WorldWideScience

Sample records for recombination dependent dna

  1. Cre-dependent DNA recombination activates a STING-dependent innate immune response

    Science.gov (United States)

    Pépin, Geneviève; Ferrand, Jonathan; Höning, Klara; Jayasekara, W. Samantha N.; Cain, Jason E.; Behlke, Mark A.; Gough, Daniel J.; G. Williams, Bryan R.; Hornung, Veit

    2016-01-01

    Abstract Gene-recombinase technologies, such as Cre/loxP-mediated DNA recombination, are important tools in the study of gene function, but have potential side effects due to damaging activity on DNA. Here we show that DNA recombination by Cre instigates a robust antiviral response in mammalian cells, independent of legitimate loxP recombination. This is due to the recruitment of the cytosolic DNA sensor STING, concurrent with Cre-dependent DNA damage and the accumulation of cytoplasmic DNA. Importantly, we establish a direct interplay between this antiviral response and cell–cell interactions, indicating that low cell densities in vitro could be useful to help mitigate these effects of Cre. Taking into account the wide range of interferon stimulated genes that may be induced by the STING pathway, these results have broad implications in fields such as immunology, cancer biology, metabolism and stem cell research. Further, this study sets a precedent in the field of gene-engineering, possibly applicable to other enzymatic-based genome editing technologies. PMID:27166376

  2. Functional intersection of ATM and DNA-dependent protein kinase catalytic subunit in coding end joining during V(D)J recombination

    DEFF Research Database (Denmark)

    Lee, Baeck-Seung; Gapud, Eric J; Zhang, Shichuan

    2013-01-01

    V(D)J recombination is initiated by the RAG endonuclease, which introduces DNA double-strand breaks (DSBs) at the border between two recombining gene segments, generating two hairpin-sealed coding ends and two blunt signal ends. ATM and DNA-dependent protein kinase catalytic subunit (DNA-PKcs) ar......V(D)J recombination is initiated by the RAG endonuclease, which introduces DNA double-strand breaks (DSBs) at the border between two recombining gene segments, generating two hairpin-sealed coding ends and two blunt signal ends. ATM and DNA-dependent protein kinase catalytic subunit (DNA......-PKcs) are serine-threonine kinases that orchestrate the cellular responses to DNA DSBs. During V(D)J recombination, ATM and DNA-PKcs have unique functions in the repair of coding DNA ends. ATM deficiency leads to instability of postcleavage complexes and the loss of coding ends from these complexes. DNA...... when ATM is present and its kinase activity is intact. The ability of ATM to compensate for DNA-PKcs kinase activity depends on the integrity of three threonines in DNA-PKcs that are phosphorylation targets of ATM, suggesting that ATM can modulate DNA-PKcs activity through direct phosphorylation of DNA...

  3. Single Molecule Study of DNA Organization and Recombination

    Science.gov (United States)

    Xiao, Botao

    We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force

  4. RecO protein initiates DNA recombination and strand annealing through two alternative DNA binding mechanisms.

    Science.gov (United States)

    Ryzhikov, Mikhail; Gupta, Richa; Glickman, Michael; Korolev, Sergey

    2014-10-17

    Recombination mediator proteins (RMPs) are important for genome stability in all organisms. Several RMPs support two alternative reactions: initiation of homologous recombination and DNA annealing. We examined mechanisms of RMPs in both reactions with Mycobacterium smegmatis RecO (MsRecO) and demonstrated that MsRecO interacts with ssDNA by two distinct mechanisms. Zinc stimulates MsRecO binding to ssDNA during annealing, whereas the recombination function is zinc-independent and is regulated by interaction with MsRecR. Thus, different structural motifs or conformations of MsRecO are responsible for interaction with ssDNA during annealing and recombination. Neither annealing nor recombinase loading depends on MsRecO interaction with the conserved C-terminal tail of single-stranded (ss) DNA-binding protein (SSB), which is known to bind Escherichia coli RecO. However, similarly to E. coli proteins, MsRecO and MsRecOR do not dismiss SSB from ssDNA, suggesting that RMPs form a complex with SSB-ssDNA even in the absence of binding to the major protein interaction motif. We propose that alternative conformations of such complexes define the mechanism by which RMPs initiate the repair of stalled replication and support two different functions during recombinational repair of DNA breaks. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

    Science.gov (United States)

    Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

    2018-01-01

    Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion

  6. Bacteriophage T5 encodes a homolog of the eukaryotic transcription coactivator PC4 implicated in recombination-dependent DNA replication.

    Science.gov (United States)

    Steigemann, Birthe; Schulz, Annina; Werten, Sebastiaan

    2013-11-15

    The RNA polymerase II cofactor PC4 globally regulates transcription of protein-encoding genes through interactions with unwinding DNA, the basal transcription machinery and transcription activators. Here, we report the surprising identification of PC4 homologs in all sequenced representatives of the T5 family of bacteriophages, as well as in an archaeon and seven phyla of eubacteria. We have solved the crystal structure of the full-length T5 protein at 1.9Å, revealing a striking resemblance to the characteristic single-stranded DNA (ssDNA)-binding core domain of PC4. Intriguing novel structural features include a potential regulatory region at the N-terminus and a C-terminal extension of the homodimerisation interface. The genome organisation of T5-related bacteriophages points at involvement of the PC4 homolog in recombination-dependent DNA replication, strongly suggesting that the protein corresponds to the hitherto elusive replicative ssDNA-binding protein of the T5 family. Our findings imply that PC4-like factors intervene in multiple unwinding-related processes by acting as versatile modifiers of nucleic acid conformation and raise the possibility that the eukaryotic transcription coactivator derives from ancestral DNA replication, recombination and repair factors. © 2013.

  7. In vitro recombination of bacteriophage T7 DNA damaged by uv radiation

    International Nuclear Information System (INIS)

    Masker, W.E.; Kuemmerle, N.B.

    1980-01-01

    A system capable of in vitro packaging of exogenous bacteriophage T7 DNA has been used to monitor the biological activity of DNA replicated in vitro. This system has been used to follow the effects of uv radiation on in vitro replication and recombination. During the in vitro replication process, a considerable exchange of genetic information occurs between T7 DNA molecules present in the reaction mixture. This in vitro recombination is reflected in the genotype of the T7 phage produced after in vitro encapsulation; depending on the genetic markers selected, recombinants can comprise nearly 20% of the total phage production. When uv-irradiated DNA is incubated in this system, the amount of in vitro synthesis is reduced and the total amount of viable phage produced after in vitro packaging is diminished. In vitro recombination rates are also lower when the participating DNA molecules have been exposed to uv. However, biochemical and genetic measurements confirmed that there is little or no transfer of pyrimidine dimers from irradiated DNA into undamaged molecules

  8. Mutations affecting RNA polymerase I-stimulated exchange and rDNA recombination in yeast

    International Nuclear Information System (INIS)

    Lin, Y.H.; Keil, R.L.

    1991-01-01

    HOT1 is a cis-acting recombination-stimulatory sequence isolated from the rDNA repeat unit of yeast. The ability of HOT1 to stimulate mitotic exchange appears to depend on its ability to promote high levels of RNA polymerase I transcription. A qualitative colony color sectoring assay was developed to screen for trans-acting mutations that alter the activity of HOT1. Both hypo-recombination and hyper-recombination mutants were isolated. Genetic analysis of seven HOT1 recombination mutants (hrm) that decrease HOT1 activity shows that they behave as recessive nuclear mutations and belong to five linkage groups. Three of these mutations, hrm1, hrm2, and hrm3, also decrease rDNA exchange but do not alter recombination in the absence of HOT1. Another mutation, hrm4, decreases HOT1-stimulated recombination but does not affect rDNA recombination or exchange in the absence of HOT1. Two new alleles of RAD52 were also isolated using this screen. With regard to HOT1 activity, rad52 is epistatic to all four hrm mutations indicating that the products of the HRM genes and of RAD52 mediate steps in the same recombination pathway. Finding mutations that decrease both the activity of HOT1 and exchange in the rDNA supports the hypothesis that HOT1 plays a role in rDNA recombination

  9. Examining a DNA Replication Requirement for Bacteriophage λ Red- and Rac Prophage RecET-Promoted Recombination in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Lynn C. Thomason

    2016-09-01

    Full Text Available Recombineering, in vivo genetic engineering with bacteriophage homologous recombination systems, is a powerful technique for making genetic modifications in bacteria. Two systems widely used in Escherichia coli are the Red system from phage λ and RecET from the defective Rac prophage. We investigated the in vivo dependence of recombineering on DNA replication of the recombining substrate using plasmid targets. For λ Red recombination, when DNA replication of a circular target plasmid is prevented, recombination with single-stranded DNA oligonucleotides is greatly reduced compared to that under replicating conditions. For RecET recombination, when DNA replication of the targeted plasmid is prevented, the recombination frequency is also reduced, to a level identical to that seen for the Red system in the absence of replication. The very low level of oligonucleotide recombination observed in the absence of any phage recombination functions is the same in the presence or absence of DNA replication. In contrast, both the Red and RecET systems recombine a nonreplicating linear dimer plasmid with high efficiency to yield a circular monomer. Therefore, the DNA replication requirement is substrate dependent. Our data are consistent with recombination by both the Red and RecET systems occurring predominately by single-strand annealing rather than by strand invasion.

  10. Prevention of DNA Rereplication Through a Meiotic Recombination Checkpoint Response

    Directory of Open Access Journals (Sweden)

    Nicole A. Najor

    2016-12-01

    Full Text Available In the budding yeast Saccharomyces cerevisiae, unnatural stabilization of the cyclin-dependent kinase inhibitor Sic1 during meiosis can trigger extra rounds of DNA replication. When programmed DNA double-strand breaks (DSBs are generated but not repaired due to absence of DMC1, a pathway involving the checkpoint gene RAD17 prevents this DNA rereplication. Further genetic analysis has now revealed that prevention of DNA rereplication also requires MEC1, which encodes a protein kinase that serves as a central checkpoint regulator in several pathways including the meiotic recombination checkpoint response. Downstream of MEC1, MEK1 is required through its function to inhibit repair between sister chromatids. By contrast, meiotic recombination checkpoint effectors that regulate gene expression and cyclin-dependent kinase activity are not necessary. Phosphorylation of histone H2A, which is catalyzed by Mec1 and the related Tel1 protein kinase in response to DSBs, and can help coordinate activation of the Rad53 checkpoint protein kinase in the mitotic cell cycle, is required for the full checkpoint response. Phosphorylation sites that are targeted by Rad53 in a mitotic S phase checkpoint response are also involved, based on the behavior of cells containing mutations in the DBF4 and SLD3 DNA replication genes. However, RAD53 does not appear to be required, nor does RAD9, which encodes a mediator of Rad53, consistent with their lack of function in the recombination checkpoint pathway that prevents meiotic progression. While this response is similar to a checkpoint mechanism that inhibits initiation of DNA replication in the mitotic cell cycle, the evidence points to a new variation on DNA replication control.

  11. Single-Molecule Tethered Particle Motion: Stepwise Analyses of Site-Specific DNA Recombination

    Directory of Open Access Journals (Sweden)

    Hsiu-Fang Fan

    2018-05-01

    Full Text Available Tethered particle motion/microscopy (TPM is a biophysical tool used to analyze changes in the effective length of a polymer, tethered at one end, under changing conditions. The tether length is measured indirectly by recording the Brownian motion amplitude of a bead attached to the other end. In the biological realm, DNA, whose interactions with proteins are often accompanied by apparent or real changes in length, has almost exclusively been the subject of TPM studies. TPM has been employed to study DNA bending, looping and wrapping, DNA compaction, high-order DNA–protein assembly, and protein translocation along DNA. Our TPM analyses have focused on tyrosine and serine site-specific recombinases. Their pre-chemical interactions with DNA cause reversible changes in DNA length, detectable by TPM. The chemical steps of recombination, depending on the substrate and the type of recombinase, may result in a permanent length change. Single molecule TPM time traces provide thermodynamic and kinetic information on each step of the recombination pathway. They reveal how mechanistically related recombinases may differ in their early commitment to recombination, reversibility of individual steps, and in the rate-limiting step of the reaction. They shed light on the pre-chemical roles of catalytic residues, and on the mechanisms by which accessory proteins regulate recombination directionality.

  12. Escherichia coli ArgR mutants defective in cer/Xer recombination, but not in DNA binding.

    Science.gov (United States)

    Sénéchal, Hélène; Delesques, Jérémy; Szatmari, George

    2010-04-01

    The Escherichia coli arginine repressor (ArgR) is an L-arginine-dependent DNA-binding protein that controls the expression of the arginine biosynthetic genes and is required as an accessory factor for Xer site-specific recombination at cer and related recombination sites in plasmids. We used the technique of pentapeptide scanning mutagenesis to isolate a series of ArgR mutants that were considerably reduced in cer recombination, but were still able to repress an argA::lacZ fusion. DNA sequence analysis showed that all of the mutants mapped to the same nucleotide, resulting in a five amino acid insertion between residues 149 and 150 of ArgR, corresponding to the end of the alpha6 helix. A truncated ArgR containing a stop codon at residue 150 displayed the same phenotype as the protein with the five amino acid insertion, and both mutants displayed sequence-specific DNA-binding activity that was L-arginine dependent. These results show that the C-terminus of ArgR is more important in cer/Xer site-specific recombination than in DNA binding.

  13. Restoration of X-ray resistance and V(D)J recombination in mutant cells by Ku cDNA

    International Nuclear Information System (INIS)

    Smider, V.; Rathmell, W.K.; Chu, G.; Lieber, M.R.

    1994-01-01

    Three genetic complementation groups of rodent cells are defective for both repair of x-ray-induced double-strand breaks and V(D)J recombination. Cells from one group lack a DNA end-binding activity that is biochemically and antigenically similar to the Ku autoantigen. Transfection of complementary DNA (cDNA) that encoded the 86-kilodalton subunit of Ku rescued these mutant cells for DNA end-binding activity, x-ray resistance, and V(D)J recombination activity. These results establish a role for Ku in DNA repair and recombination. Furthermore, as a component of a DNA-dependent protein kinase, Ku may initiate a signaling pathway induced by DNA damage

  14. Examining a DNA Replication Requirement for Bacteriophage λ Red- and Rac Prophage RecET-Promoted Recombination in Escherichia coli.

    Science.gov (United States)

    Thomason, Lynn C; Costantino, Nina; Court, Donald L

    2016-09-13

    Recombineering, in vivo genetic engineering with bacteriophage homologous recombination systems, is a powerful technique for making genetic modifications in bacteria. Two systems widely used in Escherichia coli are the Red system from phage λ and RecET from the defective Rac prophage. We investigated the in vivo dependence of recombineering on DNA replication of the recombining substrate using plasmid targets. For λ Red recombination, when DNA replication of a circular target plasmid is prevented, recombination with single-stranded DNA oligonucleotides is greatly reduced compared to that under replicating conditions. For RecET recombination, when DNA replication of the targeted plasmid is prevented, the recombination frequency is also reduced, to a level identical to that seen for the Red system in the absence of replication. The very low level of oligonucleotide recombination observed in the absence of any phage recombination functions is the same in the presence or absence of DNA replication. In contrast, both the Red and RecET systems recombine a nonreplicating linear dimer plasmid with high efficiency to yield a circular monomer. Therefore, the DNA replication requirement is substrate dependent. Our data are consistent with recombination by both the Red and RecET systems occurring predominately by single-strand annealing rather than by strand invasion. Bacteriophage homologous recombination systems are widely used for in vivo genetic engineering in bacteria. Single- or double-stranded linear DNA substrates containing short flanking homologies to chromosome targets are used to generate precise and accurate genetic modifications when introduced into bacteria expressing phage recombinases. Understanding the molecular mechanism of these recombination systems will facilitate improvements in the technology. Here, two phage-specific systems are shown to require exposure of complementary single-strand homologous targets for efficient recombination; these single

  15. DNA Sequence-Mediated, Evolutionarily Rapid Redistribution of Meiotic Recombination Hotspots

    Science.gov (United States)

    Wahls, Wayne P.; Davidson, Mari K.

    2011-01-01

    Hotspots regulate the position and frequency of Spo11 (Rec12)-initiated meiotic recombination, but paradoxically they are suicidal and are somehow resurrected elsewhere in the genome. After the DNA sequence-dependent activation of hotspots was discovered in fission yeast, nearly two decades elapsed before the key realizations that (A) DNA site-dependent regulation is broadly conserved and (B) individual eukaryotes have multiple different DNA sequence motifs that activate hotspots. From our perspective, such findings provide a conceptually straightforward solution to the hotspot paradox and can explain other, seemingly complex features of meiotic recombination. We describe how a small number of single-base-pair substitutions can generate hotspots de novo and dramatically alter their distribution in the genome. This model also shows how equilibrium rate kinetics could maintain the presence of hotspots over evolutionary timescales, without strong selective pressures invoked previously, and explains why hotspots localize preferentially to intergenic regions and introns. The model is robust enough to account for all hotspots of humans and chimpanzees repositioned since their divergence from the latest common ancestor. PMID:22084420

  16. RPA homologs and ssDNA processing during meiotic recombination.

    Science.gov (United States)

    Ribeiro, Jonathan; Abby, Emilie; Livera, Gabriel; Martini, Emmanuelle

    2016-06-01

    Meiotic homologous recombination is a specialized process that involves homologous chromosome pairing and strand exchange to guarantee proper chromosome segregation and genetic diversity. The formation and repair of DNA double-strand breaks (DSBs) during meiotic recombination differs from those during mitotic recombination in that the homologous chromosome rather than the sister chromatid is the preferred repair template. The processing of single-stranded DNA (ssDNA) formed on intermediate recombination structures is central to driving the specific outcomes of DSB repair during meiosis. Replication protein A (RPA) is the main ssDNA-binding protein complex involved in DNA metabolism. However, the existence of RPA orthologs in plants and the recent discovery of meiosis specific with OB domains (MEIOB), a widely conserved meiosis-specific RPA1 paralog, strongly suggest that multiple RPA complexes evolved and specialized to subdivide their roles during DNA metabolism. Here we review ssDNA formation and maturation during mitotic and meiotic recombination underlying the meiotic specific features. We describe and discuss the existence and properties of MEIOB and multiple RPA subunits in plants and highlight how they can provide meiosis-specific fates to ssDNA processing during homologous recombination. Understanding the functions of these RPA homologs and how they interact with the canonical RPA subunits is of major interest in the fields of meiosis and DNA repair.

  17. Promotion of BRCA2-Dependent Homologous Recombination by DSS1 via RPA Targeting and DNA Mimicry.

    Science.gov (United States)

    Zhao, Weixing; Vaithiyalingam, Sivaraja; San Filippo, Joseph; Maranon, David G; Jimenez-Sainz, Judit; Fontenay, Gerald V; Kwon, Youngho; Leung, Stanley G; Lu, Lucy; Jensen, Ryan B; Chazin, Walter J; Wiese, Claudia; Sung, Patrick

    2015-07-16

    The tumor suppressor BRCA2 is thought to facilitate the handoff of ssDNA from replication protein A (RPA) to the RAD51 recombinase during DNA break and replication fork repair by homologous recombination. However, we find that RPA-RAD51 exchange requires the BRCA2 partner DSS1. Biochemical, structural, and in vivo analyses reveal that DSS1 allows the BRCA2-DSS1 complex to physically and functionally interact with RPA. Mechanistically, DSS1 acts as a DNA mimic to attenuate the affinity of RPA for ssDNA. A mutation in the solvent-exposed acidic domain of DSS1 compromises the efficacy of RPA-RAD51 exchange. Thus, by targeting RPA and mimicking DNA, DSS1 functions with BRCA2 in a two-component homologous recombination mediator complex in genome maintenance and tumor suppression. Our findings may provide a paradigm for understanding the roles of DSS1 in other biological processes. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Exploring optimization parameters to increase ssDNA recombineering in Lactococcus lactis and Lactobacillus reuteri.

    Science.gov (United States)

    Van Pijkeren, Jan-Peter; Neoh, Kar Mun; Sirias, Denise; Findley, Anthony S; Britton, Robert A

    2012-01-01

    Single-stranded DNA (ssDNA) recombineering is a technology which is used to make subtle changes in the chromosome of several bacterial genera. Cells which express a single-stranded DNA binding protein (RecT or Bet) are transformed with an oligonucleotide which is incorporated via an annealing and replication-dependent mechanism. By in silico analysis we identified ssDNA binding protein homologs in the genus Lactobacillus and Lactococcus lactis. To assess whether we could further improve the recombineering efficiency in Lactobacillus reuteri ATCC PTA 6475 we expressed several RecT homologs in this strain. RecT derived from Enterococcus faecalis CRMEN 19 yielded comparable efficiencies compared with a native RecT protein, but none of the other proteins further increased the recombineering efficiency. We successfully improved recombineering efficiency 10-fold in L. lactis by increasing oligonucleotide concentration combined with the use of oligonucleotides containing phosphorothioate-linkages (PTOs). Surprisingly, neither increased oligonucleotide concentration nor PTO linkages enhanced recombineering in L. reuteri 6475. To emphasize the utility of this technology in improving probiotic features we modified six bases in a transcriptional regulatory element region of the pdu-operon of L. reuteri 6475, yielding a 3-fold increase in the production of the antimicrobial compound reuterin. Directed genetic modification of lactic acid bacteria through ssDNA recombineering will simplify strain improvement in a way that, when mutating a single base, is genetically indistinguishable from strains obtained through directed evolution.

  19. Somatic DNA recombination yielding circular DNA and deletion of a genomic region in embryonic brain

    International Nuclear Information System (INIS)

    Maeda, Toyoki; Chijiiwa, Yoshiharu; Tsuji, Hideo; Sakoda, Saburo; Tani, Kenzaburo; Suzuki, Tomokazu

    2004-01-01

    In this study, a mouse genomic region is identified that undergoes DNA rearrangement and yields circular DNA in brain during embryogenesis. External region-directed inverse polymerase chain reaction on circular DNA extracted from late embryonic brain tissue repeatedly detected DNA of this region containing recombination joints. Wide-range genomic PCR and digestion-circularization PCR analysis showed this region underwent recombination accompanied with deletion of intervening sequences, including the circularized regions. This region was mapped by fluorescence in situ hybridization to C1 on mouse chromosome 16, where no gene and no physiological DNA rearrangement had been identified. DNA sequence in the region has segmental homology to an orthologous region on human chromosome 3q.13. These observations demonstrated somatic DNA recombination yielding genomic deletions in brain during embryogenesis

  20. Competitive repair by naturally dispersed repetitive DNA during non-allelic homologous recombination

    Energy Technology Data Exchange (ETDEWEB)

    Hoang, Margaret L.; Tan, Frederick J.; Lai, David C.; Celniker, Sue E.; Hoskins, Roger A.; Dunham, Maitreya J.; Zheng, Yixian; Koshland, Douglas

    2010-08-27

    Genome rearrangements often result from non-allelic homologous recombination (NAHR) between repetitive DNA elements dispersed throughout the genome. Here we systematically analyze NAHR between Ty retrotransposons using a genome-wide approach that exploits unique features of Saccharomyces cerevisiae purebred and Saccharomyces cerevisiae/Saccharomyces bayanus hybrid diploids. We find that DNA double-strand breaks (DSBs) induce NAHR-dependent rearrangements using Ty elements located 12 to 48 kilobases distal to the break site. This break-distal recombination (BDR) occurs frequently, even when allelic recombination can repair the break using the homolog. Robust BDR-dependent NAHR demonstrates that sequences very distal to DSBs can effectively compete with proximal sequences for repair of the break. In addition, our analysis of NAHR partner choice between Ty repeats shows that intrachromosomal Ty partners are preferred despite the abundance of potential interchromosomal Ty partners that share higher sequence identity. This competitive advantage of intrachromosomal Tys results from the relative efficiencies of different NAHR repair pathways. Finally, NAHR generates deleterious rearrangements more frequently when DSBs occur outside rather than within a Ty repeat. These findings yield insights into mechanisms of repeat-mediated genome rearrangements associated with evolution and cancer.

  1. Competitive repair by naturally dispersed repetitive DNA during non-allelic homologous recombination.

    Directory of Open Access Journals (Sweden)

    Margaret L Hoang

    2010-12-01

    Full Text Available Genome rearrangements often result from non-allelic homologous recombination (NAHR between repetitive DNA elements dispersed throughout the genome. Here we systematically analyze NAHR between Ty retrotransposons using a genome-wide approach that exploits unique features of Saccharomyces cerevisiae purebred and Saccharomyces cerevisiae/Saccharomyces bayanus hybrid diploids. We find that DNA double-strand breaks (DSBs induce NAHR-dependent rearrangements using Ty elements located 12 to 48 kilobases distal to the break site. This break-distal recombination (BDR occurs frequently, even when allelic recombination can repair the break using the homolog. Robust BDR-dependent NAHR demonstrates that sequences very distal to DSBs can effectively compete with proximal sequences for repair of the break. In addition, our analysis of NAHR partner choice between Ty repeats shows that intrachromosomal Ty partners are preferred despite the abundance of potential interchromosomal Ty partners that share higher sequence identity. This competitive advantage of intrachromosomal Tys results from the relative efficiencies of different NAHR repair pathways. Finally, NAHR generates deleterious rearrangements more frequently when DSBs occur outside rather than within a Ty repeat. These findings yield insights into mechanisms of repeat-mediated genome rearrangements associated with evolution and cancer.

  2. Recombination Promoted by DNA Viruses: Phage λ to Herpes Simplex Virus

    Science.gov (United States)

    Weller, Sandra K.; Sawitzke, James A.

    2015-01-01

    The purpose of this review is to explore recombination strategies in DNA viruses. Homologous recombination is a universal genetic process that plays multiple roles in the biology of all organisms, including viruses. Recombination and DNA replication are interconnected, with recombination being essential for repairing DNA damage and supporting replication of the viral genome. Recombination also creates genetic diversity, and viral recombination mechanisms have important implications for understanding viral origins as well as the dynamic nature of viral-host interactions. Both bacteriophage λ and herpes simplex virus (HSV) display high rates of recombination, both utilizing their own proteins and commandeering cellular proteins to promote recombination reactions. We focus primarily on λ and HSV, as they have proven amenable to both genetic and biochemical analysis and have recently been shown to exhibit some surprising similarities that will guide future studies. PMID:25002096

  3. Genetic dependence of recombination in recD mutants of Escherichia coli

    International Nuclear Information System (INIS)

    Lovett, S.T.; Luisi-DeLuca, C.; Kolodner, R.D.

    1988-01-01

    RecBCD enzyme has multiple activities including helicase, exonuclease and endonuclease activities. Mutations in the genes recB or recC, encoding two subunits of the enzyme, reduce the frequency of many types of recombinational events. Mutations in recD, encoding the third subunit, do not reduce recombination even though most of the activities of the RecBCD enzyme are severely reduced. In this study, the genetic dependence of different types of recombination in recD mutants has been investigated. The effects of mutations in genes in the RecBCD pathway (recA and recC) as well as the genes specific for the RecF pathway (recF, recJ, recN, recO, recQ, ruv and lexA) were tested on conjugational, transductional and plasmid recombination, and on UV survival. recD mutants were hyper-recombinogenic for all the monitored recombination events, especially those involving plasmids, and all recombination events in recD strains required recA and recC. In addition, unlike recD+ strains, chromosomal recombination events and the repair of UV damage to DNA in recD strains were dependent on one RecF pathway gene, recJ. Only a subset of the tested recombination events were affected by ruv, recN, recQ, recO and lexA mutations

  4. Evidence of animal mtDNA recombination between divergent populations of the potato cyst nematode Globodera pallida.

    Science.gov (United States)

    Hoolahan, Angelique H; Blok, Vivian C; Gibson, Tracey; Dowton, Mark

    2012-03-01

    Recombination is typically assumed to be absent in animal mitochondrial genomes (mtDNA). However, the maternal mode of inheritance means that recombinant products are indistinguishable from their progenitor molecules. The majority of studies of mtDNA recombination assess past recombination events, where patterns of recombination are inferred by comparing the mtDNA of different individuals. Few studies assess contemporary mtDNA recombination, where recombinant molecules are observed as direct mosaics of known progenitor molecules. Here we use the potato cyst nematode, Globodera pallida, to investigate past and contemporary recombination. Past recombination was assessed within and between populations of G. pallida, and contemporary recombination was assessed in the progeny of experimental crosses of these populations. Breeding of genetically divergent organisms may cause paternal mtDNA leakage, resulting in heteroplasmy and facilitating the detection of recombination. To assess contemporary recombination we looked for evidence of recombination between the mtDNA of the parental populations within the mtDNA of progeny. Past recombination was detected between a South American population and several UK populations of G. pallida, as well as between two South American populations. This suggests that these populations may have interbred, paternal mtDNA leakage occurred, and the mtDNA of these populations subsequently recombined. This evidence challenges two dogmas of animal mtDNA evolution; no recombination and maternal inheritance. No contemporary recombination between the parental populations was detected in the progeny of the experimental crosses. This supports current arguments that mtDNA recombination events are rare. More sensitive detection methods may be required to adequately assess contemporary mtDNA recombination in animals.

  5. Recent advances in yeast molecular biology: recombinant DNA

    International Nuclear Information System (INIS)

    1982-09-01

    Separate abstracts were prepared for the 25 papers presented at a workshop focusing on chromosomal structure, gene regulation, recombination, DNA repair, and cell type control, that have been obtained by experimental approaches incorporating the new technologies of yeast DNA transformation, molecular cloning, and DNA sequence analysis

  6. Self-regulation of recombinant DNA technology in Japan in the 1970s.

    Science.gov (United States)

    Nagai, Hiroyuki; Nukaga, Yoshio; Saeki, Koji; Akabayashi, Akira

    2009-07-01

    Recombinant DNA technology was developed in the United States in the early 1970s. Leading scientists held an international Asilomar Conference in 1975 to examine the self regulation of recombinant DNA technology, followed by the U.S. National Institutes of Health drafting the Recombinant DNA Research Guidelines in 1976. The result of this conference significantly affected many nations, including Japan. However, there have been few historical studies on the self-regulation of recombinant technologies conducted by scientists and government officials in Japan. The purpose of this paper is to analyze how the Science Council of Japan, the Ministry of Education, Science adn Culture, and the Science and Technology Agency developed self-regulation policies for recombinant DNA technology in Japan in the 1970s. Groups of molecular biologist and geneticists played a key role in establishing guidelines in cooperation with government officials. Our findings suggest that self-regulation policies on recombinant DNA technology have influenced safety management for the life sciences and establishment of institutions for review in Japan.

  7. Mechanism of Homologous Recombination and Implications for Aging-Related Deletions in Mitochondrial DNA

    Science.gov (United States)

    2013-01-01

    SUMMARY Homologous recombination is a universal process, conserved from bacteriophage to human, which is important for the repair of double-strand DNA breaks. Recombination in mitochondrial DNA (mtDNA) was documented more than 4 decades ago, but the underlying molecular mechanism has remained elusive. Recent studies have revealed the presence of a Rad52-type recombination system of bacteriophage origin in mitochondria, which operates by a single-strand annealing mechanism independent of the canonical RecA/Rad51-type recombinases. Increasing evidence supports the notion that, like in bacteriophages, mtDNA inheritance is a coordinated interplay between recombination, repair, and replication. These findings could have profound implications for understanding the mechanism of mtDNA inheritance and the generation of mtDNA deletions in aging cells. PMID:24006472

  8. Construction of recombinant DNA clone for bovine viral diarrhea virus

    International Nuclear Information System (INIS)

    Yeo, S.G.; Cho, H.J.; Masri, S.A.

    1992-01-01

    Molecular cloning was carried out on the Danish strain of bovine viral diarrhea virus (BVDV) to construct strategy for the diagnostic tools and effective vaccine of BVD afterwards. A recombinant DNA clone (No. 29) was established successfully from cDNA for viral RNA tailed with adenine homopolymer at 3 -end. 32 P-labeled DNA probes of 300~1, 800bp fragments, originating from the clone 29, directed specific DNA-RNA hybridization results with BVDV RNA. Recombinant DNA of the clone 29 was about 5,200bp representing 41.6% of the full length of Danish strain's RNA, and restriction sites were recognized for EooR I, Sst I, Hind III and Pst I restriction enzymes in the DNA fragment

  9. Transcription and recombination: when RNA meets DNA.

    Science.gov (United States)

    Aguilera, Andrés; Gaillard, Hélène

    2014-08-01

    A particularly relevant phenomenon in cell physiology and proliferation is the fact that spontaneous mitotic recombination is strongly enhanced by transcription. The most accepted view is that transcription increases the occurrence of double-strand breaks and/or single-stranded DNA gaps that are repaired by recombination. Most breaks would arise as a consequence of the impact that transcription has on replication fork progression, provoking its stalling and/or breakage. Here, we discuss the mechanisms responsible for the cross talk between transcription and recombination, with emphasis on (1) the transcription-replication conflicts as the main source of recombinogenic DNA breaks, and (2) the formation of cotranscriptional R-loops as a major cause of such breaks. The new emerging questions and perspectives are discussed on the basis of the interference between transcription and replication, as well as the way RNA influences genome dynamics. Copyright © 2014 Cold Spring Harbor Laboratory Press; all rights reserved.

  10. Recent advances in DNA repair and recombination.

    Science.gov (United States)

    Iwanejko, L A; Jones, N J

    1998-09-11

    The subjects of the talks at this 1-day DNA Repair Network meeting, held at City University, London on December 15, 1997, encompassed a range of topics and reflected some of the current areas of research in the United Kingdom. Topics included DNA double-strand break repair, V(D)J recombination, DNA ligases, the RecQ family of helicases and Bloom's syndrome, UVB and immunosuppression, the repair of oxidative damage and mismatch repair mechanisms.

  11. DNA repair and its relation to recombination-deficient and other mutations in Bacillus subtilis

    International Nuclear Information System (INIS)

    Ganesan, A.T.

    1975-01-01

    DNA repair processes operating in Bacillus subtilis are similar to other transformable bacterial systems. Radiation-sensitive, recombination-deficient mutants are blocked in distinct steps leading to recombination. DNA polymerase I is essential for the repair of x-ray-induced damage to DNA but not for recombination

  12. The Mitochondrial DNA (mtDNA)-Associated Protein SWIB5 Influences mtDNA Architecture and Homologous Recombination

    KAUST Repository

    Blomme, Jonas

    2017-04-19

    In addition to the nucleus, mitochondria and chloroplasts in plant cells also contain genomes. Efficient DNA repair pathways are crucial in these organelles to fix damage resulting from endogenous and exogenous factors. Plant organellar genomes are complex compared with their animal counterparts, and although several plant-specific mediators of organelle DNA repair have been reported, many regulators remain to be identified. Here, we show that a mitochondrial SWI/SNF (nucleosome remodeling) complex B protein, SWIB5, is capable of associating with mitochondrial DNA (mtDNA) in Arabidopsis thaliana. Gainand loss-of-function mutants provided evidence for a role of SWIB5 in influencing mtDNA architecture and homologous recombination at specific intermediate-sized repeats both under normal and genotoxic conditions. SWIB5 interacts with other mitochondrial SWIB proteins. Gene expression and mutant phenotypic analysis of SWIB5 and SWIB family members suggests a link between organellar genome maintenance and cell proliferation. Taken together, our work presents a protein family that influences mtDNA architecture and homologous recombination in plants and suggests a link between organelle functioning and plant development.

  13. Interaction between HIV-1 Tat and DNA-PKcs modulates HIV transcription and class switch recombination.

    Science.gov (United States)

    Zhang, Shi-Meng; Zhang, He; Yang, Tian-Yi; Ying, Tian-Yi; Yang, Pei-Xiang; Liu, Xiao-Dan; Tang, Sheng-Jian; Zhou, Ping-Kun

    2014-01-01

    HIV-1 tat targets a variety of host cell proteins to facilitate viral transcription and disrupts host cellular immunity by inducing lymphocyte apoptosis, but whether it influences humoral immunity remains unclear. Previously, our group demonstrated that tat depresses expression of DNA-PKcs, a critical component of the non-homologous end joining pathway (NHEJ) of DNA double-strand breaks repair, immunoglobulin class switch recombination (CSR) and V(D)J recombination, and sensitizes cells to ionizing radiation. In this study, we demonstrated that HIV-1 Tat down-regulates DNA-PKcs expression by directly binding to the core promoter sequence. In addition, Tat interacts with and activates the kinase activity of DNA-PKcs in a dose-dependent and DNA independent manner. Furthermore, Tat inhibits class switch recombination (CSR) at low concentrations (≤ 4 µg/ml) and stimulates CSR at high concentrations (≥ 8 µg/ml). On the other hand, low protein level and high kinase activity of DNA-PKcs promotes HIV-1 transcription, while high protein level and low kinase activity inhibit HIV-1 transcription. Co-immunoprecipitation results revealed that DNA-PKcs forms a large complex comprised of Cyclin T1, CDK9 and Tat via direct interacting with CDK9 and Tat but not Cyclin T1. Taken together, our results provide new clues that Tat regulates host humoral immunity via both transcriptional depression and kinase activation of DNA-PKcs. We also raise the possibility that inhibitors and interventions directed towards DNA-PKcs may inhibit HIV-1 transcription in AIDS patients.

  14. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats

    Directory of Open Access Journals (Sweden)

    Daniël O. Warmerdam

    2016-03-01

    Full Text Available rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of breaks in 45S rDNA, and this results in repeat loss. We identify the structural maintenance of chromosomes protein 5 (SMC5 as contributing to recombination-mediated repair of rDNA breaks. Together, our data demonstrate that SMC5-mediated recombination can lead to error-prone repair of 45S rDNA repeats, resulting in their loss and thereby reducing cellular viability.

  15. Srs2 mediates PCNA-SUMO-dependent inhibition of DNA repair synthesis

    International Nuclear Information System (INIS)

    Burkovics, Peter; Sebesta, Marek; Kolesar, Peter; Sisakova, Alexandra; Marini, Victoria; Plault, Nicolas; Szukacsov, Valeria; Pinter, Lajos; Haracska, Lajos; Robert, Thomas; Kolesar, Peter; Gangloff, Serge; Krejci, Lumir

    2013-01-01

    Completion of DNA replication needs to be ensured even when challenged with fork progression problems or DNA damage. PCNA and its modifications constitute a molecular switch to control distinct repair pathways. In yeast, SUMOylated PCNA (S-PCNA) recruits Srs2 to sites of replication where Srs2 can disrupt Rad51 filaments and prevent homologous recombination (HR). We report here an unexpected additional mechanism by which S-PCNA and Srs2 block the synthesis-dependent extension of a recombination intermediate, thus limiting its potentially hazardous resolution in association with a cross-over. This new Srs2 activity requires the SUMO interaction motif at its C-terminus, but neither its translocase activity nor its interaction with Rad51. Srs2 binding to S-PCNA dissociates Polδ and Polη from the repair synthesis machinery, thus revealing a novel regulatory mechanism controlling spontaneous genome rearrangements. Our results suggest that cycling cells use the Siz1-dependent SUMOylation of PCNA to limit the extension of repair synthesis during template switch or HR and attenuate reciprocal DNA strand exchanges to maintain genome stability. (authors)

  16. Characterization of a bacteriophage T4 mutant lacking DNA-dependent ATPase

    International Nuclear Information System (INIS)

    Behme, M.T.; Ebisuzaki, K.

    1975-01-01

    A DNA-dependent ATPase has previously been purified from bacteriophage T4-infected Escherichia coli. A mutant phage strain lacking this enzyme has been isolated and characterized. Although the mutant strain produced no detectable DNA-dependent ATPase, growth properties were not affected. Burst sizes were similar for the mutant phage and T4D in polAl, recB, recC, uvrA, uvrB, uvrC, and various DNA-negative E. coli. UV sensitivity and genetic recombination were normal in a variety of E. coli hosts. Mapping data indicate that the genetic locus controlling the mutant occurs near gene 56. The nonessential nature of this gene is discussed

  17. Evaluation of the efficiency and utility of recombinant enzyme-free seamless DNA cloning methods

    Directory of Open Access Journals (Sweden)

    Ken Motohashi

    2017-03-01

    Full Text Available Simple and low-cost recombinant enzyme-free seamless DNA cloning methods have recently become available. In vivo Escherichia coli cloning (iVEC can directly transform a mixture of insert and vector DNA fragments into E. coli, which are ligated by endogenous homologous recombination activity in the cells. Seamless ligation cloning extract (SLiCE cloning uses the endogenous recombination activity of E. coli cellular extracts in vitro to ligate insert and vector DNA fragments. An evaluation of the efficiency and utility of these methods is important in deciding the adoption of a seamless cloning method as a useful tool. In this study, both seamless cloning methods incorporated inserting DNA fragments into linearized DNA vectors through short (15–39 bp end homology regions. However, colony formation was 30–60-fold higher with SLiCE cloning in end homology regions between 15 and 29 bp than with the iVEC method using DH5α competent cells. E. coli AQ3625 strains, which harbor a sbcA gene mutation that activates the RecE homologous recombination pathway, can be used to efficiently ligate insert and vector DNA fragments with short-end homology regions in vivo. Using AQ3625 competent cells in the iVEC method improved the rate of colony formation, but the efficiency and accuracy of SLiCE cloning were still higher. In addition, the efficiency of seamless cloning methods depends on the intrinsic competency of E. coli cells. The competency of chemically competent AQ3625 cells was lower than that of competent DH5α cells, in all cases of chemically competent cell preparations using the three different methods. Moreover, SLiCE cloning permits the use of both homemade and commercially available competent cells because it can use general E. coli recA− strains such as DH5α as host cells for transformation. Therefore, between the two methods, SLiCE cloning provides both higher efficiency and better utility than the iVEC method for seamless DNA plasmid

  18. ATP-dependent chromatin remodeling in the DNA-damage response

    Directory of Open Access Journals (Sweden)

    Lans Hannes

    2012-01-01

    Full Text Available Abstract The integrity of DNA is continuously challenged by metabolism-derived and environmental genotoxic agents that cause a variety of DNA lesions, including base alterations and breaks. DNA damage interferes with vital processes such as transcription and replication, and if not repaired properly, can ultimately lead to premature aging and cancer. Multiple DNA pathways signaling for DNA repair and DNA damage collectively safeguard the integrity of DNA. Chromatin plays a pivotal role in regulating DNA-associated processes, and is itself subject to regulation by the DNA-damage response. Chromatin influences access to DNA, and often serves as a docking or signaling site for repair and signaling proteins. Its structure can be adapted by post-translational histone modifications and nucleosome remodeling, catalyzed by the activity of ATP-dependent chromatin-remodeling complexes. In recent years, accumulating evidence has suggested that ATP-dependent chromatin-remodeling complexes play important, although poorly characterized, roles in facilitating the effectiveness of the DNA-damage response. In this review, we summarize the current knowledge on the involvement of ATP-dependent chromatin remodeling in three major DNA repair pathways: nucleotide excision repair, homologous recombination, and non-homologous end-joining. This shows that a surprisingly large number of different remodeling complexes display pleiotropic functions during different stages of the DNA-damage response. Moreover, several complexes seem to have multiple functions, and are implicated in various mechanistically distinct repair pathways.

  19. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats.

    Science.gov (United States)

    Warmerdam, Daniël O; van den Berg, Jeroen; Medema, René H

    2016-03-22

    rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of breaks in 45S rDNA, and this results in repeat loss. We identify the structural maintenance of chromosomes protein 5 (SMC5) as contributing to recombination-mediated repair of rDNA breaks. Together, our data demonstrate that SMC5-mediated recombination can lead to error-prone repair of 45S rDNA repeats, resulting in their loss and thereby reducing cellular viability. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  20. A role for recombination junctions in the segregation of mitochondrial DNA in yeast.

    Science.gov (United States)

    Lockshon, D; Zweifel, S G; Freeman-Cook, L L; Lorimer, H E; Brewer, B J; Fangman, W L

    1995-06-16

    In S. cerevisiae, mitochondrial DNA (mtDNA) molecules, in spite of their high copy number, segregate as if there were a small number of heritable units. The rapid segregation of mitochondrial genomes can be analyzed using mtDNA deletion variants. These small, amplified genomes segregate preferentially from mixed zygotes relative to wild-type mtDNA. This segregation advantage is abolished by mutations in a gene, MGT1, that encodes a recombination junction-resolving enzyme. We show here that resolvase deficiency causes a larger proportion of molecules to be linked together by recombination junctions, resulting in the aggregation of mtDNA into a small number of cytological structures. This change in mtDNA structure can account for the increased mitotic loss of mtDNA and the altered pattern of mtDNA segregation from zygotes. We propose that the level of unresolved recombination junctions influences the number of heritable units of mtDNA.

  1. DNA-PK, ATM and ATR collaboratively regulate p53-RPA interaction to facilitate homologous recombination DNA repair.

    Science.gov (United States)

    Serrano, M A; Li, Z; Dangeti, M; Musich, P R; Patrick, S; Roginskaya, M; Cartwright, B; Zou, Y

    2013-05-09

    Homologous recombination (HR) and nonhomologous end joining (NHEJ) are two distinct DNA double-stranded break (DSB) repair pathways. Here, we report that DNA-dependent protein kinase (DNA-PK), the core component of NHEJ, partnering with DNA-damage checkpoint kinases ataxia telangiectasia mutated (ATM) and ATM- and Rad3-related (ATR), regulates HR repair of DSBs. The regulation was accomplished through modulation of the p53 and replication protein A (RPA) interaction. We show that upon DNA damage, p53 and RPA were freed from a p53-RPA complex by simultaneous phosphorylations of RPA at the N-terminus of RPA32 subunit by DNA-PK and of p53 at Ser37 and Ser46 in a Chk1/Chk2-independent manner by ATR and ATM, respectively. Neither the phosphorylation of RPA nor of p53 alone could dissociate p53 and RPA. Furthermore, disruption of the release significantly compromised HR repair of DSBs. Our results reveal a mechanism for the crosstalk between HR repair and NHEJ through the co-regulation of p53-RPA interaction by DNA-PK, ATM and ATR.

  2. MEIOB targets single-strand DNA and is necessary for meiotic recombination.

    Directory of Open Access Journals (Sweden)

    Benoit Souquet

    Full Text Available Meiotic recombination is a mandatory process for sexual reproduction. We identified a protein specifically implicated in meiotic homologous recombination that we named: meiosis specific with OB domain (MEIOB. This protein is conserved among metazoan species and contains single-strand DNA binding sites similar to those of RPA1. Our studies in vitro revealed that both recombinant and endogenous MEIOB can be retained on single-strand DNA. Those in vivo demonstrated the specific expression of Meiob in early meiotic germ cells and the co-localization of MEIOB protein with RPA on chromosome axes. MEIOB localization in Dmc1 (-/- spermatocytes indicated that it accumulates on resected DNA. Homologous Meiob deletion in mice caused infertility in both sexes, due to a meiotic arrest at a zygotene/pachytene-like stage. DNA double strand break repair and homologous chromosome synapsis were impaired in Meiob (-/- meiocytes. Interestingly MEIOB appeared to be dispensable for the initial loading of recombinases but was required to maintain a proper number of RAD51 and DMC1 foci beyond the zygotene stage. In light of these findings, we propose that RPA and this new single-strand DNA binding protein MEIOB, are essential to ensure the proper stabilization of recombinases which is required for successful homology search and meiotic recombination.

  3. Efficient preparation of shuffled DNA libraries through recombination (Gateway) cloning.

    Science.gov (United States)

    Lehtonen, Soili I; Taskinen, Barbara; Ojala, Elina; Kukkurainen, Sampo; Rahikainen, Rolle; Riihimäki, Tiina A; Laitinen, Olli H; Kulomaa, Markku S; Hytönen, Vesa P

    2015-01-01

    Efficient and robust subcloning is essential for the construction of high-diversity DNA libraries in the field of directed evolution. We have developed a more efficient method for the subcloning of DNA-shuffled libraries by employing recombination cloning (Gateway). The Gateway cloning procedure was performed directly after the gene reassembly reaction, without additional purification and amplification steps, thus simplifying the conventional DNA shuffling protocols. Recombination-based cloning, directly from the heterologous reassembly reaction, conserved the high quality of the library and reduced the time required for the library construction. The described method is generally compatible for the construction of DNA-shuffled gene libraries. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  4. ATP- and NAD+-dependent DNA ligases share an essential function in the halophilic archaeon Haloferax volcanii

    DEFF Research Database (Denmark)

    Zhao, A.; Gray, F. C; MacNeill, S. A.

    2006-01-01

    DNA ligases join the ends of DNA molecules during replication, repair and recombination. ATP-dependent ligases are found predominantly in the eukarya and archaea whereas NAD+-dependent DNA ligases are found only in the eubacteria and in entomopoxviruses. Using the genetically tractable halophile....... volcanii also encodes an NAD+-dependent DNA ligase family member, LigN, the first such enzyme to be identified in the archaea, and present phylogenetic analysis indicating that the gene encoding this protein has been acquired by lateral gene transfer (LGT) from eubacteria. As with LigA, we show that Lig...

  5. DNA fragmentation and cytotoxicity by recombinant human tumor necrosis factor in L929 fibroblast cells

    International Nuclear Information System (INIS)

    Kosaka, T.; Kuwabara, M.; Koide, F.

    1992-01-01

    Induction of cell DNA fragmentation by treatment of recombinant human Tumor Necrosis Factor alpha (rhTNF alpha) was examined by using mouse L929 cells derived from mouse fibroblast cells. The amount of DNA fragments derived from rhTNF alpha-treated cells, detected by alkaline elution technique, was smaller than that derived from X-irradiated cells. The rhTNF alpha caused the DNA fragmentation depending on its incubation time and concentration. The DNA damage caused by rhTNF alpha treatment correlated with its cytotoxicity. This result suggested that the DNA fragmentation is one of causes of cell death. The treatment with proteinase K of DNA obtained from rhTNF alpha-treated cells did not increase the amount of DNA fragmentation, which indicates that rhTNF alpha causes DNA-fragmentation but not DNA-protein cross-linking

  6. Xrcc1-dependent and Ku-dependent DNA double-strand break repair kinetics in Arabidopsis plants.

    Science.gov (United States)

    Charbonnel, Cyril; Gallego, Maria E; White, Charles I

    2010-10-01

    Double-strand breakage (DSB) of DNA involves loss of information on the two strands of the DNA fibre and thus cannot be repaired by simple copying of the complementary strand which is possible with single-strand DNA damage. Homologous recombination (HR) can precisely repair DSB using another copy of the genome as template and non-homologous recombination (NHR) permits repair of DSB with little or no dependence on DNA sequence homology. In addition to the well-characterised Ku-dependent non-homologous end-joining (NHEJ) pathway, much recent attention has been focused on Ku-independent NHR. The complex interrelationships and regulation of NHR pathways remain poorly understood, even more so in the case of plants, and we present here an analysis of Ku-dependent and Ku-independent repair of DSB in Arabidopsis thaliana. We have characterised an Arabidopsis xrcc1 mutant and developed quantitative analysis of the kinetics of appearance and loss of γ-H2AX foci as a tool to measure DSB repair in dividing root tip cells of γ-irradiated plants in vivo. This approach has permitted determination of DSB repair kinetics in planta following a short pulse of γ-irradiation, establishing the existence of a Ku-independent, Xrcc1-dependent DSB repair pathway. Furthermore, our data show a role for Ku80 during the first minutes post-irradiation and that Xrcc1 also plays such a role, but only in the absence of Ku. The importance of Xrcc1 is, however, clearly visible at later times in the presence of Ku, showing that alternative end-joining plays an important role in DSB repair even in the presence of active NHEJ. © 2010 The Authors. Journal compilation © 2010 Blackwell Publishing Ltd.

  7. Recent advances in yeast molecular biology: recombinant DNA. [Lead abstract

    Energy Technology Data Exchange (ETDEWEB)

    1982-09-01

    Separate abstracts were prepared for the 25 papers presented at a workshop focusing on chromosomal structure, gene regulation, recombination, DNA repair, and cell type control, that have been obtained by experimental approaches incorporating the new technologies of yeast DNA transformation, molecular cloning, and DNA sequence analysis. (KRM)

  8. Overproduction of single-stranded-DNA-binding protein specifically inhibits recombination of UV-irradiated bacteriophage DNA in Escherichia coli

    International Nuclear Information System (INIS)

    Moreau, P.L.

    1988-01-01

    Overproduction of single-stranded DNA (ssDNA)-binding protein (SSB) in uvr Escherichia coli mutants results in a wide range of altered phenotypes. (i) Cell survival after UV irradiation is decreased; (ii) expression of the recA-lexA regulon is slightly reduced after UV irradiation, whereas it is increased without irradiation; and (iii) recombination of UV-damaged lambda DNA is inhibited, whereas recombination of nonirradiated DNA is unaffected. These results are consistent with the idea that in UV-damaged bacteria, SSB is first required to allow the formation of short complexes of RecA protein and ssDNA that mediate cleavage of the LexA protein. However, in a second stage, SSB should be displaced from ssDNA to permit the production of longer RecA-ssDNA nucleoprotein filaments that are required for strand pairing and, hence, recombinational repair. Since bacteria overproducing SSB appear identical in physiological respects to recF mutant bacteria, it is suggested that the RecF protein (alone or with other proteins of the RecF pathway) may help RecA protein to release SSB from ssDNA

  9. DNA-dependent protein kinase (DAN-PK), a key enzyme in the re-ligation of DNA double-strand breaks

    International Nuclear Information System (INIS)

    Hennequin, C.; Averbeck, D.

    1999-01-01

    Repair pathways of DNA are now defined and some important findings have been discovered in the last few years. DNA non-homologous end-joining (NEH) is a crucial process in the repair of radiation-induced double-strand breaks (DSBs). NHEj implies at least three steps: the DNA free-ends must get closer, preparation of the free-ends by exonucleases and then a transient hybridization in a region of DNA with weak homology. DNA-dependent protein kinase (DNA-PK) is the key enzyme in this process. DNA-PK is a nuclear serine/threonine kinase that comprises three components: a catalytic subunit (DNA-PK cs ) and two regulatory subunits, DNA-binding proteins, Ku80 and Ku70. The severe combined immuno-deficient (scid) mice are deficient in DNA-PK cs : this protein is involved both in DNA repair and in the V(D)J recombination of immunoglobulin and T-cell receptor genes. It is a protein-kinase of the P13-kinase family and which can phosphorylate Ku proteins, p53 and probably some other proteins still unknown. DNA-PK is an important actor of DSBs repair (induced by ionising radiations or by drugs like etoposide), but obviously it is not the only mechanism existing in the cell for this function. Some others, like homologous recombination, seem also to have a great importance for cell survival. (authors)

  10. Genomic analysis of murine DNA-dependent protein kinase

    International Nuclear Information System (INIS)

    Fujimori, A.; Abe, M.

    2003-01-01

    Full text: The gene of catalytic subunit of DNA dependent protein kinase is responsible gene for SCID mice. The molecules play a critical role in non-homologous end joining including the V(D)J recombination. Contribution of the molecules to the difference of radiosensitivity and the susceptibility to cancer has been suggested. Here we show the entire nucleotide sequence of approximately 193 kbp and 84 kbp genomic regions encoding the entire DNA-PKcs gene in the mouse and chicken respectively. Retroposon was found in the intron 51 of mouse genomic DNA-PKcs gene but in human and chicken. Comparative analysis of these two species strongly suggested that only two genes, DNA-PKcs and MCM4, exist in the region of both species. Several conserved sequences and cis elements, however, were predicted. Recently, the orthologous region for the human DNA-PKcs locus was completed. The results of further comparative study will be discussed

  11. The PCNA-associated protein PARI negatively regulates homologous recombination via the inhibition of DNA repair synthesis

    DEFF Research Database (Denmark)

    Burkovics, Peter; Dome, Lili; Juhasz, Szilvia

    2016-01-01

    to inhibit homologous recombination (HR) events. Here, we describe a biochemical mechanism in which PARI functions as an HR regulator after replication fork stalling and during double-strand break repair. In our reconstituted biochemical system, we show that PARI inhibits DNA repair synthesis during...... recombination events in a PCNA interaction-dependent way but independently of its UvrD-like helicase domain. In accordance, we demonstrate that PARI inhibits HR in vivo, and its knockdown suppresses the UV sensitivity of RAD18-depleted cells. Our data reveal a novel human regulatory mechanism that limits...

  12. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats

    OpenAIRE

    Warmerdam, Daniël O.; van den Berg, Jeroen; Medema, René H.

    2016-01-01

    rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of b...

  13. Quantification and persistence of recombinant DNA of Roundup Ready corn and soybean in rotation.

    Science.gov (United States)

    Lerat, Sylvain; Gulden, Robert H; Hart, Miranda M; Powell, Jeff R; England, Laura S; Pauls, K Peter; Swanton, Clarence J; Klironomos, John N; Trevors, Jack T

    2007-12-12

    The presence of the recombinant cp4 epsps gene from Roundup Ready (RR) corn and RR soybean was quantified using real-time PCR in soil samples from a field experiment growing RR and conventional corn and soybean in rotation. RR corn and RR soybean cp4 epsps persisted in soil for up to 1 year after seeding. The concentration of recombinant DNA in soil peaked in July and August in RR corn and RR soybean plots, respectively. A small fraction of soil samples from plots seeded with conventional crops contained recombinant DNA, suggesting transgene dispersal by means of natural process or agricultural practices. This research will aid in the understanding of the persistence of recombinant DNA in agricultural cropping systems.

  14. AID-induced decrease in topoisomerase 1 induces DNA structural alteration and DNA cleavage for class switch recombination.

    Science.gov (United States)

    Kobayashi, Maki; Aida, Masatoshi; Nagaoka, Hitoshi; Begum, Nasim A; Kitawaki, Yoko; Nakata, Mikiyo; Stanlie, Andre; Doi, Tomomitsu; Kato, Lucia; Okazaki, Il-mi; Shinkura, Reiko; Muramatsu, Masamichi; Kinoshita, Kazuo; Honjo, Tasuku

    2009-12-29

    To initiate class switch recombination (CSR) activation-induced cytidine deaminase (AID) induces staggered nick cleavage in the S region, which lies 5' to each Ig constant region gene and is rich in palindromic sequences. Topoisomerase 1 (Top1) controls the supercoiling of DNA by nicking, rotating, and religating one strand of DNA. Curiously, Top1 reduction or AID overexpression causes the genomic instability. Here, we report that the inactivation of Top1 by its specific inhibitor camptothecin drastically blocked both the S region cleavage and CSR, indicating that Top1 is responsible for the S region cleavage in CSR. Surprisingly, AID expression suppressed Top1 mRNA translation and reduced its protein level. In addition, the decrease in the Top1 protein by RNA-mediated knockdown augmented the AID-dependent S region cleavage, as well as CSR. Furthermore, Top1 reduction altered DNA structure of the Smu region. Taken together, AID-induced Top1 reduction alters S region DNA structure probably to non-B form, on which Top1 can introduce nicks but cannot religate, resulting in S region cleavage.

  15. Recombinational DNA repair and human disease

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, Larry H.; Schild, David

    2002-11-30

    We review the genes and proteins related to the homologous recombinational repair (HRR) pathway that are implicated in cancer through either genetic disorders that predispose to cancer through chromosome instability or the occurrence of somatic mutations that contribute to carcinogenesis. Ataxia telangiectasia (AT), Nijmegen breakage syndrome (NBS), and an ataxia-like disorder (ATLD), are chromosome instability disorders that are defective in the ataxia telangiectasia mutated (ATM), NBS, and Mre11 genes, respectively. These genes are critical in maintaining cellular resistance to ionizing radiation (IR), which kills largely by the production of double-strand breaks (DSBs). Bloom syndrome involves a defect in the BLM helicase, which seems to play a role in restarting DNA replication forks that are blocked at lesions, thereby promoting chromosome stability. The Werner syndrome gene (WRN) helicase, another member of the RecQ family like BLM, has very recently been found to help mediate homologous recombination. Fanconi anemia (FA) is a genetically complex chromosomal instability disorder involving seven or more genes, one of which is BRCA2. FA may be at least partially caused by the aberrant production of reactive oxidative species. The breast cancer-associated BRCA1 and BRCA2 proteins are strongly implicated in HRR; BRCA2 associates with Rad51 and appears to regulate its activity. We discuss in detail the phenotypes of the various mutant cell lines and the signaling pathways mediated by the ATM kinase. ATM's phosphorylation targets can be grouped into oxidative stress-mediated transcriptional changes, cell cycle checkpoints, and recombinational repair. We present the DNA damage response pathways by using the DSB as the prototype lesion, whose incorrect repair can initiate and augment karyotypic abnormalities.

  16. Recombinational DNA repair and human disease

    International Nuclear Information System (INIS)

    Thompson, Larry H.; Schild, David

    2002-01-01

    We review the genes and proteins related to the homologous recombinational repair (HRR) pathway that are implicated in cancer through either genetic disorders that predispose to cancer through chromosome instability or the occurrence of somatic mutations that contribute to carcinogenesis. Ataxia telangiectasia (AT), Nijmegen breakage syndrome (NBS), and an ataxia-like disorder (ATLD), are chromosome instability disorders that are defective in the ataxia telangiectasia mutated (ATM), NBS, and Mre11 genes, respectively. These genes are critical in maintaining cellular resistance to ionizing radiation (IR), which kills largely by the production of double-strand breaks (DSBs). Bloom syndrome involves a defect in the BLM helicase, which seems to play a role in restarting DNA replication forks that are blocked at lesions, thereby promoting chromosome stability. The Werner syndrome gene (WRN) helicase, another member of the RecQ family like BLM, has very recently been found to help mediate homologous recombination. Fanconi anemia (FA) is a genetically complex chromosomal instability disorder involving seven or more genes, one of which is BRCA2. FA may be at least partially caused by the aberrant production of reactive oxidative species. The breast cancer-associated BRCA1 and BRCA2 proteins are strongly implicated in HRR; BRCA2 associates with Rad51 and appears to regulate its activity. We discuss in detail the phenotypes of the various mutant cell lines and the signaling pathways mediated by the ATM kinase. ATM's phosphorylation targets can be grouped into oxidative stress-mediated transcriptional changes, cell cycle checkpoints, and recombinational repair. We present the DNA damage response pathways by using the DSB as the prototype lesion, whose incorrect repair can initiate and augment karyotypic abnormalities

  17. Rogue athletes and recombinant DNA technology: challenges for doping control.

    Science.gov (United States)

    Azzazy, Hassan M E; Mansour, Mai M H

    2007-10-01

    The quest for athletic excellence holds no limit for some athletes, and the advances in recombinant DNA technology have handed these athletes the ultimate doping weapons: recombinant proteins and gene doping. Some detection methods are now available for several recombinant proteins that are commercially available as pharmaceuticals and being abused by dopers. However, researchers are struggling to come up with efficient detection methods in preparation for the imminent threat of gene doping, expected in the 2008 Olympics. This Forum article presents the main detection strategies for recombinant proteins and the forthcoming detection strategies for gene doping as well as the prime analytical challenges facing them.

  18. Recombinant DNA. Rifkin's regulatory revivalism runs riot.

    Science.gov (United States)

    David, P

    Jeremy Rifkin, activist opponent of genetic engineering, has adopted tactics of litigation, persuasion, and confrontation in his campaign to halt genetic experimentation. The Recombinant DNA Advisory Committee of the National Institutes of Health has often been the target of his criticism, most recently for its failure to prepare an environmental risk assessment for some DNA tests it approved. Rifkin has won support for his position from religious organizations in the United States, and in June 1983 persuaded an ecumenical group of religious leaders to ask Congress to ban genetic experiments that would affect the human germ line.

  19. Heterogeneous nuclear ribonucleoprotein B1 protein impairs DNA repair mediated through the inhibition of DNA-dependent protein kinase activity

    International Nuclear Information System (INIS)

    Iwanaga, Kentaro; Sueoka, Naoko; Sato, Akemi; Hayashi, Shinichiro; Sueoka, Eisaburo

    2005-01-01

    Heterogeneous nuclear ribonucleoprotein B1, an RNA binding protein, is overexpressed from the early stage of lung cancers; it is evident even in bronchial dysplasia, a premalignant lesion. We evaluated the proteins bound with hnRNP B1 and found that hnRNP B1 interacted with DNA-dependent protein kinase (DNA-PK) complex, and recombinant hnRNP B1 protein dose-dependently inhibited DNA-PK activity in vitro. To test the effect of hnRNP B1 on DNA repair, we performed comet assay after irradiation, using normal human bronchial epithelial (HBE) cells treated with siRNA for hnRNP A2/B1: reduction of hnRNP B1 treated with siRNA for hnRNP A2/B1 induced faster DNA repair in normal HBE cells. Considering these results, we assume that overexpression of hnRNP B1 occurring in the early stage of carcinogenesis inhibits DNA-PK activity, resulting in subsequent accumulation of erroneous rejoining of DNA double-strand breaks, causing tumor progression

  20. Comparative Genomics of DNA Recombination and Repair in Cyanobacteria: Biotechnological Implications

    Science.gov (United States)

    Cassier-Chauvat, Corinne; Veaudor, Théo; Chauvat, Franck

    2016-01-01

    Cyanobacteria are fascinating photosynthetic prokaryotes that are regarded as the ancestors of the plant chloroplast; the purveyors of oxygen and biomass for the food chain; and promising cell factories for an environmentally friendly production of chemicals. In colonizing most waters and soils of our planet, cyanobacteria are inevitably challenged by environmental stresses that generate DNA damages. Furthermore, many strains engineered for biotechnological purposes can use DNA recombination to stop synthesizing the biotechnological product. Hence, it is important to study DNA recombination and repair in cyanobacteria for both basic and applied research. This review reports what is known in a few widely studied model cyanobacteria and what can be inferred by mining the sequenced genomes of morphologically and physiologically diverse strains. We show that cyanobacteria possess many E. coli-like DNA recombination and repair genes, and possibly other genes not yet identified. E. coli-homolog genes are unevenly distributed in cyanobacteria, in agreement with their wide genome diversity. Many genes are extremely well conserved in cyanobacteria (mutMS, radA, recA, recFO, recG, recN, ruvABC, ssb, and uvrABCD), even in small genomes, suggesting that they encode the core DNA repair process. In addition to these core genes, the marine Prochlorococcus and Synechococcus strains harbor recBCD (DNA recombination), umuCD (mutational DNA replication), as well as the key SOS genes lexA (regulation of the SOS system) and sulA (postponing of cell division until completion of DNA reparation). Hence, these strains could possess an E. coli-type SOS system. In contrast, several cyanobacteria endowed with larger genomes lack typical SOS genes. For examples, the two studied Gloeobacter strains lack alkB, lexA, and sulA; and Synechococcus PCC7942 has neither lexA nor recCD. Furthermore, the Synechocystis PCC6803 lexA product does not regulate DNA repair genes. Collectively, these findings

  1. Genetic recombination in escherichia coli and its relationship with DNA replication

    International Nuclear Information System (INIS)

    Siddiqui, O.

    1974-01-01

    Relationship of DNA replication with genetic recombination in Escherichia Coli was investigated by mating Hfr donors labelled with H 3 -thymine, C 13 and N 15 to C 13 N 15 labelled recipients. The DNA extracted from the zygotes was analysed on CsCl density gradients. The results show that all of the biparentally labelled DNA arises from the single strand insertions of the donor DNA. (M.G.B.)

  2. Establishment of Cre-mediated HBV recombinant cccDNA (rcccDNA) cell line for cccDNA biology and antiviral screening assays.

    Science.gov (United States)

    Wu, Min; Li, Jin; Yue, Lei; Bai, Lu; Li, Yaming; Chen, Jieliang; Zhang, Xiaonan; Yuan, Zhenghong

    2018-04-01

    Hepatitis B virus (HBV) covalently closed circular DNA (cccDNA), existing in hepatocyte nuclei as a stable minichromosome, plays a central role in the life cycle of the virus and permits the persistence of infection. Despite being essential for HBV infection, little is known about the molecular mechanisms of cccDNA formation, regulation and degradation, and there is no therapeutic agents directly targeting cccDNA, fore mostly due to the lack of robust, reliable and quantifiable HBV cccDNA models. In this study, combined the Cre/loxP and sleeping beauty transposons system, we established HepG2-derived cell lines integrated with 2-60 copies of monomeric HBV genome flanked by loxP sites (HepG2-HBV/loxP). After Cre expression via adenoviral transduction, 3.3-kb recombinant cccDNA (rcccDNA) bearing a chimeric intron can be produced in the nuclei of these HepG2-HBV/loxP cells. The rcccDNA could be accurately quantified by quantitative PCR using specific primers and cccDNA pool generated in this model could be easily detected by Southern blotting using the digoxigenin probe system. We demonstrated that the rcccDNA was epigenetically organized as the natural minichromosome and served as the template supporting pgRNA transcription and viral replication. As the expression of HBV S antigen (HBsAg) is dependent on the newly generated cccDNA, HBsAg is the surrogate marker of cccDNA. Additionally, the efficacies of 3 classes of anti-HBV agents were evaluated in HepG2-HBV/loxP cells and antiviral activities with different mechanisms were confirmed. These data collectively suggested that HepG2-HBV/loxP cell system will be powerful platform for studying cccDNA related biological mechanisms and developing novel cccDNA targeting drugs. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  3. [Effect of endonuclease G depletion on plasmid DNA uptake and levels of homologous recombination in hela cells].

    Science.gov (United States)

    Misic, V; El-Mogy, M; Geng, S; Haj-Ahmad, Y

    2016-01-01

    Endonuclease G (EndoG) is a mitochondrial apoptosis regulator that also has roles outside of programmed cell death. It has been implicated as a defence DNase involved in the degradation of exogenous DNA after transfection of mammalian cells and in homologous recombination of viral and endogenous DNA. In this study, we looked at the effect of EndoG depletion on plasmid DNA uptake and the levels of homologous recombination in HeLa cells. We show that the proposed defence role of EndoG against uptake of non-viral DNA vectors does not extend to the cervical carcinoma HeLa cells, as targeting of EndoG expression by RNA interference failed to increase intracellular plasmid DNA levels. However, reducing EndoG levels in HeLa cells resulted in a statistically significant reduction of homologous recombination between two plasmid DNA substrates. These findings suggest that non-viral DNA vectors are also substrates for EndoG in its role in homologous recombination.

  4. Jeremy Rifkin challenges recombinant DNA research: A rhetoric of heresy

    Energy Technology Data Exchange (ETDEWEB)

    Futrell, W.M.

    1992-01-01

    One significant issue to come before the public in recent years is recombinant DNA research or genetic engineering and its applications. An important spokesman on this issue is Jeremy Rifkin. Rifkin is of rhetorical interest because of his strategies to sustain the dialogue and define the parameters in which it occurs. This dissertation analyzes a broad range of Rifkin's rhetorical artifacts and those of scientists engaged in recombinant DNA research. They are examined against criteria developed to identify and understand heresy. The five areas of analysis are: the nearness/remoteness phenomenon, the social construction of heresy, the social consequences of heresy, the doctrinal consequences of heresy, and the heresy-hunt ritual. The first two criteria focus on the rhetorical strategies of the heretic. The last three concentrate on the rhetorical strategies of the defenders of the institutional orthodoxy. This dissertation examines the rhetorical strategies of a heretical challenge to the scientific establishment and the consequences of that challenge. This dissertation also analyzes the rhetorical strategies employed by the defenders of the scientific orthodoxy. Although an understanding of the rhetorical strategies employed on both sides of this conflict is important, the implications for the role of rhetoric in highly controversial issues such as recombinant DNA are even more critical.

  5. Recombinational DNA repair is regulated by compartmentalization of DNA lesions at the nuclear pore complex

    DEFF Research Database (Denmark)

    Géli, Vincent; Lisby, Michael

    2015-01-01

    and colleagues shows that also physiological threats to genome integrity such as DNA secondary structure-forming triplet repeat sequences relocalize to the NPC during DNA replication. Mutants that fail to reposition the triplet repeat locus to the NPC cause repeat instability. Here, we review the types of DNA...... lesions that relocalize to the NPC, the putative mechanisms of relocalization, and the types of recombinational repair that are stimulated by the NPC, and present a model for NPC-facilitated repair....

  6. Selection of LNA-containing DNA aptamers against recombinant human CD73

    DEFF Research Database (Denmark)

    Elle, Ida C; Karlsen, Kasper K; Terp, Mikkel G

    2015-01-01

    tested by surface plasmon resonance. Truncated variants of these aptamers and variants where the LNA nucleotides were substituted for the DNA equivalent also exhibited affinity for the recombinant CD73 in the low nanomolar range. In enzyme inhibition assays with recombinant CD73 the aptamer sequences......LNA-containing DNA aptamers against CD73 (human ecto-5'-nucleotidase), a protein frequently overexpressed in solid tumours, were isolated by SELEX. A pre-defined stem-loop library, containing LNA in the forward primer region, was enriched with CD73 binding sequences through six rounds of SELEX...... with recombinant his-tagged CD73 immobilised on anti-his plates. Enriched pools isolated from rounds one, three and six were subjected to next-generation sequencing and analysed for enrichment using custom bioinformatics software. The software identified aptamer sequences via the primers and then performed several...

  7. Differences in mutagenic and recombinational DNA repair in enterobacteria

    International Nuclear Information System (INIS)

    Sedgwick, S.G.; Goodwin, P.A.

    1985-01-01

    The incidence of recombinational DNA repair and inducible mutagenic DNA repair has been examined in Escherichia coli and 11 related species of enterobacteria. Recombinational repair was found to be a common feature of the DNA repair repertoire of at least 6 genera of enterobacteria. This conclusion is based on observations of (i) damage-induced synthesis of RecA-like proteins, (ii) nucleotide hybridization between E. coli recA sequences and some chromosomal DNAs, and (iii) recA-negative complementation by plasmids showing SOS-inducible expression of truncated E. coli recA genes. The mechanism of DNA damage-induced gene expression is therefore sufficiently conserved to allow non-E. coli regulatory elements to govern expression of these cloned truncated E. coli recA genes. In contrast, the process of mutagenic repair, which uses umuC+ umuD+ gene products in E. coli, appeared less widespread. Little ultraviolet light-induced mutagenesis to rifampicin resistance was detected outside the genus Escherichia, and even within the genus induced mutagenesis was detected in only 3 out of 6 species. Nucleotide hybridization showed that sequences like the E. coli umuCD+ gene are not found in these poorly mutable organisms. Evolutionary questions raised by the sporadic incidence of inducible mutagenic repair are discussed

  8. LDsplit: screening for cis-regulatory motifs stimulating meiotic recombination hotspots by analysis of DNA sequence polymorphisms.

