WorldWideScience

Sample records for raw goat milk

  1. Quality aspects of raw goat milk in Lower Southern Thailand

    OpenAIRE

    Siriwat Wasiksiri; Usa Chethanond; Sahutaya Pongprayoon; Somjit Srimai; Bunjob Nasae

    2010-01-01

    This study was conducted to determine the quality and safety of raw goat milk in Lower Southern Thailand duringAugust to September 2008. Milk samples were collected from five farms in Songkhla, Yala, and Pattani Province of which thepH, acidity, specific gravity, milk fat, solid not fat, total solid, total plate count, Coliform count, and antibiotic residue weretested. The results did not show any significant difference (p>0.05) on pH and total plate count among samples from eachfarm. However...

  2. Quality aspects of raw goat milk in Lower Southern Thailand

    Directory of Open Access Journals (Sweden)

    Siriwat Wasiksiri

    2010-05-01

    Full Text Available This study was conducted to determine the quality and safety of raw goat milk in Lower Southern Thailand duringAugust to September 2008. Milk samples were collected from five farms in Songkhla, Yala, and Pattani Province of which thepH, acidity, specific gravity, milk fat, solid not fat, total solid, total plate count, Coliform count, and antibiotic residue weretested. The results did not show any significant difference (p>0.05 on pH and total plate count among samples from eachfarm. However, acidity, specific gravity, milk fat, solid not fat, and total solid varied between farms depending on feed supplyand management. Means of total bacteria count and Coliform count of most samples were in TACF standard quality (log3.720 cfu/ml and log 1.892 cfu/ml, respectively, except four samples had higher Coliform contamination. Additionally,a higher proportion (22.7 % of samples with antibiotic residue was found.

  3. Essential elements, cadmium, and lead in raw and pasteurized cow and goat milk

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, A.; Collins, W.F.; Williams, H.L.

    1985-08-01

    Fifteen essential elements plus cadmium and lead were determined in raw and pasteurized cow and goat milks by atomic absorption spectrophotometry. When results were compared on a wet weight basis, there were no significant differences between the raw and pasteurized milks except for cobalt, iron, and lead in goat milk. When copper in goat milk was expressed on a dry weight basis, there was a significant difference between raw and pasteurized milk. There were significantly higher amounts of cobalt, copper, iron, lead, magnesium, and phosphorus, wet weight basis, in pasteurized goat milk than in pasteurized cow milk. Significantly more nickel and sodium were in pasteurized cow milk. No difference in the content of chloride, calcium, potassium, and zinc was significant between the two milks. When dry weights of the two milks were compared, statistical differences were the same, except there was significantly more calcium and potassium in pasteurized cow milk than in pasteurized goat milk and there were no significant differences in the content of lead and phosphorus between the two milks. Percentages of the established and estimated recommended daily allowances show both cow and goat milk to be excellent sources of calcium, phosphorus, and potassium and fair sources of iron, magnesium, and sodium.

  4. Tick-borne Encephalitis Associated with Consumption of Raw Goat Milk, Slovenia, 2012

    Science.gov (United States)

    Hudopisk, Neda; Korva, Miša; Janet, Evgen; Simetinger, Marjana; Grgič-Vitek, Marta; Gubenšek, Jakob; Natek, Vladimir; Kraigher, Alenka; Strle, Franc

    2013-01-01

    Tick-borne encephalitis (TBE) developed in 3 persons in Slovenia who drank raw milk; a fourth person, who had been vaccinated against TBE, remained healthy. TBE virus RNA was detected in serum and milk of the source goat. Persons in TBE-endemic areas should be encouraged to drink only boiled/pasteurized milk and to be vaccinated. PMID:23697658

  5. Microbiological Quality of Raw Goat Milk in Bogor, Indonesia

    Directory of Open Access Journals (Sweden)

    E. Taufik

    2011-08-01

    Full Text Available Milk samples were investigated for counts and prevalence of indicator bacteria, which were TPC, coliforms, coagulase positive Staphylococci (CPS, and coagulase negative Staphylococci (CNS. Ten potential risk factors were also evaluated in relation to the prevalence of indicator bacteria. The results showed that the median values of indicator bacterial counts from overall udder-half milk samples were 3.74, 0.70, 1.70, and 2.52 log cfu/ml and from bulk milk samples were 5.69, 2.98, 3.66 and 3.32 log cfu/ml for TPC, coliforms, CPS, and CNS, respectively. None of the median values of overall udder-half milk samples exceeded the maximum limit of the standards for all indicator bacteria. However, in the bulk milk samples only the median value of TPC below the maximum limit of the standards. Overall prevalence of coliforms, CPS and CNS from udder-half milk samples were 46.3%, 37.7%, and 66.0%, respectively, and from bulk milk samples were 86.7%, 76.7%, and 86.7%, respectively. Saanen crossbreed, fifth parity and udders with inflammation were found to be risk factors. This study results indicated that the hygienic practices in the dairy goat farms are still need to be increased. To increase the hygienic level of the milk, the identified significant risk factors must be controlled.

  6. Effect of raw sunflower seeds on goat milk production in different farming systems

    Directory of Open Access Journals (Sweden)

    L. Rapetti

    2010-04-01

    Full Text Available Aim of this study was to test the effect of raw sunflower seeds on goat milk production. Two farms with different farming systems (intensive and semi-intensive participated to the trial. In each farm about 60 mid-lactation Alpine goats were divided in two groups during spring-summer time. A diet containing 5-6% of sunflower seeds on DM basis was compared with a control diet in a change-over design. In the semi-intensive farm milk yield of goats fed sunflower was 3.46 kg/d compared to 3.58 kg/d of goats fed control diet, whereas in the intensive farm milk yield was 4.60 kg/d vs 4.66 kg/d. Fat content increased significantly from 2.99% to 3.23% only in the intensive farm. The research in the intensive farm investigated also milk and cheese fatty acids composition. Medium and short chain fatty acids (C8-C16 content dropped and long chain fatty acids content increased when sunflower was added. In conclusion raw sunflower seed inclusion in dairy goat diets can be useful, in order to limit the inversion of fat and protein percentages in milk.

  7. Assessment of the application of an automated electronic milk analyzer for the enumeration of total bacteria in raw goat milk.

    Science.gov (United States)

    Ramsahoi, L; Gao, A; Fabri, M; Odumeru, J A

    2011-07-01

    Automated electronic milk analyzers for rapid enumeration of total bacteria counts (TBC) are widely used for raw milk testing by many analytical laboratories worldwide. In Ontario, Canada, Bactoscan flow cytometry (BsnFC; Foss Electric, Hillerød, Denmark) is the official anchor method for TBC in raw cow milk. Penalties are levied at the BsnFC equivalent level of 50,000 cfu/mL, the standard plate count (SPC) regulatory limit. This study was conducted to assess the BsnFC for TBC in raw goat milk, to determine the mathematical relationship between the SPC and BsnFC methods, and to identify probable reasons for the difference in the SPC:BsnFC equivalents for goat and cow milks. Test procedures were conducted according to International Dairy Federation Bulletin guidelines. Approximately 115 farm bulk tank milk samples per month were tested for inhibitor residues, SPC, BsnFC, psychrotrophic bacteria count, composition (fat, protein, lactose, lactose and other solids, and freezing point), and somatic cell count from March 2009 to February 2010. Data analysis of the results for the samples tested indicated that the BsnFC method would be a good alternative to the SPC method, providing accurate and more precise results with a faster turnaround time. Although a linear regression model showed good correlation and prediction, tests for linearity indicated that the relationship was linear only beyond log 4.1 SPC. The logistic growth curve best modeled the relationship between the SPC and BsnFC for the entire sample population. The BsnFC equivalent to the SPC 50,000 cfu/mL regulatory limit was estimated to be 321,000 individual bacteria count (ibc)/mL. This estimate differs considerably from the BsnFC equivalent for cow milk (121,000 ibc/mL). Because of the low frequency of bulk tank milk pickups at goat farms, 78.5% of the samples had their oldest milking in the tank to be 6.5 to 9.0 d old when tested, compared with the cow milk samples, which had their oldest milking at 4 d

  8. Contamination Level of Staphylococcus spp. in Raw Goat Milk and Associated Risk Factors

    Directory of Open Access Journals (Sweden)

    E. Taufik

    2008-12-01

    Full Text Available This study was aimed to investigate the presence of pathogenic bacteria in raw goat milk by using Staphylococcus spp. as indicator bacteria, and also to evaluate the potential risk factors associated with them. Information regarding potential risk factors was collected by questionnaire. The conventional bacteriological method for bacterial isolation and the indirect test (California Mastitis Test (CMT for determining udder inflammation status were employed. A sample size of 300 udder halves milk samples from three commercial dairy goat farms in the Bogor District, West Java Province, Indonesia were investigated for counts and prevalence of indicator bacteria. Ten potential risk factors were also evaluated in relation to counts and prevalence of indicator bacteria. The results showed that the median value of indicator bacterial count from overall udder-half milk samples was 3.00 log cfu/ml. The indicator bacterial count from udder-half milk samples was significantly different (P<0.05 among farms. Overall prevalence of Staphylococcus spp. was 78.7%. As one of potential risk factors, udder inflammation status was found to be risk factor for Staphylococcus spp. contamination in milk. Udders with inflammation had significant association and a higher chance of having contaminated samples by Staphylococcus spp. as compared to udders without inflammation. Additionally, according to these study results, CMT can be used as an effective, reliable, cheap and “farm and farmer friendly test” for screening test of intramammary infection (IMI or sub clinical mastitis in dairy goats.

  9. Isolation and identification of Salmonella typhimurium from raw cow, sheep and goat milk in Chahamaha Va Bakhteyari Province

    Directory of Open Access Journals (Sweden)

    F Tajbakhsh

    2014-05-01

    Full Text Available Salmonella typhimurium and S. enteritidisare known as the major causes of food-borne infection throughout the world. The present study was carried out to investigate the prevalence of S. typhimurium in raw milks of Chahamaha Va Bakhteyari province. For this reason, a total of 550 raw milks (consisting of 200 cow, 175 sheep and 175 goat milk samples were collected through October 2011 to March 2012 from dairy herds around Shahrekord. The samples were cultured and the isolated colonies were confirmed by PCR using species-specific ST11 and ST15 primers. According to the results, a total of 20 samples (3.63% were found positive for Salmonellaspp.Amongst, 14 (2.54% of cow milk, 2 (0.36% of sheep milk and 4 (0.72% of goat milk samples were contaminated. Using PCR, 9 (1.63% samples were contaminated with S. typhimurium. The results indicated a relatively high occurrence of S. typhimurium in raw milks. Therefore, it is essential to maintain hygienic measures during milking and handling. Besides, it is recommended not to use raw milk for the manufacturing of dairy products such as cheese and ice-cream.

  10. Evaluation of biogenic amines and microbial counts throughout the ripening of goat cheeses from pasteurized and raw milk.

    Science.gov (United States)

    Novella-Rodríguez, Sonia; Veciana-Nogués, M Teresa; Roig-Sagués, Artur X; Trujillo-Mesa, Antonio J; Vidal-Carou, M Carmen

    2004-05-01

    The effect of the hygienic quality of milk on changes in microbial counts and biogenic amine content was evaluated during ripening of goat cheeses manufactured from pasteurized and raw milks at 1, 14, 30, 60 and 90 d. The original milk, rennet, curd and whey were also included in the study. The pH, salt content and extent of proteolysis in the cheese were also evaluated. Spermidine and spermine were the main amines in raw milk, while they were minor amines in cheeses. Other amines increased markedly during ripening, tyramine being the main amine in cheese made from raw milk and cadaverine and putrescine in those produced from pasteurized milk. Enterobacteriaceae counts decreased during ripening whereas those of lactic acid bacteria increased, especially lactobacilli and enterococci. Cheese made from raw milk showed higher microbial counts during ripening than those made from pasteurized milk, especially for Enterobacteriaceae and enterococci, counts being 2 or 3 log units higher. Raw milk cheese showed remarkably higher biogenic amines compared with pasteurized milk cheeses. Therefore, pasteurization of milk causes a decrease in final biogenic amine content of cheese as a result of the reduction of its microbial counts.

  11. A Comparative Study on Physicochemical Characteristics of Raw Goat Milk Collected from Different Farms in Malaysia.

    Science.gov (United States)

    Jaafar, Syarifah Hazirah Syd; Hashim, Roshada; Hassan, Zaiton; Arifin, Norlelawati

    2018-03-01

    This study was conducted to determine the physical and chemical composition of goat milk produced by eight local farms located in the central region of Malaysia. Farms 1 to 4 (F1-SC, F2-SP, F3-SP, F4-SBC) reared Saanen-type goats while farms 5 to 8 (F5-JK, F6-JPEC, F7-JTC, F8-JC), Jamnapari-type goats. The common feedstuffs used in all farms comprised of fresh or silage from Napier grass, feed pellets, and brans while two farms, F5-JK and F6-JPEC supplemented the feeds with soybean-based product. The total solid content, dry matter, and proximate composition of goat milk and feedstuffs from the different farms were determined and the results analysed using principal component analysis. Total solid content of goat milk from the Jamnapari crossbreed had the highest solid content ranging from 11.81% to 17.54% compared to milk from farms with Saanen and Saanen crossbreed (10.95% to 14.63%). Jamnapari-type goats from F5-JK, F6-JPEC, and F8-JC had significantly higher ( p milk fat and protein contents (7.36%, 7.14%, and 6.59% fat; 5.08%, 6.19%, and 4.23% protein, respectively) than milk from other farms but, milk produced by Saanen-type goats from F4-SBC contained similar protein content (4.34%) to that from F8-JC. Total ash and carbohydrate contents in milk ranged between 0.67% to 0.86% and 3.26% to 4.71%, respectively, regardless of goat breed. Feeding soybean-based products appear to have a positive influence on milk fat and protein content in Jamnaparitype goats.

  12. A Comparative Study on Physicochemical Characteristics of Raw Goat Milk Collected from Different Farms in Malaysia

    Science.gov (United States)

    Jaafar, Syarifah Hazirah Syd; Hashim, Roshada; Hassan, Zaiton; Arifin, Norlelawati

    2018-01-01

    This study was conducted to determine the physical and chemical composition of goat milk produced by eight local farms located in the central region of Malaysia. Farms 1 to 4 (F1-SC, F2-SP, F3-SP, F4-SBC) reared Saanen-type goats while farms 5 to 8 (F5-JK, F6-JPEC, F7-JTC, F8-JC), Jamnapari-type goats. The common feedstuffs used in all farms comprised of fresh or silage from Napier grass, feed pellets, and brans while two farms, F5-JK and F6-JPEC supplemented the feeds with soybean-based product. The total solid content, dry matter, and proximate composition of goat milk and feedstuffs from the different farms were determined and the results analysed using principal component analysis. Total solid content of goat milk from the Jamnapari crossbreed had the highest solid content ranging from 11.81% to 17.54% compared to milk from farms with Saanen and Saanen crossbreed (10.95% to 14.63%). Jamnapari-type goats from F5-JK, F6-JPEC, and F8-JC had significantly higher (p < 0.05) milk fat and protein contents (7.36%, 7.14%, and 6.59% fat; 5.08%, 6.19%, and 4.23% protein, respectively) than milk from other farms but, milk produced by Saanen-type goats from F4-SBC contained similar protein content (4.34%) to that from F8-JC. Total ash and carbohydrate contents in milk ranged between 0.67% to 0.86% and 3.26% to 4.71%, respectively, regardless of goat breed. Feeding soybean-based products appear to have a positive influence on milk fat and protein content in Jamnaparitype goats. PMID:29644024

  13. Important vectors for Listeria monocytogenes transmission at farm dairies manufacturing fresh sheep and goat cheese from raw milk.

    Science.gov (United States)

    Schoder, Dagmar; Melzner, Daniela; Schmalwieser, Alois; Zangana, Abdoulla; Winter, Petra; Wagner, Martin

    2011-06-01

    The aim of this study was to determine the transmission routs of Listeria spp. in dairy farms manufacturing fresh cheese made from ovine and caprine raw milk and to evaluate the impact of Listeria monocytogenes mastitis on raw milk contamination. Overall, 5,799 samples, including 835 environmental samples, 230 milk and milk product samples, and 4,734 aseptic half-udder foremilk samples were collected from 53 dairy farms in the dairy intensive area of Lower Austria. Farms were selected for the study because raw milk was processed to cheese that was sold directly to consumers. A total of 153 samples were positive for Listeria spp., yielding an overall prevalence of 2.6%; L. monocytogenes was found in 0.9% of the samples. Bulk tank milk, cheese, and half-udder samples were negative for Listeria spp. Because none of the sheep and goats tested positive from udder samples, L. monocytogenes mastitis was excluded as a significant source of raw milk contamination. L. monocytogenes was detected at 30.2% of all inspected farms. Swab samples from working boots and fecal samples had a significantly higher overall prevalence (P < 0.001) of L. monocytogenes (15.7 and 13.0%, respectively) than did swab samples from the milk processing environment (7.9%). A significant correlation was found between the prevalence of L. monocytogenes in the animal and in the milk processing environment and the silage feeding practices. Isolation of L. monocytogenes was three to seven times more likely from farms where silage was fed to animals throughout the year than from farms where silage was not fed to the animals.

  14. Short communication: Sensory profile of raw goat milk cheeses made with artisan kid rennet pastes from commercial-weight animals: alternative to farmhouse goat cheeses.

    Science.gov (United States)

    Fresno, M; Álvarez, S; Díaz, E; Virto, M; de Renobales, M

    2014-10-01

    The loss of traditional kid rennet pastes in the Canary Islands (Spain), as in many other regions, is most likely due to the custom of using abomasa from very young animals killed below desirable commercial weight. In addition, the reasonable price of commercial rennets (CR) has resulted in the loss of typical sensory characteristics for most farmhouse raw goat milk cheeses, placing them at a disadvantage when local and international markets are full of different cheeses, often with aggressive marketing strategies. This paper analyzes the sensory characteristics of raw goat milk cheeses made with rennet pastes prepared from commercial kid abomasa in 2 ways: dried while full of ingested milk [full, commercial, artisan kid rennet (FCKR)], or dried after being emptied of ingested milk and refilled with raw goat milk [empty, commercial, artisan kid rennet (ECKR)]. This latter practice allows the use of empty abomasa, or abomasa with grass, soil, and so on. Sensory profiles of cheeses made with FCKR and ECKR rennets were compared with those made with CR by an expert panel (n=7). The FCKR and ECKR cheeses had similar sensory profiles. Although scores for FCKR cheeses were somewhat higher than for ECKR cheeses, they were in the range found for traditional cheeses made with rennet prepared with abomasa from very young animals. The sensory profile of CR cheeses was very different. Almost 90% of consumer panelists (n=90) preferred cheeses made with the experimental rennet pastes. These results demonstrate the possibility to prepare artisan rennet pastes from commercial-weight kids in an easy way for farmhouse cheese makers using local resources that would otherwise be destroyed in abattoirs. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  15. Experimental infection of goats with tick-borne encephalitis virus and the possibilities to prevent virus transmission by raw goat milk.

