to the peripheral fusion zone of the ruffled border, which were both rich in lipid rafts as suggested by viral protein transport analysis and visualizing the rafts with fluorescent recombinant cholera toxin. Cholesterol depletion by methyl-β-cyclodextrin impaired the ruffled border-targeted vesicle trafficking pathway and inhibited bone resorption dose-dependently as quantified by measuring the CTX and TRACP 5b secreted to the culture medium and by measuring the resorbed area visualized with a bi-phasic labeling method using sulpho-NHS-biotin and WGA-lectin. Thus, rafts are vital for membrane recycling from the FSD to the late endosomal/lysosomal ruffled border and bone resorption

  2. A sequence-dependent rigid-base model of DNA

    Science.gov (United States)

    Gonzalez, O.; Petkevičiutė, D.; Maddocks, J. H.

    2013-02-01

    A novel hierarchy of coarse-grain, sequence-dependent, rigid-base models of B-form DNA in solution is introduced. The hierarchy depends on both the assumed range of energetic couplings, and the extent of sequence dependence of the model parameters. A significant feature of the models is that they exhibit the phenomenon of frustration: each base cannot simultaneously minimize the energy of all of its interactions. As a consequence, an arbitrary DNA oligomer has an intrinsic or pre-existing stress, with the level of this frustration dependent on the particular sequence of the oligomer. Attention is focussed on the particular model in the hierarchy that has nearest-neighbor interactions and dimer sequence dependence of the model parameters. For a Gaussian version of this model, a complete coarse-grain parameter set is estimated. The parameterized model allows, for an oligomer of arbitrary length and sequence, a simple and explicit construction of an approximation to the configuration-space equilibrium probability density function for the oligomer in solution. The training set leading to the coarse-grain parameter set is itself extracted from a recent and extensive database of a large number of independent, atomic-resolution molecular dynamics (MD) simulations of short DNA oligomers immersed in explicit solvent. The Kullback-Leibler divergence between probability density functions is used to make several quantitative assessments of our nearest-neighbor, dimer-dependent model, which is compared against others in the hierarchy to assess various assumptions pertaining both to the locality of the energetic couplings and to the level of sequence dependence of its parameters. It is also compared directly against all-atom MD simulation to assess its predictive capabilities. The results show that the nearest-neighbor, dimer-dependent model can successfully resolve sequence effects both within and between oligomers. For example, due to the presence of frustration, the model can

  3. A sequence-dependent rigid-base model of DNA.

    Science.gov (United States)

    Gonzalez, O; Petkevičiūtė, D; Maddocks, J H

    2013-02-07

    A novel hierarchy of coarse-grain, sequence-dependent, rigid-base models of B-form DNA in solution is introduced. The hierarchy depends on both the assumed range of energetic couplings, and the extent of sequence dependence of the model parameters. A significant feature of the models is that they exhibit the phenomenon of frustration: each base cannot simultaneously minimize the energy of all of its interactions. As a consequence, an arbitrary DNA oligomer has an intrinsic or pre-existing stress, with the level of this frustration dependent on the particular sequence of the oligomer. Attention is focussed on the particular model in the hierarchy that has nearest-neighbor interactions and dimer sequence dependence of the model parameters. For a Gaussian version of this model, a complete coarse-grain parameter set is estimated. The parameterized model allows, for an oligomer of arbitrary length and sequence, a simple and explicit construction of an approximation to the configuration-space equilibrium probability density function for the oligomer in solution. The training set leading to the coarse-grain parameter set is itself extracted from a recent and extensive database of a large number of independent, atomic-resolution molecular dynamics (MD) simulations of short DNA oligomers immersed in explicit solvent. The Kullback-Leibler divergence between probability density functions is used to make several quantitative assessments of our nearest-neighbor, dimer-dependent model, which is compared against others in the hierarchy to assess various assumptions pertaining both to the locality of the energetic couplings and to the level of sequence dependence of its parameters. It is also compared directly against all-atom MD simulation to assess its predictive capabilities. The results show that the nearest-neighbor, dimer-dependent model can successfully resolve sequence effects both within and between oligomers. For example, due to the presence of frustration, the model can

  4. Time-dependent mobility and recombination of the photoinduced charge carriers in conjugated polymer/fullerene bulk heterojunction solar cells

    Science.gov (United States)

    Mozer, A. J.; Dennler, G.; Sariciftci, N. S.; Westerling, M.; Pivrikas, A.; Österbacka, R.; Juška, G.

    2005-07-01

    Time-dependent mobility and recombination in the blend of poly[2-methoxy-5-(3,7-dimethyloctyloxy)-phenylene vinylene] (MDMO-PPV) and 1-(3-methoxycarbonyl)propyl-1-phenyl-(6,6)- C61 (PCBM) is studied simultaneously using the photoinduced charge carrier extraction by linearly increasing voltage technique. The charge carriers are photogenerated by a strongly absorbed, 3 ns laser flash, and extracted by the application of a reverse bias voltage pulse after an adjustable delay time (tdel) . It is found that the mobility of the extracted charge carriers decreases with increasing delay time, especially shortly after photoexcitation. The time-dependent mobility μ(t) is attributed to the energy relaxation of the charge carriers towards the tail states of the density of states distribution. A model based on a dispersive bimolecular recombination is formulated, which properly describes the concentration decay of the extracted charge carriers at all measured temperatures and concentrations. The calculated bimolecular recombination coefficient β(t) is also found to be time-dependent exhibiting a power law dependence as β(t)=β0t-(1-γ) with increasing slope (1-γ) with decreasing temperatures. The temperature dependence study reveals that both the mobility and recombination of the photogenerated charge carriers are thermally activated processes with activation energy in the range of 0.1 eV. Finally, the direct comparison of μ(t) and β(t) shows that the recombination of the long-lived charge carriers is controlled by diffusion.

  5. Charge recombination process in X-ray irradiated pyrene-doped polystyrene as studied by optically detected electron spin resonance and magnetic field dependence of the recombination fluorescence

    International Nuclear Information System (INIS)

    Okazaki, Masaharu; Tai, Yutaka; Toriyama, Kazumi

    1993-01-01

    The optically-detected ESR (ODESR) spectrum and magnetic field dependence on recombination fluorescence were observed for X-ray irradiated pyrene-doped polystyrene at temperatures of 242-348 K. The ODESR intensity as a function of the pyrene concentration, 0.1-8.9 wt%, showed an unusual minimum at about 1.0%. Two phases were separated in the magnetic field dependence of the fluorescence: one was sharp and saturates at fields of over 50 mT, while the other was broad with a dip at around 60-150 mT. The cause of this dip was naturally attributed to the ST -1 level crossing. The sharp magnetic field effect also showed a minimum at around a concentration of 1.0 wt%. These novel findings have been interpreted using a recombination model modified from the previous one for pyrene-doped ethylene-propylene rubber and polyethylene. The essential points of the present model are: (1) although electron hopping within the polystyrene molecule is rapid, electron transfer at the last step of recombination between the polystyrene anion and the pyrene cation proceeds at a moderate rate; (2) the hole-transfer rate in the polymer chain is moderate; (3) electron hopping between the doped pyrene molecules is very much dependent on the concentration; (4) hole hopping between the pyrenes is inhibited. (author)

  6. The 3'-to-5' exonuclease activity of vaccinia virus DNA polymerase is essential and plays a role in promoting virus genetic recombination.

    Science.gov (United States)

    Gammon, Don B; Evans, David H

    2009-05-01

    Poxviruses are subjected to extraordinarily high levels of genetic recombination during infection, although the enzymes catalyzing these reactions have never been identified. However, it is clear that virus-encoded DNA polymerases play some unknown yet critical role in virus recombination. Using a novel, antiviral-drug-based strategy to dissect recombination and replication reactions, we now show that the 3'-to-5' proofreading exonuclease activity of the viral DNA polymerase plays a key role in promoting recombination reactions. Linear DNA substrates were prepared containing the dCMP analog cidofovir (CDV) incorporated into the 3' ends of the molecules. The drug blocked the formation of concatemeric recombinant molecules in vitro in a process that was catalyzed by the proofreading activity of vaccinia virus DNA polymerase. Recombinant formation was also blocked when CDV-containing recombination substrates were transfected into cells infected with wild-type vaccinia virus. These inhibitory effects could be overcome if CDV-containing substrates were transfected into cells infected with CDV-resistant (CDV(r)) viruses, but only when resistance was linked to an A314T substitution mutation mapping within the 3'-to-5' exonuclease domain of the viral polymerase. Viruses encoding a CDV(r) mutation in the polymerase domain still exhibited a CDV-induced recombination deficiency. The A314T substitution also enhanced the enzyme's capacity to excise CDV molecules from the 3' ends of duplex DNA and to recombine these DNAs in vitro, as judged from experiments using purified mutant DNA polymerase. The 3'-to-5' exonuclease activity appears to be an essential virus function, and our results suggest that this might be because poxviruses use it to promote genetic exchange.

  7. Temperature dependent recombination dynamics in InP/ZnS colloidal nanocrystals

    Science.gov (United States)

    Shirazi, R.; Kopylov, O.; Kovacs, A.; Kardynał, B. E.

    2012-08-01

    In this letter, we investigate exciton recombination in InP/ZnS core-shell colloidal nanocrystals over a wide temperature range. Over the entire range between room temperature and liquid helium temperature, multi-exponential exciton decay curves are observed and well explained by the presence of bright and dark exciton states, as well as defect states. Two different types of defect are present: one located at the core-shell interface and the other on the surface of the nanocrystal. Based on the temperature dependent contributions of all four states to the total photoluminescence signal, we estimate that the four states are distributed within a 20 meV energy band in nanocrystals that emit at 1.82 eV.

  8. Cloning of human tumor necrosis factor (TNF) receptor cDNA and expression of recombinant soluble TNF-binding protein

    International Nuclear Information System (INIS)

    Gray, P.W.; Barrett, K.; Chantry, D.; Turner, M.; Feldmann, M.

    1990-01-01

    The cDNA for one of the receptors for human tumor necrosis factor (TNF) has been isolated. This cDNA encodes a protein of 455 amino acids that is divided into an extracellular domain of 171 residues and a cytoplasmic domain of 221 residues. The extracellular domain has been engineered for expression in mammalian cells, and this recombinant derivative binds TNFα with high affinity and inhibits its cytotoxic activity in vitro. The TNF receptor exhibits similarity with a family of cell surface proteins that includes the nerve growth factor receptor, the human B-cell surface antigen CD40, and the rat T-cell surface antigen OX40. The TNF receptor contains four cysteine-rich subdomains in the extracellular portion. Mammalian cells transfected with the entire TNF receptor cDNA bind radiolabeled TNFα with an affinity of 2.5 x 10 -9 M. This binding can be competitively inhibited with unlabeled TNFα or lymphotoxin (TNFβ)

  9. Biochemical characterization of a recombinant Japanese encephalitis virus RNA-dependent RNA polymerase

    Directory of Open Access Journals (Sweden)

    Kim Chan-Mi

    2007-07-01

    Full Text Available Abstract Background Japanese encephalitis virus (JEV NS5 is a viral nonstructural protein that carries both methyltransferase and RNA-dependent RNA polymerase (RdRp domains. It is a key component of the viral RNA replicase complex that presumably includes other viral nonstructural and cellular proteins. The biochemical properties of JEV NS5 have not been characterized due to the lack of a robust in vitro RdRp assay system, and the molecular mechanisms for the initiation of RNA synthesis by JEV NS5 remain to be elucidated. Results To characterize the biochemical properties of JEV RdRp, we expressed in Escherichia coli and purified an enzymatically active full-length recombinant JEV NS5 protein with a hexahistidine tag at the N-terminus. The purified NS5 protein, but not the mutant NS5 protein with an Ala substitution at the first Asp of the RdRp-conserved GDD motif, exhibited template- and primer-dependent RNA synthesis activity using a poly(A RNA template. The NS5 protein was able to use both plus- and minus-strand 3'-untranslated regions of the JEV genome as templates in the absence of a primer, with the latter RNA being a better template. Analysis of the RNA synthesis initiation site using the 3'-end 83 nucleotides of the JEV genome as a minimal RNA template revealed that the NS5 protein specifically initiates RNA synthesis from an internal site, U81, at the two nucleotides upstream of the 3'-end of the template. Conclusion As a first step toward the understanding of the molecular mechanisms for JEV RNA replication and ultimately for the in vitro reconstitution of viral RNA replicase complex, we for the first time established an in vitro JEV RdRp assay system with a functional full-length recombinant JEV NS5 protein and characterized the mechanisms of RNA synthesis from nonviral and viral RNA templates. The full-length recombinant JEV NS5 will be useful for the elucidation of the structure-function relationship of this enzyme and for the

  10. Evidence for the role of Mycobacterium tuberculosis RecG helicase in DNA repair and recombination.

    Science.gov (United States)

    Thakur, Roshan S; Basavaraju, Shivakumar; Somyajit, Kumar; Jain, Akshatha; Subramanya, Shreelakshmi; Muniyappa, Kalappa; Nagaraju, Ganesh

    2013-04-01

    In order to survive and replicate in a variety of stressful conditions during its life cycle, Mycobacterium tuberculosis must possess mechanisms to safeguard the integrity of the genome. Although DNA repair and recombination related genes are thought to play key roles in the repair of damaged DNA in all organisms, so far only a few of them have been functionally characterized in the tubercle bacillus. In this study, we show that M. tuberculosis RecG (MtRecG) expression was induced in response to different genotoxic agents. Strikingly, expression of MtRecG in Escherichia coli ∆recG mutant strain provided protection against mitomycin C, methyl methane sulfonate and UV induced cell death. Purified MtRecG exhibited higher binding affinity for the Holliday junction (HJ) compared with a number of canonical recombinational DNA repair intermediates. Notably, although MtRecG binds at the core of the mobile and immobile HJs, and with higher binding affinity for the immobile HJ, branch migration was evident only in the case of the mobile HJ. Furthermore, immobile HJs stimulate MtRecG ATPase activity less efficiently than mobile HJs. In addition to HJ substrates, MtRecG exhibited binding affinity for a variety of branched DNA structures including three-way junctions, replication forks, flap structures, forked duplex and a D-loop structure, but demonstrated strong unwinding activity on replication fork and flap DNA structures. Together, these results support that MtRecG plays an important role in processes related to DNA metabolism under normal as well as stress conditions. © 2013 The Authors Journal compilation © 2013 FEBS.

  11. Morphology effects on spin-dependent transport and recombination in polyfluorene thin films

    Science.gov (United States)

    Miller, Richards; van Schooten, K. J.; Malissa, H.; Joshi, G.; Jamali, S.; Lupton, J. M.; Boehme, C.

    2016-12-01

    We have studied the role of spin-dependent processes on conductivity in polyfluorene (PFO) thin films by preforming continuous wave (cw) electrically detected magnetic resonance (EDMR) spectroscopy at temperatures between 10 K and room temperature using microwave frequencies between about 1 GHz and 20 GHz, as well as pulsed EDMR at the X band (10 GHz). Variable frequency EDMR allows us to establish the role of spin-orbit coupling in spin-dependent processes whereas pulsed EDMR allows for the observation of coherent spin motion effects. We used PFO for this study in order to allow for the investigation of the effects of microscopic morphological ordering since this material can adopt two distinct intrachain morphologies: an amorphous (glassy) phase, in which monomer units are twisted with respect to each other, and an ordered (β) phase, where all monomers lie within one plane. In thin films of organic light-emitting diodes, the appearance of a particular phase can be controlled by deposition parameters and solvent vapor annealing, and is verified by electroluminescence spectroscopy. Under bipolar charge-carrier injection conditions, we conducted multifrequency cw EDMR, electrically detected Rabi spin-beat experiments, and Hahn echo and inversion-recovery measurements. Coherent echo spectroscopy reveals electrically detected electron-spin-echo envelope modulation due to the coupling of the carrier spins to nearby nuclear spins. Our results demonstrate that, while conformational disorder can influence the observed EDMR signals, including the sign of the current changes on resonance as well as the magnitudes of local hyperfine fields and charge-carrier spin-orbit interactions, it does not qualitatively affect the nature of spin-dependent transitions in this material. In both morphologies, we observe the presence of at least two different spin-dependent recombination processes. At room temperature and 10 K, polaron-pair recombination through weakly spin-spin coupled

  12. SIRT6 stabilizes DNA-dependent protein kinase at chromatin for DNA double-strand break repair

    DEFF Research Database (Denmark)

    McCord, Ronald A; Michishita, Eriko; Hong, Tao

    2009-01-01

    -PKcs) to chromatin in response to DNA damage and stabilizes DNA-PKcs at chromatin adjacent to an induced site-specific DSB. Abrogation of these SIRT6 activities leads to impaired resolution of DSBs. Together, these findings elucidate a mechanism whereby regulation of dynamic interaction of a DNA repair factor......-dependent protein kinase) and promotes DNA DSB repair. In response to DSBs, SIRT6 associates dynamically with chromatin and is necessary for an acute decrease in global cellular acetylation levels on histone H3 Lysine 9. Moreover, SIRT6 is required for mobilization of the DNA-PK catalytic subunit (DNA......, and SIRT6 knockout cells exhibit genomic instability and DNA damage hypersensitivity. However, the molecular mechanisms underlying these defects are not fully understood. Here, we show that SIRT6 forms a macromolecular complex with the DNA double-strand break (DSB) repair factor DNA-PK (DNA...

  13. Diffusion-driven and excitation-dependent recombination rate in blue InGaN/GaN quantum well structures

    International Nuclear Information System (INIS)

    Aleksiejūnas, R.; Gelžinytė, K.; Nargelas, S.; Jarašiūnas, K.; Vengris, M.; Armour, E. A.; Byrnes, D. P.; Arif, R. A.; Lee, S. M.; Papasouliotis, G. D.

    2014-01-01

    We report on diffusion-driven and excitation-dependent carrier recombination rate in multiple InGaN/GaN quantum wells by using photoluminescence, light-induced absorption, and diffraction techniques. We demonstrate gradually increasing with excitation carrier diffusivity and its correlation with the recombination rate. At low carrier densities, an increase in radiative emission and carrier lifetime was observed due to partial saturation of non-radiative recombination centers. However, at carrier densities above ∼5 × 10 18  cm −3 , a typical value of photoluminescence efficiency droop, a further increase of diffusivity forces the delocalized carriers to face higher number of fast non-radiative recombination centers leading to an increase of non-radiative losses

  14. Diffusion-driven and excitation-dependent recombination rate in blue InGaN/GaN quantum well structures

    Energy Technology Data Exchange (ETDEWEB)

    Aleksiejūnas, R.; Gelžinytė, K.; Nargelas, S., E-mail: saulius.nargelas@ff.vu.lt; Jarašiūnas, K. [Department of Semiconductor Optoelectronics, Institute of Applied Research, Vilnius University, Saulėtekio 9–III, 10222 Vilnius (Lithuania); Vengris, M. [Laser Research Center, Vilnius University, Saulėtekio 10, 10223 Vilnius (Lithuania); Armour, E. A.; Byrnes, D. P.; Arif, R. A.; Lee, S. M.; Papasouliotis, G. D. [Veeco Instruments, Turbodisc Operations, 394 Elizabeth Avenue, Somerset, New Jersey 08873 (United States)

    2014-01-13

    We report on diffusion-driven and excitation-dependent carrier recombination rate in multiple InGaN/GaN quantum wells by using photoluminescence, light-induced absorption, and diffraction techniques. We demonstrate gradually increasing with excitation carrier diffusivity and its correlation with the recombination rate. At low carrier densities, an increase in radiative emission and carrier lifetime was observed due to partial saturation of non-radiative recombination centers. However, at carrier densities above ∼5 × 10{sup 18} cm{sup −3}, a typical value of photoluminescence efficiency droop, a further increase of diffusivity forces the delocalized carriers to face higher number of fast non-radiative recombination centers leading to an increase of non-radiative losses.

  15. When two is not enough: a CtIP tetramer is required for DNA repair by Homologous Recombination.

    Science.gov (United States)

    Forment, Josep V; Jackson, Stephen P; Pellegrini, Luca

    2015-01-01

    Homologous recombination (HR) is central to the repair of double-strand DNA breaks that occur in S/G2 phases of the cell cycle. HR relies on the CtIP protein (Ctp1 in fission yeast, Sae2 in budding yeast) for resection of DNA ends, a key step in generating the 3'-DNA overhangs that are required for the HR strand-exchange reaction. Although much has been learned about the biological importance of CtIP in DNA repair, our mechanistic insight into its molecular functions remains incomplete. It has been recently discovered that CtIP and Ctp1 share a conserved tetrameric architecture that is mediated by their N-terminal domains and is critical for their function in HR. The specific arrangement of protein chains in the CtIP/Ctp1 tetramer indicates that an ability to bridge DNA ends might be an important feature of CtIP/Ctp1 function, establishing an intriguing similarity with the known ability of the MRE11-RAD50-NBS1 complex to link DNA ends. Although the exact mechanism of action remains to be elucidated, the remarkable evolutionary conservation of CtIP/Ctp1 tetramerisation clearly points to its crucial role in HR.

  16. Differentiation of Human Induced Pluripotent or Embryonic Stem Cells Decreases the DNA Damage Repair by Homologous Recombination

    Directory of Open Access Journals (Sweden)

    Kalpana Mujoo

    2017-11-01

    Full Text Available The nitric oxide (NO-cyclic GMP pathway contributes to human stem cell differentiation, but NO free radical production can also damage DNA, necessitating a robust DNA damage response (DDR to ensure cell survival. How the DDR is affected by differentiation is unclear. Differentiation of stem cells, either inducible pluripotent or embryonic derived, increased residual DNA damage as determined by γ-H2AX and 53BP1 foci, with increased S-phase-specific chromosomal aberration after exposure to DNA-damaging agents, suggesting reduced homologous recombination (HR repair as supported by the observation of decreased HR-related repair factor foci formation (RAD51 and BRCA1. Differentiated cells also had relatively increased fork stalling and R-loop formation after DNA replication stress. Treatment with NO donor (NOC-18, which causes stem cell differentiation has no effect on double-strand break (DSB repair by non-homologous end-joining but reduced DSB repair by HR. Present studies suggest that DNA repair by HR is impaired in differentiated cells.

  17. DNA hybridization kinetics: zippering, internal displacement and sequence dependence.

    Science.gov (United States)

    Ouldridge, Thomas E; Sulc, Petr; Romano, Flavio; Doye, Jonathan P K; Louis, Ard A

    2013-10-01

    Although the thermodynamics of DNA hybridization is generally well established, the kinetics of this classic transition is less well understood. Providing such understanding has new urgency because DNA nanotechnology often depends critically on binding rates. Here, we explore DNA oligomer hybridization kinetics using a coarse-grained model. Strand association proceeds through a complex set of intermediate states, with successful binding events initiated by a few metastable base-pairing interactions, followed by zippering of the remaining bonds. But despite reasonably strong interstrand interactions, initial contacts frequently dissociate because typical configurations in which they form differ from typical states of similar enthalpy in the double-stranded equilibrium ensemble. Initial contacts must be stabilized by two or three base pairs before full zippering is likely, resulting in negative effective activation enthalpies. Non-Arrhenius behavior arises because the number of base pairs required for nucleation increases with temperature. In addition, we observe two alternative pathways-pseudoknot and inchworm internal displacement-through which misaligned duplexes can rearrange to form duplexes. These pathways accelerate hybridization. Our results explain why experimentally observed association rates of GC-rich oligomers are higher than rates of AT- rich equivalents, and more generally demonstrate how association rates can be modulated by sequence choice.

  18. Polyfluorophore Labels on DNA: Dramatic Sequence Dependence of Quenching

    Science.gov (United States)

    Teo, Yin Nah; Wilson, James N.

    2010-01-01

    We describe studies carried out in the DNA context to test how a common fluorescence quencher, dabcyl, interacts with oligodeoxynu-cleoside fluorophores (ODFs)—a system of stacked, electronically interacting fluorophores built on a DNA scaffold. We tested twenty different tetrameric ODF sequences containing varied combinations and orderings of pyrene (Y), benzopyrene (B), perylene (E), dimethylaminostilbene (D), and spacer (S) monomers conjugated to the 3′ end of a DNA oligomer. Hybridization of this probe sequence to a dabcyl-labeled complementary strand resulted in strong quenching of fluorescence in 85% of the twenty ODF sequences. The high efficiency of quenching was also established by their large Stern–Volmer constants (KSV) of between 2.1 × 104 and 4.3 × 105M−1, measured with a free dabcyl quencher. Interestingly, quenching of ODFs displayed strong sequence dependence. This was particularly evident in anagrams of ODF sequences; for example, the sequence BYDS had a KSV that was approximately two orders of magnitude greater than that of BSDY, which has the same dye composition. Other anagrams, for example EDSY and ESYD, also displayed different responses upon quenching by dabcyl. Analysis of spectra showed that apparent excimer and exciplex emission bands were quenched with much greater efficiency compared to monomer emission bands by at least an order of magnitude. This suggests an important role played by delocalized excited states of the π stack of fluorophores in the amplified quenching of fluorescence. PMID:19780115

  19. DNA requirements for interaction of the C-terminal region of Ku80 with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs).

    Science.gov (United States)

    Radhakrishnan, Sarvan Kumar; Lees-Miller, Susan P

    2017-09-01

    Non-homologous end joining (NHEJ) is the major pathway for the repair of ionizing radiation induced DNA double strand breaks (DSBs) in human cells. Critical to NHEJ is the DNA-dependent interaction of the Ku70/80 heterodimer with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs) to form the DNA-PK holoenzyme. However, precisely how Ku recruits DNA-PKcs to DSBs ends to enhance its kinase activity has remained enigmatic, with contradictory findings reported in the literature. Here we address the role of the Ku80 C-terminal region (CTR) in the DNA-dependent interaction of Ku70/80 with DNA-PKcs using purified components and defined DNA structures. Our results show that the Ku80 CTR is required for interaction with DNA-PKcs on short segments of blunt ended 25bp dsDNA or 25bp dsDNA with a 15-base poly dA single stranded (ss) DNA extension, but this requirement is less stringent on longer dsDNA molecules (35bp blunt ended dsDNA) or 25bp duplex DNA with either a 15-base poly dT or poly dC ssDNA extension. Moreover, the DNA-PKcs-Ku complex preferentially forms on 25 bp DNA with a poly-pyrimidine ssDNA extension.Our work clarifies the role of the Ku80 CTR and dsDNA ends on the interaction of DNA-PKcs with Ku and provides key information to guide assembly and biology of NHEJ complexes. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Relative contribution of homologous recombination and non-homologous end-joining to DNA double-strand break repair after oxidative stress in Saccharomyces cerevisiae.

    Science.gov (United States)

    Letavayová, Lucia; Marková, Eva; Hermanská, Katarína; Vlcková, Viera; Vlasáková, Danusa; Chovanec, Miroslav; Brozmanová, Jela

    2006-05-10

    Oxidative damage to DNA seems to be an important factor in developing many human diseases including cancer. It involves base and sugar damage, base-free sites, DNA-protein cross-links and DNA single-strand (SSB) and double-strand (DSB) breaks. Oxidative DSB can be formed in various ways such as their direct induction by the drug or their generation either through attempted and aborted repair of primary DNA lesions or through DNA replication-dependent conversion of SSB. In general, two main pathways are responsible for repairing DSB, homologous recombination (HR) and non-homologous end-joining (NHEJ), with both of them being potential candidates for the repair of oxidative DSB. We have examined relative contribution of HR and NHEJ to cellular response after oxidative stress in Saccharomyces cerevisiae. Therefore, cell survival, mutagenesis and DSB induction and repair in the rad52, yku70 and rad52 yku70 mutants after hydrogen peroxide (H(2)O(2)), menadione (MD) or bleomycin (BLM) exposure were compared to those obtained for the corresponding wild type. We show that MD exposure does not lead to observable DSB induction in yeast, suggesting that the toxic effects of this agent are mediated by other types of DNA damage. Although H(2)O(2) treatment generates some DSB, their yield is relatively low and hence DSB may only partially be responsible for toxicity of H(2)O(2), particularly at high doses of the agent. On the other hand, the basis of the BLM toxicity resides primarily in DSB induction. Both HR and NHEJ act on BLM-induced DSB, although their relative participation in the process is not equal. Based on our results we suggest that the complexity and/or the quality of the BLM-induced DSB might represent an obstacle for the NHEJ pathway.

  1. DNA compaction in the early part of the SOS response is dependent on RecN and RecA.

    Science.gov (United States)

    Odsbu, Ingvild; Skarstad, Kirsten

    2014-05-01

    The nucleoids of undamaged Escherichia coli cells have a characteristic shape and number, which is dependent on the growth medium. Upon induction of the SOS response by a low dose of UV irradiation an extensive reorganization of the nucleoids occurred. Two distinct phases were observed by fluorescence microscopy. First, the nucleoids were found to change shape and fuse into compact structures at midcell. The compaction of the nucleoids lasted for 10-20 min and was followed by a phase where the DNA was dispersed throughout the cells. This second phase lasted for ~1 h. The compaction was found to be dependent on the recombination proteins RecA, RecO and RecR as well as the SOS-inducible, SMC (structural maintenance of chromosomes)-like protein RecN. RecN protein is produced in high amounts during the first part of the SOS response. It is possible that the RecN-mediated 'compact DNA' stage at the beginning of the SOS response serves to stabilize damaged DNA prior to recombination and repair.

  2. BCR/ABL downregulates DNA-PK(CS)-dependent and upregulates backup non-homologous end joining in leukemic cells.

    Science.gov (United States)

    Poplawski, Tomasz; Blasiak, Janusz

    2010-06-01

    Non-homologous end joining (NHEJ) and homologous recombination repair (HRR) are the main mechanisms involved in the processing of DNA double strand breaks (DSBs) in humans. We showed previously that the oncogenic tyrosine kinase BCR/ABL stimulated DSBs repair by HRR. To evaluate the role of BCR/ABL in DSBs repair by NHEJ we examined the ability of leukemic BCR/ABL-expressing cell line BV173 to repair DNA damage induced by two DNA topoisomerase II inhibitors: etoposide and sobuzoxane. DNA lesions induced by sobuzoxane are repaired by a NHEJ pathway which is dependent on the catalytic subunit of protein kinase dependent on DNA (DNA-PK(CS); D-NHEJ), whereas damage evoked by etoposide are repaired by two distinct NHEJ pathways, dependent on or independent of DNA-PK(CS) (backup NHEJ, B-NHEJ). Cells incubated with STI571, a highly specific inhibitor of BCR/ABL, displayed resistance to these agents associated with an accelerated kinetics of DSBs repair, as measured by the neutral comet assay and pulsed field gel electrophoresis. However, in a functional NHEJ assay, cells preincubated with STI571 repaired DSBs induced by a restriction enzyme with a lower efficacy than without the preincubation and addition of wortmannin, a specific inhibitor of DNA-PK(CS), did not change efficacy of the NHEJ reaction. We suggest that BCR/ABL switch on B-NHEJ which is more error-prone then D-NHEJ and in such manner contribute to the increase of the genomic instability of leukemic cells.

  3. 78 FR 27977 - Office of Biotechnology Activities; Recombinant DNA Research: Proposed Actions Under the NIH...

    Science.gov (United States)

    2013-05-13

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health Office of Biotechnology... Recombinant or Synthetic Nucleic Acid Molecules (NIH Guidelines) SUMMARY: The NIH Office of Biotechnology... of Biotechnology Activities, National Institutes of Health, 6705 Rockledge Drive, Suite 750, Bethesda...

  4. Effects of DNA double-strand and single-strand breaks on intrachromosomal recombination events in cell-cycle-arrested yeast cells

    International Nuclear Information System (INIS)

    Galli, A.; Schiestl, R.H.

    1998-01-01

    Intrachromosomal recombination between repeated elements can result in deletion (DEL recombination) events. We investigated the inducibility of such intrachromosomal recombination events at different stages of the cell cycle and the nature of the primary DNA lesions capable of initiating these events. Two genetic systems were constructed in Saccharomyces cerevisiae that select for DEL recombination events between duplicated alleles of CDC28 and TUB2. We determined effects of double-strand breaks (DSBs) and single-strand breaks (SSBs) between the duplicated alleles on DEL recombination when induced in dividing cells or cells arrested in G1 or G2. Site-specific DSBs and SSBs were produced by overexpression of the I-Sce I endonuclease and the gene II protein (gIIp), respectively. I-Sce I-induced DSBs caused an increase in DEL recombination frequencies in both dividing and cell-cycle-arrested cells, indicating that G1- and G2-arrested cells are capable of completing DSB repair. In contrast, gIIp-induced SSBs caused an increase in DEL recombination frequency only in dividing cells. To further examine these phenomena we used both γ-irradiation, inducing DSBs as its most relevant lesion, and UV, inducing other forms of DNA damage. UV irradiation did not increase DEL recombination frequencies in G1 or G2, whereas γ-rays increased DEL recombination frequencies in both phases. Both forms of radiation, however, induced DEL recombination in dividing cells. The results suggest that DSBsbut not SSBs induce DEL recombination, probably via the single-strand annealing pathway. Further, DSBs in dividing cells may result from the replication of a UV or SSB-damaged template. Alternatively, UV induced events may occur by replication slippage after DNA polymerase pausing in front of the damage. (author)

  5. The DNA-dependent protein kinase: a multifunctional protein kinase with roles in DNA double strand break repair and mitosis

    OpenAIRE

    Jette, Nicholas; Lees-Miller, Susan P.

    2014-01-01

    The DNA-dependent protein kinase (DNA-PK) is a serine/threonine protein kinase composed of a large catalytic subunit (DNA-PKcs) and the Ku70/80 heterodimer. Over the past two decades, significant progress has been made in elucidating the role of DNA-PK in non-homologous end joining (NHEJ), the major pathway for repair of ionizing radiation-induced DNA double strand breaks in human cells and recently, additional roles for DNA-PK have been reported. In this review, we will describe the biochemi...

  6. In vitro and in vivo characterization of DNA delivery using recombinant Lactococcus lactis expressing a mutated form of L. monocytogenes Internalin A

    NARCIS (Netherlands)

    Azevedo, de M.; Karczewski, J.; Lefevre, F.; Azevedo, V.; Miyoshi, A.; Wells, J.; Langella, P.; Chatel, J.M.

    2012-01-01

    Background The use of food-grade Lactic Acid Bacteria (LAB) as DNA delivery vehicles represents an attractive strategy to deliver DNA vaccines at the mucosal surfaces as they are generally regarded as safe (GRAS). We previously showed that either native Lactococcus lactis (LL) or recombinant

  7. DNA-dependent protein kinase in nonhomologous end joining: a lock with multiple keys?

    Science.gov (United States)

    Weterings, Eric; Chen, David J

    2007-10-22

    The DNA-dependent protein kinase (DNA-PK) is one of the central enzymes involved in DNA double-strand break (DSB) repair. It facilitates proper alignment of the two ends of the broken DNA molecule and coordinates access of other factors to the repair complex. We discuss the latest findings on DNA-PK phosphorylation and offer a working model for the regulation of DNA-PK during DSB repair.

  8. Multiple aspects of ATP-dependent nucleosome translocation by RSC and Mi-2 are directed by the underlying DNA sequence.

    Directory of Open Access Journals (Sweden)

    Joke J F A van Vugt

    Full Text Available BACKGROUND: Chromosome structure, DNA metabolic processes and cell type identity can all be affected by changing the positions of nucleosomes along chromosomal DNA, a reaction that is catalysed by SNF2-type ATP-driven chromatin remodelers. Recently it was suggested that in vivo, more than 50% of the nucleosome positions can be predicted simply by DNA sequence, especially within promoter regions. This seemingly contrasts with remodeler induced nucleosome mobility. The ability of remodeling enzymes to mobilise nucleosomes over short DNA distances is well documented. However, the nucleosome translocation processivity along DNA remains elusive. Furthermore, it is unknown what determines the initial direction of movement and how new nucleosome positions are adopted. METHODOLOGY/PRINCIPAL FINDINGS: We have used AFM imaging and high resolution PAGE of mononucleosomes on 600 and 2500 bp DNA molecules to analyze ATP-dependent nucleosome repositioning by native and recombinant SNF2-type enzymes. We report that the underlying DNA sequence can control the initial direction of translocation, translocation distance, as well as the new positions adopted by nucleosomes upon enzymatic mobilization. Within a strong nucleosomal positioning sequence both recombinant Drosophila Mi-2 (CHD-type and native RSC from yeast (SWI/SNF-type repositioned the nucleosome at 10 bp intervals, which are intrinsic to the positioning sequence. Furthermore, RSC-catalyzed nucleosome translocation was noticeably more efficient when beyond the influence of this sequence. Interestingly, under limiting ATP conditions RSC preferred to position the nucleosome with 20 bp intervals within the positioning sequence, suggesting that native RSC preferentially translocates nucleosomes with 15 to 25 bp DNA steps. CONCLUSIONS/SIGNIFICANCE: Nucleosome repositioning thus appears to be influenced by both remodeler intrinsic and DNA sequence specific properties that interplay to define ATPase

  9. The role of Candida albicans homologous recombination factors Rad54 and Rdh54 in DNA damage sensitivity

    Directory of Open Access Journals (Sweden)

    White Theodore C

    2011-09-01

    Full Text Available Abstract Background The fungal pathogen Candida albicans is frequently seen in immune suppressed patients, and resistance to one of the most widely used antifungals, fluconazole (FLC, can evolve rapidly. In recent years it has become clear that plasticity of the Candida albicans genome contributes to drug resistance through loss of heterozygosity (LOH at resistance genes and gross chromosomal rearrangements that amplify gene copy number of resistance associated genes. This study addresses the role of the homologous recombination factors Rad54 and Rdh54 in cell growth, DNA damage and FLC resistance in Candida albicans. Results The data presented here support a role for homologous recombination in cell growth and DNA damage sensitivity, as Candida albicans rad54Δ/rad54Δ mutants were hypersensitive to MMS and menadione, and had an aberrant cell and nuclear morphology. The Candida albicans rad54Δ/rad54Δ mutant was defective in invasion of Spider agar, presumably due to the altered cellular morphology. In contrast, mutation of the related gene RDH54 did not contribute significantly to DNA damage resistance and cell growth, and deletion of either Candida albicans RAD54 or Candida albicans RDH54 did not alter FLC susceptibility. Conclusions Together, these results support a role for homologous recombination in genome stability under nondamaging conditions. The nuclear morphology defects in the rad54Δ/rad54Δ mutants show that Rad54 performs an essential role during mitotic growth and that in its absence, cells arrest in G2. The viability of the single mutant rad54Δ/rad54Δ and the inability to construct the double mutant rad54Δ/rad54Δ rdh54Δ/rdh54Δ suggests that Rdh54 can partially compensate for Rad54 during mitotic growth.

  10. l dependence of dielectronic recombination from a continuum of finite bandwidth in a static electric field

    International Nuclear Information System (INIS)

    Shuman, E.S.; Evans, C.M.; Gallagher, T.F.

    2004-01-01

    It should be possible to separate experimentally the contributions to dielectronic recombination (DR) of energetically unresolved intermediate autoionizing Rydberg nl states using electric fields. This notion is based on two essential ideas. First, electric fields enhance the DR rate by Stark-mixing low-l states with high autoionization rates with high-l states with low autoionization rates. Second, the field at which an l state becomes Stark mixed is determined by its quantum defect, a known function of l. Consequently, the electric-field dependence of the DR rate should reflect the l dependence of the autoionization rates and thus the contributions of the zero-field nl states to the DR rate. This notion cannot be tested experimentally by examining true DR. However, it can be tested by studying DR from a continuum of finite bandwidth (CFB), for in this case the intermediate Rydberg nl states are restricted to a single value of l. Specifically, we have examined the electric-field dependence of DR from two CFB's, the Ba 6p 3/2 11d and 6p 3/2 8g states. In these two cases the intermediate autoionizing Rydberg states are restricted to the Ba 6p 1/2 nd and 6p 1/2 ng states (l=2 and 4), which have quantum defects of 0.25 and 0.02, respectively. For the same n they are Stark mixed at fields differing by an order of magnitude. We show experimentally that enhancement of the DR rate occurs at fields differing by a factor of 10 for nd and ng states of the same n, as expected, confirming that the field dependence of DR can be used to extract information about the contributions of energetically unresolved l states to the zero-field DR rate

  11. Mechanisms of recombination and function of DNA in bacteria. Progress report, May 3, 1975--May 5, 1976

    International Nuclear Information System (INIS)

    Guild, W.R.

    1976-01-01

    Results of investigations on phages were obtained with regard to the finding of transfection and characterizing the mode of entry of transfecting DNA; the characterization of a DNAase-resistant gene transfer agent from phage-infected cells which has some of the properties of a generalized transducing phage; and the study of multiplicity reactivation of uv-irradiated phage in a uv-sensitive pneumococcal host. Progress is also reported on a new gene transfer process, cell mutants, fine structure mapping, and stimulated recombination

  12. Evaluation of the effectiveness and safety of the thermo-treatment process to dispose of recombinant DNA waste from biological research laboratories

    International Nuclear Information System (INIS)

    Li Mengnan; Zheng Guanghong; Wang Lei; Xiao Wei; Fu Xiaohua; Le Yiquan; Ren Daming

    2009-01-01

    The discharge of recombinant DNA waste from biological laboratories into the eco-system may be one of the pathways resulting in horizontal gene transfer or 'gene pollution'. Heating at 100 deg. C for 5-10 min is a common method for treating recombinant DNA waste in biological research laboratories in China. In this study, we evaluated the effectiveness and the safety of the thermo-treatment method in the disposal of recombinant DNA waste. Quantitative PCR, plasmid transformation and electrophoresis technology were used to evaluate the decay/denaturation efficiency during the thermo-treatment process of recombinant plasmid, pET-28b. Results showed that prolonging thermo-treatment time could improve decay efficiency of the plasmid, and its decay half-life was 2.7-4.0 min during the thermo-treatment at 100 deg. C. However, after 30 min of thermo-treatment some transforming activity remained. Higher ionic strength could protect recombinant plasmid from decay during the treatment process. These results indicate that thermo-treatment at 100 deg. C cannot decay and inactivate pET-28b completely. In addition, preliminary results showed that thermo-treated recombinant plasmids were not degraded completely in a short period when they were discharged into an aquatic environment. This implies that when thermo-treated recombinant DNAs are discharged into the eco-system, they may have enough time to re-nature and transform, thus resulting in gene diffusion

  13. Evaluation of the effectiveness and safety of the thermo-treatment process to dispose of recombinant DNA waste from biological research laboratories.

    Science.gov (United States)

    Li, Meng-Nan; Zheng, Guang-Hong; Wang, Lei; Xiao, Wei; Fu, Xiao-Hua; Le, Yi-Quan; Ren, Da-Ming

    2009-01-01

    The discharge of recombinant DNA waste from biological laboratories into the eco-system may be one of the pathways resulting in horizontal gene transfer or "gene pollution". Heating at 100 degrees C for 5-10 min is a common method for treating recombinant DNA waste in biological research laboratories in China. In this study, we evaluated the effectiveness and the safety of the thermo-treatment method in the disposal of recombinant DNA waste. Quantitative PCR, plasmid transformation and electrophoresis technology were used to evaluate the decay/denaturation efficiency during the thermo-treatment process of recombinant plasmid, pET-28b. Results showed that prolonging thermo-treatment time could improve decay efficiency of the plasmid, and its decay half-life was 2.7-4.0 min during the thermo-treatment at 100 degrees C. However, after 30 min of thermo-treatment some transforming activity remained. Higher ionic strength could protect recombinant plasmid from decay during the treatment process. These results indicate that thermo-treatment at 100 degrees C cannot decay and inactivate pET-28b completely. In addition, preliminary results showed that thermo-treated recombinant plasmids were not degraded completely in a short period when they were discharged into an aquatic environment. This implies that when thermo-treated recombinant DNAs are discharged into the eco-system, they may have enough time to re-nature and transform, thus resulting in gene diffusion.

  14. Ancestry dependent DNA methylation and influence of maternal nutrition.

    Directory of Open Access Journals (Sweden)

    Khyobeni Mozhui

    Full Text Available There is extensive variation in DNA methylation between individuals and ethnic groups. These differences arise from a combination of genetic and non-genetic influences and potential modifiers include nutritional cues, early life experience, and social and physical environments. Here we compare genome-wide DNA methylation in neonatal cord blood from African American (AA; N = 112 and European American (EA; N = 91 participants of the CANDLE Study (Conditions Affecting Neurocognitive Development and Learning in Early Childhood. Our goal is to determine if there are replicable ancestry-specific methylation patterns that may implicate risk factors for diseases that have differential prevalence between populations. To identify the most robust ancestry-specific CpG sites, we replicate our results in lymphoblastoid cell lines from Yoruba African and CEPH European panels of HapMap. We also evaluate the influence of maternal nutrition--specifically, plasma levels of vitamin D and folate during pregnancy--on methylation in newborns. We define stable ancestry-dependent methylation of genes that include tumor suppressors and cell cycle regulators (e.g., APC, BRCA1, MCC. Overall, there is lower global methylation in African ancestral groups. Plasma levels of 25-hydroxy vitamin D are also considerably lower among AA mothers and about 60% of AA and 40% of EA mothers have concentrations below 20 ng/ml. Using a weighted correlation analysis, we define a network of CpG sites that is jointly modulated by ancestry and maternal vitamin D. Our results show that differences in DNA methylation patterns are remarkably stable and maternal micronutrients can exert an influence on the child epigenome.