    Science.gov (United States)

    Yang, Peng; Wu, Min; Guo, Jing; Kwoh, Chee Keong; Przytycka, Teresa M; Zheng, Jie

    2014-02-17

    As a fundamental genomic element, meiotic recombination hotspot plays important roles in life sciences. Thus uncovering its regulatory mechanisms has broad impact on biomedical research. Despite the recent identification of the zinc finger protein PRDM9 and its 13-mer binding motif as major regulators for meiotic recombination hotspots, other regulators remain to be discovered. Existing methods for finding DNA sequence motifs of recombination hotspots often rely on the enrichment of co-localizations between hotspots and short DNA patterns, which ignore the cross-individual variation of recombination rates and sequence polymorphisms in the population. Our objective in this paper is to capture signals encoded in genetic variations for the discovery of recombination-associated DNA motifs. Recently, an algorithm called "LDsplit" has been designed to detect the association between single nucleotide polymorphisms (SNPs) and proximal meiotic recombination hotspots. The association is measured by the difference of population recombination rates at a hotspot between two alleles of a candidate SNP. Here we present an open source software tool of LDsplit, with integrative data visualization for recombination hotspots and their proximal SNPs. Applying LDsplit on SNPs inside an established 7-mer motif bound by PRDM9 we observed that SNP alleles preserving the original motif tend to have higher recombination rates than the opposite alleles that disrupt the motif. Running on SNP windows around hotspots each containing an occurrence of the 7-mer motif, LDsplit is able to guide the established motif finding algorithm of MEME to recover the 7-mer motif. In contrast, without LDsplit the 7-mer motif could not be identified. LDsplit is a software tool for the discovery of cis-regulatory DNA sequence motifs stimulating meiotic recombination hotspots by screening and narrowing down to hotspot associated SNPs. It is the first computational method that utilizes the genetic variation of

  9. Choreography of recombination proteins during the DNA damage response

    DEFF Research Database (Denmark)

    Lisby, Michael; Rothstein, Rodney

    2009-01-01

    Genome integrity is frequently challenged by DNA lesions from both endogenous and exogenous sources. A single DNA double-strand break (DSB) is lethal if unrepaired and may lead to loss of heterozygosity, mutations, deletions, genomic rearrangements and chromosome loss if repaired improperly. Such...... research. Here we review the cell biological response to DSBs in mitotically growing cells with an emphasis on homologous recombination pathways in yeast Saccharomyces cerevisiae and in mammalian cells....

  10. Efficient generation of recombinant RNA viruses using targeted recombination-mediated mutagenesis of bacterial artificial chromosomes containing full-length cDNA

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Risager, Peter Christian; Fahnøe, Ulrik

    2013-01-01

    Background Infectious cDNA clones are a prerequisite for directed genetic manipulation of RNA viruses. Here, a strategy to facilitate manipulation and rescue of classical swine fever viruses (CSFVs) from full-length cDNAs present within bacterial artificial chromosomes (BACs) is described....... This strategy allows manipulation of viral cDNA by targeted recombination-mediated mutagenesis within bacteria. Results A new CSFV-BAC (pBeloR26) derived from the Riems vaccine strain has been constructed and subsequently modified in the E2 coding sequence, using the targeted recombination strategy to enable...

  11. Cold Spring Harbor symposia on quantitative biology: Volume 49, Recombination at the DNA level

    International Nuclear Information System (INIS)

    1984-01-01

    This volume contains full papers prepared by the participants to the 1984 Cold Springs Harbor Symposia on Quantitative Biology. This year's theme is entitled Recombination at the DNA level. The volume consists of 93 articles grouped into subject areas entitled chromosome mechanics, yeast systems, mammalian homologous recombination, transposons, mu, plant transposons/T4 recombination, topoisomerase, resolvase and gyrase, Escherichia coli general recombination, RecA, repair, leukaryotic enzymes, integration and excision of bacteriophage, site-specific recombination, and recombination in vitro

  12. Mechanisms of sister chromatid recombination

    International Nuclear Information System (INIS)

    Nakai, Sayaka; Machida, Isamu; Tsuji, Satsuki

    1985-01-01

    Studies using T948 as a model system have been carried out aimed at elucidating the mechanism of sister chromatid recombination (SCR). Characterization of U.V. light- and x-ray-induced SCR, the relationiship between SCR induction and DNA repair using rad mutations, and the relationship between SCR induction and the time of cell division using cdc mutations are presented. It has been supposed that SCR is induced at the phase of S-G 2 following DNA replication, that postreplication break of DNA strands is strongly involved in the induction of SCR, and that induction type of SCR, i.e., conversion type or recombination type, is dependent upon the type of molecular damage of DNA. (Namekawa, K.)

  13. Specific modifications of histone tails, but not DNA methylation, mirror the temporal variation of mammalian recombination hotspots.

    Science.gov (United States)

    Zeng, Jia; Yi, Soojin V

    2014-10-16

    Recombination clusters nonuniformly across mammalian genomes at discrete genomic loci referred to as recombination hotspots. Despite their ubiquitous presence, individual hotspots rapidly lose their activities, and the molecular and evolutionary mechanisms underlying such frequent hotspot turnovers (the so-called "recombination hotspot paradox") remain unresolved. Even though some sequence motifs are significantly associated with hotspots, multiple lines of evidence indicate that factors other than underlying sequences, such as epigenetic modifications, may affect the evolution of recombination hotspots. Thus, identifying epigenetic factors that covary with recombination at fine-scale is a promising step for this important research area. It was previously reported that recombination rates correlate with indirect measures of DNA methylation in the human genome. Here, we analyze experimentally determined DNA methylation and histone modification of human sperms, and show that the correlation between DNA methylation and recombination in long-range windows does not hold with respect to the spatial and temporal variation of recombination at hotspots. On the other hand, two histone modifications (H3K4me3 and H3K27me3) overlap extensively with recombination hotspots. Similar trends were observed in mice. These results indicate that specific histone modifications rather than DNA methylation are associated with the rapid evolution of recombination hotspots. Furthermore, many human recombination hotspots occupy "bivalent" chromatin regions that harbor both active (H3K4me3) and repressive (H3K27me3) marks. This may explain why human recombination hotspots tend to occur in nongenic regions, in contrast to yeast and Arabidopsis hotspots that are characterized by generally active chromatins. Our results highlight the dynamic epigenetic underpinnings of recombination hotspot evolution. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for

  14. Construction of recombinant adenovirus with Egr-1 promoter and Smad7 cDNA and study of the Egr-1 promoter's biological activity

    International Nuclear Information System (INIS)

    Cai Xuwei; Fu Xiaolong; Yang Jian; Song Houyan

    2005-01-01

    Objective: To construct a recombinant replication-defective adenovirus containing Egr-1 promoter and Smad7 cDNA, then to evaluate the biological activity of Egr-1 promoter. Methods: Based on Adeno- X TM expression system, CMV promoter of the pShuttle vector was replaced by Egr-1 promoter, and the Smad7 cDNA was subcloned into the MCS(multiple cloning site) of pShuttle. The recombinant pShuttle was then sub-cloned into the Adeno-X TM genome, which was transformed into E. coli to get recombinant Adeno-X TM plasmid DNA. The recombinant adenovirus was packaged and amplified in the transfected HEK293 cells before it was purified and tested for viral titer. The fibroblasts (3T6 cells) infected by the recombinant adenovirus were irradiated , and the activity of Egr-1 promoter was quantitively determined by the amount of Smad7 protein expressed in the 3T6 cells using Western blot. Results: Identified by restriction endonuclease analysis and PCR, the recombinant adenovirus containing Egr-1 promoter and Smad7 cDNA was constructed successfully, with a viral titer of 1.0 x 10 11 TCID 50 /ml. The expressed amount of Smad7 protein varied at different dose levels and different time points post-irradiation in the 3T6 cells infected with the recombinant adenovirus. The amount of Smad7 protein increased along with the rising of the irradiation dose, and remained at a high expression level from 8 Gy to 15 Gy. The amount of Smad7 protein started to increase at 2 hours post-irradiation, and maintained a relatively high level for the next 5 hours before it descended, which was not observed in the control 3T6 cells. Conclusions: With the aid of Adeno-X TM expression system and molecular cloning techniques, construction of recombinant adenovirus could be quick and efficient. The recombined Egr-1 promoter has the activity of regulating the expression of downstream Smad7 cDNA. The increase in Smad7 expression under control of Egr-1 promoter induced by ionizing radiation is time- and dose-dependent

  15. Successful development of recombinant DNA-derived pharmaceuticals.

    Science.gov (United States)

    Werner, R G; Pommer, C H

    1990-11-01

    Successful development of recombinant DNA-derived pharmaceuticals, a new class of therapeutic agents, is determined by a variety of factors affecting the selection and positioning of the compound under development. For an efficient development it is of utmost importance that the mechanism of action of the compound selected be understood on a molecular level. The compound's potential therapeutical profile and a strong patent position are key positioning considerations, as well as vital elements in shortening the development phase and protecting innovation. Installation of an interdisciplinary project management team, along with a clear definition of team members' responsibilities, is required to avoid delays and improve communication during development. Selection of the organism to be used in production must take into consideration both the structure of the protein and the quality and safety of the final product. New technologies require a considerable investment in new manufacturing facilities and equipment. Often, the decision for such an investment must be made early and with a high degree of uncertainty. Desired product yield, expected dosage, and estimated market potential are the most important considerations in this decision. Following public disclosure of the plan to develop recombinant DNA-derived products, approval of the production plant and expansion or adaptation to the new process and technology may be delayed. For this reason, they should be considered as a critical step in the overall development phase. Recruitment of qualified staff is a time-consuming and critical element of the production process. Its impact on the product timeline should not be underestimated, especially if such technologies are new to the company. The entire production process must be validated in respect to identity, purity, and safety of the product to guarantee constant product quality, as well as for safety aspects in the environment. Adequate in-process and final product

  16. Recombinant methods for screening human DNA excision repair proficiency

    International Nuclear Information System (INIS)

    Athas, W.F.

    1988-01-01

    A method for measuring DNA excision repair in response to ultraviolet radiation (UV)-induced DNA damage has been developed, validated, and field-tested in cultured human lymphocytes. The methodology is amenable to population-based screening and should facilitate future epidemiologic studies seeking to investigate associations between excision repair proficiency and cancer susceptibility. The impetus for such endeavors derives from the belief that the high incidence of skin cancer in the genetic disorder xeroderma pigmentosum (XP) primarily is a result of the reduced capacity of patients cells to repair UV-induced DNA damage. For assay, UV-irradiated non-replicating recombinant plasmid DNA harboring a chloramphenicol acetyltransferase (CAT) indicator gene is introduced into lymphocytes using DEAE-dextran short-term transfection conditions. Exposure to UV induces transcriptionally-inactivating DNA photoproducts in the plasmid DNA which inactivate CAT gene expression. Excision repair of the damaged CAT gene is monitored indirectly as a function of reactivated CAT enzyme activity following a 40 hour repair/expression incubation period

  17. Molecular requirements for radiation-activated recombination

    International Nuclear Information System (INIS)

    Stevens, Craig W.; Zeng Ming; Stamato, Thomas; Cerniglia, George

    1997-01-01

    Purpose/Objective: The major stumbling block to successful gene therapy today is poor gene transfer. We hypothesized that ionizing radiation might activate cellular recombination, and so improve stable gene transfer. We further hypothesized that known DNA-damage-repair proteins might also be important in radiation-activated recombination. Materials and Methods: The effect of irradiation on stable gene transfer efficiency was determined in human (A549 and 39F) and rodent (NIH/3T3) cell lines. Continuous low dose rate and multiple radiation fractions were also tested. Nuclear extracts were made and the effect of irradiation on inter-plasmid recombination/ligation determined. Multiple DNA damage-repair deficient cell lines were tested for radiation-activated recombination. Results: A significant radiation dose-dependent improvement in stable plasmid transfection (by as much as 1300 fold) is demonstrated in neoplastic and primary cells. An improvement in transient plasmid transfection is also seen, with as much as 85% of cells transiently expressing b-galactosidase (20-50 fold improvement). Stable transfection is only improved for linearized or nicked plasmids. Cells have improved gene transfer for at least 96 hours after irradiation. Both fractionated and continuous low dose rate irradiation are effective at improving stable gene transfer in mammalian cells, thus making relatively high radiation dose delivery clinically feasible. Inter-plasmid recombination is radiation dose dependent in nuclear extract assays, and the type of overhang (3', 5' or blunt end) significantly affects recombination efficiency and the type of product. The most common end-joining activity involves filling-in of the overhang followed by blunt end ligation. Adenovirus is a linear, double stranded DNA virus. We demonstrate that adenoviral infection efficiency is increased by irradiation. The duration of transgene expression is lengthened because the virus integrates with high efficiency (∼10

  18. DNA degradation and reduced recombination following UV irradiation during meiosis in yeast (Saccharomyces cerevisiae)

    International Nuclear Information System (INIS)

    Salts, Y.; Pinon, R.; Simchen, G.

    1976-01-01

    Irradiation of meiotic yeast cells with moderate doses of ultraviolet irradiation (1,600 erg/mm 2 ) leads to the arrest of premeiotic DNA synthesis, massive (5-40%) DNA degradation, and a 40-50% loss of cell viability. In contrast, such doses of UV irradiation had a minor effect on viability (15-20% loss) of logarithmically growing cells, and no comparable DNA degradation was observed in irradiated synchronized vegetative cells. Meiotic recombination is also affected by UV irradiation. When administered at a stage comparable to meiotic prophase, low doses of irradiation result in a reduction in recombination frequency without significantly affecting cell viability. (orig.) [de

  19. RPA accumulation during class switch recombination represents 5'-3' DNA-end resection during the S-G2/M phase of the cell cycle.

    Science.gov (United States)

    Yamane, Arito; Robbiani, Davide F; Resch, Wolfgang; Bothmer, Anne; Nakahashi, Hirotaka; Oliveira, Thiago; Rommel, Philipp C; Brown, Eric J; Nussenzweig, Andre; Nussenzweig, Michel C; Casellas, Rafael

    2013-01-31

    Activation-induced cytidine deaminase (AID) promotes chromosomal translocations by inducing DNA double-strand breaks (DSBs) at immunoglobulin (Ig) genes and oncogenes in the G1 phase. RPA is a single-stranded DNA (ssDNA)-binding protein that associates with resected DSBs in the S phase and facilitates the assembly of factors involved in homologous repair (HR), such as Rad51. Notably, RPA deposition also marks sites of AID-mediated damage, but its role in Ig gene recombination remains unclear. Here, we demonstrate that RPA associates asymmetrically with resected ssDNA in response to lesions created by AID, recombination-activating genes (RAG), or other nucleases. Small amounts of RPA are deposited at AID targets in G1 in an ATM-dependent manner. In contrast, recruitment in the S-G2/M phase is extensive, ATM independent, and associated with Rad51 accumulation. In the S-G2/M phase, RPA increases in nonhomologous-end-joining-deficient lymphocytes, where there is more extensive DNA-end resection. Thus, most RPA recruitment during class switch recombination represents salvage of unrepaired breaks by homology-based pathways during the S-G2/M phase of the cell cycle. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  20. Ensuring an exit strategy: RTEL1 restricts rogue recombination.

    Science.gov (United States)

    Villeneuve, Anne M

    2008-10-17

    Success of homologous recombination-based DNA repair depends not only on recombinases, which promote invasion of the homologous DNA duplex that serves as a template for repair, but also on antirecombinases, which dismantle recombination intermediates to allow completion of repair. In this issue, Barber et al. (2008) identify a previously elusive antirecombinase activity important for maintaining genome stability in animals.

  1. Yeast Srs2 Helicase Promotes Redistribution of Single-Stranded DNA-Bound RPA and Rad52 in Homologous Recombination Regulation

    Directory of Open Access Journals (Sweden)

    Luisina De Tullio

    2017-10-01

    Full Text Available Srs2 is a super-family 1 helicase that promotes genome stability by dismantling toxic DNA recombination intermediates. However, the mechanisms by which Srs2 remodels or resolves recombination intermediates remain poorly understood. Here, single-molecule imaging is used to visualize Srs2 in real time as it acts on single-stranded DNA (ssDNA bound by protein factors that function in recombination. We demonstrate that Srs2 is highly processive and translocates rapidly (∼170 nt per second in the 3′→5′ direction along ssDNA saturated with replication protein A (RPA. We show that RPA is evicted from DNA during the passage of Srs2. Remarkably, Srs2 also readily removes the recombination mediator Rad52 from RPA-ssDNA and, in doing so, promotes rapid redistribution of both Rad52 and RPA. These findings have important mechanistic implications for understanding how Srs2 and related nucleic acid motor proteins resolve potentially pathogenic nucleoprotein intermediates.

  2. An att site-based recombination reporter system for genome engineering and synthetic DNA assembly.

    Science.gov (United States)

    Bland, Michael J; Ducos-Galand, Magaly; Val, Marie-Eve; Mazel, Didier

    2017-07-14

    Direct manipulation of the genome is a widespread technique for genetic studies and synthetic biology applications. The tyrosine and serine site-specific recombination systems of bacteriophages HK022 and ΦC31 are widely used for stable directional exchange and relocation of DNA sequences, making them valuable tools in these contexts. We have developed site-specific recombination tools that allow the direct selection of recombination events by embedding the attB site from each system within the β-lactamase resistance coding sequence (bla). The HK and ΦC31 tools were developed by placing the attB sites from each system into the signal peptide cleavage site coding sequence of bla. All possible open reading frames (ORFs) were inserted and tested for recombination efficiency and bla activity. Efficient recombination was observed for all tested ORFs (3 for HK, 6 for ΦC31) as shown through a cointegrate formation assay. The bla gene with the embedded attB site was functional for eight of the nine constructs tested. The HK/ΦC31 att-bla system offers a simple way to directly select recombination events, thus enhancing the use of site-specific recombination systems for carrying out precise, large-scale DNA manipulation, and adding useful tools to the genetics toolbox. We further show the power and flexibility of bla to be used as a reporter for recombination.

  3. Failure to induce a DNA repair gene, RAD54, in Saccharomyces cerevisiae does not affect DNA repair or recombination phenotypes

    International Nuclear Information System (INIS)

    Cole, G.M.; Mortimer, R.K.

    1989-01-01

    The Saccharomyces cerevisiae RAD54 gene is transcriptionally regulated by a broad spectrum of DNA-damaging agents. Induction of RAD54 by DNA-damaging agents is under positive control. Sequences responsible for DNA damage induction (the DRS element) lie within a 29-base-pair region from -99 to -70 from the most proximal transcription start site. This inducible promoter element is functionally separable from a poly(dA-dT) region immediately downstream which is required for constitutive expression. Deletions which eliminate induction of RAD54 transcription by DNA damage but do not affect constitutive expression have no effect on growth or survival of noninducible strains relative to wild-type strains in the presence of DNA-damaging agents. The DRS element is also not required for homothallic mating type switching, transcriptional induction of RAD54 during meiosis, meiotic recombination, or spontaneous or X-ray-induced mitotic recombination. We find no phenotype for a lack of induction of RAD54 message via the damage-inducible DRS, which raises significant questions about the physiology of DNA damage induction in S. cerevisiae

  4. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats

    NARCIS (Netherlands)

    Warmerdam, Daniel O.; van den Berg, Jeroen; Medema, Rene H.

    2016-01-01

    rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded

  5. Recombination at DNA replication fork barriers is not universal and is differentially regulated by Swi1.

    Science.gov (United States)

    Pryce, David W; Ramayah, Soshila; Jaendling, Alessa; McFarlane, Ramsay J

    2009-03-24

    DNA replication stress has been implicated in the etiology of genetic diseases, including cancers. It has been proposed that genomic sites that inhibit or slow DNA replication fork progression possess recombination hotspot activity and can form potential fragile sites. Here we used the fission yeast, Schizosaccharomyces pombe, to demonstrate that hotspot activity is not a universal feature of replication fork barriers (RFBs), and we propose that most sites within the genome that form RFBs do not have recombination hotspot activity under nonstressed conditions. We further demonstrate that Swi1, the TIMELESS homologue, differentially controls the recombination potential of RFBs, switching between being a suppressor and an activator of recombination in a site-specific fashion.

  6. Room temperature electrocompetent bacterial cells improve DNA transformation and recombineering efficiency.

    Science.gov (United States)

    Tu, Qiang; Yin, Jia; Fu, Jun; Herrmann, Jennifer; Li, Yuezhong; Yin, Yulong; Stewart, A Francis; Müller, Rolf; Zhang, Youming

    2016-04-20

    Bacterial competent cells are essential for cloning, construction of DNA libraries, and mutagenesis in every molecular biology laboratory. Among various transformation methods, electroporation is found to own the best transformation efficiency. Previous electroporation methods are based on washing and electroporating the bacterial cells in ice-cold condition that make them fragile and prone to death. Here we present simple temperature shift based methods that improve DNA transformation and recombineering efficiency in E. coli and several other gram-negative bacteria thereby economizing time and cost. Increased transformation efficiency of large DNA molecules is a significant advantage that might facilitate the cloning of large fragments from genomic DNA preparations and metagenomics samples.

  7. DNA compaction in the early part of the SOS response is dependent on RecN and RecA.

    Science.gov (United States)

    Odsbu, Ingvild; Skarstad, Kirsten

    2014-05-01

    The nucleoids of undamaged Escherichia coli cells have a characteristic shape and number, which is dependent on the growth medium. Upon induction of the SOS response by a low dose of UV irradiation an extensive reorganization of the nucleoids occurred. Two distinct phases were observed by fluorescence microscopy. First, the nucleoids were found to change shape and fuse into compact structures at midcell. The compaction of the nucleoids lasted for 10-20 min and was followed by a phase where the DNA was dispersed throughout the cells. This second phase lasted for ~1 h. The compaction was found to be dependent on the recombination proteins RecA, RecO and RecR as well as the SOS-inducible, SMC (structural maintenance of chromosomes)-like protein RecN. RecN protein is produced in high amounts during the first part of the SOS response. It is possible that the RecN-mediated 'compact DNA' stage at the beginning of the SOS response serves to stabilize damaged DNA prior to recombination and repair.

  8. Yeast Srs2 Helicase Promotes Redistribution of Single-Stranded DNA-Bound RPA and Rad52 in Homologous Recombination Regulation.

    Science.gov (United States)

    De Tullio, Luisina; Kaniecki, Kyle; Kwon, Youngho; Crickard, J Brooks; Sung, Patrick; Greene, Eric C

    2017-10-17

    Srs2 is a super-family 1 helicase that promotes genome stability by dismantling toxic DNA recombination intermediates. However, the mechanisms by which Srs2 remodels or resolves recombination intermediates remain poorly understood. Here, single-molecule imaging is used to visualize Srs2 in real time as it acts on single-stranded DNA (ssDNA) bound by protein factors that function in recombination. We demonstrate that Srs2 is highly processive and translocates rapidly (∼170 nt per second) in the 3'→5' direction along ssDNA saturated with replication protein A (RPA). We show that RPA is evicted from DNA during the passage of Srs2. Remarkably, Srs2 also readily removes the recombination mediator Rad52 from RPA-ssDNA and, in doing so, promotes rapid redistribution of both Rad52 and RPA. These findings have important mechanistic implications for understanding how Srs2 and related nucleic acid motor proteins resolve potentially pathogenic nucleoprotein intermediates. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  9. Formation of (DNA)2-LNA triplet with recombinant base recognition: A quantum mechanical study

    Science.gov (United States)

    Mall, Vijaya Shri; Tiwari, Rakesh Kumar

    2018-05-01

    The formation of DNA triple helix offers the verity of new possibilities in molecular biology. However its applications are limited to purine and pyrimidine rich sequences recognized by forming Hoogsteen/Reverse Hoogsteen triplets in major groove sites of DNA duplex. To overcome this drawback modification in bases backbone and glucose of nucleotide unit of DNA have been proposed so that the third strand base recognized by both the bases of DNA duplex by forming Recombinant type(R-type) of bonding in mixed sequences. Here we performed Quanrum Mechanical (Hartree-Fock and DFT) methodology on natural DNA and Locked Nucleic Acids(LNA) triplets using 6-31G and some other new advance basis sets. Study suggests energetically stable conformation has been observed for recombinant triplets in order of G-C*G > A-T*A > G-C*C > T-A*T for both type of triplets. Interestingly LNA leads to more stable conformation in all set of triplets, clearly suggests an important biological tool to overcome above mentioned drawbacks.

  10. Heteroduplex DNA position defines the roles of the Sgs1, Srs2, and Mph1 helicases in promoting distinct recombination outcomes.

    Directory of Open Access Journals (Sweden)

    Katrina Mitchel

    Full Text Available The contributions of the Sgs1, Mph1, and Srs2 DNA helicases during mitotic double-strand break (DSB repair in yeast were investigated using a gap-repair assay. A diverged chromosomal substrate was used as a repair template for the gapped plasmid, allowing mismatch-containing heteroduplex DNA (hDNA formed during recombination to be monitored. Overall DSB repair efficiencies and the proportions of crossovers (COs versus noncrossovers (NCOs were determined in wild-type and helicase-defective strains, allowing the efficiency of CO and NCO production in each background to be calculated. In addition, the products of individual NCO events were sequenced to determine the location of hDNA. Because hDNA position is expected to differ depending on whether a NCO is produced by synthesis-dependent-strand-annealing (SDSA or through a Holliday junction (HJ-containing intermediate, its position allows the underlying molecular mechanism to be inferred. Results demonstrate that each helicase reduces the proportion of CO recombinants, but that each does so in a fundamentally different way. Mph1 does not affect the overall efficiency of gap repair, and its loss alters the CO-NCO by promoting SDSA at the expense of HJ-containing intermediates. By contrast, Sgs1 and Srs2 are each required for efficient gap repair, strongly promoting NCO formation and having little effect on CO efficiency. hDNA analyses suggest that all three helicases promote SDSA, and that Sgs1 and Srs2 additionally dismantle HJ-containing intermediates. The hDNA data are consistent with the proposed role of Sgs1 in the dissolution of double HJs, and we propose that Srs2 dismantles nicked HJs.

  11. Phenylbutyrate inhibits homologous recombination induced by camptothecin and methyl methanesulfonate.

    Science.gov (United States)

    Kaiser, Gitte S; Germann, Susanne M; Westergaard, Tine; Lisby, Michael

    2011-08-01

    Homologous recombination is accompanied by extensive changes to chromatin organization at the site of DNA damage. Some of these changes are mediated through acetylation/deacetylation of histones. Here, we show that recombinational repair of DNA damage induced by the anti-cancer drug camptothecin (CPT) and the alkylating agent methyl methanesulfonate (MMS) is blocked by sodium phenylbutyrate (PBA) in the budding yeast Saccharomyces cerevisiae. In particular, PBA suppresses CPT- and MMS-induced genetic recombination as well as DNA double-strand break repair during mating-type interconversion. Treatment with PBA is accompanied by a dramatic reduction in histone H4 lysine 8 acetylation. Live cell imaging of homologous recombination proteins indicates that repair of CPT-induced DNA damage is redirected to a non-recombinogenic pathway in the presence of PBA without loss in cell viability. In contrast, the suppression of MMS-induced recombination by PBA is accompanied by a dramatic loss in cell viability. Taken together, our results demonstrate that PBA inhibits DNA damage-induced homologous recombination likely by mediating changes in chromatin acetylation. Moreover, the combination of PBA with genotoxic agents can lead to different cell fates depending on the type of DNA damage inflicted. 2011 Elsevier B.V. All rights reserved.

  12. SAMHD1 Promotes DNA End Resection to Facilitate DNA Repair by Homologous Recombination

    Directory of Open Access Journals (Sweden)

    Waaqo Daddacha

    2017-08-01

    Full Text Available DNA double-strand break (DSB repair by homologous recombination (HR is initiated by CtIP/MRN-mediated DNA end resection to maintain genome integrity. SAMHD1 is a dNTP triphosphohydrolase, which restricts HIV-1 infection, and mutations are associated with Aicardi-Goutières syndrome and cancer. We show that SAMHD1 has a dNTPase-independent function in promoting DNA end resection to facilitate DSB repair by HR. SAMHD1 deficiency or Vpx-mediated degradation causes hypersensitivity to DSB-inducing agents, and SAMHD1 is recruited to DSBs. SAMHD1 complexes with CtIP via a conserved C-terminal domain and recruits CtIP to DSBs to facilitate end resection and HR. Significantly, a cancer-associated mutant with impaired CtIP interaction, but not dNTPase-inactive SAMHD1, fails to rescue the end resection impairment of SAMHD1 depletion. Our findings define a dNTPase-independent function for SAMHD1 in HR-mediated DSB repair by facilitating CtIP accrual to promote DNA end resection, providing insight into how SAMHD1 promotes genome integrity.

  13. Inhibitors of the proteasome suppress homologous DNA recombination in mammalian cells.

    Science.gov (United States)

    Murakawa, Yasuhiro; Sonoda, Eiichiro; Barber, Louise J; Zeng, Weihua; Yokomori, Kyoko; Kimura, Hiroshi; Niimi, Atsuko; Lehmann, Alan; Zhao, Guang Yu; Hochegger, Helfrid; Boulton, Simon J; Takeda, Shunichi

    2007-09-15

    Proteasome inhibitors are novel antitumor agents against multiple myeloma and other malignancies. Despite the increasing clinical application, the molecular basis of their antitumor effect has been poorly understood due to the involvement of the ubiquitin-proteasome pathway in multiple cellular metabolisms. Here, we show that treatment of cells with proteasome inhibitors has no significant effect on nonhomologous end joining but suppresses homologous recombination (HR), which plays a key role in DNA double-strand break (DSB) repair. In this study, we treat human cells with proteasome inhibitors and show that the inhibition of the proteasome reduces the efficiency of HR-dependent repair of an artificial HR substrate. We further show that inhibition of the proteasome interferes with the activation of Rad51, a key factor for HR, although it does not affect the activation of ATM, gammaH2AX, or Mre11. These data show that the proteasome-mediated destruction is required for the promotion of HR at an early step. We suggest that the defect in HR-mediated DNA repair caused by proteasome inhibitors contributes to antitumor effect, as HR plays an essential role in cellular proliferation. Moreover, because HR plays key roles in the repair of DSBs caused by chemotherapeutic agents such as cisplatin and by radiotherapy, proteasome inhibitors may enhance the efficacy of these treatments through the suppression of HR-mediated DNA repair pathways.

  14. Characterization of DNA binding, transcriptional activation, and regulated nuclear association of recombinant human NFATp

    Directory of Open Access Journals (Sweden)

    Seto Anita G

    2000-11-01

    Full Text Available Abstract Background NFATp is one member of a family of transcriptional activators whose nuclear accumulation and hence transcriptional activity is regulated in mammalian cells. Human NFATp exists as a phosphoprotein in the cytoplasm of naive T cells. Upon antigen stimulation, NFATp is dephosphorylated, accumulates in nuclei, and functions to regulate transcription of genes including those encoding cytokines. While the properties of the DNA binding domain of NFATp have been investigated in detail, biochemical studies of the transcriptional activation and regulated association with nuclei have remained unexplored because of a lack of full length, purified recombinant NFATp. Results We developed methods for expressing and purifying full length recombinant human NFATp that has all of the properties known to be associated with native NFATp. The recombinant NFATp binds DNA on its own and cooperatively with AP-1 proteins, activates transcription in vitro, is phosphorylated, can be dephosphorylated by calcineurin, and exhibits regulated association with nuclei in vitro. Importantly, activation by recombinant NFATp in a reconstituted transcription system required regions of the protein outside of the central DNA binding domain. Conclusions We conclude that NFATp is a bona fide transcriptional activator. Moreover, the reagents and methods that we developed will facilitate future studies on the mechanisms of transcriptional activation and nuclear accumulation by NFATp, a member of an important family of transcriptional regulatory proteins.

  15. FBH1 influences DNA replication fork stability and homologous recombination through ubiquitylation of RAD51

    DEFF Research Database (Denmark)

    Chu, Wai Kit; Payne, Miranda J; Beli, Petra

    2015-01-01

    Unscheduled homologous recombination (HR) can lead to genomic instability, which greatly increases the threat of neoplastic transformation in humans. The F-box DNA helicase 1 (FBH1) is a 3'-5' DNA helicase with a putative function as a negative regulator of HR. It is the only known DNA helicase t...

  16. Mixed infection of Sida jamaicensis in Jamaica reveals the presence of three recombinant begomovirus DNA A components.

    Science.gov (United States)

    Stewart, Cheryl; Kon, Tatsuya; Rojas, Maria; Graham, André; Martin, Darren; Gilbertson, Robert; Roye, Marcia

    2014-09-01

    Begomoviruses impose serious constraints on agriculture throughout the temperate, tropical and subtropical regions. Previously, we characterised a sida golden yellow vein virus isolate, SiGYVV-[JM:Lig2:08] (HQ009519-20) from a symptomatic Sida jamaicensis plant. With the aim of establishing whether it was hosting a mixed infection that could facilitate recombination, PCR-RFLP was done on DNA extracted from this plant, and the results suggested the presence of two additional genetically distinct DNA-A molecules. Sequence analysis of these two DNA-A molecules (relying on BLAST searches and the CLUSTAL V algorithm within the DNASTAR MegAlign module) revealed that they belonged to novel species, and we have tentatively named these viruses sida golden mosaic Braco virus-[Jamaica:Liguanea:2008] and sida golden mosaic Liguanea virus-[Jamaica:1:2008]. Using RDP4 (recombination detection program), we determined that all three viruses were recombinant, with bases ~10 to ~440 of both SiGMLigV-[JM:Lig:08] and SiGYVV-[JM:Lig2:08] having been derived from a relative of SiGMBV-[JM:Lig:08] (P<2.070×10(-7) for all seven of the recombination detection methods). SiGMBV-[JM:Lig:08] was itself a product of recombination, deriving bases ~490-1195 from a virus that was ~92% similar to malvastrum yellow mosaic Helshire virus. Phylogenetically, these DNA-A components are most closely related to those of malvaceous weed-infecting begomoviruses from Jamaica, Cuba, Florida and Mexico. The SiGMBV DNA-A was able to elicit symptomatic infection in N. benthamiana.

  17. Recombinational Cloning Using Gateway and In-Fusion Cloning Schemes

    Science.gov (United States)

    Throop, Andrea L.; LaBaer, Joshua

    2015-01-01

    The comprehensive study of protein structure and function, or proteomics, depends on the obtainability of full-length cDNAs in species-specific expression vectors and subsequent functional analysis of the expressed protein. Recombinational cloning is a universal cloning technique based on site-specific recombination that is independent of the insert DNA sequence of interest, which differentiates this method from the classical restriction enzyme-based cloning methods. Recombinational cloning enables rapid and efficient parallel transfer of DNA inserts into multiple expression systems. This unit summarizes strategies for generating expression-ready clones using the most popular recombinational cloning technologies, including the commercially available Gateway® (Life Technologies) and In-Fusion® (Clontech) cloning technologies. PMID:25827088

  18. Are High School Students Ready for Recombinant DNA?: The UOP Experience.

    Science.gov (United States)

    Minch, Michael J.

    1989-01-01

    Discusses a three-week summer college honors course for talented high school juniors with three exams, lab six days a week, a research paper, field trips, and student panel discussions. Presents an overview of the course. Describes the lab which uses "E. coli" for DNA recombination. (MVL)

  19. Quantification and Sequencing of Crossover Recombinant Molecules from Arabidopsis Pollen DNA.

    Science.gov (United States)

    Choi, Kyuha; Yelina, Nataliya E; Serra, Heïdi; Henderson, Ian R

    2017-01-01

    During meiosis, homologous chromosomes undergo recombination, which can result in formation of reciprocal crossover molecules. Crossover frequency is highly variable across the genome, typically occurring in narrow hotspots, which has a significant effect on patterns of genetic diversity. Here we describe methods to measure crossover frequency in plants at the hotspot scale (bp-kb), using allele-specific PCR amplification from genomic DNA extracted from the pollen of F 1 heterozygous plants. We describe (1) titration methods that allow amplification, quantification and sequencing of single crossover molecules, (2) quantitative PCR methods to more rapidly measure crossover frequency, and (3) application of high-throughput sequencing for study of crossover distributions within hotspots. We provide detailed descriptions of key steps including pollen DNA extraction, prior identification of hotspot locations, allele-specific oligonucleotide design, and sequence analysis approaches. Together, these methods allow the rate and recombination topology of plant hotspots to be robustly measured and compared between varied genetic backgrounds and environmental conditions.

  20. Effect of mutagens, chemotherapeutic agents and defects in DNA repair genes on recombination in F' partial diploid Escherichia coli

    International Nuclear Information System (INIS)

    Norin, A.J.; Goldschmidt, E.P.

    1979-01-01

    The ability of mutagenic agents, nonmutagenic substances and defects in DNA repair to alter the genotype of F' partial diploid (F30) Escherichia coli was determined. The frequency of auxotrophic mutants and histidine requiring (His - ) haploid colonies was increased by mutagen treatment but Hfr colonies were not detected in F30 E. coli even with specific selection techniques. Genotype changes due to nonreciprocal recombination were determined by measuring the frequency of His - homogenotes, eg. F' hisC780, hisI + /hisC780, hisI + , arising from a His + heterogenote, F' hisC780 hisI + /hisC + , his1903. At least 75% of the recombinants were homozygous for histidine alleles which were present on the F' plasmid (exogenote) of the parental hetergenote rather than for histidine alleles on the chromosome. Mutagens, chemotherapeutic agents which block DNA synthesis and a defective DNA polymerase I gene, polA1, were found to increase the frequency of nonreciprocal recombination. A defect in the ability to excise thymine dimers, uvrC34, did not increase spontaneous nonreciprocal recombination. However, UV irradiation but not methyl methanesulfonate (MMS) induced greater recombination in this excision-repair defective mutant than in DNA-repair-proficient strains. (Auth.)

  1. The "Frankenplasmid" Lab: An Investigative Exercise for Teaching Recombinant DNA Methods

    Science.gov (United States)

    Dean, Derek M.; Wilder, Jason A.

    2011-01-01

    We describe an investigative laboratory module designed to give college undergraduates strong practical and theoretical experience with recombinant DNA methods within 3 weeks. After deducing restriction enzyme maps for two different plasmids, students ligate the plasmids together in the same reaction, transform "E. coli" with this mixture of…

  2. The 3'-to-5' exonuclease activity of vaccinia virus DNA polymerase is essential and plays a role in promoting virus genetic recombination.

    Science.gov (United States)

    Gammon, Don B; Evans, David H

    2009-05-01

    Poxviruses are subjected to extraordinarily high levels of genetic recombination during infection, although the enzymes catalyzing these reactions have never been identified. However, it is clear that virus-encoded DNA polymerases play some unknown yet critical role in virus recombination. Using a novel, antiviral-drug-based strategy to dissect recombination and replication reactions, we now show that the 3'-to-5' proofreading exonuclease activity of the viral DNA polymerase plays a key role in promoting recombination reactions. Linear DNA substrates were prepared containing the dCMP analog cidofovir (CDV) incorporated into the 3' ends of the molecules. The drug blocked the formation of concatemeric recombinant molecules in vitro in a process that was catalyzed by the proofreading activity of vaccinia virus DNA polymerase. Recombinant formation was also blocked when CDV-containing recombination substrates were transfected into cells infected with wild-type vaccinia virus. These inhibitory effects could be overcome if CDV-containing substrates were transfected into cells infected with CDV-resistant (CDV(r)) viruses, but only when resistance was linked to an A314T substitution mutation mapping within the 3'-to-5' exonuclease domain of the viral polymerase. Viruses encoding a CDV(r) mutation in the polymerase domain still exhibited a CDV-induced recombination deficiency. The A314T substitution also enhanced the enzyme's capacity to excise CDV molecules from the 3' ends of duplex DNA and to recombine these DNAs in vitro, as judged from experiments using purified mutant DNA polymerase. The 3'-to-5' exonuclease activity appears to be an essential virus function, and our results suggest that this might be because poxviruses use it to promote genetic exchange.

  3. Role of teh Rad52 Amino-terminal DNA Binding Activity in DNA Strand Capture in Homologous Recombination

    DEFF Research Database (Denmark)

    Shi, Idina; Hallwyl, Swee Chuang Lim; Seong, Changhyun

    2009-01-01

    Saccharomyces cerevisiae Rad52 protein promotes homologous recombination by nucleating the Rad51 recombinase onto replication protein A-coated single-stranded DNA strands and also by directly annealing such strands. We show that the purified rad52-R70A mutant protein, with a compromised amino-ter...

  4. Regulatory Control of the Resolution of DNA Recombination Intermediates during Meiosis and Mitosis

    OpenAIRE

    Matos, Joao; Blanco, Miguel G.; Maslen, Sarah; Skehel, J. Mark; West, Stephen C.

    2011-01-01

    The efficient and timely resolution of DNA recombination intermediates is essential for bipolar chromosome segregation. Here, we show that the specialized chromosome segregation patterns of meiosis and mitosis, which require the coordination of recombination with cell-cycle progression, are achieved by regulating the timing of activation of two crossover-promoting endonucleases. In yeast meiosis, Mus81-Mms4 and Yen1 are controlled by phosphorylation events that lead to their sequential activa...

  5. Active site electrostatics protect genome integrity by blocking abortive hydrolysis during DNA recombination

    Science.gov (United States)

    Ma, Chien-Hui; Rowley, Paul A; Macieszak, Anna; Guga, Piotr; Jayaram, Makkuni

    2009-01-01

    Water, acting as a rogue nucleophile, can disrupt transesterification steps of important phosphoryl transfer reactions in DNA and RNA. We have unveiled this risk, and identified safeguards instituted against it, during strand cleavage and joining by the tyrosine site-specific recombinase Flp. Strand joining is threatened by a latent Flp endonuclease activity (type I) towards the 3′-phosphotyrosyl intermediate resulting from strand cleavage. This risk is not alleviated by phosphate electrostatics; neutralizing the negative charge on the scissile phosphate through methylphosphonate (MeP) substitution does not stimulate type I endonuclease. Rather, protection derives from the architecture of the recombination synapse and conformational dynamics within it. Strand cleavage is protected against water by active site electrostatics. Replacement of the catalytic Arg-308 of Flp by alanine, along with MeP substitution, elicits a second Flp endonuclease activity (type II) that directly targets the scissile phosphodiester bond in DNA. MeP substitution, combined with appropriate active site mutations, will be useful in revealing anti-hydrolytic mechanisms engendered by systems that mediate DNA relaxation, DNA transposition, site-specific recombination, telomere resolution, RNA splicing and retrohoming of mobile introns. PMID:19440204

  6. DNA secondary structures are associated with recombination in major Plasmodium falciparum variable surface antigen gene families

    DEFF Research Database (Denmark)

    Sander, Adam F.; Lavstsen, Thomas; Rask, Thomas Salhøj

    2014-01-01

    falciparum-erythrocyte membrane protein 1 class on the infected erythrocyte surface. Recombination clearly generates var diversity, but the nature and control of the genetic exchanges involved remain unclear. By experimental and bioinformatic identification of recombination events and genome...... of recombination during DNA replication in P. falciparum sexual stages, and that these DSS-regulated genetic exchanges generate functional and diverse P. falciparum adhesion antigens. DSS-induced recombination may represent a common mechanism for optimizing the evolvability of virulence gene families in pathogens....

  7. Expression of human DNA polymerase β in Escherichia coli and characterization of the recombinant enzyme

    International Nuclear Information System (INIS)

    Abbotts, J.; SenGupta, D.N.; Zmudzka, B.; Widen, S.G.; Notario, V.; Wilson, S.H.

    1988-01-01

    The coding region of a human β-polymerase cDNA, predicting a 335 amino acid protein, was subcloned in the Escherichia coli expression plasmid pRC23. After induction of transformed cells, the crude soluble extract was found to contain a new protein immunoreactive with β-polymerase antibody and corresponding in size to the protein deduced from the cDNA. This protein was purified in a yield of 1-2 mg/50 g of cells. The recombinant protein had about the same DNA polymerase specific activity as β-polymerase purified from mammalian tissues, and template-primer specificity and immunological properties of the recombinant polymerase were similar to those of natural β-polymerases. The purified enzyme was free of nuclease activity. The authors studied detailed catalytic properties of the recombinant β-polymerase using defined template-primer systems. The results indicate that this β-polymerase is essentially identical with natural β-polymerases. The recombinant enzyme is distributive in mode of synthesis and is capable of detecting changes in the integrity of the single-stranded template, such as methylated bases and a double-stranded region. The enzyme recognizes a template region four to seven bases downstream of the primer 3' end and utilizes alternative primers if this downstream template region is double stranded. The enzyme is unable to synthesize past methylated bases N 3 -methyl-dT or O 6 -methyl-dG

  8. A BAC-bacterial recombination method to generate physically linked multiple gene reporter DNA constructs

    Directory of Open Access Journals (Sweden)

    Gong Shiaochin

    2009-03-01

    Full Text Available Abstract Background Reporter gene mice are valuable animal models for biological research providing a gene expression readout that can contribute to cellular characterization within the context of a developmental process. With the advancement of bacterial recombination techniques to engineer reporter gene constructs from BAC genomic clones and the generation of optically distinguishable fluorescent protein reporter genes, there is an unprecedented capability to engineer more informative transgenic reporter mouse models relative to what has been traditionally available. Results We demonstrate here our first effort on the development of a three stage bacterial recombination strategy to physically link multiple genes together with their respective fluorescent protein (FP reporters in one DNA fragment. This strategy uses bacterial recombination techniques to: (1 subclone genes of interest into BAC linking vectors, (2 insert desired reporter genes into respective genes and (3 link different gene-reporters together. As proof of concept, we have generated a single DNA fragment containing the genes Trap, Dmp1, and Ibsp driving the expression of ECFP, mCherry, and Topaz FP reporter genes, respectively. Using this DNA construct, we have successfully generated transgenic reporter mice that retain two to three gene readouts. Conclusion The three stage methodology to link multiple genes with their respective fluorescent protein reporter works with reasonable efficiency. Moreover, gene linkage allows for their common chromosomal integration into a single locus. However, the testing of this multi-reporter DNA construct by transgenesis does suggest that the linkage of two different genes together, despite their large size, can still create a positional effect. We believe that gene choice, genomic DNA fragment size and the presence of endogenous insulator elements are critical variables.

  9. A BAC-bacterial recombination method to generate physically linked multiple gene reporter DNA constructs.

    Science.gov (United States)

    Maye, Peter; Stover, Mary Louise; Liu, Yaling; Rowe, David W; Gong, Shiaochin; Lichtler, Alexander C

    2009-03-13

    Reporter gene mice are valuable animal models for biological research providing a gene expression readout that can contribute to cellular characterization within the context of a developmental process. With the advancement of bacterial recombination techniques to engineer reporter gene constructs from BAC genomic clones and the generation of optically distinguishable fluorescent protein reporter genes, there is an unprecedented capability to engineer more informative transgenic reporter mouse models relative to what has been traditionally available. We demonstrate here our first effort on the development of a three stage bacterial recombination strategy to physically link multiple genes together with their respective fluorescent protein (FP) reporters in one DNA fragment. This strategy uses bacterial recombination techniques to: (1) subclone genes of interest into BAC linking vectors, (2) insert desired reporter genes into respective genes and (3) link different gene-reporters together. As proof of concept, we have generated a single DNA fragment containing the genes Trap, Dmp1, and Ibsp driving the expression of ECFP, mCherry, and Topaz FP reporter genes, respectively. Using this DNA construct, we have successfully generated transgenic reporter mice that retain two to three gene readouts. The three stage methodology to link multiple genes with their respective fluorescent protein reporter works with reasonable efficiency. Moreover, gene linkage allows for their common chromosomal integration into a single locus. However, the testing of this multi-reporter DNA construct by transgenesis does suggest that the linkage of two different genes together, despite their large size, can still create a positional effect. We believe that gene choice, genomic DNA fragment size and the presence of endogenous insulator elements are critical variables.

  10. Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

    OpenAIRE

    Davidson, John F.; Fox, Richard; Harris, Dawn D.; Lyons-Abbott, Sally; Loeb, Lawrence A.

    2003-01-01

    Insertion of the T3 DNA polymerase thioredoxin binding domain (TBD) into the distantly related thermostable Taq DNA polymerase at an analogous position in the thumb domain, converts the Taq DNA polymerase from a low processive to a highly processive enzyme. Processivity is dependent on the presence of thioredoxin. The enhancement in processivity is 20–50-fold when compared with the wild-type Taq DNA polymerase or to the recombinant polymerase in the absence of thioredoxin. The recombinant Taq...

  11. Caffeine suppresses homologous recombination through interference with RAD51-mediated joint molecule formation

    Science.gov (United States)

    Zelensky, Alex N.; Sanchez, Humberto; Ristic, Dejan; Vidic, Iztok; van Rossum-Fikkert, Sari E.; Essers, Jeroen; Wyman, Claire; Kanaar, Roland

    2013-01-01

    Caffeine is a widely used inhibitor of the protein kinases that play a central role in the DNA damage response. We used chemical inhibitors and genetically deficient mouse embryonic stem cell lines to study the role of DNA damage response in stable integration of the transfected DNA and found that caffeine rapidly, efficiently and reversibly inhibited homologous integration of the transfected DNA as measured by several homologous recombination-mediated gene-targeting assays. Biochemical and structural biology experiments revealed that caffeine interfered with a pivotal step in homologous recombination, homologous joint molecule formation, through increasing interactions of the RAD51 nucleoprotein filament with non-homologous DNA. Our results suggest that recombination pathways dependent on extensive homology search are caffeine-sensitive and stress the importance of considering direct checkpoint-independent mechanisms in the interpretation of the effects of caffeine on DNA repair. PMID:23666627

  12. Effects of DNA double-strand and single-strand breaks on intrachromosomal recombination events in cell-cycle-arrested yeast cells

    International Nuclear Information System (INIS)

    Galli, A.; Schiestl, R.H.

    1998-01-01

    Intrachromosomal recombination between repeated elements can result in deletion (DEL recombination) events. We investigated the inducibility of such intrachromosomal recombination events at different stages of the cell cycle and the nature of the primary DNA lesions capable of initiating these events. Two genetic systems were constructed in Saccharomyces cerevisiae that select for DEL recombination events between duplicated alleles of CDC28 and TUB2. We determined effects of double-strand breaks (DSBs) and single-strand breaks (SSBs) between the duplicated alleles on DEL recombination when induced in dividing cells or cells arrested in G1 or G2. Site-specific DSBs and SSBs were produced by overexpression of the I-Sce I endonuclease and the gene II protein (gIIp), respectively. I-Sce I-induced DSBs caused an increase in DEL recombination frequencies in both dividing and cell-cycle-arrested cells, indicating that G1- and G2-arrested cells are capable of completing DSB repair. In contrast, gIIp-induced SSBs caused an increase in DEL recombination frequency only in dividing cells. To further examine these phenomena we used both γ-irradiation, inducing DSBs as its most relevant lesion, and UV, inducing other forms of DNA damage. UV irradiation did not increase DEL recombination frequencies in G1 or G2, whereas γ-rays increased DEL recombination frequencies in both phases. Both forms of radiation, however, induced DEL recombination in dividing cells. The results suggest that DSBsbut not SSBs induce DEL recombination, probably via the single-strand annealing pathway. Further, DSBs in dividing cells may result from the replication of a UV or SSB-damaged template. Alternatively, UV induced events may occur by replication slippage after DNA polymerase pausing in front of the damage. (author)

  13. Mycobacterium smegmatis SftH exemplifies a distinctive clade of superfamily II DNA-dependent ATPases with 3′ to 5′ translocase and helicase activities

    OpenAIRE

    Yakovleva, Lyudmila; Shuman, Stewart

    2012-01-01

    Bacterial DNA helicases are nucleic acid-dependent NTPases that play important roles in DNA replication, recombination and repair. We are interested in the DNA helicases of Mycobacteria, a genus of the phylum Actinobacteria, which includes the human pathogen Mycobacterium tuberculosis and its avirulent relative Mycobacterium smegmatis. Here, we identify and characterize M. smegmatis SftH, a superfamily II helicase with a distinctive domain structure, comprising an N-terminal NTPase domain and...

  14. Senataxin plays an essential role with DNA damage response proteins in meiotic recombination and gene silencing.

    Directory of Open Access Journals (Sweden)

    Olivier J Becherel

    2013-04-01

    Full Text Available Senataxin, mutated in the human genetic disorder ataxia with oculomotor apraxia type 2 (AOA2, plays an important role in maintaining genome integrity by coordination of transcription, DNA replication, and the DNA damage response. We demonstrate that senataxin is essential for spermatogenesis and that it functions at two stages in meiosis during crossing-over in homologous recombination and in meiotic sex chromosome inactivation (MSCI. Disruption of the Setx gene caused persistence of DNA double-strand breaks, a defect in disassembly of Rad51 filaments, accumulation of DNA:RNA hybrids (R-loops, and ultimately a failure of crossing-over. Senataxin localised to the XY body in a Brca1-dependent manner, and in its absence there was incomplete localisation of DNA damage response proteins to the XY chromosomes and ATR was retained on the axial elements of these chromosomes, failing to diffuse out into chromatin. Furthermore persistence of RNA polymerase II activity, altered ubH2A distribution, and abnormal XY-linked gene expression in Setx⁻/⁻ revealed an essential role for senataxin in MSCI. These data support key roles for senataxin in coordinating meiotic crossing-over with transcription and in gene silencing to protect the integrity of the genome.

  15. Homologous Recombination DNA Repair Genes Play a Critical Role in Reprogramming to a Pluripotent State

    Directory of Open Access Journals (Sweden)

    Federico González

    2013-03-01

    Full Text Available Induced pluripotent stem cells (iPSCs hold great promise for personalized regenerative medicine. However, recent studies show that iPSC lines carry genetic abnormalities, suggesting that reprogramming may be mutagenic. Here, we show that the ectopic expression of reprogramming factors increases the level of phosphorylated histone H2AX, one of the earliest cellular responses to DNA double-strand breaks (DSBs. Additional mechanistic studies uncover a direct role of the homologous recombination (HR pathway, a pathway essential for error-free repair of DNA DSBs, in reprogramming. This role is independent of the use of integrative or nonintegrative methods in introducing reprogramming factors, despite the latter being considered a safer approach that circumvents genetic modifications. Finally, deletion of the tumor suppressor p53 rescues the reprogramming phenotype in HR-deficient cells primarily through the restoration of reprogramming-dependent defects in cell proliferation and apoptosis. These mechanistic insights have important implications for the design of safer approaches to creating iPSCs.

  16. Varicella-zoster virus (VZV) origin of DNA replication oriS influences origin-dependent DNA replication and flanking gene transcription.

    Science.gov (United States)

    Khalil, Mohamed I; Sommer, Marvin H; Hay, John; Ruyechan, William T; Arvin, Ann M

    2015-07-01

    The VZV genome has two origins of DNA replication (oriS), each of which consists of an AT-rich sequence and three origin binding protein (OBP) sites called Box A, C and B. In these experiments, the mutation in the core sequence CGC of the Box A and C not only inhibited DNA replication but also inhibited both ORF62 and ORF63 expression in reporter gene assays. In contrast the Box B mutation did not influence DNA replication or flanking gene transcription. These results suggest that efficient DNA replication enhances ORF62 and ORF63 transcription. Recombinant viruses carrying these mutations in both sites and one with a deletion of the whole oriS were constructed. Surprisingly, the recombinant virus lacking both copies of oriS retained the capacity to replicate in melanoma and HELF cells suggesting that VZV has another origin of DNA replication. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. [HPV DNA vaccines expressing recombinant CRT/HPV6bE7 fusion protein inhibit tumor growth and angiogenic activity].

    Science.gov (United States)

    Xu, Yan; Cheng, Hao; Zhao, Ke-Jia; Zhu, Ke-Jian; Zhang, Xing

    2007-11-01

    This paper was to study the angiogenic inhibitory effect and the potential antitumor effect of the constructed recombinant DNA vaccine CRT/HPV6bE7 in vivo. The C57BL/6 mice were vaccinated respectively with recombinant CRT/HPV6bE7 DNA plamids. The inhibitory effects on angiogenesis of generated vaccines in vivo were evaluated by a bFGF-induced angiogenesis assay using the Matrigel kit. To investigate the potential antitumor effect, the mean tumor weights, sizes and tumor appearing times were measured in C57BL/6 mice treated with HPV6bE7-expressing B16 cells. The results indicated that the recombinants CRT180/HPV6bE7 and CRT180 showed strong anti-angiogenic effects in bFGF-induced angiogenesis in vivo. Moreover, CRT180/HPV6bE7 and CRT180 DNA vaccines could significantly inhibit the tumor growth in tumor challenge experiment, and CRT180/HPV6bE7 was superior to other vaccines in delaying tumor formation time, limiting tumor size and weight in tumor protection experiment. In conclusion, recombinant CRT180/HPV6bE7 DNA could elicit a most efficient anti-angiogenic effect and inhibit tumor growth in mice inoculated with DNA vaccines. The antiangiogenic activity of CRT were suggested residing in a domain between CRT 120-180 aa.

  18. A PHF8 homolog in C. elegans promotes DNA repair via homologous recombination.

    Directory of Open Access Journals (Sweden)

    Changrim Lee

    Full Text Available PHF8 is a JmjC domain-containing histone demethylase, defects in which are associated with X-linked mental retardation. In this study, we examined the roles of two PHF8 homologs, JMJD-1.1 and JMJD-1.2, in the model organism C. elegans in response to DNA damage. A deletion mutation in either of the genes led to hypersensitivity to interstrand DNA crosslinks (ICLs, while only mutation of jmjd-1.1 resulted in hypersensitivity to double-strand DNA breaks (DSBs. In response to ICLs, JMJD-1.1 did not affect the focus formation of FCD-2, a homolog of FANCD2, a key protein in the Fanconi anemia pathway. However, the dynamic behavior of RPA-1 and RAD-51 was affected by the mutation: the accumulations of both proteins at ICLs appeared normal, but their subsequent disappearance was retarded, suggesting that later steps of homologous recombination were defective. Similar changes in the dynamic behavior of RPA-1 and RAD-51 were seen in response to DSBs, supporting a role of JMJD-1.1 in homologous recombination. Such a role was also supported by our finding that the hypersensitivity of jmjd-1.1 worms to ICLs was rescued by knockdown of lig-4, a homolog of Ligase 4 active in nonhomologous end-joining. The hypersensitivity of jmjd-1.1 worms to ICLs was increased by rad-54 knockdown, suggesting that JMJD-1.1 acts in parallel with RAD-54 in modulating chromatin structure. Indeed, the level of histone H3 Lys9 tri-methylation, a marker of heterochromatin, was higher in jmjd-1.1 cells than in wild-type cells. We conclude that the histone demethylase JMJD-1.1 influences homologous recombination either by relaxing heterochromatin structure or by indirectly regulating the expression of multiple genes affecting DNA repair.

  19. RPA mediates recombination repair during replication stress and is displaced from DNA by checkpoint signalling in human cells

    DEFF Research Database (Denmark)

    Sleeth, Kate M; Sørensen, Claus Storgaard; Issaeva, Natalia

    2007-01-01

    The replication protein A (RPA) is involved in most, if not all, nuclear metabolism involving single-stranded DNA. Here, we show that RPA is involved in genome maintenance at stalled replication forks by the homologous recombination repair system in humans. Depletion of the RPA protein inhibited...... the formation of RAD51 nuclear foci after hydroxyurea-induced replication stalling leading to persistent unrepaired DNA double-strand breaks (DSBs). We demonstrate a direct role of RPA in homology directed recombination repair. We find that RPA is dispensable for checkpoint kinase 1 (Chk1) activation...... and that RPA directly binds RAD52 upon replication stress, suggesting a direct role in recombination repair. In addition we show that inhibition of Chk1 with UCN-01 decreases dissociation of RPA from the chromatin and inhibits association of RAD51 and RAD52 with DNA. Altogether, our data suggest a direct role...

  20. Generating and repairing genetically programmed DNA breaks during immunoglobulin class switch recombination

    Science.gov (United States)

    Nicolas, Laura; Cols, Montserrat; Choi, Jee Eun; Chaudhuri, Jayanta; Vuong, Bao

    2018-01-01

    Adaptive immune responses require the generation of a diverse repertoire of immunoglobulins (Igs) that can recognize and neutralize a seemingly infinite number of antigens. V(D)J recombination creates the primary Ig repertoire, which subsequently is modified by somatic hypermutation (SHM) and class switch recombination (CSR). SHM promotes Ig affinity maturation whereas CSR alters the effector function of the Ig. Both SHM and CSR require activation-induced cytidine deaminase (AID) to produce dU:dG mismatches in the Ig locus that are transformed into untemplated mutations in variable coding segments during SHM or DNA double-strand breaks (DSBs) in switch regions during CSR. Within the Ig locus, DNA repair pathways are diverted from their canonical role in maintaining genomic integrity to permit AID-directed mutation and deletion of gene coding segments. Recently identified proteins, genes, and regulatory networks have provided new insights into the temporally and spatially coordinated molecular interactions that control the formation and repair of DSBs within the Ig locus. Unravelling the genetic program that allows B cells to selectively alter the Ig coding regions while protecting non-Ig genes from DNA damage advances our understanding of the molecular processes that maintain genomic integrity as well as humoral immunity. PMID:29744038

  1. The cell pole: the site of cross talk between the DNA uptake and genetic recombination machinery.

    Science.gov (United States)

    Kidane, Dawit; Ayora, Silvia; Sweasy, Joann B; Graumann, Peter L; Alonso, Juan C

    2012-01-01

    Natural transformation is a programmed mechanism characterized by binding of free double-stranded (ds) DNA from the environment to the cell pole in rod-shaped bacteria. In Bacillus subtilis some competence proteins, which process the dsDNA and translocate single-stranded (ss) DNA into the cytosol, recruit a set of recombination proteins mainly to one of the cell poles. A subset of single-stranded binding proteins, working as "guardians", protects ssDNA from degradation and limit the RecA recombinase loading. Then, the "mediators" overcome the inhibitory role of guardians, and recruit RecA onto ssDNA. A RecA·ssDNA filament searches for homology on the chromosome and, in a process that is controlled by "modulators", catalyzes strand invasion with the generation of a displacement loop (D-loop). A D-loop resolvase or "resolver" cleaves this intermediate, limited DNA replication restores missing information and a DNA ligase seals the DNA ends. However, if any step fails, the "rescuers" will repair the broken end to rescue chromosomal transformation. If the ssDNA does not share homology with resident DNA, but it contains information for autonomous replication, guardian and mediator proteins catalyze plasmid establishment after inhibition of RecA. DNA replication and ligation reconstitute the molecule (plasmid transformation). In this review, the interacting network that leads to a cross talk between proteins of the uptake and genetic recombination machinery will be placed into prospective.

  2. Top3 processes recombination intermediates and modulates checkpoint activity after DNA damage

    DEFF Research Database (Denmark)

    Mankouri, Hocine W; Hickson, Ian D

    2006-01-01

    Mutation of TOP3 in Saccharomyces cerevisiae causes poor growth, hyperrecombination, and a failure to fully activate DNA damage checkpoints in S phase. Here, we report that overexpression of a dominant-negative allele of TOP3, TOP3(Y356F), which lacks the catalytic (decatenation) activity of Top3......, the catalytic activity of Top3 is not required for DNA damage checkpoint activation, but it is required for normal S-phase progression after DNA damage. We also present evidence that the checkpoint-mediated cell cycle delay and persistence of X-shaped DNA molecules resulting from overexpression of TOP3(Y356F......) are downstream of Rad51 function. We propose that Top3 functions in S phase to both process homologous recombination intermediates and modulate checkpoint activity....

  3. Methotrexate induces DNA damage and inhibits homologous recombination repair in choriocarcinoma cells

    Directory of Open Access Journals (Sweden)

    Xie L

    2016-11-01

    Full Text Available Lisha Xie,1,* Tiancen Zhao,1,2,* Jing Cai,1 You Su,1 Zehua Wang,1 Weihong Dong1 1Department of Obstetrics and Gynecology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, 2Department of Obstetrics and Gynecology, Central Hospital of Wuhan, Wuhan, China *These authors contributed equally to this work Objective: The objective of this study was to investigate the mechanism of sensitivity to methotrexate (MTX in human choriocarcinoma cells regarding DNA damage response. Methods: Two choriocarcinoma cancer cell lines, JAR and JEG-3, were utilized in this study. An MTX-sensitive osteosarcoma cell line MG63, an MTX-resistant epithelial ovarian cancer cell line A2780 and an MTX-resistant cervical adenocarcinoma cell line Hela served as controls. Cell viability assay was carried out to assess MTX sensitivity of cell lines. MTX-induced DNA damage was evaluated by comet assay. Quantitative reverse transcription polymerase chain reaction was used to detect the mRNA levels of BRCA1, BRCA2, RAD51 and RAD52. The protein levels of γH2AX, RAD 51 and p53 were analyzed by Western blot. Results: Remarkable DNA strand breaks were observed in MTX-sensitive cell lines (JAR, JEG-3 and MG63 but not in MTX-resistant cancer cells (A2780 and Hela after 48 h of MTX treatment. Only in the choriocarcinoma cells, the expression of homologous recombination (HR repair gene RAD51 was dramatically suppressed by MTX in a dose- and time-dependent manner, accompanied with the increase in p53. Conclusion: The MTX-induced DNA strand breaks accompanied by deficiencies in HR repair may contribute to the hypersensitivity to chemotherapy in choriocarcinoma. Keywords: choriocarcinoma, chemotherapy hypersensitivity, DNA double-strand break, RAD51, p53

  4. Regulation of homologous recombination in eukaryotes

    OpenAIRE

    Heyer, Wolf-Dietrich; Ehmsen, Kirk T.; Liu, Jie

    2010-01-01

    Homologous recombination is required for accurate chromosome segregation during the first meiotic division and constitutes a key repair and tolerance pathway for complex DNA damage including DNA double-stranded breaks, interstrand crosslinks, and DNA gaps. In addition, recombination and replication are inextricably linked, as recombination recovers stalled and broken replication forks enabling the evolution of larger genomes/replicons. Defects in recombination lead to genomic instability and ...

  5. SV40 host-substituted variants: a new look at the monkey DNA inserts and recombinant junctions.

    Science.gov (United States)

    Singer, Maxine; Winocour, Ernest

    2011-04-10

    The available monkey genomic data banks were examined in order to determine the chromosomal locations of the host DNA inserts in 8 host-substituted SV40 variant DNAs. Five of the 8 variants contained more than one linked monkey DNA insert per tandem repeat unit and in all cases but one, the 19 monkey DNA inserts in the 8 variants mapped to different locations in the monkey genome. The 50 parental DNAs (32 monkey and 18 SV40 DNA segments) which spanned the crossover and flanking regions that participated in monkey/monkey and monkey/SV40 recombinations were characterized by substantial levels of microhomology of up to 8 nucleotides in length; the parental DNAs also exhibited direct and inverted repeats at or adjacent to the crossover sequences. We discuss how the host-substituted SV40 variants arose and the nature of the recombination mechanisms involved. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. Full mitochondrial genome sequences of two endemic Philippine hornbill species (Aves: Bucerotidae) provide evidence for pervasive mitochondrial DNA recombination.

    Science.gov (United States)

    Sammler, Svenja; Bleidorn, Christoph; Tiedemann, Ralph

    2011-01-14

    Although nowaday it is broadly accepted that mitochondrial DNA (mtDNA) may undergo recombination, the frequency of such recombination remains controversial. Its estimation is not straightforward, as recombination under homoplasmy (i.e., among identical mt genomes) is likely to be overlooked. In species with tandem duplications of large mtDNA fragments the detection of recombination can be facilitated, as it can lead to gene conversion among duplicates. Although the mechanisms for concerted evolution in mtDNA are not fully understood yet, recombination rates have been estimated from "one per speciation event" down to 850 years or even "during every replication cycle". Here we present the first complete mt genome of the avian family Bucerotidae, i.e., that of two Philippine hornbills, Aceros waldeni and Penelopides panini. The mt genomes are characterized by a tandemly duplicated region encompassing part of cytochrome b, 3 tRNAs, NADH6, and the control region. The duplicated fragments are identical to each other except for a short section in domain I and for the length of repeat motifs in domain III of the control region. Due to the heteroplasmy with regard to the number of these repeat motifs, there is some size variation in both genomes; with around 21,657 bp (A. waldeni) and 22,737 bp (P. panini), they significantly exceed the hitherto longest known avian mt genomes, that of the albatrosses. We discovered concerted evolution between the duplicated fragments within individuals. The existence of differences between individuals in coding genes as well as in the control region, which are maintained between duplicates, indicates that recombination apparently occurs frequently, i.e., in every generation. The homogenised duplicates are interspersed by a short fragment which shows no sign of recombination. We hypothesize that this region corresponds to the so-called Replication Fork Barrier (RFB), which has been described from the chicken mitochondrial genome. As this RFB

  7. Full mitochondrial genome sequences of two endemic Philippine hornbill species (Aves: Bucerotidae provide evidence for pervasive mitochondrial DNA recombination

    Directory of Open Access Journals (Sweden)

    Bleidorn Christoph

    2011-01-01

    Full Text Available Abstract Background Although nowaday it is broadly accepted that mitochondrial DNA (mtDNA may undergo recombination, the frequency of such recombination remains controversial. Its estimation is not straightforward, as recombination under homoplasmy (i.e., among identical mt genomes is likely to be overlooked. In species with tandem duplications of large mtDNA fragments the detection of recombination can be facilitated, as it can lead to gene conversion among duplicates. Although the mechanisms for concerted evolution in mtDNA are not fully understood yet, recombination rates have been estimated from "one per speciation event" down to 850 years or even "during every replication cycle". Results Here we present the first complete mt genome of the avian family Bucerotidae, i.e., that of two Philippine hornbills, Aceros waldeni and Penelopides panini. The mt genomes are characterized by a tandemly duplicated region encompassing part of cytochrome b, 3 tRNAs, NADH6, and the control region. The duplicated fragments are identical to each other except for a short section in domain I and for the length of repeat motifs in domain III of the control region. Due to the heteroplasmy with regard to the number of these repeat motifs, there is some size variation in both genomes; with around 21,657 bp (A. waldeni and 22,737 bp (P. panini, they significantly exceed the hitherto longest known avian mt genomes, that of the albatrosses. We discovered concerted evolution between the duplicated fragments within individuals. The existence of differences between individuals in coding genes as well as in the control region, which are maintained between duplicates, indicates that recombination apparently occurs frequently, i.e., in every generation. Conclusions The homogenised duplicates are interspersed by a short fragment which shows no sign of recombination. We hypothesize that this region corresponds to the so-called Replication Fork Barrier (RFB, which has been

  8. BCR/ABL downregulates DNA-PK(CS)-dependent and upregulates backup non-homologous end joining in leukemic cells.

    Science.gov (United States)

    Poplawski, Tomasz; Blasiak, Janusz

    2010-06-01

    Non-homologous end joining (NHEJ) and homologous recombination repair (HRR) are the main mechanisms involved in the processing of DNA double strand breaks (DSBs) in humans. We showed previously that the oncogenic tyrosine kinase BCR/ABL stimulated DSBs repair by HRR. To evaluate the role of BCR/ABL in DSBs repair by NHEJ we examined the ability of leukemic BCR/ABL-expressing cell line BV173 to repair DNA damage induced by two DNA topoisomerase II inhibitors: etoposide and sobuzoxane. DNA lesions induced by sobuzoxane are repaired by a NHEJ pathway which is dependent on the catalytic subunit of protein kinase dependent on DNA (DNA-PK(CS); D-NHEJ), whereas damage evoked by etoposide are repaired by two distinct NHEJ pathways, dependent on or independent of DNA-PK(CS) (backup NHEJ, B-NHEJ). Cells incubated with STI571, a highly specific inhibitor of BCR/ABL, displayed resistance to these agents associated with an accelerated kinetics of DSBs repair, as measured by the neutral comet assay and pulsed field gel electrophoresis. However, in a functional NHEJ assay, cells preincubated with STI571 repaired DSBs induced by a restriction enzyme with a lower efficacy than without the preincubation and addition of wortmannin, a specific inhibitor of DNA-PK(CS), did not change efficacy of the NHEJ reaction. We suggest that BCR/ABL switch on B-NHEJ which is more error-prone then D-NHEJ and in such manner contribute to the increase of the genomic instability of leukemic cells.

