WorldWideScience

Sample records for raw meat poultry

  1. Antimicrobial resistance among Campylobacter jejuni isolated from raw poultry meat at retail level in Denmark

    DEFF Research Database (Denmark)

    Andersen, S. R.; Saadbye, P.; Shukri, Naseer Mahmoud

    2006-01-01

    Campylobacter jejuni isolated from raw poultry meat collected at retail shops in Denmark in the period 1996-2003 were tested for susceptibility to seven antimicrobial agents. The food samples consisted of raw chicken meat and other raw poultry meat of domestic or imported origin. The highest levels...... for chloramphenicol, nalidixic acid and ciprofloxacin (P food animals....... Monitoring of the occurrence of antimicrobial resistance in C. jejuni isolated from raw uncooked poultry has been performed on a yearly basis since 1996, thus providing useful insight into consumer exposure to antimicrobial-resistant C. jejuni....

  2. 76 FR 44855 - Common or Usual Name for Raw Meat and Poultry Products Containing Added Solutions

    Science.gov (United States)

    2011-07-27

    ...'s experience in reviewing labels of meat and poultry products with added solution, the Agency has... or prior to consumption. Therefore, to ensure that labels adequately inform consumers that raw... of identity and that are sold for retail sale, institutional use, or further processing. If retail...

  3. Risk factors for antibiotic resistance in Campylobacter spp. isolated from raw poultry meat in Switzerland

    Directory of Open Access Journals (Sweden)

    Danuser Jürg

    2003-12-01

    Full Text Available Abstract Background The world-wide increase of foodborne infections with antibiotic resistant pathogens is of growing concern and is designated by the World Health Organization as an emerging public health problem. Thermophilic Campylobacter have been recognised as a major cause of foodborne bacterial gastrointestinal human infections in Switzerland and in many other countries throughout the world. Poultry meat is the most common source for foodborne cases caused by Campylobacter. Because all classes of antibiotics recommended for treatment of human campylobacteriosis are also used in veterinary medicine, in view of food safety, the resistance status of Campylobacter isolated from poultry meat is of special interest. Methods Raw poultry meat samples were collected throughout Switzerland and Liechtenstein at retail level and examined for Campylobacter spp. One strain from each Campylobacter-positive sample was selected for susceptibility testing with the disc diffusion and the E-test method. Risk factors associated with resistance to the tested antibiotics were analysed by multiple logistic regression. Results In total, 91 Campylobacter spp. strains were isolated from 415 raw poultry meat samples. Fifty-one strains (59% were sensitive to all tested antibiotics. Nineteen strains (22% were resistant to a single, nine strains to two antibiotics, and eight strains showed at least three antibiotic resistances. Resistance was observed most frequently to ciprofloxacin (28.7%, tetracycline (12.6%, sulphonamide (11.8%, and ampicillin (10.3%. One multiple resistant strain exhibited resistance to five antibiotics including ciprofloxacin, tetracycline, and erythromycin. These are the most important antibiotics for treatment of human campylobacteriosis. A significant risk factor associated with multiple resistance in Campylobacter was foreign meat production compared to Swiss meat production (odds ratio = 5.7. Conclusion Compared to the situation in other

  4. Occurrence of Thermotolerant Campylobacter in Raw Poultry Meat, Environmental and Pigeon Stools Collected in Open-Air Markets.

    Science.gov (United States)

    Bellio, Alberto; Traversa, Amaranta; Adriano, Daniela; Bianchi, Daniela Manila; Colzani, Alberto; Gili, Stefano; Dondo, Alessandro; Gallina, Silvia; Grattarola, Carla; Maurella, Cristiana; Zoppi, Simona; Zuccon, Fabio; Decastelli, Lucia

    2014-08-28

    Campylobacteriosis was the most commonly reported zoonosis for confirmed human cases in European Union during 2011. Poultry meat was very often implicated in Campylobacter infections in humans. In Italy commerce of raw poultry meat is common in open-air markets: these areas can be considered at high risk of bacterial contamination due to the high presence birds like pigeons. The aim of this study was to collect data about the contamination by thermotolerant Campylobacter of raw poultry meat commercialised in open-air markets, of work-surfaces in contact with poultry meat and of pigeon stools sampled in the market areas in Turin, Northern Italy. Between September 2011 and December 2012, 86 raw poultry meat samples, 86 environmental swabs and 108 animal samples were collected in 38 open-air markets. Analysis were carried out according to ISO10272-1:2006 standard. C.coli was detected in 2.3% (2/86) of raw poultry meat samples, whereas no swab (0/86) resulted positive. Of pigeon stool 28% (30/107) was positive for C.jejuni (83.3% C.jejuni subsp . jejuni and 16.7% C.jejuni subsp . doylei ). C.jejuni subsp. jejuni was isolated from 1 dead pigeon . Our results showed lower rates of contamination than those reported at retail in Europe. Although samples were collected in areas at high risk of contamination, raw poultry meat and work surfaces reported a low level of presence of thermotolerant Campylobacter . The high percentage of C.jejuni isolated from pigeon stools showed the importance of a continuous application of preventive measures by the food business operators and the surveillance activity by the Competent Authority.

  5. Staphylococcus aureus Enterotoxin A Gene Isolated From Raw Red Meat and Poultry in Tehran, Iran

    Directory of Open Access Journals (Sweden)

    Mohammad Hossein Sarrafzadeh Zargar

    2014-07-01

    Full Text Available Background: Staphylococcus aureus is the most prevalent infectious agent of food materials. Enterotoxin producing types of S. aureus cause well-known food-borne disease. Staphylococcal Enterotoxin A (SEA is the most important agent of gastroenteritis. Objectives: The present study aimed to screen the raw meat samples collected from different regions of Tehran for S. aureus infection and type of encoding enterotoxin. Materials and Methods: Hundred and eighty six meat samples were collected randomly from city dealers and transferred to laboratory within screw cap containers. The samples were first cultured according to the standard bacteriological methods and then S. aureus isolates were identified using standard bacteriological tests. The isolates were subjected to Polymerase Chain Reaction (PCR to detect gene encoding SEA. Results: Staphylococcus aureus isolated from 29 (15.6% meat samples including beef 14.8%, raw lamb 15%, raw chicken 15.7% and raw turkey 16.6%. Using special primer sets proved that the species isolated from five samples (two raw chicken, two raw beef and one raw turkey encoded enterotoxin A. Conclusions: Although staphylococcal contamination within food material is more or less a routine, but detection of enterotoxin encoding species from raw meat samples is alarming for health authorities. These data highlight the importance of periodic surveillance of raw meat distributed among ordinary consumers.

  6. Antioxidant Enzyme Activity, Iron Content and Lipid Oxidation of Raw and Cooked Meat of Korean Native Chickens and Other Poultry

    Directory of Open Access Journals (Sweden)

    Muhlisin

    2016-05-01

    Full Text Available This study was conducted to observe antioxidant enzyme activity, iron content and lipid oxidation of Korean native chickens and other poultry. The breast and thigh meat of three Korean native chicken breeds including Woorimatdak, Hyunin black and Yeonsan ogye, and three commercial poultry breeds including the broiler, White Leghorn and Pekin duck (Anasplatyrhyncos domesticus were studied. The analyses of the antioxidant enzymes activity, iron content and lipid oxidation were performed in raw and cooked samples. The activity of catalase (CAT in the thigh meat was higher than that of the breast meat of three Korean native chickens and the broiler, respectively. The activity of glutathione peroxidase (GPx in the uncooked thigh meat of three Korean native chickens was higher than that of the breasts. The breast meat of Woorimatdak and Pekin duck had higher superoxide dismutase (SOD activity than the others, while only the thigh meat of Pekin duck had the highest activity. Cooking inactivated CAT and decreased the activity of GPx and SOD. The thigh meat of Woorimatdak, White Leghorn, Yeonsan ogye and Hyunin black contained more total iron than the breast meat of those breeds. The heme-iron lost during cooking ranged from 3.2% to 14.8%. It is noted that the thigh meat had higher thiobarbituric acid reactive substances values than the breast in all chicken breeds. Though Woorimatdak showed higher antioxidant enzyme activity and lower released-iron percentage among Korean native chickens, no differences were found on lipid oxidation. We confirm that the dark meat of poultry exhibited higher antioxidant enzyme activity and contained more iron than the white meat.

  7. Impact of rearing conditions on the microbiological quality of raw retail poultry meat.

    Science.gov (United States)

    Hardy, Bridgshe; Crilly, Nate; Pendleton, Sean; Andino, Ana; Wallis, Audra; Zhang, Nan; Hanning, Irene

    2013-08-01

    There is a gap in knowledge of microbiological quality in raw chicken products produced by nonconventional methods and no studies have reported the microbiological quality of turkeys produced under different rearing environments. Thus, the aim of this study was to compare the microbiological quality of conventionally and organically reared whole chicken and turkey carcasses purchased from 3 retail outlets in Knoxville, Tenn., U.S.A. A total of 100 raw broiler chickens organically (n = 50) and 50 raw turkey carcasses consisting of 3 brands reared either conventionally (n = 25) or organically (n = 25) were evaluated. The FDA BAM protocol for rinsing poultry carcasses was used to enumerate of aerobic bacteria, Campylobacter, and Staphylococcus spp., and for qualitative analysis of Salmonella. Organic chickens from one brand had the highest average counts of aerobic bacteria, Staphylococcus spp. and Campylobacter (4.8, 4.8, and 4.7 Log10 CFU/mL rinsate, respectively) while the other organic brand had the lowest average counts (3.4, 3.3, and 3.1, respectively) of all 4 brands evaluated. The organic turkeys had the highest average counts of these same bacteria (4, 3.9, and 3.8, respectively) compared to the 2 brands of conventional turkeys evaluated. Salmonella (5% prevalence) was isolated only from organic chickens and turkeys. From these data, it appears that the microbiological quality of the raw product was not dependent on rearing conditions and, thus, it cannot be assumed that organic raw poultry is safer than conventionally raised poultry in terms of microbiological quality. © 2013 Institute of Food Technologists®

  8. Comparative antioxidant effect of BHT and water extracts of banana and sapodilla peels in raw poultry meat.

    Science.gov (United States)

    Devatkal, Suresh K; Kumboj, Ritu; Paul, Devosmita

    2014-02-01

    Antioxidant properties of banana (Musa paradisiaca) and Sapodilla/Chikoo (Manilkara zapota) peel extracts in chicken patties were evaluated. Four treatments viz., I. Control (meat + 2% salt), II.BHT (meat + 2% salt + 0.1% BHT), III. BPE (meat + 2% salt + 2% banana peel extract) and IV. SPE (meat + 2% salt + 2% sapodilla/chikoo peel extract) were compared for changes in colour and lipid oxidation during 8 days refrigerated storage (4 ± °C). The average phenolic content was 550.2 and 550.8 mg gallic acid equivalent per 10 g peel in BPE and SPE respectively. Free radical scavenging activity was 66.9 and 67.8% in BPE and SPE respectively. Banana peel extract had significantly (P peel extract (0.91). During refrigerated storage period, all color parameters decreased significantly in all treatments. Observation on lipid oxidation showed a significantly (P banana and sapodilla peels could be explored as natural antioxidants in poultry meat and meat products.

  9. 76 FR 76890 - Nutrition Labeling of Single-Ingredient Products and Ground or Chopped Meat and Poultry Products...

    Science.gov (United States)

    2011-12-09

    .... FSIS-2005-0018] Nutrition Labeling of Single-Ingredient Products and Ground or Chopped Meat and Poultry... major cuts of single-ingredient, raw meat and poultry products and ground or chopped meat and poultry... Ground or Chopped Meat and Poultry Products'' in the Federal Register (75 FR 82148) that, among other...

  10. Irradiation of meats and poultry

    International Nuclear Information System (INIS)

    Urbain, W.M.

    1978-01-01

    A number of beneficial effects can be achieved by irradiating meats and poultry under different conditions. It is possible, for example, to extend the market life of both fresh and processed meats by applying radiation doses sufficient to reduce the microbial population, thereby delaying onset of spoilage; higher doses aimed at destroying both spoilage and pathogenic microorganisms can also be applied to meats, packaged to prevent recontamination, resulting in a shelf-stable product; the objective may also be to inactivate pathogenic bacteria, parasites and viruses in order to obtain a product which is acceptable from the point of view of public health. (orig.) [de

  11. Irradiation of poultry meat and its products

    International Nuclear Information System (INIS)

    Klinger, I.; Lapidot, M.

    1992-02-01

    Modern poultry production methods provide many opportunities for microbial contamination, and poultry meat is considered to have a high bacterial load. This document describes means by which poultry meat can be decontaminated, placing especial emphasis on the use of ionizing radiation. Separate chapters describe the irradiation process, methods for detecting whether the food has been irradiated, the wholesomeness of the irradiated products and the regulatory aspects of poultry irradiation. 441 refs, 35 figs, 16 tabs

  12. Metronidazole resistance in Campylobacter jejuni from poultry meat

    DEFF Research Database (Denmark)

    Andersen, Sigrid Rita; Shukri, Naseer Mahmoud; Boel, Jeppe

    2006-01-01

    The occurrence of metronidazole resistance was investigated among Campylobacter jejuni in raw poultry meat collected from supermarkets. MICs were determined by the agar dilution procedure in the testing range of 3 to 60 mu g/ml metronidazole. The MICs showed a bimodal distribution with a signific......The occurrence of metronidazole resistance was investigated among Campylobacter jejuni in raw poultry meat collected from supermarkets. MICs were determined by the agar dilution procedure in the testing range of 3 to 60 mu g/ml metronidazole. The MICs showed a bimodal distribution...

  13. Meat and Poultry Processing. Teacher Edition.

    Science.gov (United States)

    Oklahoma State Dept. of Vocational and Technical Education, Stillwater. Curriculum and Instructional Materials Center.

    This curriculum guide contains instructional materials for a program that provides students with job skills in meat and poultry processing. The curriculum consists of 10 units that cover the following material: orientation to meat and poultry processing; maintaining plant facilities; equipment and equipment maintenance; purchasing livestock for…

  14. Additives In Meat and Poultry Products

    Science.gov (United States)

    ... Fact Sheets / Additives in Meat and Poultry Products / Additives in Meat and Poultry Products Z7_0Q0619C0JGR010IFST1G5B10H3 ... Affairs Recalls and Public Health Alerts Regulatory Compliance Regulations, Directives and Notices Rulemaking ...

  15. 9 CFR 94.26 - Restrictions on importation of live poultry, poultry meat, and other poultry products from...

    Science.gov (United States)

    2010-01-01

    ... poultry, poultry meat, and other poultry products from specified regions. 94.26 Section 94.26 Animals and... IMPORTATION OF ANIMALS (INCLUDING POULTRY) AND ANIMAL PRODUCTS RINDERPEST, FOOT-AND-MOUTH DISEASE, EXOTIC... poultry, poultry meat, and other poultry products from specified regions. Argentina and the Mexican States...

  16. [Evaluation of the quality of poultry meat and its processing for vacuum packaging].

    Science.gov (United States)

    Swiderski, F; Russel, S; Waszkiewicz-Robak, B; Cholewińska, E

    1997-01-01

    The aim of study was to evaluate the quality of poultry meat, roasted and smoked chicken and poultry pie packing under low and high vacuum. All investigated products were stored at +4 degrees C and evaluated by microbiological analysis. It was showed that packing under low and high vacuum inhibited development of aerobic microorganisms, proteolytic bacteria, yeasts and moulds. Vacuum-packaged storage of poultry meat and its products stimulated activity of anaerobic, nonsporeforming bacteria. The fast spoilage of fresh poultry meat was observed both under vacuum and conventional storage. The microbiology quality of poultry products depended on technology of production and microbiological quality of raw material.

  17. Salmonellosis: the role of poultry meat.

    Science.gov (United States)

    Antunes, P; Mourão, J; Campos, J; Peixe, L

    2016-02-01

    Salmonellosis remains one of the most frequent food-borne zoonoses, constituting a worldwide major public health concern. Currently, at a global level, the main sources of infection for humans include meat products, including the consumption of contaminated poultry meat, in spite of the success of Salmonella control measures implemented in food-animal production of industrialized countries. In recent years, a shift in Salmonella serotypes related to poultry and poultry production has been reported in diverse geographical regions, being particularly associated with the spread of certain well-adapted clones. Moreover, antimicrobial resistance in non-typhoidal Salmonella is considered one of the major public health threats related with food-animal production, including the poultry production chain and poultry meat, which is an additional concern in the management of salmonellosis. The circulation of the same multidrug-resistant Salmonella clones and/or identical mobile genetic elements encoding antibiotic resistance genes from poultry to humans highlights this scenario. The purpose of this review was to provide an overview of the role of poultry meat on salmonellosis at a global scale and the main problems that could hinder the success of Salmonella control measures at animal production level. With the increasing globalization of foodstuffs like poultry meat, new problems and challenges might arise regarding salmonellosis control, making new integrated intervention strategies necessary along the food chain. Copyright © 2015 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  18. Microbiological quality of poultry meat: a review

    Directory of Open Access Journals (Sweden)

    GC Mead

    2004-09-01

    Full Text Available Poultry meat can be contaminated with a variety of microorganisms, including those capable of spoiling the product during chill storage, and certain foodborne pathogens. Human illness may follow from handling of raw meat, undercooking or mishandling of the cooked product. While Salmonella and Campylobacter spp. remain the organisms of greatest global concern in this respect, others present include the more recently reported Arcobacter and Helicobacter spp. and, occasionally, verotoxigenic Escherichia coli. Also considered here is the growing problem of antimicrobial resistance among poultry-associated pathogens. Because of the need for a systematic and universally applicable approach to food safety control, the Hazard Analysis Critical Control Point (HACCP concept is increasingly being introduced into the Poultry Industry, and Quantitative Risk Assessment (QRA is being applied to microbial hazards. Among a number of completed and on-going studies on QRA are those undertaken by FAO/WHO on Salmonella and Campylobacter in broilers. In the case of Campylobacter, however, any QRA must assume at present that all strains have the same pathogenic potential for humans and comparable survival capabilities, even though this is unlikely to be the case. Implementation of the HACCP system in poultry processing plants addresses zoonotic agents that are not detectable by conventional meat inspection procedures and can help to control contamination of carcasses with spoilage organisms. The system brings obvious benefits in optimising plant hygiene, ensuring compliance with legislation and providing evidence of 'due diligence' on the part of the processor. It is now being applied globally in two different situations: in one, such as that occurring in the USA, carcass contamination is clearly reduced as carcasses pass through the process and are finally chilled in super-chlorinated water. There is also the option to use a chemical-rinse treatment for further

  19. Maintenance of raw and cooked ready-to-eat product quality of infused poultry meats with selected plant extracts during electron beam irradiation and after storage

    Science.gov (United States)

    Rababah, Taha

    The purpose of this study included: preparing plant extracts and evaluating these extracts for total phenolics and antioxidant activities (AA); infusing extract/combination that demonstrates superior AA into chicken breast and irradiating at 3.0 kGy; evaluating the physicochemical properties of irradiated and non-irradiated raw and cooked chicken breast at 5°C for 12 days and -20°C for 9 months; and selecting the extracts that demonstrated desirable AA, infusing these extracts into chicken breast and evaluating head-space volatiles, and conducting sensory evaluation. The total phenolic content and AA of the plant extracts ranged from 24.8 to 92.5 mg/g dry material (conjugated diene of methyl linoleate) and 3.4 to 86.3%, respectively. The AA of plant extracts using oxidative stability instrument were 4.6 to 10.2 h (Induction time). Green tea and grape seed extracts had the highest AA within several plant extracts, and were selected to retard lipid oxidation in further studies. Fresh boneless and skinless chicken breast meats were vacuum infused with varying concentrations of antioxidants: Green tea and grape seed extracts alone/in combination and tert-butylhydroquinone. The results showed that irradiation had no significant effect on pH, water holding capacity, but increased the redness and carbonyls in raw meats (p extracts into meats increased lightness and decreased redness as well as hardness and shear force. Irradiation increased TBARS, hexanal, and pentanal values in raw and cooked meats. Addition of plant extracts decreased the amount of TBARS, hexanal, pentanal, and carbonyl values. Similar results were observed when the samples were stored at -20°C for 9 months. Descriptive sensory flavor results showed that irradiation did not affect the flavor attributes. Consumer, descriptive, and instrumental results showed that irradiation increased toughness, green tea improved the meat color, and the panel indicated that irradiation decreased the tenderness of the

  20. 78 FR 19080 - Importation of Live Birds and Poultry, Poultry Meat, and Poultry Products From a Region in the...

    Science.gov (United States)

    2013-03-29

    ..., meat, parts or products of carcasses, and eggs (other than hatching eggs) of poultry, game birds, or..., Poultry Meat, and Poultry Products From a Region in the European Union AGENCY: Animal and Plant Health... governing the importation of live birds and poultry and poultry meat and products from the APHIS-defined EU...

  1. Prevalence of Arcobacter spp. in raw milk and retail raw meats in northern Ireland

    DEFF Research Database (Denmark)

    Scullion, R.; Harrington, C.S.; Madden, R.H.

    2006-01-01

    A 1-year study was undertaken to determine the prevalence of Arcobacter spp. in raw milk and retail raw meats on sale in Northern Ireland. Retail raw poultry samples (n = 94), pork samples (n = 101), and beef samples (n = 108) were obtained from supermarkets in Northern Ireland, and raw milk samp...... from raw milk samples. Arcobacter cryaerophilus was detected less frequently, and Arcobacter skirrowii was detected only as a cocontaminant. To our knowledge, this is the first report of Arcobacter spp. prevalence in a diverse range of products of animal origin in Northern Ireland....

  2. Muscle growth and poultry meat quality issues.

    Science.gov (United States)

    Petracci, Massimiliano; Cavani, Claudio

    2012-01-01

    Over the past 50 years the worldwide growing demand of poultry meat has resulted in pressure on breeders, nutritionists and growers to increase the growth rate of birds, feed efficiency, size of breast muscle and reduction in abdominal fatness. Moreover, the shift toward further processed products has emphasized the necessity for higher standards in poultry meat to improve sensory characteristics and functional properties. It is believed that genetic progress has put more stress on the growing bird and it has resulted in histological and biochemical modifications of the muscle tissue by impairing some meat quality traits. The most current poultry meat quality concerns are associated with deep pectoral muscle disease and white striping which impair product appearance, and increased occurrence of problems related with the meat's poor ability to hold water during processing and storage (PSE-like condition) as well as poor toughness and cohesiveness related to immaturity of intramuscular connective tissue. This paper is aimed at making a general statement of recent studies focusing on the relationship between muscle growth and meat quality issues in poultry.

  3. Campylobacteriosis: the role of poultry meat.

    Science.gov (United States)

    Skarp, C P A; Hänninen, M-L; Rautelin, H I K

    2016-02-01

    The incidence of human infections caused by Campylobacter jejuni and Campylobacter coli, the main bacterial agents of gastrointestinal disease, has been increasing worldwide. Here, we review the role of poultry as a source and reservoir for Campylobacter. Contamination and subsequent colonization of broiler flocks at the farm level often lead to transmission of Campylobacter along the poultry production chain and contamination of poultry meat at retail. Yet Campylobacter prevalence in poultry, as well as the contamination level of poultry products, vary greatly between different countries so there are differences in the intervention strategies that need to be applied. Temporal patterns in poultry do not always coincide with those found in human infections. Studies in rural and urban areas have revealed differences in Campylobacter infections attributed to poultry, as poultry seems to be the predominant reservoir in urban, but not necessarily in rural, settings. Furthermore, foreign travel is considered a major risk factor in acquiring the disease, especially for individuals living in the northern European countries. Intervention strategies aimed at reducing Campylobacter colonization in poultry and focused at the farm level have been successful in reducing the number of Campylobacter cases in several countries. Increasing farm biosecurity and education of consumers are likely to limit the risk of infection. Overall, poultry is an important reservoir and source of human campylobacteriosis, although the contribution of other sources, reservoirs and transmission warrants more research. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  4. Muscle Growth and Poultry Meat Quality Issues

    Directory of Open Access Journals (Sweden)

    Massimiliano Petracci

    2011-12-01

    Full Text Available Over the past 50 years the worldwide growing demand of poultry meat has resulted in pressure on breeders, nutritionists and growers to increase the growth rate of birds, feed efficiency, size of breast muscle and reduction in abdominal fatness. Moreover, the shift toward further processed products has emphasized the necessity for higher standards in poultry meat to improve sensory characteristics and functional properties. It is believed that genetic progress has put more stress on the growing bird and it has resulted in histological and biochemical modifications of the muscle tissue by impairing some meat quality traits. The most current poultry meat quality concerns are associated with deep pectoral muscle disease and white striping which impair product appearance, and increased occurrence of problems related with the meat’s poor ability to hold water during processing and storage (PSE-like condition as well as poor toughness and cohesiveness related to immaturity of intramuscular connective tissue. This paper is aimed at making a general statement of recent studies focusing on the relationship between muscle growth and meat quality issues in poultry.

  5. Irradiation and additive combinations on the pathogen reduction and quality of poultry meat.

    Science.gov (United States)

    Ahn, Dong U; Kim, Il Suk; Lee, Eun Joo

    2013-02-01

    Reduction of foodborne illnesses and deaths by improving the safety of poultry products is one of the priority areas in the United States, and developing and implementing effective food processing technologies can be very effective to accomplish that goal. Irradiation is an effective processing technology for eliminating pathogens in poultry meat. Addition of antimicrobial agents during processing can be another approach to control pathogens in poultry products. However, the adoption of irradiation technology by the meat industry is limited because of quality and health concerns about irradiated meat products. Irradiation produces a characteristic aroma as well as alters meat flavor and color that significantly affect consumer acceptance. The generation of a pink color in cooked poultry and off-odor in poultry by irradiation is a critical issue because consumers associate the presence of a pink color in cooked poultry breast meat as contaminated or undercooked, and off-odor in raw meat and off-flavor in cooked meat with undesirable chemical reactions. As a result, the meat industry has difficulties in using irradiation to achieve its food safety benefits. Antimicrobials such as sodium lactate, sodium diacetate, and potassium benzoate are extensively used to extend the shelf-life and ensure the safety of meat products. However, the use of these antimicrobial agents alone cannot guarantee the safety of poultry products. It is known that some of the herbs, spices, and antimicrobials commonly used in meat processing can have synergistic effects with irradiation in controlling pathogens in meat. Also, the addition of spices or herbs in irradiated meat improves the quality of irradiated poultry by reducing lipid oxidation and production of off-odor volatiles or masking off-flavor. Therefore, combinations of irradiation with these additives can accomplish better pathogen reduction in meat products than using them alone even at lower levels of antimicrobials/herbs and

  6. Color of Meat and Poultry

    Science.gov (United States)

    ... color. It can also occur when vegetables containing nitrites are cooked along with the meat. Because doneness and safety cannot be judged by ... or greenish cast when exposed to heat and processing. Wrapping the meat in airtight packages and storing it away from ...

  7. Update on the bird-egg syndrome and genuine poultry meat allergy.

    Science.gov (United States)

    Hemmer, Wolfgang; Klug, Christoph; Swoboda, Ines

    Allergy to poultry meat is rare and affects both children and adults. The prevalence of poultry meat allergy is unknown, but presumably is similar to that of red meat allergy. There is no close relationship between allergy to poultry meat and allergy to red meat. Poultry meat allergy may present as primary (genuine) food allergy or as secondary food allergy resulting from cross-reactivity. Secondary poultry meat allergy may arise in the context of bird-egg-syndrome, which is due to sensitization to serum albumins present in many tissues including muscle tissue and egg yolk (Gal d 5). Primary sensitization to serum albumin may happen via the respiratory tract through exposure to pet birds (mainly in adults) or within the context of egg allergy in early childhood. Due to the heat lability of serum albumins, reactions are often limited to the skin upon contact with raw meat. Symptoms from meat ingestion are rare and mostly mild, whereas systemic reactions are common after ingestion of raw or soft-boiled egg yolk. Primary poultry meat allergy is mainly seen in adolescents and young adults, though hypersensitivity may have started already at (pre)school age. Egg allergy is usually absent. Typical symptoms of primary poultry meat allergy include OAS (±dyspnea), gastrointestinal complaints, urticaria and angioedema. Severe anaphylaxis with cardiovascular symptoms is rare. Chicken and turkey meat are highly cross-reactive and responsible for most reactions, while duck and goose meat causes milder or no symptoms. Soups, sausages, and ham represent relevant allergen sources, too. Patients with poultry meat allergy unexpectedly often suffer from concomitant allergy to fish and possibly shrimp. Serum specific IgE against fish and shrimp is found in respectively 60 and 40 % of sera, suggestive of cross-reactive allergens in these foods. The allergens thus far recognized in genuine poultry meat are LMW proteins of 5-25 kDa. One of them has been identified as

  8. Safe poultry meat production in the next century

    NARCIS (Netherlands)

    Mulder, R.W.A.W.

    1997-01-01

    The revolutionary industrialisation of the poultry industry in the last 30 years has made the food poultry meat available for large groups of consumers. Due to its nutritional, sensory and economical characteristics, poultry meat is by far the most popular animal food product world-wide.

  9. The perception and preference of consumers for local poultry meat ...

    African Journals Online (AJOL)

    The perception and preference of consumers for local poultry meat in the Kumasi ... reduced its freshness and taste and made it less healthy for consumption. ... the government should subsidize the cost of inputs for the local poultry industry, ...

  10. 9 CFR 381.156 - Poultry meat content standards for certain poultry products.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Poultry meat content standards for certain poultry products. 381.156 Section 381.156 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY...

  11. Structure of the poultry meat market in Ukraine

    Directory of Open Access Journals (Sweden)

    Iryna Salkova

    2017-12-01

    Full Text Available The purpose of this paper is to carry out a marketing research of the state and structure of the poultry meat market in Ukraine; to identify the factors that hold back and stimulate the development of the poultry market and potential opportunities for growth. The competitive advantages of producers are determined and the main trends in the poultry meat market are characterized. The balance of supply and demand for meat and meat products in Ukraine has been studied. The Herfindahl-Hirschman index was used to determine the level of competition in the chicken meat market, which showed the disadvantages of competition in the market. The market is monopolistic, which poses a threat to the development of competition. The constraining factors of poultry meat market development are determined. Based on the conducted research, potential opportunities for the development of the industry and the competitiveness of the Ukrainian poultry meat producer in the external and internal market are identified.

  12. Combination treatment of gamma radiation and paraben in controlling spoilage of poultry meat

    International Nuclear Information System (INIS)

    Shiralkar, N.D.; Rege, D.V.

    1977-01-01

    With a view of controlling spoilage, combination treatment of poultry meat with gamma radiation and a chemical preservative has been investigated. Raw poultry pieces of about 25 g. weight were dipped in 0.1% propyl-paraben solution for two hours and were given a 0.1 Mrad dose from 60 Co gamma radiation. It was found that paraben was not affected by irradiation. The flavour evaluation scores indicated the shelf-life of poultry meat was prolonged by a couple of days as compared to untreated controls in refrigerated storage. (M.G.B.)

  13. Effect of irradiation on erythromycin residues in poultry meat

    International Nuclear Information System (INIS)

    Mazurowski, P.

    1993-01-01

    Ionising radiation in doses used for radurisation (Recommendations of international organizations admit for poultry meat doses up to 5 kGy. Practically doses up to 3 kGy are applied does not influence erythromycin concentration in poultry meat. Doses on a level 10 kGy reduce its concentration in slurry more effectively, but results of earlier studies on penicillin and streptomycin suggest, that reduction of erythromycin level in meat should be smaller than in slurry. This allows an assumption that poultry meat irradiation with radurisation doses (up to 5 kGy), does not cause danger of overlooking of erythromycin residues in meat, with traditional, microbiological methods of detection. (orig.)

  14. 76 FR 42595 - Importation of Live Birds and Poultry, Poultry Meat, and Poultry Products From a Region in the...

    Science.gov (United States)

    2011-07-19

    ..., 94, 95, and 104 [Docket No. APHIS-2009-0094] RIN 0579-AD45 Importation of Live Birds and Poultry, Poultry Meat, and Poultry Products From a Region in the European Union AGENCY: Animal and Plant Health... as the APHIS-defined European Union poultry trade region and adding it to the list of regions we...

  15. Detection of horse meat contamination in raw and heat-processed meat products.

    Science.gov (United States)

    Hsieh, Yun-Hwa P; Ofori, Jack A

    2014-12-31

    Europe's recent problems with the adulteration of beef products with horse meat highlight the need for a reliable method for detecting horse meat in food for human consumption. The objective of this study was therefore to develop a reliable monoclonal antibody (mAb) based enzyme-linked immunosorbent assay (ELISA) for horse meat detection. Two mAbs, H3E3 (IgG2b) and H4E7 (IgG2a), were characterized as horse-selective, and competitive ELISAs (cELISAs) employing these mAbs were developed. The cELISAs were found to be capable of detecting levels as low as 1% of horse meat in raw, cooked, and autoclaved ground beef or pork, being useful analytical tools for addressing the health, economic, and ethical concerns associated with adulterating meat products with horse meat. However, due to cross-reaction with raw poultry meat, it is recommended that samples be heated (100 °C for 15 min) prior to analysis to eliminate possible false-positive results.

  16. PRODUCTION AND SUPPLY BALANCE OF POULTRY MEAT IN CROATIA

    Directory of Open Access Journals (Sweden)

    Ivo Grgić

    2015-06-01

    Full Text Available Poultry meat is an important protein source in the human consumption. The main factors that have a positive effect on the development of the poultry industry are short production cycle, relatively low cost and the lack of religious restrictions on consumption. Chicken meat has the biggest share in the structure of poultry meat. The paper objective was to calculate the level of self-sufficiency degree in poultry meat in Croatia in the period from 2000 to 2012 and the degree of self-sufficiency in 2016 based on the results obtained. The method of balancing was used for calculation of self-sufficiency degree. The degree of self-sufficiency in the production of poultry meat in Croatia is higher than in other types of meat being between 80 and 90%. However, further decrease is expected and in 2016 domestic production would meet 81.17% of the domestic needs.

  17. Presence of Clostridium difficile in poultry and poultry meat in Egypt

    OpenAIRE

    Abdel-Glil, Mostafa Y.; Thomas, Prasad; Schmoock, Gernot; Abou-El-Azm, Kamel; Wieler, Lothar H.; Neubauer, Heinrich; Seyboldt, Christian

    2018-01-01

    C. difficile has been recognized as a potential zoonotic agent encouraging investigations of C. difficile prevalence and ribotypes in animals. Here we report the prevalence and diversity of Egyptian C. difficile in I) samples from healthy poultry (n = 50), II) samples from diseased poultry (n = 54), and III) poultry meat (n = 150). Thirteen isolates were obtained from seven healthy and five diseased animals, but no C. difficile was cultured from poultry meat. The isolated C. difficile strains...

  18. U.S. Food Safety and Inspection Service testing for Salmonella in selected raw meat and poultry products in the United States, 1998 through 2003: analysis of set results.

    Science.gov (United States)

    Naugle, Alecia Larew; Barlow, Kristina E; Eblen, Denise R; Teter, Vanessa; Umholtz, Robert

    2006-11-01

    The U.S. Food Safety and Inspection Service (FSIS) tests sets of samples of selected raw meat and poultry products for Salmonella to ensure that federally inspected establishments meet performance standards defined in the pathogen reduction-hazard analysis and critical control point system (PR-HACCP) final rule. In the present report, sample set results are described and associations between set failure and set and establishment characteristics are identified for 4,607 sample sets collected from 1998 through 2003. Sample sets were obtained from seven product classes: broiler chicken carcasses (n = 1,010), cow and bull carcasses (n = 240), market hog carcasses (n = 560), steer and heifer carcasses (n = 123), ground beef (n = 2,527), ground chicken (n = 31), and ground turkey (n = 116). Of these 4,607 sample sets, 92% (4,255) were collected as part of random testing efforts (A sets), and 93% (4,166) passed. However, the percentage of positive samples relative to the maximum number of positive results allowable in a set increased over time for broilers but decreased or stayed the same for the other product classes. Three factors associated with set failure were identified: establishment size, product class, and year. Set failures were more likely early in the testing program (relative to 2003). Small and very small establishments were more likely to fail than large ones. Set failure was less likely in ground beef than in other product classes. Despite an overall decline in set failures through 2003, these results highlight the need for continued vigilance to reduce Salmonella contamination in broiler chicken and continued implementation of programs designed to assist small and very small establishments with PR-HACCP compliance issues.

  19. Prevalence of Listeria monocytogenes in poultry meat

    Directory of Open Access Journals (Sweden)

    Mehmet ELMALI

    2015-01-01

    Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.

  20. RESEARCH ON QUALITY OF POULTRY MEAT RELATED TO GROWTH SYSTEM

    OpenAIRE

    Zeicu E.; Boltea F.; Vatca Gh.; Vekony E.

    2009-01-01

    The paper studies the influence of extensive and intensive growth systems on some physically-chemically characteristics of poultry meat. Humidity, protein and fat contents are higher in case of meat coming from broilers growth in intensive system, and the alteration rate also. High content of minerals was determined in the meat coming from broilers growth in extensive system

  1. [Microbiological studies in poultry meat production].

    Science.gov (United States)

    Monov, G

    1981-01-01

    Microbiologic studies were carried out in the production of poultry meat in a poultry dressing combine of the Stork system. Examined were a total of 125 washing samples taken at the 9th, 11th and 15th hour from the scalding vat, the cooling vat, the machine of eviscerating and the skin surface after plucking, eviscerating and shower washing and prior to packing the carcasses. It was found that the count of aerobic organisms continuously rose during the technologic processing of the slaughtered birds with regard to the surface of the carcasses, the peak values of the total counts and that of coliforms being reached during evisceration. It was further established that shower washing of the carcasses immediately following evisceration guaranteed a washing effect so far as the microflora on the surface was concerned, amounting to 77.60 per cent. So far as the coliform bacteria was concerned this effect was found to be equal to 89.78 per cent. The total count of aerobic microflora on the surface of carcasses prior to packing was found to vary within the range of 3000 to 72000, while the count of coliforms ranged from 100 to 1800/cm2.

  2. (Microbiological studies in poultry meat production)

    Energy Technology Data Exchange (ETDEWEB)

    Monov, G.

    1981-01-01

    Microbiologic studies were carried out in the production of poultry meat in a poultry dressing combine of the Stork system. Examined were a total of 125 washing samples taken at the 9th, 11th and 15th hour from the scalding vat, the cooling vat, the machine of eviscerating and the skin surface after plucking, eviscerating and shower washing and prior to packing the carcasses. It was found that the count of aerobic organisms continuously rose during the technologic processing of the slaughtered birds with regard to the surface of the carcasses, the peak values of the total counts and that of coliforms being reached during evisceration. It was further established that shower washing of the carcasses immediately following evisceration guaranteed a washing effect so far as the microflora on the surface was concerned, amounting to 77.60 per cent. So far as the coliform bacteria was concerned this effect was found to be equal to 89.78 per cent. The total count of aerobic microflora on the surface of carcasses prior to packing was found to vary within the range of 3000 to 72000, while the count of coliforms ranged from 100 to 1800/cm2.

  3. Research on Consumer Behaviour in Bucharest Poultry Meat Market

    Directory of Open Access Journals (Sweden)

    Ion Pirvutoiu

    2013-05-01

    Full Text Available The paper goal was to study consumer behaviour for poultry meat. In this purpose 100 individuals participated to a questionnaire based survey  in a supermarket of  Bucharest. Specific methods of marketing research in such a case assured the statistical processing of the respondents’ answers. The results pointed out an increased consumption of poultry meat,  a preference for fresh chicken meat which is daily bought  or 2-3 times a week in a varied amount ranging between 1-1.5 kg depending on consumer’s income for covering the family need. The main factors influencing consumer buying decision are the sensorial meat characteristics, meat quality, origin, price, prepaking grade. As a conclusion producers have to pay more attention to these aspects in their future strategy for producing and commercialising poultry meat.

  4. Genetics of Poultry Meat Production in Organic Systems

    DEFF Research Database (Denmark)

    Sørensen, Poul

    2012-01-01

    Organic Meat Production and Processing describes the challenges of production, processing and food safety of organic meat. The editors and international collection of authors explore the trends in organic meats and how the meat industry is impacted. Commencing with chapters on the economics, market....... The book concludes by describing pre-harvest control measures for assuring the safety of organic meats. Organic Meat Production and Processing serves as a unique resource for fully understanding the current and potential issues associated with organic meats...... and regulatory aspects of organic meats, coverage then extends to management issues for organically raised and processed meat animals. Processing, sensory and human health aspects are covered in detail, as are the incidences of foodborne pathogens in organic beef, swine, poultry and other organic meat species...

  5. Advances in research on poultry and rabbit meat quality

    Directory of Open Access Journals (Sweden)

    Gerolamo Xiccato

    2010-01-01

    Full Text Available Main force and weakness points of poultry and rabbit production chains are presented and meat quality discussed in relation to nutritional and technological issues. An analysis of the most important poultry and rabbit meat quality traits and their major relationships with production factors (genotype, feeding, housing, pre-slaughter handling, slaughtering, and processing is provided. Most recent research advancements are presen- ted in view of the consumer’s demand for healthy and safe products obtained respecting animal welfare.

  6. Effect of irradiation on oxytetracycline residues in poultry meat

    Energy Technology Data Exchange (ETDEWEB)

    Mazurowski, P [Warsaw Agricultural University, Faculty of Veterinary Medicine, Department of Food Hygiene, Warsaw (Poland)

    1994-12-31

    The purpose of the study was an evaluation of the effect of ionizing radiation on detection of oxytetracycline residues in poultry meat. Oxytetracycline was chosen as a representative of tetracyclines which are often applied in poultry for therapeutical reasons. The experiment was conducted using both broiler meat treated by oxytetracycline and slurry of broiler meat containing appropriate concentration of this antibiotic. A traditional microbiological method for determination of antibiotics antimicrobial activity was used. A significant decrease of oxytetracycline concentration in meat slurry as a result of irradiation was noted. A dose of 1 kGy reduced concentration of tetracycline to ca 40% and a dose of 3 kGy reduced it to ca 3%. In ground poultry meat a dose of 1 kGy reduced this antibiotic concentration to 70%, a dose of 3 kGy reduced oxytetracycline concentration to 35% and a 5 kGy dose reduced it up to ca 18% of initial concentration. It can be concluded that irradiation of poultry meat with radurization doses can cause some difficulties in detection of tetracycline residues in meat using traditional microbiological methods of detection. (author).

  7. Effect of irradiation on oxytetracycline residues in poultry meat

    International Nuclear Information System (INIS)

    Mazurowski, P.

    1994-01-01

    The purpose of the study was an evaluation of the effect of ionizing radiation on detection of oxytetracycline residues in poultry meat. Oxytetracycline was chosen as a representative of tetracyclines which are often applied in poultry for therapeutical reasons. The experiment was conducted using both broiler meat treated by oxytetracycline and slurry of broiler meat containing appropriate concentration of this antibiotic. A traditional microbiological method for determination of antibiotics antimicrobial activity was used. A significant decrease of oxytetracycline concentration in meat slurry as a result of irradiation was noted. A dose of 1 kGy reduced concentration of tetracycline to ca 40% and a dose of 3 kGy reduced it to ca 3%. In ground poultry meat a dose of 1 kGy reduced this antibiotic concentration to 70%, a dose of 3 kGy reduced oxytetracycline concentration to 35% and a 5 kGy dose reduced it up to ca 18% of initial concentration. It can be concluded that irradiation of poultry meat with radurization doses can cause some difficulties in detection of tetracycline residues in meat using traditional microbiological methods of detection. (author)

  8. Update on the bird-egg syndrome and genuine poultry meat allergy

    OpenAIRE

    Hemmer, Wolfgang; Klug, Christoph; Swoboda, Ines

    2016-01-01

    Summary Allergy to poultry meat is rare and affects both children and adults. The prevalence of poultry meat allergy is unknown, but presumably is similar to that of red meat allergy. There is no close relationship between allergy to poultry meat and allergy to red meat. Poultry meat allergy may present as primary (genuine) food allergy or as secondary food allergy resulting from cross-reactivity. Secondary poultry meat allergy may arise in the context of bird-egg-syndrome, which is due to se...

  9. Presence of Clostridium difficile in poultry and poultry meat in Egypt.

    Science.gov (United States)

    Abdel-Glil, Mostafa Y; Thomas, Prasad; Schmoock, Gernot; Abou-El-Azm, Kamel; Wieler, Lothar H; Neubauer, Heinrich; Seyboldt, Christian

    2018-06-01

    C. difficile has been recognized as a potential zoonotic agent encouraging investigations of C. difficile prevalence and ribotypes in animals. Here we report the prevalence and diversity of Egyptian C. difficile in I) samples from healthy poultry (n = 50), II) samples from diseased poultry (n = 54), and III) poultry meat (n = 150). Thirteen isolates were obtained from seven healthy and five diseased animals, but no C. difficile was cultured from poultry meat. The isolated C. difficile strains belonged to 3 different PCR-ribotypes (039/2, 205 and 001/FLI01). The detection of strains related to RT 001 known for its ability to cause disease in humans makes poultry a potential reservoir for pathogenic C. difficile. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  10. 76 FR 22667 - Availability of Salmonella Compliance Guide for Small and Very Small Meat and Poultry...

    Science.gov (United States)

    2011-04-22

    ...] Availability of Salmonella Compliance Guide for Small and Very Small Meat and Poultry Establishments That... production of ready-to-eat (RTE) meat and poultry products with respect to Salmonella and other pathogens... This document provides small and very small meat and poultry establishments \\1\\ that manufacture RTE...

  11. 78 FR 77643 - National Advisory Committee of Meat and Poultry Inspection

    Science.gov (United States)

    2013-12-24

    ... Advisory Committee of Meat and Poultry Inspection AGENCY: Food Safety and Inspection Service, USDA. ACTION... of the National Advisory Committee on Meat and Poultry Inspection (NACMPI). The Committee is being... label on meat and poultry packages. With this input, the Agency will consider whether or not the current...

  12. 77 FR 47028 - National Advisory Committee on Meat and Poultry Inspection

    Science.gov (United States)

    2012-08-07

    ... Inspection Service [Docket No. FSIS-2012-0030] National Advisory Committee on Meat and Poultry Inspection... Agriculture National Advisory Committee on Meat and Poultry Inspection. SUMMARY: The U.S. Department of Agriculture intends to reestablish the National Advisory Committee on Meat and Poultry Inspection. The purpose...

  13. Influence of color on dielectric properties of marinated poultry breast meat.

    Science.gov (United States)

    Samuel, D; Trabelsi, S

    2012-08-01

    The dielectric behavior of foods when exposed to radio-frequency and microwave electric fields is highly influenced by moisture content and the degree of water binding with constituents of the food materials. The ability to correlate specific food quality characteristics with the dielectric properties can lead to the development of rapid, nondestructive techniques for such quality measurements. Water-holding capacity is a critical attribute in meat quality. Up to 50% of raw poultry meat in the United States is marinated with mixtures of water, salts, and phosphates. The objective of this study was to determine if variations in breast meat color would affect the dielectric properties of marinated poultry meat over a broad frequency range from 500 MHz to 50 GHz. Poultry meat was obtained from a local commercial plant in Georgia (USA). Color and pH measurements were taken on the breast filets. Groups of breast filets were sorted into classes of pale and normal before adding marination pickup percentages of 0, 5, 10, and 15. Breast filets were vacuum-tumbled and weighed for pickup percentages. Dielectric properties of the filets were measured with a coaxial open-ended probe on samples equilibrated to 25°C. Samples from pale meat exhibited higher dielectric properties than samples from normal meat. No differences could be observed between samples from pale and normal meat after marination of the samples. Overall, dielectric properties increased as the marination pickup increased (α=0.05). Marination pickup strongly influenced the dielectric loss factor. Differences between samples marinated at different pickup levels were more pronounced at lower frequencies for the dielectric loss factor. As frequency increased, the differences between samples decreased. Differences in dielectric constant between samples were not as consistent as those seen with the dielectric loss factor.

  14. Child Nutrition Labeling for Meat and Poultry Products.

    Science.gov (United States)

    Wade, Cheryl; And Others

    Prepared for food manufacturers, this publication contains instructions for calculating the contribution that a meat or poultry product makes toward the meal pattern requirements of child nutrition programs. It also contains instructions on how to apply for and obtain the approval for a label containing a child nutrition statement. These…

  15. Performance of food safety management systems in poultry meat preparation processing plants in relation to Campylobacter spp. contamination.

    Science.gov (United States)

    Sampers, Imca; Jacxsens, Liesbeth; Luning, Pieternel A; Marcelis, Willem J; Dumoulin, Ann; Uyttendaele, Mieke

    2010-08-01

    A diagnostic instrument comprising a combined assessment of core control and assurance activities and a microbial assessment instrument were used to measure the performance of current food safety management systems (FSMSs) of two poultry meat preparation companies. The high risk status of the company's contextual factors, i.e., starting from raw materials (poultry carcasses) with possible high numbers and prevalence of pathogens such as Campylobacter spp., requires advanced core control and assurance activities in the FSMS to guarantee food safety. The level of the core FSMS activities differed between the companies, and this difference was reflected in overall microbial quality (mesophilic aerobic count), presence of hygiene indicators (Enterobacteriaceae, Staphylococcus aureus, and Escherichia coli), and contamination with pathogens such as Salmonella, Listeria monocytogenes, and Campylobacter spp. The food safety output expressed as a microbial safety profile was related to the variability in the prevalence and contamination levels of Campylobacter spp. in poultry meat preparations found in a Belgian nationwide study. Although a poultry meat processing company could have an advanced FSMS in place and a good microbial profile (i.e., lower prevalence of pathogens, lower microbial numbers, and less variability in microbial contamination), these positive factors might not guarantee pathogen-free products. Contamination could be attributed to the inability to apply effective interventions to reduce or eliminate pathogens in the production chain of (raw) poultry meat preparations.

  16. 9 CFR 94.23 - Importation of poultry meat and other poultry products from Sinaloa and Sonora, Mexico.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Importation of poultry meat and other poultry products from Sinaloa and Sonora, Mexico. 94.23 Section 94.23 Animals and Animal Products ANIMAL... (INCLUDING POULTRY) AND ANIMAL PRODUCTS RINDERPEST, FOOT-AND-MOUTH DISEASE, EXOTIC NEWCASTLE DISEASE, AFRICAN...

  17. 75 FR 56502 - National Advisory Committee on Meat and Poultry Inspection

    Science.gov (United States)

    2010-09-16

    ... Advisory Committee on Meat and Poultry Inspection AGENCY: Food Safety and Inspection Service, USDA. ACTION... and Poultry Inspection (NACMPI) will hold a public meeting on September 29-30, 2010, to review and... disks or CD-ROMs: Send to National Advisory Committee on Meat and Poultry Inspection, USDA, FSIS, 14th...

  18. Determination of response level for imported meat and poultry

    Energy Technology Data Exchange (ETDEWEB)

    Houston, Donald L; Engel, Ronald E

    1986-07-01

    The response level of 75,000 picocuries per kilogram (pci/kg) for imported meat and poultry was determined in accordance with the Food and Drug Administration's (FDA's) Accidental Radioactive Contamination of Human Food and Animal Feeds, Recommendations for State and Local Agencies which was published in the Federal Register of October 22, 1982, and in consultation with FDA. The response level takes into account the total intake of activity from a radionuclide and the average daily consumption of food in the United States. This response level value is based, in part, upon the expectation that the major contributors of radiation to imported meat and poultry will be cesium-134 (half-life 2.1 years) and cesium-137 (half-life 30 years)

  19. Determination of response level for imported meat and poultry

    International Nuclear Information System (INIS)

    Houston, Donald L.; Engel, Ronald E.

    1986-01-01

    The response level of 75,000 picocuries per kilogram (pci/kg) for imported meat and poultry was determined in accordance with the Food and Drug Administration's (FDA's) Accidental Radioactive Contamination of Human Food and Animal Feeds, Recommendations for State and Local Agencies which was published in the Federal Register of October 22, 1982, and in consultation with FDA. The response level takes into account the total intake of activity from a radionuclide and the average daily consumption of food in the United States. This response level value is based, in part, upon the expectation that the major contributors of radiation to imported meat and poultry will be cesium-134 (half-life 2.1 years) and cesium-137 (half-life 30 years)

  20. Utilization of byproducts and waste materials from meat, poultry and fish processing industries: a review.

    Science.gov (United States)

    Jayathilakan, K; Sultana, Khudsia; Radhakrishna, K; Bawa, A S

    2012-06-01

    India is bestowed with vast livestock wealth and it is growing at the rate of 6% per annum. The contribution of livestock industry including poultry and fish is increasing substantially in GDP of country which accounts for >40% of total agricultural sector and >12% of GDP. This contribution would have been much greater had the animal by-products been also efficiently utilized. Efficient utilization of by-products has direct impact on the economy and environmental pollution of the country. Non-utilization or under utilization of by-products not only lead to loss of potential revenues but also lead to the added and increasing cost of disposal of these products. Non-utilization of animal by-products in a proper way may create major aesthetic and catastrophic health problems. Besides pollution and hazard aspects, in many cases meat, poultry and fish processing wastes have a potential for recycling raw materials or for conversion into useful products of higher value. Traditions, culture and religion are often important when a meat by-product is being utilized for food. Regulatory requirements are also important because many countries restrict the use of meat by-products for reasons of food safety and quality. By-products such as blood, liver, lung, kidney, brains, spleen and tripe has good nutritive value. Medicinal and pharmaceutical uses of by-product are also highlighted in this review. Waste products from the poultry processing and egg production industries must be efficiently dealt with as the growth of these industries depends largely on waste management. Treated fish waste has found many applications among with which the most important are animal feed, biodiesel/biogas, dietectic products (chitosan), natural pigments (after extraction) and cosmetics (collagen). Available information pertaining to the utilization of by-products and waste materials from meat, poultry and fish and their processing industries has been reviewed here.

  1. Mechanically recovered poultry meat sausages manufactured with high hydrostatic pressure.

    Science.gov (United States)

    Yuste, J; Mor-Mur, M; Capellas, M; Guamis, B; Pla, R

    1999-06-01

    The effect of high pressure processing at high temperature on texture and color of frankfurter-type sausages made with different contents of mechanically recovered poultry meat (MRPM) was evaluated and compared with that of a standard cooking process. Five types of sausages containing 100, 75, 50, 25, and 0% MRPM and 0, 25, 50, 75, and 100% of minced pork meat (MPM), respectively, were manufactured. They were pressurized at 500 MPa for 30 min at 50, 60, 70, and 75 C or cooked at 75 C for 30 min. Pressure-treated sausages were less springy and firm, but more cohesive. Moreover, color of pressurized sausages was lighter and more yellow than that of conventionally cooked sausages. Addition of MPM increased cohesiveness, hardness, and force at 80% compression. Minced pork meat also caused the appearance of sausages to be lighter, less red, and less yellow. Cooked sausages made with MRPM can have an attractive appearance and texture via high pressure processing.

  2. The Sensory Quality of Meat, Game, Poultry, Seafood and Meat Products as Affected by Intense Light Pulses: A Systematic Review

    OpenAIRE

    Tomasevic, Igor; Rajkovic, Andreja

    2015-01-01

    The effect of intense light pulses (ILP) on sensory quality of 16 different varieties of meat, meat products, game, poultry and seafood are reviewed. Changes induced by ILP are animal species, type of meat product and fluences applied dependent. ILP significantly deteriorates sensory quality of cooked meat products. It causes less change in the sensory properties of dry cured than cooked meat products while fermented sausage is least affected. The higher fluence applied significantly changes ...

  3. Isolation and detection of Listeria monocytogenes in poultry meat by standard culture methods and PCR

    Science.gov (United States)

    Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.

    2017-09-01

    Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.

  4. 77 FR 75118 - National Advisory Committee on Meat and Poultry Inspection

    Science.gov (United States)

    2012-12-19

    ... Advisory Committee on Meat and Poultry Inspection AGENCY: Food Safety and Inspection Service, USDA. ACTION... Inspection Service (FSIS) is announcing a meeting of the National Advisory Committee on Meat and Poultry... strengthening Agency verification activities and guidance concerning sanitary dressing and antimicrobial...

  5. Competitiveness of the EU poultry meat sector : International comparison base year 2013

    NARCIS (Netherlands)

    Horne, van P.L.M.; Bondt, N.

    2014-01-01

    In this report the Agricultural Economics Research Institute (LEI), an independent research institute of Wageningen UR (University and Research) in the Netherlands, presents the results of a study on the competitiveness of the EU poultry meat sector. The production costs for poultry meat are

  6. 77 FR 13512 - National Advisory Committee on Meat and Poultry Inspection

    Science.gov (United States)

    2012-03-07

    ... Poultry Inspection AGENCY: Food Safety and Inspection Service, USDA. ACTION: Notice of committee meeting... Committee Act, that the National Advisory Committee on Meat and Poultry Inspection (NACMPI) will hold a public meeting on Wednesday, March 21, 2012, to discuss the proposed rule on the Modernization of Poultry...

  7. 9 CFR 381.170 - Standards for kinds and classes, and for cuts of raw poultry.

    Science.gov (United States)

    2010-01-01

    ... INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY... poultry, and the requirements for each class: (1) Chickens—(i) Rock Cornish game hen or Cornish game hen. A Rock Cornish game hen or Cornish game hen is a young immature chicken (usually 5 to 6 weeks of age...

  8. 77 FR 58089 - Availability of FSIS Salmonella Compliance Guidelines for Small and Very Small Meat and Poultry...

    Science.gov (United States)

    2012-09-19

    ...] Availability of FSIS Salmonella Compliance Guidelines for Small and Very Small Meat and Poultry Establishments... revised compliance guide for small and very small meat and poultry establishments on the safe production of ready-to-eat (RTE) meat and poultry products with respect to Salmonella and other pathogens. FSIS...

  9. PRODUCTION OF POULTRY MEAT AND EGGS IN THE REPUBLIC OF CROATIA AND IN THE EUROPEAN UNION

    Directory of Open Access Journals (Sweden)

    Davor Bošnjaković

    2017-01-01

    Full Text Available Poultry meat and eggs are a significant source of nutrients in the human diet. Poultry products are widely consumed because they are nutritionally valuable, there are no religious restrictions on consumption, it is relatively easy to prepare diverse meals based on poultry, and the price of such products is relatively low. The aim of this research was to investigate the development of poultry production in the Republic of Croatia in the period 2010-2014, comprising the period of two years after Croatia joined the EU. The paper also compares data of poultry production in Croatia and in the EU. Over the period in question, total meat production in Croatia was reduced by 23%, meat import was increased by 45%, poultry meat export was increased by 46%, and production of eggs decreased by 20%. At the same time, in the EU countries poultry production was increased by 8.8% on average, export was increased by 10%, and import was reduced by 3.7%, while the egg production stagnated. In 2014, consumption of poultry meat in Croatia was 18.3 kg per capita, and in the EU 26.8 kg per capita. Self-sufficiency in the poultry production over the analyzed period was not satisfactory, therefore in the coming years, Croatia will have to develop quickly this important branch of livestock breeding. In addition to conventional production, faster development refers to production of organic and functional poultry products.

  10. Farming and processing factors for improving quality properties of poultry and rabbit meat

    OpenAIRE

    Mudalal, Samer

    2015-01-01

    Recently, global meat market is facing several dramatic changes due to shifting in diet and life style, consumer demands, and economical considerations. Firstly, there was a tremendous increase in the poultry meat demand. Furthermore, current forecast and projection studies pointed out that the expansion of the poultry market will continue in future. In response to this demand, there was a great success to increase growth rate of meat-type chickens in the last few decades in order to optimize...

  11. Beneficial Effects of Poultry Meat Consumption on Cardiovascular Health and the Prevention of Childhood Obesity

    Directory of Open Access Journals (Sweden)

    Mustafa Metin Donma

    2017-08-01

    Full Text Available Poultry meat is an animal product important in human nutrition. A variable, and moderate energy content, highly digestible proteins of good nutritional quality, unsaturated lipids, fat-soluble and B-complex vitamins as well as minerals make poultry meat a valuable food. Poultry meat is one of the recommended constituents of Dietary Approaches to Stop Hypertension Diet as well as the Mediterranean Diet. The substitution of red meat with poultry as well as fish, nuts and legumes decreases the risk of developing type 2 and gestational diabetes mellitus, improves glycemic control and cardiovascular risk factors. Low-fat diets supported by fruits, grains, nuts, fish and poultry instead of red meat yields cardiovascular health benefits. Anti-inflammatory and antioxidative diet enriched with high-quality foods reduces pro-inflammatory cytokines. This favors anti-inflammatory milieu which in turn improves insulin sensitivity and endothelial function and ultimately act as a barrier to obesity, metabolic syndrome, type 2 diabetes mellitus and development of atherosclerosis. The nutritive value of poultry meat depends on different factors such as age, feeding, keeping, hybrids, carcass parts and type of meat. Preventive measures against risky aspects of the matter should be developed. Since the use of antibiotics leads to the development of antibiotic resistant pathogens, antibiotics must be replaced by herbs and spices with growth promoting effects, antimicrobial properties, and other health related benefits to solve the problem. Enrichment and fortification with nutrients may cause poultry meat to gain even more functional food character.

  12. 76 FR 24713 - Cooperative Inspection Programs: Interstate Shipment of Meat and Poultry Products

    Science.gov (United States)

    2011-05-02

    ... amenable species, such as processing game meat or for busy times in their retail shops around holidays. The... Service 9 CFR Parts 321, 332, and 381 Cooperative Inspection Programs: Interstate Shipment of Meat and... Shipment of Meat and Poultry Products AGENCY: Food Safety and Inspection Service, USDA. ACTION: Final rule...

  13. Changes in Meat/Poultry/Fish Consumption in Australia: From 1995 to 2011–2012

    Science.gov (United States)

    Sui, Zhixian; Raubenheimer, David; Cunningham, Judy; Rangan, Anna

    2016-01-01

    The purpose of the study was to examine temporal changes in meat/poultry/fish consumption patterns between 1995 and 2011–2012 in the Australian population. Meat/poultry/fish consumption from all food sources, including recipes, was analysed by gender, age group, and socio-economic status using 24-h recall data from the 1995 National Nutrition Survey (n = 13,858) and the 2011–2012 National Nutrition and Physical Activity Survey (n = 12,153). The overall proportion of people consuming meat/poultry/fish remained stable (91.7% versus 91.3%, p = 0.55), but a shift in the type of meat consumed was observed. Red meat, including beef and lamb, was consumed by fewer people over the time period (from 56% to 49%), whereas poultry consumption increased (from 29% to 38%). Amounts of all meat/poultry/fish consumed were reportedly higher in 2011–2012 compared with 1995. This resulted in similar (red meat, and processed meat) or slightly higher (poultry, and fish) per-capita intakes in 2011–2012. The magnitude of change of consumption varied between children and adults, and by gender. Monitoring trends in consumption is particularly relevant to policy makers, researchers and other health professionals for the formulation of dietary recommendations and estimation of potential health outcomes. PMID:27886131

  14. Effect of probiotics in poultry diet on microbial hazards of poultry meat

    Directory of Open Access Journals (Sweden)

    A Javadi

    2009-05-01

    Full Text Available Probiotics are products from microbial cells that have useful influence on health and tranquility of humans. According to numerous studies, many valuable properties such as anti-mutagenic, anti-carcinogenic, boosting body immunity and resistance against enteric pathogens have been attributed to probiotics. Therefore the aim of this study is to specify the effect of probiotics use in the diet of broilers on microbial hazards of poultry meat. For this purpose, two groups of treatment and control each containing 40 broiler chicks were chosen and edible probiotic were given to the treatment group throughout the whole 55 days of the rearing period under the same conditions and following slaughter 100 grams of skin and breast meat samples were collected from each carcass and transferred to food hygiene laboratory of the veterinary faculty under sterile conditions. Total microbial count,    Staphylococcus aureous, fecal Streptococci, Clostridium perferingens, Coliforms counts and detection of Salmonella and E.coli were performedon the samples according to standard approaches of Iran. The results were analyzed using independent t-Test and Chi-square test. Comparison of the means of total microbial count, coliform, enteric streptococci and meat staphylococcus counts in the control and treatment group using independent t-Test showed a significant reduction (p

  15. Quality of comminuted sausages formulated from mechanically deboned poultry meat.

    Science.gov (United States)

    Mielnik, Maria B; Aaby, Kjersti; Rolfsen, Knut; Ellekjær, Marit R; Nilsson, Astrid

    2002-05-01

    Comminuted sausages formulated with mechanically deboned poultry meat-MDPM (turkey or chicken, frame or neck) treated in different ways before production (vacuum packed MDPM or air packed skeletons deboned at production) and stored frozen for 6 or 18 weeks have been studied using a full-factorial design and chemical, physical and sensory analysis. MDPM was obtained from a Beehive separator. Comminuted sausages with MDPM from turkey frames, stored at -25 °C as skeletons, packed in air for 18 weeks developed marked rancid odour and flavour which could also be detected by thiobarbituric acid reactive substances (TBARS) and the concentration of volatile compounds. Vacuum packed mechanically deboned meat irrespective of species and carcass part could be stored for up to 18 weeks and used in formulation of sausages without any serious changes in their sensory profiles. Instrumental colour differences between sausages were mainly due to species. Turkey sausages were darker, redder and less yellow than chicken sausages. Moisture and fat contents were influenced by carcass part and to a lesser extent depended on species and storage time. Principal least squares regression (PLS2) showed close relationships between instrumental parameters and sensory attributes. TBARS, hexanal and volatile compounds were highly correlated with rancid flavour while redness (a(∗)) was strongly related to sensory colour hue and colour strength.