  15. Quinolinone and pyridopyrimidinone inhibitors of DNA-dependent protein kinase.

    Science.gov (United States)

    Barbeau, Olivier R; Cano-Soumillac, Celine; Griffin, Roger J; Hardcastle, Ian R; Smith, Graeme C M; Richardson, Caroline; Clegg, William; Harrington, Ross W; Golding, Bernard T

    2007-08-21

    8-Substituted 2-morpholin-4-yl-quinolin-4-ones and 9-substituted 2-morpholin-4-yl-pyrido[1,2-a]pyrimidin-4-ones with selected aryl and heteroaryl groups as the substituent have been synthesised as potential inhibitors of DNA-dependent protein kinase. A multiple-parallel approach, employing Suzuki cross-coupling methodology, was utilised in the preparation of 8-substituted 2-morpholin-4-yl-quinolin-4-ones. For this purpose 8-bromo-2-morpholin-4-yl-quinolin-4-one was required as an intermediate. This compound was obtained by adapting a literature route in which thermal cyclocondensation of (2-bromoanilino)-morpholin-4-yl-5-methylene-2,2-dimethyl[1,3]dioxane-4,6-dione afforded 8-bromo-2-morpholin-4-yl-quinolin-4-one. A multiple-parallel approach, employing Suzuki cross-coupling methodology, was also utilised to prepare 9-substituted 2-morpholin-4-yl-pyrido[1,2-a]pyrimidin-4-ones using 9-hydroxy-2-morpholin-4-yl-pyrido[1,2-a]pyrimidin-4-one O-trifluoromethanesulfonate as an intermediate. 8-Substituted 2-morpholin-4-yl-quinolin-4-ones and 9-substituted 2-morpholin-4-yl-pyrido[1,2-a]pyrimidin-4-ones were both inhibitors of DNA-dependent protein kinase. When the substituent was dibenzothiophen-4-yl, dibenzofuran-4-yl or biphen-3-yl, IC50 values in the low nanomolar range were observed. Interestingly, the pyridopyrimidinones and quinolinones were essentially equipotent with the corresponding 8-substituted 2-morpholin-4-yl-chromen-4-ones previously reported (I. R. Hardcastle, X. Cockcroft, N. J. Curtin, M. Desage El-Murr, J. J. J. Leahy, M. Stockley, B. T. Golding, L. Rigoreau, C. Richardson, G. C. M. Smith and R. J. Griffin, J. Med. Chem., 2005, 48, 7829-7846).

  16. The DNA-dependent protein kinase: a multifunctional protein kinase with roles in DNA double strand break repair and mitosis

    Science.gov (United States)

    Jette, Nicholas; Lees-Miller, Susan P.

    2015-01-01

    The DNA-dependent protein kinase (DNA-PK) is a serine/threonine protein kinase composed of a large catalytic subunit (DNA-PKcs) and the Ku70/80 heterodimer. Over the past two decades, significant progress has been made in elucidating the role of DNA-PK in non-homologous end joining (NHEJ), the major pathway for repair of ionizing radiation-induced DNA double strand breaks in human cells and recently, additional roles for DNA-PK have been reported. In this review, we will describe the biochemistry, structure and function of DNA-PK, its roles in DNA double strand break repair and its newly described roles in mitosis and other cellular processes. PMID:25550082

  17. Temperature dependence of interband recombination energy in symmetric (In,Ga)N spherical quantum dot-quantum well

    Energy Technology Data Exchange (ETDEWEB)

    El Ghazi, Haddou, E-mail: hadghazi@gmail.com [LPS, Faculty of Science, Dhar EL Mehrez, BP 1796 Fes-Atlas (Morocco); Special Mathematics, CPGE, 267 Quartier complémentaire Ennahda 1, Rabat (Morocco); Jorio, Anouar [LPS, Faculty of Science, Dhar EL Mehrez, BP 1796 Fes-Atlas (Morocco)

    2014-01-01

    Within the framework of effective-mass approximation and finite parabolic potential barrier, single particle and ground-state interband recombination energies in Core|well|shell based on GaN|(In,Ga)N|GaN spherical QDQW are investigated as a function of the inner and the outer radii. The temperature dependency of effective-mass, band-gap energy and potential barrier is taken into account. Particle eigenvalue and band-gap energy competing effects are speculated to explain our numerical results which show that the interband recombination energy increases when the temperature increases. The results we obtained are in quite good agreement with the findings.

  18. Temperature dependence of interband recombination energy in symmetric (In,Ga)N spherical quantum dot-quantum well

    International Nuclear Information System (INIS)

    El Ghazi, Haddou; Jorio, Anouar

    2014-01-01

    Within the framework of effective-mass approximation and finite parabolic potential barrier, single particle and ground-state interband recombination energies in Core|well|shell based on GaN|(In,Ga)N|GaN spherical QDQW are investigated as a function of the inner and the outer radii. The temperature dependency of effective-mass, band-gap energy and potential barrier is taken into account. Particle eigenvalue and band-gap energy competing effects are speculated to explain our numerical results which show that the interband recombination energy increases when the temperature increases. The results we obtained are in quite good agreement with the findings

  19. 75 FR 21008 - Office of Biotechnology Activities; Recombinant DNA Research: Proposed Actions Under the NIH...

    Science.gov (United States)

    2010-04-22

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health Office of Biotechnology... Biotechnology Activities (OBA) published a proposal to revise the NIH Guidelines for Research with Recombinant... by fax to 301-496-9839 or mail to the Office of Biotechnology Activities, National Institutes of...

  20. Effects of selenium on the structure and function of recombinant human S-adenosyl-L-methionine dependent arsenic (+3 oxidation state) methyltransferase in E. coli.

    Science.gov (United States)

    Geng, Zhirong; Song, Xiaoli; Xing, Zhi; Geng, Jinlong; Zhang, Sichun; Zhang, Xinrong; Wang, Zhilin

    2009-05-01

    The effects of Se(IV) on the structure and function of recombinant human arsenic (+3 oxidation state) methyltransferase (AS3MT) purified from the cytoplasm of Escherichia coli were studied. The coding region of human AS3MT complementary DNA was amplified from total RNA extracted from HepG2 cell by reverse transcription PCR. Soluble and active human AS3MT was expressed in the E. coli with a Trx fusion tag under a lower induction temperature of 25 degrees C. Spectra (UV-vis, circular dichroism, and fluorescence) were first used to probe the interaction of Se(IV) and recombinant human AS3MT and the structure-function relationship of the enzyme. The recombinant human AS3MT had a secondary structure of 29.0% alpha-helix, 23.9% beta-pleated sheet, 17.9% beta-turn, and 29.2% random coil. When Se(IV) was added, the content of the alpha-helix did not change, but that of the beta-pleated sheet increased remarkably in the conformation of recombinant human AS3MT. Se(IV) inhibited the enzymatic methylation of inorganic As(III) in a concentration-dependent manner. The IC(50) value for Se(IV) was 2.38 muM. Double-reciprocal (1/V vs. 1/[inorganic As(III)]) plots showed Se(IV) to be a noncompetitive inhibitor of the methylation of inorganic As(III) by recombinant human AS3MT with a K (i) value of 2.61 muM. We hypothesized that Se(IV) interacts with the sulfhydryl group of cysteine(s) in the structural residues rather than the cysteines of the active site (Cys156 and Cys206). When Se(IV) was combined with cysteine(s) in the structural residues, the conformation of recombinant human AS3MT changed and the enzymatic activity decreased. Considering the quenching of tryptophan fluorescence, Cys72 and/or Cys226 are deduced to be primary targets for Se(IV).

  1. Mouse embryonic stem cells, but not somatic cells, predominantly use homologous recombination to repair double-strand DNA breaks.

    Science.gov (United States)

    Tichy, Elisia D; Pillai, Resmi; Deng, Li; Liang, Li; Tischfield, Jay; Schwemberger, Sandy J; Babcock, George F; Stambrook, Peter J

    2010-11-01

    Embryonic stem (ES) cells give rise to all cell types of an organism. Since mutations at this embryonic stage would affect all cells and be detrimental to the overall health of an organism, robust mechanisms must exist to ensure that genomic integrity is maintained. To test this proposition, we compared the capacity of murine ES cells to repair DNA double-strand breaks with that of differentiated cells. Of the 2 major pathways that repair double-strand breaks, error-prone nonhomologous end joining (NHEJ) predominated in mouse embryonic fibroblasts, whereas the high fidelity homologous recombinational repair (HRR) predominated in ES cells. Microhomology-mediated end joining, an emerging repair pathway, persisted at low levels in all cell types examined. The levels of proteins involved in HRR and microhomology-mediated end joining were highly elevated in ES cells compared with mouse embryonic fibroblasts, whereas those for NHEJ were quite variable, with DNA Ligase IV expression low in ES cells. The half-life of DNA Ligase IV protein was also low in ES cells. Attempts to increase the abundance of DNA Ligase IV protein by overexpression or inhibition of its degradation, and thereby elevate NHEJ in ES cells, were unsuccessful. When ES cells were induced to differentiate, however, the level of DNA Ligase IV protein increased, as did the capacity to repair by NHEJ. The data suggest that preferential use of HRR rather than NHEJ may lend ES cells an additional layer of genomic protection and that the limited levels of DNA Ligase IV may account for the low level of NHEJ activity.

  2. Genetic polymorphisms in homologous recombination repair genes in healthy Slovenian population and their influence on DNA damage

    International Nuclear Information System (INIS)

    Goricar, Katja; Erculj, Nina; Zadel, Maja; Dolzan, Vita

    2012-01-01

    Homologous recombination (HR) repair is an important mechanism involved in repairing double-strand breaks in DNA and for maintaining genomic stability. Polymorphisms in genes coding for enzymes involved in this pathway may influence the capacity for DNA repair. The aim of this study was to select tag single nucleotide polymorphisms (SNPs) in specific genes involved in HR repair, to determine their allele frequencies in a healthy Slovenian population and their influence on DNA damage detected with comet assay. In total 373 individuals were genotyped for nine tag SNPs in three genes: XRCC3 722C>T, XRCC3 -316A>G, RAD51 -98G>C, RAD51 -61G>T, RAD51 1522T>G, NBS1 553G>C, NBS1 1197A>G, NBS1 37117C>T and NBS1 3474A>C using competitive allele-specific amplification (KASPar assay). Comet assay was performed in a subgroup of 26 individuals to determine the influence of selected SNPs on DNA damage. We observed that age significantly affected genotype frequencies distribution of XRCC3 -316A>G (P = 0.039) in healthy male blood donors. XRCC3 722C>T (P = 0.005), RAD51 -61G>T (P = 0.023) and NBS1 553G>C (P = 0.008) had a statistically significant influence on DNA damage. XRCC3 722C>T, RAD51 -61G>T and NBS1 553G>C polymorphisms significantly affect the repair of damaged DNA and may be of clinical importance as they are common in Slovenian population

  3. Yeast Srs2 Helicase Promotes Redistribution of Single-Stranded DNA-Bound RPA and Rad52 in Homologous Recombination Regulation

    Directory of Open Access Journals (Sweden)

    Luisina De Tullio

    2017-10-01

    Full Text Available Srs2 is a super-family 1 helicase that promotes genome stability by dismantling toxic DNA recombination intermediates. However, the mechanisms by which Srs2 remodels or resolves recombination intermediates remain poorly understood. Here, single-molecule imaging is used to visualize Srs2 in real time as it acts on single-stranded DNA (ssDNA bound by protein factors that function in recombination. We demonstrate that Srs2 is highly processive and translocates rapidly (∼170 nt per second in the 3′→5′ direction along ssDNA saturated with replication protein A (RPA. We show that RPA is evicted from DNA during the passage of Srs2. Remarkably, Srs2 also readily removes the recombination mediator Rad52 from RPA-ssDNA and, in doing so, promotes rapid redistribution of both Rad52 and RPA. These findings have important mechanistic implications for understanding how Srs2 and related nucleic acid motor proteins resolve potentially pathogenic nucleoprotein intermediates.

  4. Yeast Srs2 Helicase Promotes Redistribution of Single-Stranded DNA-Bound RPA and Rad52 in Homologous Recombination Regulation.

    Science.gov (United States)

    De Tullio, Luisina; Kaniecki, Kyle; Kwon, Youngho; Crickard, J Brooks; Sung, Patrick; Greene, Eric C

    2017-10-17

    Srs2 is a super-family 1 helicase that promotes genome stability by dismantling toxic DNA recombination intermediates. However, the mechanisms by which Srs2 remodels or resolves recombination intermediates remain poorly understood. Here, single-molecule imaging is used to visualize Srs2 in real time as it acts on single-stranded DNA (ssDNA) bound by protein factors that function in recombination. We demonstrate that Srs2 is highly processive and translocates rapidly (∼170 nt per second) in the 3'→5' direction along ssDNA saturated with replication protein A (RPA). We show that RPA is evicted from DNA during the passage of Srs2. Remarkably, Srs2 also readily removes the recombination mediator Rad52 from RPA-ssDNA and, in doing so, promotes rapid redistribution of both Rad52 and RPA. These findings have important mechanistic implications for understanding how Srs2 and related nucleic acid motor proteins resolve potentially pathogenic nucleoprotein intermediates. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  5. Microbial diversity in fecal samples depends on DNA extraction method

    DEFF Research Database (Denmark)

    Mirsepasi, Hengameh; Persson, Søren; Struve, Carsten

    2014-01-01

    was to evaluate two different DNA extraction methods in order to choose the most efficient method for studying intestinal bacterial diversity using Denaturing Gradient Gel Electrophoresis (DGGE). FINDINGS: In this study, a semi-automatic DNA extraction system (easyMag®, BioMérieux, Marcy I'Etoile, France......BACKGROUND: There are challenges, when extracting bacterial DNA from specimens for molecular diagnostics, since fecal samples also contain DNA from human cells and many different substances derived from food, cell residues and medication that can inhibit downstream PCR. The purpose of the study...... by easyMag® from the same fecal samples. Furthermore, DNA extracts obtained using easyMag® seemed to contain inhibitory compounds, since in order to perform a successful PCR-analysis, the sample should be diluted at least 10 times. DGGE performed on PCR from DNA extracted by QIAamp DNA Stool Mini Kit DNA...

  6. The role of DNA double-strand breaks in spontaneous homologous recombination in S. cerevisiae

    DEFF Research Database (Denmark)

    Lettier, Gaëlle; Feng, Q.; Mayolo, A.A. de

    2006-01-01

    of meiosis and result from the induction of a large number of DNA double-strand breaks (DSBs). By analogy, it is generally believed that the rare spontaneous mitotic HR events are due to repair of DNA DSBs that accidentally occur during mitotic growth. Here we provide the first direct evidence that most...

  7. Temperature dependence of binary and ternary recombination of H3+ ions with electrons

    International Nuclear Information System (INIS)

    Glosik, J.; Plasil, R.; Korolov, I.; Kotrik, T.; Novotny, O.; Hlavenka, P.; Dohnal, P.; Varju, J.; Kokoouline, V.; Greene, Chris H.

    2009-01-01

    We study binary and the recently discovered process of ternary He-assisted recombination of H 3 + ions with electrons in a low-temperature afterglow plasma. The experiments are carried out over a broad range of pressures and temperatures of an afterglow plasma in a helium buffer gas. Binary and He-assisted ternary recombination are observed and the corresponding recombination rate coefficients are extracted for temperatures from 77 to 330 K. We describe the observed ternary recombination as a two-step mechanism: first, a rotationally excited long-lived neutral molecule H 3 * is formed in electron-H 3 + collisions. Second, the H 3 * molecule collides with a helium atom that leads to the formation of a very long-lived Rydberg state with high orbital momentum. We present calculations of the lifetimes of H 3 * and of the ternary recombination rate coefficients for para- and ortho-H 3 + . The calculations show a large difference between the ternary recombination rate coefficients of ortho- and para-H 3 + at temperatures below 300 K. The measured binary and ternary rate coefficients are in reasonable agreement with the calculated values.

  8. Temperature dependence of binary and ternary recombination of H3+ ions with electrons

    Science.gov (United States)

    Glosík, J.; Plašil, R.; Korolov, I.; Kotrík, T.; Novotný, O.; Hlavenka, P.; Dohnal, P.; Varju, J.; Kokoouline, V.; Greene, Chris H.

    2009-05-01

    We study binary and the recently discovered process of ternary He-assisted recombination of H3+ ions with electrons in a low-temperature afterglow plasma. The experiments are carried out over a broad range of pressures and temperatures of an afterglow plasma in a helium buffer gas. Binary and He-assisted ternary recombination are observed and the corresponding recombination rate coefficients are extracted for temperatures from 77 to 330 K. We describe the observed ternary recombination as a two-step mechanism: first, a rotationally excited long-lived neutral molecule H3∗ is formed in electron- H3+ collisions. Second, the H3∗ molecule collides with a helium atom that leads to the formation of a very long-lived Rydberg state with high orbital momentum. We present calculations of the lifetimes of H3∗ and of the ternary recombination rate coefficients for para- and ortho- H3+ . The calculations show a large difference between the ternary recombination rate coefficients of ortho- and para- H3+ at temperatures below 300 K. The measured binary and ternary rate coefficients are in reasonable agreement with the calculated values.

  9. HIV-1-Specific Antibody Response and Function after DNA Prime and Recombinant Adenovirus 5 Boost HIV Vaccine in HIV-Infected Subjects.

    Directory of Open Access Journals (Sweden)

    Johannes S Gach

    Full Text Available Little is known about the humoral immune response against DNA prime-recombinant adenovirus 5 (rAd5 boost HIV vaccine among HIV-infected patients on long-term suppressive antiretroviral therapy (ART. Previous studies emphasized cellular immune responses; however, current research suggests both cellular and humoral responses are likely required for a successful therapeutic vaccine. Thus, we aimed to understand antibody response and function induced by vaccination of ART-treated HIV-1-infected patients with immune recovery. All subjects participated in EraMune 02, an open-label randomized clinical trial of ART intensification followed by a six plasmid DNA prime (envA, envB, envC, gagB, polB, nefB and rAd5 boost HIV vaccine with matching inserts. Antibody binding levels were determined with a recently developed microarray approach. We also analyzed neutralization efficiency and antibody-dependent cellular cytotoxicity (ADCC. We found that the DNA prime-rAd5 boost vaccine induced a significant cross-clade HIV-specific antibody response, which correlated with antibody neutralization efficiency. However, despite the increase in antibody binding levels, the vaccine did not significantly stimulate neutralization or ADCC responses. This finding was also reflected by a lack of change in total CD4+ cell associated HIV DNA in those who received the vaccine. Our results have important implications for further therapeutic vaccine design and administration, especially in HIV-1 infected patients, as boosting of preexisting antibody responses are unlikely to lead to clearance of latent proviruses in the HIV reservoir.

  10. Broad and potent immune responses to a low dose intradermal HIV-1 DNA boosted with HIV-1 recombinant MVA among healthy adults in Tanzania☆,☆☆

    Science.gov (United States)

    Bakari, Muhammad; Aboud, Said; Nilsson, Charlotta; Francis, Joel; Buma, Deus; Moshiro, Candida; Aris, Eric A.; Lyamuya, Eligius F.; Janabi, Mohamed; Godoy-Ramirez, Karina; Joachim, Agricola; Polonis, Victoria R.; Bråve, Andreas; Earl, Patricia; Robb, Merlin; Marovich, Mary; Wahren, Britta; Pallangyo, Kisali; Biberfeld, Gunnel; Mhalu, Fred; Sandström, Eric

    2016-01-01

    Background We conducted a phase I/II randomized placebo-controlled trial with the aim of exploring whether priming with a low intradermal dose of a multiclade, multigene HIV-1 DNA vaccine could improve the immunogenicity of the same vaccine given intramuscularly prior to boosting with a heterologous HIV-1 MVA among healthy adults in Dar es Salaam, Tanzania. Methods Sixty HIV-uninfected volunteers were randomized to receive DNA plasmid vaccine 1 mg intradermally (id), n = 20, or 3.8 mg intramuscularly (im), n = 20, or placebo, n = 20, using a needle-free injection device. DNA plasmids encoding HIV-1 genes gp160 subtype A, B, C; rev B; p17/p24 gag A, B and Rtmut B were given at weeks 0, 4 and 12. Recombinant MVA (108 pfu) expressing HIV-1 Env, Gag, Pol of CRF01_AE or placebo was administered im at month 9 and 21. Results The vaccines were well tolerated. Two weeks after the third HIV-DNA injection, 22/38 (58%) vaccinees had IFN-γ ELISpot responses to Gag. Two weeks after the first HIV-MVA boost all 35 (100%) vaccinees responded to Gag and 31 (89%) to Env. Two to four weeks after the second HIV-MVA boost, 28/29 (97%) vaccinees had IFN-γ ELISpot responses, 27 (93%) to Gag and 23 (79%) to Env. The id-primed recipients had significantly higher responses to Env than im recipients. Intracellular cytokine staining for Gag-specific IFN-γ/IL-2 production showed both CD8+ and CD4+ T cell responses. All vaccinees had HIV-specific lymphoproliferative responses. All vaccinees reacted in diagnostic HIV serological tests and 26/29 (90%) had antibodies against gp160 after the second HIV-MVA boost. Furthermore, while all of 29 vaccinee sera were negative for neutralizing antibodies against clade B, C and CRF01 AE pseudoviruses in the TZM-bl neutralization assay, in a PBMC assay, the response rate ranged from 31% to 83% positives, depending upon the clade B or CRF01_AE virus tested. This vaccine approach is safe and highly immunogenic. Low dose, id HIV-DNA priming elicited higher

  11. Condensin suppresses recombination and regulates double-strand break processing at the repetitive ribosomal DNA array to ensure proper chromosome segregation during meiosis in budding yeast

    Science.gov (United States)

    Li, Ping; Jin, Hui; Yu, Hong-Guo

    2014-01-01

    During meiosis, homologues are linked by crossover, which is required for bipolar chromosome orientation before chromosome segregation at anaphase I. The repetitive ribosomal DNA (rDNA) array, however, undergoes little or no meiotic recombination. Hyperrecombination can cause chromosome missegregation and rDNA copy number instability. We report here that condensin, a conserved protein complex required for chromosome organization, regulates double-strand break (DSB) formation and repair at the rDNA gene cluster during meiosis in budding yeast. Condensin is highly enriched at the rDNA region during prophase I, released at the prophase I/metaphase I transition, and reassociates with rDNA before anaphase I onset. We show that condensin plays a dual role in maintaining rDNA stability: it suppresses the formation of Spo11-mediated rDNA breaks, and it promotes DSB processing to ensure proper chromosome segregation. Condensin is unnecessary for the export of rDNA breaks outside the nucleolus but required for timely repair of meiotic DSBs. Our work reveals that condensin coordinates meiotic recombination with chromosome segregation at the repetitive rDNA sequence, thereby maintaining genome integrity. PMID:25103240

  12. Acute Smc5/6 depletion reveals its primary role in rDNA replication by restraining recombination at fork pausing sites.

    Directory of Open Access Journals (Sweden)

    Xiao P Peng

    2018-01-01

    Full Text Available Smc5/6, a member of the conserved SMC family of complexes, is essential for growth in most organisms. Its exact functions in a mitotic cell cycle are controversial, as chronic Smc5/6 loss-of-function alleles produce varying phenotypes. To circumvent this issue, we acutely depleted Smc5/6 in budding yeast and determined the first cell cycle consequences of Smc5/6 removal. We found a striking primary defect in replication of the ribosomal DNA (rDNA array. Each rDNA repeat contains a programmed replication fork barrier (RFB established by the Fob1 protein. Fob1 removal improves rDNA replication in Smc5/6 depleted cells, implicating Smc5/6 in the management of programmed fork pausing. A similar improvement is achieved by removing the DNA helicase Mph1 whose recombinogenic activity can be inhibited by Smc5/6 under DNA damage conditions. DNA 2D gel analyses further show that Smc5/6 loss increases recombination structures at RFB regions; moreover, mph1∆ and fob1∆ similarly reduce this accumulation. These findings point to an important mitotic role for Smc5/6 in restraining recombination events when protein barriers in rDNA stall replication forks. As rDNA maintenance influences multiple essential cellular processes, Smc5/6 likely links rDNA stability to overall mitotic growth.

  13. Concentration-dependent interactions of the organophosphates chlorpyrifos oxon and methyl paraoxon with human recombinant acetylcholinesterase

    International Nuclear Information System (INIS)

    Kaushik, R.; Rosenfeld, Clint A.; Sultatos, L.G.

    2007-01-01

    For many decades it has been thought that oxygen analogs (oxons) of organophosphorus insecticides phosphorylate the catalytic site of acetylcholinesterase by a mechanism that follows simple Michaelis-Menten kinetics. More recently, the interactions of at least some oxons have been shown to be far more complex and likely involve binding of oxons to a second site on acetylcholinesterase that modulates the inhibitory capacity of other oxon molecules at the catalytic site. The current study has investigated the interactions of chlorpyrifos oxon and methyl paraoxon with human recombinant acetylcholinesterase. Both chlorpyrifos oxon and methyl paraoxon were found to have k i 's that change as a function of oxon concentration. Furthermore, 10 nM chlorpyrifos oxon resulted in a transient increase in acetylthiocholine hydrolysis, followed by inhibition. Moreover, in the presence of 100 nM chlorpyrifos oxon, acetylthiocholine was found to influence both the K d (binding affinity) and k 2 (phosphorylation constant) of this oxon. Collectively, these results demonstrate that the interactions of chlorpyrifos oxon and methyl paraoxon with acetylcholinesterase cannot be described by simple Michaelis-Menten kinetics but instead support the hypothesis that these oxons bind to a secondary site on acetylcholinesterase, leading to activation/inhibition of the catalytic site, depending on the nature of the substrate and inhibitor. Additionally, these data raise questions regarding the adequacy of estimating risk of low levels of insecticide exposure from direct extrapolation of insecticide dose-response curves since the capacity of individual oxon molecules at low oxon levels could be greater than individual oxon molecules in vivo associated with the dose-response curve

  14. The HSP90 inhibitor NVP-AUY922 radiosensitizes by abrogation of homologous recombination resulting in mitotic entry with unresolved DNA damage.

    Directory of Open Access Journals (Sweden)

    Shane Zaidi

    Full Text Available Heat shock protein 90 (HSP90 is a molecular chaperone responsible for the conformational maintenance of a number of client proteins that play key roles in cell cycle arrest, DNA damage repair and apoptosis following radiation. HSP90 inhibitors exhibit antitumor activity by modulating the stabilisation and activation of HSP90 client proteins. We sought to evaluate NVP-AUY922, the most potent HSP90 inhibitor yet reported, in preclinical radiosensitization studies.NVP-AUY922 potently radiosensitized cells in vitro at low nanomolar concentrations with a concurrent depletion of radioresistance-linked client proteins. Radiosensitization by NVP-AUY922 was verified for the first time in vivo in a human head and neck squamous cell carcinoma xenograft model in athymic mice, as measured by delayed tumor growth and increased surrogate end-point survival (p = <0.0001. NVP-AUY922 was shown to ubiquitously inhibit resolution of dsDNA damage repair correlating to delayed Rad51 foci formation in all cell lines tested. Additionally, NVP-AUY922 induced a stalled mitotic phenotype, in a cell line-dependent manner, in HeLa and HN5 cell lines irrespective of radiation exposure. Cell cycle analysis indicated that NVP-AUY922 induced aberrant mitotic entry in all cell lines tested in the presence of radiation-induced DNA damage due to ubiquitous CHK1 depletion, but resultant downstream cell cycle effects were cell line dependent.These results identify NVP-AUY922 as the most potent HSP90-mediated radiosensitizer yet reported in vitro, and for the first time validate it in a clinically relevant in vivo model. Mechanistic analysis at clinically achievable concentrations demonstrated that radiosensitization is mediated by the combinatorial inhibition of cell growth and survival pathways, ubiquitous delay in Rad51-mediated homologous recombination and CHK1-mediated G(2/M arrest, but that the contribution of cell cycle perturbation to radiosensitization may be cell line

  15. Homologous and non-homologous recombination differentially affect DNA damage repair in mice.

    NARCIS (Netherlands)

    J. Essers (Jeroen); H. van Steeg (Harry); J. de Wit (Jan); M. Vermeij (Marcel); J.H.J. Hoeijmakers (Jan); R. Kanaar (Roland); S.M.A. Swagemakers (Sigrid)

    2000-01-01

    textabstractIonizing radiation and interstrand DNA crosslinking compounds provide important treatments against cancer due to their extreme genotoxicity for proliferating cells. Both the efficacies of such treatments and the mutagenic potential of these agents are modulated by

  16. Homologous recombination contributes to the repair of DNA double-strand breaks induced by high-energy iron ions

    Energy Technology Data Exchange (ETDEWEB)

    Zafar, Faria; Seidler, Sara B.; Kronenberg, Amy; Schild, David; Wiese, Claudia

    2010-06-29

    To test the contribution of homologous recombinational repair (HRR) in repairing DNA damaged sites induced by high-energy iron ions, we used: (1) HRR-deficient rodent cells carrying a deletion in the RAD51D gene and (2) syngeneic human cells impaired for HRR by RAD51D or RAD51 knockdown using RNA interference. We show that in response to iron ions, HRR contributes to cell survival in rodent cells, and that HRR-deficiency abrogates RAD51 foci formation. Complementation of the HRR defect by human RAD51D rescues both enhanced cytotoxicity and RAD51 foci formation. For human cells irradiated with iron ions, cell survival is decreased, and, in p53 mutant cells, the levels of mutagenesis are increased when HRR is impaired. Human cells synchronized in S phase exhibit more pronounced resistance to iron ions as compared with cells in G1 phase, and this increase in radioresistance is diminished by RAD51 knockdown. These results implicate a role for RAD51-mediated DNA repair (i.e. HRR) in removing a fraction of clustered lesions induced by charged particle irradiation. Our results are the first to directly show the requirement for an intact HRR pathway in human cells in ensuring DNA repair and cell survival in response to high-energy high LET radiation.

  17. Cloning of Human Tumor Necrosis Factor (TNF) Receptor cDNA and Expression of Recombinant Soluble TNF-Binding Protein

    Science.gov (United States)

    Gray, Patrick W.; Barrett, Kathy; Chantry, David; Turner, Martin; Feldmann, Marc

    1990-10-01

    The cDNA for one of the receptors for human tumor necrosis factor (TNF) has been isolated. This cDNA encodes a protein of 455 amino acids that is divided into an extracellular domain of 171 residues and a cytoplasmic domain of 221 residues. The extracellular domain has been engineered for expression in mammalian cells, and this recombinant derivative binds TNFα with high affinity and inhibits its cytotoxic activity in vitro. The TNF receptor exhibits similarity with a family of cell surface proteins that includes the nerve growth factor receptor, the human B-cell surface antigen CD40, and the rat T-cell surface antigen OX40. The TNF receptor contains four cysteine-rich subdomains in the extra-cellular portion. Mammalian cells transfected with the entire TNF receptor cDNA bind radiolabeled TNFα with an affinity of 2.5 x 10-9 M. This binding can be competitively inhibited with unlabeled TNFα or lymphotoxin (TNFβ).

  18. Homologous recombination contributes to the repair of DNA double-strand breaks induced by high-energy iron ions

    International Nuclear Information System (INIS)

    Zafar, Faria; Seidler, Sara B.; Kronenberg, Amy; Schild, David; Wiese, Claudia

    2010-01-01

    To test the contribution of homologous recombinational repair (HRR) in repairing DNA damaged sites induced by high-energy iron ions, we used: (1) HRR-deficient rodent cells carrying a deletion in the RAD51D gene and (2) syngeneic human cells impaired for HRR by RAD51D or RAD51 knockdown using RNA interference. We show that in response to iron ions, HRR contributes to cell survival in rodent cells, and that HRR-deficiency abrogates RAD51 foci formation. Complementation of the HRR defect by human RAD51D rescues both enhanced cytotoxicity and RAD51 foci formation. For human cells irradiated with iron ions, cell survival is decreased, and, in p53 mutant cells, the levels of mutagenesis are increased when HRR is impaired. Human cells synchronized in S phase exhibit more pronounced resistance to iron ions as compared with cells in G1 phase, and this increase in radioresistance is diminished by RAD51 knockdown. These results implicate a role for RAD51-mediated DNA repair (i.e. HRR) in removing a fraction of clustered lesions induced by charged particle irradiation. Our results are the first to directly show the requirement for an intact HRR pathway in human cells in ensuring DNA repair and cell survival in response to high-energy high LET radiation.

  19. [HPV DNA vaccines expressing recombinant CRT/HPV6bE7 fusion protein inhibit tumor growth and angiogenic activity].

    Science.gov (United States)

    Xu, Yan; Cheng, Hao; Zhao, Ke-Jia; Zhu, Ke-Jian; Zhang, Xing

    2007-11-01

    This paper was to study the angiogenic inhibitory effect and the potential antitumor effect of the constructed recombinant DNA vaccine CRT/HPV6bE7 in vivo. The C57BL/6 mice were vaccinated respectively with recombinant CRT/HPV6bE7 DNA plamids. The inhibitory effects on angiogenesis of generated vaccines in vivo were evaluated by a bFGF-induced angiogenesis assay using the Matrigel kit. To investigate the potential antitumor effect, the mean tumor weights, sizes and tumor appearing times were measured in C57BL/6 mice treated with HPV6bE7-expressing B16 cells. The results indicated that the recombinants CRT180/HPV6bE7 and CRT180 showed strong anti-angiogenic effects in bFGF-induced angiogenesis in vivo. Moreover, CRT180/HPV6bE7 and CRT180 DNA vaccines could significantly inhibit the tumor growth in tumor challenge experiment, and CRT180/HPV6bE7 was superior to other vaccines in delaying tumor formation time, limiting tumor size and weight in tumor protection experiment. In conclusion, recombinant CRT180/HPV6bE7 DNA could elicit a most efficient anti-angiogenic effect and inhibit tumor growth in mice inoculated with DNA vaccines. The antiangiogenic activity of CRT were suggested residing in a domain between CRT 120-180 aa.

  20. PRKDC mutations associated with immunodeficiency, granuloma, and autoimmune regulator-dependent autoimmunity

    NARCIS (Netherlands)

    A.-L. Mathieu (Anne-Laure); E. Verronese (Estelle); G.I. Rice (Gillian I.); F. Fouyssac (Fanny); Y. Bertrand (Yves); C. Picard (Capucine); M. Chansel (Marie); J.E. Walter (Jolan E.); L.D. Notarangelo (Luigi Daniele); M.J. Butte (Manish J.); K.C. Nadeau (Kari Christine); K. Csomos (Krisztian); D.J. Chen (David); K. Chen (Karin); A. Delgado (Ana); C. Rigal (Chantal); C. Bardin (Christine); C. Schuetz (Catharina); D. Moshous (Despina); H. Reumaux (Héloïse); F. Plenat (François); A. Phan (Alice); M.-T. Zabot (Marie-Thérèse); B. Balme (Brigitte); S. Viel (Sébastien); J. Bienvenu (Jacques); P. Cochat (Pierre); M. van der Burg (Mirjam); C. Caux (Christophe); E.H. Kemp (E. Helen); I. Rouvet (Isabelle); C. Malcus (Christophe); J.-F. Méritet (Jean-Francois); A. Lim (Annick); Y.J. Crow (Yanick J.); N. Fabien (Nicole); C. Ménétrier-Caux (Christine); J.-P. De Villartay (Jean-Pierre); T. Walzer (Thierry); A. Belot (Alexandre)

    2015-01-01

    textabstractBackground PRKDC encodes for DNA-dependent protein kinase catalytic subunit (DNA-PKcs), a kinase that forms part of a complex (DNA-dependent protein kinase [DNA-PK]) crucial for DNA double-strand break repair and V(D)J recombination. In mice DNA-PK also interacts with the transcription

  1. Identification of DNA-dependent protein kinase catalytic subunit (DNA-PKcs) as a novel target of bisphenol A.

    Science.gov (United States)

    Ito, Yuki; Ito, Takumi; Karasawa, Satoki; Enomoto, Teruya; Nashimoto, Akihiro; Hase, Yasuyoshi; Sakamoto, Satoshi; Mimori, Tsuneyo; Matsumoto, Yoshihisa; Yamaguchi, Yuki; Handa, Hiroshi

    2012-01-01

    Bisphenol A (BPA) forms the backbone of plastics and epoxy resins used to produce packaging for various foods and beverages. BPA is also an estrogenic disruptor, interacting with human estrogen receptors (ER) and other related nuclear receptors. Nevertheless, the effects of BPA on human health remain unclear. The present study identified DNA-dependent protein kinase catalytic subunit (DNA-PKcs) as a novel BPA-binding protein. DNA-PKcs, in association with the Ku heterodimer (Ku70/80), is a critical enzyme involved in the repair of DNA double-strand breaks. Low levels of DNA-PK activity are previously reported to be associated with an increased risk of certain types of cancer. Although the Kd for the interaction between BPA and a drug-binding mutant of DNA-PKcs was comparatively low (137 nM), high doses of BPA were required before cellular effects were observed (100-300 μM). The results of an in vitro kinase assay showed that BPA inhibited DNA-PK kinase activity in a concentration-dependent manner. In M059K cells, BPA inhibited the phosphorylation of DNA-PKcs at Ser2056 and H2AX at Ser139 in response to ionizing radiation (IR)-irradiation. BPA also disrupted DNA-PKcs binding to Ku70/80 and increased the radiosensitivity of M059K cells, but not M059J cells (which are DNA-PKcs-deficient). Taken together, these results provide new evidence of the effects of BPA on DNA repair in mammalian cells, which are mediated via inhibition of DNA-PK activity. This study may warrant the consideration of the possible carcinogenic effects of high doses of BPA, which are mediated through its action on DNA-PK.

  2. Prime-boost therapeutic vaccination in mice with DNA/DNA or DNA/Fowlpox virus recombinants expressing the Human Papilloma Virus type 16 E6 and E7 mutated proteins fused to the coat protein of Potato virus X.

    Science.gov (United States)

    Illiano, Elena; Bissa, Massimiliano; Paolini, Francesca; Zanotto, Carlo; De Giuli Morghen, Carlo; Franconi, Rosella; Radaelli, Antonia; Venuti, Aldo

    2016-10-02

    The therapeutic antitumor potency of a prime-boost vaccination strategy was explored, based on the mutated, nontransforming forms of the E6 (E6 F47R ) and E7 (E7 GGG ) oncogenes of Human Papilloma Virus type 16 (HPV16), fused to the Potato virus X (PVX) coat protein (CP) sequence. Previous data showed that CP fusion improves the immunogenicity of tumor-associated antigens and may thus increase their efficacy. After verifying the correct expression of E6 F47R CP and E7 GGG CP inserted into DNA and Fowlpox virus recombinants by Western blotting and immunofluorescence, their combined use was evaluated for therapy in a pre-clinical mouse model of HPV16-related tumorigenicity. Immunization protocols were applied using homologous (DNA/DNA) or heterologous (DNA/Fowlpox) prime-boost vaccine regimens. The humoral immune responses were determined by ELISA, and the therapeutic efficacy evaluated by the delay in tumor appearance and reduced tumor volume after inoculation of syngeneic TC-1* tumor cells. Homologous DNA/DNA genetic vaccines were able to better delay tumor appearance and inhibit tumor growth when DNAE6 F47R CP and DNAE7 GGG CP were administered in combination. However, the heterologous DNA/Fowlpox vaccination strategy was able to delay tumor appearance in a higher number of animals when E6 F47R CP and in particular E7 GGG CP were administered alone. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific.

    Science.gov (United States)

    Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E

    2010-06-01

    A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.

  4. HTLV-1 Tax Oncoprotein Subverts the Cellular DNA Damage Response via Binding to DNA-dependent Protein Kinase*S⃞

    Science.gov (United States)

    Durkin, Sarah S.; Guo, Xin; Fryrear, Kimberly A.; Mihaylova, Valia T.; Gupta, Saurabh K.; Belgnaoui, S. Mehdi; Haoudi, Abdelali; Kupfer, Gary M.; Semmes, O. John

    2008-01-01

    Human T-cell leukemia virus type-1 is the causative agent for adult T-cell leukemia. Previous research has established that the viral oncoprotein Tax mediates the transformation process by impairing cell cycle control and cellular response to DNA damage. We showed previously that Tax sequesters huChk2 within chromatin and impairs the response to ionizing radiation. Here we demonstrate that DNA-dependent protein kinase (DNA-PK) is a member of the Tax·Chk2 nuclear complex. The catalytic subunit, DNA-PKcs, and the regulatory subunit, Ku70, were present. Tax-containing nuclear extracts showed increased DNA-PK activity, and specific inhibition of DNA-PK prevented Tax-induced activation of Chk2 kinase activity. Expression of Tax induced foci formation and phosphorylation of H2AX. However, Tax-induced constitutive signaling of the DNA-PK pathway impaired cellular response to new damage, as reflected in suppression of ionizing radiation-induced DNA-PK phosphorylation and γH2AX stabilization. Tax co-localized with phospho-DNA-PK into nuclear speckles and a nuclear excluded Tax mutant sequestered endogenous phospho-DNA-PK into the cytoplasm, suggesting that Tax interaction with DNA-PK is an initiating event. We also describe a novel interaction between DNA-PK and Chk2 that requires Tax. We propose that Tax binds to and stabilizes a protein complex with DNA-PK and Chk2, resulting in a saturation of DNA-PK-mediated damage repair response. PMID:18957425

  5. [Serologic response to a DNA recombinant vaccine against hepatitis B in natives of the Peruvian Amazonian jungle].

    Science.gov (United States)

    Colichón, A; Vildósola, H; Sjogren, M; Cantella, R; Rojas, C

    1990-01-01

    Large areas of the Amazon basin in Brazil, Colombia, Ecuador, and in the nonoriental region of the peruvian jungle have been found to be hyperendemic to Hepatitis B with high prevalence of asymptomatic carriers (11 to 25%) and, in more selected areas, Hepatitis Delta has been also reported. In the present report, we have studied 108 volunteers from six different Jivaroes communities living in a hyperendemic Hepatitis B area. They received 2 doses of DNA recombinant yeast derivated HBV vaccine. All the selected persons were HBsAb negatives, but many (80%) had antibodies to HBc. Following immunization schedule, 80% responded with the formation of HBsAb; a better seroconversion was achieved in those negatives to anticore IgG compared with those having HBcAb. We obtained 90% of seroconversion in spite of the fact that our vaccination schedule was prolonged up to 10 months from the one recommended by the manufacturer. The vaccination schedule 0,4, 14 months, and the schedule 0,4 months, had 76 and 29% of seroconversion, respectively. We want to point out three observations: 1) It is quite possible that many of the Anti-core positives, that did not respond to vaccination were carriers of HBsAg undetectable by the conventional EIA test carried out; 2) The seroconversion rate in these natives was low (up to six months after the vaccination schedule); and 3) Many of the HBcAb were false positives and many of them were recently infected. We conclude: A) It is highly important to assess the anti-HBs hyperendemic areas before attempting vaccinations; B) All persons negative to anti-HBs should be vaccinated in spite to anticore antibodies; C) Areas with difficult access could be vaccinated even until 10 months without affecting good results, and D) DNA recombinant vaccine (ENGERIX B) was well tolerated. No side effects were observed.

  6. Purification, crystallization and preliminary crystallographic analysis of a multiple cofactor-dependent DNA ligase from Sulfophobococcus zilligii

    International Nuclear Information System (INIS)

    Supangat, Supangat; An, Young Jun; Sun, Younguk; Kwon, Suk-Tae; Cha, Sun-Shin

    2010-01-01

    A recombinant multiple cofactor-dependent DNA ligase from S. zilligii has been purified and crystallized. X-ray diffraction data were collected to 2.9 Å resolution and the crystals belonged to space group P1. A recombinant DNA ligase from Sulfophobococcus zilligii that shows multiple cofactor specificity (ATP, ADP and GTP) was expressed in Escherichia coli and purified under reducing conditions. Crystals were obtained by the microbatch crystallization method at 295 K in a drop containing 1 µl protein solution (10 mg ml −1 ) and an equal volume of mother liquor [0.1 M HEPES pH 7.5, 10%(w/v) polyethylene glycol 10 000]. A data set was collected to 2.9 Å resolution using synchrotron radiation. The crystals belonged to space group P1, with unit-cell parameters a = 63.7, b = 77.1, c = 77.8 Å, α = 83.4, β = 82.4, γ = 74.6°. Assuming the presence of two molecules in the unit cell, the solvent content was estimated to be about 53.4%

  7. Deficiency of the Arabidopsis helicase RTEL1 triggers a SOG1-dependent replication checkpoint in response to DNA cross-links.

    Science.gov (United States)

    Hu, Zhubing; Cools, Toon; Kalhorzadeh, Pooneh; Heyman, Jefri; De Veylder, Lieven

    2015-01-01

    To maintain genome integrity, DNA replication is executed and regulated by a complex molecular network of numerous proteins, including helicases and cell cycle checkpoint regulators. Through a systematic screening for putative replication mutants, we identified an Arabidopsis thaliana homolog of human Regulator of Telomere Length 1 (RTEL1), which functions in DNA replication, DNA repair, and recombination. RTEL1 deficiency retards plant growth, a phenotype including a prolonged S-phase duration and decreased cell proliferation. Genetic analysis revealed that rtel1 mutant plants show activated cell cycle checkpoints, specific sensitivity to DNA cross-linking agents, and increased homologous recombination, but a lack of progressive shortening of telomeres, indicating that RTEL1 functions have only been partially conserved between mammals and plants. Surprisingly, RTEL1 deficiency induces tolerance to the deoxynucleotide-depleting drug hydroxyurea, which could be mimicked by DNA cross-linking agents. This resistance does not rely on the essential replication checkpoint regulator WEE1 but could be blocked by a mutation in the SOG1 transcription factor. Taken together, our data indicate that RTEL1 is required for DNA replication and that its deficiency activates a SOG1-dependent replication checkpoint. © 2015 American Society of Plant Biologists. All rights reserved.