  9. PRKDC mutations associated with immunodeficiency, granuloma, and autoimmune regulator-dependent autoimmunity

    NARCIS (Netherlands)

    A.-L. Mathieu (Anne-Laure); E. Verronese (Estelle); G.I. Rice (Gillian I.); F. Fouyssac (Fanny); Y. Bertrand (Yves); C. Picard (Capucine); M. Chansel (Marie); J.E. Walter (Jolan E.); L.D. Notarangelo (Luigi Daniele); M.J. Butte (Manish J.); K.C. Nadeau (Kari Christine); K. Csomos (Krisztian); D.J. Chen (David); K. Chen (Karin); A. Delgado (Ana); C. Rigal (Chantal); C. Bardin (Christine); C. Schuetz (Catharina); D. Moshous (Despina); H. Reumaux (Héloïse); F. Plenat (François); A. Phan (Alice); M.-T. Zabot (Marie-Thérèse); B. Balme (Brigitte); S. Viel (Sébastien); J. Bienvenu (Jacques); P. Cochat (Pierre); M. van der Burg (Mirjam); C. Caux (Christophe); E.H. Kemp (E. Helen); I. Rouvet (Isabelle); C. Malcus (Christophe); J.-F. Méritet (Jean-Francois); A. Lim (Annick); Y.J. Crow (Yanick J.); N. Fabien (Nicole); C. Ménétrier-Caux (Christine); J.-P. De Villartay (Jean-Pierre); T. Walzer (Thierry); A. Belot (Alexandre)

    2015-01-01

    textabstractBackground PRKDC encodes for DNA-dependent protein kinase catalytic subunit (DNA-PKcs), a kinase that forms part of a complex (DNA-dependent protein kinase [DNA-PK]) crucial for DNA double-strand break repair and V(D)J recombination. In mice DNA-PK also interacts with the transcription

  10. Immune responses elicited by Mycoplasma hyopneumoniae recombinant antigens and DNA constructs with potential for use in vaccination against porcine enzootic pneumonia.

    Science.gov (United States)

    Virginio, Veridiana Gomes; Gonchoroski, Taylor; Paes, Jéssica Andrade; Schuck, Desirée Cigaran; Zaha, Arnaldo; Ferreira, Henrique Bunselmeyer

    2014-10-07

    Mycoplasma hyopneumoniae is the etiological agent of porcine enzootic pneumonia (PEP) and causes major economic losses to the pig industry worldwide. Commercially available vaccines provide only partial protection and are relatively expensive. In this study, we assessed the humoral and cellular immune responses to three recombinant antigens of M. hyopneumoniae. Immune responses to selected domains of the P46, HSP70 and MnuA antigens (P46102-253, HSP70212-601 and MnuA182-378), delivered as recombinant subunit or DNA vaccines, were evaluated in BALB/c mice. All purified recombinant antigens and two DNA vaccines, pcDNA3.1(+)/HSP70212-601 and pcDNA3.1(+)/MnuA182-378, elicited a strong humoral immune response, indicated by high IgG levels in the serum. The cellular immune response was assessed by detection of IFN-γ, IL-10 and IL-4 in splenocyte culture supernatants. The recombinant subunit and DNA vaccines induced Th1-polarized immune responses, as evidenced by increased levels of IFN-γ. All recombinant subunit vaccines and the pcDNA3.1(+)/MnuA182-378 vaccine also induced the secretion of IL-10, a Th2-type cytokine, in large quantities. The mixed Th1/Th2-type response may elicit an effective immune response against M. hyopneumoniae, suggesting that P46102-253, HSP70212-601 and MnuA182-378 are potential novel and promising targets for the development of vaccines against PEP. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Redundant function of DNA ligase 1 and 3 in alternative end-joining during immunoglobulin class switch recombination.

    Science.gov (United States)

    Masani, Shahnaz; Han, Li; Meek, Katheryn; Yu, Kefei

    2016-02-02

    Nonhomologous end-joining (NHEJ) is the major DNA double-strand break (DSB) repair pathway in mammals and resolves the DSBs generated during both V(D)J recombination in developing lymphocytes and class switch recombination (CSR) in antigen-stimulated B cells. In contrast to the absolute requirement for NHEJ to resolve DSBs associated with V(D)J recombination, DSBs associated with CSR can be resolved in NHEJ-deficient cells (albeit at a reduced level) by a poorly defined alternative end-joining (A-EJ) pathway. Deletion of DNA ligase IV (Lig4), a core component of the NHEJ pathway, reduces CSR efficiency in a mouse B-cell line capable of robust cytokine-stimulated CSR in cell culture. Here, we report that CSR levels are not further reduced by deletion of either of the two remaining DNA ligases (Lig1 and nuclear Lig3) in Lig4(-/-) cells. We conclude that in the absence of Lig4, Lig1, and Lig3 function in a redundant manner in resolving switch region DSBs during CSR.

  12. Rev1 Recruits Ung to Switch Regions and Enhances dU Glycosylation for Immunoglobulin Class Switch DNA Recombination

    Directory of Open Access Journals (Sweden)

    Hong Zan

    2012-11-01

    Full Text Available By diversifying the biological effector functions of antibodies, class switch DNA recombination (CSR plays a critical role in the maturation of the immune response. It is initiated by activation-induced cytidine deaminase (AID-mediated deoxycytosine deamination, yielding deoxyuridine (dU, and dU glycosylation by uracil DNA glycosylase (Ung in antibody switch (S region DNA. Here we showed that the translesion DNA synthesis polymerase Rev1 directly interacted with Ung and targeted in an AID-dependent and Ung-independent fashion the S regions undergoing CSR. Rev1−/− Ung+/+ B cells reduced Ung recruitment to S regions, DNA-dU glycosylation, and CSR. Together with an S region spectrum of mutations similar to that of Rev1+/+ Ung−/− B cells, this suggests that Rev1 operates in the same pathway as Ung, as emphasized by further decreased CSR in Rev1−/− Msh2−/− B cells. Rescue of CSR in Rev1−/− B cells by a catalytically inactive Rev1 mutant shows that the important role of Rev1 in CSR is mediated by Rev1’s scaffolding function, not its enzymatic function.

  13. Recombinant cells and organisms having persistent nonstandard amino acid dependence and methods of making them

    Science.gov (United States)

    Church, George M.; Mandell, Daniel J.; Lajoie, Marc J.

    2017-12-05

    Recombinant cells and recombinant organisms persistently expressing nonstandard amino acids (NSAAs) are provided. Methods of making recombinant cells and recombinant organisms dependent on persistently expressing NSAAs for survival are also provided. These methods may be used to make safe recombinant cells and recombinant organisms and/or to provide a selective pressure to maintain one or more reassigned codon functions in recombinant cells and recombinant organisms.

  14. Yeast Tdh3 (glyceraldehyde 3-phosphate dehydrogenase is a Sir2-interacting factor that regulates transcriptional silencing and rDNA recombination.

    Directory of Open Access Journals (Sweden)

    Alison E Ringel

    Full Text Available Sir2 is an NAD(+-dependent histone deacetylase required to mediate transcriptional silencing and suppress rDNA recombination in budding yeast. We previously identified Tdh3, a glyceraldehyde 3-phosphate dehydrogenase (GAPDH, as a high expression suppressor of the lethality caused by Sir2 overexpression in yeast cells. Here we show that Tdh3 interacts with Sir2, localizes to silent chromatin in a Sir2-dependent manner, and promotes normal silencing at the telomere and rDNA. Characterization of specific TDH3 alleles suggests that Tdh3's influence on silencing requires nuclear localization but does not correlate with its catalytic activity. Interestingly, a genetic assay suggests that Tdh3, an NAD(+-binding protein, influences nuclear NAD(+ levels; we speculate that Tdh3 links nuclear Sir2 with NAD(+ from the cytoplasm.

  15. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Science.gov (United States)

    Hirsch, Matthew L; Fagan, B Matthew; Dumitru, Raluca; Bower, Jacquelyn J; Yadav, Swati; Porteus, Matthew H; Pevny, Larysa H; Samulski, R Jude

    2011-01-01

    Human embryonic stem cells (hESCs) are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV) single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  16. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  17. Deficiency of the Arabidopsis helicase RTEL1 triggers a SOG1-dependent replication checkpoint in response to DNA cross-links.

    Science.gov (United States)

    Hu, Zhubing; Cools, Toon; Kalhorzadeh, Pooneh; Heyman, Jefri; De Veylder, Lieven

    2015-01-01

    To maintain genome integrity, DNA replication is executed and regulated by a complex molecular network of numerous proteins, including helicases and cell cycle checkpoint regulators. Through a systematic screening for putative replication mutants, we identified an Arabidopsis thaliana homolog of human Regulator of Telomere Length 1 (RTEL1), which functions in DNA replication, DNA repair, and recombination. RTEL1 deficiency retards plant growth, a phenotype including a prolonged S-phase duration and decreased cell proliferation. Genetic analysis revealed that rtel1 mutant plants show activated cell cycle checkpoints, specific sensitivity to DNA cross-linking agents, and increased homologous recombination, but a lack of progressive shortening of telomeres, indicating that RTEL1 functions have only been partially conserved between mammals and plants. Surprisingly, RTEL1 deficiency induces tolerance to the deoxynucleotide-depleting drug hydroxyurea, which could be mimicked by DNA cross-linking agents. This resistance does not rely on the essential replication checkpoint regulator WEE1 but could be blocked by a mutation in the SOG1 transcription factor. Taken together, our data indicate that RTEL1 is required for DNA replication and that its deficiency activates a SOG1-dependent replication checkpoint. © 2015 American Society of Plant Biologists. All rights reserved.

  18. DNA hybrids suggesting a recombination process repairing radiation-induced DNA double-strand breaks in Ehrlich Ascites tumor cells

    International Nuclear Information System (INIS)

    Barthel, H.R.

    1984-01-01

    The results presented suggest the possibility of repair of DNA double-strand breaks by recombination, at least in the S and G 2 -phases of the cell cycle, in mammalian cells. Further experiments with synchronized cell cultures will have to show whether this process may also occur in the G 1 -phase of the cell cycle. (orig./AJ) [de

  19. GANP regulates the choice of DNA repair pathway by DNA-PKcs interaction in AID-dependent IgV region diversification.

    Science.gov (United States)

    Eid, Mohammed Mansour Abbas; Maeda, Kazuhiko; Almofty, Sarah Ameen; Singh, Shailendra Kumar; Shimoda, Mayuko; Sakaguchi, Nobuo

    2014-06-15

    RNA export factor germinal center-associated nuclear protein (GANP) interacts with activation-induced cytidine deaminase (AID) and shepherds it from the cytoplasm to the nucleus and toward the IgV region loci in B cells. In this study, we demonstrate a role for GANP in the repair of AID-initiated DNA damage in chicken DT40 B cells to generate IgV region diversity by gene conversion and somatic hypermutation. GANP plays a positive role in IgV region diversification of DT40 B cells in a nonhomologous end joining-proficient state. DNA-PKcs physically interacts with GANP, and this interaction is dissociated by dsDNA breaks induced by a topoisomerase II inhibitor, etoposide, or AID overexpression. GANP affects the choice of DNA repair mechanism in B cells toward homologous recombination rather than nonhomologous end joining repair. Thus, GANP presumably plays a critical role in protection of the rearranged IgV loci by favoring homologous recombination of the DNA breaks under accelerated AID recruitment. Copyright © 2014 by The American Association of Immunologists, Inc.

  20. 75 FR 31795 - Office of Biotechnology Activities; Recombinant DNA Research: Amended Notice of Meeting

    Science.gov (United States)

    2010-06-04

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health Office of Biotechnology Activities; Recombinant DNA Research: Amended Notice of Meeting ACTION: Notice of cancellation of... information. Dated: May 26, 2010. Jacqueline Corrigan-Curay, Acting Director, Office of Biotechnology...

  1. Genetic recombination induced by DNA double-strand break in bacteriophage T4: nature of the left/right bias.

    Science.gov (United States)

    Shcherbakov, Victor P; Shcherbakova, Tamara; Plugina, Lidiya; Sizova, Svetlana; Kudryashova, Elena; Granovsky, Igor

    2008-06-01

    The experimental system combining double-strand breaks (DSBs), produced site-specifically by SegC endonuclease, with the famous advantages of the bacteriophage T4 rII mutant recombination analysis was used here to elucidate the origin of the recombination bias on two sides of the DSB, especially pronounced in gene 39 (topoisomerase II) and gene 59 (41-helicase loader) mutants. Three sources were found to contribute to the bias: (1) the SegC endonuclease may remain bound to the end of the broken DNA and thus protect it from exonuclease degradation; (2) in heteroduplex heterozygotes (HHs), arising as the recombinant products in the left-hand crosses, the transcribed strands are of rII mutant phenotype, so they, in contrast to the right-hand HHs, do not produce plaques on the lawn of the lambda-lysogenic host; and (3) the intrinsic polarity of T4 chromosome, reflected in transcription, may be a cause for discrimination of promoter-proximal and promoter-distal DNA sequences. It is shown that the apparent recombination bias does not imply one-sidedness of the DSB repair but just reflects a different depth of the end processing. It is inferred that the cause, underlying the "intrinsic" bias, might be interference between strand exchange and transcription. Topoisomerase and helicase functions are necessary to turn the process in favor of strand exchange. The idea is substantiated that the double-stranded to single-stranded DNA transition edge (not ss-DNA tip) serves as an actual recombinogenic element.

  2. Development of a recombinant DNA assay system for the detection of genetic change in astronauts' cells

    International Nuclear Information System (INIS)

    Atchley, S.V.; Chen, D.J.C.; Strniste, G.F.; Walters, R.A.; Moyzis, R.K.

    1984-01-01

    We are developing a new recombinant DNA system for the detection and measurement of genetic change in humans caused by exposure to low level ionizing radiation. A unique feature of the method is the use of cloned repetitive DNA probes to assay human DNA for structural changes during or after irradiation. Repetitive sequences exist in different families. Collectively they constitute over 25% of the DNA in a human cell. Repeat families have between 10 and 500,000 members. We have constructed repetitive DNA sequence libraries using recombinant DNA techniques. From these libraries we have isolated and characterized individual repeats comprising 75 to 90% of the mass of human repetitive DNA. Repeats used in our assay system exist in tandem arrays in the genome. Perturbation of these sequences in a cell, followed by detection with a repeat probe, produces a new, multimeric ''ladder'' pattern on an autoradiogram. The repeat probe used in our initial study is complementary to 1% of human DNA. Therefore, the sensitivity of this method is several orders of magnitude better than existing assays. Preliminary evidence from human skin cells exposed to acute, low-dose x-ray treatments indicates that DNA is affected at a dose as low as 5R. The radiation doses used in this system are well within the range of doses received by astronauts during spaceflight missions. Due to its small material requirements, this technique could easily be adapted for use in space. 16 refs., 1 fig

  3. Temperature and carrier-density dependence of Auger and radiative recombination in nitride optoelectronic devices

    International Nuclear Information System (INIS)

    Kioupakis, Emmanouil; Yan, Qimin; Steiauf, Daniel; Van de Walle, Chris G

    2013-01-01

    Nitride light-emitting diodes are a promising solution for efficient solid-state lighting, but their performance at high power is affected by the efficiency-droop problem. Previous experimental and theoretical work has identified Auger recombination, a three-particle nonradiative carrier recombination mechanism, as the likely cause of the droop. In this work, we use first-principles calculations to elucidate the dependence of the radiative and Auger recombination rates on temperature, carrier density and quantum-well confinement. Our calculated data for the temperature dependence of the recombination coefficients are in good agreement with experiment and provide further validation on the role of Auger recombination in the efficiency reduction. Polarization fields and phase-space filling negatively impact device efficiency because they increase the operating carrier density at a given current density and increase the fraction of carriers lost to Auger recombination. (paper)

  4. Multiple aspects of ATP-dependent nucleosome translocation by RSC and Mi-2 are directed by the underlying DNA sequence.

    Directory of Open Access Journals (Sweden)

    Joke J F A van Vugt

    Full Text Available BACKGROUND: Chromosome structure, DNA metabolic processes and cell type identity can all be affected by changing the positions of nucleosomes along chromosomal DNA, a reaction that is catalysed by SNF2-type ATP-driven chromatin remodelers. Recently it was suggested that in vivo, more than 50% of the nucleosome positions can be predicted simply by DNA sequence, especially within promoter regions. This seemingly contrasts with remodeler induced nucleosome mobility. The ability of remodeling enzymes to mobilise nucleosomes over short DNA distances is well documented. However, the nucleosome translocation processivity along DNA remains elusive. Furthermore, it is unknown what determines the initial direction of movement and how new nucleosome positions are adopted. METHODOLOGY/PRINCIPAL FINDINGS: We have used AFM imaging and high resolution PAGE of mononucleosomes on 600 and 2500 bp DNA molecules to analyze ATP-dependent nucleosome repositioning by native and recombinant SNF2-type enzymes. We report that the underlying DNA sequence can control the initial direction of translocation, translocation distance, as well as the new positions adopted by nucleosomes upon enzymatic mobilization. Within a strong nucleosomal positioning sequence both recombinant Drosophila Mi-2 (CHD-type and native RSC from yeast (SWI/SNF-type repositioned the nucleosome at 10 bp intervals, which are intrinsic to the positioning sequence. Furthermore, RSC-catalyzed nucleosome translocation was noticeably more efficient when beyond the influence of this sequence. Interestingly, under limiting ATP conditions RSC preferred to position the nucleosome with 20 bp intervals within the positioning sequence, suggesting that native RSC preferentially translocates nucleosomes with 15 to 25 bp DNA steps. CONCLUSIONS/SIGNIFICANCE: Nucleosome repositioning thus appears to be influenced by both remodeler intrinsic and DNA sequence specific properties that interplay to define ATPase

  5. Obtaining classical swine fever virus E2 recombinant protein and DNA-vaccine on the basis of one subunit

    International Nuclear Information System (INIS)

    Deryabin, O.; Deryabina, O.; Verbitskiy, P.; Kordyum, V.

    2005-01-01

    Three forms of E2 recombinant protein were expressed in E. coli. Swine sera obtained against different forms of the recombinant protein were cross-studied with indirect ELISA. Using individual proteins as an antigen, only 15% of sera against other forms of protein reacted positively, while 100% of heterologous sera showed positive reaction with fused protein. Challenge experiments showed the existence of protective action only from the individual protein. Specificity and activity of sera obtained from the animals after control challenge was confirmed in a blocking variant of ELISA. Genetic construction used a eukaryotic vector that contained the E2 protein gene. Immunization of mice with the resulting DNA induced synthesis of specific antibodies, the titre of which increased considerably after additional single immunization with the E2 recombinant protein, expressed in E. coli. This demonstrated the effectiveness of animal priming by DNA vaccine, and the possibility of using the E2 recombinant protein in E. coli for booster vaccination. (author)

  6. [Improvement of thermal adaptability and fermentation of industrial ethanologenic yeast by genomic DNA mutagenesis-based genetic recombination].

    Science.gov (United States)

    Liu, Xiuying; He, Xiuping; Lu, Ying; Zhang, Borun

    2011-07-01

    Ethanol is an attractive alternative to fossil fuels. Saccharomyces cerevisiae is the most important ethanol producer. However, in the process of industrial production of ethanol, both cell growth and fermentation of ethanologenic S. cerevisiae are dramatically affected by environmental stresses, such as thermal stress. In this study, we improved both the thermotolerance and fermentation performance of industrial ethanologenic S. cerevisiae by combined usage of chemical mutagenesis and genomic DNA mutagenesis-based genetic recombination method. The recombinant S. cerevisiae strain T44-2 could grow at 44 degrees C, 3 degrees C higher than that of the original strain CE6. The survival rate of T44-2 was 1.84 and 1.87-fold of that of CE6 when heat shock at 48 degrees C and 52 degrees C for 1 h respectively. At temperature higher than 37 degrees C, recombinant strain T44-2 always gave higher cell growth and ethanol production than those of strain CE6. Meanwhile, from 30 degrees C to 40 degrees C, recombinant strain T44-2 produces 91.2-83.8 g/L of ethanol from 200 g/L of glucose, which indicated that the recombinant strain T44-2 had both thermotolerance and broad thermal adaptability. The work offers a novel method, called genomic DNA mutagenesis-based genetic recombination, to improve the physiological functions of S. cerevisiae.

  7. Evaluation of the effectiveness and safety of the thermo-treatment process to dispose of recombinant DNA waste from biological research laboratories.

    Science.gov (United States)

    Li, Meng-Nan; Zheng, Guang-Hong; Wang, Lei; Xiao, Wei; Fu, Xiao-Hua; Le, Yi-Quan; Ren, Da-Ming

    2009-01-01

    The discharge of recombinant DNA waste from biological laboratories into the eco-system may be one of the pathways resulting in horizontal gene transfer or "gene pollution". Heating at 100 degrees C for 5-10 min is a common method for treating recombinant DNA waste in biological research laboratories in China. In this study, we evaluated the effectiveness and the safety of the thermo-treatment method in the disposal of recombinant DNA waste. Quantitative PCR, plasmid transformation and electrophoresis technology were used to evaluate the decay/denaturation efficiency during the thermo-treatment process of recombinant plasmid, pET-28b. Results showed that prolonging thermo-treatment time could improve decay efficiency of the plasmid, and its decay half-life was 2.7-4.0 min during the thermo-treatment at 100 degrees C. However, after 30 min of thermo-treatment some transforming activity remained. Higher ionic strength could protect recombinant plasmid from decay during the treatment process. These results indicate that thermo-treatment at 100 degrees C cannot decay and inactivate pET-28b completely. In addition, preliminary results showed that thermo-treated recombinant plasmids were not degraded completely in a short period when they were discharged into an aquatic environment. This implies that when thermo-treated recombinant DNAs are discharged into the eco-system, they may have enough time to re-nature and transform, thus resulting in gene diffusion.

  8. Evaluation of the effectiveness and safety of the thermo-treatment process to dispose of recombinant DNA waste from biological research laboratories

    International Nuclear Information System (INIS)

    Li Mengnan; Zheng Guanghong; Wang Lei; Xiao Wei; Fu Xiaohua; Le Yiquan; Ren Daming

    2009-01-01

    The discharge of recombinant DNA waste from biological laboratories into the eco-system may be one of the pathways resulting in horizontal gene transfer or 'gene pollution'. Heating at 100 deg. C for 5-10 min is a common method for treating recombinant DNA waste in biological research laboratories in China. In this study, we evaluated the effectiveness and the safety of the thermo-treatment method in the disposal of recombinant DNA waste. Quantitative PCR, plasmid transformation and electrophoresis technology were used to evaluate the decay/denaturation efficiency during the thermo-treatment process of recombinant plasmid, pET-28b. Results showed that prolonging thermo-treatment time could improve decay efficiency of the plasmid, and its decay half-life was 2.7-4.0 min during the thermo-treatment at 100 deg. C. However, after 30 min of thermo-treatment some transforming activity remained. Higher ionic strength could protect recombinant plasmid from decay during the treatment process. These results indicate that thermo-treatment at 100 deg. C cannot decay and inactivate pET-28b completely. In addition, preliminary results showed that thermo-treated recombinant plasmids were not degraded completely in a short period when they were discharged into an aquatic environment. This implies that when thermo-treated recombinant DNAs are discharged into the eco-system, they may have enough time to re-nature and transform, thus resulting in gene diffusion

  9. Purification, crystallization and preliminary crystallographic analysis of a multiple cofactor-dependent DNA ligase from Sulfophobococcus zilligii

    International Nuclear Information System (INIS)

    Supangat, Supangat; An, Young Jun; Sun, Younguk; Kwon, Suk-Tae; Cha, Sun-Shin

    2010-01-01

    A recombinant multiple cofactor-dependent DNA ligase from S. zilligii has been purified and crystallized. X-ray diffraction data were collected to 2.9 Å resolution and the crystals belonged to space group P1. A recombinant DNA ligase from Sulfophobococcus zilligii that shows multiple cofactor specificity (ATP, ADP and GTP) was expressed in Escherichia coli and purified under reducing conditions. Crystals were obtained by the microbatch crystallization method at 295 K in a drop containing 1 µl protein solution (10 mg ml −1 ) and an equal volume of mother liquor [0.1 M HEPES pH 7.5, 10%(w/v) polyethylene glycol 10 000]. A data set was collected to 2.9 Å resolution using synchrotron radiation. The crystals belonged to space group P1, with unit-cell parameters a = 63.7, b = 77.1, c = 77.8 Å, α = 83.4, β = 82.4, γ = 74.6°. Assuming the presence of two molecules in the unit cell, the solvent content was estimated to be about 53.4%

  10. Mechanisms and Regulation of Mitotic Recombination in Saccharomyces cerevisiae

    Science.gov (United States)

    Symington, Lorraine S.; Rothstein, Rodney; Lisby, Michael

    2014-01-01

    Homology-dependent exchange of genetic information between DNA molecules has a profound impact on the maintenance of genome integrity by facilitating error-free DNA repair, replication, and chromosome segregation during cell division as well as programmed cell developmental events. This chapter will focus on homologous mitotic recombination in budding yeast Saccharomyces cerevisiae. However, there is an important link between mitotic and meiotic recombination (covered in the forthcoming chapter by Hunter et al. 2015) and many of the functions are evolutionarily conserved. Here we will discuss several models that have been proposed to explain the mechanism of mitotic recombination, the genes and proteins involved in various pathways, the genetic and physical assays used to discover and study these genes, and the roles of many of these proteins inside the cell. PMID:25381364

  11. Mapping DNA damage-dependent genetic interactions in yeast via party mating and barcode fusion genetics.

    Science.gov (United States)

    Díaz-Mejía, J Javier; Celaj, Albi; Mellor, Joseph C; Coté, Atina; Balint, Attila; Ho, Brandon; Bansal, Pritpal; Shaeri, Fatemeh; Gebbia, Marinella; Weile, Jochen; Verby, Marta; Karkhanina, Anna; Zhang, YiFan; Wong, Cassandra; Rich, Justin; Prendergast, D'Arcy; Gupta, Gaurav; Öztürk, Sedide; Durocher, Daniel; Brown, Grant W; Roth, Frederick P

    2018-05-28

    Condition-dependent genetic interactions can reveal functional relationships between genes that are not evident under standard culture conditions. State-of-the-art yeast genetic interaction mapping, which relies on robotic manipulation of arrays of double-mutant strains, does not scale readily to multi-condition studies. Here, we describe barcode fusion genetics to map genetic interactions (BFG-GI), by which double-mutant strains generated via en masse "party" mating can also be monitored en masse for growth to detect genetic interactions. By using site-specific recombination to fuse two DNA barcodes, each representing a specific gene deletion, BFG-GI enables multiplexed quantitative tracking of double mutants via next-generation sequencing. We applied BFG-GI to a matrix of DNA repair genes under nine different conditions, including methyl methanesulfonate (MMS), 4-nitroquinoline 1-oxide (4NQO), bleomycin, zeocin, and three other DNA-damaging environments. BFG-GI recapitulated known genetic interactions and yielded new condition-dependent genetic interactions. We validated and further explored a subnetwork of condition-dependent genetic interactions involving MAG1 , SLX4, and genes encoding the Shu complex, and inferred that loss of the Shu complex leads to an increase in the activation of the checkpoint protein kinase Rad53. © 2018 The Authors. Published under the terms of the CC BY 4.0 license.

  12. Unveiling novel RecO distant orthologues involved in homologous recombination.

    Directory of Open Access Journals (Sweden)

    Stéphanie Marsin

    2008-08-01

    Full Text Available The generation of a RecA filament on single-stranded DNA is a critical step in homologous recombination. Two main pathways leading to the formation of the nucleofilament have been identified in bacteria, based on the protein complexes mediating RecA loading: RecBCD (AddAB and RecFOR. Many bacterial species seem to lack some of the components involved in these complexes. The current annotation of the Helicobacter pylori genome suggests that this highly diverse bacterial pathogen has a reduced set of recombination mediator proteins. While it is now clear that homologous recombination plays a critical role in generating H. pylori diversity by allowing genomic DNA rearrangements and integration through transformation of exogenous DNA into the chromosome, no complete mediator complex is deduced from the sequence of its genome. Here we show by bioinformatics analysis the presence of a RecO remote orthologue that allowed the identification of a new set of RecO proteins present in all bacterial species where a RecR but not RecO was previously identified. HpRecO shares less than 15% identity with previously characterized homologues. Genetic dissection of recombination pathways shows that this novel RecO and the remote RecB homologue present in H. pylori are functional in repair and in RecA-dependent intrachromosomal recombination, defining two initiation pathways with little overlap. We found, however, that neither RecOR nor RecB contributes to transformation, suggesting the presence of a third, specialized, RecA-dependent pathway responsible for the integration of transforming DNA into the chromosome of this naturally competent bacteria. These results provide insight into the mechanisms that this successful pathogen uses to generate genetic diversity and adapt to changing environments and new hosts.

  13. Effects of nuclear mutations for recombination and repair functions and of caffeine on mitochondrial recombination

    International Nuclear Information System (INIS)

    Fraenkel, A.H.M.

    1974-01-01

    Studies of both prokaryotic and eukaryotic organisms indicate that pathways governing repair of damage to nuclear DNA caused by x-ray or ultraviolet irradiation overlap with those controlling recombination. Fourteen nuclear mutants of Saccharomyces cerevisiae were tested in order to determine whether these mutant genes affected mitochondrial recombination. None of the mutations studied significantly affected mitochondrial recombination. The nuclear recombination and repair pathways studied do not overlap with the nuclear pathway which controls recombination of mitochondrial DNA. A second set of experiments was designed to test the effect of caffeine on both nuclear and mitochondrial recombination in Saccharomyces cerevisiae. (U.S.)

  14. Spin dependent surface recombination in silicon p-n junctions: the effect of irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Kaplan, D [Laboratoire Central de Recherches, 91 - Corbeville par Orsay (France); Pepper, M [Cambridge Univ. (UK). Cavendish Lab.

    1980-06-01

    The results are presented of an investigation of spin dependent recombination in (100) oriented, gate controlled Si diodes irradiated by 30 keV electrons. After irradiation, recombination at the Si-SiO/sub 2/ interface is increased, and saturation of the spin resonance increases the diode forward current by 5 parts in 10/sup 4/. The results cannot be described by a conventional Shockley-Read recombination model. An alternative picture is proposed involving recombination between trapped electrons and trapped holes.

  15. Hybridization-based antibody cDNA recovery for the production of recombinant antibodies identified by repertoire sequencing.

    Science.gov (United States)

    Valdés-Alemán, Javier; Téllez-Sosa, Juan; Ovilla-Muñoz, Marbella; Godoy-Lozano, Elizabeth; Velázquez-Ramírez, Daniel; Valdovinos-Torres, Humberto; Gómez-Barreto, Rosa E; Martinez-Barnetche, Jesús

    2014-01-01

    High-throughput sequencing of the antibody repertoire is enabling a thorough analysis of B cell diversity and clonal selection, which may improve the novel antibody discovery process. Theoretically, an adequate bioinformatic analysis could allow identification of candidate antigen-specific antibodies, requiring their recombinant production for experimental validation of their specificity. Gene synthesis is commonly used for the generation of recombinant antibodies identified in silico. Novel strategies that bypass gene synthesis could offer more accessible antibody identification and validation alternatives. We developed a hybridization-based recovery strategy that targets the complementarity-determining region 3 (CDRH3) for the enrichment of cDNA of candidate antigen-specific antibody sequences. Ten clonal groups of interest were identified through bioinformatic analysis of the heavy chain antibody repertoire of mice immunized with hen egg white lysozyme (HEL). cDNA from eight of the targeted clonal groups was recovered efficiently, leading to the generation of recombinant antibodies. One representative heavy chain sequence from each clonal group recovered was paired with previously reported anti-HEL light chains to generate full antibodies, later tested for HEL-binding capacity. The recovery process proposed represents a simple and scalable molecular strategy that could enhance antibody identification and specificity assessment, enabling a more cost-efficient generation of recombinant antibodies.

  16. The ATM signaling cascade promotes recombination-dependent pachytene arrest in mouse spermatocytes.

    Directory of Open Access Journals (Sweden)

    Sarai Pacheco

    2015-03-01

    Full Text Available Most mutations that compromise meiotic recombination or synapsis in mouse spermatocytes result in arrest and apoptosis at the pachytene stage of the first meiotic prophase. Two main mechanisms are thought to trigger arrest: one independent of the double-strand breaks (DSBs that initiate meiotic recombination, and another activated by persistent recombination intermediates. Mechanisms underlying the recombination-dependent arrest response are not well understood, so we sought to identify factors involved by examining mutants deficient for TRIP13, a conserved AAA+ ATPase required for the completion of meiotic DSB repair. We find that spermatocytes with a hypomorphic Trip13 mutation (Trip13mod/mod arrest with features characteristic of early pachynema in wild type, namely, fully synapsed chromosomes without incorporation of the histone variant H1t into chromatin. These cells then undergo apoptosis, possibly in response to the arrest or in response to a defect in sex body formation. However, TRIP13-deficient cells that additionally lack the DSB-responsive kinase ATM progress further, reaching an H1t-positive stage (i.e., similar to mid/late pachynema in wild type despite the presence of unrepaired DSBs. TRIP13-deficient spermatocytes also progress to an H1t-positive stage if ATM activity is attenuated by hypomorphic mutations in Mre11 or Nbs1 or by elimination of the ATM-effector kinase CHK2. These mutant backgrounds nonetheless experience an apoptotic block to further spermatogenic progression, most likely caused by failure to form a sex body. DSB numbers are elevated in Mre11 and Nbs1 hypomorphs but not Chk2 mutants, thus delineating genetic requirements for the ATM-dependent negative feedback loop that regulates DSB numbers. The findings demonstrate for the first time that ATM-dependent signaling enforces the normal pachytene response to persistent recombination intermediates. Our work supports the conclusion that recombination defects trigger

  17. Diversification of DnaA dependency for DNA replication in cyanobacterial evolution.

    Science.gov (United States)

    Ohbayashi, Ryudo; Watanabe, Satoru; Ehira, Shigeki; Kanesaki, Yu; Chibazakura, Taku; Yoshikawa, Hirofumi

    2016-05-01

    Regulating DNA replication is essential for all living cells. The DNA replication initiation factor DnaA is highly conserved in prokaryotes and is required for accurate initiation of chromosomal replication at oriC. DnaA-independent free-living bacteria have not been identified. The dnaA gene is absent in plastids and some symbiotic bacteria, although it is not known when or how DnaA-independent mechanisms were acquired. Here, we show that the degree of dependency of DNA replication on DnaA varies among cyanobacterial species. Deletion of the dnaA gene in Synechococcus elongatus PCC 7942 shifted DNA replication from oriC to a different site as a result of the integration of an episomal plasmid. Moreover, viability during the stationary phase was higher in dnaA disruptants than in wild-type cells. Deletion of dnaA did not affect DNA replication or cell growth in Synechocystis sp. PCC 6803 or Anabaena sp. PCC 7120, indicating that functional dependency on DnaA was already lost in some nonsymbiotic cyanobacterial lineages during diversification. Therefore, we proposed that cyanobacteria acquired DnaA-independent replication mechanisms before symbiosis and such an ancestral cyanobacterium was the sole primary endosymbiont to form a plastid precursor.

  18. Bacterial Artificial Chromosome Mutagenesis Using Recombineering

    Directory of Open Access Journals (Sweden)

    Kumaran Narayanan

    2011-01-01

    Full Text Available Gene expression from bacterial artificial chromosome (BAC clones has been demonstrated to facilitate physiologically relevant levels compared to viral and nonviral cDNA vectors. BACs are large enough to transfer intact genes in their native chromosomal setting together with flanking regulatory elements to provide all the signals for correct spatiotemporal gene expression. Until recently, the use of BACs for functional studies has been limited because their large size has inherently presented a major obstacle for introducing modifications using conventional genetic engineering strategies. The development of in vivo homologous recombination strategies based on recombineering in E. coli has helped resolve this problem by enabling facile engineering of high molecular weight BAC DNA without dependence on suitably placed restriction enzymes or cloning steps. These techniques have considerably expanded the possibilities for studying functional genetics using BACs in vitro and in vivo.

  19. DNA damage tolerance pathway involving DNA polymerase ι and the tumor suppressor p53 regulates DNA replication fork progression.

    Science.gov (United States)

    Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa

    2016-07-26

    DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress.

  20. Mycobacterium smegmatis SftH exemplifies a distinctive clade of superfamily II DNA-dependent ATPases with 3' to 5' translocase and helicase activities.

    Science.gov (United States)

    Yakovleva, Lyudmila; Shuman, Stewart

    2012-08-01

    Bacterial DNA helicases are nucleic acid-dependent NTPases that play important roles in DNA replication, recombination and repair. We are interested in the DNA helicases of Mycobacteria, a genus of the phylum Actinobacteria, which includes the human pathogen Mycobacterium tuberculosis and its avirulent relative Mycobacterium smegmatis. Here, we identify and characterize M. smegmatis SftH, a superfamily II helicase with a distinctive domain structure, comprising an N-terminal NTPase domain and a C-terminal DUF1998 domain (containing a putative tetracysteine metal-binding motif). We show that SftH is a monomeric DNA-dependent ATPase/dATPase that translocates 3' to 5' on single-stranded DNA and has 3' to 5' helicase activity. SftH homologs are found in bacteria representing 12 different phyla, being especially prevalent in Actinobacteria (including M. tuberculosis). SftH homologs are evident in more than 30 genera of Archaea. Among eukarya, SftH homologs are present in plants and fungi.

  1. Quantitative real-time PCR technique for the identification of E. coli residual DNA in streptokinase recombinant product.

    Science.gov (United States)

    Fazelahi, Mansoureh; Kia, Vahid; Kaghazian, Hooman; Paryan, Mahdi

    2017-11-26

    Recombinant streptokinase is a biopharmaceutical which is usually produced in E. coli. Residual DNA as a contamination and risk factor may remain in the product. It is necessary to control the production procedure to exclude any possible contamination. The aim of the present study was to develop a highly specific and sensitive quantitative real-time PCR-based method to determine the amount of E. coli DNA in recombinant streptokinase. A specific primers and a probe was designed to detect all strains of E. coli. To determine the specificity, in addition to using NCBI BLASTn, 28 samples including human, bacterial, and viral genomes were used. The results confirmed that the assay detects no genomic DNA but E. coli's and the specificity was determined to be 100%. To determine the sensitivity and limit of detection of the assay, a 10-fold serial dilution (10 1 to 10 7 copies/µL) was tested in triplicate. The sensitivity of the test was determined to be 101 copies/µL or 35 fg/µL. Inter-assay and intra-assay were determined to be 0.86 and 1.69%, respectively. Based on the results, this assay can be used as an accurate method to evaluate the contamination of recombinant streptokinase in E. coli.

  2. The role of DNA dependent protein kinase in synapsis of DNA ends

    NARCIS (Netherlands)

    E.P.W.C. Weterings (Eric); N.S. Verkaik (Nicole); H.T. Brüggenwirth (Hennie); D.C. van Gent (Dik); J.H.J. Hoeijmakers (Jan)

    2003-01-01

    textabstractDNA dependent protein kinase (DNA-PK) plays a central role in the non-homologous end-joining pathway of DNA double strand break repair. Its catalytic subunit (DNA-PK(CS)) functions as a serine/threonine protein kinase. We show that DNA-PK forms a stable complex at DNA termini that blocks

  3. Oligonucleotide recombination enabled site-specific mutagenesis in bacteria

    Science.gov (United States)

    Recombineering refers to a strategy for engineering DNA sequences using a specialized mode of homologous recombination. This technology can be used for rapidly constructing precise changes in bacterial genome sequences in vivo. Oligo recombination is one type of recombineering that uses ssDNA olig...

  4. DNA damage, homology-directed repair, and DNA methylation.

    Directory of Open Access Journals (Sweden)

    Concetta Cuozzo

    2007-07-01

    Full Text Available To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP genes (DR-GFP. A total of 2%-4% of the cells generated a functional GFP by homology-directed repair (HR and gene conversion. However, approximately 50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2'-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments.

  5. Cell biology of mitotic recombination

    DEFF Research Database (Denmark)

    Lisby, Michael; Rothstein, Rodney

    2015-01-01

    Homologous recombination provides high-fidelity DNA repair throughout all domains of life. Live cell fluorescence microscopy offers the opportunity to image individual recombination events in real time providing insight into the in vivo biochemistry of the involved proteins and DNA molecules as w...

  6. Construction of C35 gene bait recombinants and T47D cell cDNA library.

    Science.gov (United States)

    Yin, Kun; Xu, Chao; Zhao, Gui-Hua; Liu, Ye; Xiao, Ting; Zhu, Song; Yan, Ge

    2017-11-20

    C35 is a novel tumor biomarker associated with metastasis progression. To investigate the interaction factors of C35 in its high expressed breast cancer cell lines, we constructed bait recombinant plasmids of C35 gene and T47D cell cDNA library for yeast two-hybrid screening. Full length C35 sequences were subcloned using RT-PCR from cDNA template extracted from T47D cells. Based on functional domain analysis, the full-length C35 1-348bp was also truncated into two fragments C351-153bp and C35154-348bp to avoid auto-activation. The three kinds of C35 genes were successfully amplified and inserted into pGBKT7 to construct bait recombinant plasmids pGBKT7-C351-348bp, pGBKT7-C351-153bp and pGBKT7-C35154-348bp, then transformed into Y187 yeast cells by the lithium acetate method. Auto-activation and toxicity of C35 baits were detected using nutritional deficient medium and X-α-Gal assays. The T47D cell ds cDNA was generated by SMART TM technology and the library was constructed using in vivo recombination-mediated cloning in the AH109 yeast strain using a pGADT7-Rec plasmid. The transformed Y187/pGBKT7-C351-348bp line was intensively inhibited while the truncated Y187/pGBKT7-C35 lines had no auto-activation and toxicity in yeast cells. The titer of established cDNA library was 2 × 10 7 pfu/mL with high transformation efficiency of 1.4 × 10 6 , and the insert size of ds cDNA was distributed homogeneously between 0.5-2.0 kb. Our research generated a T47D cell cDNA library with high titer, and the constructed two C35 "baits" contained a respective functional immunoreceptor tyrosine based activation motif (ITAM) and the conserved last four amino acids Cys-Ile-Leu-Val (CILV) motif, and therefore laid a foundation for screening the C35 interaction factors in a BC cell line.

  7. Recombinant pinoresinol/lariciresinol reductase, recombinant dirigent protein, and methods of use

    Science.gov (United States)

    Lewis, Norman G.; Davin, Laurence B.; Dinkova-Kostova, Albena T.; Fujita, Masayuki; Gang, David R.; Sarkanen, Simo; Ford, Joshua D.

    2001-04-03

    Dirigent proteins and pinoresinol/lariciresinol reductases have been isolated, together with cDNAs encoding dirigent proteins and pinoresinol/lariciresinol reductases. Accordingly, isolated DNA sequences are provided which code for the expression of dirigent proteins and pinoresinol/lariciresinol reductases. In other aspects, replicable recombinant cloning vehicles are provided which code for dirigent proteins or pinoresinol/lariciresinol reductases or for a base sequence sufficiently complementary to at least a portion of dirigent protein or pinoresinol/lariciresinol reductase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding dirigent protein or pinoresinol/lariciresinol reductase. Thus, systems and methods are provided for the recombinant expression of dirigent proteins and/or pinoresinol/lariciresinol reductases.

  8. Mutagenic Organized Recombination Process by Homologous IN vivo Grouping (MORPHING) for directed enzyme evolution.

    Science.gov (United States)

    Gonzalez-Perez, David; Molina-Espeja, Patricia; Garcia-Ruiz, Eva; Alcalde, Miguel

    2014-01-01

    Approaches that depend on directed evolution require reliable methods to generate DNA diversity so that mutant libraries can focus on specific target regions. We took advantage of the high frequency of homologous DNA recombination in Saccharomyces cerevisiae to develop a strategy for domain mutagenesis aimed at introducing and in vivo recombining random mutations in defined segments of DNA. Mutagenic Organized Recombination Process by Homologous IN vivo Grouping (MORPHING) is a one-pot random mutagenic method for short protein regions that harnesses the in vivo recombination apparatus of yeast. Using this approach, libraries can be prepared with different mutational loads in DNA segments of less than 30 amino acids so that they can be assembled into the remaining unaltered DNA regions in vivo with high fidelity. As a proof of concept, we present two eukaryotic-ligninolytic enzyme case studies: i) the enhancement of the oxidative stability of a H2O2-sensitive versatile peroxidase by independent evolution of three distinct protein segments (Leu28-Gly57, Leu149-Ala174 and Ile199-Leu268); and ii) the heterologous functional expression of an unspecific peroxygenase by exclusive evolution of its native 43-residue signal sequence.

  9. Induction of intrachromosomal homologous recombination in whole plants

    International Nuclear Information System (INIS)

    Puchta, H.; Swoboda, P.; Hohn, B.

    1995-01-01

    The influence of different factors on frequencies of intrachromosomal homologous recombination in whole Arabidopsis thaliana and tobacco plants was analyzed using a disrupted β-glucuronidase marker gene. Recombination frequencies were enhanced several fold by DNA damaging agents like UV-light or MMS (methyl methanesulfonate). Applying 3-methoxybenzamide (3-MB), an inhibitor of poly(ADP)ribose polymerase (PARP), an enzyme that is postulated to be involved in DNA repair, enhanced homologous recombination frequencies strongly. These findings indicate that homologous recombination is involved in DNA repair and can (at least partially) compensate for other DNA repair pathways. Indications that recombination in plants can be induced by environmental stress factors that are not likely to be involved in DNA metabolism were also found; Arabidopsis plants growing in a medium containing 0.1 M NaCl exhibited elevated recombination frequencies. The possible general effects of ‘environmental’ challenges on genome flexibility are discussed. (author)

  10. Immunoglobulin class-switch recombination deficiencies.

    Science.gov (United States)

    Durandy, Anne; Kracker, Sven

    2012-07-30

    Immunoglobulin class-switch recombination deficiencies (Ig-CSR-Ds) are rare primary immunodeficiencies characterized by defective switched isotype (IgG/IgA/IgE) production. Depending on the molecular defect in question, the Ig-CSR-D may be combined with an impairment in somatic hypermutation (SHM). Some of the mechanisms underlying Ig-CSR and SHM have been described by studying natural mutants in humans. This approach has revealed that T cell-B cell interaction (resulting in CD40-mediated signaling), intrinsic B-cell mechanisms (activation-induced cytidine deaminase-induced DNA damage), and complex DNA repair machineries (including uracil-N-glycosylase and mismatch repair pathways) are all involved in class-switch recombination and SHM. However, several of the mechanisms required for full antibody maturation have yet to be defined. Elucidation of the molecular defects underlying the diverse set of Ig-CSR-Ds is essential for understanding Ig diversification and has prompted better definition of the clinical spectrum of diseases and the development of increasingly accurate diagnostic and therapeutic approaches.

  11. A Novel Recombinant DNA System for High Efficiency Affinity Purification of Proteins in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Brian H. Carrick

    2016-03-01

    Full Text Available Isolation of endogenous proteins from Saccharomyces cerevisiae has been facilitated by inserting encoding polypeptide affinity tags at the C-termini of chromosomal open reading frames (ORFs using homologous recombination of DNA fragments. Tagged protein isolation is limited by a number of factors, including high cost of affinity resins for bulk isolation and low concentration of ligands on the resin surface, leading to low isolation efficiencies and trapping of contaminants. To address this, we have created a recombinant “CelTag” DNA construct from which PCR fragments can be created to easily tag C-termini of S. cerevisiae ORFs using selection for a nat1 marker. The tag has a C-terminal cellulose binding module to be used in the first affinity step. Microgranular cellulose is very inexpensive and has an effectively continuous ligand on its surface, allowing rapid, highly efficient purification with minimal background. Cellulose-bound proteins are released by specific cleavage of an included site for TEV protease, giving nearly pure product. The tag can be lifted from the recombinant DNA construct either with or without a 13x myc epitope tag between the target ORF and the TEV protease site. Binding of CelTag protein fusions to cellulose is stable to high salt, nonionic detergents, and 1 M urea, allowing stringent washing conditions to remove loosely associated components, as needed, before specific elution. It is anticipated that this reagent could allow isolation of protein complexes from large quantities of yeast extract, including soluble, membrane-bound, or nucleic acid-associated assemblies.

  12. IDN2 Interacts with RPA and Facilitates DNA Double-Strand Break Repair by Homologous Recombination in Arabidopsis.

    Science.gov (United States)

    Liu, Mingming; Ba, Zhaoqing; Costa-Nunes, Pedro; Wei, Wei; Li, Lanxia; Kong, Fansi; Li, Yan; Chai, Jijie; Pontes, Olga; Qi, Yijun

    2017-03-01

    Repair of DNA double-strand breaks (DSBs) is critical for the maintenance of genome integrity. We previously showed that DSB-induced small RNAs (diRNAs) facilitate homologous recombination-mediated DSB repair in Arabidopsis thaliana Here, we show that INVOLVED IN DE NOVO2 (IDN2), a double-stranded RNA binding protein involved in small RNA-directed DNA methylation, is required for DSB repair in Arabidopsis. We find that IDN2 interacts with the heterotrimeric replication protein A (RPA) complex. Depletion of IDN2 or the diRNA binding ARGONAUTE2 leads to increased accumulation of RPA at DSB sites and mislocalization of the recombination factor RAD51. These findings support a model in which IDN2 interacts with RPA and facilitates the release of RPA from single-stranded DNA tails and subsequent recruitment of RAD51 at DSB sites to promote DSB repair. © 2017 American Society of Plant Biologists. All rights reserved.

  13. Dependence of the quasiparticle recombination rate on the superconducting gap and TC

    Science.gov (United States)

    Carr, G. L.; Xi, Xiaoxiang; Hwang, J.; Tashiro, H.; Reitze, D. H.; Tanner, D. B.

    2010-03-01

    The relaxation of excess quasiparticles in a BCS superconductor is known to depend on quantities such as the quasiparticle & phonon density of states, and their coupling (Kaplan et al, Phys. Rev. B 14 4854, 1976). Disorder or an applied field can disrupt superconductivity, as evidenced by a reduced TC. We consider some simple modifications to the quasiparticle density of states consistent with a suppressed energy gap and TC, leading to changes in the intrinsic and effective (measured) rates for excess quasiparticles to recombine into pairs. We review some results for disordered MoGe and discuss the magnetic-field dependence of the recombination process.

  14. DNA homologous recombination factor SFR1 physically and functionally interacts with estrogen receptor alpha.

    Directory of Open Access Journals (Sweden)

    Yuxin Feng

    Full Text Available Estrogen receptor alpha (ERα, a ligand-dependent transcription factor, mediates the expression of its target genes by interacting with corepressors and coactivators. Since the first cloning of SRC1, more than 280 nuclear receptor cofactors have been identified, which orchestrate target gene transcription. Aberrant activity of ER or its accessory proteins results in a number of diseases including breast cancer. Here we identified SFR1, a protein involved in DNA homologous recombination, as a novel binding partner of ERα. Initially isolated in a yeast two-hybrid screen, the interaction of SFR1 and ERα was confirmed in vivo by immunoprecipitation and mammalian one-hybrid assays. SFR1 co-localized with ERα in the nucleus, potentiated ER's ligand-dependent and ligand-independent transcriptional activity, and occupied the ER binding sites of its target gene promoters. Knockdown of SFR1 diminished ER's transcriptional activity. Manipulating SFR1 expression by knockdown and overexpression revealed a role for SFR1 in ER-dependent and -independent cancer cell proliferation. SFR1 differs from SRC1 by the lack of an intrinsic activation function. Taken together, we propose that SFR1 is a novel transcriptional modulator for ERα and a potential target in breast cancer therapy.

  15. Replicative age induces mitotic recombination in the ribosomal RNA gene cluster of Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Derek L Lindstrom

    2011-03-01

    Full Text Available Somatic mutations contribute to the development of age-associated disease. In earlier work, we found that, at high frequency, aging Saccharomyces cerevisiae diploid cells produce daughters without mitochondrial DNA, leading to loss of respiration competence and increased loss of heterozygosity (LOH in the nuclear genome. Here we used the recently developed Mother Enrichment Program to ask whether aging cells that maintain the ability to produce respiration-competent daughters also experience increased genomic instability. We discovered that this population exhibits a distinct genomic instability phenotype that primarily affects the repeated ribosomal RNA gene array (rDNA array. As diploid cells passed their median replicative life span, recombination rates between rDNA arrays on homologous chromosomes progressively increased, resulting in mutational events that generated LOH at >300 contiguous open reading frames on the right arm of chromosome XII. We show that, while these recombination events were dependent on the replication fork block protein Fob1, the aging process that underlies this phenotype is Fob1-independent. Furthermore, we provide evidence that this aging process is not driven by mechanisms that modulate rDNA recombination in young cells, including loss of cohesion within the rDNA array or loss of Sir2 function. Instead, we suggest that the age-associated increase in rDNA recombination is a response to increasing DNA replication stress generated in aging cells.

  16. A simple DNA recombination screening method by RT-PCR as an alternative to Southern blot

    DEFF Research Database (Denmark)

    Albers, Eliene; Sbroggiò, Mauro; Martin Gonzalez, Javier

    2017-01-01

    The generation of genetically engineered mouse models (GEMMs), including knock-out (KO) and knock-in (KI) models, often requires genomic screening of many mouse ES cell (mESC) clones by Southern blot. The use of large targeting constructs facilitates the recombination of exogenous DNA in a specific...

  17. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H

    2012-02-22

    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  18. Roles of Bacillus subtilis DprA and SsbA in RecA-mediated genetic recombination.

    Science.gov (United States)

    Yadav, Tribhuwan; Carrasco, Begoña; Serrano, Ester; Alonso, Juan C

    2014-10-03

    Bacillus subtilis competence-induced RecA, SsbA, SsbB, and DprA are required to internalize and to recombine single-stranded (ss) DNA with homologous resident duplex. RecA, in the ATP · Mg(2+)-bound form (RecA · ATP), can nucleate and form filament onto ssDNA but is inactive to catalyze DNA recombination. We report that SsbA or SsbB bound to ssDNA blocks the RecA filament formation and fails to activate recombination. DprA facilitates RecA filamentation; however, the filaments cannot engage in DNA recombination. When ssDNA was preincubated with SsbA, but not SsbB, DprA was able to activate DNA strand exchange dependent on RecA · ATP. This work demonstrates that RecA · ATP, in concert with SsbA and DprA, catalyzes DNA strand exchange, and SsbB is an accessory factor in the reaction. In contrast, RecA · dATP efficiently catalyzes strand exchange even in the absence of single-stranded binding proteins or DprA, and addition of the accessory factors marginally improved it. We proposed that the RecA-bound nucleotide (ATP and to a lesser extent dATP) might dictate the requirement for accessory factors. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Dual recombinant Lactococcus lactis for enhanced delivery of DNA vaccine reporter plasmid pPERDBY.

    Science.gov (United States)

    Yagnik, Bhrugu; Sharma, Drashya; Padh, Harish; Desai, Priti

    2017-04-01

    Food grade Lactococcus lactis has been widely used as an antigen and DNA delivery vehicle. We have previously reported the use of non-invasive L. lactis to deliver the newly constructed immunostimulatory DNA vaccine reporter plasmid, pPERDBY. In the present report, construction of dual recombinant L. lactis expressing internalin A of Listeria monocytogenes and harboring pPERDBY (LL InlA + pPERDBY) to enhance the efficiency of delivery of DNA by L. lactis is outlined. After confirmation and validation of LL InlA + pPERDBY, its DNA delivery potential was compared with previously developed non-invasive r- L. lactis::pPERDBY. The use of invasive L. lactis resulted in around threefold increases in the number of enhanced green fluorescent protein-expressing Caco-2 cells. These findings reinforce the prospective application of invasive strain of L. lactis for delivery of DNA/RNA and antigens. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

  20. The use of recombinant DNA techniques to study radiation-induced damage, repair and genetic change in mammalian cells

    International Nuclear Information System (INIS)

    Thacker, J.

    1986-01-01

    A brief introduction is given to appropriate elements of recombinant DNA techniques and applications to problems in radiobiology are reviewed with illustrative detail. Examples are included of studies with both 254 nm ultraviolet light and ionizing radiation and the review progresses from the molecular analysis of DNA damage in vitro through to the nature of consequent cellular responses. The review is dealt with under the following headings: Molecular distribution of DNA damage, The use of DNA-mediated gene transfer to assess damage and repair, The DNA double strand break: use of restriction endonucleases to model radiation damage, Identification and cloning of DNA repair genes, Analysis of radiation-induced genetic change. (UK)

  1. RTEL1 maintains genomic stability by suppressing homologous recombination.

    Science.gov (United States)

    Barber, Louise J; Youds, Jillian L; Ward, Jordan D; McIlwraith, Michael J; O'Neil, Nigel J; Petalcorin, Mark I R; Martin, Julie S; Collis, Spencer J; Cantor, Sharon B; Auclair, Melissa; Tissenbaum, Heidi; West, Stephen C; Rose, Ann M; Boulton, Simon J

    2008-10-17

    Homologous recombination (HR) is an important conserved process for DNA repair and ensures maintenance of genome integrity. Inappropriate HR causes gross chromosomal rearrangements and tumorigenesis in mammals. In yeast, the Srs2 helicase eliminates inappropriate recombination events, but the functional equivalent of Srs2 in higher eukaryotes has been elusive. Here, we identify C. elegans RTEL-1 as a functional analog of Srs2 and describe its vertebrate counterpart, RTEL1, which is required for genome stability and tumor avoidance. We find that rtel-1 mutant worms and RTEL1-depleted human cells share characteristic phenotypes with yeast srs2 mutants: lethality upon deletion of the sgs1/BLM homolog, hyperrecombination, and DNA damage sensitivity. In vitro, purified human RTEL1 antagonizes HR by promoting the disassembly of D loop recombination intermediates in a reaction dependent upon ATP hydrolysis. We propose that loss of HR control after deregulation of RTEL1 may be a critical event that drives genome instability and cancer.

  2. Temperature dependence of acceptor-hole recombination in germanium

    International Nuclear Information System (INIS)

    Darken, L.S.; Jellison, G.E. Jr.

    1989-01-01

    The recombination kinetics of several centers (Zn - , Cu - , B - , CuH - 2 , CuH - x , Zn = , Cu = , and CuH = x ) in high-purity Ge have been measured as a function of temperature from 8 to 160 K by transient capacitance techniques and are significantly faster than expected from cascade theory. The cascade theory also gives the wrong temperature dependence, and the wrong z dependence. Instead, the data are generally fit by the expression N v /4pτ c congruent kT/h (p and τ c are, respectively, the free-hole concentration in the sample and the experimental mean capture time for a center)

  3. Density dependence of dielectronic recombination in selenium

    International Nuclear Information System (INIS)

    Hagelstein, P.L.; Rosen, M.D.; Jacobs, V.L.

    1986-01-01

    Dielectronic recombination has been found to be the dominant recombination process in the determination of the ionization balance of selenium near the Ne-like sequence under conditions relevant to the exploding-foil EUV laser plasmas. The dielectronic recombination process tends to populate excited levels, and these levels in turn are more susceptible to subsequent excitation and ionization than are the ground-state ions. If one defines an effective recombination rate which includes, in addition to the primary recombination, the subsequent excitation and ionization of the additional excited-state population due to the primary recombination, then this effective recombination rate can be density-sensitive at relatively low electron density. We present results for this effective dielectronic recombination rate at an electron density of 3 x 10/sup 20/ electrons/cm 3 for recombination from Ne-like to Na-like selenium and from F-like to Ne-like selenium. In the former case, the effective recombination rate coefficient is found to be 1.8 x 10/sup -11/ cm 3 /sec at 1.0 keV, which is to be compared with the zero-density value of 2.8 x 10/sup -11/ cm 3 /sec. In the latter case (F-like to Ne-like), the effective recombination rate coefficient is found to be 1.3 x 10/sup -11/ cm 3 /sec, which is substantially reduced from the zero-density result of 3.3 x 10/sup -11/ cm 3 /sec. We have examined the effects of dielectronic recombination on the laser gain of the dominant Ne-like 3p-3s transitions and have compared our results with those presented by Whitten et al. [Phys. Rev. A 33, 2171 (1986)

  4. Acute Smc5/6 depletion reveals its primary role in rDNA replication by restraining recombination at fork pausing sites.

    Directory of Open Access Journals (Sweden)

    Xiao P Peng

    2018-01-01

    Full Text Available Smc5/6, a member of the conserved SMC family of complexes, is essential for growth in most organisms. Its exact functions in a mitotic cell cycle are controversial, as chronic Smc5/6 loss-of-function alleles produce varying phenotypes. To circumvent this issue, we acutely depleted Smc5/6 in budding yeast and determined the first cell cycle consequences of Smc5/6 removal. We found a striking primary defect in replication of the ribosomal DNA (rDNA array. Each rDNA repeat contains a programmed replication fork barrier (RFB established by the Fob1 protein. Fob1 removal improves rDNA replication in Smc5/6 depleted cells, implicating Smc5/6 in the management of programmed fork pausing. A similar improvement is achieved by removing the DNA helicase Mph1 whose recombinogenic activity can be inhibited by Smc5/6 under DNA damage conditions. DNA 2D gel analyses further show that Smc5/6 loss increases recombination structures at RFB regions; moreover, mph1∆ and fob1∆ similarly reduce this accumulation. These findings point to an important mitotic role for Smc5/6 in restraining recombination events when protein barriers in rDNA stall replication forks. As rDNA maintenance influences multiple essential cellular processes, Smc5/6 likely links rDNA stability to overall mitotic growth.

  5. Induction of homologous recombination in Saccharomyces cerevisiae.

    Science.gov (United States)

    Simon, J R; Moore, P D

    1988-09-01

    We have investigated the effects of UV irradiation of Saccharomyces cerevisiae in order to distinguish whether UV-induced recombination results from the induction of enzymes required for homologous recombination, or the production of substrate sites for recombination containing regions of DNA damage. We utilized split-dose experiments to investigate the induction of proteins required for survival, gene conversion, and mutation in a diploid strain of S. cerevisiae. We demonstrate that inducing doses of UV irradiation followed by a 6 h period of incubation render the cells resistant to challenge doses of UV irradiation. The effects of inducing and challenge doses of UV irradiation upon interchromosomal gene conversion and mutation are strictly additive. Using the yeast URA3 gene cloned in non-replicating single- and double-stranded plasmid vectors that integrate into chromosomal genes upon transformation, we show that UV irradiation of haploid yeast cells and homologous plasmid DNA sequences each stimulate homologous recombination approximately two-fold, and that these effects are additive. Non-specific DNA damage has little effect on the stimulation of homologous recombination, as shown by studies in which UV-irradiated heterologous DNA was included in transformation/recombination experiments. We further demonstrate that the effect of competing single- and double-stranded heterologous DNA sequences differs in UV-irradiated and unirradiated cells, suggesting an induction of recombinational machinery in UV-irradiated S. cerevisiae cells.

  6. Total DNA of Glycyrrhiza uralensis transformed into Hansenula anomala by ion implantation:Preparing Glycyrrhizic acid in recombined yeasts

    International Nuclear Information System (INIS)

    Jin Xiang; Mao Peihong; Lu Jie; Ma Yuan

    2010-01-01

    Glycyrrhizic acid (GA) in Glycyrrhiza uralensis (G. uralensis) is physiologically active. In this study, the total DNA of wild G. uralensis was randomly transformed into Hansenula anomaly by implantation of low-energy Ar + and N + , to produce five recombinant yeast strains relating to biological synthesis of the GA or Glycyrrhetinic acid (GAs). After culturing in liquid medium for 96 h, the resultant GA, 18α-GAs and 18β-Gas were determined by reversed-phase high performance liquid chromatography (RP-HPLC), and the corresponding concentrations were 114.49, 0.56, and 0.81 mg·L -1 . After one hundred primers were analyzed with random amplified polymorphic DNA (RAPD), the seven different DNA fragments were produced by the N7059 strain of recombined yeasts, and, the polymerase chain reaction (PCR) verified that one of them came from the genome of G. uralensis, indicating a successful transfer of genetic information by ion implantation. (authors)

  7. The use of recombinant DNA technology for the development of a bluetongue virus subunit vaccine

    International Nuclear Information System (INIS)

    Huismans, H.

    1985-01-01

    The double-standed RNA gene coding for the surface antigen responsible for inducing neutralising anti-bodies has been isolated, converted to DNA, and cloned in the plasmid pBR322. So far, only plasmids containing inserts smaller than the gene have been obtained. The recombinant plasmids were isolated by screening for specific antibiotic resistance markers and characterized by size, restriction enzymes and hybridization with a 32 P-labelled DNA probe made with BTV-m RNA as template. Possible strategies for the development of a bluetongue virus submit vaccine are discussed

  8. Therapeutic Recombinant Monoclonal Antibodies

    Science.gov (United States)

    Bakhtiar, Ray

    2012-01-01

    During the last two decades, the rapid growth of biotechnology-derived techniques has led to a myriad of therapeutic recombinant monoclonal antibodies with significant clinical benefits. Recombinant monoclonal antibodies can be obtained from a number of natural sources such as animal cell cultures using recombinant DNA engineering. In contrast to…

  9. Use of a ring chromosome and pulsed-field gels to study interhomolog recombination, double-strand DNA breaks and sister-chromatid exchange in yeast

    International Nuclear Information System (INIS)

    Game, J.C.; Sitney, K.C.; Cook, V.E.; Mortimer, R.K.

    1989-01-01

    The authors describe a system that uses pulsed-field gels for the physical detection of recombinant DNA molecules, double-strand DNA breaks (DSB) and sister-chromatid exchange in the yeast Saccharomyces cerevisiae. The system makes use of a circular variant of chromosome II (Chr. III). Meiotic recombination between this ring chromosome and a linear homolog produces new molecules of sizes distinguishable on gels from either parental molecule. They demonstrate that these recombinant molecules are not present either in strains with two linear Chr. III molecules or in rad50 mutants, which are defective in meiotic recombination. In conjunction with the molecular endpoints. They present data on the timing of commitment to meiotic recombination scored genetically. They have used x-rays to linearize circular Chr. III, both to develop a sensitive method for measuring frequency of DSB and as a means of detecting double-size circles originating in part from sister-chromatid exchange, which they find to be frequent during meiosis

  10. Direct and indirect control of the initiation of meiotic recombination by DNA damage checkpoint mechanisms in budding yeast.

    Directory of Open Access Journals (Sweden)

    Bilge Argunhan

    Full Text Available Meiotic recombination plays an essential role in the proper segregation of chromosomes at meiosis I in many sexually reproducing organisms. Meiotic recombination is initiated by the scheduled formation of genome-wide DNA double-strand breaks (DSBs. The timing of DSB formation is strictly controlled because unscheduled DSB formation is detrimental to genome integrity. Here, we investigated the role of DNA damage checkpoint mechanisms in the control of meiotic DSB formation using budding yeast. By using recombination defective mutants in which meiotic DSBs are not repaired, the effect of DNA damage checkpoint mutations on DSB formation was evaluated. The Tel1 (ATM pathway mainly responds to unresected DSB ends, thus the sae2 mutant background in which DSB ends remain intact was employed. On the other hand, the Mec1 (ATR pathway is primarily used when DSB ends are resected, thus the rad51 dmc1 double mutant background was employed in which highly resected DSBs accumulate. In order to separate the effect caused by unscheduled cell cycle progression, which is often associated with DNA damage checkpoint defects, we also employed the ndt80 mutation which permanently arrests the meiotic cell cycle at prophase I. In the absence of Tel1, DSB formation was reduced in larger chromosomes (IV, VII, II and XI whereas no significant reduction was found in smaller chromosomes (III and VI. On the other hand, the absence of Rad17 (a critical component of the ATR pathway lead to an increase in DSB formation (chromosomes VII and II were tested. We propose that, within prophase I, the Tel1 pathway facilitates DSB formation, especially in bigger chromosomes, while the Mec1 pathway negatively regulates DSB formation. We also identified prophase I exit, which is under the control of the DNA damage checkpoint machinery, to be a critical event associated with down-regulating meiotic DSB formation.

  11. Evidence for the role of Mycobacterium tuberculosis RecG helicase in DNA repair and recombination.

    Science.gov (United States)

    Thakur, Roshan S; Basavaraju, Shivakumar; Somyajit, Kumar; Jain, Akshatha; Subramanya, Shreelakshmi; Muniyappa, Kalappa; Nagaraju, Ganesh

    2013-04-01

    In order to survive and replicate in a variety of stressful conditions during its life cycle, Mycobacterium tuberculosis must possess mechanisms to safeguard the integrity of the genome. Although DNA repair and recombination related genes are thought to play key roles in the repair of damaged DNA in all organisms, so far only a few of them have been functionally characterized in the tubercle bacillus. In this study, we show that M. tuberculosis RecG (MtRecG) expression was induced in response to different genotoxic agents. Strikingly, expression of MtRecG in Escherichia coli ∆recG mutant strain provided protection against mitomycin C, methyl methane sulfonate and UV induced cell death. Purified MtRecG exhibited higher binding affinity for the Holliday junction (HJ) compared with a number of canonical recombinational DNA repair intermediates. Notably, although MtRecG binds at the core of the mobile and immobile HJs, and with higher binding affinity for the immobile HJ, branch migration was evident only in the case of the mobile HJ. Furthermore, immobile HJs stimulate MtRecG ATPase activity less efficiently than mobile HJs. In addition to HJ substrates, MtRecG exhibited binding affinity for a variety of branched DNA structures including three-way junctions, replication forks, flap structures, forked duplex and a D-loop structure, but demonstrated strong unwinding activity on replication fork and flap DNA structures. Together, these results support that MtRecG plays an important role in processes related to DNA metabolism under normal as well as stress conditions. © 2013 The Authors Journal compilation © 2013 FEBS.

  12. Homologous Recombination as a Replication Fork Escort: Fork-Protection and Recovery

    Directory of Open Access Journals (Sweden)

    Audrey Costes

    2012-12-01

    Full Text Available Homologous recombination is a universal mechanism that allows DNA repair and ensures the efficiency of DNA replication. The substrate initiating the process of homologous recombination is a single-stranded DNA that promotes a strand exchange reaction resulting in a genetic exchange that promotes genetic diversity and DNA repair. The molecular mechanisms by which homologous recombination repairs a double-strand break have been extensively studied and are now well characterized. However, the mechanisms by which homologous recombination contribute to DNA replication in eukaryotes remains poorly understood. Studies in bacteria have identified multiple roles for the machinery of homologous recombination at replication forks. Here, we review our understanding of the molecular pathways involving the homologous recombination machinery to support the robustness of DNA replication. In addition to its role in fork-recovery and in rebuilding a functional replication fork apparatus, homologous recombination may also act as a fork-protection mechanism. We discuss that some of the fork-escort functions of homologous recombination might be achieved by loading of the recombination machinery at inactivated forks without a need for a strand exchange step; as well as the consequence of such a model for the stability of eukaryotic genomes.

  13. On the mutagenicity of homologous recombination and double-strand break repair in bacteriophage.

    Science.gov (United States)

    Shcherbakov, Victor P; Plugina, Lidiya; Shcherbakova, Tamara; Sizova, Svetlana; Kudryashova, Elena

    2011-01-02

    The double-strand break (DSB) repair via homologous recombination is generally construed as a high-fidelity process. However, some molecular genetic observations show that the recombination and the recombinational DSB repair may be mutagenic and even highly mutagenic. Here we developed an effective and precise method for studying the fidelity of DSB repair in vivo by combining DSBs produced site-specifically by the SegC endonuclease with the famous advantages of the recombination analysis of bacteriophage T4 rII mutants. The method is based on the comparison of the rate of reversion of rII mutation in the presence and in the absence of a DSB repair event initiated in the proximity of the mutation. We observed that DSB repair may moderately (up to 6-fold) increase the apparent reversion frequency, the effect of being dependent on the mutation structure. We also studied the effect of the T4 recombinase deficiency (amber mutation in the uvsX gene) on the fidelity of DSB repair. We observed that DSBs are still repaired via homologous recombination in the uvsX mutants, and the apparent fidelity of this repair is higher than that seen in the wild-type background. The mutator effect of the DSB repair may look unexpected given that most of the normal DNA synthesis in bacteriophage T4 is performed via a recombination-dependent replication (RDR) pathway, which is thought to be indistinguishable from DSB repair. There are three possible explanations for the observed mutagenicity of DSB repair: (1) the origin-dependent (early) DNA replication may be more accurate than the RDR; (2) the step of replication initiation may be more mutagenic than the process of elongation; and (3) the apparent mutagenicity may just reflect some non-randomness in the pool of replicating DNA, i.e., preferential replication of the sequences already involved in replication. We discuss the DSB repair pathway in the absence of UvsX recombinase. Copyright © 2010 Elsevier B.V. All rights reserved.

  14. Tolerance of DNA Mismatches in Dmc1 Recombinase-mediated DNA Strand Exchange*

    Science.gov (United States)

    Borgogno, María V.; Monti, Mariela R.; Zhao, Weixing; Sung, Patrick; Argaraña, Carlos E.; Pezza, Roberto J.

    2016-01-01

    Recombination between homologous chromosomes is required for the faithful meiotic segregation of chromosomes and leads to the generation of genetic diversity. The conserved meiosis-specific Dmc1 recombinase catalyzes homologous recombination triggered by DNA double strand breaks through the exchange of parental DNA sequences. Although providing an efficient rate of DNA strand exchange between polymorphic alleles, Dmc1 must also guard against recombination between divergent sequences. How DNA mismatches affect Dmc1-mediated DNA strand exchange is not understood. We have used fluorescence resonance energy transfer to study the mechanism of Dmc1-mediated strand exchange between DNA oligonucleotides with different degrees of heterology. The efficiency of strand exchange is highly sensitive to the location, type, and distribution of mismatches. Mismatches near the 3′ end of the initiating DNA strand have a small effect, whereas most mismatches near the 5′ end impede strand exchange dramatically. The Hop2-Mnd1 protein complex stimulates Dmc1-catalyzed strand exchange on homologous DNA or containing a single mismatch. We observed that Dmc1 can reject divergent DNA sequences while bypassing a few mismatches in the DNA sequence. Our findings have important implications in understanding meiotic recombination. First, Dmc1 acts as an initial barrier for heterologous recombination, with the mismatch repair system providing a second level of proofreading, to ensure that ectopic sequences are not recombined. Second, Dmc1 stepping over infrequent mismatches is likely critical for allowing recombination between the polymorphic sequences of homologous chromosomes, thus contributing to gene conversion and genetic diversity. PMID:26709229

  15. Bicarbonate-dependent secretion and proteolytic processing of recombinant myocilin.

    Directory of Open Access Journals (Sweden)

    José-Daniel Aroca-Aguilar

    Full Text Available Myocilin is an extracellular glycoprotein of poorly understood function. Mutations of this protein are involved in glaucoma, an optic neuropathy characterized by a progressive and irreversible visual loss and frequently associated with elevated intraocular pressure. We previously showed that recombinant myocilin undergoes an intracellular proteolytic processing by calpain II which cleaves the central region of the protein, releasing one N- and one C-terminal fragment. Myocilin cleavage is reduced by glaucoma mutations and it has been proposed to participate in intraocular pressure modulation. To identify possible factors regulating the proteolytic processing of recombinant myocilin, we used a cellular model in which we analyzed how different culture medium parameters (i.e., culture time, cell density, pH, bicarbonate concentration, etc. affect the presence of the extracellular C-terminal fragment. Extracellular bicarbonate depletion associated with culture medium acidification produced a reversible intracellular accumulation of full-length recombinant myocilin and incremented its intracellular proteolytic processing, raising the extracellular C-terminal fragment percentage. It was also determined that myocilin intracellular accumulation depends on its N-terminal region. These data suggest that aqueous humor bicarbonate variations could also modulate the secretion and cleavage of myocilin present in ocular tissues.