  16. Formation of Poultry Meat Flavor by Heating Process and Lipid Oxidation

    Directory of Open Access Journals (Sweden)

    Maijon Purba

    2014-09-01

    Full Text Available Flavor is an important factor in the acceptance of food. Flavor of poultry meat is naturally formed through a specific process of heating, where various chemical reactions complex occurred among nonvolatile precursors in fatty tissue or in lean tissue. The main flavor in the form of volatile and nonvolatile components play a major influence on the acceptance of various processed meat, especially the taste. Removal of sulfur components decreases meat flavor (meaty, while removal of carbonyl compounds decrease the specific flavor and increases common flavor of the meat. Poultry meat has a fairly high fat content that easily generates lipid oxidation. Lipid oxidation in poultry meat is a sign that the meat was damaged and caused off odor. Addition of antioxidants in the diet can inhibit lipid oxidation in the meat. Lipids interaction with proteins and carbohydrates is unavoidable during the thermal processing of food, causing the appearance of volatile components. The main reaction in meat flavor formation mechanism is Maillard reaction followed by Stecker reaction and degradation of lipids and thiamine. They involve in the reaction between carbonyl and amine components to form flavor compounds, which enhance the flavor of poultry meat.

  17. U.S. Food safety and Inspection Service testing for Salmonella in selected raw meat and poultry products in the United States, 1998 through 2003: an establishment-level analysis.

    Science.gov (United States)

    Eblen, Denise R; Barlow, Kristina E; Naugle, Alecia Larew

    2006-11-01

    The U.S. Food Safety and Inspection Service (FSIS) pathogen reduction-hazard analysis critical control point systems final rule, published in 1996, established Salmonella performance standards for broiler chicken, cow and bull, market hog, and steer and heifer carcasses and for ground beef, chicken, and turkey meat. In 1998, the FSIS began testing to verify that establishments are meeting performance standards. Samples are collected in sets in which the number of samples is defined but varies according to product class. A sample set fails when the number of positive Salmonella samples exceeds the maximum number of positive samples allowed under the performance standard. Salmonella sample sets collected at 1,584 establishments from 1998 through 2003 were examined to identify factors associated with failure of one or more sets. Overall, 1,282 (80.9%) of establishments never had failed sets. In establishments that did experience set failure(s), generally the failed sets were collected early in the establishment testing history, with the exception of broiler establishments where failure(s) occurred both early and late in the course of testing. Small establishments were more likely to have experienced a set failure than were large or very small establishments, and broiler establishments were more likely to have failed than were ground beef, market hog, or steer-heifer establishments. Agency response to failed Salmonella sample sets in the form of in-depth verification reviews and related establishment-initiated corrective actions have likely contributed to declines in the number of establishments that failed sets. A focus on food safety measures in small establishments and broiler processing establishments should further reduce the number of sample sets that fail to meet the Salmonella performance standard.

  18. Comparison of the amounts of taste-related compounds in raw and cooked meats from broilers and Korean native chickens.

    Science.gov (United States)

    Jayasena, Dinesh D; Kim, Sun Hyo; Lee, Hyun Jung; Jung, Samooel; Lee, Jun Heon; Park, Hee Bok; Jo, Cheorun

    2014-12-01

    This study was aimed at comparing the taste-related compound content in the breast and leg meat from 100-d-old Korean native chickens (KNC-100) and 32-d-old commercial broilers (CB-32) and determining the changes in these compounds during cooking. Cocks from certified meat-type commercial broiler (Ross) and Korean native chicken (Woorimatdag) strains were raised under similar standard commercial conditions, and a total of 10 birds from each breed were slaughtered at 32 and 100 d of age, which represents their market ages, respectively. Raw and cooked meat samples were prepared separately from the breast and leg and analyzed. The KNC-100 showed significantly higher concentrations of inosine 5'-monophosphate, reducing sugars, glutamic acid, linoleic acid, arachidonic acid, and docosahexaenoic acid than CB-32 did. Additionally, significantly higher inosine 5'-monophosphate, cysteine, arachidonic acid, and docosahexaenoic acid concentrations were observed in the breast meat, whereas the leg meat had higher concentration of glutamic acid, oleic acid, and linoleic acid (P cooking process, except oleic and linoleic acids. We suggest that the higher levels of taste-related compounds present in KNC-100 meat compared with CB-32 meat may result in the unique taste of the former meat, as has been previously reported. In addition, the results of this study may provide useful information for selection and breeding programs. ©2014 Poultry Science Association Inc.

  19. Supplying the energy demand in the chicken meat processing poultry with biogas

    OpenAIRE

    Ferrarez, A. H; Oliveira, D; Lacerda, A. F; Costa, J. M; Aparisi, F. S

    2016-01-01

    The main use of electrical energy in the chicken meat processing unit is refrigeration. About 70 % of the electricity is consumed in the compressors for the refrigeration system. Through this study, the energetic viability of using biogas from poultry litter in supplying the demand for the refrigeration process was found. The meat processing unit studied has the potential to process about a hundred and sixty thousand chickens a day. The potential biogas production from poultry litter is 60,75...

  20. Antimicrobial activity of poultry bone and meat trimmings hydrolyzates in low-sodium turkey food.

    Science.gov (United States)

    Zanello, Pier Paolo; Sforza, Stefano; Dossena, Arnaldo; Lambertini, Francesca; Bottesini, Chiara; Nikolaev, Ilya V; Koroleva, Olga; Ciociola, Tecla; Magliani, Walter; Conti, Stefania; Polonelli, Luciano

    2014-02-01

    This research was aimed at the evaluation of the antimicrobial activity exerted by poultry protein hydrolyzates derived from industrial leftovers added to minced turkey meat, intended for the production of burgers for human consumption. Hydrolyzates were obtained through enzymatic hydrolysis from poultry bone and meat trimmings, as by-products from the poultry industry. Colony forming unit assays, under both laboratory and industrial conditions, were performed to assess microbial growth. Poultry protein hydrolyzates inhibited microbial growth occurring in semi-finished turkey meat during the normal retention period because of their water holding capacity resulting in a decreased water activity. Overall, the findings demonstrated that poultry protein hydrolyzates could decrease mesophilic, psychrophilic, and thermophilic bacterial growth for the entire product shelf-life. Bacterial growth inhibition obtained in minced turkey meat by addition of poultry protein hydrolyzates (1.5%), hygroscopic amino acids mixture (1.5%) or sodium chloride (1%) was similar. It is suggested that the use of hydrolyzates could allow the reduction of salt content in poultry meat based products leading to the production of low-sodium turkey food still maintaining acceptable sensory characteristics.

  1. A Review of the Poultry Meat Production Industry for Food Safety in Indonesia

    Science.gov (United States)

    Wahyono, N. D.; Utami, M. M. D.

    2018-01-01

    Poultry meat is an indispensable source of animal protein in human growth and development, so it is in great demand by people all over the world. Poultry meat has several advantages, namely the quality of nutrition is good enough, delicious taste, relatively affordable price, easy to get and accepted all levels of society with diverse backgrounds. The era of globalization requires competitive products, such as chicken meat in Indonesia, the current chicken meat industry is not only based on high production capacity and decreased production costs but also chicken products are safe to eat. As a consequence of trade liberalization, the poultry industry faces the threat of competition with cheaper products with better quality. The food safety of chicken meat starts from the farm, processing process until consumed. Food safety is a requirement of food products that must be handled by involving government, industry and consumers.

  2. Total Antibiotics — A New Possible Alternative for the Screening of Coccidiostat Residues in Poultry Meat

    Directory of Open Access Journals (Sweden)

    Jeevanandan V.

    2016-09-01

    Full Text Available The Total Antibiotics test is a microbial inhibition test which has been recently introduced for the detection of antibiotics in meat. The aim of this study was to determine whether it would be suitable for the detection of coccidiostats in poultry meat. A comparison with the Premi®Test was assessed also for the suitability of the detection of coccidiostats in poultry meat. A selection of poultry meat samples of different organ parts were assessed with 14 samples from Slovakian farms that had previously been tested for coccidiostats by the Veterinary and Food Institute in Košice. In addition, another 8 samples from varied Slovakian supermarkets such as Lidl, Billa and Tesco with samples of chicken or duck meat, were tested. Each prepared sample was added to the Total Antibiotics kit tubes and incubated. The samples from all sources showed a mixture of positive and negative results for the detection of coccidiostats.

  3. Analysis of poultry meat production volume in Serbia from 1984. to 2009

    Directory of Open Access Journals (Sweden)

    Glamočlija Nataša

    2013-01-01

    Full Text Available Poultry meat production has doubled in past 40 years in the world, with the tendency of constant growth, and its production volume exceeds beef, but is behind pork production. For poultry meat production it is typical that its annual increase exceeds pork as well as beef production. The biggest producers of poultry meat are Asia, North and South America and Europe. The most significant category of poultry is meat of young chicken (broilers. Cobb, Ross and Hubbard broiler provenance are most common in Serbia. The objective of this investigation was to analyse poultry meat production volume in Serbia, observed during three six-years periods - A (1984-1989, B (1994-1999 i C (2004-2009. For data processing there were used the data obtained from Statistical Yearbooks of Serbia from 1984. to 2009. It was found out that average poultry meat production in period A was 108,33 ± 7,00 thousand tonnes, than it statistically significantly decreased and in period B it was 76,67±5,54 thousand tonnes, and finally in period C it was 72,17± 5,78 thousand tonnes. [Projekat Ministarstva nauke Republike Srbije, br. TR 31034

  4. Meat consumption patterns in Vietnam: effects of household characteristics on pork and poultry consumption

    OpenAIRE

    Nguyen, Van Phuong; Mergenthaler, Marcus

    2013-01-01

    This study relates social-demographic characteristics of Vietnamese households to their consumption of meat. Tobit models are estimated drawing on the latest Vietnamese Household Living Standard Survey in 2010 (VHLSS 2010). The analysis of demand for pork and poultry in Vietnamese households demonstrates that the meat demand in Vietnam is significantly affected by socio-economic and geographic factors.

  5. Quality function deployment in the organic animal food sector: application to poultry meat

    Directory of Open Access Journals (Sweden)

    Simona Naspetti

    2015-09-01

    Full Text Available This study presents the results of an Italian investigation into the development of food quality for poultry meat in the organic sector, using the quality function deployment technique. The results show that among the characteristics of poultry, meat consumers assign greater importance to those that are strictly related to animal welfare issues. Price and product appearance (i.e., colour, presence of fat come in second. To meet these needs, producers can effectively operate along the supply chain by acting on poultry housing type, genotype lines, and stocking density. Information about these issues should then be shared with the consumers (i.e., clear product labelling.

  6. Implications of white striping and wooden breast abnormalities on quality traits of raw and marinated chicken meat.

    Science.gov (United States)

    Mudalal, S; Lorenzi, M; Soglia, F; Cavani, C; Petracci, M

    2015-04-01

    One of the consequences of intense genetic selection for growth of poultry is the recent appearance of abnormalities in chicken breast muscles, such as white striping (characterised by superficial white striations) and wooden breast (characterised by pale and bulged areas with substantial hardness). The aim of this study was to evaluate the quality traits of chicken fillets affected by white striping and wooden breast abnormalities. In two replications, 192 fillets were divided into the following four classes: normal (n=48; absence of any visual defects), white striping (n=48, presence of white striations), wooden breast (n=48; diffusely presence of hardened areas) and white striping/wooden breast (n=48; fillets affected by both abnormalities). Morphology, raw meat texture and technological properties were assessed in both unprocessed (pH, colour, drip loss, cooking loss and cooked meat shear force) and marinated meat (marinade uptake, purge loss, cooking loss and cooked meat shear force). Fillets affected by white striping, wooden breast or both abnormalities exhibited higher breast weights compared with normal fillets (305.5, 298.7, 318.3 and 244.7 g, respectively; Pcooking losses than white-striped fillets for both unprocessed and marinated meats. On the other hand, white-striped fillets showed a moderate decline in marinade and cooking yield. Fillets affected by both abnormalities had the highest (Pcooked meat, drip loss, purge loss and cooked meat shear force were negligible or relatively low and of little practical importance. Thus, the presence of white striping and wooden breast abnormalities impair not only breast meat appearance but also the quality of both raw and marinated meats mainly by reducing water holding/binding abilities.

  7. Prevalence and antibiotic resistance of Salmonella Enteritidis and Salmonella Typhimurium in raw chicken meat at retail markets in Malaysia.

    Science.gov (United States)

    Thung, T Y; Mahyudin, N A; Basri, D F; Wan Mohamed Radzi, C W J; Nakaguchi, Y; Nishibuchi, M; Radu, S

    2016-08-01

    Salmonellosis is one of the major food-borne diseases in many countries. This study was carried out to determine the occurrence of Salmonella spp., Salmonella Enteritidis, and Salmonella Typhimurium in raw chicken meat from wet markets and hypermarkets in Selangor, as well as to determine the antibiotic susceptibility profile of S. Enteritidis and S. Typhimurium. The most probable number (MPN) in combination with multiplex polymerase chain reaction (mPCR) method was used to quantify the Salmonella spp., S. Enteritidis, and S. Typhimurium in the samples. The occurrence of Salmonella spp., S. Enteritidis, and S. Typhimurium in 120 chicken meat samples were 20.80%, 6.70%, and 2.50%, respectively with estimated quantity varying from retail chicken meat could be a source of multiple antimicrobial-resistance Salmonella and may constitute a public health concern in Malaysia. © 2016 Poultry Science Association Inc.

  8. Human health risks associated with antimicrobial-resistant enterococci and Staphylococcus aureus on poultry meat

    DEFF Research Database (Denmark)

    Bortolaia, V.; Gongora, Carmen Espinosa; Guardabassi, L.

    2016-01-01

    health risks associated with the occurrence of these opportunistic human pathogens on poultry meat with particular focus on the risk of food-borne transmission of antimicrobial resistance. In the absence of conclusive evidence of transmission, this risk was inferred using data from scientific articles......-resistant S. aureus of livestock origin has been reported on poultry meat. In theory handling or ingestion of contaminated meat is a potential risk factor for colonization by methicillin-resistant S. aureus. However, this risk is presently regarded as negligible by public health authorities. Clinical......Enterococci and staphylococci are frequent contaminants on poultry meat. Enterococcus faecalis, Enterococcus faecium and Staphylococcus aureus are also well-known aetiological agents of a wide variety of infections resulting in major healthcare costs. This review provides an overview of the human...

  9. Application of a microbiological screening method for the indication of irradiation of poultry meat

    International Nuclear Information System (INIS)

    Wirtanen, G.; Karwoski, M.; Sjoberg, A.-M.; Salo, S.

    1996-01-01

    The FDA (Food and Drug Administration of the Department of Health and Human Services, USA) ruling of May 1990 permits the use of irradiation of fresh or frozen poultry and poultry parts, including ground and mechanically separated poultry products, at absorbed doses of 1.5 to 3 kGy to control foodborne pathogens and bacteria. The aim of this study was to apply a microbiological method (DEFT/APC) to assess the possible irradiation treatment of samples of frozen poultry meat. (author)

  10. Effectiveness of radiation processing in elimination of Campylobacter from poultry meat

    International Nuclear Information System (INIS)

    Raut, Amol D.; Shashidhar, Ravindranath; Bandekar, Jayant R.; Kapadnis, Balu P.

    2012-01-01

    Campylobacter, a common poultry intestine commensal, is a well known cause of human gastric illnesses across the globe. Consumption of contaminated poultry meat is a major cause of Campylobacter related infections. In the present study, radiation sensitivity of indigenous strains of C. jejuni and C. coli isolated from poultry was evaluated. The decimal reduction dose (D 10 ) values of different Campylobacter isolates at 0-4 o C in saline and blood broth were in the range of 0.120-0.210 kGy and 0.170-0.234 kGy, respectively. D 10 values in chicken meat homogenate for Campylobacter were in the range of 0.110-0.190 kGy. Chicken meat samples were inoculated with C. jejuni and exposed to gamma radiation to study the effectiveness of radiation treatment in elimination of Campylobacter. Radiation treatment with a dose of 1 kGy could achieve complete elimination of 10 5 CFU of Campylobacter/g in poultry meat samples. No recovery of Campylobacter was observed, even after enrichment and selective plating in 1 kGy treated chicken meat samples stored at 4 o C up to 7 days. Present study shows that irradiation of poultry meat with 1 kGy can ensure safety of poultry meat. - Highlights: → Campylobacter isolates were sensitive to gamma radiation. → Low dose of 1 kGy is effective for 5-log reduction of Campylobacter in chicken meat. → No recovery of Campylobacter in radiation processed samples during storage. → First report on radiation sensitivity of Indian Campylobacter isolates.

  11. Effectiveness of radiation processing in elimination of Campylobacter from poultry meat

    Energy Technology Data Exchange (ETDEWEB)

    Raut, Amol D. [Department of Microbiology, University of Pune, Pune, Ganeshkhind 411007 (India); Shashidhar, Ravindranath [Food Technology Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Bandekar, Jayant R., E-mail: jrb@barc.gov.in [Food Technology Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Kapadnis, Balu P. [Department of Microbiology, University of Pune, Pune, Ganeshkhind 411007 (India)

    2012-01-15

    Campylobacter, a common poultry intestine commensal, is a well known cause of human gastric illnesses across the globe. Consumption of contaminated poultry meat is a major cause of Campylobacter related infections. In the present study, radiation sensitivity of indigenous strains of C. jejuni and C. coli isolated from poultry was evaluated. The decimal reduction dose (D{sub 10}) values of different Campylobacter isolates at 0-4 {sup o}C in saline and blood broth were in the range of 0.120-0.210 kGy and 0.170-0.234 kGy, respectively. D{sub 10} values in chicken meat homogenate for Campylobacter were in the range of 0.110-0.190 kGy. Chicken meat samples were inoculated with C. jejuni and exposed to gamma radiation to study the effectiveness of radiation treatment in elimination of Campylobacter. Radiation treatment with a dose of 1 kGy could achieve complete elimination of 10{sup 5} CFU of Campylobacter/g in poultry meat samples. No recovery of Campylobacter was observed, even after enrichment and selective plating in 1 kGy treated chicken meat samples stored at 4 {sup o}C up to 7 days. Present study shows that irradiation of poultry meat with 1 kGy can ensure safety of poultry meat. - Highlights: > Campylobacter isolates were sensitive to gamma radiation. > Low dose of 1 kGy is effective for 5-log reduction of Campylobacter in chicken meat. > No recovery of Campylobacter in radiation processed samples during storage. > First report on radiation sensitivity of Indian Campylobacter isolates.

  12. Efficiency of Sanitary Treatment in Poultry Breeding and Poultry Meat Processing Plant

    Directory of Open Access Journals (Sweden)

    A. Kašková

    2006-01-01

    Full Text Available The aim of this study was to observe the effectiveness of disinfection on a broiler farm and in a plant processing the poultry from this farm. The broiler farm was disinfected with a preparation based on peracetic acid while a preparation based on quarternary ammonium salt was used in the processing plant. We evaluated swabs taken from surfaces, which come into contact with broilers and broiler meat. Results of the swabs taken by standard microbiological swabbing method were evaluated with results of the swabs taken by the ATP-bioluminescence method. The microbiological examination included total counts of microorganisms, coliform count and moulds. When using the standard plate counts method on the broiler farm we found that the plate counts in 0% of swabs were 100 CFU. In the processing plant, out of 22% of swabs 100. The bioluminescence method was applied only in the processing plant where 300 RLU were measured in 80, 10 and 10% of swabs, resp. Our observations and results allowed us to conclude that the disinfectants tested appeared suitable for the respective premises and the ATP bioluminescence method could be use as a as a suitable complement for detection of cleanliness of individual surfaces.

  13. An Immunoassay for Quantification of Contamination by Raw Meat Juice on Food Contact Surfaces.

    Science.gov (United States)

    Chen, Fur-Chi; Godwin, Sandria; Chambers, Edgar

    2016-11-01

    Raw chicken products often are contaminated with Salmonella and Campylobacter , which can be transmitted from packages to contact surfaces. Raw meat juices from these packages also provide potential media for cross-contamination. There are limited quantitative data on the levels of consumer exposure to raw meat juice during shopping for and handling of chicken products. An exposure assessment is needed to quantify the levels of transmission and to assess the risk. An enzyme-linked immunosorbent assay (ELISA) was developed and validated for quantitative detection of raw meat juice on hands and various food contact surfaces. Analytical procedures were designed to maximize the recovery of raw meat juice from various surfaces: hands, plastic, wood, stainless steel, laminated countertops, glass, and ceramics. The ELISA was based on the detection of a soluble muscle protein, troponin I (TnI), in the raw meat juice. The assay can detect levels as low as 1.25 ng of TnI, which is equivalent to less than 1 μl of the raw meat juice. The concentrations of TnI in the raw meat juices from 10 retail chicken packages, as determined by ELISA, were between 0.46 and 3.56 ng/μl, with an average of 1.69 ng/μl. The analytical procedures, which include swabbing, extraction, and concentration, enable the detection of TnI from various surfaces. The recoveries of raw meat juice from surfaces of hands were 92%, and recoveries from other tested surfaces were from 55% on plastic cutting boards to 75% on laminated countertops. The ELISA developed has been used for monitoring the transfer of raw meat juice during shopping for and handling of raw chicken products in our studies. The assay also can be applied to other raw meat products, such as pork and beef.

  14. Enzyme immunoassay and proteomic characterization of troponin I as a marker of mammalian muscle compounds in raw meat and some meat products.

    Science.gov (United States)

    Zvereva, Elena A; Kovalev, Leonid I; Ivanov, Alexei V; Kovaleva, Marina A; Zherdev, Anatoly V; Shishkin, Sergey S; Lisitsyn, Andrey B; Chernukha, Irina M; Dzantiev, Boris B

    2015-07-01

    The skeletal muscle protein troponin I (TnI) has been characterized as a potential thermally stable and species-specific biomarker of mammalian muscle tissues in raw meat and meat products. This study proposed a technique for the quantification of TnI comprising protein extraction and sandwich enzyme-linked immunosorbent assay (ELISA). The technique is characterized by a TnI detection limit of 4.8 ng/ml with quantifiable concentrations ranging from 8.7 to 52 ng/ml. The method was shown to be suitable for detection of TnI in mammalian (beef, pork, lamb, and horse) meat but not in poultry (chicken, turkey, and duck) meat. In particular, the TnI content in beef was 0.40 3 ± 0.058 mg/g of wet tissue. The TnI estimations obtained for the pork and beef samples using ELISA were comparable to the proteomic analysis results. Thus, the quantitative study of TnI can be a convenient way to assess the mammalian muscle tissue content of various meat products. Copyright © 2015. Published by Elsevier Ltd.

  15. The Formulation of Binding Agent Concentration on Raw Restructured Goat Meat Trimming Product

    Directory of Open Access Journals (Sweden)

    Rini Mastuti

    2012-02-01

    Full Text Available The utilization of raw materials and formulation method would affect the quality of the processed meat product. Therefore, a research on the processing method to produce a raw structured product should be conducted. The research was testing a single factor comprises of following parameters: control (without binding agent; 0.3%, 0.5% and 0.7% sodium alginat and 0.3%, 0.5% and 0.7% carragenan, respectively. The results showed that the goat meat trimming could be used as raw materials in the production of the best restructured meat using 0.5% carragenan. This raw restructured meat produced had a loss weight of 1.67%, pH value  7.89, WHC  48.345, and moisture content  75.20%.   Keywords : sodium alginat, carragenan, raw restructured goat meat trimming.

  16. Scientific and technical factors affecting the setting of Salmonella criteria for raw poultry: a global perspective

    NARCIS (Netherlands)

    Mead, G.; Lammerding, A.M.; Cox, N.; Doyle, M.P.; Humbert, F.; Kulikovskiy, A.; Panin, A.; Pinheiro do Nascimento, V.; Wierup, M.; Zwietering, M.H.

    2010-01-01

    Concerns about foodborne salmonellosis have led many countries to introduce microbiological criteria for certain food products. If such criteria are not well-grounded in science, they could be an unjustified obstacle to trade. Raw poultry products are an important part of the global food market.

  17. Artificial neural network as the tool in prediction rheological features of raw minced meat

    OpenAIRE

    Edyta Balejko; Zbigniew Nowak; Jerzy A. Balejko

    2012-01-01

      Background. The aim of the study was to elaborate a method of modelling and forecasting rheological features which could be applied to raw minced meat at the stage of mixture preparation with a given ingredient composition. Material and methods. The investigated material contained pork and beef meat, pork fat, fat substitutes, ice and curing mixture in various proportions. Seven texture parameters were measured for each sample of raw minced meat. The data obtained were processed us...

  18. Campylobacter radicidation of poultry meat by means of low dose ionizing radiation

    International Nuclear Information System (INIS)

    Tarjan, Veronika

    1984-01-01

    The effect of ionizing radiation on the number of sprouts of pathogenic Campylobacter was studied in the function of time, storage temperature and radiation dose. Culture-media and minced poultry meat treated with isolated bacteria were irradiated by sup(60)Co up to a dose of 1 kGy. It would be established that low irradiation doses of 3-5 kGy used to eliminate Salmonella infection satisfactorily destroy Campylobacter in chilled meat. (V.N.)

  19. Profile of selected bacterial counts and Salmonella prevalence on raw poultry in a poultry slaughter establishment.

    Science.gov (United States)

    James, W O; Williams, W O; Prucha, J C; Johnston, R; Christensen, W

    1992-01-01

    The USDA Food Safety and Inspection Service determined populations of bacteria on poultry during processing at a slaughter plant in Puerto Rico in November and December 1987. The plant was selected because of its management's willingness to support important changes in equipment and processing procedures. The plant was representative of modern slaughter facilities. Eight-hundred samples were collected over 20 consecutive 8-hour days of operation from 5 sites in the processing plant. Results indicated that slaughter, dressing, and chilling practices significantly decreased the bacterial contamination on poultry carcasses, as determined by counts of aerobic bacteria, Enterobacteriaceae, and Escherichia coli. Salmonella was not enumerated; rather, it was determined to be present or absent by culturing almost the entire rinse. The prevalence of Salmonella in the study decreased during evisceration, then increased during immersion chilling.

  20. Prevalence of Pathogens in Poultry Meat: A Meta-Analysis of European Published Surveys

    Directory of Open Access Journals (Sweden)

    Andiara Gonçalves-Tenório

    2018-05-01

    Full Text Available The objective of this study was to investigate and summarize the levels of incidence of Salmonella spp., Listeria monocytogenes, Staphylococcus aureus and Campylobacter spp. in poultry meat commercialized in Europe. After systematic review, incidence data and study characteristics were extracted from 78 studies conducted in 21 European countries. Pooled prevalence values from 203 extracted observations were estimated from random-effects meta-analysis models adjusted by pathogen, poultry type, sampling stage, cold preservation type, meat cutting type and packaging status. The results suggest that S. aureus is the main pathogen detected in poultry meat (38.5%; 95% CI: 25.4–53.4, followed by Campylobacter spp. (33.3%; 95% CI: 22.3–46.4%, while L. monocytogenes and Salmonella spp. present lower prevalence (19.3%; 95% CI: 14.4–25.3% and 7.10%; 95% CI: 4.60–10.8%, respectively. Despite the differences in prevalence, all pathogens were found in chicken and other poultry meats, at both end-processing step and retail level, in packed and unpacked products and in several meat cutting types. Prevalence data on cold preservation products also revealed that chilling and freezing can reduce the proliferation of pathogens but might not be able to inactivate them. The results of this meta-analysis highlight that further risk management strategies are needed to reduce pathogen incidence in poultry meat throughout the entire food chain across Europe, in particular for S. aureus and Campylobacter spp.

  1. Applying the Food Safety Objective and related concepts to thermal inactivation of Salmonella in poultry meat

    NARCIS (Netherlands)

    Membré, J.M.; Bassett, J.; Gorris, L.G.M.

    2007-01-01

    The objective of this study was to investigate the practicality of designing a heat treatment process in a food manufacturing operation for a product governed by a Food Safety Objective (FSO). Salmonella in cooked poultry meat was taken as the working example. Although there is no FSO for this

  2. Occurrence and Characterization of Salmonella Hiduddify from Chickens and Poultry Meat in Nigeria

    DEFF Research Database (Denmark)

    Raufu, I.; Hendriksen, Rene S.; Ameh, J.A.

    2009-01-01

    The objective of this study was to determine the prevalence of Salmonella serovars and the antimicrobial susceptibility in chickens and poultry meat products in rural areas in Nigeria. The study was an observational cross-sectional investigation in which the target population included exotic...

  3. 78 FR 19182 - Electronic Filing of Import Inspection Applications for Meat, Poultry, and Egg Products...

    Science.gov (United States)

    2013-03-29

    ...] Electronic Filing of Import Inspection Applications for Meat, Poultry, and Egg Products: Availability of..., and egg products through the Automated Commercial Environment (ACE). ACE is the Web- based portal for... products (21 U.S.C. 620, 466). The Egg Products Inspection Act (EPIA) (21 U.S.C. 1031 et seq.) prohibits...

  4. Standard Guide for Irradiation of Pre-packaged Processed Meat and Poultry Products to Control Pathogens and Other Microorganisms

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2005-01-01

    1.1 This guide outlines procedures for the irradiation of pre-packaged refrigerated and frozen processed meat and poultry products. Note 1—The Codex Alimentarius Commission defines "meat" (including poultry and game) as "the edible part of any mammal slaughtered in an abattoir," and "poultry meat" as "the edible part of slaughtered domesticated birds, including chicken, turkeys, ducks, geese, guinea-fowls, or pigeons." (CAC/RCP 13-1976) Note 2—Current U.S. regulations limit the definition of livestock species to cattle, sheep, swine, goat, horse, mule, or other equine and poultry species to chicken, turkey, duck, goose, and guinea (2, 3). 1.2 This guide addresses all refrigerated and frozen meat and poultry products NOT covered by Guide F 1356. 1.3 This guide provides information regarding absorbed doses used for inactivation of parasites and reduction of bacterial load. Such doses are typically less than 10 kilogray (kGy).

  5. Effect of radiation on tyrosine and tetracycline in poultry meat

    International Nuclear Information System (INIS)

    Vachin, I.; Pavlov, A.; Lashev, L.

    1994-01-01

    The effect of gamma rays on tissue level changes of unbound tyrosine and tetracycline was examined in comparative trials with broiler chicken meat. White meat and dark meat samples were taken from the killed chicken and were frozen at -18 o C. The three experimental groups were gamma irradiated with doses of 1.0, 1.5 and 2 kGy. The contents of the unbound antibiotics were microbiologically tested on 24th hour and 45th day after irradiation using Bacillus subtilis ATCC 6633, respectively Bac. mycoides HB 2 as test organisms. It was found that on 25th hour after irradiation both antibiotics were not significantly changed compared to the controls. After 45 days of storage a tendency towards decreasing the antibiotic concentrations in both the white and dark meat had been detected. (author)

  6. Properties of raw meat and meat curry from spent goat in relation with post-mortem handling conditions.

    Science.gov (United States)

    Narayan, Raj; Mendiratta, S K; Mane, B G

    2013-04-01

    The properties of raw meat and meat curry from spent goat meat in relation with post-mortem handling conditions were evaluated. The conditions evaluated were: cooking of meat within 1-2 h post-slaughter (condition 1); deboning meat storage at 25 ± 2 °C for 5-6 h and cooking (condition 2); post-slaughter storage of carcass at room temperature for 5-6 h, then deboning followed by storage of meat at refrigeration temperature for 5-6 h and cooking (condition 3); deboning and storage of meat at 25 ± 2 °C for 10-12 h and cooking (condition 4). Significant difference was observed in pH values in condition 1 (p meat as compared to the conditions 2, 3 and 4. However, the moisture content of cooked meat was significantly higher (p meat chunks, that is, the mean value was significantly higher (p < 0.01) for condition 2 and significantly lower for condition 1. Sensory scores were significantly higher in condition 1 and significantly lower in condition 2. However, sensory scores for condition 4 were almost similar to the condition 1.

  7. IMPROVING THE SYSTEM OF RAW MATERIAL SUPPLY OF THE MEAT INDUSTRY

    Directory of Open Access Journals (Sweden)

    A. M. Bukreev

    2013-01-01

    Full Text Available The article describes the characteristics of the process of improving the system raw materials supply of meat industry and presents the main factors, criteria, principles and algorithm rational distribution of the meat industry. The relevance of the research topic, in a globalized economy and Russia's accession to the WTO, caused by necessity to improve the system of raw material supply domestic enterprises and enhancing food security.

  8. Extending shelf life of poultry and red meat by irradiation processing

    International Nuclear Information System (INIS)

    Thayer, D.W.

    1993-01-01

    Research has demonstrated that ionizing radiation can inactivate parasites, eliminate or greatly reduce the populations of microbial pathogens, and extend the shelf life while preserving the desired nutritional and sensory properties of refrigerated poultry and red meats. Foodborne pathogens can be greatly reduced in population and sometimes completely eliminated from foods by low doses of ionizing radiation. The shelf life of poultry, pork, and beef can be significantly extended by treatment with ionizing radiation. Combination treatments with vacuum packaging or modified atmosphere packaging and ionizing radiation have produced better than predicted results. Additional research is needed on the combined processes

  9. Raw mechanically separated chicken meat and salmon protein hydrolysate as protein sources in extruded dog food

    DEFF Research Database (Denmark)

    Tjernsbekk, M. T.; Tauson, A. H.; Kraugerud, O. F.

    2017-01-01

    Protein quality was evaluated for mechanically separated chicken meat (MSC) and salmon protein hydrolysate (SPH), and for extruded dog foods where MSC or SPH partially replaced poultry meal (PM). Apparent total tract digestibility (ATTD) of crude protein (CP) and amino acids (AA) in the protein...

  10. OFFGEL electrophoresis and tandem mass spectrometry approach compared with DNA-based PCR method for authentication of meat species from raw and cooked ground meat mixtures containing cattle meat, water buffalo meat and sheep meat.

    Science.gov (United States)

    Naveena, Basappa M; Jagadeesh, Deepak S; Jagadeesh Babu, A; Madhava Rao, T; Kamuni, Veeranna; Vaithiyanathan, S; Kulkarni, Vinayak V; Rapole, Srikanth

    2017-10-15

    The present study compared the accuracy of an OFFGEL electrophoresis and tandem mass spectrometry-based proteomic approach with a DNA-based method for meat species identification from raw and cooked ground meat mixes containing cattle, water buffalo and sheep meat. The proteomic approach involved the separation of myofibrillar proteins using OFFGEL electrophoresis, SDS-PAGE and protein identification by MALDI-TOF MS. Species-specific peptides derived from myosin light chain-1 and 2 were identified for authenticating buffalo meat spiked at a minimum 0.5% level in sheep meat with high confidence. Relative quantification of buffalo meat mixed with sheep meat was done by quantitative label-free mass spectrometry using UPLC-QTOF and PLGS search engine to substantiate the confidence level of the data. In the DNA-based method, PCR amplification of mitochondrial D loop gene using species specific primers found 226bp and 126bp product amplicons for buffalo and cattle meat, respectively. The method was efficient in detecting a minimum of 0.5% and 1.0% when buffalo meat was spiked with cattle meat in raw and cooked meat mixes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Effect of organic poultry purchase frequency on consumer attitudes toward organic poultry meat.

    Science.gov (United States)

    Van Loo, Ellen; Caputo, Vincenzina; Nayga, Rodolfo M; Meullenet, Jean-Francois; Crandall, Philip G; Ricke, Steven C

    2010-09-01

    Because of the growing consumers' interest in organic meat, consumers' (N = 976) attitude toward organic meat was evaluated. Most respondents (59%) occasionally purchased organic chicken. To determine the organic chicken consumer profile, the organic chicken consumption frequencies of different demographic groups were compared. The results show dependence on age (P= 0.039) and ethnicity (P = 0.015). Older respondents as well as respondents who identified themselves as Caucasians tended to buy organic chicken more frequently. However, many other socio-demographic factors were not correlated with organic chicken consumption: gender (P = 0.185), education (P = 0.235), household income (0.867), living with partner or not (P = 0.235), and number of children (P = 0.883). Taste was identified as the most important meat quality attribute (perceived as [very] important by 94% of the respondents). Other important meat quality criteria were: general appearance, overall health, price, nutritional value, and containing no medical residues. "Organically produced" appeared to not be that important compared with other criteria. When respondents bought organic chicken more often, the importance of most of the meat quality attributes shifted to higher levels of importance, except for the price where an adverse effect was shown. The main motivation factors to buy organic chicken were the perception that organic chicken has fewer residues (pesticides, hormones, antibiotics), is safer, and healthier. The high price for organic meats was the strongest limiting factor for organic meat purchases followed by poor availability. Approximately 41% of the non-buyers and 30% of the occasional buyers perceived organic meat as not or hardly likely to be available in their supermarket. This study obtained a better knowledge of consumers' attitudes and perception of organic chicken as well as the effect of various demographics on the likelihood of buying organic chicken. For marketing purposes of

  12. Integration of a linear accelerator into a production line of mechanically deboned separated poultry meat

    International Nuclear Information System (INIS)

    Sadat, Theo; Volle, Christophe

    2000-01-01

    Linear accelerators, commonly called Linacs, are being used for different industrial processes. This kind of machine produces high power electron beams and can treat many products with a high throughput. The main application of a Linac is the sterilization of medical disposable devices, polymerization and decontamination of food products. Salmonella commonly contaminates poultry. Thanks to E-beam treatment, it eradicates the pathogen quickly and permits the use of meat that should have been thrown away because of its infection. The world's first Linac dedicated to treat mechanically deboned poultry meat is located in Brittany at the Societe des Proteines Industrielles. It is a Thomson CSF Linac product, the CIRCE II, with an energy of 10 MeV and a power of 10 kW. This Linac has been used for more than 8 years, and its technology is fully proven. (author)

  13. DEVELOPING MARKETING STRATEGY OF POULTRY MEAT SUPPLY IN EU- 28 COUNTRIES: MULTIVARIATE ANALYSIS APPROACH

    Directory of Open Access Journals (Sweden)

    Miro Simonič

    2016-03-01

    Full Text Available To create a concept of the marketing strategy, it is necessary to analyse the factors affecting the purchasing decisions of consumers. For the variables: production, import, export, and manufacturer's price we examine their impact on the marketing of poultry meat in the EU-28 in 2009 and 2011. Countries are grouped into clusters, their properties are analysed in relation to the mentioned variables. With multiple regression analysis, we find that there is a statistical correlation between high production and de-pending on the variable, and between the imports and exports as the independent vari-ables. Based on the analysed data in the researched countries, we conclude that the qualitative development of the production of poultry meat required implementing sophis-ticated agricultural policy with low inputs prices and exploit all available spare re-sources.

  14. Heterogeneous Risk Perceptions: The Case of Poultry Meat Purchase Intentions in Finland

    OpenAIRE

    Heikkil?, Jaakko; Pouta, Eija; Forsman-Hugg, Sari; M?kel?, Johanna

    2013-01-01

    This study focused on the heterogeneity of consumer reactions, measured through poultry meat purchase intentions, when facing three cases of risk. The heterogeneity was analysed by latent class logistic regression that included all three risk cases. Approximately 60% of the respondents belonged to the group of production risk avoiders, in which the intention to purchase risk food was significantly lower than in the second group of risk neutrals. In addition to socio-demographic variables, the...

  15. Prevalence and antibiotic resistance of Enterococcus spp. isolated from retail cheese, ready-to-eat salads, ham, and raw meat.

    Science.gov (United States)

    Pesavento, G; Calonico, C; Ducci, B; Magnanini, A; Lo Nostro, A

    2014-08-01

    Food specimens were analyzed in order to research Enterococcus spp.: 636 samples of raw meat (227 beef, 238 poultry, and 171 pork), 278 samples of cheese (110 fresh soft cheese and 168 mozzarella cheese), 214 samples of ready-to-eat salads, and 187 samples of ham. 312 strains of Enterococcus spp samples were isolated, then identified and submitted to susceptibility tests against 11 antimicrobial agents. The predominant species were Enterococcus faecalis in raw meat and Enterococcus faecium in retail products. Low percentages of microorganisms were resistant to vancomycin (3.53%), teicoplanin (2.24%), linezolid (0.32%), and amoxicillin in combination with clavulanic acid (0.32%). A high percentage of resistance was noted in E. faecalis at high level gentamicin (21.9%) and tetracycline (60.6%). In general, strains of E. faecalis were more resistant than E. faecium. Enterococci should be considered not only potential pathogens, but also a reservoir of genes encoding antibiotic resistance which can be transferred to other microorganisms. Continuous monitoring of their incidence and emerging resistance is important in order to identify foods which potentially represent a real risk to the population, and to ensure effective treatment of human enterococcal infections. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Research on the Sensorial Quality and Economic Efficiency in Obtaining of a certain Raw Meat Product - Mici Paste

    OpenAIRE

    Claudiu-Dan Salagean; Dorin Tibulca; Radu Marin

    2013-01-01

    Research aimed the sensorial quality connected with the economic efficiency to obtain a certain raw meat product (mici paste) in 4 experimental variants: 1 and 3 variants, with animal raw materials (meat + bacon) and mix of natural spices - fine grinding variant (1) and coarse grinding variant (3) - chopping at the volf through the sieve of 3-4 mm; 2 and 4 variants, with animal raw materials (meat + bacon) + vegetable protein supplements (textured soy protein) + binder (protein + fiber) + add...

  17. Dietary oxidized poultry offal fat: broiler performance and oxidative stability of thigh meat during chilled storage

    Directory of Open Access Journals (Sweden)

    AMC Racanicci

    2008-03-01

    Full Text Available Two experiments were conducted to evaluate the effects of dietary oxidized poultry offal fat on the performance of broilers and on the oxidative stability of dark chicken meat. One hundred and sixty male chicks were fed a corn-soybean meal diet containing 4% fresh or oxidized poultry fat from 10 to 47 days of age. Fresh fat was stored frozen until diets were produced, and oxidized fat was obtained by electrical heating (110 to 120 ºC. Birds were slaughtered at 47 days of age, and carcass characteristics were measured. Skinless and deboned thigh meat was stored chilled during 12 days, and samples were periodically collected to assess their quality and oxidative stability. Dietary oxidized fat did not affect bird performance or carcass characteristics. During chilled storage, meat color (L*, a* and b* was not affected by dietary treatments; however, TBARS (Thiobarbituric Acid Reactive Substances values were higher (P<0.05 in thigh meat from chickens fed the oxidized fat, indicating that oxidative stability was adversely affected.

  18. High pressure inactivation of relevant target microorganisms in poultry meat products and the evaluation of pressure-induced protein denaturation of marinated poultry under different high pressure treatments

    Science.gov (United States)

    Schmidgall, Johanna; Hertel, Christian; Bindrich, Ute; Heinz, Volker; Toepfl, Stefan

    2011-03-01

    In this study, the possibility of extending shelf life of marinated poultry meat products by high pressure processing was evaluated. Relevant spoilage and pathogenic strains were selected and used as target microorganisms (MOs) for challenge experiments. Meat and brine were inoculated with MOs and treated at 450 MPa, 4 °C for 3 min. The results of inactivation show a decreasing pressure tolerance in the series Lactobacillus > Arcobacter > Carnobacterium > Bacillus cereus > Brochothrix thermosphacta > Listeria monocytogenes. Leuconostoc gelidum exhibited the highest pressure tolerance in meat. A protective effect of poultry meat was found for L. sakei and L. gelidum. In parallel, the influence of different marinade formulations (pH, carbonates, citrates) on protein structure changes during a pressure treatment was investigated. Addition of sodium carbonate shows a protection against denaturation of myofibrillar proteins and provides a maximum water-holding capacity. Caustic marinades allowed a higher retention of product characteristics than low-pH marinades.

  19. Isolation and characterization of avian influenza viruses from raw poultry products illegally imported to Japan by international flight passengers.

    Science.gov (United States)

    Shibata, A; Hiono, T; Fukuhara, H; Sumiyoshi, R; Ohkawara, A; Matsuno, K; Okamatsu, M; Osaka, H; Sakoda, Y

    2018-04-01

    The transportation of poultry and related products for international trade contributes to transboundary pathogen spread and disease outbreaks worldwide. To prevent pathogen incursion through poultry products, many countries have regulations about animal health and poultry product quarantine. However, in Japan, animal products have been illegally introduced into the country in baggage and confiscated at the airport. Lately, the number of illegally imported poultry and the incursion risk of transboundary pathogens through poultry products have been increasing. In this study, we isolated avian influenza viruses (AIVs) from raw poultry products illegally imported to Japan by international passengers. Highly (H5N1 and H5N6) and low (H9N2 and H1N2) pathogenic AIVs were isolated from raw chicken and duck products carried by flight passengers. H5 and H9 isolates were phylogenetically closely related to viruses isolated from poultry in China, and haemagglutinin genes of H5N1 and H5N6 isolates belonged to clades 2.3.2.1c and 2.3.4.4, respectively. Experimental infections of H5 and H9 isolates in chickens and ducks demonstrated pathogenicity and tissue tropism to skeletal muscles. To prevent virus incursion by poultry products, it is important to encourage the phased cleaning based on the disease control and eradication and promote the reduction in contamination risk in animal products. © 2017 Blackwell Verlag GmbH.

  20. Volatiles in raw and cooked meat from lambs fed olive cake and linseed.

    Science.gov (United States)

    Gravador, R S; Serra, A; Luciano, G; Pennisi, P; Vasta, V; Mele, M; Pauselli, M; Priolo, A

    2015-04-01

    This study was conducted to determine the effects of feeding olive cake and linseed to lambs on the volatile organic compounds (VOCs) in raw and cooked meat. Four groups of eight male Appenninica lambs each were fed: conventional cereal-based concentrates (diet C), concentrates containing 20% on a dry matter (DM) basis of rolled linseed (diet L), concentrates containing 35% DM of stoned olive cake (diet OC), or concentrates containing both rolled linseed (10% DM) and stoned olive cake (17% DM; diet OCL). The longissimus dorsi muscle of each lamb was sampled at slaughter and was subjected to VOC profiling through the use of SPME-GC-MS. In the raw meat, the concentration of 3-methylpentanoic acid was higher in treatment C as compared with treatments L, OC and OCL (Pcooked meat the amount of 1-pentanol was higher in treatment C than in treatment OC (Plamb meat.

  1. Meat species identification and Halal authentication using PCR analysis of raw and cooked traditional Turkish foods.

    Science.gov (United States)

    Ulca, Pelin; Balta, Handan; Çağın, Ilknur; Senyuva, Hamide Z

    2013-07-01

    The method performance characteristics of commercially available PCR kits for animal species identification were established. Comminuted meat products containing different levels of pork were prepared from authentic beef, chicken, and turkey. These meat products were analysed in the raw state and after cooking for 20 min at 200 °C. For both raw and cooked meats, the PCR kit could correctly identify the animal species and could reliably detect the addition of pork at a level below 0.1%. A survey of 42 Turkish processed meat products such as soudjouk, salami, sausage, meatball, cured spiced beef and doner kebap was conducted. Thirty-six samples were negative for the presence of pork (meatball sample labelled as 100% beef was found to contain chicken. Another turkey meatball sample was predominantly chicken. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Dietary vitamin E affects lipid oxidation and total volatiles of irradiated raw turkey meat

    International Nuclear Information System (INIS)

    Ahn, D.U.; Sell, J.L.; Jeffery, M.; Jo, C.; Chen, X.; Lee, J.I.

    1997-01-01

    Breast and leg meat patties, prepared from turkeys fed diets containing 25, 200, 400 or 600 IU of dl-alpha-tocopheryl acetate (TA) per kg diet, were irradiated at 0 or 2.5 kGy with vacuum or loose packaging. The effects of dietary TA on storage stability and production of volatiles in irradiated raw turkey meat were determined. Dietary TA at 200 IU/kg decreased lipid oxidation and reduced total volatiles of raw turkey patties after 7-days of storage. However, the antioxidant effects of dietary TA were more notable when the patties were loosely packaged than when vacuum-packaged. Irradiation increased lipid oxidation of raw turkey meats only when loosely packaged but had limited effects on formation of total volatiles after storage at 4 degrees C for 7 days or longer

  3. Listeria monocytogenes in retailed raw chicken meat in Turkey.

    Science.gov (United States)

    Siriken, Belgin; Ayaz, Naim Deniz; Erol, Irfan

    2014-01-01

    The objectives of this study were, to find the prevalence and antimicrobial resistance of L. monocytogenes from a total of 116 chicken meat samples including 50 carcasses and 66 meat parts marketed in Turkey between 2008 and 2009 using immunomagnetic separation (IMS) based cultivation technique, to detect the hlyA gene for the verification of the isolates by PCR, and to identify the genoserotypes of the L. monocytogenes isolates by multiplex PCR assay. In the study, 51 L. monocytogenes colonies were isolated from 34 (29.3%) chicken meat samples (eleven [22.0%] carcasses and 23 [34.8%] pieces of meat) by IMS based cultivation technique and confirmed by PCR. According to the multiplex PCR results, all the 51 isolates were identified as genoserotype IIa (1/2a or 3a). L. monocytogenes isolates were also tested for their susceptibility to eight antibiotic (gentamicin, vancomycin, chloramphenicol, streptomycin, tetracycline, ampicillin, penicillin G, erythromycin) agents using the disk diffusion method. 14 isolates (27.45%) were susceptible to all eight antimicrobials drugs tested and the remaining 37 isolates (72.54%) were resistant to gentamicin (one isolate, 1.96%), vancomycin (four isolates, 7.84%), penicillin G (six isolates, 11.76%), streptomycin (nine isolates, 17.64%; resistant or intermediate), tetracycline (seven isolates, 13.72%) and ampicillin (six isolates, 11.76%). This study showed that antimicrobial resistance is not highly prevalent in L. monocytogenes isolated from chicken carcasses and pieces of meat. The presence of L. monocytogenes in chicken samples suggests an importance of this pathogen in chicken.

  4. Artificial neural network as the tool in prediction rheological features of raw minced meat.

    Science.gov (United States)

    Balejko, Jerzy A; Nowak, Zbigniew; Balejko, Edyta

    2012-01-01

    The aim of the study was to elaborate a method of modelling and forecasting rheological features which could be applied to raw minced meat at the stage of mixture preparation with a given ingredient composition. The investigated material contained pork and beef meat, pork fat, fat substitutes, ice and curing mixture in various proportions. Seven texture parameters were measured for each sample of raw minced meat. The data obtained were processed using the artificial neural network module in Statistica 9.0 software. The model that reached the lowest training error was a multi-layer perceptron MLP with three neural layers and architecture 7:7-11-7:7. Correlation coefficients between the experimental and calculated values in training, verification and testing subsets were similar and rather high (around 0.65) which indicated good network performance. High percentage of the total variance explained in PCA analysis (73.5%) indicated that the percentage composition of raw minced meat can be successfully used in the prediction of its rheological features. Statistical analysis of the results revealed, that artificial neural network model is able to predict rheological parameters and thus a complete texture profile of raw minced meat.

  5. Data concerning radioactive pollution of poultry meat in the period following the Csernobil disaster [poultry, rabbit and game meat

    International Nuclear Information System (INIS)

    Szabo, S.A.

    1990-01-01

    Zones showing different degress of pollution appeared in Hungary following the Csernobil disaster, mainly as a function of climatic conditions /wind direction, rainfall/ prevailing in May 1986. The measurements carried out made possible to separate four degrees of pollution zones. The amounts of radiocaesium /134Cs, 137Cs, radioiodine /131I/, radiostrontium /90Sr/ and plutonium /239Pu/ pollution were examined in chicken-duck-goose-rabbit-roe-deer-pheasant-pigeon-wild duck, haremeat, as well as in duck and goose liver. The 131I, 134Cs and 137Cs activity was the highest in the period between May and August, 1986, in the duckmeat and duckliver. The greates caesium contamination was shown in roe-meat /155 Bq/kg/, the smallest in the pheasant 8 Bq/kg/ and haremeat /3 Bq/kg/. The difference can be explained by the diverse feeding-dietary circumstances and the different discriminative capacity of the various animal organisms concerning radionuclides

  6. The Influence of Stunning Method, Refrigeration and Freezing Time on the Rheological and Textural Properties of Raw Meat

    Directory of Open Access Journals (Sweden)

    Liliana Tudoreanu

    2013-11-01

    Full Text Available The present research was conducted to provide information on the influence of stunning methods in conjunction with refrigeration and freezing time on the textural and rheological properties of raw meat. Pork raw meat, commercially available, was analyzed for textural properties such as hardness, cohesiveness, adhesiveness and fracture force. Sample were analyzed fresh, after 3 days of refrigeration, and 15 days, 30days and 60 days freezing time in commercially available refrigerators mimicking the storing conditions used by consumers. For pork raw meat, hardness increased sharply after 3 days of refrigeration and showed no significant differences after 15days of freezing compared to 3days refrigeration time. After 30 days of freezing the raw pork meat samples’ hardness decreased significantly compared to the hardness of the samples freeze for15 days. Hardness of gas stunning raw pork meat samples compared to electrical stunning raw pork meat samples was 2.57 times higher indicating a better firmness of the gas stunning raw pork meat. The cohesiveness of the raw pork meat from gas stunned animals maintained its levels after 60 days of freezing while the meat from electrically stunned animals showed significant modificatio

  7. High-performance liquid chromatography method validation for determination of tetracycline residues in poultry meat

    Directory of Open Access Journals (Sweden)

    Vikas Gupta

    2014-01-01

    Full Text Available Background: In this study, a method for determination of tetracycline (TC residues in poultry with the help of high-performance liquid chromatography technique was validated. Materials and Methods: The principle step involved in ultrasonic-assisted extraction of TCs from poultry samples by 2 ml of 20% trichloroacetic acid and phosphate buffer (pH 4, which gave a clearer supernatant and high recovery, followed by centrifugation and purification by using 0.22 μm filter paper. Results: Validity study of the method revealed that all obtained calibration curves showed good linearity (r2 > 0.999 over the range of 40-4500 ng. Sensitivity was found to be 1.54 and 1.80 ng for oxytetracycline (OTC and TC. Accuracy was in the range of 87.94-96.20% and 72.40-79.84% for meat. Precision was lower than 10% in all cases indicating that the method can be used as a validated method. Limit of detection was found to be 4.8 and 5.10 ng for OTC and TC, respectively. The corresponding values of limit of quantitation were 11 and 12 ng. Conclusion: The method reliably identifies and quantifies the selected TC and OTC in the reconstituted poultry meat in the low and sub-nanogram range and can be applied in any laboratory.

  8. Survey of Aspergillus and Fusarium species and their mycotoxins in raw materials and poultry feeds from Córdoba, Argentina.

    Science.gov (United States)

    Monge, María Del Pilar; Magnoli, Carina Elizabeth; Chiacchiera, Stella Maris

    2012-05-01

    The aims of the present work were: (1) to determine both mycobiota in raw materials and finisher poultry feed, as well as the ability to produce aflatoxin B1 by A. flavus strains, and (2) to evaluate the natural co-occurrence of aflatoxins (AFs), fumonisins (FBs), gliotoxin, diacetoxyscirpenol (DAS), HT-2 toxin, and T-2 toxin in poultry feed by LC-MS/MS. Nineteen percent of raw materials and 79% of finisher poultry feed samples exceeded the maximum allowed total fungal count (1 × 10(4) CFU g(-1)) to ensure hygienic quality. Aspergillus flavus was the only species belonging to section Flavi which was isolated while Fusarium verticilliodes was the prevalent species. Forty-seven percent of A. flavus strains were aflatoxin B1 producers and the highest frequency of aflatoxigenic strains was isolated from finisher poultry feeds. Principal component analysis showed that corn grains are closely related with total fungal and Fusarium counts. This positive relationship suggests that total fungal and Fusarium spp. counts in poultry feed might come mainly from corn grains. Regarding poultry feeds, in ground finisher type, Aspergillus spp. counts increased as water activity (aw) diminished. A positive relationship among aw, total fungal and Fusarium spp. counts was observed in both ground finisher and ground starter feed. Several mycotoxins were monitored in feeds by applying the LC MS/MS technique. One hundred percent of poultry samples were contaminated with FB1, and the highest levels were detected in pelleted finisher poultry. AFB1, gliotoxin, DAS, HT-2 toxin, and T-2 toxin were not detected in any poultry feed. The scarcity of available mycotoxicological studies from Argentinean poultry feed using a multitoxin analysis technique enhances the contribution of the findings of this report.

  9. Prevalence and antimicrobial resistance of listeria species isolated from different types of raw meat in Iran.

    Science.gov (United States)

    Rahimi, Ebrahim; Yazdi, Farzad; Farzinezhadizadeh, Hussein

    2012-12-01

    Listeria and particularly Listeria monocytogenes are important foodborne pathogens that can cause listeriosis and severe complications in immunocompromised individuals, children, pregnant women, and the elderly. The objective of this study was to determine the prevalence of Listeria spp. in raw meat in Iran. From July 2010 to November 2011, a total of 1,107 samples of various raw meats were obtained from randomly selected retail butcher shops. The results of conventional bacteriologic and PCR methods revealed that 141 samples (12.7%) were positive for Listeria spp. The highest prevalence of Listeria was found in raw buffalo meat samples (7 of 24 samples; 29.2%) followed by quail meat (26 of 116 samples; 22.4%), partridge meat (13 of 74 samples; 17.6%), and chicken meat (27 of 160 samples; 16.9%). The most common species recovered was Listeria innocua (98 of 141 strains; 75.9 % ); the remaining isolates were L. monocytogenes (19.1% of strains), Listeria welshimeri (6.4% of strains), Listeria seeligeri (3.5% of strains), and Listeria grayi (1.4% of strains). Susceptibilities of the 141 strains to 11 antimicrobial drugs were determined using the disk diffusion assay. Overall, 104 (73.8%) of the Listeria isolates were resistant to one or more antimicrobials, and 17.0% of the isolates were resistant to three or more antimicrobials. The present study provides the first baseline data on the prevalence of Listeria in raw meat derived from sheep, goat, buffalo, quail, partridge, chicken, and ostrich in Iran and the susceptibility of these isolates to antimicrobials.

  10. Escherichia coli and urinary tract infections: the role of poultry-meat.

    Science.gov (United States)

    Manges, A R

    2016-02-01

    Extraintestinal pathogenic Escherichia coli (ExPEC) is the most common cause of community-acquired and hospital-acquired extraintestinal infections. The hypothesis that human ExPEC may have a food animal reservoir has been a topic of investigation by multiple groups around the world. Experimental studies showing the shared pathogenic potential of human ExPEC and avian pathogenic E. coli suggest that these extraintestinal E. coli may be derived from the same bacterial lineages or share common evolutionary roots. The consistent observation of specific human ExPEC lineages in poultry or poultry products, and rarely in other meat commodities, supports the hypothesis that there may be a poultry reservoir for human ExPEC. The time lag between human ExPEC acquisition (in the intestine) and infection is the fundamental challenge facing studies attempting to attribute ExPEC transmission to poultry or other environmental sources. Even whole genome sequencing efforts to address attribution will struggle with defining meaningful genetic relationships outside of a discrete food-borne outbreak setting. However, if even a fraction of all human ExPEC infections, especially antimicrobial-resistant ExPEC infections, is attributable to the introduction of multidrug-resistant ExPEC lineages through contaminated food product(s), the relevance to public health, food animal production and food safety will be significant. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  11. Role of poultry meat in a balanced diet aimed at maintaining health and wellbeing: an Italian consensus document

    Directory of Open Access Journals (Sweden)

    Franca Marangoni

    2015-06-01

    Full Text Available The relationship between the consumption of meat and health is multifaceted, and it needs to be analyzed in detail, with specific attention to the relevant differences that characterize the effects of the different meat types, as yet considered by only a limited literature. A variable but moderate energy content, highly digestible proteins (with low levels of collagen of good nutritional quality, unsaturated lipids (mainly found in the skin and easily removed, B-group vitamins (mainly thiamin, vitamin B6, and pantothenic acid, and minerals (like iron, zinc, and copper make poultry meat a valuable food. Epidemiological studies performed across the world, in highly diverse populations with different food preferences and nutritional habits, provide solid information on the association between poultry consumption, within a balanced diet, and good health. Consumption of poultry meat, as part of a vegetable-rich diet, is associated with a risk reduction of developing overweight and obesity, cardiovascular diseases, and type 2 diabetes mellitus. Also, white meat (and poultry in particular is considered moderately protective or neutral on cancer risk. The relevance of poultry meat for humans also has been recognized by the UN Food and Agricultural Organization (FAO, who considers this widely available, relatively inexpensive food to be particularly useful in developing countries, where it can help to meet shortfalls in essential nutrients. Moreover, poultry meat consumption also contributes to the overall quality of the diet in specific ages and conditions (prior to conception, during pregnancy up to the end of breastfeeding, during growth, and in the geriatric age and is suitable for those who have an increased need for calorie and protein compared to the general population.

  12. Role of poultry meat in a balanced diet aimed at maintaining health and wellbeing: an Italian consensus document

    Science.gov (United States)

    Marangoni, Franca; Corsello, Giovanni; Cricelli, Claudio; Ferrara, Nicola; Ghiselli, Andrea; Lucchin, Lucio; Poli, Andrea

    2015-01-01

    The relationship between the consumption of meat and health is multifaceted, and it needs to be analyzed in detail, with specific attention to the relevant differences that characterize the effects of the different meat types, as yet considered by only a limited literature. A variable but moderate energy content, highly digestible proteins (with low levels of collagen) of good nutritional quality, unsaturated lipids (mainly found in the skin and easily removed), B-group vitamins (mainly thiamin, vitamin B6, and pantothenic acid), and minerals (like iron, zinc, and copper) make poultry meat a valuable food. Epidemiological studies performed across the world, in highly diverse populations with different food preferences and nutritional habits, provide solid information on the association between poultry consumption, within a balanced diet, and good health. Consumption of poultry meat, as part of a vegetable-rich diet, is associated with a risk reduction of developing overweight and obesity, cardiovascular diseases, and type 2 diabetes mellitus. Also, white meat (and poultry in particular) is considered moderately protective or neutral on cancer risk. The relevance of poultry meat for humans also has been recognized by the UN Food and Agricultural Organization (FAO), who considers this widely available, relatively inexpensive food to be particularly useful in developing countries, where it can help to meet shortfalls in essential nutrients. Moreover, poultry meat consumption also contributes to the overall quality of the diet in specific ages and conditions (prior to conception, during pregnancy up to the end of breastfeeding, during growth, and in the geriatric age) and is suitable for those who have an increased need for calorie and protein compared to the general population. PMID:26065493

  13. Role of poultry meat in a balanced diet aimed at maintaining health and wellbeing: an Italian consensus document.

    Science.gov (United States)

    Marangoni, Franca; Corsello, Giovanni; Cricelli, Claudio; Ferrara, Nicola; Ghiselli, Andrea; Lucchin, Lucio; Poli, Andrea

    2015-01-01

    The relationship between the consumption of meat and health is multifaceted, and it needs to be analyzed in detail, with specific attention to the relevant differences that characterize the effects of the different meat types, as yet considered by only a limited literature. A variable but moderate energy content, highly digestible proteins (with low levels of collagen) of good nutritional quality, unsaturated lipids (mainly found in the skin and easily removed), B-group vitamins (mainly thiamin, vitamin B6, and pantothenic acid), and minerals (like iron, zinc, and copper) make poultry meat a valuable food. Epidemiological studies performed across the world, in highly diverse populations with different food preferences and nutritional habits, provide solid information on the association between poultry consumption, within a balanced diet, and good health. Consumption of poultry meat, as part of a vegetable-rich diet, is associated with a risk reduction of developing overweight and obesity, cardiovascular diseases, and type 2 diabetes mellitus. Also, white meat (and poultry in particular) is considered moderately protective or neutral on cancer risk. The relevance of poultry meat for humans also has been recognized by the UN Food and Agricultural Organization (FAO), who considers this widely available, relatively inexpensive food to be particularly useful in developing countries, where it can help to meet shortfalls in essential nutrients. Moreover, poultry meat consumption also contributes to the overall quality of the diet in specific ages and conditions (prior to conception, during pregnancy up to the end of breastfeeding, during growth, and in the geriatric age) and is suitable for those who have an increased need for calorie and protein compared to the general population.