  8. Immune responses elicited by Mycoplasma hyopneumoniae recombinant antigens and DNA constructs with potential for use in vaccination against porcine enzootic pneumonia.

    Science.gov (United States)

    Virginio, Veridiana Gomes; Gonchoroski, Taylor; Paes, Jéssica Andrade; Schuck, Desirée Cigaran; Zaha, Arnaldo; Ferreira, Henrique Bunselmeyer

    2014-10-07

    Mycoplasma hyopneumoniae is the etiological agent of porcine enzootic pneumonia (PEP) and causes major economic losses to the pig industry worldwide. Commercially available vaccines provide only partial protection and are relatively expensive. In this study, we assessed the humoral and cellular immune responses to three recombinant antigens of M. hyopneumoniae. Immune responses to selected domains of the P46, HSP70 and MnuA antigens (P46102-253, HSP70212-601 and MnuA182-378), delivered as recombinant subunit or DNA vaccines, were evaluated in BALB/c mice. All purified recombinant antigens and two DNA vaccines, pcDNA3.1(+)/HSP70212-601 and pcDNA3.1(+)/MnuA182-378, elicited a strong humoral immune response, indicated by high IgG levels in the serum. The cellular immune response was assessed by detection of IFN-γ, IL-10 and IL-4 in splenocyte culture supernatants. The recombinant subunit and DNA vaccines induced Th1-polarized immune responses, as evidenced by increased levels of IFN-γ. All recombinant subunit vaccines and the pcDNA3.1(+)/MnuA182-378 vaccine also induced the secretion of IL-10, a Th2-type cytokine, in large quantities. The mixed Th1/Th2-type response may elicit an effective immune response against M. hyopneumoniae, suggesting that P46102-253, HSP70212-601 and MnuA182-378 are potential novel and promising targets for the development of vaccines against PEP. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Recombinant invasive Lactococcus lactis can transfer DNA vaccines either directly to dendritic cells or across an epithelial cell monolayer.

    Science.gov (United States)

    de Azevedo, Marcela; Meijerink, Marjolein; Taverne, Nico; Pereira, Vanessa Bastos; LeBlanc, Jean Guy; Azevedo, Vasco; Miyoshi, Anderson; Langella, Philippe; Wells, Jerry M; Chatel, Jean-Marc

    2015-09-11

    Lactococcus lactis (L. lactis), a generally regarded as safe (GRAS) bacterium has recently been investigated as a mucosal delivery vehicle for DNA vaccines. Because of its GRAS status, L. lactis represents an attractive alternative to attenuated pathogens. Previous studies showed that eukaryotic expression plasmids could be delivered into intestinal epithelial cells (IECs) by L. lactis, or recombinant invasive strains of L. lactis, leading to heterologous protein expression. Although expression of antigens in IECs might lead to vaccine responses, it would be of interest to know whether uptake of L. lactis DNA vaccines by dendritic cells (DCs) could lead to antigen expression as they are unique in their ability to induce antigen-specific T cell responses. To test this, we incubated mouse bone marrow-derived DCs (BMDCs) with invasive L. lactis strains expressing either Staphylococcus aureus Fibronectin Binding Protein A (LL-FnBPA+), or Listeria monocytogenes mutated Internalin A (LL-mInlA+), both strains carrying a plasmid DNA vaccine (pValac) encoding for the cow milk allergen β-lactoglobulin (BLG). We demonstrated that they can transfect BMDCs, inducing the secretion of the pro-inflammatory cytokine IL-12. We also measured the capacity of strains to invade a polarized monolayer of IECs, mimicking the situation encountered in the gastrointestinal tract. Gentamycin survival assay in these cells showed that LL-mInlA+ is 100 times more invasive than L. lactis. The cross-talk between differentiated IECs, BMDCs and bacteria was also evaluated using an in vitro transwell co-culture model. Co-incubation of strains in this model showed that DCs incubated with LL-mInlA+ containing pValac:BLG could express significant levels of BLG. These results suggest that DCs could sample bacteria containing the DNA vaccine across the epithelial barrier and express the antigen. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  10. Mechanisms of sister chromatid recombination

    International Nuclear Information System (INIS)

    Nakai, Sayaka; Machida, Isamu; Tsuji, Satsuki

    1985-01-01

    Studies using T948 as a model system have been carried out aimed at elucidating the mechanism of sister chromatid recombination (SCR). Characterization of U.V. light- and x-ray-induced SCR, the relationiship between SCR induction and DNA repair using rad mutations, and the relationship between SCR induction and the time of cell division using cdc mutations are presented. It has been supposed that SCR is induced at the phase of S-G 2 following DNA replication, that postreplication break of DNA strands is strongly involved in the induction of SCR, and that induction type of SCR, i.e., conversion type or recombination type, is dependent upon the type of molecular damage of DNA. (Namekawa, K.)

  11. Evolution of the Immune Repertoire with and without Somatic DNA Recombination

    NARCIS (Netherlands)

    Takumi, K.; Hogeweg, P.

    1998-01-01

    Repertoire of an immune system is a set of antigen receptors each having a unique specificity to bind an antigen. In many vertebrate species, antigen receptors are produced via combinatorial arrangements of DNA segments in specialized immune cells. Due to this molecular mechanism, repertoire

  12. DNA-PK dependent targeting of DNA-ends to a protein complex assembled on matrix attachment region DNA sequences

    International Nuclear Information System (INIS)

    Mauldin, S.K.; Getts, R.C.; Perez, M.L.; DiRienzo, S.; Stamato, T.D.

    2003-01-01

    Full text: We find that nuclear protein extracts from mammalian cells contain an activity that allows DNA ends to associate with circular pUC18 plasmid DNA. This activity requires the catalytic subunit of DNA-PK (DNA-PKcs) and Ku since it was not observed in mutants lacking Ku or DNA-PKcs but was observed when purified Ku/DNA-PKcs was added to these mutant extracts. Competition experiments between pUC18 and pUC18 plasmids containing various nuclear matrix attachment region (MAR) sequences suggest that DNA ends preferentially associate with plasmids containing MAR DNA sequences. At a 1:5 mass ratio of MAR to pUC18, approximately equal amounts of DNA end binding to the two plasmids were observed, while at a 1:1 ratio no pUC18 end-binding was observed. Calculation of relative binding activities indicates that DNA-end binding activities to MAR sequences was 7 to 21 fold higher than pUC18. Western analysis of proteins bound to pUC18 and MAR plasmids indicates that XRCC4, DNA ligase IV, scaffold attachment factor A, topoisomerase II, and poly(ADP-ribose) polymerase preferentially associate with the MAR plasmid in the absence or presence of DNA ends. In contrast, Ku and DNA-PKcs were found on the MAR plasmid only in the presence of DNA ends. After electroporation of a 32P-labeled DNA probe into human cells and cell fractionation, 87% of the total intercellular radioactivity remained in nuclei after a 0.5M NaCl extraction suggesting the probe was strongly bound in the nucleus. The above observations raise the possibility that DNA-PK targets DNA-ends to a repair and/or DNA damage signaling complex which is assembled on MAR sites in the nucleus

  13. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H; Frykholm, Karolin; Reymer, Anna; Renodon-Corniè re, Axelle; Takahashi, Masayuki; Nordé n, Bengt

    2012-01-01

    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated

  14. Temperature dependent recombination dynamics in InP/ZnS colloidal nanocrystals

    DEFF Research Database (Denmark)

    Shirazi, Roza; Kopylov, Oleksii; Kovács, András

    2012-01-01

    In this letter, we investigate exciton recombination in InP/ZnS core-shell colloidal nanocrystals over a wide temperature range. Over the entire range between room temperature and liquid helium temperature, multi-exponential exciton decay curves are observed and well explained by the presence...

  15. A recombinant CYP11B1 dependent Escherichia coli biocatalyst for selective cortisol production and optimization towards a preparative scale.

    Science.gov (United States)

    Schiffer, Lina; Anderko, Simone; Hobler, Anna; Hannemann, Frank; Kagawa, Norio; Bernhardt, Rita

    2015-02-25

    Human mitochondrial CYP11B1 catalyzes a one-step regio- and stereoselective 11β-hydroxylation of 11-deoxycortisol yielding cortisol which constitutes not only the major human stress hormone but also represents a commercially relevant therapeutic drug due to its anti-inflammatory and immunosuppressive properties. Moreover, it is an important intermediate in the industrial production of synthetic pharmaceutical glucocorticoids. CYP11B1 thus offers a great potential for biotechnological application in large-scale synthesis of cortisol. Because of its nature as external monooxygenase, CYP11B1-dependent steroid hydroxylation requires reducing equivalents which are provided from NADPH via a redox chain, consisting of adrenodoxin reductase (AdR) and adrenodoxin (Adx). We established an Escherichia coli based whole-cell system for selective cortisol production from 11-deoxycortisol by recombinant co-expression of the demanded 3 proteins. For the subsequent optimization of the whole-cell activity 3 different approaches were pursued: Firstly, CYP11B1 expression was enhanced 3.3-fold to 257 nmol∗L(-1) by site-directed mutagenesis of position 23 from glycine to arginine, which was accompanied by a 2.6-fold increase in cortisol yield. Secondly, the electron transfer chain was engineered in a quantitative manner by introducing additional copies of the Adx cDNA in order to enhance Adx expression on transcriptional level. In the presence of 2 and 3 copies the initial linear conversion rate was greatly accelerated and the final product concentration was improved 1.4-fold. Thirdly, we developed a screening system for directed evolution of CYP11B1 towards higher hydroxylation activity. A culture down-scale to microtiter plates was performed and a robot-assisted, fluorescence-based conversion assay was applied for the selection of more efficient mutants from a random library. Under optimized conditions a maximum productivity of 0.84 g cortisol∗L(-1)∗d(-1) was achieved, which

  16. Analysis of time-dependent effects when operating nested-well plasma traps for achieving antihydrogen recombination

    International Nuclear Information System (INIS)

    Chang Yongbin; Dolliver, D. D.; Ordonez, C. A.

    1999-01-01

    In the work reported, time-dependent effects are considered which affect the prospect of getting two oppositely signed plasmas to overlap the same region while trapped within a solenoidal magnetic field. Parameters that are relevant to future experimental attempts at producing cold antihydrogen atoms using nested-well plasma traps are considered. It is found that the timescale over which an overlap remains, without changing the electrode voltages, can be much larger than the timescale over which the overlap plasma recombines. Hence, it does not appear necessary to use time-dependent electrode voltages to maintain the overlap while antihydrogen atoms are being produced

  17. Coincident In Vitro Analysis of DNA-PK-Dependent and -Independent Nonhomologous End Joining

    Directory of Open Access Journals (Sweden)

    Cynthia L. Hendrickson

    2010-01-01

    Full Text Available In mammalian cells, DNA double-strand breaks (DSBs are primarily repaired by nonhomologous end joining (NHEJ. The current model suggests that the Ku 70/80 heterodimer binds to DSB ends and recruits DNA-PKcs to form the active DNA-dependent protein kinase, DNA-PK. Subsequently, XRCC4, DNA ligase IV, XLF and most likely, other unidentified components participate in the final DSB ligation step. Therefore, DNA-PK plays a key role in NHEJ due to its structural and regulatory functions that mediate DSB end joining. However, recent studies show that additional DNA-PK-independent NHEJ pathways also exist. Unfortunately, the presence of DNA-PKcs appears to inhibit DNA-PK-independent NHEJ, and in vitro analysis of DNA-PK-independent NHEJ in the presence of the DNA-PKcs protein remains problematic. We have developed an in vitro assay that is preferentially active for DNA-PK-independent DSB repair based solely on its reaction conditions, facilitating coincident differential biochemical analysis of the two pathways. The results indicate the biochemically distinct nature of the end-joining mechanisms represented by the DNA-PK-dependent and -independent NHEJ assays as well as functional differences between the two pathways.

  18. Separation of DNA-dependent polymerate activities in Micrococcus radiodurans

    International Nuclear Information System (INIS)

    Kitayama, S.; Matsuyama, A.

    1977-01-01

    DNA polymerase activities in Micrococcus radiodurans were separated into two fractions after purification more than 2000 fold. They differ in pH optimum and residual activities in the absence of a full deoxyribonucleoside triphosphates complement. NAD partly inhibited one of the activities. Both activities were eluted as a single peak on gel filtration and sedimented at the same rate on glycerol gradient centrifugation. Molecular weight 140000 was calculated from Stokes radius and sedimentation constant. Deoxyribonuclease activity was detected on one of the polymerase activities which preferentially degraded double-stranded DNA. Priming activity of nicked DNA was reduced by γ-radiation. These results have been related to the possible roles in repair synthesis in vivo or DNA synthesis in permeable cells of M. radiodurans

  19. Separation of DNA-dependent polymerase activities in Micrococcus radiodurans

    Energy Technology Data Exchange (ETDEWEB)

    Kitayama, S; Matsuyama, A [Institute of Physical and Chemical Research, Wako, Saitama (Japan)

    1977-03-02

    DNA polymerase activities in Micrococcus radiodurans were separated into two fractions after purification more than 2000 fold. They differ in pH optimum and residual activities in the absence of a full deoxyribonucleoside triphosphates complement. NAD partly inhibited one of the activities. Both activities were eluted as a single peak on gel filtration and sedimented at the same rate on glycerol gradient centrifugation. Molecular weight 140000 was calculated from Stokes radius and sedimentation constant. Deoxyribonuclease activity was detected on one of the polymerase activities which preferentially degraded double-stranded DNA. Priming activity of nicked DNA was reduced by ..gamma.. radiation. These results have been related to the possible roles in repair synthesis in vivo or DNA synthesis in permeable cells of M. radiodurans.

  20. In vitro Ca(2+)-dependent maturation of milk-clotting recombinant Epr: minor extracellular protease: from Bacillus licheniformis.

    Science.gov (United States)

    Ageitos, José Manuel; Vallejo, Juan Andrés; Serrat, Manuel; Sánchez-Pérez, Angeles; Villa, Tomás G

    2013-06-01

    The minor extracellular protease (Epr) is secreted into the culture medium during Bacillus licheniformis, strain USC13, stationary phase of growth. Whereas, B. subtilis Epr has been reported to be involved in swarming; the B. licheniformis protease is also involved in milk-clotting as shown by the curd forming ability of culture broths expressing this protein. The objectives of this study are the characterization of recombinant B. licheniformis Epr (minor extracellular protease) and the determination of its calcium-dependent activation process. In this work, we have cloned and expressed B. licheniformis Epr in Escherichia coli. We were also able to construct a tridimensional model for Epr based on its homology to Thermococcus kodakarensis pro-tk-subtilisin 2e1p, fervidolysin from Fervidobacterium pennivorans 1rv6, and B. lentus 1GCI subtilisin. Recombinant Epr was accumulated into inclusion bodies; after protein renaturation, Epr undergoes an in vitro calcium-dependent activation, similar to that described for tk protease. The recombinant Epr is capable of producing milk curds with the same clotting activity previously described for the native B. licheniformis Epr enzyme although further rheological and industrial studies should be carried out to confirm its real applicability. This work represents for the first time that Epr may be successfully expressed in a non-bacilli microorganism.

  1. [DNA-dependent DNA polymerase induced by herpes virus papio (HVP) in producing cells].

    Science.gov (United States)

    D'iachenko, A G; Beriia, L Ia; Matsenko, L D; Kakubava, V V; Kokosh, L V

    1980-11-01

    A new DNA polymerase was found in the cells of suspension lymphoblastoid cultures, which produce lymphotropic baboon herpes virus (HVP). The enzyme was isolated in a partially purified form. In some properties the enzyme differs from other cellular DNA polymerases. The HVP-induced DNA polymerase has the molecular weight of 1,6 x 10(5) and sedimentation coefficient of about 8S. The enzyme is resistant to high salt concentrations and N-ethylmaleimide, but shows a pronounced sensitivity to phosphonoacetate. The enzyme effectively copies "activated" DNA and synthetic deoxyribohomopolymers. The attempts to detect the DNA polymerase activity in HVP virions were unsuccessful.

  2. Identification and verification of hybridoma-derived monoclonal antibody variable region sequences using recombinant DNA technology and mass spectrometry.

    Science.gov (United States)

    Babrak, Lmar; McGarvey, Jeffery A; Stanker, Larry H; Hnasko, Robert

    2017-10-01

    Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibodies (rAb). This determination can be achieved by sequence analysis of immunoglobulin (Ig) transcripts obtained from a monoclonal antibody (MAb) producing hybridoma and subsequent expression of a rAb. However the polyploidy nature of a hybridoma cell often results in the added expression of aberrant immunoglobulin-like transcripts or even production of anomalous antibodies which can confound production of rAb. An incorrect VR sequence will result in a non-functional rAb and de novo assembly of Ig primary structure without a sequence map is challenging. To address these problems, we have developed a methodology which combines: 1) selective PCR amplification of VR from both the heavy and light chain IgG from hybridoma, 2) molecular cloning and DNA sequence analysis and 3) tandem mass spectrometry (MS/MS) on enzyme digests obtained from the purified IgG. Peptide analysis proceeds by evaluating coverage of the predicted primary protein sequence provided by the initial DNA maps for the VR. This methodology serves to both identify and verify the primary structure of the MAb VR for production as rAb. Published by Elsevier Ltd.

  3. Eimeria maxima microneme protein 2 delivered as DNA vaccine and recombinant protein induces immunity against experimental homogenous challenge.

    Science.gov (United States)

    Huang, Jingwei; Zhang, Zhenchao; Li, Menghui; Song, Xiaokai; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui

    2015-10-01

    E. maxima is one of the seven species of Eimeria that infects chicken. Until now, only a few antigenic genes of E. maxima have been reported. In the present study, the immune protective effects against E. maxima challenge of recombinant protein and DNA vaccine encoding EmMIC2 were evaluated. Two-week-old chickens were randomly divided into five groups. The experimental group of chickens was immunized with 100 μg DNA vaccine pVAX1-MIC2 or 200 μg rEmMIC2 protein while the control group of chickens was injected with pVAX1 plasmid or sterile PBS. The results showed that the anti-EmMIC2 antibody titers of both rEmMIC2 protein and pVAX1-MIC2 groups were significantly higher as compared to PBS and pVAX1 control (Pmaxima challenge and it could be an effective antigen candidate for the development of new vaccines against E. maxima. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  4. Research in Undergraduate Instruction: A Biotech Lab Project for Recombinant DNA Protein Expression in Bacteria

    Science.gov (United States)

    Brockman, Mark; Ordman, Alfred B.; Campbell, A. Malcolm

    1996-06-01

    In the sophomore-level Molecular Biology and Biotechnology course at Beloit College, students learn basic methods in molecular biology in the context of pursuing a semester-long original research project. We are exploring how DNA sequence affects expression levels of proteins. A DNA fragment encoding all or part of the guanylate monokinase (gmk) sequence is cloned into pSP73 and expressed in E. coli. A monoclonal antibody is made to gmk. The expression level of gmk is determined by SDS gel elctrophoresis, a Western blot, and an ELISA assay. Over four years, an increase in enrollment in the course from 9 to 34 students, the 85% of majors pursuing advanced degrees, and course evaluations all support the conclusion that involving students in research during undergraduate courses encourages them to pursue careers in science.

  5. Break-induced ATR and Ddb1-Cul4(Cdt)² ubiquitin ligase-dependent nucleotide synthesis promotes homologous recombination repair in fission yeast

    DEFF Research Database (Denmark)

    Moss, Jennifer; Tinline-Purvis, Helen; Walker, Carol A

    2010-01-01

    Nucleotide synthesis is a universal response to DNA damage, but how this response facilitates DNA repair and cell survival is unclear. Here we establish a role for DNA damage-induced nucleotide synthesis in homologous recombination (HR) repair in fission yeast. Using a genetic screen, we found...... the Ddb1-Cul4(Cdt)² ubiquitin ligase complex and ribonucleotide reductase (RNR) to be required for HR repair of a DNA double-strand break (DSB). The Ddb1-Cul4(Cdt)² ubiquitin ligase complex is required for degradation of Spd1, an inhibitor of RNR in fission yeast. Accordingly, deleting spd1(+) suppressed...

  6. Intranuclear Delivery of a Novel Antibody-Derived Radiosensitizer Targeting the DNA-Dependent Protein Kinase Catalytic Subunit

    Energy Technology Data Exchange (ETDEWEB)

    Xiong Hairong [Institute of Molecular Medicine and Genetics, Georgia Health Sciences University, Augusta, GA (Georgia); State Key Laboratory of Virology, Institute of Medical Virology, Wuhan University School of Medicine, Wuhan (China); Lee, Robert J. [Division of Pharmaceutics, College of Pharmacy, Ohio State University, Columbus, OH (United States); Haura, Eric B. [Thoracic Oncology and Experimental Therapeutics Programs, H. Lee Moffitt Cancer Center and Research Institute, Tampa, FL (United States); Edwards, John G. [Apeliotus Technologies, Inc., Atlanta, GA (United States); Dynan, William S. [Institute of Molecular Medicine and Genetics, Georgia Health Sciences University, Augusta, GA (Georgia); Li Shuyi, E-mail: sli@georgiahealth.edu [Institute of Molecular Medicine and Genetics, Georgia Health Sciences University, Augusta, GA (Georgia); Apeliotus Technologies, Inc., Atlanta, GA (United States)

    2012-07-01

    Purpose: To inhibit DNA double-strand break repair in tumor cells by delivery of a single-chain antibody variable region fragment (ScFv 18-2) to the cell nucleus. ScFv 18-2 binds to a regulatory region of the DNA-dependent protein kinase (DNA-PK), an essential enzyme in the nonhomologous end-joining pathway, and inhibits DNA end-joining in a cell-free system and when microinjected into single cells. Development as a radiosensitizer has been limited by the lack of a method for intranuclear delivery to target cells. We investigated a delivery method based on folate receptor-mediated endocytosis. Methods and Materials: A recombinant ScFv 18-2 derivative was conjugated to folate via a scissile disulfide linker. Folate-ScFv 18-2 was characterized for its ability to be internalized by tumor cells and to influence the behavior of ionizing radiation-induced repair foci. Radiosensitization was measured in a clonogenic survival assay. Survival curves were fitted to a linear-quadratic model, and between-group differences were evaluated by an F test. Sensitization ratios were determined based on mean inhibitory dose. Results: Human KB and NCI-H292 lung cancer cells treated with folate-conjugated ScFv 18-2 showed significant radiosensitization (p < 0.001). Sensitization enhancement ratios were 1.92 {+-} 0.42 for KB cells and 1.63 {+-} 0.13 for NCI-H292 cells. Studies suggest that treatment inhibits repair of radiation-induced DSBs, as evidenced by the persistence of {gamma}-H2AX-stained foci and by inhibition of staining with anti-DNA-PKcs phosphoserine 2056. Conclusions: Folate-mediated endocytosis is an effective method for intranuclear delivery of an antibody-derived DNA repair inhibitor.

  7. Varicella-zoster virus (VZV) origin of DNA replication oriS influences origin-dependent DNA replication and flanking gene transcription.

    Science.gov (United States)

    Khalil, Mohamed I; Sommer, Marvin H; Hay, John; Ruyechan, William T; Arvin, Ann M

    2015-07-01

    The VZV genome has two origins of DNA replication (oriS), each of which consists of an AT-rich sequence and three origin binding protein (OBP) sites called Box A, C and B. In these experiments, the mutation in the core sequence CGC of the Box A and C not only inhibited DNA replication but also inhibited both ORF62 and ORF63 expression in reporter gene assays. In contrast the Box B mutation did not influence DNA replication or flanking gene transcription. These results suggest that efficient DNA replication enhances ORF62 and ORF63 transcription. Recombinant viruses carrying these mutations in both sites and one with a deletion of the whole oriS were constructed. Surprisingly, the recombinant virus lacking both copies of oriS retained the capacity to replicate in melanoma and HELF cells suggesting that VZV has another origin of DNA replication. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Recent research in DNA repair, mutation and recombination: a report of the DNA Repair Network meeting, held at City University, London on 18 December 1995.

    Science.gov (United States)

    Jones, N J; Strike, P

    1996-09-02

    The now traditional one day Christmas DNA Repair meeting was held at City University, London for the third year in succession. With over 130 participants and a programme consisting of a total of 24 pre-offered presentations the meeting reached record dimensions. Attendees were from 24 institutions throughout the United Kingdom, and with several distinct research groups contained within the large contingents from the ICRF Clare Hall Laboratories and the MRC Cell Mutation Unit in Brighton, this indicates the increasing interest and depth of UK research in DNA repair. One slight disappointment of the meeting was the fall in the numbers of non-UK participants. Although the meeting in 1994 (Strike, 1995) saw an increase in presentations from Continental Europe (six countries including France, Germany. The Netherlands and Switzerland), the trend did not continue this year, with only Denmark being represented. The 24 contributors consisted of approximately equal numbers of postgraduate students, postdoctoral researchers and more "established' scientists reflecting the continuing policy of encouraging younger members of the repair community to present their work. The mix of presenters was particularly well illustrated by two excellent and consecutive talks by Professor Bryn Bridges (MRC Cell Mutation Unit) and Alison Mitchell, a postgraduate student in Stephen West's laboratory (ICRF, Clare Hall). The organisms under study were as equally disparate and included Archaebacteria, Escherichia coli. Saccharomyces cerevisiae, Schizosaccharomyces pombe, Aspergillus, mice and men. The range of topics was also varied and included bacterial mutagenesis, NMR studies of Ada protein, preferential DNA repair, cell cycle checkpoint genes, reconstitution of nucleotide excision repair and V(D)J recombination in vitro, creation of repair deficient transgenic mice and mismatch defects in human cells. The result was a very successful meeting which was characterized by the consistently high

  9. ATR-p53 restricts homologous recombination in response to replicative stress but does not limit DNA interstrand crosslink repair in lung cancer cells.

    Directory of Open Access Journals (Sweden)

    Bianca M Sirbu

    Full Text Available Homologous recombination (HR is required for the restart of collapsed DNA replication forks and error-free repair of DNA double-strand breaks (DSB. However, unscheduled or hyperactive HR may lead to genomic instability and promote cancer development. The cellular factors that restrict HR processes in mammalian cells are only beginning to be elucidated. The tumor suppressor p53 has been implicated in the suppression of HR though it has remained unclear why p53, as the guardian of the genome, would impair an error-free repair process. Here, we show for the first time that p53 downregulates foci formation of the RAD51 recombinase in response to replicative stress in H1299 lung cancer cells in a manner that is independent of its role as a transcription factor. We find that this downregulation of HR is not only completely dependent on the binding site of p53 with replication protein A but also the ATR/ATM serine 15 phosphorylation site. Genetic analysis suggests that ATR but not ATM kinase modulates p53's function in HR. The suppression of HR by p53 can be bypassed under experimental conditions that cause DSB either directly or indirectly, in line with p53's role as a guardian of the genome. As a result, transactivation-inactive p53 does not compromise the resistance of H1299 cells to the interstrand crosslinking agent mitomycin C. Altogether, our data support a model in which p53 plays an anti-recombinogenic role in the ATR-dependent mammalian replication checkpoint but does not impair a cell's ability to use HR for the removal of DSB induced by cytotoxic agents.

  10. Molecular requirements for radiation-activated recombination

    International Nuclear Information System (INIS)

    Stevens, Craig W.; Zeng Ming; Stamato, Thomas; Cerniglia, George

    1997-01-01

    Purpose/Objective: The major stumbling block to successful gene therapy today is poor gene transfer. We hypothesized that ionizing radiation might activate cellular recombination, and so improve stable gene transfer. We further hypothesized that known DNA-damage-repair proteins might also be important in radiation-activated recombination. Materials and Methods: The effect of irradiation on stable gene transfer efficiency was determined in human (A549 and 39F) and rodent (NIH/3T3) cell lines. Continuous low dose rate and multiple radiation fractions were also tested. Nuclear extracts were made and the effect of irradiation on inter-plasmid recombination/ligation determined. Multiple DNA damage-repair deficient cell lines were tested for radiation-activated recombination. Results: A significant radiation dose-dependent improvement in stable plasmid transfection (by as much as 1300 fold) is demonstrated in neoplastic and primary cells. An improvement in transient plasmid transfection is also seen, with as much as 85% of cells transiently expressing b-galactosidase (20-50 fold improvement). Stable transfection is only improved for linearized or nicked plasmids. Cells have improved gene transfer for at least 96 hours after irradiation. Both fractionated and continuous low dose rate irradiation are effective at improving stable gene transfer in mammalian cells, thus making relatively high radiation dose delivery clinically feasible. Inter-plasmid recombination is radiation dose dependent in nuclear extract assays, and the type of overhang (3', 5' or blunt end) significantly affects recombination efficiency and the type of product. The most common end-joining activity involves filling-in of the overhang followed by blunt end ligation. Adenovirus is a linear, double stranded DNA virus. We demonstrate that adenoviral infection efficiency is increased by irradiation. The duration of transgene expression is lengthened because the virus integrates with high efficiency (∼10

  11. Underwound DNA under Tension: Structure, Elasticity, and Sequence-Dependent Behaviors

    Science.gov (United States)

    Sheinin, Maxim Y.; Forth, Scott; Marko, John F.; Wang, Michelle D.

    2011-09-01

    DNA melting under torsion plays an important role in a wide variety of cellular processes. In the present Letter, we have investigated DNA melting at the single-molecule level using an angular optical trap. By directly measuring force, extension, torque, and angle of DNA, we determined the structural and elastic parameters of torsionally melted DNA. Our data reveal that under moderate forces, the melted DNA assumes a left-handed structure as opposed to an open bubble conformation and is highly torsionally compliant. We have also discovered that at low forces melted DNA properties are highly dependent on DNA sequence. These results provide a more comprehensive picture of the global DNA force-torque phase diagram.

  12. Prevalence of Germline Mutations in Genes Engaged in DNA Damage Repair by Homologous Recombination in Patients with Triple-Negative and Hereditary Non-Triple-Negative Breast Cancers.

    Directory of Open Access Journals (Sweden)

    Pawel Domagala

    Full Text Available This study sought to assess the prevalence of common germline mutations in several genes engaged in the repair of DNA double-strand break by homologous recombination in patients with triple-negative breast cancers and hereditary non-triple-negative breast cancers. Tumors deficient in this type of DNA damage repair are known to be especially sensitive to DNA cross-linking agents (e.g., platinum drugs and to poly(ADP-ribose polymerase (PARP inhibitors.Genetic testing was performed for 36 common germline mutations in genes engaged in the repair of DNA by homologous recombination, i.e., BRCA1, BRCA2, CHEK2, NBN, ATM, PALB2, BARD1, and RAD51D, in 202 consecutive patients with triple-negative breast cancers and hereditary non-triple-negative breast cancers.Thirty five (22.2% of 158 patients in the triple-negative group carried mutations in genes involved in DNA repair by homologous recombination, while 10 (22.7% of the 44 patients in the hereditary non-triple-negative group carried such mutations. Mutations in BRCA1 were most frequent in patients with triple-negative breast cancer (18.4%, and mutations in CHEK2 were most frequent in patients with hereditary non-triple-negative breast cancers (15.9%. In addition, in the triple-negative group, mutations in CHEK2, NBN, and ATM (3.8% combined were found, while mutations in BRCA1, NBN, and PALB2 (6.8% combined were identified in the hereditary non-triple-negative group.Identifying mutations in genes engaged in DNA damage repair by homologous recombination other than BRCA1/2 can substantially increase the proportion of patients with triple-negative breast cancer and hereditary non-triple-negative breast cancer who may be eligible for therapy using PARP inhibitors and platinum drugs.

  13. Conditions for gene disruption by homologous recombination of exogenous DNA into the Sulfolobus solfataricus genome

    Directory of Open Access Journals (Sweden)

    Sonja-Verena Albers

    2008-01-01

    Full Text Available The construction of directed gene deletion mutants is an essential tool in molecular biology that allows functional studies on the role of genes in their natural environment. For hyperthermophilic archaea, it has been difficult to obtain a reliable system to construct such mutants. However, during the past years, systems have been developed for Thermococcus kodakarensis and two Sulfolobus species, S. acidocaldarius and derivatives of S. solfataricus 98/2. Here we describe an optimization of the method for integration of exogenous DNA into S. solfataricus PBL 2025, an S. solfataricus 98/2 derivative, based on lactose auxotrophy that now allows for routine gene inactivation.

  14. Conditions for gene disruption by homologous recombination of exogenous DNA into the Sulfolobus solfataricus genome.

    Science.gov (United States)

    Albers, Sonja-Verena; Driessen, Arnold J M

    2008-12-01

    The construction of directed gene deletion mutants is an essential tool in molecular biology that allows functional studies on the role of genes in their natural environment. For hyperthermophilic archaea, it has been difficult to obtain a reliable system to construct such mutants. However, during the past years, systems have been developed for Thermococcus kodakarensis and two Sulfolobus species, S. acidocaldarius and derivatives of S. solfataricus 98/2. Here we describe an optimization of the method for integration of exogenous DNA into S. solfataricus PBL 2025, an S. solfataricus 98/2 derivative, based on lactose auxotrophy that now allows for routine gene inactivation.

  15. Use of a ring chromosome and pulsed-field gels to study interhomolog recombination, double-strand DNA breaks and sister-chromatid exchange in yeast

    International Nuclear Information System (INIS)

    Game, J.C.; Sitney, K.C.; Cook, V.E.; Mortimer, R.K.

    1989-01-01

    The authors describe a system that uses pulsed-field gels for the physical detection of recombinant DNA molecules, double-strand DNA breaks (DSB) and sister-chromatid exchange in the yeast Saccharomyces cerevisiae. The system makes use of a circular variant of chromosome II (Chr. III). Meiotic recombination between this ring chromosome and a linear homolog produces new molecules of sizes distinguishable on gels from either parental molecule. They demonstrate that these recombinant molecules are not present either in strains with two linear Chr. III molecules or in rad50 mutants, which are defective in meiotic recombination. In conjunction with the molecular endpoints. They present data on the timing of commitment to meiotic recombination scored genetically. They have used x-rays to linearize circular Chr. III, both to develop a sensitive method for measuring frequency of DSB and as a means of detecting double-size circles originating in part from sister-chromatid exchange, which they find to be frequent during meiosis

  16. DNA repair synthesis dependent on the uvrA,B gene products

    International Nuclear Information System (INIS)

    Moses, R.E.; Moody, E.E.M.

    1975-01-01

    Ultraviolet irradiation of toluene-treated Escherichia coli causes an inhibition of replicative DNA synthesis. This is followed by the appearance of nonconservative DNA repair synthesis which does not require either the polymerase or 5' → 3' exonucleolytic activities of DNA polymerase I. The repair synthesis may be catalyzed by DNA polymerase III activity but does not require a functional DNA polymerase II. The ultraviolet-induced synthesis requires ATP and is dependent on a functional uvrA and uvrB gene product. However, other uvr gene products are not required for the synthesis. The recB function is also not required

  17. Mycobacterium smegmatis Lhr Is a DNA-dependent ATPase and a 3'-to-5' DNA translocase and helicase that prefers to unwind 3'-tailed RNA:DNA hybrids.

    Science.gov (United States)

    Ordonez, Heather; Shuman, Stewart

    2013-05-17

    We are interested in the distinctive roster of helicases of Mycobacterium, a genus of the phylum Actinobacteria that includes the human pathogen Mycobacterium tuberculosis and its avirulent relative Mycobacterium smegmatis. Here, we identify and characterize M. smegmatis Lhr as the exemplar of a novel clade of superfamily II helicases, by virtue of its biochemical specificities and signature domain organization. Lhr is a 1507-amino acid monomeric nucleic acid-dependent ATPase that uses the energy of ATP hydrolysis to drive unidirectional 3'-to-5' translocation along single strand DNA and to unwind duplexes en route. The ATPase is more active in the presence of calcium than magnesium. ATP hydrolysis is triggered by either single strand DNA or single strand RNA, yet the apparent affinity for a DNA activator is 11-fold higher than for an RNA strand of identical size and nucleobase sequence. Lhr is 8-fold better at unwinding an RNA:DNA hybrid than it is at displacing a DNA:DNA duplex of identical nucleobase sequence. The truncated derivative Lhr-(1-856) is an autonomous ATPase, 3'-to-5' translocase, and RNA:DNA helicase. Lhr-(1-856) is 100-fold better RNA:DNA helicase than DNA:DNA helicase. Lhr homologs are found in bacteria representing eight different phyla, being especially prevalent in Actinobacteria (including M. tuberculosis) and Proteobacteria (including Escherichia coli).

  18. PH- and salt-dependent molecular combing of DNA: experiments and phenomenological model

    International Nuclear Information System (INIS)

    Benke, Annegret; Pompe, Wolfgang; Mertig, Michael

    2011-01-01

    λ-DNA as well as plasmids can be successfully deposited by molecular combing on hydrophobic surfaces, for pH values ranging from 4 to 10. On polydimethylsiloxane (PDMS) substrates, the deposited DNA molecules are overstretched by about 60-100%. There is a significant influence of sodium ions (NaCl) on the surface density of the deposited DNA, with a maximum near to 100 mM NaCl for a DNA solution (28 ng μl -1 ) at pH 8. The combing process can be described by a micromechanical model including: (i) the adsorption of free moving coiled DNA at the substrate; (ii) the stretching of the coiled DNA by the preceding meniscus; (iii) the relaxation of the deposited DNA to the final length. The sticky ends of λ-DNA cause an adhesion force in the range of about 400 pN which allows a stable overstretching of the DNA by the preceding meniscus. The exposing of hidden hydrophobic bonds of the overstretched DNA leads to a stable deposition on the hydrophobic substrate. The pH-dependent density of deposited DNA as well as the observed influence of sodium ions can be explained by their screening of the negatively charged DNA backbone and sticky ends, respectively. The final DNA length can be derived from a balance of the stored elastic energy of the overstretched molecules and the energy of adhesion.

  19. DNA supercoiling depends on the phosphorylation potential in Escherichia coli

    DEFF Research Database (Denmark)

    Van Workum, M.; van Dooren, S.J.M; Oldenburg, N

    1996-01-01

    ATP/ADP ratios were varied in different ways and the degree of negative supercoiling was determined in Escherichia coli. Independent of whether the ATP/ADP ratio was reduced by a shift to anaerobic conditions, by addition of protonophore (dinitrophenol) or by potassium cyanide addition, DNA super...

  20. Chromatin maturation depends on continued DNA-replication

    International Nuclear Information System (INIS)

    Schlaeger, E.J.; Puelm, W.; Knippers, R.

    1983-01-01

    The structure of [ 3 H]thymidine pulse-labeled chromatin in lymphocytes differs from that of non-replicating chromatin by several operational criteria which are related to the higher nuclease sensitivity of replicating chromatin. These structural features of replicating chromatin rapidly disappear when the [ 3 H]thymidine pulse is followed by a chase in the presence of an excess of non-radioactive thymidine. However, when the rate of DNA replication is reduced, as in cycloheximide-treated lymphocytes, chromatin maturation is retarded. No chromatin maturation is observed when nuclei from pulse-labeled lymphocytes are incubated in vitro in the absence of DNA precursors. In contrast, when these nuclei are incubated under conditions known to be optimal for DNA replication, the structure of replicating chromatin is efficiently converted to that of 'mature', non-replicating chromatin. The authors conclude that the properties of nascent DNA and/or the distance from the replication fork are important factors in chromatin maturation. (Auth.)

  1. Therapeutic Recombinant Monoclonal Antibodies

    Science.gov (United States)

    Bakhtiar, Ray

    2012-01-01

    During the last two decades, the rapid growth of biotechnology-derived techniques has led to a myriad of therapeutic recombinant monoclonal antibodies with significant clinical benefits. Recombinant monoclonal antibodies can be obtained from a number of natural sources such as animal cell cultures using recombinant DNA engineering. In contrast to…

  2. DNA Duplex Length and Salt Concentration Dependence of Enthalpy−Entropy Compensation Parameters for DNA Melting

    KAUST Repository

    Starikov, E. B.; Nordén, Bengt

    2009-01-01

    of the DNA and their water-counterion surrounding. With this in mind, to reinterpret the most recent results of calorimetric experiments on DNA oligomers of such a kind, the recent enthalpy-entropy compensation theory has been used. It is demonstrated

  3. p53 regulates the repair of DNA double-strand breaks by both homologous and non-homologous recombination

    International Nuclear Information System (INIS)

    Willers, H.; Powell, S.N.; Dahm-Daphi, J.

    2003-01-01

    Full text: p53 is known to suppress spontaneous homologous recombination (HR), while its role in non-homologous recombination (NHR) remains to be clarified. Here, we sought to determine the influence of p53 on the repair of chromosomal double-strand breaks (DSBs) by HR or NHR using specially designed recombination substrates that integrate into the genome. Isogenic mouse fibroblast pairs with or without expression of exogenous p53 protein were utilized. A reporter plasmid carrying a mutated XGPRT gene was chromosomally integrated and DSBs were generated within the plasmid by the I-SceI endonuclease. Subsequent homology-mediated repair from an episomal donor resulted in XGPRT reconstitution and cellular resistance to a selection antibiotic. Analogously, the repair of chromosomal I-SceI breaks by NHR using another novel reporter plasmid restored XGPRT translation. For p53-null cells, the mean frequency of I-SceI break repair via HR was 5.5 x 10 -4 . The p53-Val135 mutant, which previously has been shown to suppress spontaneous HR by 14-fold employing the same cell system and reporter gene, only caused a 2- to 3-fold suppression of break-induced HR. In contrast, a dramatic effect of p53 on repair via NHR was found. Preliminary sequence analysis indicated that there was at least a 1000-fold reduction of illegitimate repair events resulting in loss of sequence at the break sites. The observed effects were mediated by p53 mutants defective in regulation of the cell-cycle and apoptosis. The main findings were: (1) p53 virtually blocked illegitimate rejoining of chromosomal ends. (2) The suppression of homologous DSB repair was less pronounced than the inhibition of spontaneous HR. We hypothesize that p53 allows to a certain extent error-free homology-dependent repair to proceed, while blocking error-prone NHR. The data support and extent a previous model, in which p53 maintains genomic stability by regulating recombination independently of its transactivation function

  4. Functional characterization of recombinant snake venom rhodocytin: rhodocytin mutant blocks CLEC-2/podoplanin-dependent platelet aggregation and lung metastasis.

    Science.gov (United States)

    Sasaki, T; Shirai, T; Tsukiji, N; Otake, S; Tamura, S; Ichikawa, J; Osada, M; Satoh, K; Ozaki, Y; Suzuki-Inoue, K

    2018-02-28

    Essentials We generated recombinant rhodocytin that could aggregate platelets via CLEC-2. Recombinant wild-type rhodocytin formed heterooctamer with four α- and β-subunits. Asp 4 in α-subunit of rhodocytin was required for binding to CLEC-2. Inhibitory mutant of rhodocytin blocked podoplanin-dependent hematogenous metastasis. Background Rhodocytin, a disulfide-linked heterodimeric C-type lectin from Calloselasma rhodostoma consisting of α-subunits and β-subunits, induces platelet aggregation through C-type lectin-like receptor 2 (CLEC-2). CLEC-2 is a physiological binding partner of podoplanin (PDPN), which is expressed on some tumor cell types, and is involved in tumor cell-induced platelet aggregation and tumor metastasis. Thus, modified rhodocytin may be a possible source of anti-CLEC-2 drugs for both antiplatelet and antimetastasis therapy. However, its molecular function has not been well characterized, because of the lack of recombinant rhodocytin that induces platelet aggregation. Objective To produce recombinant rhodocytin, in order to verify its function with mutagenesis, and to develop an anti-CLEC-2 drug based on the findings. Methods We used Chinese hamster ovary cells to express recombinant rhodocytin (wild-type [WT] and mutant), which was analyzed for induction/inhibition of platelet aggregation with light transmission aggregometry, the formation of multimers with blue native PAGE, and binding to CLEC-2 with flow cytometry. Finally, we investigated whether mutant rhodocytin could suppress PDPN-induced metastasis in an experimental lung metastasis mouse model. Results Functional WT] rhodocytin (αWTβWT) was obtained by coexpression of both subunits. Asp4 in α-subunits of rhodocytin was required for CLEC-2 binding. αWTβWT formed a heterooctamer similarly to native rhodocytin. Moreover, an inhibitory mutant of rhodocytin (αWTβK53A/R56A), forming a heterotetramer, bound to CLEC-2 without inducing platelet aggregation, and blocked CLEC-2-PDPN

  5. Gene conversion at the gray locus of Sordaria fimicola: fit of the experimental data to a hybrid DNA model of recombination.

    Science.gov (United States)

    Kalogeropoulos, A; Thuriaux, P

    1985-03-01

    A hybrid DNA (hDNA) model of recombination has been algebraically formulated, which allows the prediction of frequencies of postmeiotic segregation and conversion of a given allele and their probability of being associated with a crossing over. The model considered is essentially the "Aviemore model." In contrast to some other interpretations of recombination, it states that gene conversion can only result from the repair of heteroduplex hDNA, with postmeiotic segregation resulting from unrepaired heteroduplexes. The model also postulates that crossing over always occurs distally to the initiation site of the hDNA. Eleven types of conversion and postmeiotic segregation with or without associated crossover were considered. Their theoretical frequencies are given by 11 linear equations with ten variables, four describing heteroduplex repair, four giving the probability of hDNA formation and its topological properties and two giving the probability that crossing over occurs at the left or right of the converting allele. Using the experimental data of Kitani and coworkers on conversion at the six best studied gray alleles of Sordaria fimicola, we found that the model considered fit the data at a P level above or very close (allele h4) to the 5% level of sampling error provided that the hDNA is partly asymmetric. The best fitting solutions are such that the hDNA has an equal probability of being formed on either chromatid or, alternatively, that both DNA strands have the same probability of acting as the invading strand during hDNA formation. The two mismatches corresponding to a given allele are repaired with different efficiencies. Optimal solutions are found if one allows for repair to be more efficient on the asymmetric hDNA than on the symmetric one. In the case of allele g1, our data imply that the direction of repair is nonrandom with respect to the strand on which it occurs.