  16. Sequence-dependent DNA deformability studied using molecular dynamics simulations.

    Science.gov (United States)

    Fujii, Satoshi; Kono, Hidetoshi; Takenaka, Shigeori; Go, Nobuhiro; Sarai, Akinori

    2007-01-01

    Proteins recognize specific DNA sequences not only through direct contact between amino acids and bases, but also indirectly based on the sequence-dependent conformation and deformability of the DNA (indirect readout). We used molecular dynamics simulations to analyze the sequence-dependent DNA conformations of all 136 possible tetrameric sequences sandwiched between CGCG sequences. The deformability of dimeric steps obtained by the simulations is consistent with that by the crystal structures. The simulation results further showed that the conformation and deformability of the tetramers can highly depend on the flanking base pairs. The conformations of xATx tetramers show the most rigidity and are not affected by the flanking base pairs and the xYRx show by contrast the greatest flexibility and change their conformations depending on the base pairs at both ends, suggesting tetramers with the same central dimer can show different deformabilities. These results suggest that analysis of dimeric steps alone may overlook some conformational features of DNA and provide insight into the mechanism of indirect readout during protein-DNA recognition. Moreover, the sequence dependence of DNA conformation and deformability may be used to estimate the contribution of indirect readout to the specificity of protein-DNA recognition as well as nucleosome positioning and large-scale behavior of nucleic acids.

  17. BRIT1/MCPH1 is essential for mitotic and meiotic recombination DNA repair and maintaining genomic stability in mice.

    Directory of Open Access Journals (Sweden)

    Yulong Liang

    2010-01-01

    Full Text Available BRIT1 protein (also known as MCPH1 contains 3 BRCT domains which are conserved in BRCA1, BRCA2, and other important molecules involved in DNA damage signaling, DNA repair, and tumor suppression. BRIT1 mutations or aberrant expression are found in primary microcephaly patients as well as in cancer patients. Recent in vitro studies suggest that BRIT1/MCPH1 functions as a novel key regulator in the DNA damage response pathways. To investigate its physiological role and dissect the underlying mechanisms, we generated BRIT1(-/- mice and identified its essential roles in mitotic and meiotic recombination DNA repair and in maintaining genomic stability. Both BRIT1(-/- mice and mouse embryonic fibroblasts (MEFs were hypersensitive to gamma-irradiation. BRIT1(-/- MEFs and T lymphocytes exhibited severe chromatid breaks and reduced RAD51 foci formation after irradiation. Notably, BRIT1(-/- mice were infertile and meiotic homologous recombination was impaired. BRIT1-deficient spermatocytes exhibited a failure of chromosomal synapsis, and meiosis was arrested at late zygotene of prophase I accompanied by apoptosis. In mutant spermatocytes, DNA double-strand breaks (DSBs were formed, but localization of RAD51 or BRCA2 to meiotic chromosomes was severely impaired. In addition, we found that BRIT1 could bind to RAD51/BRCA2 complexes and that, in the absence of BRIT1, recruitment of RAD51 and BRCA2 to chromatin was reduced while their protein levels were not altered, indicating that BRIT1 is involved in mediating recruitment of RAD51/BRCA2 to the damage site. Collectively, our BRIT1-null mouse model demonstrates that BRIT1 is essential for maintaining genomic stability in vivo to protect the hosts from both programmed and irradiation-induced DNA damages, and its depletion causes a failure in both mitotic and meiotic recombination DNA repair via impairing RAD51/BRCA2's function and as a result leads to infertility and genomic instability in mice.

  18. Probing Temperature-Dependent Recombination Kinetics in Polymer:Fullerene Solar Cells by Electric Noise Spectroscopy

    Directory of Open Access Journals (Sweden)

    Giovanni Landi

    2017-09-01

    Full Text Available The influence of solvent additives on the temperature behavior of both charge carrier transport and recombination kinetics in bulk heterojunction solar cells has been investigated by electric noise spectroscopy. The observed differences in charge carrier lifetime and mobility are attributed to a different film ordering and donor-acceptor phase segregation in the blend. The measured temperature dependence indicates that bimolecular recombination is the dominant loss mechanism in the active layer, affecting the device performance. Blend devices prepared with a high-boiling-point solvent additive show a decreased recombination rate at the donor-acceptor interface as compared to the ones prepared with the reference solvent. A clear correlation between the device performance and the morphological properties is discussed in terms of the temperature dependence of the mobility-lifetime product.

  19. Assembly and dynamics of the bacteriophage T4 homologous recombination machinery

    Directory of Open Access Journals (Sweden)

    Morrical Scott W

    2010-12-01

    Full Text Available Abstract Homologous recombination (HR, a process involving the physical exchange of strands between homologous or nearly homologous DNA molecules, is critical for maintaining the genetic diversity and genome stability of species. Bacteriophage T4 is one of the classic systems for studies of homologous recombination. T4 uses HR for high-frequency genetic exchanges, for homology-directed DNA repair (HDR processes including DNA double-strand break repair, and for the initiation of DNA replication (RDR. T4 recombination proteins are expressed at high levels during T4 infection in E. coli, and share strong sequence, structural, and/or functional conservation with their counterparts in cellular organisms. Biochemical studies of T4 recombination have provided key insights on DNA strand exchange mechanisms, on the structure and function of recombination proteins, and on the coordination of recombination and DNA synthesis activities during RDR and HDR. Recent years have seen the development of detailed biochemical models for the assembly and dynamics of presynaptic filaments in the T4 recombination system, for the atomic structure of T4 UvsX recombinase, and for the roles of DNA helicases in T4 recombination. The goal of this chapter is to review these recent advances and their implications for HR and HDR mechanisms in all organisms.

  20. Use of homologous recombination in yeast to create chimeric bovine viral diarrhea virus cDNA clones

    Directory of Open Access Journals (Sweden)

    Sandra Arenhart

    Full Text Available Abstract The open reading frame of a Brazilian bovine viral diarrhea virus (BVDV strain, IBSP4ncp, was recombined with the untranslated regions of the reference NADL strain by homologous recombination in Saccharomyces cerevisiae, resulting in chimeric full-length cDNA clones of BVDV (chi-NADL/IBSP4ncp#2 and chi-NADL/IBSP4ncp#3. The recombinant clones were successfully recovered, resulting in viable viruses, having the kinetics of replication, focus size, and morphology similar to those of the parental virus, IBSP4ncp. In addition, the chimeric viruses remained stable for at least 10 passages in cell culture, maintaining their replication efficiency unaltered. Nucleotide sequencing revealed a few point mutations; nevertheless, the phenotype of the rescued viruses was nearly identical to that of the parental virus in all experiments. Thus, genetic stability of the chimeric clones and their phenotypic similarity to the parental virus confirm the ability of the yeast-based homologous recombination to maintain characteristics of the parental virus from which the recombinant viruses were derived. The data also support possible use of the yeast system for the manipulation of the BVDV genome.

  1. DNA-PK inhibition causes a low level of H2AX phosphorylation and homologous recombination repair in Medaka (Oryzias latipes) cells

    International Nuclear Information System (INIS)

    Urushihara, Yusuke; Kobayashi, Junya; Matsumoto, Yoshihisa; Komatsu, Kenshi; Oda, Shoji; Mitani, Hiroshi

    2012-01-01

    Highlights: ► We investigated the effect of DNA-PK inhibition on DSB repair using fish cells. ► A radiation sensitive mutant RIC1 strain showed a low level of DNA-PK activity. ► DNA-PK dysfunction leads defects in HR repair and DNA-PKcs autophosphorylation. ► DNA-PK dysfunction leads a slight increase in the number of 53BP1 foci after DSBs. ► DNA-PK dysfunction leads an alternative NHEJ that depends on 53BP1. -- Abstract: Nonhomologous end joining (NHEJ) and homologous recombination (HR) are known as DNA double-strand break (DSB) repair pathways. It has been reported that DNA-PK, a member of PI3 kinase family, promotes NHEJ and aberrant DNA-PK causes NHEJ deficiency. However, in this study, we demonstrate that a wild-type cell line treated with DNA-PK inhibitor and a mutant cell line with dysfunctional DNA-PK showed decreased HR efficiency in fish cells (Medaka, Oryzias latipes). Previously, we reported that the radiation-sensitive mutant RIC1 strain has a defect in the Histone H2AX phosphorylation after γ-irradiation. Here, we showed that a DNA-PK inhibitor, NU7026, treatment resulted in significant reduction in the number of γH2AX foci after γ-irradiation in wild-type cells, but had no significant effect in RIC1 cells. In addition, RIC1 cells showed significantly lower levels of DNA-PK kinase activity compared with wild-type cells. We investigated NHEJ and HR efficiency after induction of DSBs. Wild-type cells treated with NU7026 and RIC1 cells showed decreased HR efficiency. These results indicated that aberrant DNA-PK causes the reduction in the number of γH2AX foci and HR efficiency in RIC1 cells. We performed phosphorylated DNA-PKcs (Thr2609) and 53BP1 focus assay after γ-irradiation. RIC1 cells showed significant reduction in the number of phosphorylated DNA-PKcs foci and no deference in the number of 53BP1 foci compared with wild-type cells. These results suggest that low level of DNA-PK activity causes aberrant DNA-PKcs autophosphorylation

  2. Tolerance of DNA Mismatches in Dmc1 Recombinase-mediated DNA Strand Exchange.

    Science.gov (United States)

    Borgogno, María V; Monti, Mariela R; Zhao, Weixing; Sung, Patrick; Argaraña, Carlos E; Pezza, Roberto J

    2016-03-04

    Recombination between homologous chromosomes is required for the faithful meiotic segregation of chromosomes and leads to the generation of genetic diversity. The conserved meiosis-specific Dmc1 recombinase catalyzes homologous recombination triggered by DNA double strand breaks through the exchange of parental DNA sequences. Although providing an efficient rate of DNA strand exchange between polymorphic alleles, Dmc1 must also guard against recombination between divergent sequences. How DNA mismatches affect Dmc1-mediated DNA strand exchange is not understood. We have used fluorescence resonance energy transfer to study the mechanism of Dmc1-mediated strand exchange between DNA oligonucleotides with different degrees of heterology. The efficiency of strand exchange is highly sensitive to the location, type, and distribution of mismatches. Mismatches near the 3' end of the initiating DNA strand have a small effect, whereas most mismatches near the 5' end impede strand exchange dramatically. The Hop2-Mnd1 protein complex stimulates Dmc1-catalyzed strand exchange on homologous DNA or containing a single mismatch. We observed that Dmc1 can reject divergent DNA sequences while bypassing a few mismatches in the DNA sequence. Our findings have important implications in understanding meiotic recombination. First, Dmc1 acts as an initial barrier for heterologous recombination, with the mismatch repair system providing a second level of proofreading, to ensure that ectopic sequences are not recombined. Second, Dmc1 stepping over infrequent mismatches is likely critical for allowing recombination between the polymorphic sequences of homologous chromosomes, thus contributing to gene conversion and genetic diversity. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. The Effect of Basepair Mismatch on DNA Strand Displacement

    OpenAIRE

    Broadwater, D.?W.?Bo; Kim, Harold?D.

    2016-01-01

    DNA strand displacement is a key reaction in DNA homologous recombination and DNA mismatch repair and is also heavily utilized in DNA-based computation and locomotion. Despite its ubiquity in science and engineering, sequence-dependent effects of displacement kinetics have not been extensively characterized. Here, we measured toehold-mediated strand displacement kinetics using single-molecule fluorescence in the presence of a single base pair mismatch. The apparent displacement rate varied si...

  4. V(D)J recombination process and the Pre-B to immature B-cells transition are altered in Fanca ?/? mice

    OpenAIRE

    Nguyen, Thuy Vy; Pawlikowska, Patrycja; Firlej, Virginie; Rosselli, Filippo; Aoufouchi, Sa?d

    2016-01-01

    B-lymphocytes in the bone marrow (BM) must generate a functional B-cell receptor and overcome the negative selection induced by reactivity with autoantigens. Two rounds of DNA recombination are required for the production of functional immunoglobulin heavy (Ig-HCs) and light (LCs) chains necessary for the continuation of B-lymphocyte development in the BM. Both rounds depend on the joint action of recombination activating gene-1 (RAG-1) and RAG-2 endonucleases with the DNA non-homologous end-...

  5. Role of DNA-PK in cellular responses to DNA double-strand breaks

    International Nuclear Information System (INIS)

    Chen, D.J.

    2003-01-01

    DNA double-strand breaks (DSBs) are probably the most dangerous of the many different types of DNA damage that occur within the cell. DSBs are generated by exogenous agents such as ionizing radiation (IR) or by endogenously generated reactive oxygen species and occur as intermediates during meiotic and V(D)J recombination. The repair of DSBs is of paramount importance to the cell as misrepair of DSBs can lead to cell death or promote tumorigenesis. In eukaryotes there exists two distinct mechanisms for DNA DSB repair: homologous recombination (HR) and non-homologous end joining (NHEJ). In mammalian cells, however, it is clear that nonhomologous repair of DSBs is highly active and plays a major role in conferring radiation resistance to the cell. The NHEJ machinery minimally consists of the DNA-dependent Protein Kinase (DNA-PK) and a complex of XRCC4 and DNA Ligase IV. The DNA-PK complex is composed of a 470 kDa catalytic subunit (DNA-PKcs), and the heterodimeric Ku70 and Ku80 DNA end-binding complex. DNA-PKcs is a PI-3 kinase with homology to ATM and ATR in its C-terminal kinase domain. The DNA-PK complex protects and tethers the ends, and directs assembly and, perhaps, the activation of other NHEJ proteins. We have previously demonstrated that the kinase activity of DNA-PK is essential for DNA DSB repair and V(D)J recombination. It is, therefore, of immense interest to determine the in vivo targets of DNA-PKcs and the mechanisms by which phosphorylation of these targets modulates NHEJ. Recent studies have resulted in the identification of a number of protein targets that are phosphorylated by and/or interact with DNA-PKcs. Our laboratory has recently identified autophosphorylation site(s) on DNA-PKcs. We find that phosphorylation at these sites in vivo is an early and essential response to DSBs and demonstrate, for the first time, the localization of DNA-PKcs to the sites of DNA damage in vivo. Furthermore, mutation of these phosphorylation sites in mammalian

  6. Recombinant DNA in Cambridge: lessons for nuclear energy

    International Nuclear Information System (INIS)

    Federow, H.

    1977-09-01

    The 1976 experience of Cambridge, Massachusetts, in settling the recombinant DNA research issue is unique in recent history as the first instance of essentially lay panels judging the conduct of scientific research. Furthermore, because the panel was composed of citizens who would be affected by the research, the experience suggests a model for conflict resolution in other areas of public controversy. With one of these, nuclear energy, the controversy has two important points in common: although the primary burden of any accident would be borne by the local community, benefits of the DNA research or reactor operation accrue to a much broader range of people; and in both issues there is a need to resolve the question, ''How safe is safe enough.'' It is therefore proposed that a panel similar to the Cambridge one could be established to deal with the controversy surrounding a proposed nuclear plant. In any community where there was such controversy, a panel could be convened to assess whether the plant was acceptable to that community. Such a panel would be composed of members of the community who were not affected directly by the plant. It would also have to have a restricted range of inquiry, oriented toward the specifics of the proposed plant. Such a plant review panel, under properly designed procedures, could change the licensing process to one concerned solely with safety and provide an appropriate forum for issues concerning the acceptability of nuclear power

  7. Characterization of the Caenorhabditis elegans HIM-6/BLM helicase: unwinding recombination intermediates.

    Science.gov (United States)

    Jung, Hana; Lee, Jin A; Choi, Seoyoon; Lee, Hyunwoo; Ahn, Byungchan

    2014-01-01

    Mutations in three human RecQ genes are implicated in heritable human syndromes. Mutations in BLM, a RecQ gene, cause Bloom syndrome (BS), which is characterized by short stature, cancer predisposition, and sensitivity to sunlight. BLM is a RecQ DNA helicase that, with interacting proteins, is able to dissolve various DNA structures including double Holliday junctions. A BLM ortholog, him-6, has been identified in Caenorhabditis elegans, but little is known about its enzymatic activities or its in vivo roles. By purifying recombinant HIM-6 and performing biochemical assays, we determined that the HIM-6 has DNA-dependent ATPase activity HIM-6 and helicase activity that proceeds in the 3'-5' direction and needs at least five 3' overhanging nucleotides. HIM-6 is also able to unwind DNA structures including D-loops and Holliday junctions. Worms with him-6 mutations were defective in recovering the cell cycle arrest after HU treatment. These activities strongly support in vivo roles for HIM-6 in processing recombination intermediates.

  8. Evidence for a Chk2-BRCA1-BRCA2 pathway in controlling homologous recombination

    International Nuclear Information System (INIS)

    Powell, S.N.

    2003-01-01

    The BRCA2 protein is thought to play a role as a supportive protein for the assembly of Rad51 filaments at the sites of DNA damage or stalled DNA replication, and thereby facilitates the process of homologous recombination (HR). We provide direct evidence that the interaction of BRCA2 and Rad51, via the BRC repeat motifs of BRCA2, is the key to its function in HR. Furthermore, the BRCA2's role to facilitate HR is dependent on a replicating DNA template, closely linking the process of HR to DNA replication. To date, no other role for BRCA2 has been elucidated in-vivo. BRCA1, by contrast, has a complex series of functions including a supportive role in HR, a possible role in non-homologous recombination (NHR), transcriptional co-activation and E3 ubiquitin ligase activity. The protein undergoes extensive post-translational modification, principally by phosphorylation, in both S-phase and in response to DNA damage. We show that ATM-dependent modifications of BRCA1 are important for S-phase and G2/M checkpoints, but have no direct impact on DNA repair. However, a chk2 dependent modification of BRCA1 at serine-988, appears critical for the promotion of Rad51-dependent HR and the inhibition of Mre11/Rad50/NBS1- dependent repair. Direct modification of chk2 kinase activity, by over-expression of a kinase-dead chk2, results in an identical phenotype as seen with the S988A mutation of BRCA1. Taken together, these results suggest that a chk2-BRCA1-BRCA2 dependent pathway promotes error-free HR, suppresses error-prone NHR and thereby maintains genomic stability

  9. Spin-dependent recombination involving oxygen-vacancy complexes in silicon

    Science.gov (United States)

    Franke, David P.; Hoehne, Felix; Vlasenko, Leonid S.; Itoh, Kohei M.; Brandt, Martin S.

    2014-05-01

    Spin-dependent relaxation and recombination processes in γ-irradiated n-type Czochralski-grown silicon are studied using continuous wave (cw) and pulsed electrically detected magnetic resonance (EDMR). Two processes involving the SL1 center, the neutral excited triplet state of the oxygen-vacancy complex, are observed which can be separated by their different dynamics. One of the processes is the relaxation of the excited SL1 state to the ground state of the oxygen-vacancy complex, the other a charge transfer between 31P donors and SL1 centers forming close pairs, as indicated by electrically detected electron double resonance. For both processes, the recombination dynamics is studied with pulsed EDMR techniques. We demonstrate the feasibility of true zero-field cw and pulsed EDMR for spin-1 systems and use this to measure the lifetimes of the different spin states of SL1 also at vanishing external magnetic field.

  10. Recombinant DNA production of spider silk proteins.

    Science.gov (United States)

    Tokareva, Olena; Michalczechen-Lacerda, Valquíria A; Rech, Elíbio L; Kaplan, David L

    2013-11-01

    Spider dragline silk is considered to be the toughest biopolymer on Earth due to an extraordinary combination of strength and elasticity. Moreover, silks are biocompatible and biodegradable protein-based materials. Recent advances in genetic engineering make it possible to produce recombinant silks in heterologous hosts, opening up opportunities for large-scale production of recombinant silks for various biomedical and material science applications. We review the current strategies to produce recombinant spider silks. © 2013 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  11. In vitro and in vivo characterization of DNA delivery using recombinant Lactococcus lactis expressing a mutated form of L. monocytogenes Internalin A

    NARCIS (Netherlands)

    Azevedo, de M.; Karczewski, J.; Lefevre, F.; Azevedo, V.; Miyoshi, A.; Wells, J.; Langella, P.; Chatel, J.M.

    2012-01-01

    Background The use of food-grade Lactic Acid Bacteria (LAB) as DNA delivery vehicles represents an attractive strategy to deliver DNA vaccines at the mucosal surfaces as they are generally regarded as safe (GRAS). We previously showed that either native Lactococcus lactis (LL) or recombinant

  12. Alkyladenine DNA glycosylase (Aag) in somatic hypermutation and class switch recombination.

    Science.gov (United States)

    Longerich, Simonne; Meira, Lisiane; Shah, Dharini; Samson, Leona D; Storb, Ursula

    2007-12-01

    Somatic hypermutation (SHM) and class switch recombination (CSR) of immunoglobulin (Ig) genes require the cytosine deaminase AID, which deaminates cytosine to uracil in Ig gene DNA. Paradoxically, proteins involved normally in error-free base excision repair and mismatch repair, seem to be co-opted to facilitate SHM and CSR, by recruiting error-prone translesion polymerases to DNA sequences containing deoxy-uracils created by AID. Major evidence supports at least one mechanism whereby the uracil glycosylase Ung removes AID-generated uracils creating abasic sites which may be used either as uninformative templates for DNA synthesis, or processed to nicks and gaps that prime error-prone DNA synthesis. We investigated the possibility that deamination at adenines also initiates SHM. Adenosine deamination would generate hypoxanthine (Hx), a substrate for the alkyladenine DNA glycosylase (Aag). Aag would generate abasic sites which then are subject to error-prone repair as above for AID-deaminated cytosine processed by Ung. If the action of an adenosine deaminase followed by Aag were responsible for significant numbers of mutations at A, we would find a preponderance of A:T>G:C transition mutations during SHM in an Aag deleted background. However, this was not observed and we found that the frequencies of SHM and CSR were not significantly altered in Aag-/- mice. Paradoxically, we found that Aag is expressed in B lymphocytes undergoing SHM and CSR and that its activity is upregulated in activated B cells. Moreover, we did find a statistically significant, albeit low increase of T:A>C:G transition mutations in Aag-/- animals, suggesting that Aag may be involved in creating the SHM A>T bias seen in wild type mice.

  13. DNA Binding in High Salt: Analysing the Salt Dependence of Replication Protein A3 from the Halophile Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Jody A. Winter

    2012-01-01

    Full Text Available Halophilic archaea maintain intracellular salt concentrations close to saturation to survive in high-salt environments and their cellular processes have adapted to function under these conditions. Little is known regarding halophilic adaptation of the DNA processing machinery, particularly intriguing since protein-DNA interactions are classically salt sensitive. To investigate such adaptation, we characterised the DNA-binding capabilities of recombinant RPA3 from Haloferax volcanii (HvRPA3. Under physiological salt conditions (3 M KCl, HvRPA3 is monomeric, binding 18 nucleotide ssDNA with nanomolar affinity, demonstrating that RPAs containing the single OB-fold/zinc finger architecture bind with broadly comparable affinity to two OB-fold/zinc finger RPAs. Reducing the salt concentration to 1 M KCl induces dimerisation of the protein, which retains its ability to bind DNA. On circular ssDNA, two concentration-dependent binding modes are observed. Conventionally, increased salt concentration adversely affects DNA binding but HvRPA3 does not bind DNA in 0.2 M KCl, although multimerisation may occlude the binding site. The single N-terminal OB-fold is competent to bind DNA in the absence of the C-terminal zinc finger, albeit with reduced affinity. This study represents the first quantitative characterisation of DNA binding in a halophilic protein in extreme salt concentrations.

  14. Histone dosage regulates DNA damage sensitivity in a checkpoint-independent manner by the homologous recombination pathway

    Science.gov (United States)

    Liang, Dun; Burkhart, Sarah Lyn; Singh, Rakesh Kumar; Kabbaj, Marie-Helene Miquel; Gunjan, Akash

    2012-01-01

    In eukaryotes, multiple genes encode histone proteins that package genomic deoxyribonucleic acid (DNA) and regulate its accessibility. Because of their positive charge, ‘free’ (non-chromatin associated) histones can bind non-specifically to the negatively charged DNA and affect its metabolism, including DNA repair. We have investigated the effect of altering histone dosage on DNA repair in budding yeast. An increase in histone gene dosage resulted in enhanced DNA damage sensitivity, whereas deletion of a H3–H4 gene pair resulted in reduced levels of free H3 and H4 concomitant with resistance to DNA damaging agents, even in mutants defective in the DNA damage checkpoint. Studies involving the repair of a HO endonuclease-mediated DNA double-strand break (DSB) at the MAT locus show enhanced repair efficiency by the homologous recombination (HR) pathway on a reduction in histone dosage. Cells with reduced histone dosage experience greater histone loss around a DSB, whereas the recruitment of HR factors is concomitantly enhanced. Further, free histones compete with the HR machinery for binding to DNA and associate with certain HR factors, potentially interfering with HR-mediated repair. Our findings may have important implications for DNA repair, genomic stability, carcinogenesis and aging in human cells that have dozens of histone genes. PMID:22850743

  15. Construction of a trivalent candidate vaccine against Shigella species with DNA recombination

    Institute of Scientific and Technical Information of China (English)

    王恒樑; 冯尔玲; 林云; 廖翔; 金明; 黄留玉; 苏国富; 黄翠芬

    2002-01-01

    In this work asd gene of Shigella flexneri 2a strain T32 was replaced by Vibrio cholerae toxin B subunit (ctxB) gene with DNA recombination in vivo and in vitro. The resulting derivative of T32, designed as FWL01, could stably express CtxB, but its growth in LB medium depended on the presence of diaminopimelic acid (DAP). Then form I plasmid of Shigella sonnei strain S7 was labeled with strain T32 asd gene and mobilized into FWL01. Thus a trivalent candidate oral vaccine strain, designed as FSW01, was constructed. In this candidate strain, a balanced-lethal system was constituted between the host strain and the form I plasmid expressing S. sonnei O antigen. Therefore the candidate strain can express stably not only its own O antigen but also CtxB and O antigen of S. sonnei in the absence of any antibiotic. Experiments showed that FSW01 did not invade HeLa cells or cause keratoconjunctivitis in guinea pigs. However, rabbits immunized FSW01 can elicit significant immune responses. In mice and rhesus monkey models, vaccinated animals were protected against the challenges of wild S. flexneri 2a strain 2457T and S. sonnei strain S9.

  16. Site-specific DNA Inversion by Serine Recombinases

    Science.gov (United States)

    2015-01-01

    Reversible site-specific DNA inversion reactions are widely distributed in bacteria and their viruses. They control a range of biological reactions that most often involve alterations of molecules on the surface of cells or phage. These programmed DNA rearrangements usually occur at a low frequency, thereby preadapting a small subset of the population to a change in environmental conditions, or in the case of phages, an expanded host range. A dedicated recombinase, sometimes with the aid of additional regulatory or DNA architectural proteins, catalyzes the inversion of DNA. RecA or other components of the general recombination-repair machinery are not involved. This chapter discusses site-specific DNA inversion reactions mediated by the serine recombinase family of enzymes and focuses on the extensively studied serine DNA invertases that are stringently controlled by the Fis-bound enhancer regulatory system. The first section summarizes biological features and general properties of inversion reactions by the Fis/enhancer-dependent serine invertases and the recently described serine DNA invertases in Bacteroides. Mechanistic studies of reactions catalyzed by the Hin and Gin invertases are then discussed in more depth, particularly with regards to recent advances in our understanding of the function of the Fis/enhancer regulatory system, the assembly of the active recombination complex (invertasome) containing the Fis/enhancer, and the process of DNA strand exchange by rotation of synapsed subunit pairs within the invertasome. The role of DNA topological forces that function in concert with the Fis/enhancer controlling element in specifying the overwhelming bias for DNA inversion over deletion and intermolecular recombination is emphasized. PMID:25844275

  17. Spin-dependent recombination involving oxygen-vacancy complexes in silicon

    OpenAIRE

    Franke, David P.; Hoehne, Felix; Vlasenko, Leonid S.; Itoh, Kohei M.; Brandt, Martin S.

    2014-01-01

    Spin-dependent relaxation and recombination processes in $\\gamma$-irradiated $n$-type Czochralski-grown silicon are studied using continuous wave (cw) and pulsed electrically detected magnetic resonance (EDMR). Two processes involving the SL1 center, the neutral excited triplet state of the oxygen-vacancy complex, are observed which can be separated by their different dynamics. One of the processes is the relaxation of the excited SL1 state to the ground state of the oxygen-vacancy complex, t...

  18. The role of DNA dependent protein kinase in synapsis of DNA ends.

    Science.gov (United States)

    Weterings, Eric; Verkaik, Nicole S; Brüggenwirth, Hennie T; Hoeijmakers, Jan H J; van Gent, Dik C

    2003-12-15

    DNA dependent protein kinase (DNA-PK) plays a central role in the non-homologous end-joining pathway of DNA double strand break repair. Its catalytic subunit (DNA-PK(CS)) functions as a serine/threonine protein kinase. We show that DNA-PK forms a stable complex at DNA termini that blocks the action of exonucleases and ligases. The DNA termini become accessible after autophosphorylation of DNA-PK(CS), which we demonstrate to require synapsis of DNA ends. Interestingly, the presence of DNA-PK prevents ligation of the two synapsed termini, but allows ligation to another DNA molecule. This alteration of the ligation route is independent of the type of ligase that we used, indicating that the intrinsic architecture of the DNA-PK complex itself is not able to support ligation of the synapsed DNA termini. We present a working model in which DNA-PK creates a stable molecular bridge between two DNA ends that is remodeled after DNA-PK autophosphorylation in such a way that the extreme termini become accessible without disrupting synapsis. We infer that joining of synapsed DNA termini would require an additional protein factor.

  19. Spin-dependent tunneling recombination in heterostructures with a magnetic layer

    Energy Technology Data Exchange (ETDEWEB)

    Denisov, K. S., E-mail: denisokonstantin@gmail.com; Rozhansky, I. V.; Averkiev, N. S. [Russian Academy of Sciences, Ioffe Physical–Technical Institute (Russian Federation); Lähderanta, E. [Lappeenranta University of Technology (Finland)

    2017-01-15

    We propose a mechanism for the generation of spin polarization in semiconductor heterostructures with a quantum well and a magnetic impurity layer spatially separated from it. The spin polarization of carriers in a quantum well originates from spin-dependent tunneling recombination at impurity states in the magnetic layer, which is accompanied by a fast linear increase in the degree of circular polarization of photoluminescence from the quantum well. Two situations are theoretically considered. In the first case, resonant tunneling to the spin-split sublevels of the impurity center occurs and spin polarization is caused by different populations of resonance levels in the quantum well for opposite spin projections. In the second, nonresonant case, the spin-split impurity level lies above the occupied states of electrons in the quantum well and plays the role of an intermediate state in the two-stage coherent spin-dependent recombination of an electron from the quantum well and a hole in the impurity layer. The developed theory allows us to explain both qualitatively and quantitatively the kinetics of photoexcited electrons in experiments with photoluminescence with time resolution in Mn-doped InGaAs heterostructures.

  20. Construction, Expression, and Characterization of Recombinant Pfu DNA Polymerase in Escherichia coli.

    Science.gov (United States)

    Zheng, Wenjun; Wang, Qingsong; Bi, Qun

    2016-04-01

    Pfu DNA polymerase (Pfu) is a DNA polymerase isolated from the hyperthermophilic archaeon Pyrococcus furiosus. With its excellent thermostability and high fidelity, Pfu is well known as one of the enzymes widely used in the polymerase chain reaction. In this study, the recombinant plasmid pLysS His6-tagged Pfu-pET28a was constructed. His-tagged Pfu was expressed in Escherichia coli BL21 (DE3) competent cells and then successfully purified with the ÄKTAprime plus compact one-step purification system by Ni(2+) chelating affinity chromatography after optimization of the purification conditions. The authenticity of the purified Pfu was further confirmed by peptide mass fingerprinting. A bio-assay indicated that its activity in the polymerase chain reaction was equivalent to that of commercial Pfu and its isoelectric point was found to be between 6.85 and 7.35. These results will be useful for further studies on Pfu and its wide application in the future.

  1. The Fanconi anemia ortholog FANCM ensures ordered homologous recombination in both somatic and meiotic cells in Arabidopsis.

    Science.gov (United States)

    Knoll, Alexander; Higgins, James D; Seeliger, Katharina; Reha, Sarah J; Dangel, Natalie J; Bauknecht, Markus; Schröpfer, Susan; Franklin, F Christopher H; Puchta, Holger

    2012-04-01

    The human hereditary disease Fanconi anemia leads to severe symptoms, including developmental defects and breakdown of the hematopoietic system. It is caused by single mutations in the FANC genes, one of which encodes the DNA translocase FANCM (for Fanconi anemia complementation group M), which is required for the repair of DNA interstrand cross-links to ensure replication progression. We identified a homolog of FANCM in Arabidopsis thaliana that is not directly involved in the repair of DNA lesions but suppresses spontaneous somatic homologous recombination via a RecQ helicase (At-RECQ4A)-independent pathway. In addition, it is required for double-strand break-induced homologous recombination. The fertility of At-fancm mutant plants is compromised. Evidence suggests that during meiosis At-FANCM acts as antirecombinase to suppress ectopic recombination-dependent chromosome interactions, but this activity is antagonized by the ZMM pathway to enable the formation of interference-sensitive crossovers and chromosome synapsis. Surprisingly, mutation of At-FANCM overcomes the sterility phenotype of an At-MutS homolog4 mutant by apparently rescuing a proportion of crossover-designated recombination intermediates via a route that is likely At-MMS and UV sensitive81 dependent. However, this is insufficient to ensure the formation of an obligate crossover. Thus, At-FANCM is not only a safeguard for genome stability in somatic cells but is an important factor in the control of meiotic crossover formation.

  2. Recombinant protein production from stable mammalian cell lines and pools.

    Science.gov (United States)

    Hacker, David L; Balasubramanian, Sowmya

    2016-06-01

    We highlight recent developments for the production of recombinant proteins from suspension-adapted mammalian cell lines. We discuss the generation of stable cell lines using transposons and lentivirus vectors (non-targeted transgene integration) and site-specific recombinases (targeted transgene integration). Each of these methods results in the generation of cell lines with protein yields that are generally superior to those achievable through classical plasmid transfection that depends on the integration of the transfected DNA by non-homologous DNA end-joining. This is the main reason why these techniques can also be used for the generation of stable cell pools, heterogenous populations of recombinant cells generated by gene delivery and genetic selection without resorting to single cell cloning. This allows the time line from gene transfer to protein production to be reduced. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Condensin suppresses recombination and regulates double-strand break processing at the repetitive ribosomal DNA array to ensure proper chromosome segregation during meiosis in budding yeast

    Science.gov (United States)

    Li, Ping; Jin, Hui; Yu, Hong-Guo

    2014-01-01

    During meiosis, homologues are linked by crossover, which is required for bipolar chromosome orientation before chromosome segregation at anaphase I. The repetitive ribosomal DNA (rDNA) array, however, undergoes little or no meiotic recombination. Hyperrecombination can cause chromosome missegregation and rDNA copy number instability. We report here that condensin, a conserved protein complex required for chromosome organization, regulates double-strand break (DSB) formation and repair at the rDNA gene cluster during meiosis in budding yeast. Condensin is highly enriched at the rDNA region during prophase I, released at the prophase I/metaphase I transition, and reassociates with rDNA before anaphase I onset. We show that condensin plays a dual role in maintaining rDNA stability: it suppresses the formation of Spo11-mediated rDNA breaks, and it promotes DSB processing to ensure proper chromosome segregation. Condensin is unnecessary for the export of rDNA breaks outside the nucleolus but required for timely repair of meiotic DSBs. Our work reveals that condensin coordinates meiotic recombination with chromosome segregation at the repetitive rDNA sequence, thereby maintaining genome integrity. PMID:25103240

  4. Controlled Release from Recombinant Polymers

    Science.gov (United States)

    Price, Robert; Poursaid, Azadeh; Ghandehari, Hamidreza

    2014-01-01

    Recombinant polymers provide a high degree of molecular definition for correlating structure with function in controlled release. The wide array of amino acids available as building blocks for these materials lend many advantages including biorecognition, biodegradability, potential biocompatibility, and control over mechanical properties among other attributes. Genetic engineering and DNA manipulation techniques enable the optimization of structure for precise control over spatial and temporal release. Unlike the majority of chemical synthetic strategies used, recombinant DNA technology has allowed for the production of monodisperse polymers with specifically defined sequences. Several classes of recombinant polymers have been used for controlled drug delivery. These include, but are not limited to, elastin-like, silk-like, and silk-elastinlike proteins, as well as emerging cationic polymers for gene delivery. In this article, progress and prospects of recombinant polymers used in controlled release will be reviewed. PMID:24956486

  5. A nuclear mutation defective in mitochondrial recombination in yeast.

    Science.gov (United States)

    Ling, F; Makishima, F; Morishima, N; Shibata, T

    1995-08-15

    Homologous recombination (crossing over and gene conversion) is generally essential for heritage and DNA repair, and occasionally causes DNA aberrations, in nuclei of eukaryotes. However, little is known about the roles of homologous recombination in the inheritance and stability of mitochondrial DNA which is continuously damaged by reactive oxygen species, by-products of respiration. Here, we report the first example of a nuclear recessive mutation which suggests an essential role for homologous recombination in the stable inheritance of mitochondrial DNA. For the detection of this class of mutants, we devised a novel procedure, 'mitochondrial crossing in haploid', which has enabled us to examine many mutant clones. Using this procedure, we examined mutants of Saccharomyces cerevisiae that showed an elevated UV induction of respiration-deficient mutations. We obtained a mutant that was defective in both the omega-intron homing and Endo.SceI-induced homologous gene conversion. We found that the mutant cells are temperature sensitive in the maintenance of mitochondrial DNA. A tetrad analysis indicated that elevated UV induction of respiration-deficient mutations, recombination deficiency and temperature sensitivity are all caused by a single nuclear mutation (mhr1) on chromosome XII. The pleiotropic characteristics of the mutant suggest an essential role for the MHR1 gene in DNA repair, recombination and the maintenance of DNA in mitochondria.

  6. DNA-dependent protein kinase inhibits AID-induced antibody gene conversion.

    Directory of Open Access Journals (Sweden)

    Adam J L Cook

    2007-04-01

    Full Text Available Affinity maturation and class switching of antibodies requires activation-induced cytidine deaminase (AID-dependent hypermutation of Ig V(DJ rearrangements and Ig S regions, respectively, in activated B cells. AID deaminates deoxycytidine bases in Ig genes, converting them into deoxyuridines. In V(DJ regions, subsequent excision of the deaminated bases by uracil-DNA glycosylase, or by mismatch repair, leads to further point mutation or gene conversion, depending on the species. In Ig S regions, nicking at the abasic sites produced by AID and uracil-DNA glycosylases results in staggered double-strand breaks, whose repair by nonhomologous end joining mediates Ig class switching. We have tested whether nonhomologous end joining also plays a role in V(DJ hypermutation using chicken DT40 cells deficient for Ku70 or the DNA-dependent protein kinase catalytic subunit (DNA-PKcs. Inactivation of the Ku70 or DNA-PKcs genes in DT40 cells elevated the rate of AID-induced gene conversion as much as 5-fold. Furthermore, DNA-PKcs-deficiency appeared to reduce point mutation. The data provide strong evidence that double-strand DNA ends capable of recruiting the DNA-dependent protein kinase complex are important intermediates in Ig V gene conversion.

  7. Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

    DEFF Research Database (Denmark)

    Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie

    2014-01-01

    The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sec...

  8. Recombinational repair: workshop summary

    International Nuclear Information System (INIS)

    Howard-Flanders, P.

    1983-01-01

    Recombinational repair may or may not be synonymous with postreplication repair. Considerable progress has been made in the study of the relevant enzymes, particularly those from bacteria. In this workshop we focus on the recombination enzyme RecA protein. What structural changes take place in the protein and in DNA during repair. How does homologous pairing take place. How is ATP hydrolysis coupled to the stand exchange reaction and the formation of heteroduplx DNA. Turning to another enzyme needed for certain kinds of bacterial recombination, we will ask whether the purified recB protein and recC protein complement each other and are sufficient for exonuclease V activity. In higher cells, we would like to know whether sister exchanges, which occur in bacteria after uv irradiation, are also seen in animal cells

  9. Excision of HIV-1 proviral DNA by recombinant cell permeable tre-recombinase.

    Directory of Open Access Journals (Sweden)

    Lakshmikanth Mariyanna

    Full Text Available Over the previous years, comprehensive studies on antiretroviral drugs resulted in the successful introduction of highly active antiretroviral therapy (HAART into clinical practice for treatment of HIV/AIDS. However, there is still need for new therapeutic approaches, since HAART cannot eradicate HIV-1 from the infected organism and, unfortunately, can be associated with long-term toxicity and the development of drug resistance. In contrast, novel gene therapy strategies may have the potential to reverse the infection by eradicating HIV-1. For example, expression of long terminal repeat (LTR-specific recombinase (Tre-recombinase has been shown to result in chromosomal excision of proviral DNA and, in consequence, in the eradication of HIV-1 from infected cell cultures. However, the delivery of Tre-recombinase currently depends on the genetic manipulation of target cells, a process that is complicating such therapeutic approaches and, thus, might be undesirable in a clinical setting. In this report we demonstrate that E.coli expressed Tre-recombinases, tagged either with the protein transduction domain (PTD from the HIV-1 Tat trans-activator or the translocation motif (TLM of the Hepatitis B virus PreS2 protein, were able to translocate efficiently into cells and showed significant recombination activity on HIV-1 LTR sequences. Tre activity was observed using episomal and stable integrated reporter constructs in transfected HeLa cells. Furthermore, the TLM-tagged enzyme was able to excise the full-length proviral DNA from chromosomal integration sites of HIV-1-infected HeLa and CEM-SS cells. The presented data confirm Tre-recombinase activity on integrated HIV-1 and provide the basis for the non-genetic transient application of engineered recombinases, which may be a valuable component of future HIV eradication strategies.

  10. Time-dependent wave-packet study of the direct low-energy dissociative recombination of HD+

    International Nuclear Information System (INIS)

    Orel, A. E.

    2000-01-01

    Wave-packet methods involving the numerical solution of the time-dependent Schroedinger equation have been used with great success in the calculation of cross sections for dissociative recombination of molecular ions by electron impact in the high energy region where the ''boomerang'' model [L. Dube and A. Herzenberg, Phys. Rev. A 11, 1314 (1975)] is valid. We extend this method to study low-energy dissociative recombination where this approximation is no longer appropriate. We apply the method to the ''direct'' low-energy dissociative recombination of HD + . Our results are in excellent agreement with calculations using the multichannel quantum defect method. (c) 2000 The American Physical Society

  11. The role of Candida albicans homologous recombination factors Rad54 and Rdh54 in DNA damage sensitivity

    Directory of Open Access Journals (Sweden)

    White Theodore C

    2011-09-01

    Full Text Available Abstract Background The fungal pathogen Candida albicans is frequently seen in immune suppressed patients, and resistance to one of the most widely used antifungals, fluconazole (FLC, can evolve rapidly. In recent years it has become clear that plasticity of the Candida albicans genome contributes to drug resistance through loss of heterozygosity (LOH at resistance genes and gross chromosomal rearrangements that amplify gene copy number of resistance associated genes. This study addresses the role of the homologous recombination factors Rad54 and Rdh54 in cell growth, DNA damage and FLC resistance in Candida albicans. Results The data presented here support a role for homologous recombination in cell growth and DNA damage sensitivity, as Candida albicans rad54Δ/rad54Δ mutants were hypersensitive to MMS and menadione, and had an aberrant cell and nuclear morphology. The Candida albicans rad54Δ/rad54Δ mutant was defective in invasion of Spider agar, presumably due to the altered cellular morphology. In contrast, mutation of the related gene RDH54 did not contribute significantly to DNA damage resistance and cell growth, and deletion of either Candida albicans RAD54 or Candida albicans RDH54 did not alter FLC susceptibility. Conclusions Together, these results support a role for homologous recombination in genome stability under nondamaging conditions. The nuclear morphology defects in the rad54Δ/rad54Δ mutants show that Rad54 performs an essential role during mitotic growth and that in its absence, cells arrest in G2. The viability of the single mutant rad54Δ/rad54Δ and the inability to construct the double mutant rad54Δ/rad54Δ rdh54Δ/rdh54Δ suggests that Rdh54 can partially compensate for Rad54 during mitotic growth.

  12. Genetic exchanges caused by ultraviolet photoproducts in phage lamda DNA molecules: the role of DNA replication

    International Nuclear Information System (INIS)

    Lin, P.F.; Howard-Flanders, P.; Yale Univ., New Haven, Conn.

    1976-01-01

    Genetic recombination induced by structural damage in DNA molecules was investigated in E. coli K12(lamda) lysogens infected with genetically marked phage lamda. Photoproducts were induced in the phage DNA before infection by exposing them either to 313 nm light in the presence of acetophenone or to 254 nm light. To test the role of the replication of the damage phage DNA on the frequency of the induced recombination , both heteroimmune and homoimmune crosses were performed, and scored for P + recombinants. In heteroimmune crosses, recombination was less frequent in infected cells exposed to visible light and in wild type cells able to perform excision repair than in excision-defective lysogens. Therefore, much of the induced recombination can be attributed to the pyrimidine dimers in the phage DNA. In homoimmune crosses, replication of the phage DNA containing ultraviolet photoproducts was represented by lamda immunity, and was further blocked by the lack of the P gene product needed for replication. The 254 nm photoproducts increased the frequency of recombination in these homoimmune crosses, even though phage DNA replication was blocked. Irradiation with 313 nm light and acetophenone M, which produces dimers and unknown photoproducts, was not as effective per dimer as the 254 nm light. It is concluded from these results that certain unidentified 254 nm photoproducts can cause recombination even in the absence of DNA replication. They are not pyrimidine dimers, as they are not susceptible to excision repair or photoreactivation. In contrast, pyrimidine dimers appear to cause recombination only when the DNA containing them undergoes replication. (orig./MG) [de

  13. Time-dependent mobility and recombination of the photoinduced charge carriers in conjugated polymer/fullerene bulk heterojunction solar cells

    Science.gov (United States)

    Mozer, A. J.; Dennler, G.; Sariciftci, N. S.; Westerling, M.; Pivrikas, A.; Österbacka, R.; Juška, G.

    2005-07-01

    Time-dependent mobility and recombination in the blend of poly[2-methoxy-5-(3,7-dimethyloctyloxy)-phenylene vinylene] (MDMO-PPV) and 1-(3-methoxycarbonyl)propyl-1-phenyl-(6,6)- C61 (PCBM) is studied simultaneously using the photoinduced charge carrier extraction by linearly increasing voltage technique. The charge carriers are photogenerated by a strongly absorbed, 3 ns laser flash, and extracted by the application of a reverse bias voltage pulse after an adjustable delay time (tdel) . It is found that the mobility of the extracted charge carriers decreases with increasing delay time, especially shortly after photoexcitation. The time-dependent mobility μ(t) is attributed to the energy relaxation of the charge carriers towards the tail states of the density of states distribution. A model based on a dispersive bimolecular recombination is formulated, which properly describes the concentration decay of the extracted charge carriers at all measured temperatures and concentrations. The calculated bimolecular recombination coefficient β(t) is also found to be time-dependent exhibiting a power law dependence as β(t)=β0t-(1-γ) with increasing slope (1-γ) with decreasing temperatures. The temperature dependence study reveals that both the mobility and recombination of the photogenerated charge carriers are thermally activated processes with activation energy in the range of 0.1 eV. Finally, the direct comparison of μ(t) and β(t) shows that the recombination of the long-lived charge carriers is controlled by diffusion.

  14. DNA requirements for interaction of the C-terminal region of Ku80 with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs).

    Science.gov (United States)

    Radhakrishnan, Sarvan Kumar; Lees-Miller, Susan P

    2017-09-01

    Non-homologous end joining (NHEJ) is the major pathway for the repair of ionizing radiation induced DNA double strand breaks (DSBs) in human cells. Critical to NHEJ is the DNA-dependent interaction of the Ku70/80 heterodimer with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs) to form the DNA-PK holoenzyme. However, precisely how Ku recruits DNA-PKcs to DSBs ends to enhance its kinase activity has remained enigmatic, with contradictory findings reported in the literature. Here we address the role of the Ku80 C-terminal region (CTR) in the DNA-dependent interaction of Ku70/80 with DNA-PKcs using purified components and defined DNA structures. Our results show that the Ku80 CTR is required for interaction with DNA-PKcs on short segments of blunt ended 25bp dsDNA or 25bp dsDNA with a 15-base poly dA single stranded (ss) DNA extension, but this requirement is less stringent on longer dsDNA molecules (35bp blunt ended dsDNA) or 25bp duplex DNA with either a 15-base poly dT or poly dC ssDNA extension. Moreover, the DNA-PKcs-Ku complex preferentially forms on 25 bp DNA with a poly-pyrimidine ssDNA extension.Our work clarifies the role of the Ku80 CTR and dsDNA ends on the interaction of DNA-PKcs with Ku and provides key information to guide assembly and biology of NHEJ complexes. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Molecular anatomy of the recombination mediator function of Saccharomyces cerevisiae Rad52

    DEFF Research Database (Denmark)

    Seong, C.; Sehorn, M.G.; Plate, Iben

    2008-01-01

    A helical filament of Rad51 on single-strand DNA (ssDNA), called the presynaptic filament, catalyzes DNA joint formation during homologous recombination. Rad52 facilitates presynaptic filament assembly, and this recombination mediator activity is thought to rely on the interactions of Rad52...... with Rad51, the ssDNA-binding protein RPA, and ssDNA. The N-terminal region of Rad52, which has DNA binding activity and an oligomeric structure, is thought to be crucial for mediator activity and recombination. Unexpectedly, we find that the C-terminal region of Rad52 also harbors a DNA binding function....... Importantly, the Rad52 C-terminal portion alone can promote Rad51 presynaptic filament assembly. The middle portion of Rad52 associates with DNA-bound RPA and contributes to the recombination mediator activity. Accordingly, expression of a protein species that harbors the middle and C-terminal regions of Rad...

  16. Physical analyses of E. coli heteroduplex recombination products in vivo: on the prevalence of 5' and 3' patches.

    Directory of Open Access Journals (Sweden)

    Laura M Gumbiner-Russo

    Full Text Available BACKGROUND: Homologous recombination in Escherichia coli creates patches (non-crossovers or splices (half crossovers, each of which may have associated heteroduplex DNA. Heteroduplex patches have recombinant DNA in one strand of the duplex, with parental flanking markers. Which DNA strand is exchanged in heteroduplex patches reflects the molecular mechanism of recombination. Several models for the mechanism of E. coli RecBCD-mediated recombinational double-strand-end (DSE repair specify that only the 3'-ending strand invades the homologous DNA, forming heteroduplex in that strand. There is, however, in vivo evidence that patches are found in both strands. METHODOLOGY/PRINCIPLE FINDINGS: This paper re-examines heteroduplex-patch-strand polarity using phage lambda and the lambdadv plasmid as DNA substrates recombined via the E. coli RecBCD system in vivo. These DNAs are mutant for lambda recombination functions, including orf and rap, which were functional in previous studies. Heteroduplexes are isolated, separated on polyacrylamide gels, and quantified using Southern blots for heteroduplex analysis. This method reveals that heteroduplexes are still found in either 5' or 3' DNA strands in approximately equal amounts, even in the absence of orf and rap. Also observed is an independence of the RuvC Holliday-junction endonuclease on patch formation, and a slight but statistically significant alteration of patch polarity by recD mutation. CONCLUSIONS/SIGNIFICANCE: These results indicate that orf and rap did not contribute to the presence of patches, and imply that patches occurring in both DNA strands reflects the molecular mechanism of recombination in E. coli. Most importantly, the lack of a requirement for RuvC implies that endonucleolytic resolution of Holliday junctions is not necessary for heteroduplex-patch formation, contrary to predictions of all of the major previous models. This implies that patches are not an alternative resolution of the

  17. Recombinant organisms for production of industrial products

    OpenAIRE

    Adrio, Jose-Luis; Demain, Arnold L

    2009-01-01

    A revolution in industrial microbiology was sparked by the discoveries of ther double-stranded structure of DNA and the development of recombinant DNA technology. Traditional industrial microbiology was merged with molecular biology to yield improved recombinant processes for the industrial production of primary and secondary metabolites, protein biopharmaceuticals and industrial enzymes. Novel genetic techniques such as metabolic engineering, combinatorial biosynthesis and molecular breeding...

  18. Regulation of the DNA Damage Response by DNA-PKcs Inhibitory Phosphorylation of ATM.

    Science.gov (United States)

    Zhou, Yi; Lee, Ji-Hoon; Jiang, Wenxia; Crowe, Jennie L; Zha, Shan; Paull, Tanya T

    2017-01-05

    Ataxia-telangiectasia mutated (ATM) regulates the DNA damage response as well as DNA double-strand break repair through homologous recombination. Here we show that ATM is hyperactive when the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) is chemically inhibited or when the DNA-PKcs gene is deleted in human cells. Pre-incubation of ATM protein with active DNA-PKcs also significantly reduces ATM activity in vitro. We characterize several phosphorylation sites in ATM that are targets of DNA-PKcs and show that phospho-mimetic mutations at these residues significantly inhibit ATM activity and impair ATM signaling upon DNA damage. In contrast, phospho-blocking mutations at one cluster of sites increase the frequency of apoptosis during normal cell growth. DNA-PKcs, which is integral to the non-homologous end joining pathway, thus negatively regulates ATM activity through phosphorylation of ATM. These observations illuminate an important regulatory mechanism for ATM that also controls DNA repair pathway choice. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Differentiation of Human Induced Pluripotent or Embryonic Stem Cells Decreases the DNA Damage Repair by Homologous Recombination

    Directory of Open Access Journals (Sweden)

    Kalpana Mujoo

    2017-11-01

    Full Text Available The nitric oxide (NO-cyclic GMP pathway contributes to human stem cell differentiation, but NO free radical production can also damage DNA, necessitating a robust DNA damage response (DDR to ensure cell survival. How the DDR is affected by differentiation is unclear. Differentiation of stem cells, either inducible pluripotent or embryonic derived, increased residual DNA damage as determined by γ-H2AX and 53BP1 foci, with increased S-phase-specific chromosomal aberration after exposure to DNA-damaging agents, suggesting reduced homologous recombination (HR repair as supported by the observation of decreased HR-related repair factor foci formation (RAD51 and BRCA1. Differentiated cells also had relatively increased fork stalling and R-loop formation after DNA replication stress. Treatment with NO donor (NOC-18, which causes stem cell differentiation has no effect on double-strand break (DSB repair by non-homologous end-joining but reduced DSB repair by HR. Present studies suggest that DNA repair by HR is impaired in differentiated cells.

  20. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  1. Distinct DNA-binding surfaces in the ATPase and linker domains of MutLγ determine its substrate specificities and exert separable functions in meiotic recombination and mismatch repair.

    Directory of Open Access Journals (Sweden)

    Corentin Claeys Bouuaert

    2017-05-01

    Full Text Available Mlh1-Mlh3 (MutLγ is a mismatch repair factor with a central role in formation of meiotic crossovers, presumably through resolution of double Holliday junctions. MutLγ has DNA-binding, nuclease, and ATPase activities, but how these relate to one another and to in vivo functions are unclear. Here, we combine biochemical and genetic analyses to characterize Saccharomyces cerevisiae MutLγ. Limited proteolysis and atomic force microscopy showed that purified recombinant MutLγ undergoes ATP-driven conformational changes. In vitro, MutLγ displayed separable DNA-binding activities toward Holliday junctions (HJ and, surprisingly, single-stranded DNA (ssDNA, which was not predicted from current models. MutLγ bound DNA cooperatively, could bind multiple substrates simultaneously, and formed higher-order complexes. FeBABE hydroxyl radical footprinting indicated that the DNA-binding interfaces of MutLγ for ssDNA and HJ substrates only partially overlap. Most contacts with HJ substrates were located in the linker regions of MutLγ, whereas ssDNA contacts mapped within linker regions as well as the N-terminal ATPase domains. Using yeast genetic assays for mismatch repair and meiotic recombination, we found that mutations within different DNA-binding surfaces exert separable effects in vivo. For example, mutations within the Mlh1 linker conferred little or no meiotic phenotype but led to mismatch repair deficiency. Interestingly, mutations in the N-terminal domain of Mlh1 caused a stronger meiotic defect than mlh1Δ, suggesting that the mutant proteins retain an activity that interferes with alternative recombination pathways. Furthermore, mlh3Δ caused more chromosome missegregation than mlh1Δ, whereas mlh1Δ but not mlh3Δ partially alleviated meiotic defects of msh5Δ mutants. These findings illustrate functional differences between Mlh1 and Mlh3 during meiosis and suggest that their absence impinges on chromosome segregation not only via reduced

  2. Prevalence of Germline Mutations in Genes Engaged in DNA Damage Repair by Homologous Recombination in Patients with Triple-Negative and Hereditary Non-Triple-Negative Breast Cancers.

    Directory of Open Access Journals (Sweden)

    Pawel Domagala

    Full Text Available This study sought to assess the prevalence of common germline mutations in several genes engaged in the repair of DNA double-strand break by homologous recombination in patients with triple-negative breast cancers and hereditary non-triple-negative breast cancers. Tumors deficient in this type of DNA damage repair are known to be especially sensitive to DNA cross-linking agents (e.g., platinum drugs and to poly(ADP-ribose polymerase (PARP inhibitors.Genetic testing was performed for 36 common germline mutations in genes engaged in the repair of DNA by homologous recombination, i.e., BRCA1, BRCA2, CHEK2, NBN, ATM, PALB2, BARD1, and RAD51D, in 202 consecutive patients with triple-negative breast cancers and hereditary non-triple-negative breast cancers.Thirty five (22.2% of 158 patients in the triple-negative group carried mutations in genes involved in DNA repair by homologous recombination, while 10 (22.7% of the 44 patients in the hereditary non-triple-negative group carried such mutations. Mutations in BRCA1 were most frequent in patients with triple-negative breast cancer (18.4%, and mutations in CHEK2 were most frequent in patients with hereditary non-triple-negative breast cancers (15.9%. In addition, in the triple-negative group, mutations in CHEK2, NBN, and ATM (3.8% combined were found, while mutations in BRCA1, NBN, and PALB2 (6.8% combined were identified in the hereditary non-triple-negative group.Identifying mutations in genes engaged in DNA damage repair by homologous recombination other than BRCA1/2 can substantially increase the proportion of patients with triple-negative breast cancer and hereditary non-triple-negative breast cancer who may be eligible for therapy using PARP inhibitors and platinum drugs.

  3. The contribution of alu elements to mutagenic DNA double-strand break repair.

    Science.gov (United States)

    Morales, Maria E; White, Travis B; Streva, Vincent A; DeFreece, Cecily B; Hedges, Dale J; Deininger, Prescott L

    2015-03-01

    Alu elements make up the largest family of human mobile elements, numbering 1.1 million copies and comprising 11% of the human genome. As a consequence of evolution and genetic drift, Alu elements of various sequence divergence exist throughout the human genome. Alu/Alu recombination has been shown to cause approximately 0.5% of new human genetic diseases and contribute to extensive genomic structural variation. To begin understanding the molecular mechanisms leading to these rearrangements in mammalian cells, we constructed Alu/Alu recombination reporter cell lines containing Alu elements ranging in sequence divergence from 0%-30% that allow detection of both Alu/Alu recombination and large non-homologous end joining (NHEJ) deletions that range from 1.0 to 1.9 kb in size. Introduction of as little as 0.7% sequence divergence between Alu elements resulted in a significant reduction in recombination, which indicates even small degrees of sequence divergence reduce the efficiency of homology-directed DNA double-strand break (DSB) repair. Further reduction in recombination was observed in a sequence divergence-dependent manner for diverged Alu/Alu recombination constructs with up to 10% sequence divergence. With greater levels of sequence divergence (15%-30%), we observed a significant increase in DSB repair due to a shift from Alu/Alu recombination to variable-length NHEJ which removes sequence between the two Alu elements. This increase in NHEJ deletions depends on the presence of Alu sequence homeology (similar but not identical sequences). Analysis of recombination products revealed that Alu/Alu recombination junctions occur more frequently in the first 100 bp of the Alu element within our reporter assay, just as they do in genomic Alu/Alu recombination events. This is the first extensive study characterizing the influence of Alu element sequence divergence on DNA repair, which will inform predictions regarding the effect of Alu element sequence divergence on both

  4. The unconventional xer recombination machinery of Streptococci/Lactococci

    NARCIS (Netherlands)

    Le Bourgeois, Pascal; Bugarel, Marie; Campo, Nathalie; Daveran-Mingot, Marie-Line; Labonte, Jessica; Lanfranchi, Daniel; Lautier, Thomas; Pages, Carine; Ritzenthaler, Paul

    Homologous recombination between circular sister chromosomes during DNA replication in bacteria can generate chromosome dimers that must be resolved into monomers prior to cell division. In Escherichia coli, dimer resolution is achieved by site-specific recombination, Xer recombination, involving

  5. Genome-Wide Analysis of Heteroduplex DNA in Mismatch Repair–Deficient Yeast Cells Reveals Novel Properties of Meiotic Recombination Pathways

    Science.gov (United States)

    Martini, Emmanuelle; Borde, Valérie; Legendre, Matthieu; Audic, Stéphane; Regnault, Béatrice; Soubigou, Guillaume; Dujon, Bernard; Llorente, Bertrand

    2011-01-01

    Meiotic DNA double-strand breaks (DSBs) initiate crossover (CO) recombination, which is necessary for accurate chromosome segregation, but DSBs may also repair as non-crossovers (NCOs). Multiple recombination pathways with specific intermediates are expected to lead to COs and NCOs. We revisited the mechanisms of meiotic DSB repair and the regulation of CO formation, by conducting a genome-wide analysis of strand-transfer intermediates associated with recombination events. We performed this analysis in a SK1 × S288C Saccharomyces cerevisiae hybrid lacking the mismatch repair (MMR) protein Msh2, to allow efficient detection of heteroduplex DNAs (hDNAs). First, we observed that the anti-recombinogenic activity of MMR is responsible for a 20% drop in CO number, suggesting that in MMR–proficient cells some DSBs are repaired using the sister chromatid as a template when polymorphisms are present. Second, we observed that a large fraction of NCOs were associated with trans–hDNA tracts constrained to a single chromatid. This unexpected finding is compatible with dissolution of double Holliday junctions (dHJs) during repair, and it suggests the existence of a novel control point for CO formation at the level of the dHJ intermediate, in addition to the previously described control point before the dHJ formation step. Finally, we observed that COs are associated with complex hDNA patterns, confirming that the canonical double-strand break repair model is not sufficient to explain the formation of most COs. We propose that multiple factors contribute to the complexity of recombination intermediates. These factors include repair of nicks and double-stranded gaps, template switches between non-sister and sister chromatids, and HJ branch migration. Finally, the good correlation between the strand transfer properties observed in the absence of and in the presence of Msh2 suggests that the intermediates detected in the absence of Msh2 reflect normal intermediates. PMID

  6. Genome-wide analysis of heteroduplex DNA in mismatch repair-deficient yeast cells reveals novel properties of meiotic recombination pathways.

    Directory of Open Access Journals (Sweden)

    Emmanuelle Martini

    2011-09-01

    Full Text Available Meiotic DNA double-strand breaks (DSBs initiate crossover (CO recombination, which is necessary for accurate chromosome segregation, but DSBs may also repair as non-crossovers (NCOs. Multiple recombination pathways with specific intermediates are expected to lead to COs and NCOs. We revisited the mechanisms of meiotic DSB repair and the regulation of CO formation, by conducting a genome-wide analysis of strand-transfer intermediates associated with recombination events. We performed this analysis in a SK1 × S288C Saccharomyces cerevisiae hybrid lacking the mismatch repair (MMR protein Msh2, to allow efficient detection of heteroduplex DNAs (hDNAs. First, we observed that the anti-recombinogenic activity of MMR is responsible for a 20% drop in CO number, suggesting that in MMR-proficient cells some DSBs are repaired using the sister chromatid as a template when polymorphisms are present. Second, we observed that a large fraction of NCOs were associated with trans-hDNA tracts constrained to a single chromatid. This unexpected finding is compatible with dissolution of double Holliday junctions (dHJs during repair, and it suggests the existence of a novel control point for CO formation at the level of the dHJ intermediate, in addition to the previously described control point before the dHJ formation step. Finally, we observed that COs are associated with complex hDNA patterns, confirming that the canonical double-strand break repair model is not sufficient to explain the formation of most COs. We propose that multiple factors contribute to the complexity of recombination intermediates. These factors include repair of nicks and double-stranded gaps, template switches between non-sister and sister chromatids, and HJ branch migration. Finally, the good correlation between the strand transfer properties observed in the absence of and in the presence of Msh2 suggests that the intermediates detected in the absence of Msh2 reflect normal intermediates.

  7. Gene conversion at the gray locus of Sordaria fimicola: fit of the experimental data to a hybrid DNA model of recombination.

    Science.gov (United States)

    Kalogeropoulos, A; Thuriaux, P

    1985-03-01

    A hybrid DNA (hDNA) model of recombination has been algebraically formulated, which allows the prediction of frequencies of postmeiotic segregation and conversion of a given allele and their probability of being associated with a crossing over. The model considered is essentially the "Aviemore model." In contrast to some other interpretations of recombination, it states that gene conversion can only result from the repair of heteroduplex hDNA, with postmeiotic segregation resulting from unrepaired heteroduplexes. The model also postulates that crossing over always occurs distally to the initiation site of the hDNA. Eleven types of conversion and postmeiotic segregation with or without associated crossover were considered. Their theoretical frequencies are given by 11 linear equations with ten variables, four describing heteroduplex repair, four giving the probability of hDNA formation and its topological properties and two giving the probability that crossing over occurs at the left or right of the converting allele. Using the experimental data of Kitani and coworkers on conversion at the six best studied gray alleles of Sordaria fimicola, we found that the model considered fit the data at a P level above or very close (allele h4) to the 5% level of sampling error provided that the hDNA is partly asymmetric. The best fitting solutions are such that the hDNA has an equal probability of being formed on either chromatid or, alternatively, that both DNA strands have the same probability of acting as the invading strand during hDNA formation. The two mismatches corresponding to a given allele are repaired with different efficiencies. Optimal solutions are found if one allows for repair to be more efficient on the asymmetric hDNA than on the symmetric one. In the case of allele g1, our data imply that the direction of repair is nonrandom with respect to the strand on which it occurs.

  8. Characterization of recombinant human HBP/CAP37/azurocidin, a pleiotropic mediator of inflammation-enhancing LPS-induced cytokine release from monocytes.

    Science.gov (United States)

    Rasmussen, P B; Bjørn, S; Hastrup, S; Nielsen, P F; Norris, K; Thim, L; Wiberg, F C; Flodgaard, H

    1996-07-15

    Neutrophil-derived heparin-binding protein (HBP) is a strong chemoattractant for monocytes. We report here for the first time the expression of recombinant HBP. A baculovirus containing the human HBP cDNA mediated in insect cells the secretion of a 7-residue N-terminally extended HBP form (pro-HBP). Deletion of the pro-peptide-encoding cDNA sequence resulted in correctly processed HBP at the N-terminus. Electrospray mass spectrum analysis of recombinant HBP yielded a molecular weight of 27.237 +/- 3 amu. Consistent with this mass is a HBP form of 225 amino acids (mature part +3 amino acid C-terminal extension). The biological activity of recombinant HBP was confirmed by its chemotactic action towards monocytes. Furthermore, we have shown that recombinant HBP stimulates in a dose-dependent manner the lipopolysaccharide (LPS)-induced cytokine release from human monocytes.

  9. Research and development of basic technologies for the next generation industries, 'recombinant DNA utilizing technology'. Evaluation on the research and development; Jisedai sangyo kiban gijutsu kenkyu kaihatsu 'kumikae DNA riyo gijutsu'. Kenkyu kaihatsu hyoka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-03-01

    Research, development and evaluation were performed with an objective of establishing the basic technology related to the recombinant DNA utilizing technology to create new microorganisms for processes in the chemical industry. The major achievements of the present research and development include establishment of the P450 gene manifestation system attributed from microsomes and mitochondria, and the success of the world's first simultaneous manifestation of P450 and reduction enzyme. Furthermore, the fused enzyme combining P450 and the reduction enzyme genetically was successfully manufactured ahead of the other countries, opening the way to industrializing the recombinant enzymes for use in bio-processes in the chemical industry. In creating a high-efficiency secretion recombinant bacillus subtilis stock, a bacillus subtilis host whose protease activity has been noticeably decreased was created. As an achievement of the research on the 'basic recombinant DNA technology', high-efficiency manifestation vector of medium level thermophile was created, and its usefulness was demonstrated. In addition, a host and vector system for high level thermophile was developed for the first time in the world. These achievements have opened the way to industrial utilization of the thermophilic bacteria. (NEDO)

  10. DNA end resection by CtIP and exonuclease 1 prevents genomic instability

    DEFF Research Database (Denmark)

    Eid, Wassim; Steger, Martin; El-Shemerly, Mahmoud

    2010-01-01

    End resection of DNA-which is essential for the repair of DNA double-strand breaks (DSBs) by homologous recombination-relies first on the partnership between MRE11-RAD50-NBS1 (MRN) and CtIP, followed by a processive step involving helicases and exonucleases such as exonuclease 1 (EXO1). In this s......End resection of DNA-which is essential for the repair of DNA double-strand breaks (DSBs) by homologous recombination-relies first on the partnership between MRE11-RAD50-NBS1 (MRN) and CtIP, followed by a processive step involving helicases and exonucleases such as exonuclease 1 (EXO1...... of DNA-PK-dependent radial chromosome formation. Thus, our study identifies new functions of CtIP and EXO1 in DNA end resection and provides new information on the regulation of DSB repair pathways, which is a key factor in the maintenance of genome integrity....

  11. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H; Frykholm, Karolin; Reymer, Anna; Renodon-Corniè re, Axelle; Takahashi, Masayuki; Nordé n, Bengt

    2012-01-01

    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated

  12. Meiotic recombination hotspots - a comparative view.

    Science.gov (United States)

    Choi, Kyuha; Henderson, Ian R

    2015-07-01

    During meiosis homologous chromosomes pair and undergo reciprocal genetic exchange, termed crossover. Meiotic recombination has a profound effect on patterns of genetic variation and is an important tool during crop breeding. Crossovers initiate from programmed DNA double-stranded breaks that are processed to form single-stranded DNA, which can invade a homologous chromosome. Strand invasion events mature into double Holliday junctions that can be resolved as crossovers. Extensive variation in the frequency of meiotic recombination occurs along chromosomes and is typically focused in narrow hotspots, observed both at the level of DNA breaks and final crossovers. We review methodologies to profile hotspots at different steps of the meiotic recombination pathway that have been used in different eukaryote species. We then discuss what these studies have revealed concerning specification of hotspot locations and activity and the contributions of both genetic and epigenetic factors. Understanding hotspots is important for interpreting patterns of genetic variation in populations and how eukaryotic genomes evolve. In addition, manipulation of hotspots will allow us to accelerate crop breeding, where meiotic recombination distributions can be limiting. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  13. DNA2—An Important Player in DNA Damage Response or Just Another DNA Maintenance Protein?

    Directory of Open Access Journals (Sweden)

    Elzbieta Pawłowska

    2017-07-01

    Full Text Available The human DNA2 (DNA replication helicase/nuclease 2 protein is expressed in both the nucleus and mitochondria, where it displays ATPase-dependent nuclease and helicase activities. DNA2 plays an important role in the removing of long flaps in DNA replication and long-patch base excision repair (LP-BER, interacting with the replication protein A (RPA and the flap endonuclease 1 (FEN1. DNA2 can promote the restart of arrested replication fork along with Werner syndrome ATP-dependent helicase (WRN and Bloom syndrome protein (BLM. In mitochondria, DNA2 can facilitate primer removal during strand-displacement replication. DNA2 is involved in DNA double strand (DSB repair, in which it is complexed with BLM, RPA and MRN for DNA strand resection required for homologous recombination repair. DNA2 can be a major protein involved in the repair of complex DNA damage containing a DSB and a 5′ adduct resulting from a chemical group bound to DNA 5′ ends, created by ionizing radiation and several anticancer drugs, including etoposide, mitoxantrone and some anthracyclines. The role of DNA2 in telomere end maintenance and cell cycle regulation suggests its more general role in keeping genomic stability, which is impaired in cancer. Therefore DNA2 can be an attractive target in cancer therapy. This is supported by enhanced expression of DNA2 in many cancer cell lines with oncogene activation and premalignant cells. Therefore, DNA2 can be considered as a potential marker, useful in cancer therapy. DNA2, along with PARP1 inhibition, may be considered as a potential target for inducing synthetic lethality, a concept of killing tumor cells by targeting two essential genes.