    Science.gov (United States)

    Balogh, Zsuzsanna; Egyed, László; Ferenczi, Emőke; Bán, Enikő; Szomor, Katalin N; Takács, Mária; Berencsi, György

    2012-01-01

    The aim of this work was to study the tick-borne encephalitis virus (TBEV) infection of goats and the possibilities to prevent human milk-borne infections either by immunizing animals or the heat treatment of milk. An experiment was conducted with 20 milking goats. Ten goats (half of them immunized) were challenged with live TBEV and 10 were left uninfected. Clinical signs and body temperatures of the animals were recorded and milk samples were collected daily. The presence of viral RNA and infectious virions in milk were detected by RT-PCR and intracerebral inoculation of suckling mice, respectively. Milk samples containing infectious virions were subjected to various heat treatment conditions and retested afterwards to assess the effect on infectivity. The infected goats did not show any clinical signs or fever compared to uninfected ones. Infectious virions were detected for 8-19 days from the milk samples (genome for 3-18 days by PCR) of infected goats. Immunized goats did not shed the virus. After heat treatment of the milk, the inoculated mice survived. Goats shed the virus with their milk without showing any symptoms. Human milk-borne infections can be avoided both by immunizing goats and boiling/pasteurizing infected milk. Copyright © 2011 S. Karger AG, Basel.

  16. Outbreak of Human Brucellosis from Consumption of Raw Goats' Milk in Penang, Malaysia.

    Science.gov (United States)

    Leong, Kar Nim; Chow, Ting Soo; Wong, Peng Shyan; Hamzah, Siti Hawa; Ahmad, Norazah; Ch'ng, Chin Chin

    2015-09-01

    We report the largest outbreak of brucellosis in Penang, Malaysia. Brucellosis is not endemic in this region. The index case was a 45-year-old goat farm owner presented with 3 weeks of fever, headache, severe lethargy, poor appetite, and excessive sweating. He claimed to have consumed unpasteurized goat's milk that he had also sold to the public. Tests were negative for tropical diseases (i.e., dengue fever, malaria, leptospirosis and scrub typhus) and blood culture showed no growth. Based on epidemiological clues, Brucella serology was ordered and returned positive. Over a period of 1 year, 79 patients who had consumed milk bought from the same farm were diagnosed with brucellosis. Two of these patients were workers on the farm. Four laboratory staff had also contracted the disease presumably through handling of the blood samples. The mean duration from onset of symptoms to diagnosis was 53 days with a maximum duration of 210 days. A combination treatment of rifampin and doxycycline for 6 weeks was the first line of treatment in 90.5% of patients. One-third of the patients had sequelae after recovering and 21% had a relapse. We highlight the importance of Brucellosis as a differential diagnosis when a patient has unexplained chronic fever. © The American Society of Tropical Medicine and Hygiene.

  17. Lead Concentrations in Raw Cow and Goat Milk Collected in Rural Areas of Croatia from 2010 to 2014.

    Science.gov (United States)

    Bilandžić, Nina; Sedak, Marija; Čalopek, Bruno; Luburić, Đurđica Božić; Solomun Kolanović, Božica; Varenina, Ivana; Đokić, Maja; Kmetič, Ivana; Murati, Teuta

    2016-05-01

    A total of 249 cow and 33 goat milk samples were collected in rural areas of Croatia during the period 2010-2014. Lead concentrations in milk samples were analyzed by graphite furnace-atomic absorption spectroscopy. Mean Pb concentrations in milk ranged from (μg/kg): cow 10.8-12.2; goat 9.33-60.0. The highest Pb level of 131 μg/kg in cow milk was measured during 2014. There were no significant differences in Pb levels between cow and goat milk and also in goat milk among the analysed years. However, significant differences were found in cow milk among years. The highest Pb was determined in 2011 (157 μg/kg in goat milk). The calculated estimated weekly intakes of Pb concentrations for cow and goat milk contribute only 1.37 % and 1.84 % to the provisional tolerable weekly intake. Therefore, the consumption of milk from both species should not pose a consumer health risk.

  18. Phenotypic and genotypic characterization of lactic acid bacteria isolated from raw goat milk and effect of farming practices on the dominant species of lactic acid bacteria.

    Science.gov (United States)

    Tormo, Hélène; Ali Haimoud Lekhal, Djamila; Roques, C

    2015-10-01

    Lactic acid bacteria, in particular Lactococcus lactis, play a decisive role in the cheese making process and more particularly in lactic cheeses which are primarily produced on goat dairy farms. The objective of this study was therefore to identify the main lactic acid bacteria found in raw goats' milk from three different regions in France and evaluate if certain farming practices have an effect on the distribution of species of lactic acid bacteria in the various milk samples. Identification at genus or species level was carried out using phenotypic tests and genotypic methods including repetitive element REP-PCR, species-specific PCR and 16S rRNA gene sequencing. The distribution of the main bacterial species in the milk samples varied depending on farms and their characteristics. Out of the 146 strains identified, L. lactis was the dominant species (60% of strains), followed by Enterococcus (38%) of which Enterococcus faecalis and Enterococcus faecium. Within the species L. lactis, L. lactis subsp lactis was detected more frequently than L. lactis subsp cremoris (74% vs. 26%). The predominance of L. lactis subsp cremoris was linked to geographical area studied. It appears that the animals' environment plays a role in the balance between the dominance of L. lactis and enterococci in raw goats' milk. The separation between the milking parlor and the goat shed (vs no separation) and only straw in the bedding (vs straw and hay) seems to promote L. lactis in the milk (vs enterococci). Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Cow's milk and goat's milk.

    Science.gov (United States)

    Turck, Dominique

    2013-01-01

    Cow's milk is increasingly suggested to play a role in the development of chronic degenerative, non-communicable disorders whereas goat's milk is advocated as having several health benefits. Cow's milk is a rich and cheap source of protein and calcium, and a valuable food for bone health. Despite their high content in saturated fats, consumption of full-fat dairy products does not seem to cause significant changes in cardiovascular disease risk variables. Early introduction of cow's milk is a strong negative determinant of iron status. Unmodified cow's milk does not meet nutritional requirements of infants although it is acceptable to add small volumes of cow's milk to complementary foods. Cow's milk protein allergy has a prevalence ranging from 2 to 7%, and the age of recovery is usually around 2-3 years. The evidence linking cow's milk intake to a later risk of type 1 diabetes or chronic degenerative, non-communicable disorders (obesity, metabolic syndrome, type 2 diabetes, hypertension) is not convincing. Milk probably protects against colorectal cancer, diets high in calcium are a probable cause of prostate cancer, and there is limited evidence suggesting that high consumption of milk and dairy products increases the risk for prostate cancer. There is no evidence to support the use of a cow's milk-free diet as a primary treatment for individuals with autistic spectrum disorders. Unmodified goat's milk is not suitable for infants because of the high protein and minerals content and of a low folate content. Goat's milk has no clear nutritional advantage over cow's milk and is not less allergenic. The European Food Safety Authority recently stated that proteins from goat's milk can be suitable as a protein source for infant and follow-on formula, provided the final product complies with the compositional criteria laid down in Directive 2006/141/EC. Copyright © 2013 S. Karger AG, Basel.

  20. Lipolysis and proteolysis profiles of fresh artisanal goat cheese made with raw milk with 3 different fat contents.

    Science.gov (United States)

    Sánchez-Macías, D; Morales-Delanuez, A; Moreno-Indias, I; Hernández-Castellano, L E; Mendoza-Grimón, V; Castro, N; Argüello, A

    2011-12-01

    The objective of this study was to describe the proteolysis and lipolysis profiles in goat cheese made in the Canary Islands (Spain) using raw milk with 3 different fat contents (0.5, 1.5, and 5%) and ripened for 1, 7, 14, and 28 d. β-Casein was the most abundant protein in all cheeses and at all ripening times. Quantitative analysis showed a general decrease in caseins as ripening progressed, and degradation rates were higher for α(S1)-casein than for β-casein and α(S2)-casein. Furthermore, the degradation rate during the experimental time decreased with lower fat contents. The α(S2)-casein and α(S1)-casein levels that remained in full-fat and reduced-fat cheeses were less than those in low-fat cheese. In contrast, β-casein also showed degradation along with ripening, but differences in degradation among the 3 cheese types were not significant at 28 d. The degradation products increased with the ripening time in all cheeses, but they were higher in full-fat cheese than in reduced-fat and low-fat cheeses. The free fatty acid concentration per 100g of cheese was higher in full-fat cheese than in reduced- and low-fat cheese; however, when the results were expressed as milligrams of free fatty acids per gram of fat in cheese, then lipolysis occurred more rapidly in low-fat cheese than in reduced- and full-fat cheeses. These results may explain the atypical texture and off-flavors found in low-fat goat cheeses, likely the main causes of non-acceptance. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  1. High occurrence of Helicobacter pylori in raw goat, sheep and cow milk inferred by glmM gene: a risk of food-borne infection?

    Science.gov (United States)

    Quaglia, N C; Dambrosio, A; Normanno, G; Parisi, A; Patrono, R; Ranieri, G; Rella, A; Celano, G V

    2008-05-10

    Helicobacter pylori is an organism widespread in humans and sometimes responsible for serious illnesses, such as gastric and duodenal ulcers, MALToma and even gastric cancer. It has been hypothesized that the infection route by H. pylori involves multiple pathways including food-borne transmission, as the microorganism has been detected from foods such as sheep and cow milk. This work reports the results of a survey conducted in order to investigate the presence of H. pylori in raw goat, sheep and cow milk produced in Southern Italy, employing a Nested Polymerase Chain Reaction (Nested-PCR) assay for the detection of the phosphoglucosamine mutase gene (glmM), as screening method followed by conventional bacteriological isolation. Out of the 400 raw milk samples examined, 139 (34.7%) resulted positive for the presence of glmM gene, but no strains were isolated. In this work H. pylori DNA has been firstly detected from 41 (25.6%) raw goat milk samples. The results deserve further investigations on the contamination source/s of the milk samples and on the major impact that it may have on consumers.

  2. Food Safety and Raw Milk

    Science.gov (United States)

    ... and Food Safety Food Safety Modernization Act Raw Milk Recommend on Facebook Tweet Share Compartir RAW MILK ... Decide? Questions & Answers Outbreak Studies Resources & Publications Raw Milk Infographic [PDF – 1 page] More Resources 5 Raw ...

  3. Ptaquiloside, the major carcinogen of bracken fern, in the pooled raw milk of healthy sheep and goats: an underestimated, global concern of food safety.

    Science.gov (United States)

    Virgilio, Antonella; Sinisi, Annamaria; Russo, Valeria; Gerardo, Salvatore; Santoro, Adriano; Galeone, Aldo; Taglialatela-Scafati, Orazio; Roperto, Franco

    2015-05-20

    Bracken fern (Pteridium aquilinum) is a worldwide plant containing toxic substances, which represent an important chemical hazard for animals, including humans. Ptaquiloside, 1, a norsesquiterpenoid glucoside, is the major carcinogen of bracken detected in the food chain, particularly in the milk from farm animals. To date, ptaquiloside has been shown in the milk of cows feeding on a diet containing bracken fern. This is the first study that shows the systematic detection of ptaquiloside, 1, and reports its direct quantitation in pooled raw milk of healthy sheep and goats grazing on bracken. Ptaquiloside, 1, was detected by a sensitive method based on the chemical conversion of ptaquiloside, 1, into bromopterosine, 4, following gas chromatography-mass spectrometry (GC-MS) analysis. The presence of ptaquiloside, 1, possibly carcinogenic to humans, in the milk of healthy animals is an unknown potential health risk, thus representing a harmful and potential global concern of food safety.

  4. Milk drink with goat milk and goat serum is alternative for exploitation of pulp umbu

    Directory of Open Access Journals (Sweden)

    Nkarthe Guerra Araújo

    2015-09-01

    Full Text Available This research aimed to develop and evaluate the acceptance and intention to purchase two dairy beverages formulations prepared with fermented umbus, goat serum and goat milk in order to add greater economic value to the three raw materials. The treatments consisted of the variation in serum concentrations goat (28,5% and 44% and goat milk (44% and 28,5%, respectively. The pulp has previously been analyzed and showed 15,21mg/100g of ascorbic acid. The fermented dairy beverages showed microbiological characteristics within the established by the legislation. It was found that there was no significant difference (p > 0,05 for color attributes, flavor and consistency of both, however, the flavor attributes and global acceptance have been significantly affected. The formulation with 28,5% of goat serum and 44% goat milk had the best average from 10 days, and acceptances up to 25 days of storage.

  5. Microbial Quality of and Biochemical Changes in Fresh Soft, Acid-Curd Xinotyri Cheese Made from Raw or Pasteurized Goat's Milk.

    Science.gov (United States)

    Pappa, Eleni C; Bontinis, Thomas G; Tasioula-Margari, Maria; Samelis, John

    2017-12-01

    The microbiological quality of and changes in the main physicochemical parameters, together with the evolution of proteolysis, lipolysis and volatile profiles of soft Xinotyri, a traditional Greek acid-curd cheese (pH≈4.4, moisture 65%, salt 1%) made from raw (RMC) or pasteurized (PMC) goat's milk without starters, were evaluated during aerobic storage at 4 o C for 60 days. No statistically significant differences between the total nitrogen (TN) and nitrogen fraction (% of TN) contents, the degradation of intact α s - or β-caseins, total free amino acid (FAA) contents, and the ratio of hydrophilic and hydrophobic peptides in the water-soluble fraction of RMC and PMC were found. Threonine, alanine and lysine were the principal FAAs. Oleic, palmitic, capric and caprylic acids, and ethyl hexonate, ethyl octanoate, ethyl decanoate, ethanol, 3-methyl butanol, phenyl ethyl alcohol and acetone were the most abundant free fatty acids and volatile compounds, respectively. Cheese lipolysis evolved slowly at 4 o C, and milk pasteurization had no significant effect on it. Mesophilic lactic acid bacteria (LAB) were predominant in fresh cheese samples. PMC samples had significantly lower levels of enterococci and enterobacteria than RMC samples, while yeasts grew at similar levels during storage at 4 o C. All cheese samples (25 g) were free of Salmonella and Listeria monocytogenes . Coagulase-
-positive staphylococci exceeded the 5-log safety threshold in fresh RMC samples, whereas they were suppressed (pasteurization of raw goat milk's and utilization of commercially defined or natural mesophilic LAB starters are recommended for standardizing the biochemical, microbial and safety qualities of fresh soft Xinotyri cheese.

  6. Microbiological quality of goat's milk obtained under different production systems

    Directory of Open Access Journals (Sweden)

    J.K. Kyozaire

    2005-06-01

    Full Text Available In order to determine the safety of milk produced by smallholder dairy goat farms, a farm-based research study was conducted on commercial dairy goat farms to compare the microbiological quality of milk produced using 3 different types of dairy goat production systems (intensive, semi-intensive and extensive. A survey of dairy goat farms in and around Pretoria carried out by means of a questionnaire revealed that most of the smallholder dairy goat farms surveyed used an extensive type of production system. The method of milking varied with the type of production system, i.e. machine milking; bucket system machine milking and hand-milking, respectively. Udder half milk samples (n=270 were analysed, of which 31.1 % were infected with bacteria. The lowest intra-mammary infection was found amongst goats in the herd under the extensive system (13.3 %, compared with 43.3 % and 36.7 % infection rates under the intensive and semi-intensive production systems, respectively. Staphylococcus intermedius (coagulase positive, Staphylococcus epidermidis and Staphylococcus simulans (both coagulase negative, were the most common cause of intramammary infection with a prevalence of 85.7 % of the infected udder halves. The remaining 14.3 % of the infection was due to Staphylococcus aureus. Bacteriology of bulk milk samples on the other hand, showed that raw milk obtained by the bucket system milking machine had the lowest total bacterial count (16 450 colony forming units (CFU/mℓ compared to that by pipeline milking machine (36 300 CFU/mℓ or handmilking (48 000 CFU/mℓ. No significant relationship was found between the somatic cell counts (SCC and presence of bacterial infection in goat milk. In comparison with the herds under the other 2 production systems, it was shown that dairy goat farming under the extensive production system, where hand-milking was used, can be adequate for the production of safe raw goat milk.

  7. Growth and enterotoxin production of Staphylococcus aureus during the manufacture and ripening of Camembert-type cheeses from raw goats' milk.

    Science.gov (United States)

    Meyrand, A; Boutrand-Loei, S; Ray-Gueniot, S; Mazuy, C; Gaspard, C E; Jaubert, G; Perrin, G; Lapeyre, C; Vernozy-Rozand, C

    1998-09-01

    Tests were carried out to determine the effect of manufacturing procedures for a Camembert-type cheese from raw goats' milk on the growth and survival of Staphylococcus aureus organisms added to milk at the start of the process, and to study the possible presence of staphylococcal enterotoxin A in these cheeses. The initial staphylococcal counts were, respectively, 2, 3, 4, 5 and 6 log cfu ml-1. Cheese was prepared following the industrial specifications and ripened for 41 d. Detection of enterotoxins was done by the Vidas SET test and by an indirect double-sandwich ELISA technique using antienterotoxin monoclonal antibodies. Generally, numbers of microbes increased at a similar rate during manufacture in all cheeses until salting. During the ripening period, the aerobic plate count population and Staph. aureus levels remained stable and high. There was an approximately 1 log reduction of Staph. aureus in cheeses made with an initial inoculum of Staph. aureus greater than 10(3) cfu ml-1 at the end of the ripening period (41 d) compared with the count at 22 h. The level of staphylococcal enterotoxin A recovered varied from 1 to 3.2 ng g-1 of cheese made with an initial population of 10(3)-10(6) cfu ml-1. No trace of enterotoxin A was detected in cheeses made with the lowest Staph. aureus inoculum used in this study.

  8. Direct Quantitative Detection and Identification of Lactococcal Bacteriophages from Milk and Whey by Real-Time PCR: Application for the Detection of Lactococcal Bacteriophages in Goat's Raw Milk Whey in France

    Directory of Open Access Journals (Sweden)

    Mai Huong Ly-Chatain

    2011-01-01

    Full Text Available The presence of Lactococcus bacteriophages in milk can partly or completely inhibit milk fermentation. To prevent the problems associated with the bacteriophages, the real-time PCR was developed in this study for direct detection from whey and milk of three main groups of Lactococcus bacteriophages, c2, 936, and P335. The optimization of DNA extraction protocol from complex matrices such as whey and milk was optimized allowed the amplification of PCR without any matrix and nontarget contaminant interference. The real-time PCR program was specific and with the detection limit of 102 PFU/mL. The curve slopes were −3.49, −3.69, and −3.45 with the amplification efficiency estimated at 94%, 94%, and 98% and the correlation coefficient (2 of 0.999, 0.999, and 0.998 for c2, 936 and P335 group, respectively. This method was then used to detect the bacteriophages in whey and goat's raw milk coming from three farms located in the Rhône-Alpes region (France.