  14. Survival of Salmonella Copenhagen in food bowls following contamination with experimentally inoculated raw meat: Effects of time, cleaning, and disinfection

    OpenAIRE

    Weese, J Scott; Rousseau, J.

    2006-01-01

    There are concerns regarding the safety of feeding raw meat to household pets. This study demonstrated that Salmonella persists in food bowls that are inoculated with Salmonella-containing raw meat. Standard methods of cleaning and disinfection were minimally effective at eliminating Salmonella contamination.

  15. Zoonotic bacteria and parasites found in raw meat-based diets for cats and dogs.

    NARCIS (Netherlands)

    van Bree, Freek P J; Bokken, Gertie C A M; Mineur, Robin; Franssen, Frits; Opsteegh, Marieke; van der Giessen, Joke W B; Lipman, Len J A; Overgaauw, Paul A M

    2018-01-01

    Feeding raw meat-based diets (RMBDs) to companion animals has become increasingly popular. Since these diets may be contaminated with bacteria and parasites, they may pose a risk to both animal and human health. The purpose of this study was to test for the presence of zoonotic bacterial and

  16. Radiotracer studies of agrochemical residues in meat, milk and related products of livestock and poultry

    International Nuclear Information System (INIS)

    1987-01-01

    The joint FAO/IAEA programme was initiated in 1981 and terminates with this report. The specific objectives of the programme have been to evaluate the magnitude, fate and significance of agricultural chemical residues in edible tissues and by-products of livestock and poultry, aided by radiotracer techniques. It was anticipated that the data arising from studies conducted under this programme would be useful in assessing the toxicological significance of studied chemicals to exposed animals and to humans who may consume potentially polluted meat, milk or eggs. A separate abstract was prepared for each of the 13 papers in this report

  17. Freezing of meat raw materials affects tyramine and diamine accumulation in spontaneously fermented sausages.

    Science.gov (United States)

    Bover-Cid, Sara; Miguelez-Arrizado, M Jesús; Luz Latorre Moratalla, L; Vidal Carou, M Carmen

    2006-01-01

    Biogenic amine accumulation was studied in spontaneously fermented sausages (Fuet) manufactured from unfrozen-fresh meat (U-sausages) and frozen-thawed meat (F-sausages). The aim was to investigate whether the frozen storage of raw materials affects the microbial composition and its aminogenic activity during sausage fermentation. Tyramine was the major amine in all sausages. Although the final levels were similar, tyramine accumulated more rapidly in F-sausages, which contained putrescine as the second amine. By contrast, U-sausages accumulated much more cadaverine than putrescine. F-sausages showed a slightly lower pH and free amino acid content as well as higher counts of technological flora (lactic acid and gram positive catalase positive bacteria) and lower counts of enterobacteria. Therefore, to freeze the meat raw materials for few days before sausage manufacture could be a useful practice, especially for the artisan fermented sausages (without starter), because it helps to reduce enterobacteria development and cadaverine production.

  18. New scientific challenges - the possibilities of using selenium in poultry nutrition and impact on meat quality

    Science.gov (United States)

    Marković, R.; Glišić, M.; Bošković, M.; Baltić, M. Ž.

    2017-09-01

    Physiological stress is one of many concerns facing modern broiler production. In conditions when birds are exposed to stress, supplementation of selenium, which is a crucial glutathione peroxidase enzymatic cofactor, increases the antioxidant capacity of the animals and decreases the harmful effects of free radicals. Dietary selenium improves production performance and health of animals, and positively affects the immune system, the quality, selenium content and fatty acid composition of meat and eggs. There are several different forms of selenium, the most common dietary supplements being an inorganic form (sodium selenite) and anorganic form (selenomethionine). However, in recent years, new forms of selenium, such as a 2-hydroxy-4-methylselenobutanoic acid (HMSeBA) and nanoselenium, which have more bioavailability, bioefficacy, and low toxicity have been designed. In this short comparative overview discusses the effects of inorganic, organic and nanoforms of selenium on production results, glutathione peroxidase activity, meat quality and level of toxicity in poultry.

  19. Microbiological characteristics of poultry meats - Results of inspections carried out in the province of Milano, Italy

    Directory of Open Access Journals (Sweden)

    Guido Grilli

    2010-01-01

    Full Text Available Examinations were conducted in terms of microbiological quality/quantity (TMC, Coliforms, E. coli, S. aureus, Sulphate-reducing Clostridia, B. cereus, Salmonella spp. and Lysteria spp. and Campylobacter spp. on 240 poultry meat samples (chicken, turkey and quail acquired pursuant to the standards set by the Regional Plan of programming and coordination in the field of operations concerning official inspections of Lombardia animal origin and by a few private companies for self-inspection. The TMC was consistently low and in line with reports in the literature, as was the case with coliforms, E. coli, S. aureus, sulphatereducing Clostrides and B. cereus. In the case of Salmonella spp., only 5 samples tested positive: one for S. typhimurium and one for S. enteritidis (chicken; only one sample from turkey tested positive for S. blokley, and two out of five samples analysed from quail tested positive result for S. typhimurium. About 3% of the samples analyzed tested positive for Listeria monocitogenes, but they were within the legal limits. Research on Campylobacter thermophiles has involved only 50 samples, of which only 5 have tested positive. These results confirm the high quality of hygiene and cleanliness of poultry meat, in accordance with that reported in the national literature and with respect to EU norms.

  20. Prevalence and Characteristics of Salmonella and Campylobacter in Retail Poultry Meat in Japan.

    Science.gov (United States)

    Furukawa, Ichiro; Ishihara, Tomoe; Teranishi, Hiroshi; Saito, Shioko; Yatsuyanagi, Jun; Wada, Eriko; Kumagai, Yuko; Takahashi, Shiho; Konno, Takayuki; Kashio, Hiroko; Kobayashi, Akihiko; Kato, Naoki; Hayashi, Ken-Ichi; Fukushima, Keisuke; Ishikawa, Kazuhiko; Horikawa, Kazumi; Oishi, Akira; Izumiya, Hidemasa; Ohnishi, Takahiro; Konishi, Yoshiko; Kuroki, Toshiro

    2017-05-24

    This study was performed to determine the prevalence, antimicrobial susceptibility, and genetic relatedness of Salmonella enterica subsp. enterica and Campylobacter spp. in poultry meat, and to analyze the association of genetic types of these bacteria with their geographical distribution and antimicrobial resistance profiles. Salmonella and Campylobacter isolates have been detected, respectively, in 54 and 71 samples out of 100 samples tested. Nine Salmonella serotypes were found, including S. enterica subsp. enterica serovar Infantis (33%), Schwarzengrund (12%), Manhattan (9%), and others. Campylobacter jejuni and C. coli were detected in 64 (64%) and 14 (14%) samples, respectively. S. enterica subsp. enterica isolates were very frequently resistant to tetracycline (78.3%) and streptomycin (68.3%). Many C. jejuni and C. coli isolates were resistant to sulfamethoxazole/trimethoprim (90.5%), nalidixic acid (47.3%), ampicillin (45.9%), and ciprofloxacin (40.5%). Cluster analysis was performed for the Salmonella isolates using pulsed-field gel electrophoresis (PFGE) data. For Campylobacter isolates, the cluster analysis was based on both PFGE and comparative genomic fingerprinting. The molecular typing results were compared with the information about antimicrobial resistance and geographical locations in which the poultry meat was produced. This analysis revealed that C. jejuni strains with a particular genotype and antimicrobial resistance profile are spreading in specific areas of Japan.

  1. Supplying the energy demand in the chicken meat processing poultry with biogas

    Directory of Open Access Journals (Sweden)

    Adriano Henrique Ferrarez

    2016-01-01

    Full Text Available The main use of electrical energy in the chicken meat processing unit is refrigeration. About 70% of the electricity is consumed in the compressors for the refrigeration system. Through this study, the energetic viability of using biogas from poultry litter in supplying the demand for the refrigeration process was found. The meat processing unit studied has the potential to process about a hundred and sixty thousand chickens a day. The potential biogas production from poultry litter is 60,754,298.91 m3.year-1. There will be a surplus of approximately 8,103MWh per month of electric energy generated from biogas. An economic analysis was performed considering a planning horizon of 20 years and the discount rate of 12% per year. The economic analysis was performed considering scenario 1: sale of all electricity generated by the thermoelectric facility, and scenario 2: sale of the surplus electricity generated after complying with the demands of the refrigeration process and all other electrical energy and thermal energy use. Economic indicators obtained for scenarios 1 and 2 were favorable for the project implementation.

  2. Injuries of Repetitive Efforts in Workers from the Poultry Meat Industry: A Bibliometric Analysis of Literature

    Directory of Open Access Journals (Sweden)

    Alexandre Crespo Coelho S. Pinto

    2018-01-01

    Full Text Available Injuries of repetitive efforts constitute one of the prime causes of absenteeism in the workplace, bear a considerable cost for the public health system and can cast doubt on the sustainability of a company. The objective of this paper is to build, in the researchers, the needed knowledge to choose a set of relevant scientific articles about repetitive strain injuries in the poultry meat industry, aiming to identify characteristics in those scientific publications that have the potential to contribute to the topic of this paper. The research is characterized as exploratory-descriptive, and draws on primary and secondary data sources. The study involves the application of a method for the selection and analysis of the selected articles. To this end, the method utilized was the knowledge development process—constructivist (Proknow-C, as the theoretical intervention instrument. Within the process development, a portfolio of 16 articles aligned to the research and scientifically recognized with the main periodicals, papers, authors and keywords was obtained. The ProKnow-C process allowed us to identify opportunities in the literature about injuries in the poultry meat industry and showed opportunities for future research. This paper, under the constructivist perspective, presents a structured process to build, in the researcher, the necessary knowledge for the identification, selection and analysis of relevant scientific articles relating to research context and, for these articles, find prominences and opportunities for a research theme without similar publications.

  3. THE SCIENTIFIC APPROACH OF DETERMINATION POULTRY GRADE AND POULTRY PRODUCTS

    Directory of Open Access Journals (Sweden)

    V. N. Makhonina

    2017-01-01

    Full Text Available There was proposed the system of classification of poultry by grades, taking into account the rate of individual bone-in and boneless pieces, and minced meat according to objective quality indexes, namely the ratio of the mass fraction of fat and mass fraction of protein in terms of protein quality (ratio of tryptophan to hydroxyproline, the ratio of the energy value and other indicators established for land and water-floating bird and is comparable to similar measures for beef and pork. Was given the quantitative criteria for rating the quality of poultry meat for content of muscle, connective and fatty tissues (skin with fat in gutted carcass and its parts, installed there output and factors consumer value (FCV. Also was given the comparative rate of biological value of raw meat of slaughter animals and poultry, poultry meat mechanically deboning and nutritional supplements of animal and vegetable origin. It is established, that poultry meat mechanically separated on the functional-technological properties and bioavailability significantly superior to animal and vegetable proteins. The biological value of the lump meat of chickens-broilers and hens egg directions 1 grade has values 73.12 and 72.92%, the same time the biological value of goose meat from deboning carcasses of 2 and 1 grades has high values and varies from 79.77 to 81.14%. The new approach of the definition types of meat poultry and poultry products increases the range of foods allowed by the introduction in the recipe of sausage stuffing alternative sources of raw materials of animal and vegetable origin, adequate and balanced protein composition that is a definite contribution to the solution of the problem of providing the population with goods of high quality and enhance production efficiency.

  4. Isolation of Campylobacter spp. from Client-Owned Dogs and Cats, and Retail Raw Meat Pet Food in the Manawatu, New Zealand.

    Science.gov (United States)

    Bojanić, K; Midwinter, A C; Marshall, J C; Rogers, L E; Biggs, P J; Acke, E

    2017-09-01

    Campylobacter causes acute gastroenteritis in people worldwide and is frequently isolated from food, animals and the environment. The disease is predominately food-borne but many routes of transmission and sources of infection have been described, including contact with pets. The prevalence of Campylobacter spp. in dogs and cats varies widely, and data on New Zealand pets are limited. This study aimed to investigate the prevalence of Campylobacter spp. in dogs, cats and retail raw meat pet food products in New Zealand and to characterize Campylobacter jejuni isolates using multilocus sequence typing (MLST). Ninety dogs and 110 cats examined at the Massey University Veterinary Teaching Hospital for elective procedures, and fifty locally purchased retail raw meat pet diets were sampled. Two culture protocols combining Bolton broth enrichment and mCCDA and CAT agars in a microaerobic atmosphere at 42°C and 37°C with species identification using PCR were performed. The prevalence of Campylobacter spp., C. jejuni, Campylobacter upsaliensis and Campylobacter helveticus was 36%, 13%, 23% and 1% in dogs and 16%, 5%, 5% and 7% in cats, respectively. One dog had Campylobacter lari confirmed, and three dogs and one cat had multiple Campylobacter spp. detected. Significantly more animals tested positive using CAT than mCCDA agar (P dogs, whereas attendance for dental treatment was a risk factor for cats. Campylobacter spp. were isolated from 28%, C. jejuni 22%, C. lari 6% and Campylobacter coli 6% of food samples. Six isolates positive by Campylobacter genus PCR were identified as Arcobacter butzleri. Poultry meat was more likely to be positive than non-poultry meat (P = 0.006). Of the 13 C. jejuni pet isolates with full MLST profiles, eight were of different sequence types (ST) and all nine food isolates were of different STs. © 2016 Blackwell Verlag GmbH.

  5. Antibiotic susceptibility and prevalence of foodborne pathogens in poultry meat in Romania.

    Science.gov (United States)

    Dan, Sorin Daniel; Tăbăran, Alexandra; Mihaiu, Liora; Mihaiu, Marian

    2015-01-15

    The occurrence of pathogenic strains in poultry meat is of growing concern in Romania. Another problem found on a global level is the continuous increase of antimicrobial resistance in bacteria isolated from food. This study aimed to evaluate the prevalence of pathogenic bacteria in poultry carcasses obtained in Romania in 2012-2013 and to reveal the most prevalent patterns of antimicrobial resistance in the isolated strains. A total of 144 broiler chicken carcasses were evaluated according to classical microbiological methods. The DNA was extracted from the bacterial colonies and the resistance genes were identified by PCR. In 2012, 47.2% of the samples revealed at least one of the following bacteria: Campylobacter jejuni (9.72%; n = 7), Salmonella enterica serotype Enteritidis (4.17%; n = 3), Listeria monocytogenes (15.28%; n = 11), and Escherichia coli (16.67%; n = 12). In 2013, the number of positive samples of pathogenic bacteria decreased, although Campylobacter jejuni was isolated in a higher percentage (20.8% vs. 9.72%). The percentage of multidrug-resistant (MDR) bacteria was high (23%); the most prevalent pattern included resistance to tetracycline, sulfonamides, and quinolones/fluoroquinolones. All the resistant Salmonella and E. coli strains were tested for the presence of characteristic resistance genes (Kn, bla(TEM), tetA, tetB, tetG, DfrIa, aadA1a, Sul) and revealed that these isolates represent an important reservoir in the spread of this phenomenon. Our findings suggest that Romania urgently needs an integrated surveillance system within the entire chain, for drug-resistant pathogens isolated from poultry meat.

  6. Prevalence of Clostridium difficile in raw beef, cow, sheep, goat, camel and buffalo meat in Iran.

    Science.gov (United States)

    Rahimi, Ebrahim; Jalali, Mohammad; Weese, J Scott

    2014-02-05

    Clostridium difficile has been shown to be a nosocomial pathogen associated with diarrhoea and pseudomembranous colitis in hospitalised patients and the infection is believed to be acquired nosocomially. Recent studies have shown the occurrence of C. difficile in food animals which may act as a source of infection to humans.The aim of this study was to determine the occurrence of C. difficile in retail raw beef, cow, sheep, goat, camel and buffalo meat in Iran. From April to October 2012, a total of 660 raw meat samples from beef, cow, sheep, goat, camel and buffalo were purchased from 49 butcheries in Isfahan and Khuzestan provinces, Iran, and were evaluated for the presence of C. difficile using a method including selective enrichment in C. difficile broth, subsequent alcohol shock-treatment and plating onto C. difficile selective medium. C. difficile isolates were tested for the presence of toxin genes and were typed using PCR ribotyping. In this study, 13 of 660 meat samples (2%) were contaminated with C. difficile. The highest prevalence of C. difficile was found in buffalo meat (9%), followed by goat meat (3.3%), beef meat (1.7%), cow (0.94%) and sheep meat (0.9%). Seven of the 13C. difficile strains (53.9%) were positive for tcdA, tcdB and cdtB toxin genes and were classified as ribotype 078. Four strains (30.8%) were positive tcdA, and tcdB, and one strain (7.7%) was possessed only tcdB. The remaining isolate was non-toxigenic. Susceptibilities of 13C. difficile isolates were determined for 11 antimicrobial drugs using the disk diffusion assay. Resistance to clindamycin, gentamycin, and nalidixic acid was the most common finding. To our knowledge, the present study is the first report of the isolation of C. difficile from raw buffalo meat. This study indicates the potential importance of food, including buffalo meat, as a source of transmission of C. difficile to humans.

  7. Fate of gamma-irradiated Listeria monocytogenes during refrigerated storage on raw or cooked turkey breast meat

    International Nuclear Information System (INIS)

    Thayer, D.W.; Boyd, G.; Kim, A.; Fox, J.B. Jr.; Farrell, H.M. Jr.

    1998-01-01

    The radiation resistance and ability of Listeria monocytogenes ATCC 7644, 15313, 43256, and 49594 to multiply on irradiated, air-packed, refrigerated raw or cooked turkey breast meat nuggets (ca. 25 g) and ground turkey breast meat was investigated. Gamma-radiation D values for L. monocytogenes were significantly different on raw and cooked nuggets, 0.56 +/- 0.03 kGy and 0.69 +/- 0.03 kGy, respectively; but they were not significantly different (P less than or equal to 0.05) on raw and cooked ground turkey meat. High populations (approximately 10(9) CFU/g) of L. monocytogenes declined during 14 days of storage at 4 degrees C in both irradiated and nonirradiated samples of raw but not of cooked ground turkey breast meat. A moderate inoculum (approximately 10(3) CFU/g) did not survive a radiation dose of 3 kGy. The population increased in cooked but not in raw samples of irradiated ground turkey meat stored at either 2 or 7 degrees C for 21 days. The D value changed significantly from 0.70 +/- 0.04 to 0.60 +/- 0.02 kGy when the product was cooked to an internal temperature of 80 degrees C before irradiation. Growth on either raw or cooked turkey meat did not alter the radiation resistance of L. monocytogenes. Analyses were performed for pH, a(w), moisture, and reducing potential of raw and cooked turkey meat and for pH, amino acid profile, thiamine, and riboflavin contents of aqueous extracts of raw and cooked turkey meats without identifying the factor or factors involved in differences in the survival and multiplication of L. monocytogenes on raw and cooked meat

  8. Occurrence and characterization of Shiga toxin-producing Escherichia coli in raw meat, raw milk, and street vended juices in Bangladesh.

    Science.gov (United States)

    Islam, Mohammad A; Mondol, Abdus S; Azmi, Ishrat J; de Boer, Enne; Beumer, Rijkelt R; Zwietering, Marcel H; Heuvelink, Annet E; Talukder, Kaisar A

    2010-11-01

    The major objective of this study was to investigate the prevalence of Shiga toxin (Stx)-producing Escherichia coli (STEC) in different types of food samples and to compare their genetic relatedness with STEC strains previously isolated from animal sources in Bangladesh. We investigated a total of 213 food samples, including 90 raw meat samples collected from retail butcher shops, 20 raw milk samples from domestic cattle, and 103 fresh juice samples from street vendors in Dhaka city. We found that more than 68% (n = 62) of the raw meat samples were positive for the stx gene(s); 34% (n = 21) of buffalo meats and 66% (n = 41) of beef. Approximately 10% (n = 2) of the raw milk and 8% (n = 8) of the fresh juice samples were positive for stx. We isolated STEC O157 from seven meat samples (7.8%), of which two were from buffalo meats and five from beef; and no other STEC serotypes could be isolated. We could not isolate STEC from any of the stx-positive raw milk and juice samples. The STEC O157 isolates from raw meats were positive for the stx(2), eae, katP, etpD, and enterohemorrhagic E. coli hly virulence genes, and they belonged to three different phage types: 8 (14.3%), 31 (42.8%), and 32 (42.8%). Pulsed-field gel electrophoresis (PFGE) typing revealed six distinct patterns among seven isolates of STEC O157, suggesting a heterogeneous clonal diversity. Of the six PFGE patterns, one was identical and the other two were ≥90% related to PFGE patterns of STEC O157 strains previously isolated from animal feces, indicating that raw meats are readily contaminated with fecal materials. This study represents the first survey of STEC in the food chain in Bangladesh.

  9. Performance of Food Safety Management Systems in Poultry Meat Preparation Processing Plants in Relation to Campylobacter spp. Contamination.

    NARCIS (Netherlands)

    Sampers, I.; Jacxsens, L.; Luning, P.A.; Marcelis, W.J.; Dumoulin, F.H.J.N.

    2010-01-01

    A diagnostic instrument comprising a combined assessment of core control and assurance activities and a microbial assessment instrument were used to measure the performance of current food safety management systems (FSMSs) of two poultry meat preparation companies. The high risk status of the

  10. Identification and assessment of potential vulnerabilities in the poultry meat production chain to dangerous agents and substances

    NARCIS (Netherlands)

    Schwägele, F.C.; Andrée, S.; Beraquet, N.; Castrillon, M.; Winkel, C.; Garforth, D.; Cnossen, H.J.; Lucas Luijckx, N.B.; Ayalew, G.

    2009-01-01

    The specific targeted European research project ΣChain (2006) addresses existing as well as potential vulnerabilities within food chains. One of the food chains within the focus of ΣChain is dealing with poultry meat. Fundamental for the assessment of potential vulnerabilities in the chain is basic

  11. Survival of Salmonella Typhimurium in poultry-based meat preparations during grilling, frying and baking.

    Science.gov (United States)

    Roccato, Anna; Uyttendaele, Mieke; Cibin, Veronica; Barrucci, Federica; Cappa, Veronica; Zavagnin, Paola; Longo, Alessandra; Ricci, Antonia

    2015-03-16

    The burden of food-borne diseases still represents a threat to public health; in 2012, the domestic setting accounted for 57.6% of strong-evidence EU food-borne Salmonella outbreaks. Next to cross-contamination, inadequate cooking procedure is considered as one of the most important factors contributing to food-borne illness. The few studies which have assessed the effect of domestic cooking on the presence and numbers of pathogens in different types of meat have shown that consumer-style cooking methods can allow bacteria to survive and that the probability of eating home-cooked poultry meat that still contains surviving bacteria after heating is higher than previously assumed. Thus, the main purpose of this study was to reproduce and assess the effect of several types of cooking treatments (according to label instructions and not following label instructions) on the presence and numbers of Salmonella Typhimurium DT 104 artificially inoculated in five types of poultry-based meat preparations (burgers, sausages, ready-to-cook-kebabs, quail roulades and extruded roulades) that are likely to be contaminated by Salmonella. Three contamination levels (10 cfu/g; 100 cfu/g and 1000 cfu/g) and three cooking techniques (grilling, frying and baking) were applied. Cooking treatments performed according to label instructions eliminated Salmonella Typhimurium (absence per 25g) for contamination levels of 10 and 100 cfu/g but not for contamination levels of 1000 cfu/g. After improper cooking, 26 out of 78 samples were Salmonella-positive, and 23 out of these 26 samples were artificially contaminated with bacterial loads between 100 and 1000 cfu/g. Nine out of 26 samples provided quantifiable results with a minimum level of 1.4MPN/g in kebabs (initial inoculum level: 100 cfu/g) after grilling and a maximum level of 170MPN/g recorded in sausages (initial inoculum level: 1000 cfu/g) after grilling. Kebabs were the most common Salmonella-positive meat product after cooking

  12. Heterogeneous Risk Perceptions: The Case of Poultry Meat Purchase Intentions in Finland

    Directory of Open Access Journals (Sweden)

    Johanna Mäkelä

    2013-10-01

    Full Text Available This study focused on the heterogeneity of consumer reactions, measured through poultry meat purchase intentions, when facing three cases of risk. The heterogeneity was analysed by latent class logistic regression that included all three risk cases. Approximately 60% of the respondents belonged to the group of production risk avoiders, in which the intention to purchase risk food was significantly lower than in the second group of risk neutrals. In addition to socio-demographic variables, the purchase intentions were statistically associated with several attitude-based variables. We highlighted some policy implications of the heterogeneity. Overall, the study demonstrated that risk matters to consumers, not all risk is equal, and consumer types react somewhat differently to different types of risk.

  13. Heterogeneous risk perceptions: the case of poultry meat purchase intentions in Finland.

    Science.gov (United States)

    Heikkilä, Jaakko; Pouta, Eija; Forsman-Hugg, Sari; Mäkelä, Johanna

    2013-10-11

    This study focused on the heterogeneity of consumer reactions, measured through poultry meat purchase intentions, when facing three cases of risk. The heterogeneity was analysed by latent class logistic regression that included all three risk cases. Approximately 60% of the respondents belonged to the group of production risk avoiders, in which the intention to purchase risk food was significantly lower than in the second group of risk neutrals. In addition to socio-demographic variables, the purchase intentions were statistically associated with several attitude-based variables. We highlighted some policy implications of the heterogeneity. Overall, the study demonstrated that risk matters to consumers, not all risk is equal, and consumer types react somewhat differently to different types of risk.

  14. Flavour development in pork. Influence of flavour precursor concentrations in longissimus dorsi from pigs with different raw meat qualities

    DEFF Research Database (Denmark)

    Meinert, Lene; Tikk, Kaja; Tikk, Meelis

    2009-01-01

    Flavour development and overall eating quality of pan-fried pork chops of longissimus dorsi from eight different raw meat qualities aged for 4 and IS days were assessed by a trained sensory panel. The raw meat qualities were obtained through combinations of strategic feeding/fasting (control vs...... the differences in sensory perception of the pan-fried pork chops. Overall, the differences were small....

  15. Effect of acute heat stress and slaughter processing on poultry meat quality and postmortem carbohydrate metabolism.

    Science.gov (United States)

    Wang, R H; Liang, R R; Lin, H; Zhu, L X; Zhang, Y M; Mao, Y W; Dong, P C; Niu, L B; Zhang, M H; Luo, X

    2017-03-01

    This study investigated the effects of acute heat stress and slaughter processing on poultry meat quality and carbohydrate metabolism. Broilers (200) were randomly divided into 2 groups receiving heat stress (HS; 36°C for one h), compared to a non-stressed control (C). At slaughter, each group was further divided into 2 groups for slaughter processing (L = laboratory; F = commercial factory). L group breasts were removed immediately after bleeding without carcass scalding or defeathering, and stored at 4°C. F group broilers were scalded (60°C, 45 s) after bleeding and defeathering. Then the breasts were removed and cooled in ice water until the core temperature was ≤4°C. Rates of Pectoralis core temperature and pH decline were changed by slaughter processing, but only HS affected ultimate pH in group L. HS muscles had higher L* values (P  0.05). Sarcoplasmic protein solubility was higher in F processed birds (P < 0.05). HS decreased the solubility of myofibrillar and total protein in the L-slaughtered birds. Thus, HS caused a higher frequency of accelerated muscle glycolysis than controls. Factory processing (chilling) could not completely eliminate the effects of accelerated glycolysis caused by pre-slaughter HS. © 2016 Poultry Science Association Inc.

  16. Incidence of Salmonella Infantis in poultry meat and products and the resistance of isolates to antimicrobials

    Science.gov (United States)

    Kalaba, V.; Golić, B.; Sladojević, Ž.; Kalaba, D.

    2017-09-01

    Globalisation, climate change, changes in eating habits and the food industry, modern animal husbandry and market demands often have a negative impact on quality assurance, food safety and animal health. After the eradication of some zoonotic diseases that previously often jeopardized the human population, today in developed countries, the focus is mainly on the control of zoonoses transmitted by food. Salmonella is one of the most common pathogens that can be transmitted from animals to humans, and its reservoirs are poultry, cattle and pigs, so one transmission route to humans is from contaminated food of animal origin. Multidrug-resistant isolates of Salmonella, which can transfer their resistance genes to other microorganisms, are considered a serious threat to public health. Control of Salmonella primarily depends on a good monitoring system and knowledge of the presence of serovars and strains in an epizootiological area. During the first nine months of 2016, 1321 samples of poultry meat and products were examined, among which 108 harboured Salmonella. Altogether, 29 of the 108 isolates (26.85%) were Salmonella Infantis. For all 29 S. Infantis isolates, antimicrobial resistance was tested by the disc diffusion method. The isolates showed 100% resistance to amoxicillin, and nalidixic acid.

  17. Physico-chemical and microbiological properties of raw fermented sausages are not influenced by color differences of turkey breast meat.

    Science.gov (United States)

    Popp, J; Krischek, C; Janisch, S; Wicke, M; Klein, G

    2013-05-01

    It has been suggested that the color of turkey breast meat influences both physico-chemical and microbiological properties of raw fermented sausages. In this study, raw fermented sausages were produced with turkey breast meat in 3 different colors (pale, normal, or dark), which were obtained from 2 fast-growing-genetic-line toms at 2 slaughterhouses. Prior to the sausage production, the breast muscles were sorted into color groups according to the lightness values determined at 24 h postmortem. This meat was subsequently processed to raw fermented sausages using 1.5 or 2.5% curing salt (CS). The pale meat had higher lightness, electrical conductivity, and drip loss, whereas the dark meat showed a darker color only. The physico-chemical (pH, water activity), visual (lightness, redness), and microbial (total plate count) properties of the sausages were not influenced by the color of the turkey breast meat. The sausage made with 2.5% CS had lower aw and higher ash and hardness values than the sausages produced with 1.5% CS. In conclusion, processing of differently colored turkey meat to raw fermented sausages does not influence the quality characteristics of the products. Based on these findings, there is no reason for the sausage producer to separate turkey breast muscles by color before producing raw fermented sausages.

  18. Standard Practice for Irradiation of Fresh and Frozen Red Meat and Poultry to Control Pathogens and Other Microorganisms

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2008-01-01

    1.1 This practice outlines procedures for the irradiation of fresh or frozen meat and poultry. Note 1—The Codex Alimentarius Commission defines meat as “the edible part of any mammal” and poultry as “any domesticated bird, including chicken, turkeys, ducks, geese, guinea-fowls, or pigeons” (CAC/MISC 5). Note 2—Current U.S. regulations limit the definition of livestock species to cattle, sheep, swine, goat, horse, mule, or other equine and poultry species to chicken, turkey, duck, goose, and guinea (2, 3). 1.2 This practice covers absorbed doses used for inactivation of parasites and reduction of bacterial load in fresh and frozen red meat and poultry. Such doses are typically less than 10 kGy. 1.3 This practice addresses irradiation of pre-packaged product for retail sale or for use as an ingredient in other products. It also addresses the in-line irradiation of unpackaged product. 1.4 This standard does not purport to address all of the safety concerns, if any, associated with its use. It i...

  19. Effects of freezing-thawing on sensory descriptive profiles of cooked poultry breast meat

    Directory of Open Access Journals (Sweden)

    ZHUANG Hong

    2014-12-01

    Full Text Available Freezing is a common method used by consumers to extend meat shelf life and by researchers to allow for subsequent meat quality assessments and processing.However,the effects of freezing on the sensory quality of cooked poultry breast meat are not well documented.The objective of this study was to compare sensory quality profiles of fresh and frozen/thawed chicken breast fillets (pectoralis major.Breast fillets were removed from carcasses within 24 h postmortem and either cooked from a fresh state or placed in a -20℃ freezer.Frozen samples were thawed by three different methods:thawing during cooking directly from a frozen state (0 h,thawing in 20℃ water for 2 h prior to cooking (2 h,or thawing at 4℃ for 24 h prior to cooking (24 h.A control treatment with fillets cooked directly from a fresh state was used.Fillets were cooked to an endpoint temperature of 78℃ and sensory quality was evaluated by trained descriptive panelists using 0~15 universal intensity scales.Results show that there were not treatment differences (P>0.05 in the average intensity scores for any of the descriptive flavor attributes or for 5 of the descriptive texture attributes (cohesiveness,hardness,juiciness,wad size,and wetness of wad.However,the intensity scores for cohesiveness of mass,rate of breakdown,and chewiness were significantly different among the treatments (P<0.05.Cohesiveness of mass intensity scores for 0h and 24 h fillets were significantly higher than 2 h samples.Fillets cooked directly from a frozen state (0 h had significantly higher intensity scores for rate of breakdown and chewiness than fresh controls and 2 h samples,respectively.These results indicate that freezing-thawing does not affect sensory flavor quality;however,it may change the texture attributes of cooked chicken breast meat products.The effects on meat texture depend on thawing methods prior to cooking.

  20. Fluoroquinolone residues in raw meat from open markets in Ibadan, Southwest, Nigeria

    Directory of Open Access Journals (Sweden)

    Adekunbi Bridget Omotoso

    2015-07-01

    Full Text Available Misuse of fluoroquinolones in livestock production may lead to the presence of their residues in tissues of meat animals after slaughter, constituting health hazards to consumers. The present study was designed to screen for residues of three fluoroquinolones (ciprofloxacin, norfloxacin and ofloxacin in raw meat. Microbiological assay, followed by High Performance Liquid Chromatography (HPLC was used to screen three hundred and twenty samples of beef, chicken, pork and chevon purchased from open markets. Initial screening by microbiological assay revealed that 50%, 55%, 40% and 40% of beef, chicken, pork and chevon, respectively were positive for residues of antibiotics. Further analysis by HPLC with UV detection revealed the presence of ciprofloxacin, norfloxacin and ofloxacin at varying concentrations in the meat samples. Ofloxacin was the least in frequency and abundance in all meat types. Results obtained in this study have implications for public health and will lead to steps that will further enhance the safety of animal foods in order to protect consumers and the animal production industry

  1. Risk factors and spatial distribution of extended spectrum ?-lactamase-producing- Escherichia coli at retail poultry meat markets in Malaysia: a cross-sectional study

    OpenAIRE

    Aliyu, A. B.; Saleha, A. A.; Jalila, A.; Zunita, Z.

    2016-01-01

    Background The significant role of retail poultry meat as an important exposure pathway for the acquisition and transmission of extended spectrum ?-lactamase-producing Escherichia coli (ESBL-EC) into the human population warrants understanding concerning those operational practices associated with dissemination of ESBL-EC in poultry meat retailing. Hence, the objective of this study was to determine the prevalence, spatial distribution and potential risk factors associated with the disseminat...

  2. Quality characteristics of broiler chicken meat from free-range and industrial poultry system for the consumers.

    Science.gov (United States)

    da Silva, Débora Cristina Fernandes; de Arruda, Alex Martins Varela; Gonçalves, Alex Augusto

    2017-06-01

    The aim of this study was to determine and compare the quality parameters of broiler chicken meat from free-range and industrial poultry system. Proximate composition, color, pH, shear force, microbial quality and sensory characteristics were evaluated. Both free-range and industrial chicken meat presented PSE (pale, soft and exudative) anomaly ( L * > 53). An inverse correlation between lightness, pH and shear force was observed. The free range broiler meat had higher yellow color ( b * 11.56) and shear force (2.75 kgf) and lower red color ( a * 1.65) and pH (5.75) in comparison to the industrial broiler meat, due intensive physical activity on growing phase and influence of the pre-slaughter stress on the rigor mortis. The thigh cut from free range broiler meat showed higher protein levels (18.00%), while to the thigh and drumstick cuts of industrial broiler meat showed higher total fat levels (3.4 and 5.0%, respectively). In general, each strain and chickens producing methods gave the peculiar characteristics to meat (chemical, physical, microbiological and sensorial).

  3. In vitro antimicrobial effect of Satureja wiedemanniana against Bacillus species isolated from raw meat samples.

    Science.gov (United States)

    Yucel, Nihal; Aslim, Belma; Ozdoğan, Hakan

    2009-08-01

    In this study a total of 30 raw meat samples obtained from Ankara, Turkey were screened for the presence of Bacillus species. Among the meat samples analyzed, the predominant species isolated was Bacillus circulans; other Bacillus species were identified as Bacillus firmus, Bacillus lentus, Bacillus megaterium, Bacillus licheniformis, Bacillus mycoides, Bacillus sphaericus, and Bacillus cereus. Minced meat samples were more contaminated with Bacillus species than sliced beef sample. From these samples, 242 Bacillus species isolates were obtained, which were investigated for proteolytic and lipolytic activity, associated with meat spoilage. Interestingly, some Bacillus strains produced the highest values of proteolytic/lipolytic activities. Nineteen Bacillus strains were selected among the 242 isolates according to their proteolytic/lipolytic activity with a clear zone diameter of > or =6 mm. The essential oil of Satureja wiedemanniana (Lalem) Velen was also tested against these 19 Bacillus species that had proteolytic and lipolytic activity. The essential oil yield obtained from the aerial parts of the plant was 0.35% (vol/wt). The inhibition zones of the essential oil obtained against all the Bacillus species were in the range of 5.0-12.0 mm. The oil showed high antimicrobial activities against B. licheniformis M 6(26), M 11(16), and M 12(1) strains. B. licheniformis 12(1) showed high lipolytic activity (18.0 mm). Also, B. licheniformis M 6(26) and M 11(16) showed high proteolytic activity (16.0 and 14.0 mm). These results may suggest that an essential oil of S. wiedemanniana can be used as a natural preservative in meat against spoilage bacteria.

  4. Validation of methods for determination of free water content in poultry meat

    Directory of Open Access Journals (Sweden)

    Jarmila Žítková

    2007-01-01

    Full Text Available Methods for determination of free water content in poultry meat are described in Commission Regulation EEC No 1538/91 as amended and in ČSN 57 3100. Two of them (method A and D have been validated in conditions of a Czech poultry processing plant. The capacity of slaughtering was 6000 pieces per hour and carcasses were chilled by air with spraying. All determinations were carried out in the plant’s lab and in the lab of the Institute of Food Technology. Method A was used to detect the amount of water lost from frozen chicken during thawing in controlled conditions. Twenty carcasses from six weight groups (900 g–1400 g were tested. The average values of thaw loss water contents ranged between 0.46% and 1.71%, the average value of total 120 samples was 1.16%. The results were compared with the required maximum limit value of 3.3%. The water loss content was in negative correlation with the weight of chicken (r = –0.56. Method D (chemical test has been applied to determine the total water content of certain poultry cuts. It involved the determination of water and protein contents of 62 representative samples in total. The average values of ratio of water weight to proteins weight WA/RPA were in breast fillets 3.29, in legs with a portion of the back 4.06, legs 4.00, thighs 3.85 and drumsticks 4.10. The results corresponded to the required limit values for breast fillets 3.40 and for leg cuts 4.15. The ratio of water weight to proteins weight WA/RPA was correlated with the weight of chicken for breast fillets negatively (r = –0.61 and for leg cuts positively (r = 0.70. Different correlations can be explained by the distribution of water, protein and fat in carcasses. The evaluation of methods in the parameter of percentage ratio of the average value to the limit showed that method D (results were at the level of 97% of the limit was more exact than method A (results were at the level 32% of the limit but it is more expensive. Both methods

  5. Campylobacter fetus meningitis associated with eating habits of raw meat and raw liver in a healthy patient: A case report and literature review.

    Science.gov (United States)

    Ishihara, Ayaka; Hashimoto, Etaro; Ishioka, Haruhiko; Kobayashi, Hiroyuki; Gomi, Harumi

    2018-01-01

    Meningitis caused by the zoonotic pathogen Campylobacter fetus in immunocompetent adults is rare. We report a 48-year-old Japanese woman with no underlying disease who was found to have meningitis caused by C. fetus . Both C. fetus subsp. fetus and C. fetus subsp. venerealis were isolated from the cerebrospinal fluid culture. The mode of infection in our patient was considered to be associated with the consumption of raw beef and raw cattle liver on a regular basis. Public awareness and education to avoid the consumption of raw or undercooked meat might help prevent C. fetus meningitis.

  6. The physical and microbiological quality of chicken meat in the different type of enterprise poultry slaughterhouse: a case study in Karanganyar District

    Science.gov (United States)

    Hertanto, B. S.; Nurmalasari, C. D. A.; Nuhriawangsa, A. M. P.; Cahyadi, M.; Kartikasari, L. R.

    2018-01-01

    The aim of this study was to determine the physical and microbiological quality of chicken meat produced by the different type of enterprise slaughterhouse in Karanganyar District. The number of 20 poultry slaughterhouses was determined by convenience sampling method. The samples of chicken meat were randomly collected from medium enterprise poultry slaughterhouses (n=12) and small enterprise poultry slaughterhouses (n=8). A survey was carried out among poultry slaughterhouses in Karanganyar District. All the samples were subjected to physical quality consisted of pH test, texture, and color, while microbiological quality consisted of total plate count, microbial detection of Escherichia coli and Salmonella. The data were analyzed using descriptive quantitative analysis. The study showed that chicken meat in 6 small enterprise slaughterhouses and 11 medium enterprise slaughterhouses had normal pH of 5.81 - 6.3. Color and texture of chicken meats had relatively normal in both small and medium enterprise slaughterhouses. The total plate count of chicken meat showed in both small and medium enterprise slaughterhouses was 1x101 CFU/gr, and Salmonella was detected in 1 medium enterprise slaughterhouse. The overall results of the study suggest that the potential risk of chicken meat contamination depends on the processing of chicken meat in poultry slaughterhouses.

  7. Dietary Intake of High-Protein Foods and Other Major Foods in Meat-Eaters, Poultry-Eaters, Fish-Eaters, Vegetarians, and Vegans in UK Biobank

    Science.gov (United States)

    2017-01-01

    Vegetarian diets are defined by the absence of meat and fish, but differences in the intake of other foods between meat-eaters and low or non-meat eaters are also important to document. We examined intakes of high-protein foods (meat, poultry, fish, legumes, nuts, vegetarian protein alternatives, dairy products, and eggs) and other major food groups (fruit, vegetables, bread, pasta, rice, snack foods, and beverages) in regular meat-eaters, low meat-eaters, poultry-eaters, fish-eaters, vegetarians, and vegans of white ethnicity participating in UK Biobank who had completed at least one web-based 24-h dietary assessment (n = 199,944). In regular meat-eaters, around 25% of total energy came from meat, fish, dairy and plant milk, cheese, yogurt, and eggs. In vegetarians, around 20% of energy came from dairy and plant milk, cheese, yoghurt, eggs, legumes, nuts, and vegetarian protein alternatives, and in vegans around 15% came from plant milk, legumes, vegetarian alternatives, and nuts. Low and non-meat eaters had higher intakes of fruit and vegetables and lower intakes of roast or fried potatoes compared to regular meat-eaters. The differences in the intakes of meat, plant-based high-protein foods, and other foods between meat-eaters and low and non-meat eaters in UK Biobank may contribute to differences in health outcomes. PMID:29207491

  8. Dietary Intake of High-Protein Foods and Other Major Foods in Meat-Eaters, Poultry-Eaters, Fish-Eaters, Vegetarians, and Vegans in UK Biobank.

    Science.gov (United States)

    Bradbury, Kathryn E; Tong, Tammy Y N; Key, Timothy J

    2017-12-02

    Vegetarian diets are defined by the absence of meat and fish, but differences in the intake of other foods between meat-eaters and low or non-meat eaters are also important to document. We examined intakes of high-protein foods (meat, poultry, fish, legumes, nuts, vegetarian protein alternatives, dairy products, and eggs) and other major food groups (fruit, vegetables, bread, pasta, rice, snack foods, and beverages) in regular meat-eaters, low meat-eaters, poultry-eaters, fish-eaters, vegetarians, and vegans of white ethnicity participating in UK Biobank who had completed at least one web-based 24-h dietary assessment ( n = 199,944). In regular meat-eaters, around 25% of total energy came from meat, fish, dairy and plant milk, cheese, yogurt, and eggs. In vegetarians, around 20% of energy came from dairy and plant milk, cheese, yoghurt, eggs, legumes, nuts, and vegetarian protein alternatives, and in vegans around 15% came from plant milk, legumes, vegetarian alternatives, and nuts. Low and non-meat eaters had higher intakes of fruit and vegetables and lower intakes of roast or fried potatoes compared to regular meat-eaters. The differences in the intakes of meat, plant-based high-protein foods, and other foods between meat-eaters and low and non-meat eaters in UK Biobank may contribute to differences in health outcomes.

  9. Dietary Intake of High-Protein Foods and Other Major Foods in Meat-Eaters, Poultry-Eaters, Fish-Eaters, Vegetarians, and Vegans in UK Biobank

    Directory of Open Access Journals (Sweden)

    Kathryn E. Bradbury

    2017-12-01

    Full Text Available Vegetarian diets are defined by the absence of meat and fish, but differences in the intake of other foods between meat-eaters and low or non-meat eaters are also important to document. We examined intakes of high-protein foods (meat, poultry, fish, legumes, nuts, vegetarian protein alternatives, dairy products, and eggs and other major food groups (fruit, vegetables, bread, pasta, rice, snack foods, and beverages in regular meat-eaters, low meat-eaters, poultry-eaters, fish-eaters, vegetarians, and vegans of white ethnicity participating in UK Biobank who had completed at least one web-based 24-h dietary assessment (n = 199,944. In regular meat-eaters, around 25% of total energy came from meat, fish, dairy and plant milk, cheese, yogurt, and eggs. In vegetarians, around 20% of energy came from dairy and plant milk, cheese, yoghurt, eggs, legumes, nuts, and vegetarian protein alternatives, and in vegans around 15% came from plant milk, legumes, vegetarian alternatives, and nuts. Low and non-meat eaters had higher intakes of fruit and vegetables and lower intakes of roast or fried potatoes compared to regular meat-eaters. The differences in the intakes of meat, plant-based high-protein foods, and other foods between meat-eaters and low and non-meat eaters in UK Biobank may contribute to differences in health outcomes.

  10. Characterization and antibiotic susceptibility of Listeria monocytogenes isolated from poultry and red meat in Morocco

    Directory of Open Access Journals (Sweden)

    Hayat Ennaji

    2008-09-01

    Full Text Available Hayat Ennaji1,2, Mohammed Timinouni2, My Mustapha Ennaji3, Mohammed Hassar1, Nozha Cohen11Laboratoire de Microbiologie et Hygiène des Aliments et de l’Environnement, Institut Pasteur du Maroc., Casablanca, Morocco; 2Laboratoire de Microbiologie et Biologie Moléculaire, Institut Pasteur du Maroc., Casablanca, Morocco; 3Laboratoire de Virologie et Hygiène and Microbiologie., Faculté des Sciences et Techniques - Mohammedia, Université Hassan II, Mohammedia, MoroccoAbstract: This study was carried out on 426 samples of raw meats collected from butcheries and supermarkets in Casablanca, Morocco. The samples were examined for the occurrence of Listeria species. Strains of Listeria monocytogenes were characterized by several biochemical tests and confirmed by polymerase chain reaction (PCR. β-hemolytic cultures and nonhemolytic isolates were tested for biochemical properties with the Listeria API test. Among the 43 Listeria species isolates; we identified 10 strains for L. monocytogenes (23.3%, 31 strains for L. innocua (72.1% and 2 strains for L. welshimeri (4.6%. Strains of L. monocytogenes were separated by multiplex PCR; two serogroups IIb and IVb were thus differentiated. Antibiotic susceptibility of L. monocytogenes to 21 antibiotics was determined by the disk diffusion method. All isolates were susceptible to a wide range of the tested antibiotics with the exception of nalidixic acid, colistine and cephalosporins second and third generation for which they were all resistant.Keywords: antibiotic susceptibility, Listeria monocytogenes, meat, PCR

  11. A comparison of three methods for the isolation of Arcobacter spp. from retail raw poultry in Northern Ireland

    DEFF Research Database (Denmark)

    Scullion, R.; Harrington, C. S.; Madden, R. H.

    2004-01-01

    Recent evidence suggests that arcobacters, especially Arcobacter butzleri, are potential foodborne pathogens, but standardized detection methods have yet to be established. A study was undertaken to determine which of three isolation methods was the most effective for the isolation of Arcobacter...... spp. from fresh raw poultry. Method I was microaerobic and involved a membrane filtration step followed by plating onto blood agar. Method 2 was also microaerobic and involved enrichment and plating media containing a five-antibiotic cocktail. Method 3 was aerobic and was based on enrichment...... in a charcoal-based broth containing two antibiotics. Retail poultry samples (n = 50) were obtained from supermarkets in Northern Ireland; the European Community license number was recorded to ensure sample diversity. Presumptive arcobacters were identified using genus-specific and species-specific primers...

  12. Antioxidant Effect of Extracts from the Coffee Residue in Raw and Cooked Meat

    Directory of Open Access Journals (Sweden)

    Ji-Hee Kim

    2016-07-01

    Full Text Available The residue of ground coffee obtained after the brewing process (spent coffee still contains various functional components with high antioxidant capacity and health benefits, but no attempts have been made to use it as a resource to produce value-added food ingredients. This study evaluates the antioxidant activity of ethanol or hot water extracts from the residues of coffee after brewing. An extraction experiment was carried out using the conventional solid–liquid methods, including ethanol and water as the extraction media at different temperatures and liquid/solid ratios. The antioxidant activity of extracts was tested for total phenolic compound (TPC, 2,2-diphenyl-1-picrylhydrazyl (DPPH, and 2-thiobarbituric acid reactive substances (TBARS using oil emulsion and raw/cooked meat systems. The DPPH radical scavenging activity of the ethanol extracts with heating (HEE and without heating (CEE were higher than that of the hot water extracts (WE. The highest DPPH value of HEE and CEE at 1000 ppm was 91.22% and 90.21%, respectively. In oil emulsion and raw/cooked systems, both the water and ethanol extracts had similar antioxidant effects to the positive control (BHA, but HEE and CEE extracts showed stronger antioxidant activities than WE extract. These results indicated that the ethanol extracts of coffee residue have a strong antioxidant activity and have the potential to be used as a natural antioxidant in meat.

  13. Effects of microbial aerosol in poultry house on meat ducks’ immune function

    Directory of Open Access Journals (Sweden)

    Guanliu YU

    2016-08-01

    Full Text Available The aim of this study was to evaluate effects of microbial aerosols on immune function of ducks and shed light on the establishment of microbial aerosol concentration standards for poultry. A total of 1800 1-d-old Cherry Valley ducks were randomly divided into 5 groups (A, B, C, D and E with 360 ducks in each. To obtain objective data, each group had three replications. Concentrations of airborne bacteria, fungi, endotoxin in different groups were created by controlling ventilation and bedding cleaning frequency. Group A was the control group and hygienic conditions deteriorated progressively from group B to E. A 6-stage Andersen impactor was used to detect the aerosol concentration of aerobes, gram-negative bacteria, fungi and AGI-30 microbial air sampler detect the endotoxin, and Composite Gas Detector detect the noxious gas. In order to assess the immune function of meat ducks, immune indicators including H5 AIV antibody titer, IgG, IL-2, T-lymphocyte transformation rate, lysozyme and immune organ indexes were evaluated. Correlation coefficients were also calculated to evaluate the relationships among airborne bacteria, fungi, endotoxin and immune indicators. The results showed that the concentration of airborne aerobe, gram-negative bacteria, fungi, endotoxin have a strong correlation to H5 AIV antibody titer, IgG, IL-2, T-lymphocyte transformation rate, lysozyme and immune organ indexes, respectively. In addition, when the concentration of microbial aerosol reach the level of group D, serum IgG (6 - 8 weeks, lysozyme (4 week were significantly higher than in group A (P < 0.05; serum IL-2 (7 and 8 weeks , T-lymphocyte transformation rate, lysozyme (7 and 8 weeks, spleen index (6 and 8 weeks and bursa index (8 week were significantly lower than in group A(P < 0.05 or P < 0.01. The results indicated that a high level of microbial aerosol adversely affected the immune level of meat ducks. The microbial aerosol values in group D provide a basis

  14. Prevalence and antimicrobial resistance of Campylobacter species isolated from raw camel, beef, lamb, and goat meat in Iran.

    Science.gov (United States)

    Rahimi, Ebrahim; Ameri, Mehrdad; Kazemeini, Hamid Reza

    2010-04-01

    Campylobacter spp. are one of the most common causes of acute bacterial gastroenteritis in human beings which are transmitted mostly via food originating from animals. This study was conducted to determine the prevalence and antimicrobial resistance of Campylobacter spp. isolated from retail raw meats in Iran. From June 2008 to June 2009, a total of 722 raw meat samples from camel (n = 107), beef (n = 190), lamb (n = 225), and goat (n = 180) were purchased from randomly selected retail outlets in Isfahan and Yazd, Iran, and were evaluated for the presence of Campylobacter spp. In this study, 50 of the 722 meat samples (6.9%) were contaminated with Campylobacter spp. The highest prevalence of Campylobacter spp. was found in lamb meat (12.0%), followed by goat meat (9.4%), beef meat (2.4%), and camel meat (0.9%). The most prevalent Campylobacter spp. isolated from the meat samples was Campylobacter jejuni (84.0%); the remaining isolates were Campylobacter coli (16.0%). Susceptibilities of 50 Campylobacter isolates were determined for 10 antimicrobial drugs using the disk-diffusion assay. Resistance to tetracycline was the most common finding (68.0%), followed by resistance to ciprofloxacin (46.0%) and nalidixic acid (40.0%). All of the isolates were susceptible to erythromycin, gentamicin, and chloramphenicol. Significantly higher prevalence rates of Campylobacter spp. (p meat samples taken in spring (20.0%) and summer (18.9%). To our knowledge, this study is the first report of the isolation of Campylobacter spp. from raw camel, lamb, and goat meat in Iran.

  15. Vancomycin resistance in Enterococcus faecium isolated from Danish chicken meat is located on a pVEF4-like plasmid persisting in poultry for 18 years

    DEFF Research Database (Denmark)

    Leinweber, Helena Augusta Katharina; Alotaibi, Sulaiman Mohammed I; Overballe-Petersen, Søren

    2018-01-01

    traits of VREfm in Danish retail chicken meat. Three out of 40 samples (7.5%) from two slaughterhouses yielded VREfm (vancomycin MIC > 32mg/L). This is the first report of VREfm in Danish retail poultry meat since 2010 (DANMAP). All three VREfm belonged to the sequence type ST32, cluster type CT1068...

  16. Polybrominated diphenyl ethers (PBDEs) in US meat and poultry: 2012-13 levels, trends and estimated consumer exposures.

    Science.gov (United States)

    Lupton, Sara J; Hakk, Heldur

    2017-09-01

    Polybrominated diphenyl ethers (PBDEs) are a class of brominated flame retardants whose use has contaminated foods and caused subsequent human exposures. To address the issue of possible human exposure, samples from a 2012-13 US meat and poultry (beef, pork, chicken, turkey) study were analysed for seven PBDEs. The mean summed concentrations of the seven BDE congeners (ΣPBDE) from beef, pork, chicken and turkey were 0.40, 0.36, 0.19, and 0.76 ng g -1 lipid weight (lw). The range of ΣPBDEs for all meat classes was 0.01-15.78 ng g -1 lw. A comparison of this study with a 2007-08 study revealed a decline in the median ΣPBDEs for all four meat classes, a reduction of 25.9% to 70.0%, with pork, chicken and turkey PBDE residues being statistically lower relative to the 2007-08 study. BDEs 47 and 99 contributed the most to the ΣPBDE concentrations, indicating likely animal exposures to the penta-BDE formulation. Based on the reported data an estimate of US consumer daily intake of PBDEs from meat and poultry was 6.42 ng day -1 .

  17. The freezing and thawing of water in poultry meat and vegetables irradiated by electrons at doses of 0.1-4 kGy

    International Nuclear Information System (INIS)

    Dubini, B.; Montecchia, F.; Ponzi-Bossi, M.G.; Messina, G.

    1993-01-01

    Poultry meat and some vegetables, irradiated by 5 MeV electrons (0.1-4 kGy), were analysed by differential scanning calorimetry, from 24 h after irradiation. The temperature and enthalpy transitions of the water contained in the irradiated samples were measured and compared with those of unirradiated samples. The authors analysed 18 meat and 10 vegetable samples for each irradiation dose together with a similar number of unirradiated controls. The mean supercooling temperatures of water in the irradiated poultry meat samples and in some vegetables are significantly lower than those of controls. Moreover, the freezing enthalpies of the irradiated poultry breast are significantly lower than those of controls, while they are unchanged in the other cases. The mean ice melting temperatures and enthalpies are similar for all samples. The amount of the lowering of the water-ice transition depends on the nature of the sample and is highest in poultry breast and lowest in vegetables. (author)

  18. Extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae in local and imported poultry meat in Ghana.

    Science.gov (United States)

    Eibach, Daniel; Dekker, Denise; Gyau Boahen, Kennedy; Wiafe Akenten, Charity; Sarpong, Nimako; Belmar Campos, Cristina; Berneking, Laura; Aepfelbacher, Martin; Krumkamp, Ralf; Owusu-Dabo, Ellis; May, Jürgen

    2018-04-01

    Antibiotic use in animal husbandry has raised concerns on the spread of resistant bacteria. Currently animal products are traded globally with unprecedented ease, which has been challenging the control of antimicrobial resistance. This study aims to detect and characterize extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli and Klebsiella pneumoniae from imported and locally produced poultry products sold in Ghana. Local and imported chicken meat was collected from 94 stores and markets throughout Kumasi (Ghana) and cultured on selective ESBL screening agar. Phenotypic ESBL-producing E. coli and K. pneumoniae isolates were confirmed by combined disc test and further characterized by antibiotic susceptibility testing, amplification of the bla CTX-M , bla TEM and bla SHV genes as well as multilocus sequence typing (MLST) and linked to the country of origin. Out of 200 meat samples, 71 (36%) samples revealed 81 ESBL-producing isolates (46 E. coli and 35 K. pneumoniae), with 44% (30/68) of local poultry and 31% (41/132) of imported products being contaminated. Most ESBL-producing isolates harboured the bla CTX-M-15 gene (61/81, 75%) and the dominant Sequence Types (ST) were ST2570 (7/35, 20%) among K. pneumoniae and ST10 (5/46, 11%) among E. coli. High numbers of ESBL-producing bacteria, particularly on local but also imported poultry meat, represent a potential source for human colonization and infection as well as spread within the community. Surveillance along the poultry production-food-consumer chain would be a valuable tool to identify sources of emerging multidrug resistant pathogens in Ghana. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. Development of a Rapid Immunodiagnostic Test for Pork Components in Raw Beef and Chicken Meats: a Preliminary Study

    Directory of Open Access Journals (Sweden)

    S. N. Depamede

    2011-08-01

    Full Text Available A rapid immunodiagnostic test that provides visual evidence of the presence of pork components in raw beef and chicken meats was developed. Colloidal gold was prepared and conjugated with anti-Swine IgG polyclonal antibody. Immunochromatographic test strips were produced, and then were used to test laboratory adulterated raw meat samples. The samples consisted adulteration meat, immunodiagnostic, pork, rapid test of pork-in-beef, or pork-in-chicken at 1/0; 1/100; 1/1,000; 1/5,000; 1/10,000 (w/w adulteration levels that were extracted in phosphate-buffered saline. Raw beef and chicken meats without pork were included as controls. Analysis was completed in 10 min. Detection limit was 1/5,000 (w/w, although 1/10,000 was also observed. This immunodiagnostic tests can be conveniently applied to detect low levels of pork components in raw beef and chicken meat products. For the commercial purposes, further studies need to be carried out.

  20. FUNCTION FEED ADDITIVE OF CAROTE-NOID VEGETABLE RAW MATERIALS FOR POULTRY

    OpenAIRE

    Koshchayev A. G.; Kalyuzhniy S. A.; Koshchaeva O. V.; Gavrilenko D. V.; Eliseev M. A.

    2013-01-01

    The article is concerned with the use of functional feed additives from pumpkin fruits and alfalfa juice for the poultry industry. In the study of laying hen it has been found that the use of a feed additive in-creased pumpkin paste content in serum and egg yolk carotenoids is more than two times, and the concentration of vitamin A in these tissues increased slightly, not exceeding 20%. Livability and productivity of poultry increased and average expendable fodder per head per day decreased. ...

  1. Presence and changes in populations of yeasts on raw and processed poultry products stored at refrigeration temperature.

    Science.gov (United States)

    Ismail, S A; Deak, T; El-Rahman, H A; Yassien, M A; Beuchat, L R

    2000-12-05

    A study was undertaken to determine populations and profiles of yeast species on fresh and processed poultry products upon purchase from retail supermarkets and after storage at 5 degrees C until shelf life expiration, and to assess the potential role of these yeasts in product spoilage. Fifty samples representing 15 commercial raw, marinated, smoked, or roasted chicken and turkey products were analyzed. Yeast populations were determined by plating on dichloran rose bengal chloramphenicol (DRBC) agar and tryptone glucose yeast extract (TGY) agar. Proteolytic activity was determined using caseinate and gelatin agars and lipolytic activity was determined on plate count agar supplemented with tributyrin. Populations of aerobic microorganisms were also determined. Initial populations of yeasts (log10 cfu/g) ranged from less than 1 (detection limit) to 2.89, and increased by the expiration date to 0.37-5.06, indicating the presence of psychrotrophic species. Highest initial populations were detected in raw chicken breast, wings, and ground chicken, as well as in turkey necks and legs, whereas roasted chicken and turkey products contained less than 1 log10 cfu/g. During storage, yeast populations increased significantly (P chicken, ground chicken, liver, heart and gizzard, and in ground turkey and turkey sausage. Isolates (152 strains) of yeasts from poultry products consisted of 12 species. Yarrowia lipolytica and Candida zeylanoides were predominant, making up 39 and 26% of the isolates, respectively. Six different species of basidiomycetous yeasts representing 24% of the isolates were identified. Most Y. lipolytica strains showed strong proteolytic and lipolytic activities, whereas C. zeylanoides was weakly lipolytic. Results suggest that yeasts, particularly Y. lipolytica, may play a more prominent role than previously recognized in the spoilage of fresh and processed poultry stored at 5 degrees C.

  2. Assessment of Meat and Poultry Product Recalls Due to Salmonella Contamination: Product Recovery and Illness Prevention.

    Science.gov (United States)

    Seys, Scott A; Sampedro, Fernando; Hedberg, Craig W

    2017-08-01

    Data from the recalls of meat and poultry products from 2000 through 2012 due to Salmonella contamination were used to assess the factors associated with the recovery of the recalled product and to develop quantitative models to estimate the number of illnesses prevented by recalls. The percentage of product recovered following a recall action was not dependent on establishment size, recall expansions, complexity of the distribution chain, type of distribution, amount of time between the production and recall dates, or number of pounds of product recalled. However, illness-related recalls were associated with larger amounts of recalled product, smaller percentages of recalled product recovered, a greater number of days between the production date and recall date, and nationwide distribution than were recalls that were not illness related. In addition, the detection of recall-associated illnesses appeared to be enhanced in states with strong foodborne illness investigation systems. The number of Salmonella illnesses prevented by recalls was based on the number of illnesses occurring relative to the number of pounds consumed, which was then extrapolated to the number of pounds of recalled product recovered. A simulation using a program evaluation and review technique probability distribution with illness-related recalls from 2003 through 2012 estimated that there were 19,000 prevented Salmonella illnesses, after adjusting for underdiagnosis. Recalls not associated with illnesses from 2000 through 2012 prevented an estimated additional 8,300 Salmonella illnesses, after adjusting for underdiagnosis. Although further improvements to ensure accurate and complete reporting should be undertaken, our study demonstrates that recalls are an important tool for preventing additional Salmonella illnesses. Moreover, additional training resources dedicated to public health agencies for enhancing foodborne illness detection, investigations, and rapid response and reporting would

  3. Effect of mechanically deboned poultry meat content on technological properties and sensory characteristics of lamb and mutton sausages

    Directory of Open Access Journals (Sweden)

    Armando Abel Massingue

    2018-04-01

    Full Text Available Objective This study aimed to develop a value-added product concerning technological and sensory characteristics changes of the use of mechanically deboned poultry meat (MDPM as meat replacer in lamb and mutton emulsion-type sausages (mortadella. Methods Sausages were produced with lamb and mutton and with different contents of MDPM. Six treatments, using lamb or mutton and 0%, 30%, and 60% of MDPM in relation to the meat batter, were produced and analyzed for pH, proximal composition, calcium and residual nitrite content, water activity, 2-thiobarbituric acid reactive substances (TBARS, instrumental color and texture profile. The sensory profile of the mortadella’s was also evaluated by acceptance test and check-all-that-applies (CATA analysis. Results The MDPM addition increased (p<0.05 fat, residual nitrite and calcium content in the all sausage formulations, but mutton sausage had (p<0.05 higher fat and lower moisture content than lamb sausage. The pH, water activity, TBARS index and color was not affected by MDPM additions, while the mutton sausages were significantly redder (higher a*, C*, and lower h° and darker (lower L* than lamb sausages. Adding up to 60% of MDPM reduced (p<0.05 sausages hardness and chewiness. Overall, the meat replacement by MDPM increased the sausages acceptance, but the mutton sausage with 30% of MDPM replacer were the most preferred. Consumers related that pink color, glossy appearance, poultry meat-like taste, soft texture, juicy and greasy mouth feel to all sausages contain MDPM according to CATA analysis. Conclusion Mutton from culled ewes can be utilized for mortadella production with 30% replacement of lean mutton and fat by MDPM.