  6. Expression of protein engineered NADP{sup +}-dependent xylitol dehydrogenase increases ethanol production from xylose in recombinant Saccharomyces cerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Matsushika, Akinori; Inoue, Hiroyuki; Murakami, Katsuji; Takimura, Osamu; Sawayama, Shigeki [National Institute of Advanced Industrial Science and Technology, Hiroshima (Japan). Biomass Technology Research Center; Watanabe, Seiya; Kodaki, Tsutomu; Makino, Keisuke [Kyoto Univ. (Japan). Inst. of Advanced Energy

    2008-11-15

    A recombinant Saccharomyces cerevisiae strain transformed with xylose reductase (XR) and xylitol dehydrogenase (XDH) genes from Pichia stipitis has the ability to convert xylose to ethanol together with the unfavorable excretion of xylitol, which may be due to cofactor imbalance between NADPH-preferring XR and NAD{sup +}-dependent XDH. To reduce xylitol formation, we have already generated several XDH mutants with a reversal of coenzyme specificity toward NADP{sup +}. In this study, we constructed a set of recombinant S. cerevisiae strains with xylose-fermenting ability, including protein-engineered NADP{sup +}-dependent XDH-expressing strains. The most positive effect on xylose-to-ethanol fermentation was found by using a strain named MA-N5, constructed by chromosomal integration of the gene for NADP{sup +}-dependent XDH along with XR and endogenous xylulokinase genes. The MA-N5 strain had an increase in ethanol production and decrease in xylitol excretion compared with the reference strain expressing wild-type XDH when fermenting not only xylose but also mixed sugars containing glucose and xylose. Furthermore, the MA-N5 strain produced ethanol with a high yield of 0.49 g of ethanol/g of total consumed sugars in the nonsulfuric acid hydrolysate of wood chips. The results demonstrate that glucose and xylose present in the lignocellulosic hydrolysate can be efficiently fermented by this redox-engineered strain. (orig.)

  7. Differential expression and requirements for Schizosaccharomyces pombe RAD52 homologs in DNA repair and recombination

    OpenAIRE

    van den Bosch, Michael; Zonneveld, José B. M.; Vreeken, Kees; de Vries, Femke A. T.; Lohman, Paul H. M.; Pastink, Albert

    2002-01-01

    In fission yeast two RAD52 homologs have been identified, rad22A+ and rad22B+. Two-hybrid experiments and GST pull-down assays revealed physical interaction between Rad22A and Rad22B, which is dependent on the N-terminal regions. Interaction with Rhp51 is dependent on the C-terminal parts of either protein. Both Rad22A and Rad22B also interact with RPA. The expression of rad22B+ in mitotically dividing cells is very low in comparison with rad22A+ but is strongly enhanced after induction of me...

  8. Suppression of DNA-dependent protein kinase sensitize cells to radiation without affecting DSB repair

    Energy Technology Data Exchange (ETDEWEB)

    Gustafsson, Ann-Sofie, E-mail: ann-sofie.gustafsson@bms.uu.se; Abramenkovs, Andris; Stenerlöw, Bo

    2014-11-15

    Highlights: • We reduced the level of DNA-PKcs with siRNA and examined cells after γ-irradiation. • Low DNA-PKcs levels lead to radiosensitivity but did not affect repair of DSB. • Low DNA-PKcs levels may block progression of mitosis. • DNA-PKcs role in mitotic progression is independent of its role in DSB repair. • We suggest different mechanisms by which loss of DNA-PKcs function sensitize cells. - Abstract: Efficient and correct repair of DNA double-strand break (DSB) is critical for cell survival. Defects in the DNA repair may lead to cell death, genomic instability and development of cancer. The catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) is an essential component of the non-homologous end joining (NHEJ) which is the major DSB repair pathway in mammalian cells. In the present study, by using siRNA against DNA-PKcs in four human cell lines, we examined how low levels of DNA-PKcs affected cellular response to ionizing radiation. Decrease of DNA-PKcs levels by 80–95%, induced by siRNA treatment, lead to extreme radiosensitivity, similar to that seen in cells completely lacking DNA-PKcs and low levels of DNA-PKcs promoted cell accumulation in G2/M phase after irradiation and blocked progression of mitosis. Surprisingly, low levels of DNA-PKcs did not affect the repair capacity and the removal of 53BP1 or γ-H2AX foci and rejoining of DSB appeared normal. This was in strong contrast to cells completely lacking DNA-PKcs and cells treated with the DNA-PKcs inhibitor NU7441, in which DSB repair were severely compromised. This suggests that there are different mechanisms by which loss of DNA-PKcs functions can sensitize cells to ionizing radiation. Further, foci of phosphorylated DNA-PKcs (T2609 and S2056) co-localized with DSB and this was independent of the amount of DNA-PKcs but foci of DNA-PKcs was only seen in siRNA-treated cells. Our study emphasizes on the critical role of DNA-PKcs for maintaining survival after radiation exposure

  9. Suppression of DNA-dependent protein kinase sensitize cells to radiation without affecting DSB repair

    International Nuclear Information System (INIS)

    Gustafsson, Ann-Sofie; Abramenkovs, Andris; Stenerlöw, Bo

    2014-01-01

    Highlights: • We reduced the level of DNA-PKcs with siRNA and examined cells after γ-irradiation. • Low DNA-PKcs levels lead to radiosensitivity but did not affect repair of DSB. • Low DNA-PKcs levels may block progression of mitosis. • DNA-PKcs role in mitotic progression is independent of its role in DSB repair. • We suggest different mechanisms by which loss of DNA-PKcs function sensitize cells. - Abstract: Efficient and correct repair of DNA double-strand break (DSB) is critical for cell survival. Defects in the DNA repair may lead to cell death, genomic instability and development of cancer. The catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) is an essential component of the non-homologous end joining (NHEJ) which is the major DSB repair pathway in mammalian cells. In the present study, by using siRNA against DNA-PKcs in four human cell lines, we examined how low levels of DNA-PKcs affected cellular response to ionizing radiation. Decrease of DNA-PKcs levels by 80–95%, induced by siRNA treatment, lead to extreme radiosensitivity, similar to that seen in cells completely lacking DNA-PKcs and low levels of DNA-PKcs promoted cell accumulation in G2/M phase after irradiation and blocked progression of mitosis. Surprisingly, low levels of DNA-PKcs did not affect the repair capacity and the removal of 53BP1 or γ-H2AX foci and rejoining of DSB appeared normal. This was in strong contrast to cells completely lacking DNA-PKcs and cells treated with the DNA-PKcs inhibitor NU7441, in which DSB repair were severely compromised. This suggests that there are different mechanisms by which loss of DNA-PKcs functions can sensitize cells to ionizing radiation. Further, foci of phosphorylated DNA-PKcs (T2609 and S2056) co-localized with DSB and this was independent of the amount of DNA-PKcs but foci of DNA-PKcs was only seen in siRNA-treated cells. Our study emphasizes on the critical role of DNA-PKcs for maintaining survival after radiation exposure

  10. Origin-Dependent Inverted-Repeat Amplification: Tests of a Model for Inverted DNA Amplification.

    Directory of Open Access Journals (Sweden)

    Bonita J Brewer

    2015-12-01

    Full Text Available DNA replication errors are a major driver of evolution--from single nucleotide polymorphisms to large-scale copy number variations (CNVs. Here we test a specific replication-based model to explain the generation of interstitial, inverted triplications. While no genetic information is lost, the novel inversion junctions and increased copy number of the included sequences create the potential for adaptive phenotypes. The model--Origin-Dependent Inverted-Repeat Amplification (ODIRA-proposes that a replication error at pre-existing short, interrupted, inverted repeats in genomic sequences generates an extrachromosomal, inverted dimeric, autonomously replicating intermediate; subsequent genomic integration of the dimer yields this class of CNV without loss of distal chromosomal sequences. We used a combination of in vitro and in vivo approaches to test the feasibility of the proposed replication error and its downstream consequences on chromosome structure in the yeast Saccharomyces cerevisiae. We show that the proposed replication error-the ligation of leading and lagging nascent strands to create "closed" forks-can occur in vitro at short, interrupted inverted repeats. The removal of molecules with two closed forks results in a hairpin-capped linear duplex that we show replicates in vivo to create an inverted, dimeric plasmid that subsequently integrates into the genome by homologous recombination, creating an inverted triplication. While other models have been proposed to explain inverted triplications and their derivatives, our model can also explain the generation of human, de novo, inverted amplicons that have a 2:1 mixture of sequences from both homologues of a single parent--a feature readily explained by a plasmid intermediate that arises from one homologue and integrates into the other homologue prior to meiosis. Our tests of key features of ODIRA lend support to this mechanism and suggest further avenues of enquiry to unravel the origins

  11. Origin-Dependent Inverted-Repeat Amplification: Tests of a Model for Inverted DNA Amplification.

    Science.gov (United States)

    Brewer, Bonita J; Payen, Celia; Di Rienzi, Sara C; Higgins, Megan M; Ong, Giang; Dunham, Maitreya J; Raghuraman, M K

    2015-12-01

    DNA replication errors are a major driver of evolution--from single nucleotide polymorphisms to large-scale copy number variations (CNVs). Here we test a specific replication-based model to explain the generation of interstitial, inverted triplications. While no genetic information is lost, the novel inversion junctions and increased copy number of the included sequences create the potential for adaptive phenotypes. The model--Origin-Dependent Inverted-Repeat Amplification (ODIRA)-proposes that a replication error at pre-existing short, interrupted, inverted repeats in genomic sequences generates an extrachromosomal, inverted dimeric, autonomously replicating intermediate; subsequent genomic integration of the dimer yields this class of CNV without loss of distal chromosomal sequences. We used a combination of in vitro and in vivo approaches to test the feasibility of the proposed replication error and its downstream consequences on chromosome structure in the yeast Saccharomyces cerevisiae. We show that the proposed replication error-the ligation of leading and lagging nascent strands to create "closed" forks-can occur in vitro at short, interrupted inverted repeats. The removal of molecules with two closed forks results in a hairpin-capped linear duplex that we show replicates in vivo to create an inverted, dimeric plasmid that subsequently integrates into the genome by homologous recombination, creating an inverted triplication. While other models have been proposed to explain inverted triplications and their derivatives, our model can also explain the generation of human, de novo, inverted amplicons that have a 2:1 mixture of sequences from both homologues of a single parent--a feature readily explained by a plasmid intermediate that arises from one homologue and integrates into the other homologue prior to meiosis. Our tests of key features of ODIRA lend support to this mechanism and suggest further avenues of enquiry to unravel the origins of interstitial

  12. Intron loss from the NADH dehydrogenase subunit 4 gene of lettuce mitochondrial DNA: evidence for homologous recombination of a cDNA intermediate.

    Science.gov (United States)

    Geiss, K T; Abbas, G M; Makaroff, C A

    1994-04-01

    The mitochondrial gene coding for subunit 4 of the NADH dehydrogenase complex I (nad4) has been isolated and characterized from lettuce, Lactuca sativa. Analysis of nad4 genes in a number of plants by Southern hybridization had previously suggested that the intron content varied between species. Characterization of the lettuce gene confirms this observation. Lettuce nad4 contains two exons and one group IIA intron, whereas previously sequenced nad4 genes from turnip and wheat contain three group IIA introns. Northern analysis identified a transcript of 1600 nucleotides, which represents the mature nad4 mRNA and a primary transcript of 3200 nucleotides. Sequence analysis of lettuce and turnip nad4 cDNAs was used to confirm the intron/exon border sequences and to examine RNA editing patterns. Editing is observed at the 5' and 3' ends of the lettuce transcript, but is absent from sequences that correspond to exons two, three and the 5' end of exon four in turnip and wheat. In contrast, turnip transcripts are highly edited in this region, suggesting that homologous recombination of an edited and spliced cDNA intermediate was involved in the loss of introns two and three from an ancestral lettuce nad4 gene.

  13. Who owns what? Private ownership and the public interest in recombinant DNA technology in the 1970s.

    Science.gov (United States)

    Yi, Doogab

    2011-09-01

    This essay analyzes how academic institutions, government agencies, and the nascent biotech industry contested the legal ownership of recombinant DNA technology in the name of the public interest. It reconstructs the way a small but influential group of government officials and university research administrators introduced a new framework for the commercialization of academic research in the context of a national debate over scientific research's contributions to American economic prosperity and public health. They claimed that private ownership of inventions arising from public support would provide a powerful means to liberate biomedical discoveries for public benefit. This articulation of the causal link between private ownership and the public interest, it is argued, justified a new set of expectations about the use of research results arising from government or public support, in which commercialization became a new public obligation for academic researchers. By highlighting the broader economic and legal shifts that prompted the reconfiguration of the ownership of public knowledge in late twentieth-century American capitalism, the essay examines the threads of policy-informed legal ideas that came together to affirm private ownership of biomedical knowledge as germane to the public interest in the coming of age of biotechnology and genetic medicine.

  14. DNA Duplex Length and Salt Concentration Dependence of Enthalpy−Entropy Compensation Parameters for DNA Melting

    KAUST Repository

    Starikov, E. B.

    2009-08-20

    Systematical differential calorimetry experiments on DNA oligomers with different lengths and placed in water solutions with various added salt concentrations may, in principle, unravel important information about the structure and dynamics of the DNA and their water-counterion surrounding. With this in mind, to reinterpret the most recent results of calorimetric experiments on DNA oligomers of such a kind, the recent enthalpy-entropy compensation theory has been used. It is demonstrated that the application of the latter could enable direct estimation of thermodynamic parameters of the microphase transitions connected to the changes in DNA dynamical regimes versus the length of the biopolymers and the ionic strengths of their water solutions, and this calls for much more systematical experimental and theoretical studies in this field. © 2009 American Chemical Society.

  15. DNA-dependent protein kinase inhibits AID-induced antibody gene conversion.

    Directory of Open Access Journals (Sweden)

    Adam J L Cook

    2007-04-01

    Full Text Available Affinity maturation and class switching of antibodies requires activation-induced cytidine deaminase (AID-dependent hypermutation of Ig V(DJ rearrangements and Ig S regions, respectively, in activated B cells. AID deaminates deoxycytidine bases in Ig genes, converting them into deoxyuridines. In V(DJ regions, subsequent excision of the deaminated bases by uracil-DNA glycosylase, or by mismatch repair, leads to further point mutation or gene conversion, depending on the species. In Ig S regions, nicking at the abasic sites produced by AID and uracil-DNA glycosylases results in staggered double-strand breaks, whose repair by nonhomologous end joining mediates Ig class switching. We have tested whether nonhomologous end joining also plays a role in V(DJ hypermutation using chicken DT40 cells deficient for Ku70 or the DNA-dependent protein kinase catalytic subunit (DNA-PKcs. Inactivation of the Ku70 or DNA-PKcs genes in DT40 cells elevated the rate of AID-induced gene conversion as much as 5-fold. Furthermore, DNA-PKcs-deficiency appeared to reduce point mutation. The data provide strong evidence that double-strand DNA ends capable of recruiting the DNA-dependent protein kinase complex are important intermediates in Ig V gene conversion.

  16. The PCNA interaction protein box sequence in Rad54 is an integral part of its ATPase domain and is required for efficient DNA repair and recombination

    DEFF Research Database (Denmark)

    Burgess, Rebecca C; Sebesta, Marek; Sisakova, Alexandra

    2013-01-01

    Rad54 is an ATP-driven translocase involved in the genome maintenance pathway of homologous recombination (HR). Although its activity has been implicated in several steps of HR, its exact role(s) at each step are still not fully understood. We have identified a new interaction between Rad54...... and the replicative DNA clamp, proliferating cell nuclear antigen (PCNA). This interaction was only mildly weakened by the mutation of two key hydrophobic residues in the highly-conserved PCNA interaction motif (PIP-box) of Rad54 (Rad54-AA). Intriguingly, the rad54-AA mutant cells displayed sensitivity to DNA damage...

  17. Recombinant mouse PAP has pH-dependent ectonucleotidase activity and acts through A(1-adenosine receptors to mediate antinociception.

    Directory of Open Access Journals (Sweden)

    Nathaniel A Sowa

    Full Text Available Prostatic acid phosphatase (PAP is expressed in nociceptive neurons and functions as an ectonucleotidase. When injected intraspinally, the secretory isoforms of human and bovine PAP protein have potent and long-lasting antinociceptive effects that are dependent on A(1-adenosine receptor (A(1R activation. In this study, we purified the secretory isoform of mouse (mPAP using the baculovirus expression system to determine if recombinant mPAP also had antinociceptive properties. We found that mPAP dephosphorylated AMP, and to a much lesser extent, ADP at neutral pH (pH 7.0. In contrast, mPAP dephosphorylated all purine nucleotides (AMP, ADP, ATP at an acidic pH (pH 5.6. The transmembrane isoform of mPAP had similar pH-dependent ectonucleotidase activity. A single intraspinal injection of mPAP protein had long-lasting (three day antinociceptive properties, including antihyperalgesic and antiallodynic effects in the Complete Freund's Adjuvant (CFA inflammatory pain model. These antinociceptive effects were transiently blocked by the A(1R antagonist 8-cyclopentyl-1, 3-dipropylxanthine (CPX, suggesting mPAP dephosphorylates nucleotides to adenosine to mediate antinociception just like human and bovine PAP. Our studies indicate that PAP has species-conserved antinociceptive effects and has pH-dependent ectonucleotidase activity. The ability to metabolize nucleotides in a pH-dependent manner could be relevant to conditions like inflammation where tissue acidosis and nucleotide release occur. Lastly, our studies demonstrate that recombinant PAP protein can be used to treat chronic pain in animal models.

  18. Role of the DNA Mismatch Repair Gene MutS4 in Driving the Evolution of Mycobacterium yongonense Type I via Homologous Recombination.

    Science.gov (United States)

    Kim, Byoung-Jun; Kim, Bo-Ram; Kook, Yoon-Hoh; Kim, Bum-Joon

    2017-01-01

    We recently showed that Mycobacterium yongonense could be divided into two genotypes: Type I, in which the rpoB gene has been transferred from Mycobacterium parascrofulaceum , and Type II, in which the rpoB gene has not been transferred. Comparative genome analysis of three M. yongonense Type I, two M. yongonense Type II and M. parascrofulaceum type strains were performed in this study to gain insight into gene transfer from M. parascrofulaceum into M. yongonense Type I strains. We found two genome regions transferred from M. parascrofulaceum : one contained 3 consecutive genes, including the rpoBC operon, and the other contained 57 consecutive genes that had been transferred into M. yongonense Type I genomes via homologous recombination. Further comparison between the M. yongonense Type I and II genomes revealed that Type I, but not Type II has a distinct DNA mismatch repair gene ( MutS4 subfamily) that was possibly transferred via non-homologous recombination from other actinomycetes. We hypothesized that it could facilitate homologous recombination from the M. parascrofulaceum to the M. yongonense Type I genomes. We therefore generated recombinant Mycobacterium smegmatis containing a MutS4 operon of M. yongonense . We found that the M. tuberculosis rpoB fragment with a rifampin resistance-conferring mutation was more frequently inserted into recombinant M. smegmatis than the wild type, suggesting that MutS4 is a driving force in the gene transfer from M. parascrofulaceum to M. yongonense Type I strains via homologous recombination. In conclusion, our data indicated that MutS4 in M. yongonense Type I genomes may drive gene transfer from M. parascrofulaceum via homologous recombination, resulting in division of M. yongonense into two genotypes, Type I and II.

  19. Role of the DNA Mismatch Repair Gene MutS4 in Driving the Evolution of Mycobacterium yongonense Type I via Homologous Recombination

    Directory of Open Access Journals (Sweden)

    Byoung-Jun Kim

    2017-12-01

    Full Text Available We recently showed that Mycobacterium yongonense could be divided into two genotypes: Type I, in which the rpoB gene has been transferred from Mycobacterium parascrofulaceum, and Type II, in which the rpoB gene has not been transferred. Comparative genome analysis of three M. yongonense Type I, two M. yongonense Type II and M. parascrofulaceum type strains were performed in this study to gain insight into gene transfer from M. parascrofulaceum into M. yongonense Type I strains. We found two genome regions transferred from M. parascrofulaceum: one contained 3 consecutive genes, including the rpoBC operon, and the other contained 57 consecutive genes that had been transferred into M. yongonense Type I genomes via homologous recombination. Further comparison between the M. yongonense Type I and II genomes revealed that Type I, but not Type II has a distinct DNA mismatch repair gene (MutS4 subfamily that was possibly transferred via non-homologous recombination from other actinomycetes. We hypothesized that it could facilitate homologous recombination from the M. parascrofulaceum to the M. yongonense Type I genomes. We therefore generated recombinant Mycobacterium smegmatis containing a MutS4 operon of M. yongonense. We found that the M. tuberculosis rpoB fragment with a rifampin resistance-conferring mutation was more frequently inserted into recombinant M. smegmatis than the wild type, suggesting that MutS4 is a driving force in the gene transfer from M. parascrofulaceum to M. yongonense Type I strains via homologous recombination. In conclusion, our data indicated that MutS4 in M. yongonense Type I genomes may drive gene transfer from M. parascrofulaceum via homologous recombination, resulting in division of M. yongonense into two genotypes, Type I and II.

  20. nuvA, an Aspergillus nidulans gene involved in DNA repair and recombination, is a homologue of Saccharomyces cerevisiae RAD18 and Neurospora crassa uvs-2.

    Science.gov (United States)

    Iwanejko, L; Cotton, C; Jones, G; Tomsett, B; Strike, P

    1996-03-01

    A 40 kb genomic clone and 2.3 kb EcoRI subclone that rescued the DNA repair and recombination defects of the Aspergillus nidulans nuvA11 mutant were isolated and the subclone sequenced. The subclone hybridized to a cosmid in a chromosome-specific library confirming the assignment of nuvA to linkage group IV and indicating its closeness to bimD. Amplification by PCR clarified the relative positions of nuvA and bimD. A region identified within the subclone, encoding a C3HC4 zinc finger motif, was used as a probe to retrieve a cDNA clone. Sequencing of this clone showed that the nuvA gene has an ORF of 1329 bp with two introns of 51 bp and 60 bp. Expression of nuvA appears to be extremely low. The putative NUVA polypeptide has two zinc finger motifs, a molecular mass of 48906 Da and has 39% identity with the Neurospora crassa uvs-2 and 25% identity with the Saccharomyces cerevisiae RAD18 translation products. Although mutations in nuvA, uvs-2 and RAD18 produce similar phenotypes, only the nuvA11 mutation affects meiotic recombination. A role for nuvA in both DNA repair and genetic recombination is proposed.

  1. ATM-dependent pathways of chromatin remodelling and oxidative DNA damage responses.

    Science.gov (United States)

    Berger, N Daniel; Stanley, Fintan K T; Moore, Shaun; Goodarzi, Aaron A

    2017-10-05

    Ataxia-telangiectasia mutated (ATM) is a serine/threonine protein kinase with a master regulatory function in the DNA damage response. In this role, ATM commands a complex biochemical network that signals the presence of oxidative DNA damage, including the dangerous DNA double-strand break, and facilitates subsequent repair. Here, we review the current state of knowledge regarding ATM-dependent chromatin remodelling and epigenomic alterations that are required to maintain genomic integrity in the presence of DNA double-strand breaks and/or oxidative stress. We will focus particularly on the roles of ATM in adjusting nucleosome spacing at sites of unresolved DNA double-strand breaks within complex chromatin environments, and the impact of ATM on preserving the health of cells within the mammalian central nervous system.This article is part of the themed issue 'Chromatin modifiers and remodellers in DNA repair and signalling'. © 2017 The Author(s).

  2. Dpb11/TopBP1 plays distinct roles in DNA replication, checkpoint response and homologous recombination

    DEFF Research Database (Denmark)

    Germann, Susanne Manuela; Østergaard, Vibe Hallundbæk; Haas, Caroline

    2011-01-01

    DPB11/TopBP1 is an essential evolutionarily conserved gene involved in initiation of DNA replication and checkpoint signaling. Here, we show that Saccharomyces cerevisiae Dpb11 forms nuclear foci that localize to sites of DNA damage in G1, S and G2 phase, a recruitment that is conserved for its...... and Tel1, and of the checkpoint mediator Rad9. In a site-directed mutagenesis screen, we identify a separation-of-function mutant, dpb11-PF, that is sensitive to DSB-inducing agents yet remains proficient for DNA replication and the S-phase checkpoint at the permissive temperature. The dpb11-PF mutant...... homologue TopBP1 in Gallus gallus. Damage-induced Dpb11 foci are distinct from Sld3 replication initiation foci. Further, Dpb11 foci are dependent on the checkpoint proteins Mec3 (9-1-1 complex) and Rad24, and require the C-terminal domain of Dpb11. Dpb11 foci are independent of the checkpoint kinases Mec1...

  3. Situation-dependent repair of DNA damage in yeast

    International Nuclear Information System (INIS)

    von Borstel, R.C.; Hastings, P.J.

    1985-01-01

    The concept of channelling of lesions in DNA into defined repair systems has been used to explain many aspects of induced and spontaneous mutation. The channelling hypothesis states that lesions excluded from one repair process will be taken up by another repair process. This is a simplification. The three known modes of repair of damage induced by radiation are not equivalent modes of repair; they are, instead, different solutions to the problem of replacement of damaged molecules with new molecules which have the same informational content as those that were damaged. The mode of repair that is used is the result of the response to the situation in which the damage takes place. Thus, when the most likely mode of repair does not take place, then the situation changes with respect to the repair of the lesion; the lesion may enter the replication fork and be reparable by another route

  4. Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

    OpenAIRE

    Davidson, John F.; Fox, Richard; Harris, Dawn D.; Lyons-Abbott, Sally; Loeb, Lawrence A.

    2003-01-01

    Insertion of the T3 DNA polymerase thioredoxin binding domain (TBD) into the distantly related thermostable Taq DNA polymerase at an analogous position in the thumb domain, converts the Taq DNA polymerase from a low processive to a highly processive enzyme. Processivity is dependent on the presence of thioredoxin. The enhancement in processivity is 20–50-fold when compared with the wild-type Taq DNA polymerase or to the recombinant polymerase in the absence of thioredoxin. The recombinant Taq...

  5. Estrogen signalling and the DNA damage response in hormone dependent breast cancers

    Directory of Open Access Journals (Sweden)

    C Elizabeth Caldon

    2014-05-01

    Full Text Available Estrogen is necessary for the normal growth and development of breast tissue, but high levels of estrogen are a major risk factor for breast cancer. One mechanism by which estrogen could contribute to breast cancer is via the induction of DNA damage. This perspective discusses the mechanisms by which estrogen alters the DNA damage response (DDR and DNA repair through the regulation of key effector proteins including ATM, ATR, CHK1, BRCA1 and p53 and the feedback on estrogen receptor signalling from these proteins. We put forward the hypothesis that estrogen receptor signalling converges to suppress effective DNA repair and apoptosis in favour of proliferation. This is important in hormone-dependent breast cancer as it will affect processing of estrogen-induced DNA damage, as well as other genotoxic insults. DDR and DNA repair proteins are frequently mutated or altered in estrogen responsive breast cancer which will further change the processing of DNA damage. Finally the action of estrogen signalling on DNA damage is also relevant to the therapeutic setting as the suppression of a DNA damage response by estrogen has the potential to alter the response of cancers to anti-hormone treatment or chemotherapy that induces DNA damage.

  6. Fluorescence quenching studies of potential-dependent DNA reorientation dynamics at glassy carbon electrode surfaces.

    Science.gov (United States)

    Li, Qin; Cui, Chenchen; Higgins, Daniel A; Li, Jun

    2012-09-05

    The potential-dependent reorientation dynamics of double-stranded DNA (ds-DNA) attached to planar glassy carbon electrode (GCE) surfaces were investigated. The orientation state of surface-bound ds-DNA was followed by monitoring the fluorescence from a 6-carboxyfluorescein (FAM6) fluorophore covalently linked to the distal end of the DNA. Positive potentials (i.e., +0.2 V vs open circuit potential, OCP) caused the ds-DNA to align parallel to the electrode surface, resulting in strong dipole-electrode quenching of FAM6 fluorescence. Switching of the GCE potential to negative values (i.e., -0.2 V vs OCP) caused the ds-DNA to reorient perpendicular to the electrode surface, with a concomitant increase in FAM6 fluorescence. In addition to the very fast (submilliseconds) dynamics of the initial reorientation process, slow (0.1-0.9 s) relaxation of FAM6 fluorescence to intermediate levels was also observed after potential switching. These dynamics have not been previously described in the literature. They are too slow to be explained by double layer charging, and chronoamperometry data showed no evidence of such effects. Both the amplitude and rate of the dynamics were found to depend upon buffer concentration, and ds-DNA length, demonstrating a dependence on the double layer field. The dynamics are concluded to arise from previously undetected complexities in the mechanism of potential-dependent ds-DNA reorientation. The possible origins of these dynamics are discussed. A better understanding of these dynamics will lead to improved models for potential-dependent ds-DNA reorientation at electrode surfaces and will facilitate the development of advanced electrochemical devices for detection of target DNAs.

  7. The use of /sup 125/I recombinant DNA/sub 125/ derived human erythropoietin (R-HuEPO) as a replacement for /sup 125/I human urinary epo as tracer antigen in a radioimmunoassay for human epo

    International Nuclear Information System (INIS)

    Cotes, P.M.; Tam, R.C.; GainesDas, R.E.

    1987-01-01

    This paper represents evidence that in a radioimmunoassay for human erythropoietin, recombinant DNA derived human erythropoietin can replace highly purified human urinary erythropoietin in the preparation of radioiodinated tracer antigen

  8. DNA methylation results depend on DNA integrity – role of post mortem interval

    Directory of Open Access Journals (Sweden)

    Mathias eRhein

    2015-05-01

    Full Text Available Major questions of neurological and psychiatric mechanisms involve the brain functions on a molecular level and cannot be easily addressed due to limitations in access to tissue samples. Post mortem studies are able to partly bridge the gap between brain tissue research retrieved from animal trials and the information derived from peripheral analysis (e.g. measurements in blood cells in patients. Here, we wanted to know how fast DNA degradation is progressing under controlled conditions in order to define thresholds for tissue quality to be used in respective trials. Our focus was on the applicability of partly degraded samples for bisulfite sequencing and the determination of simple means to define cut-off values.After opening the brain cavity, we kept two consecutive pig skulls at ambient temperature (19-21°C and removed cortex tissue up to a post mortem interval (PMI of 120h. We calculated the percentage of degradation on DNA gel electrophoresis of brain DNA to estimate quality and relate this estimation spectrum to the quality of human post-mortem control samples. Functional DNA quality was investigated by bisulfite sequencing of two functionally relevant genes for either the serotonin receptor 5 (SLC6A4 or aldehyde dehydrogenase 2 (ALDH2.Testing our approach in a heterogeneous collective of human blood and brain samples, we demonstrate integrity of measurement quality below the threshold of 72h PMI.While sequencing technically worked for all timepoints irrespective of conceivable DNA degradation, there is a good correlation between variance of methylation to degradation levels documented in the gel (R2=0.4311, p=0.0392 for advancing post mortem intervals (PMI. This otherwise elusive phenomenon is an important prerequisite for the interpretation and evaluation of samples prior to in-depth processing via an affordable and easy assay to estimate identical sample quality and thereby comparable methylation measurements.

  9. Nrf2 facilitates repair of radiation induced DNA damage through homologous recombination repair pathway in a ROS independent manner in cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Jayakumar, Sundarraj; Pal, Debojyoti; Sandur, Santosh K., E-mail: sskumar@barc.gov.in

    2015-09-15

    Highlights: • Nrf2 inhibition in A549 cells led to attenuated DNA repair and radiosensitization. • Influence of Nrf2 on DNA repair is not linked to its antioxidant function. • Nrf2 influences DNA repair through homologous recombination (HR) repair pathway. • Many genes involved in HR pathway show ARE sequences in their upstream region. - Abstract: Nrf2 is a redox sensitive transcription factor that is involved in the co-ordinated transcription of genes involved in redox homeostasis. But the role of Nrf2 in DNA repair is not investigated in detail. We have employed A549 and MCF7 cells to study the role of Nrf2 on DNA repair by inhibiting Nrf2 using all-trans retinoic acid (ATRA) or by knock down approach prior to radiation exposure (4 Gy). DNA damage and repair analysis was studied by γH2AX foci formation and comet assay. Results suggested that the inhibition of Nrf2 in A549 or MCF7 cells led to significant slowdown in DNA repair as compared to respective radiation controls. The persistence of residual DNA damage even in the presence of free radical scavenger N-acetyl cysteine, suggested that the influence of Nrf2 on DNA repair was not linked to its antioxidant functions. Further, its influence on non-homologous end joining repair pathway was studied by inhibiting both Nrf2 and DNA-PK together. This led to synergistic reduction of survival fraction, indicating that Nrf2 may not be influencing the NHEJ pathway. To investigate the role of homologous recombination repair (HR) pathway, RAD51 foci formation was monitored. There was a significant reduction in the foci formation in cells treated with ATRA or shRNA against Nrf2 as compared to their respective radiation controls. Further, Nrf2 inhibition led to significant reduction in mRNA levels of RAD51. BLAST analysis was also performed on upstream regions of DNA repair genes to identify antioxidant response element and found that many repair genes that are involved in HR pathway may be regulated by Nrf2

  10. Phylogeny of Mycobacterium tuberculosis Beijing strains constructed from polymorphisms in genes involved in DNA replication, recombination and repair.

    Science.gov (United States)

    Mestre, Olga; Luo, Tao; Dos Vultos, Tiago; Kremer, Kristin; Murray, Alan; Namouchi, Amine; Jackson, Céline; Rauzier, Jean; Bifani, Pablo; Warren, Rob; Rasolofo, Voahangy; Mei, Jian; Gao, Qian; Gicquel, Brigitte

    2011-01-20

    The Beijing family is a successful group of M. tuberculosis strains, often associated with drug resistance and widely distributed throughout the world. Polymorphic genetic markers have been used to type particular M. tuberculosis strains. We recently identified a group of polymorphic DNA repair replication and recombination (3R) genes. It was shown that evolution of M. tuberculosis complex strains can be studied using 3R SNPs and a high-resolution tool for strain discrimination was developed. Here we investigated the genetic diversity and propose a phylogeny for Beijing strains by analyzing polymorphisms in 3R genes. A group of 3R genes was sequenced in a collection of Beijing strains from different geographic origins. Sequence analysis and comparison with the ones of non-Beijing strains identified several SNPs. These SNPs were used to type a larger collection of Beijing strains and allowed identification of 26 different sequence types for which a phylogeny was constructed. Phylogenetic relationships established by sequence types were in agreement with evolutionary pathways suggested by other genetic markers, such as Large Sequence Polymorphisms (LSPs). A recent Beijing genotype (Bmyc10), which included 60% of strains from distinct parts of the world, appeared to be predominant. We found SNPs in 3R genes associated with the Beijing family, which enabled discrimination of different groups and the proposal of a phylogeny. The Beijing family can be divided into different groups characterized by particular genetic polymorphisms that may reflect pathogenic features. These SNPs are new, potential genetic markers that may contribute to better understand the success of the Beijing family.

  11. Phylogeny of Mycobacterium tuberculosis Beijing strains constructed from polymorphisms in genes involved in DNA replication, recombination and repair.

    Directory of Open Access Journals (Sweden)

    Olga Mestre

    2011-01-01

    Full Text Available The Beijing family is a successful group of M. tuberculosis strains, often associated with drug resistance and widely distributed throughout the world. Polymorphic genetic markers have been used to type particular M. tuberculosis strains. We recently identified a group of polymorphic DNA repair replication and recombination (3R genes. It was shown that evolution of M. tuberculosis complex strains can be studied using 3R SNPs and a high-resolution tool for strain discrimination was developed. Here we investigated the genetic diversity and propose a phylogeny for Beijing strains by analyzing polymorphisms in 3R genes.A group of 3R genes was sequenced in a collection of Beijing strains from different geographic origins. Sequence analysis and comparison with the ones of non-Beijing strains identified several SNPs. These SNPs were used to type a larger collection of Beijing strains and allowed identification of 26 different sequence types for which a phylogeny was constructed. Phylogenetic relationships established by sequence types were in agreement with evolutionary pathways suggested by other genetic markers, such as Large Sequence Polymorphisms (LSPs. A recent Beijing genotype (Bmyc10, which included 60% of strains from distinct parts of the world, appeared to be predominant.We found SNPs in 3R genes associated with the Beijing family, which enabled discrimination of different groups and the proposal of a phylogeny. The Beijing family can be divided into different groups characterized by particular genetic polymorphisms that may reflect pathogenic features. These SNPs are new, potential genetic markers that may contribute to better understand the success of the Beijing family.

  12. Mycobacterium smegmatis SftH exemplifies a distinctive clade of superfamily II DNA-dependent ATPases with 3' to 5' translocase and helicase activities.

    Science.gov (United States)

    Yakovleva, Lyudmila; Shuman, Stewart

    2012-08-01

    Bacterial DNA helicases are nucleic acid-dependent NTPases that play important roles in DNA replication, recombination and repair. We are interested in the DNA helicases of Mycobacteria, a genus of the phylum Actinobacteria, which includes the human pathogen Mycobacterium tuberculosis and its avirulent relative Mycobacterium smegmatis. Here, we identify and characterize M. smegmatis SftH, a superfamily II helicase with a distinctive domain structure, comprising an N-terminal NTPase domain and a C-terminal DUF1998 domain (containing a putative tetracysteine metal-binding motif). We show that SftH is a monomeric DNA-dependent ATPase/dATPase that translocates 3' to 5' on single-stranded DNA and has 3' to 5' helicase activity. SftH homologs are found in bacteria representing 12 different phyla, being especially prevalent in Actinobacteria (including M. tuberculosis). SftH homologs are evident in more than 30 genera of Archaea. Among eukarya, SftH homologs are present in plants and fungi.

  13. Genome-Wide Analysis of Heteroduplex DNA in Mismatch Repair–Deficient Yeast Cells Reveals Novel Properties of Meiotic Recombination Pathways

    Science.gov (United States)

    Martini, Emmanuelle; Borde, Valérie; Legendre, Matthieu; Audic, Stéphane; Regnault, Béatrice; Soubigou, Guillaume; Dujon, Bernard; Llorente, Bertrand

    2011-01-01

    Meiotic DNA double-strand breaks (DSBs) initiate crossover (CO) recombination, which is necessary for accurate chromosome segregation, but DSBs may also repair as non-crossovers (NCOs). Multiple recombination pathways with specific intermediates are expected to lead to COs and NCOs. We revisited the mechanisms of meiotic DSB repair and the regulation of CO formation, by conducting a genome-wide analysis of strand-transfer intermediates associated with recombination events. We performed this analysis in a SK1 × S288C Saccharomyces cerevisiae hybrid lacking the mismatch repair (MMR) protein Msh2, to allow efficient detection of heteroduplex DNAs (hDNAs). First, we observed that the anti-recombinogenic activity of MMR is responsible for a 20% drop in CO number, suggesting that in MMR–proficient cells some DSBs are repaired using the sister chromatid as a template when polymorphisms are present. Second, we observed that a large fraction of NCOs were associated with trans–hDNA tracts constrained to a single chromatid. This unexpected finding is compatible with dissolution of double Holliday junctions (dHJs) during repair, and it suggests the existence of a novel control point for CO formation at the level of the dHJ intermediate, in addition to the previously described control point before the dHJ formation step. Finally, we observed that COs are associated with complex hDNA patterns, confirming that the canonical double-strand break repair model is not sufficient to explain the formation of most COs. We propose that multiple factors contribute to the complexity of recombination intermediates. These factors include repair of nicks and double-stranded gaps, template switches between non-sister and sister chromatids, and HJ branch migration. Finally, the good correlation between the strand transfer properties observed in the absence of and in the presence of Msh2 suggests that the intermediates detected in the absence of Msh2 reflect normal intermediates. PMID

  14. Genome-wide analysis of heteroduplex DNA in mismatch repair-deficient yeast cells reveals novel properties of meiotic recombination pathways.

    Directory of Open Access Journals (Sweden)

    Emmanuelle Martini

    2011-09-01

    Full Text Available Meiotic DNA double-strand breaks (DSBs initiate crossover (CO recombination, which is necessary for accurate chromosome segregation, but DSBs may also repair as non-crossovers (NCOs. Multiple recombination pathways with specific intermediates are expected to lead to COs and NCOs. We revisited the mechanisms of meiotic DSB repair and the regulation of CO formation, by conducting a genome-wide analysis of strand-transfer intermediates associated with recombination events. We performed this analysis in a SK1 × S288C Saccharomyces cerevisiae hybrid lacking the mismatch repair (MMR protein Msh2, to allow efficient detection of heteroduplex DNAs (hDNAs. First, we observed that the anti-recombinogenic activity of MMR is responsible for a 20% drop in CO number, suggesting that in MMR-proficient cells some DSBs are repaired using the sister chromatid as a template when polymorphisms are present. Second, we observed that a large fraction of NCOs were associated with trans-hDNA tracts constrained to a single chromatid. This unexpected finding is compatible with dissolution of double Holliday junctions (dHJs during repair, and it suggests the existence of a novel control point for CO formation at the level of the dHJ intermediate, in addition to the previously described control point before the dHJ formation step. Finally, we observed that COs are associated with complex hDNA patterns, confirming that the canonical double-strand break repair model is not sufficient to explain the formation of most COs. We propose that multiple factors contribute to the complexity of recombination intermediates. These factors include repair of nicks and double-stranded gaps, template switches between non-sister and sister chromatids, and HJ branch migration. Finally, the good correlation between the strand transfer properties observed in the absence of and in the presence of Msh2 suggests that the intermediates detected in the absence of Msh2 reflect normal intermediates.

  15. A prime/boost strategy by DNA/fowlpox recombinants expressing a mutant E7 protein for the immunotherapy of HPV-associated cancers.

    Science.gov (United States)

    Radaelli, Antonia; De Giuli Morghen, Carlo; Zanotto, Carlo; Pacchioni, Sole; Bissa, Massimiliano; Franconi, Rosella; Massa, Silvia; Paolini, Francesca; Muller, Antonio; Venuti, Aldo

    2012-12-01

    Development of effective therapeutic vaccines against human papilloma virus (HPV) infections remains a priority, considering the high number of new cases of cervical cancer each year by high-risk HPVs, in particular by HPV-16. Vaccines expressing the E7 oncoprotein, which is detectable in all HPV-positive pre-cancerous and cancer cells, might clear already established tumors and support the treatment of HPV-related lesions. In this study, DNA or fowlpox virus recombinants expressing the harmless variant E7GGG of the HPV-16 E7 oncoprotein (DNA(E7GGG) and FP(E7GGG)) were generated. Two immunization regimens were tested in a pre-clinical mouse model by homologous (FP/FP) or heterologous (DNA/FP) prime-boost protocols to evaluate the immune response and therapeutic efficacy of the proposed HPV-16 vaccine. Low levels of anti-E7-specific antibodies were elicited after immunization, and in vivo experiments resulted in a higher number of tumor-free mice after the heterologous immunization. These results establish a preliminary indication for therapy of HPV-related tumors by the combined use of DNA and avipox recombinants, which might represent safer immunogens than vaccinia-based vaccines. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Dependence of Immunoglobulin Class Switch Recombination in B Cells on Vesicular Release of ATP and CD73 Ectonucleotidase Activity

    Directory of Open Access Journals (Sweden)

    Francesca Schena

    2013-06-01

    Full Text Available Immunoglobulin (Ig isotype diversification by class switch recombination (CSR is an essential process for mounting a protective humoral immune response. Ig CSR deficiencies in humans can result from an intrinsic B cell defect; however, most of these deficiencies are still molecularly undefined and diagnosed as common variable immunodeficiency (CVID. Here, we show that extracellular adenosine critically contributes to CSR in human naive and IgM memory B cells. In these cells, coordinate stimulation of B cell receptor and toll-like receptors results in the release of ATP stored in Ca2+-sensitive secretory vesicles. Plasma membrane ectonucleoside triphosphate diphosphohydrolase 1 CD39 and ecto-5′-nucleotidase CD73 hydrolyze ATP to adenosine, which induces CSR in B cells in an autonomous fashion. Notably, CVID patients with impaired class-switched antibody responses are selectively deficient in CD73 expression in B cells, suggesting that CD73-dependent adenosine generation contributes to the pathogenesis of this disease.

  17. The repetitive portion of the Xenopus IgH Mu switch region mediates orientation-dependent class switch recombination.