  14. Metal binding proteins, recombinant host cells and methods

    Science.gov (United States)

    Summers, Anne O.; Caguiat, Jonathan J.

    2004-06-15

    The present disclosure provides artificial heavy metal binding proteins termed chelons by the inventors. These chelons bind cadmium and/or mercuric ions with relatively high affinity. Also disclosed are coding sequences, recombinant DNA molecules and recombinant host cells comprising those recombinant DNA molecules for expression of the chelon proteins. In the recombinant host cells or transgenic plants, the chelons can be used to bind heavy metals taken up from contaminated soil, groundwater or irrigation water and to concentrate and sequester those ions. Recombinant enteric bacteria can be used within the gastrointestinal tracts of animals or humans exposed to toxic metal ions such as mercury and/or cadmium, where the chelon recombinantly expressed in chosen in accordance with the ion to be rededicated. Alternatively, the chelons can be immobilized to solid supports to bind and concentrate heavy metals from a contaminated aqueous medium including biological fluids.

  15. A nuclear mutation defective in mitochondrial recombination in yeast.

    OpenAIRE

    Ling, F; Makishima, F; Morishima, N; Shibata, T

    1995-01-01

    Homologous recombination (crossing over and gene conversion) is generally essential for heritage and DNA repair, and occasionally causes DNA aberrations, in nuclei of eukaryotes. However, little is known about the roles of homologous recombination in the inheritance and stability of mitochondrial DNA which is continuously damaged by reactive oxygen species, by-products of respiration. Here, we report the first example of a nuclear recessive mutation which suggests an essential role for homolo...

  16. A prime/boost strategy by DNA/fowlpox recombinants expressing a mutant E7 protein for the immunotherapy of HPV-associated cancers.

    Science.gov (United States)

    Radaelli, Antonia; De Giuli Morghen, Carlo; Zanotto, Carlo; Pacchioni, Sole; Bissa, Massimiliano; Franconi, Rosella; Massa, Silvia; Paolini, Francesca; Muller, Antonio; Venuti, Aldo

    2012-12-01

    Development of effective therapeutic vaccines against human papilloma virus (HPV) infections remains a priority, considering the high number of new cases of cervical cancer each year by high-risk HPVs, in particular by HPV-16. Vaccines expressing the E7 oncoprotein, which is detectable in all HPV-positive pre-cancerous and cancer cells, might clear already established tumors and support the treatment of HPV-related lesions. In this study, DNA or fowlpox virus recombinants expressing the harmless variant E7GGG of the HPV-16 E7 oncoprotein (DNA(E7GGG) and FP(E7GGG)) were generated. Two immunization regimens were tested in a pre-clinical mouse model by homologous (FP/FP) or heterologous (DNA/FP) prime-boost protocols to evaluate the immune response and therapeutic efficacy of the proposed HPV-16 vaccine. Low levels of anti-E7-specific antibodies were elicited after immunization, and in vivo experiments resulted in a higher number of tumor-free mice after the heterologous immunization. These results establish a preliminary indication for therapy of HPV-related tumors by the combined use of DNA and avipox recombinants, which might represent safer immunogens than vaccinia-based vaccines. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. A newly identified DNA ligase of Saccharomyces cerevisiae involved in RAD52-independent repair of DNA double-strand breaks

    Science.gov (United States)

    Schär, Primo; Herrmann, Gernot; Daly, Graham; Lindahl, Tomas

    1997-01-01

    Eukaryotic DNA ligases are ATP-dependent DNA strand-joining enzymes that participate in DNA replication, repair, and recombination. Whereas mammalian cells contain several different DNA ligases, encoded by at least three distinct genes, only one DNA ligase has been detected previously in either budding yeast or fission yeast. Here, we describe a newly identified nonessential Saccharomyces cerevisiae gene that encodes a DNA ligase distinct from the CDC9 gene product. This DNA ligase shares significant amino acid sequence homology with human DNA ligase IV; accordingly, we designate the yeast gene LIG4. Recombinant LIG4 protein forms a covalent enzyme-AMP complex and can join a DNA single-strand break in a DNA/RNA hybrid duplex, the preferred substrate in vitro. Disruption of the LIG4 gene causes only marginally increased cellular sensitivity to several DNA damaging agents, and does not further sensitize cdc9 or rad52 mutant cells. In contrast, lig4 mutant cells have a 1000-fold reduced capacity for correct recircularization of linearized plasmids by illegitimate end-joining after transformation. Moreover, homozygous lig4 mutant diploids sporulate less efficiently than isogenic wild-type cells, and show retarded progression through meiotic prophase I. Spore viability is normal, but lig4 mutants appear to produce a higher proportion of tetrads with only three viable spores. The mutant phenotypes are consistent with functions of LIG4 in an illegitimate DNA end-joining pathway and ensuring efficient meiosis. PMID:9271115

  18. Recovery of arrested replication forks by homologous recombination is error-prone.

    Directory of Open Access Journals (Sweden)

    Ismail Iraqui

    Full Text Available Homologous recombination is a universal mechanism that allows repair of DNA and provides support for DNA replication. Homologous recombination is therefore a major pathway that suppresses non-homology-mediated genome instability. Here, we report that recovery of impeded replication forks by homologous recombination is error-prone. Using a fork-arrest-based assay in fission yeast, we demonstrate that a single collapsed fork can cause mutations and large-scale genomic changes, including deletions and translocations. Fork-arrest-induced gross chromosomal rearrangements are mediated by inappropriate ectopic recombination events at the site of collapsed forks. Inverted repeats near the site of fork collapse stimulate large-scale genomic changes up to 1,500 times over spontaneous events. We also show that the high accuracy of DNA replication during S-phase is impaired by impediments to fork progression, since fork-arrest-induced mutation is due to erroneous DNA synthesis during recovery of replication forks. The mutations caused are small insertions/duplications between short tandem repeats (micro-homology indicative of replication slippage. Our data establish that collapsed forks, but not stalled forks, recovered by homologous recombination are prone to replication slippage. The inaccuracy of DNA synthesis does not rely on PCNA ubiquitination or trans-lesion-synthesis DNA polymerases, and it is not counteracted by mismatch repair. We propose that deletions/insertions, mediated by micro-homology, leading to copy number variations during replication stress may arise by progression of error-prone replication forks restarted by homologous recombination.

  19. Recombinant vaccines and the development of new vaccine strategies

    Energy Technology Data Exchange (ETDEWEB)

    Nascimento, I.P.; Leite, L.C.C. [Centro de Biotecnologia, Instituto Butantan, São Paulo, SP (Brazil)

    2012-09-07

    Vaccines were initially developed on an empirical basis, relying mostly on attenuation or inactivation of pathogens. Advances in immunology, molecular biology, biochemistry, genomics, and proteomics have added new perspectives to the vaccinology field. The use of recombinant proteins allows the targeting of immune responses focused against few protective antigens. There are a variety of expression systems with different advantages, allowing the production of large quantities of proteins depending on the required characteristics. Live recombinant bacteria or viral vectors effectively stimulate the immune system as in natural infections and have intrinsic adjuvant properties. DNA vaccines, which consist of non-replicating plasmids, can induce strong long-term cellular immune responses. Prime-boost strategies combine different antigen delivery systems to broaden the immune response. In general, all of these strategies have shown advantages and disadvantages, and their use will depend on the knowledge of the mechanisms of infection of the target pathogen and of the immune response required for protection. In this review, we discuss some of the major breakthroughs that have been achieved using recombinant vaccine technologies, as well as new approaches and strategies for vaccine development, including potential shortcomings and risks.

  20. Recombinant vaccines and the development of new vaccine strategies

    Directory of Open Access Journals (Sweden)

    I.P. Nascimento

    2012-12-01

    Full Text Available Vaccines were initially developed on an empirical basis, relying mostly on attenuation or inactivation of pathogens. Advances in immunology, molecular biology, biochemistry, genomics, and proteomics have added new perspectives to the vaccinology field. The use of recombinant proteins allows the targeting of immune responses focused against few protective antigens. There are a variety of expression systems with different advantages, allowing the production of large quantities of proteins depending on the required characteristics. Live recombinant bacteria or viral vectors effectively stimulate the immune system as in natural infections and have intrinsic adjuvant properties. DNA vaccines, which consist of non-replicating plasmids, can induce strong long-term cellular immune responses. Prime-boost strategies combine different antigen delivery systems to broaden the immune response. In general, all of these strategies have shown advantages and disadvantages, and their use will depend on the knowledge of the mechanisms of infection of the target pathogen and of the immune response required for protection. In this review, we discuss some of the major breakthroughs that have been achieved using recombinant vaccine technologies, as well as new approaches and strategies for vaccine development, including potential shortcomings and risks.

  1. Recombinant vaccines and the development of new vaccine strategies

    International Nuclear Information System (INIS)

    Nascimento, I.P.; Leite, L.C.C.

    2012-01-01

    Vaccines were initially developed on an empirical basis, relying mostly on attenuation or inactivation of pathogens. Advances in immunology, molecular biology, biochemistry, genomics, and proteomics have added new perspectives to the vaccinology field. The use of recombinant proteins allows the targeting of immune responses focused against few protective antigens. There are a variety of expression systems with different advantages, allowing the production of large quantities of proteins depending on the required characteristics. Live recombinant bacteria or viral vectors effectively stimulate the immune system as in natural infections and have intrinsic adjuvant properties. DNA vaccines, which consist of non-replicating plasmids, can induce strong long-term cellular immune responses. Prime-boost strategies combine different antigen delivery systems to broaden the immune response. In general, all of these strategies have shown advantages and disadvantages, and their use will depend on the knowledge of the mechanisms of infection of the target pathogen and of the immune response required for protection. In this review, we discuss some of the major breakthroughs that have been achieved using recombinant vaccine technologies, as well as new approaches and strategies for vaccine development, including potential shortcomings and risks

  2. Regulation of rDNA stability by sumoylation

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine; Lisby, Michael

    2009-01-01

    Repair of DNA lesions by homologous recombination relies on the copying of genetic information from an intact homologous sequence. However, many eukaryotic genomes contain repetitive sequences such as the ribosomal gene locus (rDNA), which poses a risk for illegitimate recombination. Therefore, t......6 complex and sumoylation of Rad52, which directs DNA double-strand breaks in the rDNA to relocalize from within the nucleolus to the nucleoplasm before association with the recombination machinery. The relocalization before repair is important for maintaining rDNA stability. The focus...

  3. Rad10 exhibits lesion-dependent genetic requirements for recruitment to DNA double-strand breaks in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Moore, Destaye M; Karlin, Justin; González-Barrera, Sergio

    2009-01-01

    In the yeast Saccharomyces cerevisiae, the Rad1-Rad10 protein complex participates in nucleotide excision repair (NER) and homologous recombination (HR). During HR, the Rad1-Rad10 endonuclease cleaves 3' branches of DNA and aberrant 3' DNA ends that are refractory to other 3' processing enzymes. ...

  4. Regulation of Meiotic Recombination

    Energy Technology Data Exchange (ETDEWEB)

    Gregory p. Copenhaver

    2011-11-09

    Meiotic recombination results in the heritable rearrangement of DNA, primarily through reciprocal exchange between homologous chromosome or gene conversion. In plants these events are critical for ensuring proper chromosome segregation, facilitating DNA repair and providing a basis for genetic diversity. Understanding this fundamental biological mechanism will directly facilitate trait mapping, conventional plant breeding, and development of genetic engineering techniques that will help support the responsible production and conversion of renewable resources for fuels, chemicals, and the conservation of energy (1-3). Substantial progress has been made in understanding the basal recombination machinery, much of which is conserved in organisms as diverse as yeast, plants and mammals (4, 5). Significantly less is known about the factors that regulate how often and where that basal machinery acts on higher eukaryotic chromosomes. One important mechanism for regulating the frequency and distribution of meiotic recombination is crossover interference - or the ability of one recombination event to influence nearby events. The MUS81 gene is thought to play an important role in regulating the influence of interference on crossing over. The immediate goals of this project are to use reverse genetics to identify mutants in two putative MUS81 homologs in the model plant Arabidopsis thaliana, characterize those mutants and initiate a novel forward genetic screen for additional regulators of meiotic recombination. The long-term goal of the project is to understand how meiotic recombination is regulated in higher eukaryotes with an emphasis on the molecular basis of crossover interference. The ability to monitor recombination in all four meiotic products (tetrad analysis) has been a powerful tool in the arsenal of yeast geneticists. Previously, the qrt mutant of Arabidopsis, which causes the four pollen products of male meiosis to remain attached, was developed as a facile system

  5. Intranuclear Delivery of a Novel Antibody-Derived Radiosensitizer Targeting the DNA-Dependent Protein Kinase Catalytic Subunit

    Energy Technology Data Exchange (ETDEWEB)

    Xiong Hairong [Institute of Molecular Medicine and Genetics, Georgia Health Sciences University, Augusta, GA (Georgia); State Key Laboratory of Virology, Institute of Medical Virology, Wuhan University School of Medicine, Wuhan (China); Lee, Robert J. [Division of Pharmaceutics, College of Pharmacy, Ohio State University, Columbus, OH (United States); Haura, Eric B. [Thoracic Oncology and Experimental Therapeutics Programs, H. Lee Moffitt Cancer Center and Research Institute, Tampa, FL (United States); Edwards, John G. [Apeliotus Technologies, Inc., Atlanta, GA (United States); Dynan, William S. [Institute of Molecular Medicine and Genetics, Georgia Health Sciences University, Augusta, GA (Georgia); Li Shuyi, E-mail: sli@georgiahealth.edu [Institute of Molecular Medicine and Genetics, Georgia Health Sciences University, Augusta, GA (Georgia); Apeliotus Technologies, Inc., Atlanta, GA (United States)

    2012-07-01

    Purpose: To inhibit DNA double-strand break repair in tumor cells by delivery of a single-chain antibody variable region fragment (ScFv 18-2) to the cell nucleus. ScFv 18-2 binds to a regulatory region of the DNA-dependent protein kinase (DNA-PK), an essential enzyme in the nonhomologous end-joining pathway, and inhibits DNA end-joining in a cell-free system and when microinjected into single cells. Development as a radiosensitizer has been limited by the lack of a method for intranuclear delivery to target cells. We investigated a delivery method based on folate receptor-mediated endocytosis. Methods and Materials: A recombinant ScFv 18-2 derivative was conjugated to folate via a scissile disulfide linker. Folate-ScFv 18-2 was characterized for its ability to be internalized by tumor cells and to influence the behavior of ionizing radiation-induced repair foci. Radiosensitization was measured in a clonogenic survival assay. Survival curves were fitted to a linear-quadratic model, and between-group differences were evaluated by an F test. Sensitization ratios were determined based on mean inhibitory dose. Results: Human KB and NCI-H292 lung cancer cells treated with folate-conjugated ScFv 18-2 showed significant radiosensitization (p < 0.001). Sensitization enhancement ratios were 1.92 {+-} 0.42 for KB cells and 1.63 {+-} 0.13 for NCI-H292 cells. Studies suggest that treatment inhibits repair of radiation-induced DSBs, as evidenced by the persistence of {gamma}-H2AX-stained foci and by inhibition of staining with anti-DNA-PKcs phosphoserine 2056. Conclusions: Folate-mediated endocytosis is an effective method for intranuclear delivery of an antibody-derived DNA repair inhibitor.

  6. Recombination Phenotypes of Escherichia coli greA Mutants

    Directory of Open Access Journals (Sweden)

    Poteete Anthony R

    2011-03-01

    Full Text Available Abstract Background The elongation factor GreA binds to RNA polymerase and modulates transcriptional pausing. Some recent research suggests that the primary role of GreA may not be to regulate gene expression, but rather, to promote the progression of replication forks which collide with RNA polymerase, and which might otherwise collapse. Replication fork collapse is known to generate dsDNA breaks, which can be recombinogenic. It follows that GreA malfunction could have consequences affecting homologous recombination. Results Escherichia coli mutants bearing substitutions of the active site acidic residues of the transcription elongation factor GreA, D41N and E44K, were isolated as suppressors of growth inhibition by a toxic variant of the bacteriophage lambda Red-beta recombination protein. These mutants, as well as a D41A greA mutant and a greA deletion, were tested for proficiency in recombination events. The mutations were found to increase the efficiency of RecA-RecBCD-mediated and RecA-Red-mediated recombination, which are replication-independent, and to decrease the efficiency of replication-dependent Red-mediated recombination. Conclusion These observations provide new evidence for a role of GreA in resolving conflicts between replication and transcription.

  7. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    International Nuclear Information System (INIS)

    Shokri, Leila; Williams, Mark C; Rouzina, Ioulia

    2009-01-01

    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork

  8. Diffusion-driven and excitation-dependent recombination rate in blue InGaN/GaN quantum well structures

    International Nuclear Information System (INIS)

    Aleksiejūnas, R.; Gelžinytė, K.; Nargelas, S.; Jarašiūnas, K.; Vengris, M.; Armour, E. A.; Byrnes, D. P.; Arif, R. A.; Lee, S. M.; Papasouliotis, G. D.

    2014-01-01

    We report on diffusion-driven and excitation-dependent carrier recombination rate in multiple InGaN/GaN quantum wells by using photoluminescence, light-induced absorption, and diffraction techniques. We demonstrate gradually increasing with excitation carrier diffusivity and its correlation with the recombination rate. At low carrier densities, an increase in radiative emission and carrier lifetime was observed due to partial saturation of non-radiative recombination centers. However, at carrier densities above ∼5 × 10 18  cm −3 , a typical value of photoluminescence efficiency droop, a further increase of diffusivity forces the delocalized carriers to face higher number of fast non-radiative recombination centers leading to an increase of non-radiative losses

  9. Diffusion-driven and excitation-dependent recombination rate in blue InGaN/GaN quantum well structures

    Energy Technology Data Exchange (ETDEWEB)

    Aleksiejūnas, R.; Gelžinytė, K.; Nargelas, S., E-mail: saulius.nargelas@ff.vu.lt; Jarašiūnas, K. [Department of Semiconductor Optoelectronics, Institute of Applied Research, Vilnius University, Saulėtekio 9–III, 10222 Vilnius (Lithuania); Vengris, M. [Laser Research Center, Vilnius University, Saulėtekio 10, 10223 Vilnius (Lithuania); Armour, E. A.; Byrnes, D. P.; Arif, R. A.; Lee, S. M.; Papasouliotis, G. D. [Veeco Instruments, Turbodisc Operations, 394 Elizabeth Avenue, Somerset, New Jersey 08873 (United States)

    2014-01-13

    We report on diffusion-driven and excitation-dependent carrier recombination rate in multiple InGaN/GaN quantum wells by using photoluminescence, light-induced absorption, and diffraction techniques. We demonstrate gradually increasing with excitation carrier diffusivity and its correlation with the recombination rate. At low carrier densities, an increase in radiative emission and carrier lifetime was observed due to partial saturation of non-radiative recombination centers. However, at carrier densities above ∼5 × 10{sup 18} cm{sup −3}, a typical value of photoluminescence efficiency droop, a further increase of diffusivity forces the delocalized carriers to face higher number of fast non-radiative recombination centers leading to an increase of non-radiative losses.

  10. RTEL1: an essential helicase for telomere maintenance and the regulation of homologous recombination.

    Science.gov (United States)

    Uringa, Evert-Jan; Youds, Jillian L; Lisaingo, Kathleen; Lansdorp, Peter M; Boulton, Simon J

    2011-03-01

    Telomere maintenance and DNA repair are crucial processes that protect the genome against instability. RTEL1, an essential iron-sulfur cluster-containing helicase, is a dominant factor that controls telomere length in mice and is required for telomere integrity. In addition, RTEL1 promotes synthesis-dependent strand annealing to direct DNA double-strand breaks into non-crossover outcomes during mitotic repair and in meiosis. Here, we review the role of RTEL1 in telomere maintenance and homologous recombination and discuss models linking RTEL1's enzymatic activity to its function in telomere maintenance and DNA repair.

  11. Effect of deoxyribonucleic acid replication inhibitors on bacterial recombination

    International Nuclear Information System (INIS)

    Canosi, U.; Siccardi, A.G.; Falaschi, A.; Mazza, G.

    1976-01-01

    Two inhibitors of replicative deoxyribonucleic acid (DNA) synthesis, nalidixic acid (NAL) and 6-(p-hydroxyphenylazo)-uracil (HPUra), showed different effects on genetic recombination and DNA repair in Bacillus subtilis. Previous work (Pedrini et al., 1972) showed that NAL does not interfere with the transformation process of B. subtilis. The results reported in this work demonstrated that the drug was also without effect on the transfection SPP1 or SPO-1 phage DNA (a process that requires a recombination event). The drug was also ineffective on the host cell reactivation of ultraviolet-irradiated SPP1 phage, as well as on transfection with ultraviolet-irradiated DNA of the same phage. HPUra instead markedly reduced the transformation process, as well as transfection, by SPO-1 DNA, but it did not affect the host cell reactivation of SPO-1 phage. In conclusion, whereas the NAL target seems to be specific for replicative DNA synthesis, the HPUra target (i.e., the DNA polymerase III of B. subtilis) seems to be involved also in recombination, but not in the excision repair process. The mutations conferring NAL and HPUra resistance used in this work were mapped by PBS-1 transduction

  12. Break-induced ATR and Ddb1-Cul4(Cdt)² ubiquitin ligase-dependent nucleotide synthesis promotes homologous recombination repair in fission yeast

    DEFF Research Database (Denmark)

    Moss, Jennifer; Tinline-Purvis, Helen; Walker, Carol A

    2010-01-01

    Nucleotide synthesis is a universal response to DNA damage, but how this response facilitates DNA repair and cell survival is unclear. Here we establish a role for DNA damage-induced nucleotide synthesis in homologous recombination (HR) repair in fission yeast. Using a genetic screen, we found...... the Ddb1-Cul4(Cdt)² ubiquitin ligase complex and ribonucleotide reductase (RNR) to be required for HR repair of a DNA double-strand break (DSB). The Ddb1-Cul4(Cdt)² ubiquitin ligase complex is required for degradation of Spd1, an inhibitor of RNR in fission yeast. Accordingly, deleting spd1(+) suppressed...

  13. Dialects of the DNA Uptake Sequence in Neisseriaceae

    Science.gov (United States)

    Frye, Stephan A.; Nilsen, Mariann; Tønjum, Tone; Ambur, Ole Herman

    2013-01-01

    In all sexual organisms, adaptations exist that secure the safe reassortment of homologous alleles and prevent the intrusion of potentially hazardous alien DNA. Some bacteria engage in a simple form of sex known as transformation. In the human pathogen Neisseria meningitidis and in related bacterial species, transformation by exogenous DNA is regulated by the presence of a specific DNA Uptake Sequence (DUS), which is present in thousands of copies in the respective genomes. DUS affects transformation by limiting DNA uptake and recombination in favour of homologous DNA. The specific mechanisms of DUS–dependent genetic transformation have remained elusive. Bioinformatic analyses of family Neisseriaceae genomes reveal eight distinct variants of DUS. These variants are here termed DUS dialects, and their effect on interspecies commutation is demonstrated. Each of the DUS dialects is remarkably conserved within each species and is distributed consistent with a robust Neisseriaceae phylogeny based on core genome sequences. The impact of individual single nucleotide transversions in DUS on meningococcal transformation and on DNA binding and uptake is analysed. The results show that a DUS core 5′-CTG-3′ is required for transformation and that transversions in this core reduce DNA uptake more than two orders of magnitude although the level of DNA binding remains less affected. Distinct DUS dialects are efficient barriers to interspecies recombination in N. meningitidis, N. elongata, Kingella denitrificans, and Eikenella corrodens, despite the presence of the core sequence. The degree of similarity between the DUS dialect of the recipient species and the donor DNA directly correlates with the level of transformation and DNA binding and uptake. Finally, DUS–dependent transformation is documented in the genera Eikenella and Kingella for the first time. The results presented here advance our understanding of the function and evolution of DUS and genetic transformation

  14. Dialects of the DNA uptake sequence in Neisseriaceae.

    Directory of Open Access Journals (Sweden)

    Stephan A Frye

    2013-04-01

    Full Text Available In all sexual organisms, adaptations exist that secure the safe reassortment of homologous alleles and prevent the intrusion of potentially hazardous alien DNA. Some bacteria engage in a simple form of sex known as transformation. In the human pathogen Neisseria meningitidis and in related bacterial species, transformation by exogenous DNA is regulated by the presence of a specific DNA Uptake Sequence (DUS, which is present in thousands of copies in the respective genomes. DUS affects transformation by limiting DNA uptake and recombination in favour of homologous DNA. The specific mechanisms of DUS-dependent genetic transformation have remained elusive. Bioinformatic analyses of family Neisseriaceae genomes reveal eight distinct variants of DUS. These variants are here termed DUS dialects, and their effect on interspecies commutation is demonstrated. Each of the DUS dialects is remarkably conserved within each species and is distributed consistent with a robust Neisseriaceae phylogeny based on core genome sequences. The impact of individual single nucleotide transversions in DUS on meningococcal transformation and on DNA binding and uptake is analysed. The results show that a DUS core 5'-CTG-3' is required for transformation and that transversions in this core reduce DNA uptake more than two orders of magnitude although the level of DNA binding remains less affected. Distinct DUS dialects are efficient barriers to interspecies recombination in N. meningitidis, N. elongata, Kingella denitrificans, and Eikenella corrodens, despite the presence of the core sequence. The degree of similarity between the DUS dialect of the recipient species and the donor DNA directly correlates with the level of transformation and DNA binding and uptake. Finally, DUS-dependent transformation is documented in the genera Eikenella and Kingella for the first time. The results presented here advance our understanding of the function and evolution of DUS and genetic

  15. Identification of a mammalian nuclear factor and human cDNA-encoded proteins that recognize DNA containing apurinic sites

    International Nuclear Information System (INIS)

    Lenz, J.; Okenquist, S.A.; LoSardo, J.E.; Hamilton, K.K.; Doetsch, P.W.

    1990-01-01

    Damage to DNA can have lethal or mutagenic consequences for cells unless it is detected and repaired by cellular proteins. Repair depends on the ability of cellular factors to distinguish the damaged sites. Electrophoretic binding assays were used to identify a factor from the nuclei of mammalian cells that bound to DNA containing apurinic sites. A binding assay based on the use of β-galactosidase fusion proteins was subsequently used to isolate recombinant clones of human cDNAs that encoded apurinic DNA-binding proteins. Two distinct human cDNAs were identified that encoded proteins that bound apurinic DNA preferentially over undamaged, methylated, or UV-irradiated DNA. These approaches may offer a general method for the detection of proteins that recognize various types of DNA damage and for the cloning of genes encoding such proteins

  16. Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches

    Science.gov (United States)

    McCutchen-Maloney, Sandra L.

    2002-01-01

    Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

  17. Recombinant HT{sub m4} gene, protein and assays

    Science.gov (United States)

    Lim, B.; Adra, C.N.; Lelias, J.M.

    1996-09-03

    The invention relates to a recombinant DNA molecule which encodes a HT{sub m4} protein, a transformed host cell which has been stably transfected with a DNA molecule which encodes a HT{sub m4} protein and a recombinant HT{sub m4} protein. The invention also relates to a method for detecting the presence of a hereditary atopy. 2 figs.

  18. When two is not enough: a CtIP tetramer is required for DNA repair by Homologous Recombination.

    Science.gov (United States)

    Forment, Josep V; Jackson, Stephen P; Pellegrini, Luca

    2015-01-01

    Homologous recombination (HR) is central to the repair of double-strand DNA breaks that occur in S/G2 phases of the cell cycle. HR relies on the CtIP protein (Ctp1 in fission yeast, Sae2 in budding yeast) for resection of DNA ends, a key step in generating the 3'-DNA overhangs that are required for the HR strand-exchange reaction. Although much has been learned about the biological importance of CtIP in DNA repair, our mechanistic insight into its molecular functions remains incomplete. It has been recently discovered that CtIP and Ctp1 share a conserved tetrameric architecture that is mediated by their N-terminal domains and is critical for their function in HR. The specific arrangement of protein chains in the CtIP/Ctp1 tetramer indicates that an ability to bridge DNA ends might be an important feature of CtIP/Ctp1 function, establishing an intriguing similarity with the known ability of the MRE11-RAD50-NBS1 complex to link DNA ends. Although the exact mechanism of action remains to be elucidated, the remarkable evolutionary conservation of CtIP/Ctp1 tetramerisation clearly points to its crucial role in HR.

  19. Biotechnology and genetic engineering in the new drug development. Part I. DNA technology and recombinant proteins.

    Science.gov (United States)

    Stryjewska, Agnieszka; Kiepura, Katarzyna; Librowski, Tadeusz; Lochyński, Stanisław

    2013-01-01

    Pharmaceutical biotechnology has a long tradition and is rooted in the last century, first exemplified by penicillin and streptomycin as low molecular weight biosynthetic compounds. Today, pharmaceutical biotechnology still has its fundamentals in fermentation and bioprocessing, but the paradigmatic change affected by biotechnology and pharmaceutical sciences has led to an updated definition. The biotechnology revolution redrew the research, development, production and even marketing processes of drugs. Powerful new instruments and biotechnology related scientific disciplines (genomics, proteomics) make it possible to examine and exploit the behavior of proteins and molecules. Recombinant DNA (rDNA) technologies (genetic, protein, and metabolic engineering) allow the production of a wide range of peptides, proteins, and biochemicals from naturally nonproducing cells. This technology, now approximately 25 years old, is becoming one of the most important technologies developed in the 20(th) century. Pharmaceutical products and industrial enzymes were the first biotech products on the world market made by means of rDNA. Despite important advances regarding rDNA applications in mammalian cells, yeasts still represent attractive hosts for the production of heterologous proteins. In this review we describe these processes.

  20. Deriving the coronal hole electron temperature: electron density dependent ionization / recombination considerations

    International Nuclear Information System (INIS)

    Doyle, John Gerard; Perez-Suarez, David; Singh, Avninda; Chapman, Steven; Bryans, Paul; Summers, Hugh; Savin, Daniel Wolf

    2010-01-01

    Comparison of appropriate theoretically derived line ratios with observational data can yield estimates of a plasma's physical parameters, such as electron density or temperature. The usual practice in the calculation of the line ratio is the assumption of excitation by electrons/protons followed by radiative decay. Furthermore, it is normal to use the so-called coronal approximation, i.e. one only considers ionization and recombination to and from the ground-state. A more accurate treatment is to include ionization/recombination to and from metastable levels. Here, we apply this to two lines from adjacent ionization stages, Mg IX 368 A and Mg X 625 A, which has been shown to be a very useful temperature diagnostic. At densities typical of coronal hole conditions, the difference between the electron temperature derived assuming the zero density limit compared with the electron density dependent ionization/recombination is small. This, however, is not the case for flares where the electron density is orders of magnitude larger. The derived temperature for the coronal hole at solar maximum is around 1.04 MK compared to just below 0.82 MK at solar minimum.

  1. SIRT6 stabilizes DNA-dependent protein kinase at chromatin for DNA double-strand break repair

    DEFF Research Database (Denmark)

    McCord, Ronald A; Michishita, Eriko; Hong, Tao

    2009-01-01

    -PKcs) to chromatin in response to DNA damage and stabilizes DNA-PKcs at chromatin adjacent to an induced site-specific DSB. Abrogation of these SIRT6 activities leads to impaired resolution of DSBs. Together, these findings elucidate a mechanism whereby regulation of dynamic interaction of a DNA repair factor......-dependent protein kinase) and promotes DNA DSB repair. In response to DSBs, SIRT6 associates dynamically with chromatin and is necessary for an acute decrease in global cellular acetylation levels on histone H3 Lysine 9. Moreover, SIRT6 is required for mobilization of the DNA-PK catalytic subunit (DNA......, and SIRT6 knockout cells exhibit genomic instability and DNA damage hypersensitivity. However, the molecular mechanisms underlying these defects are not fully understood. Here, we show that SIRT6 forms a macromolecular complex with the DNA double-strand break (DSB) repair factor DNA-PK (DNA...

  2. HIV-1-Specific Antibody Response and Function after DNA Prime and Recombinant Adenovirus 5 Boost HIV Vaccine in HIV-Infected Subjects.

    Directory of Open Access Journals (Sweden)

    Johannes S Gach

    Full Text Available Little is known about the humoral immune response against DNA prime-recombinant adenovirus 5 (rAd5 boost HIV vaccine among HIV-infected patients on long-term suppressive antiretroviral therapy (ART. Previous studies emphasized cellular immune responses; however, current research suggests both cellular and humoral responses are likely required for a successful therapeutic vaccine. Thus, we aimed to understand antibody response and function induced by vaccination of ART-treated HIV-1-infected patients with immune recovery. All subjects participated in EraMune 02, an open-label randomized clinical trial of ART intensification followed by a six plasmid DNA prime (envA, envB, envC, gagB, polB, nefB and rAd5 boost HIV vaccine with matching inserts. Antibody binding levels were determined with a recently developed microarray approach. We also analyzed neutralization efficiency and antibody-dependent cellular cytotoxicity (ADCC. We found that the DNA prime-rAd5 boost vaccine induced a significant cross-clade HIV-specific antibody response, which correlated with antibody neutralization efficiency. However, despite the increase in antibody binding levels, the vaccine did not significantly stimulate neutralization or ADCC responses. This finding was also reflected by a lack of change in total CD4+ cell associated HIV DNA in those who received the vaccine. Our results have important implications for further therapeutic vaccine design and administration, especially in HIV-1 infected patients, as boosting of preexisting antibody responses are unlikely to lead to clearance of latent proviruses in the HIV reservoir.

  3. nuvA, an Aspergillus nidulans gene involved in DNA repair and recombination, is a homologue of Saccharomyces cerevisiae RAD18 and Neurospora crassa uvs-2.

    Science.gov (United States)

    Iwanejko, L; Cotton, C; Jones, G; Tomsett, B; Strike, P

    1996-03-01

    A 40 kb genomic clone and 2.3 kb EcoRI subclone that rescued the DNA repair and recombination defects of the Aspergillus nidulans nuvA11 mutant were isolated and the subclone sequenced. The subclone hybridized to a cosmid in a chromosome-specific library confirming the assignment of nuvA to linkage group IV and indicating its closeness to bimD. Amplification by PCR clarified the relative positions of nuvA and bimD. A region identified within the subclone, encoding a C3HC4 zinc finger motif, was used as a probe to retrieve a cDNA clone. Sequencing of this clone showed that the nuvA gene has an ORF of 1329 bp with two introns of 51 bp and 60 bp. Expression of nuvA appears to be extremely low. The putative NUVA polypeptide has two zinc finger motifs, a molecular mass of 48906 Da and has 39% identity with the Neurospora crassa uvs-2 and 25% identity with the Saccharomyces cerevisiae RAD18 translation products. Although mutations in nuvA, uvs-2 and RAD18 produce similar phenotypes, only the nuvA11 mutation affects meiotic recombination. A role for nuvA in both DNA repair and genetic recombination is proposed.

  4. Cell biology of homologous recombination in yeast

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine Valerie; Rothstein, Rodney; Lisby, Michael

    2011-01-01

    Homologous recombination is an important pathway for error-free repair of DNA lesions, such as single- and double-strand breaks, and for rescue of collapsed replication forks. Here, we describe protocols for live cell imaging of single-lesion recombination events in the yeast Saccharomyces...

  5. Involvement of the yeast DNA polymerase delta in DNA repair in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Giot, L. [State University of New York at Stony Brook, Stony Brook, NY. (United States); Chanet, R.; Simon, M.; Facca, C.; Faye, G.

    1997-08-15

    The POL3 encoded catalytic subunit of DNA polymerase delta possesses a highly conserved C-terminal cysteine-rich domain in Saccharomyces cerevisiae. Mutations in some of its cysteine codons display a lethal phenotype, which demonstrates an essential function of this domain. The thermosensitive mutant pol3-13, in which a serine replaces a cysteine of this domain, exhibits a range of defects in DNA repair, such as hypersensitivity to different DNA-damaging agents and deficiency for induced mutagenesis and for recombination. These phenotypes are observed at 24 degrees, a temperature at which DNA replication is almost normal; this differentiates the functions of POL3 in DNA repair and DNA replication. Since spontaneous mutagenesis and spontaneous recombination are efficient in pol3-13, we propose that POL3 plays an important role in DNA repair after irradiation, particularly in the error-prone and recombinational pathways. Extragenic suppressors of pol3-13 are allelic to sdp5-1, previously identified as an extragenic suppressor of pol3-11. SDP5, which is identical to HYS2, encodes a protein homologous to the p50 subunit of bovine and human DNA polymerase delta. SDP5 is most probably the p55 subunit of Pol delta of S. cerevisiae and seems to be associated with the catalytic subunit for both DNA replication and DNA repair. (author)

  6. DNA gyrase with a single catalytic tyrosine can catalyze DNA supercoiling by a nicking-closing mechanism

    Science.gov (United States)

    Gubaev, Airat; Weidlich, Daniela; Klostermeier, Dagmar

    2016-01-01

    The topological state of DNA is important for replication, recombination and transcription, and is regulated in vivo by DNA topoisomerases. Gyrase introduces negative supercoils into DNA at the expense of ATP hydrolysis. It is the accepted view that gyrase achieves supercoiling by a strand passage mechanism, in which double-stranded DNA is cleaved, and a second double-stranded segment is passed through the gap, converting a positive DNA node into a negative node. We show here that gyrase with only one catalytic tyrosine that cleaves a single strand of its DNA substrate can catalyze DNA supercoiling without strand passage. We propose an alternative mechanism for DNA supercoiling via nicking and closing of DNA that involves trapping, segregation and relaxation of two positive supercoils. In contrast to DNA supercoiling, ATP-dependent relaxation and decatenation of DNA by gyrase lacking the C-terminal domains require both tyrosines and strand passage. Our results point towards mechanistic plasticity of gyrase and might pave the way for finding novel and specific mechanism-based gyrase inhibitors. PMID:27557712

  7. Underwound DNA under Tension: Structure, Elasticity, and Sequence-Dependent Behaviors

    Science.gov (United States)

    Sheinin, Maxim Y.; Forth, Scott; Marko, John F.; Wang, Michelle D.

    2011-09-01

    DNA melting under torsion plays an important role in a wide variety of cellular processes. In the present Letter, we have investigated DNA melting at the single-molecule level using an angular optical trap. By directly measuring force, extension, torque, and angle of DNA, we determined the structural and elastic parameters of torsionally melted DNA. Our data reveal that under moderate forces, the melted DNA assumes a left-handed structure as opposed to an open bubble conformation and is highly torsionally compliant. We have also discovered that at low forces melted DNA properties are highly dependent on DNA sequence. These results provide a more comprehensive picture of the global DNA force-torque phase diagram.

  8. The Dependence of the Dose Response Supralinearity of Peak 5 in TLD-100 on Recombination Temperature

    International Nuclear Information System (INIS)

    Horowitz, Y.S.; Satinger, D.; Oster, L.

    1999-01-01

    Isothermal readout of LiF:Mg,Ti (TLD-700) has recently been used to study the dependence of the supralinearity of peak 5 on recombination temperature. The results were interpreted to be in conflict with earlier results which investigated the effect of readout heating rate on the supralinearity of peak 5 in TLD-100. In this work the two experiments are inspected in greater detail. It is illustrated that the isothermal decay data is not in conflict with the heating rate data. However, the heating rate results do apparently indicate a strong transition in the temperature dependence of the relative strengths of the recombination and competitive cross sections at approximately 235 deg. C, which requires further study and analysis. (author)

  9. Radiation induced asymmetries in mitotic recombination: evidence for a directional bias in the formation of asymmetric hybrid DNA in yeast

    International Nuclear Information System (INIS)

    Friedman, L.R.; Sobell, H.M.

    We have examined radiation-induced mitotic recombination using two alleles (his1-36, his1-49) in the his1 gene. When the haploid containing his1-36 is irradiated with varying doses of γ rays and then mated with the unirradiated strain containing his1-49, analyses of the selected prototrophs show them to be primarily + +/+ 49. If, on the other hand, the haploid strain containing his1-49 is the irradiated parent, the prototrophic diploids are primarily + +/36 +. In control experiments, where either both strains are irradiated or not irradiated, no such asymmetries are found. These data indicate that the irradiated haploid chromosome tends to be the recipient of genetic information. We interpret these results as indicating a directional bias in the formation of hybrid DNA in radiation-induced mitotic recombination, and discuss these results in terms of current models of genetic recombination

  10. Research and development of basic technologies for the next generation industries, 'recombinant DNA utilizing technology'. Evaluation on the research and development; Jisedai sangyo kiban gijutsu kenkyu kaihatsu 'kumikae DNA riyo gijutsu'. Kenkyu kaihatsu hyoka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-03-01

    Research, development and evaluation were performed with an objective of establishing the basic technology related to the recombinant DNA utilizing technology to create new microorganisms for processes in the chemical industry. The major achievements of the present research and development include establishment of the P450 gene manifestation system attributed from microsomes and mitochondria, and the success of the world's first simultaneous manifestation of P450 and reduction enzyme. Furthermore, the fused enzyme combining P450 and the reduction enzyme genetically was successfully manufactured ahead of the other countries, opening the way to industrializing the recombinant enzymes for use in bio-processes in the chemical industry. In creating a high-efficiency secretion recombinant bacillus subtilis stock, a bacillus subtilis host whose protease activity has been noticeably decreased was created. As an achievement of the research on the 'basic recombinant DNA technology', high-efficiency manifestation vector of medium level thermophile was created, and its usefulness was demonstrated. In addition, a host and vector system for high level thermophile was developed for the first time in the world. These achievements have opened the way to industrial utilization of the thermophilic bacteria. (NEDO)

  11. Relative contribution of homologous recombination and non-homologous end-joining to DNA double-strand break repair after oxidative stress in Saccharomyces cerevisiae.

    Science.gov (United States)

    Letavayová, Lucia; Marková, Eva; Hermanská, Katarína; Vlcková, Viera; Vlasáková, Danusa; Chovanec, Miroslav; Brozmanová, Jela

    2006-05-10

    Oxidative damage to DNA seems to be an important factor in developing many human diseases including cancer. It involves base and sugar damage, base-free sites, DNA-protein cross-links and DNA single-strand (SSB) and double-strand (DSB) breaks. Oxidative DSB can be formed in various ways such as their direct induction by the drug or their generation either through attempted and aborted repair of primary DNA lesions or through DNA replication-dependent conversion of SSB. In general, two main pathways are responsible for repairing DSB, homologous recombination (HR) and non-homologous end-joining (NHEJ), with both of them being potential candidates for the repair of oxidative DSB. We have examined relative contribution of HR and NHEJ to cellular response after oxidative stress in Saccharomyces cerevisiae. Therefore, cell survival, mutagenesis and DSB induction and repair in the rad52, yku70 and rad52 yku70 mutants after hydrogen peroxide (H(2)O(2)), menadione (MD) or bleomycin (BLM) exposure were compared to those obtained for the corresponding wild type. We show that MD exposure does not lead to observable DSB induction in yeast, suggesting that the toxic effects of this agent are mediated by other types of DNA damage. Although H(2)O(2) treatment generates some DSB, their yield is relatively low and hence DSB may only partially be responsible for toxicity of H(2)O(2), particularly at high doses of the agent. On the other hand, the basis of the BLM toxicity resides primarily in DSB induction. Both HR and NHEJ act on BLM-induced DSB, although their relative participation in the process is not equal. Based on our results we suggest that the complexity and/or the quality of the BLM-induced DSB might represent an obstacle for the NHEJ pathway.

  12. A sequence-dependent rigid-base model of DNA

    Science.gov (United States)

    Gonzalez, O.; Petkevičiutė, D.; Maddocks, J. H.

    2013-02-01

    A novel hierarchy of coarse-grain, sequence-dependent, rigid-base models of B-form DNA in solution is introduced. The hierarchy depends on both the assumed range of energetic couplings, and the extent of sequence dependence of the model parameters. A significant feature of the models is that they exhibit the phenomenon of frustration: each base cannot simultaneously minimize the energy of all of its interactions. As a consequence, an arbitrary DNA oligomer has an intrinsic or pre-existing stress, with the level of this frustration dependent on the particular sequence of the oligomer. Attention is focussed on the particular model in the hierarchy that has nearest-neighbor interactions and dimer sequence dependence of the model parameters. For a Gaussian version of this model, a complete coarse-grain parameter set is estimated. The parameterized model allows, for an oligomer of arbitrary length and sequence, a simple and explicit construction of an approximation to the configuration-space equilibrium probability density function for the oligomer in solution. The training set leading to the coarse-grain parameter set is itself extracted from a recent and extensive database of a large number of independent, atomic-resolution molecular dynamics (MD) simulations of short DNA oligomers immersed in explicit solvent. The Kullback-Leibler divergence between probability density functions is used to make several quantitative assessments of our nearest-neighbor, dimer-dependent model, which is compared against others in the hierarchy to assess various assumptions pertaining both to the locality of the energetic couplings and to the level of sequence dependence of its parameters. It is also compared directly against all-atom MD simulation to assess its predictive capabilities. The results show that the nearest-neighbor, dimer-dependent model can successfully resolve sequence effects both within and between oligomers. For example, due to the presence of frustration, the model can

  13. A sequence-dependent rigid-base model of DNA.

    Science.gov (United States)

    Gonzalez, O; Petkevičiūtė, D; Maddocks, J H

    2013-02-07

    A novel hierarchy of coarse-grain, sequence-dependent, rigid-base models of B-form DNA in solution is introduced. The hierarchy depends on both the assumed range of energetic couplings, and the extent of sequence dependence of the model parameters. A significant feature of the models is that they exhibit the phenomenon of frustration: each base cannot simultaneously minimize the energy of all of its interactions. As a consequence, an arbitrary DNA oligomer has an intrinsic or pre-existing stress, with the level of this frustration dependent on the particular sequence of the oligomer. Attention is focussed on the particular model in the hierarchy that has nearest-neighbor interactions and dimer sequence dependence of the model parameters. For a Gaussian version of this model, a complete coarse-grain parameter set is estimated. The parameterized model allows, for an oligomer of arbitrary length and sequence, a simple and explicit construction of an approximation to the configuration-space equilibrium probability density function for the oligomer in solution. The training set leading to the coarse-grain parameter set is itself extracted from a recent and extensive database of a large number of independent, atomic-resolution molecular dynamics (MD) simulations of short DNA oligomers immersed in explicit solvent. The Kullback-Leibler divergence between probability density functions is used to make several quantitative assessments of our nearest-neighbor, dimer-dependent model, which is compared against others in the hierarchy to assess various assumptions pertaining both to the locality of the energetic couplings and to the level of sequence dependence of its parameters. It is also compared directly against all-atom MD simulation to assess its predictive capabilities. The results show that the nearest-neighbor, dimer-dependent model can successfully resolve sequence effects both within and between oligomers. For example, due to the presence of frustration, the model can

  14. Charge recombination process in X-ray irradiated pyrene-doped polystyrene as studied by optically detected electron spin resonance and magnetic field dependence of the recombination fluorescence

    International Nuclear Information System (INIS)

    Okazaki, Masaharu; Tai, Yutaka; Toriyama, Kazumi

    1993-01-01

    The optically-detected ESR (ODESR) spectrum and magnetic field dependence on recombination fluorescence were observed for X-ray irradiated pyrene-doped polystyrene at temperatures of 242-348 K. The ODESR intensity as a function of the pyrene concentration, 0.1-8.9 wt%, showed an unusual minimum at about 1.0%. Two phases were separated in the magnetic field dependence of the fluorescence: one was sharp and saturates at fields of over 50 mT, while the other was broad with a dip at around 60-150 mT. The cause of this dip was naturally attributed to the ST -1 level crossing. The sharp magnetic field effect also showed a minimum at around a concentration of 1.0 wt%. These novel findings have been interpreted using a recombination model modified from the previous one for pyrene-doped ethylene-propylene rubber and polyethylene. The essential points of the present model are: (1) although electron hopping within the polystyrene molecule is rapid, electron transfer at the last step of recombination between the polystyrene anion and the pyrene cation proceeds at a moderate rate; (2) the hole-transfer rate in the polymer chain is moderate; (3) electron hopping between the doped pyrene molecules is very much dependent on the concentration; (4) hole hopping between the pyrenes is inhibited. (author)

  15. Conformation-dependent DNA attraction

    Science.gov (United States)

    Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

    2014-05-01

    Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by

  16. Mycobacterium smegmatis RqlH defines a novel clade of bacterial RecQ-like DNA helicases with ATP-dependent 3'-5' translocase and duplex unwinding activities.

    Science.gov (United States)

    Ordonez, Heather; Unciuleac, Mihaela; Shuman, Stewart

    2012-05-01

    The Escherichia coli RecQ DNA helicase participates in a pathway of DNA repair that operates in parallel to the recombination pathway driven by the multisubunit helicase-nuclease machine RecBCD. The model mycobacterium Mycobacterium smegmatis executes homologous recombination in the absence of its helicase-nuclease machine AdnAB, though it lacks a homolog of E. coli RecQ. Here, we identify and characterize M. smegmatis RqlH, a RecQ-like helicase with a distinctive domain structure. The 691-amino acid RqlH polypeptide consists of a RecQ-like ATPase domain (amino acids 1-346) and tetracysteine zinc-binding domain (amino acids 435-499), separated by an RqlH-specific linker. RqlH lacks the C-terminal HRDC domain found in E. coli RecQ. Rather, the RqlH C-domain resembles bacterial ComF proteins and includes a phosphoribosyltransferase-like module. We show that RqlH is a DNA-dependent ATPase/dATPase that translocates 3'-5' on single-stranded DNA and has 3'-5' helicase activity. These functions inhere to RqlH-(1-505), a monomeric motor unit comprising the ATPase, linker and zinc-binding domains. RqlH homologs are distributed widely among bacterial taxa. The mycobacteria that encode RqlH lack a classical RecQ, though many other Actinobacteria have both RqlH and RecQ. Whereas E. coli K12 encodes RecQ but lacks a homolog of RqlH, other strains of E. coli have both RqlH and RecQ.

  17. Generation of Modified Pestiviruses by Targeted Recombination

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Friis, Martin Barfred; Risager, Peter Christian

    involves targeted modification of viral cDNA genomes, cloned within BACs, by Red/ET recombination-mediated mutagenesis in E.coli DH10B cells. Using recombination-mediated mutagenesis for the targeted design, the work can be expedited and focused in principal on any sequence within the viral genome...

  18. Doping in the recombinant era: strategies and counterstrategies.

    Science.gov (United States)

    Azzazy, Hassan M E; Mansour, Mai M H; Christenson, Robert H

    2005-11-01

    Advances in recombinant DNA technology have created one of the most powerful weapons in the current doping arsenal: recombinant proteins [Sweeney HL. Gene doping. Sci Am 2004;291:62-9; Unal M, Ozer Unal D. Gene doping in sports. Sports Med 2004;34:357-62]. Recombinant erythropoietin (EPO) and human growth hormone (hGH) are currently being abused but are fortunately detectable either directly by employing isoelectric focusing and immunoassays or indirectly by assessing changes in selected hematopoietic parameters. The detection is technically demanding due to the extent of similarity between the recombinant proteins and their endogenous counterparts. Another issue facing detection efforts is the speed and conditions at which blood samples are collected and analyzed in a sports setting. Recently, gene doping, which stemmed out of legitimate gene therapy trials, has emerged as the next level of doping. Erythropoietin (EPO), human growth hormone (hGH), insulin-like growth factor-1 (IGF-1), peroxisome proliferator-activated receptor-delta (PPAR delta), and myostatin inhibitor genes have been identified as primary targets for doping. Sports clinical scientists today are racing against the clock because assuring the continued integrity of sports competition depends on their ability to outpace the efforts of dopers by developing new detection strategies.

  19. SPAR1/RTEL1 maintains genomic stability by suppressing homologous recombination

    Science.gov (United States)

    Barber, Louise J.; Youds, Jillian L.; Ward, Jordan D.; McIlwraith, Michael J.; O’Neil, Nigel J.; Petalcorin, Mark I.R.; Martin, Julie S.; Collis, Spencer J.; Cantor, Sharon B.; Auclair, Melissa; Tissenbaum, Heidi; West, Stephen C.; Rose, Ann M.; Boulton, Simon J.

    2013-01-01

    SUMMARY Inappropriate homologous recombination (HR) can cause gross chromosomal rearrangements that in mammalian cells may lead to tumorigenesis. In yeast, the Srs2 protein is an anti-recombinase that eliminates inappropriate recombination events, but the functional equivalent of Srs2 in higher eukaryotes has proven to be elusive. In this work, we identify C. elegans SPAR-1 as a functional analogue of Srs2 and describe its vertebrate counterpart, SPAR1/RTEL1, which is required for genome stability and tumour avoidance. We find that spar-1 mutant worms and SPAR1 knockdown human cells share characteristic phenotypes with yeast srs2 mutants, including inviability upon deletion of the sgs1/BLM homologue, hyper-recombination, and DNA damage sensitivity. In vitro, purified human SPAR1 antagonises HR by promoting the disassembly of D loop recombination intermediates in a reaction dependent upon ATP hydrolysis. We propose that loss of HR control following deregulation of SPAR1/RTEL1 may be a critical event that drives genome instability and cancer. PMID:18957201

  20. Nrf2 facilitates repair of radiation induced DNA damage through homologous recombination repair pathway in a ROS independent manner in cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Jayakumar, Sundarraj; Pal, Debojyoti; Sandur, Santosh K., E-mail: sskumar@barc.gov.in

    2015-09-15

    Highlights: • Nrf2 inhibition in A549 cells led to attenuated DNA repair and radiosensitization. • Influence of Nrf2 on DNA repair is not linked to its antioxidant function. • Nrf2 influences DNA repair through homologous recombination (HR) repair pathway. • Many genes involved in HR pathway show ARE sequences in their upstream region. - Abstract: Nrf2 is a redox sensitive transcription factor that is involved in the co-ordinated transcription of genes involved in redox homeostasis. But the role of Nrf2 in DNA repair is not investigated in detail. We have employed A549 and MCF7 cells to study the role of Nrf2 on DNA repair by inhibiting Nrf2 using all-trans retinoic acid (ATRA) or by knock down approach prior to radiation exposure (4 Gy). DNA damage and repair analysis was studied by γH2AX foci formation and comet assay. Results suggested that the inhibition of Nrf2 in A549 or MCF7 cells led to significant slowdown in DNA repair as compared to respective radiation controls. The persistence of residual DNA damage even in the presence of free radical scavenger N-acetyl cysteine, suggested that the influence of Nrf2 on DNA repair was not linked to its antioxidant functions. Further, its influence on non-homologous end joining repair pathway was studied by inhibiting both Nrf2 and DNA-PK together. This led to synergistic reduction of survival fraction, indicating that Nrf2 may not be influencing the NHEJ pathway. To investigate the role of homologous recombination repair (HR) pathway, RAD51 foci formation was monitored. There was a significant reduction in the foci formation in cells treated with ATRA or shRNA against Nrf2 as compared to their respective radiation controls. Further, Nrf2 inhibition led to significant reduction in mRNA levels of RAD51. BLAST analysis was also performed on upstream regions of DNA repair genes to identify antioxidant response element and found that many repair genes that are involved in HR pathway may be regulated by Nrf2

  1. Conformation-dependent DNA attraction.

    Science.gov (United States)

    Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

    2014-06-21

    Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg(2+) ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg(2+) or Na(+), benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg(2+) bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.

  2. Relationship among the repair mechanisms and the genetic recombination

    International Nuclear Information System (INIS)

    Alcantara D, D.

    1987-12-01

    In accordance with the previous reports of the Project BZ87 of the Department of Radiobiology, a dependent stimulation of the system exists in E.coli SOS, of the recombination of the bacteriophage Lambda whose genetic material has not been damaged. This stimulation is not due to the increase of the cellular concentration of the protein RecA and the mechanism but probable for which we find that it is carried out, it is through a cooperation among the product of the gene rec N of E. coli and the system Net of recombination of Lambda. The gene recN belongs to the group of genes SOS and its expression is induced when damaging the bacterial DNA where it intervenes in the repair of breaks of the double helix of the molecule (Picksley et, 1984). If the repair of breaks of this type is a factor that limits the speed with which it happens the recombination among viral chromosomes, then the biggest readiness in the protein RecN, due to the induction of the functions SOS, would facilitate the repair of such ruptures. In this new project it is to enlarge the knowledge about this phenomenon, it was, on one hand of corroborating in a way but he/she specifies the relationship between the recombinogenic response of Lambda and the System SOS of E. coli and for the other one to determine the effect that has the inhibition of the duplication of the DNA on the stimulation of the viral recombination. Everything it with the idea of making it but evident and to be able to use it as a system of genotoxic agents detection in E. coli. (Author)

  3. Mechanisms of recombination and function of DNA in bacteria. Progress report, May 3, 1975--May 5, 1976

    International Nuclear Information System (INIS)

    Guild, W.R.

    1976-01-01

    Results of investigations on phages were obtained with regard to the finding of transfection and characterizing the mode of entry of transfecting DNA; the characterization of a DNAase-resistant gene transfer agent from phage-infected cells which has some of the properties of a generalized transducing phage; and the study of multiplicity reactivation of uv-irradiated phage in a uv-sensitive pneumococcal host. Progress is also reported on a new gene transfer process, cell mutants, fine structure mapping, and stimulated recombination

  4. Effects of selenium on the structure and function of recombinant human S-adenosyl-L-methionine dependent arsenic (+3 oxidation state) methyltransferase in E. coli.

    Science.gov (United States)

    Geng, Zhirong; Song, Xiaoli; Xing, Zhi; Geng, Jinlong; Zhang, Sichun; Zhang, Xinrong; Wang, Zhilin

    2009-05-01

    The effects of Se(IV) on the structure and function of recombinant human arsenic (+3 oxidation state) methyltransferase (AS3MT) purified from the cytoplasm of Escherichia coli were studied. The coding region of human AS3MT complementary DNA was amplified from total RNA extracted from HepG2 cell by reverse transcription PCR. Soluble and active human AS3MT was expressed in the E. coli with a Trx fusion tag under a lower induction temperature of 25 degrees C. Spectra (UV-vis, circular dichroism, and fluorescence) were first used to probe the interaction of Se(IV) and recombinant human AS3MT and the structure-function relationship of the enzyme. The recombinant human AS3MT had a secondary structure of 29.0% alpha-helix, 23.9% beta-pleated sheet, 17.9% beta-turn, and 29.2% random coil. When Se(IV) was added, the content of the alpha-helix did not change, but that of the beta-pleated sheet increased remarkably in the conformation of recombinant human AS3MT. Se(IV) inhibited the enzymatic methylation of inorganic As(III) in a concentration-dependent manner. The IC(50) value for Se(IV) was 2.38 muM. Double-reciprocal (1/V vs. 1/[inorganic As(III)]) plots showed Se(IV) to be a noncompetitive inhibitor of the methylation of inorganic As(III) by recombinant human AS3MT with a K (i) value of 2.61 muM. We hypothesized that Se(IV) interacts with the sulfhydryl group of cysteine(s) in the structural residues rather than the cysteines of the active site (Cys156 and Cys206). When Se(IV) was combined with cysteine(s) in the structural residues, the conformation of recombinant human AS3MT changed and the enzymatic activity decreased. Considering the quenching of tryptophan fluorescence, Cys72 and/or Cys226 are deduced to be primary targets for Se(IV).

  5. Damage-induced ectopic recombination in the yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Kupiec, M; Steinlauf, R

    1997-06-09

    Mitotic recombination in the yeast Saccharomyces cerevisiae is induced when cells are irradiated with UV or X-rays, reflecting the efficient repair of damage by recombinational repair mechanisms. We have used multiply marked haploid strains that allow the simultaneous detection of several types of ectopic recombination events. We show that inter-chromosomal ectopic conversion of lys2 heteroalleles and, to a lesser extent, direct repeat recombination (DRR) between non-tandem repeats, are increased by DNA-damaging agents; in contrast, ectopic recombination of the naturally occurring Ty element is not induced. We have tested several hypotheses that could explain the preferential lack of induction of Ty recombination by DNA-damaging agents. We have found that the lack of induction cannot be explained by a cell cycle control or by an effect of the mating-type genes. We also found no role for the flanking long terminal repeats (LTRs) of the Ty in preventing the induction. Ectopic conversion, DRR, and forward mutation of artificial repeats show different kinetics of induction at various positions of the cell cycle, reflecting different mechanisms of recombination. We discuss the mechanistic and evolutionary aspects of these results.

  6. Consequences of recombination on traditional phylogenetic analysis

    DEFF Research Database (Denmark)

    Schierup, M H; Hein, J

    2000-01-01

    We investigate the shape of a phylogenetic tree reconstructed from sequences evolving under the coalescent with recombination. The motivation is that evolutionary inferences are often made from phylogenetic trees reconstructed from population data even though recombination may well occur (mt......DNA or viral sequences) or does occur (nuclear sequences). We investigate the size and direction of biases when a single tree is reconstructed ignoring recombination. Standard software (PHYLIP) was used to construct the best phylogenetic tree from sequences simulated under the coalescent with recombination....... With recombination present, the length of terminal branches and the total branch length are larger, and the time to the most recent common ancestor smaller, than for a tree reconstructed from sequences evolving with no recombination. The effects are pronounced even for small levels of recombination that may...

  7. Identification of DNA-dependent protein kinase catalytic subunit (DNA-PKcs) as a novel target of bisphenol A.

    Science.gov (United States)

    Ito, Yuki; Ito, Takumi; Karasawa, Satoki; Enomoto, Teruya; Nashimoto, Akihiro; Hase, Yasuyoshi; Sakamoto, Satoshi; Mimori, Tsuneyo; Matsumoto, Yoshihisa; Yamaguchi, Yuki; Handa, Hiroshi

    2012-01-01

    Bisphenol A (BPA) forms the backbone of plastics and epoxy resins used to produce packaging for various foods and beverages. BPA is also an estrogenic disruptor, interacting with human estrogen receptors (ER) and other related nuclear receptors. Nevertheless, the effects of BPA on human health remain unclear. The present study identified DNA-dependent protein kinase catalytic subunit (DNA-PKcs) as a novel BPA-binding protein. DNA-PKcs, in association with the Ku heterodimer (Ku70/80), is a critical enzyme involved in the repair of DNA double-strand breaks. Low levels of DNA-PK activity are previously reported to be associated with an increased risk of certain types of cancer. Although the Kd for the interaction between BPA and a drug-binding mutant of DNA-PKcs was comparatively low (137 nM), high doses of BPA were required before cellular effects were observed (100-300 μM). The results of an in vitro kinase assay showed that BPA inhibited DNA-PK kinase activity in a concentration-dependent manner. In M059K cells, BPA inhibited the phosphorylation of DNA-PKcs at Ser2056 and H2AX at Ser139 in response to ionizing radiation (IR)-irradiation. BPA also disrupted DNA-PKcs binding to Ku70/80 and increased the radiosensitivity of M059K cells, but not M059J cells (which are DNA-PKcs-deficient). Taken together, these results provide new evidence of the effects of BPA on DNA repair in mammalian cells, which are mediated via inhibition of DNA-PK activity. This study may warrant the consideration of the possible carcinogenic effects of high doses of BPA, which are mediated through its action on DNA-PK.

  8. Immunization of Pigs by DNA Prime and Recombinant Vaccinia Virus Boost To Identify and Rank African Swine Fever Virus Immunogenic and Protective Proteins.

    Science.gov (United States)

    Jancovich, James K; Chapman, Dave; Hansen, Debra T; Robida, Mark D; Loskutov, Andrey; Craciunescu, Felicia; Borovkov, Alex; Kibler, Karen; Goatley, Lynnette; King, Katherine; Netherton, Christopher L; Taylor, Geraldine; Jacobs, Bertram; Sykes, Kathryn; Dixon, Linda K

    2018-04-15

    African swine fever virus (ASFV) causes an acute hemorrhagic fever in domestic pigs, with high socioeconomic impact. No vaccine is available, limiting options for control. Although live attenuated ASFV can induce up to 100% protection against lethal challenge, little is known of the antigens which induce this protective response. To identify additional ASFV immunogenic and potentially protective antigens, we cloned 47 viral genes in individual plasmids for gene vaccination and in recombinant vaccinia viruses. These antigens were selected to include proteins with different functions and timing of expression. Pools of up to 22 antigens were delivered by DNA prime and recombinant vaccinia virus boost to groups of pigs. Responses of immune lymphocytes from pigs to individual recombinant proteins and to ASFV were measured by interferon gamma enzyme-linked immunosorbent spot (ELISpot) assays to identify a subset of the antigens that consistently induced the highest responses. All 47 antigens were then delivered to pigs by DNA prime and recombinant vaccinia virus boost, and pigs were challenged with a lethal dose of ASFV isolate Georgia 2007/1. Although pigs developed clinical and pathological signs consistent with acute ASFV, viral genome levels were significantly reduced in blood and several lymph tissues in those pigs immunized with vectors expressing ASFV antigens compared with the levels in control pigs. IMPORTANCE The lack of a vaccine limits the options to control African swine fever. Advances have been made in the development of genetically modified live attenuated ASFV that can induce protection against challenge. However, there may be safety issues relating to the use of these in the field. There is little information about ASFV antigens that can induce a protective immune response against challenge. We carried out a large screen of 30% of ASFV antigens by delivering individual genes in different pools to pigs by DNA immunization prime and recombinant vaccinia

  9. Stimulation of NADH-dependent microsomal DNA strand cleavage by rifamycin SV.

    Science.gov (United States)

    Kukiełka, E; Cederbaum, A I

    1995-04-15

    Rifamycin SV is an antibiotic anti-bacterial agent used in the treatment of tuberculosis. This drug can autoxidize, especially in the presence of metals, and generate reactive oxygen species. A previous study indicated that rifamycin SV can increase NADH-dependent microsomal production of reactive oxygen species. The current study evaluated the ability of rifamycin SV to interact with iron and increase microsomal production of hydroxyl radical, as detected by conversion of supercoiled plasmid DNA into the relaxed open circular state. The plasmid used was pBluescript II KS(-), and the forms of DNA were separated by agarose-gel electrophoresis. Incubation of rat liver microsomes with plasmid plus NADH plus ferric-ATP caused DNA strand cleavage. The addition of rifamycin SV produced a time- and concentration-dependent increase in DNA-strand cleavage. No stimulation by rifamycin SV occurred in the absence of microsomes, NADH or ferric-ATP. Stimulation occurred with other ferric complexes besides ferric-ATP, e.g. ferric-histidine, ferric-citrate, ferric-EDTA, and ferric-(NH4)2SO4. Rifamycin SV did not significantly increase the high rates of DNA strand cleavage found with NADPH as the microsomal reductant. The stimulation of NADH-dependent microsomal DNA strand cleavage was completely blocked by catalase, superoxide dismutase, GSH and a variety of hydroxyl-radical-scavenging agents, but not by anti-oxidants that prevent microsomal lipid peroxidation. Redox cycling agents, such as menadione and paraquat, in contrast with rifamycin SV, stimulated the NADPH-dependent reaction; menadione and rifamycin SV were superior to paraquat in stimulating the NADH-dependent reaction. These results indicate that rifamycin SV can, in the presence of an iron catalyst, increase microsomal production of reactive oxygen species which can cause DNA-strand cleavage. In contrast with other redox cycling agents, the stimulation by rifamycin SV is more pronounced with NADH than with NADPH as the

  10. Multifaceted regulation of V(D)J recombination

    Science.gov (United States)

    Wang, Guannan

    V(D)J recombination is responsible for generating an enormous repertoire of immunoglobulins and T cell receptors, therefore it is a centerpiece to the formation of the adaptive immune system. The V(D)J recombination process proceeds through two steps, site-specific cleavage at RSS (Recombination Signal Sequence) site mediated by the RAG recombinase (RAG1/2) and the subsequent imprecise resolution of the DNA ends, which is carried out by the ubiquitous non-homologous end joining pathway (NHEJ). The V(D)J recombination reaction is obliged to be tightly controlled under all circumstances, as it involves generations of DNA double strand breaks, which are considered the most dangerous lesion to a cell. Multifaceted regulatory mechanisms have been evolved to create great diversity of the antigen receptor repertoire while ensuring genome stability. The RAG-mediated cleavage reaction is stringently regulated at both the pre-cleavage stage and the post-cleavage stage. Specifically, RAG1/2 first forms a pre-cleavage complex assembled at the boarder of RSS and coding flank, which ensures the appropriate DNA targeting. Subsequently, this complex initiates site-specific cleavage, generating two types of double stranded DNA breaks, hairpin-ended coding ends (HP-CEs) and blunt signal ends (SEs). After the cleavage, RAG1/2 proteins bind and retain the recombination ends to form post-cleavage complexes (PCC), which collaborates with the NHEJ machinery for appropriate transfer of recombination ends to NHEJ for proper end resolution. However, little is known about the molecular basis of this collaboration, partly attributed to the lack of sensitive assays to reveal the interaction of PCC with HP-CEs. Here, for the first time, by using two complementary fluorescence-based techniques, fluorescence anisotropy and fluorescence resonance energy transfer (FRET), I managed to monitor the RAG1/2-catalyzed cleavage reaction in real time, from the pre-cleavage to the post-cleavage stages. By

  11. Synthetic lethality between murine DNA repair factors XLF and DNA-PKcs is rescued by inactivation of Ku70

    DEFF Research Database (Denmark)

    Xing, Mengtan; Bjørås, Magnar; Daniel, Jeremy A

    2017-01-01

    DNA double-strand breaks (DSBs) are recognized and repaired by the Classical Non-Homologous End-Joining (C-NHEJ) and Homologous Recombination pathways. C-NHEJ includes the core Ku70 and Ku80 (or Ku86) heterodimer that binds DSBs and thus promotes recruitment of accessory downstream NHEJ factors XLF......, PAXX, DNA-PKcs, Artemis and other core subunits, XRCC4 and DNA Ligase 4 (Lig4). In the absence of core C-NHEJ factors, DNA repair can be performed by Alternative End-Joining, which likely depends on DNA Ligase 1 and DNA Ligase 3. Genetic inactivation of C-NHEJ factors, such as Ku70, Ku80, XLF, PAXX...... with severe apoptosis in the central nervous system. Here, we demonstrate that inactivation of the Ku70 gene rescues the synthetic lethality between XLF and DNA-PKcs, resulting in triple knockout mice that are indistinguishable from Ku70-deficient littermates by size or levels of genomic instability. Moreover...

  12. Cloning and characterization of BKV(MM) DNA and its use for detection of BKV DNA in human urine

    International Nuclear Information System (INIS)

    Harley, E.H.; Olliver, C.L.; Rhodes-Harrison, L.; Mew, R.T.; Lecatsas, G.; Naude, W. du T.

    1982-01-01

    The two fragments produced by restriction of BKV(MM) DNA with the endonucleases Pst I and Eco RI have been cloned separately into the vector pBR322 and amplified in E. coli HB101. Eight recombinant plasmids were characterized by gel electrophoresis of Pst I/Eco RI double digestions or Hind III digestions of the DNA and by hybridization of Southern gel blots to a nick-translated BKV(MM) DNA probe. Four of the recombinant plasmids contained the large Pst I/Eco RI BKV(MM) DNA fragment and four contained the small fragment. Two of these recombinant plasmids were then used to make a probe for the identification of BK DNA in a urine specimen from a patient known to be exreting particles with the morphological features of papovavirus [af

  13. Cloning of human tumor necrosis factor (TNF) receptor cDNA and expression of recombinant soluble TNF-binding protein

    International Nuclear Information System (INIS)

    Gray, P.W.; Barrett, K.; Chantry, D.; Turner, M.; Feldmann, M.

    1990-01-01

    The cDNA for one of the receptors for human tumor necrosis factor (TNF) has been isolated. This cDNA encodes a protein of 455 amino acids that is divided into an extracellular domain of 171 residues and a cytoplasmic domain of 221 residues. The extracellular domain has been engineered for expression in mammalian cells, and this recombinant derivative binds TNFα with high affinity and inhibits its cytotoxic activity in vitro. The TNF receptor exhibits similarity with a family of cell surface proteins that includes the nerve growth factor receptor, the human B-cell surface antigen CD40, and the rat T-cell surface antigen OX40. The TNF receptor contains four cysteine-rich subdomains in the extracellular portion. Mammalian cells transfected with the entire TNF receptor cDNA bind radiolabeled TNFα with an affinity of 2.5 x 10 -9 M. This binding can be competitively inhibited with unlabeled TNFα or lymphotoxin (TNFβ)

  14. Cloning of Human Tumor Necrosis Factor (TNF) Receptor cDNA and Expression of Recombinant Soluble TNF-Binding Protein

    Science.gov (United States)

    Gray, Patrick W.; Barrett, Kathy; Chantry, David; Turner, Martin; Feldmann, Marc

    1990-10-01

    The cDNA for one of the receptors for human tumor necrosis factor (TNF) has been isolated. This cDNA encodes a protein of 455 amino acids that is divided into an extracellular domain of 171 residues and a cytoplasmic domain of 221 residues. The extracellular domain has been engineered for expression in mammalian cells, and this recombinant derivative binds TNFα with high affinity and inhibits its cytotoxic activity in vitro. The TNF receptor exhibits similarity with a family of cell surface proteins that includes the nerve growth factor receptor, the human B-cell surface antigen CD40, and the rat T-cell surface antigen OX40. The TNF receptor contains four cysteine-rich subdomains in the extra-cellular portion. Mammalian cells transfected with the entire TNF receptor cDNA bind radiolabeled TNFα with an affinity of 2.5 x 10-9 M. This binding can be competitively inhibited with unlabeled TNFα or lymphotoxin (TNFβ).