  9. Influence of vegetable coagulant and ripening time on the lipolytic and sensory profile of cheeses made with raw goat milk from Canary breeds.

    Science.gov (United States)

    Rincón, Arturo A; Pino, Verónica; Fresno, María R; Jiménez-Abizanda, Ana I; Álvarez, Sergio; Ayala, Juan H; Afonso, Ana M

    2017-04-01

    Free fatty acids and sensory profiles were obtained for cheeses made with raw goat milk and vegetable coagulant, derived from the cardoon flower ( Cynara cardunculus), at different ripening times (7 and 20 days). A solid-liquid phase extraction method followed by solid-phase extraction and gas chromatography was used. Profiles were also obtained with cheeses made with commercial coagulant, traditional kid rennet paste, and mixture coagulant (vegetable coagulant-kid rennet). The use of vegetable coagulant and vegetable coagulant-kid rennet is common in traditional Protected Designation of Origin cheeses such as " Queso Flor de Guía" and " Queso Media Flor de Guía" (Spain). Contents of short-chain free fatty acids (7.5-22.5 mmol·kg -1 ), medium-chain free fatty acids (0.4-3.7 mmol·kg -1 ), and long-chain free fatty acids (0.2-2.1 mmol·kg -1 ) varied depending on the coagulant type and the ripening time. Vegetable coagulant cheeses present odour intensity and flavour intensity much higher than commercial coagulant cheeses in the sensory analysis for cheeses obtained with seven days of ripening, but the values decrease when increasing the ripening time. Multivariate analysis allowed us to differentiate cheese samples according to the ripening time when using lipolytic profile and according to the coagulant type using the sensory profile.

  10. Effect of gamma irradiation on the unsaponifiable matter components of cows, buffaloes and goats milk fat

    International Nuclear Information System (INIS)

    Rady, A.H.

    1986-01-01

    Fresh cow's, buffalo's and goat's milk were treated with gamma-irradiation from a cobalt-60 source at safe doses (250, 500 and 750 krad) in addition to raw milk of the same types. Results indicate that total hydrocarbon was much lower in unsaponifiable matter (unsap. m) of goat's raw milk fat than that of cow's and buffalo's. Unsap. m of cow's milk fat consisted of ten hydrocarbon compounds, while it consisted of eight hydrocarbon compounds in both buffaloes and goats ones. Moreover, the unsap. m of goat's milk had the highest total sterols followed by buffalo's and cow's, respectively. Cholesterol represents the predominant sterol compound of the unsap. m in all kinds of raw milk fat. The application of ascendent doses of gamma irradiation increased total hydrocarbons and decreased total sterols (particularly cholesterol compounds) of unsap. m of both buffalo's and goat's milk fats, while the reverse trend occurred with cow's milk fat

  11. Preference for goat meat and milk products consumption in Bauchi ...

    African Journals Online (AJOL)

    Very few people were involved in the consumption of goat milk and milk products, with the highest percentage coming from respondents who consume goat milk only on certain occasions. In general, the study indicated that goat meat is well cherished, while milk from goats is unpopular in the state. Since goat milk is known ...

  12. Relationship of goat milk flow emission variables with milking routine, milking parameters, milking machine characteristics and goat physiology.

    Science.gov (United States)

    Romero, G; Panzalis, R; Ruegg, P

    2017-11-01

    The aim of this paper was to study the relationship between milk flow emission variables recorded during milking of dairy goats with variables related to milking routine, goat physiology, milking parameters and milking machine characteristics, to determine the variables affecting milking performance and help the goat industry pinpoint farm and milking practices that improve milking performance. In total, 19 farms were visited once during the evening milking. Milking parameters (vacuum level (VL), pulsation ratio and pulsation rate, vacuum drop), milk emission flow variables (milking time, milk yield, maximum milk flow (MMF), average milk flow (AVMF), time until 500 g/min milk flow is established (TS500)), doe characteristics of 8 to 10 goats/farm (breed, days in milk and parity), milking practices (overmilking, overstripping, pre-lag time) and milking machine characteristics (line height, presence of claw) were recorded on every farm. The relationships between recorded variables and farm were analysed by a one-way ANOVA analysis. The relationships of milk yield, MMF, milking time and TS500 with goat physiology, milking routine, milking parameters and milking machine design were analysed using a linear mixed model, considering the farm as the random effect. Farm was significant (Pfarms, being similar to those recommended in scientific studies. Few milking parameters and milking machine characteristics affected the tested variables: average vacuum level only showed tendency on MMF, and milk pipeline height on TS500. Milk yield (MY) was mainly affected by parity, as the interaction of days in milk with parity was also significant. Milking time was mainly affected by milk yield and breed. Also significant were parity, the interaction of days in milk with parity and overstripping, whereas overmilking showed a slight tendency. We concluded that most of the studied variables were mainly related to goat physiology characteristics, as the effects of milking parameters and

  13. Raw milk consumption and health

    Directory of Open Access Journals (Sweden)

    Popović-Vranješ Anka

    2015-01-01

    Full Text Available Contrary to the safe practices of milk pasteurization or sterilization, which effectively reduce foodborne outbreaks incidence associated with raw milk and dairy products use, outbreaks caused by such products continue to occur. Despite this fact, a worldwide movement advocating for the rights of raw milk and cheese selling and consumption, due to their specific nutritive characteristics, has strengthened significantly in recent years. Traditional agricultural manufacturers from Serbia still sell products related to thermally unprocessed milk, such as cottage cheese and raw cream. In AP Vojvodina during the period of 1981-2010 a total of 179 foodborne outbreaks were reported, where the incriminated cause of the outbreak were milk or diary. In 126 (70.39% outbreaks, totaling 2276 sick individuals and one casualty, it was confirmed that the incriminated food was from the group of dairy products. In 48 instances (26.82%, bacteriological tests confirmed that milk and dairy products were excluded as the outbreak causes, while in another 5 (2.79% outbreaks, microbiological analysis of food failed to confirm any relation to the actual epidemiological instances. In some cases, bacteriological testing of incriminated foods was not possible. In the cases of outbreaks associated with the consumption of milk and dairy products, traditional raw milk products were cited as being used. Consumption of unpasteurized milk and cheese represents public health threat. National and international rules ensuring use of safe products for human consumption have to set rules of trade of thermally processed milk and products on the market. [Projekat Ministarstva nauke Republike Srbije, br. TR31095

  14. BIOLOGICAL VALUE OF GOAT MILK CASEIN

    OpenAIRE

    Samir Ahmed Salem; Elsayed Ibrahim Elagamy; Fatma Salama; Nagwa Hussein Abosoliman

    2009-01-01

    The effect of feeding of goat and cow milk caseins on the body weight gain, body organs, erythrocytic & leukocytic counts and their parameters, plasma lipid profile, liver enzyme activities, renal function and plasma proteins of rats over a period of 45 days was studied. Feeding of goat or cow milk caseins had no significant effect on the parameters studied (P≤0.05) between rats fed either milk. However, rats fed on goat milk casein showed a significant increase in high density lipoproteins...

  15. Consumption of raw or unpasteurized milk and milk products by pregnant women and children.

    Science.gov (United States)

    2014-01-01

    Sales of raw or unpasteurized milk and milk products are still legal in at least 30 states in the United States. Raw milk and milk products from cows, goats, and sheep continue to be a source of bacterial infections attributable to a number of virulent pathogens, including Listeria monocytogenes, Campylobacter jejuni, Salmonella species, Brucella species, and Escherichia coli O157. These infections can occur in both healthy and immunocompromised individuals, including older adults, infants, young children, and pregnant women and their unborn fetuses, in whom life-threatening infections and fetal miscarriage can occur. Efforts to limit the sale of raw milk products have met with opposition from those who are proponents of the purported health benefits of consuming raw milk products, which contain natural or unprocessed factors not inactivated by pasteurization. However, the benefits of these natural factors have not been clearly demonstrated in evidence-based studies and, therefore, do not outweigh the risks of raw milk consumption. Substantial data suggest that pasteurized milk confers equivalent health benefits compared with raw milk, without the additional risk of bacterial infections. The purpose of this policy statement was to review the risks of raw milk consumption in the United States and to provide evidence of the risks of infectious complications associated with consumption of unpasteurized milk and milk products, especially among pregnant women, infants, and children.

  16. The bacteriological quality of goat and ovine milk

    Directory of Open Access Journals (Sweden)

    Kateřina Bogdanovičová

    2015-05-01

    Full Text Available This study concentrates on information concerning the microbiological hazards that can be present in raw milk from animal species other than cows. A total of 54 (23 of ovine and 31 of goat bulk tank milk samples from 10 farms in the Czech Republic were collected in years 2013 - 2014. The sampling was done at regular time intervals during the whole year, with five to eight samples collected from each of the 10 dairy farms involved in the study. All milk samples were collected into sterile sampling bottles and transported in a cooler sampling case to the laboratory for immediate examination. Farms were randomly selected to cover the whole area of the Czech Republic. The prevalence and characteristic of Escherichia coli, Staphylococcus aureus, Salmonella spp., Campylobacter spp. and Listeria monocytogenes was studied. Raw cow's milk can be contaminated by E. coli intramammarily during clinical or subclinical mastitis and either directly through animal feces or indirectly during milk collection through farm employees or the milking equipment. E. coli was detected in 90.3% of the goat milk and 95.7% of the ovine milk samples. The genes encoding Shiga toxins 1 and 2- (stx1, stx2 were not detected and no STEC was identified. The Eae was the detected in 3 (4.6% isolates. S. aureus was detected in 9 (29.0% samples of goat milk and 8 (34.8% samples of ovine milk. A total 12 (57.1% enterotoxin positive S. aureus were obtained; 6 (28.6% were positive for the production of sec encoding enterotoxin SEC; in 4 (19.0% isolates the gene seh was detected; 2 (9.5% isolates were proven positive for seg (4.8% and combination seg and sei (4.8%. The presence of MRSA was not detected in the tested samples in our study. L. monocytogenes was detected in 1 (3.2% samples of goat milk and 1 (4.3% samples of ovine milk. The serotype (1/2a, 1/2b was detected in our study. Campylobacter spp. and Salmonella spp. were not isolated from any of the samples. These results form

  17. GOAT MILK PRODUCTION UNDER ORGANIC FARMING STANDARS

    Directory of Open Access Journals (Sweden)

    Gerold Hartmut Rahmann

    2009-02-01

    Full Text Available Organic farming has emerged from its niche. This holds true for organic goat milk, yoghurt and cheese as well. Particularly in the EU many dairy goat farms have converted or want to convert towards organic farming to profit from the positive image and the good prices for milk (+100% in Western Europe and Alpine regions. High performance dairy goats demand excellent feedstuffs, a sound environment and top management. It was not clear how organic farming can fulfil these demands. The restrictive factors influencing the productivity of the animals in organic farming are as follows: limited concentrate feeding (

  18. Applicability of Screening Tests for Oxytetracycline in the Milk of Three Breeds of Goats.

    Science.gov (United States)

    Attaie, Rahmat; Bsharat, Mohammed; Mora-Gutierrez, Adela

    2016-06-01

    Antibiotics are widely used in animal husbandry, and the presence of antibiotic residues in milk is a health hazard. The objectives of this study were to determine residual amounts of oxytetracycline in the milk of three breeds of goats using high-pressure liquid chromatography (HPLC) analysis and screening tests. It was also essential to explore the safe withdrawal period of oxytetracycline in lactating goats and examine the applicability of Charm ROSA and SNAP screening tests. The qualitative results of these tests were compared with the quantitative results of the HPLC method. Fifteen milking does, five each from the Alpine, LaMancha, and Nubian breeds, were selected from the herd at Prairie View A&M University. Milk samples containing antibiotic residues were deproteinized by HCl and acetonitrile, and then oxytetracycline was extracted from the supernatant. The residues of oxytetracycline in goat's milk up to 110 h after injection were qualitatively detected using the Charm ROSA test. Similarly, the SNAP test detected the antibiotic residues in milk up to 110 h after treatment. The HPLC results indicated that oxytetracycline residues in milk from Alpine goats were below the tolerance level (300 ng/ml) 82 h after drug treatment (72 h for LaManchas, 58 h for Nubians); however, the results of the screening tests would indicate longer withdrawal periods for milk from the breeds of goats studied, which would result in economic losses to goat's milk producers. The results of this study also indicated that oxytetracycline was not stable in raw goat's milk at refrigeration temperature or during pasteurization and that the concentrations decreased significantly. Commercial goat's milk is usually exposed to several hours of refrigeration and then to pasteurization. The results of this study indicated that, if oxytetracycline was present in raw goat's milk, the concentration would decrease significantly before it was marketed.

  19. Clotting of cow (Bos taurus) and goat milk (Capra hircus) using calve ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-10-06

    Oct 6, 2008 ... Goat and cow milk protein are 24 and 27 g×L-1 respectively. These values .... Formagramm obtained by kid rennet on cow milk (raw picture was .... structure, and functionality of low-fat Iranian white cheese made with different ...

  20. Bacterial diversity in goat milk from the Guanzhong area of China.

    Science.gov (United States)

    Zhang, Fuxin; Wang, Zhaoxia; Lei, Feiyan; Wang, Bini; Jiang, Shuaiming; Peng, Qiannan; Zhang, Jiachao; Shao, Yuyu

    2017-10-01

    In this study, the V3 and V4 regions of the 16S rRNA gene from metagenomic DNA were sequenced to identify differences in microbial diversity in raw milk of Saanen and Guanzhong goats from the Guanzhong area of China. The results showed that Proteobacteria was the predominant phylum, accounting for 71.31% of all phyla identified in milk from the 2 breeds, and Enterobacter was the predominant genus (24.69%) within the microbial community. Microbial alpha diversity from Saanen goat milk was significantly higher than that of Guanzhong goat milk based on bioinformatic analysis of indices of Chao1, Shannon, Simpson, observed species, and the abundance-based coverage estimator. Functional genes and their likely metabolic pathways were predicted, which demonstrated that the functional genes present in the bacteria in goat milk were enriched in pathways for amino acid metabolism and carbohydrate metabolism, which represented 11.93 and 11.23% of functional genes, respectively. Physicochemical properties such as pH, protein, fat, and AA levels were also determined and correlations made with microbial diversity. We detected a significant difference in the content of lactose and 6 AA, which were higher in Saanen milk than in Guanzhong milk, and positively correlated with microbial carbohydrate metabolism and AA metabolism. Lactococcus, Lactobacillus, Bifidobacterium, Enterococcus, and Streptococcus, which are lactose-utilizing genera, were more abundant in Saanen milk than in Guanzhong milk. Higher levels of lactose in Saanen goat milk may explain its greater microbial diversity. We also demonstrated that most of the AA metabolism-related bacterial genera (e.g., Massilia, Bacteroides, Lysobacter) were enriched in Saanen goat milk. In this research, both probiotic and pathogenic bacteria were identified in goat milk, which provided the microbial information necessary to direct the utilization of beneficial microbial resources and prevent the development of harmful organisms in

  1. Modeling to control spores in raw milk

    NARCIS (Netherlands)

    Vissers, M.

    2007-01-01

    A modeling approach was used to identify measures at the farm that reduce transmission of microorganisms to raw milk. Butyric acid bacteria (BAB) and Bacillus cereus were used as case-studies. Minimizing the concentration of BAB spores in raw milk is important to prevent late-blowing of Gouda-type

  2. Evaluation of quality of kefir from milk obtained from goats supplemented with a diet rich in bioactive compounds.

    Science.gov (United States)

    Cais-Sokolińska, Dorota; Pikul, Jan; Wójtowski, Jacek; Danków, Romualda; Teichert, Joanna; Czyżak-Runowska, Grażyna; Bagnicka, Emilia

    2015-04-01

    The composition of bioactive components in dairy products depends on their content in raw milk and the processing conditions. The experimental material consisted of the milk of dairy goats supplemented with 120 g d(-1) per head of false flax cake. The aim of the study was to evaluate the quality of kefir produced from goat's milk with a higher content of bioactive components resulting from supplementation of the goats' diet with false flax cake. The administration of false flax cake to goats had a positive effect on the fatty acid profile of the raw milk, causing an increase in the proportion of polyunsaturated fatty acids (PUFA), including conjugated linoleic acid (CLA) and n-3 fatty acids. Their increased percentage was detected in the kefir after production as well as after storage. The processing value of the harvested milk did not differ from the qualitative characteristics of milk from goats of the control group. Increasing the proportion of bioactive components in goat's milk did not result in changes in the acidity, texture, colour, flavour, aroma or consistency of the kefir obtained. Milk and kefir obtained after the administration of false flax cake to goats contain bioactive components (PUFA including CLA, n-3 and monoenic trans fatty acids) in significant amounts. Kefir from experimental goat's milk did not differ in quality from kefir made from the milk of the control group. © 2014 Society of Chemical Industry.

  3. Growth and enterotoxin production of Bacillus cereus in cow, goat, and sheep milk

    Directory of Open Access Journals (Sweden)

    Lenka Necidová

    2014-01-01

    Full Text Available The aim of this study was to compare Bacillus cereus growth rates and diarrhoeal enterotoxin production in raw and pasteurized goat, sheep, and cow milk in terms of storage conditions. Milk samples were inoculated with B. cereus (CCM 2010, which produces diarrhoeal enterotoxins. Enterotoxin production was tested by ELISA (Enzyme-Linked Immunosorbent Assay, and the count of B. cereus was determined by the plate method. With raw cow milk, B. cereus growth and enterotoxin production can be completely suppressed; in raw goat and sheep milk, enterotoxin was produced at 22 °C. In pasteurized cow, goat, and sheep milk, the B. cereus count increased under all storage conditions, with more rapid growth being observed at 15 °C (sheep milk and 22 °C (cow and goat milk. Enterotoxin presence was detected at 15 °C and 22 °C, and with pasteurized cow milk also at 8 °C. Our model experiments have determined that B. cereus multiplication and subsequent enterotoxin production depend on storage temperature and milk type.