    Science.gov (United States)

    Zhang, Zheng Z; Pannunzio, Nicholas R; Lu, Zhengfei; Hsu, Ellen; Yu, Kefei; Lieber, Michael R

    2015-10-01

    Vertebrates developed immunoglobulin heavy chain (IgH) class switch recombination (CSR) to express different IgH constant regions. Most double-strand breaks for Ig CSR occur within the repetitive portion of the switch regions located upstream of each set of constant domain exons for the Igγ, Igα or Igϵ heavy chain. Unlike mammalian switch regions, Xenopus switch regions do not have a high G-density on the non-template DNA strand. In previous studies, when Xenopus Sμ DNA was moved to the genome of mice, it is able to support substantial CSR when it is used to replace the murine Sγ1 region. Here, we tested both the 2kb repetitive portion and the 4.6 kb full-length portions of the Xenopus Sμ in both their natural (forward) orientation relative to the constant domain exons, as well as the opposite (reverse) orientation. Consistent with previous work, we find that the 4.6 kb full-length Sμ mediates similar levels of CSR in both the forward and reverse orientations. Whereas, the forward orientation of the 2kb portion can restore the majority of the CSR level of the 4.6 kb full-length Sμ, the reverse orientation poorly supports R-looping and no CSR. The forward orientation of the 2kb repetitive portion has more GG dinucleotides on the non-template strand than the reverse orientation. The correlation of R-loop formation with CSR efficiency, as demonstrated in the 2kb repetitive fragment of the Xenopus switch region, confirms a role played by R-looping in CSR that appears to be conserved through evolution. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Research and development of basic technologies for the next generation industries, 'recombinant DNA utilizing technology'. Evaluation on the research and development; Jisedai sangyo kiban gijutsu kenkyu kaihatsu 'kumikae DNA riyo gijutsu'. Kenkyu kaihatsu hyoka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-03-01

    Research, development and evaluation were performed with an objective of establishing the basic technology related to the recombinant DNA utilizing technology to create new microorganisms for processes in the chemical industry. The major achievements of the present research and development include establishment of the P450 gene manifestation system attributed from microsomes and mitochondria, and the success of the world's first simultaneous manifestation of P450 and reduction enzyme. Furthermore, the fused enzyme combining P450 and the reduction enzyme genetically was successfully manufactured ahead of the other countries, opening the way to industrializing the recombinant enzymes for use in bio-processes in the chemical industry. In creating a high-efficiency secretion recombinant bacillus subtilis stock, a bacillus subtilis host whose protease activity has been noticeably decreased was created. As an achievement of the research on the 'basic recombinant DNA technology', high-efficiency manifestation vector of medium level thermophile was created, and its usefulness was demonstrated. In addition, a host and vector system for high level thermophile was developed for the first time in the world. These achievements have opened the way to industrial utilization of the thermophilic bacteria. (NEDO)

  19. Variation in a surface-exposed region of the Mycoplasma pneumoniae P40 protein as a consequence of homologous DNA recombination between RepMP5 elements.

    Science.gov (United States)

    Spuesens, Emiel B M; van de Kreeke, Nick; Estevão, Silvia; Hoogenboezem, Theo; Sluijter, Marcel; Hartwig, Nico G; van Rossum, Annemarie M C; Vink, Cornelis

    2011-02-01

    Mycoplasma pneumoniae is a human pathogen that causes a range of respiratory tract infections. The first step in infection is adherence of the bacteria to the respiratory epithelium. This step is mediated by a specialized organelle, which contains several proteins (cytadhesins) that have an important function in adherence. Two of these cytadhesins, P40 and P90, represent the proteolytic products from a single 130 kDa protein precursor, which is encoded by the MPN142 gene. Interestingly, MPN142 contains a repetitive DNA element, termed RepMP5, of which homologues are found at seven other loci within the M. pneumoniae genome. It has been hypothesized that these RepMP5 elements, which are similar but not identical in sequence, recombine with their counterpart within MPN142 and thereby provide a source of sequence variation for this gene. As this variation may give rise to amino acid changes within P40 and P90, the recombination between RepMP5 elements may constitute the basis of antigenic variation and, possibly, immune evasion by M. pneumoniae. To investigate the sequence variation of MPN142 in relation to inter-RepMP5 recombination, we determined the sequences of all RepMP5 elements in a collection of 25 strains. The results indicate that: (i) inter-RepMP5 recombination events have occurred in seven of the strains, and (ii) putative RepMP5 recombination events involving MPN142 have induced amino acid changes in a surface-exposed part of the P40 protein in two of the strains. We conclude that recombination between RepMP5 elements is a common phenomenon that may lead to sequence variation of MPN142-encoded proteins.

  20. Human, recombinant interleukin-2 induces in vitro histamine release in a dose-dependent manner

    DEFF Research Database (Denmark)

    Nielsen, Hans Jørgen; Petersen, L J; Skov, P S

    1995-01-01

    significantly in the supernatant from cells stimulated by rIL-2 in a dose-dependent manner both in patients and volunteers. Total cell-bound histamine was 49.3 +/- 4.1 ng/ml in patients compared to 78.5 +/- 7.7 ng/ml in volunteers (p ... was significantly enhanced in cancer patients compared to volunteers (*p manner in both cancer patients and volunteers. This may in part explain the severe toxicity observed during high...

  1. Introducing improved structural properties and salt dependence into a coarse-grained model of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Snodin, Benedict E. K., E-mail: benedict.snodin@chem.ox.ac.uk; Mosayebi, Majid; Schreck, John S.; Romano, Flavio; Doye, Jonathan P. K., E-mail: jonathan.doye@chem.ox.ac.uk [Physical and Theoretical Chemistry Laboratory, Department of Chemistry, University of Oxford, South Parks Road, Oxford OX1 3QZ (United Kingdom); Randisi, Ferdinando [Life Sciences Interface Doctoral Training Center, South Parks Road, Oxford OX1 3QU (United Kingdom); Rudolf Peierls Centre for Theoretical Physics, 1 Keble Road, Oxford OX1 3NP (United Kingdom); Šulc, Petr [Center for Studies in Physics and Biology, The Rockefeller University, 1230 York Avenue, New York, New York 10065 (United States); Ouldridge, Thomas E. [Department of Mathematics, Imperial College, 180 Queen’s Gate, London SW7 2AZ (United Kingdom); Tsukanov, Roman; Nir, Eyal [Department of Chemistry and the Ilse Katz Institute for Nanoscale Science and Technology, Ben-Gurion University of the Negev, Beer Sheva (Israel); Louis, Ard A. [Rudolf Peierls Centre for Theoretical Physics, 1 Keble Road, Oxford OX1 3NP (United Kingdom)

    2015-06-21

    We introduce an extended version of oxDNA, a coarse-grained model of deoxyribonucleic acid (DNA) designed to capture the thermodynamic, structural, and mechanical properties of single- and double-stranded DNA. By including explicit major and minor grooves and by slightly modifying the coaxial stacking and backbone-backbone interactions, we improve the ability of the model to treat large (kilobase-pair) structures, such as DNA origami, which are sensitive to these geometric features. Further, we extend the model, which was previously parameterised to just one salt concentration ([Na{sup +}] = 0.5M), so that it can be used for a range of salt concentrations including those corresponding to physiological conditions. Finally, we use new experimental data to parameterise the oxDNA potential so that consecutive adenine bases stack with a different strength to consecutive thymine bases, a feature which allows a more accurate treatment of systems where the flexibility of single-stranded regions is important. We illustrate the new possibilities opened up by the updated model, oxDNA2, by presenting results from simulations of the structure of large DNA objects and by using the model to investigate some salt-dependent properties of DNA.

  2. Introducing improved structural properties and salt dependence into a coarse-grained model of DNA

    International Nuclear Information System (INIS)

    Snodin, Benedict E. K.; Mosayebi, Majid; Schreck, John S.; Romano, Flavio; Doye, Jonathan P. K.; Randisi, Ferdinando; Šulc, Petr; Ouldridge, Thomas E.; Tsukanov, Roman; Nir, Eyal; Louis, Ard A.

    2015-01-01

    We introduce an extended version of oxDNA, a coarse-grained model of deoxyribonucleic acid (DNA) designed to capture the thermodynamic, structural, and mechanical properties of single- and double-stranded DNA. By including explicit major and minor grooves and by slightly modifying the coaxial stacking and backbone-backbone interactions, we improve the ability of the model to treat large (kilobase-pair) structures, such as DNA origami, which are sensitive to these geometric features. Further, we extend the model, which was previously parameterised to just one salt concentration ([Na + ] = 0.5M), so that it can be used for a range of salt concentrations including those corresponding to physiological conditions. Finally, we use new experimental data to parameterise the oxDNA potential so that consecutive adenine bases stack with a different strength to consecutive thymine bases, a feature which allows a more accurate treatment of systems where the flexibility of single-stranded regions is important. We illustrate the new possibilities opened up by the updated model, oxDNA2, by presenting results from simulations of the structure of large DNA objects and by using the model to investigate some salt-dependent properties of DNA

  3. Structural basis of PAM-dependent target DNA recognition by the Cas9 endonuclease.

    Science.gov (United States)

    Anders, Carolin; Niewoehner, Ole; Duerst, Alessia; Jinek, Martin

    2014-09-25

    The CRISPR-associated protein Cas9 is an RNA-guided endonuclease that cleaves double-stranded DNA bearing sequences complementary to a 20-nucleotide segment in the guide RNA. Cas9 has emerged as a versatile molecular tool for genome editing and gene expression control. RNA-guided DNA recognition and cleavage strictly require the presence of a protospacer adjacent motif (PAM) in the target DNA. Here we report a crystal structure of Streptococcus pyogenes Cas9 in complex with a single-molecule guide RNA and a target DNA containing a canonical 5'-NGG-3' PAM. The structure reveals that the PAM motif resides in a base-paired DNA duplex. The non-complementary strand GG dinucleotide is read out via major-groove interactions with conserved arginine residues from the carboxy-terminal domain of Cas9. Interactions with the minor groove of the PAM duplex and the phosphodiester group at the +1 position in the target DNA strand contribute to local strand separation immediately upstream of the PAM. These observations suggest a mechanism for PAM-dependent target DNA melting and RNA-DNA hybrid formation. Furthermore, this study establishes a framework for the rational engineering of Cas9 enzymes with novel PAM specificities.

  4. Phenylbutyrate inhibits homologous recombination induced by camptothecin and methyl methanesulfonate.

    Science.gov (United States)

    Kaiser, Gitte S; Germann, Susanne M; Westergaard, Tine; Lisby, Michael

    2011-08-01

    Homologous recombination is accompanied by extensive changes to chromatin organization at the site of DNA damage. Some of these changes are mediated through acetylation/deacetylation of histones. Here, we show that recombinational repair of DNA damage induced by the anti-cancer drug camptothecin (CPT) and the alkylating agent methyl methanesulfonate (MMS) is blocked by sodium phenylbutyrate (PBA) in the budding yeast Saccharomyces cerevisiae. In particular, PBA suppresses CPT- and MMS-induced genetic recombination as well as DNA double-strand break repair during mating-type interconversion. Treatment with PBA is accompanied by a dramatic reduction in histone H4 lysine 8 acetylation. Live cell imaging of homologous recombination proteins indicates that repair of CPT-induced DNA damage is redirected to a non-recombinogenic pathway in the presence of PBA without loss in cell viability. In contrast, the suppression of MMS-induced recombination by PBA is accompanied by a dramatic loss in cell viability. Taken together, our results demonstrate that PBA inhibits DNA damage-induced homologous recombination likely by mediating changes in chromatin acetylation. Moreover, the combination of PBA with genotoxic agents can lead to different cell fates depending on the type of DNA damage inflicted. 2011 Elsevier B.V. All rights reserved.

  5. A role for the malignant brain tumour (MBT domain protein LIN-61 in DNA double-strand break repair by homologous recombination.

    Directory of Open Access Journals (Sweden)

    Nicholas M Johnson

    Full Text Available Malignant brain tumour (MBT domain proteins are transcriptional repressors that function within Polycomb complexes. Some MBT genes are tumour suppressors, but how they prevent tumourigenesis is unknown. The Caenorhabditis elegans MBT protein LIN-61 is a member of the synMuvB chromatin-remodelling proteins that control vulval development. Here we report a new role for LIN-61: it protects the genome by promoting homologous recombination (HR for the repair of DNA double-strand breaks (DSBs. lin-61 mutants manifest numerous problems associated with defective HR in germ and somatic cells but remain proficient in meiotic recombination. They are hypersensitive to ionizing radiation and interstrand crosslinks but not UV light. Using a novel reporter system that monitors repair of a defined DSB in C. elegans somatic cells, we show that LIN-61 contributes to HR. The involvement of this MBT protein in HR raises the possibility that MBT-deficient tumours may also have defective DSB repair.

  6. Spin-dependent recombination processes in wide band gap II-Mn-VI compounds

    International Nuclear Information System (INIS)

    Godlewski, M.; Yatsunenko, S.; Khachapuridze, A.; Ivanov, V.Yu.

    2004-01-01

    Mechanisms of optical detection of magnetic resonance in wide band gap II-Mn-VI diluted magnetic semiconductor (DMS) are discussed based on the results of photoluminescence (PL), PL kinetics, electron spin resonance (ESR) and optically detected magnetic resonance (ODMR) and optically detected cyclotron resonance (ODCR) investigations. Spin-dependent interactions between localized spins of Mn 2+ ions and spins/magnetic moments of free, localized or bound carriers are responsible for the observed ODMR signals. We conclude that these interactions are responsible for the observed rapid shortening of the PL decay time of 4 T 1 → 6 A 1 intra-shell emission of Mn 2+ ions and also for the observed delocalization of excitons in low dimensional structures

  7. Time-dependent inhibition of CYP3A4 by gallic acid in human liver microsomes and recombinant systems.

    Science.gov (United States)

    Pu, Qiang-Hong; Shi, Liang; Yu, Chao

    2015-03-01

    1.Gallic acid is a main polyphenol in various fruits and plants. Inhibitory characteristics of gallic acid on CYP3A4 were still unclear. The objective of this work is hence to investigate inhibitory characteristics of gallic acid on CYP3A4 using testosterone as the probe substrate in human liver microsomes (HLMs) and recombinant CYP3A4 (rCYP3A4) systems. 2.Gallic acid caused concentration-dependent loss of CYP3A4 activity with IC50 values of 615.2 μM and 669.5 μM in HLM and rCYP3A4 systems, respectively. IC50-shift experiments showed that pre-incubation with gallic acid in the absence of NADPH contributed to 12- or 14-fold reduction of IC50 in HLM and rCYP3A4 systems, respectively, supporting a time-dependent inhibition. In HLM, time-dependent inactivation variables KI and Kinact were 485.8 μM and 0.05 min(-1), respectively. 3.Compared with the presence of NADPH, pre-incubation of gallic acid in the absence of NADPH markedly increased its inhibitory effects in HLM and rCYP3A4 systems. Those results indicate that CYP3A4 inactivation by gallic acid was independent on NADPH and was mainly mediated its oxidative products. 4.In conclusion, we showed that gallic acid weakly and time-dependently inactivated CYP3A4 via its oxidative products.

  8. Immunization of Pigs by DNA Prime and Recombinant Vaccinia Virus Boost To Identify and Rank African Swine Fever Virus Immunogenic and Protective Proteins.

    Science.gov (United States)

    Jancovich, James K; Chapman, Dave; Hansen, Debra T; Robida, Mark D; Loskutov, Andrey; Craciunescu, Felicia; Borovkov, Alex; Kibler, Karen; Goatley, Lynnette; King, Katherine; Netherton, Christopher L; Taylor, Geraldine; Jacobs, Bertram; Sykes, Kathryn; Dixon, Linda K

    2018-04-15

    African swine fever virus (ASFV) causes an acute hemorrhagic fever in domestic pigs, with high socioeconomic impact. No vaccine is available, limiting options for control. Although live attenuated ASFV can induce up to 100% protection against lethal challenge, little is known of the antigens which induce this protective response. To identify additional ASFV immunogenic and potentially protective antigens, we cloned 47 viral genes in individual plasmids for gene vaccination and in recombinant vaccinia viruses. These antigens were selected to include proteins with different functions and timing of expression. Pools of up to 22 antigens were delivered by DNA prime and recombinant vaccinia virus boost to groups of pigs. Responses of immune lymphocytes from pigs to individual recombinant proteins and to ASFV were measured by interferon gamma enzyme-linked immunosorbent spot (ELISpot) assays to identify a subset of the antigens that consistently induced the highest responses. All 47 antigens were then delivered to pigs by DNA prime and recombinant vaccinia virus boost, and pigs were challenged with a lethal dose of ASFV isolate Georgia 2007/1. Although pigs developed clinical and pathological signs consistent with acute ASFV, viral genome levels were significantly reduced in blood and several lymph tissues in those pigs immunized with vectors expressing ASFV antigens compared with the levels in control pigs. IMPORTANCE The lack of a vaccine limits the options to control African swine fever. Advances have been made in the development of genetically modified live attenuated ASFV that can induce protection against challenge. However, there may be safety issues relating to the use of these in the field. There is little information about ASFV antigens that can induce a protective immune response against challenge. We carried out a large screen of 30% of ASFV antigens by delivering individual genes in different pools to pigs by DNA immunization prime and recombinant vaccinia

  9. Improvement of the Immunogenicity of Porcine Circovirus Type 2 DNA Vaccine by Recombinant ORF2 Gene and CpG Motifs.

    Science.gov (United States)

    Li, Jun; Shi, Jian-Li; Wu, Xiao-Yan; Fu, Fang; Yu, Jiang; Yuan, Xiao-Yuan; Peng, Zhe; Cong, Xiao-Yan; Xu, Shao-Jian; Sun, Wen-Bo; Cheng, Kai-Hui; Du, Yi-Jun; Wu, Jia-Qiang; Wang, Jin-Bao; Huang, Bao-Hua

    2015-06-01

    Nowadays, adjuvant is still important for boosting immunity and improving resistance in animals. In order to boost the immunity of porcine circovirus type 2 (PCV2) DNA vaccine, CpG motifs were inserted. In this study, the dose-effect was studied, and the immunity of PCV2 DNA vaccines by recombinant open reading frame 2 (ORF2) gene and CpG motifs was evaluated. Three-week-old Changbai piglets were inoculated intramuscularly with 200 μg, 400 μg, and 800 μg DNA vaccines containing 14 and 18 CpG motifs, respectively. Average gain and rectum temperature were recorded everyday during the experiments. Blood was collected from the piglets after vaccination to detect the changes of specific antibodies, interleukin-2, and immune cells every week. Tissues were collected for histopathology and polymerase chain reaction. The results indicated that compared to those of the control piglets, all concentrations of two DNA vaccines could induce PCV2-specific antibodies. A cellular immunity test showed that PCV2-specific lymphocytes proliferated the number of TH, TC, and CD3+ positive T-cells raised in the blood of DNA vaccine immune groups. There was no distinct pathological damage and viremia occurring in pigs that were inoculated with DNA vaccines, but there was some minor pathological damage in the control group. The results demonstrated that CpG motifs as an adjuvant could boost the humoral and cellular immunity of pigs to PCV2, especially in terms of cellular immunity. Comparing two DNA vaccines that were constructed, the one containing 18 CpG motifs was more effective. This is the first report that CpG motifs as an adjuvant insert to the PCV2 DNA vaccine could boost immunity.

  10. DNA-Dependent Protein Kinase As Molecular Target for Radiosensitization of Neuroblastoma Cells.

    Directory of Open Access Journals (Sweden)

    M Emmy M Dolman

    Full Text Available Tumor cells might resist therapy with ionizing radiation (IR by non-homologous end-joining (NHEJ of IR-induced double-strand breaks. One of the key players in NHEJ is DNA-dependent protein kinase (DNA-PK. The catalytic subunit of DNA-PK, i.e. DNA-PKcs, can be inhibited with the small-molecule inhibitor NU7026. In the current study, the in vitro potential of NU7026 to radiosensitize neuroblastoma cells was investigated. DNA-PKcs is encoded by the PRKDC (protein kinase, DNA-activated, catalytic polypeptide gene. We showed that PRKDC levels were enhanced in neuroblastoma patients and correlated with a more advanced tumor stage and poor prognosis, making DNA-PKcs an interesting target for radiosensitization of neuroblastoma tumors. Optimal dose finding for combination treatment with NU7026 and IR was performed using NGP cells. One hour pre-treatment with 10 μM NU7026 synergistically sensitized NGP cells to 0.63 Gy IR. Radiosensitizing effects of NU7026 increased in time, with maximum effects observed from 96 h after IR-exposure on. Combined treatment of NGP cells with 10 μM NU7026 and 0.63 Gy IR resulted in apoptosis, while no apoptotic response was observed for either of the therapies alone. Inhibition of IR-induced DNA-PK activation by NU7026 confirmed the capability of NGP cells to, at least partially, resist IR by NHEJ. NU7026 also synergistically radiosensitized other neuroblastoma cell lines, while no synergistic effect was observed for low DNA-PKcs-expressing non-cancerous fibroblasts. Results obtained for NU7026 were confirmed by PRKDC knockdown in NGP cells. Taken together, the current study shows that DNA-PKcs is a promising target for neuroblastoma radiosensitization.

  11. DNA-Dependent Protein Kinase As Molecular Target for Radiosensitization of Neuroblastoma Cells.

    Science.gov (United States)

    Dolman, M Emmy M; van der Ploeg, Ida; Koster, Jan; Bate-Eya, Laurel Tabe; Versteeg, Rogier; Caron, Huib N; Molenaar, Jan J

    2015-01-01

    Tumor cells might resist therapy with ionizing radiation (IR) by non-homologous end-joining (NHEJ) of IR-induced double-strand breaks. One of the key players in NHEJ is DNA-dependent protein kinase (DNA-PK). The catalytic subunit of DNA-PK, i.e. DNA-PKcs, can be inhibited with the small-molecule inhibitor NU7026. In the current study, the in vitro potential of NU7026 to radiosensitize neuroblastoma cells was investigated. DNA-PKcs is encoded by the PRKDC (protein kinase, DNA-activated, catalytic polypeptide) gene. We showed that PRKDC levels were enhanced in neuroblastoma patients and correlated with a more advanced tumor stage and poor prognosis, making DNA-PKcs an interesting target for radiosensitization of neuroblastoma tumors. Optimal dose finding for combination treatment with NU7026 and IR was performed using NGP cells. One hour pre-treatment with 10 μM NU7026 synergistically sensitized NGP cells to 0.63 Gy IR. Radiosensitizing effects of NU7026 increased in time, with maximum effects observed from 96 h after IR-exposure on. Combined treatment of NGP cells with 10 μM NU7026 and 0.63 Gy IR resulted in apoptosis, while no apoptotic response was observed for either of the therapies alone. Inhibition of IR-induced DNA-PK activation by NU7026 confirmed the capability of NGP cells to, at least partially, resist IR by NHEJ. NU7026 also synergistically radiosensitized other neuroblastoma cell lines, while no synergistic effect was observed for low DNA-PKcs-expressing non-cancerous fibroblasts. Results obtained for NU7026 were confirmed by PRKDC knockdown in NGP cells. Taken together, the current study shows that DNA-PKcs is a promising target for neuroblastoma radiosensitization.

  12. GANP regulates the choice of DNA repair pathway by DNA-PKcs interaction in AID-dependent IgV region diversification.

    Science.gov (United States)

    Eid, Mohammed Mansour Abbas; Maeda, Kazuhiko; Almofty, Sarah Ameen; Singh, Shailendra Kumar; Shimoda, Mayuko; Sakaguchi, Nobuo

    2014-06-15

    RNA export factor germinal center-associated nuclear protein (GANP) interacts with activation-induced cytidine deaminase (AID) and shepherds it from the cytoplasm to the nucleus and toward the IgV region loci in B cells. In this study, we demonstrate a role for GANP in the repair of AID-initiated DNA damage in chicken DT40 B cells to generate IgV region diversity by gene conversion and somatic hypermutation. GANP plays a positive role in IgV region diversification of DT40 B cells in a nonhomologous end joining-proficient state. DNA-PKcs physically interacts with GANP, and this interaction is dissociated by dsDNA breaks induced by a topoisomerase II inhibitor, etoposide, or AID overexpression. GANP affects the choice of DNA repair mechanism in B cells toward homologous recombination rather than nonhomologous end joining repair. Thus, GANP presumably plays a critical role in protection of the rearranged IgV loci by favoring homologous recombination of the DNA breaks under accelerated AID recruitment. Copyright © 2014 by The American Association of Immunologists, Inc.

  13. Polo-like kinase 1 (PLK1) and protein phosphatase 6 (PP6) regulate DNA-dependent protein kinase catalytic subunit (DNA-PKcs) phosphorylation in mitosis.

    Science.gov (United States)

    Douglas, Pauline; Ye, Ruiqiong; Trinkle-Mulcahy, Laura; Neal, Jessica A; De Wever, Veerle; Morrice, Nick A; Meek, Katheryn; Lees-Miller, Susan P

    2014-06-25

    The protein kinase activity of the DNA-PKcs (DNA-dependent protein kinase catalytic subunit) and its autophosphorylation are critical for DBS (DNA double-strand break) repair via NHEJ (non-homologous end-joining). Recent studies have shown that depletion or inactivation of DNA-PKcs kinase activity also results in mitotic defects. DNA-PKcs is autophosphorylated on Ser2056, Thr2647 and Thr2609 in mitosis and phosphorylated DNA-PKcs localize to centrosomes, mitotic spindles and the midbody. DNA-PKcs also interacts with PP6 (protein phosphatase 6), and PP6 has been shown to dephosphorylate Aurora A kinase in mitosis. Here we report that DNA-PKcs is phosphorylated on Ser3205 and Thr3950 in mitosis. Phosphorylation of Thr3950 is DNA-PK-dependent, whereas phosphorylation of Ser3205 requires PLK1 (polo-like kinase 1). Moreover, PLK1 phosphorylates DNA-PKcs on Ser3205 in vitro and interacts with DNA-PKcs in mitosis. In addition, PP6 dephosphorylates DNA-PKcs at Ser3205 in mitosis and after IR (ionizing radiation). DNA-PKcs also phosphorylates Chk2 on Thr68 in mitosis and both phosphorylation of Chk2 and autophosphorylation of DNA-PKcs in mitosis occur in the apparent absence of Ku and DNA damage. Our findings provide mechanistic insight into the roles of DNA-PKcs and PP6 in mitosis and suggest that DNA-PKcs' role in mitosis may be mechanistically distinct from its well-established role in NHEJ.

  14. A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers.

    Science.gov (United States)

    Bissa, Massimiliano; Illiano, Elena; Pacchioni, Sole; Paolini, Francesca; Zanotto, Carlo; De Giuli Morghen, Carlo; Massa, Silvia; Franconi, Rosella; Radaelli, Antonia; Venuti, Aldo

    2015-03-05

    Considering the high number of new cases of cervical cancer each year that are caused by human papilloma viruses (HPVs), the development of an effective vaccine for prevention and therapy of HPV-associated cancers, and in particular against the high-risk HPV-16 genotype, remains a priority. Vaccines expressing the E6 and E7 proteins that are detectable in all HPV-positive pre-cancerous and cancer cells might support the treatment of HPV-related lesions and clear already established tumors. In this study, DNA and fowlpox virus recombinants expressing the E6F47R mutant of the HPV-16 E6 oncoprotein were generated, and their correct expression verified by RT-PCR, Western blotting and immunofluorescence. Immunization protocols were tested in a preventive or therapeutic pre-clinical mouse model of HPV-16 tumorigenicity using heterologous (DNA/FP) or homologous (DNA/DNA and FP/FP) prime/boost regimens. The immune responses and therapeutic efficacy were evaluated by ELISA, ELISPOT assays, and challenge with TC-1* cells. In the preventive protocol, while an anti-E6-specific humoral response was just detectable, a specific CD8(+) cytotoxic T-cell response was elicited in immunized mice. After the challenge, there was a delay in cancer appearance and a significant reduction of tumor volume in the two groups of E6-immunized mice, thus confirming the pivotal role of the CD8(+) T-cell response in the control of tumor growth in the absence of E6-specific antibodies. In the therapeutic protocol, in-vivo experiments resulted in a higher number of tumor-free mice after the homologous DNA/DNA or heterologous DNA/FP immunization. These data establish a preliminary indication for the prevention and treatment of HPV-related tumors by the use of DNA and avipox constructs as safe and effective immunogens following a prime/boost strategy. The combined use of recombinants expressing both E6 and E7 proteins might improve the antitumor efficacy, and should represent an important approach to

  15. Genome-Derived Cytosolic DNA Mediates Type I Interferon-Dependent Rejection of B Cell Lymphoma Cells

    Directory of Open Access Journals (Sweden)

    Yu J. Shen

    2015-04-01

    Full Text Available The DNA damage response (DDR induces the expression of type I interferons (IFNs, but the underlying mechanisms are poorly understood. Here, we show the presence of cytosolic DNA in different mouse and human tumor cells. Treatment of cells with genotoxic agents increased the levels of cytosolic DNA in a DDR-dependent manner. Cloning of cytosolic DNA molecules from mouse lymphoma cells suggests that cytosolic DNA is derived from unique genomic loci and has the potential to form non-B DNA structures, including R-loops. Overexpression of Rnaseh1, which resolves R-loops, reduced the levels of cytosolic DNA, type I Ifn transcripts, and type I IFN-dependent rejection of lymphoma cells. Live-cell imaging showed a dynamic contact of cytosolic DNA with mitochondria, an important organelle for innate immune recognition of cytosolic nucleotides. In summary, we found that cytosolic DNA is present in many tumor cells and contributes to the immunogenicity of tumor cells.

  16. Increased mitochondrial DNA deletions and copy number in transfusion-dependent thalassemia

    Science.gov (United States)

    Calloway, Cassandra

    2016-01-01

    BACKGROUND. Iron overload is the primary cause of morbidity in transfusion-dependent thalassemia. Increase in iron causes mitochondrial dysfunction under experimental conditions, but the occurrence and significance of mitochondrial damage is not understood in patients with thalassemia. METHODS. Mitochondrial DNA (mtDNA) to nuclear DNA copy number (Mt/N) and frequency of the common 4977-bp mitochondrial deletion (ΔmtDNA4977) were quantified using a quantitative PCR assay on whole blood samples from 38 subjects with thalassemia who were receiving regular transfusions. RESULTS. Compared with healthy controls, Mt/N and ΔmtDNA4977 frequency were elevated in thalassemia (P = 0.038 and P 15 mg/g dry-weight or splenectomy, with the highest levels observed in subjects who had both risk factors (P = 0.003). Myocardial iron (MRI T2* 40/1 × 107 mtDNA, respectively (P = 0.025). Subjects with Mt/N values below the group median had significantly lower Matsuda insulin sensitivity index (5.76 ± 0.53) compared with the high Mt/N group (9.11 ± 0.95, P = 0.008). CONCLUSION. Individuals with transfusion-dependent thalassemia demonstrate age-related increase in mtDNA damage in leukocytes. These changes are markedly amplified by splenectomy and are associated with extrahepatic iron deposition. Elevated mtDNA damage in blood cells may predict the risk of iron-associated organ damage in thalassemia. FUNDING. This project was supported by Children’s Hospital & Research Center Oakland Institutional Research Award and by the National Center for Advancing Translational Sciences, NIH, through UCSF-CTSI grant UL1 TR000004. PMID:27583305

  17. Sequence Dependent Interactions Between DNA and Single-Walled Carbon Nanotubes

    Science.gov (United States)

    Roxbury, Daniel

    solution, which suggested an energy-dependent pathway. Additionally, by means of pharmacological inhibition and vector-induced gene knockout studies, the DNA-SWCNTs were shown to enter the cells via Rac1-mediated macropinocytosis.

  18. Geometry-dependent DNA-TiO2 immobilization mechanism: A spectroscopic approach

    Science.gov (United States)

    Silva-Moraes, M. O.; Garcia-Basabe, Y.; de Souza, R. F. B.; Mota, A. J.; Passos, R. R.; Galante, D.; Fonseca Filho, H. D.; Romaguera-Barcelay, Y.; Rocco, M. L. M.; Brito, W. R.

    2018-06-01

    DNA nucleotides are used as a molecular recognition system on electrodes modified to be applied in the detection of various diseases, but immobilization mechanisms, as well as, charge transfers are not satisfactorily described in the literature. An electrochemical and spectroscopic study was carried out to characterize the molecular groups involved in the direct immobilization of DNA structures on the surface of nanostructured TiO2 with the aim of evaluating the influence of the geometrical aspects. X-ray photoelectron spectroscopy at O1s and P2p core levels indicate that immobilization of DNA samples occurs through covalent (Psbnd Osbnd Ti) bonds. X-ray absorption spectra at the Ti2p edge reinforce this conclusion. A new species at 138.5 eV was reported from P2p XPS spectra analysis which plays an important role in DNA-TiO2 immobilization. The Psbnd Osbnd Ti/Osbnd Ti ratio showed that quantitatively the DNA immobilization mechanism is dependent on their geometry, becoming more efficient for plasmid ds-DNA structures than for PCR ds-DNA structures. The analysis of photoabsorption spectra at C1s edge revealed that the molecular groups that participate in the C1s → LUMO electronic transitions have different pathways in the charge transfer processes at the DNA-TiO2 interface. Our results may contribute to additional studies of immobilization mechanisms understanding the influence of the geometry of different DNA molecules on nanostructured semiconductor and possible impact to the charge transfer processes with application in biosensors or aptamers.

  19. Calcium dependent formation of tubular assemblies by recombinant S-layer proteins in vivo and in vitro

    Science.gov (United States)

    Korkmaz, Nuriye; Ostermann, Kai; Rödel, Gerhard

    2011-03-01

    Surface layer proteins have the appealing property to self-assemble in nanosized arrays in solution and on solid substrates. In this work, we characterize the formation of assembly structures of the recombinant surface layer protein SbsC of Geobacillus stearothermophilus ATTC 12980, which was tagged with enhanced green fluorescent protein and expressed in the yeast Saccharomyces cerevisiae. The tubular structures formed by the protein in vivo are retained upon bursting the cells by osmotic shock; however, their average length is decreased. During dialysis, monomers obtained by treatment with chaotropic chemicals recrystallize again to form tube-like structures. This process is strictly dependent on calcium (Ca2 + ) ions, with an optimal concentration of 10 mM. Further increase of the Ca2 + concentration results in multiple non-productive nucleation points. We further show that the lengths of the S-layer assemblies increase with time and can be controlled by pH. After 48 h, the average length at pH 9.0 is 4.13 µm compared to 2.69 µm at pH 5.5. Successful chemical deposition of platinum indicates the potential of recrystallized mSbsC-eGFP structures for nanobiotechnological applications.

  20. Characterization of the neutralization determinants of equine arteritis virus using recombinant chimeric viruses and site-specific mutagenesis of an infectious cDNA clone

    International Nuclear Information System (INIS)

    Balasuriya, Udeni B.R.; Dobbe, Jessika C.; Heidner, Hans W.; Smalley, Victoria L.; Navarrette, Andrea; Snijder, Eric J.; MacLachlan, N. James

    2004-01-01

    We have used an infectious cDNA clone of equine arteritis virus (EAV) and reverse genetics technology to further characterize the neutralization determinants in the GP5 envelope glycoprotein of the virus. We generated a panel of 20 recombinant viruses, including 10 chimeric viruses that each contained the ORF5 (which encodes GP5) of different laboratory, field, and vaccine strains of EAV, a chimeric virus containing the N-terminal ectodomain of GP5 of a European strain of porcine reproductive and respiratory syndrome virus, and 9 mutant viruses with site-specific substitutions in their GP5 proteins. The neutralization phenotype of each recombinant chimeric/mutant strain of EAV was determined with EAV-specific monoclonal antibodies and EAV strain-specific polyclonal equine antisera and compared to that of their parental viruses from which the substituted ORF5 was derived. The data unequivocally confirm that the GP5 ectodomain contains critical determinants of EAV neutralization. Furthermore, individual neutralization sites are conformationally interactive, and the interaction of GP5 with the unglycosylated membrane protein M is likely critical to expression of individual epitopes in neutralizing conformation. Substitution of individual amino acids within the GP5 ectodomain usually resulted in differences in neutralization phenotype of the recombinant viruses, analogous to differences in the neutralization phenotype of field strains of EAV and variants generated during persistent infection of EAV carrier stallions

  1. Germline Mutations in PALB2, BRCA1, and RAD51C, Which Regulate DNA Recombination Repair, in Patients with Gastric Cancer

    Science.gov (United States)

    Sahasrabudhe, Ruta; Lott, Paul; Bohorquez, Mabel; Toal, Ted; Estrada, Ana P.; Suarez, John J.; Brea-Fernández, Alejandro; Cameselle-Teijeiro, José; Pinto, Carla; Ramos, Irma; Mantilla, Alejandra; Prieto, Rodrigo; Corvalan, Alejandro; Norero, Enrique; Alvarez, Carolina; Tapia, Teresa; Carvallo, Pilar; Gonzalez, Luz M.; Cock-Rada, Alicia; Solano, Angela; Neffa, Florencia; Valle, Adriana Della; Yau, Chris; Soares, Gabriela; Borowsky, Alexander; Hu, Nan; He, Li-Ji; Han, Xiao-You; Taylor, Philip R.; Goldstein, Alisa M.; Torres, Javier; Echeverry, Magdalena; Ruiz-Ponte, Clara; Teixeira, Manuel R.; Carvajal Carmona, Luis G.

    2016-01-01

    Up to 10% of cases of gastric cancer are familial, but so far, only mutations in CDH1 have been associated with gastric cancer risk. To identify genetic variants that affect risk for gastric cancer, we collected blood samples from 28 patients with hereditary diffuse gastric cancer (HDGC) not associated with mutations in CDH1 and performed whole-exome sequence analysis. We then analyzed sequences of candidate genes in 333 independent HDGC and non-HDGC cases. We identified 11 cases with mutations in PALB2, BRCA1, or RAD51C genes, which regulate homologous DNA recombination. We found these mutations in 2 of 31 patients with HDGC (6.5%) and 9 of 331 patients with sporadic gastric cancer (2.8%). Most of these mutations had been previously associated with other types of tumors and partially co-segregated with gastric cancer in our study. Tumors that developed in patients with these mutations had a mutation signature associated with somatic homologous recombination deficiency. Our findings indicate that defects in homologous recombination increase risk for gastric cancer. PMID:28024868

  2. Delineating species with DNA barcodes: a case of taxon dependent method performance in moths.

    Directory of Open Access Journals (Sweden)

    Mari Kekkonen

    Full Text Available The accelerating loss of biodiversity has created a need for more effective ways to discover species. Novel algorithmic approaches for analyzing sequence data combined with rapidly expanding DNA barcode libraries provide a potential solution. While several analytical methods are available for the delineation of operational taxonomic units (OTUs, few studies have compared their performance. This study compares the performance of one morphology-based and four DNA-based (BIN, parsimony networks, ABGD, GMYC methods on two groups of gelechioid moths. It examines 92 species of Finnish Gelechiinae and 103 species of Australian Elachistinae which were delineated by traditional taxonomy. The results reveal a striking difference in performance between the two taxa with all four DNA-based methods. OTU counts in the Elachistinae showed a wider range and a relatively low (ca. 65% OTU match with reference species while OTU counts were more congruent and performance was higher (ca. 90% in the Gelechiinae. Performance rose when only monophyletic species were compared, but the taxon-dependence remained. None of the DNA-based methods produced a correct match with non-monophyletic species, but singletons were handled well. A simulated test of morphospecies-grouping performed very poorly in revealing taxon diversity in these small, dull-colored moths. Despite the strong performance of analyses based on DNA barcodes, species delineated using single-locus mtDNA data are best viewed as OTUs that require validation by subsequent integrative taxonomic work.

  3. DNA-dependent protein kinase participates in the radiation activation of NF-kB

    International Nuclear Information System (INIS)

    Rosenzweig, Kenneth E.; Youmell, Matthew B.; Price, Brendan D.

    1997-01-01

    The NF-kB transcription factor is maintained in an inactive state by binding to the lkBa inhibitory protein. Activation requires phosphorylation and degradation of lkBa, releasing active NF-kB. NF-kB can be activated by cytokines, antigens, free radicals and X-ray irradiation. The protein kinase responsible for phosphorylation of lkBa in vivo has not been fully characterized. Here, we have examined the role of the DNA-dependent protein kinases (DNA-PK) in the radiation-activation of NF-kB. Wortmannin is an inhibitor of DNA-PK and related kinases. Exposure of SW480 cells to wortmannin inhibited the radioactivation of NF-kB DNA-binding. Analysis of lkBa levels by western blotting indicated that wortmannin blocked the radiation induced degradation of lkBa. In in vitro experiments, purified DNA-PK was able to efficiently phosphorylate lkBa, and this phosphorylation was inhibited by wortmannin. In contrast, the induction of NF-kB activity by TNFa was unaffected by wortmannin. The results suggest that DNA-PK may phosphorylate lkBa following irradiation, leading to degradation of lkBa and the release of active NF-kB. The inability of wortmannin to block TNFa activation of NF-kB indicates there may be more than one pathway for the activation of NF-kB

  4. The recombination correction and the dependence of the response of plane parallel chambers on the polarizing voltage in pulsed electron and photon beams

    International Nuclear Information System (INIS)

    Roos, M.; Derikum, K.

    2000-01-01

    Based on an experimental investigation of the recombination effect in plane parallel chambers, a relation is deduced that allows the correction to be calculated from the electrode spacing and from the dose per pulse. It is shown that the uncertainties caused by the application of the Boag formula for volume recombination (recommended in the International Code of Practice TRS-381) amount to not more than about 0.1% for conventional beams. Calculated recombinations are compared with experimental results concerning the dependence of the response of various commercial plane parallel chambers on the polarizing voltage. Since it cannot be excluded that particular chambers collect a non-negligible amount of charge from regions outside the designated collecting volume or that the effective polarizing voltage is reduced by poor contacts, it seems advisable to experimentally check the chambers before use and before application of the analytical relations. (author)

  5. Spin-polarization dependent carrier recombination dynamics and spin relaxation mechanism in asymmetrically doped (110) n-GaAs quantum wells

    Science.gov (United States)

    Teng, Lihua; Jiang, Tianran; Wang, Xia; Lai, Tianshu

    2018-05-01

    Carrier recombination and electron spin relaxation dynamics in asymmetric n-doped (110) GaAs/AlGaAs quantum wells are investigated with time-resolved pump-probe spectroscopy. The experiment results reveal that the measured carrier recombination time depends strongly on the polarization of pump pulse. With the same pump photon flux densities, the recombination time of spin-polarized carriers is always longer than that of the spin-balanced carriers except at low pump photon flux densities, this anomaly originates from the polarization-sensitive nonlinear absorption effect. Differing from the traditional views, in the low carrier density regime, the D'yakonov-Perel' (DP) mechanism can be more important than the Bir-Aronov-Pikus (BAP) mechanism, since the DP mechanism takes effect, the spin relaxation time in (110) GaAs QWs is shortened obviously via asymmetric doping.

  6. DNA apoptosis and stability in B-cell chronic lymphoid leukaemia: implication of the DNA double-strand breaks repair system by non homologous recombination

    International Nuclear Information System (INIS)

    Deriano, L.

    2005-01-01

    After an introduction presenting the diagnosis and treatment of chronic lymphoid leukaemia, its molecular and genetic characteristics, and its cellular origin and clonal evolution, this research thesis describes the apoptosis (definition and characteristics, cancer and chemotherapy, apoptotic ways induced by gamma irradiation), the genotoxic stresses, the different repair mechanisms for different damages, and the DNA repair processes. It reports how human chronic lymphocytic leukaemia B cells can escape DNA damage-induced apoptosis through the non-homologous end-joining DNA repair pathway, and presents non-homologous end-joining DNA repair as a potent mutagenic process in human chronic lymphocytic leukaemia B cells

  7. ATP-dependent partitioning of the DNA template into supercoiled domains by Escherichia coli UvrAB

    International Nuclear Information System (INIS)

    Koo, Hyeon-Sook; Liu, L.F.; Claassen, L.; Grossman, L.

    1991-01-01

    The helicase action of the Escherichia coli UvrAB complex on a covalently closed circular DNA template was monitored using bacterial DNA topoisomerase I, which specifically removes negative supercoils. In the presence of E. coli DNA topoisomerase I and ATP, the UvrAB complex gradually introduced positive supercoils into the input relaxed plasmid DNA template. Positive supercoils were not produced when E. coli DNA topoisomerase I was replaced by eukaryotic DNA topoisomerase I or when both E. coli and eukaryotic DNA topoisomerases I were added simultaneously. These results suggest that like other DNA helix-tracking processes, the ATP-dependent action of the UvrAM complex on duplex DNA simultaneously generates both positive and negative supercoils, which are not constrained by protein binding but are torsionally strained. The supercoiling activity of UvrAB on UV-damaged DNA was also studied using UV-damaged plasmid DNA and a mutant UvrA protein that lacks the 40 C-terminal amino acids and is defective in preferential binding to UV-damaged DNA. UvrAB was found to preferentially supercoil the UV-damaged DNA template, whereas the mutant protein supercoiled UV-damaged and undamaged DNA with equal efficiency. The authors results therefore suggest that the DNA helix-tracking activity of UvrAB may be involved in searching and/or prepriming the damaged DNA for UvrC incision. A possible role of supercoiled domains in the incision process is discussed

  8. pH-dependence of the optical bio-sensor based on DNA-carbon nanotube

    International Nuclear Information System (INIS)

    Vu Thuy Huong; Quach Kha Quang; Tran Thanh Thuy; Phan Duc Anh; Ngo Van Thanh; Nguyen Ai Viet

    2010-01-01

    In 2006, Daniel A. Heller et al. [1] demonstrated that carbon nanotubes (CNNTs) wrapped with DNA can be placed inside living cells and detect trace amounts of harmful contaminants using near infrared light. This discovery could lead to new types of optical sensors and biomarkers at the sub cellular level. The working principle of this optical bio-sensor from DNA and CNNTs can be explained by a simple theoretical model which was introduced in [3]. In this paper, the pH-dependence of DNA and the pH-dependence of solution around CNNTs are shown by using data analysis method. By substituting them into the same model, the pH-dependence of DNA-wrapped CNNTs was elicited in this paper. The range of parameters for workable conditions of this bio-sensor was indicated that the solution should have pH from 6 to 9 and the concentration of ions should be more than a critical value. These results are according to the experimental data and the deduction about pH and salt concentration in solution. They are very useful as using such a new bio-sensor like this in living environment. (author)

  9. Identification and verification of hybridoma-derived monoclonal antibody variable region sequences using recombinant DNA technology and mass spectrometry

    Science.gov (United States)

    Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibo...