  4. Effect of mechanically deboned poultry meat content on technological properties and sensory characteristics of lamb and mutton sausages.

    Science.gov (United States)

    Massingue, Armando Abel; de Almeida Torres Filho, Robledo; Fontes, Paulo Rogério; de Lemos Souza Ramos, Alcinéia; Fontes, Edimar Aparecida Filomeno; Perez, Juan Ramon Olalquiaga; Ramos, Eduardo Mendes

    2018-04-01

    This study aimed to develop a value-added product concerning technological and sensory characteristics changes of the use of mechanically deboned poultry meat (MDPM) as meat replacer in lamb and mutton emulsion-type sausages (mortadella). Sausages were produced with lamb and mutton and with different contents of MDPM. Six treatments, using lamb or mutton and 0%, 30%, and 60% of MDPM in relation to the meat batter, were produced and analyzed for pH, proximal composition, calcium and residual nitrite content, water activity, 2-thiobarbituric acid reactive substances (TBARS), instrumental color and texture profile. The sensory profile of the mortadella's was also evaluated by acceptance test and check-all-that-applies (CATA) analysis. The MDPM addition increased (p<0.05) fat, residual nitrite and calcium content in the all sausage formulations, but mutton sausage had (p<0.05) higher fat and lower moisture content than lamb sausage. The pH, water activity, TBARS index and color was not affected by MDPM additions, while the mutton sausages were significantly redder (higher a *, C *, and lower h °) and darker (lower L *) than lamb sausages. Adding up to 60% of MDPM reduced (p<0.05) sausages hardness and chewiness. Overall, the meat replacement by MDPM increased the sausages acceptance, but the mutton sausage with 30% of MDPM replacer were the most preferred. Consumers related that pink color, glossy appearance, poultry meat-like taste, soft texture, juicy and greasy mouth feel to all sausages contain MDPM according to CATA analysis. Mutton from culled ewes can be utilized for mortadella production with 30% replacement of lean mutton and fat by MDPM.

  5. Zoonotic bacteria and parasites found in raw meat-based diets for cats and dogs.

    Science.gov (United States)

    van Bree, Freek P J; Bokken, Gertie C A M; Mineur, Robin; Franssen, Frits; Opsteegh, Marieke; van der Giessen, Joke W B; Lipman, Len J A; Overgaauw, Paul A M

    2018-01-13

    Feeding raw meat-based diets (RMBDs) to companion animals has become increasingly popular. Since these diets may be contaminated with bacteria and parasites, they may pose a risk to both animal and human health. The purpose of this study was to test for the presence of zoonotic bacterial and parasitic pathogens in Dutch commercial RMBDs. We analysed 35 commercial frozen RMBDs from eight different brands. Escherichia coli serotype O157:H7 was isolated from eight products (23 per cent) and extended-spectrum beta-lactamases-producing E coli was found in 28 products (80 per cent). Listeria monocytogenes was present in 19 products (54 per cent), other Listeria species in 15 products (43 per cent) and Salmonella species in seven products (20 per cent). Concerning parasites, four products (11 per cent) contained Sarcocystis cruzi and another four (11 per cent) S tenella In two products (6 per cent) Toxoplasma gondii was found. The results of this study demonstrate the presence of potential zoonotic pathogens in frozen RMBDs that may be a possible source of bacterial infections in pet animals and if transmitted pose a risk for human beings. If non-frozen meat is fed, parasitic infections are also possible. Pet owners should therefore be informed about the risks associated with feeding their animals RMBDs. © British Veterinary Association (unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  6. Genetic diversity of thermotolerant Campylobacter spp. isolates from different stages of the poultry meat supply chain in Argentina.

    Science.gov (United States)

    Zbrun, María V; Romero-Scharpen, Analía; Olivero, Carolina; Zimmermann, Jorge A; Rossler, Eugenia; Soto, Lorena P; Astesana, Diego M; Blajman, Jesica E; Berisvil, Ayelén; Frizzo, Laureano S; Signorini, Marcelo L

    The objective of this study was to investigate a clonal relationship among thermotolerant Campylobacter spp. isolates from different stages of the poultry meat supply chain in Argentina. A total of 128 thermotolerant Campylobacter spp. (89 C. jejuni and 39 C. coli) isolates from six poultry meat chains were examined. These isolates were from: a) hens from breeder flocks, b) chickens on the farm (at ages 1 wk and 5 wk), c) chicken carcasses in the slaughterhouse, and d) chicken carcasses in the retail market. Chickens sampled along each food chain were from the same batch. Campylobacter spp. isolates were analyzed using pulsed-field gel electrophoresis to compare different profiles according to the source. Clustering of C. jejuni isolates resulted in 17 profiles, with four predominant genotypes and many small profiles with just a few isolates or unique patterns, showing a very high degree of heterogeneity among the C. jejuni isolates. Some clusters included isolates from different stages within the same chain, which would indicate a spread of strains along the same poultry meat chain. Moreover, twenty-two strains of C. coli clustered in seven groups and the remaining 17 isolates exhibited unique profiles. Evidence for transmission of thermotolerant Campylobacter spp. through the food chain and cross contamination in the slaughterhouses were obtained. This collective evidence should be considered as the scientific basis to implement risk management measures to protect the public health. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  7. EFSA Panel on Biological Hazards (BIOHAZ); Scientific Opinion on the public health risks related to mechanically separated meat (MSM) derived from poultry and swine

    DEFF Research Database (Denmark)

    Hald, Tine; Baggesen, Dorte Lau

    The purpose of this assessment was to identify public health risks linked to mechanically separated meat (MSM) types from pork and poultry and compare them with fresh meat, minced meat and meat preparations (non-MSM); and to select, rank and suggest objective measurement methods and values...... is a promising method for distinction of MSM types, but further validation is needed. In order to improve methods for MSM identification, specifically designed studies for the collection of data obtained by standardised methods on indicators such as calcium and cholesterol should be undertaken, while studies...

  8. Sodium-Reduced Meat and Poultry Products Contain a Significant Amount of Potassium from Food Additives.

    Science.gov (United States)

    Parpia, Arti Sharma; Goldstein, Marc B; Arcand, JoAnne; Cho, France; L'Abbé, Mary R; Darling, Pauline B

    2018-05-01

    Sodium-reduced packaged food products are increasingly available to consumers; however, it is not clear whether they are suitable for inclusion in a potassium-reduced diet. For individuals with impaired renal potassium excretion caused by chronic kidney disease and for those taking certain medications that interfere with the rennin-angiotensin aldosterone axis, the need to limit dietary potassium is important in view of the risk for development of hyperkalemia and fatal cardiac arrhythmias. The primary objective of this study was to determine the impact of the reduction of sodium in packaged meat and poultry products (MPPs) on the content of potassium and phosphorus from food additives. This was a cross-sectional study comparing chemically analyzed MPPs (n=38, n=19 original, n=19 sodium-reduced), selected from the top three grocery chains in Canada, based on market share sales. All MPPs with a package label containing a reduced sodium content claim together with their non-sodium-reduced packaged MPP counterparts were selected for analysis. The protein, sodium, phosphorus, and potassium contents of sodium-reduced MPPs and the non-sodium-reduced (original) MPP counterparts were chemically analyzed according to the Association of Analytical Communities official methods 992.15 and 984.27 and compared by using a paired t test. The frequency of phosphorus and potassium additives appearing on the product labels' ingredient lists were compared between groups by using McNemar's test. Sodium-reduced MPPs (n=19) contained 44% more potassium (mg/100 g) than their non-sodium-reduced counterparts (n=19) (mean difference [95% CI): 184 [90-279]; P=0.001). The potassium content of sodium-reduced MPPs varied widely and ranged from 210 to 1,500 mg/100 g. Potassium-containing additives were found on the ingredient list in 63% of the sodium-reduced products and 26% of the non-sodium-reduced products (P=0.02). Sodium-reduced MPPs contained 38% less sodium (mg/100 g) than their non

  9. Isolation of Yersinia from raw meat (pork and chicken) and precooked meat (porcine tongues and sausages) collected from commercial establishments in Mexico City.

    Science.gov (United States)

    Ramírez, E I; Vázquez-Salinas, C; Rodas-Suárez, O R; Pedroche, F F

    2000-04-01

    A total of 160 meat product samples were collected from commercial outlets in Mexico City to investigate the presence of different species of Yersinia by the 4 degrees C enrichment method after 1, 3, 5, and 7 days of incubation using alkaline treatment and isolating in cefsulodin-Irgasan-novobiocin and MacConkey agars with Tween 80. Overall, Yersinia spp. were isolated from 27% of the samples analyzed, whereas 40% of the raw and only 13% of the precooked samples were contaminated. Although 2,970 colonies showed Yersinia characteristics, only 706 (24%) actually corresponded to this genus: 49% were Yersinia enterocolitica, 25% Yersinia kristensenii, 15% Yersinia intermedia, 9% Yersinia frederiksenii, and 2% Yersinia aldovae; 10% corresponded to biotype 2, 2% to biotype 3, and 4% to biotype 4. The presence of Yersinia in raw and cooked meat products represents a health risk for consumers in Mexico, where further clinical studies are needed to assess the epidemiological importance of this pathogen.

  10. Occurrence of Campylobacter spp. in poultry and poultry products for sale on the Polish retail market.

    Science.gov (United States)

    Maćkiw, Elżbieta; Rzewuska, Katarzyna; Stoś, Katarzyna; Jarosz, Mirosław; Korsak, Dorota

    2011-06-01

    In 2007 and 2008, a monitoring study was carried out in Poland to examine the occurrence of thermotolerant Campylobacter spp. in raw and cooked chicken products available on the retail market. A total of 912 samples were tested: 443 samples of raw chicken meat, 146 samples of giblets, and 323 ready-to-eat poultry products (150 samples of spit-roasted chicken, 56 samples of smoked chicken, and 117 samples of pâté and cold meats). A high level of contamination of raw chicken meat (51.7% of samples) and chicken giblets (47.3% of samples) was detected. However, thermotolerant Campylobacter spp. were found in only 1.2% of the ready-to-eat poultry products.

  11. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  12. Effect of salt, kinnow and pomegranate fruit by-product powders on color and oxidative stability of raw ground goat meat during refrigerated storage.

    Science.gov (United States)

    Devatkal, Suresh K; Naveena, B M

    2010-06-01

    Effects of salt, kinnow and pomegranate fruit by-product powders on color and oxidative stability of raw ground goat meat stored at 4+/-1 degrees C was evaluated. Five treatments evaluated include: control (only meat), MS (meat+2% salt), KRP (meat+2% salt+2% kinnow rind powder), PRP (meat+2% salt+2% pomegranate rind powder) and PSP (meat+2% salt+2% pomegranate seed powder). Addition of salt resulted in reduction of redness scores. Lightness increased in control and unchanged in others during storage. Redness scores declined and yellowness showed inconsistent changes during storage. Thiobarbituric acid reactive substances (TBARS) values were higher (PPRP>KRP>control>MS. Therefore, these powders have potential to be used as natural antioxidants to minimize the auto-oxidation and salt induced lipid oxidation in raw ground goat meat. Crown Copyright 2010. Published by Elsevier Ltd. All rights reserved.

  13. Effects of Tannic Acid on Lipid and Protein Oxidation, Color, and Volatiles of Raw and Cooked Chicken Breast Meat during Storage

    Directory of Open Access Journals (Sweden)

    Marwan Al-Hijazeen

    2016-06-01

    Full Text Available The objective of this study was to determine the effect of tannic acid (TA on the oxidative stability and the quality characteristics of ground chicken breast meat. Five treatments including (1 control (none added, (2 2.5 ppm TA, (3 5 ppm TA, (4 10 ppm TA, and (5 5 ppm butylated hydroxyanisole (BHA were added to boneless, skinless ground chicken breast meat, and used for both raw and cooked meat studies. For the raw meat study, the ground chicken breast meat was packaged in oxygen-permeable bags and stored at 4 °C for 7 days. For the cooked study, raw ground meat samples were vacuum-packaged in oxygen-impermeable vacuum bags, cooked in-bag to the internal temperature of 75 °C, re-packaged in oxygen-permeable bags, and then stored. Both raw and cooked meats were analyzed for lipid and protein oxidation, color, and volatiles (cooked meat only at 0, 3, and 7 days of storage. Raw meats with 10 ppm of TA added had significantly (p ≤ 0.05 lower lipid and protein oxidation than other treatments during storage. In addition, TA at 10 ppm level maintained the highest color a*- and L*-values during storage. Cooked chicken breast meat with 5 and 10 ppm TA added produced significantly (p ≤ 0.05 lower amounts of off-odor volatiles than other treatments. Among the volatile compounds, the amount of hexanal increased rapidly during storage for cooked meat. However, meats with 5 and 10 ppm TA added showed the lowest amount of hexanal and other aldehydes related to lipid oxidation, indicating a strong antioxidant effect of TA in cooked chicken breast meat. Furthermore, the differences in aldehydes among the treatments were bigger in cooked than in raw meat, indicating that the antioxidant effect of TA in cooked meat was greater than that in raw meat. Therefore, TA at >5 ppm can be used as a good natural preservative in cooked chicken meat to maintain its quality during storage.

  14. Prevalence of Antibiotic Resistance in Escherichia coli Isolated from Poultry Meat Supply in Isfahan

    Directory of Open Access Journals (Sweden)

    Farhad Safarpordehkordi

    2014-08-01

    Conclusions: Despite the high contamination rate of chicken meat with Escherichia coli, majority of isolates had high resistance to common antibiotics. Complete cooking of meat and avoid indiscriminate prescribing of antibiotics, preventing the occurrence of food poisoning due to resistant Escherichia coli.

  15. Assessing the potential for raw meat to influence human colonization with Staphylococcus aureus

    OpenAIRE

    Carrel, Margaret; Zhao, Chang; Thapaliya, Dipendra; Bitterman, Patrick; Kates, Ashley E.; Hanson, Blake M.; Smith, Tara C.

    2017-01-01

    The role of household meat handling and consumption in the transfer of Staphylococcus aureus (S. aureus) from livestock to consumers is not well understood. Examining the similarity of S. aureus colonizing humans and S. aureus in meat from the stores in which those individuals shop can provide insight into the role of meat in human S. aureus colonization. S. aureus isolates were collected from individuals in rural and urban communities in Iowa (n?=?3347) and contemporaneously from meat produc...

  16. No evidence of decreased risk of colorectal adenomas with white meat, poultry, and fish intake: a meta-analysis of observational studies.

    Science.gov (United States)

    Xu, Bin; Sun, Jing; Sun, Yunwei; Huang, Liya; Tang, Yuming; Yuan, Yaozong

    2013-04-01

    Observational studies on the association between white meat (including fish and poultry) intake and the risk of colorectal adenoma (CRA), the precursor of colorectal cancer, have reported mixed results. To provide a quantitative assessment of this association, we summarized the evidence from observational studies. Relevant studies published on or before April 30, 2012 were identified from MEDLINE and EMBASE. Summary effect size estimates with 95% confidence intervals (CIs) were calculated with a random-effects model. Between-study heterogeneity was assessed using the Cochran Q and I(2) statistics. A total of 23 publications from 21 independent studies (16 case-control and 5 cohort studies) were included in this meta-analysis. Based on high versus low analysis, the summary effect size estimate of CRA was 0.96 (95% CI, 0.84-1.09) for white meat intake, 0.98 (95% CI, 0.80-1.19) for fish intake, and 0.98 (95% CI, 0.80-1.18) for poultry intake. Subgroup analyses revealed that the null associations of CRA with intake of white meat (fish/poultry) were independent of geographic locations, study design, type of food frequency questionnaire, number of cases, and adjustments for confounders, such as body mass index, use of nonsteroidal anti-inflammatory drugs, dietary energy intake, smoking, and physical activity. Intake of white meat (fish/poultry) is not associated with the risk of CRA. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Characterization of transferable tetracycline resistance genes in Enterococcus faecalis isolated from raw food

    DEFF Research Database (Denmark)

    Wilcks, Andrea; Andersen, Sigrid Rita; Licht, Tine Rask

    2005-01-01

    The prevalence of tetracycline resistance, and of specific genetic determinants for this resistance was investigated in 1003 strains of Enterococcus faecalis isolated from various raw food products originating from five categories including chicken meat, other poultry meat, beef, pork, and 'other...

  18. Valorization of functional properties of extract and powder of olive leaves in raw and cooked minced beef meat.

    Science.gov (United States)

    Aouidi, Fathia; Okba, Aicha; Hamdi, Moktar

    2017-08-01

    Olive leaves (OL), available in huge amounts from pruning, are known to be a useful source of biologically active compounds. This study investigated the potential application of OL as a supplement to minced beef meat in order to develop a functional product. The effect of OL extract or powder (100 and 150 µg phenols g -1 meat) on the quality and stability of raw and cooked meat during refrigerated storage was examined. Microwave drying at 600 W gave OL with the highest antioxidant quality (evaluated by TEAC/[phenols] (mg mg -1 ) and DPPH/[phenols] (mg mg -1 )) compared with other methods. OL showed an ability to inhibit (P production was 43-65% in control samples and 14-35% in treated samples). OL also improved the technological quality of the meat, decreasing (P functional meat products of good technological quality that remain stable during storage. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  19. The physicochemical properties and antioxidative potential of raw thigh meat from broilers fed a dietary medicinal herb extract mixture

    Directory of Open Access Journals (Sweden)

    K. Shirzadegan

    2014-07-01

    Full Text Available A 6-wk feeding study was conducted to evaluate the antioxidative potential, indices such as quality of the thigh meat and liver of broiler chickens fed with a dietary medicinal herb extract mixture (HEM, consisting: Iranian green tea, cinnamon, garlic and chicory at a ratio of 25:15:45:15. A total of 320, one-d-old Ross (male broiler chickens were used to investigate the effects of 0.0, 2.5, 5.0 and 7.5 g/kg HEM in the diet, on aforementioned factors. The HEM supplementation did not influence the composition of raw thigh meat except for the total phenols and crude ash (P<0.05. Furthermore, pH, water-holding capacity (WHC and acceptability of thigh meat were affecting by administration of HEM in diets (P<0.05. Meat flavor increased in the supplemented groups (P<0.05. According to our data, HEM supplementation decreased the amount of thiobarbituric acid reactive substance (TBARS in various times of storage and improved the liver lipid peroxides and superoxide dismutase (SOD activities at week 6 (P<0.05, but did not influence the catalase activity. Our results reveal that the addition of 7.5 g/kg or higher HEM in diet could be sufficient to increase the antioxidative activity and 2.5 g/kg for meat taste of broilers in maximum levels.

  20. Effects of the addition of mechanically deboned poultry meat and collagen fibers on quality characteristics of frankfurter-type sausages.

    Science.gov (United States)

    Pereira, Anirene Galvão Tavares; Ramos, Eduardo Mendes; Teixeira, Jacyara Thaís; Cardoso, Giselle Pereira; Ramos, Alcinéia de Lemos Souza; Fontes, Paulo Rogério

    2011-12-01

    The effects of mechanically deboned poultry meat (MDPM) and levels of collagen fibers on comminuted, cooked sausage quality characteristics were investigated using the central composite rotatable design of response surface methodology (RSM). Use of collagen fiber as an additive affected the sausage characteristics, but the effect depended on the amount of the MDPM used. While MDPM additions resulted in higher cooking loss and darker and redder frankfurters, the addition of collagen fibers improved cooking yields and contributed to the lightness of the final product. Higher collagen fiber content was also accompanied by a significant increase in frankfurter hardness regardless of the MDPM content. Use of collagen fibers countered the negative effects of MDPM on sausage quality attributes, especially on cooking yields and final product color. Copyright © 2011 Elsevier Ltd. All rights reserved.

  1. Effect of methionine supplementation in chicken feed on the quality and shelf life of fresh poultry meat.

    Science.gov (United States)

    Albrecht, Antonia; Herbert, Ulrike; Miskel, Dennis; Heinemann, Celine; Braun, Carina; Dohlen, Sophia; Zeitz, Johanna O; Eder, Klaus; Saremi, Behnam; Kreyenschmidt, Judith

    2017-08-01

    occurred slightly faster. In conclusion, methionine concentration, but not methionine source, effected meat quality parameters in breast muscles of broilers. © 2017 Poultry Science Association Inc.

  2. Assessing the potential for raw meat to influence human colonization with Staphylococcus aureus.

    Science.gov (United States)

    Carrel, Margaret; Zhao, Chang; Thapaliya, Dipendra; Bitterman, Patrick; Kates, Ashley E; Hanson, Blake M; Smith, Tara C

    2017-09-07

    The role of household meat handling and consumption in the transfer of Staphylococcus aureus (S. aureus) from livestock to consumers is not well understood. Examining the similarity of S. aureus colonizing humans and S. aureus in meat from the stores in which those individuals shop can provide insight into the role of meat in human S. aureus colonization. S. aureus isolates were collected from individuals in rural and urban communities in Iowa (n = 3347) and contemporaneously from meat products in stores where participants report purchasing meat (n = 913). The staphylococcal protein A (spa) gene was sequenced for all isolates to determine a spa type. Morisita indices and Permutational Multivariate Analysis of Variance Using Distance Matrices (PERMANOVA) were used to determine the relationship between spa type composition among human samples and meat samples. spa type composition was significantly different between households and meat sampled from their associated grocery stores. spa types found in meat were not significantly different regardless of the store or county in which they were sampled. spa types in people also exhibit high similarity regardless of residential location in urban or rural counties. Such findings suggest meat is not an important source of S. aureus colonization in shoppers.

  3. Detection of Mechanically Recovered Poultry Meat (MRPM in Traditional Egyptian Luncheon (Emulsion Type Sausage

    Directory of Open Access Journals (Sweden)

    Mohamed Mai A.

    2016-03-01

    Full Text Available Detection of MRPM in emulsion type products is a challenge facing meat industry. Where, most of meat products processors in Egypt illegally replace beef meat partially or totally with MRPM in meat products to reduce products cost. Commercial and experimentally produced emulsion type sausage (traditional Egyptian luncheon formulated with 0, 10, 30, 50, 70, 90% MRPM instead of the meat mass and cooked to different core temperature (70, 80 and 90°C were examined for technological properties, ash, bones, cartilage and calcium (Ca content, in addition to histological sections stained with H&E and Trichrome blue. Results indicated that all market samples showed unacceptable texture and binding scores with high ash, collagen, cartilage, bone and Ca content. Histological section showed the presence of skin and cartilage. Addition of 10% MRPM to luncheon formulation could not be detected at different cooking temperatures. While the use of 30% or more MRPM to luncheon formulation, significantly changed technological properties and chemical composition of the product. Thermal treatments of luncheon sausages changed their chemical composition as well as induced structural changes in bone and cartilage content.

  4. Omega-3 fatty acids, nutrient retention values, and sensory meat eating quality in cooked and raw Australian lamb.

    Science.gov (United States)

    Flakemore, Aaron Ross; Malau-Aduli, Bunmi Sherifat; Nichols, Peter David; Malau-Aduli, Aduli Enoch Othniel

    2017-01-01

    This study evaluated omega-3 intramuscular fatty acids in the longissimus thoracis et lumborum of commercially prepared Australian lamb loin chops. Meats, denuded of external fats were cooked by means of conductive dry-heat using a fry grilling hot plate, to a core temperature of 70°C. An untrained consumer panel assessed meat appearance, aroma, tenderness, juiciness, taste and overall liking. Results showed no compositional alterations (P>0.05) to omega-3 fatty acids due to cooking treatment, whereas on absolute terms (mg/100g muscle) omega-3 fatty acids significantly (Pcooked meat at 32.8±2.3mg/100g muscle exceeded the minimum 30mg/100g per edible portion required for the defined Australian classification as 'source' long-chain (≥C 20 ) omega-3 for cooked lamb. A 3.4% intramuscular fat content in the initial raw meat was sufficient to maintain acceptable overall sensory eating quality. Results endorse the application of this cooking method to enable delivery of health beneficial long-chain omega-3 fatty acids of commercially prepared Australian lamb loin chops to consumers without impediments to sensory eating properties. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Quantification of meat proportions by measuring DNA contents in raw and boiled sausages using matrix-adapted calibrators and multiplex real-time PCR.

    Science.gov (United States)

    Köppel, René; Eugster, Albert; Ruf, Jürg; Rentsch, Jürg

    2012-01-01

    The quantification of meat proportions in raw and boiled sausage according to the recipe was evaluated using three different calibrators. To measure the DNA contents from beef, pork, sheep (mutton), and horse, a tetraplex real-time PCR method was applied. Nineteen laboratories analyzed four meat products each made of different proportions of beef, pork, sheep, and horse meat. Three kinds of calibrators were used: raw and boiled sausages of known proportions ranging from 1 to 55% of meat, and a dilution series of DNA from muscle tissue. In general, results generated using calibration sausages were more accurate than those resulting from the use of DNA from muscle tissue, and exhibited smaller measurement uncertainties. Although differences between uses of raw and boiled calibration sausages were small, the most precise and accurate results were obtained by calibration with fine-textured boiled reference sausages.

  6. A survey of PCDD/Fs and co-planar PCBs in the US meat and poultry supply in 2002-2003

    Energy Technology Data Exchange (ETDEWEB)

    Huwe, J.; Larsen, G.; Zaylskie, R.; Lorentzsen, M. [USDA, ARS, Biosciences Research Lab., Fargo (United States); Hoffman, M.K.; Deyrup, C.; Hulebak, K.; Clinch, N. [USDA, FSIS, OPHS, WA (United States)

    2004-09-15

    Periodic surveys of the food supply for dioxins and dioxin-like compounds are a useful tool to measure changes in dioxin levels in the environment and to update predictions of human exposure to these toxic compounds from dietary components. In the mid-1990s, the US Department of Agriculture together with the US Environmental Protection Agency conducted a survey of dioxins in beef, pork, and poultry from slaughtering facilities across the US. A similar survey has been conducted to obtain statistically-valid information about current levels of dioxins in domesticallyproduced meat and poultry, to further investigate any unusual findings, and to compare these new results with those from the previous survey.

  7. Presence of Salmonella Spp and Escherichia Coli O157:H7 in Raw Meat, in São Paulo City, Brazil and Evaluation of Low Temperature (Refrigeration and Freezing) Resistance of these Bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Jakabi, M.; Gelli, D. S.; Ristori, C. A.; De Paula, A. M.R.; Sakuma, H.; Lopez, G. I.S. [Seção de Microbiologia Alimentar (Brazil); Fernandes, S. A. [Seção de Bacteriologia Médica (Brazil); Luchesi, R. B. [Seção de Meios de Cultura (Brazil); Instituto Adolfo Lutz, São Paulo (Brazil)

    2005-01-15

    A total of 253 samples of raw meat (bovine, swine and poultry) were collected in local supermarkets in Sao Paulo, Brazil, and analysed for Salmonella and E. coli 0157:H7, in order to determine their microbiological quality and compliance with the established standards for these two bacteria. Additionally, samples of ground beef were artificially contaminated with S. enteritidis and E. coli 0157:H7, in order to determine the effect of refrigeration and freezing temperature during the storage period (4ºC for 5 days, and - 18ºC for 90 days, respectively). Twenty-three samples (9.1%) were positive to Salmonella and seven different serotypes were isolated, S. enteritidis being the most common serotype founded (34,8%). The results of the artificially contaminated samples showed that E. coli 0157:H7 was sensitive to refrigeration as well as freezing temperature. S. enteritidis was only affected by freezing temperature during the storage time. (author)

  8. Prevalence of Campylobacter jejuni in eggs and poultry meat in New York State.

    Science.gov (United States)

    Baker, R C; Paredes, M D; Qureshi, R A

    1987-11-01

    The presence of Campylobacter jejuni was tested for but not isolated from any of 276 eggs sampled from 23 egg farms in New York State. The presence of C. jejuni was evaluated in broilers, kosher broilers, spent layers, Peking ducks, and turkeys. Four of five poultry dressing plants tested showed positive growth of C. jejuni on the 25-carcass samples at various stages of processing. Twenty to 100% of live birds sampled contained C. jejuni on the skin but 90 to 100% were contaminated after scalding and defeathering operations from contaminated birds and equipment. A three to four-fold increase in carcass contamination was observed after evisceration. The number of C. jejuni on the carcasses decreased after washing and chilling. The organisms did not survive the salting, rinsing, and chilling operations in a kosher processing plant. Several pieces of equipment, i.e., shackles, eviscerating troughs, and cooling tanks were contaminated with C. jejuni. This study illustrates how C. jejuni may be transmitted from the live bird to the final poultry product.

  9. Cost-effectiveness of interventions to control Campylobacter in the New Zealand poultry meat food supply.

    Science.gov (United States)

    Lake, Robin J; Horn, Beverley J; Dunn, Alex H; Parris, Ruth; Green, F Terri; McNickle, Don C

    2013-07-01

    An analysis of the cost-effectiveness of interventions to control Campylobacter in the New Zealand poultry supply examined a series of interventions. Effectiveness was evaluated in terms of reduced health burden measured by disability-adjusted life years (DALYs). Costs of implementation were estimated from the value of cost elements, determined by discussions with industry. Benefits were estimated by changing the inputs to a poultry food chain quantitative risk model. Proportional reductions in the number of predicted Campylobacter infections were converted into reductions in the burden of disease measured in DALYs. Cost-effectiveness ratios were calculated for each intervention, as cost per DALY reduction and the ratios compared. The results suggest that the most cost-effective interventions (lowest ratios) are at the primary processing stage. Potential phage-based controls in broiler houses were also highly cost-effective. This study is limited by the ability to quantify costs of implementation and assumptions required to estimate health benefits, but it supports the implementation of interventions at the primary processing stage as providing the greatest quantum of benefit and lowest cost-effectiveness ratios.

  10. Risk factors and spatial distribution of extended spectrum β-lactamase-producing- Escherichia coli at retail poultry meat markets in Malaysia: a cross-sectional study

    Directory of Open Access Journals (Sweden)

    A. B. Aliyu

    2016-08-01

    Full Text Available Abstract Background The significant role of retail poultry meat as an important exposure pathway for the acquisition and transmission of extended spectrum β-lactamase-producing Escherichia coli (ESBL-EC into the human population warrants understanding concerning those operational practices associated with dissemination of ESBL-EC in poultry meat retailing. Hence, the objective of this study was to determine the prevalence, spatial distribution and potential risk factors associated with the dissemination of ESBL-EC in poultry meat retail at wet-markets in Selangor, Malaysia. Methods Poultry meat (breast, wing, thigh, and keel as well as the contact surfaces of weighing scales and cutting boards were sampled to detect ESBL-EC by using culture and disk combination methods and polymerase chain reaction assays. Besides, questionnaire was used to obtain data and information pertaining to those operational practices that may possibly explain the occurrence of ESBL-EC. The data were analysed using logistic regression analysis at 95 % CI. Results The overall prevalence of ESBL-EC was 48.8 % (95 % CI, 42 – 55 %. Among the risk factors that were explored, type of countertop, sanitation of the stall environment, source of cleaning water, and type of cutting board were found to be significantly associated with the presence of ESBL-EC. Conclusions Thus, in order to prevent or reduce the presence of ESBL-EC and other contaminants at the retail-outlet, there is a need to design a process control system based on the current prevailing practices in order to reduce cross contamination, as well as to improve food safety and consumer health.

  11. Risk factors and spatial distribution of extended spectrum β-lactamase-producing- Escherichia coli at retail poultry meat markets in Malaysia: a cross-sectional study.

    Science.gov (United States)

    Aliyu, A B; Saleha, A A; Jalila, A; Zunita, Z

    2016-08-02

    The significant role of retail poultry meat as an important exposure pathway for the acquisition and transmission of extended spectrum β-lactamase-producing Escherichia coli (ESBL-EC) into the human population warrants understanding concerning those operational practices associated with dissemination of ESBL-EC in poultry meat retailing. Hence, the objective of this study was to determine the prevalence, spatial distribution and potential risk factors associated with the dissemination of ESBL-EC in poultry meat retail at wet-markets in Selangor, Malaysia. Poultry meat (breast, wing, thigh, and keel) as well as the contact surfaces of weighing scales and cutting boards were sampled to detect ESBL-EC by using culture and disk combination methods and polymerase chain reaction assays. Besides, questionnaire was used to obtain data and information pertaining to those operational practices that may possibly explain the occurrence of ESBL-EC. The data were analysed using logistic regression analysis at 95 % CI. The overall prevalence of ESBL-EC was 48.8 % (95 % CI, 42 - 55 %). Among the risk factors that were explored, type of countertop, sanitation of the stall environment, source of cleaning water, and type of cutting board were found to be significantly associated with the presence of ESBL-EC. Thus, in order to prevent or reduce the presence of ESBL-EC and other contaminants at the retail-outlet, there is a need to design a process control system based on the current prevailing practices in order to reduce cross contamination, as well as to improve food safety and consumer health.

  12. Designing a time-effective TaqMan probe-based real-time polymerase chain reaction protocol for the identification of Yersinia enterocolitica in raw pork meat

    Directory of Open Access Journals (Sweden)

    Milena Alicja Stachelska

    2017-01-01

    Full Text Available The aim of this study was to design a time-effective method comprising a short pre-enrichment step in a non-selective broth in combination with the TaqMan probe applied in the real-time polymerase chain reaction to detect Yersinia enterocolitica strains in raw pork meat. The method enabled to detect 1 colony forming unit per 25 mg of Yersinia enterocolitica in pork meat. The specificity and reliability of the method was not diminished by the company of microflora naturally present in meat. The method was found successful to detect pathogenic Yersinia enterocolitica strains in pork meat. It is advised to be used for assessing the microbial risk and for controlling the microbial quality of meat and meat products.

  13. Effect of chosen lactic acid bacteria strains on Staphylococcus aureus in vitro as well as in meat and raw sausages.

    Science.gov (United States)

    Gomółka-Pawlicka, M; Uradziński, J; Wiszniewska, A

    2004-01-01

    The present study was aimed at determining the influence of 15 strains of lactic acid bacteria on the growth of 2 Staphylococcus aureus strains in vitro as well as in meat and raw sausages. The investigations were performed within the framework of three alternate stages which differed in respect to the products studied, the number of Lactobacillus sp. strains and, partly, methodological approach. The study also considered water activity (a(w)) and pH of the products investigated. The results obtained are demonstrated in 5 diagrams. It was found that among 15 strains of Lactobacillus aureus investigated only one strain, Lactobacillus helveticus T 78, showed antagonistic effect on studied strains of Staphylococcus aureus both in vitro as well as in meat and raw sausages. Five other strains of Lactobacillus spp. displayed the antagonistic effect in vitro only. The temperature and incubation time of sausages, but also the type of sausage stuffing were found to have a distinct or slight influence, respectively, on the antagonistic interaction between the bacteria. However, this phenomenon was affected by neither a(w) nor pH.

  14. The safety and quality of pork and poultry meat imports for the common European market received at border inspection post Hamburg Harbour between 2014 and 2015.

    Science.gov (United States)

    Jansen, Wiebke; Woudstra, Svenja; Müller, Anja; Grabowski, Nils; Schoo, Gundela; Gerulat, Bettina; Klein, Günter; Kehrenberg, Corinna

    2018-01-01

    Though imports of products of animal origin into the European Union (EU) have to comply with legal requirements and quality standards of the community, food consignment rejections at external EU borders have been increasing in recent years. This study explored microbiological metrics according to national target and critical values valid for samples at consumer level of 498 fresh poultry meat and 136 fresh pork filets from consignments subjected to physical checks during clearing at the border inspection post Hamburg harbour between January 2014 and December 2015 with ISO standard methods. Quantitative results indicated that critical thresholds for aerobic counts, Enterobacteriaceae, and E. coli were never surpassed. Merely for staphylococci, one poultry sample (0.2%) and 10 pork samples (9.3%) exceeded the critical limit (3.7 log cfu/g). However, qualitative analyses revealed that, Staphylococcus aureus was present in 16% and 10% of all poultry and pork samples, respectively, though no methicillin-resistant Staphylococcus aureus could be confirmed. Moreover, E. coli was present in 50% and 67% of all pork and poultry samples, respectively, and thereof 33 isolates were confirmed as extended-spectrum β-lactamase-producing E. coli. Only 1.2% of the poultry samples were unacceptable due to the presence of Salmonella spp., whereas they were not detected in any pork sample. Campylobacter spp. were not detected in any sample. Though imported pork and poultry meat complies mostly with national market requirements, it might pose a potential risk to public health, especially for a direct or indirect foodborne transmission of imported, uncommon strains of zoonotic bacteria.

  15. Effect of irradiation dose and irradiation temperature on the thiamin content of raw and cooked chicken breast meat

    International Nuclear Information System (INIS)

    Graham, W.D.; Stevenson, M.H.; Stewart, E.M.

    1998-01-01

    The usefulness of ionising radiation for the elimination of pathogenic bacteria in poultry meat has been well documented as have the effects of this processing treatment on the nutritional status of the food, in particular, the vitamins. Unfortunately, much of the earlier research carried out on the effect of irradiation on vitamins was carried out in solution or in model systems at doses much greater than those used commercially thereby resulting in considerable destruction of these compounds. Thus, those opposed to the process of food irradiation labelled the treated food as nutritionally poor. However, in reality, due to the complexity of food systems the effects of irradiation on vitamins are generally not as marked and many processes, for example cooking, cause the same degree of change to the vitamins. Thiamin (vitamin B1) is the most radiation sensitive of the water-soluble vitamins and is therefore a good indicator of the effect of irradiation treatment. In this study the effects of irradiation at either 4°C or −20°C followed by cooking on the thiamin content of chicken breast meat was determined. Results showed that whilst both irradiation and cooking resulted in a decrease in thiamin concentration, the losses incurred were unlikely to be of nutritional significance and could be further minimised by irradiating the chicken meat at a low temperature. Thiamin analyses were carried out using high-performance liquid chromatography since this technique is faster and more selective than the chemical or microbiological methods more commonly employed. Total thiamin, both free and combined form, was determined following acid and enzyme hydrolysis. © 1998 Society of Chemical Industry

  16. Dietary phosphorus restriction in dialysis patients: potential impact of processed meat, poultry, and fish products as protein sources.

    Science.gov (United States)

    Sherman, Richard A; Mehta, Ojas

    2009-07-01

    Dietary intake of phosphorus is derived largely from protein sources and is a critical determinant of phosphorus balance in patients with chronic kidney disease. Information about the phosphorus content of prepared foods generally is unavailable, but it is believed to contribute significantly to the phosphorus burden of patients with chronic kidney disease. Analysis of dietary components. We measured the phosphorus content of 44 food products, including 30 refrigerated or frozen precooked meat, poultry, and fish items, generally national brands. Measured and reported phosphorus content of foods. Phosphorus by using Association of Analytical Communities official method 984.27; protein by using Association of Analytical Communities official method 990.03. We found that the ratio of phosphorus to protein content in these items ranged from 6.1 to 21.5 mg of phosphorus per 1 g of protein. The mean ratio in the 19 food products with a label listing phosphorus as an additive was 14.6 mg/g compared with 9.0 mg/g in the 11 items without listed phosphorus. The phosphorus content of only 1 precooked food product was available in a widely used dietary database. Results cannot be extrapolated to other products. Manufacturers also may alter the phosphorus content of foods at any time. Protein content was not directly measured for all foods. Better reporting of phosphorus content of foods by manufacturers could result in improved dietary phosphorus control without risk of protein malnutrition.

  17. Improvement of production standards in a company leader in the poultry meat market: the competent authority’s role

    Directory of Open Access Journals (Sweden)

    Monica Gramenzi

    2013-09-01

    Full Text Available The object of this study was to evaluate, in a company that is leader in the production of poultry meat, the effects of the combined action between the official veterinary controls and the food business operator (FBO on corporate manufacturing standards. To this purpose, the corporate documentation have been examined (inspection reports and audits of official veterinary controls and data obtained by self-control procedures on a four-year period between 2008 and 2011. The results obtained showed that, despite the application of specific procedures by the FBO, the competent authority has observed a number of non-compliances, grouped into four main areas: cleaning and disinfection, maintenance in the plant, staff training, management of animal by-products. The immediate response of the FBO for the resolution of the non-compliances resulted in an overall significant improvement in hygiene and safety of products and processes, a gradually reduced number of non-compliance reports, a decrease of all microbiological parameters and the extension of products’ shelf life.

  18. Prevalence and antimicrobial susceptibility of Salmonella isolated from a variety of raw meat sausages in Gaborone (Botswana) retail stores.

    Science.gov (United States)

    Samaxa, Ronald Gaelekolwe; Matsheka, Maitshwarelo Ignatius; Mpoloka, Sununguko Wata; Gashe, Berhanu Abegaz

    2012-04-01

    The objective of the study was to provide baseline data on the prevalence and antimicrobial susceptibility of Salmonella in different types of raw meat sausages directly accessible to the consumers in Gaborone, Botswana. A total of 300 raw sausages comprising 79 beef, 78 pork, 72 chicken, and 71 mutton samples were concurrently analyzed for the presence of Salmonella using a conventional culture method and a validated PCR method. The PCR assay results were in full concordance with those of the conventional culture method for the detection of Salmonella. Sixty-five (21.7%) of 300 samples were positive for Salmonella by both the conventional culture method and PCR assay. Even though more chicken samples contained Salmonella than did any other sausage type, the difference in the presence of Salmonella among the four sausages types was not significant. Eleven serotypes were identified, and Salmonella enterica subsp. salamae II was most prevalent in all the sausage types. Beef sausages generally had higher mesophilic bacterial counts than did the other three sausage types. However, higher microbial counts were not reflective of the presence of salmonellae. Susceptibility of the Salmonella enterica serotypes to 20 antimicrobial agents was determined, and Salmonella Muenchen was resistant to the widest array of agents and was mostly isolated from chicken sausages. Regardless of the meat of origin, all 65 Salmonella isolates were resistant to at least four antimicrobial agents: amikacin, gentamicin, cefuroxime, and tombramycin. This resistance profile group was the most common in all four sausage types, comprising 90% of all Salmonella isolates from beef, 71% from pork, 63% from mutton, and 35% from chicken. These results suggest that raw sausages pose a risk of transmitting multidrug-resistant Salmonella isolates to consumers.

  19. Compared with Raw Bovine Meat, Boiling but Not Grilling, Barbecuing, or Roasting Decreases Protein Digestibility without Any Major Consequences for Intestinal Mucosa in Rats, although the Daily Ingestion of Bovine Meat Induces Histologic Modifications in the Colon.

    Science.gov (United States)

    Oberli, Marion; Lan, Annaïg; Khodorova, Nadezda; Santé-Lhoutellier, Véronique; Walker, Francine; Piedcoq, Julien; Davila, Anne-Marie; Blachier, François; Tomé, Daniel; Fromentin, Gilles; Gaudichon, Claire

    2016-08-01

    Cooking may impair meat protein digestibility. When undigested proteins are fermented by the colon microbiota, they can generate compounds that potentially are harmful to the mucosa. This study addressed the effects of typical cooking processes and the amount of bovine meat intake on the quantity of undigested proteins entering the colon, as well as their effects on the intestinal mucosa. Male Wistar rats (n = 88) aged 8 wk were fed 11 different diets containing protein as 20% of energy. In 10 diets, bovine meat proteins represented 5% [low-meat diet (LMD)] or 15% [high-meat diet (HMD)] of energy, with the rest as total milk proteins. Meat was raw or cooked according to 4 processes (boiled, barbecued, grilled, or roasted). A meat-free diet contained only milk proteins. After 3 wk, rats ingested a (15)N-labeled meat meal and were killed 6 h later after receiving a (13)C-valine injection. Meat protein digestibility was determined from (15)N enrichments in intestinal contents. Cecal short- and branched-chain fatty acids and hydrogen sulfide were measured. Intestinal tissues were used for the assessment of protein synthesis rates, inflammation, and histopathology. Meat protein digestibility was lower in rats fed boiled meat (94.5% ± 0.281%) than in the other 4 groups (97.5% ± 0.0581%, P HMD) and on myeloperoxidase activity in the proximal colon (HMD > LMD), but not on other outcomes. The ingestion of bovine meat, whatever the cooking process and the intake amount, resulted in discrete histologic modifications of the colon (epithelium abrasion, excessive mucus secretion, and inflammation). Boiling bovine meat at a high temperature (100°C) for a long time (3 h) moderately lowered protein digestibility compared with raw meat and other cooking processes, but did not affect cecal bacterial metabolites related to protein fermentation. The daily ingestion of raw or cooked bovine meat had no marked effect on intestinal tissues, despite some slight histologic modifications

  20. THE USAGE OF ANIMAL AND VEGETABLE ORIGIN RAW MATERIALS COMBINATORICS IN MEAT PRODUCTS OF “HALAL†CATEGORY DEVELOPMENT

    OpenAIRE

    Ivan F. Gorlov; Oksana B. Gelunova; Tatiana M. Giro; Ekaterina P. Mirzayanova

    2014-01-01

    Integrated researches aimed to develop technologies and recipes for meat products of “Halal†category using seed fat and Milk Protein-Carbohydrate Concentrate (MPCC) represent a new generation of scientific and practical interest. In this connection, the authors propose technologies and recipes for meat products of “Halal†category, designed on the basis of rational combinatorics of animal and vegetable origin raw materials, that l...

  1. Effect of radurization of the chemical, microbiological and organoleptic characteristics of poultry meat

    International Nuclear Information System (INIS)

    El-Wakeil, F.A.; El-Magoli, S.B.M.; Salama, N.A.M.

    1978-01-01

    The possible use of irradiation at three different doses, 0.5, 1.0 and 1.5 Mrad, to prolong the shelf-life of chicken meat was investigated. A pretreatment with salt solution (2.5% NaCl and 0.25% Na 5 PH 3 O 10 ) was also studied. The effect of such pretreatments and irradiation doses on the chemical, microbiological and acceptability characteristics were evaluated. A shelf-life extension of 4 weeks with satisfactorily acceptable scores was obtained at 1.5 Mrad. Salt pretreatment had an improving effect on the acceptability scores, even at 0.8 Mrad after 4 weeks. The microbial level directly after irradiation was reduced by about 80 to 95% in all the samples investigated. The rate of bacterial growth increased during storage and reached a maximum of 10 5 /g at 0.8 Mrad in the samples pretreated with salt. At this level the samples were still acceptable. All the irradiated samples showed neither E. coli nor faecal streptococci, although they were both found in the controls. Irradiation apparently resulted in a net increase in the free amino acids, which increased from abut 0.67 in the control to about 1.9 after four weeks of storage. This increase was clearer in lysine, methionine and valine. On the other hand, salt pretreatment revealed the same trend, reaching about 1.2 especially in glutamic acid, aspartic acid, histidine, methionine and valine. Radiation at a dose of 0.8 Mrad failed to prolong the shelf-life of the birds as TBA values increased significantly and rendered the flesh unacceptable to the consumer after two weeks. Higher radiation doses, i.e. 1.0 and 1.5 Mrad, kept the TBA values and consequently the organoleptic properties within the acceptable range, even after 4 weeks of storage. The use of salt and sodium pyrophosphate clearly lowered the TBA values even at 0.8 Mrad. However, the TBA values at the end of the shelf-life did not exceed the normal range for unspoiled meat. (author)

  2. 'Prevalence and antimicrobial susceptibility of Listeria monocytogenes and methicillin-resistant Staphylococcus aureus strains from raw meat and meat products in Zaria, Nigeria.

    Science.gov (United States)

    Ndahi, M D; Kwaga, J K P; Bello, M; Kabir, J; Umoh, V J; Yakubu, S E; Nok, A J

    2014-03-01

    The bacterial genera Listeria and Staphylococcus have been frequently isolated from food products and are responsible for a number of animal and human diseases. The aim of the study was to simultaneously isolate and characterize L. monocytogenes and Staphylococcus species from 300 samples of raw meat and meat products, to determine the susceptibility of the organisms to commonly used antimicrobial agents and to determine the presence of haemolysin A (hyl) virulence gene in L. monocytogenes and staphylococcal cassette chromosome mecA (SCCmec) gene in the Staph. aureus isolates using PCR. Of the 85 Listeria isolates tested, 12 L. monocytogenes were identified and tested for their sensitivity to 14 antimicrobial agents. All the 12 isolates (100%) were resistant to nine antimicrobial agents, but however sensitive to gentamicin. Only one isolate was found to harbour the hylA gene. Twenty-nine isolates were confirmed as Staph. aureus by the Microbact 12S identification system and were all presumptively identified as methicillin-resistant Staph. aureus species using oxacillin-resistant Staph. aureus basal medium (ORSAB). The 29 Staph. aureus isolates were tested for their sensitivity to 16 antimicrobial agents, and 11 were resistant to methicillin. None of the 11 Staph. aureus isolates harboured the methicillin resistance, mecA gene. Listeria monocytogenes and Staphylococcus aureus are important agents of foodborne diseases. Occurrence of these infectious agents was established in meat and meat products in Zaria, Nigeria. Majority of isolates obtained from this study, displayed multidrug resistance to commonly used antimicrobial agents, including methicillin resistance among the Staph. aureus isolates. The potential virulence of L. monocytogenes found in ready-to-eat food was documented by the carriage of hly A gene by one of the isolates. A different mechanism of methicillin resistance or different homologue of mec A gene may be circulating among Nigerian

  3. Poultry meat irradiation: effect of temperature on chemical changes and inactivation of microorganisms

    International Nuclear Information System (INIS)

    Hanis, T.; Jelen, P.; Klir, P.; Mnukova, J.; Perez, B.; Pesek, M.

    1989-01-01

    Chilled (10 degrees C) and frozen (-15 degrees C) broiler carcasses initially artificially contaminated either with Pseudomonas aeruginosa, Salmonella typhimurium or Serratia marcescens (10(6) cfu/g) were irradiated (Co(60)) with doses of 0.5, 1.0, 2.5, 5.0 and 10.0 kGy. Ps. aeruginosa was eliminated by doses of 1.0 - 2.5 kGy, S. marcescens by doses of 2.5 - 5.0 kGy and S. typhimurium by a dose of 10 kGy. Characteristic radiation odor increasing with radiation dose and temperature was well removed by heat meat preparation. Radiation resulted in increase of acid and peroxide values and destruction of thiamine (up to 57%/10 kGy) and riboflavin (up to 27%/10 kGy), lower increase of fat indexes and lower destruction of vitamins was observed at lower irradiation temperature. Content of amino acids was not affected by the treatment

  4. Alteration by irradiation and storage at amount of heme iron in poultry meat

    International Nuclear Information System (INIS)

    Souza, A.R.M. de; Arthur, V.; Canniatti-Brazaca, S.G.

    2007-01-01

    Studies of irradiation and storage effects in chicken were carried out to discover the influence in iron heme, non-heme amount, color and total pigments. Chicken thighs and chicken breast were studied. These were irradiated to 0, 1 and 2 kGy stored by 14 days to 4 °C in refrigerator. Determining the heme content and non-heme of meat was done using the colorimeter method and the Ferrozine reagent. The values of iron heme were influenced both by the irradiation and the storage, reducing the amount throughout the course of time. The iron non-heme was also influenced by the doses and the storage time, however the values increased throughout the course of time, because of the conversion of iron heme in non-heme. The color did not show that it was influenced by the studied doses, except for the storage, and the total number of pigments was affected by the irradiation and the time, reducing the values with the increase of storage. Irradiation was shown to be a good method to conserve iron. (author) [pt

  5. Alteration by irradiation and storage at amount of heme iron in poultry meat

    International Nuclear Information System (INIS)

    Souza, Adriana Regia Marques de; Arthur, Valter Arthur; Canniatti-Brazaca, Solange Guidolin

    2007-01-01

    Studies of irradiation and storage effects in chicken were carried out to discover the influence in iron heme, non-heme amount, color and total pigments. Chicken thighs and chicken breast were studied. These were irradiated to 0, 1 and 2 kGy stored by 14 days to 4 deg C in refrigerator. Determining the heme content and non-heme of meat was done using the colorimeter method and the Ferrozine reagent. The values of iron heme were influenced both by the irradiation and the storage, reducing the amount throughout the course of time. The iron non-heme was also influenced by the doses and the storage time, however the values increased throughout the course of time, because of the conversion of iron heme in non-heme. The color did not show that it was influenced by the studied doses, except for the storage, and the total number of pigments was affected by the irradiation and the time, reducing the values with the increase of storage. Irradiation was shown to be a good method to conserve iron. (author)

  6. Destruction of Salmonellae on poultry meat with lysozyme, EDTA, x ray, microwave, and chlorine

    International Nuclear Information System (INIS)

    Teotia, J.S.; Miller, B.F.

    1975-01-01

    Lysozyme, ethylenediaminetetracetic acid, chlorine, x-irradiation and microwaves were used in experimental attempts to eliminate Salmonella senftenberg 775W or Salmonella typhimurium from turkey drumsticks and whole carcasses. Turkey drumsticks or whole carcasses were artificially contaminated with S. senfenberg 775W or S. typhimurium in concentrations ranging between 5 x 10 5 to 8 x 10 5 viable cells per ml. of contaminating fluid. After each treatment, samples were cultured, plated, and tested according to standard methods to determine the susceptibility of Salmonella organisms to the particular treatment. A 0.1 percent solution of lysozyme eliminated the S. senftenberg 775W at 22 0 C within three hours. A 0.5 percent solution of ethylenediaminetetracetic acid failed to destroy the test organism under the same conditions. Eighty thousand rads of X-ray eliminated the test organism on turkey drumsticks but failed to remove it from whole turkey carcasses. Microwaves eliminated the S. senftenberg 775W in 150 seconds from turkey drumsticks and ten minutes from broiler chicken carcasses. Aqueous solutions containing 3400 and 2125 ppM chlorine failed to destroy the test organism on turkey drumsticks at 21 0 C. in 9 and 24 hours. None of the treatments changed the appearance of the skin or meat, except microwaves produced a partially-cooked appearance. Chlorine produced off-color drumsticks

  7. Meat and poultry consumption contribution to the natural radionuclide intake of the inhabitants of the Obafemi Awolowo University, Ile-Ife, Nigeria

    International Nuclear Information System (INIS)

    Akinloye, M.K.; Olomo, J.B.; Olubunmi, P.A.

    1999-01-01

    The mean activity concentrations of the naturally occurring radionuclides ( 226 Ra, 228 Ra and 40 K) in three types of meat (goat meat, beef and pork) from stock animals as well as free-range and intensive poultry raised within the OAU environment of the Obafemi Awolowo University (OAU), Ile-Ife, were measured by means of a well-calibrated high-purity germanium detector. The specific activities of 226 Ra in the three types of meat ranged from 1.11 to 5.83 Bq kg -1 with a mean of 3.10±1.52 Bq kg -1 . 228 Ra was not detectable in both beef and pork but had a range of 1.53-1.63 Bq kg -1 with a mean of 1.58±0.30 Bq kg -1 in goat meat while 40 K recorded an average specific activity of 360.00±54.20 Bq kg -1 for the various samples of meat. The mean activity values of 226 Ra, 228 Ra and 40 K for the poultry were 2.59±0.48, 0.78±0.13 and 265.01±15.90 Bq kg -1 , respectively. The results obtained for the daily radionuclide intake of the various meat types showed that those of 226 Ra ranged from 0.4 to 8.1 mBq d -1 with a mean of 4.9±0.4 mBq d -1 . Since 228 Ra was not detectable in beef and pork its daily intake could not be estimated. However, a mean value of intake of 2.2±0.4 mBq d -1 was obtained for goat meat. The values of 40 K intake ranged from 150.0 to 672.7 mBq d -1 with an average of 455.5±19.0 mBq d -1 . The mean daily intakes of 226 Ra, 228 Ra and 40 K for the two types of poultry were 6.15±0.70, 1.9±0.3 and 633.4±38.0 mBq d -1 , respectively

  8. Red meat and poultry intakes and risk of total and cause-specific mortality: results from cohort studies of Chinese adults in Shanghai.

    Directory of Open Access Journals (Sweden)

    Yumie Takata

    Full Text Available Most previous studies of meat intake and total or cause-specific mortality were conducted in North America, whereas studies in other areas have been limited and reported inconsistent results. This study investigated the association of red meat or poultry intake with risk of total and cause-specific mortality, including cancer and cardiovascular disease (CVD, in two large population-based prospective cohort studies of 134,290 Chinese adult women and men in Shanghai. Meat intakes were assessed through validated food frequency questionnaires administered in person at baseline. Vital status and dates and causes of deaths were ascertained through annual linkage to the Shanghai Vital Statistics Registry and Shanghai Cancer Registry databases and home visits every 2-3 years. Cox regression was used to calculate hazard ratios (HRs and 95% confidence intervals (CIs for the risk of death associated with quintiles of meat intake. During 803,265 person-years of follow up for women and 334,281 person-years of follow up for men, a total of 4,210 deaths in women and 2,733 deaths in men accrued. The median intakes of red meat were 43 g/day among women and 54 g/day among men, and pork constituted at least 95% of total meat intake for both women and men. Red meat intake was associated with increased total mortality among men, but not among women; the HR (95% CI comparing the highest with the lowest quintiles were 1.18 (1.02-1.35 and 0.92 (0.82-1.03, respectively. This sex difference was statistically significant (P = 0.01. Red meat intake was associated with increased risk of ischemic heart disease mortality (HR = 1.41, 95% CI = 1.05-1.89 and with decreased risk of hemorrhagic stroke mortality (HR = 0.62, 95% CI = 0.45-0.87. There were suggestive inverse associations of poultry intake with risk of total and all-CVD mortality among men, but not among women. Further investigations are needed to elucidate the sex-specific associations between red

  9. Consumer Poultry Handling Behavior in the Grocery Store and In-Home Storage.

    Science.gov (United States)

    Donelan, Amy K; Chambers, Delores H; Chambers, Edgar; Godwin, Sandria L; Cates, Sheryl C

    2016-04-01

    Considerable work on consumers' food safety habits has highlighted issues associated with home food preparation. However, consumer handling of foods, such as poultry, during shopping and storage has not been noted. The objective of this study was to determine consumer behaviors during purchasing and initial storage of raw poultry to determine potential cross-contamination issues. A shop-along observational study was conducted to determine actual shopping, transportation, and storage behavior of consumers who purchase raw poultry products. Neither hand sanitizer nor wipes were observed in 71% of grocery store meat sections of stores visited. Plastic bags could be found in the meat section 85% of the time, but only 25% of shoppers used the bag for their raw poultry purchases. During checkout, the poultry was bagged separately from other products 71% of the time. A majority of shoppers stored raw poultry in the original package without an additional container or overwrap. Overall, there needs to be an increase in food safety education on the handling of poultry during purchasing, transportation, and storage.

  10. Presence of Staphylococcus aureus and Shiga Toxigenic Escherichia coli O157:H7 in Raw Meat in Ağrı, Turkey

    Directory of Open Access Journals (Sweden)

    Naim Deniz Ayaz

    2016-08-01

    Full Text Available Background: Staphylococcus aureus and Shiga toxin producing Escherichia coli O157:H7 (EHEC are significant foodborne pathogens worldwide. While S. aureus can cause mild superficial skin infections or life-threatening bacteremia and endocarditis, as well as toxininduced cases such as toxic shock syndrome; E. coli O157:H7 can cause symptoms from mild diarrhea to severe hemorrhagic colitis (HC, hemolytic uremic syndrome (HUS, thrombotic thrombocytopenic purpura (TTP. Objectives: The objectives of this study were to find out the prevalence and seasonal distribution of S. aureus in 214 frozen raw meat (turkey, chicken and beef and the prevalence of E. coli O157:H7 in 70 raw beef with the characterization of the E. coli O157:H7 isolate by multiplex polymerase chain reaction (PCR. Materials and Methods: For the detection of S. aureus, a total of 214 frozen raw meat samples including 74 turkey meat, 70 chicken meat and 70 beef cuts (approximately 2 × 3 cm cubic parts; and for the detection of E. coli O157:H7, a total of 70 frozen raw beef samples that all were produced from national companies and consumed in Ağrı, Turkey were analyzed. Results: Out of 214 meat samples, 25.7 % (18/70 of the beef, 11.4 % (8/74 of the chicken meat, and 5.4 % (4/70 of the turkey meat samples were contaminated with S. aureus. Out of 70 frozen raw beef samples, only 1 (1.4% was identified as both Shiga toxin 1 and 2producing E. coli O157:H7 by the detection of stx1, stx2, eaeA, hly, and fliCh7 according to multiplex PCR analysis. Conclusion: Our findings demonstrate that occurrence frequency of S. aureus was higher in frozen raw beef than in raw chicken and turkey meat samples. Although the prevalence of E. coli O157:H7 was low in beef, the presence of virulence genes, especially toxin genesrema in a significant public health concern.

  11. Immunomagnetic separation and conventional culture procedure for detection of naturally occurring Salmonella in raw pork sausages and chicken meat.

    Science.gov (United States)

    Ripabelli, G; Sammarco, M L; Ruberto, A; Iannitto, G; Grasso, G M

    1997-06-01

    The aim of the study was to compare immunomagnetic separation (IMS) and conventional selective enrichment procedures using selenite cystine broth (SC) and Rappaport-Vassiliadis broth (RV) in 137 naturally contaminated food samples (69 raw pork sausages and 68 chicken meat). The utilization of SC or IMS appeared to be the most appropriate enrichment procedure: 15 out of 18 Salmonella-positive samples (83.3%) were detected by SC and 12 (66.7%) by IMS; RV yielded only seven positive isolations (38.9%). However, RV yielded the highest count of Salmonella colonies per plate and the lowest interference by competing organisms. IMS could become a reliable alternative to standard enrichment procedures and a combined IMS and selective enrichment broth could increase the chance of Salmonella recovery.

  12. Effects of raw material extrusion and steam conditioning on feed pellet quality and nutrient digestibility of growing meat rabbits.

    Science.gov (United States)

    Liao, Kuoyao; Cai, Jingyi; Shi, Zhujun; Tian, Gang; Yan, Dong; Chen, Delin

    2017-06-01

    This study was conducted to investigate the effects of raw material extrusion and steam conditioning on feed pellet quality and nutrient digestibility of growing meat rabbits, in order to determine appropriate rabbit feed processing methods and processing parameters. In Exp. 1, an orthogonal design was adopted. Barrel temperature, material moisture content and feed rate were selected as test factors, and acid detergent fiber (ADF) content was selected as an evaluation index to research the optimum extrusion parameters. In Exp. 2, a two-factor design was adopted. Four kinds of rabbit feeds were processed and raw material extrusion adopted optimum extrusion parameters of Exp. 1. A total of 40 healthy and 42-day-old rabbits with similar weight were used in a randomized design, which consisted of 4 groups and 10 replicates in each group (1 rabbits in each replicate). The adaptation period lasted for 7 d, and the digestion trial lasted for 4 d. The results showed as follows: 1) ADF was significantly affected by barrel temperature ( P  digestibility of dry matter and total energy ( P  digestibility of crude fiber (CF), ADF and NDF ( P  digestibility of rabbit feed. Thus, using extrusion and steam conditioning technology at the same time in the weaning rabbits feed processing can improve the pellet quality and nutrient apparent digestibility of rabbit feed.