  4. Influence of raw milk quality on fluid milk shelf life.

    Science.gov (United States)

    Barbano, D M; Ma, Y; Santos, M V

    2006-03-01

    Pasteurized fluid milk shelf life is influenced by raw milk quality. The microbial count and somatic cell count (SCC) determine the load of heat-resistant enzymes in milk. Generally, high levels of psychrotrophic bacteria in raw milk are required to contribute sufficient quantities of heat-stable proteases and lipases to cause breakdown of protein and fat after pasteurization. Sanitation, refrigeration, and the addition of CO2 to milk are used to control both total and psychrotrophic bacteria count. It is not uncommon for total bacterial counts of raw milk to be milk processors have not focused much attention on milk SCC. Increased SCC is correlated with increased amounts of heat-stable protease (plasmin) and lipase (lipoprotein lipase) in milk. When starting with raw milk that has a low bacterial count, and in the absence of microbial growth in pasteurized milk, enzymes associated with high SCC will cause protein and fat degradation during refrigerated storage, and produce off-flavors. As the ability to kill, remove, or control microbial growth in pasteurized refrigerated milk continues to improve, the original milk SCC will be the factor limiting the time of refrigerated storage before development of an off-flavor in milk. Most healthy cows in a dairy herd have a milk SCC 200,000 cell/mL are usually due to the contribution of high SCC milk from a small number of cows in the herd. Technology to identify these cows and keep their milk out of the bulk tank could substantially increase the value of the remaining milk for use in fluid milk processing. To achieve a 60- to 90-d shelf life of refrigerated fluid milk, fluid processors and dairy farmers need to work together to structure economic incentives that allow farmers to produce milk with the SCC needed for extended refrigerated shelf life.

  5. Evaluation of hippuric acid content in goat milk as a marker of feeding regimen.

    Science.gov (United States)

    Carpio, A; Bonilla-Valverde, D; Arce, C; Rodríguez-Estévez, V; Sánchez-Rodríguez, M; Arce, L; Valcárcel, M

    2013-09-01

    Organic producers, traders, and consumers must address 2 issues related to milk: authentication of the production system and nutritional differentiation. The presence of hippuric acid (HA) in goat milk samples has been proposed as a possible marker to differentiate the feeding regimen of goats. The objective of this work is to check the hypothesis that HA could be a marker for the type of feeding regimen of goats by studying the influence of production system (conventional or organic) and feeding regimen (with or without grazing fodder). With this purpose, commercial cow and goat milk samples (n=27) and raw goat milk samples (n=185; collected from different breeds, localizations, and dates) were analyzed. Samples were grouped according to breed, feeding regimen, production system, and origin to compare HA content by ANOVA and honestly significant difference Tukey test at a confidence level of ≥95%. Hippuric acid content was obtained by analyzing milk samples with capillary electrophoresis. This method was validated by analyzing part of the samples with HPLC as a reference technique. Sixty-nine raw goat milk samples (of the total 158 samples analyzed in this work) were quantified by capillary electrophoresis. In these samples, the lowest average content for HA was 7±3 mg/L. This value corresponds to a group of conventional raw milk samples from goats fed with compound feed. The highest value of this group was 28±10 mg/L, corresponding to goats fed compound feed plus grass. Conversely, for organic raw goat milk samples, the highest concentration was 67±14 mg/L, which corresponds to goats fed grass. By contrast, the lowest value of this organic group was 26±10 mg/L, which belongs to goats fed organic compounds. Notice that the highest HA average content was found in samples from grazing animals corresponding to the organic group. This result suggests that HA is a good marker to determine the type of goats feeding regimen; a high content of HA represents a diet

  6. Impact of Heat Treatment on the Freezing Points of Cow and Goat Milk

    Directory of Open Access Journals (Sweden)

    Bohumíra Janštová

    2009-01-01

    Full Text Available The aim of this study was to monitor the impact of heat treatment variables on the freezing point of cow and goat milk. The freezing point (FP was established in 30 bulk tank samples of goat milk and in 30 bulk tank samples of cow milk which were subject to laboratory heat treatment at temperatures of 72 °C (A, 85 °C (B, 95 °C (C, with the same exposition times of 20 s. Freezing point measurements of raw and heat-treated milk were carried out in compliance with the Standard CTS 57 0538 by a thermistor cryoscope. The FP of raw cow milk increased with heat treatment from the initial values of -0.5252 ± 0.0114 °C (O by 0.0023 °C (A, 0.0034 °C (B and 0.0051°C (C. Changes in FP values of goat milk were detected, from its initial value of –0.5530 ± 0.0086 °C there was an increase in the FP depending on the mode of heat treatment due to pasteurization by an average of 0.0028 °C (A, 0.0036 °C (B and 0.0054 °C (C. The dynamics of the changes were similar both in goat and cow milk. Freezing point values in cow and goat milk differed (P ⪬ 0.01 when compared to the freezing point of untreated milk after the individual interventions as well as when compared between each other. An increase in the heat treatment temperature of cow and goat milk causes an increase in the freezing point (a shift towards zero. These results can be used in practice for checking the raw material in dairy industry.

  7. quality and consumer acceptability of goat milk with respect to goat

    African Journals Online (AJOL)

    ACSS

    African Crop Science Journal by African Crop Science Society is licensed under ... farmers' goats in Trans Nzoia County was also determined. ..... Consumer acceptability (panelists scores*) of goat milk products in the north rift region in Kenya.

  8. Effects of goat milk or milk replacer diet on meat quality and fat composition of suckling goat kids.

    Science.gov (United States)

    Bañón, S; Vila, R; Price, A; Ferrandini, E; Garrido, M D

    2006-02-01

    The effects of a diet with goat milk "GM" or milk replacer "MR" on the meat quality and fat composition of suckling Murciano-Granadina kids were studied. MR consisted of powdered skimmed milk, coconut oil and fat, and cereal products and by-products. Raw meat quality (moisture, protein, lipids, ash, collagen, cholesterol, haem pigments, CIELab colour, pH and water retention capacity), fatty acid "FA" composition and eating quality of cooked meat (odour, flavour and texture) were determined. Diet had only a slight effect on raw meat quality but had a pronounced effect on fatty acid composition and eating quality of cooked meat. MR diet increased the water/protein proportion in the muscle. The saturated/unsaturated FA ratio in GM and MR fat was 0.94 and 2.27, respectively. The major FA in GM and MR fat were C16:0 and C18:1, respectively. Short-chain C4-C12 hardly accumulated in the adipose tissue of suckling kid, increasing the relative percentages of C14-C20. This effect was more pronounced in MR fat, due to the fact that MR contained more short-chain fatty acids than GM. MR diet gave cooked meat a more intense characteristic goat meat odour and flavour, more tenderness and more juiciness than the natural suckling diet. This fact could be related to differences in meat and fat composition.

  9. Somatic cell count of milk from different goat breeds

    Directory of Open Access Journals (Sweden)

    Csanádi J.

    2015-01-01

    Full Text Available There is no standard limit value for somatic cell count (SCC of raw goat milk in the EU despite that excellent hygienic quality milk is needed for the manufacture of fermented milk products or cheese varieties. Mastitis often results such high SCC - besides the potential risk for humans - that the clotting of milk will not be perfect, resulting slack curd with higher whey releasing; furthermore, wrong structure, ripening, bad sensory properties of cheese can also be its consequences. In this paper, we report the SCC of milk samples from five different goat breeds bred in Hungary, measured with two fast methods compared with the results from the reference method. Furthermore, we investigated the applicability and the accuracy of the MT-02 (Agro Legato Ltd., Hungary instrument. We determined that the White Side test and the instrument MT were suitable for the estimation of possible risks and consequences in the case of the use of high SCC milk before production. The general summarized average milk SCC was 6.64 × 105 ml−1. The highest difference between the results from MT-02 and the fluorometric (reference method was 5 × 105 ml−1, but it was a singular, extreme value. The r2 of the calculated linear calibration equation was 0.7819; consequently, this method seems to be applicable in the measurement of SCC with MT-02 instrument. Furthermore, the SCC of samples did not differ significantly by genotypes and by seasons (spring: 5.85 × 105 ml−1, autumn: 6.22 × 105 ml−1.

  10. Evaluation of a microbiological indicator test for antibiotic detection in ewe and goat milk.

    Science.gov (United States)

    Comunian, R; Paba, A; Dupré, I; Daga, E S; Scintu, M F

    2010-12-01

    Antibiotics are widely used for therapeutic and prophylactic purposes in dairy animals. The presence of residual antibiotics in milk could cause potentially serious problems in human health and have technological implication in the manufacturing of dairy products. The aim of this study was to evaluate Delvotest Accelerator (DSM Food Specialties, Delft, the Netherlands), a new system for a fully automated microbial test to detect antibiotic residues in ewe and goat milk. Forty-three samples of raw, whole, refrigerated bulk-tank milk samples (22 of ewe milk and 21 of goat milk) were analyzed during the whole lactation period. Four concentrations of 4 antibiotics were diluted in milk: penicillin G at 1, 2, 3, and 4 μg/L; sulfadiazine at 25, 50, 100, and 200 μg/L; tetracycline at 50, 100, 200, and 400 μg/L; and gentamicin at 25, 50, 100, and 200 μg/L. The detection limit of the Delvotest Accelerator was calculated as the range of antibiotic concentrations within which 95% of positive result lie. The range of detection limit of penicillin G and sulfadiazine was easily detected by Delvotest Accelerator at or below the European Union maximum residue limits, both for ewe and goat milk samples. In contrast, the system showed a lower ability to detect tetracycline and gentamicin both for ewe and goat milk samples. Very low percentages of false-positive outcomes were obtained. Lactation phase did not seem to be a crucial factor affecting the ability of the Delvotest Accelerator to detect spiked milk samples. A higher detection ability was observed for goat milk samples compared with ewe milk samples. A negative correlation between the percentage of positive milk samples detected and milk fat, protein, and lactose contents was observed for gentamicin only. Copyright © 2010 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  11. Determination of essential nutrients in raw milk

    Directory of Open Access Journals (Sweden)

    Penphimon Phongphanphanee

    2006-03-01

    Full Text Available Milk production in Thailand has gradually increased since 1961. Occasional oversupply of raw milk has become one of dairy farmers' major problems. Increasing the consumption of milk by making use of its separated nutrients may offer a solution. This study was to assess the composition of raw milk produced in Thailand, which included fat, protein, lactose, solid-not-fat (SNF and total solid (TS. A large dairy cooperatives in Saraburi Province was selected for the study. About 9% of its total members, constituting 108 farms, were randomly chosen. They consisted of small size (less than 20 cows/farm, medium size (21-100 cows/farm and large size (>100 cows/farm. The majority was medium-size. Raw milk from each farm was sampled at the delivery site of the cooperatives in the morning. Milk data of the 108 farms were compiled at 3 different periods between February and July 2003. The raw milk was analyzed by the Fourier Transform Infrared Analysis (FTIR using MilkoScan FT6000. The results showed the average fat content of 3.50±0.47%, protein of 3.13±0.16%, lactose of 4.59±0.12%, SNF of 8.42±0.20%, and TS of 11.92±0.54%. The samples were superior in all of the nutrients as compared to the standard levels set by the Department of Livestock Development, except for TS. This indicates the possibility of a local production of milk nutrients such as lactose and protein as ingredients for the pharmaceutical and health food industries.

  12. Food safety hazards associated with consumption of raw milk.

    Science.gov (United States)

    Oliver, Stephen P; Boor, Kathryn J; Murphy, Steven C; Murinda, Shelton E

    2009-09-01

    An increasing number of people are consuming raw unpasteurized milk. Enhanced nutritional qualities, taste, and health benefits have all been advocated as reasons for increased interest in raw milk consumption. However, science-based data to substantiate these claims are limited. People continue to consume raw milk even though numerous epidemiological studies have shown clearly that raw milk can be contaminated by a variety of pathogens, some of which are associated with human illness and disease. Several documented milkborne disease outbreaks occurred from 2000-2008 and were traced back to consumption of raw unpasteurized milk. Numerous people were found to have infections, some were hospitalized, and a few died. In the majority of these outbreaks, the organism associated with the milkborne outbreak was isolated from the implicated product(s) or from subsequent products made at the suspected dairy or source. In contrast, fewer milkborne disease outbreaks were associated with consumption of pasteurized milk during this same time period. Twenty nine states allow the sale of raw milk by some means. Direct purchase, cow-share or leasing programs, and the sale of raw milk as pet food have been used as means for consumers to obtain raw milk. Where raw milk is offered for sale, strategies to reduce risks associated with raw milk and products made from raw milk are needed. Developing uniform regulations including microbial standards for raw milk to be sold for human consumption, labeling of raw milk, improving sanitation during milking, and enhancing and targeting educational efforts are potential approaches to this issue. Development of pre- and postharvest control measures to effectively reduce contamination is critical to the control of pathogens in raw milk. One sure way to prevent raw milk-associated foodborne illness is for consumers to refrain from drinking raw milk and from consuming dairy products manufactured using raw milk.

  13. Gamma ray irradiated goat milk: comparative sensorial analysis with pasteurized goat milk

    International Nuclear Information System (INIS)

    Gurgel, Maria Sylvia de C.C. do Amaral; Domarco, Rachel E.; Spoto, Marta H.F.

    2002-01-01

    Goat milk consumption has increased in the last years, due to its better digestibility and for constituting a good alternative to cow milk for intolerant people. Brazil has over 10 millions goats, mainly in the Northeast area. Considering that it is very important to increase the shelf-life for this product, this work was done to test the gamma-radiation as a preservation method, evaluating acceptability by sensorial analysis compared with pasteurized milk. The goat milk was bought in the Animal Production Department/ESALQ/USP, Piracicaba, and irradiated with 3,5 kGy in the Food Irradiation Laboratory/CENA/USP, using a cobalt-60 irradiator, type Gammabeam-650, from Nordion, Canada. After irradiation, the samples were maintained under refrigeration at 5 deg C and submitted to sensorial analysis at 1 st , 7 th and 15 th days by 30 untrained tasters. The results indicated, by Tukey test, a significant preference for the pasteurized milk in comparison to the irradiated one, because a hard caprine flavor was developed by the irradiation. (author)

  14. Cyolane residues in milk of lactating goats

    International Nuclear Information System (INIS)

    Zayed, S.M.A.D.; Osman, A.; Fakhr, I.M.I.

    1981-01-01

    Consecutive feeding of lactating goats with 14 C-alkyl labelled cyolane for 5 days at dietary levels 8 and 16 ppm resulted in the appearance of measurable insecticide residues in milk (0.02-0.04 mg/kg). The residue levels were markedly reduced after a withdrawal period of 7 days. Analysis of urine and milk residues showed the presence of similar metabolites in addition to the parent compound. The major part of the residue consisted of mono-, diethyl phosphate and 2 hydrophilic unknown metabolites. The erythrocyte cholinesterase activity was reduced to about 50% after 24 hours whereas the plasma enzyme was only slightly affected. The animals remained symptom-free during the experimental period. (author)

  15. Milk production of Tswana goats fed diets containing different levels ...

    African Journals Online (AJOL)

    The aim of this experiment was to characterize the milk yield of the Tswana goat of Botswana. Twenty-one Tswana goat does were allocated to one of three diets formulated to provide energy for maintenance and a milk yield of either 1.5 kg/d, 1.0 kg/d or 0.5 kg/d. Intake, milk yield and kid growth rate was monitored for 14 ...

  16. Monitoring of psychrotrophic microorganisms in raw milk

    Directory of Open Access Journals (Sweden)

    Radka Burdychová

    2008-01-01

    Full Text Available The group of psychrotrophic microorganisms belongs to the microorganisms representing a risk for human health as well as a risk of milk and milk products spoilage. Some genus are considered to be significant producers of proteolytic and lipolytic enzymes. In this work, we analysed raw milk samples (n = 109 originated from 26 different suppliers from the area of North and Middle Moravia. The screening was performed from March 2007 to February 2008. The total bacterial counts (TBC ranged between 3.2 × 103 to 8.3 × 106 CFU/ml. The psychrotrophic bacterial counts (PBC ranged between 1.0 × 103 to 8.2 × 106 CFU/ml. Total of 48.62 % and 48.62 % of samples exceeded the hygienic limit in raw milk for TBC and PBC, respectively. The correlation between TBC and PBC was highly significant (r = 0.87.Significantly higher (P < 0.05 numbers of psychrotrophic microorganisms were detected in summer months. The identification of isolates was carried out and all strains were sreened for ability to produce proteolytic and lipolytic enzymes. The most commonly identified genus in raw milk was of the genus Pseudomonas. The ability to produce proteases or lipases was found at 76 % identified bacterial strains.

  17. Characterization of goat milk and potentially symbiotic non-fat yogurt

    Directory of Open Access Journals (Sweden)

    Noelia Fernanda Paz

    2014-09-01

    Full Text Available Combining prebiotics and probiotic microorganisms improve quality in the formulation of foods. In this paper, the characteristics of goat milk and symbiotic yogurt were studied. Raw goat milk was analyzed and the skimming process was optimized. For the formulation of a potentially non-fat symbiotic yogurt made with skimmed goat milk, inulin, gelatin, sugar, and Streptococcus salivarius subsp. thermophilus, Lactobacillus delbrueckii subsp. bulgaricus and Lactobacillus casei subsp. rhamnoshus. Chemical characteristics, acceptability, and viability of lactic acid bacteria and probiotic culture were assessed. The protein and fat content of the raw milk was 2.90 and 3.56 g/100 mL, respectively. The optimum skimming process was obtained at 9,800 rpm and 4 °C for 15 minutes. The product formulated had a protein and fat content of 4.04 to 0.04 g/100 mL, good sensory properties, and acceptability of 95%. The lactic bacteria count was 9 × 10(7 CFU mL- 1, and probiotic culture count was higher than 1 × 10(6 CFU mL- 1, which guarantees their effect and capacity to survive in the digestive tract and spread in the intestine. The yogurt was stable during the 21 days of storage. Therefore, this study shows that goat milk yogurt is an adequate delivery vehicle of the probiotic culture L. casei and inulin.