  15. HSV-I and the cellular DNA damage response.

    Science.gov (United States)

    Smith, Samantha; Weller, Sandra K

    2015-04-01

    Peter Wildy first observed genetic recombination between strains of HSV in 1955. At the time, knowledge of DNA repair mechanisms was limited, and it has only been in the last decade that particular DNA damage response (DDR) pathways have been examined in the context of viral infections. One of the first reports addressing the interaction between a cellular DDR protein and HSV-1 was the observation by Lees-Miller et al . that DNA-dependent protein kinase catalytic subunit levels were depleted in an ICP0-dependent manner during Herpes simplex virus 1 infection. Since then, there have been numerous reports describing the interactions between HSV infection and cellular DDR pathways. Due to space limitations, this review will focus predominantly on the most recent observations regarding how HSV navigates a potentially hostile environment to replicate its genome.

  16. RAD51 interconnects between DNA replication, DNA repair and immunity.

    Science.gov (United States)

    Bhattacharya, Souparno; Srinivasan, Kalayarasan; Abdisalaam, Salim; Su, Fengtao; Raj, Prithvi; Dozmorov, Igor; Mishra, Ritu; Wakeland, Edward K; Ghose, Subroto; Mukherjee, Shibani; Asaithamby, Aroumougame

    2017-05-05

    RAD51, a multifunctional protein, plays a central role in DNA replication and homologous recombination repair, and is known to be involved in cancer development. We identified a novel role for RAD51 in innate immune response signaling. Defects in RAD51 lead to the accumulation of self-DNA in the cytoplasm, triggering a STING-mediated innate immune response after replication stress and DNA damage. In the absence of RAD51, the unprotected newly replicated genome is degraded by the exonuclease activity of MRE11, and the fragmented nascent DNA accumulates in the cytosol, initiating an innate immune response. Our data suggest that in addition to playing roles in homologous recombination-mediated DNA double-strand break repair and replication fork processing, RAD51 is also implicated in the suppression of innate immunity. Thus, our study reveals a previously uncharacterized role of RAD51 in initiating immune signaling, placing it at the hub of new interconnections between DNA replication, DNA repair, and immunity. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. The consequences of sequence erosion in the evolution of recombination hotspots.

    Science.gov (United States)

    Tiemann-Boege, Irene; Schwarz, Theresa; Striedner, Yasmin; Heissl, Angelika

    2017-12-19

    Meiosis is initiated by a double-strand break (DSB) introduced in the DNA by a highly controlled process that is repaired by recombination. In many organisms, recombination occurs at specific and narrow regions of the genome, known as recombination hotspots, which overlap with regions enriched for DSBs. In recent years, it has been demonstrated that conversions and mutations resulting from the repair of DSBs lead to a rapid sequence evolution at recombination hotspots eroding target sites for DSBs. We still do not fully understand the effect of this erosion in the recombination activity, but evidence has shown that the binding of trans -acting factors like PRDM9 is affected. PRDM9 is a meiosis-specific, multi-domain protein that recognizes DNA target motifs by its zinc finger domain and directs DSBs to these target sites. Here we discuss the changes in affinity of PRDM9 to eroded recognition sequences, and explain how these changes in affinity of PRDM9 can affect recombination, leading sometimes to sterility in the context of hybrid crosses. We also present experimental data showing that DNA methylation reduces PRDM9 binding in vitro Finally, we discuss PRDM9-independent hotspots, posing the question how these hotspots evolve and change with sequence erosion.This article is part of the themed issue 'Evolutionary causes and consequences of recombination rate variation in sexual organisms'. © 2017 The Authors.

  18. Mouse RAD54 affects DNA double-strand break repair and sister chromatid exchange

    NARCIS (Netherlands)

    H.B. Beverloo (Berna); R.D. Johnson (Roger); M. Jasin (Maria); R. Kanaar (Roland); J.H.J. Hoeijmakers (Jan); M.L.G. Dronkert (Mies)

    2000-01-01

    textabstractCells can achieve error-free repair of DNA double-strand breaks (DSBs) by homologous recombination through gene conversion with or without crossover. In contrast, an alternative homology-dependent DSB repair pathway, single-strand annealing (SSA), results in deletions. In this study, we

  19. Electron-ion recombination rates for merged-beams experiments

    International Nuclear Information System (INIS)

    Pajek, M.

    1994-01-01

    Energy dependence of the electron-ion recombination rates are studied for different recombination processes (radiative recombination, three-body recombination, dissociative recombination) for Maxwellian relative velocity distribution of arbitrary asymmetry. The results are discussed in context of the electron-ion merged beams experiments in cooling ion storage rings. The question of indication of a possible contribution of the three-body recombination to the measured recombination rates versus relative energy is particularly addressed. Its influence on the electron beam temperature derived from the energy dependence of recombination rate is discussed

  20. New vaccine strategies against enterotoxigenic Escherichia coli: II: Enhanced systemic and secreted antibody responses against the CFA/I fimbriae by priming with DNA and boosting with a live recombinant Salmonella vaccine

    Directory of Open Access Journals (Sweden)

    M.O. Lásaro

    1999-02-01

    Full Text Available The induction of systemic (IgG and mucosal (IgA antibody responses against the colonization factor I antigen (CFA/I of enterotoxigenic Escherichia coli (ETEC was evaluated in mice primed with an intramuscularly delivered CFA/I-encoding DNA vaccine followed by two oral immunizations with a live recombinant Salmonella typhimurium vaccine strain expressing the ETEC antigen. The booster effect induced by the oral immunization was detected two weeks and one year after the administration of the DNA vaccine. The DNA-primed/Salmonella-boosted vaccination regime showed a synergistic effect on the induced CFA/I-specific systemic and secreted antibody levels which could not be attained by either immunization strategy alone. These results suggest that the combined use of DNA vaccines and recombinant Salmonella vaccine strains can be a useful immunization strategy against enteric pathogens.

  1. Recombinant vaccines: experimental and applied aspects

    DEFF Research Database (Denmark)

    Lorenzen, Niels

    1999-01-01

    Development of vaccines for aquaculture fish represent an important applied functional aspect of fish immunology research. Particularly in the case of recombinant vaccines, where a single antigen is usually expected to induce immunity to a specific pathogen, knowledge of mechanisms involved...... in induction of a protective immune response may become vital. The few recombinant vaccines licensd so far, despite much research during the last decade, illustrate that this is not a straightforward matter. However, as vaccine technology as well as our knowledge of the fish immune system is steadily improved......, these fields will open up a number of interesting research objectives of mutual benefit. Recent aspects of recombinant protein vaccines, live recombinant vaccines and DNA vaccines are discussed....

  2. Rad51C deficiency destabilizes XRCC3, impairs recombination and radiosensitizes S/G2-phase cells

    Energy Technology Data Exchange (ETDEWEB)

    Lio, Yi-Ching; Schild, David; Brenneman, Mark A.; Redpath, J. Leslie; Chen, David J.

    2004-05-01

    The highly conserved Rad51 protein plays an essential role in repairing DNA damage through homologous recombination. In vertebrates, five Rad51 paralogs (Rad51B, Rad51C, Rad51D, XRCC2, XRCC3) are expressed in mitotically growing cells, and are thought to play mediating roles in homologous recombination, though their precise functions remain unclear. Here we report the use of RNA interference to deplete expression of Rad51C protein in human HT1080 and HeLa cells. In HT1080 cells, depletion of Rad51C by small interfering RNA caused a significant reduction of frequency in homologous recombination. The level of XRCC3 protein was also sharply reduced in Rad51C-depleted HeLa cells, suggesting that XRCC3 is dependent for its stability upon heterodimerization with Rad51C. In addition, Rad51C-depleted HeLa cells showed hypersensitivity to the DNA cross-linking agent mitomycin C, and moderately increased sensitivity to ionizing radiation. Importantly, the radiosensitivity of Rad51C-deficient HeLa cells was evident in S and G{sub 2}/M phases of the cell cycle but not in G{sub 1} phase. Together, these results provide direct cellular evidence for the importance of human Rad51C in homologous recombinational repair.

  3. DNA template dependent accuracy variation of nucleotide selection in transcription.

    Directory of Open Access Journals (Sweden)

    Harriet Mellenius

    Full Text Available It has been commonly assumed that the effect of erroneous transcription of DNA genes into messenger RNAs on peptide sequence errors are masked by much more frequent errors of mRNA translation to protein. We present a theoretical model of transcriptional accuracy. It uses experimentally estimated standard free energies of double-stranded DNA and RNA/DNA hybrids and predicts a DNA template dependent transcriptional accuracy variation spanning several orders of magnitude. The model also identifies high-error as well a high-accuracy transcription motifs. The source of the large accuracy span is the context dependent variation of the stacking free energy of pairs of correct and incorrect base pairs in the ever moving transcription bubble. Our model predictions have direct experimental support from recent single molecule based identifications of transcriptional errors in the C. elegans transcriptome. Our conclusions challenge the general view that amino acid substitution errors in proteins are mainly caused by translational errors. It suggests instead that transcriptional error hotspots are the dominating source of peptide sequence errors in some DNA template contexts, while mRNA translation is the major cause of protein errors in other contexts.

  4. Double-stranded DNA-dependent ATPase Irc3p is directly involved in mitochondrial genome maintenance.

    Science.gov (United States)

    Sedman, Tiina; Gaidutšik, Ilja; Villemson, Karin; Hou, YingJian; Sedman, Juhan

    2014-12-01

    Nucleic acid-dependent ATPases are involved in nearly all aspects of DNA and RNA metabolism. Previous studies have described a number of mitochondrial helicases. However, double-stranded DNA-dependent ATPases, including translocases or enzymes remodeling DNA-protein complexes, have not been identified in mitochondria of the yeast Saccharomyces cerevisae. Here, we demonstrate that Irc3p is a mitochondrial double-stranded DNA-dependent ATPase of the Superfamily II. In contrast to the other mitochondrial Superfamily II enzymes Mss116p, Suv3p and Mrh4p, which are RNA helicases, Irc3p has a direct role in mitochondrial DNA (mtDNA) maintenance. Specific Irc3p-dependent mtDNA metabolic intermediates can be detected, including high levels of double-stranded DNA breaks that accumulate in irc3Δ mutants. irc3Δ-related topology changes in rho- mtDNA can be reversed by the deletion of mitochondrial RNA polymerase RPO41, suggesting that Irc3p counterbalances adverse effects of transcription on mitochondrial genome stability. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Force-dependent melting of supercoiled DNA at thermophilic temperatures.

    Science.gov (United States)

    Galburt, E A; Tomko, E J; Stump, W T; Ruiz Manzano, A

    2014-01-01

    Local DNA opening plays an important role in DNA metabolism as the double-helix must be melted before the information contained within may be accessed. Cells finely tune the torsional state of their genomes to strike a balance between stability and accessibility. For example, while mesophilic life forms maintain negatively superhelical genomes, thermophilic life forms use unique mechanisms to maintain relaxed or even positively supercoiled genomes. Here, we use a single-molecule magnetic tweezers approach to quantify the force-dependent equilibrium between DNA melting and supercoiling at high temperatures populated by Thermophiles. We show that negatively supercoiled DNA denatures at 0.5 pN lower tension at thermophilic vs. mesophilic temperatures. This work demonstrates the ability to monitor DNA supercoiling at high temperature and opens the possibility to perform magnetic tweezers assays on thermophilic systems. The data allow for an estimation of the relative energies of base-pairing and DNA bending as a function of temperature and support speculation as to different general mechanisms of DNA opening in different environments. Lastly, our results imply that average in vivo DNA tensions range between 0.3 and 1.1 pN. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Expression and purification of recombinant hemoglobin in Escherichia coli

    DEFF Research Database (Denmark)

    Natarajan, Chandrasekhar; Jiang, Xiaoben; Fago, Angela

    2011-01-01

    BACKGROUND: Recombinant DNA technologies have played a pivotal role in the elucidation of structure-function relationships in hemoglobin (Hb) and other globin proteins. Here we describe the development of a plasmid expression system to synthesize recombinant Hbs in Escherichia coli, and we describe...

  7. Temperature dependence of interband recombination energy in symmetric (In,Ga)N spherical quantum dot-quantum well

    Energy Technology Data Exchange (ETDEWEB)

    El Ghazi, Haddou, E-mail: hadghazi@gmail.com [LPS, Faculty of Science, Dhar EL Mehrez, BP 1796 Fes-Atlas (Morocco); Special Mathematics, CPGE, 267 Quartier complémentaire Ennahda 1, Rabat (Morocco); Jorio, Anouar [LPS, Faculty of Science, Dhar EL Mehrez, BP 1796 Fes-Atlas (Morocco)

    2014-01-01

    Within the framework of effective-mass approximation and finite parabolic potential barrier, single particle and ground-state interband recombination energies in Core|well|shell based on GaN|(In,Ga)N|GaN spherical QDQW are investigated as a function of the inner and the outer radii. The temperature dependency of effective-mass, band-gap energy and potential barrier is taken into account. Particle eigenvalue and band-gap energy competing effects are speculated to explain our numerical results which show that the interband recombination energy increases when the temperature increases. The results we obtained are in quite good agreement with the findings.

  8. Temperature dependence of interband recombination energy in symmetric (In,Ga)N spherical quantum dot-quantum well

    International Nuclear Information System (INIS)

    El Ghazi, Haddou; Jorio, Anouar

    2014-01-01

    Within the framework of effective-mass approximation and finite parabolic potential barrier, single particle and ground-state interband recombination energies in Core|well|shell based on GaN|(In,Ga)N|GaN spherical QDQW are investigated as a function of the inner and the outer radii. The temperature dependency of effective-mass, band-gap energy and potential barrier is taken into account. Particle eigenvalue and band-gap energy competing effects are speculated to explain our numerical results which show that the interband recombination energy increases when the temperature increases. The results we obtained are in quite good agreement with the findings

  9. Coincident In Vitro Analysis of DNA-PK-Dependent and -Independent Nonhomologous End Joining

    Directory of Open Access Journals (Sweden)

    Cynthia L. Hendrickson

    2010-01-01

    Full Text Available In mammalian cells, DNA double-strand breaks (DSBs are primarily repaired by nonhomologous end joining (NHEJ. The current model suggests that the Ku 70/80 heterodimer binds to DSB ends and recruits DNA-PKcs to form the active DNA-dependent protein kinase, DNA-PK. Subsequently, XRCC4, DNA ligase IV, XLF and most likely, other unidentified components participate in the final DSB ligation step. Therefore, DNA-PK plays a key role in NHEJ due to its structural and regulatory functions that mediate DSB end joining. However, recent studies show that additional DNA-PK-independent NHEJ pathways also exist. Unfortunately, the presence of DNA-PKcs appears to inhibit DNA-PK-independent NHEJ, and in vitro analysis of DNA-PK-independent NHEJ in the presence of the DNA-PKcs protein remains problematic. We have developed an in vitro assay that is preferentially active for DNA-PK-independent DSB repair based solely on its reaction conditions, facilitating coincident differential biochemical analysis of the two pathways. The results indicate the biochemically distinct nature of the end-joining mechanisms represented by the DNA-PK-dependent and -independent NHEJ assays as well as functional differences between the two pathways.

  10. A Rapid and Improved Method to Generate Recombinant Dengue Virus Vaccine Candidates.

    Science.gov (United States)

    Govindarajan, Dhanasekaran; Guan, Liming; Meschino, Steven; Fridman, Arthur; Bagchi, Ansu; Pak, Irene; ter Meulen, Jan; Casimiro, Danilo R; Bett, Andrew J

    2016-01-01

    Dengue is one of the most important mosquito-borne infections accounting for severe morbidity and mortality worldwide. Recently, the tetravalent chimeric live attenuated Dengue vaccine Dengvaxia® was approved for use in several dengue endemic countries. In general, live attenuated vaccines (LAV) are very efficacious and offer long-lasting immunity against virus-induced disease. Rationally designed LAVs can be generated through reverse genetics technology, a method of generating infectious recombinant viruses from full length cDNA contained in bacterial plasmids. In vitro transcribed (IVT) viral RNA from these infectious clones is transfected into susceptible cells to generate recombinant virus. However, the generation of full-length dengue virus cDNA clones can be difficult due to the genetic instability of viral sequences in bacterial plasmids. To circumvent the need for a single plasmid containing a full length cDNA, in vitro ligation of two or three cDNA fragments contained in separate plasmids can be used to generate a full-length dengue viral cDNA template. However, in vitro ligation of multiple fragments often yields low quality template for IVT reactions, resulting in inconsistent low yield RNA. These technical difficulties make recombinant virus recovery less efficient. In this study, we describe a simple, rapid and efficient method of using LONG-PCR to recover recombinant chimeric Yellow fever dengue (CYD) viruses as potential dengue vaccine candidates. Using this method, we were able to efficiently generate several viable recombinant viruses without introducing any artificial mutations into the viral genomes. We believe that the techniques reported here will enable rapid and efficient recovery of recombinant flaviviruses for evaluation as vaccine candidates and, be applicable to the recovery of other RNA viruses.

  11. Conversion of Deletions during Recombination in Pneumococcal Transformation

    Science.gov (United States)

    Lefevre, J. C.; Mostachfi, P.; Gasc, A. M.; Guillot, E.; Pasta, F.; Sicard, M.

    1989-01-01

    Genetic analysis of 16 deletions obtained in the amiA locus of pneumococcus is described. When present on donor DNA, all deletions increased drastically the frequency of wild-type recombinants in two-point crosses. This effect was maximal for deletions longer than 200 bases. It was reduced for heterologies shorter than 76 bases and did not exist for very short deletions. In three-point crosses in which the deletion was localized between two point mutations, we demonstrated that this excess of wild-type recombinants was the result of a genetic conversion. This conversion extended over several scores of bases outside the deletion. Conversion takes place during the heteroduplex stage of recombination. Therefore, in pneumococcal transformation, long heterologies participated in this heteroduplex configuration. As this conversion did not require an active DNA polymerase A gene it is proposed that the mechanism of conversion is not a DNA repair synthesis but involves breakage and ligation between DNA molecules. Conversion of deletions did not require the Hex system of correction of mismatched bases. It differs also from localized conversion. It appears that it is a process that evolved to correct errors of replication which lead to long heterologies and which are not eliminated by other systems. PMID:2599365

  12. RAD52 Facilitates Mitotic DNA Synthesis Following Replication Stress

    DEFF Research Database (Denmark)

    Bhowmick, Rahul; Minocherhomji, Sheroy; Hickson, Ian D

    2016-01-01

    Homologous recombination (HR) is necessary to counteract DNA replication stress. Common fragile site (CFS) loci are particularly sensitive to replication stress and undergo pathological rearrangements in tumors. At these loci, replication stress frequently activates DNA repair synthesis in mitosis...... replication stress at CFS loci during S-phase. In contrast, MiDAS is RAD52 dependent, and RAD52 is required for the timely recruitment of MUS81 and POLD3 to CFSs in early mitosis. Our results provide further mechanistic insight into MiDAS and define a specific function for human RAD52. Furthermore, selective...

  13. Generation and CRISPR/Cas9 editing of transformed progenitor B cells as a pseudo-physiological system to study DNA repair gene function in V(D)J recombination.

    Science.gov (United States)

    Lenden Hasse, Hélène; Lescale, Chloé; Bianchi, Joy J; Yu, Wei; Bedora-Faure, Marie; Deriano, Ludovic

    2017-12-01

    Antigen receptor gene assembly is accomplished in developing lymphocytes by the V(D)J recombination reaction, which can be separated into two steps: DNA cleavage by the recombination-activating gene (RAG) nuclease and joining of DNA double strand breaks (DSBs) by components of the nonhomologous end joining (NHEJ) pathway. Deficiencies for NHEJ factors can result in immunodeficiency and a propensity to accumulate genomic instability, thus highlighting the importance of identifying all players in this process and deciphering their functions. Bcl2 transgenic v-Abl kinase-transformed pro-B cells provide a pseudo-physiological cellular system to study V(D)J recombination. Treatment of v-Abl/Bcl2 pro-B cells with the Abl kinase inhibitor Imatinib leads to G1 cell cycle arrest, the rapid induction of Rag1/2 gene expression and V(D)J recombination. In this system, the Bcl2 transgene alleviates Imatinib-induced apoptosis enabling the analysis of induced V(D)J recombination. Although powerful, the use of mouse models carrying the Bcl2 transgene for the generation of v-Abl pro-B cell lines is time and money consuming. Here, we describe a method for generating v-Abl/Bcl2 pro-B cell lines from wild type mice and for performing gene knock-out using episomal CRISPR/Cas9 targeting vectors. Using this approach, we generated distinct NHEJ-deficient pro-B cell lines and quantified V(D)J recombination levels in these cells. Furthermore, this methodology can be adapted to generate pro-B cell lines deficient for any gene suspected to play a role in V(D)J recombination, and more generally DSB repair. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  14. The DNA-dependent protein kinase: a multifunctional protein kinase with roles in DNA double strand break repair and mitosis

    OpenAIRE

    Jette, Nicholas; Lees-Miller, Susan P.

    2014-01-01

    The DNA-dependent protein kinase (DNA-PK) is a serine/threonine protein kinase composed of a large catalytic subunit (DNA-PKcs) and the Ku70/80 heterodimer. Over the past two decades, significant progress has been made in elucidating the role of DNA-PK in non-homologous end joining (NHEJ), the major pathway for repair of ionizing radiation-induced DNA double strand breaks in human cells and recently, additional roles for DNA-PK have been reported. In this review, we will describe the biochemi...

  15. Genetic polymorphisms in homologous recombination repair genes in healthy Slovenian population and their influence on DNA damage

    International Nuclear Information System (INIS)

    Goricar, Katja; Erculj, Nina; Zadel, Maja; Dolzan, Vita

    2012-01-01

    Homologous recombination (HR) repair is an important mechanism involved in repairing double-strand breaks in DNA and for maintaining genomic stability. Polymorphisms in genes coding for enzymes involved in this pathway may influence the capacity for DNA repair. The aim of this study was to select tag single nucleotide polymorphisms (SNPs) in specific genes involved in HR repair, to determine their allele frequencies in a healthy Slovenian population and their influence on DNA damage detected with comet assay. In total 373 individuals were genotyped for nine tag SNPs in three genes: XRCC3 722C>T, XRCC3 -316A>G, RAD51 -98G>C, RAD51 -61G>T, RAD51 1522T>G, NBS1 553G>C, NBS1 1197A>G, NBS1 37117C>T and NBS1 3474A>C using competitive allele-specific amplification (KASPar assay). Comet assay was performed in a subgroup of 26 individuals to determine the influence of selected SNPs on DNA damage. We observed that age significantly affected genotype frequencies distribution of XRCC3 -316A>G (P = 0.039) in healthy male blood donors. XRCC3 722C>T (P = 0.005), RAD51 -61G>T (P = 0.023) and NBS1 553G>C (P = 0.008) had a statistically significant influence on DNA damage. XRCC3 722C>T, RAD51 -61G>T and NBS1 553G>C polymorphisms significantly affect the repair of damaged DNA and may be of clinical importance as they are common in Slovenian population

  16. BIOTECHNOLOGY OF RECOMBINANT HORMONES IN DOPING

    Directory of Open Access Journals (Sweden)

    Biljana Vitošević

    2011-09-01

    Full Text Available Recombinant DNA technology has allowed rapid progress in creating biosynthetic gene products for the treatment of many diseases. In this way it can produce large amounts of hormone, which is intended for the treatment of many pathological conditions. Recombinant hormones that are commonly used are insulin, growth hormone and erythropoietin. Precisely because of the availability of these recombinant hormones, it started their abuse by athletes. Experiments in animal models confirmed the potential effects of some of these hormones in increasing physical abilities, which attracted the attention of athletes who push the limits of their competitive capability by such manipulation. The risks of the use of recombinant hormones in doping include serious consequences for the health of athletes. Methods of detection of endogenous hormones from recombined based on the use of a monoclonal antibodies, capillary zone electrophoresis and protein biomarkers

  17. The temperature--dependent expression of GST of Schistosoma japonicum (Philippine strain).

    Science.gov (United States)

    Cai, Z H; Song, G C; Xu, Y X; Liu, S X

    1993-03-01

    Obtained from pSj5, the cDNA gene encoding GST antigen of Schistosoma japonicum (Philippine strain) was ligated with efficient temperature-dependent PBV220 vector which was constructed in CAPM, and then introduced into host bacterium-DH5 alpha (E. coli) by transformation. Transformants were selected by ampicillin and recombinant clones were identified by restriction mapping. The result showed that recombinant clone 43 was the one carrying recombinant plasmid PBV 220 with the correct insertion of the gene fragment. The GST expression ability of clone 43 was investigated by GST enzymic activity assay and SDS-PAGE. A relatively high level of GST enzymic activity was expressed by this clone under the temperature-dependent condition, that is, cultured at 30 degrees C and expressed at 42 degrees C. A more strongly stained 26 kDa protein band was identified by SDS-PAGE. The result indicated that GST of S. japonicum (Philippine strain) could be expressed not only by IPTG induction, but also by the temperature-dependent method.

  18. Choreography of the DNA damage response

    DEFF Research Database (Denmark)

    Lisby, Michael; Barlow, Jacqueline H; Burgess, Rebecca C

    2004-01-01

    DNA repair is an essential process for preserving genome integrity in all organisms. In eukaryotes, recombinational repair is choreographed by multiprotein complexes that are organized into centers (foci). Here, we analyze the cellular response to DNA double-strand breaks (DSBs) and replication...... stress in Saccharomyces cerevisiae. The Mre11 nuclease and the ATM-related Tel1 kinase are the first proteins detected at DSBs. Next, the Rfa1 single-strand DNA binding protein relocalizes to the break and recruits other key checkpoint proteins. Later and only in S and G2 phase, the homologous...... recombination machinery assembles at the site. Unlike the response to DSBs, Mre11 and recombination proteins are not recruited to hydroxyurea-stalled replication forks unless the forks collapse. The cellular response to DSBs and DNA replication stress is likely directed by the Mre11 complex detecting...

  19. Analyses of a whole-genome inter-clade recombination map of hepatitis delta virus suggest a host polymerase-driven and viral RNA structure-promoted template-switching mechanism for viral RNA recombination

    Science.gov (United States)

    Chao, Mei; Wang, Tzu-Chi; Lin, Chia-Chi; Yung-Liang Wang, Robert; Lin, Wen-Bin; Lee, Shang-En; Cheng, Ying-Yu; Yeh, Chau-Ting; Iang, Shan-Bei

    2017-01-01

    The genome of hepatitis delta virus (HDV) is a 1.7-kb single-stranded circular RNA that folds into an unbranched rod-like structure and has ribozyme activity. HDV redirects host RNA polymerase(s) (RNAP) to perform viral RNA-directed RNA transcription. RNA recombination is known to contribute to the genetic heterogeneity of HDV, but its molecular mechanism is poorly understood. Here, we established a whole-genome HDV-1/HDV-4 recombination map using two cloned sequences coexisting in cultured cells. Our functional analyses of the resulting chimeric delta antigens (the only viral-encoded protein) and recombinant genomes provide insights into how recombination promotes the genotypic and phenotypic diversity of HDV. Our examination of crossover distribution and subsequent mutagenesis analyses demonstrated that ribozyme activity on HDV genome, which is required for viral replication, also contributes to the generation of an inter-clade junction. These data provide circumstantial evidence supporting our contention that HDV RNA recombination occurs via a replication-dependent mechanism. Furthermore, we identify an intrinsic asymmetric bulge on the HDV genome, which appears to promote recombination events in the vicinity. We therefore propose a mammalian RNAP-driven and viral-RNA-structure-promoted template-switching mechanism for HDV genetic recombination. The present findings improve our understanding of the capacities of the host RNAP beyond typical DNA-directed transcription. PMID:28977829

  20. DNA-dependent protein kinase in nonhomologous end joining: a lock with multiple keys?

    Science.gov (United States)

    Weterings, Eric; Chen, David J

    2007-10-22

    The DNA-dependent protein kinase (DNA-PK) is one of the central enzymes involved in DNA double-strand break (DSB) repair. It facilitates proper alignment of the two ends of the broken DNA molecule and coordinates access of other factors to the repair complex. We discuss the latest findings on DNA-PK phosphorylation and offer a working model for the regulation of DNA-PK during DSB repair.

  1. DNA repair synthesis dependent on the uvrA,B gene products

    International Nuclear Information System (INIS)

    Moses, R.E.; Moody, E.E.M.

    1975-01-01

    Ultraviolet irradiation of toluene-treated Escherichia coli causes an inhibition of replicative DNA synthesis. This is followed by the appearance of nonconservative DNA repair synthesis which does not require either the polymerase or 5' → 3' exonucleolytic activities of DNA polymerase I. The repair synthesis may be catalyzed by DNA polymerase III activity but does not require a functional DNA polymerase II. The ultraviolet-induced synthesis requires ATP and is dependent on a functional uvrA and uvrB gene product. However, other uvr gene products are not required for the synthesis. The recB function is also not required

  2. Fluorescence quenching studies of potential-dependent DNA reorientation dynamics at glassy carbon electrode surfaces.

    Science.gov (United States)

    Li, Qin; Cui, Chenchen; Higgins, Daniel A; Li, Jun

    2012-09-05

    The potential-dependent reorientation dynamics of double-stranded DNA (ds-DNA) attached to planar glassy carbon electrode (GCE) surfaces were investigated. The orientation state of surface-bound ds-DNA was followed by monitoring the fluorescence from a 6-carboxyfluorescein (FAM6) fluorophore covalently linked to the distal end of the DNA. Positive potentials (i.e., +0.2 V vs open circuit potential, OCP) caused the ds-DNA to align parallel to the electrode surface, resulting in strong dipole-electrode quenching of FAM6 fluorescence. Switching of the GCE potential to negative values (i.e., -0.2 V vs OCP) caused the ds-DNA to reorient perpendicular to the electrode surface, with a concomitant increase in FAM6 fluorescence. In addition to the very fast (submilliseconds) dynamics of the initial reorientation process, slow (0.1-0.9 s) relaxation of FAM6 fluorescence to intermediate levels was also observed after potential switching. These dynamics have not been previously described in the literature. They are too slow to be explained by double layer charging, and chronoamperometry data showed no evidence of such effects. Both the amplitude and rate of the dynamics were found to depend upon buffer concentration, and ds-DNA length, demonstrating a dependence on the double layer field. The dynamics are concluded to arise from previously undetected complexities in the mechanism of potential-dependent ds-DNA reorientation. The possible origins of these dynamics are discussed. A better understanding of these dynamics will lead to improved models for potential-dependent ds-DNA reorientation at electrode surfaces and will facilitate the development of advanced electrochemical devices for detection of target DNAs.

  3. The DNA-dependent protein kinase: a multifunctional protein kinase with roles in DNA double strand break repair and mitosis

    Science.gov (United States)

    Jette, Nicholas; Lees-Miller, Susan P.

    2015-01-01

    The DNA-dependent protein kinase (DNA-PK) is a serine/threonine protein kinase composed of a large catalytic subunit (DNA-PKcs) and the Ku70/80 heterodimer. Over the past two decades, significant progress has been made in elucidating the role of DNA-PK in non-homologous end joining (NHEJ), the major pathway for repair of ionizing radiation-induced DNA double strand breaks in human cells and recently, additional roles for DNA-PK have been reported. In this review, we will describe the biochemistry, structure and function of DNA-PK, its roles in DNA double strand break repair and its newly described roles in mitosis and other cellular processes. PMID:25550082

  4. The HSP90 inhibitor NVP-AUY922 radiosensitizes by abrogation of homologous recombination resulting in mitotic entry with unresolved DNA damage.

    Directory of Open Access Journals (Sweden)

    Shane Zaidi

    Full Text Available Heat shock protein 90 (HSP90 is a molecular chaperone responsible for the conformational maintenance of a number of client proteins that play key roles in cell cycle arrest, DNA damage repair and apoptosis following radiation. HSP90 inhibitors exhibit antitumor activity by modulating the stabilisation and activation of HSP90 client proteins. We sought to evaluate NVP-AUY922, the most potent HSP90 inhibitor yet reported, in preclinical radiosensitization studies.NVP-AUY922 potently radiosensitized cells in vitro at low nanomolar concentrations with a concurrent depletion of radioresistance-linked client proteins. Radiosensitization by NVP-AUY922 was verified for the first time in vivo in a human head and neck squamous cell carcinoma xenograft model in athymic mice, as measured by delayed tumor growth and increased surrogate end-point survival (p = <0.0001. NVP-AUY922 was shown to ubiquitously inhibit resolution of dsDNA damage repair correlating to delayed Rad51 foci formation in all cell lines tested. Additionally, NVP-AUY922 induced a stalled mitotic phenotype, in a cell line-dependent manner, in HeLa and HN5 cell lines irrespective of radiation exposure. Cell cycle analysis indicated that NVP-AUY922 induced aberrant mitotic entry in all cell lines tested in the presence of radiation-induced DNA damage due to ubiquitous CHK1 depletion, but resultant downstream cell cycle effects were cell line dependent.These results identify NVP-AUY922 as the most potent HSP90-mediated radiosensitizer yet reported in vitro, and for the first time validate it in a clinically relevant in vivo model. Mechanistic analysis at clinically achievable concentrations demonstrated that radiosensitization is mediated by the combinatorial inhibition of cell growth and survival pathways, ubiquitous delay in Rad51-mediated homologous recombination and CHK1-mediated G(2/M arrest, but that the contribution of cell cycle perturbation to radiosensitization may be cell line

  5. Inter-Fork Strand Annealing causes genomic deletions during the termination of DNA replication.

    Science.gov (United States)

    Morrow, Carl A; Nguyen, Michael O; Fower, Andrew; Wong, Io Nam; Osman, Fekret; Bryer, Claire; Whitby, Matthew C

    2017-06-06

    Problems that arise during DNA replication can drive genomic alterations that are instrumental in the development of cancers and many human genetic disorders. Replication fork barriers are a commonly encountered problem, which can cause fork collapse and act as hotspots for replication termination. Collapsed forks can be rescued by homologous recombination, which restarts replication. However, replication restart is relatively slow and, therefore, replication termination may frequently occur by an active fork converging on a collapsed fork. We find that this type of non-canonical fork convergence in fission yeast is prone to trigger deletions between repetitive DNA sequences via a mechanism we call Inter-Fork Strand Annealing (IFSA) that depends on the recombination proteins Rad52, Exo1 and Mus81, and is countered by the FANCM-related DNA helicase Fml1. Based on our findings, we propose that IFSA is a potential threat to genomic stability in eukaryotes.

  6. DNA degradation in minicells of Escherichia coli K-12. Pt. 2. Effect of recA1 and recB21 mutations on DNA degradation in minicells and detection of exonuclease V activity

    Energy Technology Data Exchange (ETDEWEB)

    Khachatourians, G G [Saskatchewan Univ., Saskatoon (Canada). Dept. of Microbiology; Oak Ridge National Lab., Tenn. (USA). Biology Div.); Paterson, M C [Tennessee Univ., Oak Ridge (USA). Graduate School of Biomedical Sciences; Rijksuniversiteit Leiden (Netherlands). Lab. voor Stralengenetica); Sheehy, R J [Tennessee Univ., Oak Ridge (USA). Graduate School of Biomedical Sciences; Dorp, B Van [Rijksuniversiteit Leiden (Netherlands). Lab. voor Stralengenetica; Worthy, T E [Tennessee Univ., Knoxville (USA). Inst. of Radiation Biology

    1975-06-01

    The properties of minicell producing mutants of Escherichia coli deficient in genetic recombination were examined. Experiments were designed to test recombinant formation in conjugal crosses, survival following UV-irradiation in cells, and the state of DNA metabolism in minicells. The REC-phenotypes are unaffected by min/sup +///sup -/ genotypes in whole cells. In contrast to minicells produced by rec/sup +/ parental cells, minicells from a recB21 strain have limited capacity to degrade linear, Hfr transferred DNA. The lack of a functional recA gene product, presumably involved in inhibiting the recBC nuclease action(s), permits unrestricted Hfr DNA breakdown in minicells produced by a recA1 strain. This results in an increase in TGA soluble products and in the formation of small DNA molecules that sediment near the top of an alkaline sucrose gradient. Unlike the linear DNA, circular duplex DNA from plasmids R64-11 or lambdadv, segregated into the minicells, is resistant to breakdown. By using in vitro criteria, and (/sup 32/P)-labelled linear DNA from bacteriophage T/sub 7/ for substrate, we found that the ATP-dependent exonuclease of the recBC complex (exo V) is present in rec/sup +/ and recA/sup -/ minicells, and is lacking in the recB21 mutant. In fact, the absence of a functional exo V in recBC/sup -/ minicells results in isolation of larger than average Hfr DNA from minicells. We suggest that recombination (REC) enzymes segregate into the polar minicells at the time of minicell biogenesis. This system should be useful for studies on DNA metabolism and functions of the recBC and recA gene products.

  7. A Rapid and Improved Method to Generate Recombinant Dengue Virus Vaccine Candidates.

    Directory of Open Access Journals (Sweden)

    Dhanasekaran Govindarajan

    Full Text Available Dengue is one of the most important mosquito-borne infections accounting for severe morbidity and mortality worldwide. Recently, the tetravalent chimeric live attenuated Dengue vaccine Dengvaxia® was approved for use in several dengue endemic countries. In general, live attenuated vaccines (LAV are very efficacious and offer long-lasting immunity against virus-induced disease. Rationally designed LAVs can be generated through reverse genetics technology, a method of generating infectious recombinant viruses from full length cDNA contained in bacterial plasmids. In vitro transcribed (IVT viral RNA from these infectious clones is transfected into susceptible cells to generate recombinant virus. However, the generation of full-length dengue virus cDNA clones can be difficult due to the genetic instability of viral sequences in bacterial plasmids. To circumvent the need for a single plasmid containing a full length cDNA, in vitro ligation of two or three cDNA fragments contained in separate plasmids can be used to generate a full-length dengue viral cDNA template. However, in vitro ligation of multiple fragments often yields low quality template for IVT reactions, resulting in inconsistent low yield RNA. These technical difficulties make recombinant virus recovery less efficient. In this study, we describe a simple, rapid and efficient method of using LONG-PCR to recover recombinant chimeric Yellow fever dengue (CYD viruses as potential dengue vaccine candidates. Using this method, we were able to efficiently generate several viable recombinant viruses without introducing any artificial mutations into the viral genomes. We believe that the techniques reported here will enable rapid and efficient recovery of recombinant flaviviruses for evaluation as vaccine candidates and, be applicable to the recovery of other RNA viruses.

  8. Mechanisms and factors that influence high frequency retroviral recombination

    DEFF Research Database (Denmark)

    Delviks-Frankenberry, Krista; Galli, Andrea; Nikolaitchik, Olga

    2011-01-01

    With constantly changing environmental selection pressures, retroviruses rely upon recombination to reassort polymorphisms in their genomes and increase genetic diversity, which improves the chances for the survival of their population. Recombination occurs during DNA synthesis, whereby reverse...... transcriptase undergoes template switching events between the two copackaged RNAs, resulting in a viral recombinant with portions of the genetic information from each parental RNA. This review summarizes our current understanding of the factors and mechanisms influencing retroviral recombination, fidelity...... of the recombination process, and evaluates the subsequent viral diversity and fitness of the progeny recombinant. Specifically, the high mutation rates and high recombination frequencies of HIV-1 will be analyzed for their roles in influencing HIV-1 global diversity, as well as HIV-1 diagnosis, drug treatment...

  9. Studying of the standardization principles of pharmacological activity of recombinant erythropoietin preparations

    OpenAIRE

    A. K. Yakovlev; L. A. Gayderova; N. A. Alpatova; T. N. Lobanova; E. L. Postnova; E. I. Yurchikova; T. A. Batuashvili; R. A. Volkova; V. N. Podkuiko; Yu. V. Olefir

    2016-01-01

    Analysis of the publications devoted to the structure, functions, mechanism of action of erythropoietin is given in the article. Erythropoietin preparations derived from recombinant DNA technology are a mixture of isoforms with different biological activity, which determine the biological properties pharmacological activity, pharmacokinetics, efficacy and safety of medicinal product. Erythropoietin preparations derived by using recombinant DNA technology are a mixture of isoforms with differe...

  10. Histone modifications in response to DNA damage

    International Nuclear Information System (INIS)

    Altaf, Mohammed; Saksouk, Nehme; Cote, Jacques

    2007-01-01

    The packaging of the eukaryotic genome into highly condensed chromatin makes it inaccessible to the factors required for gene transcription, DNA replication, recombination and repair. Eukaryotes have developed intricate mechanisms to overcome this repressive barrier imposed by chromatin. Histone modifying enzymes and ATP-dependent chromatin remodeling complexes play key roles here as they regulate many nuclear processes by altering the chromatin structure. Significantly, these activities are integral to the process of DNA repair where histone modifications act as signals and landing platforms for various repair proteins. This review summarizes the recent developments in our understanding of histone modifications and their role in the maintenance of genome integrity

  11. A recombination hotspot in a schizophrenia-associated region of GABRB2.

    Directory of Open Access Journals (Sweden)

    Siu-Kin Ng

    Full Text Available BACKGROUND: Schizophrenia is a major disorder with complex genetic mechanisms. Earlier, population genetic studies revealed the occurrence of strong positive selection in the GABRB2 gene encoding the beta(2 subunit of GABA(A receptors, within a segment of 3,551 bp harboring twenty-nine single nucleotide polymorphisms (SNPs and containing schizophrenia-associated SNPs and haplotypes. METHODOLOGY/PRINCIPAL FINDINGS: In the present study, the possible occurrence of recombination in this 'S1-S29' segment was assessed. The occurrence of hotspot recombination was indicated by high resolution recombination rate estimation, haplotype diversity, abundance of rare haplotypes, recurrent mutations and torsos in haplotype networks, and experimental haplotyping of somatic and sperm DNA. The sub-segment distribution of relative recombination strength, measured by the ratio of haplotype diversity (H(d over mutation rate (theta, was indicative of a human specific Alu-Yi6 insertion serving as a central recombining sequence facilitating homologous recombination. Local anomalous DNA conformation attributable to the Alu-Yi6 element, as suggested by enhanced DNase I sensitivity and obstruction to DNA sequencing, could be a contributing factor of the increased sequence diversity. Linkage disequilibrium (LD analysis yielded prominent low LD points that supported ongoing recombination. LD contrast revealed significant dissimilarity between control and schizophrenic cohorts. Among the large array of inferred haplotypes, H26 and H73 were identified to be protective, and H19 and H81 risk-conferring, toward the development of schizophrenia. CONCLUSIONS/SIGNIFICANCE: The co-occurrence of hotspot recombination and positive selection in the S1-S29 segment of GABRB2 has provided a plausible contribution to the molecular genetics mechanisms for schizophrenia. The present findings therefore suggest that genome regions characterized by the co-occurrence of positive selection and

  12. AIDing Chromatin and Transcription-Coupled Orchestration of Immunoglobulin Class-Switch Recombination

    Science.gov (United States)

    Vaidyanathan, Bharat; Yen, Wei-Feng; Pucella, Joseph N.; Chaudhuri, Jayanta

    2014-01-01

    Secondary diversification of the antibody repertoire upon antigenic challenge, in the form of immunoglobulin heavy chain (IgH) class-switch recombination (CSR) endows mature, naïve B cells in peripheral lymphoid organs with a limitless ability to mount an optimal humoral immune response, thus expediting pathogen elimination. CSR replaces the default constant (CH) region exons (Cμ) of IgH with any of the downstream CH exons (Cγ, Cε, or Cα), thereby altering effector functions of the antibody molecule. This process depends on, and is orchestrated by, activation-induced deaminase (AID), a DNA cytidine deaminase that acts on single-stranded DNA exposed during transcription of switch (S) region sequences at the IgH locus. DNA lesions thus generated are processed by components of several general DNA repair pathways to drive CSR. Given that AID can instigate DNA lesions and genomic instability, stringent checks are imposed that constrain and restrict its mutagenic potential. In this review, we will discuss how AID expression and substrate specificity and activity is rigorously enforced at the transcriptional, post-transcriptional, post-translational, and epigenetic levels, and how the DNA-damage response is choreographed with precision to permit targeted activity while limiting bystander catastrophe. PMID:24734031

  13. Overexpressed of RAD51 suppresses recombination defects: a possible mechanism to reverse genomic instability

    Energy Technology Data Exchange (ETDEWEB)

    Schild, David; Wiese, Claudia

    2009-10-15

    RAD51, a key protein in the homologous recombinational DNA repair (HRR) pathway, is the major strand-transferase required for mitotic recombination. An important early step in HRR is the formation of single-stranded DNA (ss-DNA) coated by RPA (a ss-DNA binding protein). Displacement of RPA by RAD51 is highly regulated and facilitated by a number of different proteins known as the 'recombination mediators'. To assist these recombination mediators, a second group of proteins also is required and we are defining these proteins here as 'recombination co-mediators'. Defects in either recombination mediators or comediators, including BRCA1 and BRCA2, lead to impaired HRR that can genetically be complemented for (i.e. suppressed) by overexpression of RAD51. Defects in HRR have long been known to contribute to genomic instability leading to tumor development. Since genomic instability also slows cell growth, precancerous cells presumably require genomic restabilization to gain a growth advantage. RAD51 is overexpressed in many tumors, and therefore, we hypothesize that the complementing ability of elevated levels of RAD51 in tumors with initial HRR defects limits genomic instability during carcinogenic progression. Of particular interest, this model may also help explain the high frequency of TP53 mutations in human cancers, since wild-type p53 represses RAD51.

  14. Mutants of Escherichia coli K-12 with enhanced resistance to ionizing radiation. 4. Peculiarities of recombination in Gamsup(r) mutants

    International Nuclear Information System (INIS)

    Bresler, S.E.; Kalinin, V.L.; Laneeva, N.I.

    1984-01-01

    Radioresistant mutant Gam sup(r) 444 differs from a wild type and from Gam sup(r) 445 mutant in decreased frequency of long episome heritage ORF 1 (pur E + -tsx + -proC + -lac + ) and F 14 (ilv + -argE + ), containing hot points of RecRecF - depending recombination and in increased frequency of chromosome mobilization and integrative suppression of temperature sensitive dna A46 mutation by sexual factor F. In this respect Gam sup(r) 444 mutant resembles rec BC sbs B mutant with RecF - recombination type

  15. cgDNA: a software package for the prediction of sequence-dependent coarse-grain free energies of B-form DNA.

    Science.gov (United States)

    Petkevičiūtė, D; Pasi, M; Gonzalez, O; Maddocks, J H

    2014-11-10

    cgDNA is a package for the prediction of sequence-dependent configuration-space free energies for B-form DNA at the coarse-grain level of rigid bases. For a fragment of any given length and sequence, cgDNA calculates the configuration of the associated free energy minimizer, i.e. the relative positions and orientations of each base, along with a stiffness matrix, which together govern differences in free energies. The model predicts non-local (i.e. beyond base-pair step) sequence dependence of the free energy minimizer. Configurations can be input or output in either the Curves+ definition of the usual helical DNA structural variables, or as a PDB file of coordinates of base atoms. We illustrate the cgDNA package by comparing predictions of free energy minimizers from (a) the cgDNA model, (b) time-averaged atomistic molecular dynamics (or MD) simulations, and (c) NMR or X-ray experimental observation, for (i) the Dickerson-Drew dodecamer and (ii) three oligomers containing A-tracts. The cgDNA predictions are rather close to those of the MD simulations, but many orders of magnitude faster to compute. Both the cgDNA and MD predictions are in reasonable agreement with the available experimental data. Our conclusion is that cgDNA can serve as a highly efficient tool for studying structural variations in B-form DNA over a wide range of sequences. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Further details of a hypothesis for the initiation of genetic recombination from recognition sites

    Energy Technology Data Exchange (ETDEWEB)

    Markham, P [Queen Elizabeth College, London (G.B.)

    1982-01-01

    Consideration of the initiation of genetic recombination from fixed sites recognised by an initiation complex, has provided more details of the envisaged mechanism and implications of a recent hypothesis. It has been shown that the hypothesis allows for more than one recombinogenic-event to result from a single binding of the recombination initiation complex to a recognition site in a DNA duplex. This capacity can explain data from fungal systems which are apparently inconsistent with the Meselson-Radding model of genetic recombination with respect to the positional relationship between tracts of hybrid DNA and sites of crossing-over. A mechanism for conversion, involving hybrid DNA formation, but without mismatch correction has also been proposed on the basis of this capacity. It is suggested that the hypothesis may apply generally to genetic recombination, in prokaryotes as well as eukaryotes.

  17. Collaborating functions of BLM and DNA topoisomerase I in regulating human rDNA transcription

    Energy Technology Data Exchange (ETDEWEB)

    Grierson, Patrick M. [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States); Acharya, Samir, E-mail: samir.acharya@osumc.edu [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States); Groden, Joanna [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States)

    2013-03-15

    Bloom's syndrome (BS) is an inherited disorder caused by loss of function of the recQ-like BLM helicase. It is characterized clinically by severe growth retardation and cancer predisposition. BLM localizes to PML nuclear bodies and to the nucleolus; its deficiency results in increased intra- and inter-chromosomal recombination, including hyper-recombination of rDNA repeats. Our previous work has shown that BLM facilitates RNA polymerase I-mediated rRNA transcription in the nucleolus (Grierson et al., 2012 [18]). This study uses protein co-immunoprecipitation and in vitro transcription/translation (IVTT) to identify a direct interaction of DNA topoisomerase I with the C-terminus of BLM in the nucleolus. In vitro helicase assays demonstrate that DNA topoisomerase I stimulates BLM helicase activity on a nucleolar-relevant RNA:DNA hybrid, but has an insignificant effect on BLM helicase activity on a control DNA:DNA duplex substrate. Reciprocally, BLM enhances the DNA relaxation activity of DNA topoisomerase I on supercoiled DNA substrates. Our study suggests that BLM and DNA topoisomerase I function coordinately to modulate RNA:DNA hybrid formation as well as relaxation of DNA supercoils in the context of nucleolar transcription.

  18. Collaborating functions of BLM and DNA topoisomerase I in regulating human rDNA transcription

    International Nuclear Information System (INIS)

    Grierson, Patrick M.; Acharya, Samir; Groden, Joanna

    2013-01-01

    Bloom's syndrome (BS) is an inherited disorder caused by loss of function of the recQ-like BLM helicase. It is characterized clinically by severe growth retardation and cancer predisposition. BLM localizes to PML nuclear bodies and to the nucleolus; its deficiency results in increased intra- and inter-chromosomal recombination, including hyper-recombination of rDNA repeats. Our previous work has shown that BLM facilitates RNA polymerase I-mediated rRNA transcription in the nucleolus (Grierson et al., 2012 [18]). This study uses protein co-immunoprecipitation and in vitro transcription/translation (IVTT) to identify a direct interaction of DNA topoisomerase I with the C-terminus of BLM in the nucleolus. In vitro helicase assays demonstrate that DNA topoisomerase I stimulates BLM helicase activity on a nucleolar-relevant RNA:DNA hybrid, but has an insignificant effect on BLM helicase activity on a control DNA:DNA duplex substrate. Reciprocally, BLM enhances the DNA relaxation activity of DNA topoisomerase I on supercoiled DNA substrates. Our study suggests that BLM and DNA topoisomerase I function coordinately to modulate RNA:DNA hybrid formation as well as relaxation of DNA supercoils in the context of nucleolar transcription

  19. The Saccharomyces cerevisiae MUM2 gene interacts with the DNA replication machinery and is required for meiotic levels of double strand breaks.

    Science.gov (United States)

    Davis, L; Barbera, M; McDonnell, A; McIntyre, K; Sternglanz, R; Jin , Q; Loidl, J; Engebrecht, J

    2001-01-01

    The Saccharomyces cerevisiae MUM2 gene is essential for meiotic, but not mitotic, DNA replication and thus sporulation. Genetic interactions between MUM2 and a component of the origin recognition complex and polymerase alpha-primase suggest that MUM2 influences the function of the DNA replication machinery. Early meiotic gene expression is induced to a much greater extent in mum2 cells than in meiotic cells treated with the DNA synthesis inhibitor hydroxyurea. This result indicates that the mum2 meiotic arrest is downstream of the arrest induced by hydroxyurea and suggests that DNA synthesis is initiated in the mutant. Genetic analyses indicate that the recombination that occurs in mum2 mutants is dependent on the normal recombination machinery and on synaptonemal complex components and therefore is not a consequence of lesions created by incompletely replicated DNA. Both meiotic ectopic and allelic recombination are similarly reduced in the mum2 mutant, and the levels are consistent with the levels of meiosis-specific DSBs that are generated. Cytological analyses of mum2 mutants show that chromosome pairing and synapsis occur, although at reduced levels compared to wild type. Given the near-wild-type levels of meiotic gene expression, pairing, and synapsis, we suggest that the reduction in DNA replication is directly responsible for the reduced level of DSBs and meiotic recombination. PMID:11238403

  20. Epigenetic codes programming class switch recombination

    Directory of Open Access Journals (Sweden)

    Bharat eVaidyanathan

    2015-09-01

    Full Text Available Class switch recombination imparts B cells with a fitness-associated adaptive advantage during a humoral immune response by using a precision-tailored DNA excision and ligation process to swap the default constant region gene of the antibody with a new one that has unique effector functions. This secondary diversification of the antibody repertoire is a hallmark of the adaptability of B cells when confronted with environmental and pathogenic challenges. Given that the nucleotide sequence of genes during class switching remains unchanged (genetic constraints, it is logical and necessary therefore, to integrate the adaptability of B cells to an epigenetic state, which is dynamic and can be heritably modulated before, after or even during an antibody-dependent immune response. Epigenetic regulation encompasses heritable changes that affect function (phenotype without altering the sequence information embedded in a gene, and include histone, DNA and RNA modifications. Here, we review current literature on how B cells use an epigenetic code language as a means to ensure antibody plasticity in light of pathogenic insults.

  1. A prime/boost strategy using DNA/fowlpox recombinants expressing the genetically attenuated E6 protein as a putative vaccine against HPV-16-associated cancers.

    Science.gov (United States)

    Bissa, Massimiliano; Illiano, Elena; Pacchioni, Sole; Paolini, Francesca; Zanotto, Carlo; De Giuli Morghen, Carlo; Massa, Silvia; Franconi, Rosella; Radaelli, Antonia; Venuti, Aldo

    2015-03-05

    Considering the high number of new cases of cervical cancer each year that are caused by human papilloma viruses (HPVs), the development of an effective vaccine for prevention and therapy of HPV-associated cancers, and in particular against the high-risk HPV-16 genotype, remains a priority. Vaccines expressing the E6 and E7 proteins that are detectable in all HPV-positive pre-cancerous and cancer cells might support the treatment of HPV-related lesions and clear already established tumors. In this study, DNA and fowlpox virus recombinants expressing the E6F47R mutant of the HPV-16 E6 oncoprotein were generated, and their correct expression verified by RT-PCR, Western blotting and immunofluorescence. Immunization protocols were tested in a preventive or therapeutic pre-clinical mouse model of HPV-16 tumorigenicity using heterologous (DNA/FP) or homologous (DNA/DNA and FP/FP) prime/boost regimens. The immune responses and therapeutic efficacy were evaluated by ELISA, ELISPOT assays, and challenge with TC-1* cells. In the preventive protocol, while an anti-E6-specific humoral response was just detectable, a specific CD8(+) cytotoxic T-cell response was elicited in immunized mice. After the challenge, there was a delay in cancer appearance and a significant reduction of tumor volume in the two groups of E6-immunized mice, thus confirming the pivotal role of the CD8(+) T-cell response in the control of tumor growth in the absence of E6-specific antibodies. In the therapeutic protocol, in-vivo experiments resulted in a higher number of tumor-free mice after the homologous DNA/DNA or heterologous DNA/FP immunization. These data establish a preliminary indication for the prevention and treatment of HPV-related tumors by the use of DNA and avipox constructs as safe and effective immunogens following a prime/boost strategy. The combined use of recombinants expressing both E6 and E7 proteins might improve the antitumor efficacy, and should represent an important approach to

  2. In vitro Ca(2+)-dependent maturation of milk-clotting recombinant Epr: minor extracellular protease: from Bacillus licheniformis.

    Science.gov (United States)

    Ageitos, José Manuel; Vallejo, Juan Andrés; Serrat, Manuel; Sánchez-Pérez, Angeles; Villa, Tomás G

    2013-06-01

    The minor extracellular protease (Epr) is secreted into the culture medium during Bacillus licheniformis, strain USC13, stationary phase of growth. Whereas, B. subtilis Epr has been reported to be involved in swarming; the B. licheniformis protease is also involved in milk-clotting as shown by the curd forming ability of culture broths expressing this protein. The objectives of this study are the characterization of recombinant B. licheniformis Epr (minor extracellular protease) and the determination of its calcium-dependent activation process. In this work, we have cloned and expressed B. licheniformis Epr in Escherichia coli. We were also able to construct a tridimensional model for Epr based on its homology to Thermococcus kodakarensis pro-tk-subtilisin 2e1p, fervidolysin from Fervidobacterium pennivorans 1rv6, and B. lentus 1GCI subtilisin. Recombinant Epr was accumulated into inclusion bodies; after protein renaturation, Epr undergoes an in vitro calcium-dependent activation, similar to that described for tk protease. The recombinant Epr is capable of producing milk curds with the same clotting activity previously described for the native B. licheniformis Epr enzyme although further rheological and industrial studies should be carried out to confirm its real applicability. This work represents for the first time that Epr may be successfully expressed in a non-bacilli microorganism.

  3. Evolution of cagA oncogene of Helicobacter pylori through recombination.

    Directory of Open Access Journals (Sweden)

    Yoshikazu Furuta

    Full Text Available Helicobacter pylori is a gastric pathogen that infects half the human population and causes gastritis, ulcers, and cancer. The cagA gene product is a major virulence factor associated with gastric cancer. It is injected into epithelial cells, undergoes phosphorylation by host cell kinases, and perturbs host signaling pathways. CagA is known for its geographical, structural, and functional diversity in the C-terminal half, where an EPIYA host-interacting motif is repeated. The Western version of CagA carries the EPIYA segment types A, B, and C, while the East Asian CagA carries types A, B, and D and shows higher virulence. Many structural variants such as duplications and deletions are reported. In this study, we gained insight into the relationships of CagA variants through various modes of recombination, by analyzing all known cagA variants at the DNA sequence level with the single nucleotide resolution. Processes that occurred were: (i homologous recombination between DNA sequences for CagA multimerization (CM sequence; (ii recombination between DNA sequences for the EPIYA motif; and (iii recombination between short similar DNA sequences. The left half of the EPIYA-D segment characteristic of East Asian CagA was derived from Western type EPIYA, with Amerind type EPIYA as the intermediate, through rearrangements of specific sequences within the gene. Adaptive amino acid changes were detected in the variable region as well as in the conserved region at sites to which no specific function has yet been assigned. Each showed a unique evolutionary distribution. These results clarify recombination-mediated routes of cagA evolution and provide a solid basis for a deeper understanding of its function in pathogenesis.

  4. Germline Mutations in PALB2, BRCA1, and RAD51C, Which Regulate DNA Recombination Repair, in Patients with Gastric Cancer

    Science.gov (United States)

    Sahasrabudhe, Ruta; Lott, Paul; Bohorquez, Mabel; Toal, Ted; Estrada, Ana P.; Suarez, John J.; Brea-Fernández, Alejandro; Cameselle-Teijeiro, José; Pinto, Carla; Ramos, Irma; Mantilla, Alejandra; Prieto, Rodrigo; Corvalan, Alejandro; Norero, Enrique; Alvarez, Carolina; Tapia, Teresa; Carvallo, Pilar; Gonzalez, Luz M.; Cock-Rada, Alicia; Solano, Angela; Neffa, Florencia; Valle, Adriana Della; Yau, Chris; Soares, Gabriela; Borowsky, Alexander; Hu, Nan; He, Li-Ji; Han, Xiao-You; Taylor, Philip R.; Goldstein, Alisa M.; Torres, Javier; Echeverry, Magdalena; Ruiz-Ponte, Clara; Teixeira, Manuel R.; Carvajal Carmona, Luis G.

    2016-01-01

    Up to 10% of cases of gastric cancer are familial, but so far, only mutations in CDH1 have been associated with gastric cancer risk. To identify genetic variants that affect risk for gastric cancer, we collected blood samples from 28 patients with hereditary diffuse gastric cancer (HDGC) not associated with mutations in CDH1 and performed whole-exome sequence analysis. We then analyzed sequences of candidate genes in 333 independent HDGC and non-HDGC cases. We identified 11 cases with mutations in PALB2, BRCA1, or RAD51C genes, which regulate homologous DNA recombination. We found these mutations in 2 of 31 patients with HDGC (6.5%) and 9 of 331 patients with sporadic gastric cancer (2.8%). Most of these mutations had been previously associated with other types of tumors and partially co-segregated with gastric cancer in our study. Tumors that developed in patients with these mutations had a mutation signature associated with somatic homologous recombination deficiency. Our findings indicate that defects in homologous recombination increase risk for gastric cancer. PMID:28024868

  5. Induction of mutation and recombination following UV irradiation during meiosis in Saccharomyces cerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Kelly, S.L.; Parry, J.M. (University Coll. of Swansea (UK). Dept. of Genetics)

    1983-03-01

    Irradiation of yeast cultures with ultraviolet light at discrete stages during meiosis produces cyclic variations in sensitivity, i.e. cells are more sensitive to the lethal effects of UV light prior to entry into the meiotic DNA synthesis, and this corresponds to a peak of induction of point mutation. Cells become more resistant to both induced point mutation and lethality as they enter meiotic DNA synthesis, but become more sensitive again during spore formation. The induced level of intragenic recombination rises during the period of commitment ot recombination to a level indistinguishable from the full meiotic level of spontaneous intragenic recombination. Induced reciprocal recombination remains above the spontaneous level up to the point of commitment to sporulation.

  6. Increased mitochondrial DNA deletions and copy number in transfusion-dependent thalassemia

    Science.gov (United States)

    Calloway, Cassandra

    2016-01-01

    BACKGROUND. Iron overload is the primary cause of morbidity in transfusion-dependent thalassemia. Increase in iron causes mitochondrial dysfunction under experimental conditions, but the occurrence and significance of mitochondrial damage is not understood in patients with thalassemia. METHODS. Mitochondrial DNA (mtDNA) to nuclear DNA copy number (Mt/N) and frequency of the common 4977-bp mitochondrial deletion (ΔmtDNA4977) were quantified using a quantitative PCR assay on whole blood samples from 38 subjects with thalassemia who were receiving regular transfusions. RESULTS. Compared with healthy controls, Mt/N and ΔmtDNA4977 frequency were elevated in thalassemia (P = 0.038 and P 15 mg/g dry-weight or splenectomy, with the highest levels observed in subjects who had both risk factors (P = 0.003). Myocardial iron (MRI T2* 40/1 × 107 mtDNA, respectively (P = 0.025). Subjects with Mt/N values below the group median had significantly lower Matsuda insulin sensitivity index (5.76 ± 0.53) compared with the high Mt/N group (9.11 ± 0.95, P = 0.008). CONCLUSION. Individuals with transfusion-dependent thalassemia demonstrate age-related increase in mtDNA damage in leukocytes. These changes are markedly amplified by splenectomy and are associated with extrahepatic iron deposition. Elevated mtDNA damage in blood cells may predict the risk of iron-associated organ damage in thalassemia. FUNDING. This project was supported by Children’s Hospital & Research Center Oakland Institutional Research Award and by the National Center for Advancing Translational Sciences, NIH, through UCSF-CTSI grant UL1 TR000004. PMID:27583305

  7. Recombination-dependent replication and gene conversion homogenize repeat sequences and diversify plastid genome structure.

    Science.gov (United States)

    Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K

    2017-04-01

    There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.

  8. Recominant Pinoresino-Lariciresinol Reductase, Recombinant Dirigent Protein And Methods Of Use

    Science.gov (United States)

    Lewis, Norman G.; Davin, Laurence B.; Dinkova-Kostova, Albena T.; Fujita, Masayuki , Gang; David R. , Sarkanen; Simo , Ford; Joshua D.

    2003-10-21

    Dirigent proteins and pinoresinol/lariciresinol reductases have been isolated, together with cDNAs encoding dirigent proteins and pinoresinol/lariciresinol reductases. Accordingly, isolated DNA sequences are provided from source species Forsythia intermedia, Thuja plicata, Tsuga heterophylla, Eucommia ulmoides, Linum usitatissimum, and Schisandra chinensis, which code for the expression of dirigent proteins and pinoresinol/lariciresinol reductases. In other aspects, replicable recombinant cloning vehicles are provided which code for dirigent proteins or pinoresinol/lariciresinol reductases or for a base sequence sufficiently complementary to at least a portion of dirigent protein or pinoresinol/lariciresinol reductase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding dirigent protein or pinoresinol/lariciresinol reductase. Thus, systems and methods are provided for the recombinant expression of dirigent proteins and/or pinoresinol/lariciresinol reductases.

  9. Genetic Confirmation of Mungbean (Vigna radiata) and Mashbean (Vigna mungo) Interspecific Recombinants using Molecular Markers.

    Science.gov (United States)

    Abbas, Ghulam; Hameed, Amjad; Rizwan, Muhammad; Ahsan, Muhammad; Asghar, Muhammad J; Iqbal, Nayyer

    2015-01-01

    Molecular confirmation of interspecific recombinants is essential to overcome the issues like self-pollination, environmental influence, and inadequacy of morphological characteristics during interspecific hybridization. The present study was conducted for genetic confirmation of mungbean (female) and mashbean (male) interspecific crosses using molecular markers. Initially, polymorphic random amplified polymorphic DNA (RAPD), universal rice primers (URP), and simple sequence repeats (SSR) markers differentiating parent genotypes were identified. Recombination in hybrids was confirmed using these polymorphic DNA markers. The NM 2006 × Mash 88 was most successful interspecific cross. Most of true recombinants confirmed by molecular markers were from this cross combination. SSR markers were efficient in detecting genetic variability and recombination with reference to specific chromosomes and particular loci. SSR (RIS) and RAPD identified variability dispersed throughout the genome. In conclusion, DNA based marker assisted selection (MAS) efficiently confirmed the interspecific recombinants. The results provided evidence that MAS can enhance the authenticity of selection in mungbean improvement program.

  10. Mechanisms and Factors that Influence High Frequency Retroviral Recombination

    Science.gov (United States)

    Delviks-Frankenberry, Krista; Galli, Andrea; Nikolaitchik, Olga; Mens, Helene; Pathak, Vinay K.; Hu, Wei-Shau

    2011-01-01

    With constantly changing environmental selection pressures, retroviruses rely upon recombination to reassort polymorphisms in their genomes and increase genetic diversity, which improves the chances for the survival of their population. Recombination occurs during DNA synthesis, whereby reverse transcriptase undergoes template switching events between the two copackaged RNAs, resulting in a viral recombinant with portions of the genetic information from each parental RNA. This review summarizes our current understanding of the factors and mechanisms influencing retroviral recombination, fidelity of the recombination process, and evaluates the subsequent viral diversity and fitness of the progeny recombinant. Specifically, the high mutation rates and high recombination frequencies of HIV-1 will be analyzed for their roles in influencing HIV-1 global diversity, as well as HIV-1 diagnosis, drug treatment, and vaccine development. PMID:21994801

  11. Mouse embryonic stem cells, but not somatic cells, predominantly use homologous recombination to repair double-strand DNA breaks.

    Science.gov (United States)

    Tichy, Elisia D; Pillai, Resmi; Deng, Li; Liang, Li; Tischfield, Jay; Schwemberger, Sandy J; Babcock, George F; Stambrook, Peter J

    2010-11-01

    Embryonic stem (ES) cells give rise to all cell types of an organism. Since mutations at this embryonic stage would affect all cells and be detrimental to the overall health of an organism, robust mechanisms must exist to ensure that genomic integrity is maintained. To test this proposition, we compared the capacity of murine ES cells to repair DNA double-strand breaks with that of differentiated cells. Of the 2 major pathways that repair double-strand breaks, error-prone nonhomologous end joining (NHEJ) predominated in mouse embryonic fibroblasts, whereas the high fidelity homologous recombinational repair (HRR) predominated in ES cells. Microhomology-mediated end joining, an emerging repair pathway, persisted at low levels in all cell types examined. The levels of proteins involved in HRR and microhomology-mediated end joining were highly elevated in ES cells compared with mouse embryonic fibroblasts, whereas those for NHEJ were quite variable, with DNA Ligase IV expression low in ES cells. The half-life of DNA Ligase IV protein was also low in ES cells. Attempts to increase the abundance of DNA Ligase IV protein by overexpression or inhibition of its degradation, and thereby elevate NHEJ in ES cells, were unsuccessful. When ES cells were induced to differentiate, however, the level of DNA Ligase IV protein increased, as did the capacity to repair by NHEJ. The data suggest that preferential use of HRR rather than NHEJ may lend ES cells an additional layer of genomic protection and that the limited levels of DNA Ligase IV may account for the low level of NHEJ activity.

  12. Genetic evidence for inducibility of recombination competence in yeast

    International Nuclear Information System (INIS)

    Fabre, F.; Roman, H.

    1977-01-01

    Recombination between unirradiated chromosomes was induced by UV or x-ray irradiation of haploids followed by a mating with heteroallelic diploids of Saccharomyces cerevisiae. The selected event of intragenic recombination did not involve the participation of the irradiated chromosome and apparently was not caused by lesions introduced into the unirradiated chromosomes by some indirect process. The results favor the idea that recombination is repressed in the majority of vegetative cells and that one effect of radiation is the release of some factor(s) necessary for recombination. Consequently, the proportion of competent cells (i.e., cells able to recombine) in the population increases. This competent state seems necessary not only for the recombinational repair of radiation-induced lesions but also, since recombinants are produced in the absence of such lesions, for spontaneous recombination. Photoreactivation of the UV-irradiated haploids led to a decrease in the production of recombinants. Hence, lesions in the DNA appear to be responsible for the induction of the recombinational ability

  13. Role of the RecF pathway of recombination in the metabolism of uv-irradiated DNA in Escherichia coli K-12

    International Nuclear Information System (INIS)

    Rothman, R.H.

    1976-01-01

    The RecF pathway of genetic recombination in Escherichia coli is potentially capable of supporting wild type levels of recombination, but in wild type cells it plays a relatively minor role in this process. RecF and recL single mutants were found to be ultraviolet-sensitive but recombination proficient. These observations led to the hypothesis that the main function of the RecF pathway lies in the metabolism of uv-damaged DNA. The role of reF and recL in pathways of recovery from uv-irradiation has been examined. Both recF - and recL - inhibited post-replication joining of DNA fragments synthesized on uv-damaged DNA templates (post-replication repair). The addition of a uvrB5 mutation to the single mutants did not affect the cell's ability to complete post-replication repair in the case of recL, but did completely prevent completion of joining in the case of recF. It was hypothesized that recF is an endonuclease weakly indirectly suppressible by the presence of functional correndo II. It is suggested that recF is necessary to cleave the crossed strand intermediate at the end of repair. RecL, in addition to its involvement in post-replication repair, was also found to be involved in excision repair. A uvrB recB recC recF multiple mutant was as sensitive as a uvrB recA strain, suggesting that it is devoid of any repair abilities. RecB - was shown to have an inhibitory effect of post-replication repair. The uvrB recF mutant, however, was totally devoid of post-replication repair even though recB + contributed to the recovery of the strain. Thus the role of recB in post-replication repair is unclear. Lastly, the effects of recF and recL on uv-inducible repair was studied. W-reactivation of uv-irradiated lambda was used as an assay for inducible repair. The conclusions from these experiments were unclear. They seemed to imply that W-reactivation is effected by the combined action of excision repair and post-replication repair

  14. Chemo-mechanical pushing of proteins along single-stranded DNA.

    Science.gov (United States)

    Sokoloski, Joshua E; Kozlov, Alexander G; Galletto, Roberto; Lohman, Timothy M

    2016-05-31

    Single-stranded (ss)DNA binding (SSB) proteins bind with high affinity to ssDNA generated during DNA replication, recombination, and repair; however, these SSBs must eventually be displaced from or reorganized along the ssDNA. One potential mechanism for reorganization is for an ssDNA translocase (ATP-dependent motor) to push the SSB along ssDNA. Here we use single molecule total internal reflection fluorescence microscopy to detect such pushing events. When Cy5-labeled Escherichia coli (Ec) SSB is bound to surface-immobilized 3'-Cy3-labeled ssDNA, a fluctuating FRET signal is observed, consistent with random diffusion of SSB along the ssDNA. Addition of Saccharomyces cerevisiae Pif1, a 5' to 3' ssDNA translocase, results in the appearance of isolated, irregularly spaced saw-tooth FRET spikes only in the presence of ATP. These FRET spikes result from translocase-induced directional (5' to 3') pushing of the SSB toward the 3' ssDNA end, followed by displacement of the SSB from the DNA end. Similar ATP-dependent pushing events, but in the opposite (3' to 5') direction, are observed with EcRep and EcUvrD (both 3' to 5' ssDNA translocases). Simulations indicate that these events reflect active pushing by the translocase. The ability of translocases to chemo-mechanically push heterologous SSB proteins along ssDNA provides a potential mechanism for reorganization and clearance of tightly bound SSBs from ssDNA.