  13. Effect of type of suckling and polyunsaturated fatty acid use on lamb production. 2. Chemical and fatty acid composition of raw and cooked meat

    Directory of Open Access Journals (Sweden)

    Francesco Toteda

    2010-01-01

    Full Text Available This study was carried out in order to examine the chemical and fatty acid composition of raw and cooked meat obtained fromlambs raised under mothers or reared by artificial suckling with acidified milk replacers with or without polyunsaturated fattyacid (PUFA supplementation. Meat samples were taken from twenty Gentile di Puglia male lambs subjected to the followingfeeding treatments: the control group received only maternal milk (MM, n.=6 while two groups were reared by artificial sucklingwith an acidified milk replacer (MR, n.=7 or with an acidified milk replacer supplemented with 10 ml/l of a PUFA enrichedoil (MR+PUFA, n.=7. Lambs were slaughtered at 45 days of age. After 24 hours of refrigeration at 4 °C, the lumbar regionwas dissected from each right half-carcass and split into pieces, one of which was used raw while the other was cooked in aventilated electric oven at 180 °C until an internal temperature of 75 °C was reached. Chemical and fatty acid analysis wereperformed on raw and cooked meat, while only raw meat was assessed for cholesterol. Cooking losses were also evaluated.Meat obtained from MR+PUFA fed lambs contained more fat (Punder mothers increased the total amount of saturated fatty acids (SFA, compared with both the MR group (Pthe MR+PUFA one (Pcomparison with both MR diets. The highest PUFA/SFA ratio of meat was recorded for the MR+PUFA group (0.27, with statisticaldifferences respect to the MR group (0.21; Pmilk produced meat containing more cholesterol than the MR+PUFA group (85.89 vs 76.26 mg/100 g; Pindex of meat was higher following natural rearing in comparison with the MR+PUFA treatment (1.34 vs 1.05;Pand 0.76, respectively; Pparameters evaluated. In conclusion, artificial suckling with acidified milk replacers improves some meat quality features.Supplementation of milk replacers with PUFAs, although in a limited way, may improve the dietetic properties of lamb meat.

  14. Research on the Sensorial Quality and Economic Efficiency in Obtaining of a certain Raw Meat Product - Mici Paste

    Directory of Open Access Journals (Sweden)

    Claudiu-Dan Salagean

    2013-11-01

    Full Text Available Research aimed the sensorial quality connected with the economic efficiency to obtain a certain raw meat product (mici paste in 4 experimental variants: 1 and 3 variants, with animal raw materials (meat + bacon and mix of natural spices - fine grinding variant (1 and coarse grinding variant (3 - chopping at the volf through the sieve of 3-4 mm; 2 and 4 variants, with animal raw materials (meat + bacon + vegetable protein supplements (textured soy protein + binder (protein + fiber + additive mix - fine grinding variant (2 and coarse grinding variant (4 - chopping at the volf through the sieve of 3 - 4 mm. In this respect organoleptic analyzes were performed on appearance (exterior and section, color, smell, texture and taste of the finished product (after roasting, the results highlighting that, in terms of organoleptic, sample 1 obtained the highest score (on a scale of 1-poor to 5-very good quality (average 21.83, followed by sample 3 (average 19.22, the very small difference in the case of sample 2 (average 19.19 and finally, sample 4 (average 18.75. It was noted that sample 1 obtained the highest score (average of all analyzed organoleptic indicators: appearance (4.33, color (4.39, smell (4.67, texture (4.33 and taste (4.11 being favorite by all volunteer subjects who participated at the analysis. The same thing was found in sensory analysis of mici paste in fresh/chilled condition: 65% of subjects preferred variant 1 followed by variant 3 (19.2%, variant 2 (11.5% and finally, variant 4 (3.8%. In terms of economic the highest efficiency was found in 2 (specific consumption 0.73 and 4 (specific consumption 0.77 variants compared to 1 (specific consumption 0.80 and 3 (specific consumption 0.82 variants, which translates into a reduction in the cost of products manufactured in the variants 2 and 4 (with protein supplements and additive mix by about 25-20% (with importance for the manufacturer. Also, thermal processing (roasting revealed the

  15. Raw meat based diet influences faecal microbiome and end products of fermentation in healthy dogs.

    Science.gov (United States)

    Sandri, Misa; Dal Monego, Simeone; Conte, Giuseppe; Sgorlon, Sandy; Stefanon, Bruno

    2017-02-28

    Dietary intervention studies are required to deeper understand the variability of gut microbial ecosystem in healthy dogs under different feeding conditions and to improve diet formulations. The aim of the study was to investigate in dogs the influence of a raw based diet supplemented with vegetable foods on faecal microbiome in comparison with extruded food. Eight healthy adult Boxer dogs were recruited and randomly divided in two experimental blocks of 4 individuals. Dogs were regularly fed a commercial extruded diet (RD) and starting from the beginning of the trial, one group received the raw based diet (MD) and the other group continued to be fed with the RD diet (CD) for a fortnight. After 14 days, the two groups were inverted, the CD group shifted to the MD and the MD shifted to the CD, for the next 14 days. Faeces were collected at the beginning of the study (T0), after 14 days (T14) before the change of diet and at the end of experimental period (T28) for DNA extraction and analysis of metagenome by sequencing 16SrRNA V3 and V4 regions, short chain fatty acids (SCFA), lactate and faecal score. A decreased proportion of Lactobacillus, Paralactobacillus (P diet significantly (P diet composition modifies faecal microbial composition and end products of fermentation. The administration of MD diet promoted a more balanced growth of bacterial communities and a positive change in the readouts of healthy gut functions in comparison to RD diet.

  16. [Instinct therapy--raw food with meat with exclusion of milk products. Report No. 16].

    Science.gov (United States)

    Jallut, O

    1989-06-13

    Instinct therapy is a diet consisting exclusively of food in its natural form, which has not been subjected to cooking, preserving or seasoning. Dairy products are forbidden. Indications are numerous and rather imprecise including especially cancer. Burger developed Instinct therapy in 1964 as a diet according to his own philosophy. 1980 he left Switzerland because the practice of "metasexuality" had caused him problems with the law. He founded a school of Instinct therapy in 1982 in France and published his book "La guerre du cru" (The Raw Food Fight) in 1985. In Switzerland, Besuchet took on the teaching of Burger in 1978 and was very active in giving lectures. He died in June 1985 of mediastinal cancer. According to Burger, man originally ate raw food and his instinct has not evolved since those pre-historic times, but has been "artificially modified" by cooked food and the consumption of non-human milk. If man could re-develop his natural instinct and eat only fresh food, which is not prepared in any way, he could solve his health problems and restore defenses against diseases such that these could become beneficial. Cooked food, milk and cereals are thought to be the cause of cancer but instinctive eating would help to avoid or to cure cancer. No preclinical or clinical trials have been carried out. The theories of Burger and Besuchet are based on unverifiable personal experiences.

  17. Effects of gamma irradiation on the survival of Listeria monocytogenes and on its growth at refrigeration temperature in poultry and red meat

    International Nuclear Information System (INIS)

    Gursel, B.; Gurakan, G.C.

    1997-01-01

    Gamma irradiation sensitivity of a strain of Listeria monocytogenes was determined in trypticase soy broth supplemented with yeast extract (TSB-YE), in a slurry of chicken breast meat and in raw ground beef. D10 values in these different media were 0.364, 0.599, and 0.699 kGy, respectively. This organism appeared most sensitive in TSB-YE, more resistant in minced fresh chicken breast meat, and most resistant in fresh minced beef. It was found that irradiation at 2.5 kGy prior to refrigeration is an efficient way for the preservation of meat products contaminated at 10(3) to 10(4) per gram initial load of L. monocytogenes for about 7 d. However, with this initial load, the injured cells might repair themselves and cause a health hazard during storage at 4 C in the presence of air after 7 d

  18. The Study of Effect of Surimi Production Steps on Chemical Composition and Electrophoresis Pattern of Myofibrillar Proteins of Mechanically Deboned poultry meat (MDPM

    Directory of Open Access Journals (Sweden)

    Sh Haji BagherNaeeni

    2013-08-01

    Full Text Available Mechanically deboning poultry meat (MDPM is widely used due to its suitable technological properties as well as low lipids and saturated fatty acids contents. Besides, production processes applied during the surimi production can improve the technological properties of MDPM. That is to say, the production steps of surimi can change chemical composition and concentration of myofibrillar proteins and improve functional properties of MDPM. In this study, MDPM was prepared from the poultry meat. The production process consisted of 2 washing steps with sodium bicarbonate solution followed by another washing step with 4°C water. Afterwards, chemical properties of MDPM and surimi (moisture content, protein, lipid, and ash content as well as electrophoresis pattern were evaluated. Result showed that surimi production steps could significantly decrease protein, lipid and ash contents; however, moisture content of MDPM increased significantly. The result of electrophoresis indicated a significant increase in heavy chain myosin with 200 KDa and actin with 45 KDa molecular weights. It was concluded that the production steps improved the chemical properties and increased the concentration of MDPM myofibrillar proteins.

  19. 75 FR 82148 - Nutrition Labeling of Single-Ingredient Products and Ground or Chopped Meat and Poultry Products

    Science.gov (United States)

    2010-12-29

    ... organization, members of the regulated industry, trade and professional associations, and a city health... to it during cooking that alter the calories, fat, and protein. For those reasons, the poultry trade... 82154

  20. Technological Feasibility of Preserving Meat, Poultry and Fish Products by Using a Combination of Conventional Additives, Mild Heat Treatment and Irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Wierbicki, E. [United States Army Natick Research and Development Laboratory, Natick, MD (United States)

    1981-09-15

    Radappertization, or irradiation sterilization of meats and other protein foods (poultry, seafoods) is a new processing method applicable to pre-cooked (enzyme inactivated) foods that are hermetically sealed (either in metal cans, flexible pouches, or metal or plastic trays) and involves irradiation to sterilizing doses of either gamma rays (from a cobalt-60 or caesium-137 source) or by X-rays and electrons. The process is particularly applicable to pre-cooked meat, poultry, fin fish, and shellfish, as well as to dry foods, animal feed, and spices. The resulting radappertized products are free from food spoilage microorganisms and organisms of public health significance, including the pathogens such as C. botulinum, salmonellae, trichinae, etc. The radappertized products can be stored without refrigeration for long periods (years), the limiting factor being the integrity of the primary packaging material. Irradiation sterilization of cured meats allows complete elimination or a drastic reduction of incoming nitrite to the levels needed only for characteristic colour and flavour of the items while providing protection against C. botulinum by irradiation. The irradiated-cured products with the low levels of added nitrite are free from residual nitrite and nitrosamines, including nitrosopyrrolidine in fried bacon. In recent co-operative research with the US Department of Agriculture, it was shown that irradiation also destroys pre-formed nitrosamines in bacon. The technology of the process was developed by the US National Food Irradiation Program and the US Army from 1953 to 1980. The US Army spearheaded the development of this new technology to the point where the food irradiation potentials have become meaningful within the broad scope of national and international interests. Therefore, it was highly appropriate that, effective 1 October 1980, the responsibility for the programme at this stage was transferred to the US Department of Agriculture which has been

  1. Nonthermal processing technologies to improve the safety of raw meat and poultry products and ready-to-eat foods

    Science.gov (United States)

    Newly emerging nonthermal and advanced thermal processing technologies are now being adopted by the food processing industry for the purpose of providing safe and high quality food products to consumers. Scientists and engineers at USDA’s Eastern Regional Research Center in Wyndmoor, PA are activel...

  2. meat

    African Journals Online (AJOL)

    p2492989

    These nutrient values determined in meat from red hartebeest could ... percentage of a-linolenic acid (C18:3n-3) (Wiklund et al., 2001). .... system (1525 HPLC with a binary gradient delivery, 717 auto-sampler and Injector, 1500 ..... polyunsaturated fatty acids and conjugated linoleic acid in lamb, beef and pork: A review.

  3. Relation of unprocessed, processed red meat and poultry consumption to blood pressure in East Asian and Western adults

    NARCIS (Netherlands)

    Oude Griep, L.M.; Seferidi, Paraskevi; Stamler, J.; Horn, van L.; Chan, Queenie; Tzoulaki, Ioanna; Steffen, L.M.; Miura, K.; Ueshima, H.; Okuda, N.; Zhao, Liancheng; Soedamah-Muthu, S.S.; Daviglus, M.L.; Elliott, P.

    2016-01-01

    Background: Epidemiologic evidence suggests that relationships of red meat consumption with risk of cardiovascular diseases depends on whether or not the meat is processed, including addition of preservatives, but evidence is limited for blood pressure (BP). Objective: To examine cross-sectional

  4. Host-Specific Patterns of Genetic Diversity among IncI1-I gamma and IncK Plasmids Encoding CMY-2 beta-Lactamase in Escherichia coli Isolates from Humans, Poultry Meat, Poultry, and Dogs in Denmark

    DEFF Research Database (Denmark)

    Hansen, Katrine Hartung; Bortolaia, Valeria; Nielsen, Christine Ahl

    2016-01-01

    and commensal E. coli isolates collected from 2006 to 2012 from humans, retail poultry meat, broilers, and dogs. Multilocus sequence typing (MLST), antimicrobial susceptibility testing, and conjugation were performed in conjunction with plasmid replicon typing, plasmid multilocus sequence typing (p......MLST), restriction fragment length polymorphism (RFLP), and sequencing of selected bla(CMY-2)-harboring plasmids. MLST revealed high strain diversity, with few E. coli lineages occurring in multiple host species and sample types. bla(CMY-2) was detected on plasmids in 83 (89%) isolates. Most (75%) of the plasmids...... were conjugative and did not (96%) cotransfer resistance to antimicrobials other than cephalosporins. The main replicon types identified were IncI1-I gamma (55%) and IncK (39%). Isolates from different host species mainly carried distinct plasmid subtypes. Seven of the 18 human isolates harbored IncI1...

  5. Effects of diet, packaging, and irradiation on protein oxidation, lipid oxidation, and color of raw broiler thigh meat during refrigerated storage.

    Science.gov (United States)

    Xiao, S; Zhang, W G; Lee, E J; Ma, C W; Ahn, D U

    2011-06-01

    This study was designed to evaluate the effects of dietary treatment, packaging, and irradiation singly or in combination on the oxidative stability of broiler chicken thigh meat. A total of 120 four-week-old chickens were divided into 12 pens (10 birds/pen), and 4 pens of broilers were randomly assigned to a control oxidized diet (5% oxidized oil) or an antioxidant-added diet [500 IU of vitamin E + 200 mg/kg of butylated hydroxyanisole (BHA)] and fed for 2 wk. After slaughter, thigh meats were separated, ground, packaged in either oxygen-permeable or oxygen-impermeable vacuum bags, and irradiated at 0 or 3 kGy. Lipid oxidation (TBA-reactive substances), protein oxidation (carbonyl), and color of the meat were measured at 1, 4, and 7 d of refrigerated storage. The lipid and protein oxidation of thigh meats from birds fed the diet supplemented with antioxidants (vitamin E + BHA) was significantly lower than the lipid and protein oxidation of birds fed the control diet, whereas the lipid and protein oxidation of broilers fed the oxidized oil diet was higher than that of birds fed the control diet. Vacuum packaging slowed, but irradiation accelerated, the lipid and protein oxidation of thigh meat during storage. Dietary antioxidants (vitamin E + BHA) and irradiation treatments showed a stronger effect on lipid oxidation than on protein oxidation. A significant correlation between lipid and protein oxidation in meat was found during storage. Dietary supplementation of vitamin E + BHA and the irradiation treatment increased the lightness and redness of thigh meat, respectively. It is suggested that appropriate use of dietary antioxidants in combination with packaging could be effective in minimizing oxidative changes in irradiated raw chicken thigh meat.

  6. Chemical composition and some anti-nutrient content of raw and processed bitter vetch (Vicia ervilia) seed for use as feeding stuff in poultry diet.

    Science.gov (United States)

    Sadeghi, Gh; Pourreza, J; Samei, A; Rahmani, H

    2009-01-01

    An experiment was conducted to determine chemical composition of raw and treated bitter vetch seed for use in poultry diets. Processing methods were: soaked in water for 12 h, then autoclaved and dried (SA); coarsely ground, soaked in water for 24 h, autoclaved and dried (GSA); coarsely ground, soaked in water for 47 h with exchange of water every 12 h, cooked and dried (GSC); coarsely ground, soaked in solution of 1% acetic acid for 24 h at 60 degrees C and dried (GAA). Raw bitter vetch seed was contained 94.52, 26.56, 0.4, 58.86, 3.38, 5.32, 12.28 and 14.20 percent DM, CP, EE, NFE, Ash, CF, ADF and NDF, respectively. Its GE, AME, AMEn, TME and TMEn values were 18.10, 13.15, 14.38, 14.10 and 14.69 MJ/kg, respectively. Results indicated that bitter vetch is a good source of Fe (340 ppm) and Cu (46.7 ppm). It s amino acid profile was suitable and methionine was the first limiting amino acid when compared with broiler and layer chicks requirements. Its canavanine and tannin content were 0.78 and 6.7 mg/kgDM, respectively. Processing methods improved CP and in some cases AMEn. All processing methods especially GSC resulted in a significant (P < 0.05) reduction in canavanine and tannin.

  7. Prevalence and characterization of motile Salmonella in commercial layer poultry farms in Bangladesh

    DEFF Research Database (Denmark)

    Barua, Himel; Biswas, Paritosh K.; Olsen, Katharina E. P.

    2012-01-01

    Salmonella is a globally widespread food-borne pathogen having major impact on public health. All motile serovars of Salmonella enterica of poultry origin are zoonotic, and contaminated meat and raw eggs are an important source to human infections. Information on the prevalence of Salmonella...

  8. Predicting the concentration of verotoxin-producing Escherichia coli bacteria during processing and storage of fermented raw-meat sausages.

    Science.gov (United States)

    Quinto, E J; Arinder, P; Axelsson, L; Heir, E; Holck, A; Lindqvist, R; Lindblad, M; Andreou, P; Lauzon, H L; Marteinsson, V Þ; Pin, C

    2014-05-01

    A model to predict the population density of verotoxigenic Escherichia coli (VTEC) throughout the elaboration and storage of fermented raw-meat sausages (FRMS) was developed. Probabilistic and kinetic measurement data sets collected from publicly available resources were completed with new measurements when required and used to quantify the dependence of VTEC growth and inactivation on the temperature, pH, water activity (aw), and concentration of lactic acid. Predictions were compared with observations in VTEC-contaminated FRMS manufactured in a pilot plant. Slight differences in the reduction of VTEC were predicted according to the fermentation temperature, 24 or 34°C, with greater inactivation at the highest temperature. The greatest reduction was observed during storage at high temperatures. A population decrease greater than 6 decimal logarithmic units was observed after 66 days of storage at 25°C, while a reduction of only ca. 1 logarithmic unit was detected at 12°C. The performance of our model and other modeling approaches was evaluated throughout the processing of dry and semidry FRMS. The greatest inactivation of VTEC was predicted in dry FRMS with long drying periods, while the smallest reduction was predicted in semidry FMRS with short drying periods. The model is implemented in a computing tool, E. coli SafeFerment (EcSF), freely available from http://www.ifr.ac.uk/safety/EcoliSafeFerment. EcSF integrates growth, probability of growth, and thermal and nonthermal inactivation models to predict the VTEC concentration throughout FRMS manufacturing and storage under constant or fluctuating environmental conditions.

  9. 76 FR 68058 - Classes of Poultry

    Science.gov (United States)

    2011-11-03

    ... for some poultry classes, while extensive cross breeding has produced poultry with higher meat yields... Committee on Meat and Poultry Inspection (NACMPI) for consultation to ensure that there is no inconsistency... classifications, proposed changes to the game hen classes, and other proposed editorial changes. Response: FSIS...

  10. Development and validation of confirmatory method for analysis of nitrofuran metabolites in milk, honey, poultry meat and fish by liquid chromatography-mass spectrometry

    Directory of Open Access Journals (Sweden)

    Fatih Alkan

    2016-03-01

    Full Text Available In this study we have devoloped and validated a confirmatory analysis method for nitrofuran metabolites, which is in accordance with European Commission Decision 2002/657/EC requirements. Nitrofuran metabolites in honey, milk, poultry meat and fish samples were acidic hydrolised followed by derivatisation with nitrobenzaldehyde and liquid-liquid extracted with ethylacetate. The quantitative and confirmative determination of nitrofuran metbolites was performed by liquid chromatography/electrospray ionisation tandem mass spectrometry (LC/ESI-MS/MS in the positive ion mode. In-house method validation was performed and reported data of validation (specificity, linearity, recovery, CCα and CCβ. The advantage of this method is that it avoids the use of clean-up by Solid-Phase Extraction (SPE. Furthermore, low levels of nitrofuran metabolites are detectable and quantitatively confirmed at a rapid rate in all samples.

  11. Importance of the producer on retail broiler meat product contamination with Campylobacter spp

    DEFF Research Database (Denmark)

    Kudirkiene, Egle; Buneviciene, Jurgita; Serniene, Loreta

    2013-01-01

    Background Campylobacter spp. are a leading cause of human bacterial gastroenteritis worldwide, with poultry meat being considered the most important source of the infection. To obtain data on broiler meat contamination with Campylobacter spp. in Lithuania, the occurrence, counts and genotypes...... of these pathogens on raw broiler meat products from different producers were examined. Results Out of 312 broiler meat product samples examined, 46.8% were contaminated with Campylobacter spp. Campylobacter jejuni was identified in 51.4% and Campylobacter coli in 37.7% of positive samples. Campylobacter jejuni...

  12. Free range and deep litter poultry production systems: effect on performance, carcass yield and meat composition of cockerel chickens.

    Science.gov (United States)

    Sogunle, Olajide Mark; Olaniyi, Olagoke Ayobami; Egbeyale, Lawrence Tokunbo; Akinola, Olufemi Sunday; Shittu, Taofeek A; Abiola, Samuel Soladoye; Ladokun, Abimbola O; Sobayo, Richard Abayomi

    2013-01-01

    This study was carried out on 150 cockerel chickens each of Harco Black and Novogen strains to determine their performance, carcass yield and meat composition on free range and deep litter production systems. The birds were brooded for 4 weeks and thereafter allotted to the different production systems for a period of 12 weeks. Each production system was allotted 150 chicks (75 chicks per strain) with three replicates of 25 chicks. The birds on deep litter production system were fed ad libitum while each bird on free range was fed 50 % of its daily feed requirement. On the 84 th day, a total of 36 birds were randomly selected for analysis of the carcass yield and meat composition. The data generated were subjected to a two-way analysis of variance in a 2 × 2 factorial experimental arrangement. Novogen strain consumed less feed (P free range and had the best feed/gain (2.72). A higher (P free range. The tibia proximal length and breadth, and tibia distal length and breadth were significantly (P free range, Harco black had more meat (85.69 g) than bone (18.07 g) in the breast while Novogen had the lowest meat/bone (2.38). Conclusively, Novogen strain should be raised on free range for a better performance in terms of feed/gain, but for higher meat composition, Harco black is a better strain.

  13. UNDERSTANDING CONSUMERS' ATTITUDE TOWARD MEAT LABELS AND MEAT CONSUMPTION PATTERN

    OpenAIRE

    Rimal, Arbindra; Fletcher, Stanley M.

    2003-01-01

    This paper addressed consumers' attitude toward meat labels and the influence of different aspects of meat labels on beef, poultry and seafood consumption using a national survey data. Nutrition and ingredient information on meat labels were positively related with attitude toward meat labels as well as meat consumption frequency.

  14. Degummed crude canola oil, sire breed and gender effects on intramuscular long-chain omega-3 fatty acid properties of raw and cooked lamb meat.

    Science.gov (United States)

    Flakemore, Aaron Ross; Malau-Aduli, Bunmi Sherifat; Nichols, Peter David; Malau-Aduli, Aduli Enoch Othniel

    2017-01-01

    Omega-3 long-chain (≥C 20 ) polyunsaturated fatty acids (ω3 LC-PUFA) confer important attributes to health-conscious meat consumers due to the significant role they play in brain development, prevention of coronary heart disease, obesity and hypertension. In this study, the ω3 LC-PUFA content of raw and cooked Longissimus thoracis et lumborum (LTL) muscle from genetically divergent Australian prime lambs supplemented with dietary degummed crude canola oil (DCCO) was evaluated. Samples of LTL muscle were sourced from 24 first cross ewe and wether lambs sired by Dorset, White Suffolk and Merino rams joined to Merino dams that were assigned to supplemental regimes of degummed crude canola oil (DCCO): a control diet at 0 mL/kg DM of DCCO (DCCOC); 25 mL/kg DM of DCCO (DCCOM) and 50 mL/kg DCCO (DCCOH). Lambs were individually housed and offered 1 kg/day/head for 42 days before being slaughtered. Samples for cooked analysis were prepared to a core temperature of 70 °C using conductive dry-heat. Within raw meats: DCCOH supplemented lambs had significantly ( P  culinary preparation method can be used as effective management tools to deliver nutritionally improved ω3 LC-PUFA lamb to meat consumers.

  15. Prevalence of Methicillin-Resistant Staphylococcus aureus and Other Staphylococcus Species in Raw Meat Samples Intended for Human Consumption in Benin City, Nigeria: Implications for Public Health.

    Science.gov (United States)

    Igbinosa, Etinosa O; Beshiru, Abeni; Akporehe, Lucy U; Oviasogie, Faith E; Igbinosa, Owen O

    2016-09-24

    The present study was designed to characterize methicillin-resistant staphylococci from raw meat. A total of 126 meat samples were obtained from open markets between February and April, 2015. Antimicrobial susceptibility testing was carried out using the disc diffusion method. Molecular profiling was conducted using 16S rRNA, mecA, nuc, and PVL gene signatures were detected by polymerase chain reaction assay. Fifty isolates of methicillin-resistant Staphylococcus spp. were detected in 26 (52%) pork, 14 (28%) beef and 10 (20%) chicken samples. The staphylococcal isolates were identified through partial 16S ribosomal ribonucleic acid (16S rRNA) nucleotide sequencing, and BLAST analysis of the gene sequence revealed 98%-100% staphylococcal similarity. All isolates from beef and chicken samples amplified the mecA gene, while 100% of the MRSA isolates amplified the PVL gene. The multidrug resistance profile (resistant to ≥1 antimicrobial agent in ≥3 classes of antimicrobial agents) of the staphylococcal isolates showed that 7 isolates were resistant to methicillin, penicillin, clindamycin, chloramphenicol, trimethoprim-sulfamethoxazole, kanamycin, amoxicillin, cloxacillin, erythromycin, vancomycin, and gentamycin. There was a significant regression effect from the multidrug-resistant profile on the number of isolates (p resistant strains within bacterial populations. The findings of the present study indicate that raw meats in the Benin metropolis were possibly contaminated with pathogenic and multi-drug resistant staphylococci strains and therefore could constitute a risk to public health communities.

  16. Quality characteristics of raw and canned goat meat in water, brine, oil and Thai curry during storage

    OpenAIRE

    Yoottana Polpara; Thanyaporn Sornprasitt; Saowakon Wattanachant

    2008-01-01

    The quality characteristics of three groups of goat meat obtained from one year and three years old Anglonubian crossed native, and culled Saanen crossed native were investigated. Significant differences in fat, ash and total collagen content, were observed among groups of goat meat (P

  17. Technological feasibility of preserving meat, poultry and fish products by using a combination of conventional additives, mild heat treatment and irradiation

    International Nuclear Information System (INIS)

    Wierbicki, E.

    1981-01-01

    Radappertization is particularly applicable to precooked meat, poultry, fin fish, and shellfish, as well as to dry foods, animal feed, and spices. The resulting radappertized products are free from food spoilage microorganisms and organisms of public health significance, including the pathogens such as C. botulinum, salmonellae, trichinae, etc. The radappertized products can be stored without refrigeration for long periods (years), the limiting factor being the integrity of the primary packaging material. Irradiation sterilization of cured meats allows complete elimination or a drastic reduction of incoming nitrite to the levels needed only for characteristic colour and flavour of the items while providing protection against C. botulinum by irradiation. The irradiated-cured products with the low levels of added nitrite are free from residual nitrite and nitrosamines, including nitrosopyrrolidine in fried bacon. In recent co-operative research with the US Department of Agriculture, it was shown that irradiation also destroys pre-formed nitrosamines in bacon. The technology of the process was developed by the US National Food Irradiation Program and the US Army from 1953 to 1980. The US Army spearheaded the development of this new technology to the point where the food irradiation potentials have become meaningful within the broad scope of national and international interests. Therefore, it was highly appropriate that, effective 1 October 1980, the responsibility for the programme at this stage was transferred to the US Department of Agriculture which has been designated as the leading agency for the US Federal food and nutrition programmes

  18. Occurrence of Campylobacter spp. in raw and ready-to-eat foods and in a Canadian food service operation.

    Science.gov (United States)

    Medeiros, Diane T; Sattar, Syed A; Farber, Jeffrey M; Carrillo, Catherine D

    2008-10-01

    The occurrence of Campylobacter spp. in a variety of foods from Ottawa, Ontario, Canada, and raw milk samples from across Canada was determined over a 2-year period. The samples consisted of 55 raw foods (chicken, pork, and beef), 126 raw milk samples from raw milk cheese manufacturers, and 135 ready-to-eat foods (meat products, salads, and raw milk cheeses). Campylobacter jejuni was detected in 4 of the 316 samples analyzed: 1 raw beef liver sample and 3 raw chicken samples. An isolation rate of 9.7% was observed among the raw chicken samples tested. This study also investigated the role of cross-contamination in disseminating Campylobacter from raw poultry within a food service operation specializing in poultry dishes. Accordingly, kitchen surfaces within a restaurant in Ottawa, Ontario, were sampled between March and August 2001. Tests of the sampling method indicated that as few as 100 Campylobacter cells could be detected if sampling was done within 45 min of inoculation; however, Campylobacter spp. were not detected in 125 swabs of surfaces within the kitchens of this food service operation. Despite the reported high prevalence of Campylobacter spp. in raw poultry, this organism was not detected on surfaces within a kitchen of a restaurant specializing in poultry dishes.

  19. Identifying ingredients that delay outgrowth of Listeria monocytogenes in natural, organic, and clean-label ready-to-eat meat and poultry products.

    Science.gov (United States)

    McDonnell, Lindsey M; Glass, Kathleen A; Sindelar, Jeffrey J

    2013-08-01

    The objective of this study was to identify ingredients that inhibit Listeria monocytogenes in natural, organic, or clean-label ready-to-eat meat and poultry products. Fourteen ingredients were screened in uncured (no-nitrate-or-nitrite-added), traditional-cured (156 ppm of purified sodium nitrite), cultured (alternative cured, natural nitrate source, and Staphylococcus carnosus), or preconverted (alternative cured, natural nitrite source) turkey slurries. Slurries were cooked, cooled, inoculated to yield 3 log CFU/ml L. monocytogenes, stored at 4°C, and tested weekly for 4 weeks. Three antimicrobial ingredients, 1.5 % vinegar-lemon-cherry powder blend, 2.5 % buffered vinegar, and 3.0 % cultured sugar-vinegar blend, were incorporated into alternative-cured ham and uncured roast beef and deli-style turkey breast. Controls included all three meat products without antimicrobial ingredients and a traditional-cured ham with 2.8 % sodium lactate-diacetate. Cooked, sliced products were inoculated with 3 log CFU/g L. monocytogenes, vacuum packed, and stored at 4 or 7°C, for up to 12 weeks. For control products without antimicrobial agents stored at 4°C, a 2-log L. monocytogenes increase was observed at 2 weeks for ham and turkey and at 4 weeks for roast beef. Growth (>1-log increase) in the sodium lactate-diacetate was delayed until week 6. Compared with the control, the addition of either vinegar-lemon-cherry powder blend or buffered vinegar delayed L. monocytogenes growth for an additional 2 weeks, while the addition of cultured sugar-vinegar blend delayed growth for an additional 4 weeks for both ham and turkey. The greatest L. monocytogenes delay was observed in roast beef containing any of the three antimicrobial ingredients, with no growth detected through 12 weeks at 4°C for all the treatments. As expected, L. monocytogenes grew substantially faster in products stored at 7°C than at 4°C. These data suggest that antimicrobial ingredients from a natural source

  20. Quantitative determination of titin and nebulin in poultry meat by SDS-PAGE with an internal standard

    NARCIS (Netherlands)

    Tomaszewska Gras, J.; Kijowski,; Schreurs, F.J.G.

    2002-01-01

    The method of quantitative determination of titin and nebulin in chicken meat by SDS-PAGE electrophoresis technique was developed by application of β-galactosidase as the internal standard. The method was tested first on marker protein samples of known concentrations (myosin, transferrin, glutamic

  1. Analysis of raw meat for heavy metals and bacterial contamination and comparison of antibiotic susceptibility of isolated bacteria

    International Nuclear Information System (INIS)

    Ahmad, F.

    2016-01-01

    The focus of the study was to analyze the commercially available meat for its heavy metal contents and bacterial contamination. The meat samples were collected from four commercial markets of Lahore, i.e., as Wafaqi Colony (Site I),Township (Site II), G-1 Market (Site III) and Zenith (Site IV), and analyzed for heavy metal [i.e., manganese (Mn), nickel (Ni), chromium (Cr), cadmium (Cd) and copper (Cu)] contents and bacterial contaminants (E. coli, Pseudomonas sp., Bacillus sp. and Salmonella sp.) Atomic absorption spectrophotometery was employed for the detection of the heavy metals and plate count method was used for the detection of bacterial contaminants. The Ni concentration in the Site II sample only and Cd concentration in all meat samples were found above the standard value and the concentration of other metals (Cu, Cr, and Mn) was less than the standard concentrations. Bacterial (E. coli, Pseudomonas sp., Bacillus sp., Salmonella sp. and Staphylococcus sp.) contamination was found in all meat samples; however, the number was a little lower in the Site IV samples. Statistical analysis was done, by one-way ANOVA using SPSS, to compare heavy metal contamination in the meat samples. The results showed distribution of heavy metals in all meat samples there was significant difference of Ni concentration in the meat samples. The measure of antibiotic susceptibility showed that isolated species of bacteria were resistant to lincomycin, streptomycin, tertracyclin, ampicillin, amoxicillin and doxycyclin, but did not survive in the medium containing ofloxacin. (author)

  2. VacA and cagA genotypes of Helicobacter pylori isolated from raw meat in Isfahan province, Iran.

    Science.gov (United States)

    Gilani, Ali; Razavilar, Vadood; Rokni, Nordahr; Rahimi, Ebrahim

    2017-01-01

    Foods with animal origins play a substantial role in the transmission of Helicobacter pylori . The present investigation was carried out to study the vacA and cagA genotypes status of H. pylori isolated from various types of meat samples. Two hundred and twenty meat samples were collected and cultured. H. pylori -positive strains were analyzed for the presence of vacA and cagA genotypes. Eleven out of 220 (5.00%) samples were positive for H. pylori . Findings were confirmed by nested PCR. Prevalence of H. pylori in the meat samples of slaughterhouses and butcheries were 72.20% and 27.70%, respectively. The most commonly detected genotypes in the meat samples of slaughterhouses and butcheries were vacA m1a (66.66%) and vacA s1a (37.50%), respectively. The S1am1a was the most commonly detected genotype. Meat sampled from butcheries had the higher prevalence of H. pylori and its genotypes than those of slaughterhouses ( p meat samples could be the potential sources of virulent strains of H. pylori . Application of sanitary measures in the storage, transportation and sale of meat is essential for reducing the levels of H. pylori cross contamination.

  3. Technological characteristics of meat - viscosity

    OpenAIRE

    DIBĎÁK, Tomáš

    2012-01-01

    This bachelor thesis is focused on the technological characteristics of meat, mainly viscosity of meat. At the beginning I dealt with construction of meat and various types of meat: beef, veal, pork, mutton, rabbit, poultry and venison. Then I described basic chemical composition of meat and it?s characteristic. In detail I dealt with viscosity of meat. Viscosity is the ability of meat to bind water both own and added. I mentioned influences, which effects viscosity and I presented the possib...

  4. Chemical and biotechnological processing of collagen-containing raw materials into functional components of feed suitable for production of high-quality meat from farm animals

    Science.gov (United States)

    Baburina, M. I.; Ivankin, A. N.; Stanovova, I. A.

    2017-09-01

    The process of chemical biotechnological processing of collagen-containing raw materials into functional components of feeds for effective pig rearing was studied. Protein components of feeds were obtained as a result of hydrolysis in the presence of lactic acid of the animal collagen from secondary raw materials, which comprised subcutaneous collagen (cuticle), skin and veined mass with tendons from cattle. For comparison, a method is described for preparing protein components of feeds by cultivating Lactobacillus plantarum. Analysis of the kinetic data of the conversion of a high-molecular collagen protein to an aminolyte polypeptide mixture showed the advantage of microbiological synthesis in obtaining a protein for feeds. Feed formulations have been developed to include the components obtained, and which result in high quality pork suitable for the production of quality meat products.

  5. A digital PCR method for identifying and quantifying adulteration of meat species in raw and processed food.

    Directory of Open Access Journals (Sweden)

    Junan Ren

    Full Text Available Meat adulteration is a worldwide concern. In this paper, a new droplet digital PCR (ddPCR method was developed for the quantitative determination of the presence of chicken in sheep and goat meat products. Meanwhile, a constant (multiplication factor was introduced to transform the ratio of copy numbers to the proportion of meats. The presented ddPCR method was also proved to be more accurate (showing bias of less than 9% in the range from 5% to 80% than real-time PCR, which has been widely used in this determination. The method exhibited good repeatability and stability in different thermal treatments and at ultra-high pressure. The relative standard deviation (RSD values of 5% chicken content was less than 5.4% for ultra-high pressure or heat treatment. Moreover, we confirmed that different parts of meat had no effect on quantification accuracy of the ddPCR method. In contrast to real-time PCR, we examined the performance of ddPCR as a more precise, sensitive and stable analytical strategy to overcome potential problems of discrepancies in amplification efficiency discrepancy and to obtain the copy numbers directly without standard curves. The method and strategy developed in this study can be applied to quantify the presence and to confirm the absence of adulterants not only to sheep but also to other kinds of meat and meat products.

  6. Lessons learned from a textbook outbreak: EHEC-O157:H7 infections associated with the consumption of raw meat products, June 2012, Limburg, Belgium.

    Science.gov (United States)

    Braeye, Toon; Denayer, Sarah; De Rauw, Klara; Forier, Anmarie; Verluyten, Jurgen; Fourie, Ludo; Dierick, Katelijne; Botteldoorn, Nadine; Quoilin, Sophie; Cosse, Pascale; Noyen, Jeannine; Pierard, Denis

    2014-01-01

    On 5 June 2012 several enterohemorrhagic Escherichia coli, EHEC, O157:H7 infections were reported to the public health authorities of Limburg. We performed a case-control study, a trace back/forward investigation and compared strains isolated from human cases and food samples. A case was defined as anyone with a laboratory-confirmed E. coli O157:H7-infection in North-East Limburg from May 30 2012 till July 15 2012. Family members with bloody diarrhea were also included as cases. E. coli O157 was isolated by culture and the presence of the virulence genes was verified using (q)PCR. Isolates were genotyped and compared by Pulsed Field Gel Electrophoresis (PFGE) and insertion sequence 629-printing (IS629-printing). The outbreak involved 24 cases, of which 17 were laboratory-confirmed. Five cases developed Hemolytic Uremic Syndrome (HUS) and fifteen were hospitalized. Cases reported a significantly higher consumption of "steak tartare", a raw meat product (OR 48.12; 95% CI; 5.62- 416.01). Cases were also more likely to buy meat-products at certain butcheries (OR 11.67; 95% CI; 1.41 - 96.49). PFGE and IS629-printing demonstrated that the vtx1a vtx2a eae ehxA positive EHEC O157:H7 strains isolated from three meat products and all seventeen human stool samples were identical. In a slaughterhouse, identified by the trace-back investigation, a carcass infected with a different EHEC strain was found and confiscated. We present a well described and effectively investigated foodborne outbreak associated with meat products. Our main recommendations are the facilitation and acceleration of the outbreak detection and the development of a communication plan to reaches all persons at risk. Foodborne diseases, Shiga-toxigenic Escherichia coli, Enterohemorrhagic Escherichia coli, Meat products, Case control studies, Electrophoresis, Gel, Pulsed-Field.

  7. QUANTIFICATION OF LEAD AND CADMIUM IN POULTRY AND BIRD GAME MEAT BY SQUARE WAVE ANODIC STRIPPING VOLTAMMETRY

    OpenAIRE

    2011-01-01

    Abstract A Square Wave Anodic Stripping Voltammetric method for the analysis of lead and cadmium in chicken muscle and liver was developed and validated, and the results of a monitoring study relative to chicken and pigeon meat are reported. The voltammetric method allows the analysis of lead and cadmium at the same time in samples after acid digestion. The use of perchloric acid for digestion and of acetate buffer in the supporting electrolyte have been found suitable to reduce ma...

  8. Quantification of lead and cadmium in poultry and bird game meat by square-wave anodic-stripping voltammetry.

    Science.gov (United States)

    Trevisani, M; Cecchini, M; Taffetani, L; Vercellotti, L; Rosmini, R

    2011-02-01

    A square-wave anodic-stripping voltammetric method for the analysis of lead and cadmium in chicken muscle and liver was developed and validated, and the results of a monitoring study relative to chicken and pigeon meat are reported. The voltammetric method allows the analysis of lead and cadmium at the same time in samples after acid digestion. The use of perchloric acid for digestion and of acetate buffer in the supporting electrolyte are suitable to reduce matrix interferences and obtain limits of quantification which were below 10 ng g⁻¹ for meat and liver samples. The regression between the analytical signal and the concentration of the target analytes in spiked samples and Certified Reference Materials proved to be linear within the 10-100 ng g⁻¹ range for meat and within the 50-500 ng g⁻¹ range for liver. The analytical method was verified using available Certified Reference Materials BCR-184 (cattle meat) and BCR-185R (cattle liver) as well as with spiked chicken samples. Precision (i.e. repeatability and intermediate precision) and accuracy (percentage recovery and bias) were of the order of 0.3-4.5% for both lead and cadmium The level of lead in muscle was in the range between 6.4 and 59.8 ng g⁻¹ in chickens and between 7.9 and 63.6 ng g⁻¹ in farmed pigeons, whereas it was between 8.0 and 84.4 ng g⁻¹ in chicken liver. The cadmium concentration was 0.4-10.4 ng g⁻¹ in chicken muscle, 10.4-90.6 ng g⁻¹ in chicken liver and 2.2-8.0 ng g⁻¹ in farmed pigeons.

  9. Changes in endogenous bioactive compounds of Korean native chicken meat at different ages and during cooking.

    Science.gov (United States)

    Jayasena, Dinesh D; Jung, Samooel; Bae, Young Sik; Kim, Sun Hyo; Lee, Soo Kee; Lee, Jun Heon; Jo, Cheorun

    2014-07-01

    This study aimed to examine the effect of bird age on the contents of endogenous bioactive compounds, including carnosine, anserine, creatine, betaine, and carnitine, in meat from a certified meat-type commercial Korean native chicken strain (KNC; Woorimatdag). Additionally, the effects of the meat type (breast or leg meat) and the state of the meat (raw or cooked) were examined. Cocks of KNC were raised under similar standard commercial conditions at a commercial chicken farm. At various ages (10, 11, 12, 13, and 14 wk), breast and leg meats from a total of 10 birds from each age group were obtained. Raw and cooked meat samples were then prepared separately and analyzed for bioactive compounds. The age of the KNC had a significant effect only on the betaine content. The breast meat of KNC had higher amounts of carnosine and anserine but had lower amounts of betaine and carnitine than the leg meat (P cooking (P cooking, whereas breast meat showed almost complete retention of betaine and carnitine. The results of this study provide useful and rare information regarding the presence, amounts, and determinants of endogenous bioactive compounds in KNC meat, which can be useful for selection and breeding programs, and also for popularizing indigenous chicken meat. © 2014 Poultry Science Association Inc.

  10. Aerobic Mesophilic, Coliform, Escherichia coli, and Staphylococcus aureus Counts of Raw Meat from the Formal and Informal Meat Sectors in South Africa.

    Science.gov (United States)

    Jaja, Ishmael Festus; Green, Ezekiel; Muchenje, Voster

    2018-04-21

    Foodborne disease (FBD) is a global public health concern, and foods from animal sources have been associated with outbreaks of food-related illness. In this study, animal carcasses from the two abattoirs (HT1 and HT2) in the formal meat sector (FMS) and slaughter points in the informal meat sector (INMS) were examined at two stages of slaughter (before washing and after washing) for aerobic colony counts (ACC) and total viable count (TCC), as well as Escherichia coli and Staphylococcus aureus count. At each stage, carcasses were sampled by swabbing at the neck, brisket, flank, and rump. ACC for beef, mutton, and pork carcasses at HT1 and HT2 before washing were between 2.5⁻5.8, 2.2⁻4.7, and 2.7⁻3.7 mean log CFU/cm², respectively, and TCC count before washing was highest on the neck of cattle (6.3 ± 2.4) and after washing was highest on the perineal of sheep (5.7 ± 6.9). In the INMS, TCC count was highest on the brisket (6.9 ± 3.2) and in the neck (5.5 ± 2.4). Higher ACC values of 6.2⁻6.7 mean log CFU/cm² were obtained in the INMS. The highest count for E. coli (4.2 mean log CFU/cm²) after washing was in the neck, while the highest count for S. aureus (4.0 mean log CFU/cm²) was in the flank. All bacteria count in the INMS exceeded acceptable limits, and washing did not significantly reduce microbial load in meat in the FMS and INMS. Bacteria count in the FMS and INMS exceeded acceptable standards. However, meat processed in the INMS poses a more significant risk of FBD to consumers.

  11. FEEDING OF FERRETS WITH THE RAW MEAT AND LIVER OF CHICKENS CHRONICALLY POISONED WITH TOXIC GROUNDNUT MEAL.

    Science.gov (United States)

    PLATONOW, N; BEAUREGARD, M

    1965-03-01

    Chickens were fed a ration containing 30 per cent of toxic groundnut meal for up to six weeks. The concentration of aflatoxin (toxic metabolites of Aspergillus flavus) in the above ration was 3.06 p.p.m. At the end of 2nd, 4th or 6th week the birds were killed. The meat was removed from the bones and put through a meat grinder. The livers of three groups were pooled together. Three control groups of birds kept on commercial pellets were treated similarly. Female ferrets, two years of age, were used in the present study. They were divided into four groups. The first three groups were given for one month meat from chickens fed the toxic ration for 2, 4, and 6 weeks, respectively. Each of these three groups contained one control ferret that was fed with the meat of chickens fed a commercial ration for a similar period of time. One half of the 4th group was fed pooled liver from intoxicated birds and one half was fed liver from control birds. No significant changes in the ferret tissues were observed as a consequence of feeding them with the meat or liver from the chickens chronically poisoned with toxic groundnut meal.

  12. Verification for the presence of inhibitory substances in poultry meat after the consumption of the feed mixture supplemented with fermented feed

    Directory of Open Access Journals (Sweden)

    Ivona Kožárová

    2016-12-01

    Full Text Available The European Union has an obligation to ensure that feed produced in the European Union is safe for animals and also humans by ensuring food of animal origin is safe and wholesome. An increasing demand for safe, wholesome and nutritious animal products has led to the search for alternative substances in animal feed. Fermented feed has gained a lot of popularity in many animal diets today. They meet the demand for animal nutrition due to the formation of target substances with the desired properties. As some of them are attracting attention as potential antimicrobial agents that inhibit the growth of certain microorganisms, and the products of animal origin are controlled for the presence of residues of inhibitory (antimicrobial substances, the aim of this work was to verify the presence of inhibitory substances in poultry meat (muscle, heart, liver, kidneys of broiler chickens after the consumption of the feed mixture with addition of fermented feed (wheat bran fermented with the strain Umbelopsis isabellina CCF 2412 in a dose of 10 % of the total amount of the feed. The detection of residues was performed by two approved microbiological screening methods, the screening test for the detection of antibiotic residues (STAR and the Premi®Test. Both methods detected the positive results and pre-identified the presence of residues of the inhibitory substances not only in the meat of broiler chickens but also in the investigated fermented feed. Due to the antimicrobial potential of the fermented feed and the possible presence of the false-positive results, each positive result must be confirmed by a confirmatory analysis. 

  13. Developments and competitiveness of Mozambican chicken meat industry

    Directory of Open Access Journals (Sweden)

    Carlos Alberto de Oliveira

    2015-12-01

    Full Text Available Mozambican poultry industry might be an option to facilitate people's access to animal protein, as well as to reduce the dependence on imports of the product, bringing jobs and income forth. This study aimed to characterize and to analyze the competitiveness of poultry industry in Mozambique. Porter’s Five Forces Model, which focuses on the five strengths that shape business competition, was applied. The results show a low level of competition within the industry, a limited supply of raw material and the fact that national products are commodities and competes with strong foreign participants. Domestic demand for chicken meat is increasing, but buyers base their decision mainly on price. Challenges include establishment of governance structure and policies for poultry sector and consumer welfare. Another alternative to improve the poultry industry in Mozambique is to promote technical cooperation with other countries, such as Brazil, in order to acquire specific structures for chicken production, genetic material and adequate nutrition.

  14. 9 CFR 381.194 - Transportation and other transactions concerning dead, dying, disabled, or diseased poultry, and...

    Science.gov (United States)

    2010-01-01

    ... concerning dead, dying, disabled, or diseased poultry, and parts of carcasses of poultry that died otherwise... SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS...

  15. Analysis of micro-structure in raw and heat treated meat emulsions from multimodal X-ray microtomography

    DEFF Research Database (Denmark)

    Einarsdottir, Hildur; Nielsen, Mikkel Schou; Miklos, Rikke

    2014-01-01

    This study presents a novel non-destructive X-ray technique for analyzing meat emulsions before and after heat treatment. The method is based on X-ray grating-interferometry where three complementary imaging modalities are obtained simultaneously measuring the absorption, refraction and scatterin...

  16. A rapid and sensitive evaluation of nitrite content in Saudi Arabian processed meat and poultry using a novel ultra performance liquid chromatography-mass spectrometry method.

    Science.gov (United States)

    Siddiqui, Masoom Raza; Wabaidur, Saikh Mohammad; Khan, Moonis Ali; ALOthman, Zeid A; Rafiquee, M Z A; Alqadami, Ayoub Abdullah

    2018-01-01

    Quantitative assessment of nitrite (NO 2 - ) anion was performed using a newly developed high throughput ultra performance liquid chromatography-mass spectrometric (UPLC-MS) method. The nitrite determination with the proposed method using micellar mobile phase was unknown. Selected ion reaction mode using negative electrospray ionization was adopted for the identification and quantitative analysis of nitrite. The chromatographic separation was performed using BEH C-18 column and a micellar mobile phase consisted of sodium dodecyl sulphate and acetonitrile in ratio 30:70 was used. The elution of nitrite anion was accomplished in less than 1 min. Under the optimal analysis conditions, the linearity of the developed method was checked in the concentration range of 0.5-20 mg kg -1 NO 2 - with an excellent correlation coefficient of 0.996. The precisions of the method with relative standard deviation <2% was observed when standard at concentration of 1 mg kg -1 was used. The limit of detection and limit of quantitation of the developed mass spectrometric method was found to be 0.114 and 0.346 mg kg -1 , respectively. The developed UPLC/MS method was applied to quantify this anion in processed meats and poultries from various super market of Saudi Arabia (Riyadh region). The recoveries of the nitrite in the various samples were found in the range of 100.03-103.5%.

  17. Metode Direct Polymerase Chain Reaction untuk Melacak Campylobacter sp. pada Daging Ayam (DIRECT POLYMERASE CHAIN REACTION METHOD FOR DETECTION CAMPYLOBACTER SP. OF POULTRY MEAT

    Directory of Open Access Journals (Sweden)

    Andriani .

    2013-08-01

    Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.

  18. Detection of cell surface hydrophobicity, biofilm and fimbirae genes in salmonella isolated from tunisian clinical and poultry meat.

    Science.gov (United States)

    Ben Abdallah, Fethi; Lagha, Rihab; Said, Khaled; Kallel, Héla; Gharbi, Jawhar

    2014-04-01

    The aim of this study was to evaluate the ability of 15 serotypes of Salmonella to form biofilm on polystyrene, polyvinyl chloride (PVC) and glass surfaces. . Initially slime production was assessed on CRA agar and hydrophobicity of 20 Salmonella strains isolated from poultry and human and two Salmonella enterica serovar Typhimurium references strains was achieved by microbial adhesion to n-hexadecane. In addition, biofilm formation on polystyrene, PVC and glass surfaces was also investigated by using MTT and XTT colorimetric assay. Further, distribution of Salmonella enterotoxin (stn), Salmonella Enteritidis fimbrial (sef) and plasmid encoded fimbrial (pef) genes among tested strains was achieved by PCR. Salmonella strains developed red and white colonies on CRA and they are considered as hydrophilic with affinity values to n-hexadecane ranged between 0.29% and 29.55%. Quantitative biofilm assays showed that bacteria are able to form biofilm on polystyrene with different degrees and 54.54% of strains produce a strong biofilm on glass. In addition, all the strains form only a moderate (54.54%) and weak (40.91%) biofilm on PVC. PCR detection showed that only S. Enteritidis harbour Sef gene, whereas Pef and stn genes were detected in S. Kentucky, S. Amsterdam, S. Hadar, S. Enteritidis and S. Typhimurium. Salmonella serotypes are able to form biofilm on hydrophobic and hydrophilic industrial surfaces. Biofilm formation of Salmonella on these surfaces has an increased potential to compromise food safety and potentiate public health risk.

  19. Degummed crude canola oil, sire breed and gender effects on intramuscular long-chain omega-3 fatty acid properties of raw and cooked lamb meat

    Directory of Open Access Journals (Sweden)

    Aaron Ross Flakemore

    2017-08-01

    Full Text Available Abstract Background Omega-3 long-chain (≥C20 polyunsaturated fatty acids (ω3 LC-PUFA confer important attributes to health-conscious meat consumers due to the significant role they play in brain development, prevention of coronary heart disease, obesity and hypertension. In this study, the ω3 LC-PUFA content of raw and cooked Longissimus thoracis et lumborum (LTL muscle from genetically divergent Australian prime lambs supplemented with dietary degummed crude canola oil (DCCO was evaluated. Methods Samples of LTL muscle were sourced from 24 first cross ewe and wether lambs sired by Dorset, White Suffolk and Merino rams joined to Merino dams that were assigned to supplemental regimes of degummed crude canola oil (DCCO: a control diet at 0 mL/kg DM of DCCO (DCCOC; 25 mL/kg DM of DCCO (DCCOM and 50 mL/kg DCCO (DCCOH. Lambs were individually housed and offered 1 kg/day/head for 42 days before being slaughtered. Samples for cooked analysis were prepared to a core temperature of 70 °C using conductive dry-heat. Results Within raw meats: DCCOH supplemented lambs had significantly (P < 0.05 higher concentrations of eicosapentaenoic (EPA, 20:5ω3 and EPA + docosahexaenoic (DHA, 22:6ω3 acids than those supplemented with DCCOM or DCCOC; Dorset sired lambs contained significantly (P < 0.05 more EPA and EPA + DHA than other sire breeds; diet and sire breed interactions were significant (P < 0.05 in affecting EPA and EPA + DHA concentrations. In cooked meat, ω3 LC-PUFA concentrations in DCCOM (32 mg/100 g, DCCOH (38 mg/100 g, Dorset (36 mg/100 g, White Suffolk (32 mg/100 g, ewes (32 mg/100 g and wethers (33 mg/100 g, all exceeded the minimum content of 30 mg/100 g of edible cooked portion of EPA + DHA for Australian defined ‘source’ level ω3 LC-PUFA classification. Conclusion These results present that combinations of dietary degummed crude canola oil, sheep genetics and culinary preparation method can be used as

  20. Improvement of biomolecular methods for the identification and typing of Escherichia coli O157:H7 isolated from raw meat.

    Science.gov (United States)

    Paris, A; Bonardi, S; Bacci, C; Boni, E; Salmi, F; Bassi, L; Brindani, F

    2010-06-01

    The aim of the study was to evaluate the sensitivity of two m-PCR methods for the quantitative determination of E. coli O157:H7 in foodstuffs. Genomic serotyping was carried out on bacterial cultures, and the necessary time was optimized to increase the resolution of the method. Subsequently, artificial contamination trials using meat were conducted to assess method accuracy in foodstuffs and pursue the genetic typing of pathogens. Measurement thresholds were shown to range between 10(5) and 10(6) CFU/mL, but were reduced by four logarithmic cycles in 80% of samples. Relative to the meat contamination trials, serotypes were identified after 24 hours, corresponding to 10 CFU/mL inoculum, with higher rates seen when m-TSB was used for enrichment. Inoculated samples were found to contain three virulence factors (hlyA, eaeA, and stx1).

  1. Microbiological safety of tenderized, proteinaceous, semi-processed and processed food prepared from poultry treated with ionizing radiation and other processes

    International Nuclear Information System (INIS)

    Klinger, I.; Lapidot, M.

    1998-01-01

    From a microbiological point of view, poultry meat is considered to be one of the most contaminated raw foods, harbouring bacteria, including pathogens such as Salmonella spp., Staphylococcus aureus, Listeria monocytogenes and Campylobacter spp. Some of these pathogens can survive the heat treatment used during the further processing of poultry meat into ready to eat products such as sausages and patties, and thus endanger consumer health, particularly in the young, the elderly and the immunocompromised. L. monocytogenes is of particular concern. This Gram positive, non-spore forming, psychrotrophic pathogen has been recognized as one of the causes of a severe food borne illness. The organism is relatively heat stable and can multiply under refrigeration conditions, but is sensitive to ionizing radiation. A survey conducted in Israel demonstrated that raw poultry meat was heavily contaminated with L. monocytogenes and that the pathogen could also be recovered from ready to eat poultry products. It was proposed that treatment of the raw meat with ionizing radiation prior to heating and use of the hazard analysis critical control point concept in the further processing plant would result in the elimination of contamination in ready to eat products. (author)

  2. Poultry Slaughter facility Zambezi Valley, Mozambique

    NARCIS (Netherlands)

    Vernooij, A.G.; Wilschut, S.

    2015-01-01

    This business plan focuses on the establishment of a slaughterhouse, one of the essential elements of a sustainable and profitable poultry meat value chain. There is a growing demand for poultry meat in the Zambezi Valley, and currently a large part of the consumed broilers comes from other parts of

  3. MARKET CHOICES FOR BROILER CHICKEN MEAT IN THE OPINION

    Directory of Open Access Journals (Sweden)

    Anna Augustyńska-Prejsnar

    2014-09-01

    Full Text Available Recently there has, been growing a increase in consumption of poultry meat in Poland. The most important material for slaughter poultry are broilers. Among factors that influence rising demand for poultry meat are: low price, availability of raw materials and promotional campaigns of safe nutrition. Its nutritional and sensory value makes it a choice product. University students are a specific group that has aroused the interest of nutritionists. The students’ lifestyle is characterised by high active social life and intense responsibilities, which ought to be augmented with a carefully chosen diet. The youth do not only have significant impact on the family purchasing decisions but display a strong purchasing power due to financial resources at their disposal and would in the future become mature and rational consumers. The article lists factors that determine purchasing needs, reasons for choice of markets and the consumption frequency of broiler meat. The feeling of lack of other products coupled with current sales promotions were, in the opinion of the students surveyed, often responsible for the decision to purchase of broiler chicken meat. Low price and the ease of preparation were also key reasons for the choice of this meat product. Responding students noted that skinless chicken breast fillet was most commonly consumed.

  4. Food irradiation in the United States: irradiation as a phytosanitary treatment for fresh fruits and vegetables and for the control of microorganisms in meat and poultry

    International Nuclear Information System (INIS)

    Ross, Ralph T.; Engeljohn, Dan

    2000-01-01

    favorably received by the US food industries and health organizations because it can control E. coli 0157:H7 and several other disease-causing microorganisms. However, irradiation will not be authorized until the USDA Food Safety and Inspection Service (FSIS), the US federal agency that regulates meat and poultry products, finalizes it regulations. (author)

  5. 9 CFR 381.159 - Poultry rolls.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Poultry rolls. 381.159 Section 381.159... ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Definitions and Standards of Identity or Composition § 381...

  6. Incomplete sanitation of a meat grinder and ingestion of raw ground beef: contributing factors to a large outbreak of Salmonella typhimurium infection.

    Science.gov (United States)

    Roels, T H; Frazak, P A; Kazmierczak, J J; Mackenzie, W R; Proctor, M E; Kurzynski, T A; Davis, J P

    1997-10-01

    Consumers in the United States continue to eat raw or undercooked foods of animal origin despite public health warnings following several well-publicized outbreaks. We investigated an outbreak of Salmonella serotype Typhimurium infection in 158 patients in Wisconsin during the 1994 Christmas holiday period. To determine the vehicle and source of the outbreak, we conducted cohort and case-control studies, and environmental investigations in butcher shop A. Eating raw ground beef purchased from butcher shop A was the only item significantly associated with illness [cohort study: relative risk = 5.8, 95% confidence interval (CI) = 1.5-21.8; case control study: odds ratio = 46.2, 95% CI = 3.8-2751]. Inadequate cleaning and sanitization of the meat grinder in butcher shop A likely resulted in sustained contamination of ground beef during an 8-day interval. Consumer education, coupled with hazard reduction efforts at multiple stages in the food processing chain, will continue to play an important role in the control of foodborne illness.

  7. MODERN TECHNOLOGY OF FERMENTED MEAT PRODUCTS

    Directory of Open Access Journals (Sweden)

    L. V. Antipova

    2015-01-01

    Full Text Available Summary. New trends of meat industry development, on the example of sausages are shown. The detailed description of indicators of quality of meat raw materials, auxiliary materials and their influence on the processes of tissue and microbial fermentation in the process of ripening raw sausages. Measures for improving the quality control of meat raw materials, auxiliary materials, as well as the processing conditions in all stages of production of smoked products are suggested. The modern technology of production of raw sausages with starter cultures and complex products, allowing better standardization process is considered. Questions of chemistry of color formation, the formation of taste and flavor, textures and the suppression of undesired microflora in foods in general, and in particular the raw sausage are thoroughly covered. Ideas about factors affecting the formation of color in sausages are given. It is pointed out that the susceptibility to oxidation of nitrosilmioglobin is directly related to the fat oxidation in the whole redox potential. Trends in the market of raw sausages are shown. Requirements used in the meat industry to starting cultures are shown. Recommendations on the rational use of starter cultures, and other functional additives in technology of uncooked fermented products, which are used to improve the quality and ensure a high level of product safety are given. The characteristic of the innovative series of starter cultures Protect, its species belonging and qualitative composition, providing a unique protection system in the process of ripening and storage of smoked products is given. The properties are proved on the example of smoked poultry sausage.

  8. 75 FR 57200 - National Poultry Improvement Plan and Auxiliary Provisions

    Science.gov (United States)

    2010-09-20

    ... samples from egg-type and meat-type chicken flocks and waterfowl, exhibition poultry, and game bird flocks... required only for egg- type and meat-type chicken flocks and waterfowl, exhibition poultry, and game bird.... Avian Influenza Clean program of the Plan in Sec. 145.23(h); Meat-type breeding chickens from a flock...

  9. Microbiological, physicochemical and sensory parameters of dry fermented sausages manufactured with high hydrostatic pressure processed raw meat.

    Science.gov (United States)

    Omer, M K; Prieto, B; Rendueles, E; Alvarez-Ordoñez, A; Lunde, K; Alvseike, O; Prieto, M

    2015-10-01

    The aim of this trial was to describe physicochemical, microbiological and organoleptic characteristics of dry fermented sausages produced from high hydrostatic pressure (HHP) pre-processed trimmings. During ripening of the meat products pH, weight, water activity (aw), and several microbiological parameters were measured at zero, eight, fifteen days and after 6weeks. Sensory characteristics were estimated at day 15 and after six weeks by a test panel by using several sensory tests. Enterobacteriaceae were not detected in sausages from HHP-processed trimmings. Fermentation was little affected, but weight and aw of the HHP-processed sausages decreased faster during ripening. HHP-treated sausages were consistently less favoured than non HHP-treated sausages, but the strategy may be an alternative approach if the process is optimized. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. 9 CFR 381.75 - Poultry used for research.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Poultry used for research. 381.75... AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Ante Mortem Inspection § 381.75 Poultry...