  18. Evidence of scrapie transmission to sheep via goat milk.

    Science.gov (United States)

    Konold, Timm; Thorne, Leigh; Simmons, Hugh A; Hawkins, Steve A C; Simmons, Marion M; González, Lorenzo

    2016-09-17

    Previous studies confirmed that classical scrapie can be transmitted via milk in sheep. The current study aimed to investigate whether scrapie can also be transmitted via goat milk using in vivo (new-born lambs fed milk from scrapie-affected goats due to the unavailability of goat kids from guaranteed scrapie-free herds) and in vitro methods (serial protein misfolding cyclic amplification [sPMCA] on milk samples). In an initial pilot study, new-born lambs of two different prion protein gene (PRNP) genotypes (six VRQ/VRQ and five ARQ/ARQ) were orally challenged with 5 g brain homogenate from two scrapie-affected goats to determine susceptibility of sheep to goat scrapie. All sheep challenged with goat scrapie brain became infected based on the immunohistochemical detection of disease-associated PrP (PrP(sc)) in lymphoid tissue, with an ARQ/ARQ sheep being the first to succumb. Subsequent feeding of milk to eight pairs of new-born ARQ/ARQ lambs, with each pair receiving milk from a different scrapie-affected goat, resulted in scrapie in the six pairs that received the largest volume of milk (38-87 litres per lamb), whereas two pairs fed 8-9 litres per lamb, and an environmental control group raised on sheep milk from healthy ewes, did not show evidence of infection when culled at up to 1882 days of age. Infection in those 12 milk recipients occurred regardless of the clinical status, PrP(sc) distribution, caprine arthritis-encephalitis virus infection status and PRNP polymorphisms at codon 142 (II or IM) of the donor goats, but survival time was influenced by PRNP polymorphisms at codon 141. Serial PMCA applied to a total of 32 milk samples (four each from the eight donor goats collected throughout lactation) detected PrP(sc) in one sample each from two goats. The scrapie agent was present in the milk from infected goats and was able to transmit to susceptible species even at early preclinical stage of infection, when PrP(sc) was undetectable in the brain of the

  19. Milk yield of some goat breeds in Croatia

    Directory of Open Access Journals (Sweden)

    Boro Mioč

    2007-04-01

    Full Text Available In Croatia, goats are primarily bred for meat production. However, for the past twenty years the interest in goat milk production was based on imported breeds such as Alpine-French, Saanen and German Improved Fawn goat. The purpose of this paper is to establish litter size of the principal goat breeds in Croatia and the indicators related to milk yield and chemical composition. The largest average litter size has been determined on the German Improved Fawn (1.72, then with the Boer (1.54, the Saanen (1.53 and the Croatian coloured goat (1.51, while the Alpine-French goat was the smallest (1.31. The longest lactation period (259 days has been determined on the Alpine-French goat, while the largest milk yield during lactation (724.4 kg and the largest milk fat yield (20.16 kg and protein yield (18.64 kg have been determined on the Saanen goat. However, it has been established that the Alpine-French goat milk has the highest average fat content (3.55 %, while the German Improved Fawn’s milk has the highest protein content (3.23 %. The Saanen goat had the longest milking period (222 days and the shortest suckling period (32 days, while the Alpine-French and the German Improved Fawn had the longest suckling period (51 and 45 days, respectively. The lowest quantity of milk during the suckling period (102.97 kg, i.e. 14 % was suckled by Saanen kids, while the Alpine-French (122.08 kg, i.e. 22 % and the German Improved Fawn kids suckled the greatest quantity (116.31 kg, i.e. 22 %.

  20. Assessment of the colorimetric and fluorometric assays for alkaline phosphatase activity in cow's, goat's, and sheep's milk.

    Science.gov (United States)

    Klotz, V; Hill, Art; Warriner, K; Griffiths, M; Odumeru, J

    2008-09-01

    Raw milk is a well-established vehicle for the carriage of human pathogens, and many regulatory bodies have consequently mandated compulsory pasteurization as a food safety intervention. The residual activity of alkaline phosphatase (ALP) has historically been used to verify the adequacy of pasteurization of cow's milk. However, there is uncertainty on how the current ALP standards and methods of analysis can be applied to sheep's and goat's milk, which naturally contain different levels of the enzyme than that found in cow's milk. The official ALP methods applied in Canada (colorimetric assay; MFO-3) and in the United States (Fluorophos) were assessed for their ability to detect enzyme activity in raw and pasteurized milk derived from cows, sheep, and goats. The detection limit and the limit of quantitation were 0.8 and 2.02 microg/ml phenol, respectively, for the MFO-3 method and 43 and 85 mU/liter, respectively, for the Fluorophos method. The average ALP levels in raw goat's, cow's, and sheep's milk were 165, 1,562, and 3,512 microg/ml phenol, respectively. Raw milk detection limits, which correspond to raw milk phosphatase levels, were 0.051, 0.485, and 0.023% in cow's, goat's, and sheep's milk, respectively, for the MFO-3 method and 0.007, 0.070, and 0.004%, respectively, for the Fluorophos method. Although both methods can be used for ALP determination in cow's, goat's, and sheep's milk, the Fluorophos assay was superior to the colorimetric MFO-3 method based on sensitivity and time required to complete the analysis.

  1. Identification of cow milk in goat milk by nonlinear chemical fingerprint technique.

    Science.gov (United States)

    Ma, Yong-Jie; Dong, Wen-Bin; Fan, Cheng; Wang, Er-Dan

    2017-10-01

    The objective of this paper was to develop a nonlinear chemical fingerprint technique for identifying and detecting adulteration of goat milk with cow milk. In this study, by taking the Belousov-Zhabotinsky oscillatory chemical reaction using acetone and substrates in goat milk or cow milk as main dissipative substances, when the same dosage of goat milk and cow milk was introduced to the "H +  + Mn 2+  + BrO 3 -  + acetone" oscillating system respectively, nonlinear chemical fingerprints were obtained for goat milk and cow milk from the same origin. The results showed that inductive time value and the content of cow milk in goat milk had a linear relationship in the range of 0-100% and the corresponding regression coefficient was 0.9991. A detection limit of 0.0107 g/g was obtained, and the content of cow milk in mixed milk was calculated. The proposed method in this study was simple, economical and effective. In addition, the method did not need the pretreatment and separation of samples for identifying and evaluating cow milk adulteration in goat milk. Copyright © 2017. Published by Elsevier B.V.

  2. Hygienic and other aspects of raw milk vending machines

    OpenAIRE

    DANIEL, Radovan

    2011-01-01

    The aim of this work was to evaluate opportunities of raw milk sales. The questionnaire was submitted to respondents, which assessed the direct sale of milk, consumption, awareness about milk quality connecting with the sales of raw milk using a vending machines.

  3. The hygienic quality of raw reindeer milk

    Directory of Open Access Journals (Sweden)

    Joanna Kurki

    2004-04-01

    Full Text Available The somatic cell count (SCC and total bacterial count (TBC as well as the presence of major food-borne pathogens and udder pathogens in reindeer raw milk were studied. Two groups of 4 female reindeer were milked on alternate days for six weeks. A milk sample from each quarter was taken before milking and of the bulk milk at the end of milking. Micrococcus sp. was observed in one, Staphylococcus aureus in one and coagulase-negative staphylococci in five of the quarter samples (n=318. In the bulk milk (n=19 TBC varied between 700 and 1 700 000 cfu (colony forming units/ml and SCC between 52 000 and 183 000 cells/ml. No Bacillus cereus, S. aureus or Listeria monocytogenes were detected in the bulk milk, but Escherichia coli and Enterobacteriaceae were found in 5 bulk milk samples. According to the bacteriological examination the udder health of the reindeer was good. Indicative information on the SCC of healthy reindeer was obtained. None of the common potential food-poisoning bacteria were found in raw milk. There was great variation in the bulk milk TBC and the average TBC was rather high (ca. 300 000 cfu/ml. The hygienic quality of raw reindeer milk makes it well suited for food manufacture. However, the results indicate that the milking conditions may be crucial for the quality of raw milk.Abstract in Finnish / Yhteenveto:Tutkimuksen kohteena oli poron raakamaidon solupitoisuus ja kokonaispesäkeluku sekä tärkeimpien elintarvike- ja utarepatogeenien esiintyminen raakamaidossa. Kaksi 4 vaatimen ryhmää lypsettiin vuoropäivinä 6 viikon ajan. Ennen lypsyä vaatimista otettiin vedinkohtaiset näytteet ja lypsyn päätyttyä näyte yhteismaidosta. Micrococcus sp. todettiin yhdessä, Staphylococcus aureus yhdessä ja koagulaasinegatiivisia stafylokokkeja viidessä vedinkohtaisessa näytteessä (n=318. Yhteismaitonäytteiden (n=19 kokonaispesäkeluvut vaihtelivat välillä 700-1 700 000 pmy (pesäkkeitä muodostava yksikkö/ml ja somaattisten

  4. Prevalence, pathogenic capability, virulence genes, biofilm formation, and antibiotic resistance of Listeria in goat and sheep milk confirms need of hygienic milking conditions.

    Science.gov (United States)

    Osman, Kamelia M; Zolnikov, Tara Rava; Samir, Ahmed; Orabi, Ahmed

    2014-01-01

    Goat and sheep milk is consumed by human populations throughout the world; as a result, it has been proposed as an alternative, nutrient-rich milk to feed infants allergic to cow's milk. Unfortunately, potentially harmful bacteria have not been thoroughly tested in goat or sheep milk. Listeria monocytogenes is a harmful bacterium that causes adverse health effects if ingested by humans. The purpose of this study was to estimate the prevalence and characterize the phenotype, genotype, virulence factors, biofilm formation, and antibiopotential of Listeria isolated from the milk of goat and sheep. Udder milk samples were collected from 107 goats and 102 sheep and screened for mastitis using the California mastitis test (CMT). Samples were then examined for the presence of pathogenic Listeria spp; if detected, the isolation of pathogenic Listeria (L. monocytogenes and Listeria ivanovii) was completed using isolation and identification techniques recommended by the International Organization for Standards (ISO 11290-1, 1996), in addition to serological, in vitro and in vivo pathogenicity tests. The isolates were subjected to PCR assay for virulence associated genes (hlyA, plcA, actA, and iap). Pathogenic Listeria spp. were isolated from 5·6% of goat and 3·9% sheep milk samples, with 33·3 and 25% of these selected samples respectively containing L. monocytogenes. The results of this study provide evidence of the low-likelihood of contamination leading to the presence of L. monocytogenes in raw goat and sheep milk; however, this study also confirmed a strong in vitro ability for biofilm formation and pathogenic capability of L. monocytogenes if discovered in the milk. L. monocytogenes may be present in goat and sheep milk and in order to reduce the exposure, hygienic milking conditions must be employed for the milk to be considered a safe alternative for human consumption.

  5. The Effect of Heating and Postfermentation on Lactoferrin of Fresh and Kefir Goat Milk

    Directory of Open Access Journals (Sweden)

    Erfan Kustiawan

    2012-02-01

    Full Text Available The aim of this study was determinated of lactoferrin profile in goat milk and kefir. The samples were collected from whey raw milk, pasteurized and kefir. Lactoferrin profile in this study consisted of concentration and molecule weight of lactoferrin. Goat lactoferrin was isolated from whey by fractionation on sephadex     G-100 column, it was eluted at 0.1 M phosphate buffer pH 6.8. Characterization of goat lactoferrin by electrophoretic SDS-PAGE techniques detected molecule weight of goat lactoferrin that the isolate of the fractions from fractionation on sephadex G-100 column. Result of the research  showed that pasteurization during storage after fermentation process were influenced by concentration of lactoferrin significant (P<0.05. The molecule weights of lactoferrin in goat milk and kefir were estimated at 84 kDa and 80 kDa. The average concentration of goat lactoferrin at 1.915 mg/ml (without pasteurized, 1.579 mg/ml (pasteurized at 65oC, 0.954 mg/ml (pasteurized at 73oC and 0.322 mg/ml (pasteurized at 83oC. The average concentration of goat lactoferrin in kefir during storage at 0.663 mg/ml (0 day, 0.448 mg/ml (3  day, 0.249 mg/ml (6 day, 0.142 mg/ml (9 day dan 0.048 mg/ml (12 day.  Pasteurization at temperature 65oC 30’’ can defend concentration of lactoferrin higher than temperature 73oC 15’’  and temperature 83oC 2’’. Concentration of lactoferrin in kefir were defended until 12 day storage.   Keywords : Lactoferrin, goat milks, kefir

  6. Time resolved fluorescence of cow and goat milk powder

    Science.gov (United States)

    Brandao, Mariana P.; de Carvalho dos Anjos, Virgílio; Bell., Maria José V.

    2017-01-01

    Milk powder is an international dairy commodity. Goat and cow milk powders are significant sources of nutrients and the investigation of the authenticity and classification of milk powder is particularly important. The use of time-resolved fluorescence techniques to distinguish chemical composition and structure modifications could assist develop a portable and non-destructive methodology to perform milk powder classification and determine composition. This study goal is to differentiate milk powder samples from cows and goats using fluorescence lifetimes. The samples were excited at 315 nm and the fluorescence intensity decay registered at 468 nm. We observed fluorescence lifetimes of 1.5 ± 0.3, 6.4 ± 0.4 and 18.7 ± 2.5 ns for goat milk powder; and 1.7 ± 0.3, 6.9 ± 0.2 and 29.9 ± 1.6 ns for cow's milk powder. We discriminate goat and cow powder milk by analysis of variance using Fisher's method. In addition, we employed quadratic discriminant analysis to differentiate the milk samples with accuracy of 100%. Our results suggest that time-resolved fluorescence can provide a new method to the analysis of powder milk and its composition.

  7. Changes in the microflora composition of goat and sheep milk during lactation

    Directory of Open Access Journals (Sweden)

    Libor Kalhotka

    2015-08-01

    Full Text Available The aim of this work was to determine extend of microbial contamination of raw milk in individual seasons. Raw goat milk (3 farms and sheep milk (2 farms were analyzed. Milk was produced on farms of different way of farming and with a different number of milked animals. Samples were taken during lactation three terms in the beginning, middle and end of lactation. In milk, following groups of microorganisms were determined by standard methods: total count of microorganisms (TCM, psychrotrophic microorganisms, Enterobacteriaceae, lactic acid bacteria (lactobacilli, enterococci, aerobic and anaerobic thermoresistant microorganisms (TMRae, TMRan, micromycetes (yeast and moulds. In goat milk, the following numbers of microorganisms were detected: total count of microorganisms (TCM from 105 to 109 CFU x mL-1, lactobacilli from 102 to 105 CFU x mL-1, bacteria fam. Enterobacteriaceae from 101 to 105 CFU x mL-1, enterococci from 101 to 105 CFU x mL-1, thermoresistant aerobic and anaerobic microorganisms (TMRae and TMRan from units to 103 resp. 105 CFU x mL-1, psychrotrophic microorganisms from 101 to 106 CFU x mL-1, micromycets from 101 to 104 CFU x mL-1. In the sheep milk, the following numbers of microorganisms were determined: TCM from 105 to 106 CFU x mL-1, lactobacilli from 103 to 106 CFU x mL-1, bacteria fam. Enterobacteriaceae from 101 to 105 CFU x mL-1, enterococci from 101 to 104 CFU x mL-1, TMRae and TMRan from units to 105 CFU x mL-1, psychrotrophic microorganisms from 104 to 106 CFU x mL-1, micromycets from 102 to 104 CFU x mL-1. From the above mentioned results, the following conclusions can be suggested. The bacterial counts of raw goat and sheep milk are highly variable and influenced by a number of important factors in the course of lactation and year (temperature, health, secondary contamination etc.. The bacterial numbers are not affected by the stage of lactation. High numbers of microorganisms in goat and sheep milk may be primarily

  8. INFLUENCE OF BETAINE ON GOAT MILK YIELD AND BLOOD METABOLITES

    Directory of Open Access Journals (Sweden)

    Carlos Javier Fernandez

    2009-02-01

    Full Text Available Betaine is a natural occurring compound with methyl donor properties which is increasingly being used in animal feeding. Betaine, an oxidative product of choline is able to replace methionine in some physiologically important body processes. The subject of this work was to study the effect of betaine added to the diet on milk production and blood metabolites on Murciano-Granadina dairy goats.  Sixty lactating goats were selected from a commercial Murciano-Granadina goat herd (EXCAMUR S.L. located in Murcia Region (Spain. Goats were selected from a 250 goats herd, taken  into account the age, stage of lactation (2.5 as average, live weight (36 kg as average and type of birth (2 kids. Two homogenous groups of 30 goats were made and fed with 1.5 kg of compound feed and 1 kg of alfalfa hay per day and goat. Goats were fed twice a day and water was provided ad libitum. Both groups received the same diet but for the second group the diet was supplemented with 4 g∙kg-1 betaine (betaine anhydrous, Danisco Animal Nutrition. The feeds, presented in pellets, were formulated in based on recommendations of INRA (2007. The experimental period was 6 months and the experimental diets were provided 15 days before parturition. The herd was machine milked once at day. Chemical composition, milk production and blood metabolites of each goat were recorded and analyzed at the end of the trial. Variance analysis and means comparison were carried out using the general lineal model procedure and Tukey test for mean comparison. Goats fed with betaine diet had higher milk fat than goats fed control diet (4.8 vs. 5.2 % for control and betaine respectively; P

  9. Survey to determine why people drink raw milk.

    Science.gov (United States)

    Mullin, Gerard E; Belkoff, Stephen M

    2014-11-01

    Fragility fractures associated with osteoporosis extract a large financial and personal toll on society. Pharmaceutical or dietary calcium intake is needed to increase bone mineral density to prevent fragility fractures. Although dairy products are a good source of calcium, patients who are unable to digest lactose tend to avoid them and are put at a greater risk for fracture than the general population. Anecdotal reports suggest that lactose maldigesters, when consuming raw milk, have a dramatic reduction in symptoms relative to pasteurized milk. The mechanism of the reported reduction in symptoms, if true, is unknown. The purpose of the current study was to survey raw milk drinkers to ascertain their health-related motivations for consuming raw milk, especially as they relate to lactose maldigestion. An online survey regarding raw milk was completed by 153 of 1527 members of a raw milk-buying community. The primary reason the respondents cited for drinking raw milk was that they believed it was more healthful; 30% reported some gastrointestinal discomfort when drinking pasteurized milk, yet almost all (99%) reported consuming raw milk without discomfort. Despite the reports of gastrointestinal discomfort, only 5% of respondents had been diagnosed as lactose intolerant by a medical professional, and only 1% had been diagnosed as lactose intolerant via the gold-standard hydrogen breath test. The primary motivation for drinking raw milk is its perceived health value, not its digestibility. Although raw milk appears to be more easily digested than pasteurized milk in our survey sample, the mechanism of digestibility remains unknown.

  10. Hygienic quality of raw milk with regard to legislation

    Directory of Open Access Journals (Sweden)

    Slavko Kirin

    2001-01-01

    Full Text Available Hygienic quality of raw milk is basic indicator of hygienic conditionduring processing and handling of milk as well as economical valorisation of animal product as a raw material in dairy products manufacture. Thus, total bacterial count in 1 mL of raw milk is used in modern legislation in milk pricing system. Apart from the economical and technological reasons hygienic quality of raw milk is also important from the health safety issue. In this paper microbiological quality legislation, set down by the EU and Croatian directives, are presented. Apart form the total microorganisms number the normative on the somatic cell number in row milk, as one of the quality indicators, are also presented. Pricing system of raw milk with regard to hygienic quality, current legislation especially from the point of view of a new legislation on row milk quality as well as suggestions to faster association into progressive dairy, legislation are listed.

  11. Seroprevalence, Detection of DNA in Blood and Milk, and Genotyping of Toxoplasma gondii in a Goat Population in Italy

    Directory of Open Access Journals (Sweden)

    Francesca Mancianti

    2013-01-01

    Full Text Available Toxoplasma gondii is the causative agent of a major zoonosis with cosmopolitan distribution and is known to be transmitted mainly by the ingestion of undercooked or raw animal products. Drinking unpasteurized goat’s milk is a risk factor associated with human toxoplasmosis. However, very little is known about the excretion of DNA in goat milk. Aim of the present study was to determine the seroprevalence of T. gondii infection using a modified agglutination test (MAT, to detect T. gondii DNA by nested-PCR (n-PCR in samples of blood and milk from seropositive goats, and to genotype DNA isolates using 11 molecular markers in 127 adult lactating goats from 6 farms in Italy. Positive MAT results were found in 60.6% of goats while 13% of blood and milk samples from seropositive goats were positive to n-PCR. A kappa coefficient of 1 indicated a perfect agreement between blood and milk n-PCR. Genetic characterization of isolates revealed the occurrence of genotype III (, genotype I (, and atypical genotypes with hints for genotype I (. Our results suggest that the risk of excretion of Toxoplasma tachyzoites might frequently occur in milk of seropositive goats testing positive to n-PCR on blood.