  15. Biochemical characterization of a recombinant Japanese encephalitis virus RNA-dependent RNA polymerase

    Directory of Open Access Journals (Sweden)

    Kim Chan-Mi

    2007-07-01

    Full Text Available Abstract Background Japanese encephalitis virus (JEV NS5 is a viral nonstructural protein that carries both methyltransferase and RNA-dependent RNA polymerase (RdRp domains. It is a key component of the viral RNA replicase complex that presumably includes other viral nonstructural and cellular proteins. The biochemical properties of JEV NS5 have not been characterized due to the lack of a robust in vitro RdRp assay system, and the molecular mechanisms for the initiation of RNA synthesis by JEV NS5 remain to be elucidated. Results To characterize the biochemical properties of JEV RdRp, we expressed in Escherichia coli and purified an enzymatically active full-length recombinant JEV NS5 protein with a hexahistidine tag at the N-terminus. The purified NS5 protein, but not the mutant NS5 protein with an Ala substitution at the first Asp of the RdRp-conserved GDD motif, exhibited template- and primer-dependent RNA synthesis activity using a poly(A RNA template. The NS5 protein was able to use both plus- and minus-strand 3'-untranslated regions of the JEV genome as templates in the absence of a primer, with the latter RNA being a better template. Analysis of the RNA synthesis initiation site using the 3'-end 83 nucleotides of the JEV genome as a minimal RNA template revealed that the NS5 protein specifically initiates RNA synthesis from an internal site, U81, at the two nucleotides upstream of the 3'-end of the template. Conclusion As a first step toward the understanding of the molecular mechanisms for JEV RNA replication and ultimately for the in vitro reconstitution of viral RNA replicase complex, we for the first time established an in vitro JEV RdRp assay system with a functional full-length recombinant JEV NS5 protein and characterized the mechanisms of RNA synthesis from nonviral and viral RNA templates. The full-length recombinant JEV NS5 will be useful for the elucidation of the structure-function relationship of this enzyme and for the

  16. Site directed recombination

    Science.gov (United States)

    Jurka, Jerzy W.

    1997-01-01

    Enhanced homologous recombination is obtained by employing a consensus sequence which has been found to be associated with integration of repeat sequences, such as Alu and ID. The consensus sequence or sequence having a single transition mutation determines one site of a double break which allows for high efficiency of integration at the site. By introducing single or double stranded DNA having the consensus sequence flanking region joined to a sequence of interest, one can reproducibly direct integration of the sequence of interest at one or a limited number of sites. In this way, specific sites can be identified and homologous recombination achieved at the site by employing a second flanking sequence associated with a sequence proximal to the 3'-nick.

  17. Temperature dependent recombination dynamics in InP/ZnS colloidal nanocrystals

    Science.gov (United States)

    Shirazi, R.; Kopylov, O.; Kovacs, A.; Kardynał, B. E.

    2012-08-01

    In this letter, we investigate exciton recombination in InP/ZnS core-shell colloidal nanocrystals over a wide temperature range. Over the entire range between room temperature and liquid helium temperature, multi-exponential exciton decay curves are observed and well explained by the presence of bright and dark exciton states, as well as defect states. Two different types of defect are present: one located at the core-shell interface and the other on the surface of the nanocrystal. Based on the temperature dependent contributions of all four states to the total photoluminescence signal, we estimate that the four states are distributed within a 20 meV energy band in nanocrystals that emit at 1.82 eV.

  18. Activation of cGAS-dependent antiviral responses by DNA intercalating agents.

    Science.gov (United States)

    Pépin, Geneviève; Nejad, Charlotte; Thomas, Belinda J; Ferrand, Jonathan; McArthur, Kate; Bardin, Philip G; Williams, Bryan R G; Gantier, Michael P

    2017-01-09

    Acridine dyes, including proflavine and acriflavine, were commonly used as antiseptics before the advent of penicillins in the mid-1940s. While their mode of action on pathogens was originally attributed to their DNA intercalating activity, work in the early 1970s suggested involvement of the host immune responses, characterized by induction of interferon (IFN)-like activities through an unknown mechanism. We demonstrate here that sub-toxic concentrations of a mixture of acriflavine and proflavine instigate a cyclic-GMP-AMP (cGAMP) synthase (cGAS)-dependent type-I IFN antiviral response. This pertains to the capacity of these compounds to induce low level DNA damage and cytoplasmic DNA leakage, resulting in cGAS-dependent cGAMP-like activity. Critically, acriflavine:proflavine pre-treatment of human primary bronchial epithelial cells significantly reduced rhinovirus infection. Collectively, our findings constitute the first evidence that non-toxic DNA binding agents have the capacity to act as indirect agonists of cGAS, to exert potent antiviral effects in mammalian cells. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. DNA ligase III is involved in a DNA-PK independent pathway of NHEJ in human cells

    International Nuclear Information System (INIS)

    Wang, H.; Perrault, A.R.; Qin, W.; Wang, H.; Iliakis, G.

    2003-01-01

    Full text: Double strand breaks (DSB) induced by ionizing radiation (IR) and other cytotoxic agents in the genome of higher eukaryotes are thought to be repaired either by homologous recombination repair (HRR), or non-homologous endjoining (NHEJ). We previously reported the operation of two components of NHEJ in vivo: a DNA-PK dependent component that operates with fast kinetics (D-NHEJ), and a DNA-PK independent component that acts as a backup (basic or B-NHEJ) and operates with kinetics an order of magnitude slower. To gain further insight into the mechanisms of B-NHEJ, we investigated DNA endjoining in extracts 180BR, a human cell line deficient in DNA ligase IV, using an in vitro plasmid-based DNA endjoining assay. An anti DNA ligase III antibody inhibited almost completely DNA endjoining activity in these extracts. On the other hand, an anti DNA ligase I antibody had no measurable effect in DNA endjoining activity. Immunodepletion of DNA ligase III from 180BR cell extracts abolished the DNA endjoining activity, which could be restored by addition of purified human DNA ligase IIIb. Full-length DNA ligase III bound to double stranded DNA and stimulated DNA endjoining in both intermolecular and intramolecular ligation. Furthermore, fractionation of HeLa cell extracts demonstrated the presence of an activity stimulating the function of DNA ligase III. Based on these observations we propose that DNA ligase III is the ligase operating in B-NHEJ

  20. Hairpin-induced tRNA-mediated (HITME) recombination in HIV-1

    NARCIS (Netherlands)

    Konstantinova, Pavlina; de Haan, Peter; Das, Atze T.; Berkhout, Ben

    2006-01-01

    Recombination due to template switching during reverse transcription is a major source of genetic variability in retroviruses. In the present study we forced a recombination event in human immunodeficiency virus type 1 (HIV-1) by electroporation of T cells with DNA from a molecular HIV-1 clone that

  1. Prime-boost therapeutic vaccination in mice with DNA/DNA or DNA/Fowlpox virus recombinants expressing the Human Papilloma Virus type 16 E6 and E7 mutated proteins fused to the coat protein of Potato virus X.

    Science.gov (United States)

    Illiano, Elena; Bissa, Massimiliano; Paolini, Francesca; Zanotto, Carlo; De Giuli Morghen, Carlo; Franconi, Rosella; Radaelli, Antonia; Venuti, Aldo

    2016-10-02

    The therapeutic antitumor potency of a prime-boost vaccination strategy was explored, based on the mutated, nontransforming forms of the E6 (E6 F47R ) and E7 (E7 GGG ) oncogenes of Human Papilloma Virus type 16 (HPV16), fused to the Potato virus X (PVX) coat protein (CP) sequence. Previous data showed that CP fusion improves the immunogenicity of tumor-associated antigens and may thus increase their efficacy. After verifying the correct expression of E6 F47R CP and E7 GGG CP inserted into DNA and Fowlpox virus recombinants by Western blotting and immunofluorescence, their combined use was evaluated for therapy in a pre-clinical mouse model of HPV16-related tumorigenicity. Immunization protocols were applied using homologous (DNA/DNA) or heterologous (DNA/Fowlpox) prime-boost vaccine regimens. The humoral immune responses were determined by ELISA, and the therapeutic efficacy evaluated by the delay in tumor appearance and reduced tumor volume after inoculation of syngeneic TC-1* tumor cells. Homologous DNA/DNA genetic vaccines were able to better delay tumor appearance and inhibit tumor growth when DNAE6 F47R CP and DNAE7 GGG CP were administered in combination. However, the heterologous DNA/Fowlpox vaccination strategy was able to delay tumor appearance in a higher number of animals when E6 F47R CP and in particular E7 GGG CP were administered alone. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Construction and expression of pEgr-sHemopexin recombinant plasmid induced by ionizing radiation in vitro

    International Nuclear Information System (INIS)

    Wang Guiquan; Jilin Univ., Changchun; Xu Chuanjie; Yang Wen; Piao Chunji; Dong Zhen

    2005-01-01

    Objective: To clone mouse secretable Hemopexin (sPEX) cDNA, construct pEgr-sPEX recombinant plasmid and detect the expression of recombinant plasmid in B16F10 cells. Methods: Hemopexin cDNA was amplified from the NIH3T3 cells by RT-PCR. After the cDNA identified by sequencing, the pEgr-sPEX recombinant plasmid was constructed and the plasmid was transfected into B16F10 cells with liposome and the expression of PEX induced by ionizing radiation in B16F10 cells was detected by Western blotting. Results: The sequencing results proved the cloned sPEX cDNA to be completely identical with that reported in the GenBank. The mouse sPEX cDNA was inserted correctly into expression vector and expressed successfully. Conclusion: The mouse sPEX cDNA is cloned successfully and it is confirmed that pEgr-sPEX possesses the radiation inducing expression characteristics in vitro. (authors)

  3. Role of the DNA Mismatch Repair Gene MutS4 in Driving the Evolution of Mycobacterium yongonense Type I via Homologous Recombination.

    Science.gov (United States)

    Kim, Byoung-Jun; Kim, Bo-Ram; Kook, Yoon-Hoh; Kim, Bum-Joon

    2017-01-01

    We recently showed that Mycobacterium yongonense could be divided into two genotypes: Type I, in which the rpoB gene has been transferred from Mycobacterium parascrofulaceum , and Type II, in which the rpoB gene has not been transferred. Comparative genome analysis of three M. yongonense Type I, two M. yongonense Type II and M. parascrofulaceum type strains were performed in this study to gain insight into gene transfer from M. parascrofulaceum into M. yongonense Type I strains. We found two genome regions transferred from M. parascrofulaceum : one contained 3 consecutive genes, including the rpoBC operon, and the other contained 57 consecutive genes that had been transferred into M. yongonense Type I genomes via homologous recombination. Further comparison between the M. yongonense Type I and II genomes revealed that Type I, but not Type II has a distinct DNA mismatch repair gene ( MutS4 subfamily) that was possibly transferred via non-homologous recombination from other actinomycetes. We hypothesized that it could facilitate homologous recombination from the M. parascrofulaceum to the M. yongonense Type I genomes. We therefore generated recombinant Mycobacterium smegmatis containing a MutS4 operon of M. yongonense . We found that the M. tuberculosis rpoB fragment with a rifampin resistance-conferring mutation was more frequently inserted into recombinant M. smegmatis than the wild type, suggesting that MutS4 is a driving force in the gene transfer from M. parascrofulaceum to M. yongonense Type I strains via homologous recombination. In conclusion, our data indicated that MutS4 in M. yongonense Type I genomes may drive gene transfer from M. parascrofulaceum via homologous recombination, resulting in division of M. yongonense into two genotypes, Type I and II.

  4. Role of the DNA Mismatch Repair Gene MutS4 in Driving the Evolution of Mycobacterium yongonense Type I via Homologous Recombination

    Directory of Open Access Journals (Sweden)

    Byoung-Jun Kim

    2017-12-01

    Full Text Available We recently showed that Mycobacterium yongonense could be divided into two genotypes: Type I, in which the rpoB gene has been transferred from Mycobacterium parascrofulaceum, and Type II, in which the rpoB gene has not been transferred. Comparative genome analysis of three M. yongonense Type I, two M. yongonense Type II and M. parascrofulaceum type strains were performed in this study to gain insight into gene transfer from M. parascrofulaceum into M. yongonense Type I strains. We found two genome regions transferred from M. parascrofulaceum: one contained 3 consecutive genes, including the rpoBC operon, and the other contained 57 consecutive genes that had been transferred into M. yongonense Type I genomes via homologous recombination. Further comparison between the M. yongonense Type I and II genomes revealed that Type I, but not Type II has a distinct DNA mismatch repair gene (MutS4 subfamily that was possibly transferred via non-homologous recombination from other actinomycetes. We hypothesized that it could facilitate homologous recombination from the M. parascrofulaceum to the M. yongonense Type I genomes. We therefore generated recombinant Mycobacterium smegmatis containing a MutS4 operon of M. yongonense. We found that the M. tuberculosis rpoB fragment with a rifampin resistance-conferring mutation was more frequently inserted into recombinant M. smegmatis than the wild type, suggesting that MutS4 is a driving force in the gene transfer from M. parascrofulaceum to M. yongonense Type I strains via homologous recombination. In conclusion, our data indicated that MutS4 in M. yongonense Type I genomes may drive gene transfer from M. parascrofulaceum via homologous recombination, resulting in division of M. yongonense into two genotypes, Type I and II.

  5. Analysis of time-dependent effects when operating nested-well plasma traps for achieving antihydrogen recombination

    International Nuclear Information System (INIS)

    Chang Yongbin; Dolliver, D. D.; Ordonez, C. A.

    1999-01-01

    In the work reported, time-dependent effects are considered which affect the prospect of getting two oppositely signed plasmas to overlap the same region while trapped within a solenoidal magnetic field. Parameters that are relevant to future experimental attempts at producing cold antihydrogen atoms using nested-well plasma traps are considered. It is found that the timescale over which an overlap remains, without changing the electrode voltages, can be much larger than the timescale over which the overlap plasma recombines. Hence, it does not appear necessary to use time-dependent electrode voltages to maintain the overlap while antihydrogen atoms are being produced

  6. The induction of mutation and recombination following UV irradiation during meiosis in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Kelly, S.L.; Parry, J.M.

    1983-01-01

    Irradiation of yeast cultures with ultraviolet light at discrete stages during meiosis produces cyclic variations in sensitivity, i.e. cells are more sensitive to the lethal effects of UV light prior to entry into the meiotic DNA synthesis, and this corresponds to a peak of induction of point mutation. Cells become more resistant to both induced point mutation and lethality as they enter meiotic DNA synthesis, but become more sensitive again during spore formation. The induced level of intragenic recombination rises during the period of commitment ot recombination to a level indistinguishable from the full meiotic level of spontaneous intragenic recombination. Induced reciprocal recombination remains above the spontaneous level up to the point of commitment to sporulation. (orig.)

  7. The induction of mutation and recombination following UV irradiation during meiosis in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kelly, S L; Parry, J M

    1983-03-01

    Irradiation of yeast cultures with ultraviolet light at discrete stages during meiosis produces cyclic variations in sensitivity, i.e. cells are more sensitive to the lethal effects of UV light prior to entry into the meiotic DNA synthesis, and this corresponds to a peak of induction of point mutation. Cells become more resistant to both induced point mutation and lethality as they enter meiotic DNA synthesis, but become more sensitive again during spore formation. The induced level of intragenic recombination rises during the period of commitment to recombination to a level indistinguishable from the full meiotic level of spontaneous intragenic recombination. Induced reciprocal recombination remains above the spontaneous level up to the point of commitment to sporulation.

  8. Recombination activating activity of XRCC1 analogous genes in X-ray sensitive and resistant CHO cell lines

    International Nuclear Information System (INIS)

    Golubnitchaya-Labudova, O.; Hoefer, M.; Portele, A.; Vacata, V.; Rink, H.; Lubec, G.

    1997-01-01

    The XRCC1 gene (X-ray repair cross complementing) complements the DNA repair deficiency of the radiation sensitive Chinese hamster ovary (CHO) mutant cell line EM9 but the mechanism of the correction is not elucidated yet. XRCC1 shows substantial homology to the RAG2 gene (recombination activating gene) and we therefore tried to answer the question, whether structural similarities (sequence of a putative recombination activating domain, aa 332-362 for XRCC1 and aa 286-316 in RAG2) would reflect similar functions of the homologous, putative recombination activating domain. PCR experiments revealed that no sequence homologous to the structural part of human XRCC1 was present in cDNA of CHO. Differential display demonstrated two putative recombination activating in the parental CHO line AA8 and one in the radiosensitive mutant EM9. Southern blot experiments showed the presence of several genes with partial homology to human XRCC1. Recombination studies consisted of expressing amplified target domains within chimeric proteins in recA - bacteria and subsequent detection of recombination events by sequencing the recombinant plasmids. Recombination experiments demonstrated recombination activating activity of all putative recombination activating domains amplified from AA8 and EM9 genomes as reflected by deletions within the inserts of the recombinant plasmids. The recombination activating activity of XRCC1 analogues could explain a mechanism responsible for the correction of the DNA repair defect in EM9. (author)

  9. DNA helicase HIM-6/BLM both promotes MutSγ-dependent crossovers and antagonizes MutSγ-independent interhomolog associations during caenorhabditis elegans meiosis.

    Science.gov (United States)

    Schvarzstein, Mara; Pattabiraman, Divya; Libuda, Diana E; Ramadugu, Ajit; Tam, Angela; Martinez-Perez, Enrique; Roelens, Baptiste; Zawadzki, Karl A; Yokoo, Rayka; Rosu, Simona; Severson, Aaron F; Meyer, Barbara J; Nabeshima, Kentaro; Villeneuve, Anne M

    2014-09-01

    Meiotic recombination is initiated by the programmed induction of double-strand DNA breaks (DSBs), lesions that pose a potential threat to the genome. A subset of the DSBs induced during meiotic prophase become designated to be repaired by a pathway that specifically yields interhomolog crossovers (COs), which mature into chiasmata that temporarily connect the homologs to ensure their proper segregation at meiosis I. The remaining DSBs must be repaired by other mechanisms to restore genomic integrity prior to the meiotic divisions. Here we show that HIM-6, the Caenorhabditis elegans ortholog of the RecQ family DNA helicase BLM, functions in both of these processes. We show that him-6 mutants are competent to load the MutSγ complex at multiple potential CO sites, to generate intermediates that fulfill the requirements of monitoring mechanisms that enable meiotic progression, and to accomplish and robustly regulate CO designation. However, recombination events at a subset of CO-designated sites fail to mature into COs and chiasmata, indicating a pro-CO role for HIM-6/BLM that manifests itself late in the CO pathway. Moreover, we find that in addition to promoting COs, HIM-6 plays a role in eliminating and/or preventing the formation of persistent MutSγ-independent associations between homologous chromosomes. We propose that HIM-6/BLM enforces biased outcomes of recombination events to ensure that both (a) CO-designated recombination intermediates are reliably resolved as COs and (b) other recombination intermediates reliably mature into noncrossovers in a timely manner. Copyright © 2014 by the Genetics Society of America.

  10. Expression and purification of recombinant hemoglobin in Escherichia coli

    DEFF Research Database (Denmark)

    Natarajan, Chandrasekhar; Jiang, Xiaoben; Fago, Angela

    2011-01-01

    BACKGROUND: Recombinant DNA technologies have played a pivotal role in the elucidation of structure-function relationships in hemoglobin (Hb) and other globin proteins. Here we describe the development of a plasmid expression system to synthesize recombinant Hbs in Escherichia coli, and we describe...... a protocol for expressing Hbs with low intrinsic solubilities. Since the alpha- and beta-chain Hbs of different species span a broad range of solubilities, experimental protocols that have been optimized for expressing recombinant human HbA may often prove unsuitable for the recombinant expression......-translational modifications. CONCLUSION/SIGNIFICANCE: Our protocol should prove useful for the experimental study of recombinant Hbs in many non-human animals. One of the chief advantages of our protocol is that we can express soluble recombinant Hb without co-expressing molecular chaperones, and without the need...

  11. Morphology effects on spin-dependent transport and recombination in polyfluorene thin films

    Science.gov (United States)

    Miller, Richards; van Schooten, K. J.; Malissa, H.; Joshi, G.; Jamali, S.; Lupton, J. M.; Boehme, C.

    2016-12-01

    We have studied the role of spin-dependent processes on conductivity in polyfluorene (PFO) thin films by preforming continuous wave (cw) electrically detected magnetic resonance (EDMR) spectroscopy at temperatures between 10 K and room temperature using microwave frequencies between about 1 GHz and 20 GHz, as well as pulsed EDMR at the X band (10 GHz). Variable frequency EDMR allows us to establish the role of spin-orbit coupling in spin-dependent processes whereas pulsed EDMR allows for the observation of coherent spin motion effects. We used PFO for this study in order to allow for the investigation of the effects of microscopic morphological ordering since this material can adopt two distinct intrachain morphologies: an amorphous (glassy) phase, in which monomer units are twisted with respect to each other, and an ordered (β) phase, where all monomers lie within one plane. In thin films of organic light-emitting diodes, the appearance of a particular phase can be controlled by deposition parameters and solvent vapor annealing, and is verified by electroluminescence spectroscopy. Under bipolar charge-carrier injection conditions, we conducted multifrequency cw EDMR, electrically detected Rabi spin-beat experiments, and Hahn echo and inversion-recovery measurements. Coherent echo spectroscopy reveals electrically detected electron-spin-echo envelope modulation due to the coupling of the carrier spins to nearby nuclear spins. Our results demonstrate that, while conformational disorder can influence the observed EDMR signals, including the sign of the current changes on resonance as well as the magnitudes of local hyperfine fields and charge-carrier spin-orbit interactions, it does not qualitatively affect the nature of spin-dependent transitions in this material. In both morphologies, we observe the presence of at least two different spin-dependent recombination processes. At room temperature and 10 K, polaron-pair recombination through weakly spin-spin coupled

  12. Genetic recombination pathways and their application for genome modification of human embryonic stem cells.

    Science.gov (United States)

    Nieminen, Mikko; Tuuri, Timo; Savilahti, Harri

    2010-10-01

    Human embryonic stem cells are pluripotent cells derived from early human embryo and retain a potential to differentiate into all adult cell types. They provide vast opportunities in cell replacement therapies and are expected to become significant tools in drug discovery as well as in the studies of cellular and developmental functions of human genes. The progress in applying different types of DNA recombination reactions for genome modification in a variety of eukaryotic cell types has provided means to utilize recombination-based strategies also in human embryonic stem cells. Homologous recombination-based methods, particularly those utilizing extended homologous regions and those employing zinc finger nucleases to boost genomic integration, have shown their usefulness in efficient genome modification. Site-specific recombination systems are potent genome modifiers, and they can be used to integrate DNA into loci that contain an appropriate recombination signal sequence, either naturally occurring or suitably pre-engineered. Non-homologous recombination can be used to generate random integrations in genomes relatively effortlessly, albeit with a moderate efficiency and precision. DNA transposition-based strategies offer substantially more efficient random strategies and provide means to generate single-copy insertions, thus potentiating the generation of genome-wide insertion libraries applicable in genetic screens. 2010 Elsevier Inc. All rights reserved.

  13. Efficacy of recombinant birch pollen vaccine for the treatment of birch-allergic rhinoconjunctivitis

    DEFF Research Database (Denmark)

    Pauli, Gabrielle; Larsen, Tina H; Rak, Sabina

    2008-01-01

    BACKGROUND: Recombinant DNA technology has the potential to produce allergen-specific immunotherapy vaccines with defined composition. OBJECTIVE: To evaluate the effectiveness of a new recombinant birch pollen allergen vaccine in patients with birch pollen allergy. METHODS: A multicenter, randomi......-treated group. CONCLUSION: The rBet v 1-based vaccine was safe and effective in treating birch pollen allergy, and induced a highly specific immune response.......BACKGROUND: Recombinant DNA technology has the potential to produce allergen-specific immunotherapy vaccines with defined composition. OBJECTIVE: To evaluate the effectiveness of a new recombinant birch pollen allergen vaccine in patients with birch pollen allergy. METHODS: A multicenter......, randomized, double-blind, placebo-controlled trial was undertaken to compare the following 3 vaccines in 134 adults with birch pollen allergy: recombinant birch pollen allergen vaccine (rBet v 1a), licensed birch pollen extract, natural purified birch pollen allergen (nBet v 1), and placebo. Patients...

  14. Is photocleavage of DNA by YOYO-1 using a synchrotron radiation light source sequence dependent?

    DEFF Research Database (Denmark)

    Gilroy, Emma L.; Hoffmann, Søren Vrønning; Jones, Nykola C.

    2011-01-01

    ) throughout the irradiation period. The dependence of LD signals on DNA sequences and on time in the intense light beam was explored and quantified for single-stranded poly(dA), poly[(dA-dT)2], calf thymus DNA (ctDNA) and Micrococcus luteus DNA (mlDNA). The DNA and ligand regions of the spectrum showed...

  15. Residual DNA analysis in biologics development: review of measurement and quantitation technologies and future directions.

    Science.gov (United States)

    Wang, Xing; Morgan, Donna M; Wang, Gan; Mozier, Ned M

    2012-02-01

    Residual DNA (rDNA) is comprised of deoxyribonucleic acid (DNA) fragments and longer length molecules originating from the host organism that may be present in samples from recombinant biological processes. Although similar in basic structural base pair units, rDNA may exist in different sizes and physical forms. Interest in measuring rDNA in recombinant products is based primarily on demonstration of effective purification during manufacturing, but also on some hypothetical concerns that, in rare cases, depending on the host expression system, some DNA sequences may be potentially infectious or oncogenic (e.g., HIV virus and the Ras oncogene, respectively). Recent studies suggest that a sequence known as long interspersed nucleotide element-1 (LINE-1), widely distributed in the mammalian genome, is active as a retrotransposon that can be transcribed to RNA, reverse-transcribed into DNA and inserts into a new site in genome. This integration process could potentially disrupt critical gene functions or induce tumorigenesis in mammals. Genomic DNA from microbial sources, on the other hand, could add to risk of immunogenicity to the target recombinant protein being expressed, due to the high CpG content and unmethylated DNA sequence. For these and other reasons, it is necessary for manufacturers to show clearance of DNA throughout production processes and to confirm low levels in the final drug substance using an appropriately specific and quantitative analytical method. The heterogeneity of potential rDNA sequences that might be makes the testing of all potential analytes challenging. The most common methodology for rDNA quantitation used currently is real-time polymerase chain reaction (RT-PCR), a robust and proven technology. Like most rDNA quantitation methods, the specificity of RT-PCR is limited by the sequences to which the primers are directed. To address this, primase-based whole genome amplification is introduced herein. This paper will review the recent

  16. [Construction and selection of effective mouse Smad6 recombinant lenti-virus interference vectors].

    Science.gov (United States)

    Yu, Jing; Qi, Mengchun; Deng, Jiupeng; Liu, Gang; Chen, Huaiqing

    2010-10-01

    This experiment was designed to construct mouse Smad6 recombinant RNA interference vectors and determine their interference effects on bone marrow mesenchymal stem cells (BMSCs). Three recombinant Smad6 RNA interference vectors were constructed by molecular clone techniques with a lenti-virus vector expressing green fluorescent protein (GFP), and the correctness of recombinant vectors was verified by DNA sequencing. Mouse BMSCs were used for transfection experiments and BMP-2 was in use for osteogenic induction of MSCs. The transfection efficiency of recombinant vectors was examined by Laser confocal scanning microscope and the interference effect of recombinant vectors on Smad6 gene expression was determined by real-time RT-PCR and Western blot, respectively. Three Smad6 recombinant RNA interference vectors were successfully constructed and their correctness was proved by DNA sequencing. After transfection, GFPs were effectively expressed in MSCs and all of three recombinant vectors gained high transfection efficiency (> 95%). Both real-time PCR and Western blot examination indicated that among three recombinant vectors, No. 2 Svector had the best interference effect and the interference effect was nearly 91% at protein level. In conclusion, Mouse recombinant Smad6 RNA interference (RNAi) vector was successfully constructed and it provided an effective tool for further studies on BMP signal pathways.

  17. Protein Cofactors Are Essential for High-Affinity DNA Binding by the Nuclear Factor κB RelA Subunit.

    Science.gov (United States)

    Mulero, Maria Carmen; Shahabi, Shandy; Ko, Myung Soo; Schiffer, Jamie M; Huang, De-Bin; Wang, Vivien Ya-Fan; Amaro, Rommie E; Huxford, Tom; Ghosh, Gourisankar

    2018-05-22

    Transcription activator proteins typically contain two functional domains: a DNA binding domain (DBD) that binds to DNA with sequence specificity and an activation domain (AD) whose established function is to recruit RNA polymerase. In this report, we show that purified recombinant nuclear factor κB (NF-κB) RelA dimers bind specific κB DNA sites with an affinity significantly lower than that of the same dimers from nuclear extracts of activated cells, suggesting that additional nuclear cofactors might facilitate DNA binding by the RelA dimers. Additionally, recombinant RelA binds DNA with relatively low affinity at a physiological salt concentration in vitro. The addition of p53 or RPS3 (ribosomal protein S3) increases RelA:DNA binding affinity 2- to >50-fold depending on the protein and ionic conditions. These cofactor proteins do not form stable ternary complexes, suggesting that they stabilize the RelA:DNA complex through dynamic interactions. Surprisingly, the RelA-DBD alone fails to bind DNA under the same solution conditions even in the presence of cofactors, suggesting an important role of the RelA-AD in DNA binding. Reduced RelA:DNA binding at a physiological ionic strength suggests that multiple cofactors might be acting simultaneously to mitigate the electrolyte effect and stabilize the RelA:DNA complex in vivo. Overall, our observations suggest that the RelA-AD and multiple cofactor proteins function cooperatively to prime the RelA-DBD and stabilize the RelA:DNA complex in cells. Our study provides a mechanism for nuclear cofactor proteins in NF-κB-dependent gene regulation.

  18. Recombinant organisms for production of industrial products

    Science.gov (United States)

    Adrio, Jose-Luis

    2010-01-01

    A revolution in industrial microbiology was sparked by the discoveries of ther double-stranded structure of DNA and the development of recombinant DNA technology. Traditional industrial microbiology was merged with molecular biology to yield improved recombinant processes for the industrial production of primary and secondary metabolites, protein biopharmaceuticals and industrial enzymes. Novel genetic techniques such as metabolic engineering, combinatorial biosynthesis and molecular breeding techniques and their modifications are contributing greatly to the development of improved industrial processes. In addition, functional genomics, proteomics and metabolomics are being exploited for the discovery of novel valuable small molecules for medicine as well as enzymes for catalysis. The sequencing of industrial microbal genomes is being carried out which bodes well for future process improvement and discovery of new industrial products. PMID:21326937

  19. Recombinant organisms for production of industrial products.

    Science.gov (United States)

    Adrio, Jose-Luis; Demain, Arnold L

    2010-01-01

    A revolution in industrial microbiology was sparked by the discoveries of ther double-stranded structure of DNA and the development of recombinant DNA technology. Traditional industrial microbiology was merged with molecular biology to yield improved recombinant processes for the industrial production of primary and secondary metabolites, protein biopharmaceuticals and industrial enzymes. Novel genetic techniques such as metabolic engineering, combinatorial biosynthesis and molecular breeding techniques and their modifications are contributing greatly to the development of improved industrial processes. In addition, functional genomics, proteomics and metabolomics are being exploited for the discovery of novel valuable small molecules for medicine as well as enzymes for catalysis. The sequencing of industrial microbal genomes is being carried out which bodes well for future process improvement and discovery of new industrial products. © 2010 Landes Bioscience

  20. ATM-dependent pathways of chromatin remodelling and oxidative DNA damage responses.

    Science.gov (United States)

    Berger, N Daniel; Stanley, Fintan K T; Moore, Shaun; Goodarzi, Aaron A

    2017-10-05

    Ataxia-telangiectasia mutated (ATM) is a serine/threonine protein kinase with a master regulatory function in the DNA damage response. In this role, ATM commands a complex biochemical network that signals the presence of oxidative DNA damage, including the dangerous DNA double-strand break, and facilitates subsequent repair. Here, we review the current state of knowledge regarding ATM-dependent chromatin remodelling and epigenomic alterations that are required to maintain genomic integrity in the presence of DNA double-strand breaks and/or oxidative stress. We will focus particularly on the roles of ATM in adjusting nucleosome spacing at sites of unresolved DNA double-strand breaks within complex chromatin environments, and the impact of ATM on preserving the health of cells within the mammalian central nervous system.This article is part of the themed issue 'Chromatin modifiers and remodellers in DNA repair and signalling'. © 2017 The Author(s).

  1. Opposing roles of RNF8/RNF168 and deubiquitinating enzymes in ubiquitination-dependent DNA double-strand break response signaling and DNA-repair pathway choice

    International Nuclear Information System (INIS)

    Nakada, Shinichiro

    2016-01-01

    The E3 ubiquitin ligases ring finger protein (RNF) 8 and RNF168 transduce the DNA double-strand break (DSB) response (DDR) signal by ubiquitinating DSB sites. The depletion of RNF8 or RNF168 suppresses the accumulation of DNA-repair regulating factors such as 53BP1 and RAP80 at DSB sites, suggesting roles for RNF8- and RNF168-mediated ubiquitination in DSB repair. This mini-review provides a brief overview of the RNF8- and RNF168-dependent DDR-signaling and DNA-repair pathways. The choice of DNA-repair pathway when RNF8- and RNF168-mediated ubiquitination-dependent DDR signaling is negatively regulated by deubiquitinating enzymes (DUBs) is reviewed to clarify how the opposing roles of RNF8/RNF168 and DUBs regulate ubiquitination-dependent DDR signaling and the choice of DNA-repair pathway

  2. The role of DNA repair in herpesvirus pathogenesis.

    Science.gov (United States)

    Brown, Jay C

    2014-10-01

    In cells latently infected with a herpesvirus, the viral DNA is present in the cell nucleus, but it is not extensively replicated or transcribed. In this suppressed state the virus DNA is vulnerable to mutagenic events that affect the host cell and have the potential to destroy the virus' genetic integrity. Despite the potential for genetic damage, however, herpesvirus sequences are well conserved after reactivation from latency. To account for this apparent paradox, I have tested the idea that host cell-encoded mechanisms of DNA repair are able to control genetic damage to latent herpesviruses. Studies were focused on homologous recombination-dependent DNA repair (HR). Methods of DNA sequence analysis were employed to scan herpesvirus genomes for DNA features able to activate HR. Analyses were carried out with a total of 39 herpesvirus DNA sequences, a group that included viruses from the alpha-, beta- and gamma-subfamilies. The results showed that all 39 genome sequences were enriched in two or more of the eight recombination-initiating features examined. The results were interpreted to indicate that HR can stabilize latent herpesvirus genomes. The results also showed, unexpectedly, that repair-initiating DNA features differed in alpha- compared to gamma-herpesviruses. Whereas inverted and tandem repeats predominated in alpha-herpesviruses, gamma-herpesviruses were enriched in short, GC-rich initiation sequences such as CCCAG and depleted in repeats. In alpha-herpesviruses, repair-initiating repeat sequences were found to be concentrated in a specific region (the S segment) of the genome while repair-initiating short sequences were distributed more uniformly in gamma-herpesviruses. The results suggest that repair pathways are activated differently in alpha- compared to gamma-herpesviruses. Copyright © 2014. Published by Elsevier Inc.

  3. Genome-Derived Cytosolic DNA Mediates Type I Interferon-Dependent Rejection of B Cell Lymphoma Cells

    Directory of Open Access Journals (Sweden)

    Yu J. Shen

    2015-04-01

    Full Text Available The DNA damage response (DDR induces the expression of type I interferons (IFNs, but the underlying mechanisms are poorly understood. Here, we show the presence of cytosolic DNA in different mouse and human tumor cells. Treatment of cells with genotoxic agents increased the levels of cytosolic DNA in a DDR-dependent manner. Cloning of cytosolic DNA molecules from mouse lymphoma cells suggests that cytosolic DNA is derived from unique genomic loci and has the potential to form non-B DNA structures, including R-loops. Overexpression of Rnaseh1, which resolves R-loops, reduced the levels of cytosolic DNA, type I Ifn transcripts, and type I IFN-dependent rejection of lymphoma cells. Live-cell imaging showed a dynamic contact of cytosolic DNA with mitochondria, an important organelle for innate immune recognition of cytosolic nucleotides. In summary, we found that cytosolic DNA is present in many tumor cells and contributes to the immunogenicity of tumor cells.

  4. Human RECQ5 helicase promotes repair of DNA double-strand breaks by synthesis-dependent strand annealing

    Czech Academy of Sciences Publication Activity Database

    Paliwal, S.; Kanagaraj, R.; Sturzenegger, A.; Burdová, Kamila; Janščák, Pavel

    2014-01-01

    Roč. 42, č. 4 (2014), s. 2380-2390 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565; GA ČR GAP305/10/0281 Grant - others:Swiss National Science Foundation(CH) 31003A-129747; Swiss National Science Foundation(CH) 31003A_146206 Institutional support: RVO:68378050 Keywords : Human RECQ5 helicase * DNA double-strand breaks * mitotic homologous recombination Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  5. Reconstitution of the yeast RNA polymerase III transcription system with all recombinant factors.

    Science.gov (United States)

    Ducrot, Cécile; Lefebvre, Olivier; Landrieux, Emilie; Guirouilh-Barbat, Josée; Sentenac, André; Acker, Joel

    2006-04-28

    Transcription factor TFIIIC is a multisubunit complex required for promoter recognition and transcriptional activation of class III genes. We describe here the reconstitution of complete recombinant yeast TFIIIC and the molecular characterization of its two DNA-binding domains, tauA and tauB, using the baculovirus expression system. The B block-binding module, rtauB, was reconstituted with rtau138, rtau91, and rtau60 subunits. rtau131, rtau95, and rtau55 formed also a stable complex, rtauA, that displayed nonspecific DNA binding activity. Recombinant rTFIIIC was functionally equivalent to purified yeast TFIIIC, suggesting that the six recombinant subunits are necessary and sufficient to reconstitute a transcriptionally active TFIIIC complex. The formation and the properties of rTFIIIC-DNA complexes were affected by dephosphorylation treatments. The combination of complete recombinant rTFIIIC and rTFIIIB directed a low level of basal transcription, much weaker than with the crude B'' fraction, suggesting the existence of auxiliary factors that could modulate the yeast RNA polymerase III transcription system.

  6. DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific.

    Science.gov (United States)

    Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E

    2010-06-01

    A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.

  7. ATR-p53 restricts homologous recombination in response to replicative stress but does not limit DNA interstrand crosslink repair in lung cancer cells.

    Directory of Open Access Journals (Sweden)

    Bianca M Sirbu

    Full Text Available Homologous recombination (HR is required for the restart of collapsed DNA replication forks and error-free repair of DNA double-strand breaks (DSB. However, unscheduled or hyperactive HR may lead to genomic instability and promote cancer development. The cellular factors that restrict HR processes in mammalian cells are only beginning to be elucidated. The tumor suppressor p53 has been implicated in the suppression of HR though it has remained unclear why p53, as the guardian of the genome, would impair an error-free repair process. Here, we show for the first time that p53 downregulates foci formation of the RAD51 recombinase in response to replicative stress in H1299 lung cancer cells in a manner that is independent of its role as a transcription factor. We find that this downregulation of HR is not only completely dependent on the binding site of p53 with replication protein A but also the ATR/ATM serine 15 phosphorylation site. Genetic analysis suggests that ATR but not ATM kinase modulates p53's function in HR. The suppression of HR by p53 can be bypassed under experimental conditions that cause DSB either directly or indirectly, in line with p53's role as a guardian of the genome. As a result, transactivation-inactive p53 does not compromise the resistance of H1299 cells to the interstrand crosslinking agent mitomycin C. Altogether, our data support a model in which p53 plays an anti-recombinogenic role in the ATR-dependent mammalian replication checkpoint but does not impair a cell's ability to use HR for the removal of DSB induced by cytotoxic agents.

  8. Plant molecular biology and biotechnology research in the post-recombinant DNA era.

    Science.gov (United States)

    Tyagi, Akhilesh K; Khurana, Jitendra P

    2003-01-01

    After the beginning of the recombinant DNA era in the mid-1970s, researchers in India started to make use of the new technology to understand the structure of plant genes and regulation of their expression. The outcome started to appear in print in early the 1980s and genes for histones, tubulin, photosynthetic membrane proteins, phototransduction components, organelles and those regulated differentially by developmental and extrinsic signals were sequenced and characterized. Some genes of biotechnological importance like those encoding an interesting seed protein and the enzyme glyoxalase were also isolated. While work on the characterization of genome structure and organization was started quite early, it remained largely focused on the identification of DNA markers and genetic variability. In this context, the work on mustard, rice and wheat is worth mentioning. In the year 2000, India became a member of the international consortium to sequence entire rice genome. Several laboratories have also given attention to regulated expression of plastid and nuclear genes as well as to isolate target-specific promoters or design promoters with improved potential. Simultaneously, transgenic systems for crops like mustard, rice, wheat, cotton, legumes and several vegetables have been established. More recently, genes of agronomic importance like those for insect resistance, abiotic stress tolerance, nutritional improvement and male sterility, isolated in India or abroad, have been utilized for raising transgenics for crop improvement. Some of these transgenics have already shown their potential in containment facility or limited field trials conducted under the stipulated guidelines. Plant molecular biology and biotechnology are thus clearly poised to make an impact on research in basic biology and agriculture in the near future.

  9. Sequence Dependencies of DNA Deformability and Hydration in the Minor Groove

    Science.gov (United States)

    Yonetani, Yoshiteru; Kono, Hidetoshi

    2009-01-01

    Abstract DNA deformability and hydration are both sequence-dependent and are essential in specific DNA sequence recognition by proteins. However, the relationship between the two is not well understood. Here, systematic molecular dynamics simulations of 136 DNA sequences that differ from each other in their central tetramer revealed that sequence dependence of hydration is clearly correlated with that of deformability. We show that this correlation can be illustrated by four typical cases. Most rigid basepair steps are highly likely to form an ordered hydration pattern composed of one water molecule forming a bridge between the bases of distinct strands, but a few exceptions favor another ordered hydration composed of two water molecules forming such a bridge. Steps with medium deformability can display both of these hydration patterns with frequent transition. Highly flexible steps do not have any stable hydration pattern. A detailed picture of this correlation demonstrates that motions of hydration water molecules and DNA bases are tightly coupled with each other at the atomic level. These results contribute to our understanding of the entropic contribution from water molecules in protein or drug binding and could be applied for the purpose of predicting binding sites. PMID:19686662

  10. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  11. Meiotic sister chromatid cohesion and recombination in two filamentous fungi

    NARCIS (Netherlands)

    Heemst, van D.

    2000-01-01

    Homologous recombination and sister chromatid cohesion play important roles in the maintenance of genome integrity and the fidelity of chromosome segregation in mitosis and meiosis. Within the living cell, the integrity of the DNA is threatened by various factors that cause DNA-lesions, of

  12. On the relict recombination lines

    International Nuclear Information System (INIS)

    Bershtejn, I.N.; Bernshtejn, D.N.; Dubrovich, V.K.

    1977-01-01

    Accurate numerical calculation of intensities and profiles of hydrogen recombination lines of cosmological origin is made. Relie radiation distortions stipulated by recombination quantum release at the irrevocable recombination are investigated. Mean number calculation is given for guantums educing for one irrevocably-lost electron. The account is taken of the educed quantums interraction with matter. The main quantum-matter interrraction mechanisms are considered: electronic blow broadening; free-free, free-bound, bound-bound absorptions Recombination dynamics is investigated depending on hydrogen density and total density of all the matter kinds in the Universe

  13. Evidence that yeast SGS1, DNA2, SRS2, and FOB1 interact to maintain rDNA stability

    International Nuclear Information System (INIS)

    Tao Weitao; Budd, Martin; Campbell, Judith L.

    2003-01-01

    We and others have proposed that faulty processing of arrested replication forks leads to increases in recombination and chromosome instability in Saccharomyces cerevisiae. Now we use the ribosomal DNA locus, which is a good model for all stages of DNA replication, to test this hypothesis. We showed previously that DNA replication pausing at the ribosomal DNA replication fork barrier (RFB) is accompanied by the occurrence of double-strand breaks near the RFB. Both pausing and breakage are elevated in the hypomorphic dna2-2 helicase mutant. Deletion of FOB1 suppresses the elevated pausing and DSB formation. Our current work shows that mutation inactivating Sgs1, the yeast RecQ helicase ortholog, also causes accumulation of stalled replication forks and DSBs at the rDNA RFB. Either deletion of FOB1, which suppresses fork blocking and certain types of rDNA recombination, or an increase in SIR2 gene dosage, which suppresses rDNA recombination, reduces the number of forks persisting at the RFB. Although dna2-2 sgs1Δ double mutants are conditionally lethal, they do not show enhanced rDNA defects compared to sgs1Δ alone. However, surprisingly, the dna2-2 sgs1Δ lethality is suppressed by deletion of FOB1. On the other hand, the dna2-2 sgs1Δ lethality is only partially suppressed by deletion of rad51Δ. We propose that the replication-associated defects that we document in the rDNA are characteristic of similar events occurring either stochastically throughout the genome or at other regions where replication forks move slowly or stall, such as telomeres, centromeres, or replication slow zones

  14. Evidence that yeast SGS1, DNA2, SRS2, and FOB1 interact to maintain rDNA stability

    Energy Technology Data Exchange (ETDEWEB)

    Tao Weitao; Budd, Martin; Campbell, Judith L

    2003-11-27

    We and others have proposed that faulty processing of arrested replication forks leads to increases in recombination and chromosome instability in Saccharomyces cerevisiae. Now we use the ribosomal DNA locus, which is a good model for all stages of DNA replication, to test this hypothesis. We showed previously that DNA replication pausing at the ribosomal DNA replication fork barrier (RFB) is accompanied by the occurrence of double-strand breaks near the RFB. Both pausing and breakage are elevated in the hypomorphic dna2-2 helicase mutant. Deletion of FOB1 suppresses the elevated pausing and DSB formation. Our current work shows that mutation inactivating Sgs1, the yeast RecQ helicase ortholog, also causes accumulation of stalled replication forks and DSBs at the rDNA RFB. Either deletion of FOB1, which suppresses fork blocking and certain types of rDNA recombination, or an increase in SIR2 gene dosage, which suppresses rDNA recombination, reduces the number of forks persisting at the RFB. Although dna2-2 sgs1{delta} double mutants are conditionally lethal, they do not show enhanced rDNA defects compared to sgs1{delta} alone. However, surprisingly, the dna2-2 sgs1{delta} lethality is suppressed by deletion of FOB1. On the other hand, the dna2-2 sgs1{delta} lethality is only partially suppressed by deletion of rad51{delta}. We propose that the replication-associated defects that we document in the rDNA are characteristic of similar events occurring either stochastically throughout the genome or at other regions where replication forks move slowly or stall, such as telomeres, centromeres, or replication slow zones.

  15. Spin-polarization dependent carrier recombination dynamics and spin relaxation mechanism in asymmetrically doped (110) n-GaAs quantum wells

    Science.gov (United States)

    Teng, Lihua; Jiang, Tianran; Wang, Xia; Lai, Tianshu

    2018-05-01

    Carrier recombination and electron spin relaxation dynamics in asymmetric n-doped (110) GaAs/AlGaAs quantum wells are investigated with time-resolved pump-probe spectroscopy. The experiment results reveal that the measured carrier recombination time depends strongly on the polarization of pump pulse. With the same pump photon flux densities, the recombination time of spin-polarized carriers is always longer than that of the spin-balanced carriers except at low pump photon flux densities, this anomaly originates from the polarization-sensitive nonlinear absorption effect. Differing from the traditional views, in the low carrier density regime, the D'yakonov-Perel' (DP) mechanism can be more important than the Bir-Aronov-Pikus (BAP) mechanism, since the DP mechanism takes effect, the spin relaxation time in (110) GaAs QWs is shortened obviously via asymmetric doping.

  16. Recombinant protein blends: silk beyond natural design.

    Science.gov (United States)

    Dinjaski, Nina; Kaplan, David L

    2016-06-01

    Recombinant DNA technology and new material concepts are shaping future directions in biomaterial science for the design and production of the next-generation biomaterial platforms. Aside from conventionally used synthetic polymers, numerous natural biopolymers (e.g., silk, elastin, collagen, gelatin, alginate, cellulose, keratin, chitin, polyhydroxyalkanoates) have been investigated for properties and manipulation via bioengineering. Genetic engineering provides a path to increase structural and functional complexity of these biopolymers, and thereby expand the catalog of available biomaterials beyond that which exists in nature. In addition, the integration of experimental approaches with computational modeling to analyze sequence-structure-function relationships is starting to have an impact in the field by establishing predictive frameworks for determining material properties. Herein, we review advances in recombinant DNA-mediated protein production and functionalization approaches, with a focus on hybrids or combinations of proteins; recombinant protein blends or 'recombinamers'. We highlight the potential biomedical applications of fibrous protein recombinamers, such as Silk-Elastin Like Polypeptides (SELPs) and Silk-Bacterial Collagens (SBCs). We also discuss the possibility for the rationale design of fibrous proteins to build smart, stimuli-responsive biomaterials for diverse applications. We underline current limitations with production systems for these proteins and discuss the main trends in systems/synthetic biology that may improve recombinant fibrous protein design and production. Copyright © 2016. Published by Elsevier Ltd.

  17. [Serologic response to a DNA recombinant vaccine against hepatitis B in natives of the Peruvian Amazonian jungle].

    Science.gov (United States)

    Colichón, A; Vildósola, H; Sjogren, M; Cantella, R; Rojas, C

    1990-01-01

    Large areas of the Amazon basin in Brazil, Colombia, Ecuador, and in the nonoriental region of the peruvian jungle have been found to be hyperendemic to Hepatitis B with high prevalence of asymptomatic carriers (11 to 25%) and, in more selected areas, Hepatitis Delta has been also reported. In the present report, we have studied 108 volunteers from six different Jivaroes communities living in a hyperendemic Hepatitis B area. They received 2 doses of DNA recombinant yeast derivated HBV vaccine. All the selected persons were HBsAb negatives, but many (80%) had antibodies to HBc. Following immunization schedule, 80% responded with the formation of HBsAb; a better seroconversion was achieved in those negatives to anticore IgG compared with those having HBcAb. We obtained 90% of seroconversion in spite of the fact that our vaccination schedule was prolonged up to 10 months from the one recommended by the manufacturer. The vaccination schedule 0,4, 14 months, and the schedule 0,4 months, had 76 and 29% of seroconversion, respectively. We want to point out three observations: 1) It is quite possible that many of the Anti-core positives, that did not respond to vaccination were carriers of HBsAg undetectable by the conventional EIA test carried out; 2) The seroconversion rate in these natives was low (up to six months after the vaccination schedule); and 3) Many of the HBcAb were false positives and many of them were recently infected. We conclude: A) It is highly important to assess the anti-HBs hyperendemic areas before attempting vaccinations; B) All persons negative to anti-HBs should be vaccinated in spite to anticore antibodies; C) Areas with difficult access could be vaccinated even until 10 months without affecting good results, and D) DNA recombinant vaccine (ENGERIX B) was well tolerated. No side effects were observed.

  18. Close encounters for the first time: Helicase interactions with DNA damage.

    Science.gov (United States)

    Khan, Irfan; Sommers, Joshua A; Brosh, Robert M

    2015-09-01

    DNA helicases are molecular motors that harness the energy of nucleoside triphosphate hydrolysis to unwinding structured DNA molecules that must be resolved during cellular replication, DNA repair, recombination, and transcription. In vivo, DNA helicases are expected to encounter a wide spectrum of covalent DNA modifications to the sugar phosphate backbone or the nitrogenous bases; these modifications can be induced by endogenous biochemical processes or exposure to environmental agents. The frequency of lesion abundance can vary depending on the lesion type. Certain adducts such as oxidative base modifications can be quite numerous, and their effects can be helix-distorting or subtle perturbations to DNA structure. Helicase encounters with specific DNA lesions and more novel forms of DNA damage will be discussed. We will also review the battery of assays that have been used to characterize helicase-catalyzed unwinding of damaged DNA substrates. Characterization of the effects of specific DNA adducts on unwinding by various DNA repair and replication helicases has proven to be insightful for understanding mechanistic and biological aspects of helicase function in cellular DNA metabolism. Published by Elsevier B.V.

  19. Tomato protoplast DNA transformation : physical linkage and recombination of exogenous DNA sequences

    NARCIS (Netherlands)

    Jongsma, Maarten; Koornneef, Maarten; Zabel, Pim; Hille, Jacques

    1987-01-01

    Tomato protoplasts have been transformed with plasmid DNA's, containing a chimeric kanamycin resistance gene and putative tomato origins of replication. A calcium phosphate-DNA mediated transformation procedure was employed in combination with either polyethylene glycol or polyvinyl alcohol. There

  20. Human DNA repair and recombination genes

    International Nuclear Information System (INIS)

    Thompson, L.H.; Weber, C.A.; Jones, N.J.

    1988-09-01

    Several genes involved in mammalian DNA repair pathways were identified by complementation analysis and chromosomal mapping based on hybrid cells. Eight complementation groups of rodent mutants defective in the repair of uv radiation damage are now identified. At least seven of these genes are probably essential for repair and at least six of them control the incision step. The many genes required for repair of DNA cross-linking damage show overlap with those involved in the repair of uv damage, but some of these genes appear to be unique for cross-link repair. Two genes residing on human chromosome 19 were cloned from genomic transformants using a cosmid vector, and near full-length cDNA clones of each gene were isolated and sequenced. Gene ERCC2 efficiently corrects the defect in CHO UV5, a nucleotide excision repair mutant. Gene XRCC1 normalizes repair of strand breaks and the excessive sister chromatid exchange in CHO mutant EM9. ERCC2 shows a remarkable /approximately/52% overall homology at both the amino acid and nucleotide levels with the yeast RAD3 gene. Evidence based on mutation induction frequencies suggests that ERCC2, like RAD3, might also be an essential gene for viability. 100 refs., 4 tabs

  1. LEM-3 is a midbody-tethered DNA nuclease that resolves chromatin bridges during late mitosis.

    Science.gov (United States)

    Hong, Ye; Sonneville, Remi; Wang, Bin; Scheidt, Viktor; Meier, Bettina; Woglar, Alexander; Demetriou, Sarah; Labib, Karim; Jantsch, Verena; Gartner, Anton

    2018-02-20

    Faithful chromosome segregation and genome maintenance requires the removal of all DNA bridges that physically link chromosomes before cells divide. Using C. elegans embryos we show that the LEM-3/Ankle1 nuclease defines a previously undescribed genome integrity mechanism by processing DNA bridges right before cells divide. LEM-3 acts at the midbody, the structure where abscission occurs at the end of cytokinesis. LEM-3 localization depends on factors needed for midbody assembly, and LEM-3 accumulation is increased and prolonged when chromatin bridges are trapped at the cleavage plane. LEM-3 locally processes chromatin bridges that arise from incomplete DNA replication, unresolved recombination intermediates, or the perturbance of chromosome structure. Proper LEM-3 midbody localization and function is regulated by AIR-2/Aurora B kinase. Strikingly, LEM-3 acts cooperatively with the BRC-1/BRCA1 homologous recombination factor to promote genome integrity. These findings provide a molecular basis for the suspected role of the LEM-3 orthologue Ankle1 in human breast cancer.

  2. PRDM9 and Its Role in Genetic Recombination.

    Science.gov (United States)

    Paigen, Kenneth; Petkov, Petko M

    2018-04-01

    PRDM9 is a zinc finger protein that binds DNA at specific locations in the genome where it trimethylates histone H3 at lysines 4 and 36 at surrounding nucleosomes. During meiosis in many species, including humans and mice where PRDM9 has been most intensely studied, these actions determine the location of recombination hotspots, where genetic recombination occurs. In addition, PRDM9 facilitates the association of hotspots with the chromosome axis, the site of the programmed DNA double-strand breaks (DSBs) that give rise to genetic exchange between chromosomes. In the absence of PRDM9 DSBs are not properly repaired. Collectively, these actions determine patterns of genetic linkage and the possibilities for chromosome reorganization over successive generations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Establishment of human sperm-specific voltage-dependent anion channel 3 recombinant vector for the production of a male contraceptive vaccine

    Directory of Open Access Journals (Sweden)

    Asmarinah Asmarinah

    2012-05-01

    Full Text Available Background: The aim of this study was to construct a recombinant vector of human sperm specific VDAC3 gene for production of VDAC3 antibody, which is potential as male contraception vaccine.Methods: Target fragment sequence of VDAC3 gene was obtained through amplification of human sperm VDAC3 cDNA with primers covering exon 5 to exon 8. Its PCR product in size of 435 bp was cloned to the pET101/D-TOPO expression vector (5753 bp. E. coli bacteria were transformed with this vector. Cloning of VDAC3 fragment gene to the vector was confirmed by the using of XbaI restriction enzyme and PCR colony method with primers covering exons 5-8 of the human VDAC3 gene.Results: Alignment analysis of amplified fragment covering exon 5 to exon 8 of VDAC3 gene showed 94% homology to human VDAC3 gene from databank. After cloning to the expression vector and transformation to E. coli competent cells, twelve colonies could grow in culture media. Gel electrophoresis of sliced VDAC3 recombinant vector showed a single band in the size of 6181 bp in 8 colonies. After application of PCR colony and amplicon sequencing, the result showed a single band in the size of 435 bp and fragment sequence with 94% identity to human VDAC3 gene.Conclusion: The construction of human sperm specific VDAC3 gene recombinant vector was established in this study. In the future, this recombinant vector will be used to produce VDAC3 antibody for the development of a male contraception vaccine. (Med J Indones. 2012;21:61-5Keywords: Contraception, recombinant vector, sperm, VDAC3

  4. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.

    1980-01-01

    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  5. Effects of the rad52 gene on recombination in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Prakash, S.; Prakash, L.; Burke, W.; Montelone, B.A.

    1979-01-01

    Effects of the rad52 mutation in Saccharomyces cerevisiae on meiotic, γ-ray-induced, uv-induced, and spontaneous mitotic recombination were studied. The rad52/rad52 diploids undergo premeiotic DNA synthesis; sporulation occurs but inviable spores are produced. Intra- and intergenic recombination during meiosis were examined in cells transferred from sporulation medium to vegetative medium at different time intervals. No intragenic recombination was observed at the hisl-1/hisl-315 and trp5-2/trp5-48 heteroalleles. Gene-centromere recombination was also not observed in rad52/rad52 diploids. No γ-ray-induced intragenic mitotic recombination is seen in rad52/rad52 diploids and uv-induced intragenic recombination is greatly reduced. However, spontaneous mitotic recombination is not similarly affected. The RAD52 gene thus functions in recombination in meiosis and in γ-ray and uv-induced mitotic recombination but not in spontaneous mitotic recombination

  6. DNA binding properties of the small cascade subunit Csa5.

    Directory of Open Access Journals (Sweden)

    Michael Daume

    Full Text Available CRISPR-Cas systems provide immunity against viral attacks in archaeal and bacterial cells. Type I systems employ a Cas protein complex termed Cascade, which utilizes small CRISPR RNAs to detect and degrade the exogenic DNA. A small sequence motif, the PAM, marks the foreign substrates. Previously, a recombinant type I-A Cascade complex from the archaeon Thermoproteus tenax was shown to target and degrade DNA in vitro, dependent on a native PAM sequence. Here, we present the biochemical analysis of the small subunit, Csa5, of this Cascade complex. T. tenax Csa5 preferentially bound ssDNA and mutants that showed decreased ssDNA-binding and reduced Cascade-mediated DNA cleavage were identified. Csa5 oligomerization prevented DNA binding. Specific recognition of the PAM sequence was not observed. Phylogenetic analyses identified Csa5 as a universal member of type I-A systems and revealed three distinct groups. A potential role of Csa5 in R-loop stabilization is discussed.

  7. Homologous recombination contributes to the repair of DNA double-strand breaks induced by high-energy iron ions

    Energy Technology Data Exchange (ETDEWEB)

    Zafar, Faria; Seidler, Sara B.; Kronenberg, Amy; Schild, David; Wiese, Claudia

    2010-06-29

    To test the contribution of homologous recombinational repair (HRR) in repairing DNA damaged sites induced by high-energy iron ions, we used: (1) HRR-deficient rodent cells carrying a deletion in the RAD51D gene and (2) syngeneic human cells impaired for HRR by RAD51D or RAD51 knockdown using RNA interference. We show that in response to iron ions, HRR contributes to cell survival in rodent cells, and that HRR-deficiency abrogates RAD51 foci formation. Complementation of the HRR defect by human RAD51D rescues both enhanced cytotoxicity and RAD51 foci formation. For human cells irradiated with iron ions, cell survival is decreased, and, in p53 mutant cells, the levels of mutagenesis are increased when HRR is impaired. Human cells synchronized in S phase exhibit more pronounced resistance to iron ions as compared with cells in G1 phase, and this increase in radioresistance is diminished by RAD51 knockdown. These results implicate a role for RAD51-mediated DNA repair (i.e. HRR) in removing a fraction of clustered lesions induced by charged particle irradiation. Our results are the first to directly show the requirement for an intact HRR pathway in human cells in ensuring DNA repair and cell survival in response to high-energy high LET radiation.

  8. Homologous recombination contributes to the repair of DNA double-strand breaks induced by high-energy iron ions

    International Nuclear Information System (INIS)

    Zafar, Faria; Seidler, Sara B.; Kronenberg, Amy; Schild, David; Wiese, Claudia

    2010-01-01

    To test the contribution of homologous recombinational repair (HRR) in repairing DNA damaged sites induced by high-energy iron ions, we used: (1) HRR-deficient rodent cells carrying a deletion in the RAD51D gene and (2) syngeneic human cells impaired for HRR by RAD51D or RAD51 knockdown using RNA interference. We show that in response to iron ions, HRR contributes to cell survival in rodent cells, and that HRR-deficiency abrogates RAD51 foci formation. Complementation of the HRR defect by human RAD51D rescues both enhanced cytotoxicity and RAD51 foci formation. For human cells irradiated with iron ions, cell survival is decreased, and, in p53 mutant cells, the levels of mutagenesis are increased when HRR is impaired. Human cells synchronized in S phase exhibit more pronounced resistance to iron ions as compared with cells in G1 phase, and this increase in radioresistance is diminished by RAD51 knockdown. These results implicate a role for RAD51-mediated DNA repair (i.e. HRR) in removing a fraction of clustered lesions induced by charged particle irradiation. Our results are the first to directly show the requirement for an intact HRR pathway in human cells in ensuring DNA repair and cell survival in response to high-energy high LET radiation.

  9. Lyn tyrosine kinase promotes silencing of ATM-dependent checkpoint signaling during recovery from DNA double-strand breaks

    International Nuclear Information System (INIS)

    Fukumoto, Yasunori; Kuki, Kazumasa; Morii, Mariko; Miura, Takahito; Honda, Takuya; Ishibashi, Kenichi; Hasegawa, Hitomi; Kubota, Sho; Ide, Yudai; Yamaguchi, Noritaka; Nakayama, Yuji; Yamaguchi, Naoto

    2014-01-01

    Highlights: • Inhibition of Src family kinases decreased γ-H2AX signal. • Inhibition of Src family increased ATM-dependent phosphorylation of Chk2 and Kap1. • shRNA-mediated knockdown of Lyn increased phosphorylation of Kap1 by ATM. • Ectopic expression of Src family kinase suppressed ATM-mediated Kap1 phosphorylation. • Src is involved in upstream signaling for inactivation of ATM signaling. - Abstract: DNA damage activates the DNA damage checkpoint and the DNA repair machinery. After initial activation of DNA damage responses, cells recover to their original states through completion of DNA repair and termination of checkpoint signaling. Currently, little is known about the process by which cells recover from the DNA damage checkpoint, a process called checkpoint recovery. Here, we show that Src family kinases promote inactivation of ataxia telangiectasia mutated (ATM)-dependent checkpoint signaling during recovery from DNA double-strand breaks. Inhibition of Src activity increased ATM-dependent phosphorylation of Chk2 and Kap1. Src inhibition increased ATM signaling both in G2 phase and during asynchronous growth. shRNA knockdown of Lyn increased ATM signaling. Src-dependent nuclear tyrosine phosphorylation suppressed ATM-mediated Kap1 phosphorylation. These results suggest that Src family kinases are involved in upstream signaling that leads to inactivation of the ATM-dependent DNA damage checkpoint

  10. Recombination: the good, the bad and the variable.

    Science.gov (United States)

    Stapley, Jessica; Feulner, Philine G D; Johnston, Susan E; Santure, Anna W; Smadja, Carole M

    2017-12-19

    Recombination, the process by which DNA strands are broken and repaired, producing new combinations of alleles, occurs in nearly all multicellular organisms and has important implications for many evolutionary processes. The effects of recombination can be good , as it can facilitate adaptation, but also bad when it breaks apart beneficial combinations of alleles, and recombination is highly variable between taxa, species, individuals and across the genome. Understanding how and why recombination rate varies is a major challenge in biology. Most theoretical and empirical work has been devoted to understanding the role of recombination in the evolution of sex-comparing between sexual and asexual species or populations. How recombination rate evolves and what impact this has on evolutionary processes within sexually reproducing organisms has received much less attention. This Theme Issue focusses on how and why recombination rate varies in sexual species, and aims to coalesce knowledge of the molecular mechanisms governing recombination with our understanding of the evolutionary processes driving variation in recombination within and between species. By integrating these fields, we can identify important knowledge gaps and areas for future research, and pave the way for a more comprehensive understanding of how and why recombination rate varies. © 2017 The Authors.

  11. HTLV-1 Tax Oncoprotein Subverts the Cellular DNA Damage Response via Binding to DNA-dependent Protein Kinase*S⃞

    Science.gov (United States)

    Durkin, Sarah S.; Guo, Xin; Fryrear, Kimberly A.; Mihaylova, Valia T.; Gupta, Saurabh K.; Belgnaoui, S. Mehdi; Haoudi, Abdelali; Kupfer, Gary M.; Semmes, O. John

    2008-01-01

    Human T-cell leukemia virus type-1 is the causative agent for adult T-cell leukemia. Previous research has established that the viral oncoprotein Tax mediates the transformation process by impairing cell cycle control and cellular response to DNA damage. We showed previously that Tax sequesters huChk2 within chromatin and impairs the response to ionizing radiation. Here we demonstrate that DNA-dependent protein kinase (DNA-PK) is a member of the Tax·Chk2 nuclear complex. The catalytic subunit, DNA-PKcs, and the regulatory subunit, Ku70, were present. Tax-containing nuclear extracts showed increased DNA-PK activity, and specific inhibition of DNA-PK prevented Tax-induced activation of Chk2 kinase activity. Expression of Tax induced foci formation and phosphorylation of H2AX. However, Tax-induced constitutive signaling of the DNA-PK pathway impaired cellular response to new damage, as reflected in suppression of ionizing radiation-induced DNA-PK phosphorylation and γH2AX stabilization. Tax co-localized with phospho-DNA-PK into nuclear speckles and a nuclear excluded Tax mutant sequestered endogenous phospho-DNA-PK into the cytoplasm, suggesting that Tax interaction with DNA-PK is an initiating event. We also describe a novel interaction between DNA-PK and Chk2 that requires Tax. We propose that Tax binds to and stabilizes a protein complex with DNA-PK and Chk2, resulting in a saturation of DNA-PK-mediated damage repair response. PMID:18957425

  12. Recombinant protein expression in microbial systems

    OpenAIRE

    Rosano, Germán L.; Ceccarelli, Eduardo A.

    2014-01-01

    The emergence of recombinant DNA technology during the early 70's set a revolution in molecular biology. This set of techniques was strengthened even further later on with the introduction of the polymerase chain reaction and allowed scientists to explore and understand essential life processes in an easy and straightforward way. It also marked the birth of the modern biotech industry. At that time, it was shown that eukaryotic DNA could be propagated in Escherichia coli (Morrow et al., 1974)...

  13. Testing the effect of paraquat exposure on genomic recombination rates in queens of the western honey bee, Apis mellifera.

    Science.gov (United States)

    Langberg, Kurt; Phillips, Matthew; Rueppell, Olav

    2018-04-01

    The rate of genomic recombination displays evolutionary plasticity and can even vary in response to environmental factors. The western honey bee (Apis mellifera L.) has an extremely high genomic recombination rate but the mechanistic basis for this genome-wide upregulation is not understood. Based on the hypothesis that meiotic recombination and DNA damage repair share common mechanisms in honey bees as in other organisms, we predicted that oxidative stress leads to an increase in recombination rate in honey bees. To test this prediction, we subjected honey bee queens to oxidative stress by paraquat injection and measured the rates of genomic recombination in select genome intervals of offspring produced before and after injection. The evaluation of 26 genome intervals in a total of over 1750 offspring of 11 queens by microsatellite genotyping revealed several significant effects but no overall evidence for a mechanistic link between oxidative stress and increased recombination was found. The results weaken the notion that DNA repair enzymes have a regulatory function in the high rate of meiotic recombination of honey bees, but they do not provide evidence against functional overlap between meiotic recombination and DNA damage repair in honey bees and more mechanistic studies are needed.

  14. pH-dependence of the optical bio-sensor based on DNA-carbon nanotube

    International Nuclear Information System (INIS)

    Vu Thuy Huong; Quach Kha Quang; Tran Thanh Thuy; Phan Duc Anh; Ngo Van Thanh; Nguyen Ai Viet

    2010-01-01

    In 2006, Daniel A. Heller et al. [1] demonstrated that carbon nanotubes (CNNTs) wrapped with DNA can be placed inside living cells and detect trace amounts of harmful contaminants using near infrared light. This discovery could lead to new types of optical sensors and biomarkers at the sub cellular level. The working principle of this optical bio-sensor from DNA and CNNTs can be explained by a simple theoretical model which was introduced in [3]. In this paper, the pH-dependence of DNA and the pH-dependence of solution around CNNTs are shown by using data analysis method. By substituting them into the same model, the pH-dependence of DNA-wrapped CNNTs was elicited in this paper. The range of parameters for workable conditions of this bio-sensor was indicated that the solution should have pH from 6 to 9 and the concentration of ions should be more than a critical value. These results are according to the experimental data and the deduction about pH and salt concentration in solution. They are very useful as using such a new bio-sensor like this in living environment. (author)

  15. Lower sperm DNA fragmentation after r-FSH administration in functional hypogonadotropic hypogonadism.

    Science.gov (United States)

    Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana

    2013-04-01

    An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .

  16. Structure and function of DNA polymerase μ

    International Nuclear Information System (INIS)

    Matsumoto, Takuro; Maezawa, So

    2013-01-01

    DNA polymerases are enzymes playing the central role in DNA metabolism, including DNA replication, DNA repair and recombination. DNA polymerase μ (pol μ DNA polymerase λ (pol λ) and terminal deoxynucleotidyltransferase (TdT) in X family DNA polymerases function in non-homologous end-joining (NHEJ), which is the predonmiant repair pathway for DNA double-strand breaks (DSBs). NHEJ involves enzymes that capture both ends of the broken DNA strand, bring them together in a synaptic DNA-protein complex, and repair the DSB. Pol μ and pol λ fill in the gaps at the junction to maintain the genomic integrity. TdT synthesizes N region at the junction during V(D)J recombination and promotes diversity of immunoglobulin or T-cell receptor gene. Among these three polymerases, the regulatory mechanisms of pol μ remain rather unclear. We have approached the mechanism of pol μ from both sides of structure and cellular dynamics. Here, we propose some new insights into pol μ and the probable NHEJ model including our findings. (author)

  17. Formulation, characterization, and expression of a recombinant MOMP Chlamydia trachomatis DNA vaccine encapsulated in chitosan nanoparticles

    Directory of Open Access Journals (Sweden)

    Cambridge CD

    2013-05-01

    Full Text Available Chino D Cambridge, Shree R Singh, Alain B Waffo, Stacie J Fairley, Vida A DennisCenter for NanoBiotechnology Research (CNBR, Alabama State University, Montgomery, AL, USAAbstract: Chlamydia trachomatis is a bacterial sexually transmitted infection affecting millions of people worldwide. Previous vaccination attempts have employed the recombinant major outer membrane protein (MOMP of C. trachomatis nonetheless, with limited success, perhaps, due to stability, degradation, and delivery issues. In this study we cloned C. trachomatis recombinant MOMP DNA (DMOMP and encapsulated it in chitosan nanoparticles (DMCNP using the complex coacervation technique. Physiochemical characterizations of DMCNP included transmission and scanning electron microcopy, Fourier transform infrared and ultraviolet-visible spectroscopy, and zeta potential. Encapsulated DMOMP was 167–250 nm, with a uniform spherical shape and homogenous morphology, and an encapsulation efficiency > 90%. A slow release pattern of encapsulated DMOMP, especially in acidic solution, was observed over 7 days. The zeta potential of DMCNP was ~8.80 mV, which indicated that it was highly stable. Toxicity studies of DMCNP (25–400 µg/mL to Cos-7 cells using the MTT assay revealed minimal toxicity over 24–72 hours with >90% viable cells. Ultra-violet visible (UV-vis spectra indicated encapsulated DMOMP protection by chitosan, whereas agarose gel electrophoresis verified its protection from enzymatic degradation. Expression of MOMP protein in DMCNP-transfected Cos-7 cells was demonstrated via Western blotting and immunofluorescence microscopy. Significantly, intramuscular injection of BALB/c mice with DMCNP confirmed the delivery of encapsulated DMOMP, and expression of the MOMP gene transcript in thigh muscles and spleens. Our data show that encapsulation of DMOMP in biodegradable chitosan nanoparticles imparts stability and protection from enzymatic digestion, and enhances delivery and

  18. MHF1-2/CENP-S-X performs distinct roles in centromere metabolism and genetic recombination.

    Science.gov (United States)

    Bhattacharjee, Sonali; Osman, Fekret; Feeney, Laura; Lorenz, Alexander; Bryer, Claire; Whitby, Matthew C

    2013-09-11

    The histone-fold proteins Mhf1/CENP-S and Mhf2/CENP-X perform two important functions in vertebrate cells. First, they are components of the constitutive centromere-associated network, aiding kinetochore assembly and function. Second, they work with the FANCM DNA translocase to promote DNA repair. However, it has been unclear whether there is crosstalk between these roles. We show that Mhf1 and Mhf2 in fission yeast, as in vertebrates, serve a dual function, aiding DNA repair/recombination and localizing to centromeres to promote chromosome segregation. Importantly, these functions are distinct, with the former being dependent on their interaction with the FANCM orthologue Fml1 and the latter not. Together with Fml1, they play a second role in aiding chromosome segregation by processing sister chromatid junctions. However, a failure of this activity does not manifest dramatically increased levels of chromosome missegregation due to the Mus81-Eme1 endonuclease, which acts as a failsafe to resolve DNA junctions before the end of mitosis.