  10. Cloning of human and mouse genes homologous to RAD52, a yeast gene involved in DNA repair and recombination.

    NARCIS (Netherlands)

    D.F.R. Muris; O.Y. Bezzubova (Olga); J-M. Buerstedde; K. Vreeken; A.S. Balajee; C.J. Osgood; C. Troelstra (Christine); J.H.J. Hoeijmakers (Jan); K. Ostermann; H. Schmidt (Henning); A.T. Natarajan; J.C.J. Eeken; P.H.M. Lohmann (Paul); A. Pastink (Albert)

    1994-01-01

    textabstractThe RAD52 gene of Saccharomyces cerevisiae is required for recombinational repair of double-strand breaks. Using degenerate oligonucleotides based on conserved amino acid sequences of RAD52 and rad22, its counterpart from Schizosaccharomyces pombe, RAD52 homologs from man and mouse were

  11. Docetaxel, Carboplatin, and Rucaparib Camsylate in Treating Patients With Metastatic Castration Resistant Prostate Cancer With Homologous Recombination DNA Repair Deficiency

    Science.gov (United States)

    2018-02-20

    ATM Gene Mutation; BRCA1 Gene Mutation; BRCA2 Gene Mutation; Castration Levels of Testosterone; Castration-Resistant Prostate Carcinoma; Homologous Recombination Deficiency; Prostate Carcinoma Metastatic in the Bone; PSA Level Greater Than or Equal to Two; PSA Progression; Stage IV Prostate Adenocarcinoma AJCC v7

  12. Small serine recombination systems ParA-MRS and CinH-RS2 perform precise excision of plastid DNA

    Science.gov (United States)

    Selectable marker genes (SMGs) are necessary for selection of transgenic plants. However, once stable transformants have been identified, the marker gene is no longer needed. In this study, we demonstrate the use of the small serine recombination systems, ParA-MRS and CinH-RS2, to precisely excise ...

  13. The Bipolar Filaments Formed by Herpes Simplex Virus Type 1 SSB/Recombination Protein (ICP8) Suggest a Mechanism for DNA Annealing

    Energy Technology Data Exchange (ETDEWEB)

    Makhov, A.M.; Simon, M.; Sen, A.; Yu, X.; Griffith, J. D.; Egelman, E. H.

    2009-02-20

    Herpes simplex virus type 1 encodes a multifunctional protein, ICP8, which serves both as a single-strand binding protein and as a recombinase, catalyzing reactions involved in replication and recombination of the viral genome. In the presence of divalent ions and at low temperature, previous electron microscopic studies showed that ICP8 will form long left-handed helical filaments. Here, electron microscopic image reconstruction reveals that the filaments are bipolar, with an asymmetric unit containing two subunits of ICP8 that constitute a symmetrical dimer. This organization of the filament has been confirmed using scanning transmission electron microscopy. The pitch of the filaments is {approx} 250 {angstrom}, with {approx} 6.2 dimers per turn. Docking of a crystal structure of ICP8 into the reconstructed filament shows that the C-terminal domain of ICP8, attached to the body of the subunit by a flexible linker containing {approx} 10 residues, is packed into a pocket in the body of a neighboring subunit in the crystal in a similar manner as in the filament. However, the interactions between the large N-terminal domains are quite different in the filament from that observed in the crystal. A previously proposed model for ICP8 binding single-stranded DNA (ssDNA), based upon the crystal structure, leads to a model for a continuous strand of ssDNA near the filament axis. The bipolar nature of the ICP8 filaments means that a second strand of ssDNA would be running through this filament in the opposite orientation, and this provides a potential mechanism for how ICP8 anneals complementary ssDNA into double-stranded DNA, where each strand runs in opposite directions.

  14. Stimulation of NADH-dependent microsomal DNA strand cleavage by rifamycin SV.

    Science.gov (United States)

    Kukiełka, E; Cederbaum, A I

    1995-04-15

    Rifamycin SV is an antibiotic anti-bacterial agent used in the treatment of tuberculosis. This drug can autoxidize, especially in the presence of metals, and generate reactive oxygen species. A previous study indicated that rifamycin SV can increase NADH-dependent microsomal production of reactive oxygen species. The current study evaluated the ability of rifamycin SV to interact with iron and increase microsomal production of hydroxyl radical, as detected by conversion of supercoiled plasmid DNA into the relaxed open circular state. The plasmid used was pBluescript II KS(-), and the forms of DNA were separated by agarose-gel electrophoresis. Incubation of rat liver microsomes with plasmid plus NADH plus ferric-ATP caused DNA strand cleavage. The addition of rifamycin SV produced a time- and concentration-dependent increase in DNA-strand cleavage. No stimulation by rifamycin SV occurred in the absence of microsomes, NADH or ferric-ATP. Stimulation occurred with other ferric complexes besides ferric-ATP, e.g. ferric-histidine, ferric-citrate, ferric-EDTA, and ferric-(NH4)2SO4. Rifamycin SV did not significantly increase the high rates of DNA strand cleavage found with NADPH as the microsomal reductant. The stimulation of NADH-dependent microsomal DNA strand cleavage was completely blocked by catalase, superoxide dismutase, GSH and a variety of hydroxyl-radical-scavenging agents, but not by anti-oxidants that prevent microsomal lipid peroxidation. Redox cycling agents, such as menadione and paraquat, in contrast with rifamycin SV, stimulated the NADPH-dependent reaction; menadione and rifamycin SV were superior to paraquat in stimulating the NADH-dependent reaction. These results indicate that rifamycin SV can, in the presence of an iron catalyst, increase microsomal production of reactive oxygen species which can cause DNA-strand cleavage. In contrast with other redox cycling agents, the stimulation by rifamycin SV is more pronounced with NADH than with NADPH as the

  15. Recombinant DNA specifying the human amyloid. beta. precursor protein (ABPP) encodes a 95-kDa polypeptide

    Energy Technology Data Exchange (ETDEWEB)

    Mita, S; Sadlock, J; Herbert, J; Schon, E A

    1988-10-11

    Although the ABPP gene give rise to multiple mRNAs, the primary translation product of this gene is unknown. The longest published cDNA sequences predict a 770-aa polypeptide of 87 kDa. However, in immunoblots, ABPP migrated as a single species of >92 kDa in rat brain, and in human, as a species of 95-100 kDa in non-membrane bound form, as multiple species of 110-135 kDa in membrane-associated form and as a 130-kDa species in fibroblasts. The sizes of these larger species relative to the MW of ABPP predicted from the cDNA sequences have been attributed to postranslational modification. However, the authors have isolated a cDNA (lambdaHAP2) from a human fetal muscle lambdagt11 cDNA library encoding an 843-aa polypeptide with a deduced MW of 94,642. This cDNA contains both exons encoding an 843-aa polypeptide with a deduced MW of 94.642. This cDNA contains both exons encoding the protease inhibitor domains. Primer extension analysis indicates that the 5' terminus of this cDNA is 14 nt from a transcriptional start site. This cDNA, encoding the longest ABPP described to date, may explain some of the observations on the sizes of tissue-derived ABPP.

  16. Opposing roles of RNF8/RNF168 and deubiquitinating enzymes in ubiquitination-dependent DNA double-strand break response signaling and DNA-repair pathway choice

    International Nuclear Information System (INIS)

    Nakada, Shinichiro

    2016-01-01

    The E3 ubiquitin ligases ring finger protein (RNF) 8 and RNF168 transduce the DNA double-strand break (DSB) response (DDR) signal by ubiquitinating DSB sites. The depletion of RNF8 or RNF168 suppresses the accumulation of DNA-repair regulating factors such as 53BP1 and RAP80 at DSB sites, suggesting roles for RNF8- and RNF168-mediated ubiquitination in DSB repair. This mini-review provides a brief overview of the RNF8- and RNF168-dependent DDR-signaling and DNA-repair pathways. The choice of DNA-repair pathway when RNF8- and RNF168-mediated ubiquitination-dependent DDR signaling is negatively regulated by deubiquitinating enzymes (DUBs) is reviewed to clarify how the opposing roles of RNF8/RNF168 and DUBs regulate ubiquitination-dependent DDR signaling and the choice of DNA-repair pathway

  17. Establishment of human sperm-specific voltage-dependent anion channel 3 recombinant vector for the production of a male contraceptive vaccine

    Directory of Open Access Journals (Sweden)

    Asmarinah Asmarinah

    2012-05-01

    Full Text Available Background: The aim of this study was to construct a recombinant vector of human sperm specific VDAC3 gene for production of VDAC3 antibody, which is potential as male contraception vaccine.Methods: Target fragment sequence of VDAC3 gene was obtained through amplification of human sperm VDAC3 cDNA with primers covering exon 5 to exon 8. Its PCR product in size of 435 bp was cloned to the pET101/D-TOPO expression vector (5753 bp. E. coli bacteria were transformed with this vector. Cloning of VDAC3 fragment gene to the vector was confirmed by the using of XbaI restriction enzyme and PCR colony method with primers covering exons 5-8 of the human VDAC3 gene.Results: Alignment analysis of amplified fragment covering exon 5 to exon 8 of VDAC3 gene showed 94% homology to human VDAC3 gene from databank. After cloning to the expression vector and transformation to E. coli competent cells, twelve colonies could grow in culture media. Gel electrophoresis of sliced VDAC3 recombinant vector showed a single band in the size of 6181 bp in 8 colonies. After application of PCR colony and amplicon sequencing, the result showed a single band in the size of 435 bp and fragment sequence with 94% identity to human VDAC3 gene.Conclusion: The construction of human sperm specific VDAC3 gene recombinant vector was established in this study. In the future, this recombinant vector will be used to produce VDAC3 antibody for the development of a male contraception vaccine. (Med J Indones. 2012;21:61-5Keywords: Contraception, recombinant vector, sperm, VDAC3

  18. Rosa26-GFP direct repeat (RaDR-GFP mice reveal tissue- and age-dependence of homologous recombination in mammals in vivo.

    Directory of Open Access Journals (Sweden)

    Michelle R Sukup-Jackson

    2014-06-01

    Full Text Available Homologous recombination (HR is critical for the repair of double strand breaks and broken replication forks. Although HR is mostly error free, inherent or environmental conditions that either suppress or induce HR cause genomic instability. Despite its importance in carcinogenesis, due to limitations in our ability to detect HR in vivo, little is known about HR in mammalian tissues. Here, we describe a mouse model in which a direct repeat HR substrate is targeted to the ubiquitously expressed Rosa26 locus. In the Rosa26 Direct Repeat-GFP (RaDR-GFP mice, HR between two truncated EGFP expression cassettes can yield a fluorescent signal. In-house image analysis software provides a rapid method for quantifying recombination events within intact tissues, and the frequency of recombinant cells can be evaluated by flow cytometry. A comparison among 11 tissues shows that the frequency of recombinant cells varies by more than two orders of magnitude among tissues, wherein HR in the brain is the lowest. Additionally, de novo recombination events accumulate with age in the colon, showing that this mouse model can be used to study the impact of chronic exposures on genomic stability. Exposure to N-methyl-N-nitrosourea, an alkylating agent similar to the cancer chemotherapeutic temozolomide, shows that the colon, liver and pancreas are susceptible to DNA damage-induced HR. Finally, histological analysis of the underlying cell types reveals that pancreatic acinar cells and liver hepatocytes undergo HR and also that HR can be specifically detected in colonic somatic stem cells. Taken together, the RaDR-GFP mouse model provides new understanding of how tissue and age impact susceptibility to HR, and enables future studies of genetic, environmental and physiological factors that modulate HR in mammals.

  19. Regulation of homologous recombination in eukaryotes

    OpenAIRE

    Heyer, Wolf-Dietrich; Ehmsen, Kirk T.; Liu, Jie

    2010-01-01

    Homologous recombination is required for accurate chromosome segregation during the first meiotic division and constitutes a key repair and tolerance pathway for complex DNA damage including DNA double-stranded breaks, interstrand crosslinks, and DNA gaps. In addition, recombination and replication are inextricably linked, as recombination recovers stalled and broken replication forks enabling the evolution of larger genomes/replicons. Defects in recombination lead to genomic instability and ...

  20. Set2 Methyltransferase Facilitates DNA Replication and Promotes Genotoxic Stress Responses through MBF-Dependent Transcription.

    Science.gov (United States)

    Pai, Chen-Chun; Kishkevich, Anastasiya; Deegan, Rachel S; Keszthelyi, Andrea; Folkes, Lisa; Kearsey, Stephen E; De León, Nagore; Soriano, Ignacio; de Bruin, Robertus Antonius Maria; Carr, Antony M; Humphrey, Timothy C

    2017-09-12

    Chromatin modification through histone H3 lysine 36 methylation by the SETD2 tumor suppressor plays a key role in maintaining genome stability. Here, we describe a role for Set2-dependent H3K36 methylation in facilitating DNA replication and the transcriptional responses to both replication stress and DNA damage through promoting MluI cell-cycle box (MCB) binding factor (MBF)-complex-dependent transcription in fission yeast. Set2 loss leads to reduced MBF-dependent ribonucleotide reductase (RNR) expression, reduced deoxyribonucleoside triphosphate (dNTP) synthesis, altered replication origin firing, and a checkpoint-dependent S-phase delay. Accordingly, prolonged S phase in the absence of Set2 is suppressed by increasing dNTP synthesis. Furthermore, H3K36 is di- and tri-methylated at these MBF gene promoters, and Set2 loss leads to reduced MBF binding and transcription in response to genotoxic stress. Together, these findings provide new insights into how H3K36 methylation facilitates DNA replication and promotes genotoxic stress responses in fission yeast. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Set2 Methyltransferase Facilitates DNA Replication and Promotes Genotoxic Stress Responses through MBF-Dependent Transcription

    Directory of Open Access Journals (Sweden)

    Chen-Chun Pai

    2017-09-01

    Full Text Available Chromatin modification through histone H3 lysine 36 methylation by the SETD2 tumor suppressor plays a key role in maintaining genome stability. Here, we describe a role for Set2-dependent H3K36 methylation in facilitating DNA replication and the transcriptional responses to both replication stress and DNA damage through promoting MluI cell-cycle box (MCB binding factor (MBF-complex-dependent transcription in fission yeast. Set2 loss leads to reduced MBF-dependent ribonucleotide reductase (RNR expression, reduced deoxyribonucleoside triphosphate (dNTP synthesis, altered replication origin firing, and a checkpoint-dependent S-phase delay. Accordingly, prolonged S phase in the absence of Set2 is suppressed by increasing dNTP synthesis. Furthermore, H3K36 is di- and tri-methylated at these MBF gene promoters, and Set2 loss leads to reduced MBF binding and transcription in response to genotoxic stress. Together, these findings provide new insights into how H3K36 methylation facilitates DNA replication and promotes genotoxic stress responses in fission yeast.

  2. Cell biology of mitotic recombination

    DEFF Research Database (Denmark)

    Lisby, Michael; Rothstein, Rodney

    2015-01-01

    Homologous recombination provides high-fidelity DNA repair throughout all domains of life. Live cell fluorescence microscopy offers the opportunity to image individual recombination events in real time providing insight into the in vivo biochemistry of the involved proteins and DNA molecules as w...

  3. Characterization of little skate (Leucoraja erinacea) recombinant transthyretin: Zinc-dependent 3,3',5-triiodo-l-thyronine binding.

    Science.gov (United States)

    Suzuki, Shunsuke; Kasai, Kentaro; Yamauchi, Kiyoshi

    2015-01-01

    Transthyretin (TTR) diverged from an ancestral 5-hydroxyisourate hydrolase (HIUHase) by gene duplication at some early stage of chordate evolution. To clarify how TTR had participated in the thyroid system as an extracellular thyroid hormone (TH) binding protein, TH binding properties of recombinant little skate Leucoraja erinacea TTR was investigated. At the amino acid level, skate TTR showed 37-46% identities with the other vertebrate TTRs. Because the skate TTR had a unique histidine-rich segment in the N-terminal region, it could be purified by Ni-affinity chromatography. The skate TTR was a 46-kDa homotetramer of 14.5kDa subunits, and had one order of magnitude higher affinity for 3,3',5-triiodo-l-thyronine (T3) and some halogenated phenols than for l-thyroxine. However, the skate TTR had no HIUHase activity. Ethylenediaminetetraacetic acid (EDTA) treatment inhibited [(125)I]T3 binding activity whereas the addition of Zn(2+) to the EDTA-treated TTR recovered [(125)I]T3 binding activity in a Zn(2+) concentration-dependent manner. Scatchard analysis revealed the presence of two classes of binding site for T3, with dissociation constants of 0.24 and 17nM. However, the high-affinity sites were completely abolished with 1mM EDTA, whereas the remaining low-affinity sites decreased binding capacity. The number of zinc per TTR was quantified to be 4.5-6.3. Our results suggest that skate TTR has tight Zn(2+)-binding sites, which are essential for T3 binding to at least the high-affinity sites. Zn(2+) binding to the N-terminal histidine-rich segment may play an important role in acquisition or reinforcement of TH binding ability during early evolution of TTR. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. STING-Dependent Cytosolic DNA Sensing Promotes Radiation-Induced Type I Interferon-Dependent Antitumor Immunity in Immunogenic Tumors.

    Science.gov (United States)

    Deng, Liufu; Liang, Hua; Xu, Meng; Yang, Xuanming; Burnette, Byron; Arina, Ainhoa; Li, Xiao-Dong; Mauceri, Helena; Beckett, Michael; Darga, Thomas; Huang, Xiaona; Gajewski, Thomas F; Chen, Zhijian J; Fu, Yang-Xin; Weichselbaum, Ralph R

    2014-11-20

    Ionizing radiation-mediated tumor regression depends on type I interferon (IFN) and the adaptive immune response, but several pathways control I IFN induction. Here, we demonstrate that adaptor protein STING, but not MyD88, is required for type I IFN-dependent antitumor effects of radiation. In dendritic cells (DCs), STING was required for IFN-? induction in response to irradiated-tumor cells. The cytosolic DNA sensor cyclic GMP-AMP (cGAMP) synthase (cGAS) mediated sensing of irradiated-tumor cells in DCs. Moreover, STING was essential for radiation-induced adaptive immune responses, which relied on type I IFN signaling on DCs. Exogenous IFN-? treatment rescued the cross-priming by cGAS or STING-deficient DCs. Accordingly, activation of STING by a second messenger cGAMP administration enhanced antitumor immunity induced by radiation. Thus radiation-mediated antitumor immunity in immunogenic tumors requires a functional cytosolic DNA-sensing pathway and suggests that cGAMP treatment might provide a new strategy to improve radiotherapy. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Is There Still Any Role for Oxidative Stress in Mitochondrial DNA-Dependent Aging?

    Directory of Open Access Journals (Sweden)

    Gábor Zsurka

    2018-03-01

    Full Text Available Recent deep sequencing data has provided compelling evidence that the spectrum of somatic point mutations in mitochondrial DNA (mtDNA in aging tissues lacks G > T transversion mutations. This fact cannot, however, be used as an argument for the missing contribution of reactive oxygen species (ROS to mitochondria-related aging because it is probably caused by the nucleotide selectivity of mitochondrial DNA polymerase γ (POLG. In contrast to point mutations, the age-dependent accumulation of mitochondrial DNA deletions is, in light of recent experimental data, still explainable by the segregation of mutant molecules generated by the direct mutagenic effects of ROS (in particular, of HO· radicals formed from H2O2 by a Fenton reaction. The source of ROS remains controversial, because the mitochondrial contribution to tissue ROS production is probably lower than previously thought. Importantly, in the discussion about the potential role of oxidative stress in mitochondria-dependent aging, ROS generated by inflammation-linked processes and the distribution of free iron also require careful consideration.

  6. Activation of cGAS-dependent antiviral responses by DNA intercalating agents.

    Science.gov (United States)

    Pépin, Geneviève; Nejad, Charlotte; Thomas, Belinda J; Ferrand, Jonathan; McArthur, Kate; Bardin, Philip G; Williams, Bryan R G; Gantier, Michael P

    2017-01-09

    Acridine dyes, including proflavine and acriflavine, were commonly used as antiseptics before the advent of penicillins in the mid-1940s. While their mode of action on pathogens was originally attributed to their DNA intercalating activity, work in the early 1970s suggested involvement of the host immune responses, characterized by induction of interferon (IFN)-like activities through an unknown mechanism. We demonstrate here that sub-toxic concentrations of a mixture of acriflavine and proflavine instigate a cyclic-GMP-AMP (cGAMP) synthase (cGAS)-dependent type-I IFN antiviral response. This pertains to the capacity of these compounds to induce low level DNA damage and cytoplasmic DNA leakage, resulting in cGAS-dependent cGAMP-like activity. Critically, acriflavine:proflavine pre-treatment of human primary bronchial epithelial cells significantly reduced rhinovirus infection. Collectively, our findings constitute the first evidence that non-toxic DNA binding agents have the capacity to act as indirect agonists of cGAS, to exert potent antiviral effects in mammalian cells. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Sequence Dependencies of DNA Deformability and Hydration in the Minor Groove

    Science.gov (United States)

    Yonetani, Yoshiteru; Kono, Hidetoshi

    2009-01-01

    Abstract DNA deformability and hydration are both sequence-dependent and are essential in specific DNA sequence recognition by proteins. However, the relationship between the two is not well understood. Here, systematic molecular dynamics simulations of 136 DNA sequences that differ from each other in their central tetramer revealed that sequence dependence of hydration is clearly correlated with that of deformability. We show that this correlation can be illustrated by four typical cases. Most rigid basepair steps are highly likely to form an ordered hydration pattern composed of one water molecule forming a bridge between the bases of distinct strands, but a few exceptions favor another ordered hydration composed of two water molecules forming such a bridge. Steps with medium deformability can display both of these hydration patterns with frequent transition. Highly flexible steps do not have any stable hydration pattern. A detailed picture of this correlation demonstrates that motions of hydration water molecules and DNA bases are tightly coupled with each other at the atomic level. These results contribute to our understanding of the entropic contribution from water molecules in protein or drug binding and could be applied for the purpose of predicting binding sites. PMID:19686662

  8. DNA unwinding by ASCC3 helicase is coupled to ALKBH3 dependent DNA alkylation repair and cancer cell proliferation

    Science.gov (United States)

    Dango, Sebastian; Mosammaparast, Nima; Sowa, Mathew E.; Xiong, Li-Jun; Wu, Feizhen; Park, Keyjung; Rubin, Mark; Gygi, Steve; Harper, J. Wade; Shi, Yang

    2011-01-01

    Summary Demethylation by the AlkB dioxygenases represents an important mechanism for repair of N-alkylated nucleotides. However, little is known about their functions in mammalian cells. We report the purification of the ALKBH3 complex and demonstrate its association with the Activating Signal Co-integrator Complex (ASCC). ALKBH3 is overexpressed in various cancers, and both ALKBH3 and ASCC are important for alkylation damage resistance in these tumor cell lines. ASCC3, the largest subunit of ASCC, encodes a 3′-5′ DNA helicase, whose activity is crucial for the generation of single-stranded DNA upon which ALKBH3 preferentially functions for dealkylation. In cell lines that are dependent on ALKBH3 and ASCC3 for alkylation damage resistance, loss of ALKBH3 or ASCC3 leads to increased 3-methylcytosine and reduced cell proliferation, which correlates with pH2A.X and 53BP1 foci formation. Our data provide a molecular mechanism by which ALKBH3 collaborates with ASCC to maintain genomic integrity in a cell type specific manner. PMID:22055184

  9. Protection of Rhesus Monkeys by a DNA Prime/Poxvirus Boost Malaria Vaccine Depends on Optimal DNA Priming and Inclusion of Blood Stage Antigens

    Science.gov (United States)

    Weiss, Walter R.; Kumar, Anita; Jiang, George; Williams, Jackie; Bostick, Anthony; Conteh, Solomon; Fryauff, David; Aguiar, Joao; Singh, Manmohan; O'Hagan, Derek T.; Ulmer, Jeffery B.; Richie, Thomas L.

    2007-01-01

    Background We have previously described a four antigen malaria vaccine consisting of DNA plasmids boosted by recombinant poxviruses which protects a high percentage of rhesus monkeys against Plasmodium knowlesi (Pk) malaria. This is a multi-stage vaccine that includes two pre-erythrocytic antigens, PkCSP and PkSSP2(TRAP), and two erythrocytic antigens, PkAMA-1 and PkMSP-1(42kD). The present study reports three further experiments where we investigate the effects of DNA dose, timing, and formulation. We also compare vaccines utilizing only the pre-erythrocytic antigens with the four antigen vaccine. Methodology In three experiments, rhesus monkeys were immunized with malaria vaccines using DNA plasmid injections followed by boosting with poxvirus vaccine. A variety of parameters were tested, including formulation of DNA on poly-lactic co-glycolide (PLG) particles, varying the number of DNA injections and the amount of DNA, varying the interval between the last DNA injection to the poxvirus boost from 7 to 21 weeks, and using vaccines with from one to four malaria antigens. Monkeys were challenged with Pk sporozoites given iv 2 to 4 weeks after the poxvirus injection, and parasitemia was measured by daily Giemsa stained blood films. Immune responses in venous blood samples taken after each vaccine injection were measured by ELIspot production of interferon-γ, and by ELISA. Conclusions 1) the number of DNA injections, the formulation of the DNA plasmids, and the interval between the last DNA injection and the poxvirus injection are critical to vaccine efficacy. However, the total dose used for DNA priming is not as important; 2) the blood stage antigens PkAMA-1 and PkMSP-1 were able to protect against high parasitemias as part of a genetic vaccine where antigen folding is not well defined; 3) immunization with PkSSP2 DNA inhibited immune responses to PkCSP DNA even when vaccinations were given into separate legs; and 4) in a counter-intuitive result, higher

  10. Role of the RecF pathway of recombination in the metabolism of uv-irradiated DNA in Escherichia coli K-12

    International Nuclear Information System (INIS)

    Rothman, R.H.

    1976-01-01

    The RecF pathway of genetic recombination in Escherichia coli is potentially capable of supporting wild type levels of recombination, but in wild type cells it plays a relatively minor role in this process. RecF and recL single mutants were found to be ultraviolet-sensitive but recombination proficient. These observations led to the hypothesis that the main function of the RecF pathway lies in the metabolism of uv-damaged DNA. The role of reF and recL in pathways of recovery from uv-irradiation has been examined. Both recF - and recL - inhibited post-replication joining of DNA fragments synthesized on uv-damaged DNA templates (post-replication repair). The addition of a uvrB5 mutation to the single mutants did not affect the cell's ability to complete post-replication repair in the case of recL, but did completely prevent completion of joining in the case of recF. It was hypothesized that recF is an endonuclease weakly indirectly suppressible by the presence of functional correndo II. It is suggested that recF is necessary to cleave the crossed strand intermediate at the end of repair. RecL, in addition to its involvement in post-replication repair, was also found to be involved in excision repair. A uvrB recB recC recF multiple mutant was as sensitive as a uvrB recA strain, suggesting that it is devoid of any repair abilities. RecB - was shown to have an inhibitory effect of post-replication repair. The uvrB recF mutant, however, was totally devoid of post-replication repair even though recB + contributed to the recovery of the strain. Thus the role of recB in post-replication repair is unclear. Lastly, the effects of recF and recL on uv-inducible repair was studied. W-reactivation of uv-irradiated lambda was used as an assay for inducible repair. The conclusions from these experiments were unclear. They seemed to imply that W-reactivation is effected by the combined action of excision repair and post-replication repair

  11. Mucosal immunization with PLGA-microencapsulated DNA primes a SIV-specific CTL response revealed by boosting with cognate recombinant modified vaccinia virus Ankara

    International Nuclear Information System (INIS)

    Sharpe, Sally; Hanke, Tomas; Tinsley-Bown, Anne; Dennis, Mike; Dowall, Stuart; McMichael, Andrew; Cranage, Martin

    2003-01-01

    Systemically administered DNA encoding a recombinant human immunodeficiency virus (HIV) derived immunogen effectively primes a cytotoxic T lymphocyte (CTL) response in macaques. In this further pilot study we have evaluated mucosal delivery of DNA as an alternative priming strategy. Plasmid DNA, pTH.HW, encoding a multi-CTL epitope gene, was incorporated into poly(D,L-lactic-co-glycolic acid) microparticles of less than 10 μm in diameter. Five intrarectal immunizations failed to stimulate a circulating vaccine-specific CTL response in 2 Mamu-A*01 + rhesus macaques. However, 1 week after intradermal immunization with a cognate modified vaccinia virus Ankara vaccine MVA.HW, CTL responses were detected in both animals that persisted until analysis postmortem, 12 weeks after the final boost. In contrast, a weaker and less durable response was seen in an animal vaccinated with the MVA construct alone. Analysis of lymphoid tissues revealed a disseminated CTL response in peripheral and regional lymph nodes but not the spleen of both mucosally primed animals

  12. The Over-expression of the β2 Catalytic Subunit of the Proteasome Decreases Homologous Recombination and Impairs DNA Double-Strand Break Repair in Human Cells

    Directory of Open Access Journals (Sweden)

    Anita Collavoli

    2011-01-01

    Full Text Available By a human cDNA library screening, we have previously identified two sequences coding two different catalytic subunits of the proteasome which increase homologous recombination (HR when overexpressed in the yeast Saccharomyces cerevisiae. Here, we investigated the effect of proteasome on spontaneous HR and DNA repair in human cells. To determine if the proteasome has a role in the occurrence of spontaneous HR in human cells, we overexpressed the β2 subunit of the proteasome in HeLa cells and determined the effect on intrachromosomal HR. Results showed that the overexpression of β2 subunit decreased HR in human cells without altering the cell proteasome activity and the Rad51p level. Moreover, exposure to MG132 that inhibits the proteasome activity reduced HR in human cells. We also found that the expression of the β2 subunit increases the sensitivity to the camptothecin that induces DNA double-strand break (DSB. This suggests that the β2 subunit has an active role in HR and DSB repair but does not alter the intracellular level of the Rad51p.

  13. Caffeine suppresses homologous recombination through interference with RAD51-mediated joint molecule formation

    Science.gov (United States)

    Zelensky, Alex N.; Sanchez, Humberto; Ristic, Dejan; Vidic, Iztok; van Rossum-Fikkert, Sari E.; Essers, Jeroen; Wyman, Claire; Kanaar, Roland

    2013-01-01

    Caffeine is a widely used inhibitor of the protein kinases that play a central role in the DNA damage response. We used chemical inhibitors and genetically deficient mouse embryonic stem cell lines to study the role of DNA damage response in stable integration of the transfected DNA and found that caffeine rapidly, efficiently and reversibly inhibited homologous integration of the transfected DNA as measured by several homologous recombination-mediated gene-targeting assays. Biochemical and structural biology experiments revealed that caffeine interfered with a pivotal step in homologous recombination, homologous joint molecule formation, through increasing interactions of the RAD51 nucleoprotein filament with non-homologous DNA. Our results suggest that recombination pathways dependent on extensive homology search are caffeine-sensitive and stress the importance of considering direct checkpoint-independent mechanisms in the interpretation of the effects of caffeine on DNA repair. PMID:23666627

  14. Prereplicative complexes assembled in vitro support origin-dependent and independent DNA replication

    Science.gov (United States)

    On, Kin Fan; Beuron, Fabienne; Frith, David; Snijders, Ambrosius P; Morris, Edward P; Diffley, John F X

    2014-01-01

    Eukaryotic DNA replication initiates from multiple replication origins. To ensure each origin fires just once per cell cycle, initiation is divided into two biochemically discrete steps: the Mcm2-7 helicase is first loaded into prereplicative complexes (pre-RCs) as an inactive double hexamer by the origin recognition complex (ORC), Cdt1 and Cdc6; the helicase is then activated by a set of “firing factors.” Here, we show that plasmids containing pre-RCs assembled with purified proteins support complete and semi-conservative replication in extracts from budding yeast cells overexpressing firing factors. Replication requires cyclin-dependent kinase (CDK) and Dbf4-dependent kinase (DDK). DDK phosphorylation of Mcm2-7 does not by itself promote separation of the double hexamer, but is required for the recruitment of firing factors and replisome components in the extract. Plasmid replication does not require a functional replication origin; however, in the presence of competitor DNA and limiting ORC concentrations, replication becomes origin-dependent in this system. These experiments indicate that Mcm2-7 double hexamers can be precursors of replication and provide insight into the nature of eukaryotic DNA replication origins. PMID:24566989

  15. Rad10 exhibits lesion-dependent genetic requirements for recruitment to DNA double-strand breaks in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Moore, Destaye M; Karlin, Justin; González-Barrera, Sergio

    2009-01-01

    In the yeast Saccharomyces cerevisiae, the Rad1-Rad10 protein complex participates in nucleotide excision repair (NER) and homologous recombination (HR). During HR, the Rad1-Rad10 endonuclease cleaves 3' branches of DNA and aberrant 3' DNA ends that are refractory to other 3' processing enzymes. ...

  16. Recombinational Cloning Using Gateway and In-Fusion Cloning Schemes

    Science.gov (United States)

    Throop, Andrea L.; LaBaer, Joshua

    2015-01-01

    The comprehensive study of protein structure and function, or proteomics, depends on the obtainability of full-length cDNAs in species-specific expression vectors and subsequent functional analysis of the expressed protein. Recombinational cloning is a universal cloning technique based on site-specific recombination that is independent of the insert DNA sequence of interest, which differentiates this method from the classical restriction enzyme-based cloning methods. Recombinational cloning enables rapid and efficient parallel transfer of DNA inserts into multiple expression systems. This unit summarizes strategies for generating expression-ready clones using the most popular recombinational cloning technologies, including the commercially available Gateway® (Life Technologies) and In-Fusion® (Clontech) cloning technologies. PMID:25827088

  17. Brownian dynamics simulations of sequence-dependent duplex denaturation in dynamically superhelical DNA

    Science.gov (United States)

    Mielke, Steven P.; Grønbech-Jensen, Niels; Krishnan, V. V.; Fink, William H.; Benham, Craig J.

    2005-09-01

    The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.

  18. New vaccine strategies against enterotoxigenic Escherichia coli: II: Enhanced systemic and secreted antibody responses against the CFA/I fimbriae by priming with DNA and boosting with a live recombinant Salmonella vaccine

    Directory of Open Access Journals (Sweden)

    M.O. Lásaro

    1999-02-01

    Full Text Available The induction of systemic (IgG and mucosal (IgA antibody responses against the colonization factor I antigen (CFA/I of enterotoxigenic Escherichia coli (ETEC was evaluated in mice primed with an intramuscularly delivered CFA/I-encoding DNA vaccine followed by two oral immunizations with a live recombinant Salmonella typhimurium vaccine strain expressing the ETEC antigen. The booster effect induced by the oral immunization was detected two weeks and one year after the administration of the DNA vaccine. The DNA-primed/Salmonella-boosted vaccination regime showed a synergistic effect on the induced CFA/I-specific systemic and secreted antibody levels which could not be attained by either immunization strategy alone. These results suggest that the combined use of DNA vaccines and recombinant Salmonella vaccine strains can be a useful immunization strategy against enteric pathogens.

  19. Caffeine potentiates or protects against radiation-induced DNA and chromosomal damage in human lymphocytes depending on temperature and concentration

    Energy Technology Data Exchange (ETDEWEB)

    Stoilov, L.M. (Department of Molecular Genetics, Institute of Genetics, Sofia (Bulgaria)); Mullenders, L.H.F.; Natarajan, A.T. (J.A. Cohen Institute, Interuniversity Research Institute for Radiopathology and Radiation Protection, Leiden (Netherlands))

    1994-12-01

    The effect of caffeine on radiation-induced chromosomal aberrations and DNA strand breaks in unstimulated human lymphocytes was investigated. When present prior to and during the radiation exposure, caffeine treatment was found to cause either potentiation or protection against induction of chromosomal aberrations depending on the concentration and temperature. When the nucleoid sedimentation technique was applied, enhancement or reduction of radiation-induced DNA strand breaks by caffeine was also found to be dependent on temperature and caffeine concentration. It is proposed that caffeine, in addition to its suspected ability to influence DNA repair, can also influence the induction of DNA damage, leading to alterations in the yield of chromosomal aberrations.

  20. Caffeine potentiates or protects against radiation-induced DNA and chromosomal damage in human lymphocytes depending on temperature and concentration

    International Nuclear Information System (INIS)

    Stoilov, L.M.; Mullenders, L.H.F.; Natarajan, A.T.

    1994-01-01

    The effect of caffeine on radiation-induced chromosomal aberrations and DNA strand breaks in unstimulated human lymphocytes was investigated. When present prior to and during the radiation exposure, caffeine treatment was found to cause either potentiation or protection against induction of chromosomal aberrations depending on the concentration and temperature. When the nucleoid sedimentation technique was applied, enhancement or reduction of radiation-induced DNA strand breaks by caffeine was also found to be dependent on temperature and caffeine concentration. It is proposed that caffeine, in addition to its suspected ability to influence DNA repair, can also influence the induction of DNA damage, leading to alterations in the yield of chromosomal aberrations

  1. Sequence dependent DNA conformations: Raman spectroscopic studies and a model of action of restriction enzymes

    International Nuclear Information System (INIS)

    Nishimura, Y.

    1985-01-01

    Raman spectra have been examined to clarify the polymorphic forms of DNA, A, B, and Z forms. From an analysis the authors found that the guanine ring breathing vibration is sensitive to its local conformation. Examination of nine crystals of guanosine residues in which the local conformations are well established revealed that a guanosine residue with a C3'endo-anti gives a strong line at 666+-2 cm/sup -1/, O4'endo-anti at 682 cm/sup -1/, C1'exo-anti at 673 cm/sup -1/, C2'endo-anti at 677 cm/sup -1/ and syn-forms around 625 cm/sup -1/. Using this characteristic line, they were able to obtain the local conformations of guanosine moieties in poly(dG-dC). Such a sequence derived variation is suggested to be recognized by sequence specific proteins such as restriction enzymes. The authors found a correlation between sequence dependent DNA conformation and a mode of action of restriction enzymes. The cutting mode of restriction enzymes is classified into three groups. The classification of whether the products have blunt ends, two-base-long cohesive ends, or four-base-long cohesive ends depends primarily on the substrate, not on the enzyme. It is suggested that sequence dependent DNA conformation causes such a classification by the use of the Calladine-Dickerson analysis. In the recognition of restriction enzymes, the methyl group in a certain sequence is considered to play an important role by changing the local conformation of DNA

  2. Bacillus subtilis DNA polymerases, PolC and DnaE, are required for both leading and lagging strand synthesis in SPP1 origin-dependent DNA replication

    Science.gov (United States)

    Seco, Elena M.

    2017-01-01

    Abstract Firmicutes have two distinct replicative DNA polymerases, the PolC leading strand polymerase, and PolC and DnaE synthesizing the lagging strand. We have reconstituted in vitro Bacillus subtilis bacteriophage SPP1 θ-type DNA replication, which initiates unidirectionally at oriL. With this system we show that DnaE is not only restricted to lagging strand synthesis as previously suggested. DnaG primase and DnaE polymerase are required for initiation of DNA replication on both strands. DnaE and DnaG synthesize in concert a hybrid RNA/DNA ‘initiation primer’ on both leading and lagging strands at the SPP1 oriL region, as it does the eukaryotic Pol α complex. DnaE, as a RNA-primed DNA polymerase, extends this initial primer in a reaction modulated by DnaG and one single-strand binding protein (SSB, SsbA or G36P), and hands off the initiation primer to PolC, a DNA-primed DNA polymerase. Then, PolC, stimulated by DnaG and the SSBs, performs the bulk of DNA chain elongation at both leading and lagging strands. Overall, these modulations by the SSBs and DnaG may contribute to the mechanism of polymerase switch at Firmicutes replisomes. PMID:28575448

  3. Circadian clock protein KaiC forms ATP-dependent hexameric rings and binds DNA.

    Science.gov (United States)

    Mori, Tetsuya; Saveliev, Sergei V; Xu, Yao; Stafford, Walter F; Cox, Michael M; Inman, Ross B; Johnson, Carl H

    2002-12-24

    KaiC from Synechococcus elongatus PCC 7942 (KaiC) is an essential circadian clock protein in cyanobacteria. Previous sequence analyses suggested its inclusion in the RecADnaB superfamily. A characteristic of the proteins of this superfamily is that they form homohexameric complexes that bind DNA. We show here that KaiC also forms ring complexes with a central pore that can be visualized by electron microscopy. A combination of analytical ultracentrifugation and chromatographic analyses demonstrates that these complexes are hexameric. The association of KaiC molecules into hexamers depends on the presence of ATP. The KaiC sequence does not include the obvious DNA-binding motifs found in RecA or DnaB. Nevertheless, KaiC binds forked DNA substrates. These data support the inclusion of KaiC into the RecADnaB superfamily and have important implications for enzymatic activity of KaiC in the circadian clock mechanism that regulates global changes in gene expression patterns.

  4. Double-stranded DNA-dependent ATPase Irc3p is directly involved in mitochondrial genome maintenance.

    Science.gov (United States)

    Sedman, Tiina; Gaidutšik, Ilja; Villemson, Karin; Hou, YingJian; Sedman, Juhan

    2014-12-01

    Nucleic acid-dependent ATPases are involved in nearly all aspects of DNA and RNA metabolism. Previous studies have described a number of mitochondrial helicases. However, double-stranded DNA-dependent ATPases, including translocases or enzymes remodeling DNA-protein complexes, have not been identified in mitochondria of the yeast Saccharomyces cerevisae. Here, we demonstrate that Irc3p is a mitochondrial double-stranded DNA-dependent ATPase of the Superfamily II. In contrast to the other mitochondrial Superfamily II enzymes Mss116p, Suv3p and Mrh4p, which are RNA helicases, Irc3p has a direct role in mitochondrial DNA (mtDNA) maintenance. Specific Irc3p-dependent mtDNA metabolic intermediates can be detected, including high levels of double-stranded DNA breaks that accumulate in irc3Δ mutants. irc3Δ-related topology changes in rho- mtDNA can be reversed by the deletion of mitochondrial RNA polymerase RPO41, suggesting that Irc3p counterbalances adverse effects of transcription on mitochondrial genome stability. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Hormone-dependent nuclear export of estradiol receptor and DNA synthesis in breast cancer cells

    Science.gov (United States)

    Lombardi, Maria; Castoria, Gabriella; Migliaccio, Antimo; Barone, Maria Vittoria; Di Stasio, Rosina; Ciociola, Alessandra; Bottero, Daniela; Yamaguchi, Hiroshi; Appella, Ettore; Auricchio, Ferdinando

    2008-01-01

    In breast cancer cells, cytoplasmic localization of the estradiol receptor α (ERα) regulates estradiol-dependent S phase entry. We identified a nuclear export sequence (NES) in ERα and show that its export is dependent on both estradiol-mediated phosphatidylinositol-3-kinase (PI3K)/AKT activation and chromosome region maintenance 1 (CRM1). A Tat peptide containing the ERα NES disrupts ERα–CRM1 interaction and prevents nuclear export of ERα- and estradiol-induced DNA synthesis. NES-ERα mutants do not exit the nucleus and inhibit estradiol-induced S phase entry; ERα-dependent transcription is normal. ERα is associated with Forkhead proteins in the nucleus, and estradiol stimulates nuclear exit of both proteins. ERα knockdown or ERα NES mutations prevent ERα and Forkhead nuclear export. A mutant of forkhead in rhabdomyosarcoma (FKHR), which cannot be phosphorylated by estradiol-activated AKT, does not associate with ERα and is trapped in the nucleus, blocking S phase entry. In conclusion, estradiol-induced AKT-dependent phosphorylation of FKHR drives its association with ERα, thereby triggering complex export from the nucleus necessary for initiation of DNA synthesis and S phase entry. PMID:18644889

  6. CRISPR-Cas and Contact-Dependent Secretion Systems Present on Excisable Pathogenicity Islands with Conserved Recombination Modules.