  12. Perception of Sheep and Goat Milk Consumption among Rural ...

    African Journals Online (AJOL)

    A total of 120 respondents were purposively selected to study the perception of sheep and goat milk consumption among rural dwellers in South-Western Nigeria. The study showed that most of the respondents (72.5%) are not aware of the consumption of such milk and as such only few (10, 8%) claimed that they have ...

  13. Milk production potential of South African Boer and Nguni goats

    African Journals Online (AJOL)

    Unknown

    Given the ever-growing human population, particularly in the rural areas of ... of the NG were randomly allocated to extensive (veld) and intensive (high energy ... Table 1 Goat milk production and composition (7-100 days) for Boer and Nguni does. ... breeds to produced 0.75, 1.0 and 0.6 kg/milk/day respectively, which in ...

  14. Survey on the fatty acids profile of fluid goat milk

    Directory of Open Access Journals (Sweden)

    Daniela Pittau

    2013-10-01

    Full Text Available Fluid goat milk submitted to thermal treatment has interesting nutritional properties and a potential expanding market. The present study was aimed to conduct fatty acids profile characterisation of goat milk placed on market. Forty-nine fluid milk samples were collected: 12 pasteurised, 12 pasteurised at high temperature, 11 ultrahigh temperature (UHT whole milk and 14 UHT semi-skimmed milk. Milk samples were collected at retail level from 7 different companies and from different production batches. After extraction and methilation, fatty acids (FAs profile was determined on each sample using a gas chromatograph with flame ionisation detector (GC-FID with high-polarity capillary column. The concentration (g/100mL of saturated fatty acids (SFAs, monounsaturated fatty acids (MUFAs, polyunsaturated fatty acids (PUFAs, trans fatty acids (t-FAs, and isomers of conjugated linoleic acid (CLA was determined. N-6/n-3 ratio, atherogenic index (AI and thrombogenic index (TI were also assessed. Fluid goat milk lipid profile was characterised by SFAs (68.4% of total FAs, PUFAs (5.3%, MUFAs (21.3%, t-FAs (3.6% and CLA (0.8%. The most represented fatty acids were: 16:0 (24.5%, 9cis-18:1 (18.2%, 18:0 (9.6%, 14:0 (9.5%, 10:0 (9.3% and 12:0 (4.5%. Nutritional indices were 2.8-6.8 for n-6/n-3 ratio; 2.3-2.9 for AI; and 2.7-3.2 for TI. Milk produced by small scale plants, with no milk fat standardisation, showed greater differences in fatty acid profile as compared to industrial plants milk. Large scale production is characterised by commingled bulk tank milk of different origins and then is more homogeneous. The whole goat milk supply chain should be controlled to obtain milk with fatty acids of high nutritional value.

  15. Reproduction and milk production performances of Draa goats in Morocco

    Directory of Open Access Journals (Sweden)

    I. Boujenane

    2010-03-01

    Full Text Available The main objective of this study was a contribution to the knowledge of Draa goats. The study concerned the analysis of reproduction and milk production performances of Draa goats at Skoura research station from 1989 to 2001. Age at first kidding, gestation period, kidding interval, and kidding to conception interval averaged 25.5 months, 153 days, 157 days and 206 days, respectively. The lactation period was 133 days. Daily milk production and total milk production were 0.46 and 61.3 kg, respectively. It was concluded that it would be interesting to make use of the genetic variability present in the breed for selection purposes.

  16. Role of milk protein-based products in some quality attributes of goat milk yogurt.

    Science.gov (United States)

    Gursel, A; Gursoy, A; Anli, E A K; Budak, S O; Aydemir, S; Durlu-Ozkaya, F

    2016-04-01

    Goat milk yogurts were manufactured with the fortification of 2% (wt/vol) skim goat milk powder (SGMP), sodium caseinate (NaCn), whey protein concentrate (WPC), whey protein isolate (WPI), or yogurt texture improver (YTI). Yogurts were characterized based on compositional, microbiological, and textural properties; volatile flavor components (with gas chromatography); and sensory analyses during storage (21d at 5 °C). Compared with goat milk yogurt made by using SGMP, the other goat milk yogurt variants had higher protein content and lower acidity values. Goat milk yogurts with NaCn and WPC, in particular, had better physical characteristics. Using WPI caused the hardest structure in yogurt, leading to higher syneresis values. Acetaldehyde and ethanol formation increased with the incorporation of WPI, WPC, or YTI to yogurt milk. The tyrosine value especially was higher in the samples with NaCn and YTI than in the samples with WPC and WPI. Counts of Streptococcus thermophilus were higher than the counts of Lactobacillus delbrueckii ssp. bulgaricus, possibly due to a stimulatory effect of milk protein-based ingredients other than SGMP on the growth of S. thermophilus. Yogurt with NaCn was the best accepted among the yogurts. For the parameters used, milk protein-based products such as NaCn or WPC have promising features as suitable ingredients for goat milk yogurt manufacture. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  17. The Production of Goat Milk under Organic Requests

    Directory of Open Access Journals (Sweden)

    Roger Stan

    2011-10-01

    Full Text Available Organic farming has turned into a very important subject who consists in a food production label and it has become very popular. That is because, especially in the EU the majority of the dairy goat farms want or have already applied the organic farming in order to benefit not only from the good price of milk but also from the given positive image. The main issue of this study is the high production of goat milk using organic farming under specific regulations. Therefore, the organic farming is based on a safe environment, 100% organic feedstuffs, healthy animals (by prevention of diseases, natural mating, reduced stress in animal rearing, modern stables and milking equipment. A few feeding rations were established to improve the quantity and quality of goat milk.

  18. Introduction of distillate rosemary leaves into the diet of the Murciano-Granadina goat: transfer of polyphenolic compounds to goats' milk and the plasma of suckling goat kids.

    Science.gov (United States)

    Jordán, Maria José; Moñino, María Inmaculada; Martínez, Cristina; Lafuente, Arturo; Sotomayor, José Antonio

    2010-07-28

    The effect of the introduction of distilled rosemary leaves into the diet of the Murciano-Granadina goat on the polyphenolic profile of the goats' milk during the physiological stages of gestation and lactation was studied. The inclusion of rosemary leaves into the animal diet modified neither animal productivity (milk yield) nor milk quality. The following components were found in increased concentration (P goats' milk after the introduction of rosemary leaves into their diet: flavonoids hesperidin, naringin, and genkwanin; gallic acid; and phenolic diterpenes carnosol and carnosic acid. With regard to the transfer of polyphenols to the plasma of the suckling goat kid, a statistically significant increase (P goats' milk and allow for an increased concentration of polyphenolic components in the goats' milk and in the plasma of the suckling goat kid.

  19. Microbiological quality and safety of raw and pasteurized milk ...

    African Journals Online (AJOL)

    This requires urgent attention by the appropriate authorities, because the poor microbiological quality of raw milk and pasteurized milk may expose consumers to health risks associated with the consumption of contaminated milk. Key words: Marketed milk, quality, acidity, total viable count, coliforms, enterobacteriaceae, ...

  20. Determination of Micro minerals in Milk from Farm and Pasture-reared Cow, Goat and Camel; using Inductively Coupled Plasma-Optical Emission Spectrometry

    OpenAIRE

    SirelkhatimBalla Elhardallou; Ashraf Yehia El-naggar

    2016-01-01

    This study covers raw fresh milk of cow, goat and camel (farm and pasture-reared),in addition to two brands of commercial milk samples, liquid milk of powder origin and drinking yoghurt samples. Camel milk showed a relatively lower pH range (6.15 - 6.46) compared cow, goat and commercial milk. The pH of drinking yoghurt was found (4.35 - 4.47).Microwave digestion, was selected followed by mineral analysis using Inductively Coupled Plasma-Optical Emission Spectrometry. Micro minerals; Cd, Cr...

  1. "Don't Have A Cow, Man!": Recognizing Herd Share Agreements for Raw Milk.

    Science.gov (United States)

    Mayer, Timothy J

    2015-01-01

    Dissatisfaction with the industrial model of food production has caused many consumers to seek out food produced on local, family-scale farms that use U.S. Department of Agriculture certified organic or other sustainable practices to grow their food and raise their livestock. While almost all of the types of food that are available at the grocery store can also be found at the local farmers market, one food that is difficult to find in many states is raw milk—that is, milk that has not undergone pasteurization (heat treatment). This difficulty lies in the fact that most states prohibit the direct retail sale of raw milk to the final consumer because public health officials and state legislators fear that raw milk may contain bacteria harmful to human health such as E. coli, Campylobacter, and Listeria. However, some consumers reject these warnings and instead believe that raw milk possesses both nutritional and medicinal qualities. Indeed, an ever-increasing body of scientific research published in peer-reviewed journals supports the claim that raw milk consumption can mitigate or prevent some allergies and infections, especially in young children. In order for consumers to obtain raw milk in states where its sale is prohibited, some consumers have entered into arrangements with farmers known as “herd sharing,” through which the consumer effectively becomes an owner of the herd of cows or goats. For the price of the share and a monthly boarding fee, the shareholder can receive a weekly distribution of the herd’s primary dividend, namely the raw milk. Several states expressly permit this practice while most are silent and still a few prohibit it outright. The three courts in the United States that have ruled on herd share agreements have split, with two courts rejecting the agreements as a circumvention of the state’s prohibition on the sale of raw milk, and the other court assuming the agreement’s validity in light of the state’s failure to adequately

  2. Mineral retention in three-week-old piglets fed goat and cow milk infant formulas

    NARCIS (Netherlands)

    Rutherfurd, S.M.; Darragh, A.J.; Hendriks, W.H.; Prosser, C.G.; Lowry, D.

    2006-01-01

    Goat milk and cow milk are commonly used in infant formula preparations and, as such, understanding the nutritional characteristics of infant formulas made from these milks is important. In this study, a goat milk infant formula was compared with an adapted (whey-enhanced) cow milk infant formula

  3. Aflatoxin M1 levels in raw milk, pasteurised milk and infant formula

    Directory of Open Access Journals (Sweden)

    Sharaf S. Omar

    2016-06-01

    Full Text Available The incidence of contamination of aflatoxin M1 (AFM1 in milk samples collected from the Jordanian market was investigated by using the competitive enzyme linked immunosorbent assay (ELISA technique. A total of 175 samples were collected during 2014-2015. All tested samples were contaminated with various levels of AFM1 ranging from 9.71 to 288.68 ng/kg. The concentration of AFM1 in 66% of fresh milk samples was higher than the maximum tolerance limit accepted by the European Union (50 ng/kg and 23% higher than the maximum tolerance limit accepted by the US (500 ng/kg. Percentages of contaminated raw cow, sheep, goat and camel milk exceeding the European tolerance limit were 60, 85, 75 and 0%, respectively. Of AFM1 contaminated pasteurised cow milk samples, 12% exceeded the European tolerance limit with a range of contamination between 14.60 and 216.78 ng/kg. For infant formula samples, the average concentration of AFM1 was 120.26 ng/kg (range from 16.55 to 288.68 ng/kg, the concentration of AFM1 in 85% of infant formula samples was higher than the maximum tolerance limit accepted by the European Union and the US (25 ng/kg.

  4. Production, composition, fatty acid profile and sensory analysis of goat milk in goats fed buriti oil.

    Science.gov (United States)

    Morais, J S; Bezerra, L R; Silva, A M A; Araújo, M J; Oliveira, R L; Edvan, R L; Torreão, J N C; Lanna, D P D

    2017-01-01

    This study evaluated the effects of replacing ground corn with buriti oil ( L.) on feed intake and digestibility and on the production, composition, fatty acid profile and sensory characteristics of goat milk. A double Latin square (4 × 4) was used; eight goats were distributed in a completely randomized design. The square comprised four periods and four buriti oil concentration (0.00; 1.50; 3.00 and 4.50% of total DM) replacing corn. Intakes of DM, CP, NDF, ADF, non-fibrous carboydrates (NFC) and TDN were not affected by the replacement of corn with oil in the diet. However, lipids intake was increased ( goats with 4.50% oil inclusion, as total DM. DM and CP digestibility were similar between the buriti oil concentrations. However, lipid digestibility increased linearly ( = 0.01) and may have contributed to a quadratic reduction in NDF digestibility ( = 0.01) and a linear reduction of NFC ( = 0.04) with buriti oil content in the goat feed. Goat milk production, corrected production and chemical composition were not influenced by the concentration of buriti oil replacement; however, milk fat concentration ( = 0.04) and feed efficiency ( goat's diet. In contrast, the fatty acids C18:0 ( goats that were fed with buriti oil. However, CLA ( 0.05) by the replacement of corn with buriti oil in the goats' diet. It is recommended to replace corn with buriti oil in goat feed by up to 4.5% of total DM, resulting in improved feed efficiency and milk fat without affecting production; this recommendation satisfies the minimum requirements of the industry and preserves the organoleptic characteristics of the milk and its acceptability for human consumption. In addition, buriti oil replacing ground corn by up to 4.5% DM in the diet of lactating goats decrease medium-chain SFA which are hypercholesterolemic and increase the concentrations of the C18:19, CLA and DFA in goat milk fat, helping to protect against cardiovascular disease.

  5. [Bacteriological evaluation of goat milk and cheese distributed in the Metropolitan Area of San José, Costa Rica].

    Science.gov (United States)

    Araya, Viviana; Gallo, Leslie; Quesada, Carlos; Chaves, Carolina; Arias, María Laura

    2008-06-01

    In the last years, there has been an increase in the production, industrialization and consumption of goat's milk and derivate products, including cheese, worldwide. Nevertheless, in Costa Rica there is no study of these products, reason why the objective of this work was to determine the microbiological characteristics of goat's milk and fresh cheese distributed in the Metropolitan Area of San José, Costa Rica, in order to evaluate its impact in the economical field and as a potential risk for Public Health. A total of 25 raw goat's milk samples, obtained by manual milking from 5 different producers tested in five different dates and 15 cheese samples, elaborated with pasteurized milk, commercially available and coming from three different producers were analyzed. The study included the analysis of spoilage bacteria (total aeobic count and lactic bacteria count), indicators of hygiene (total coliforms), fecal contamination (fecal coliforms), manipulation (Staphylococcus aureus) and pathogens (Listeria monocytogenes and Salmonella spp). High results were obtained for the total aerobic count and lactic bacteria count of the milk and cheese samples, showing a reduced shelf life. Total coliforms, in limits beyond the established ones by the Costa Rican legislation for human consumption raw milk, were found in 100% of milk samples, as well as for fecal coliforms in 76% of them. All cheese samples, except one, were negative for these indicators, suggesting good manufacturing practices. S. aureus counts were low and both Salmonella spp. and L. monocytogenes were not isolated from samples analyzed.

  6. Prevalence of Arcobacter spp. in raw milk and retail raw meats in northern Ireland

    DEFF Research Database (Denmark)

    Scullion, R.; Harrington, C.S.; Madden, R.H.

    2006-01-01

    A 1-year study was undertaken to determine the prevalence of Arcobacter spp. in raw milk and retail raw meats on sale in Northern Ireland. Retail raw poultry samples (n = 94), pork samples (n = 101), and beef samples (n = 108) were obtained from supermarkets in Northern Ireland, and raw milk samp...... from raw milk samples. Arcobacter cryaerophilus was detected less frequently, and Arcobacter skirrowii was detected only as a cocontaminant. To our knowledge, this is the first report of Arcobacter spp. prevalence in a diverse range of products of animal origin in Northern Ireland....

  7. Short-term effects of milking frequency on milk yield, milk composition, somatic cell count and milk protein profile in dairy goats

    DEFF Research Database (Denmark)

    Torres, Alexandr; Hernandez Castellano, Lorenzo E; Morales-delaNuez, Antonio

    2014-01-01

    Goats in Canary Islands are milked once a day by tradition, but in most countries with high technology on farms, goats are milked twice a day, which is known to improve milk yield. Therefore it is important to know whether the increase of milking frequency can improve the production without impai...... was returned to X2 and X1. Finally, quantitative analysis showed an increase in intensities of milk protein bands from X1 to X2, but the intensities of casein bands (αS1-CN, αS2-CN, β-CN, κ-CN) and major whey proteins (α-La, β-Lg) decreased from X2 to X3.......Goats in Canary Islands are milked once a day by tradition, but in most countries with high technology on farms, goats are milked twice a day, which is known to improve milk yield. Therefore it is important to know whether the increase of milking frequency can improve the production without...... impairing milk quality. The objective of this study was to investigate the short term effects of three milking frequencies on milk yield, milk composition, somatic cell count (SCC) and milk protein profile in dairy goats traditionally milked once a day. Twelve Majorera goats in early lactation (48±4 d...

  8. Incidence of Escherichia coli  - Glucuronidase Positive on Goat Milk

    Directory of Open Access Journals (Sweden)

    Zorica Voşgan

    2016-11-01

    Full Text Available Papers on beta- glucuronidase sensitivity and specificity for identifying Escherichia coli in sources of environment, food, water, etc. have been published since 1976. In this study we conducted a review of the incidence of E. coli β- glucuronidase -positive in goat milk, obtained by hand milking throughout the lactation: spring, summer, autumn. The presence of E. coli in milk is considered both as a health indicator and a pathogenic factor capable of causing food poisoning. The determination of the E. coli β-glucuronidase-positive was carried using TBX medium by cultivating colonies typical blue at 440C. The absence of E. coli in milk yielded during the spring, when the animal milking is done three times a day, was found in the performed analyses; the same was observed during fall, when the milk production is lower and the milking is done once a day. The load of E. coli β-glucuronidase-positive was averaging 66.67 CFU/ml of goat milk, during the middle lactation period (July-August, in conditions of higher temperature. During this period, milking is done in the mountain zone, where the transhumance of animals takes place in summer. The presence of the species E. coli was also confirmed by microscopic examination. Attention should be paid to hygiene and milk should be immediately cooled, during hot weather, as E. coli can be a source of food poisoning.