  11. EFSA Panels on Biological Hazards (BIOHAZ), on Contaminants in the Food Chain (CONTAM), and on Animal Health and Welfare (AHAW); Scientific Opinion on the public health hazards to be covered by inspection of meat (poultry)

    DEFF Research Database (Denmark)

    Hald, Tine

    2012-01-01

    be risk categorisation of flocks based on FCI and classification of abattoirs according to their capability to reduce carcass faecal contamination. It is proposed that post-mortem visual inspection is replaced by setting targets for the main hazards on the carcass, and by verification of the food business......A qualitative risk assessment identified Campylobacter spp., Salmonella spp. and ESBL/AmpC gene-carrying bacteria as the most relevant biological hazards in the context of meat inspection of poultry. As none of these are detected by traditional visual meat inspection, establishing an integrated...... food safety assurance system, achievable through improved food chain information (FCI) and risk-based interventions, was proposed. This includes setting targets at carcass level and, when appropriate, flock level indicating what should be achieved for a given hazard. Elements of the system would...

  12. 9 CFR 381.150 - Requirements for the production of fully cooked poultry products and partially cooked poultry...

    Science.gov (United States)

    2010-01-01

    ... fully cooked poultry products and partially cooked poultry breakfast strips. 381.150 Section 381.150... ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Entry of Articles Into Official Establishments; Processing...

  13. 9 CFR 381.15 - Exemption from definition of “poultry product” of certain human food products containing poultry.

    Science.gov (United States)

    2010-01-01

    ... productâ of certain human food products containing poultry. 381.15 Section 381.15 Animals and Animal...; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Exemptions § 381.15 Exemption from definition of “poultry product” of certain human...

  14. The Impact of Additives on the Phosphorus, Potassium, and Sodium Content of Commonly Consumed Meat, Poultry, and Fish Products Among Patients With Chronic Kidney Disease.

    Science.gov (United States)

    Parpia, Arti Sharma; L'Abbé, Mary; Goldstein, Marc; Arcand, Joanne; Magnuson, Bernadene; Darling, Pauline B

    2018-03-01

    Patients with chronic kidney disease (CKD) are advised to limit their dietary intake of phosphorus and potassium as hyperphosphatemia and hyperkalemia are both associated with an increased risk of mortality. There is uncertainty concerning the actual content of these minerals in the Canadian food supply, as phosphorus and potassium are increasingly being used as food additives. This study aimed to determine the impact of food additives on the chemically analyzed content of phosphorus, potassium, sodium, and protein in commonly consumed meat, poultry, and fish products (MPFs). Foods representing commonly consumed MPF identified by a food frequency questionnaire in dialysis patients were purchased from three major grocery store chains in Canada. MPF with and without phosphorus and potassium additives listed on their ingredient list (n = 76) as well as reference MPF that was additive free (n = 15) were chemically analyzed for phosphorus, potassium, sodium, and protein content according to Association of Analytical Community official methods. Phosphorus, potassium, and sodium additives were present on the ingredient list in 37%, 9%, and 72% of MPF, respectively. Among MPF categories that contained a phosphorus additive, phosphorus content was significantly (P additives versus MPF without phosphorus additives and MPF reference foods (median [min, max]): (270 [140, 500] mg/100 g) versus (200 [130, 510] mg/100 g) versus (210 [100, 260] mg/100 g), respectively. Among MPF categories containing a potassium additive, foods listing a potassium additive had significantly more (P foods that did not list potassium additives and reference foods (900 [750, 1100] mg/100 g) versus (325 [260, 470] mg/100 g) versus (420 [270, 450] mg/100 g). The use of additives in packaged MPF products as indicated by the ingredient list can significantly contribute to the dietary phosphorus and potassium loads in patients with CKD. Patients with CKD should be educated to avoid MPF foods

  15. Mycotoxins in poultry production

    Directory of Open Access Journals (Sweden)

    Resanović Radmila M.

    2009-01-01

    Full Text Available All poultry is sensitive to mycotoxins. This partly depends on the type, age and production categories of poultry, their living conditions and nutritive status and partly on the type, quantity and duration of mycotoxin ingestion. The presence of mycotoxins results in significant health disorders and a decrease in production performances. This leads to considerable economic loss for the poultry industry - either direct losses, i.e. death of the poultry or the indirect ones, i.e. the decrease in body mass, number and quality of eggs, greater food conversion, and immunosuppression. Immunosuppression results in increased sensitivity to infective agents and a bad vaccinal response. Morevover, mycotoxin residues in poultry meat, eggs and products derived from them pose a threat to human health. In order to prevent and reduce the negative implications of mycotoxins in the poultry production, it is necessary to create both global and national strategies for combatting mycotoxins, advance diagnostic techniques and procedures, intensify the control of food quality, introduce new limits on the maximum amount of mycotoxins allowed in food and poultry feed used for certain species and categories of animals, and synchronise it with the European standards.

  16. Fate of acid-resistant and non-acid resistant Shiga toxin-producing Escherichia coli strains in experimentally contaminated French fermented raw meat sausages.

    Science.gov (United States)

    Montet, M P; Christieans, S; Thevenot, D; Coppet, V; Ganet, S; Muller, M L Delignette; Dunière, L; Miszczycha, S; Vernozy-Rozand, C

    2009-02-28

    Both pathogenic and nonpathogenic E. coli exhibit a stress response to sublethal environmental stresses. Several studies have reported acid tolerance and survival characteristics of E. coli O157:H7 in foodstuffs, but there are few reports about the tolerance of non-O157 serogroups (STEC) to organic acids in foods. The purpose of this study was to examine the effect of the manufacturing process of French fermented raw meat sausages on the growth and survival of acid-resistant (AR) and non-acid resistant (NAR) STEC strains. The six strains, 3 AR and 3 NAR, were inoculated separately into raw sausage mixture at a level of 10(4)-10(5) CFU/g. A total of 19 batches of sausages were manufactured. A rapid and similar decrease in the number of both AR and NAR STEC strains, from less than 1 to 1.5 log(10) CFU/g, was observed during the first 5 days of fermentation at 20-24 degrees C. This rapid decrease was followed by a more gradual but continuous decrease in STEC counts after drying at 13-14 degrees C, up to day 35. The STEC counts were <10 CFU/g after 35 days for the NAR strains and the same concentration for the AR strains on the best before date (day 60). It was not possible to detect any NAR STEC after 60 days. The present study shows that the process used in the manufacture of French sausages results in a complete destruction of NAR STEC strains after 60 days, but it does not have the same effect on the AR STEC strains.

  17. Prevalence, Antimicrobial Resistance, and Genetic Diversity of Listeria spp. Isolated from Raw Chicken Meat and Chicken-Related Products in Malaysia.

    Science.gov (United States)

    Chin, Pui San; Ang, Geik Yong; Yu, Choo Yee; Tan, Eng Lee; Tee, Kok Keng; Yin, Wai Fong; Chan, Kok Gan; Tan, Geok Yuan Annie

    2018-02-01

    Listeria spp. are ubiquitous in nature and can be found in various environmental niches such as soil, sewage, river water, plants, and foods, but the most frequently isolated species are Listeria monocytogenes and Listeria innocua. In this study, the presence of Listeria spp. in raw chicken meat and chicken-related products sold in local markets in Klang Valley, Malaysia was investigated. A total of 44 Listeria strains (42 L. innocua and 2 L. welshimeri) were isolated from 106 samples. Antibiotic susceptibility tests of the L. innocua strains revealed a high prevalence of resistance to clindamycin (92.9%), ceftriaxone (76.2%), ampicillin (73.8%), tetracycline (69%), and penicillin G (66.7%). Overall, 31 L. innocua and 1 L. welshimeri strain were multidrug resistant, i.e., nonsusceptible to at least one antimicrobial agent in three or more antibiotic classes. The majority of the L. innocua strains were placed into five AscI pulsogroups, and overall 26 distinct AscI pulsotypes were identified. The detection of multidrug-resistant Listeria strains from different food sources and locations warrants attention because these strains could serve as reservoirs for antimicrobial resistance genes and may facilitate the spread and emergence of other drug-resistant strains.

  18. Healthier meat and meat products: Their role as functional foods

    OpenAIRE

    Jiménez Colmenero, Francisco; Carballo, José; Cofrades, Susana

    2001-01-01

    This review deals with the implications of meat and meat products for human health. It analyses the effect of the presence or absence of various factors: fat, fatty acid composition, cholesterol, calorific value, salt, nitrite or lipid oxidation products that can cause health problems. Bearing in mind these considerations, it then describes the strategies used in animal production, treatment of meat raw material and reformulation of meat products to obtain healthier meat and meat products. Fu...

  19. Meat and Poultry Labeling Terms

    Science.gov (United States)

    ... the name of the organization responsible for the "certification" process, e.g., "XYZ Company's Certified Beef." [ Top ... animals were raised without antibiotics. [ Top of Page ] ORGANIC: For information about the National Organic Program and ...

  20. Molecular characterization of Salmonella Paratyphi B dT+ and Salmonella Heidelberg from poultry and retail chicken meat in Colombia by pulsed-field gel electrophoresis

    Science.gov (United States)

    Salmonella Paratyphi B dT+ variant (also termed Salmonella Java) and Salmonella Heidelberg are human pathogens frequently isolated from poultry. As a step towards implementing the Colombian Integrated Program for Antimicrobial Resistant Surveillance (COIPARS), this study characterized molecular patt...

  1. Occurrence and characteristics of extended-spectrum β-lactamase (ESBL producing Enterobacteriaceae in food producing animals, minced meat and raw milk

    Directory of Open Access Journals (Sweden)

    Geser Nadine

    2012-03-01

    Full Text Available Abstract Background The impact of food animals as a possible reservoir for extended-spectrum beta-lactamase (ESBL producing Enterobacteriaceae, and the dissemination of such strains into the food production chain need to be assessed. In this study 334 fecal samples from pigs, cattle, chicken and sheep were investigated at slaughter. Additionally, 100 raw milk samples, representing bulk tank milk of 100 different dairy farms, 104 minced meat (pork and beef samples and 67 E. coli isolates from cattle E. coli mastitis were analyzed. Results As many as 15.3% of the porcine, 13.7% of the bovine, 8.6% of the sheep and 63.4% of the chicken fecal samples yielded ESBL producers after an enrichment step. In contrast, none of the minced meat, none of the bulk tank milk samples and only one of the mastitis milk samples contained ESBL producing strains. Of the total of 91 isolates, 89 were E. coli, one was Citrobacter youngae and one was Enterobacter cloacae. PCR analysis revealed that 78 isolates (85.7% produced CTX-M group 1 ESBLs while six isolates (6.6% produced CTX-M group 9 enzymes. Five detected ESBLs (5.5% belonged to the SHV group and 2 isolates (2.2% contained a TEM-type enzyme. A total of 27 CTX-M producers were additionally PCR-positive for TEM-beta-lactamase. The ESBL-encoding genes of 53 isolates were sequenced of which 34 produced CTX-M-1, 6 produced CTX-M-14, 5 produced CTX-M-15 and also 5 produced SHV-12. Two isolates produced TEM-52 and one isolate expressed a novel CTX-M group 1 ESBL, CTX-M-117. One isolate--aside from a CTX-M ESBL-- contained an additional novel TEM-type broad-spectrum beta-lactamase, TEM-186. Conclusions The relatively high rates of ESBL producers in food animals and the high genetic diversity among these isolates are worrisome and indicate an established reservoir in farm animals.

  2. 76 FR 22359 - Notice of Request for Extension of Approval of an Information Collection; Importation of Poultry...

    Science.gov (United States)

    2011-04-21

    ... Collection; Importation of Poultry Meat and Other Poultry Products From Sinaloa and Sonora, Mexico AGENCY... an information collection associated with regulations for the importation of poultry meat and other poultry products from Sinaloa and Sonora, Mexico. DATES: We will consider all comments that we receive on...

  3. Detection of Yersinia Enterocolitica Species in Pig Tonsils and Raw Pork Meat by the Real-Time Pcr and Culture Methods.

    Science.gov (United States)

    Stachelska, M A

    2017-09-26

    The aim of the present study was to establish a rapid and accurate real-time PCR method to detect pathogenic Yersinia enterocolitica in pork. Yersinia enterocolitica is considered to be a crucial zoonosis, which can provoke diseases both in humans and animals. The classical culture methods designated to detect Y. enterocolitica species in food matrices are often very time-consuming. The chromosomal locus _tag CH49_3099 gene, that appears in pathogenic Y. enterocolitica strains, was applied as DNA target for the 5' nuclease PCR protocol. The probe was labelled at the 5' end with the fluorescent reporter dye (FAM) and at the 3' end with the quencher dye (TAMRA). The real-time PCR cycling parameters included 41 cycles. A Ct value which reached a value higher than 40 constituted a negative result. The developed for the needs of this study qualitative real-time PCR method appeared to give very specific and reliable results. The detection rate of locus _tag CH49_3099 - positive Y. enterocolitica in 150 pig tonsils was 85 % and 32 % with PCR and culture methods, respectively. Both the Real-time PCR results and culture method results were obtained from material that was enriched during overnight incubation. The subject of the study were also raw pork meat samples. Among 80 samples examined, 7 ones were positive when real-time PCR was applied, and 6 ones were positive when classical culture method was applied. The application of molecular techniques based on the analysis of DNA sequences such as the Real-time PCR enables to detect this pathogenic bacteria very rapidly and with higher specificity, sensitivity and reliability in comparison to classical culture methods.

  4. Rapid detection of peptide markers for authentication purposes in raw and cooked meat using ambient liquid extraction surface analysis mass spectrometry.

    Science.gov (United States)

    Montowska, Magdalena; Alexander, Morgan R; Tucker, Gregory A; Barrett, David A

    2014-10-21

    In this Article, our previously developed ambient LESA-MS methodology is implemented to analyze five types of thermally treated meat species, namely, beef, pork, horse, chicken, and turkey meat, to select and identify heat-stable and species-specific peptide markers. In-solution tryptic digests of cooked meats were deposited onto a polymer surface, followed by LESA-MS analysis and evaluation using multivariate data analysis and tandem electrospray MS. The five types of cooked meat were clearly discriminated using principal component analysis and orthogonal partial least-squares discriminant analysis. 23 heat stable peptide markers unique to species and muscle protein were identified following data-dependent tandem LESA-MS analysis. Surface extraction and direct ambient MS analysis of mixtures of cooked meat species was performed for the first time and enabled detection of 10% (w/w) of pork, horse, and turkey meat and 5% (w/w) of chicken meat in beef, using the developed LESA-MS/MS analysis. The study shows, for the first time, that ambient LESA-MS methodology displays specificity sufficient to be implemented effectively for the analysis of processed and complex peptide digests. The proposed approach is much faster and simpler than other measurement tools for meat speciation; it has potential for application in other areas of meat science or food production.

  5. A comparative study of functional properties of normal and wooden breast broiler chicken meat with NaCl addition.

    Science.gov (United States)

    Xing, Tong; Zhao, Xue; Han, Minyi; Cai, Linlin; Deng, Shaolin; Zhou, Guanghong; Xu, Xinglian

    2017-09-01

    The selection of broilers for augmented growth rate and breast has brought about wooden-breast (WB) muscle abnormalities, which caused substantial economic losses. The objective of this study was to compare water holding capacity, water mobility and distribution, salt-soluble protein (SSP) content, and protein profiles of normal and WB chicken meat with different additions of NaCl. Thirty WB and 30 normal chicken breasts were selected from a deboning line of a major Chinese processing plant at 2 to 3 h post mortem. Two different meat batters were formulated to 150 mg/g meat protein and different NaCl contents (0%, 1%, 2%, 3%, and 4%). Results indicated that as NaCl contents increased, the cooking loss of meat batters decreased (P meat showed different protein profiles, with myosin heavy chain exhibiting a higher intensity at ≥3% salt level. Low-field nuclear magnetic resonance (LF-NMR)revealed an increased T22 and higher P22 in raw WB meat compared to normal meat (P meat batters, WB meat batters had reduced T21 and lower immobilized water proportions at low NaCl contents (meat gels. Meat gels prepared from WB had a lower proportion of water within the myofibrillar protein matrix and a greater proportion of exuded bulk water at NaCl contents meat, meat batters and gels, water distribution and mobility of WB exhibited significant differences compared to normal meat. The addition of NaCl affected water mobility and distributions in meat batters, with a level of 3% NaCl eliminating the differences between processed normal and WB meat products. © 2017 Poultry Science Association Inc.

  6. Detection of thermophilic Campylobacter sp. in raw chicken sausages by methods ISO 10272: 2006 in Curitiba - Parana State - Brazil

    Directory of Open Access Journals (Sweden)

    K. Konell

    2014-12-01

    Full Text Available The aim of this study was the detection of Campylobacter sp. in raw chicken sausages using the methods ISO 10272-1 and ISO 10272-2. The overall prevalence of Campylobacter sp. in the samples tested was 16.67%, representing a serious risk to the health of consumers, particularly if measures guaranteeing proper cooking of foods and prevention of cross-contamination are not adopted. Furthermore, the majority of campylobacteriosis cases in humans are caused by consumption or improper handling of contaminated raw or undercooked poultry meat, which constitute the main vehicle of this infection.

  7. 9 CFR 311.38 - Meat and meat byproducts from livestock which have been exposed to radiation.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Meat and meat byproducts from... MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION DISPOSAL OF DISEASED OR OTHERWISE ADULTERATED CARCASSES AND PARTS § 311.38 Meat and meat byproducts from livestock which have been...

  8. White striping and woody breast myopathies in the modern poultry industry: a review.

    Science.gov (United States)

    Kuttappan, V A; Hargis, B M; Owens, C M

    2016-11-01

    Myopathies are gaining the attention of poultry meat producers globally. White Striping (WS) is a condition characterized by the occurrence of white striations parallel to muscle fibers on breast, thigh, and tender muscles of broilers, while Woody Breast (WB) imparts tougher consistency to raw breast fillets. Histologically, both conditions have been characterized with myodegeneration and necrosis, fibrosis, lipidosis, and regenerative changes. The occurrence of these modern myopathies has been associated with increased growth rate in birds. The severity of the myopathies can adversely affect consumer acceptance of raw cut up parts and/or quality of further processed poultry meat products, resulting in huge economic loss to the industry. Even though gross and/or histologic characteristics of modern myopathies are similar to some of the known conditions, such as hereditary muscular dystrophy, nutritional myopathy, toxic myopathies, and marbling, WS and WB could have a different etiology. As a result, there is a need for future studies to identify markers for WS and WB in live birds and genetic, nutritional, and/or management strategies to alleviate the condition. © 2016 Poultry Science Association Inc.

  9. 9 CFR 381.140 - Relabeling poultry products.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Relabeling poultry products. 381.140... AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Labeling and Containers § 381.140...

  10. 9 CFR 381.173 - Mechanically Separated (Kind of Poultry).

    Science.gov (United States)

    2010-01-01

    ... Poultry). 381.173 Section 381.173 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Definitions and...

  11. 9 CFR 381.158 - Poultry dinners (frozen) and pies.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Poultry dinners (frozen) and pies. 381... AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Definitions and Standards of Identity or...

  12. 9 CFR 381.95 - Disposal of condemned poultry products.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Disposal of condemned poultry products... AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Handling and Disposal of Condemned or...

  13. 9 CFR 381.400 - Nutrition labeling of poultry products.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Nutrition labeling of poultry products... AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Nutrition Labeling § 381.400 Nutrition...

  14. 9 CFR 381.73 - Quarantine of diseased poultry.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Quarantine of diseased poultry. 381.73... AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Ante Mortem Inspection § 381.73...

  15. Radurization of fowl meat

    International Nuclear Information System (INIS)

    Gel'fand, S.

    1974-01-01

    The effects of pre-slaughter adrenalization and of treatment with additives of semifinished poultry products were studied with a view to improving the storage quality of irradiated poultry. It was found that pre-slaughter adrenalization, pre-irradiation treatment with phosphates and, particularly, a combination of these two methods considerably delayed the formation of carbonyl compounds, the delay being somewhat greater in white meat. (E.T.)

  16. Organic Poultry Feeding

    Directory of Open Access Journals (Sweden)

    Arda Yıldırım

    2014-02-01

    Full Text Available Many people have led to the consumption of organic animal products in the event that the increase in sensitivity to a healthy diet in developed countries, and maintaining the safety of food of animal origin. Feeding and breeding in conventional production are emerged some of the negative effects and also it is more in organic production with new restrictions. Organic production is based on animal welfare. On the basis of behaviors such as feather-pecking and cannibalism known to be low in protein level of rations and unbalanced in terms of amino acids or minerals. As of 2015, organic poultry feed provided the appropriate conditions that will be 95% organic certified in Turkey and therefore, to create a balanced ration and feed hygiene in protecting brings serious challenges. Fodder supply of organic poultry feed raw materials that make up the quality, quantity and issue forms a significant effect on the health of the poultry additives permitted. The quality of the feed raw materials that constituent diets, quantity, feed supplying form and permitted feed additives significantly affects the health of poultry. Different physiological stages of the animal's nutritional requirements in order to ensure production of quality poultry products must be met from organically produced and very well-known with the contents of feedstuff digestibility. In this study, the problems encountered in feeding can be eliminated while performing economic production with considering animal welfare, following that balanced and adequate organic ration formulations and issues such as improving the production of feed raw materials are discussed.

  17. Evaluating the performance of a new model for predicting the growth of Clostridium perfringens in cooked, uncured meat and poultry products under isothermal, heating, and dynamically cooling conditions

    Science.gov (United States)

    Clostridium perfringens Type A is a significant public health threat and may germinate, outgrow, and multiply during cooling of cooked meats. This study evaluates a new C. perfringens growth model in IPMP Dynamic Prediction using the same criteria and cooling data in Mohr and others (2015), but inc...

  18. Eggs and Poultry Purchase, Storage, and Preparation Practices of Consumers in Selected Asian Countries

    Directory of Open Access Journals (Sweden)

    Kadri Koppel

    2014-01-01

    Full Text Available The objective of this study was to begin characterizing purchase, storage, handling, and preparation of poultry products and eggs by selected consumers in three Asian countries: India, Korea, and Thailand. Approximately 100 consumers in each location were recruited to participate in this study. The consumers were surveyed about eggs and poultry purchase behavior characteristics, such as temperatures and locations, storage behavior, such as storage locations in the refrigerator or freezer, preparation behavior, such as washing eggs and poultry before cooking, and handling behavior, such as using cutting boards during cooking. The results indicated differences in purchase and storage practices of raw eggs. Most Korean consumers purchased refrigerated eggs and stored the eggs in the refrigerator, while Indian and Thai consumers bought eggs that were stored at room temperature, but would refrigerate the eggs at home. Approximately half of the consumers in each country froze raw meat, poultry, or seafood. Food preparation practices showed potential for cross-contamination during cooking, such as using the same cutting board for different kinds of foods or not washing hands with soap and water. The results presented in this pilot study may lead to development of educational messages and raising consumer awareness of food safety practices in Asian countries.

  19. Eggs and Poultry Purchase, Storage, and Preparation Practices of Consumers in Selected Asian Countries

    Science.gov (United States)

    Koppel, Kadri; Suwonsichon, Suntaree; Chitra, Uma; Lee, Jeehyun; Chambers, Edgar

    2014-01-01

    The objective of this study was to begin characterizing purchase, storage, handling, and preparation of poultry products and eggs by selected consumers in three Asian countries: India, Korea, and Thailand. Approximately 100 consumers in each location were recruited to participate in this study. The consumers were surveyed about eggs and poultry purchase behavior characteristics, such as temperatures and locations, storage behavior, such as storage locations in the refrigerator or freezer, preparation behavior, such as washing eggs and poultry before cooking, and handling behavior, such as using cutting boards during cooking. The results indicated differences in purchase and storage practices of raw eggs. Most Korean consumers purchased refrigerated eggs and stored the eggs in the refrigerator, while Indian and Thai consumers bought eggs that were stored at room temperature, but would refrigerate the eggs at home. Approximately half of the consumers in each country froze raw meat, poultry, or seafood. Food preparation practices showed potential for cross-contamination during cooking, such as using the same cutting board for different kinds of foods or not washing hands with soap and water. The results presented in this pilot study may lead to development of educational messages and raising consumer awareness of food safety practices in Asian countries. PMID:28234307

  20. 9 CFR 381.27 - Inauguration of service; notification concerning regulations; status of uninspected poultry...

    Science.gov (United States)

    2010-01-01

    ... concerning regulations; status of uninspected poultry products. 381.27 Section 381.27 Animals and Animal...; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS... concerning regulations; status of uninspected poultry products. The inspector in charge or his supervisor...

  1. Entre aves, carnes e embalagens: divisão sexual e sentidos do trabalho em abatedouro avícola Among poultry, meat and packaging: sexual division and meanings of work in a poultry slaughterhouse

    Directory of Open Access Journals (Sweden)

    Laila Priscila Graf

    2012-12-01

    Full Text Available Este artigo apresenta uma investigação sobre o trabalho de mulheres atuantes em um abatedouro avícola em Santa Catarina, Brasil. As concepções teóricas da divisão sexual do trabalho e da produção de sentidos pela psicologia do construcionismo social nortearam as análises. O conceito de trabalho foi compreendido a partir de uma dupla dimensão: como concreto (produtor de coisas úteis e abstrato (produtor de mercadorias. Com base na estratégia investigativa do estudo de caso, foi desenvolvida uma pesquisa de campo, com dois procedimentos principais: observações e oito entrevistas com trabalhadoras. Os resultados geraram duas grandes categorias temáticas, uma delas é apresentada aqui. Trata-se da divisão sexual do trabalho identificada tanto no âmbito produtivo como no doméstico. Os resultados, por meio da articulação analítica dos sentidos e da divisão sexual do trabalho, expuseram as relações assimétricas no trabalho na indústria de carne avícola e, consequentemente, no ambiente familiar.This article informs the results of a research which focus on the women's work at a small poultry slaughterhouse, in Santa Catarina State, Brazil. . The sexual division of labor and the meanings of work were supported by the social constructionism. The concept of work was understood from a double dimension: as concrete work (producing useful things and as abstract work (producing goods. Based on a case study, a qualitative approach was developed through observation and eight interviews with women workers. Based on the analytic articulation of meanings and sexual division of labor theories, the results showed the asymmetric relations at work in the poultry industry and also in the domestic place.

  2. Insects - a natural nutrient source for poultry - a review

    OpenAIRE

    Józefiak, D; Josefiak, A; Kieronczyk, B; Rawski, M; Swiatkiewicz, S; Dlugosz, Jakub; Engberg, Ricarda Greuel

    2016-01-01

    The consumption of poultry meat and eggs is expected to increase considerably in the nearest future, which creates the demand for new poultry feed ingredients in order to support sustainable intensive production. Moreover, the constant improvement of the genetic potential of poultry has resulted in an increased nutrient density in poultry feeds, which limits the possibility to include low quality feed ingredients. Therefore, the feed industry needs new sources of highly digestible protein wit...

  3. 77 FR 26706 - Food Ingredients and Sources of Radiation Listed and Approved for Use in the Production of Meat...

    Science.gov (United States)

    2012-05-07

    ... Listed and Approved for Use in the Production of Meat and Poultry Products AGENCY: Food Safety and... the regulations prohibit for use in meat or poultry products. Under this proposal, new uses of these substances in meat or poultry products would continue to be approved by the Food and Drug Administration (FDA...

  4. 78 FR 14636 - Food Ingredients and Sources of Radiation Listed and Approved for Use in the Production of Meat...

    Science.gov (United States)

    2013-03-07

    ... Production of Meat and Poultry Products AGENCY: Food Safety and Inspection Service, USDA. ACTION: Final rule. SUMMARY: The Food Safety and Inspection Service (FSIS) is amending the Federal meat and poultry products... substances that the regulations prohibit for use in meat or poultry products. New uses of these substances in...

  5. 9 CFR 319.261 - Meat loaf.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Meat loaf. 319.261 Section 319.261... ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION DEFINITIONS AND STANDARDS OF IDENTITY OR COMPOSITION Luncheon Meat, Loaves and Jellied Products...

  6. 9 CFR 319.500 - Meat pies.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Meat pies. 319.500 Section 319.500... ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION DEFINITIONS AND STANDARDS OF IDENTITY OR COMPOSITION Meat Food Entree Products, Pies, and...

  7. 9 CFR 319.304 - Meat stews.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Meat stews. 319.304 Section 319.304... ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION DEFINITIONS AND STANDARDS OF IDENTITY OR COMPOSITION Canned, Frozen, or Dehydrated Meat Food...

  8. 9 CFR 319.260 - Luncheon meat.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Luncheon meat. 319.260 Section 319.260... ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION DEFINITIONS AND STANDARDS OF IDENTITY OR COMPOSITION Luncheon Meat, Loaves and Jellied Products...

  9. Listeria monocytogenes infection in poultry and its public health importance with special reference to food borne zoonoses.

    Science.gov (United States)

    Dhama, Kuldeep; Verma, Amit Kumar; Rajagunalan, S; Kumar, Amit; Tiwari, Ruchi; Chakraborty, Sandip; Kumar, Rajesh

    2013-04-01

    Listeriosis is a disease that causes septicemia or encephalitis in humans, animals and birds. Although, the disease is rare and sporadic in poultry but if occurs then causes septicemia or sometimes localized encephalitis. Occasionally, the disease is seen in young chicks and the causative agent, like in humans and animals, is Listeria monocytogenes. The organism is capable to infect almost all animals and poultry; however, outbreaks of listeriosis are infrequent in birds. It is widely distributed among avian species and chickens, turkeys, waterfowl (geese, ducks), game birds, pigeons, parrots, wood grouse, snowy owl, eagle, canaries, which appear to be the most commonly affected. Chickens are thought to be the carriers of Listeria and also the prime reservoirs for the infection and thus contaminate the litter and environment of the poultry production units. Listeriosis is often noticed along with other poultry diseases such as coccidiosis, infectious coryza, salmonellosis, campylobacteriosis and parasitic infections, signifying the opportunistic nature of the organism. Intestinal colonization of poultry and the presence of L. monocytogenes in feces represent a potential source of the organism for listeriosis in ruminants. Man gets infection from raw broiler meat due to Listeria contamination and unhygienic conditions of the processing area, rather than acquiring direct infection from birds. With the changing food habits of the people, the health consciousness is also increasing and since listeriosis has now been recognized as an emerging food borne zoonoses. Therefore, this review has been compiled to make aware the poultry producers and the consumers of poultry meat/products regarding the importance of the disease and its public health significance.

  10. Economics of poultry manure utilization in land quality improvement ...

    African Journals Online (AJOL)

    The rapid growth of Nigerian's poultry has made it more advantageous in terms of providing the essential raw material for soil fertility enhancement than other livestock. This paper evaluates the benefits of poultry manure use among integrated poultry-maize farmers in Ekiti and Osun States of Nigeria for improved land ...

  11. Salmonella in meats, water, fruit and vegetables as disclosed from testing undertaken by Food Business Operators in Ireland from 2005 to 2009

    Directory of Open Access Journals (Sweden)

    Duggan Sharon

    2012-09-01

    Full Text Available Abstract Food Business Operators (FBO are responsible for the safety of the food they produce and in Ireland those under the regulatory control of the Department of Agriculture, Food and Marine are required to provide summary data on microbiological tests undertaken as part of their food safety controls. These data are provided to the National Reference Laboratory through the 25 private laboratories undertaking the testing. Results Over the five-year period Salmonella sp. was isolated from 0.7% of the 254,000 raw meat or raw meat products tested with the annual prevalence ranging from 0.5 to 1.1%. Poultry meats were consistently more contaminated than other meats with higher recovery rates in turkey (3.3%, duck (3.3%, and chicken (2.5% compared with meats of porcine (1.6%, ovine (0.2% and bovine origin (0.1%. Salmonella sp. was also isolated from 58 (0.06% of the 96,115 cooked or partially cooked meat and meat products tested during the reporting period with the annual percentage positive samples ranging from 0.01 to 0.16%. A total of 50 different serotypes were recovered from raw meats over this period with the greatest diversity found in poultry samples (n = 36. Four serotypes, Kentucky, Typhimurium, Agona and Derby accounted for over 70% of all isolates detected on FBO testing over the period 2005 to 2009. Conclusions Capturing microbiological data generated by Food Business Operators allows the regulatory sector access to a substantial amount of valuable data with the minimum financial outlay.

  12. Fast and reliable DNA extraction protocol for identification of species in raw and processed meat products sold on the commercial market

    Directory of Open Access Journals (Sweden)

    Alvarado Pavel Espinoza

    2017-08-01

    Full Text Available In this work a protocol for the extraction of DNA from the meat of different animals (beef, pork, and horse was established. The protocol utilized TE lysis buffer with varying concentrations of phenol and chloroform as a base reagent. Reactions were carried out for verying time periods and under differing temperatures. All samples analyzed were obtained from commercial grade meat sourced from the local region. 12 samples were used for methodological optimization with 30 repetitions per sample. Once optimized, purity results for the three species were 1.7 with a concentration (determined spectrophotometrically at 260 nm of 100 μl/ml of DNA. The protocol was tested using 465 different meat samples from different animal species. All meat used was fresh and processed. Results showed a purity of 1.35 ± 0.076 and a DNA concentration of 70 ± 0.31 μl for a time duration of 1.5 hours. These results were tested by polymerase chain reaction (PCR as reported by several authors. The extracts were tested using different PCR reactions using specific primers for horses. Results suggest that there was 39 positive samples. The proposed methodology provides an efficient way to detect DNA concentration and purity, suitable for amplification with PCR.

  13. 9 CFR 319.307 - Spaghetti sauce with meat.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Spaghetti sauce with meat. 319.307... AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY... Dehydrated Meat Food Products § 319.307 Spaghetti sauce with meat. “Spaghetti Sauce with Meat” shall contain...

  14. 9 CFR 319.761 - Potted meat food product and deviled meat food product.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Potted meat food product and deviled meat food product. 319.761 Section 319.761 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY...

  15. 9 CFR 319.311 - Chow mein vegetables with meat, and chop suey vegetables with meat.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Chow mein vegetables with meat, and chop suey vegetables with meat. 319.311 Section 319.311 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY...

  16. ANTE-MORTEM FORMATION OF THE QUALITATIVE CHARACTERISTICS OF ENVIRONMENTALLY FRIENDLY MEAT RAW MATERIAL BY INTENSIFICATION OF THE MECHANISMS OF THE METABOLIC PROCESSES IN GILTS

    Directory of Open Access Journals (Sweden)

    T. M. Giro

    2016-01-01

    Full Text Available Abstract In order to reduce the time of feeding, increase the intensity of weight gain without hormones, antibiotics, anabolic drugs, as well as to obtain high-quality meat with marble structure, the authors studied the influence of ovarioectomy on the intensification of the metabolic processes in gilts. The experiments were carried out in the FGUP “Mummovskoe” – the educational experimental enterprise of the Russian State Agrarian University - Moscow Timiryazev Agricultural Academy (RSAU – MAA named after K.A.  Timiryazev, in the Atkarsky district of the Saratov region. Two groups of Duroc gilts (10 animals each raised under the same conditions were studied. As a result of the experiment, the influence of ovariectomy on the level of insulinlike growth factor-1 (IGF-1 and indicators of metabolic processes in gilts were established. It is confirmed that stimulation of the the somatotropin/insulin-like growth factor (ST-IGF system along with hereditary factors and the characteristics of feeding contributes to the development of muscle tissue. Stimulation of ST secretion with insulin-like growth factor facilitates the development of muscle tissue.An increase in IGF-1 level leads to the development of new muscle fibers and muscle hyperplasia. After surgery, the major factors of changes in meat and feeding indicators in gilts were the rise in the metabolic activity of muscle tissue and fat metabolism, enhancement of production of IGF-1, which has insulin-like action and ensures activation of the processes of cell proliferation and differentiation. Increase in IGF-1 level had a positive impact on meat productivity, chemical and biochemical composition of pork. Simultaneous triggering of the systemic catabolic and local anabolic reactions in gilts after ovariectomy contributed to obtaining higher nutritional value of meat.

  17. Effects of choice white grease or poultry fat on growth performance, carcass leanness, and meat quality characteristics of growing-finishing pigs.

    Science.gov (United States)

    Engel, J J; Smith, J W; Unruh, J A; Goodband, R D; O'Quinn, P R; Tokach, M D; Nelssen, J L

    2001-06-01

    Eighty-four crossbred gilts were used to evaluate the effects of dietary choice white grease (CWG) or poultry fat (PF) on growth performance, carcass characteristics, and quality characteristics of longissimus muscle (LM), belly, and bacon of growing-finishing pigs. Pigs (initially 60 kg) were fed a control diet with no added fat or diets containing 2, 4, or 6% CWG or PF. Diets were fed from 60 to 110 kg and contained 2.26 g lysine/Mcal ME. Data were analyzed as a 2 x 3 factorial plus a control with main effects of fat source (CWG and PF) and fat level (2, 4, and 6%). Pigs fed the control diet, 2% fat, and 4% fat had greater (P 0.05) were observed for ADG, dressing percentage, leaf fat weight, LM pH, backfat depth, LM area, percentage lean, LM visual evaluation, LM waterholding capacity, Warner-Bratzler shear and sensory evaluation of the LM and bacon, fat color and firmness measurements, or bacon processing characteristics. Adding dietary fat improved G/F and altered the fatty acid profiles of the LM and bacon, but differences in growth rate, carcass characteristics, and quality and sensory characteristics of the LM and bacon were minimal. Dietary additions of up to 6% CWG or PF can be made with little effect on quality of pork LM, belly, or bacon.

  18. In Dogs with Periodontal Disease Is Feeding a Complete Raw Meat Diet More Effective Than a Complete Kibble 'Dental' Diet at Reducing Periodontal Disease?

    Directory of Open Access Journals (Sweden)

    Nieky van Veggel

    2017-04-01

    Full Text Available Clinical bottom line:In light of the absence of evidence, vets and vet nurses should be cautious when recommending raw diets to support periodontal health and advise clients accordingly by relying on their clinical experience rather than the literature until more evidence is generated.

  19. Tratamentos de pré-resfriamento e resfriamento sobre a qualidade de carne de peito de frango Pre-chilling and chilling treatments on poultry breast meat quality

    Directory of Open Access Journals (Sweden)

    Maria Cristina Bressan

    2004-06-01

    Full Text Available O total de 402 frangos foi processado em abatedouro comercial e submetido a seis tratamentos de resfriamento. Inicialmente as carcaças foram pré-resfriadas (PR por imersão em água e gelo, seguido de resfriamento (R a -35°C e estocagem a 4°C por 20 horas. Os tratamentos foram: a (0°C/30min, -35°C/3h e 15min, b (10°C/30min, 0°C/30min, -35°C/2h e 45 min, c (10°C/30min, -35°C/3h e 15min, d (20°C/30min, 0°C/30min, -35°C/2h e 45min, e (20°C/30min, -35°C/3h e 15min e F (20°C/30min, 0°C/3h e 15min. Temperaturas baixas utilizadas após a evisceração aceleraram a instalação do rigor em músculos pectoralis major (PM. Aos 45min post mortem carcaças sem PR (A ou PR a 10°C (B tiveram músculo PM com menor (PA total of 402 poultry was processed in a commercial poultry processing plant and submitted to six chilling treatments. Initially, the carcasses were chilled by immersion in water and ice, followed by cooling at -35°C or storage at 4°C for 20 hours. The treatments were: A (0°C/30min, -35°C/3h and 15min, B (10°C/30min, 0°C/30min, -35°C/2h and 45min, C (10°C/30min, -35°C/3h and 15min, D (20°C/30min, 0°C/30min, -35°C/2h and 45min, E (20°C/30min, -35°C/3h and 15min and F (20°C/30min, 0°C/3h and 15min. Low temperatures used after evisceration, accelerated the onset and resolution of rigor in pectoralis major (PM muscles. Up to 45 minutes post mortem, carcasses without pre-chilling (A or pre-chilled at 10°C (B, showed lower (P<0.001 pH values of 5.75 and 5.81, while in carcasses pre-chilled at 20°C (D, the values were higher, reaching 5.95. After 4h post mortem, the R values found in treatments A and B, with averages of 1.51 and 1.44, were higher (P<0.05 than the value of 1.32 found in treatment D. The luminescence (L* was influenced (P<0.001 by the treatments (in treatments A, B and C, the averages were 48.2, 47.7 and 47.6, while in treatments D and E, they were 45.5 and 45.7, respectively. The greater values for

  20. Alteration by irradiation and storage at amount of heme iron in poultry meat; Alteracoes provocadas pela irradiacao e armazenamento nos teores de ferro heme em carne de frango

    Energy Technology Data Exchange (ETDEWEB)

    Souza, Adriana Regia Marques de; Arthur, Valter Arthur [Centro de Energia Nuclear na Agricultura (CENA), Piracicaba, SP (Brazil). Lab. de Irradiacao de Alimentos e Radioentomologia; Canniatti-Brazaca, Solange Guidolin [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil). Dept. de Agroindustria, Alimentos e Nutricao]. E-mail: sgcbraza@esalq.usp.br

    2007-04-15

    Studies of irradiation and storage effects in chicken were carried out to discover the influence in iron heme, non-heme amount, color and total pigments. Chicken thighs and chicken breast were studied. These were irradiated to 0, 1 and 2 kGy stored by 14 days to 4 deg C in refrigerator. Determining the heme content and non-heme of meat was done using the colorimeter method and the Ferrozine reagent. The values of iron heme were influenced both by the irradiation and the storage, reducing the amount throughout the course of time. The iron non-heme was also influenced by the doses and the storage time, however the values increased throughout the course of time, because of the conversion of iron heme in non-heme. The color did not show that it was influenced by the studied doses, except for the storage, and the total number of pigments was affected by the irradiation and the time, reducing the values with the increase of storage. Irradiation was shown to be a good method to conserve iron. (author)

  1. Prospects and challenges of radiation processing of meats and meat products in India

    International Nuclear Information System (INIS)

    Chander, Ramesh

    2014-01-01

    In India goat, lamb and chicken meat are widely preferred, while, bovine meat and pork are consumed only by a small segment of the population. Meats in the country are mainly marketed fresh or in frozen state. Recently chilled poultry has been introduced in Indian market. In addition to fresh meats, several other ready to eat or ready to cook meat products like chicken chilly, chicken tikka, mutton shammi kababs, mutton seekh kababs etc are available in urban Indian market. These products are marketed only in the frozen state and have limited market due to expensive and inadequate freezing facilities. Major share of domestic fresh meat and poultry market is by unorganized sector and only a few corporate houses like Godrej and Venkey's are marketing poultry products. The time has come to benefit from radiation processing for safe, chilled meat and poultry in India. Shelf-stable, nutritious meat and meat products can also be produced by the process. Radiation processing of these foods will be of great economic and health significance and give boost to exports. This radiation processing can meet the needs of services of convenient and ready-to-eat meat and meat products

  2. Worldwide Mycotoxins Exposure in Pig and Poultry Feed Formulations

    OpenAIRE

    Guerre, Philippe

    2016-01-01

    The purpose of this review is to present information about raw materials that can be used in pig and poultry diets and the factors responsible for variations in their mycotoxin contents. The levels of mycotoxins in pig and poultry feeds are calculated based on mycotoxin contamination levels of the raw materials with different diet formulations, to highlight the important role the stage of production and the raw materials used can have on mycotoxins levels in diets. Our analysis focuses on myc...

  3. Isolation and Identification of Campylobacter spp. from Poultry and Poultry By-Products in Tunisia by Conventional Culture Method and Multiplex Real-Time PCR.

    Science.gov (United States)

    Jribi, Hela; Sellami, Hanen; Mariam, Siala; Smaoui, Salma; Ghorbel, Asma; Hachicha, Salma; Benejat, Lucie; Messadi-Akrout, Feriel; Mégraud, Francis; Gdoura, Radhouane

    2017-10-01

    Thermophilic Campylobacter spp. are one of the primary causes of bacterial human diarrhea. The consumption of poultry meats, by-products, or both is suspected to be a major cause of human campylobacteriosis. The aims of this study were to determine the prevalence of thermophilic Campylobacter spp. in fresh poultry meat and poultry by-products by conventional culture methods and to confirm Campylobacter jejuni and Campylobacter coli isolates by using the multiplex PCR assay. Two hundred fifty fresh poultry samples were collected from a variety of supermarkets and slaughterhouses located in Sfax, Tunisia, including chicken (n =149) and turkey (n =101). The samples were analyzed using conventional microbiological examinations according to the 2006 International Organization for Standardization method (ISO 10272-1) for Campylobacter spp. Concurrently, a real-time PCR was used for identification of C. jejuni and C. coli . Of the 250 samples of poultry meat and poultry by-products, 25.6% (n = 64) were contaminated with Campylobacter spp. The highest prevalence of Campylobacter spp. was found in chicken meat (26.8%) followed by turkey meat (23.7%). Among the different products, poultry breasts showed the highest contamination (36.6%) followed by poultry by-products (30%), poultry wings (28%) and poultry legs (26%) showed the lowest contamination, and no contamination was found on neck skin. Of the 64 thermophilic Campylobacter isolates, C. jejuni (59.7%) was the most frequently isolated species and 10.9% of the isolates were identified as C. coli . All of the 64 Campylobacter isolates identified by the conventional culture methods were further confirmed by PCR. The seasonal peak of Campylobacter spp. contamination was in the warm seasons (spring and summer). The study concluded that high proportions of poultry meat and poultry by-products marketed in Tunisia are contaminated by Campylobacter spp. Furthermore, to ensure food safety, poultry meats must be properly cooked

  4. Poultry Internet

    Science.gov (United States)

    Cheok, Adrian David

    Poultry are one of the most badly treated animals in the modern world. It has been shown that they have high levels of both cognition and feelings, and as a result there has been a recent trend of promoting poultry welfare. There is also a tradition of keeping poultry as pets in some parts of the world. However, in modern cities and societies, it is often difficult to maintain contact with pets, particularly for office workers. We propose and describe a novel cybernetics system to use mobile and Internet technology to improve human-pet interaction. It can also be used for people who are allergic to touching animals and thus cannot stroke them directly. This interaction encompasses both visualization and tactile sensation of real objects.

  5. Transfer of arsenic from poultry feed to poultry litter: A mass balance study.

    Science.gov (United States)

    Gupta, Sanjay K; Le, X Chris; Kachanosky, Gary; Zuidhof, Martin J; Siddique, Tariq

    2018-07-15

    Roxarsone (rox), an arsenic (As) containing organic compound, is a common feed additive used in poultry production. To determine if As present in rox is excreted into the poultry litter without any retention in chicken meat for safe human consumption, the transference of As from the feed to poultry excreta was assessed using two commercial chicken strains fed with and without dietary rox. The results revealed that both the strains had similar behaviour in growth (chicken weight; 2.17-2.25kg), feed consumption (282-300kgpen -1 initially containing 102 chicken) and poultry litter production (73-81kgpen -1 ) during the growth phase of 35days. Our mass balance calculations showed that chickens ingested 2669-2730mg As with the feed and excreted out 2362-2896mg As in poultry litter during the growth period of 28days when As containing feed was used, yielding As recovery between 86 and 108%. Though our complementary studies show that residual arsenic species in rox-fed chicken meat may have relevance to human exposure, insignificant retention of total As in the chicken meat substantiates our mass balance results. The results are important in evaluating the fate of feed additive used in poultry production and its potential environmental implications if As containing poultry litter is applied to soil for crop production. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Influence of Detection Methods in Characterizing Escherichia coli O157:H7 in Raw Goat Meat Using Conventional and Molecular Methods.

    Science.gov (United States)

    Tabashsum, Zajeba; Nazneen, Mafruha; Ahsan, C R; Bari, M L; Yasmin, M

    2016-01-01

     Presence of Escherichia coli O157:H7 on fresh goat meat samples (n= 40) of Dhaka city was analyzed using conventional and molecular methods. A total of 86 presumptive E. coli O157:H7 colonies were isolated from 60% of the samples using selective agar plating method. After conventional biochemical assay followed by API 20E assay, only 11 isolates were found to be E. coli O157:H7. Further serological test identified only four isolates that has strong agglutination reaction against anti-H7 sensitized latex. The biochemically and serologically confirmed isolates were then screened for major virulence factors include eaeA, rfbE, fliC, stx1 and stx2 genes by PCR. PCR analysis of positive isolates showed, 10 isolates were eaeA and rfbE genes positive but fliC gene was only in six, indicating that these isolates were H7 positive with flagellum antigens which might not expressed or detected in serotyping tests. Multiplex PCR against eaeA, stx1 and stx2 genes of the isolates showed similar results as when done individually. These results revealed that only 7% of the primary presumptive E. coli O157:H7 was found to be stx producing E. coli O157:H7 and thus greatly influenced the detection of the pathogen in meat samples.

  7. QUANTITATIVE ASSESSMENT OF CAMPYLOBACTER SPP. ON POULTRY CARCASSES

    Directory of Open Access Journals (Sweden)

    L. Alberghini

    2011-01-01

    Full Text Available Campylobacter spp. are bacterial pathogens associated with human gastroenteritis worldwide. In Europe, campylobacteriosis is one of the leading food-borne bacterial diseases and the consumption of poultry meats is suspected to be one of the major causes of illness. The aim of our research was to determine the number of Campylobacter spp. in poultry carcasses and in poultry meat samples during their storage till to retail markets. The study was conducted from February 2009 to February 2010 at slaughterhouse in Veneto region, followed by a test of fresh poultry meat placed on the market for sale. A total of 90 poultry carcass and 90 samples of poultry meat were examined. The quantitative examination resulted in Campylobacter spp. counts (mean: for carcasses between 2,0 ∙101 ufc/g and 1,5 ∙103 ufc/g (4,2 ∙102 and poultry meat between 2,0 ∙101 ufc/g and 3,7 ∙102 ufc/g (8,1 ∙101. The majority of isolates were classified as Campylobacter jejuni (58,3%, Campylobacter coli (22,9% or Arcobacter cryaerophilus (4,2%. Acknowledgments: The project was funded with grants from Fondazione Cariverona 2007.

  8. Volatile compounds in meat and meat products

    Directory of Open Access Journals (Sweden)

    Monika KOSOWSKA

    Full Text Available Abstract Meaty flavor is composed of a few hundreds of volatile compounds, only minor part of which are responsible for the characteristic odor. It is developed as a result of multi-directional reactions proceeding between non-volatile precursors contained in raw meat under the influence of temperature. The volatile compounds are generated upon: Maillard reactions, lipid oxidation, interactions between Maillard reaction products and lipid oxidation products as well as upon thiamine degradation. The developed flavor is determined by many factors associated with: raw material (breed, sex, diet and age of animal, conditions and process of slaughter, duration and conditions of meat storage, type of muscle, additives applied and the course of the technological process. The objective of this review article is to draw attention to the issue of volatile compounds characteristic for meat products and factors that affect their synthesis.

  9. Rural Poultry Farming with Improved Breed of Backyard Chicken

    OpenAIRE

    P.K. Pathak; B.G. Nath

    2013-01-01

    Livestock and poultry rearing is an imperative factor for improving the nutritional security of rural poor in India. Rural farmers rear Desi type chicken with low egg and meat production in backyard system. For developing the rural poultry farming, improved backyard poultry like Vanaraja/Gramapriya birds rearing is of utmost important. These improved birds can rear in both intensive and free ranging system. Birds can be reared for egg production in small numbers (10- 20) in fre...

  10. Backyard Poultry

    Centers for Disease Control (CDC) Podcasts

    2017-01-18

    Dr. Colin Basler, an epidemiologist with CDC, discusses his article on Salmonella infections associated with keeping live poultry in backyards.  Created: 1/18/2017 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 1/18/2017.

  11. In vitro evaluation of the antimicrobial effect of a raw bacteriocin extract in combination with chemical preservatives employed in meat industry

    Directory of Open Access Journals (Sweden)

    Luis A. Aguado Bautista

    2010-12-01

    Full Text Available Biopreservation can be defined as the foods shelf life extension employing antibacterial products like bacteriocins. The objective of this work was to determinate the efficacy of E. faecium MXVK29 bacteriocin in combination with chemical preservatives against spoilage and pathogens microorganisms. Bacteriocin raw extrac antimicrobial activity was 46.34 UA/g of protein. Growth of Pseudomonas putida was not affected by the preservatives employed at the conditions employed. Antimicrobial response was different for other microorganisms since a synergetic effect of the preservatives combination inhibited Brochothrix thermosphacta and Escherichia coli growth. Sodium lactate had additive effect only against Listeria innocua.

  12. Metabolic bone disease and central retinal degeneration in a kitten due to nutritional inadequacy of an all-meat raw diet

    Directory of Open Access Journals (Sweden)

    Catherine Lenox

    2015-05-01

    Full Text Available A 5-month-old castrated male Sphynx kitten presented with left hindlimb lameness shortly after adoption. Prior to adoption, the breeder had fed the kitten an exclusively raw chicken diet. Radiographs revealed generalized osteopenia and a left tibia–fibula fracture. Ophthalmic examination revealed corneal vascularization and opacity in the right eye, and lesions suggestive of feline central retinal degeneration in the left eye. The patient’s diagnoses included metabolic bone disease and feline central retinal degeneration, which can result from taurine deficiency. The kitten’s nutritional diseases were managed with a complete and balanced canned diet designed for kitten growth and with taurine supplementation.

  13. Simulations at Czech poultry market

    Directory of Open Access Journals (Sweden)

    Lenka Rumánková

    2012-01-01

    Full Text Available This paper defines the possible scenarios of the development of the poultry market in the Czech Republic, in view of the trends in production, consumption and foreign trade. The individual scenarios are based upon the forecasts of selected factors that have a substantial impact on the poultry market and whose changes can be expected in the subsequent years with great likelihood. The article sets out and addresses various scenarios for the period of 2012–2014. The scenarios are based upon the partial equilibrium model of the poultry market, which has been derived on the basis of time series and panel data within the years 1995–2009. The conducted analysis clearly shows that changes in the prices of agricultural producers will have an effect on changes in the production of poultry meat, an increase in VAT through consumer prices will impact the rate of domestic consumption, as well as changes in disposable income. Similarly, a change in the exchange rate will have an effect on the amount of poultry imported into the Czech Republic.

  14. Myoglobin chemistry and meat color.

    Science.gov (United States)

    Suman, Surendranath P; Joseph, Poulson

    2013-01-01

    Consumers rely heavily on fresh meat color as an indicator of wholesomeness at the point of sale, whereas cooked color is exploited as an indicator of doneness at the point of consumption. Deviations from the bright cherry-red color of fresh meat lead to product rejection and revenue loss. Myoglobin is the sarcoplasmic heme protein primarily responsible for the meat color, and the chemistry of myoglobin is species specific. The mechanistic interactions between myoglobin and multiple extrinsic and intrinsic factors govern the color of raw as well as cooked meats. The objective of this review is to provide an overview of the current research in meat color and how the findings are applied in the meat industry. Characterizing the fundamental basis of myoglobin's interactions with biomolecules in postmortem skeletal muscles is necessary to interpret the chemistry of meat color phenomena and to engineer innovative processing strategies to minimize meat discoloration-induced revenue loss to the agricultural economy.

  15. Taste-active compound levels in Korean native chicken meat: The effects of bird age and the cooking process.

    Science.gov (United States)

    Jayasena, Dinesh D; Jung, Samooel; Kim, Hyun Joo; Yong, Hae In; Nam, Ki Chang; Jo, Cheorun

    2015-08-01

    The effects of bird age and the cooking process on the levels of several taste-active compounds, including inosine 5'-monophosphate (IMP), glutamic acid, cysteine, reducing sugars, as well as oleic, linoleic, arachidonic, and docosahexaenoic acids (DHA), in the breast and leg meats from a certified meat-type commercial Korean native chicken (KNC) strain (Woorimatdag) were investigated. KNC cocks were raised under similar standard conditions at a commercial chicken farm, and breast and leg meats from birds of various ages (10, 11, 12, 13, and 14 wk; 10 birds/age group) were obtained. After raw and cooked meat samples were prepared, they were analyzed for the aforementioned taste-active compounds. Compared to the leg meat, KNC breast meat had higher levels of IMP, arachidonic acid, and DHA, but lower levels of the other taste-active compounds (P cooking process (P cooking process. This information could be useful for selection and breeding programs, and for popularizing native chicken meat. © 2015 Poultry Science Association Inc.

  16. 9 CFR 381.148 - Processing and handling requirements for frozen poultry products.

    Science.gov (United States)

    2010-01-01

    ... for frozen poultry products. 381.148 Section 381.148 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS...

  17. 9 CFR 381.168 - Maximum percent of skin in certain poultry products.

    Science.gov (United States)

    2010-01-01

    ... poultry products. 381.168 Section 381.168 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Definitions and...

  18. 9 CFR 381.174 - Limitations with respect to use of Mechanically Separated (Kind of Poultry).

    Science.gov (United States)

    2010-01-01

    ... Mechanically Separated (Kind of Poultry). 381.174 Section 381.174 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS...

  19. 9 CFR 381.193 - Poultry carcasses, etc., not intended for human food.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Poultry carcasses, etc., not intended..., DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Transportation...

  20. 9 CFR 381.215 - Poultry or other articles subject to judicial seizure and condemnation.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Poultry or other articles subject to... INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS...

  1. 78 FR 32226 - Poultry Market News Reports; Request for Extension and Revision of the Currently Approved...

    Science.gov (United States)

    2013-05-29

    ... Service [Doc. No. AMS-LPS-13-0021] Poultry Market News Reports; Request for Extension and Revision of the Currently Approved Information Collection and To Merge the Collections of Livestock, Poultry, Meat, Grain... merged its Livestock and Grain Market News Division with the Poultry Market News Division, creating the...

  2. 9 CFR 381.74 - Poultry suspected of having biological residues.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Poultry suspected of having biological... OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Ante Mortem...

  3. 9 CFR 381.444 - Identification of major cuts of poultry products.

    Science.gov (United States)

    2010-01-01

    ... poultry products. 381.444 Section 381.444 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Nutrition Labeling...

  4. 9 CFR 381.210 - Poultry and other articles subject to administrative detention.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Poultry and other articles subject to..., DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Detention; Seizure...

  5. Assessing the variability of the fatty acid profile and cholesterol content of meat sausages

    OpenAIRE

    Amaral, J.S.; Soares, S.; Mafra, I.; Oliveira, M.B.P.P.

    2014-01-01

    Eighteen different brands of meat sausages including pork, poultry and the mixture of both meats (pork and poultry) in sausages, were analysed for their nutritional composition (total fat, moisture, crude protein and ash), cholesterol content and fatty acid composition. As expected, the pork Frankfurter sausages presented a higher fat content compared to sausages that include poultry meat in their composition. A multivariate statistical analysis was applied to the data showing the existence o...

  6. Strand-specific transcriptomes of Enterohemorrhagic Escherichia coli in response to interactions with ground beef microbiota: interactions between microorganisms in raw meat.

    Science.gov (United States)

    Galia, Wessam; Leriche, Francoise; Cruveiller, Stéphane; Garnier, Cindy; Navratil, Vincent; Dubost, Audrey; Blanquet-Diot, Stéphanie; Thevenot-Sergentet, Delphine

    2017-08-03

    Enterohemorrhagic Escherichia coli (EHEC) are zoonotic agents associated with outbreaks worldwide. Growth of EHEC strains in ground beef could be inhibited by background microbiota that is present initially at levels greater than that of the pathogen E. coli. However, how the microbiota outcompetes the pathogenic bacteria is unknown. Our objective was to identify metabolic pathways of EHEC that were altered by natural microbiota in order to improve our understanding of the mechanisms controlling the growth and survival of EHECs in ground beef. Based on 16S metagenomics analysis, we identified the microbial community structure in our beef samples which was an essential preliminary for subtractively analyzing the gene expression of the EHEC strains. Then, we applied strand-specific RNA-seq to investigate the effects of this microbiota on the global gene expression of EHEC O26 21765 and O157 EDL933 strains by comparison with their behavior in beef meat without microbiota. In strain O26 21765 , the expression of genes connected with nitrate metabolism and nitrite detoxification, DNA repair, iron and nickel acquisition and carbohydrate metabolism, and numerous genes involved in amino acid metabolism were down-regulated. Further, the observed repression of ftsL and murF, involved respectively in building the cytokinetic ring apparatus and in synthesizing the cytoplasmic precursor of cell wall peptidoglycan, might help to explain the microbiota's inhibitory effect on EHECs. For strain O157 EDL933 , the induced expression of the genes implicated in detoxification and the general stress response and the repressed expression of the peR gene, a gene negatively associated with the virulence phenotype, might be linked to the survival and virulence of O157:H7 in ground beef with microbiota. In the present study, we show how RNA-Seq coupled with a 16S metagenomics analysis can be used to identify the effects of a complex microbial community on relevant functions of an individual

  7. 29 CFR 570.61 - Occupations in the operation of power-driven meat-processing machines and occupations involving...

    Science.gov (United States)

    2010-07-01

    ..., for example, the slicing in a retail delicatessen of meat, poultry, seafood, bread, vegetables, or.... This section shall not apply to: (1) The killing and processing of poultry, rabbits, or small game in... and occupations involving slaughtering, meat and poultry packing, processing, or rendering (Order 10...

  8. Transgenesis techniques and its application in poultry production ...

    African Journals Online (AJOL)

    Transgenesis is applied in production of therapeutic proteins, improvement of economic traits such as meat quality, disease resistance, feed conversion efficiency; as well as protection of humans from zoonotic diseases. Thus, transgenic technologies may revolutionalize the production of poultry birds with improved meat ...

  9. 9 CFR 319.721 - Fluid extract of meat.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Fluid extract of meat. 319.721 Section... AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION DEFINITIONS AND STANDARDS OF IDENTITY OR COMPOSITION Meat Soups, Soup Mixes...

  10. 9 CFR 327.9 - Burlap wrapping for foreign meat.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Burlap wrapping for foreign meat. 327... AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION IMPORTED PRODUCTS § 327.9 Burlap wrapping for foreign meat. Burlap shall not be...

  11. Heterocyclic amines in meat and meat products

    Directory of Open Access Journals (Sweden)

    Aliye BULGAN

    2013-06-01

    Full Text Available Heterocyclic amines (HA are the mutagenic/carcinogenic compounds which generate as a result of cooking of red meat, poultry meat and fish fillets at high temperatures. Up to 20 different HAs were detected and classified in the researches that conducted on these types of meats cooked at high temperatures. HAs are the products of Maillard reactions and the Strecker degredation of main precursors such as creatine/creatinine, aminoacid and the polysaccharides. Many physical and chemical factors effect the formation of HAs. Thus, it was reported by many researchers that utilizing coating and marination processes in addition to using natural and synthetic antioxidants and seasonings-plant extracts were effective on inhibiting/decreasing the formation of HAs. Additionally, boiling/steaming and microwave cooking methodologies were recommended instead of barbecuing, grilling or frying to inhibit/decrease the formation of HAs. The HAs formed in meat and meat products and the factors which have effects on the formation of HAs are presented in this review.

  12. Functional Characteristics of Spent Duck Meat for Use in Emulsion-Type Meat Products

    OpenAIRE

    Juni Sumarmono; Samsu Wasito

    2010-01-01

    Spent ducks produce nutritive meat; however the meat possesses undesirable characteristics such as strong odor and tough. Hence, appropriate yet simple processing technologies need to be developed in order to maximize the use of duck meat. The experiment was conducted to evaluate functional characteristics of spent duck meat as raw material for the production of emulsion-type meat products, such as nugget and sausage. Chilled carcasses of 96 spent ducks were deboned manually, then mixed thor...

  13. Radiation decontamination of meat lyophylized products

    International Nuclear Information System (INIS)

    Migdal, W.; Owczarczyk, H.B.

    2002-01-01

    There is an increasing demand for a powder soups and sauces composed with lyophylizated meat. Technology of lyophylization is not always accompanied by thermal treatment of raw materials. That is the reason the meat lyophylization process does not ensure as good microbiological quality as is required. Degree of microbiological decontamination and organoleptic properties of lyophilized meat were investigated after radiation treatment

  14. The significance of Campylobacter jejuni infection in poultry: a review.

    Science.gov (United States)

    Shane, S M

    1992-01-01

    Campylobacter is a significant cause of enterocolitis in consumers of undercooked poultry meat. Campylobacter jejuni is the most significant of the three thermophilic Campylobacter species, and is responsible for intestinal colonization in poultry and food-borne enteritis in humans. Generally, C. jejuni is apathogenic in poultry, although newly hatched chicks and turkeys may develop a transient diarrhoea following infection. Modern intensive poultry production favours the introduction of infection into commercial growing units, resulting in intestinal colonization during the second to fourth weeks inclusive. Routes of infection include contaminated fomites, infected water supply, rodents, insects, and free-living birds. Vertical transmission is considered unlikely. Contamination of poultry meat is enhanced by deficiencies in transport and processing of broilers and turkeys. Scalding, defeathering and evisceration represent the significant points of cross-contamination during processing. Epidemiological correlation has been established between consumption of contaminated chicken and outbreaks of human campylobacteriosis. Amelioration of infection by application of improved standards of hygiene and decontamination is possible in the context of commercial poultry production. Improvement in washing of carcasses, and the application of chemical disinfectants and gamma irradiation have the potential to reduce the prevalence of C. jejuni contamination in poultry meat. These innovations, together with improved storage and handling of meat products, will reduce the risk of campylobacteriosis to consumers.