  19. Mucosal immunization with PLGA-microencapsulated DNA primes a SIV-specific CTL response revealed by boosting with cognate recombinant modified vaccinia virus Ankara

    International Nuclear Information System (INIS)

    Sharpe, Sally; Hanke, Tomas; Tinsley-Bown, Anne; Dennis, Mike; Dowall, Stuart; McMichael, Andrew; Cranage, Martin

    2003-01-01

    Systemically administered DNA encoding a recombinant human immunodeficiency virus (HIV) derived immunogen effectively primes a cytotoxic T lymphocyte (CTL) response in macaques. In this further pilot study we have evaluated mucosal delivery of DNA as an alternative priming strategy. Plasmid DNA, pTH.HW, encoding a multi-CTL epitope gene, was incorporated into poly(D,L-lactic-co-glycolic acid) microparticles of less than 10 μm in diameter. Five intrarectal immunizations failed to stimulate a circulating vaccine-specific CTL response in 2 Mamu-A*01 + rhesus macaques. However, 1 week after intradermal immunization with a cognate modified vaccinia virus Ankara vaccine MVA.HW, CTL responses were detected in both animals that persisted until analysis postmortem, 12 weeks after the final boost. In contrast, a weaker and less durable response was seen in an animal vaccinated with the MVA construct alone. Analysis of lymphoid tissues revealed a disseminated CTL response in peripheral and regional lymph nodes but not the spleen of both mucosally primed animals

  20. Site-Selective Conjugation of Native Proteins with DNA

    DEFF Research Database (Denmark)

    Trads, Julie Brender; Tørring, Thomas; Gothelf, Kurt Vesterager

    2017-01-01

    Conjugation of DNA to proteins is increasingly used in academia and industry to provide proteins with tags for identification or handles for hybridization to other DNA strands. Assay technologies such as immuno-PCR and proximity ligation and the imaging technology DNA-PAINT require DNA-protein....... The introduction of a bioorthogonal handle at a specific position of a protein by recombinant techniques provides an excellent approach to site-specific conjugation, but for many laboratories and for applications where several proteins are to be labeled, the expression of recombinant proteins may be cumbersome...... conjugates. In DNA nanotechnology, the DNA handle is exploited to precisely position proteins by self-assembly. For these applications, site-selective conjugation is almost always desired because fully functional proteins are required to maintain the specificity of antibodies and the activity of enzymes...

  1. Replication and Transcription of Eukaryotic DNA in Esherichia coli

    Science.gov (United States)

    Morrow, John F.; Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Goodman, Howard M.; Helling, Robert B.

    1974-01-01

    Fragments of amplified Xenopus laevis DNA, coding for 18S and 28S ribosomal RNA and generated by EcoRI restriction endonuclease, have been linked in vitro to the bacterial plasmid pSC101; and the recombinant molecular species have been introduced into E. coli by transformation. These recombinant plasmids, containing both eukaryotic and prokaryotic DNA, replicate stably in E. coli. RNA isolated from E. coli minicells harboring the plasmids hybridizes to amplified X. laevis rDNA. Images PMID:4600264

  2. Photochemical Acceleration of DNA Strand Displacement by Using Ultrafast DNA Photo-crosslinking.

    Science.gov (United States)

    Nakamura, Shigetaka; Hashimoto, Hirokazu; Kobayashi, Satoshi; Fujimoto, Kenzo

    2017-10-18

    DNA strand displacement is an essential reaction in genetic recombination, biological processes, and DNA nanotechnology. In particular, various DNA nanodevices enable complicated calculations. However, it takes time before the output is obtained, so acceleration of DNA strand displacement is required for a rapid-response DNA nanodevice. Herein, DNA strand displacement by using DNA photo-crosslinking to accelerate this displacement is evaluated. The DNA photo-crosslinking of 3-cyanovinylcarbazole ( CNV K) was accelerated at least 20 times, showing a faster DNA strand displacement. The rate of photo-crosslinking is a key factor and the rate of DNA strand displacement is accelerated through ultrafast photo-crosslinking. The rate of DNA strand displacement was regulated by photoirradiation energy. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Competition between replicative and translesion polymerases during homologous recombination repair in Drosophila.

    Directory of Open Access Journals (Sweden)

    Daniel P Kane

    Full Text Available In metazoans, the mechanism by which DNA is synthesized during homologous recombination repair of double-strand breaks is poorly understood. Specifically, the identities of the polymerase(s that carry out repair synthesis and how they are recruited to repair sites are unclear. Here, we have investigated the roles of several different polymerases during homologous recombination repair in Drosophila melanogaster. Using a gap repair assay, we found that homologous recombination is impaired in Drosophila lacking DNA polymerase zeta and, to a lesser extent, polymerase eta. In addition, the Pol32 protein, part of the polymerase delta complex, is needed for repair requiring extensive synthesis. Loss of Rev1, which interacts with multiple translesion polymerases, results in increased synthesis during gap repair. Together, our findings support a model in which translesion polymerases and the polymerase delta complex compete during homologous recombination repair. In addition, they establish Rev1 as a crucial factor that regulates the extent of repair synthesis.

  4. Repair by genetic recombination in bacteria: overview

    International Nuclear Information System (INIS)

    Howard-Flanders, P.

    1975-01-01

    DNA molecules that have been damaged in both strands at the same level are not subject to repair by excision but instead can be repaired through recombination with homologous molecules. Examples of two-strand damage include postreplication gaps opposite pyrimidine dimers, two-strand breaks produced by x-rays, and chemically induced interstrand cross-links. In ultraviolet-irradiated bacteria, and newly synthesized DNA is of length equal to the interdimer spacing. With continued incubation, this low-molecular-weight DNA is joined into high-molecular-weight chains (postreplication repair), a process associated with sister exchanges in bacteria. Recombination is initiated by pyrimidine dimers opposite postreplication gaps and by interstrand cross-links that have been cut by excision enzymes. The free ends at the resulting gaps presumably initiate the exchanges. Postreplication repair in Escherichia coli occurs in recB - and recC - but is greatly slowed in recF - mutants. RecB and recC are the structural genes for exonuclease V, which digests two-stranded DNA by releasing oligonucleotides first from one strand and then from the other. The postreplication sister exchanges in ultraviolet-irradiated bacteria result in the distribution of pyrimidine dimers between parental and daughter strands, indicating that long exchanges involving both strands of each duplex occur. The R1 restriction endonuclease from E. coli has been used to cut the DNA of a bacterial drug-resistance transfer factor with one nuclease-sensitive site, and also DNA from the frog Xenopus enriched for ribosomal 18S and 28S genes. The fragments were annealed with the cut plasmid DNA and ligated, producing a new larger plasmid carrying the eukaryotic rDNA and able to infect and replicate in E. coli

  5. Improvement of the Immunogenicity of Porcine Circovirus Type 2 DNA Vaccine by Recombinant ORF2 Gene and CpG Motifs.

    Science.gov (United States)

    Li, Jun; Shi, Jian-Li; Wu, Xiao-Yan; Fu, Fang; Yu, Jiang; Yuan, Xiao-Yuan; Peng, Zhe; Cong, Xiao-Yan; Xu, Shao-Jian; Sun, Wen-Bo; Cheng, Kai-Hui; Du, Yi-Jun; Wu, Jia-Qiang; Wang, Jin-Bao; Huang, Bao-Hua

    2015-06-01

    Nowadays, adjuvant is still important for boosting immunity and improving resistance in animals. In order to boost the immunity of porcine circovirus type 2 (PCV2) DNA vaccine, CpG motifs were inserted. In this study, the dose-effect was studied, and the immunity of PCV2 DNA vaccines by recombinant open reading frame 2 (ORF2) gene and CpG motifs was evaluated. Three-week-old Changbai piglets were inoculated intramuscularly with 200 μg, 400 μg, and 800 μg DNA vaccines containing 14 and 18 CpG motifs, respectively. Average gain and rectum temperature were recorded everyday during the experiments. Blood was collected from the piglets after vaccination to detect the changes of specific antibodies, interleukin-2, and immune cells every week. Tissues were collected for histopathology and polymerase chain reaction. The results indicated that compared to those of the control piglets, all concentrations of two DNA vaccines could induce PCV2-specific antibodies. A cellular immunity test showed that PCV2-specific lymphocytes proliferated the number of TH, TC, and CD3+ positive T-cells raised in the blood of DNA vaccine immune groups. There was no distinct pathological damage and viremia occurring in pigs that were inoculated with DNA vaccines, but there was some minor pathological damage in the control group. The results demonstrated that CpG motifs as an adjuvant could boost the humoral and cellular immunity of pigs to PCV2, especially in terms of cellular immunity. Comparing two DNA vaccines that were constructed, the one containing 18 CpG motifs was more effective. This is the first report that CpG motifs as an adjuvant insert to the PCV2 DNA vaccine could boost immunity.

  6. Polo-like kinase 1 (PLK1) and protein phosphatase 6 (PP6) regulate DNA-dependent protein kinase catalytic subunit (DNA-PKcs) phosphorylation in mitosis.

    Science.gov (United States)

    Douglas, Pauline; Ye, Ruiqiong; Trinkle-Mulcahy, Laura; Neal, Jessica A; De Wever, Veerle; Morrice, Nick A; Meek, Katheryn; Lees-Miller, Susan P

    2014-06-25

    The protein kinase activity of the DNA-PKcs (DNA-dependent protein kinase catalytic subunit) and its autophosphorylation are critical for DBS (DNA double-strand break) repair via NHEJ (non-homologous end-joining). Recent studies have shown that depletion or inactivation of DNA-PKcs kinase activity also results in mitotic defects. DNA-PKcs is autophosphorylated on Ser2056, Thr2647 and Thr2609 in mitosis and phosphorylated DNA-PKcs localize to centrosomes, mitotic spindles and the midbody. DNA-PKcs also interacts with PP6 (protein phosphatase 6), and PP6 has been shown to dephosphorylate Aurora A kinase in mitosis. Here we report that DNA-PKcs is phosphorylated on Ser3205 and Thr3950 in mitosis. Phosphorylation of Thr3950 is DNA-PK-dependent, whereas phosphorylation of Ser3205 requires PLK1 (polo-like kinase 1). Moreover, PLK1 phosphorylates DNA-PKcs on Ser3205 in vitro and interacts with DNA-PKcs in mitosis. In addition, PP6 dephosphorylates DNA-PKcs at Ser3205 in mitosis and after IR (ionizing radiation). DNA-PKcs also phosphorylates Chk2 on Thr68 in mitosis and both phosphorylation of Chk2 and autophosphorylation of DNA-PKcs in mitosis occur in the apparent absence of Ku and DNA damage. Our findings provide mechanistic insight into the roles of DNA-PKcs and PP6 in mitosis and suggest that DNA-PKcs' role in mitosis may be mechanistically distinct from its well-established role in NHEJ.

  7. Reiterative Recombination for the in vivo assembly of libraries of multigene pathways.

    Science.gov (United States)

    Wingler, Laura M; Cornish, Virginia W

    2011-09-13

    The increasing sophistication of synthetic biology is creating a demand for robust, broadly accessible methodology for constructing multigene pathways inside of the cell. Due to the difficulty of rationally designing pathways that function as desired in vivo, there is a further need to assemble libraries of pathways in parallel, in order to facilitate the combinatorial optimization of performance. While some in vitro DNA assembly methods can theoretically make libraries of pathways, these techniques are resource intensive and inherently require additional techniques to move the DNA back into cells. All previously reported in vivo assembly techniques have been low yielding, generating only tens to hundreds of constructs at a time. Here, we develop "Reiterative Recombination," a robust method for building multigene pathways directly in the yeast chromosome. Due to its use of endonuclease-induced homologous recombination in conjunction with recyclable markers, Reiterative Recombination provides a highly efficient, technically simple strategy for sequentially assembling an indefinite number of DNA constructs at a defined locus. In this work, we describe the design and construction of the first Reiterative Recombination system in Saccharomyces cerevisiae, and we show that it can be used to assemble multigene constructs. We further demonstrate that Reiterative Recombination can construct large mock libraries of at least 10(4) biosynthetic pathways. We anticipate that our system's simplicity and high efficiency will make it a broadly accessible technology for pathway construction and render it a valuable tool for optimizing pathways in vivo.

  8. Sequence Dependent Interactions Between DNA and Single-Walled Carbon Nanotubes

    Science.gov (United States)

    Roxbury, Daniel

    solution, which suggested an energy-dependent pathway. Additionally, by means of pharmacological inhibition and vector-induced gene knockout studies, the DNA-SWCNTs were shown to enter the cells via Rac1-mediated macropinocytosis.

  9. Asy2/Mer2: an evolutionarily conserved mediator of meiotic recombination, pairing, and global chromosome compaction.

    Science.gov (United States)

    Tessé, Sophie; Bourbon, Henri-Marc; Debuchy, Robert; Budin, Karine; Dubois, Emeline; Liangran, Zhang; Antoine, Romain; Piolot, Tristan; Kleckner, Nancy; Zickler, Denise; Espagne, Eric

    2017-09-15

    Meiosis is the cellular program by which a diploid cell gives rise to haploid gametes for sexual reproduction. Meiotic progression depends on tight physical and functional coupling of recombination steps at the DNA level with specific organizational features of meiotic-prophase chromosomes. The present study reveals that every step of this coupling is mediated by a single molecule: Asy2/Mer2. We show that Mer2, identified so far only in budding and fission yeasts, is in fact evolutionarily conserved from fungi (Mer2/Rec15/Asy2/Bad42) to plants (PRD3/PAIR1) and mammals (IHO1). In yeasts, Mer2 mediates assembly of recombination-initiation complexes and double-strand breaks (DSBs). This role is conserved in the fungus Sordaria However, functional analysis of 13 mer2 mutants and successive localization of Mer2 to axis, synaptonemal complex (SC), and chromatin revealed, in addition, three further important functions. First, after DSB formation, Mer2 is required for pairing by mediating homolog spatial juxtaposition, with implications for crossover (CO) patterning/interference. Second, Mer2 participates in the transfer/maintenance and release of recombination complexes to/from the SC central region. Third, after completion of recombination, potentially dependent on SUMOylation, Mer2 mediates global chromosome compaction and post-recombination chiasma development. Thus, beyond its role as a recombinosome-axis/SC linker molecule, Mer2 has important functions in relation to basic chromosome structure. © 2017 Tessé et al.; Published by Cold Spring Harbor Laboratory Press.

  10. Regulation of homologous recombination repair protein Rad51 by Ku70

    International Nuclear Information System (INIS)

    Du Liqing; Liu Qiang; Wang Yan; Xu Chang; Cao Jia; Fu Yue; Chen Fenghua; Fan Feiyue

    2013-01-01

    Objective: To explore the regulative effect of non-homologous end joining (NHEJ)protein Ku70 on homologous recombination repair protein Rad51, and to investigate the synergistic mechanism of homologous recombination repair in combination with NHEJ. Methods: Observed Rad51 protein expression after transfect Ku70 small interfering RNA or Ku70 plasmid DNA into tumor cells using Western blot. Results: Expression of Rad51 was obviously reduced after pretreated with Ku70 small interfering RNA. And with the increasing expression of Ku70 protein after transfection of Ku70 plasmid DNA PGCsi3.0-hKu70 into tumor cell lines, the Rad51 protein expression was increased. Conclusion: Ku70 protein has regulating effect on gene expression of Rad51, and it might participate in the collaboration between homologous recombination repair and NHEJ. (authors)

  11. DNA double-strand breaks & poptosis in the testis

    NARCIS (Netherlands)

    Hamer, Geert

    2003-01-01

    During spermatogenesis, DNA damage is a naturally occurring event. At a certain stage, during the first meiotic prophase, DNA breaks are endogenously induced and even required for meiotic recombination. We studied these DNA breaks but also used ionizing radiation (IR) to induce DNA double-strand

  12. BRED: a simple and powerful tool for constructing mutant and recombinant bacteriophage genomes.

    Directory of Open Access Journals (Sweden)

    Laura J Marinelli

    Full Text Available Advances in DNA sequencing technology have facilitated the determination of hundreds of complete genome sequences both for bacteria and their bacteriophages. Some of these bacteria have well-developed and facile genetic systems for constructing mutants to determine gene function, and recombineering is a particularly effective tool. However, generally applicable methods for constructing defined mutants of bacteriophages are poorly developed, in part because of the inability to use selectable markers such as drug resistance genes during viral lytic growth. Here we describe a method for simple and effective directed mutagenesis of bacteriophage genomes using Bacteriophage Recombineering of Electroporated DNA (BRED, in which a highly efficient recombineering system is utilized directly on electroporated phage DNA; no selection is required and mutants can be readily detected by PCR. We describe the use of BRED to construct unmarked gene deletions, in-frame internal deletions, base substitutions, precise gene replacements, and the addition of gene tags.

  13. Eimeria maxima microneme protein 2 delivered as DNA vaccine and recombinant protein induces immunity against experimental homogenous challenge.

    Science.gov (United States)

    Huang, Jingwei; Zhang, Zhenchao; Li, Menghui; Song, Xiaokai; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui

    2015-10-01

    E. maxima is one of the seven species of Eimeria that infects chicken. Until now, only a few antigenic genes of E. maxima have been reported. In the present study, the immune protective effects against E. maxima challenge of recombinant protein and DNA vaccine encoding EmMIC2 were evaluated. Two-week-old chickens were randomly divided into five groups. The experimental group of chickens was immunized with 100 μg DNA vaccine pVAX1-MIC2 or 200 μg rEmMIC2 protein while the control group of chickens was injected with pVAX1 plasmid or sterile PBS. The results showed that the anti-EmMIC2 antibody titers of both rEmMIC2 protein and pVAX1-MIC2 groups were significantly higher as compared to PBS and pVAX1 control (Pmaxima challenge and it could be an effective antigen candidate for the development of new vaccines against E. maxima. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  14. Protection of Rhesus Monkeys by a DNA Prime/Poxvirus Boost Malaria Vaccine Depends on Optimal DNA Priming and Inclusion of Blood Stage Antigens

    Science.gov (United States)

    Weiss, Walter R.; Kumar, Anita; Jiang, George; Williams, Jackie; Bostick, Anthony; Conteh, Solomon; Fryauff, David; Aguiar, Joao; Singh, Manmohan; O'Hagan, Derek T.; Ulmer, Jeffery B.; Richie, Thomas L.

    2007-01-01

    Background We have previously described a four antigen malaria vaccine consisting of DNA plasmids boosted by recombinant poxviruses which protects a high percentage of rhesus monkeys against Plasmodium knowlesi (Pk) malaria. This is a multi-stage vaccine that includes two pre-erythrocytic antigens, PkCSP and PkSSP2(TRAP), and two erythrocytic antigens, PkAMA-1 and PkMSP-1(42kD). The present study reports three further experiments where we investigate the effects of DNA dose, timing, and formulation. We also compare vaccines utilizing only the pre-erythrocytic antigens with the four antigen vaccine. Methodology In three experiments, rhesus monkeys were immunized with malaria vaccines using DNA plasmid injections followed by boosting with poxvirus vaccine. A variety of parameters were tested, including formulation of DNA on poly-lactic co-glycolide (PLG) particles, varying the number of DNA injections and the amount of DNA, varying the interval between the last DNA injection to the poxvirus boost from 7 to 21 weeks, and using vaccines with from one to four malaria antigens. Monkeys were challenged with Pk sporozoites given iv 2 to 4 weeks after the poxvirus injection, and parasitemia was measured by daily Giemsa stained blood films. Immune responses in venous blood samples taken after each vaccine injection were measured by ELIspot production of interferon-γ, and by ELISA. Conclusions 1) the number of DNA injections, the formulation of the DNA plasmids, and the interval between the last DNA injection and the poxvirus injection are critical to vaccine efficacy. However, the total dose used for DNA priming is not as important; 2) the blood stage antigens PkAMA-1 and PkMSP-1 were able to protect against high parasitemias as part of a genetic vaccine where antigen folding is not well defined; 3) immunization with PkSSP2 DNA inhibited immune responses to PkCSP DNA even when vaccinations were given into separate legs; and 4) in a counter-intuitive result, higher

  15. DNA repair and recombination in higher plants: insights from comparative genomics of arabidopsis and rice

    Directory of Open Access Journals (Sweden)

    Choudhury Swarup

    2010-07-01

    Full Text Available Abstract Background The DNA repair and recombination (DRR proteins protect organisms against genetic damage, caused by environmental agents and other genotoxic agents, by removal of DNA lesions or helping to abide them. Results We identified genes potentially involved in DRR mechanisms in Arabidopsis and rice using similarity searches and conserved domain analysis against proteins known to be involved in DRR in human, yeast and E. coli. As expected, many of DRR genes are very similar to those found in other eukaryotes. Beside these eukaryotes specific genes, several prokaryotes specific genes were also found to be well conserved in plants. In Arabidopsis, several functionally important DRR gene duplications are present, which do not occur in rice. Among DRR proteins, we found that proteins belonging to the nucleotide excision repair pathway were relatively more conserved than proteins needed for the other DRR pathways. Sub-cellular localization studies of DRR gene suggests that these proteins are mostly reside in nucleus while gene drain in between nucleus and cell organelles were also found in some cases. Conclusions The similarities and dissimilarities in between plants and other organisms' DRR pathways are discussed. The observed differences broaden our knowledge about DRR in the plants world, and raises the potential question of whether differentiated functions have evolved in some cases. These results, altogether, provide a useful framework for further experimental studies in these organisms.

  16. DNA repair and recombination in higher plants: insights from comparative genomics of Arabidopsis and rice.

    Science.gov (United States)

    Singh, Sanjay K; Roy, Sujit; Choudhury, Swarup Roy; Sengupta, Dibyendu N

    2010-07-21

    The DNA repair and recombination (DRR) proteins protect organisms against genetic damage, caused by environmental agents and other genotoxic agents, by removal of DNA lesions or helping to abide them. We identified genes potentially involved in DRR mechanisms in Arabidopsis and rice using similarity searches and conserved domain analysis against proteins known to be involved in DRR in human, yeast and E. coli. As expected, many of DRR genes are very similar to those found in other eukaryotes. Beside these eukaryotes specific genes, several prokaryotes specific genes were also found to be well conserved in plants. In Arabidopsis, several functionally important DRR gene duplications are present, which do not occur in rice. Among DRR proteins, we found that proteins belonging to the nucleotide excision repair pathway were relatively more conserved than proteins needed for the other DRR pathways. Sub-cellular localization studies of DRR gene suggests that these proteins are mostly reside in nucleus while gene drain in between nucleus and cell organelles were also found in some cases. The similarities and dissimilarities in between plants and other organisms' DRR pathways are discussed. The observed differences broaden our knowledge about DRR in the plants world, and raises the potential question of whether differentiated functions have evolved in some cases. These results, altogether, provide a useful framework for further experimental studies in these organisms.

  17. Prereplicative complexes assembled in vitro support origin-dependent and independent DNA replication

    Science.gov (United States)

    On, Kin Fan; Beuron, Fabienne; Frith, David; Snijders, Ambrosius P; Morris, Edward P; Diffley, John F X

    2014-01-01

    Eukaryotic DNA replication initiates from multiple replication origins. To ensure each origin fires just once per cell cycle, initiation is divided into two biochemically discrete steps: the Mcm2-7 helicase is first loaded into prereplicative complexes (pre-RCs) as an inactive double hexamer by the origin recognition complex (ORC), Cdt1 and Cdc6; the helicase is then activated by a set of “firing factors.” Here, we show that plasmids containing pre-RCs assembled with purified proteins support complete and semi-conservative replication in extracts from budding yeast cells overexpressing firing factors. Replication requires cyclin-dependent kinase (CDK) and Dbf4-dependent kinase (DDK). DDK phosphorylation of Mcm2-7 does not by itself promote separation of the double hexamer, but is required for the recruitment of firing factors and replisome components in the extract. Plasmid replication does not require a functional replication origin; however, in the presence of competitor DNA and limiting ORC concentrations, replication becomes origin-dependent in this system. These experiments indicate that Mcm2-7 double hexamers can be precursors of replication and provide insight into the nature of eukaryotic DNA replication origins. PMID:24566989

  18. Functional analysis of coordinated cleavage in V(D)J recombination.

    Science.gov (United States)

    Kim, D R; Oettinger, M A

    1998-08-01

    V(D)J recombination in vivo requires a pair of signals with distinct spacer elements of 12 and 23 bp that separate conserved heptamer and nonamer motifs. Cleavage in vitro by the RAG1 and RAG2 proteins can occur at individual signals when the reaction buffer contains Mn2+, but cleavage is restricted to substrates containing two signals when Mg2+ is the divalent cation. By using a novel V(D)J cleavage substrate, we show that while the RAG proteins alone establish a moderate preference for a 12/23 pair versus a 12/12 pair, a much stricter dependence of cleavage on the 12/23 signal pair is produced by the inclusion of HMG1 and competitor double-stranded DNA. The competitor DNA serves to inhibit the cleavage of substrates carrying a 12/12 or 23/23 pair, as well as the cutting at individual signals in 12/23 substrates. We show that a 23/33 pair is more efficiently recombined than a 12/33 pair, suggesting that the 12/23 rule can be generalized to a requirement for spacers that differ from each other by a single helical turn. Furthermore, we suggest that a fixed spatial orientation of signals is required for cleavage. In general, the same signal variants that can be cleaved singly can function under conditions in which a signal pair is required. However, a chemically modified substrate with one noncleavable signal enables us to show that formation of a functional cleavage complex is mechanistically separable from the cleavage reaction itself and that although cleavage requires a pair of signals, cutting does not have to occur simultaneously at both. The implications of these results are discussed with respect to the mechanism of V(D)J recombination and the generation of chromosomal translocations.

  19. Homologous recombination in mammalian cells: effect of p53 and Bcl-2 proteins, replication inhibition and ionizing radiations

    International Nuclear Information System (INIS)

    Saintigny, Yannick

    1999-01-01

    The control of cell cycle, associated with the mechanisms of replication, DNA repair/recombination allows the cells to maintain their genetic integrity. The p53 protein ensures the control of G1/S transition. Its inactivation would allow to initial replication on damaged matrix and lead to the block of replication forks followed by DNA strand breaks, good substrates for recombination. This work shows that the expression of mutant p53 protein stimulates both spontaneous and radio-induced homologous recombination, independently of the control of cell cycle. Moreover, the use of a set of replication inhibitors show that inhibition of the replication elongation stimulates recombination more strongly than the initiation inhibition. Replication arrest by these inhibitors also significantly increases the number of DNA strand breaks. These results highlighted a point of action of p53 protein on the ultimate stages of the homologous recombination mechanism. Lastly, the expression of Bcl-2 protein inhibits apoptosis and increases survival, but specifically inhibits conservative recombination, after radiation as well as in absence of apoptotic stress. The extinction of this mechanism of DNA repair is associated with an increase of mutagenesis. Taken together, these results allow ta consider the maintenance of the genetic stability as a cellular network involving different pathways. A multiple stages model for tumoral progression can be deduced. (author) [fr

  20. Sordaria, a model system to uncover links between meiotic pairing and recombination.

    Science.gov (United States)

    Zickler, Denise; Espagne, Eric

    2016-06-01

    The mycelial fungus Sordaria macrospora was first used as experimental system for meiotic recombination. This review shows that it provides also a powerful cytological system for dissecting chromosome dynamics in wild-type and mutant meioses. Fundamental cytogenetic findings include: (1) the identification of presynaptic alignment as a key step in pairing of homologous chromosomes. (2) The discovery that biochemical complexes that mediate recombination at the DNA level concomitantly mediate pairing of homologs. (3) This pairing process involves not only resolution but also avoidance of chromosomal entanglements and the resolution system includes dissolution of constraining DNA recombination interactions, achieved by a unique role of Mlh1. (4) Discovery that the central components of the synaptonemal complex directly mediate the re-localization of the recombination proteins from on-axis to in-between homologue axis positions. (5) Identification of putative STUbL protein Hei10 as a structure-based signal transduction molecule that coordinates progression and differentiation of recombinational interactions at multiple stages. (6) Discovery that a single interference process mediates both nucleation of the SC and designation of crossover sites, thereby ensuring even spacing of both features. (7) Discovery of local modulation of sister-chromatid cohesion at sites of crossover recombination. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Cross-system excision of chaperone-mediated proteolysis in chaperone-assisted recombinant protein production

    Science.gov (United States)

    Martínez-Alonso, Mónica; Villaverde, Antonio

    2010-01-01

    Main Escherichia coli cytosolic chaperones such as DnaK are key components of the control quality network designed to minimize the prevalence of polypeptides with aberrant conformations. This is achieved by both favoring refolding activities but also stimulating proteolytic degradation of folding reluctant species. This last activity is responsible for the decrease of the proteolytic stability of recombinant proteins when co-produced along with DnaK, where an increase in solubility might be associated to a decrease in protein yield. However, when DnaK and its co-chaperone DnaJ are co-produced in cultured insect cells or whole insect larvae (and expectedly, in other heterologous hosts), only positive, folding-related effects of these chaperones are observed, in absence of proteolysis-mediated reduction of recombinant protein yield. PMID:21326941

  2. Retroviral DNA Integration Directed by HIV Integration Protein in Vitro

    Science.gov (United States)

    Bushman, Frederic D.; Fujiwara, Tamio; Craigie, Robert

    1990-09-01

    Efficient retroviral growth requires integration of a DNA copy of the viral RNA genome into a chromosome of the host. As a first step in analyzing the mechanism of integration of human immunodeficiency virus (HIV) DNA, a cell-free system was established that models the integration reaction. The in vitro system depends on the HIV integration (IN) protein, which was partially purified from insect cells engineered to express IN protein in large quantities. Integration was detected in a biological assay that scores the insertion of a linear DNA containing HIV terminal sequences into a λ DNA target. Some integration products generated in this assay contained five-base pair duplications of the target DNA at the recombination junctions, a characteristic of HIV integration in vivo; the remaining products contained aberrant junctional sequences that may have been produced in a variation of the normal reaction. These results indicate that HIV IN protein is the only viral protein required to insert model HIV DNA sequences into a target DNA in vitro.

  3. A role for the malignant brain tumour (MBT domain protein LIN-61 in DNA double-strand break repair by homologous recombination.

    Directory of Open Access Journals (Sweden)

    Nicholas M Johnson

    Full Text Available Malignant brain tumour (MBT domain proteins are transcriptional repressors that function within Polycomb complexes. Some MBT genes are tumour suppressors, but how they prevent tumourigenesis is unknown. The Caenorhabditis elegans MBT protein LIN-61 is a member of the synMuvB chromatin-remodelling proteins that control vulval development. Here we report a new role for LIN-61: it protects the genome by promoting homologous recombination (HR for the repair of DNA double-strand breaks (DSBs. lin-61 mutants manifest numerous problems associated with defective HR in germ and somatic cells but remain proficient in meiotic recombination. They are hypersensitive to ionizing radiation and interstrand crosslinks but not UV light. Using a novel reporter system that monitors repair of a defined DSB in C. elegans somatic cells, we show that LIN-61 contributes to HR. The involvement of this MBT protein in HR raises the possibility that MBT-deficient tumours may also have defective DSB repair.

  4. PH- and salt-dependent molecular combing of DNA: experiments and phenomenological model

    International Nuclear Information System (INIS)

    Benke, Annegret; Pompe, Wolfgang; Mertig, Michael

    2011-01-01

    λ-DNA as well as plasmids can be successfully deposited by molecular combing on hydrophobic surfaces, for pH values ranging from 4 to 10. On polydimethylsiloxane (PDMS) substrates, the deposited DNA molecules are overstretched by about 60-100%. There is a significant influence of sodium ions (NaCl) on the surface density of the deposited DNA, with a maximum near to 100 mM NaCl for a DNA solution (28 ng μl -1 ) at pH 8. The combing process can be described by a micromechanical model including: (i) the adsorption of free moving coiled DNA at the substrate; (ii) the stretching of the coiled DNA by the preceding meniscus; (iii) the relaxation of the deposited DNA to the final length. The sticky ends of λ-DNA cause an adhesion force in the range of about 400 pN which allows a stable overstretching of the DNA by the preceding meniscus. The exposing of hidden hydrophobic bonds of the overstretched DNA leads to a stable deposition on the hydrophobic substrate. The pH-dependent density of deposited DNA as well as the observed influence of sodium ions can be explained by their screening of the negatively charged DNA backbone and sticky ends, respectively. The final DNA length can be derived from a balance of the stored elastic energy of the overstretched molecules and the energy of adhesion.

  5. Concentration and length dependence of DNA looping in transcriptional regulation.

    Directory of Open Access Journals (Sweden)

    Lin Han

    2009-05-01

    Full Text Available In many cases, transcriptional regulation involves the binding of transcription factors at sites on the DNA that are not immediately adjacent to the promoter of interest. This action at a distance is often mediated by the formation of DNA loops: Binding at two or more sites on the DNA results in the formation of a loop, which can bring the transcription factor into the immediate neighborhood of the relevant promoter. These processes are important in settings ranging from the historic bacterial examples (bacterial metabolism and the lytic-lysogeny decision in bacteriophage, to the modern concept of gene regulation to regulatory processes central to pattern formation during development of multicellular organisms. Though there have been a variety of insights into the combinatorial aspects of transcriptional control, the mechanism of DNA looping as an agent of combinatorial control in both prokaryotes and eukaryotes remains unclear. We use single-molecule techniques to dissect DNA looping in the lac operon. In particular, we measure the propensity for DNA looping by the Lac repressor as a function of the concentration of repressor protein and as a function of the distance between repressor binding sites. As with earlier single-molecule studies, we find (at least two distinct looped states and demonstrate that the presence of these two states depends both upon the concentration of repressor protein and the distance between the two repressor binding sites. We find that loops form even at interoperator spacings considerably shorter than the DNA persistence length, without the intervention of any other proteins to prebend the DNA. The concentration measurements also permit us to use a simple statistical mechanical model of DNA loop formation to determine the free energy of DNA looping, or equivalently, the for looping.

  6. Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans-Expression and characterization.

    Directory of Open Access Journals (Sweden)

    Marcin Olszewski

    Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.

  7. Mycobacterial UvrD1 is a Ku-dependent DNA helicase that plays a role in multiple DNA repair events, including double-strand break repair.

    Science.gov (United States)

    Sinha, Krishna Murari; Stephanou, Nicolas C; Gao, Feng; Glickman, Michael S; Shuman, Stewart

    2007-05-18

    Mycobacterium tuberculosis and other bacterial pathogens have a Ku-dependent nonhomologous end joining pathway of DNA double-strand break repair. Here we identify mycobacterial UvrD1 as a novel interaction partner for Ku in a genome-wide yeast two-hybrid screen. UvrD1 per se is a vigorous DNA-dependent ATPase but a feeble DNA helicase. Ku stimulates UvrD1 to catalyze ATP-dependent unwinding of 3'-tailed DNAs. UvrD1, Ku, and DNA form a stable ternary complex in the absence of ATP. The Ku binding determinants are located in the distinctive C-terminal segment of UvrD1. A second mycobacterial paralog, UvrD2, is a vigorous Ku-independent DNA helicase. Ablation of UvrD1 sensitizes Mycobacterium smegmatis to killing by ultraviolet and ionizing radiation and to a single chromosomal break generated by I-SceI endonuclease. The physical and functional interactions of bacterial Ku and UvrD1 highlight the potential for cross-talk between components of nonhomologous end joining and nucleotide excision repair pathways.

  8. Rad52 forms DMA repair and recombination centers during S phase

    DEFF Research Database (Denmark)

    Lisby, M.; Rothstein, R.; Mortensen, Uffe Hasbro

    2001-01-01

    fluorescent protein (GFP) is fully functional in DNA repair and recombination. After induction of DNA double-strand breaks by gamma -irradiation, meiosis, or the HO endonuclease, Rad52-GFP relocalizes from a diffuse nuclear distribution to distinct foci. Interestingly, Rad52 foci are formed almost exclusively...

  9. Interface recombination influence on carrier transport

    International Nuclear Information System (INIS)

    Konin, A

    2013-01-01

    A theory of interface recombination in the semiconductor–semiconductor junction is developed. The interface recombination rate dependence on the nonequilibrium carrier densities is derived on the basis of a model in which the interface recombination occurs through the mechanism of trapping. The general relation between the interface recombination parameters at small carrier density deviation from the equilibrium ones is obtained. The validity of this relation is proved considering the generation of the Hall electric field in the extrinsic semiconductor sample. The anomalous Hall electromotive force in a weak magnetic field was investigated and interpreted by means of a new interface recombination model. The experimental data corroborate the developed theory. (paper)

  10. Analysis of DNA double-strand break repair pathways in mice

    International Nuclear Information System (INIS)

    Brugmans, Linda; Kanaar, Roland; Essers, Jeroen

    2007-01-01

    During the last years significant new insights have been gained into the mechanism and biological relevance of DNA double-strand break (DSB) repair in relation to genome stability. DSBs are a highly toxic DNA lesion, because they can lead to chromosome fragmentation, loss and translocations, eventually resulting in cancer. DSBs can be induced by cellular processes such as V(D)J recombination or DNA replication. They can also be introduced by exogenous agents DNA damaging agents such as ionizing radiation or mitomycin C. During evolution several pathways have evolved for the repair of these DSBs. The most important DSB repair mechanisms in mammalian cells are nonhomologous end-joining and homologous recombination. By using an undamaged repair template, homologous recombination ensures accurate DSB repair, whereas the untemplated nonhomologous end-joining pathway does not. Although both pathways are active in mammals, the relative contribution of the two repair pathways to genome stability differs in the different cell types. Given the potential differences in repair fidelity, it is of interest to determine the relative contribution of homologous recombination and nonhomologous end-joining to DSB repair. In this review, we focus on the biological relevance of DSB repair in mammalian cells and the potential overlap between nonhomologous end-joining and homologous recombination in different tissues

  11. RYBP Is a K63-Ubiquitin-Chain-Binding Protein that Inhibits Homologous Recombination Repair

    Directory of Open Access Journals (Sweden)

    Mohammad A.M. Ali

    2018-01-01

    Full Text Available Summary: Ring1-YY1-binding protein (RYBP is a member of the non-canonical polycomb repressive complex 1 (PRC1, and like other PRC1 members, it is best described as a transcriptional regulator. However, several PRC1 members were recently shown to function in DNA repair. Here, we report that RYBP preferentially binds K63-ubiquitin chains via its Npl4 zinc finger (NZF domain. Since K63-linked ubiquitin chains are assembled at DNA double-strand breaks (DSBs, we examined the contribution of RYBP to DSB repair. Surprisingly, we find that RYBP is K48 polyubiquitylated by RNF8 and rapidly removed from chromatin upon DNA damage by the VCP/p97 segregase. High expression of RYBP competitively inhibits recruitment of BRCA1 repair complex to DSBs, reducing DNA end resection and homologous recombination (HR repair. Moreover, breast cancer cell lines expressing high endogenous RYBP levels show increased sensitivity to DNA-damaging agents and poly ADP-ribose polymerase (PARP inhibition. These data suggest that RYBP negatively regulates HR repair by competing for K63-ubiquitin chain binding. : Ali et al. find that RYBP binds K63-linked ubiquitin chains and is removed from DNA damage sites. This K63-ubiquitin binding allows RYBP to hinder the recruitment of BRCA1 and Rad51 to DNA double-strand breaks, thus inhibiting homologous recombination repair. Accordingly, cancer cells expressing high RYBP are more sensitive to DNA-damaging therapies. Keywords: DNA damage response, homologous recombination, ubiquitylation, RYBP, polycomb proteins, double-strand break repair, chromatin, histone modification

  12. Serological diagnosis of Strongylus vulgaris infection: use of a recombinant protein

    DEFF Research Database (Denmark)

    Andersen, Ulla Vestergaard; Howe, Daniel K.; Olsen, Susanne Nautrup

    , an immunoreactive cDNA clone was subcloned into E. coli and the plasmid sequenced, the open reading frame encoding the mature protein was cloned into a pET22b expression vector and expressed as a His-tagged recombinant protein in BL21 expression cells. The recombinant protein was used in an indirect enzyme....... vulgaris (n=9) reacted against the recombinant protein, expressed as optic density (OD) readings of >24 % of a positive control, while sera from negative horses had OD readings

  13. Mycobacterium tuberculosis UvrB Is a Robust DNA-Stimulated ATPase That Also Possesses Structure-Specific ATP-Dependent DNA Helicase Activity.

    Science.gov (United States)

    Thakur, Manoj; Kumar, Mohan B J; Muniyappa, K

    2016-10-18

    Much is known about the Escherichia coli nucleotide excision repair (NER) pathway; however, very little is understood about the proteins involved and the molecular mechanism of NER in mycobacteria. In this study, we show that Mycobacterium tuberculosis UvrB (MtUvrB), which exists in solution as a monomer, binds to DNA in a structure-dependent manner. A systematic examination of MtUvrB substrate specificity reveals that it associates preferentially with single-stranded DNA, duplexes with 3' or 5' overhangs, and linear duplex DNA with splayed arms. Whereas E. coli UvrB (EcUvrB) binds weakly to undamaged DNA and has no ATPase activity, MtUvrB possesses intrinsic ATPase activity that is greatly stimulated by both single- and double-stranded DNA. Strikingly, we found that MtUvrB, but not EcUvrB, possesses the DNA unwinding activity characteristic of an ATP-dependent DNA helicase. The helicase activity of MtUvrB proceeds in the 3' to 5' direction and is strongly modulated by a nontranslocating 5' single-stranded tail, indicating that in addition to the translocating strand it also interacts with the 5' end of the substrate. The fraction of DNA unwound by MtUvrB decreases significantly as the length of the duplex increases: it fails to unwind duplexes longer than 70 bp. These results, on one hand, reveal significant mechanistic differences between MtUvrB and EcUvrB and, on the other, support an alternative role for UvrB in the processing of key DNA replication intermediates. Altogether, our findings provide insights into the catalytic functions of UvrB and lay the foundation for further understanding of the NER pathway in M. tuberculosis.

  14. The PCNA interaction protein box sequence in Rad54 is an integral part of its ATPase domain and is required for efficient DNA repair and recombination

    DEFF Research Database (Denmark)

    Burgess, Rebecca C; Sebesta, Marek; Sisakova, Alexandra

    2013-01-01

    Rad54 is an ATP-driven translocase involved in the genome maintenance pathway of homologous recombination (HR). Although its activity has been implicated in several steps of HR, its exact role(s) at each step are still not fully understood. We have identified a new interaction between Rad54...... and the replicative DNA clamp, proliferating cell nuclear antigen (PCNA). This interaction was only mildly weakened by the mutation of two key hydrophobic residues in the highly-conserved PCNA interaction motif (PIP-box) of Rad54 (Rad54-AA). Intriguingly, the rad54-AA mutant cells displayed sensitivity to DNA damage...

  15. The evolutionary turnover of recombination hot spots contributes to speciation in mice.

    Science.gov (United States)

    Smagulova, Fatima; Brick, Kevin; Pu, Yongmei; Camerini-Otero, R Daniel; Petukhova, Galina V

    2016-02-01

    Meiotic recombination is required for the segregation of homologous chromosomes and is essential for fertility. In most mammals, the DNA double-strand breaks (DSBs) that initiate meiotic recombination are directed to a subset of genomic loci (hot spots) by sequence-specific binding of the PRDM9 protein. Rapid evolution of the DNA-binding specificity of PRDM9 and gradual erosion of PRDM9-binding sites by gene conversion will alter the recombination landscape over time. To better understand the evolutionary turnover of recombination hot spots and its consequences, we mapped DSB hot spots in four major subspecies of Mus musculus with different Prdm9 alleles and in their F1 hybrids. We found that hot spot erosion governs the preferential usage of some Prdm9 alleles over others in hybrid mice and increases sequence diversity specifically at hot spots that become active in the hybrids. As crossovers are disfavored at such hot spots, we propose that sequence divergence generated by hot spot turnover may create an impediment for recombination in hybrids, potentially leading to reduced fertility and, eventually, speciation. Published by Cold Spring Harbor Laboratory Press.

  16. Functional characterization of recombinant snake venom rhodocytin: rhodocytin mutant blocks CLEC-2/podoplanin-dependent platelet aggregation and lung metastasis.

    Science.gov (United States)

    Sasaki, T; Shirai, T; Tsukiji, N; Otake, S; Tamura, S; Ichikawa, J; Osada, M; Satoh, K; Ozaki, Y; Suzuki-Inoue, K

    2018-02-28

    Essentials We generated recombinant rhodocytin that could aggregate platelets via CLEC-2. Recombinant wild-type rhodocytin formed heterooctamer with four α- and β-subunits. Asp 4 in α-subunit of rhodocytin was required for binding to CLEC-2. Inhibitory mutant of rhodocytin blocked podoplanin-dependent hematogenous metastasis. Background Rhodocytin, a disulfide-linked heterodimeric C-type lectin from Calloselasma rhodostoma consisting of α-subunits and β-subunits, induces platelet aggregation through C-type lectin-like receptor 2 (CLEC-2). CLEC-2 is a physiological binding partner of podoplanin (PDPN), which is expressed on some tumor cell types, and is involved in tumor cell-induced platelet aggregation and tumor metastasis. Thus, modified rhodocytin may be a possible source of anti-CLEC-2 drugs for both antiplatelet and antimetastasis therapy. However, its molecular function has not been well characterized, because of the lack of recombinant rhodocytin that induces platelet aggregation. Objective To produce recombinant rhodocytin, in order to verify its function with mutagenesis, and to develop an anti-CLEC-2 drug based on the findings. Methods We used Chinese hamster ovary cells to express recombinant rhodocytin (wild-type [WT] and mutant), which was analyzed for induction/inhibition of platelet aggregation with light transmission aggregometry, the formation of multimers with blue native PAGE, and binding to CLEC-2 with flow cytometry. Finally, we investigated whether mutant rhodocytin could suppress PDPN-induced metastasis in an experimental lung metastasis mouse model. Results Functional WT] rhodocytin (αWTβWT) was obtained by coexpression of both subunits. Asp4 in α-subunits of rhodocytin was required for CLEC-2 binding. αWTβWT formed a heterooctamer similarly to native rhodocytin. Moreover, an inhibitory mutant of rhodocytin (αWTβK53A/R56A), forming a heterotetramer, bound to CLEC-2 without inducing platelet aggregation, and blocked CLEC-2-PDPN

  17. Detection of dietary DNA, protein, and glyphosate in meat, milk, and eggs.

    Science.gov (United States)

    Van Eenennaam, A L; Young, A E

    2017-07-01

    Products such as meat, milk, and eggs from animals that have consumed genetically engineered (GE) feed are not currently subject to mandatory GE labeling requirements. Some voluntary "non-genetically modified organism" labeling has been associated with such products, indicating that the animals were not fed GE crops, as there are no commercialized GE food animals. This review summarizes the available scientific literature on the detection of dietary DNA and protein in animal products and briefly discusses the implications of mandatory GE labeling for products from animals that have consumed GE feed. Because glyphosate is used on some GE crops, the available studies on glyphosate residues in animal products are also reviewed. In GE crops, recombinant DNA (rDNA) makes up a small percentage of the plant's total DNA. The final amount of DNA in food/feed depends on many factors including the variable number and density of cells in the edible parts, the DNA-containing matrix, environmental conditions, and the specific transgenic event. Processing treatments and animals' digestive systems degrade DNA into small fragments. Available reports conclude that endogenous DNA and rDNA are processed in exactly the same way in the gastrointestinal tract and that they account for a very small proportion of food intake by weight. Small pieces of high copy number endogenous plant genes have occasionally been detected in meat and milk. Similarly sized pieces of rDNA have also been identified in meat, primarily fish, although detection is inconsistent. Dietary rDNA fragments have not been detected in chicken or quail eggs or in fresh milk from cows or goats. Collectively, studies have failed to identify full-length endogenous or rDNA transcripts or recombinant proteins in meat, milk, or eggs. Similarly, because mammals do not bioaccumulate glyphosate and it is rapidly excreted, negligible levels of glyphosate in cattle, pig and poultry meat, milk, and eggs have been reported. Despite

  18. Impact of homologous recombination on individual cellular radiosensitivity

    International Nuclear Information System (INIS)

    Koch, Kerstin; Wrona, Agnieszka; Dikomey, Ekkehard; Borgmann, Kerstin

    2009-01-01

    Purpose: Individual radiosensitivity as measured with in vitro irradiated lymphocytes using metaphase analysis can predict the risk of normal tissue effects after radiotherapy. This parameter is considered to be primarily determined by the cellular repair capacity of DNA double-strand breaks (DSBs). It is now tested to which extent this capacity also depends on homologous recombination (HR), which is a pathway available when cells are in S/G2 phase. Methods: Experiments were performed with CHO K1 cells, in which HR was suppressed via knock-down of RAD51 using RNA interference (RNAi). RAD51 was measured via western and foci formation, cell survival by colony forming, DSBs by γH2AX foci formation, and chromosomal damage using PCC, G0 or G2 assay. Results: In quiescent G1 cells DSB repair is completed 6 h after irradiation. But there is still a substantial fraction of non-repaired DSBs. Most of these DSBs are repaired when G1 cells are stimulated into cell cycle. Suppression of HR by down-regulation of RAD51 did not affect this repair. In contrast, repair was inhibited when cells were irradiated in late S/G2. In line with these data down-regulation of HR did affect survival of cells irradiated in late S/G2, but not in G1. Conclusions: Individual radiosensitivity as measured for G0/1 cells using metaphase analysis does not depend on homologous recombination

  19. FBH1 Helicase Disrupts RAD51 Filaments in Vitro and Modulates Homologous Recombination in Mammalian Cells

    Czech Academy of Sciences Publication Activity Database

    Šimandlová, Jitka; Zagelbaum, J.; Payne, M.J.; Chu, W.K.; Shevelev, Igor; Hanada, K.; Chatterjee, S.; Reid, D.A.; Liu, Y.; Janščák, Pavel; Rothenberg, E.; Hickson, I.D.

    2013-01-01

    Roč. 288, č. 47 (2013), s. 34168-34180 ISSN 0021-9258 R&D Projects: GA ČR GAP305/10/0281 Institutional support: RVO:68378050 Keywords : DNA damage * DNA helicase * DNA recombination * DNA repair * DNA replication Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.600, year: 2013

  20. Analysis of TCRAD gene recombination: radio-induct rearrangement and signal joint structure

    International Nuclear Information System (INIS)

    Touvrey, C.

    2005-09-01

    We have shown that irradiation of pre-TCR-deficient CD3ε -/- mice restores thymocyte differentiation, by a p53-dependent and by a p53-independent pathway. Events normally associated during normal thymocyte development are dissociated in response to radiation exposure. Both of these pathways require LAT expression. Therefore, radiation exposure activates pre-TCR-like signals. TCRA gene rearrangement is induced following radiation exposure. The signal joints resulting from TCRA gene rearrangement have the same structure than those found in wild type mice. All signal joint analyzed in un-manipulated wild type mice do exhibit junctional diversity. This diversity results mainly from TdT activity. We present evidences that proteins involved in DNA repair and genomic stability participated in SJ formation. We propose that signal joint diversity is not an aberrant process but is a key feature of V(D)J recombination. All our work increases our understanding of molecular events associated with V(D)J recombination. (author)

  1. V(D)J recombination on minichromosomes is not affected by transcription.

    Science.gov (United States)

    Hsieh, C L; McCloskey, R P; Lieber, M R

    1992-08-05

    It has been shown previously by others that transcription is temporally correlated with the onset of V(D)J recombination at the endogenous antigen receptor loci. We have been interested in determining whether this temporal correlation indicates a causal connection between these two processes. We have compared V(D)J recombination minichromosome substrates that have transcripts running through the recombination zone with substrates that do not in a transient transfection assay. In this system, the substrates acquire a minichromosome conformation within the first several hours after transfection. We find that the substrates recombine equally well over a 100-fold range in transcriptional variation. In additional studies, we have taken substrates that have low levels of transcription and inhibited transcription further by methylating the substrate DNA or by treating the cells with a general transcription inhibitor (alpha-amanitin). Although these treatments decrease the level of expression an additional 10-100-fold, there is still no observable effect on V(D)J recombination. Based on these results, we conclude that transcription is not necessary for the V(D)J reaction mechanism and does not alter substrate structure at the DNA level or at the simplest levels of chromatin structure in a way that affects the reaction.

  2. Estrogen signalling and the DNA damage response in hormone dependent breast cancers

    Directory of Open Access Journals (Sweden)

    C Elizabeth Caldon

    2014-05-01

    Full Text Available Estrogen is necessary for the normal growth and development of breast tissue, but high levels of estrogen are a major risk factor for breast cancer. One mechanism by which estrogen could contribute to breast cancer is via the induction of DNA damage. This perspective discusses the mechanisms by which estrogen alters the DNA damage response (DDR and DNA repair through the regulation of key effector proteins including ATM, ATR, CHK1, BRCA1 and p53 and the feedback on estrogen receptor signalling from these proteins. We put forward the hypothesis that estrogen receptor signalling converges to suppress effective DNA repair and apoptosis in favour of proliferation. This is important in hormone-dependent breast cancer as it will affect processing of estrogen-induced DNA damage, as well as other genotoxic insults. DDR and DNA repair proteins are frequently mutated or altered in estrogen responsive breast cancer which will further change the processing of DNA damage. Finally the action of estrogen signalling on DNA damage is also relevant to the therapeutic setting as the suppression of a DNA damage response by estrogen has the potential to alter the response of cancers to anti-hormone treatment or chemotherapy that induces DNA damage.

  3. DNA repair and the evolution of transformation in Bacillus subtilis. 3. Sex with damaged DNA

    International Nuclear Information System (INIS)

    Hoelzer, M.A.; Michod, R.E.

    1991-01-01

    Natural genetic transformation in the bacterium Bacillus subtilis provides an experimental system for studying the evolutionary function of sexual recombination. The repair hypothesis proposes that during transformation the exogenous DNA taken up by cells is used as template for recombinational repair of damages in the recipient cell's genome. Earlier results demonstrated that the population density of transformed cells (i.e., sexual cells) increases, relative to nontransformed cells (primarily asexual cells), with increasing dosage of ultraviolet irradiation, provided that the cells are transformed with undamaged homologous DNA after they have become damaged. In nature, however, donor DNA for transformation is likely to come from cells that are as damaged as the recipient cells. In order to better simulate the effects of transformation in natural populations we conducted similar experiments as those just described using damaged donor DNA. The authors document in this report that transformants continue to increase in relative density even if they are transformed with damaged donor DNA. These results suggest that sites of transformation are often damaged sites in the recipient cell's genome

  4. In vitro fluorescence studies of transcription factor IIB-DNA interaction.

    Science.gov (United States)

    Górecki, Andrzej; Figiel, Małgorzata; Dziedzicka-Wasylewska, Marta

    2015-01-01

    General transcription factor TFIIB is one of the basal constituents of the preinitiation complex of eukaryotic RNA polymerase II, acting as a bridge between the preinitiation complex and the polymerase, and binding promoter DNA in an asymmetric manner, thereby defining the direction of the transcription. Methods of fluorescence spectroscopy together with circular dichroism spectroscopy were used to observe conformational changes in the structure of recombinant human TFIIB after binding to specific DNA sequence. To facilitate the exploration of the structural changes, several site-directed mutations have been introduced altering the fluorescence properties of the protein. Our observations showed that binding of specific DNA sequences changed the protein structure and dynamics, and TFIIB may exist in two conformational states, which can be described by a different microenvironment of W52. Fluorescence studies using both intrinsic and exogenous fluorophores showed that these changes significantly depended on the recognition sequence and concerned various regions of the protein, including those interacting with other transcription factors and RNA polymerase II. DNA binding can cause rearrangements in regions of proteins interacting with the polymerase in a manner dependent on the recognized sequences, and therefore, influence the gene expression.

  5. Caffeine inhibits gene conversion by displacing Rad51 from ssDNA

    Science.gov (United States)

    Tsabar, Michael; Mason, Jennifer M.; Chan, Yuen-Ling; Bishop, Douglas K.; Haber, James E.

    2015-01-01

    Efficient repair of chromosomal double-strand breaks (DSBs) by homologous recombination relies on the formation of a Rad51 recombinase filament that forms on single-stranded DNA (ssDNA) created at DSB ends. This filament facilitates the search for a homologous donor sequence and promotes strand invasion. Recently caffeine treatment has been shown to prevent gene targeting in mammalian cells by increasing non-productive Rad51 interactions between the DSB and random regions of the genome. Here we show that caffeine treatment prevents gene conversion in yeast, independently of its inhibition of the Mec1ATR/Tel1ATM-dependent DNA damage response or caffeine's inhibition of 5′ to 3′ resection of DSB ends. Caffeine treatment results in a dosage-dependent eviction of Rad51 from ssDNA. Gene conversion is impaired even at low concentrations of caffeine, where there is no discernible dismantling of the Rad51 filament. Loss of the Rad51 filament integrity is independent of Srs2's Rad51 filament dismantling activity or Rad51's ATPase activity and does not depend on non-specific Rad51 binding to undamaged double-stranded DNA. Caffeine treatment had similar effects on irradiated HeLa cells, promoting loss of previously assembled Rad51 foci. We conclude that caffeine treatment can disrupt gene conversion by disrupting Rad51 filaments. PMID:26019181

  6. The evolutionary value of recombination is constrained by genome modularity.

    Directory of Open Access Journals (Sweden)

    Darren P Martin

    2005-10-01

    Full Text Available Genetic recombination is a fundamental evolutionary mechanism promoting biological adaptation. Using engineered recombinants of the small single-stranded DNA plant virus, Maize streak virus (MSV, we experimentally demonstrate that fragments of genetic material only function optimally if they reside within genomes similar to those in which they evolved. The degree of similarity necessary for optimal functionality is correlated with the complexity of intragenomic interaction networks within which genome fragments must function. There is a striking correlation between our experimental results and the types of MSV recombinants that are detectable in nature, indicating that obligatory maintenance of intragenome interaction networks strongly constrains the evolutionary value of recombination for this virus and probably for genomes in general.

  7. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Directory of Open Access Journals (Sweden)

    Solenne Ithurbide

    2015-10-01

    Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  8. Temperature dependence of binary and ternary recombination of H3+ ions with electrons

    International Nuclear Information System (INIS)

    Glosik, J.; Plasil, R.; Korolov, I.; Kotrik, T.; Novotny, O.; Hlavenka, P.; Dohnal, P.; Varju, J.; Kokoouline, V.; Greene, Chris H.

    2009-01-01

    We study binary and the recently discovered process of ternary He-assisted recombination of H 3 + ions with electrons in a low-temperature afterglow plasma. The experiments are carried out over a broad range of pressures and temperatures of an afterglow plasma in a helium buffer gas. Binary and He-assisted ternary recombination are observed and the corresponding recombination rate coefficients are extracted for temperatures from 77 to 330 K. We describe the observed ternary recombination as a two-step mechanism: first, a rotationally excited long-lived neutral molecule H 3 * is formed in electron-H 3 + collisions. Second, the H 3 * molecule collides with a helium atom that leads to the formation of a very long-lived Rydberg state with high orbital momentum. We present calculations of the lifetimes of H 3 * and of the ternary recombination rate coefficients for para- and ortho-H 3 + . The calculations show a large difference between the ternary recombination rate coefficients of ortho- and para-H 3 + at temperatures below 300 K. The measured binary and ternary rate coefficients are in reasonable agreement with the calculated values.

  9. Temperature dependence of binary and ternary recombination of H3+ ions with electrons

    Science.gov (United States)

    Glosík, J.; Plašil, R.; Korolov, I.; Kotrík, T.; Novotný, O.; Hlavenka, P.; Dohnal, P.; Varju, J.; Kokoouline, V.; Greene, Chris H.

    2009-05-01

    We study binary and the recently discovered process of ternary He-assisted recombination of H3+ ions with electrons in a low-temperature afterglow plasma. The experiments are carried out over a broad range of pressures and temperatures of an afterglow plasma in a helium buffer gas. Binary and He-assisted ternary recombination are observed and the corresponding recombination rate coefficients are extracted for temperatures from 77 to 330 K. We describe the observed ternary recombination as a two-step mechanism: first, a rotationally excited long-lived neutral molecule H3∗ is formed in electron- H3+ collisions. Second, the H3∗ molecule collides with a helium atom that leads to the formation of a very long-lived Rydberg state with high orbital momentum. We present calculations of the lifetimes of H3∗ and of the ternary recombination rate coefficients for para- and ortho- H3+ . The calculations show a large difference between the ternary recombination rate coefficients of ortho- and para- H3+ at temperatures below 300 K. The measured binary and ternary rate coefficients are in reasonable agreement with the calculated values.

  10. A photoactivatable Cre-loxP recombination system for optogenetic genome engineering.

    Science.gov (United States)

    Kawano, Fuun; Okazaki, Risako; Yazawa, Masayuki; Sato, Moritoshi

    2016-12-01

    Genome engineering techniques represented by the Cre-loxP recombination system have been used extensively for biomedical research. However, powerful and useful techniques for genome engineering that have high spatiotemporal precision remain elusive. Here we develop a highly efficient photoactivatable Cre recombinase (PA-Cre) to optogenetically control genome engineering in vivo. PA-Cre is based on the reassembly of split Cre fragments by light-inducible dimerization of the Magnet system. PA-Cre enables sharp induction (up to 320-fold) of DNA recombination and is efficiently activated even by low-intensity illumination (∼0.04 W m -2 ) or short periods of pulsed illumination (∼30 s). We demonstrate that PA-Cre allows for efficient DNA recombination in an internal organ of living mice through noninvasive external illumination using a LED light source. The present PA-Cre provides a powerful tool to greatly facilitate optogenetic genome engineering in vivo.

  11. Ionizing and ultraviolet radiation enhances the efficiency of DNA mediated gene transfer in vitro

    International Nuclear Information System (INIS)

    Perez, C.F.

    1984-08-01

    The enhancement effects of ionizing and non-ionizing radiation on the efficiency of DNA mediated gene transfer were studied. Confluent Rat-2 cells were transfected with purified SV40 viral DNA, irradiated with either X-rays or ultraviolet, trypsinized, plated, and assayed for the formation of foci on Rat-2 monolayers. Both ionizing and ultraviolet radiation enhanced the frequency of A-gene transformants/survivor compared to unirradiated transfected cells. These enhancements were non-linear and dose dependent. A recombinant plasmid, pOT-TK5, was constructed that contained the SV40 virus A-gene and the Herpes Simplex virus (HSV) thymidine kinase (TK) gene. Confluent Rat-2 cells transfected with pOT-TK5 DNA and then immediately irradiated with either X-rays or 330 MeV/amu argon particles at the Berkeley Bevalac showed a higher frequency of HAT + colonies/survivor than unirradiated transfected cells. Rat-2 cells transfected with the plasmid, pTK2, containing only the HSV TK-gene were enhanced for TK-transformation by both X-rays and ultraviolet radiation. The results demonstrate that radiation enhancement of the efficiency of DNA mediated gene transfer is not explained by increased nuclear uptake of the transfected DNA. Radiation increases the competence of the transfected cell population for genetic transformation. Three models for this increased competence are presented. The targeted integration model, the inducible recombination model, the partition model, and the utilization of DNA mediated gene transfer for DNA repair studies are discussed. 465 references

  12. Ionizing and ultraviolet radiation enhances the efficiency of DNA mediated gene transfer in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Perez, C.F.

    1984-08-01

    The enhancement effects of ionizing and non-ionizing radiation on the efficiency of DNA mediated gene transfer were studied. Confluent Rat-2 cells were transfected with purified SV40 viral DNA, irradiated with either X-rays or ultraviolet, trypsinized, plated, and assayed for the formation of foci on Rat-2 monolayers. Both ionizing and ultraviolet radiation enhanced the frequency of A-gene transformants/survivor compared to unirradiated transfected cells. These enhancements were non-linear and dose dependent. A recombinant plasmid, pOT-TK5, was constructed that contained the SV40 virus A-gene and the Herpes Simplex virus (HSV) thymidine kinase (TK) gene. Confluent Rat-2 cells transfected with pOT-TK5 DNA and then immediately irradiated with either X-rays or 330 MeV/amu argon particles at the Berkeley Bevalac showed a higher frequency of HAT/sup +/ colonies/survivor than unirradiated transfected cells. Rat-2 cells transfected with the plasmid, pTK2, containing only the HSV TK-gene were enhanced for TK-transformation by both X-rays and ultraviolet radiation. The results demonstrate that radiation enhancement of the efficiency of DNA mediated gene transfer is not explained by increased nuclear uptake of the transfected DNA. Radiation increases the competence of the transfected cell population for genetic transformation. Three models for this increased competence are presented. The targeted integration model, the inducible recombination model, the partition model, and the utilization of DNA mediated gene transfer for DNA repair studies are discussed. 465 references.

  13. TopBP1 associates with NBS1 and is involved in homologous recombination repair

    International Nuclear Information System (INIS)

    Morishima, Ken-ichi; Sakamoto, Shuichi; Kobayashi, Junya; Izumi, Hideki; Suda, Tetsuji; Matsumoto, Yoshiyuki; Tauchi, Hiroshi; Ide, Hiroshi; Komatsu, Kenshi; Matsuura, Shinya

    2007-01-01

    TopBP1 is involved in DNA replication and DNA damage checkpoint. Recent studies have demonstrated that TopBP1 is a direct positive effecter of ATR. However, it is not known how TopBP1 recognizes damaged DNA. Here, we show that TopBP1 formed nuclear foci after exposure to ionizing radiation, but such TopBP1 foci were abolished in Nijmegen breakage syndrome cells. We also show that TopBP1 physically associated with NBS1 in vivo. These results suggested that NBS1 might regulate TopBP1 recruitment to the sites of DNA damage. TopBP1-depleted cells showed hypersensitivity to Mitomycin C and ionizing radiation, an increased frequency of sister-chromatid exchange level, and a reduced frequency of DNA double-strand break induced homologous recombination repair. Together, these results suggested that TopBP1 might be a mediator of DNA damage signaling from NBS1 to ATR and promote homologous recombination repair

  14. Rapid outer-surface protein C DNA tattoo vaccination protects against Borrelia afzelii infection.

    Science.gov (United States)

    Wagemakers, A; Mason, L M K; Oei, A; de Wever, B; van der Poll, T; Bins, A D; Hovius, J W R

    2014-12-01

    Borrelia afzelii is the predominant Borrelia species causing Lyme borreliosis in Europe. Currently there is no human vaccine against Lyme borreliosis, and most research focuses on recombinant protein vaccines against Borrelia burgdorferi sensu stricto. DNA tattooing is a novel vaccination method that can be applied in a rapid vaccination schedule. We vaccinated C3H/HeN mice with B. afzelii strain PKo OspC (outer-surface protein C) using a codon-optimized DNA vaccine tattoo and compared this with recombinant protein vaccination in a 0-2-4 week vaccination schedule. We also assessed protection by DNA tattoo in a 0-3-6 day schedule. DNA tattoo and recombinant OspC vaccination induced comparable total IgG responses, with a lower IgG1/IgG2a ratio after DNA tattoo. Two weeks after syringe-challenge with 5 × 10(5) B. afzelii spirochetes most vaccinated mice had negative B. afzelii tissue DNA loads and all were culture negative. Furthermore, DNA tattoo vaccination in a 0-3-6 day regimen also resulted in negative Borrelia loads and cultures after challenge. To conclude, DNA vaccination by tattoo was fully protective against B. afzelii challenge in mice in a rapid vaccination protocol, and induces a favorable humoral immunity compared to recombinant protein vaccination. Rapid DNA tattoo is a promising vaccination strategy against spirochetes.

  15. Production, purification and characterization of two recombinant ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-06-17

    Jun 17, 2008 ... Two recombinant DNA-derived variants of ovine growth hormone were produced, purified, characterized and compared with the authentic pituitary derived GH. The variants oGH3 and oGH5 were isolated by differential centrifugation method and were purified after refolding by ion-exchange.

  16. Structure of the hDmc1-ssDNA filament reveals the principles of its architecture.

    Directory of Open Access Journals (Sweden)

    Andrei L Okorokov

    Full Text Available In eukaryotes, meiotic recombination is a major source of genetic diversity, but its defects in humans lead to abnormalities such as Down's, Klinefelter's and other syndromes. Human Dmc1 (hDmc1, a RecA/Rad51 homologue, is a recombinase that plays a crucial role in faithful chromosome segregation during meiosis. The initial step of homologous recombination occurs when hDmc1 forms a filament on single-stranded (ss DNA. However the structure of this presynaptic complex filament for hDmc1 remains unknown. To compare hDmc1-ssDNA complexes to those known for the RecA/Rad51 family we have obtained electron microscopy (EM structures of hDmc1-ssDNA nucleoprotein filaments using single particle approach. The EM maps were analysed by docking crystal structures of Dmc1, Rad51, RadA, RecA and DNA. To fully characterise hDmc1-DNA complexes we have analysed their organisation in the presence of Ca2+, Mg2+, ATP, AMP-PNP, ssDNA and dsDNA. The 3D EM structures of the hDmc1-ssDNA filaments allowed us to elucidate the principles of their internal architecture. Similar to the RecA/Rad51 family, hDmc1 forms helical filaments on ssDNA in two states: extended (active and compressed (inactive. However, in contrast to the RecA/Rad51 family, and the recently reported structure of hDmc1-double stranded (ds DNA nucleoprotein filaments, the extended (active state of the hDmc1 filament formed on ssDNA has nine protomers per helical turn, instead of the conventional six, resulting in one protomer covering two nucleotides instead of three. The control reconstruction of the hDmc1-dsDNA filament revealed 6.4 protein subunits per helical turn indicating that the filament organisation varies depending on the DNA templates. Our structural analysis has also revealed that the N-terminal domain of hDmc1 accomplishes its important role in complex formation through domain swapping between adjacent protomers, thus providing a mechanistic basis for coordinated action of hDmc1 protomers

  17. Is There Still Any Role for Oxidative Stress in Mitochondrial DNA-Dependent Aging?

    Directory of Open Access Journals (Sweden)

    Gábor Zsurka

    2018-03-01

    Full Text Available Recent deep sequencing data has provided compelling evidence that the spectrum of somatic point mutations in mitochondrial DNA (mtDNA in aging tissues lacks G > T transversion mutations. This fact cannot, however, be used as an argument for the missing contribution of reactive oxygen species (ROS to mitochondria-related aging because it is probably caused by the nucleotide selectivity of mitochondrial DNA polymerase γ (POLG. In contrast to point mutations, the age-dependent accumulation of mitochondrial DNA deletions is, in light of recent experimental data, still explainable by the segregation of mutant molecules generated by the direct mutagenic effects of ROS (in particular, of HO· radicals formed from H2O2 by a Fenton reaction. The source of ROS remains controversial, because the mitochondrial contribution to tissue ROS production is probably lower than previously thought. Importantly, in the discussion about the potential role of oxidative stress in mitochondria-dependent aging, ROS generated by inflammation-linked processes and the distribution of free iron also require careful consideration.

  18. Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro

    Science.gov (United States)

    Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.

    2015-01-01

    The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241

  19. Effects of mutagen-sensitive mus mutations on spontaneous mitotic recombination in Aspergillus.

    Science.gov (United States)

    Zhao, P; Kafer, E

    1992-04-01

    Methyl methane-sulfonate (MMS)-sensitive, radiation-induced mutants of Aspergillus were shown to define nine new DNA repair genes, musK to musS. To test mus mutations for effects on mitotic recombination, intergenic crossing over was assayed between color markers and their centromeres, and intragenic recombination between two distinguishable adE alleles. Of eight mutants analyzed, four showed significant deviations from mus+ controls in both tests. Two mutations, musK and musL, reduced recombination, while musN and musQ caused increases. In contrast, musO diploids produced significantly higher levels only for intragenic recombination. Effects were relatively small, but averages between hypo- and hyperrec mus differed 15-20-fold. In musL diploids, most of the rare color segregants resulted from mitotic malsegregation rather than intergenic crossing over. This indicates that the musL gene product is required for recombination and that DNA lesions lead to chromosome loss when it is deficient. In addition, analysis of the genotypes of intragenic (ad+) recombinants showed that the musL mutation specifically reduced single allele conversion but increased complex conversion types (especially recombinants homozygous for ad+). Similar analysis revealed differences between the effects of two hyperrec mutations; musN apparently caused high levels solely of mitotic crossing over, while musQ increased various conversion types but not reciprocal crossovers. These results suggest that mitotic gene conversion and crossing over, while generally associated, are affected differentially in some of the mus strains of Aspergillus nidulans.

  20. Roles of C-Terminal Region of Yeast and Human Rad52 in Rad51-Nucleoprotein Filament Formation and ssDNA Annealing.

    Directory of Open Access Journals (Sweden)

    Nilesh V Khade

    Full Text Available Yeast Rad52 (yRad52 has two important functions at homologous DNA recombination (HR; annealing complementary single-strand DNA (ssDNA molecules and recruiting Rad51 recombinase onto ssDNA (recombination mediator activity. Its human homolog (hRAD52 has a lesser role in HR, and apparently lacks mediator activity. Here we show that yRad52 can load human Rad51 (hRAD51 onto ssDNA complexed with yeast RPA in vitro. This is biochemically equivalent to mediator activity because it depends on the C-terminal Rad51-binding region of yRad52 and on functional Rad52-RPA interaction. It has been reported that the N-terminal two thirds of both yRad52 and hRAD52 is essential for binding to and annealing ssDNA. Although a second DNA binding region has been found in the C-terminal region of yRad52, its role in ssDNA annealing is not clear. In this paper, we also show that the C-terminal region of yRad52, but not of hRAD52, is involved in ssDNA annealing. This suggests that the second DNA binding site is required for the efficient ssDNA annealing by yRad52. We propose an updated model of Rad52-mediated ssDNA annealing.