  9. Pasteurization of goat milk using a low cost solar concentrator

    Energy Technology Data Exchange (ETDEWEB)

    Franco, Judith; Saravia, Luis; Javi, Veronica; Caso, Ricardo; Fernandez, Carlos [INENCO - UNSa, Av. Bolivia 5150, 4400, Salta (Argentina)

    2008-11-15

    This paper presents the design of a system for pasteurizing goat milk as a part of a process for artisan elaboration of cheese. The system consists in a Fresnel type concentrator used for cooking large amounts of food with a vaporizer located in the focus. The steam bubbles into the isolated container where the milk is cooked by a double boiler. When the desired temperature is reached, the steam flow is closed and the milk remains in this condition for 30 min into the closed container. Pasteurizing of 10 l of milk is done in about 1 h. The project considers guidelines for achieving a successful process. (author)

  10. Analysis of polymorphisms in milk proteins from cloned and sexually reproduced goats.

    Science.gov (United States)

    Xing, H; Shao, B; Gu, Y Y; Yuan, Y G; Zhang, T; Zang, J; Cheng, Y

    2015-12-08

    This study evaluates the relationship between the genotype and milk protein components in goats. Milk samples were collected from cloned goats and normal white goats during different postpartum (or abortion) phases. Two cloned goats, originated from the same somatic line of goat mammary gland epithelial cells, and three sexually reproduced normal white goats with no genetic relationships were used as the control. The goats were phylogenetically analyzed by polymerase chain reaction-restriction fragment length polymorphism. The milk protein components were identified by sodium dodecyl sulfate polyacrylamide gel electrophoresis. The results indicated that despite the genetic fingerprints being identical, the milk protein composition differed between the two cloned goats. The casein content of cloned goat C-50 was significantly higher than that of cloned goat C-4. Conversely, although the genetic fingerprints of the normal white goats N-1, N-2, and N-3 were not identical, the milk protein profiles did not differ significantly in their milk samples (obtained on postpartum day 15, 20, 25, 30, and 150). These results indicated an association between milk protein phenotypes and genetic polymorphisms, epigenetic regulation, and/or non-chromosomal factors. This study extends the knowledge of goat milk protein polymorphisms, and provides new strategies for the breeding of high milk-yielding goats.

  11. Seasonal variation in the Dutch bovine raw milk composition

    NARCIS (Netherlands)

    Heck, J.M.L.; Valenberg, van H.J.F.; Dijkstra, J.; Hooijdonk, van A.C.M.

    2009-01-01

    In this study, we determined the detailed composition of and seasonal variation in Dutch dairy milk. Raw milk samples representative of the complete Dutch milk supply were collected weekly from February 2005 until February 2006. Large seasonal variation exists in the concentrations of the main

  12. Composition of raw cow milk and artisanal yoghurt collected in ...

    African Journals Online (AJOL)

    The composition of milk is of most importance to the dairy industry and human health. This study was conducted to provide data on the composition of raw cow milk and artisanal yoghurt collected in Maroua (Cameroon). Milk and yoghurt samples were collected from 11 breeding sites and 12 producers in the city of Maroua, ...

  13. Microbes from raw milk for fermented dairy products

    NARCIS (Netherlands)

    Wouters, J.T.M.; Ayad, E.H.E.; Hugenholtz, J.; Smit, G.

    2002-01-01

    Milk has a high nutritive value, not only For the new-born mammal and for the human consumer, but also for microbes. Raw milk kept at roam temperature will be liable to microbial spoilage. After some days, the milk will spontaneously become sour. This is generally due to the activity of lactic acid

  14. True ileal amino acid digestibility of goat and cow milk infant formulas

    NARCIS (Netherlands)

    Rutherfurd, S.M.; Darragh, A.J.; Hendriks, W.H.; Prosser, C.G.; Lowry, D.

    2006-01-01

    Goat milk is used as an alternative to cow milk for the production of infant formulas. However, little is known about the protein quality and, specifically, about the digestible AA pattern of goat milk formulas compared with their cow milk counterparts. In this study, the true ileal AA digestibility

  15. 21 CFR 135.115 - Goat's milk ice cream.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Goat's milk ice cream. 135.115 Section 135.115 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION FROZEN DESSERTS Requirements for Specific Standardized Frozen Desserts § 135.115...

  16. Occurrence of Salmonella, Listeria monocytogenes, and enterotoxigenic Staphylococcus in goat milk from small and medium-sized farms located in Minas Gerais State, Brazil.

    Science.gov (United States)

    Cavicchioli, V Q; Scatamburlo, T M; Yamazi, A K; Pieri, F A; Nero, L A

    2015-12-01

    Consumption of goat milk has been increasing due to its nutritional characteristics and health benefits. Therefore, assessment of the presence of foodborne pathogens in this product is critical to ensure its safety to consumers. The present study aimed to identify common foodborne pathogens in raw goat milk. Fifty-three samples of raw goat milk from 11 farms were collected and cultured for the presence of Salmonella spp. and Listeria monocytogenes, as well as for enumeration and isolation of coagulase-positive and coagulase-negative Staphylococcus (CPS and CNS, respectively). All samples tested negative for Salmonella spp. and L. monocytogenes. The CPS counts in raw goat milk samples were predominantly less than 2 log cfu/mL (n=39), and CNS counts were predominantly higher than 3 log cfu/mL (n=42). Based on Staphylococcus counts, 51 isolates were selected (CPS=26; CNS=25) and tested by PCR for the presence of classic enterotoxin-encoding genes (sea, seb, sec, sed, and see). Only 3 isolates (CPS=2, CNS=1) were negative for all enterotoxin-encoding genes tested, and the genotype sec and see was the most frequent (n=16), followed by sea, sec, and see (n=13) and sec (n=13); sed was not detected in any isolate. The frequencies of enterotoxin-encoding genes for CPS and CNS were similar, demonstrating the equivalence of both groups in harboring these virulent markers. These results suggest that Salmonella and L. monocytogenes are not frequent contaminants of raw goat milk, but that Staphylococcus spp. that are capable of producing enterotoxins are prevalent; therefore, consumers of raw goat milk and products made from raw milk are at risk. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  17. Prevalence of Listeria monocytogenes in raw bovine milk and milk products from central highlands of Ethiopia.

    Science.gov (United States)

    Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe

    2015-11-30

    Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.

  18. Microbiological quality of goat milk on rural properties in the region of Macaíba/RN

    Directory of Open Access Journals (Sweden)

    Joyce Bruna Paiva Silva

    2018-02-01

    Full Text Available Goat’s milk is an excellent food that can guarantee beneficial effects to human health, but its characteristics are easily altered by the action of microorganisms and by manipulation. The present study aimed to evaluate the microbiological quality of goat milk in 11 farms in the region of Macaíba/RN. Samples of milk and swabs from the hands of milkers, utensils and goat teats were collected and transported in a thermal box (10 ºC – 12 ºC to the Laboratory of Food Engineering of UFRN. The microorganisms studied were the aerobic mesophilic bacteria, psychrotrophic, coagulase positive and negative staphylococci, coliforms at 35 ºC and 45 ºC. Regarding the hands of milkers, 56% presented contamination by aerobic mesophilic bacteria. In the analyzed utensils were found, in 18.2%, coliforms at 45 ºC and coagulase positive staphylococci, as well as coagulase negative staphylococci (63.6% and coliforms at 35 ºC in 27.3% of the samples. For cold raw goat milk, 10% of the samples presented contamination with psychrotrophic and 17% with coliforms at 45 ºC. Regarding goat teats, 52% of the samples had aerobic mesophilic bacteria counts above 103 CFU/ceiling, 61% presented coagulase negative staphylococci and 10% coagulase positive staphylococci, this one of the main agents causing mastitis. Thus, these values indicate that hygienic procedures need to be adopted appropriately in the milking of raw goat milk, requiring guidelines that enable producers to obtain higher quality milk.

  19. Spoilage potential of Pseudomonas species isolated from goat milk.

    Science.gov (United States)

    Scatamburlo, T M; Yamazi, A K; Cavicchioli, V Q; Pieri, F A; Nero, L A

    2015-02-01

    Pseudomonas spp. are usually associated with spoilage microflora of dairy products due to their proteolytic potential. This is of particular concern for protein-based products, such as goat milk cheeses and fermented milks. Therefore, the goal of the present study was to characterize the proteolytic activity of Pseudomonas spp. isolated from goat milk. Goat milk samples (n=61) were obtained directly from bulk tanks on dairy goat farms (n=12), and subjected to a modified International Organization for Standardization (ISO) protocol to determine the number and proteolytic activity of Pseudomonas spp. Isolates (n=82) were obtained, identified by PCR, and subjected to pulsed-field gel electrophoresis with XbaI macro-restriction. Then, the isolates were subjected to PCR to detect the alkaline protease gene (apr), and phenotypic tests were performed to check proteolytic activity at 7°C, 25°C, and 35°C. Mean Pseudomonas spp. counts ranged from 2.9 to 4.8 log cfu/mL, and proteolytic Pseudomonas spp. counts ranged from 1.9 to 4.6 log cfu/mL. All isolates were confirmed to be Pseudomonas spp., and 41 were identified as Pseudomonas fluorescens, which clustered into 5 groups sharing approximately 82% similarity. Thirty-six isolates (46.9%) were positive for the apr gene; and 57 (69.5%) isolates presented proteolytic activity at 7°C, 82 (100%) at 25°C, and 64 (78%) at 35°C. The isolates were distributed ubiquitously in the goat farms, and no relationship among isolates was observed when the goat farms, presence of apr, pulsotypes, and proteolytic activity were taken into account. We demonstrated proteolytic activity of Pseudomonas spp. present in goat milk by phenotypic and genotypic tests and indicated their spoilage potential at distinct temperatures. Based on these findings and the ubiquity of Pseudomonas spp. in goat farm environments, proper monitoring and control of Pseudomonas spp. during production are critical. Copyright © 2015 American Dairy Science Association

  20. Encephalitozoon cuniculi in Raw Cow's Milk Remains Infectious After Pasteurization.

    Science.gov (United States)

    Kváč, Martin; Tomanová, Vendula; Samková, Eva; Koubová, Jana; Kotková, Michaela; Hlásková, Lenka; McEvoy, John; Sak, Bohumil

    2016-02-01

    This study describes the prevalence of Encephalitozoon cuniculi in raw cow's milk and evaluates the effect of different milk pasteurization treatments on E. cuniculi infectivity for severe combined immunodeficient (SCID) mice. Using a nested polymerase chain reaction approach, 1 of 50 milking cows was found to repeatedly shed E. cuniculi in its feces and milk. Under experimental conditions, E. cuniculi spores in milk remained infective for SCID mice following pasteurization treatments at 72 °C for 15 s or 85 °C for 5 s. Based on these findings, pasteurized cow's milk should be considered a potential source of E. cuniculi infection in humans.

  1. Research on the preparation, uniformity and stability of mixed standard substance for rapid detection of goat milk composition.

    Science.gov (United States)

    Zhu, Yuying; Wang, Jianmin; Wang, Cunfang

    2018-05-01

    Taking fresh goat milk as raw material after filtering, centrifuging, hollow fiber ultrafiltration, allocating formula, value detection and preparation processing, a set of 10 goat milk mixed standard substances was prepared on the basis of one-factor-at-a-time using a uniform design method, and its accuracy, uniformity and stability were evaluated by paired t-test and F-test of one-way analysis of variance. The results showed that three milk composition contents of these standard products were independent of each other, and the preparation using the quasi-level design method, and without emulsifier was the best program. Compared with detection value by cow milk standards for calibration fast analyzer, the calibration by goat milk mixed standard was more applicable to rapid detection of goat milk composition, detection value was more accurate and the deviation showed less error. Single factor analysis of variance showed that the uniformity and stability of the mixed standard substance were better; it could be stored for 15 days at 4°C. The uniformity and stability of the in-units and inter-units could meet the requirements of the preparation of national standard products. © 2018 Japanese Society of Animal Science.

  2. A comparative analysis of acceptance by Japanese females and price of goat milk from different sources.

    Science.gov (United States)

    Ozawa, Takeyuki; Takada, Ruriko; Nishitani, Jiro; Fujita, Masaru; Blair, Hugh T

    2010-04-01

    A sensory survey was carried out using 4 different types of whole goat milk among middle-class females to investigate consumer acceptability of goat milk and whether there is an opportunity to expand the sale of goat milk products in Japan. Four different types of whole milk powder (domestic concentrate-fed, domestic pasture-fed, USA commercially canned, and New Zealand commercially canned) were used. Fresh cow milk was served as a control. Thirty-one housewives evaluated the 5 liquid milk samples for smell, taste and overall characteristics on a scale of 1 (low) to 3 (high). Chi-square analyses were carried out to detect significant differences between the milk types in each category. The goat milk from the USA was the most preferred goat milk with respect to smell and overall evaluation. Domestic pasture-fed milk received the lowest grade in the evaluation for its 'grassy and goaty' smell. This result shows us that pasture intake affects the taste and smell of powdered milk which gives the lowest evaluation by the participants. If Japanese goat milk producers want to be successful in the domestic goat milk market and compete against goat milk products from other countries, they should improve production methods and flavor of their products.

  3. Detection of mycoplasmas in goat milk by flow cytometry.

    Science.gov (United States)

    Assunção, Patricia; Davey, Hazel M; Rosales, Ruben S; Antunes, Nuno T; de la Fe, Christian; Ramirez, Ana S; de Galarreta, Carlos M Ruiz; Poveda, Jose B

    2007-12-01

    The detection of mycoplasma in milk can be performed by either culture techniques or polymerase chain reaction (PCR) based methods. Although PCR can reduce the average diagnostic time to 5 h in comparison with the several days for the isolation of the agent, there is still a need to develop methods, which could give earlier results. For this purpose, we tested the ability of flow cytometry (FC) to detect mycoplasmas in milk samples. Milk samples inoculated with four different mycoplasmas, Mycoplasma agalactiae, Mycoplasma putrefaciens, Mycoplasma capricolum subsp. Capricolum, or Mycoplasma mycoides subsp. mycoides large-colony type, known to cause contagious agalactia in goats, were stained with the DNA stain SYBR Green I and analyzed by FC. Three goat milk samples, from which mycoplasmas have been isolated in broth medium were also analyzed. All mycoplasmas were easily distinguished from debris of milk samples, but it was not possible to distinguish between the different mycoplasma species. In our conditions, the detection limit of the technique was of the order of 10(3)-10(4) cells ml(-1). Furthermore, mycoplasmas were also distinguished from Staphylococcus aureus. FC together with SYBR Green I was able to distinguish between mycoplasma cells and debris present in milk samples and gave results in 20-30 min. This is an important first step in developing a robust, routine flow cytometric method for the detection of mycoplasmas in milk samples. (c) 2007 International Society for Analytical Cytology

  4. Transfer of Orally Administered Terpenes in Goat Milk and Cheese

    Directory of Open Access Journals (Sweden)

    I. Poulopoulou

    2012-10-01

    Full Text Available The objective of the present study was to investigate the relationships between terpenes’ intake and their presence in animal tissues (blood and milk as well as in the final product (cheese. Eight dairy goats were divided in two balanced groups, representing control (C and treatment (T group. In T group oral administration of a mixture of terpenes (α-pinene, limonene and β-caryophyllene was applied over a period of 18 d. Cheese was produced, from C and T groups separately, on three time points, twice during the period of terpenes’ oral administration and once after the end of experiment. Terpenes were identified in blood by extraction using petroleum ether and in milk and cheese by the use of solid phase micro-extraction (SPME method, followed by GC-MS analysis. Chemical properties of the milk and the produced cheeses were analyzed and found not differing between the two groups. Limonene and α-pinene were found in all blood and milk samples of the T group after a lag-phase of 3 d, while β-caryophyllene was determined only in few milk samples. Moreover, none of the terpenes were traced in blood and milk of C animals. In cheese, terpenes’ concentrations presented a more complicated pattern implying that terpenes may not be reliable feed tracers. We concluded that monoterpenes can be regarded as potential feed tracers for authentification of goat milk, but further research is required on factors affecting their transfer.

  5. Prevalence and distribution of Arcobacter spp. in raw milk and retail raw beef.

    Science.gov (United States)

    Shah, A H; Saleha, A A; Murugaiyah, M; Zunita, Z; Memon, A A

    2012-08-01

    A total of 106 beef samples which consisted of local (n = 59) and imported (n = 47) beef and 180 milk samples from cows (n = 86) and goats (n = 94) were collected from Selangor, Malaysia. Overall, 30.2% (32 of 106) of beef samples were found positive for Arcobacter species. Imported beef was significantly more contaminated (46.80%) than local beef (16.9%). Arcobacter butzleri was the species isolated most frequently from imported (81.8%) and local (60%) beef, followed by Arcobacter cryaerophilus in local (33.3%) and imported (18.2%) beef samples. Only one local beef sample (10%) yielded Arcobacter skirrowii. Arcobacter species were detected from cow's milk (5.8%), with A. butzleri as the dominant species (60%), followed by A. cryaerophilus (40%), whereas none of the goat's milk samples were found positive for Arcobacter. This is the first report of the detection of Arcobacter in milk and beef in Malaysia.

  6. Effects of storage on the major constituents of raw milk

    Directory of Open Access Journals (Sweden)

    Peter Zajác

    2015-10-01

    Full Text Available Milk testing and quality control should be carried out at all stages of the dairy chain. Milk can be tested for quantity, organoleptic characteristic, compositional characteristic, physical and chemical characteristics, hygienic characteristics, adulteration or drug residues. The content of the major constituents of raw milk is important for milk payment system. Enzymes naturally present in the milk can change the chemical composition of raw milk. Also, enzymes secreted by bacteria or enzymes from somatic cells can degrade the raw milk composition. Products of these degradation reactions can have undesirable effects on milk structure, smell and taste. It is very important that farm-fresh raw milk be cooled immediately to not more than 8 °C in the case of daily collection, or not more than 6 °C if collection is not daily. During transport the cold chain must be maintained. An authorized person, properly trained in the appropriate technique, shall perform sampling of bulk milk in farm. Laboratory samples should be dispatched immediately after sampling to the dairy company and consequently to the testing laboratory. The time for dispatch of the samples to the testing laboratory should be as short as possible, preferably within 24 h. Laboratory samples shall be transported and stored at temperature 1 to 5 °C. Higher temperatures may adversely affect the composition of the laboratory sample and may cause disputes between the farmer, the dairy company and the laboratory. The effect of refrigerated storage at temperature 4 °C during 24 h on the composition of raw milk were investigated in this work, because we wanted to know how the milk composition will be changed and how the laboratory results will be affected. In many cases, the samples are not preserved with chemical preservants like azidiol, bronopol, potassium dichromate or Microtabs. We found, that the composition of raw cows' milk after 24 was changed significantly (p >0.005. We found an

  7. [Composition of nutrients and minerals in some goat milk products].

    Science.gov (United States)

    Gajewska, R; Ganowiak, Z; Nabrzyski, M

    1997-01-01

    The paper contains results of determinations of protein, fat, carbohydrates, water and minerals (Ca, P, Fe, Mn, Cu, Zn, Na, K) in 12 goat milk products. The nutrient components were determined by general approved analytical methods. Minerals like Ca, Fe, Mn, Cu, Zn, Na and K were determined by the flame ASA method. Phosphorus was determined as phosphates by colorimetric method with ammonium molybdate. Mean percentage content of protein, fat, carbohydrates and water were: 9.7-25.7; 1.4-33.5; 2.2-70.2; and 3.0-77.4 respectively. The content of minerals according to the products of goat milk were as follow: 86-1113 mg% Ca; 96-846 mg% P; 0.2-2.4 mg% Fe; 6-148 mg% Mg; 0.002-0.284 mg% Mn; 0.071-0.754 mg% Cu; 1.1-3.9 mg% Zn; 63-1281 mg% K and 27-407 mg% Na. The levels of nutrients and mineral composition of the examined goat milk products were similar to that of the cows milk products.