  15. CURRENT STATE OF POULTRY BREEDING AND ITS FUTURE TRENDS

    Directory of Open Access Journals (Sweden)

    Gordana Kralik

    2013-06-01

    Full Text Available Poultry production in eastern Croatia is developed by individual producers mainly in semi intensive way, and within the organized poultry systems where the process is organized in a modern, intensive way. There is a tradition of breeding hens and geese in this area. Poultry products - meat and eggs are important in supplying the population with animal protein, minerals and vitamins. Modern hybrid hens are used for egg production and for meat production in the intensive production. Today geese breeding in these areas are completely neglected. Croatia as a member of European Union, has possibility of the placement of autochthonous breeds of poultry such as Hrvatica hen, Zagorje turkey and Podravian goose. Financial supports at the national level are allocated for the first two autochthonous breeds of poultry because these breeds can, with good production traits, represent genetic resources and strategic reserves in the future development of domestic poultry genotypes. Poultry production is especial emphasis in accordance with the criteria of welfare and health of poultry. This paper discusses further development of poultry in terms of production of poultry meat and eggs as a functional food. The composition and content of nutricines in meat and eggs can be affected by feed composition. Desired nutricines are installed in muscular tissue of poultry by using feed and adding some components. Consumption of eggs and poultry meat enriched by selenium, lutein and omega-3 fatty acids affects the improvement of the quality of the human diet. The recent researches show that chicken can effectively be enriched in carnosine - ingredients that are now taught as “anti-aging” factor. Enrichment of poultry products with nutricines gives greater importance to these foods in the diet of the population than the former one, mainly based on the nutritional aspect. Greater selection of quality poultry products can be a significant factor in the development of

  16. Trends in microbial control techniques for poultry products.

    Science.gov (United States)

    Silva, Filomena; Domingues, Fernanda C; Nerín, Cristina

    2018-03-04

    Fresh poultry meat and poultry products are highly perishable foods and high potential sources of human infection due to the presence of several foodborne pathogens. Focusing on the microbial control of poultry products, the food industry generally implements numerous preventive measures based on the Hazard Analysis and Critical Control Points (HACCP) food safety management system certification together with technological steps, such as refrigeration coupled to modified atmosphere packaging that are able to control identified potential microbial hazards during food processing. However, in recent years, to meet the demand of consumers for minimally processed, high-quality, and additive-free foods, technologies are emerging associated with nonthermal microbial inactivation, such as high hydrostatic pressure, irradiation, and natural alternatives, such as biopreservation or the incorporation of natural preservatives in packaging materials. These technologies are discussed throughout this article, emphasizing their pros and cons regarding the control of poultry microbiota and their effects on poultry sensory properties. The discussion for each of the preservation techniques mentioned will be provided with as much detail as the data and studies provided in the literature for poultry meat and products allow. These new approaches, on their own, have proved to be effective against a wide range of microorganisms in poultry meat. However, since some of these emergent technologies still do not have full consumer's acceptability and, taking into consideration the hurdle technology concept for poultry processing, it is suggested that they will be used as combined treatments or, more frequently, in combination with modified atmosphere packaging.

  17. Comparative evaluation of quality and composition of ostrich, turkey and broiler meat

    OpenAIRE

    Jukna V.; Klementavičiūtė J.; Meškinytė-Kaušilienė E.; Pečiulaitienė N.; Samborskytė M.; Ambrasūnas L.

    2012-01-01

    In this article are presented research data on comparative evaluation of meat quality of various poultry species. The study was made on 5 samples of ostrich, turkey and broiler meat. Samples were weighed 500 to 550 grams. Qualitative and nutritional properties of meat from different species of poultry were estimated. The chemical composition, pH, color, firmness, water holding capacity, cooking loss, drip loss of ostrich, turkey and broiler meat were analyz...

  18. Financial analysis of poultry commodity chains in Hanoi Suburb, North of Vietnam

    OpenAIRE

    Phan Dang, Thang; Vu Dinh, Ton; Dogot, Thomas; Lebailly, Philippe

    2013-01-01

    Poultry production plays an important role in the structure of familial incomes in Vietnam but this activity is currently met with difficulties caused by the great influence of inputs/outputs on the markets and the risks of epidemic diseases. This research was conducted for interviews and records according to book keeping among 280 poultry smallholders; 100 intermediary agents of poultry meat supply chains at the various scales of poultry supply chains and the diversification o...

  19. The Role of Probiotics in the Poultry Industry

    Science.gov (United States)

    Lutful Kabir, S. M.

    2009-01-01

    The increase of productivity in the poultry industry has been accompanied by various impacts, including emergence of a large variety of pathogens and bacterial resistance. These impacts are in part due to the indiscriminate use of chemotherapeutic agents as a result of management practices in rearing cycles. This review provides a summary of the use of probiotics for prevention of bacterial diseases in poultry, as well as demonstrating the potential role of probiotics in the growth performance and immune response of poultry, safety and wholesomeness of dressed poultry meat evidencing consumer’s protection, with a critical evaluation of results obtained to date. PMID:20111681

  20. The role of probiotics in the poultry industry.

    Science.gov (United States)

    Lutful Kabir, S M

    2009-08-12

    The increase of productivity in the poultry industry has been accompanied by various impacts, including emergence of a large variety of pathogens and bacterial resistance. These impacts are in part due to the indiscriminate use of chemotherapeutic agents as a result of management practices in rearing cycles. This review provides a summary of the use of probiotics for prevention of bacterial diseases in poultry, as well as demonstrating the potential role of probiotics in the growth performance and immune response of poultry, safety and wholesomeness of dressed poultry meat evidencing consumer's protection, with a critical evaluation of results obtained to date.

  1. Advancements in meat packaging.

    Science.gov (United States)

    McMillin, Kenneth W

    2017-10-01

    Packaging of meat provides the same or similar benefits for raw chilled and processed meats as other types of food packaging. Although air-permeable packaging is most prevalent for raw chilled red meat, vacuum and modified atmosphere packaging offer longer shelf life. The major advancements in meat packaging have been in the widely used plastic polymers while biobased materials and their integration into composite packaging are receiving much attention for functionality and sustainability. At this time, active and intelligent packaging are not widely used for antioxidant, antimicrobial, and other functions to stabilize and enhance meat properties although many options are being developed and investigated. The advances being made in nanotechnology will be incorporated into food packaging and presumably into meat packaging when appropriate and useful. Intelligent packaging using sensors for transmission of desired information and prompting of subsequent changes in packaging materials, environments or the products to maintain safety and quality are still in developmental stages. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. 我国西南地区肉禽配合饲料中霉菌毒素的污染分布规律%Mycotoxin Distribution of Meat-type Poultry Feeds in Southwest China

    Institute of Scientific and Technical Information of China (English)

    李雅伶; 张克英; 王建萍; 李云; 丁雪梅; 白世平; 曾秋凤; 程传民; 高庆军; 柏凡

    2016-01-01

    This experiment was conducted to study on the mycotoxins contamination of meat-type poultry feeds in southwest area of China.A total of 100 feed samples from different area ( Sichuan, Chongqing, Guizhou, Guangxi and Yunnan ) of southwest were obtained to determine the contents of aflatoxin B1 ( AFB1 ) , zearalenone ( ZON) , deoxynivalenol ( DON) and fumonisin ( FB) .To determine the contents of mycotoxins, enzyme-linked immunosorbent assay ( ELISA ) and high performance liquid chromatography ( HPLC ) were used.The results showed as follows: the detection rates of AFB1 , DON, ZON and FB in meat-type poultry feeds were 89%, 96%, 85%and 94.74%, respectively.The over-limit ratios of AFB1 and ZON were 18%and 5%, while DON and FB were not observed to exceed the limits.The average contents of AFB1 , DON and ZON in feed of different area were different, Chongqing had the highest average content of AFB1 ( 11.76 μg/kg) , Sichuan had the highest average content of DON ( 1.23 mg/kg) , and Yunnan had the high-est average content of ZON ( 0.26 mg/kg) .The highest average content of AFB1 was found in duckling starter feed, followed by broiler starter feed and broiler grower feed.The broiler starter feed had the highest average content of DON and FB.The average contents of these four mycotoxins had no difference in different feed type ( P>0.05) .The small-scale feed company ( between 20 000 t and 50 000 t per year) had higher average con-tent of AFB1 , DON and ZON than the big-scale feed company ( more than 100 000 t per year) , but there were no significant difference ( P>0.05) .In conclusion, the mycotoxin ( AFB1 , DON, ZON and FB) contamina-tion problem is common in southwest of China, with the AFB1 has the highest over-limit ratio.The contents of these four mycotoxins detected in the layers feed are influenced by different location, feed types and scales of the feed mills.%本研究旨在了解我国西南地区肉禽配合饲料中霉菌毒素的污染分布规律。从西

  3. Consumer acceptance of irradiated poultry

    International Nuclear Information System (INIS)

    Hashim, I.B.; Resurreccion, A.V.A.; McWatters, K.H.

    1995-01-01

    A simulated supermarket setting (SSS) test was conducted to determine whether consumers (n = 126) would purchase irradiated poultry products, and the effects of marketing strategies on consumer purchase of irradiated poultry products. Consumer preference for irradiated poultry was likewise determined using a home-use test. A slide program was the most effective educational strategy in changing consumers' purchase behavior. The number of participants who purchased irradiated boneless, skinless breasts and irradiated thighs after the educational program increased significantly from 59.5 and 61.9% to 83.3 and 85.7% for the breasts and thighs, respectively. Using a label or poster did not increase the number of participants who bought irradiated poultry products. About 84% of the participants consider it either 'somewhat necessary' or 'very necessary' to irradiate raw chicken and would like all chicken that was served in restaurants or fast food places to be irradiated. Fifty-eight percent of the participants would always buy irradiated chicken if available, and an additional 27% would buy it sometimes. About 44% of the participants were willing to pay the same price for irradiated chicken as for nonirradiated. About 42% of participants were willing to pay 5% or more than what they were currently paying for nonirradiated chicken. Seventy-three percent or more of consumers who participated in the home-use test (n = 74) gave the color, appearance, and aroma of the raw poultry products a minimum rating of 7 (= like moderately). After consumers participated in a home-use test, 84 and 88% selected irradiated thighs and breasts, respectively, over nonirradiated in a second SSS test

  4. Consumer acceptance of irradiated poultry.

    Science.gov (United States)

    Hashim, I B; Resurreccion, A V; McWatters, K H

    1995-08-01

    A simulated supermarket setting (SSS) test was conducted to determine whether consumers (n = 126) would purchase irradiated poultry products, and the effects of marketing strategies on consumer purchase of irradiated poultry products. Consumer preference for irradiated poultry was likewise determined using a home-use test. A slide program was the most effective educational strategy in changing consumers' purchase behavior. The number of participants who purchased irradiated boneless, skinless breasts and irradiated thighs after the educational program increased significantly from 59.5 and 61.9% to 83.3 and 85.7% for the breasts and thighs, respectively. Using a label or poster did not increase the number of participants who bought irradiated poultry products. About 84% of the participants consider it either "somewhat necessary" or "very necessary" to irradiate raw chicken and would like all chicken that was served in restaurants or fast food places to be irradiated. Fifty-eight percent of the participants would always buy irradiated chicken if available, and an additional 27% would buy it sometimes. About 44% of the participants were willing to pay the same price for irradiated chicken as for nonirradiated. About 42% of participants were willing to pay 5% or more than what they were currently paying for nonirradiated chicken. Seventy-three percent or more of consumers who participated in the home-use test (n = 74) gave the color, appearance, and aroma of the raw poultry products a minimum rating of 7 (= like moderately). After consumers participated in a home-use test, 84 and 88% selected irradiated thighs and breasts, respectively, over nonirradiated in a second SSS test.

  5. Campylobacter in Poultry: Ecology and Potential Interventions.

    Science.gov (United States)

    Sahin, Orhan; Kassem, Issmat I; Shen, Zhangqi; Lin, Jun; Rajashekara, Gireesh; Zhang, Qijing

    2015-06-01

    Avian hosts constitute a natural reservoir for thermophilic Campylobacter species, primarily Campylobacter jejuni and Campylobacter coli, and poultry flocks are frequently colonized in the intestinal tract with high numbers of the organisms. Prevalence rates in poultry, especially in slaughter-age broiler flocks, could reach as high as 100% on some farms. Despite the extensive colonization, Campylobacter is essentially a commensal in birds, although limited evidence has implicated the organism as a poultry pathogen. Although Campylobacter is insignificant for poultry health, it is a leading cause of food-borne gastroenteritis in humans worldwide, and contaminated poultry meat is recognized as the main source for human exposure. Therefore, considerable research efforts have been devoted to the development of interventions to diminish Campylobacter contamination in poultry, with the intention to reduce the burden of food-borne illnesses. During the past decade, significant advance has been made in understanding Campylobacter in poultry. This review summarizes the current knowledge with an emphasis on ecology, antibiotic resistance, and potential pre- and postharvest interventions.

  6. 9 CFR 381.198 - Importer to make application for inspection of poultry products offered for entry.

    Science.gov (United States)

    2010-01-01

    ... MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Importer to make application for inspection of poultry products offered for entry. 381.198 Section 381.198 Animals and Animal Products FOOD...

  7. 9 CFR 381.107 - Special procedures as to certification of poultry products for export to certain countries.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Special procedures as to certification...; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS... Procedures § 381.107 Special procedures as to certification of poultry products for export to certain...

  8. 9 CFR 381.204 - Marking of poultry products offered for entry; official import inspection marks and devices.

    Science.gov (United States)

    2010-01-01

    ... Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Marking of poultry products offered...

  9. 9 CFR 381.145 - Poultry products and other articles entering or at official establishments; examination and other...

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Poultry products and other articles... AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Entry of Articles Into Official Establishments; Processing...

  10. Aplicação de redes neurais para avaliação do teor de carne mecanicamente separada em salsicha de frango Application of neural network for evaluation of the amount of mechanically deboned poultry meat in sausage

    Directory of Open Access Journals (Sweden)

    Erlandsson Anthony de Sousa

    2003-12-01

    Full Text Available A carne mecanicamente separada (CMS de frango é uma matéria-prima cárnea produzida através de equipamentos próprios do tipo desossadores mecânicos, utilizando partes de frango de baixo valor comercial como o dorso e o pescoço. Para determinação do teor de CMS utilizada na composição de produtos cárneos comerciais construímos uma rede neural artificial do tipo Backpropagation (BP. O objetivo deste trabalho foi treinar, testar e aplicar uma rede do tipo BP, com três camadas de neurônios, para previsão do teor de CMS a partir do teor de minerais de salsichas formuladas com diferentes teores de carne de frango mecanicamente separada. Utilizamos a composição mineral de 29 amostras de salsicha contendo diferentes teores de CMS e 22 amostras de produtos cárneos comerciais. A topologia da rede foi 5-5-1. O erro quadrático médio no conjunto de treinamento foi de 2,4% e na fase de teste foi de apenas 3,8%. No entanto, a aplicação da rede às amostras comerciais foi inadequada devido à diferença de ingredientes das salsichas usadas no treinamento e os ingredientes das amostras comerciais. A rede neural construída para determinação do teor de carne mecanicamente separada mostrou-se eficiente durante a fase de treinamento e teste da rede.Mechanically Deboned Poultry Meat (MDPM is constituted of the neck and back from chicken carcasses that are extracted in machine. An artificial neural network of the Back-Propagation type was built to determine the amount of MDPM in the composition of commercial foods. The objective of this work was to train, evaluate and apply a network of the Back-Propagation type, with three layers of neurons, in predicting the amount of MDPM in relation to the amount of minerals in the sausage. We used the mineral composition of 29 product samples that contained different amounts of MDPM and 23 commercial samples. The topology of the network was a 5-5-1. The average quadratic error in the training group was of

  11. CLOSTRIDIUM PERFRINGENS IN MEAT AND MEAT PRODUCTS.

    Science.gov (United States)

    HALL, H E; ANGELOTTI, R

    1965-05-01

    A total of 262 specimens of meat and meat dishes were examined for the presence of Clostridium perfringens. Of this total, 161 were raw, unprocessed beef, veal, lamb, pork, or chicken; 101 were processed meats and meat dishes. C. perfringens was isolated from 113 (43.1%) of these specimens. The highest percentage of contamination (82%) was found in veal cuts, and the lowest (4.7%) in sliced sandwich meats and spreads. Only 2 of the 113 isolates were shown to produce heat-resistant spores, which indicates a very low incidence (0.8%) of contamination. These findings indicate that outbreaks of C. perfringens food-borne disease in the Cincinnati area are caused principally by the contamination of the food with vegetative cells or spores of the organism after cooking. Studies of the effects of various holding temperatures on the growth of C. perfringens indicated that, in the range of 5 to 15 C, no multiplication would occur, but that viable cells would still be present at the end of a 5-day holding period. Extremely rapid growth occurred at temperatures around 45 C, and complete inhibition of growth was accomplished between 49 and 52 C.

  12. Identification of duck, partridge, pheasant, quail, chicken and turkey meats by species-specific PCR assays to assess the authenticity of traditional game meat Alheira sausages

    OpenAIRE

    Amaral, J.S.; Santos, Cristina G.; Melo, Vitor S.; Costa, Joana; Oliveira, M.B.P.P.; Mafra, I.

    2015-01-01

    Game meat Alheira (Alheira de caça) sausage is a traditional fermented product typical from the Northeast region of Portugal, having bread and meats (including game) as main ingredients. It is a particularly appreciated product by consumers that commands higher prices, especially in comparison with the common Alheira produced with pork and poultry meats. Following our previous work in which several mammalian game meat species were successfully identified in game meat Alheira sausages for auth...

  13. Meat Processing.

    Science.gov (United States)

    Legacy, Jim; And Others

    This publication provides an introduction to meat processing for adult students in vocational and technical education programs. Organized in four chapters, the booklet provides a brief overview of the meat processing industry and the techniques of meat processing and butchering. The first chapter introduces the meat processing industry and…

  14. Prevalence and Characterization of Motile Salmonella in Commercial Layer Poultry Farms in Bangladesh

    Science.gov (United States)

    Barua, Himel; Biswas, Paritosh K.; Olsen, Katharina E. P.; Christensen, Jens P.

    2012-01-01

    Salmonella is a globally widespread food-borne pathogen having major impact on public health. All motile serovars of Salmonella enterica of poultry origin are zoonotic, and contaminated meat and raw eggs are an important source to human infections. Information on the prevalence of Salmonella at farm/holding level, and the zoonotic serovars circulating in layer poultry in the South and South-East Asian countries including Bangladesh, where small-scale commercial farms are predominant, is limited. To investigate the prevalence of Salmonella at layer farm level, and to identify the prevalent serovars we conducted a cross-sectional survey by randomly selecting 500 commercial layer poultry farms in Bangladesh. Faecal samples from the selected farms were collected following standard procedure, and examined for the presence of Salmonella using conventional bacteriological procedures. Thirty isolates were randomly selected, from the ninety obtained from the survey, for serotyping and characterized further by plasmid profiling and pulsed-field gel electrophoresis (PFGE). Results of the survey showed that the prevalence of motile Salmonella at layer farm level was 18% (95% confidence interval 15–21%), and Salmonella Kentucky was identified to be the only serovar circulating in the study population. Plasmid analysis of the S. Kentucky and non-serotyped isolates revealed two distinct profiles with a variation of two different sizes (2.7 and 4.8 kb). PFGE of the 30 S. Kentucky and 30 non-serotyped isolates showed that all of them were clonally related because only one genotype and three subtypes were determined based on the variation in two or three bands. This is also the first report on the presence of any specific serovar of Salmonella enterica in poultry in Bangladesh. PMID:22558269

  15. A guide on the possibilities of increasing energy efficiency in the meat, poultry, beverage and milk processing industries; Guide sur les possibilites d'accroitre l'efficacite energetique dans l'industrie de la transformation des viandes et volailles, des boissons et de la transformation du lait

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2002-08-01

    This guide describes the potential for improving the energy effectiveness in Canada's agri-food sector. The food and beverage sector is the second most important manufacturing sector in Canada. Since 1998, it has ranked as the highest employer in Quebec. The sector consumed 29,050 GWh of electricity in 1998, with greenhouse gas emissions in the order of 3,800 kilo tonnes. This report referred specifically to energy efficiency measures that can be adopted for meat and poultry processing, beverage and beer production, and milk processing. It also described some aspects of water management, which is closely associated with energy use in the agri-food sector which relies heavily on hot water. Some promising innovations that can lead to energy savings include membrane filtration, cold pasteurization, heat pumps, and mechanical vapour re-compression. Energy savings can also be achieved through innovative heat transfer methods such as infrared, microwave, and heat induction. refs., tabs., figs.

  16. Radiation preservation of meat and meat products: A review.

    Science.gov (United States)

    Dempster, J F

    1985-01-01

    The World Health Organisation (WHO) in 1980 clarified the position regarding the medical acceptability of irradiated foods when it said'…no health hazard results from consuming any food irradiated up to a dose of one megarad (1 Mrad)'. This resulted in renewed interest in irradiation as a cost-effective alternative to traditional preservation methods such as canning and freezing. Thus, radurisation (the application of ionising radiation at a dose level which substantially reduces the microbial population) increases the shelf life of poultry, comminuted meat and meat dishes significantly. Low dose irradiation, or radicidation, eliminates parasites such as Trichinae and cysticerci in pork and, very importantly, salmonella organisms in poultry and red meat. Therefore, irradiation has an important rôle to play in public health protection. High dose irradiation, or radappertisation ('cold sterilisation'), uses doses in excess of 1 Mrad and is analogous to retorting as understood in the canning industry. However, it can adversely affect quality in producing 'free radicals' in high protein foods such as meat. To prevent this, special precautions are necessary, e.g. irradiation is conducted at very low temperatures and the product is usually vacuum packed. A further potential use of irradiation is its ability to reduce the quantity of nitrite necessary in cured meats. This may become of practical significance if legislation further reduces the amount of nitrite permitted in these products. Copyright © 1985. Published by Elsevier Ltd.

  17. Developing control points for halal slaughtering of poultry.

    Science.gov (United States)

    Shahdan, I A; Regenstein, J M; Shahabuddin, A S M; Rahman, M T

    2016-07-01

    Halal (permissible or lawful) poultry meat production must meet industry, economic, and production needs, and government health requirements without compromising the Islamic religious requirements derived from the Qur'an and the Hadiths (the actions and sayings of the Prophet Muhammad, peace and blessings be upon him). Halal certification authorities may vary in their interpretation of these teachings, which leads to differences in halal slaughter requirements. The current study proposes 6 control points (CP) for halal poultry meat production based on the most commonly used halal production systems. CP 1 describes what is allowed and prohibited, such as blood and animal manure, and feed ingredients for halal poultry meat production. CP 2 describes the requirements for humane handling during lairage. CP 3 describes different methods for immobilizing poultry, when immobilization is used, such as water bath stunning. CP 4 describes the importance of intention, details of the halal slaughter, and the equipment permitted. CP 5 and CP 6 describe the requirements after the neck cut has been made such as the time needed before the carcasses can enter the scalding tank, and the potential for meat adulteration with fecal residues and blood. It is important to note that the proposed halal CP program is presented as a starting point for any individual halal certifying body to improve its practices. © 2016 Poultry Science Association Inc.

  18. Meat spoilage during distribution.

    Science.gov (United States)

    Nychas, George-John E; Skandamis, Panos N; Tassou, Chrysoula C; Koutsoumanis, Konstantinos P

    2008-01-01

    Meat spoilage during distribution can be considered as an ecological phenomenon that encompasses the changes of the available substrata (e.g., low molecular compounds), during the prevailing of a particular microbial association, the so-called specific spoilage organisms (SSO). In fact, spoilage of meat depends on an even smaller fraction of SSO, called ephemeral spoilage organisms (ESO). These ESO are the consequence of factors that dynamically persist or imposed during, e.g., processing, transportation and storage in the market. Meanwhile spoilage is a subjective judgment by the consumer, which may be influenced by cultural and economic considerations and background as well as by the sensory acuity of the individual and the intensity of the change. Indeed, when spoilage progresses, most consumers would agree that gross discoloration, strong off-odors, and the development of slime would constitute the main qualitative criteria for meat rejection. On the other hand, meat industry needs rapid analytical methods or tools for quantification of these indicators to determine the type of processing needed for their raw material and to predict remaining shelf life of their products. The need of an objective evaluation of meat spoilage is of great importance. The use of metabolomics as a potential tool for the evaluation of meat spoilage can be of great importance. The microbial association of meat should be monitored in parallel with the estimation of changes occurring in the production and/or assimilation of certain compounds would allow us to evaluate spoilage found or produced during the storage of meat under different temperatures as well as packaging conditions.

  19. Poultry litter power station in the United Kingdom

    International Nuclear Information System (INIS)

    Anon.

    1995-01-01

    Poultry litter has presented a waste disposal problem to the poultry industry in many parts of the United Kingdom. The plant at Eye is a small to medium scale power station, fired using poultry litter. The 12.7 MW of electricity generated is supplied, through the local utility, to the National Grid. The spent litter that constitutes the fuel is made up of excrement and animal bedding (usually 90% excrement and 10% straw or wood shavings). It comes from large climate-controlled buildings (broiler houses) where birds, reared for meat production, are allowed to roam freely. (UK)

  20. Production costs of the Mexican poultry and pig sector

    OpenAIRE

    Horne, van, Peter; Hoste, Robert; Wagenberg, van, Coen

    2018-01-01

    Wageningen Economic Research conducted a study on the potential consequences of a free trade agreement between Mexico and the EU. The Dutch government is concerned that giving access to products from countries with a lower level of animal welfare could undermine the EU welfare standard. This study shows that production costs are lower in Mexico compared to the EU in all three sectors investigated: egg production, poultry meat and pig meat. In egg production in particular, the welfare standard...

  1. Mycotoxins in poultry production

    OpenAIRE

    Resanović Radmila M.; Nešić Ksenija D.; Nesić Vladimir D.; Palić Todor D.; Jaćević Vesna M.

    2009-01-01

    All poultry is sensitive to mycotoxins. This partly depends on the type, age and production categories of poultry, their living conditions and nutritive status and partly on the type, quantity and duration of mycotoxin ingestion. The presence of mycotoxins results in significant health disorders and a decrease in production performances. This leads to considerable economic loss for the poultry industry - either direct losses, i.e. death of the poultry or the indirect ones, i.e. the decrease i...

  2. Family poultry production in Mauritius: problems and prospects

    International Nuclear Information System (INIS)

    Jugessur, V.S.; Seenevassen Pillay, M.M.

    2002-01-01

    The Republic of Mauritius has been self-sufficient in poultry meat and eggs for more than two decades and has been successfully meeting the increasing demand for these commodities. About 85% of the poultry meat is presently produced by four industrial farms, 10% by small commercial producers, and around 5% by family (backyard) poultry farms. The flourishing broiler production industry has transformed the erstwhile important traditional backyard poultry farming of indigenous chickens into an insignificant side activity on the main island of Mauritius, while on the other hand, scavenging chickens continue to be an important source of both food and income on Rodrigues, the second biggest island territory of the Republic. A survey carried out on 30 selected family poultry farms in Mauritius and Rodrigues in 1999 and 2000 enabled the identification of the major problems faced by smallholder poultry farmers. At the same time the results provided a basis for future interventions for improving family poultry production. The results showed that diseases like fowl pox, Newcastle disease, Gumboro disease, respiratory and parasitic diseases occurred all year round on 42% and 82% of farms in Mauritius and Rodrigues, respectively. Low to mild helminth and lice infestations were detected on 40% and 50% of the farms in Mauritius and Rodrigues, respectively. (author)

  3. Meat Consumption Culture in Ethiopia

    Science.gov (United States)

    Jo, Cheorun

    2014-01-01

    The consumption of animal flesh food in Ethiopia has associated with cultural practices. Meat plays pivotal and vital parts in special occasions and its cultural symbolic weight is markedly greater than that accorded to most other food. Processing and cooking of poultry is a gender based duty and has socio-cultural roles. Ethiopians are dependent on limited types of animals for meats due to the taboo associated culturally. Moreover, the consumption of meat and meat products has a very tidy association with religious beliefs, and are influenced by religions. The main religions of Ethiopia have their own peculiar doctrines of setting the feeding habits and customs of their followers. They influence meat products consumption through dictating the source animals that should be used or not be used for food, and scheduling the days of the years in periodical permeation and restriction of consumptions which in turn influences the pattern of meat consumption in the country. In Ethiopia, a cow or an ox is commonly butchered for the sole purpose of selling within the community. In special occasions, people have a cultural ceremony of slaughtering cow or ox and sharing among the group, called Kircha, which is a very common option of the people in rural area where access of meat is challenging frequently. PMID:26760739

  4. EFSA BIOHAZ Panel (EFSA Panel on Biological Hazards), 2014. Scientific Opinion on the evaluation of the safety and efficacy of peroxyacetic acid solutions for reduction of pathogens on poultry carcasses and meat

    DEFF Research Database (Denmark)

    Hald, Tine; Baggesen, Dorte Lau

    no concerns for environmental risk of peroxyacids, acetic acid and octanoic acid. On the basis of a conservative preliminary guideline for surface water quality, the emission of HEDP from a poultry plant into the environment could not be considered safe a priori. It was recommended that HACCP plans should...... include monitoring of the concentration of HEDP and of the decontaminating substance in the working solution and post-marketing surveillance for resistance in both pathogenic and commensal bacteria....

  5. Health and Welfare in Organic Poultry Production

    Directory of Open Access Journals (Sweden)

    Berg C

    2002-03-01

    Full Text Available This review paper deals with the major health and welfare aspects of organic poultry production. The differences between organic and conventional egg and poultry meat production are discussed, with the main emphasis on housing and management requirements, feed composition and the use of veterinary prophylactic and therapeutic drugs. The effects of the legislation and statutes for organic farming on the health and welfare of the birds are also discussed, especially in relation to the biosecurity problems associated with free-range systems, the occurrence of behavioural disturbances in loose housed flocks and the use of veterinary drugs and vaccinations in general. The results from a questionnaire sent out to all Swedish organic egg producers, where questions about the farmer's perception of the birds' health status were included, are presented at the end of the paper. It is concluded that most of the health and welfare problems seen in conventional poultry systems for loose housed or free ranging birds can also been found on organic poultry farms. It is also concluded that there is a need for information about biosecurity, disease detection and disease prevention on organic poultry farms.

  6. 9 CFR 318.23 - Heat-processing and stabilization requirements for uncured meat patties.

    Science.gov (United States)

    2010-01-01

    ... requirements for uncured meat patties. 318.23 Section 318.23 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY... uncured meat patties. (a) Definitions. For purposes of this section, the following definitions shall apply...

  7. 9 CFR 327.21 - Inspection procedures for chilled fresh and frozen boneless manufacturing meat.

    Science.gov (United States)

    2010-01-01

    ... fresh and frozen boneless manufacturing meat. 327.21 Section 327.21 Animals and Animal Products FOOD... MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION IMPORTED PRODUCTS § 327.21 Inspection procedures for chilled fresh and frozen boneless manufacturing meat. (a) Definitions...

  8. 9 CFR 146.33 - Terminology and classification; meat-type chicken slaughter plants.

    Science.gov (United States)

    2010-01-01

    ...-type chicken slaughter plants. 146.33 Section 146.33 Animals and Animal Products ANIMAL AND PLANT... PLAN FOR COMMERCIAL POULTRY Special Provisions for Meat-Type Chicken Slaughter Plants § 146.33 Terminology and classification; meat-type chicken slaughter plants. Participating meat-type chicken slaughter...

  9. Raw data

    DEFF Research Database (Denmark)

    Walford, Antonia

    2017-01-01

    . Although science and technology studies (STS) makes a strong case for associating relationality with certainty, the article argues that a particular form of data, ‘raw data’, complicates this association. It further argues that scientific data is not simply composed out of relations, but is a relation......This article takes scientific ‘raw data’ as its ethnographic object in order to investigate the co-implication of nature and culture in scientific knowledge practices. The article traces out some of the activities that are involved in producing numerical climate data from the Brazilian Amazon...... itself. The article ends with a brief reflection on the possible repercussions of shifting from thinking of science as producing multiple natures and cultures to thinking of it as producing the potential for relations....

  10. Associations between red meat and risks for colon and rectal cancer depend on the type of red meat consumed.

    Science.gov (United States)

    Egeberg, Rikke; Olsen, Anja; Christensen, Jane; Halkjær, Jytte; Jakobsen, Marianne Uhre; Overvad, Kim; Tjønneland, Anne

    2013-04-01

    Cancer prevention guidelines recommend limiting intake of red meat and avoiding processed meat; however, few studies have been conducted on the effects of specific red meat subtypes on colon cancer or rectal cancer risk. The study aim was to evaluate associations between intake of red meat and its subtypes, processed meat, fish, and poultry and risk for colon cancer or rectal cancer in the Danish Diet, Cancer and Health cohort study. We also evaluated whether fish or poultry should replace red meat intake to prevent colon cancer or rectal cancer. During follow-up (13.4 y), 644 cases of colon cancer and 345 cases of rectal cancer occurred among 53,988 participants. Cox proportional hazards models were used to compute incidence rate ratio (IRRs) and 95% CIs. No associations were found between intake of red meat, processed meat, fish, or poultry and risk for colon cancer or rectal cancer. The risk associated with specific red meat subtypes depended on the animal of origin and cancer subsite; thus, the risk for colon cancer was significantly elevated for higher intake of lamb [IRR(per 5g/d) = 1.07 (95% CI: 1.02-1.13)], whereas the risk for rectal cancer was elevated for higher intake of pork [IRR(per 25g/d) = 1.18 (95% CI: 1.02-1.36)]. Substitution of fish for red meat was associated with a significantly lower risk for colon cancer [IRR(per 25g/d) = 0.89 (95% CI: 0.80-0.99)] but not rectal cancer. Substitution of poultry for red meat did not reduce either risk. This study suggests that the risks for colon cancer and potentially for rectal cancer differ according to the specific red meat subtype consumed.

  11. The condition of the poultry industry in Poland

    Directory of Open Access Journals (Sweden)

    Iwona Kozioł

    2014-08-01

    Full Text Available The poultry industry in Poland is characterized by high dynamics of development and in this regard was placed at the forefront of European Union countries. The main reason for the acceleration and modernization of the industry was the Polish accession to the European Union. Sanitary and veterinary requirements, and rules on the placing of poultry products in the trade, which our country was obliged to fulfill, led to the sector producing products with a high level of security. Rapidly growing domestic demand and foreign markets for Polish products affectes the growth of poultry production. Consumers are attracted primarily by the high quality products and reasonable price, as well as the relatively low cost of production. The industry has become an example of what can grow even in a crisis. As a result of changes occurring in the Polish market, meat and aspecially poultry meat is becoming increasingly important, becoming an essential part of the economy. Forecasts for the poultry industry in 2014 are positive, sae to an anticipated decline in grain prices and a limited supply of pork and beef. This will increase the global and the European Union demand for white meat, due to its nutritional properties and competitive prices.

  12. Meat consumption, cooking methods, mutagens, and risk of squamous cell carcinoma of the esophagus: a case-control study in Uruguay.

    Science.gov (United States)

    De Stefani, Eduardo; Deneo-Pellegrini, Hugo; Ronco, Alvaro L; Boffetta, Paolo; Correa, Pelayo; Aune, Dagfinn; Mendilaharsu, María; Acosta, Gisele; Silva, Cecilia; Landó, Gabriel; Luaces, María E

    2012-01-01

    The role of meat in squamous cell carcinoma of the esophagus (ESCC) has been considered conflictive. For this reason, we decided to conduct a case-control study on meat consumption and ESCC. Data included 234 newly diagnosed and microscopically examined ESCC and 2,020 controls with conditions not related to tobacco smoking nor alcohol drinking and without changes in their diets. We studied total meat, red meat, beef, lamb, processed meat, poultry, fish, total white meat, liver, fried meat, barbecued meat, boiled meat, heterocyclic amines, nitrosodimethylamine, and benzo[a]pyrene in relation with the risk of ESCC. Red meat, lamb, and boiled meat were directly associated with the risk of ESCC, whereas total white meat, poultry, fish, and liver were mainly protective against this malignancy.

  13. Cogeneration from Poultry Industry Wastes -- Part II: Economic Analysis

    DEFF Research Database (Denmark)

    Bianchi, M.; Cherubini, F.; Pascale, A. D.

    2003-01-01

    an existing poultry industry as fuel. Different plant configurations have been considered in order to make use of the oil and of the meat and bone meal, which are the by-products of the chicken cooking process. In particular, the process plant can be integrated with an energy supply plant which can consist...

  14. Studies on the quality of duck meat sausages during refrigeration.

    Science.gov (United States)

    Naveen, Z; Naik, B R; Subramanyam, B V; Reddy, P M

    2016-01-01

    Duck farming is on the raise in the current scenario, but processed products from duck meat are still uncommon to find. Investigating the duck meat qualities during storage will provide information to enhance duck meat utilization. Development of ready-to-eat and ready-to-cook duck meat products is expected to increase and improve non-chicken meat-based protein. The Study was aimed to evaluate the changes in quality characteristics of duck meat sausages preserved by refrigeration (7 ± 1 °C). Duck meat sausages were prepared by utilizing raw and partially cooked duck meat with addition of soy flour at 10% level as a binder. Different quality characteristics like physical and chemical characteristics, proximate composition, and organoleptic characteristics were evaluated. Cooking loss of partially cooked meat sausages was lower than raw duck meat sausages, whereas emulsion stability and 2-thiobarbituric acid (TBA) values of raw duck meat sausages were lesser than partially cooked meat sausages. Cooking loss and emulsion stability decreased in both types of meat sausages, while, 2-TBA values increased as refrigerated storage progressed for 14 days. Percent moisture content of raw duck meat sausages was higher than partially cooked meat sausages, which decreased in both types of meat sausages as refrigerated storage progressed for 14 days. Percent crude protein (CP) and percent ether extract (EE) content of partially cooked duck meat sausages were higher than raw duck meat sausages. Regardless of type of meat used, refrigerated storage of sausages increased CP and EE up to 10th day but decreased upon further storage up to 14th day. Organoleptic scores for raw duck meat sausages were higher than partially cooked duck meat sausages and all the scores decreased with an increase in the storage period. However the scores were within the acceptable limits. The findings prove that, duck meat can be effectively acclaimed as an alternative avenue to meet the escalating

  15. Unraveling the chemical identity of meat pigments.

    Science.gov (United States)

    Pegg, R B; Shahidi, F

    1997-10-01

    This review examines the chemistry of nitrite curing of meat and meat products as it relates to the development of cured meat color and provides a detailed account of how nitrite-free processed meats could be prepared using the preformed cooked cured-meat pigment (CCMP). Thus, a chemical description of meat color, both raw and cooked, and characterization of nitrosylheme pigments follows. Based on electron paramagnetic resonance (EPR), visible and infrared spectroscopic studies, evidence has been provided to support the hypothesis that the chemical structure of the preformed CCMP is identical to that of the pigment prepared in situ after thermal processing of nitrite-cured meat and is in fact a mononitrosylheme complex. An appendix, which describes the basic principles of EPR spectroscopy used in the context of this review, is attached.

  16. Approaches to the production and use of microbial transglutaminase in emulsified meat and vegetable systems

    Directory of Open Access Journals (Sweden)

    I. A. Glotova

    2017-01-01

    Full Text Available In the technology of traditional and new forms of food, the modification of structure of proteins is carry out in two opposite directions: the hydrolytic destruction of high-molecular polymers and the artificial creation of polymeric structures of high molecular mass. The transglutaminase preparations (protein-glutamine (-glutamyltransferase, EC 2.3.2.13, TG are used in practical work for realization of the second direction. The main mechanisms of action are polymerization reactions, which lead to a change in the hydrophobicity of protein molecules. The main catalyzed reactions are acyl transfer, binding between glutamine and lysine residues of proteins and deamination. The authors analyzed the approaches to the preparation, properties and studied the joint effect of temperature and pH on the activity of the commercial preparation Revada TG 11 with the application of an enzymatic colorimetric test. The authors studied combined stuffing systems based on beef, pork, poultry mechanical deboning, as well as replacing part of the raw material with protein-carbohydrate compositions with Revada TG 11. The results were used to develop simulated meat systems of biopolymer compositions (SMSBC, approximate in structure and properties to the gels formed by actin and myosin during extraction from myofibrils under the traditional technological processes of meat products production - maturation, salt curing, fine meat grinding. SMSBC includes lupine flour bio-activated by germination, a preparations of dietary fiber as well as a preparation of transglutaminase Revada TG 11. The protein components of the secondary raw materials during the processing of milk such as sodium caseinate, and also whey were used to balance the amino acid composition of the food systems. For practical use, the following options for SMSBC introducing into the composition of minced meat emulsions were recommended by the authors: in the form of hydrated biopolymer dispersion at cutting

  17. Nutritional quality of raw and processed unripe Carica papaya fruit ...

    African Journals Online (AJOL)

    the unripe or green fruit is added into fresh salads (Boshra .... Copper showed the least concentration being undetectable in the raw and dried-cooked samples ..... meat. COMPETING INTERESTS. The authors declare that there is no conflict of ...

  18. Nutritional Factors Affecting Abdominal Fat Deposition in Poultry: A Review

    Science.gov (United States)

    Fouad, A. M.; El-Senousey, H. K.

    2014-01-01

    The major goals of the poultry industry are to increase the carcass yield and to reduce carcass fatness, mainly the abdominal fat pad. The increase in poultry meat consumption has guided the selection process toward fast-growing broilers with a reduced feed conversion ratio. Intensive selection has led to great improvements in economic traits such as body weight gain, feed efficiency, and breast yield to meet the demands of consumers, but modern commercial chickens exhibit excessive fat accumulation in the abdomen area. However, dietary composition and feeding strategies may offer practical and efficient solutions for reducing body fat deposition in modern poultry strains. Thus, the regulation of lipid metabolism to reduce the abdominal fat content based on dietary composition and feeding strategy, as well as elucidating their effects on the key enzymes associated with lipid metabolism, could facilitate the production of lean meat and help to understand the fat-lowering effects of diet and different feeding strategies. PMID:25050050

  19. Broilers’ Supply Value Chain in the National Capital Region Delhi: A Case Study of Ghazipur Poultry Market

    OpenAIRE

    Gangwar, L.S.; Saran, Sandeep; Kumar, Sarvesh

    2010-01-01

    The marketing of broilers/chicken meat in the National Capital Region (NCR) Delhi has been compared in two distinct kinds of markets, viz. organized (shopping malls, organized multi-product retailers) and unorganized or primarily wet markets (exclusive chicken dressers, poultry meat retailers, etc.). Data have been collected from various functionaries involved in marketing of broilers/poultry meat in the NCR Delhi during the year 2008-09 through primary survey. The most prominent channel in t...

  20. Trichinellosis acquired in Nunavut, Canada in September 2009: meat from grizzly bear suspected.

    Science.gov (United States)

    Houzé, S; Ancelle, T; Matra, R; Boceno, C; Carlier, Y; Gajadhar, A A; Dupouy-Camet, J

    2009-11-05

    Five cases of trichinellosis with onset of symptoms in September 2009, were reported in France, and were probably linked to the consumption of meat from a grizzly bear in Cambridge Bay in Nunavut, Canada. Travellers should be aware of the risks of eating raw or rare meat products in arctic regions, particularly game meat such as bear or walrus meat.

  1. Risk perceptions of public health and food safety hazards in poultry husbandry by citizens, poultry farmers and poultry veterinarians

    Science.gov (United States)

    Poortvliet, P M; Ekkel, E D; Kemp, B; Stassen, E N

    2018-01-01

    Abstract Differences in risk perceptions of public health and food safety hazards in various poultry husbandry systems by various stakeholder groups, may affect the acceptability of those husbandry systems. Therefore, the objective was to gain insight into risk perceptions of citizens, poultry farmers, and poultry veterinarians regarding food safety and public health hazards in poultry husbandry systems, and into factors explaining these risk perceptions. We surveyed risk perceptions of Campylobacter contamination of broiler meat, avian influenza introduction in laying hens, and altered dioxin levels in eggs for the most commonly used broiler and laying hen husbandry systems in Dutch citizens (n = 2,259), poultry farmers (n = 100), and poultry veterinarians (n = 41). Citizens perceived the risks of the three hazards in the indoor systems higher and in the outdoor systems lower than did the professionals. Citizens reported higher concerns regarding aspects reflecting underlying psychological factors of risk perception compared to professionals. Professionals indicated a relatively low level of personal control, which might imply risk denial. Of the socio-demographic characteristics, gender and childhood residence were associated with risk perceptions. The influence of other factors of risks perception are discussed. It is suggested that risk perceptions of all stakeholder groups are influenced by affect, stigma, and underlying values. To adapt current or new husbandry systems that can count on societal support, views of key stakeholders and multiple aspects such as animal welfare, public health, food safety, and underlying values should be considered integrally. When trade-offs, such as between animal welfare and public health have to be made, insight into underlying values might help to find consensus among stakeholders. PMID:29161444

  2. Antimicrobial use in Chinese swine and broiler poultry production.

    Science.gov (United States)

    Krishnasamy, Vikram; Otte, Joachim; Silbergeld, Ellen

    2015-01-01

    Antimicrobial use for growth promotion in food animal production is now widespread. A major concern is the rise of antimicrobial resistance and the subsequent impact on human health. The antimicrobials of concern are used in concentrated animal feeding operations (CAFOs) which are responsible for almost all meat production including swine and poultry in the US. With global meat consumption rising, the CAFO model has been adopted elsewhere to meet this demand. One such country where this has occurred is China, and evidence suggests 70% of poultry production now occurs outside of traditional small farms. Moreover, China is now the largest aggregate consumer of meat products in the world. With this rapid rise in consumption, the Chinese production model has changed along with the use of antimicrobials in feeds. However, the specific antibiotic use in the Chinese food animal production sector is unclear. Additionally, we are aware of high quantities of antimicrobial use because of reports of high concentrations of antimicrobials in animal waste and surface waters surrounding animal feeding operations. In this report, we estimate the volume of antibiotics used for swine and poultry production as these are the two meat sources with the highest levels of production and consumption in China. We adopt a model developed by Mellon et al. in the US for estimating drug use in feed for poultry and swine production to estimate overall antimicrobial use as well as antimicrobial use by class. We calculate that 38.5 million kg [84.9 million lbs] were used in 2012 in China's production of swine and poultry. By antibiotic class, the highest weights are tetracyclines in swine and coccidiostats in poultry. The volume of antimicrobial use is alarming. Although there are limitations to these data, we hope our report will stimulate further analysis and a sense of urgency in assessing the consequences of such high levels of utilization in terms of antibiotic resistance in the food supply

  3. Blue Water Footprint Management in a UK Poultry Supply Chain under Environmental Regulatory Constraints

    OpenAIRE

    Naoum Tsolakis; Jagjit Singh Srai; Eirini Aivazidou

    2018-01-01

    Chicken is the most consumed meat in the UK, accounting for 40% of meat consumption, while national production sufficiency reaches about 80%. As a farmed animal product, chicken meat is responsible for significant freshwater appropriation volumes during its production cycle. In this context, this research aims at exploring freshwater dynamics in the UK processed poultry industry. Specifically, we develop a System Dynamics model to capture the blue water footprint, as a key sustainability perf...

  4. Influence of Skin Packaging on Raw Beef Quality: A Review

    Directory of Open Access Journals (Sweden)

    S. Stella

    2018-01-01

    Full Text Available A detailed revision of several aspects related to the application of skin packaging to raw beef was considered. Skin packaging, a relatively new technique derived from vacuum packaging, was developed with the aim of retailing small portions of fresh meat, minced meat, or meat preparations. Above all, the influence of this typology of packaging on the microbial population of raw meat was studied, with particular attention to total viable count, aerobic spoilage bacteria, anaerobic bacteria, Enterobacteriaceae, Brochothrix thermosphacta, and lactic acid bacteria. Moreover, the effect on acidification by LAB was also deepened. As colour is the main characteristic influencing purchase decisions at the point of sale, the effect of skin packaging on this parameter was evaluated for raw meat but also for cooked meat. Tenderness, juiciness, and the ability to hold liquid of raw meat when packed in skin conditions were also considered. Furthermore, odour and flavour were considered as sensorial parameters possibly affected by skin packaging. Finally, acceptability by consumer was also investigated. In the studies considered, results showed that skin packaging is advantageous in terms of maintenance of meat quality and for prolonging shelf-life, improving the stability of the products.

  5. Poultry Production and Marketing in Nepal : with Comparison to Other South Asian Countries.

    OpenAIRE

    杉山, 道夫; 小栗, 克之; BHATTARAI, Til Chandra; スギヤマ, ミチオ; オグリ, カツユキ; SUGIYAMA, Michio; OGURI, Katsuyuki

    1999-01-01

    The present study is an attempt to assess the present situation of the Nepalese poultry industry and its comparison to other South Asian Countries with the help of survey and available secondary data. There were about 15.9 million poultry producing 10,962 Mt meat and 421,460 thousands of eggs including commercial and backyard poultry in the year 1996/97. The commercial poultry produced 269 eggs in 48 weeks of production with feed conversion ratio 2.9. The per Kg production cost of eggs was ab...

  6. 78 FR 14635 - HACCP Plan Reassessment for Not-Ready-To-Eat Comminuted Poultry Products and Related Agency...

    Science.gov (United States)

    2013-03-07

    ... it will determine whether the association of NRTE meat or poultry product with an illness outbreak... and activities on the basis of race, color, national origin, gender, religion, age, disability...

  7. Meat species identification by polymerase chain reaction technique to authenticate alheiras de caça

    OpenAIRE

    Santos, C.G.; Melo, V.S.; Amaral, J.S.; Oliveira, M.B.P.P.; Mafra, I.

    2012-01-01

    The manufacture of traditional meat products is a long-established practice in the Northeast of Portugal, being Alheiras one of the most appreciated products. Alheiras are traditional smoked fermented sausages, mainly produced with pork and poultry meat in a mixture with bread and spices. Currently, game meat Alheiras (Alheiras de caça) are also available as very attractive meat products and prone to adulterations. To allow accurate information for consumers and avoid unfair co...

  8. Authentication of Meat Species in Sucuk by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    Osman İrfan İLHAK

    2015-01-01

    Full Text Available The identification of meat species used in meat products is important by reason of economic considerations, religious factors, verification of label, and prevention of unfair-market competition. In this paper, multiplex PCR method was experienced for routine detection of equine (horse and donkey, poultry (chicken and turkey, pig and cattle meat in sucuk (sausage. The primers used for these animals generated specific fragments, and they did not show cross reactions with the DNA from the other genus of animal. After multiplex PCR was successfully optimized, a field study was carried out to investigate the presence of horse, donkey, chicken, turkey and pig meat in 50 sucuks (30 beef and 20 beef + poultry collected from markets. The result of the field study indicated that 23.3% of 30 beef sucuk samples were containing poultry meat. None of the 50 sucuk samples was containing pig meat, but one (2% of the samples generated equine fragment. The present study showed that the multiplex PCR method can be used for routine analysis of meat species identification, verification and control of label information of meat products.

  9. Environmental impacts of cultured meat production.

    Science.gov (United States)

    Tuomisto, Hanna L; de Mattos, M Joost Teixeira

    2011-07-15

    Cultured meat (i.e., meat produced in vitro using tissue engineering techniques) is being developed as a potentially healthier and more efficient alternative to conventional meat. Life cycle assessment (LCA) research method was used for assessing environmental impacts of large-scale cultured meat production. Cyanobacteria hydrolysate was assumed to be used as the nutrient and energy source for muscle cell growth. The results showed that production of 1000 kg cultured meat requires 26-33 GJ energy, 367-521 m(3) water, 190-230 m(2) land, and emits 1900-2240 kg CO(2)-eq GHG emissions. In comparison to conventionally produced European meat, cultured meat involves approximately 7-45% lower energy use (only poultry has lower energy use), 78-96% lower GHG emissions, 99% lower land use, and 82-96% lower water use depending on the product compared. Despite high uncertainty, it is concluded that the overall environmental impacts of cultured meat production are substantially lower than those of conventionally produced meat.

  10. Meet meat

    NARCIS (Netherlands)

    Bekker, Gerben A.; Tobi, Hilde; Fischer, Arnout R.H.

    2017-01-01

    In this cross-cultural study we investigated how study participants from China, Ethiopia and the Netherlands operationalize the concept of meat and to what extent cultured meat fits or does not fit into this operationalization. We argue that combining the conceptual approaches symbolic boundaries

  11. ENRICHMENT OF POULTRY PRODUCTS WITH FUNCTIONAL INGREDIENTS

    Directory of Open Access Journals (Sweden)

    Gordana Kralik

    2012-06-01

    Full Text Available Primary role of food is to provide nutritive stuffs in sufficient amounts to meet nutritive requirements. However, recent scientific findings confirm assumptions that particular food or its ingredients had positive physiological and psychological effects on health. Functional food is referred to food rich in ingredients, having beneficial effects on one or more functions in an organism. By consuming functional food consumers can expect some health benefits. Production of poultry products as functional food is getting more important on foreign markets while portion of such products on domestic food market is insignificant. The aim of this paper is to present possibilities for enrichment of poultry products, such as broiler and turkey meat and chicken eggs, as they can be characterized as functional food. Functional ingredients in poultry products are polyunsaturated fatty acids (LNA, EPA and DHA and antioxidants. Enrichment of poultry products with the stated ingredients that are beneficial for human health is subject of many researches, and only recently have researches been directed towards assessment of market sustainability of such products.

  12. Meat quality of broiler breast fillets with white striping and woody breast muscle myopathies.

    Science.gov (United States)

    Tijare, V V; Yang, F L; Kuttappan, V A; Alvarado, C Z; Coon, C N; Owens, C M

    2016-09-01

    The global poultry industry has been faced with emerging broiler breast meat quality issues including conditions known as white striping (WS, white striations parallel to muscle fibers) and woody breast (WB, hardness of raw fillet). Experiments were conducted to evaluate effects of WS and WB hardness on meat quality traits in broiler breast fillets. In Exp. 1, birds were processed at approximately 9 wk of age and deboned at 4 h postmortem (PM); in Exp. 2, birds were processed at approximately 6 and 9 wk of age and deboned at 2 h PM. Fillets were categorized as: normal for both white striping and woody breast (NORM); moderate for white striping and mild for woody breast (MILD); severe for white striping and mild for woody breast (WS); severe for woody breast and moderate for white striping (WB); or severe for both white striping and woody breast (BOTH). Sarcomere length, gravimetric fragmentation index, marination uptake, cook loss, and Meullenet-Owens razor shear energy (MORSE) values on non-marinated and marinated fillets were assessed. Sarcomeres tended to be longer (P = 0.07) with increasing severity of WS and WB in both experiments and gravimetric fragmentation index did not differ (P > 0.05) among categories. Marinade uptake decreased (P  0.05) in non-marinated fillets, the marinated BOTH fillets had greater MORSE values (P  0.05) among categories of marinated breasts. At 9 wk, WS and BOTH were higher (P white striping and woody breast, individually or in combination, negatively impact meat quality, especially water holding capacity attributes such as marinade uptake and cook loss. © 2016 Poultry Science Association Inc.

  13. Functional Characteristics of Spent Duck Meat for Use in Emulsion-Type Meat Products

    Directory of Open Access Journals (Sweden)

    Juni Sumarmono

    2010-01-01

    Full Text Available Spent ducks produce nutritive meat; however the meat possesses undesirable characteristics such as strong odor and tough. Hence, appropriate yet simple processing technologies need to be developed in order to maximize the use of duck meat. The experiment was conducted to evaluate functional characteristics of spent duck meat as raw material for the production of emulsion-type meat products, such as nugget and sausage. Chilled carcasses of 96 spent ducks were deboned manually, then mixed thoroughly and ground using a 5 mm diameter grinding plate. The ground meat was divided into 4 batches (group of treatments; one batch was treated with iced tap water (M1, one batch with 0.1% NaCl solution (M2, one batch with 0.5% NaHCO3 solution (M3, and one batch was left as is as control (M4. Variables measured were water holding capacity (WHC, pH, emulsion capacity and stability of the meat; and firmness and tenderness of the meat gel. Results showed that M1 meat has significantly higher WHC (less percentage of free water than control (M4, whereas M2 and M3 meat has similar WHC to control. Processing caused the ground duck meat to have significantly higher pH than control. The highest meat pH was observed in M3, followed by M2, M1 and control. Processing duck meat with iced tap water, NaCl or NaHCO3 produced significantly more tender meat gel compared to untreated meat (as is. Tenderness of meat gel of M3 was the most tender followed by M2 and M1. Similar results for meat gel firmness were observed. No significant differences were observed in term of emulsion capacity (expressed as ml oil/gr protein and ml oil/gr fresh meat, emulsion stability (expressed as ml oil and total liquid released per 100 gr emulsion, and cooking recovery (%. The study reported in this paper offers simple processing technologies to improve functional characteristics of spent duck meat to be use as raw material for the production of emulsion type meat products. (Animal Production 12

  14. Significance of authenticity in meat and meat products in Iran

    Directory of Open Access Journals (Sweden)

    Tahereh Rezazadeh

    2014-06-01

    Full Text Available The Authenticity of meat products is very important for religious and health reasons in Iran. According to legislation in Iran, the consumption and importation of pork, horse, donkey and cat products should be banned. Therefore, the identification of meat products cannot be judged solely by its appearance. This issue led to the authenticity of bovine, sheep, pig, horse, donkey, chicken and soya (Glycine max in raw and processed meat products.In this study, specific primers were designed for the identification of pig ( base pair, donkey (325 base pair, chicken (391 base pair, sheep (499 base pair, horse (607 base pair, soya (707 base pair and bovine (853 base pair by Polymerase chain reaction. Following PCR, expected,, , 499,,  and  base pair fragments were detectable in pig, donkey, chicken, sheep, horse, soya and bovine, respectively. This protocol can be used for identification of raw and processed meat products in various animal species for replication to regulatory obligations for meat species safety in Iran.

  15. 9 CFR 381.172 - Requirements for substitute standardized poultry products named by use of an expressed nutrient...

    Science.gov (United States)

    2010-01-01

    ... AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY... properties, functional properties, and shelf-life, of the poultry product shall be similar to those of the... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Requirements for substitute...

  16. EVOLUTION AND STRATEGY OF POULTRY PRODUCTION DEVELOPMENT IN THE REPUBLIC OF MOLDOVA

    Directory of Open Access Journals (Sweden)

    Zinaida BARBACARU (Pistol,

    2013-02-01

    Full Text Available Poultry farming is a strategic branch of the livestock sector with high potential recovery in a short period of time. Today poultry farming in our country is developed in three basic systems: industrial-intensive, household-intensive and household-extensive, more importance and priority being given to intensive-industry system, the share of which in the production of eggs and meat consumption, is 50-60% of the total volume of poultry production. Intensive-industrial system is characteristic of poultry factories using biological material with valuable productive potential, are equipped with modern technological equipment, which ensures increasing the rate of production and delivery of eggs and meat, poultry achieve high production, reducing costs per unit production. In this system annually will produce 25-30 thousand tons of meat, 280-350 million eggs for consumption, including 100-150 million eggs for export. The household-intensive system is specific for small and medium farms is characteristic of which optimal dimension is considered of 1-10 thousand laying hens or up to 20-40 thousand chickens bred for meat. Household-extensive system is specific for individual poultry farms; the production obtained was mainly used to ensure family needs.

  17. Free systems of rearing of chickens and layer hens: Quality of meat and eggs

    OpenAIRE

    Pavlovski, Zlatica; Škrbić, Zdenka; Lukić, Miloš

    2011-01-01

    Conventional broiler and egg production are basis of modern production of poultry meat and table eggs in the World and in our country. Standing requirements and demands for more and better in poultry production have induced continuous work on improvement of technologies of broiler rearing and production of table eggs. Improvements in technologies of production of meat and eggs depend on country's natural resources, environment conditions and, certainly, on consumer opinion and demands. In add...

  18. Meat flavour

    International Nuclear Information System (INIS)

    Rosset, R.; Liger, P.; Roussel-Ciquard, N.

    1978-01-01

    For the consumer, meat is characterized by a certain number of organoleptic qualities; among them, flavour -that is to say the association of both odour and taste- plays a leading part. This property is based upon a great number of chemical components: some volatile components are responsible for the aroma and some non-volatile ones for the taste. These substances are either made or released during the heating of the meat on account of components called precursors which are produced during the aging of the meat. The two main reactions which preside over the elaboration of flavour are: the Maillard's reaction and the autooxidation reactions. Meat flavour is associated with the animal characteristics; it is influenced by the ante- and post mortem treatments as well as by the technological treatments for storing it. The use of synthetical flavours is to be considered as possible in the future [fr

  19. Binary combination of epsilon-poly-L-lysine and isoeugenol affect progression of spoilage microbiota in fresh turkey meat, and delay onset of spoilage in Pseudomonas putida challenged meat.

    Science.gov (United States)

    Hyldgaard, Morten; Meyer, Rikke L; Peng, Min; Hibberd, Ashley A; Fischer, Jana; Sigmundsson, Arnar; Mygind, Tina

    2015-12-23

    Proliferation of microbial population on fresh poultry meat over time elicits spoilage when reaching unacceptable levels, during which process slime production, microorganism colony formation, negative organoleptic impact and meat structure change are observed. Spoilage organisms in raw meat, especially Gram-negative bacteria can be difficult to combat due to their cell wall composition. In this study, the natural antimicrobial agents ε-poly-L-lysine (ε-PL) and isoeugenol were tested individually and in combinations for their activities against a selection of Gram-negative strains in vitro. All combinations resulted in additive interactions between ε-PL and isoeugenol towards the bacteria tested. The killing efficiency of different ratios of the two antimicrobial agents was further evaluated in vitro against Pseudomonas putida. Subsequently, the most efficient ratio was applied to a raw turkey meat model system which was incubated for 96 h at spoilage temperature. Half of the samples were challenged with P. putida, and the bacterial load and microbial community composition was followed over time. CFU counts revealed that the antimicrobial blend was able to lower the amount of viable Pseudomonas spp. by one log compared to untreated samples of challenged turkey meat, while the single compounds had no effect on the population. However, the compounds had no effect on Pseudomonas spp. CFU in unchallenged meat. Next-generation sequencing offered culture-independent insight into population diversity and changes in microbial composition of the meat during spoilage and in response to antimicrobial treatment. Spoilage of unchallenged turkey meat resulted in decreasing species diversity over time, regardless of whether the samples received antimicrobial treatment. The microbiota composition of untreated unchallenged meat progressed from a Pseudomonas spp. to a Pseudomonas spp., Photobacterium spp., and Brochothrix thermosphacta dominated food matrix on the expense of low

  20. Can we improve the nutritional quality of meat?

    Science.gov (United States)

    Scollan, Nigel D; Price, Eleri M; Morgan, Sarah A; Huws, Sharon A; Shingfield, Kevin J

    2017-11-01

    The nutritional value of meat is an increasingly important factor influencing consumer preferences for poultry, red meat and processed meat products. Intramuscular fat content and composition, in addition to high quality protein, trace minerals and vitamins are important determinants of nutritional value. Fat content of meat at retail has decreased substantially over the past 40 years through advances in animal genetics, nutrition and management and changes in processing techniques. Evidence of the association between diet and the incidence of human non-communicable diseases has driven an interest in developing production systems for lowering total SFA and trans fatty acid (TFA) content and enrichment of n-3 PUFA concentrations in meat and meat products. Typically, poultry and pork has a lower fat content, containing higher PUFA and lower TFA concentrations than lamb or beef. Animal genetics, nutrition and maturity, coupled with their rumen microbiome, are the main factors influencing tissue lipid content and relative proportions of SFA, MUFA and PUFA. Altering the fatty acid (FA) profile of lamb and beef is determined to a large extent by extensive plant and microbial lipolysis and subsequent microbial biohydrogenation of dietary lipid in the rumen, and one of the major reasons explaining the differences in lipid composition of meat from monogastrics and ruminants. Nutritional strategies can be used to align the fat content and FA composition of poultry, pork, lamb and beef with Public Health Guidelines for lowering the social and economic burden of chronic disease.