    Science.gov (United States)

    Carpenter, Megan R; Kalburge, Sai S; Borowski, Joseph D; Peters, Molly C; Colwell, Rita R; Boyd, E Fidelma

    2017-05-15

    Pathogenicity islands (PAIs) are mobile integrated genetic elements that contain a diverse range of virulence factors. PAIs integrate into the host chromosome at a tRNA locus that contains their specific bacterial attachment site, attB , via integrase-mediated site-specific recombination generating attL and attR sites. We identified conserved recombination modules (integrases and att sites) previously described in choleragenic Vibrio cholerae PAIs but with novel cargo genes. Clustered regularly interspaced short palindromic repeat (CRISPR)-associated proteins (Cas proteins) and a type VI secretion system (T6SS) gene cluster were identified at the Vibrio pathogenicity island 1 (VPI-1) insertion site in 19 V. cholerae strains and contained the same recombination module. Two divergent type I-F CRISPR-Cas systems were identified, which differed in Cas protein homology and content. The CRISPR repeat sequence was identical among all V. cholerae strains, but the CRISPR spacer sequences and the number of spacers varied. In silico analysis suggests that the CRISPR-Cas systems were active against phages and plasmids. A type III secretion system (T3SS) was present in 12 V. cholerae strains on a 68-kb island inserted at the same tRNA-serine insertion site as VPI-2 and contained the same recombination module. Bioinformatics analysis showed that two divergent T3SSs exist among the strains examined. Both the CRISPR and T3SS islands excised site specifically from the bacterial chromosome as complete units, and the cognate integrases were essential for this excision. These data demonstrated that identical recombination modules that catalyze integration and excision from the chromosome can acquire diverse cargo genes, signifying a novel method of acquisition for both CRISPR-Cas systems and T3SSs. IMPORTANCE This work demonstrated the presence of CRISPR-Cas systems and T3SSs on PAIs. Our work showed that similar recombination modules can associate with different cargo genes and

  7. Lyn tyrosine kinase promotes silencing of ATM-dependent checkpoint signaling during recovery from DNA double-strand breaks

    International Nuclear Information System (INIS)

    Fukumoto, Yasunori; Kuki, Kazumasa; Morii, Mariko; Miura, Takahito; Honda, Takuya; Ishibashi, Kenichi; Hasegawa, Hitomi; Kubota, Sho; Ide, Yudai; Yamaguchi, Noritaka; Nakayama, Yuji; Yamaguchi, Naoto

    2014-01-01

    Highlights: • Inhibition of Src family kinases decreased γ-H2AX signal. • Inhibition of Src family increased ATM-dependent phosphorylation of Chk2 and Kap1. • shRNA-mediated knockdown of Lyn increased phosphorylation of Kap1 by ATM. • Ectopic expression of Src family kinase suppressed ATM-mediated Kap1 phosphorylation. • Src is involved in upstream signaling for inactivation of ATM signaling. - Abstract: DNA damage activates the DNA damage checkpoint and the DNA repair machinery. After initial activation of DNA damage responses, cells recover to their original states through completion of DNA repair and termination of checkpoint signaling. Currently, little is known about the process by which cells recover from the DNA damage checkpoint, a process called checkpoint recovery. Here, we show that Src family kinases promote inactivation of ataxia telangiectasia mutated (ATM)-dependent checkpoint signaling during recovery from DNA double-strand breaks. Inhibition of Src activity increased ATM-dependent phosphorylation of Chk2 and Kap1. Src inhibition increased ATM signaling both in G2 phase and during asynchronous growth. shRNA knockdown of Lyn increased ATM signaling. Src-dependent nuclear tyrosine phosphorylation suppressed ATM-mediated Kap1 phosphorylation. These results suggest that Src family kinases are involved in upstream signaling that leads to inactivation of the ATM-dependent DNA damage checkpoint

  8. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.

    1980-01-01

    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  9. Development of an efficient process intensification strategy for enhancing Pfu DNA polymerase production in recombinant Escherichia coli.

    Science.gov (United States)

    Hu, Jian-Hua; Wang, Feng; Liu, Chun-Zhao

    2015-04-01

    An efficient induction strategy that consisted of multiple additions of small doses of isopropyl-β-D-thiogalactopyranoside (IPTG) in the early cell growth phase was developed for enhancing Pfu DNA polymerase production in Escherichia coli. In comparison to the most commonly used method of a single induction of 1 mM IPTG, the promising induction strategy resulted in an increase in the Pfu activity of 13.5% in shake flasks, while simultaneously decreasing the dose of IPTG by nearly half. An analysis of the intracellular IPTG concentrations indicated that the cells need to maintain an optimum intracellular IPTG concentration after 6 h for efficient Pfu DNA polymerase production. A significant increase in the Pfu DNA polymerase activity of 31.5% under the controlled dissolved oxygen concentration of 30% in a 5 L fermentor was achieved using the multiple IPTG induction strategy in comparison with the single IPTG induction. The induction strategy using multiple inputs of IPTG also avoided over accumulation of IPTG and reduced the cost of Pfu DNA polymerase production.

  10. Evaluation of DNA Recombinant Methodologies for the Diagnosis of Plasmodium falciparum and their Comparison with the Microscopy Assay

    Directory of Open Access Journals (Sweden)

    L Urdaneta

    1998-09-01

    Full Text Available Since 1984, DNA tests based on the highly repeated subtelomeric sequences of Plasmodium falciparum (rep 20 have been frequently used in malaria diagnosis. Rep 20 is very specific for this parasite, and is made of 21 bp units, organized in repeated blocks with direct and inverted orientation. Based in this particular organization, we selected a unique consensus oligonucleotide (pf-21 to drive a PCR reaction coupled to hybridization to non-radioactive labeled probes. The pf-21 unique oligo PCR (pf-21-I assay produced DNA amplification fingerprints when was applied on purified P. falciparum DNA samples (Brazil and Colombia, as well as in patient's blood samples from a large area of Venezuela. The performance of the Pf-21-I assay was compared against Giemsa stained thick blood smears from samples collected at a malaria endemic area of the Bolívar State, Venezuela, at the field station of Malariología in Tumeremo. Coupled to non-radioactive hybridization the pf-21-I performed better than the traditional microscopic method with a r=1.7:1. In the case of mixed infections the r value of P. falciparum detection increased to 2.5:1. The increased diagnostic sensitivity of the test produced with this homologous oligonucleotide could provide an alternative to the epidemiological diagnosis of P. falciparum being currently used in Venezuela endemic areas, where low parasitemia levels and asymptomatic malaria are frequent. In addition, the DNA fingerprint could be tested in molecular population studies

  11. Molecular architecture of the recombinant human MCM2-7 helicase in complex with nucleotides and DNA

    DEFF Research Database (Denmark)

    Boskovic, Jasminka; Bragado-Nilsson, Elisabeth; Saligram Prabhakar, Bhargav

    2016-01-01

    DNA replication is a key biological process that involves different protein complexes whose assembly is rigorously regulated in a successive order. One of these complexes is a replicative hexameric helicase, the MCM complex, which is essential for the initiation and elongation phases of replicati...

  12. Viral recombination blurs taxonomic lines: examination of single-stranded DNA viruses in a wastewater treatment plant

    Directory of Open Access Journals (Sweden)

    Victoria M. Pearson

    2016-10-01

    Full Text Available Understanding the structure and dynamics of microbial communities, especially those of economic concern, is of paramount importance to maintaining healthy and efficient microbial communities at agricultural sites and large industrial cultures, including bioprocessors. Wastewater treatment plants are large bioprocessors which receive water from multiple sources, becoming reservoirs for the collection of many viral families that infect a broad range of hosts. To examine this complex collection of viruses, full-length genomes of circular ssDNA viruses were isolated from a wastewater treatment facility using a combination of sucrose-gradient size selection and rolling-circle amplification and sequenced on an Illumina MiSeq. Single-stranded DNA viruses are among the least understood groups of microbial pathogens due to genomic biases and culturing difficulties, particularly compared to the larger, more often studied dsDNA viruses. However, the group contains several notable well-studied examples, including agricultural pathogens which infect both livestock and crops (Circoviridae and Geminiviridae, and model organisms for genetics and evolution studies (Microviridae. Examination of the collected viral DNA provided evidence for 83 unique genotypic groupings, which were genetically dissimilar to known viral types and exhibited broad diversity within the community. Furthermore, although these genomes express similarities to known viral families, such as Circoviridae, Geminiviridae, and Microviridae, many are so divergent that they may represent new taxonomic groups. This study demonstrated the efficacy of the protocol for separating bacteria and large viruses from the sought after ssDNA viruses and the ability to use this protocol to obtain an in-depth analysis of the diversity within this group.

  13. Targeting GLI by GANT61 involves mechanisms dependent on inhibition of both transcription and DNA licensing.

    Science.gov (United States)

    Zhang, Ruowen; Wu, Jiahui; Ferrandon, Sylvain; Glowacki, Katie J; Houghton, Janet A

    2016-12-06

    The GLI genes are transcription factors and in cancers are oncogenes, aberrantly and constitutively activated. GANT61, a specific GLI inhibitor, has induced extensive cytotoxicity in human models of colon cancer. The FOXM1 promoter was determined to be a transcriptional target of GLI1. In HT29 cells, inhibition of GLI1 binding at the GLI consensus sequence by GANT61 led to inhibited binding of Pol II, the pause-release factors DSIF, NELF and p-TEFb. The formation of R-loops (RNA:DNA hybrids, ssDNA), were reduced by GANT61 at the FOXM1 promoter. Pretreatment of HT29 cells with α-amanitin reduced GANT61-induced γH2AX foci. Co-localization of GLI1 and BrdU foci, inhibited by GANT61, indicated GLI1 and DNA replication to be linked. By co-immunoprecipitation and confocal microscopy, GLI1 co-localized with the DNA licensing factors ORC4, CDT1, and MCM2. Significant co-localization of GLI1 and ORC4 was inhibited by GANT61, and enrichment of ORC4 occurred at the GLI binding site in the FOXM1 promoter. CDT1 was found to be a transcription target of GLI1. Overexpression of CDT1 in HT29 and SW480 cells reduced GANT61-induced cell death, gH2AX foci, and cleavage of caspase-3. Data demonstrate involvement of transcription and of DNA replication licensing factors by non-transcriptional and transcriptional mechanisms in the GLI-dependent mechanism of action of GANT61.

  14. Biochemical characterisation of LigN, an NAD+-dependent DNA ligase from the halophilic euryarchaeon Haloferax volcanii that displays maximal in vitro activity at high salt concentrations

    DEFF Research Database (Denmark)

    Poidevin, L.; MacNeill, S. A.

    2006-01-01

    Background DNA ligases are required for DNA strand joining in all forms of cellular life. NAD+-dependent DNA ligases are found primarily in eubacteria but also in some eukaryotic viruses, bacteriophage and archaea. Among the archaeal NAD+-dependent DNA ligases is the LigN enzyme of the halophilic...

  15. Hybrid lentivirus-phiC31-int-NLS vector allows site-specific recombination in murine and human cells but induces DNA damage.

    Directory of Open Access Journals (Sweden)

    Nicolas Grandchamp

    Full Text Available Gene transfer allows transient or permanent genetic modifications of cells for experimental or therapeutic purposes. Gene delivery by HIV-derived lentiviral vector (LV is highly effective but the risk of insertional mutagenesis is important and the random/uncontrollable integration of the DNA vector can deregulate the cell transcriptional activity. Non Integrative Lentiviral Vectors (NILVs solve this issue in non-dividing cells, but they do not allow long term expression in dividing cells. In this context, obtaining stable expression while avoiding the problems inherent to unpredictable DNA vector integration requires the ability to control the integration site. One possibility is to use the integrase of phage phiC31 (phiC31-int which catalyzes efficient site-specific recombination between the attP site in the phage genome and the chromosomal attB site of its Streptomyces host. Previous studies showed that phiC31-int is active in many eukaryotic cells, such as murine or human cells, and directs the integration of a DNA substrate into pseudo attP sites (pattP which are homologous to the native attP site. In this study, we combined the efficiency of NILV for gene delivery and the specificity of phiC31-int for DNA substrate integration to engineer a hybrid tool for gene transfer with the aim of allowing long term expression in dividing and non-dividing cells preventing genotoxicity. We demonstrated the feasibility to target NILV integration in human and murine pattP sites with a dual NILV vectors system: one which delivers phiC31-int, the other which constitute the substrate containing an attB site in its DNA sequence. These promising results are however alleviated by the occurrence of significant DNA damages. Further improvements are thus required to prevent chromosomal rearrangements for a therapeutic use of the system. However, its use as a tool for experimental applications such as transgenesis is already applicable.

  16. Optimization of a multi-gene HIV-1 recombinant subtype CRF02AG DNA vaccine for expression of multiple immunogenic forms

    International Nuclear Information System (INIS)

    Ellenberger, Dennis; Li Bin; Smith, James; Yi Hong; Folks, Thomas; Robinson, Harriet; Butera, Salvatore

    2004-01-01

    We developed an AIDS vaccine for Western and West-Central Africa based on a DNA plasmid vector expressing HIV-1 recombinant subtype CRF02 A G gag, pol, and env genes. To optimize the production of noninfectious HIV-like particles (VLPs) and potentially improve the effectiveness of the vaccine, we generated four potential vaccine constructs: the parental (IC2) and three modifications (IC25, IC48, and IC90) containing mutations within the HIV protease. While the parental construct IC2 expressed aggregates of Gag proteins, the IC25 construct resulted in the production of immature VLPs (the core comprises unprocessed Pr 55Gag ). The remaining two constructs (IC48 and IC90) produced mature VLPs (the core comprises processed capsid p24) in addition to immature VLPs and aggregates of Gag proteins. VLPs incorporated significant levels of mature gp120 envelope glycoprotein. Importantly, the mature VLPs were fusion competent and entered coreceptor-specific target cells. The production of multiple antigenic forms, including fusion-competent VLPs, by candidate DNA vaccine constructs may provide immunologic advantages for induction of protective cellular and humoral responses against HIV-1 proteins

  17. Dual inhibition of ATR and ATM potentiates the activity of trabectedin and lurbinectedin by perturbing the DNA damage response and homologous recombination repair.

    Science.gov (United States)

    Lima, Michelle; Bouzid, Hana; Soares, Daniele G; Selle, Frédéric; Morel, Claire; Galmarini, Carlos M; Henriques, João A P; Larsen, Annette K; Escargueil, Alexandre E

    2016-05-03

    Trabectedin (Yondelis®, ecteinascidin-743, ET-743) is a marine-derived natural product approved for treatment of advanced soft tissue sarcoma and relapsed platinum-sensitive ovarian cancer. Lurbinectedin is a novel anticancer agent structurally related to trabectedin. Both ecteinascidins generate DNA double-strand breaks that are processed through homologous recombination repair (HRR), thereby rendering HRR-deficient cells particularly sensitive. We here characterize the DNA damage response (DDR) to trabectedin and lurbinectedin in HeLa cells. Our results show that both compounds activate the ATM/Chk2 (ataxia-telangiectasia mutated/checkpoint kinase 2) and ATR/Chk1 (ATM and RAD3-related/checkpoint kinase 1) pathways. Interestingly, pharmacological inhibition of Chk1/2, ATR or ATM is not accompanied by any significant improvement of the cytotoxic activity of the ecteinascidins while dual inhibition of ATM and ATR strongly potentiates it. Accordingly, concomitant inhibition of both ATR and ATM is an absolute requirement to efficiently block the formation of γ-H2AX, MDC1, BRCA1 and Rad51 foci following exposure to the ecteinascidins. These results are not restricted to HeLa cells, but are shared by cisplatin-sensitive and -resistant ovarian carcinoma cells. Together, our data identify ATR and ATM as central coordinators of the DDR to ecteinascidins and provide a mechanistic rationale for combining these compounds with ATR and ATM inhibitors.

  18. Fusion-Expressed CTB Improves Both Systemic and Mucosal T-Cell Responses Elicited by an Intranasal DNA Priming/Intramuscular Recombinant Vaccinia Boosting Regimen

    Directory of Open Access Journals (Sweden)

    Sugan Qiu

    2014-01-01

    Full Text Available Previous study showed that CTB (Cholera toxin subunit B can be used as a genetic adjuvant to enhance the systemic immune responses. To further investigate whether it can also be used as a genetic adjuvant to improve mucosal immune responses, we constructed DNA and recombinant Tiantan vaccinia (rTTV vaccines expressing OVA-CTB fusion antigen. Female C57BL/6 mice were immunized with an intranasal DNA priming/intramuscular rTTV boosting regimen. OVA specific T-cell responses were measured by IFN-γ ELISPOT and specific antibody responses were determined by ELISA. Compared to the nonadjuvant group (pSV-OVA intranasal priming/rTTV-OVA intramuscular boosting, pSV-OVA-CTB intranasal priming/rTTV-OVA-CTB intramuscular boosting group significantly improved the magnitudes of T-cell responses at spleen (1562±567 SFCs/106 splenocytes versus 330±182 SFCs/106 splenocytes, P<0.01, mesenteric LN (96±83 SFCs/106 lymphocytes versus 1±2 SFCs/106 lymphocytes, P<0.05, draining LNs of respiratory tract (109±60 SFCs/106 lymphocytes versus 2±2 SFCs/106 lymphocytes, P<0.01 and female genital tract (89±48 SFCs/106 lymphocytes versus 23±21 SFCs/106 lymphocytes, P<0.01. These results collectively demonstrated that fusion-expressed CTB could act as a potent adjuvant to improve both systemic and mucosal T-cell responses.

  19. ATP-dependent chromatin remodeling and histone binding by the Cockayne syndrome B DNA repair-transcription coupling factor.

    NARCIS (Netherlands)

    E. Citterio (Elisabetta); V. van den Boom (Vincent); G. Schnitzler; R. Kanaar (Roland); E. Bonte (Edgar); R.E. Kingston; J.H.J. Hoeijmakers (Jan); W. Vermeulen (Wim)

    2000-01-01

    textabstractThe Cockayne syndrome B protein (CSB) is required for coupling DNA excision repair to transcription in a process known as transcription-coupled repair (TCR). Cockayne syndrome patients show UV sensitivity and severe neurodevelopmental abnormalities. CSB is a DNA-dependent ATPase of the

  20. The unconventional xer recombination machinery of Streptococci/Lactococci

    NARCIS (Netherlands)

    Le Bourgeois, Pascal; Bugarel, Marie; Campo, Nathalie; Daveran-Mingot, Marie-Line; Labonte, Jessica; Lanfranchi, Daniel; Lautier, Thomas; Pages, Carine; Ritzenthaler, Paul

    Homologous recombination between circular sister chromosomes during DNA replication in bacteria can generate chromosome dimers that must be resolved into monomers prior to cell division. In Escherichia coli, dimer resolution is achieved by site-specific recombination, Xer recombination, involving

  1. Microarray and cDNA sequence analysis of transcription during nerve-dependent limb regeneration

    Directory of Open Access Journals (Sweden)

    Bryant Susan V

    2009-01-01

    Full Text Available Abstract Background Microarray analysis and 454 cDNA sequencing were used to investigate a centuries-old problem in regenerative biology: the basis of nerve-dependent limb regeneration in salamanders. Innervated (NR and denervated (DL forelimbs of Mexican axolotls were amputated and transcripts were sampled after 0, 5, and 14 days of regeneration. Results Considerable similarity was observed between NR and DL transcriptional programs at 5 and 14 days post amputation (dpa. Genes with extracellular functions that are critical to wound healing were upregulated while muscle-specific genes were downregulated. Thus, many processes that are regulated during early limb regeneration do not depend upon nerve-derived factors. The majority of the transcriptional differences between NR and DL limbs were correlated with blastema formation; cell numbers increased in NR limbs after 5 dpa and this yielded distinct transcriptional signatures of cell proliferation in NR limbs at 14 dpa. These transcriptional signatures were not observed in DL limbs. Instead, gene expression changes within DL limbs suggest more diverse and protracted wound-healing responses. 454 cDNA sequencing complemented the microarray analysis by providing deeper sampling of transcriptional programs and associated biological processes. Assembly of new 454 cDNA sequences with existing expressed sequence tag (EST contigs from the Ambystoma EST database more than doubled (3935 to 9411 the number of non-redundant human-A. mexicanum orthologous sequences. Conclusion Many new candidate gene sequences were discovered for the first time and these will greatly enable future studies of wound healing, epigenetics, genome stability, and nerve-dependent blastema formation and outgrowth using the axolotl model.

  2. cgDNA: a software package for the prediction of sequence-dependent coarse-grain free energies of B-form DNA.

    Science.gov (United States)

    Petkevičiūtė, D; Pasi, M; Gonzalez, O; Maddocks, J H

    2014-11-10

    cgDNA is a package for the prediction of sequence-dependent configuration-space free energies for B-form DNA at the coarse-grain level of rigid bases. For a fragment of any given length and sequence, cgDNA calculates the configuration of the associated free energy minimizer, i.e. the relative positions and orientations of each base, along with a stiffness matrix, which together govern differences in free energies. The model predicts non-local (i.e. beyond base-pair step) sequence dependence of the free energy minimizer. Configurations can be input or output in either the Curves+ definition of the usual helical DNA structural variables, or as a PDB file of coordinates of base atoms. We illustrate the cgDNA package by comparing predictions of free energy minimizers from (a) the cgDNA model, (b) time-averaged atomistic molecular dynamics (or MD) simulations, and (c) NMR or X-ray experimental observation, for (i) the Dickerson-Drew dodecamer and (ii) three oligomers containing A-tracts. The cgDNA predictions are rather close to those of the MD simulations, but many orders of magnitude faster to compute. Both the cgDNA and MD predictions are in reasonable agreement with the available experimental data. Our conclusion is that cgDNA can serve as a highly efficient tool for studying structural variations in B-form DNA over a wide range of sequences. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Stereospecific suppression of active site mutants by methylphosphonate substituted substrates reveals the stereochemical course of site-specific DNA recombination

    OpenAIRE

    Rowley, Paul A.; Kachroo, Aashiq H.; Ma, Chien-Hui; Maciaszek, Anna D.; Guga, Piotr; Jayaram, Makkuni

    2015-01-01

    Tyrosine site-specific recombinases, which promote one class of biologically important phosphoryl transfer reactions in DNA, exemplify active site mechanisms for stabilizing the phosphate transition state. A highly conserved arginine duo (Arg-I; Arg-II) of the recombinase active site plays a crucial role in this function. Cre and Flp recombinase mutants lacking either arginine can be rescued by compensatory charge neutralization of the scissile phosphate via methylphosphonate (MeP) modificati...

  4. UV-dependent production of 25-hydroxyvitamin D2 in the recombinant yeast cells expressing human CYP2R1

    International Nuclear Information System (INIS)

    Yasuda, Kaori; Endo, Mariko; Ikushiro, Shinichi; Kamakura, Masaki; Ohta, Miho; Sakaki, Toshiyuki

    2013-01-01

    Highlights: •We produce 25-hydroxyvitamin D in the recombinant yeast expressing human CYP2R1. •Vitamin D2 is produced in yeast from endogenous ergosterol with UV irradiation. •We produce 25-hydroxyvitamin D2 in the recombinant yeast without added substrate. -- Abstract: CYP2R1 is known to be a physiologically important vitamin D 25-hydroxylase. We have successfully expressed human CYP2R1 in Saccharomyces cerevisiae to reveal its enzymatic properties. In this study, we examined production of 25-hydroxylated vitamin D using whole recombinant yeast cells that expressed CYP2R1. When vitamin D 3 or vitamin D 2 was added to the cell suspension of CYP2R1-expressing yeast cells in a buffer containing glucose and β-cyclodextrin, the vitamins were converted into their 25-hydroxylated products. Next, we irradiated the cell suspension with UVB and incubated at 37 °C. Surprisingly, the 25-hydroxy vitamin D 2 was produced without additional vitamin D 2 . Endogenous ergosterol was likely converted into vitamin D 2 by UV irradiation and thermal isomerization, and then the resulting vitamin D 2 was converted to 25-hydroxyvitamin D 2 by CYP2R1. This novel method for producing 25-hydroxyvitamin D 2 without a substrate could be useful for practical purposes

  5. Isolation and characterization of DNA-dependent ATPases from the Novikoff Hepatoma

    International Nuclear Information System (INIS)

    Thomas, D.C.

    1984-01-01

    Four DNA-dependent ATPases have been purified to apparent homogeneity from extracts of the Novikoff Hepatoma, and named ATPases II, III, IV, and V. The physical and enzymological properties of ATPases II, III, and V are nearly identical, and from tryptic peptide mapping these proteins were determined to be related, though they are still chromatographically distinct; all appear to be dimers. ATPaseIV is unique among the ATPases, and is probably a monomer. ATPase V appears much more stable to thermal inactivation than the similar curves generated by ATPases II, and III. ATPase IV, however, projects of a heat-inactivation curve intermediate to these two types. ATPase II is labelled to a much higher degree than the others when treated with a heterologous protein kinase using gamma-[ 32 P]-ATP. When ATPase II was treated with this kinase, and subsequently run over a DNA-cellulose column, the profile of ATPase II was found to contain small peaks of activity in the positions where ATPases III and V normally elute, suggesting that ATPase II may be a dephosphorylated form of the other two. The ATPases have been extensively characterized with respect to reaction products and requirements, substrate utilization, DNA effector requirements, and effects of ATP analogs

  6. Kinetic Basis of Nucleotide Selection Employed by a Protein Template-Dependent DNA Polymerase†

    Science.gov (United States)

    Brown, Jessica A.; Fowler, Jason D.; Suo, Zucai

    2010-01-01

    Rev1, a Y-family DNA polymerase, contributes to spontaneous and DNA damage-induced mutagenic events. In this paper, we have employed pre-steady state kinetic methodology to establish a kinetic basis for nucleotide selection by human Rev1, a unique nucleotidyl transferase that uses a protein template-directed mechanism to preferentially instruct dCTP incorporation. This work demonstrated that the high incorporation efficiency of dCTP is dependent on both substrates: an incoming dCTP and a templating base dG. The extremely low base substitution fidelity of human Rev1 (100 to 10-5) was due to the preferred misincorporation of dCTP with templating bases dA, dT, and dC over correct dNTPs. Using non-natural nucleotide analogs, we showed that hydrogen bonding interactions between residue R357 of human Rev1 and an incoming dNTP are not essential for DNA synthesis. Lastly, human Rev1 discriminates between ribonucleotides and deoxyribonucleotides mainly by reducing the rate of incorporation, and the sugar selectivity of human Rev1 is sensitive to both the size and orientation of the 2′-substituent of a ribonucleotide. PMID:20518555

  7. Recombinant Programming

    OpenAIRE

    Pawlak , Renaud; Cuesta , Carlos; Younessi , Houman

    2004-01-01

    This research report presents a promising new approach to computation called Recombinant Programming. The novelty of our approach is that it separates the program into two layers of computation: the recombination and the interpretation layer. The recombination layer takes sequences as inputs and allows the programmer to recombine these sequences through the definition of cohesive code units called extensions. The output of such recombination is a mesh that can be used by the interpretation la...

  8. Bacterial Artificial Chromosome Mutagenesis Using Recombineering

    Directory of Open Access Journals (Sweden)

    Kumaran Narayanan

    2011-01-01

    Full Text Available Gene expression from bacterial artificial chromosome (BAC clones has been demonstrated to facilitate physiologically relevant levels compared to viral and nonviral cDNA vectors. BACs are large enough to transfer intact genes in their native chromosomal setting together with flanking regulatory elements to provide all the signals for correct spatiotemporal gene expression. Until recently, the use of BACs for functional studies has been limited because their large size has inherently presented a major obstacle for introducing modifications using conventional genetic engineering strategies. The development of in vivo homologous recombination strategies based on recombineering in E. coli has helped resolve this problem by enabling facile engineering of high molecular weight BAC DNA without dependence on suitably placed restriction enzymes or cloning steps. These techniques have considerably expanded the possibilities for studying functional genetics using BACs in vitro and in vivo.

  9. Salt-Dependent DNA-DNA Spacings in Intact Bacteriophage lambda Reflect Relative Importance of DNA Self-Repulsion and Bending Energies

    Energy Technology Data Exchange (ETDEWEB)

    X Qiu; D Rau; V Parsegian; L Fang; C Knobler; W Gelbart

    2011-12-31

    Using solution synchrotron x-ray scattering, we measure the variation of DNA-DNA d spacings in bacteriophage {lambda} with mono-, di-, and polyvalent salt concentrations, for wild-type [48.5 x 10{sup 3} base pairs (bp)] and short-genome-mutant (37.8 kbp) strains. From the decrease in d spacings with increasing salt, we deduce the relative contributions of DNA self-repulsion and bending to the energetics of packaged phage genomes. We quantify the DNA-DNA interaction energies within the intact phage by combining the measured d spacings in the capsid with measurements of osmotic pressure in DNA assemblies under the same salt conditions in bulk solution. In the commonly used Tris-Mg buffer, the DNA-DNA interaction energies inside the phage capsids are shown to be about 1 kT/bp, an order of magnitude larger than the bending energies.

  10. Cell cycle phase dependent role of DNA polymerase beta in DNA repair and survival after ionizing radiation.

    NARCIS (Netherlands)

    Vermeulen, C.; Verwijs-Janssen, M.; Begg, A.C.; Vens, C.

    2008-01-01

    PURPOSE: The purpose of the present study was to determine the role of DNA polymerase beta in repair and response after ionizing radiation in different phases of the cell cycle. METHODS AND MATERIALS: Synchronized cells deficient and proficient in DNA polymerase beta were irradiated in different

  11. Genetic determinants of PAM-dependent DNA targeting and pre-crRNA processing in Sulfolobus islandicus

    DEFF Research Database (Denmark)

    Peng, Wenfang; Li, Huan; Hallstrøm, Søren

    2013-01-01

    -adjacent motif (PAM)-dependent DNA targeting activity and mature CRISPR RNA (crRNA) production in this organism, mutants deleting individual genes of the type IA system or removing each of other Cas modules were constructed. Characterization of these mutants revealed that Cas7, Cas5, Cas6, Cas3' and Cas3......" are essential for PAM-dependent DNA targeting activity, whereas Csa5, along with all other Cas modules, is dispensable for the targeting in the crenarchaeon. Cas6 is implicated as the only enzyme for pre-crRNA processing and the crRNA maturation is independent of the DNA targeting activity. Importantly, we show...

  12. Mycobacterium tuberculosis UvrB Is a Robust DNA-Stimulated ATPase That Also Possesses Structure-Specific ATP-Dependent DNA Helicase Activity.

    Science.gov (United States)

    Thakur, Manoj; Kumar, Mohan B J; Muniyappa, K

    2016-10-18

    Much is known about the Escherichia coli nucleotide excision repair (NER) pathway; however, very little is understood about the proteins involved and the molecular mechanism of NER in mycobacteria. In this study, we show that Mycobacterium tuberculosis UvrB (MtUvrB), which exists in solution as a monomer, binds to DNA in a structure-dependent manner. A systematic examination of MtUvrB substrate specificity reveals that it associates preferentially with single-stranded DNA, duplexes with 3' or 5' overhangs, and linear duplex DNA with splayed arms. Whereas E. coli UvrB (EcUvrB) binds weakly to undamaged DNA and has no ATPase activity, MtUvrB possesses intrinsic ATPase activity that is greatly stimulated by both single- and double-stranded DNA. Strikingly, we found that MtUvrB, but not EcUvrB, possesses the DNA unwinding activity characteristic of an ATP-dependent DNA helicase. The helicase activity of MtUvrB proceeds in the 3' to 5' direction and is strongly modulated by a nontranslocating 5' single-stranded tail, indicating that in addition to the translocating strand it also interacts with the 5' end of the substrate. The fraction of DNA unwound by MtUvrB decreases significantly as the length of the duplex increases: it fails to unwind duplexes longer than 70 bp. These results, on one hand, reveal significant mechanistic differences between MtUvrB and EcUvrB and, on the other, support an alternative role for UvrB in the processing of key DNA replication intermediates. Altogether, our findings provide insights into the catalytic functions of UvrB and lay the foundation for further understanding of the NER pathway in M. tuberculosis.

  13. Oligonucleotide recombination enabled site-specific mutagenesis in bacteria

    Science.gov (United States)

    Recombineering refers to a strategy for engineering DNA sequences using a specialized mode of homologous recombination. This technology can be used for rapidly constructing precise changes in bacterial genome sequences in vivo. Oligo recombination is one type of recombineering that uses ssDNA olig...

  14. Systemically administered DNA and fowlpox recombinants expressing four vaccinia virus genes although immunogenic do not protect mice against the highly pathogenic IHD-J vaccinia strain.

    Science.gov (United States)

    Bissa, Massimiliano; Pacchioni, Sole Maria; Zanotto, Carlo; De Giuli Morghen, Carlo; Illiano, Elena; Granucci, Francesca; Zanoni, Ivan; Broggi, Achille; Radaelli, Antonia

    2013-12-26

    The first-generation smallpox vaccine was based on live vaccinia virus (VV) and it successfully eradicated the disease worldwide. Therefore, it was not administered any more after 1980, as smallpox no longer existed as a natural infection. However, emerging threats by terrorist organisations has prompted new programmes for second-generation vaccine development based on attenuated VV strains, which have been shown to cause rare but serious adverse events in immunocompromised patients. Considering the closely related animal poxviruses that might also be used as bioweapons, and the increasing number of unvaccinated young people and AIDS-affected immunocompromised subjects, a safer and more effective smallpox vaccine is still required. New avipoxvirus-based vectors should improve the safety of conventional vaccines, and protect from newly emerging zoonotic orthopoxvirus diseases and from the threat of deliberate release of variola or monkeypox virus in a bioterrorist attack. In this study, DNA and fowlpox recombinants expressing the L1R, A27L, A33R and B5R genes were constructed and evaluated in a pre-clinical trial in mouse, following six prime/boost immunisation regimens, to compare their immunogenicity and protective efficacy against a challenge with the lethal VV IHD-J strain. Although higher numbers of VV-specific IFNγ-producing T lymphocytes were observed in the protected mice, the cytotoxic T-lymphocyte response and the presence of neutralising antibodies did not always correlate with protection. In spite of previous successful results in mice, rabbits and monkeys, where SIV/HIV transgenes were expressed by the fowlpox vector, the immune response elicited by these recombinants was low, and most of the mice were not protected. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Human RECQ5 helicase promotes repair of DNA double-strand breaks by synthesis-dependent strand annealing

    Czech Academy of Sciences Publication Activity Database

    Paliwal, S.; Kanagaraj, R.; Sturzenegger, A.; Burdová, Kamila; Janščák, Pavel

    2014-01-01

    Roč. 42, č. 4 (2014), s. 2380-2390 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565; GA ČR GAP305/10/0281 Grant - others:Swiss National Science Foundation(CH) 31003A-129747; Swiss National Science Foundation(CH) 31003A_146206 Institutional support: RVO:68378050 Keywords : Human RECQ5 helicase * DNA double-strand breaks * mitotic homologous recombination Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  16. The Effect of Basepair Mismatch on DNA Strand Displacement

    OpenAIRE

    Broadwater, D.?W.?Bo; Kim, Harold?D.

    2016-01-01

    DNA strand displacement is a key reaction in DNA homologous recombination and DNA mismatch repair and is also heavily utilized in DNA-based computation and locomotion. Despite its ubiquity in science and engineering, sequence-dependent effects of displacement kinetics have not been extensively characterized. Here, we measured toehold-mediated strand displacement kinetics using single-molecule fluorescence in the presence of a single base pair mismatch. The apparent displacement rate varied si...

  17. Generation and CRISPR/Cas9 editing of transformed progenitor B cells as a pseudo-physiological system to study DNA repair gene function in V(D)J recombination.

    Science.gov (United States)

    Lenden Hasse, Hélène; Lescale, Chloé; Bianchi, Joy J; Yu, Wei; Bedora-Faure, Marie; Deriano, Ludovic

    2017-12-01

    Antigen receptor gene assembly is accomplished in developing lymphocytes by the V(D)J recombination reaction, which can be separated into two steps: DNA cleavage by the recombination-activating gene (RAG) nuclease and joining of DNA double strand breaks (DSBs) by components of the nonhomologous end joining (NHEJ) pathway. Deficiencies for NHEJ factors can result in immunodeficiency and a propensity to accumulate genomic instability, thus highlighting the importance of identifying all players in this process and deciphering their functions. Bcl2 transgenic v-Abl kinase-transformed pro-B cells provide a pseudo-physiological cellular system to study V(D)J recombination. Treatment of v-Abl/Bcl2 pro-B cells with the Abl kinase inhibitor Imatinib leads to G1 cell cycle arrest, the rapid induction of Rag1/2 gene expression and V(D)J recombination. In this system, the Bcl2 transgene alleviates Imatinib-induced apoptosis enabling the analysis of induced V(D)J recombination. Although powerful, the use of mouse models carrying the Bcl2 transgene for the generation of v-Abl pro-B cell lines is time and money consuming. Here, we describe a method for generating v-Abl/Bcl2 pro-B cell lines from wild type mice and for performing gene knock-out using episomal CRISPR/Cas9 targeting vectors. Using this approach, we generated distinct NHEJ-deficient pro-B cell lines and quantified V(D)J recombination levels in these cells. Furthermore, this methodology can be adapted to generate pro-B cell lines deficient for any gene suspected to play a role in V(D)J recombination, and more generally DSB repair. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  18. Temperature-dependent photoluminescence analysis of 1-MeV electron irradiation-induced nonradiative recombination centers in GaAs/Ge space solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Tiancheng, Yi; Pengfei, Xiao; Yong, Zheng; Juan, Tang; Rong, Wang, E-mail: wangr@bnu.edu.cn

    2016-03-01

    The effects of irradiation of 1-MeV electrons on p{sup +}–n GaAs/Ge solar cells have been investigated by temperature-dependent photoluminescence (PL) measurements in the temperature range of 10–290 K. The temperature dependence of the PL peak energy agrees well with the Varnish relation, and the thermal quenching of the total integrated PL intensity is well explained by the thermal quenching theory. Meanwhile, the thermal quenching of temperature-dependent PL confirmed that there are two nonradiative recombination centers in the solar cells, and the thermal activation energies of these centers are determined by Arrhenius plots of the total integrated PL intensity. Furthermore, the nonradiative recombination center, as a primary defect, is identified as the H3 hole trap located at E{sub v} + 0.71 eV at room temperature and the H2 hole trap located at E{sub v} + 0.41 eV in the temperature range of 100–200 K, by comparing the thermal activation and ionization energies of the defects.

  19. Neutralizing Antibody Response and Efficacy of Novel Recombinant Tetravalent Dengue DNA Vaccine Comprising Envelope Domain III in Mice

    Directory of Open Access Journals (Sweden)

    Ajit Kulkarni

    2017-03-01

    Full Text Available Background: Dengue is a global arboviral threat to humans; causing 390 million infections per year. The availability of safe and effective tetravalent dengue vaccine is a global requirement to prevent epidemics, morbidity, and mortality associated with it. Methods: Five experimental groups (6 mice per group each of 5-week-old BALB/c mice were immunized with vaccine and placebo (empty plasmid (100 µg, i.m. on days 0, 14 and 28. Among these, four groups (one group per serotype of each were subsequently challenged 3 weeks after the last boost with dengue virus (DENV serotypes 1-4 (100 LD50, 20 µl intracerebrally to determine vaccine efficacy. The fifth group of each was used as a control. The PBS immunized group was used as mock control. Serum samples were collected before and after subsequent immunizations. EDIII fusion protein expression was determined by Western blot. Total protein concentration was measured by Bradford assay. Neutralizing antibodies were assessed by TCID50-CPE inhibition assay. Statistical analysis was performed using Stata/IC 10.1 software for Windows. One-way repeated measures ANOVA and Mann-Whitney test were used for neutralizing antibody analysis and vaccine efficacy, respectively. Results: The recombinant EDIII fusion protein was expressed adequately in transfected 293T cells. Total protein concentration was almost 3 times more than the control. Vaccine candidate induced neutralizing antibodies against all four DENV serotypes with a notable increase after subsequent boosters. Vaccine efficacy was 83.3% (DENV-1, -3, -4 and 50% (DENV-2. Conclusion: Our results suggest that vaccine is immunogenic and protective; however, further studies are required to improve the immunogenicity particularly against DENV-2.

  20. Sequential priming with simian immunodeficiency virus (SIV) DNA vaccines, with or without encoded cytokines, and a replicating adenovirus-SIV recombinant followed by protein boosting does not control a pathogenic SIVmac251 mucosal challenge.

    Science.gov (United States)

    Demberg, Thorsten; Boyer, Jean D; Malkevich, Nina; Patterson, L Jean; Venzon, David; Summers, Ebonita L; Kalisz, Irene; Kalyanaraman, V S; Lee, Eun Mi; Weiner, David B; Robert-Guroff, Marjorie

    2008-11-01

    Previously, combination DNA/nonreplicating adenovirus (Ad)- or poxvirus-vectored vaccines have strongly protected against SHIV(89.6P), DNAs expressing cytokines have modulated immunity elicited by DNA vaccines, and replication-competent Ad-recombinant priming and protein boosting has strongly protected against simian immunodeficiency virus (SIV) challenge. Here we evaluated a vaccine strategy composed of these promising components. Seven rhesus macaques per group were primed twice with multigenic SIV plasmid DNA with or without interleukin-12 (IL-12) DNA or IL-15 DNA. After a multigenic replicating Ad-SIV immunization, all groups received two booster immunizations with SIV gp140 and SIV Nef protein. Four control macaques received control DNA plasmids, empty Ad vector, and adjuvant. All vaccine components were immunogenic, but the cytokine DNAs had little effect. Macaques that received IL-15-DNA exhibited higher peak anti-Nef titers, a more rapid anti-Nef anamnestic response postchallenge, and expanded CD8(CM) T cells 2 weeks postchallenge compared to the DNA-only group. Other immune responses were indistinguishable between groups. Overall, no protection against intrarectal challenge with SIV(mac251) was observed, although immunized non-Mamu-A*01 macaques as a group exhibited a statistically significant 1-log decline in acute viremia compared to non-Mamu-A*01 controls. Possible factors contributing to the poor outcome include administration of cytokine DNAs to sites different from the Ad recombinants (intramuscular and intratracheal, respectively), too few DNA priming immunizations, a suboptimal DNA delivery method, failure to ensure delivery of SIV and cytokine plasmids to the same cell, and instability and short half-life of the IL-15 component. Future experiments should address these issues to determine if this combination approach is able to control a virulent SIV challenge.

  1. Mycobacterial UvrD1 is a Ku-dependent DNA helicase that plays a role in multiple DNA repair events, including double-strand break repair.

    Science.gov (United States)

    Sinha, Krishna Murari; Stephanou, Nicolas C; Gao, Feng; Glickman, Michael S; Shuman, Stewart

    2007-05-18

    Mycobacterium tuberculosis and other bacterial pathogens have a Ku-dependent nonhomologous end joining pathway of DNA double-strand break repair. Here we identify mycobacterial UvrD1 as a novel interaction partner for Ku in a genome-wide yeast two-hybrid screen. UvrD1 per se is a vigorous DNA-dependent ATPase but a feeble DNA helicase. Ku stimulates UvrD1 to catalyze ATP-dependent unwinding of 3'-tailed DNAs. UvrD1, Ku, and DNA form a stable ternary complex in the absence of ATP. The Ku binding determinants are located in the distinctive C-terminal segment of UvrD1. A second mycobacterial paralog, UvrD2, is a vigorous Ku-independent DNA helicase. Ablation of UvrD1 sensitizes Mycobacterium smegmatis to killing by ultraviolet and ionizing radiation and to a single chromosomal break generated by I-SceI endonuclease. The physical and functional interactions of bacterial Ku and UvrD1 highlight the potential for cross-talk between components of nonhomologous end joining and nucleotide excision repair pathways.

  2. DNA adducts and liver DNA replication in rats during chronic exposure to N-nitrosodimethylamine (NDMA) and their relationships to the dose-dependence of NDMA hepatocarcinogenesis.

    Science.gov (United States)

    Souliotis, Vassilis L; Henneman, John R; Reed, Carl D; Chhabra, Saranjit K; Diwan, Bhalchandra A; Anderson, Lucy M; Kyrtopoulos, Soterios A

    2002-03-20

    Exposure of rats to the hepatocarcinogen N-nitrosodimethylamine (NDMA) (0.2-2.64 ppm in the drinking water) for up to 180 days resulted in rapid accumulation of N7- and O6-methylguanine in liver and white blood cell DNA, maximum adduct levels being reached within 1-7 days, depending on the dose. The levels of both adducts remained constant up to treatment day 28, subsequently declining slowly to about 40% of maximal levels for the liver and 60% for white blood cells by day 180. In order to elucidate the role of DNA replication in NDMA hepatocarcinogenesis, changes in liver cell labeling index (LI) were also measured on treatment days 21, 120 and 180. Although the time- and dose-dependence of the observed effects were complex, a clear trend towards increased rates of hepatocyte LI, as indicated by BrdU incorporation, with increasing NDMA doses was evident, particularly above 1 ppm, a concentration above which NDMA hepatocarcinogenicity is known to increase sharply. In contrast, no increase in Kupffer cell DNA replication was found at any of the doses employed, in accordance with the low susceptibility of these cells to NDMA-induced carcinogenesis. No significant increase in the occurrence of necrotic or apoptotic cells was noted under the treatment conditions employed. These results suggest that, in addition to the accumulation of DNA damage, alterations in hepatocyte DNA replication during the chronic NDMA exposure may influence the dose-dependence of its carcinogenic efficacy.

  3. The response of mammalian cells to UV-light reveals Rad54-dependent and independent pathways of homologous recombination

    DEFF Research Database (Denmark)

    Eppink, Berina; Tafel, Agnieszka A; Hanada, Katsuhiro

    2011-01-01

    with lesions in replicating DNA. The core HR protein in mammalian cells is the strand exchange protein RAD51, which is aided by numerous proteins, including RAD54. We used RAD54 as a cellular marker for HR to study the response of mammalian embryonic stem (ES) cells to UV irradiation. In contrast to yeast, ES...