  1. Mycotoxins in poultry feed in Kuwait.

    Science.gov (United States)

    Beg, M U; Al-Mutairi, M; Beg, K R; Al-Mazeedi, H M; Ali, L N; Saeed, T

    2006-05-01

    A survey was conducted at a poultry feed production unit in Kuwait for mycotoxin contamination in the samples of yellow maize, soybean meal, wheat bran used as raw material and the poultry feed prepared for broiler starter, broiler finisher, and layer mash. Individual aflatoxins were determined by high-pressure liquid chromatography after immunoaffinity column purification. Repeated analysis revealed average aflatoxin concentration in maize at 0.27 ppb (range 0 to 1.69 ppb), soybean meal at 0.20 ppb (range 0 to 1.27 ppb), wheat bran at 0.15 ppb (range 0 to 1.07 ppb), prepared poultry feed for broiler starter at 0.48 ppb (range 0 to 3.26 ppb), broiler finisher at 0.39 ppb (range 0 to 1.05 ppb), and layer mash at 0.21 ppb (range 0 to 1.30 ppb). Other mycotoxins (ochratoxin, fumonisin, deoxynivalenol (DON), and zearalenone), were detected by quantitative enzyme-linked immunosorbent assay. The average levels of ochratoxin A ranged from 4.6 to 9.6 ppb, fumonisin from 1.4 to 3.2 ppm, DON from 0.17 to 0.29 ppm, and zearalenone from 46.4 to 67.6 ppb in various commodities and prepared feed samples. The study revealed the coexistence of determined mycotoxins, although their concentrations in general were found to be lower than the permissible levels, wherever defined, for the poultry feed.

  2. Predicting bacterial growth in raw, salted, and cooked chicken breast fillets during storage.

    Science.gov (United States)

    Galarz, Liane Aldrighi; Fonseca, Gustavo Graciano; Prentice, Carlos

    2016-09-01

    Growth curves were evaluated for aerobic mesophilic and psychrotrophic bacteria, Pseudomonas spp. and Staphylococcus spp., grown in raw, salted, and cooked chicken breast at 2, 4, 7, 10, 15, and 20 ℃, respectively, using the modified Gompertz and modified logistic models. Shelf life was determined based on microbiological counts and sensory analysis. Temperature increase reduced the shelf life, which varied from 10 to 26 days at 2 ℃, from nine to 21 days at 4 ℃, from six to 12 days at 7 ℃, from four to eight days at 10 ℃, from two to four days at 15 ℃, and from one to two days at 20 ℃. In most cases, cooked chicken breast showed the highest microbial count, followed by raw breast and lastly salted breast. The data obtained here were useful for the generation of mathematical models and parameters. The models presented high correlation and can be used for predictive purposes in the poultry meat supply chain. © The Author(s) 2015.

  3. Occurrence of Salmonella in retail beef and related meat products in Zaria, Nigeria

    DEFF Research Database (Denmark)

    Tafida, S.Y.; Kabir, J.; Kwaga, J.K.P.

    2013-01-01

    Salmonella is among the most important food borne pathogens worldwide contaminating a wide range of animal products including meat products. Human illnesses due to this pathogen are attributed to poor biosecurity in production, improper processing and handling of meat and meat products....... This is more likely where surveillance and regulatory control is weak. There is however limited information on the occurrence of these pathogens in foods in Nigeria. The extent of contamination of retail-beef and related meat products with Salmonellae in Zaria was evaluated. A total of 435 retailed beef...... and related meat products consisting of muscle meat, offal and processed meat products were tested for the presence of Salmonella species. Sample types included raw meat, ‘suya’ (roasted meat), ‘balangu’ (barbequed meat), ‘Kilishi’ (spiced sun dried meat) and ‘dambu’ (shredded fried meat). Samples were...

  4. Poultry Plant Noise Control

    Science.gov (United States)

    1982-01-01

    A demonstration conducted last winter at the Tip Top Poultry Plant intended to show poultry plant managers from all over the U.S. potential solutions to the problem of plant noise. Plastic covers used over sound absorbing materials need to meet cleanability requirements, high- pressure water cleaning and other harsh maintenance procedures peculiar to the poultry processing industry. For the demonstration, Fiber Flex, Inc. manufactured and donated 750 noise panels; Owens-Corning Fiberglas Corporation donated the fiberglas cores; and the cover material was purchased from Howe and Bainbridge. The Engineering Experiment Station (EES) conducted before and after noise surveys and is evaluating the effect of noise reduction on turnover and productivity in the demonstration plant. EES plans to conduct a noise abatement workshop and update a handbook to help poultry processors with noise problems. EES study and demonstration may be applicable to other food processing plants where similar sanitary constraints exist.

  5. Molecular Epidemiology of Nontyphoidal Salmonella in Poultry and Poultry Products in India: Implications for Human Health.

    Science.gov (United States)

    Saravanan, Sellappan; Purushothaman, Venketaraman; Murthy, Thippichettypalayam Ramasamy Gopala Krishna; Sukumar, Kuppannan; Srinivasan, Palani; Gowthaman, Vasudevan; Balusamy, Mohan; Atterbury, Robert; Kuchipudi, Suresh V

    2015-09-01

    Human infections with non-typhoidal Salmonella (NTS) serovars are increasingly becoming a threat to human health globally. While all motile Salmonellae have zoonotic potential, Salmonella Enteritidis and Salmonella Typhimurium are most commonly associated with human disease, for which poultry are a major source. Despite the increasing number of human NTS infections, the epidemiology of NTS in poultry in India has not been fully understood. Hence, as a first step, we carried out epidemiological analysis to establish the incidence of NTS in poultry to evaluate the risk to human health. A total of 1215 samples (including poultry meat, tissues, egg and environmental samples) were collected from 154 commercial layer farms from southern India and screened for NTS. Following identification by cultural and biochemical methods, Salmonella isolates were further characterized by multiplex PCR, allele-specific PCR, enterobacterial repetitive intergenic consensus (ERIC) PCR and pulse field gel electrophoresis (PFGE). In the present study, 21/1215 (1.73 %) samples tested positive for NTS. We found 12/392 (3.06 %) of tissue samples, 7/460 (1.52 %) of poultry products, and 2/363 (0.55 %) of environmental samples tested positive for NTS. All the Salmonella isolates were resistant to oxytetracycline, which is routinely used as poultry feed additive. The multiplex PCR results allowed 16/21 isolates to be classified as S. Typhimurium, and five isolates as S. Enteritidis. Of the five S. Enteritidis isolates, four were identified as group D Salmonella by allele-specific PCR. All of the isolates produced different banding patterns in ERIC PCR. Of the thirteen macro restriction profiles (MRPs) obtained by PFGE, MRP 6 was predominant which included 6 (21 %) isolates. In conclusion, the findings of the study revealed higher incidence of contamination of NTS Salmonella in poultry tissue and animal protein sources used for poultry. The results of the study warrants further investigation

  6. INFLUENCE OF AUTOLYTIC TRANSFORMATIONS ON ELECTROPHYSICAL PROPERTIES OF GOAT MEAT

    Directory of Open Access Journals (Sweden)

    L. V. Antipova

    2014-01-01

    Full Text Available Functional foods represented an important element of a balanced, healthy diet. They play an important role in improving the structure of the diet of the population, are a means of prevention, correction and prevention of early transition premorbid conditions and various diseases. Meat and meat products based on it can be considered as a promising raw material for functional foods. Goat has certain dietary properties and can be used in manufacturing, but the production of high-grade products from goat meat, capable of long-term storage is not well developed. The chemical composition of the new raw meat - goat meat, on the example of the longissimus muscle of back is rich in protein, moisture, ash, and low-fat compared with other types of raw meat, which lets you create based on goat meat sector wide functional meat products. Therefore investigated the possibility of using goat meat in the production technology of functional foods. Showing the prospects for the development of goat in Russia. Investigated character of autolysis goat meat electro-physical methods and histological analysis. In the process of autolysis of goat meat are changing the electrical properties of raw meat, which are correlated with the morphological characteristics. Basic autolytic changes occurring in muscle tissue in the early stages of ripening, were reduced to a small extent the political process involving varying degrees of muscle structure in the early stages. In the later stages of maturation revealed changing widespread. Revealed that autolysis has characteristic periods and develops within 12 hours, further changes are irreversible. Shows the change in pH, carbohydrate fractions in the longissimus muscle of back goat. Results of the study of dynamics of change in pH, carbohydrate fractions in the longissimus muscle of back goat show compliance with the laws of classical autolysis noted in other sources, but differ in the time period. Defined stages of autolysis in

  7. Biological conversion of poultry and animal waste to a feedstuff for poultry

    Energy Technology Data Exchange (ETDEWEB)

    El Boushy, A.R.; Klaassen, G.J.; Ketelaars, E.H.

    1985-06-01

    Poultry and animal waste can be converted into a high protein feed-stuff by biological digestion and degradation, oxidation or by the action of micro-organisms and algae. These processes might help to solve the accummulating problem of disposal of poultry and animal waste, which in some cases are not suitable as soil fertilizers and cause pollution problems. International co-operation between advanced industrialized countries and developing areas is not only desirable but essential to overcome malnutrition by increasing the animal protein supply in the form of meat and eggs. Only a limited number of published data are available but nevertheless five types of treated waste are considered useful under certain conditions as feedstuffs for poultry: 1. housefly pupae meal - caged layer manure degraded by housefly larvae; 2. earthworm meal - another biodegradation of caged layer manure; 3. liquor and residue from a ditch used for oxidizing swine liquid manure; 4. aerobic fermentation of poultry manure; and 5. meals produced from algae grown in ponds of sedimented animal waste and sewage. 46 references.

  8. Molecular assay to fraud identification of meat products.

    Science.gov (United States)

    Doosti, Abbas; Ghasemi Dehkordi, Payam; Rahimi, Ebrahim

    2014-01-01

    Detection of species fraud in meat products is important for consumer protection and food industries. A molecular technique such as PCR method for detection of beef, sheep, pork, chicken, donkey, and horse meats in food products was established. The purpose of this study was to identification of fraud and adulteration in industrial meat products by PCR-RFLP assay in Iran. In present study, 224 meat products include 68 sausages, 48 frankfurters, 55 hamburgers, 33 hams and 20 cold cut meats were collected from different companies and food markets in Iran. Genomic DNA was extracted and PCR was performed for gene amplification of meat species using specific oligonucleotid primers. Raw meat samples are served as the positive control. For differentiation between donkey's and horse's meat, the mitochondrial DNA segment (cytochrome-b gene) was amplified and products were digested with AluI restriction enzyme. Results showed that 6 of 68 fermented sausages (8.82%), 4 of 48 frankfurters (8.33%), 4 of 55 hamburgers (7.27%), 2 of 33 hams (6.6%), and 1 of 20 cold cut meat (5%) were found to contain Haram (unlawful or prohibited) meat. These results indicate that 7.58% of the total samples were not containing Halal (lawful or permitted) meat and have another meat. These findings showed that molecular methods such as PCR and PCR-RFLP are potentially reliable techniques for detection of meat type in meat products for Halal authentication.

  9. Inactivation of Salmonella enteritidis on raw poultry using microwave heating

    Directory of Open Access Journals (Sweden)

    Amanda B. Pucciarelli

    2005-11-01

    Full Text Available The effect of microwave heating on Salmonella Enteritidis inoculated on fresh chicken was investigated using a microwave oven (800 w to determine the destruction of Salmonella Enteritidis isolated from chicken carcasses, in relation to the time of heating at two power settings: high (power level 10 and medium (power level 6; The relationship between heating time and temperature was also been studied. The destruction was 6.4 log cycles at time 95 sec for the high power level, and 5 log cycles at time 140 sec for medium power setting. After 110 sec for higher power level, no survival of Salmonella Enteritidis was detected in samples (100g, but at 140 sec for medium power level, these food pathogens were still present.Foi investigado o efeito do aquecimento por microondas sobre Salmonella Enteritidis inoculada em frangos frescos usando um forno de microondas doméstico (800 W para determinar a destruição da Salmonella Enteritidis isolada a partir de carcaças de frangos, em relação com o tempo de aquecimento a dois níveis de potência: alta (nível 10 e média ( nível 6; a relação entre tempo de aquecimento e temperatura também foi estudada. A destruição foi de 6 log em 95 s de tempo para o nível alto e 5 log em 140 s de tempo para o nível médio de potência. Depois de 110 s no nível de potência alta, não foi detectada sobrevivência de Salmonella Enteritidis em amostras de 100g de peso, porém, depois de 140 s a potência média, esse patôgeno nos alimentos ainda permanecia.

  10. Survey of polychlorinated dibenzo-p-dioxins, polychlorinated dibenzofurans and non-ortho-polychlorinated biphenyls in US meat and poultry, 2012-13: toxic equivalency levels, patterns, temporal trends and implications.

    Science.gov (United States)

    Lupton, Sara J; O'Keefe, Margaret; Muñiz-Ortiz, Jorge G; Clinch, Nelson; Basu, Pat

    2017-11-01

    The US Department of Agriculture (USDA) conducts a statistically based survey of the domestic meat supply (beef, pork, chicken and turkey) to determine current levels of polychlorinated dibenzo-p-dioxins (PCDDs), polychlorinated dibenzofurans (PCDFs) and non-ortho-polychlorinated biphenyls (no-PCBs) every 5 years. Fat samples for each slaughter class were collected from US federally licensed slaughter facilities. The samples were processed and analysed for 17 PCDD/Fs and three no-PCBs. The sum of PCDD, PCDF and no-PCB toxic equivalencies (sum-TEQ) calculated using 2005 toxic-equivalency factors for all slaughter classes ranged from non-detect (n.d.) to 6.47 pg TEQ g -1 lipid. The median sum-TEQs, when n.d. = 0.5 LOD, for beef, pork, chicken and turkey were 0.66, 0.12, 0.13 and 0.34 pg TEQ g -1 lipid respectively. A comparison of the current survey with the previous three surveys shows a declining trend, with decreasing differences between medians; differences between the median sum-TEQs from 2007-08 and 2012-13 were -10%, -29%, -33% and -25% for beef, pork, chicken and turkey respectively. Several beef samples underwent further characterisation and congener patterns from these beef samples suggested pentachlorophenol treated wood as the likely exposure source. US consumer exposure to these compounds is relatively low and no slaughter class contributed more than 26% to the US Environmental Protection Agency (USEPA) chronic oral reference dose of 0.7 pg TEQ kg -1 bw day -1 .

  11. Meat and meat products – analysis of the most common threats in the years 2011-2015 in Rapid Alert System for Food and Feed (RASFF)

    Science.gov (United States)

    Kononiuk, Anna D.; Karwowska, Małgorzata

    The key tool used in the European Union in order to eliminate the risks associated with the consumption of potentially hazardous food is RASFF - Rapid Alert System for Food and Feed Safety. The RASFF was established to increase accountability and strengthening cooperation between states of the European Union in the field of food safety control. The aim of this study was to explore the trends and temporal and spatial distribution of notifications on food safety hazards between January 2011 and December 2015 with a special emphasis on meat and meat products on the basis of notification from RASFF. The study analyzed notifications on the annual reports of the RASFF published by the European Commission and requests added to the portal RASFF in the period 01.01.2011 - 31.12.2015 on the category of “meat and meat products (other than poultry) and “poultry meat and poultry meat products”. Analysis included detailed information on each notification, such as the classification and date, hazard category, notifying country, country origin. The most common classifications of notification were ‘alert’ and ‘border rejection’. Generally, basis of this notifications were ‘company’s own check’ and ‘official control on the market’. Pathogenic microorganisms were the most often hazard of category in which the higher number of notifications concerned with Salmonella spp. Alert notification which is the most dangerous for consumers were the most common type of classification for notifications on ‘meat and meat product’ category. The most of notifications in category ‘poultry meat and poultry meat products’ were the result of border control. Pathogenic microorganisms were the reason for the huge number of notifications in studied product categories. Many of notifications were associated with products which origin countries were outside RASFF member states.

  12. In-gel and OFFGEL-based proteomic approach for authentication of meat species from minced meat and meat products.

    Science.gov (United States)

    Naveena, Basappa M; Jagadeesh, Deepak S; Kamuni, Veeranna; Muthukumar, Muthupalani; Kulkarni, Vinayak V; Kiran, Mohan; Rapole, Srikanth

    2018-02-01

    Fraudulent mislabelling of processed meat products on a global scale that cannot be detected using conventional techniques necessitates sensitive, robust and accurate methods of meat authentication to ensure food safety and public health. In the present study, we developed an in-gel (two-dimensional gel electrophoresis, 2DE) and OFFGEL-based proteomic method for authenticating raw and cooked water buffalo (Bubalus bubalis), sheep (Ovis aries) and goat (Caprus hircus) meat and their mixes. The matrix-assisted liquid desorption/ionization time-of-flight mass spectrometric analysis of proteins separated using 2DE or OFFGEL electrophoresis delineated species-specific peptide biomarkers derived from myosin light chain 1 and 2 (MLC1 and MLC2) of buffalo-sheep-goat meat mix in definite proportions at 98:1:1, 99:0.5:0.5 and 99.8:0.1:0.1 that were found stable to resist thermal processing. In-gel and OFFGEL-based proteomic approaches are efficient in authenticating meat mixes spiked at minimum 1.0% and 0.1% levels, respectively, in triple meat mix for both raw and cooked samples. The study demonstrated that authentication of meat from a complex mix of three closely related species requires identification of more than one species-specific peptide due to close similarity between their amino acid sequences. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  13. Dynamic strategic responses among advertisers: the case of meat products

    OpenAIRE

    Jeffrey Hyde; Brent Gloy

    2007-01-01

    The case of strategic advertising response is examined for branded and generic meat products (beef, pork, and poultry). A dynamic conceptual model is developed to identify the determinants of advertising expenditures. A time-series model is then used to examine the competitive behavior of branded and generic meat advertisers. The results identify two types of advertising strategies those based upon changes in revenues and those based upon changes in competitor advertising expenditures. Most g...

  14. Detection of partridge meat for the authentication of “alheiras de caça” using polymerase chain reaction

    OpenAIRE

    Santos, C.G.; Melo, V.S.; Mafra, I.; Amaral, J.S.; Costa, J.; Oliveira, M.B.P.P.

    2011-01-01

    The manufacture or traditional meat products is a long-eslablished lradition in Northeastern region of Portugal, in particular the case of "Alheiras" Besides the traditional "Alheiras" mainly produced with pork and poultry meat, others are currently available in lhe market. which are produced with diffcrcnt game meats, such as "Alhciras de caça" Since this kind of mcat products are prepared using more expensive meats, they are prone to adulterations due to the economic profit t...

  15. SELECTION OF MICROORGANISMS FOR FERMENTATION OF MEAT MATERIALS

    Directory of Open Access Journals (Sweden)

    Danylenko S. G.

    2014-08-01

    Full Text Available Principal criteria for the selection of microorganisms with a wide range of biological and technological properties for fermentation of raw meats are considered. Attention is paid to the main groups of microorganisms such as Micrococсus, Staphylococcus, Lactobacillus, Bifidobacterium and Propionibacterium which are promising for creation of bacterial preparations. To create bacterial preparations, the basic criteria of selection for microorganisms were determined as follows: the ability of microorganisms to be developed within the specific ecological niche (raw meat materials and their influence on flavor characteristics of the final product under the conditions of intensification of production technologies of meat products. Methods used for search and retrieval of technologically promising strains from different natural sources (fresh meats, minced meats, meat, dairy and sour-milk products, vegetables, fruit, brines and mixtures for salting are considered.

  16. Mycotoxins and Mycotoxigenic Fungi in Poultry Feed for Food-Producing Animals

    OpenAIRE

    Greco, Mariana Vanesa; Franchi, María Luisa; Rico Golba, Silvia Laura; Pardo, Alejandro Guillermo; Pose, Graciela Noemí

    2014-01-01

    Moulds are capable of reducing the nutritional value of feedstuff as well as elaborating several mycotoxins. Mycotoxin-contaminated feed has adverse effects on animal health and productivity. Also, mycotoxins may be carried over into meat and eggs when poultry are fed with contaminated feed. In a point prevalence study feedstuff used for poultry nutrition in Argentina was analyzed for fungal flora, natural incidence of selected mycotoxins, and nutritional quality. Ten mould genera were recove...

  17. Comparative evaluation of local poultry breeds status in Algeria, Vietnam and the Democratic Republic of Congo

    OpenAIRE

    Moula, Nassim; Farnir, Frédéric; Abdellah, Salhi; Do Duc, Luc; Vu Dinh, Ton; Leroy, Pascal; Antoine-Moussiaux, Nicolas

    2012-01-01

    Local chicken breeds contribute significantly to the world production of meat and eggs. Indigenous breeds represent 80% of the world poultry population. However, the majority of these breeds has not been recorded and studied. About 40% of poultry breeds have an unknown risk status. Hence, considerable efforts are necessary to evaluate them. Obviously, managing animal genetic resources requires the identification of the concerned phenotypes, population sizes, their geographical ...

  18. Irradiation of red meat. A compilation of technical data for its authorization and control

    International Nuclear Information System (INIS)

    1996-08-01

    The aim of this monograph is to provide the rationale and justification for treating red meats with ionizing radiation for improving microbiological safety, parasite control and extending non-frozen shelf-life. It is intended to complement a previous publication ''Irradiation of Poultry Meat and its Products - A compilation of Technical Data for its Authorization and Control''. 146 refs

  19. Carcass and meat quality of Boer and indigenous goats of South ...

    African Journals Online (AJOL)

    Pamela

    2017-09-28

    Sep 28, 2017 ... This study was conducted to evaluate the carcass and meat quality of Boer ... Meadow game pellets (110 g/kg dry matter (DM) crude protein, 3.68% ..... In: Quality attributes and their measurement in meat, poultry and fish.

  20. Irradiation of red meat. A compilation of technical data for its authorization and control

    Energy Technology Data Exchange (ETDEWEB)

    International consultative group on food irradiation

    1996-08-01

    The aim of this monograph is to provide the rationale and justification for treating red meats with ionizing radiation for improving microbiological safety, parasite control and extending non-frozen shelf-life. It is intended to complement a previous publication ``Irradiation of Poultry Meat and its Products - A compilation of Technical Data for its Authorization and Control``. 146 refs.

  1. Occurrence of bioactive sphingolipids in meat and fish products

    DEFF Research Database (Denmark)

    Hellgren, Lars

    2001-01-01

    /neutral glycolipids varied from 1 to 2.9, while in poultry this ratio varied between 5.2 to 19.2 and in red meat it varied from 1.6 to 8.3. The fatty acid composition of sphingomyelin in fish was dominated by C24:1 (Delta (9)) or C22:1 (Delta (9)), while C16:0 and C18:0 were the dominating sphingomyelin species....... Therefore we investigated the contents of sphingomyelin and neutral glycosphingolipids in commonly consumed meat and fish products. Sphingomyelin and glycosphingolipids were found in all foodstuffs studied. The total amount varied between 118 +/- 17 nmol/g (cod) to 589 +/- 39 nmol/g (chicken leg). Generally......, lower amounts of sphingolipids were determined in fish meat than in red meat and poultry, while poultry was the richest source of this class of lipids. However, fish meat contained a relatively high content of neutral glycolipids compared with other types of meat. Thus, in fish the ratio sphingomyelin...

  2. DISTRIBUTION Of AFLATOXIN B1 FROM POULTRY FEED TO DIFFERENT BODY TISSUES OF BROILERS

    Directory of Open Access Journals (Sweden)

    Farida Begum, A. Rehman1, G. Maliha and J. Nuzhat

    2001-07-01

    Full Text Available This study was carried out to know the distribution of aflatoxin B1 In various edible tissues of broilers from poultry feed at the stage of marketing. For this purpose liver, kidney, dressed meat and poultry feed of the representative flocks were collected and oven dried. The aflatoxin B1 contents of the samples were .e; determined through thin layer chromatography, The data thus collected were statistically analyzed and the results showed that the aflatoxin B1 level was higher (P<0.01 in liver as compared to kidneys and meat.

  3. An assessment of the impact of pulsed electric fields processing factors on oxidation, color, texture, and sensory attributes of turkey breast meat.

    Science.gov (United States)

    Arroyo, Cristina; Eslami, Sara; Brunton, Nigel P; Arimi, Joshua M; Noci, Francesco; Lyng, James G

    2015-05-01

    Pulsed electric fields (PEF) is a novel nonthermal technology that has the potential to cause physical disruption to muscle tissue which in turn could alter the sensorial aspects of meat in both a positive (e.g., enhanced tenderization) and a negative way (e.g., off-flavor development). If there is a risk of off-flavor development it should be identified prior to embarking on an extensive investigation on PEF in meat tenderization and turkey meat was chosen for this purpose as it is particularly prone to oxidation. The objective of this study was to investigate the effect of various PEF treatments on the quality attributes of turkey breast meat. Turkey breast meat obtained 1 d postslaughter was treated in a batch PEF chamber with increasing electric field strength up to 3 kV/cm and analyzed for lipid oxidation by thiobarbituric acid reactive substances assay (TBARS) with up to 5 d storage at 4°C in aerobic conditions. In a separate experiment, turkey breast meat samples were exposed to PEF under various combinations of pulse number, frequency, and voltage. Following PEF treatments weight loss, cook loss, lipid oxidation, texture, and color were assessed by instrumental methods. A sensory analysis was also performed to determine consumer acceptability for color, texture, and odor of the samples. Lipid oxidation in all PEF-treated samples progressed at the same rate with storage as the untreated samples and was not found to be significantly different to the control. Under the conditions examined PEF treatments did not induce differences in instrumentally measured weight loss, cook loss, lipid oxidation, texture, and color (raw and cooked) either on fresh or frozen samples. However, the sensory evaluation suggested that panelists could detect slight differences between the PEF-treated samples and the controls in terms of texture and odor. © 2015 Poultry Science Association Inc.

  4. Metabolomics of meat exudate: Its potential to evaluate beef meat conservation and aging

    International Nuclear Information System (INIS)

    Castejón, David; García-Segura, Juan Manuel; Escudero, Rosa; Herrera, Antonio; Cambero, María Isabel

    2015-01-01

    In this study we analyzed the exudate of beef to evaluate its potential as non invasive sampling for nuclear magnetic resonance (NMR) based metabolomic analysis of meat samples. Exudate, as the natural juice from raw meat, is an easy to obtain matrix that it is usually collected in small amounts in commercial meat packages. Although meat exudate could provide complete and homogeneous metabolic information about the whole meat piece, this sample has been poorly studied. Exudates from 48 beef samples of different breeds, cattle and storage times have been studied by "1H NMR spectroscopy. The liquid exudate spectra were compared with those obtained by High Resolution Magic Angle Spinning (HRMAS) of the original meat pieces. The close correlation found between both spectra (>95% of coincident peaks in both registers; Spearman correlation coefficient = 0.945) lead us to propose the exudate as an excellent alternative analytical matrix with a view to apply meat metabolomics. 60 metabolites could be identified through the analysis of mono and bidimensional exudate spectra, 23 of them for the first time in NMR meat studies. The application of chemometric tools to analyze exudate dataset has revealed significant metabolite variations associated with meat aging. Hence, NMR based metabolomics have made it possible both to classify meat samples according to their storage time through Principal Component Analysis (PCA), and to predict that storage time through Partial Least Squares (PLS) regression. - Highlights: • NMR spectra from beef samples and their exudates are very strongly correlated. • 23 metabolites not reported in previous NMR meat studies have been identified. • Meat exudate NMR spectra allow monitoring of biochemical changes related to aging. • PCA of exudate NMR spectra classified meat samples by their storage time. • The aging of a meat sample can be predicted by PLS analysis of its exudate.

  5. Metabolomics of meat exudate: Its potential to evaluate beef meat conservation and aging

    Energy Technology Data Exchange (ETDEWEB)

    Castejón, David [Centro de Asistencia a la Investigación de Resonancia Magnética Nuclear y de Espín Electrónico, Universidad Complutense de Madrid, 28040 Madrid (Spain); García-Segura, Juan Manuel [Centro de Asistencia a la Investigación de Resonancia Magnética Nuclear y de Espín Electrónico, Universidad Complutense de Madrid, 28040 Madrid (Spain); Departamento de Bioquímica y Biología Molecular I, Facultad de Químicas, Universidad Complutense de Madrid, 28040 Madrid (Spain); Escudero, Rosa [Departamento de Nutrición, Bromatología y Tecnología de los Alimentos, Facultad de Veterinaria. Universidad Complutense de Madrid, 28040 Madrid (Spain); Herrera, Antonio [Departamento de Química Orgánica, Facultad de Químicas, Universidad Complutense de Madrid, 28040 Madrid (Spain); Cambero, María Isabel, E-mail: icambero@vet.ucm.es [Departamento de Nutrición, Bromatología y Tecnología de los Alimentos, Facultad de Veterinaria. Universidad Complutense de Madrid, 28040 Madrid (Spain)

    2015-12-11

    In this study we analyzed the exudate of beef to evaluate its potential as non invasive sampling for nuclear magnetic resonance (NMR) based metabolomic analysis of meat samples. Exudate, as the natural juice from raw meat, is an easy to obtain matrix that it is usually collected in small amounts in commercial meat packages. Although meat exudate could provide complete and homogeneous metabolic information about the whole meat piece, this sample has been poorly studied. Exudates from 48 beef samples of different breeds, cattle and storage times have been studied by {sup 1}H NMR spectroscopy. The liquid exudate spectra were compared with those obtained by High Resolution Magic Angle Spinning (HRMAS) of the original meat pieces. The close correlation found between both spectra (>95% of coincident peaks in both registers; Spearman correlation coefficient = 0.945) lead us to propose the exudate as an excellent alternative analytical matrix with a view to apply meat metabolomics. 60 metabolites could be identified through the analysis of mono and bidimensional exudate spectra, 23 of them for the first time in NMR meat studies. The application of chemometric tools to analyze exudate dataset has revealed significant metabolite variations associated with meat aging. Hence, NMR based metabolomics have made it possible both to classify meat samples according to their storage time through Principal Component Analysis (PCA), and to predict that storage time through Partial Least Squares (PLS) regression. - Highlights: • NMR spectra from beef samples and their exudates are very strongly correlated. • 23 metabolites not reported in previous NMR meat studies have been identified. • Meat exudate NMR spectra allow monitoring of biochemical changes related to aging. • PCA of exudate NMR spectra classified meat samples by their storage time. • The aging of a meat sample can be predicted by PLS analysis of its exudate.

  6. Campylobacter jejuni survival in a poultry processing plant environment.

    Science.gov (United States)

    García-Sánchez, Lourdes; Melero, Beatriz; Jaime, Isabel; Hänninen, Marja-Liisa; Rossi, Mirko; Rovira, Jordi

    2017-08-01

    Campylobacteriosis is the most common cause of bacterial gastroenteritis worldwide. Consumption of poultry, especially chicken's meat is considered the most common route for human infection. The aim of this study was to determine if Campylobacter spp. might persist in the poultry plant environment before and after cleaning and disinfection procedures and the distribution and their genetic relatedness. During one month from a poultry plant were analyzed a total of 494 samples -defeathering machine, evisceration machine, floor, sink, conveyor belt, shackles and broiler meat- in order to isolate C. jejuni and C. coli. Results showed that C. jejuni and C. coli prevalence was 94.5% and 5.5% respectively. Different typing techniques as PFGE, MLST established seven C. jejuni genotypes. Whole genome MLST strongly suggest that highly clonal populations of C. jejuni can survive in adverse environmental conditions, even after cleaning and disinfection, and persist for longer periods than previous thought (at least 21 days) in the poultry plant environment. Even so, it might act as a source of contamination independently of the contamination level of the flock entering the slaughter line. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Advances in ingredient and processing systems for meat and meat products.

    Science.gov (United States)

    Weiss, Jochen; Gibis, Monika; Schuh, Valerie; Salminen, Hanna

    2010-09-01

    Changes in consumer demand of meat products as well as increased global competition are causing an unprecedented spur in processing and ingredient system developments within the meat manufacturing sector. Consumers demand healthier meat products that are low in salt, fat, cholesterol, nitrites and calories in general and contain in addition health-promoting bioactive components such as for example carotenoids, unsaturated fatty acids, sterols, and fibers. On the other hand, consumers expect these novel meat products with altered formulations to taste, look and smell the same way as their traditionally formulated and processed counterparts. At the same time, competition is forcing the meat processing industry to use the increasingly expensive raw material "meat" more efficiently and produce products at lower costs. With these changes in mind, this article presents a review of novel ingredient systems and processing approaches that are emerging to create high quality, affordable meat products not only in batch mode but also in large-scale continuous processes. Fat replacers, fat profile modification and cholesterol reduction techniques, new texture modifiers and alternative antioxidant and antimicrobial systems are being discussed. Modern processing equipment to establish continuously operating product manufacturing lines and that allow new meat product structures to be created and novel ingredients to be effectively utilized including vacuum fillers, grinders and fine dispersers, and slicers is reviewed in the context of structure creation in meat products. Finally, trends in future developments of ingredient and processing systems for meat products are highlighted.

  8. Prevalence, seasonal occurrence and antimicrobial resistance of Salmonella in poultry retail products in Greece.

    Science.gov (United States)

    Zdragas, A; Mazaraki, K; Vafeas, G; Giantzi, V; Papadopoulos, T; Ekateriniadou, L

    2012-10-01

    To detect the prevalence, the seasonal occurrence and distribution of Salmonella serotypes in poultry products and to determine the resistance profile of Salmonella isolates. A total of 96 skin-on chicken carcasses and 30 liver samples were analysed between May 2007 and May 2009 from twenty-two different commercial farm brands found in retail market countrywide. Salmonella was isolated from 38 (39·5%) of 96 chicken carcasses and from 10 (33·3%) of 30 liver samples. Higher isolation rate (60·4%) was observed in carcasses detected during summer (May to October), and lower isolation rate (18·7%) was observed in carcasses detected during winter (November to April); in liver samples, the positive rates were 53·4 and 13·2%, respectively. Twelve serotypes were detected with the serotypes Hadar, Enteritidis and Blockley being the most prevalent at 29·2, 22·9 and 12·5%, respectively. Nine of 11 Salm. Enteritidis isolates occurred during summer. Of 48 isolates, 38 (79%) were resistant to one or more of the antimicrobial agents used. The highest resistance rates were found to the following antimicrobials: streptomycin (64·5%), tetracycline (56·2%), nalidixic acid (39·5%), ampicillin and rifampicin (33·3%). The relatively high Salmonella spp. contamination rates of raw chicken meat and liver have been detected. Salm. Enteritidis isolates peaked in summer, increasing the risk to human health. Antibiotic resistance of Salmonella still remains a threat as resistance plasmids may be extensively shared between animal and humans. The study enabled us to improve the data on the seasonal occurrence of Salmonella and to determine the antimicrobial pattern profile and trends in Salmonella strains isolated from poultry retail products in Greece. © 2012 The Authors. Letters in Applied Microbiology © 2012 The Society for Applied Microbiology.

  9. Aspergillus fumigatus in Poultry

    Directory of Open Access Journals (Sweden)

    Pascal Arné

    2011-01-01

    Full Text Available Aspergillus fumigatus remains a major respiratory pathogen in birds. In poultry, infection by A. fumigatus may induce significant economic losses particularly in turkey production. A. fumigatus develops and sporulates easily in poor quality bedding or contaminated feedstuffs in indoor farm environments. Inadequate ventilation and dusty conditions increase the risk of bird exposure to aerosolized spores. Acute cases are seen in young animals following inhalation of spores, causing high morbidity and mortality. The chronic form affects older birds and looks more sporadic. The respiratory tract is the primary site of A. fumigatus development leading to severe respiratory distress and associated granulomatous airsacculitis and pneumonia. Treatments for infected poultry are nonexistent; therefore, prevention is the only way to protect poultry. Development of avian models of aspergillosis may improve our understanding of its pathogenesis, which remains poorly understood.

  10. Prevention of poultry-borne salmonellosis by irradiation: Costs and benefits in Scotland

    International Nuclear Information System (INIS)

    Yule, B.F; Forbes, G.I.; MacLeod, A.F.

    1988-01-01

    Poultry-borne salmonellosis is the most common foodborne infection in Scotland for which the vehicle can be identified. The cost of the disease to society in terms of health service use, absence from work, morbidity, and mortality is substantial. The study estimates the total cost of poultry-borne salmonellosis in Scotland and compares it with the cost of a single preventive measure: the irradiation of poultry meat. The results suggest that the public health benefits exceed irradiation costs. This conclusion is, however, sensitive to assumptions made in the analysis, particularly those related to the cost of unreported cases of salmonellosis. 19 refs, 3 tabs

  11. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  12. Technical and Economic Considerations in the Preservation of Meats and Poultry by Ionizing Radiation; Considerations d'Ordre Technique et Economique sur la Conservation des Viandes et de la Volaille par les Rayonnements Ionisants; Tekhnicheskie i ehkonomicheskie soobrazheniya otnositel'no'konservatsii myasa i ptitsy s pomoshch'yu ioniziruyushchikh izluchenij; Consideraciones Tecnicas y Economicas Acerca de la Conservacion de Carnes y Volateria por Irradiacion

    Energy Technology Data Exchange (ETDEWEB)

    Urbain, W. M. [Department of Food Science, Michigan State University, East Lansing, MI (United States)

    1966-11-15

    Radiation-sterilized meats and poultry can be of a quality better than that obtained with thermal processing. Where the normal method of preservation of meat and poultry during distribution is refrigeration, radiation at sterilizing levels is not likely to replace it. A principal reason for this is cost. In such a civilian market, radiation-sterilized meats will serve primarily as convenience foods. Radiation-pasteurization could provide a significant product life extension for fresh meats and poultry by delaying microbial spoilage, especially in the centralized preparation of retail cuts. Other factors of meat spoilage of a chemical or physical nature, however, are not controlled by radiation; and until they are, there is no real marketing value in the use of radiation. For fresh or frozen poultry there is the possibility of Salmonella control, should this be needed. Costs for sterilization and pasteurization are estimated and are presented in a form to permit selection of specific conditions within a range for certain important variables. From a commercial viewpoint, it is important to determine the consumer acceptance of radiation- sterilized meats and poultry. The usual approach to such a determination is to market the products in question in a limited manner and to measure the acceptance under such market conditions. To accomplish this with radiation-sterilized foods, the next step appears to be to obtain a production capability to supply the products for test marketing. (author) [French] Les viandes et la volaille sterilisees par les rayonnements peuvent etre de meilleure qualite que celle obtenue par un traitement thermique; Lorsqu'on utilise la refrigeration comme methode normale de conservation de la viande et de la volaille en cours de distribution, il est peu probable qu'on lui substitue l'irradiation a des doses sterilisantes. La principale raison eri est le cout eleve de l'irradiation. Dans un marche destine a repondre aux besoins civils, les viandes

  13. Secular trends in meat and seafood consumption patterns among Chinese adults, 1991-2011.

    Science.gov (United States)

    Wang, Z H; Zhai, F Y; Wang, H J; Zhang, J G; Du, W W; Su, C; Zhang, J; Jiang, H R; Zhang, B

    2015-02-01

    Several studies have suggested differential health effects in relation to different meat composition in Western population. The purpose of the study was to examine secular trends in meat and seafood consumption patterns among Chinese adults between 1991 and 2011. Our longitudinal data are from 21,144 adults aged 18-75 in the China Health and Nutrition Survey, prospective cohort study. We assessed the intakes of meat and subtypes with three 24-h dietary recalls. We conducted multilevel mixed-effect logistic and linear regression models to examine meat consumption dynamics. The proportions of Chinese adults who consumed red meat, poultry and seafood increased from 65.7% in 1991 to 86.1% in 2011, from 7.5 to 20.9% and from 27.4 to 37.8%, respectively. With rapid decrease in meat intakes since 2009, the intakes of total meat, red meat, poultry and seafood among their consumers were 86.7 g/day, 86.4 g/day, 71.0 g/day and 70.3 g/day in 2011, respectively, which were just slightly higher compared with those in 1991. Fatty fresh pork has been predominantly component of total meat overtime, which consituted 54.0% of total meat intake, 80.0% of fresh red meat intake and 98.7% of fatty fresh red meat intake in 2011. Over the past two decades, meat consumption patterns of Chinese adults have been characterized by having a predominant intake of fatty fresh pork, suboptimal intakes of seafood and increased proportion of adults having excessive intakes of red meat and poultry overtime.

  14. Worldwide Mycotoxins Exposure in Pig and Poultry Feed Formulations

    Directory of Open Access Journals (Sweden)

    Philippe Guerre

    2016-11-01

    Full Text Available The purpose of this review is to present information about raw materials that can be used in pig and poultry diets and the factors responsible for variations in their mycotoxin contents. The levels of mycotoxins in pig and poultry feeds are calculated based on mycotoxin contamination levels of the raw materials with different diet formulations, to highlight the important role the stage of production and the raw materials used can have on mycotoxins levels in diets. Our analysis focuses on mycotoxins for which maximum tolerated levels or regulatory guidelines exist, and for which sufficient contamination data are available. Raw materials used in feed formulation vary considerably depending on the species of animal, and the stage of production. Mycotoxins are secondary fungal metabolites whose frequency and levels also vary considerably depending on the raw materials used and on the geographic location where they were produced. Although several reviews of existing data and of the literature on worldwide mycotoxin contamination of food and feed are available, the impact of the different raw materials used on feed formulation has not been widely studied.

  15. Worldwide Mycotoxins Exposure in Pig and Poultry Feed Formulations.

    Science.gov (United States)

    Guerre, Philippe

    2016-11-24

    The purpose of this review is to present information about raw materials that can be used in pig and poultry diets and the factors responsible for variations in their mycotoxin contents. The levels of mycotoxins in pig and poultry feeds are calculated based on mycotoxin contamination levels of the raw materials with different diet formulations, to highlight the important role the stage of production and the raw materials used can have on mycotoxins levels in diets. Our analysis focuses on mycotoxins for which maximum tolerated levels or regulatory guidelines exist, and for which sufficient contamination data are available. Raw materials used in feed formulation vary considerably depending on the species of animal, and the stage of production. Mycotoxins are secondary fungal metabolites whose frequency and levels also vary considerably depending on the raw materials used and on the geographic location where they were produced. Although several reviews of existing data and of the literature on worldwide mycotoxin contamination of food and feed are available, the impact of the different raw materials used on feed formulation has not been widely studied.

  16. Growth modeling of uropathogenic Escherichia coli in ground chicken meat

    Science.gov (United States)

    Extraintestinal Pathogenic Escherichia coli (ExPEC), including Uropathogenic E. coli (UPEC), are common contaminants in poultry meat, and are a major pathogen associated with inflammatory bowel disease, ulcerative colitis, sepsis, and urinary tract infections. The purpose of this study was to determ...

  17. Extensive protein hydrolyzation is indispensable to prevent IgE-mediated poultry allergen recognition in dogs and cats.

    Science.gov (United States)

    Olivry, Thierry; Bexley, Jennifer; Mougeot, Isabelle

    2017-08-17

    The central premise for the commercialization of diets with hydrolyzed ingredients is that the small-sized digested peptides would be unable to crosslink allergen-specific IgE at the surface of tissue mast cells and induce their degranulation. Evidence for the validity of this concept to diagnose food allergies in dogs and cats is limited, however. Our objectives were to study the recognition of standard and variably hydrolyzed poultry extracts by sera from dogs and cats with elevated chicken-specific serum IgE. Forty sera from dogs and 40 from cats with undetectable, low, medium or high serum levels of chicken-specific IgE were tested by ELISA on plates coated with the positive controls chicken, duck and turkey meat extracts and the negative controls beef meat (dogs) or wheat (cats). Plates were also coated with a non-hydrolyzed chicken meal, and mildly- or extensively-hydrolyzed poultry feather extracts. The frequencies of dogs with positive IgE against the various extracts were: chicken meat: 100%, duck and turkey meats: 97%, beef meat: 3%, non-hydrolyzed chicken meal: 73%, mildly-hydrolyzed poultry feathers: 37% and extensively-hydrolyzed poultry feathers: 0%. For cats, these respective percentages were (with wheat replacing beef as a negative control): 100, 84, 97, 7, 7, 0 and 0%. To detect any allergenic cross-reactivity between poultry meat-based and feather hydrolysate-derived extracts, an IgE ELISA inhibition was also done. Ten canine sera with the highest level of anti-poultry IgE in the previous experiment were incubated overnight with a previously optimized 50 μg amount of each of the extracts used above. We performed ELISA on plates coated with chicken, duck or turkey meats with or without inhibitors. The median inhibition percentages after incubation with the non-hydrolyzed chicken meal were ~22%, with the mildly-hydrolyzed poultry feathers: 14-22%, and those with the extensively-hydrolyzed poultry feathers: 5 to 10%; the last inhibition level was

  18. Proteomic approach to characterize biochemistry of meat quality defects.

    Science.gov (United States)

    Schilling, M W; Suman, S P; Zhang, X; Nair, M N; Desai, M A; Cai, K; Ciaramella, M A; Allen, P J

    2017-10-01

    Proteomics can be used to characterize quality defects including pale, soft, and exudative (PSE) meat (pork and poultry), woody broiler breast meat, reddish catfish fillets, meat toughness, and beef myoglobin oxidation. PSE broiler meat was characterized by 15 proteins that differed in abundance in comparison to normal broiler breast meat, and eight proteins were differentially expressed in woody breast meat in comparison to normal breast meat. Hemoglobin was the only protein that was differentially expressed between red and normal catfish fillets. However, inducing low oxygen and/or heat stress conditions to catfish fillets did not lead to the production of red fillets. Proteomic data provided information pertaining to the protein differences that exist in meat quality defects. However, these data need to be evaluated in conjunction with information pertaining to genetics, nutrition, environment of the live animal, muscle to meat conversion, meat quality analyses and sensory attributes to understand causality, protein biomarkers, and ultimately how to prevent quality defects. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Mercury risk in poultry in the Wanshan Mercury Mine, China

    International Nuclear Information System (INIS)

    Yin, Runsheng; Zhang, Wei; Sun, Guangyi; Feng, Zhaohui; Hurley, James P.; Yang, Liyuan; Shang, Lihai; Feng, Xinbin

    2017-01-01

    In this study, total mercury (THg) and methylmercury (MeHg) concentrations in muscles (leg and breast), organs (intestine, heart, stomach, liver) and blood were investigated for backyard chickens, ducks and geese of the Wanshan Mercury Mine, China. THg in poultry meat products range from 7.9 to 3917.1 ng/g, most of which exceeded the Chinese national standard limit for THg in meat (50 ng/g). Elevated MeHg concentrations (0.4–62.8 ng/g) were also observed in meat products, suggesting that poultry meat can be an important human MeHg exposure source. Ducks and geese showed higher Hg levels than chickens. For all poultry species, the highest Hg concentrations were observed in liver (THg: 23.2–3917.1 ng/g; MeHg: 7.1–62.8 ng/g) and blood (THg: 12.3–338.0 ng/g; MeHg: 1.4–17.6 ng/g). We estimated the Hg burdens in chickens (THg: 15.3–238.1 μg; MeHg: 2.2–15.6 μg), ducks (THg: 15.3–238.1 μg; MeHg: 3.5–14.7 μg) and geese (THg: 83.8–93.4 μg; MeHg: 15.4–29.7 μg). To not exceed the daily intake limit for THg (34.2 μg/day) and MeHg (6 μg/day), we suggested that the maximum amount (g) for chicken leg, breast, heart, stomach, intestine, liver, and blood should be 1384, 1498, 2315, 1214, 1081, 257, and 717, respectively; the maximum amount (g) for duck leg, breast, heart, stomach, intestine, liver, and blood should be 750, 1041, 986, 858, 752, 134, and 573, respectively; and the maximum amount (g) for goose leg, breast, heart, stomach, intestine, liver, and blood should be 941, 1051, 1040, 1131, 964, 137, and 562, respectively. - Highlights: • Elevated mercury levels were observed in poultry from Wanshan Mercury Mine, China. • Ducks and geese showed higher mercury levels than chickens. • Liver and blood showed the highest mercury levels. • Poultry can be an important dietary Hg exposure source for local residents. - High levels of Hg associated with poultry surrounding the Wanshan Mercury Mine pose a great risk of Hg exposure to

  20. Radiation decontamination of meat lyophilized products

    International Nuclear Information System (INIS)

    Owczarczyk, H.B.; Migdal, W.

    2002-01-01

    There is an increasing demand for powder soups and sauces compose with lyophilized products. Technology of lyophilization is not always accompanied by thermal treatment of raw materials. That is the reason the products lyophilization process does not ensure as good microbiological quality as is required. Degree of microbiological decontamination and organoleptic properties of lyophilized meat were investigated after radiation treatment. (author)

  1. Agriculture. Poultry Livestock.

    Science.gov (United States)

    Michigan State Univ., East Lansing. Coll. of Agriculture and Natural Resources Education Inst.

    This task-based curriculum guide for agricultural production, specifically for poultry, is intended to help the teacher develop a classroom management system where students learn by doing. Introductory materials include a Dictionary of Occupational Titles job code and title sheet, a task sheet for developing leadership skills, and a task list.…

  2. Stunning systems for poultry

    Science.gov (United States)

    Poultry are stunned immediately prior to slaughter to facilitate automated processing, to minimize the subsequent death struggle and thereby minimize carcass damage and down grades, and to render the bird unconscious and incapable to perceive pain. A stunning method for slaughter should be consider...

  3. Technology and Poultry Welfare

    Directory of Open Access Journals (Sweden)

    Neila Ben Sassi

    2016-10-01

    Full Text Available Consideration of animal welfare is essential to address the consumers’ demands and for the long term sustainability of commercial poultry. However, assessing welfare in large poultry flocks, to be able to detect potential welfare risks and to control or minimize its impact is difficult. Current developments in technology and mathematical modelling open new possibilities for real-time automatic monitoring of animal welfare and health. New technological innovations potentially adaptable to commercial poultry are appearing, although their practical implementation is still being defined. In this paper, we review the latest technological developments with potential to be applied to poultry welfare, especially for broiler chickens and laying hens. Some of the examples that are presented and discussed include the following: sensors for farm environmental monitoring, movement, or physiological parameters; imaging technologies such as optical flow to detect gait problems and feather pecking; infrared technologies to evaluate birds’ thermoregulatory features and metabolism changes, that may be indicative of welfare, health and management problems. All these technologies have the potential to be implemented at the commercial level to improve birds’ welfare and to optimize flock management, therefore, improving the efficiency of the system in terms of use of resources and, thus, long term sustainability.

  4. Technology and Poultry Welfare

    Science.gov (United States)

    Ben Sassi, Neila; Averós, Xavier; Estevez, Inma

    2016-01-01

    Consideration of animal welfare is essential to address the consumers’ demands and for the long term sustainability of commercial poultry. However, assessing welfare in large poultry flocks, to be able to detect potential welfare risks and to control or minimize its impact is difficult. Current developments in technology and mathematical modelling open new possibilities for real-time automatic monitoring of animal welfare and health. New technological innovations potentially adaptable to commercial poultry are appearing, although their practical implementation is still being defined. In this paper, we review the latest technological developments with potential to be applied to poultry welfare, especially for broiler chickens and laying hens. Some of the examples that are presented and discussed include the following: sensors for farm environmental monitoring, movement, or physiological parameters; imaging technologies such as optical flow to detect gait problems and feather pecking; infrared technologies to evaluate birds’ thermoregulatory features and metabolism changes, that may be indicative of welfare, health and management problems. All these technologies have the potential to be implemented at the commercial level to improve birds’ welfare and to optimize flock management, therefore, improving the efficiency of the system in terms of use of resources and, thus, long term sustainability. PMID:27727169

  5. Smallholder Poultry Production

    DEFF Research Database (Denmark)

    Kryger, Karsten Nellemann; Thomsen, Karin; Whyte, Michael

    Smallholder poultry production is practised by most rural households throughout the developing world; despite the fact that its contribution to livelihoods appears to be of little nominal value when observed by researchers and other outsiders. This paper utilizes a Sustainable Livelihoods Framewo...

  6. Black bone syndrome in chiken meat

    Directory of Open Access Journals (Sweden)

    GAA Baldo

    2013-12-01

    Full Text Available Black bone syndrome (BBS affects poultry industry, and it is caused by the darkening of the tissue adjacent to the bone due to leak age of bone marrow contents during cooking. The objective of this experiment was to estimate BBS incidence in chicken thighs. A completely randomized experimental design, with two treatments (refrigerated or frozen of 50 replicates each, was applied. The influence of BBS on meat quality was assessed according to bone lightness (*L, and meat appearance and sensorial characteristics. Lightness was measured using a colorimeter (Minolta® 410R positioned on the proximal epiphyseal growth plate. Meat quality was evaluated after roasting by assigning scores for appearance (acceptable = no darkening, intermediate = little darkened, and unacceptable = severe darkening. Twelve refrigerated and 12 frozen thighs were used for sensorial analysis (adjacent muscle appearance, odor, tenderness, and flavor, assessed using a hedonic scale (1 = bad to 10 = very good by trained panelists. Lightness was submitted to ANOVA and Tukey's test (p37.5=normal. The incidence of BBS was 35%,with a 16%increase thighs were frozen. Meat taste was not influenced by the treatments. Meat appearance, flavor, and tenderness were not affected by freezing or refrigeration, only by BBS degree. It was concluded that freezing increases the incidence of BBS and chicken thighs with bones presenting lower luminosity have worse meat quality.

  7. Some technological aspects of combined processing of meat by heat and ionizing radiations

    International Nuclear Information System (INIS)

    Gel'fand, S.Yu.; Nomenotskaya, N.F.; Mozul', M.Ya.

    1974-01-01

    The paper discusses the use of ionizing radiation to prolong the storage life of meat and meat products. Irradiating raw meat with doses of 0.4-0.6 Mrad increased storage life up to two months at low above-zero C temperatures. The difficulty of inhibiting autolytic processes during storage of irradiated raw meat led to searches for combined methods of meat treatment. A series of experiments was staged with pre-irradiation heating of meat up to 75, 77, and 80 0 C in order to see how cathepsin activity is affected by the duration and temperature of heating in the case of combined treatment. To increase the resistance of meat products to microbial damage, tests were carried out in which meat was exposed to short-term but intensive heat by immersing it in hot (130-160 0 C) vegetable oil (frying grease). The results are presented in the form of tables and diagrams. (E.T.)

  8. Effect of three postmortem electrical stimulation treatments on the quality of early-deboned broiler breast meat

    Science.gov (United States)

    Electrical stimulation (ES) of animal carcasses during postmortem has been commonly used by beef industry to enhance meat tenderness, and has been recently adapted for commercial use with poultry. Majority of published investigations of ES effects on the tenderness of early-deboned poultry breast m...

  9. PREDICTION OF MEAT PRODUCT QUALITY BY THE MATHEMATICAL PROGRAMMING METHODS

    Directory of Open Access Journals (Sweden)

    A. B. Lisitsyn

    2016-01-01

    Full Text Available Abstract Use of the prediction technologies is one of the directions of the research work carried out both in Russia and abroad. Meat processing is accompanied by the complex physico-chemical, biochemical and mechanical processes. To predict the behavior of meat raw material during the technological processing, a complex of physico-technological and structural-mechanical indicators, which objectively reflects its quality, is used. Among these indicators are pH value, water binding and fat holding capacities, water activity, adhesiveness, viscosity, plasticity and so on. The paper demonstrates the influence of animal proteins (beef and pork on the physico-chemical and functional properties before and after thermal treatment of minced meat made from meat raw material with different content of the connective and fat tissues. On the basis of the experimental data, the model (stochastic dependence parameters linking the quantitative resultant and factor variables were obtained using the regression analysis, and the degree of the correlation with the experimental data was assessed. The maximum allowable levels of meat raw material replacement with animal proteins (beef and pork were established by the methods of mathematical programming. Use of the information technologies will significantly reduce the costs of the experimental search and substantiation of the optimal level of replacement of meat raw material with animal proteins (beef, pork, and will also allow establishing a relationship of product quality indicators with quantity and quality of minced meat ingredients.

  10. Influence of turkey meat on residual nitrite in cured meat products.

    Science.gov (United States)

    Kilic, B; Cassens, R G; Borchert, L L

    2001-02-01

    A response surface experimental design was employed to estimate residual nitrite level at various initial nitrite concentrations, percent turkey meat in the formula, and heat quantity (F) values using a typical wiener as the test system. Pork and mechanically separated turkey were used as the meat ingredients. Residual nitrite and pH were measured at day 1, 7 days, 14 days, and 49 days after processing. Protein, fat, salt, moisture, and CIE (L*a*b*) color values were also determined. Results showed that the effect of turkey meat on residual nitrite level was significant (P meat in the formula resulted in lower residual nitrite levels at a fixed pH. The residual nitrite level was initially proportional to initial nitrite concentration, but it became a nonsignificant factor during longer storage time. Differences in heat quantity had a significant effect (P nitrite level initially. Greater heat quantity decreased residual nitrite level in finished cured meat products at a fixed pH. However, this effect became nonsignificant during longer storage. Reduction of residual nitrite in wieners because of turkey meat addition at a fixed pH was due to characteristics of the turkey tissue, but the mechanism of action remains unknown. It was also established that commercial wieners had a higher pH if poultry meat was included in the formulation.

  11. Residual Nitrite in Some Egyptian Meat Products and the Reduction Effect of Electron Beam Irradiation

    OpenAIRE

    Dalia A. Zahran; Gehan M.A. Kassem

    2011-01-01

    Nitrite, a curing agent of meat products, is a precursor of carcinogenic N-nitrosamines during processing of meat products or under human stomach conditions, as well as having its own toxicity. To investigate the residual nitrite level in meat products marketed in Egyptian markets, 160 samples of cured cooked (luncheon and frankfurter) and cured raw (oriental sausages and pastirma) meat products (40 sample each) were analyzed for residual nitrite by a spectrophotometric method. Samples were s...

  12. The quality evaluation of frankfurter-type sausages from hand and mechanically deboned turkey meat.

    Science.gov (United States)

    Radomyski, T; Niewiarowicz, A

    1987-03-01

    A quality evaluation was made of frankfurter-type sausages made from hand and mechanically deboned meat from various parts of turkey carcasses. The results led to the conclusions that despite some differences in objective measurements of the sausage quality, mechanically deboned turkey meat can be considered as an exclusive meat raw material for the production of frankfurter-type sausages. The quality of sausages from mechanically deboned turkey meat from wings and frames with skin was the least satisfactory.

  13. Prevalence of pale, soft, and exudative (PSE) condition in chicken meat used for commercial meat processing and its effect on roasted chicken breast

    OpenAIRE

    Karunanayaka, Deshani S.; Jayasena, Dinesh D.; Jo, Cheorun

    2016-01-01

    Abstract Background Studies on prevalence of pale, soft, exudative (PSE) condition in Sri Lankan poultry industry is minimal. Hence, the objective of present study was to determine the incidence of PSE chicken meat in a commercial meat processing plant and to find out its consequences on meat quality traits of roasted chicken breast. Method A total of 60 breast fillets were randomly selected, evaluated based on color L* value, and placed into 1 of 2 categories; PSE (L* > 58) or normal meat (L...

  14. The Characteristics of Meat Duck, Problems and Prevention of Off Flavor Due to Lipid Oxidation

    Directory of Open Access Journals (Sweden)

    Procula R Matitaputty

    2010-09-01

    Full Text Available Source of poultry meat in Indonesia is currently dominated by chicken while local resources such as ducks have the potential to grow and be used as an alternative meat producer. Duck contribution towards the provision of a relatively small meat of 2.29%, compared with free-range chicken to reachs 20.33%. Sources of duck meat in Indonesia comes from local duck, and culled female ducks. Acceptance of most local duck meat is still relatively low, although in some areas local duck dishes are excellent. Meat ducks are generally less desirable, because taste and smell is different from chicken. Because consumers are not accustomed to the taste of typical meat, especially those that give the sensation of irregularities off meat – flavor or smell fishy/ rancid. Similarly, the color of duck meat is darker than that of chicken meat, high fat content of about 2.7 to 6.8%, which also influences consumer preferences. The high fat content, especially acid-unsaturated fatty acids in meat duck gives a tendency to produce off – flavors. Efforts to increase the consumption of duck meat should be based on the cause of the lack of acceptance by consumers. The smell of rancid meat duck is the most dominant cause of which is not liked by consumers. Efforts to reduce the off flavor of duck meat could be by adding antioxidant in feed stuffs.

  15. Study of chemisrty and hydrolysates drying parameters of feather-downy raw material

    OpenAIRE

    LISITSYN A.B.; KRIGER O.V.; MITROKHIN P.V.

    2016-01-01

    The article describes chemical and amino acid composition of feather-downy raw material. It determines the mass fraction of crude protein, crude fiber, ash, calcium, phosphorus, sodium in the samples of feather-downy raw material. It is stated that the waste from poultry processing obtained from hens of all the studied species are characterized by a high content of crude protein and low in crude fiber and ash. The most valuable feather-downy raw material regarding protein is waste containing ...

  16. How can we improve the environmental sustainability of poultry production?

    Science.gov (United States)

    Leinonen, Ilkka; Kyriazakis, Ilias

    2016-08-01

    The review presents results of recent life cycle assessment studies aiming to quantify and improve the environmental performance of UK poultry production systems, including broiler meat, egg and turkey meat production. Although poultry production has been found to be relatively environmentally friendly compared with the production of other livestock commodities, it still contributes to environmental impacts, such as global warming, eutrophication and acidification. Amongst different sub-processes, feed production and transport contributes about 70 % to the global warming potential of poultry systems, whereas manure management contributes about 40-60 % to their eutrophication potential and acidification potential, respectively. All these impacts can be reduced by improving the feed efficiency, either by changing the birds through genetic selection or by making the feed more digestible (e.g. by using additives such as enzymes). However, although genetic selection has the potential to reduce the resources needed for broiler production (including feed consumption), the changing need of certain feed ingredients, most notably protein sources as a result of changes in bird requirements may limit the benefits of this strategy. The use of alternative feed ingredients, such as locally grown protein crops and agricultural by-products, as a replacement of South American grown soya, can potentially also lead to improvements in several environmental impact categories, as long as such feeding strategies have no negative effect on bird performance. Other management options, such as improving poultry housing and new strategies for manure management have also the potential to further improve the environmental sustainability of the poultry industries in Europe.

  17. Turkish organic poultry sector: General evaluation and lessons from successful practices

    OpenAIRE

    AKSOY, Tulin

    2014-01-01

    Considering Turkey’s success in conventional chicken industry which is around the frontlines in chicken meat and egg production in the EU, the aim of this article was to define the status and potential of organic poultry meat production in Turkey. Also we aimed to generate some advice to accelerate the progress in organic chicken meat production with a view to the successful implementations in EU and USA. In line with the purpose, we will consider the results of some of our past research on ...

  18. Genome sequences of two stress-tolerant Campylobacter jejuni poultry strains, 305 and DFVF1099

    DEFF Research Database (Denmark)

    Takamiya, Monica; Özen, Asli Ismihan; Rasmussen, Morten

    2011-01-01

    Campylobacter jejuni is a food-borne pathogen with a high prevalence in poultry meat, which in fresh unfrozen condition is the major source of campylobacteriosis. C. jejuni strains DFVF1099 and 305 are considered tolerant to several environmental stresses (T. Birk et al., J. Food Prot. 73...

  19. Raw material versus processing

    International Nuclear Information System (INIS)

    Berg, E.A.T.

    1989-01-01

    Some brazilian aspects related with the obtainment of raw materials for advanced ceramic products are described. The necessity of import raw materials by the advanced ceramic industries is mentioned, generating dangerous depedence for the country. The brazilian mineral reserves for using in raw materials of advanced ceramic are also cited. (C.G.C.) [pt

  20. Radiation processing of poultry

    International Nuclear Information System (INIS)

    Niemand, J.G.; Hauser, G.A.M.; Clarke, I.R.; Thomas, A.C.

    1977-06-01

    Gamma irradiation, through its ability to inactivate microorganisms, has been shown to effectively extend the shelf life of commercially slaughtered chickens from 2-4 d to 14-21 d under normal refrigeration temperatures. Although a high percentage of carcasses were contaminated with Salmonella, the level of contamination was relatively low; the doses applied for shelf-life extention thus also served to eliminate this pathogen. Even when carcasses were artificially inoculated with Salmonella of levels several orders of magnitude higher than normal, the recommended radiation doses (3 or 5 kGy) were still capable of rendering the product 'pathogen free'. Irradiated poultry could not be distinguished organoleptically from control samples, even when twice the maximum recommended dose was applied. In conclusion, the irradiation of commercially produced poultry in South Africa with relatively low doses can be of significant benefit by (1) markedly extending the acceptable shelf life and (2) eliminating pathogenic bacteria present on the commercially available product [af