  4. Local HPV Recombinant Vaccinia Boost Following Priming with an HPV DNA Vaccine Enhances Local HPV-Specific CD8+ T Cell Mediated Tumor Control in the Genital Tract

    Science.gov (United States)

    Sun, Yun-Yan; Peng, Shiwen; Han, Liping; Qiu, Jin; Song, Liwen; Tsai, Yachea; Yang, Benjamin; Roden, Richard B.S.; Trimble, Cornelia L.; Hung, Chien-Fu; Wu, T-C

    2015-01-01

    Purpose Two viral oncoproteins, E6 and E7, are expressed in all human papillomavirus (HPV)-infected cells, from initial infection in the genital tract to metastatic cervical cancer. Intramuscular vaccination of women with high grade cervical intraepithelial neoplasia (CIN2/3) twice with a naked DNA vaccine, pNGVL4a-sig/E7(detox)/HSP70, and a single boost with HPVE6/E7 recombinant vaccinia vaccine (TA-HPV) elicited systemic HPV-specific CD8 T cell responses that could traffic to the lesion and was associated with regression in some patients (NCT00788164). Experimental Design Here we examine whether alteration of this vaccination regimen by administration of TA-HPV vaccination in the cervicovaginal tract, rather than IM delivery, can more effectively recruit antigen-specific T cells in an orthotopic syngeneic mouse model of HPV16+ cervical cancer (TC-1 luc). Results We found that pNGVL4a-sig/E7(detox)/HSP70 vaccination followed by cervicovaginal vaccination with TA-HPV increased accumulation of total and E7-specific CD8+ T cells in the cervicovaginal tract and better controlled E7-expressing cervicovaginal TC-1 luc tumor than IM administration of TA-HPV. Furthermore, the E7-specific CD8+ T cells in the cervicovaginal tract generated through the cervicovaginal route of vaccination expressed the α4β7 integrin and CCR9, which are necessary for the homing of the E7-specific CD8+ T cells to the cervicovaginal tract. Finally, we show that cervicovaginal vaccination with TA-HPV can induce potent local HPV-16 E7 antigen-specific CD8+ T cell immune responses regardless of whether an HPV DNA vaccine priming vaccination was administered IM or within the cervicovaginal tract. Conclusions Our results support future clinical translation using cervicovaginal TA-HPV vaccination. PMID:26420854

  5. Distribution of AAV8 particles in cell lysates and culture media changes with time and is dependent on the recombinant vector

    Directory of Open Access Journals (Sweden)

    Bryan A Piras

    2016-01-01

    Full Text Available With clinical trials ongoing, efficient clinical production of adeno-associated virus (AAV to treat large numbers of patients remains a challenge. We compared distribution of AAV8 packaged with Factor VIII (FVIII in cell culture media and lysates on days 3, 5, 6, and 7 post-transfection and found increasing viral production through day 6, with the proportion of viral particles in the media increasing from 76% at day 3 to 94% by day 7. Compared to FVIII, AAV8 packaged with Factor IX and Protective Protein/Cathepsin A vectors demonstrated a greater shift from lysate towards media from day 3 to 6, implying that particle distribution is dependent on recombinant vector. Larger-scale productions showed that the ratio of full-to-empty AAV particles is similar in media and lysate, and that AAV harvested on day 6 post-transfection provides equivalent function in mice compared to AAV harvested on day 3. This demonstrates that AAV8 production can be optimized by prolonging the duration of culture post-transfection, and simplified by allowing harvest of media only, with disposal of cells that contain 10% or less of total vector yield. Additionally, the difference in particle distribution with different expression cassettes implies a recombinant vector-dependent processing mechanism which should be taken into account during process development.

  6. Topoisomerase II Inhibitors Induce DNA Damage-Dependent Interferon Responses Circumventing Ebola Virus Immune Evasion

    Directory of Open Access Journals (Sweden)

    Priya Luthra

    2017-04-01

    Full Text Available Ebola virus (EBOV protein VP35 inhibits production of interferon alpha/beta (IFN by blocking RIG-I-like receptor signaling pathways, thereby promoting virus replication and pathogenesis. A high-throughput screening assay, developed to identify compounds that either inhibit or bypass VP35 IFN-antagonist function, identified five DNA intercalators as reproducible hits from a library of bioactive compounds. Four, including doxorubicin and daunorubicin, are anthracycline antibiotics that inhibit topoisomerase II and are used clinically as chemotherapeutic drugs. These compounds were demonstrated to induce IFN responses in an ATM kinase-dependent manner and to also trigger the DNA-sensing cGAS-STING pathway of IFN induction. These compounds also suppress EBOV replication in vitro and induce IFN in the presence of IFN-antagonist proteins from multiple negative-sense RNA viruses. These findings provide new insights into signaling pathways activated by important chemotherapy drugs and identify a novel therapeutic approach for IFN induction that may be exploited to inhibit RNA virus replication.

  7. Position dependent mismatch discrimination on DNA microarrays – experiments and model

    Directory of Open Access Journals (Sweden)

    Michel Wolfgang

    2008-12-01

    Full Text Available Abstract Background The propensity of oligonucleotide strands to form stable duplexes with complementary sequences is fundamental to a variety of biological and biotechnological processes as various as microRNA signalling, microarray hybridization and PCR. Yet our understanding of oligonucleotide hybridization, in particular in presence of surfaces, is rather limited. Here we use oligonucleotide microarrays made in-house by optically controlled DNA synthesis to produce probe sets comprising all possible single base mismatches and base bulges for each of 20 sequence motifs under study. Results We observe that mismatch discrimination is mostly determined by the defect position (relative to the duplex ends as well as by the sequence context. We investigate the thermodynamics of the oligonucleotide duplexes on the basis of double-ended molecular zipper. Theoretical predictions of defect positional influence as well as long range sequence influence agree well with the experimental results. Conclusion Molecular zipping at thermodynamic equilibrium explains the binding affinity of mismatched DNA duplexes on microarrays well. The position dependent nearest neighbor model (PDNN can be inferred from it. Quantitative understanding of microarray experiments from first principles is in reach.

  8. LET dependence of the production of oxidative DNA damage in mammalian cells

    International Nuclear Information System (INIS)

    Ito, Atsushi; Furuichi, Wataru; Inoguchi, Hiroki; Hirayama, Ryoichi; Murayama, Chieko; Furusawa, Yoshiya

    2006-01-01

    Production of 8-hydroxy-2'-deoxyguanosine (8-OHdG) in human leukemia HL-60 cells was examined upon irradiation with carbon, neon silicon ions. Cell suspension with the concentration of 1 x 10 7 /ml was irradiated tinder air-saturated condition. After irradiation cells were subjected to the DNA extraction using isopropanol, separation of DNA strands by heat treatment, digestion into nucleosides with nuclease P1 and alkaline phosphatase. A single peak of 8-OHdG on a chromatogram was observed using newly installed ECD detector (Coulochem III; ESA, Inc. U.S.A.). Reproducibility was also greatly improved with this detector. 8-OHdG yield was decreased with increasing linear energy transfer (LET) for carbon and silicon beam. These results are in good accordance with those of dG solution which was previously reported by us. Ion species dependence in 8-OHdG yield was not so apparent through the comparison of carbon and neon beam with an LET of 80 keV/μm and neon and silicon beam with an LET of 150 keV/μm. (author)

  9. Distinct DNA-binding surfaces in the ATPase and linker domains of MutLγ determine its substrate specificities and exert separable functions in meiotic recombination and mismatch repair.

    Directory of Open Access Journals (Sweden)

    Corentin Claeys Bouuaert

    2017-05-01

    Full Text Available Mlh1-Mlh3 (MutLγ is a mismatch repair factor with a central role in formation of meiotic crossovers, presumably through resolution of double Holliday junctions. MutLγ has DNA-binding, nuclease, and ATPase activities, but how these relate to one another and to in vivo functions are unclear. Here, we combine biochemical and genetic analyses to characterize Saccharomyces cerevisiae MutLγ. Limited proteolysis and atomic force microscopy showed that purified recombinant MutLγ undergoes ATP-driven conformational changes. In vitro, MutLγ displayed separable DNA-binding activities toward Holliday junctions (HJ and, surprisingly, single-stranded DNA (ssDNA, which was not predicted from current models. MutLγ bound DNA cooperatively, could bind multiple substrates simultaneously, and formed higher-order complexes. FeBABE hydroxyl radical footprinting indicated that the DNA-binding interfaces of MutLγ for ssDNA and HJ substrates only partially overlap. Most contacts with HJ substrates were located in the linker regions of MutLγ, whereas ssDNA contacts mapped within linker regions as well as the N-terminal ATPase domains. Using yeast genetic assays for mismatch repair and meiotic recombination, we found that mutations within different DNA-binding surfaces exert separable effects in vivo. For example, mutations within the Mlh1 linker conferred little or no meiotic phenotype but led to mismatch repair deficiency. Interestingly, mutations in the N-terminal domain of Mlh1 caused a stronger meiotic defect than mlh1Δ, suggesting that the mutant proteins retain an activity that interferes with alternative recombination pathways. Furthermore, mlh3Δ caused more chromosome missegregation than mlh1Δ, whereas mlh1Δ but not mlh3Δ partially alleviated meiotic defects of msh5Δ mutants. These findings illustrate functional differences between Mlh1 and Mlh3 during meiosis and suggest that their absence impinges on chromosome segregation not only via reduced

  10. RFWD3-Mediated Ubiquitination Promotes Timely Removal of Both RPA and RAD51 from DNA Damage Sites to Facilitate Homologous Recombination.

    Science.gov (United States)

    Inano, Shojiro; Sato, Koichi; Katsuki, Yoko; Kobayashi, Wataru; Tanaka, Hiroki; Nakajima, Kazuhiro; Nakada, Shinichiro; Miyoshi, Hiroyuki; Knies, Kerstin; Takaori-Kondo, Akifumi; Schindler, Detlev; Ishiai, Masamichi; Kurumizaka, Hitoshi; Takata, Minoru

    2017-06-01

    RFWD3 is a recently identified Fanconi anemia protein FANCW whose E3 ligase activity toward RPA is essential in homologous recombination (HR) repair. However, how RPA ubiquitination promotes HR remained unknown. Here, we identified RAD51, the central HR protein, as another target of RFWD3. We show that RFWD3 polyubiquitinates both RPA and RAD51 in vitro and in vivo. Phosphorylation by ATR and ATM kinases is required for this activity in vivo. RFWD3 inhibits persistent mitomycin C (MMC)-induced RAD51 and RPA foci by promoting VCP/p97-mediated protein dynamics and subsequent degradation. Furthermore, MMC-induced chromatin loading of MCM8 and RAD54 is defective in cells with inactivated RFWD3 or expressing a ubiquitination-deficient mutant RAD51. Collectively, our data reveal a mechanism that facilitates timely removal of RPA and RAD51 from DNA damage sites, which is crucial for progression to the late-phase HR and suppression of the FA phenotype. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. A radioimmunoassay of chicken growth hormone using growth hormone produced by recombinant DNA technology: validation and observations of plasma hormone variations in genetically fat and lean chickens

    International Nuclear Information System (INIS)

    Picaper, G.; Leclercq, B.; Saadoun, A.; Mongin, P.

    1986-01-01

    A radioimmunoassay (RIA) of chicken growth hormone (c-GH) has been developed using growth hormone produced by recombinant DNA technology. The best rabbit antiserum was used at 1/300,000 final dilution. Hormone labelling by iodine-125, achieved by chloramine T, allowed a specific activity of 3.7 MBq/μg. The equilibrium curves show that optimal conditions of incubation were reached at room temperature for 24h. This RIA used a second sheep antibody which precipitated the whole c-GH bound to the first antibody in the presence of polyethylene glycol solution (6%) at room temperature for 30 min. In our conditions, sensitivity was about 30 pg of c-GH per tube. Coefficient of variation was around 10%. No cross reaction was found with avian LH and prolactin. Thyrotrophin-releasing hormone (TRH) injection to young chickens induced 20-fold higher plasma c-GH concentrations. Simultaneous injection of somatostatin and TRH slightly reduced these concentrations. Hypoglycemia induced by insulin led to a drop of the plasma c-GH concentration. Conversely, refeeding or glucose load induced slight increases of the c-GH level. Genetically fat chickens tended to exhibit higher plasma c-GH concentrations than lean chickens

  12. DNA methyltransferase mediates dose-dependent stimulation of neural stem cell proliferation by folate.

    Science.gov (United States)

    Li, Wen; Yu, Min; Luo, Suhui; Liu, Huan; Gao, Yuxia; Wilson, John X; Huang, Guowei

    2013-07-01

    The proliferative response of neural stem cells (NSCs) to folate may play a critical role in the development, function and repair of the central nervous system. It is important to determine the dose-dependent effects of folate in NSC cultures that are potential sources of transplantable cells for therapies for neurodegenerative diseases. To determine the optimal concentration and mechanism of action of folate for stimulation of NSC proliferation in vitro, NSCs were exposed to folic acid or 5-methyltetrahydrofolate (5-MTHF) (0-200 μmol/L) for 24, 48 or 72 h. Immunocytochemistry and methyl thiazolyl tetrazolium assay showed that the optimal concentration of folic acid for NSC proliferation was 20-40 μmol/L. Stimulation of NSC proliferation by folic acid was associated with DNA methyltransferase (DNMT) activation and was attenuated by the DNMT inhibitor zebularine, which implies that folate dose-dependently stimulates NSC proliferation through a DNMT-dependent mechanism. Based on these new findings and previously published evidence, we have identified a mechanism by which folate stimulates NSC growth. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. Recombinational repair: workshop summary

    International Nuclear Information System (INIS)

    Howard-Flanders, P.

    1983-01-01

    Recombinational repair may or may not be synonymous with postreplication repair. Considerable progress has been made in the study of the relevant enzymes, particularly those from bacteria. In this workshop we focus on the recombination enzyme RecA protein. What structural changes take place in the protein and in DNA during repair. How does homologous pairing take place. How is ATP hydrolysis coupled to the stand exchange reaction and the formation of heteroduplx DNA. Turning to another enzyme needed for certain kinds of bacterial recombination, we will ask whether the purified recB protein and recC protein complement each other and are sufficient for exonuclease V activity. In higher cells, we would like to know whether sister exchanges, which occur in bacteria after uv irradiation, are also seen in animal cells

  14. Chicken line-dependent mortality after experimental infection with three type IIxIII recombinant Toxoplasma gondii clones.

    Science.gov (United States)

    Schares, G; Herrmann, D C; Maksimov, P; Matzkeit, B; Conraths, F J; Moré, G; Preisinger, R; Weigend, S

    2017-09-01

    Three genetically different clones of Toxoplasma gondii, also different in mouse virulence, were studied by experimental infection in chickens. For the experiments, four chicken lines were used, which differed in phylogenetic origin and performance level: two white egg layer lines, one with high laying performance (WLA), one with low (R11) and two brown layer lines, also displaying high (BLA) and low (L68) egg number. Chickens were intraperitoneally infected with three different T. gondii isolates representing type IIxIII recombinant clones, i.e. showing both, type II- and type III-specific alleles. These clones (K119/2 2C10, B136/1 B6H6, K119/2 A7) had exhibited virulence differences in a mouse model. In chickens, a significantly higher mortality was observed in white layer lines, but not in brown layer lines, suggesting that differences in the phylogenetic background may influence the susceptibility of chickens for toxoplasmosis. In addition, antibody (IgY) levels varied in surviving chickens at 31 days post infection. While low to intermediate antibody levels were observed in white layers, intermediate to high levels were measured in brown layers. Infection with a T. gondii clone showing low chicken virulence resulted in higher antibody levels in all chicken lines compared to infection with T. gondii clones of intermediate or high chicken virulence. This was in agreement with the parasite load as determined by real-time PCR. Overall, results show that progeny resulting from natural sexual recombination of T. gondii clonal lineages, may differ in their virulence for mice and chickens. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Mechanisms and Regulation of Mitotic Recombination in Saccharomyces cerevisiae

    Science.gov (United States)

    Symington, Lorraine S.; Rothstein, Rodney; Lisby, Michael

    2014-01-01

    Homology-dependent exchange of genetic information between DNA molecules has a profound impact on the maintenance of genome integrity by facilitating error-free DNA repair, replication, and chromosome segregation during cell division as well as programmed cell developmental events. This chapter will focus on homologous mitotic recombination in budding yeast Saccharomyces cerevisiae. However, there is an important link between mitotic and meiotic recombination (covered in the forthcoming chapter by Hunter et al. 2015) and many of the functions are evolutionarily conserved. Here we will discuss several models that have been proposed to explain the mechanism of mitotic recombination, the genes and proteins involved in various pathways, the genetic and physical assays used to discover and study these genes, and the roles of many of these proteins inside the cell. PMID:25381364

  16. RTEL1 maintains genomic stability by suppressing homologous recombination.

    Science.gov (United States)

    Barber, Louise J; Youds, Jillian L; Ward, Jordan D; McIlwraith, Michael J; O'Neil, Nigel J; Petalcorin, Mark I R; Martin, Julie S; Collis, Spencer J; Cantor, Sharon B; Auclair, Melissa; Tissenbaum, Heidi; West, Stephen C; Rose, Ann M; Boulton, Simon J

    2008-10-17

    Homologous recombination (HR) is an important conserved process for DNA repair and ensures maintenance of genome integrity. Inappropriate HR causes gross chromosomal rearrangements and tumorigenesis in mammals. In yeast, the Srs2 helicase eliminates inappropriate recombination events, but the functional equivalent of Srs2 in higher eukaryotes has been elusive. Here, we identify C. elegans RTEL-1 as a functional analog of Srs2 and describe its vertebrate counterpart, RTEL1, which is required for genome stability and tumor avoidance. We find that rtel-1 mutant worms and RTEL1-depleted human cells share characteristic phenotypes with yeast srs2 mutants: lethality upon deletion of the sgs1/BLM homolog, hyperrecombination, and DNA damage sensitivity. In vitro, purified human RTEL1 antagonizes HR by promoting the disassembly of D loop recombination intermediates in a reaction dependent upon ATP hydrolysis. We propose that loss of HR control after deregulation of RTEL1 may be a critical event that drives genome instability and cancer.

  17. DNA double strand break repair is enhanced by P53 following induction by DNA damage and is dependent on the C-terminal domain of P53

    International Nuclear Information System (INIS)

    Wei Tang; Powell, Simon N.

    1996-01-01

    Purpose: The tumor suppressor gene p53 can mediate cell cycle arrest or apoptosis in response to DNA damage. Accumulating evidence suggests that it may also directly or indirectly influence the DNA repair machinery. In the present study, we investigated whether p53, induced by DNA damage, could enhance the rejoining of double-strand DNA breaks. Materials and Methods: DNA double-strand breaks (dsb) were made by restriction enzyme digestion of a plasmid, between a promoter and a 'reporter' gene: luciferase (LUC) or chloramphenicol acetyl-transferase (CAT). Linear or circular plasmid DNA (LUC or CAT) was co-transfected with circular β-Gal plasmid (to normalize for uptake) into mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) for p53. Their ability to rejoin linearized plasmid was measured by the luciferase or CAT activity detected in rescued plasmids. The activity detected in cells transfected with linear plasmid was scored relative to the activity detected in cells transfected with circular plasmid. Results: Ionizing radiation (IR, 2 Gy) enhanced the dsb repair activity in wild type p53 cells; however, p53 null cells lose this effect, indicating that the enhancement of dsb repair was p53-dependent. REF cells with dominant-negative mutant p53 showed a similar induction compared with the parental REF cells with wild-type p53. This ala-143 mutant p53 prevents cell cycle arrest and transactivation of p21 WAF1/cip1) following IR, indicating that the p53-dependent enhancement of DNA repair is distinct from transactivation. Immortalized murine embryonic fibroblasts, 10(1)VasK1 cells, which express p53 cDNA encoding a temperature-sensitive mutant in the DNA sequence specific binding domain (ala135 to val135) with an alternatively spliced C-terminal domain (ASp53: amino-acids 360-381) and, 10(1)Val5 cells, which express the normal spliced p53 (NSp53) with the same temperature-sensitive mutant were compared. It was found that 10(1)VasK1 cells showed no DNA

  18. Wavelength dependence for the photoreactions of DNA-Psoralen monoadducts. 1. Photoreversal of monoadducts

    International Nuclear Information System (INIS)

    Shi, Y.; Hearst, J.E.

    1987-01-01

    The authors have studied the wavelength dependence for the photoreversal of a monoadducted psoralen derivative, HMT [4'(hydroxymethyl)-4,5',8-trimethylpsoralen], in a single-stranded deoxyoligonucleotide (5'-GAAGCTACGAGC-3'). The psoralen was covalently attached to the thymidine residue in the oligonucleotide as either a furan-side monoadduct, which is formed through the cycloaddition between the 4',5' double bond of the psoralen and the 5,6 double bond of the thymidine, or a pyrone-side monoadduct, which is formed through the cycloaddition between the 3,4 double bond of the psoralen and the 5,6 double bond of the thymidine. As a comparison, they have also investigated the wavelength-dependent photoreversal of the isolated thymidine-HMT monoadducts. All photoreversal action spectra correlate with the extinction spectra of the isolate monoadducts. In the case of the pyrone-side monoadduct, two absorption bands contribute to the photoreversal with a quantum yield of 2 x 10 -2 at wavelengths below 250 nm and 7 x 10 -3 at wavelengths from 287 to 314 nm. The incorporation of the monoadduct into the DNA oligomer had little effect upon the photoreversal rate. For the furan-side monoadduct at least three absorption bands contribute to the photoreversal. The quantum yield varied from 5 x 10 -2 at wavelengths below 250 nm to 7 x 10 -4 at wavelengths between 295 and 365 nm. In contrast to the case of the pyrone-side monoadduct, the incorporation of the furan-side monoadduct into the DNA oligomer reduced the photoreversal rate constant at wavelengths above 285 nm

  19. Oxygen dependency of epidermal growth factor receptor binding and DNA synthesis of rat hepatocytes

    International Nuclear Information System (INIS)

    Hirose, Tetsuro; Terajima, Hiroaki; Yamauchi, Akira

    1997-01-01

    Background/Aims: Changes in oxygen availability modulate replicative responses in several cell types, but the effects on hepatocyte replication remain unclear. We have studied the effects of transient nonlethal hypoxia on epidermal growth factor receptor binding and epidermal growth factor-induced DNA synthesis of rat hepatocytes. Methods: Lactate dehydrogenase activity in culture supernatant, intracellular adenosine triphosphate content, 125 I-epidermal growth factor specific binding, epidermal growth factor receptor protein expression, and 3 H-thymidine incorporation were compared between hepatocytes cultured in hypoxia and normoxia. Results: Hypoxia up to 3 h caused no significant increase in lactate dehydrogenase activity in the culture supernatant, while intracellular adenosine triphosphate content decreased time-dependently and was restored to normoxic levels by reoxygenation (nonlethal hypoxia). Concomitantly, 125 I-epidermal growth factor specific binding to hepatocytes decreased time-dependently (to 54.1% of normoxia) and was restored to control levels by reoxygenation, although 125 I-insulin specific binding was not affected. The decrease in 125 I-epidermal growth factor specific binding was explained by the decrease in the number or available epidermal growth factor receptors (21.37±3.08 to 12.16±1.42 fmol/10 5 cells), while the dissociation constant of the receptor was not affected. The change in the number of available receptors was not considered to be due to receptor degradation-resynthesis, since immuno-detection of the epidermal growth factor receptor revealed that the receptor protein expression did not change during hypoxia and reoxygenation, and since neither actinomycin D nor cycloheximide affected the recovery of 125 I-epidermal growth factor binding by reoxygenation. Inhibition of epidermal growth factor-induced DNA synthesis after hypoxia (to 75.4% of normoxia by 3 h hypoxia) paralleled the decrease in 125 I-epidermal growth factor binding

  20. Epigenetic control of viral life-cycle by a DNA-methylation dependent transcription factor.

    Directory of Open Access Journals (Sweden)

    Kirsty Flower

    Full Text Available Epstein-Barr virus (EBV encoded transcription factor Zta (BZLF1, ZEBRA, EB1 is the prototype of a class of transcription factor (including C/EBPalpha that interact with CpG-containing DNA response elements in a methylation-dependent manner. The EBV genome undergoes a biphasic methylation cycle; it is extensively methylated during viral latency but is reset to an unmethylated state following viral lytic replication. Zta is expressed transiently following infection and again during the switch between latency and lytic replication. The requirement for CpG-methylation at critical Zta response elements (ZREs has been proposed to regulate EBV replication, specifically it could aid the activation of viral lytic gene expression from silenced promoters on the methylated genome during latency in addition to preventing full lytic reactivation from the non-methylated EBV genome immediately following infection. We developed a computational approach to predict the location of ZREs which we experimentally assessed using in vitro and in vivo DNA association assays. A remarkably different binding motif is apparent for the CpG and non-CpG ZREs. Computational prediction of the location of these binding motifs in EBV revealed that the majority of lytic cycle genes have at least one and many have multiple copies of methylation-dependent CpG ZREs within their promoters. This suggests that the abundance of Zta protein coupled with the methylation status of the EBV genome act together to co-ordinate the expression of lytic cycle genes at the majority of EBV promoters.

  1. Alphavirus replicon DNA expressing HIV antigens is an excellent prime for boosting with recombinant modified vaccinia Ankara (MVA or with HIV gp140 protein antigen.

    Directory of Open Access Journals (Sweden)

    Maria L Knudsen

    Full Text Available Vaccination with DNA is an attractive strategy for induction of pathogen-specific T cells and antibodies. Studies in humans have shown that DNA vaccines are safe, but their immunogenicity needs further improvement. As a step towards this goal, we have previously demonstrated that immunogenicity is increased with the use of an alphavirus DNA-launched replicon (DREP vector compared to conventional DNA vaccines. In this study, we investigated the effect of varying the dose and number of administrations of DREP when given as a prime prior to a heterologous boost with poxvirus vector (MVA and/or HIV gp140 protein formulated in glucopyranosyl lipid A (GLA-AF adjuvant. The DREP and MVA vaccine constructs encoded Env and a Gag-Pol-Nef fusion protein from HIV clade C. One to three administrations of 0.2 μg DREP induced lower HIV-specific T cell and IgG responses than the equivalent number of immunizations with 10 μg DREP. However, the two doses were equally efficient as a priming component in a heterologous prime-boost regimen. The magnitude of immune responses depended on the number of priming immunizations rather than the dose. A single low dose of DREP prior to a heterologous boost resulted in greatly increased immune responses compared to MVA or protein antigen alone, demonstrating that a mere 0.2 μg DREP was sufficient for priming immune responses. Following a DREP prime, T cell responses were expanded greatly by an MVA boost, and IgG responses were also expanded when boosted with protein antigen. When MVA and protein were administered simultaneously following multiple DREP primes, responses were slightly compromised compared to administering them sequentially. In conclusion, we have demonstrated efficient priming of HIV-specific T cell and IgG responses with a low dose of DREP, and shown that the priming effect depends on number of primes administered rather than dose.

  2. Yields of clustered DNA damage induced by charged-particle radiations of similar kinetic energy per nucleon: LET dependence in different DNA microenvironments

    International Nuclear Information System (INIS)

    Keszenman, D.J.; Sutherland, B.M.

    2010-01-01

    To determine the linear energy transfer (LET) dependence of the biological effects of densely ionizing radiation in relation to changes in the ionization density along the track, we measured the yields and spectrum of clustered DNA damages induced by charged particles of different atomic number but similar kinetic energy per nucleon in different DNA microenvironments. Yeast DNA embedded in agarose in solutions of different free radical scavenging capacity was irradiated with 1 GeV protons, 1 GeV/nucleon oxygen ions, 980 MeV/nucleon titanium ions or 968 MeV/nucleon iron ions. The frequencies of double-strand breaks (DSBs), abasic sites and oxypurine clusters were quantified. The total DNA damage yields per absorbed dose induced in non-radioquenching solution decreased with LET, with minor variations in radioquenching conditions being detected. However, the total damage yields per particle fluence increased with LET in both conditions, indicating a higher efficiency per particle to induce clustered DNA damages. The yields of DSBs and non-DSB clusters as well as the damage spectra varied with LET and DNA milieu, suggesting the involvement of more than one mechanism in the formation of the different types of clustered damages.

  3. Effect of neonatal undernutrition on various forms of DNA-dependent DNA polymerases in cerebellum and liver of rat

    International Nuclear Information System (INIS)

    Baksi, K.; Kumar, A.

    1978-01-01

    Effect of neonatal undernutrition on the two forms of DNA polymerases obtained by DEAF-cellulose column chromatography of the solubilized nuclei and the high speed supernatant fractions of cerebellum and liver of rats has been studied. The form of DNA polymerase eluting with 0.1 M potassium phosphate buffer (pH 7.5) was significantly reduced, whereas that eluting with 0.3 M buffer (pH 7.5) was devoid of neonatal undernutrition effect. The properties of the separated DNA polymerases, both from cerebellum and liver, of control and undernourished groups were also studied. [Me- 3 H]thymidine-5--'triphosphate has been used in the study. (author)

  4. Pilot Study on the Use of DNA Priming Immunization to Enhance Y. pestis LcrV-Specific B Cell Responses Elicited by a Recombinant LcrV Protein Vaccine

    Directory of Open Access Journals (Sweden)

    Wei Li

    2013-12-01

    Full Text Available Recent studies indicate that DNA immunization is powerful in eliciting antigen-specific antibody responses in both animal and human studies. However, there is limited information on the mechanism of this effect. In particular, it is not known whether DNA immunization can also enhance the development of antigen-specific B cell development. In this report, a pilot study was conducted using plague LcrV immunogen as a model system to determine whether DNA immunization is able to enhance LcrV-specific B cell development in mice. Plague is an acute and often fatal infectious disease caused by Yersinia pestis (Y. pestis. Humoral immune responses provide critical protective immunity against plague. Previously, we demonstrated that a DNA vaccine expressing LcrV antigen can protect mice from lethal mucosal challenge. In the current study, we further evaluated whether the use of a DNA priming immunization is able to enhance the immunogenicity of a recombinant LcrV protein vaccine, and in particular, the development of LcrV-specific B cells. Our data indicate that DNA immunization was able to elicit high-level LcrV antibody responses when used alone or as part of a prime-boost immunization approach. Most significantly, DNA immunization was also able to increase the levels of LcrV-specific B cell development. The finding that DNA immunization can enhance antigen-specific B cell responses is highly significant and will help guide similar studies in other model antigen systems.

  5. Shape-dependent bactericidal activity of copper oxide nanoparticle mediated by DNA and membrane damage

    International Nuclear Information System (INIS)

    Laha, Dipranjan; Pramanik, Arindam; Laskar, Aparna; Jana, Madhurya; Pramanik, Panchanan; Karmakar, Parimal

    2014-01-01

    Highlights: • Spherical and sheet shaped copper oxide nanoparticles were synthesized. • Physical characterizations of these nanoparticles were done by TEM, DLS, XRD, FTIR. • They showed shape dependent antibacterial activity on different bacterial strain. • They induced both membrane damage and ROS mediated DNA damage in bacteria. - Abstract: In this work, we synthesized spherical and sheet shaped copper oxide nanoparticles and their physical characterizations were done by the X-ray diffraction, fourier transform infrared spectroscopy, transmission electron microscopy and dynamic light scattering. The antibacterial activity of these nanoparticles was determined on both gram positive and gram negative bacterial. Spherical shaped copper oxide nanoparticles showed more antibacterial property on gram positive bacteria where as sheet shaped copper oxide nanoparticles are more active on gram negative bacteria. We also demonstrated that copper oxide nanoparticles produced reactive oxygen species in both gram negative and gram positive bacteria. Furthermore, they induced membrane damage as determined by atomic force microscopy and scanning electron microscopy. Thus production of and membrane damage are major mechanisms of the bactericidal activity of these copper oxide nanoparticles. Finally it was concluded that antibacterial activity of nanoparticles depend on physicochemical properties of copper oxide nanoparticles and bacterial strain

  6. Shape-dependent bactericidal activity of copper oxide nanoparticle mediated by DNA and membrane damage

    Energy Technology Data Exchange (ETDEWEB)

    Laha, Dipranjan; Pramanik, Arindam [Department of Life Science and Biotechnology, Jadavpur University, 188, Raja S C Mallick Road, Kolkata 700032 (India); Laskar, Aparna [CSIR-Indian Institute of Chemical Biology, Kolkata 700032 (India); Jana, Madhurya [Department of Life Science and Biotechnology, Jadavpur University, 188, Raja S C Mallick Road, Kolkata 700032 (India); Pramanik, Panchanan [Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India); Karmakar, Parimal, E-mail: pkarmakar_28@yahoo.co.in [Department of Life Science and Biotechnology, Jadavpur University, 188, Raja S C Mallick Road, Kolkata 700032 (India)

    2014-11-15

    Highlights: • Spherical and sheet shaped copper oxide nanoparticles were synthesized. • Physical characterizations of these nanoparticles were done by TEM, DLS, XRD, FTIR. • They showed shape dependent antibacterial activity on different bacterial strain. • They induced both membrane damage and ROS mediated DNA damage in bacteria. - Abstract: In this work, we synthesized spherical and sheet shaped copper oxide nanoparticles and their physical characterizations were done by the X-ray diffraction, fourier transform infrared spectroscopy, transmission electron microscopy and dynamic light scattering. The antibacterial activity of these nanoparticles was determined on both gram positive and gram negative bacterial. Spherical shaped copper oxide nanoparticles showed more antibacterial property on gram positive bacteria where as sheet shaped copper oxide nanoparticles are more active on gram negative bacteria. We also demonstrated that copper oxide nanoparticles produced reactive oxygen species in both gram negative and gram positive bacteria. Furthermore, they induced membrane damage as determined by atomic force microscopy and scanning electron microscopy. Thus production of and membrane damage are major mechanisms of the bactericidal activity of these copper oxide nanoparticles. Finally it was concluded that antibacterial activity of nanoparticles depend on physicochemical properties of copper oxide nanoparticles and bacterial strain.

  7. Effects of nuclear mutations for recombination and repair functions and of caffeine on mitochondrial recombination

    International Nuclear Information System (INIS)

    Fraenkel, A.H.M.

    1974-01-01

    Studies of both prokaryotic and eukaryotic organisms indicate that pathways governing repair of damage to nuclear DNA caused by x-ray or ultraviolet irradiation overlap with those controlling recombination. Fourteen nuclear mutants of Saccharomyces cerevisiae were tested in order to determine whether these mutant genes affected mitochondrial recombination. None of the mutations studied significantly affected mitochondrial recombination. The nuclear recombination and repair pathways studied do not overlap with the nuclear pathway which controls recombination of mitochondrial DNA. A second set of experiments was designed to test the effect of caffeine on both nuclear and mitochondrial recombination in Saccharomyces cerevisiae. (U.S.)

  8. DNA-tension dependence of restriction enzyme activity reveals mechanochemical properties of the reaction pathway

    NARCIS (Netherlands)

    van den Broek, B.; Noom, M.C.; Wuite, G.J.L.

    2005-01-01

    Type II restriction endonucleases protect bacteria against phage infections by cleaving recognition sites on foreign double-stranded DNA (dsDNA) with extraordinary specificity. This capability arises primarily from large conformational changes in enzyme and/or DNA upon target sequence recognition.

  9. DNA-based asymmetric catalysis : Sequence-dependent rate acceleration and enantioselectivity

    NARCIS (Netherlands)

    Boersma, Arnold J.; Klijn, Jaap E.; Feringa, Ben L.; Roelfes, Gerard

    2008-01-01

    This study shows that the role of DNA in the DNA-based enantioselective Diels-Alder reaction of azachalcone with cyclopentadiene is not limited to that of a chiral scaffold. DNA in combination with the copper complex of 4,4'-dimethyl-2,2'-bipyridine (Cu-L1) gives rise to a rate acceleration of up to

  10. rad-Dependent response of the chk1-encoded protein kinase at the DNA damage checkpoint

    NARCIS (Netherlands)

    Walworth, N.C.; Bernards, R.A.

    1996-01-01

    Exposure of eukaryotic cells to agents that generate DNA damage results in transient arrest of progression through the cell cycle. In fission yeast, the DNA damage checkpoint associated with cell cycle arrest before mitosis requires the protein kinase p56chk1. DNA damage induced by ultraviolet

  11. Activity of Proteus mirabilis FliL is viscosity dependent and requires extragenic DNA.

    Science.gov (United States)

    Lee, Yi-Ying; Patellis, Julius; Belas, Robert

    2013-02-01

    Proteus mirabilis is a urinary tract pathogen and well known for its ability to move over agar surfaces by flagellum-dependent swarming motility. When P. mirabilis encounters a highly viscous environment, e.g., an agar surface, it differentiates from short rods with few flagella to elongated, highly flagellated cells that lack septa and contain multiple nucleoids. The bacteria detect a surface by monitoring the rotation of their flagellar motors. This process involves an enigmatic flagellar protein called FliL, the first gene in an operon (fliLMNOPQR) that encodes proteins of the flagellar rotor switch complex and flagellar export apparatus. We used a fliL knockout mutant to gain further insight into the function of FliL. Loss of FliL results in cells that cannot swarm (Swr(-)) but do swim (Swm(+)) and produces cells that look like wild-type swarmer cells, termed "pseudoswarmer cells," that are elongated, contain multiple nucleoids, and lack septa. Unlike swarmer cells, pseudoswarmer cells are not hyperflagellated due to reduced expression of flaA (the gene encoding flagellin), despite an increased transcription of both flhD and fliA, two positive regulators of flagellar gene expression. We found that defects in fliL prevent viscosity-dependent sensing of a surface and viscosity-dependent induction of flaA transcription. Studies with fliL cells unexpectedly revealed that the fliL promoter, fliL coding region, and a portion of fliM DNA are needed to complement the Swr(-) phenotype. The data support a dual role for FliL as a critical link in sensing a surface and in the maintenance of flagellar rod integrity.

  12. Strategic role of the ubiquitin-dependent segregase p97 (VCP or Cdc48) in DNA replication.

    Science.gov (United States)

    Ramadan, Kristijan; Halder, Swagata; Wiseman, Katherine; Vaz, Bruno

    2017-02-01

    Genome amplification (DNA synthesis) is one of the most demanding cellular processes in all proliferative cells. The DNA replication machinery (also known as the replisome) orchestrates genome amplification during S-phase of the cell cycle. Genetic material is particularly vulnerable to various events that can challenge the replisome during its assembly, activation (firing), progression (elongation) and disassembly from chromatin (termination). Any disturbance of the replisome leads to stalling of the DNA replication fork and firing of dormant replication origins, a process known as DNA replication stress. DNA replication stress is considered to be one of the main causes of sporadic cancers and other pathologies related to tissue degeneration and ageing. The mechanisms of replisome assembly and elongation during DNA synthesis are well understood. However, once DNA synthesis is complete, the process of replisome disassembly, and its removal from chromatin, remains unclear. In recent years, a growing body of evidence has alluded to a central role in replisome regulation for the ubiquitin-dependent protein segregase p97, also known as valosin-containing protein (VCP) in metazoans and Cdc48 in lower eukaryotes. By orchestrating the spatiotemporal turnover of the replisome, p97 plays an essential role in DNA replication. In this review, we will summarise our current knowledge about how p97 controls the replisome from replication initiation, to elongation and finally termination. We will also further examine the more recent findings concerning the role of p97 and how mutations in p97 cofactors, also known as adaptors, cause DNA replication stress induced genomic instability that leads to cancer and accelerated ageing. To our knowledge, this is the first comprehensive review concerning the mechanisms involved in the regulation of DNA replication by p97.

  13. Induction of immunity to antigens expressed by recombinant adeno-associated virus depends on the route of administration.

    Science.gov (United States)

    Brockstedt, D G; Podsakoff, G M; Fong, L; Kurtzman, G; Mueller-Ruchholtz, W; Engleman, E G

    1999-07-01

    Recombinant adeno-associated virus (rAAV) is a replication-defective parvovirus which is being explored as a vector for gene therapy because of its broad host range, excellent safety profile, and durable transgene expression in infected hosts. rAAV has also been reported by several groups to induce little or no immune response to its encoded transgene products. In this study we examined the immunogenicity of rAAV by studying the immune response of C57BL/6 mice to a single dose of rAAV-encoding ovalbumin (AAV-Ova) administered by a variety of routes. Mice injected with AAV-Ova intraperitoneally (ip), intravenously, or subcutaneously developed potent ovalbumin-specific cytotoxic T lymphocytes (CTL) as well as anti-ovalbumin antibodies and antibodies to AAV. In contrast, mice injected with AAV-Ova intramuscularly developed a humoral response to the virus and the transgene but minimal ovalbumin-specific CTLs. The induced CTL response after ip administration of AAV-Ova protected mice against a subsequent tumor challenge with an ovalbumin-transfected B16 melanoma cell line. Studies of the mechanism by which AAV-Ova induces CTL confirmed that the virus delivers the transgene product into the classical MHC class I pathway of antigen processing. Mice that previously had been exposed to rAAV vectors failed to develop ovalbumin-specific CTL following administration of AAV-Ova. Analysis of these mice revealed the presence of circulating anti-AAV antibodies that blocked rAAV transduction in vitro and inhibited CTL induction in vivo. These results suggest a possible role for rAAV in the immunotherapy of malignancies and viral infections, although induced antibody responses to AAV may limit its ability to be administered for repeated vaccinations. Copyright 1999 Academic Press.

  14. Application of a time-dependent coalescence process for inferring the history of population size changes from DNA sequence data.

    Science.gov (United States)

    Polanski, A; Kimmel, M; Chakraborty, R

    1998-05-12

    Distribution of pairwise differences of nucleotides from data on a sample of DNA sequences from a given segment of the genome has been used in the past to draw inferences about the past history of population size changes. However, all earlier methods assume a given model of population size changes (such as sudden expansion), parameters of which (e.g., time and amplitude of expansion) are fitted to the observed distributions of nucleotide differences among pairwise comparisons of all DNA sequences in the sample. Our theory indicates that for any time-dependent population size, N(tau) (in which time tau is counted backward from present), a time-dependent coalescence process yields the distribution, p(tau), of the time of coalescence between two DNA sequences randomly drawn from the population. Prediction of p(tau) and N(tau) requires the use of a reverse Laplace transform known to be unstable. Nevertheless, simulated data obtained from three models of monotone population change (stepwise, exponential, and logistic) indicate that the pattern of a past population size change leaves its signature on the pattern of DNA polymorphism. Application of the theory to the published mtDNA sequences indicates that the current mtDNA sequence variation is not inconsistent with a logistic growth of the human population.

  15. Novel HBV recombinants between genotypes B and C in 3'-terminal reverse transcriptase (RT) sequences are associated with enhanced viral DNA load, higher RT point mutation rates and place of birth among Chinese patients.

    Science.gov (United States)

    Liu, Baoming; Yang, Jing-Xian; Yan, Ling; Zhuang, Hui; Li, Tong

    2018-01-01

    As one of the major global public health concerns, hepatitis B virus (HBV) can be divided into at least eight genotypes, which may be related to disease severity and treatment response. We previously demonstrated that genotypes B and C HBV, with distinct geographical distribution in China, had divergent genotype-dependent amino acid polymorphisms and variations in reverse transcriptase (RT) gene region, a target of antiviral therapy using nucleos(t)ide analogues. Recently recombination between HBV genotypes B and C was reported to occur in the RT region. However, their frequency and clinical significance is poorly understood. Here full-length HBV RT sequences from 201 Chinese chronic hepatitis B (CHB) patients were amplified and sequenced, among which 31.34% (63/201) were genotype B whereas 68.66% (138/201) genotype C. Although no intergenotypic recombination was detected among C-genotype HBV, 38.10% (24/63) of B-genotype HBV had recombination with genotype C in the 3'-terminal RT sequences. The patients with B/C intergenotypic recombinants had significantly (Pdistribution feature in China. Our findings provide novel insight into the virological, clinical and epidemiological features of new HBV B/C intergenotypic recombinants at the 3' end of RT sequences among Chinese CHB patients. The highly complex genetic background of the novel recombinant HBV carrying new mutations affecting RT protein may contribute to an enhanced heterogeneity in treatment response or prognosis among CHB patients. Published by Elsevier B.V.

  16. TRX-LOGOS - a graphical tool to demonstrate DNA information content dependent upon backbone dynamics in addition to base sequence.

    Science.gov (United States)

    Fortin, Connor H; Schulze, Katharina V; Babbitt, Gregory A

    2015-01-01

    It is now widely-accepted that DNA sequences defining DNA-protein interactions functionally depend upon local biophysical features of DNA backbone that are important in defining sites of binding interaction in the genome (e.g. DNA shape, charge and intrinsic dynamics). However, these physical features of DNA polymer are not directly apparent when analyzing and viewing Shannon information content calculated at single nucleobases in a traditional sequence logo plot. Thus, sequence logos plots are severely limited in that they convey no explicit information regarding the structural dynamics of DNA backbone, a feature often critical to binding specificity. We present TRX-LOGOS, an R software package and Perl wrapper code that interfaces the JASPAR database for computational regulatory genomics. TRX-LOGOS extends the traditional sequence logo plot to include Shannon information content calculated with regard to the dinucleotide-based BI-BII conformation shifts in phosphate linkages on the DNA backbone, thereby adding a visual measure of intrinsic DNA flexibility that can be critical for many DNA-protein interactions. TRX-LOGOS is available as an R graphics module offered at both SourceForge and as a download supplement at this journal. To demonstrate the general utility of TRX logo plots, we first calculated the information content for 416 Saccharomyces cerevisiae transcription factor binding sites functionally confirmed in the Yeastract database and matched to previously published yeast genomic alignments. We discovered that flanking regions contain significantly elevated information content at phosphate linkages than can be observed at nucleobases. We also examined broader transcription factor classifications defined by the JASPAR database, and discovered that many general signatures of transcription factor binding are locally more information rich at the level of DNA backbone dynamics than nucleobase sequence. We used TRX-logos in combination with MEGA 6.0 software

  17. Direct evidence for sequence-dependent attraction between double-stranded DNA controlled by methylation.

    Science.gov (United States)

    Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Tae