  8. Seasonal variation in the Dutch bovine raw milk composition.

    Science.gov (United States)

    Heck, J M L; van Valenberg, H J F; Dijkstra, J; van Hooijdonk, A C M

    2009-10-01

    In this study, we determined the detailed composition of and seasonal variation in Dutch dairy milk. Raw milk samples representative of the complete Dutch milk supply were collected weekly from February 2005 until February 2006. Large seasonal variation exists in the concentrations of the main components and milk fatty acid composition. Milk lactose concentration was rather constant throughout the season. Milk true protein content was somewhat more responsive to season, with the lowest content in June (3.21 g/100 g) and the highest content in December (3.38 g/100 g). Milk fat concentration increased from a minimum of 4.10 g/100 g in June to a maximum of 4.57 g/100 g in January. The largest (up to 2-fold) seasonal changes in the fatty acid composition were found for trans fatty acids, including conjugated linoleic acid. Milk protein composition was rather constant throughout the season. Milk unsaturation indices, which were used as an indication of desaturase activity, were lowest in spring and highest in autumn. Compared with a previous investigation of Dutch dairy milk in 1992, the fatty acid composition of Dutch raw milk has changed considerably, in particular with a higher content of saturated fatty acids in 2005 milk.

  9. Study Regarding Goat Milk Composition and the Growth Rate in Kids of Carpatina Goat Breed

    Directory of Open Access Journals (Sweden)

    Sorin Voia

    2010-10-01

    Full Text Available The aim of the study was to determine the fat and protein content from goat colostrum and milk at weaning the kids. Also, the growth rate of kids was determined during the 50 days of milk feeding period. The experiment was carried out on 8 Carpatina breed goats with their twin male/female couple kids (n=16. Fat and protein content is significant higher (p<0,001 by 8.12 and 13.2 percentage points, respectively compared to normal goat milk. Body weight at birth was on average 2.72 kg for females and 2.89 kg for males. At the end of experimental period, body weight of males was 2.15 kg higher compared to females. Average daily gain during the milk feeding period was 41.97 g/day significantly higher (p<0.001 in males (168.85 g/day than in females (126.88 g/day.

  10. Training small producers in Good Manufacturing Practices for the development of goat milk cheese

    Directory of Open Access Journals (Sweden)

    Adriana Noemí RAMÓN

    Full Text Available Abstract Training in Good Manufacturing Practices enhances quality during food processing. This paper evaluates GMP training aimed at improving the chemical, sensory and microbiological quality of goat milk cheese. We worked with 26 families that produce cheese as their main source of income. Semi-structured interviews and observation were conducted to select relevant topics. The manufacturing processes were compared and samples were analyzed before and after GMP training. We trained 80% of the producers. Before receiving training, they used to make cheese from raw milk in unhygienic conditions and with little equipment. The products obtained had bad sensory characteristics, cracks, eyes on the pasta, a high number of aerobic mesophilic bacteria and total coliforms. After training, the producers pasteurized the milk and standardized processing procedures, resulting in final products that contained higher protein and calcium content, suitable sensory characteristics, and a significant reduction in microorganisms, with total coliforms falling to ≤ 5.103 UFC/g. Therefore, this study shows that the manufacturing process and the chemical, sensory and microbiological parameters of goat milk cheese improved after GMP training.

  11. Quality control of raw cows' milk by headspace analysis

    NARCIS (Netherlands)

    Hettinga, K.A.; Valenberg, van H.J.F.; Hooijdonk, van A.C.M.

    2008-01-01

    This study investigated whether headspace analysis of volatile components can be used for monitoring the quality of raw cows¿ milk. The detection of different quality defects caused by cows¿ feed, microbiological and chemical contamination, as well as enzymatic deterioration was studied. Fresh raw

  12. Incorporation of Listeria monocytogenes strains in raw milk biofilms.

    Science.gov (United States)

    Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias

    2013-02-01

    Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Development of a goat fermented milk with probiotics starter culture

    Directory of Open Access Journals (Sweden)

    Aldo Hernández-Monzón

    2016-07-01

    Full Text Available The goat milk for their multiple properties nutraceutical and for the high yield of their derived products, it represents an interesting commercial alternative for the elaboration of special fermented milk. At the present time the probiotics starter culture for their proven properties are used thoroughly in the elaboration of fermented milk. Keeping in mind these antecedents this work had as objective to develop a fermented milk of goat with characteristic probiotics, good acceptability and appropriate shelf life using the starter culture Lactobacillus casei, Lactobacillus acidophilus jointly with the starter culture of the yogurt. It was carried out a design of experiment of response surface (22 with the independent variables, starter culture dose (1.5 to 2.5% and the relationship of starter culture of yogurt: probiotics starter culture 1:3 at 1:5. As variable answers they took: the viability, the acidity and the sensorial indicators. The formulation selected with the best characteristics was conserved to temperature of 4 oC for the evaluation of the storage life. The best formulation was the 2% starter culture with a relationship of 1:4. The fermented milk was evaluated of “I like” and its viability was above the therapeutic minimum until the 21 days (log (UFC/ml of 8.8 at 7.0.

  14. Monitoring of foodborne pathogens in raw cow milk in Tuscany

    Directory of Open Access Journals (Sweden)

    Laura Gasperetti

    2014-03-01

    Full Text Available Raw milk consumption in Italy has increased over the last few years and although raw milk is characterised by cold chain, short shelf-life and the duty of boiling before domestic consumption, it is still considered a hazard. From 2010 to 2013 a monitoring survey of raw milk sold through vending machines was carried out to investigate the occurrence of several foodborne pathogens stipulated in the national legal requirements, i.e. Listeria monocytogenes, Campylobacter spp., Salmonella spp., Escherichia coli O:157 and coagulase-positive Staphylococci. A total of 127 raw milk samples were collected from 19 dairy herds in Tuscany Region, Italy. In addition, the milk samples were tested for the presence and count of Yersinia genus. Results shown that only one sample was positive for non verocytotoxin- producing E. coli O:157, whereas a total of 38 samples (29.9% were postive for Yersinia genus; of the total 39 isolated bacteria, 23.6% were Y. enterocolitica, 2.4% Y. kristenseni and 4.7% Y. frederiksenii. None isolate was enteropathogenic; serotypes O:5 and O:8 were found in 16.6 and 13.3% of the isolates respectively, whereas none of the serotypes tested was detected in 70% of the isolates. The most probable number method revealed a count value between 0.03 and 24 MPN/mL. Based on these data a general assurance on health safety of raw milk produced and sold in Tuscany could be assessed.

  15. Multivariate factor analysis of Girgentana goat milk composition

    Directory of Open Access Journals (Sweden)

    Pietro Giaccone

    2010-01-01

    Full Text Available The interpretation of the several variables that contribute to defining milk quality is difficult due to the high degree of  correlation among them. In this case, one of the best methods of statistical processing is factor analysis, which belongs  to the multivariate groups; for our study this particular statistical approach was employed.  A total of 1485 individual goat milk samples from 117 Girgentana goats, were collected fortnightly from January to July,  and analysed for physical and chemical composition, and clotting properties. Milk pH and tritable acidity were within the  normal range for fresh goat milk. Morning milk yield resulted 704 ± 323 g with 3.93 ± 1.23% and 3.48±0.38% for fat  and protein percentages, respectively. The milk urea content was 43.70 ± 8.28 mg/dl. The clotting ability of Girgentana  milk was quite good, with a renneting time equal to 16.96 ± 3.08 minutes, a rate of curd formation of 2.01 ± 1.63 min-  utes and a curd firmness of 25.08 ± 7.67 millimetres.  Factor analysis was performed by applying axis orthogonal rotation (rotation type VARIMAX; the analysis grouped the  milk components into three latent or common factors. The first, which explained 51.2% of the total covariance, was  defined as “slow milks”, because it was linked to r and pH. The second latent factor, which explained 36.2% of the total  covariance, was defined as “milk yield”, because it is positively correlated to the morning milk yield and to the urea con-  tent, whilst negatively correlated to the fat percentage. The third latent factor, which explained 12.6% of the total covari-  ance, was defined as “curd firmness,” because it is linked to protein percentage, a30 and titatrable acidity. With the aim  of evaluating the influence of environmental effects (stage of kidding, parity and type of kidding, factor scores were anal-  ysed with the mixed linear model. Results showed significant effects of the season of

  16. [Investigation of gestagenic effect of raw drone milk in rats].

    Science.gov (United States)

    Seres, Adrienn; Ducza, Eszter; Gáspár, Róbert

    2014-01-01

    Numerous honeybee products are used in traditional medicine. The best-known honeybee products are the honey, the propolis and the royal jelly. Drone milk is a relatively little-known honeybee product. Although, drone milk is traditionally used to treat infertility and to promote vitality in both men and women in certain countries, the literature furnishes no information concerning effects of the drone milk. The oestrogenic and androgenic effects of drone milk have recently been reported in rats and the effective compounds have also been identified. The aim of this study was to determine the putative gestagenic effect of raw drone milk in rats. Maintenance of pregnancy assays revealed that drone milk was able to increase the number of surviving fetuses. This results suggested some gestagenic effects. This effect was confirmed by RT-PCR and Western blot methods in which the mRNA and protein expressions of gestagen-dependent CRLR (Calcitonin Receptor-Like Receptor) peptide were determined. To determine the efficacy of gestagenic effect of drone milk, spironolactone (weak gestagen compound) was used. The combination of drone milk and spironolactone showed more potent gestagenic effect. These results lead us to suppose that raw drone milk shows weak gestagenic effect and this effect can be increased by another weak gestagen. Further studies are required to clarify the gestagenic mechanisms of action of drone milk.

  17. The analysis of milk components and pathogenic bacteria isolated from bovine raw milk in Korea.

    Science.gov (United States)

    Park, Y K; Koo, H C; Kim, S H; Hwang, S Y; Jung, W K; Kim, J M; Shin, S; Kim, R T; Park, Y H

    2007-12-01

    Bovine mastitis can be diagnosed by abnormalities in milk components and somatic cell count (SCC), as well as by clinical signs. We examined raw milk in Korea by analyzing SCC, milk urea nitrogen (MUN), and the percentages of milk components (milk fat, protein, and lactose). The associations between SCC or MUN and other milk components were investigated, as well as the relationships between the bacterial species isolated from milk. Somatic cell counts, MUN, and the percentages of milk fat, protein, and lactose were analyzed in 30,019 raw milk samples collected from 2003 to 2006. The regression coefficients of natural logarithmic-transformed SCC (SCCt) on milk fat (-0.0149), lactose (-0.8910), and MUN (-0.0096), and those of MUN on milk fat (-0.3125), protein (-0.8012), and SCCt (-0.0671) were negative, whereas the regression coefficient of SCCt on protein was positive (0.3023). When the data were categorized by the presence or absence of bacterial infection in raw milk, SCCt was negatively associated with milk fat (-0.0172), protein (-0.2693), and lactose (-0.4108). The SCCt values were significantly affected by bacterial species. In particular, 104 milk samples infected with Staphylococcus aureus had the highest SCCt (1.67) compared with milk containing other mastitis-causing bacteria: coagulase-negative staphylococci (n = 755, 1.50), coagulase-positive staphylococci (except Staphylococcus aureus; n = 77, 1.59), Streptococcus spp. (Streptococcus dysgalactiae, n = 37; Streptococcus uberis, n = 12, 0.83), Enterococcus spp. (n = 46, 1.04), Escherichia coli (n = 705, 1.56), Pseudomonas spp. (n = 456, 1.59), and yeast (n = 189, 1.52). These results show that high SCC and MUN negatively affect milk components and that a statistical approach associating SCC, MUN, and milk components by bacterial infection can explain the patterns among them. Bacterial species present in raw milk are an important influence on SCC in Korea.

  18. Raw Milk Hygiene at Local Markets and Automatic Milk Dispenser Machines

    Directory of Open Access Journals (Sweden)

    Gheorghe Şteţca

    2014-11-01

    Full Text Available In Romania, direct sales of raw milk to the final consumer is developed based on the local regulations. These are in accordance to European Regulation that must meet some quality requirements for the total number of germs, somatic cells, without antibiotics, coming from healthy animals who did not suffer from diseases that can be transmitted to humans through milk. Raw milk is sold in Romania in local markets and by automatic milk dispenser machines. Based on these regulations, a study regarding the quality and security to human health of raw milk was conducted on the commercialized milk in local markets and automatic milk dispensers. During May-June 2014 samples of raw milk were collected from Cluj-Napoca local markets and automatic milk dispensers. All samples were kept to refrigeration conditions until the moment of analyze which took place at the sampling day. The following parameters were taken into account: fat content, protein, casein, lactose, nonfat dry matter, pH, milk freezing point, added water, antibiotics residues, milk urea, number of germ cells and somatic cells. All obtained results were verified by the validated methods applied. Our research can be forward conducted in order to verify the hygiene and composition of milk from the whole dairy chain. 

  19. 119-132 Microbiological Quality of Raw Cow Milk across the Milk ...

    African Journals Online (AJOL)

    t

    equipment of producers in rural areas of Babile district; from the equipment of .... pastoral areas is supplied to urban centers through informal milk marketing channels ... raw milk across the milk supply chain to ensure safety and suitability ... Materials and Methods. 2.1. ... Ethiopia at 9°36′ N latitude and 41°52′ E longitude.

  20. Fermentation optimization of goat milk with Lactobacillus acidophilus and Bifidobacterium bifidum by Box-Behnken design.

    Science.gov (United States)

    Shu, Guowei; Bao, Chunju; Chen, He; Wang, Changfeng; Yang, Hui

    2016-01-01

    Goat milk is only limited to the processing of goat milk powder and liquid milk, the products are mainly about milk powder and a few of them are made as milk tablet. Therefore, the study of probiotic goat milk will have great significance in the full use of goats and the development of the goat milk industry in China. The effect of fermentation temperature (35°C, 37°C, 39°C), strain ratio (1:1:1, 2:1:1, 3:1:1) and inoculum size (4%, 5%, 6%) on viable counts of L. acidophilus and B. bifidum, total bacteria and sensory value during fermentation process of L. acidophilus and B. bifidum goat yogurt (AB-goat yogurt) was investigated. The optimum fermentation conditions for AB-goat yogurt were: fermentation temperature 38°C, the strain ratio 2:1:1, inoculum size 6%. Under the optimum conditions, the viable counts of B. bifidum, L. acidophilus, total bacteria and sensory value reached (4.30 ±0.11)×107  cfu/mL, (1.39 ±0.09)×108  cfu/mL, (1.82±0.06)×109  cfu/mL and 7.90 ±0.14, respectively. The fermentation temperature, the strain ratio and inoculum size had a significant effect on the fermentation of AB-goat yogurt and these results are beneficial for developing AB-goat yogurt.

  1. Strontium-90 and cesium-137 in raw milk

    International Nuclear Information System (INIS)

    1979-01-01

    Under the commission of Science and Technology Agency, prefectural public health laboratories and institutes and Japan Chemical Analysis Center have measured the levels of 90 Sr and 137 Cs in milk samples. Sampling was done as follows: 4 times of raw milk samples a year in 10 prefectures for the report to WHO, 2 times of raw milk samples a year in 4 prefectures; and 2 times of city milk samples a year in 29 prefectures. Three litters of fresh milk were collected and carbonated in the prefectural public health laboratories and institutes of each prefecture, and the carbonated samples were collected at Japan Chemical Analysis Center. At Japan Chemical Analysis Center, these collected samples were radiochemically analysed for 90 Sr and 137 Cs using the method applied for the analysis of the radionuclides contents in total diet materials. (author)

  2. Prevalence of the pathogen microorganisms in raw cow milk

    Directory of Open Access Journals (Sweden)

    Angelovski Ljupco

    2009-11-01

    Full Text Available The aim of this study was to study the prevalence of Salmonella spp., Listeria spp., Staphylococcus spp. and E. coli in the raw cow milk. In this study 133 milk-tank samples from several milk collecting points were analysed. After the tests the following prevalence was detected: for Listeria spp. 13 positive samples (9.77%, with 9 Listeria monocytogenes samples confirmed (6.76%. Salmonella spp. was not detected in any of the the samples. The biggest presence was detected for Staphylococcus spp. with 113 positive samples (85.0%. Further testes has shown prevalence of coagulase-positive staphylococci of 73% (97 positive samples. Escherichia coli was confirmed in 57 samples (46.0%. The results from this study clearly indicate that pathogen microorganisms which are important for the human health can be found in the raw cow milk and their presence can be potential hazard for contamination of the milk-processing establishments.

  3. Utilization of nitrogen and energy from diets containing protein and fat derived from either goat milk or cow milk.

    Science.gov (United States)

    Ceballos, Laura Sanz; Morales, Eva Ramos; Martínez, Luis Pérez; Extremera, Francisca Gil; Sampelayo, M Remedios Sanz

    2009-11-01

    Consumption of whole milk and related dairy products has decreased considerably as a result of negative aspects associated with the consumption of saturated fats. The main difference between the composition of goat milk and cow milk concerns the composition of the fat, that of goat milk containing a larger proportion of medium-chain triglycerides. The metabolic utilization of these compounds is fundamentally oriented towards their use as sources of energy, and they may even contribute to the synthesis of proteins. This study was carried out, using 40 rats at weaning, in order to determine whether, on the basis of their fat and protein composition, there is any difference between the nutritional utilization of the N and the energy from goat and cow milk. Eight animals were killed on arrival at the laboratory, and the rest were divided into four groups of eight animals and killed at the end of the experiment. Each group was given a different diet: diet 1 contained fat and protein from goat milk; diet 2 had fat from cow milk and protein from goat milk; diet 3 had fat from goat milk and protein from cow milk; diet 4 had fat and protein from cow milk. The animals were allowed to feed ad libitum for 30 d and a balance assay was performed during the final 7 d to determine N and energy utilization. At the same time and by the comparative slaughter method, the protein and fat deposition for each group was established. It was concluded that goat milk protein is more digestible than that of cow milk. Moreover, the metabolic utilization of digestible N was found to be dependent on the sources of both the protein and the fat in the diet; a higher degree of utilization was recorded for the digestible N obtained using diets with protein or fat from goat milk. Consumption of diets with goat milk fat led to a lower level of thermogenesis associated with protein oxidation and a higher one for that associated with fat oxidation, which in turn implied a protein-sparing effect of the

  4. Improvement of goat TSE discriminative diagnosis and susceptibility based assessment of BSE infectivity in goat milk and meat

    NARCIS (Netherlands)

    Bossers, A.; Langeveld, J.P.M.

    2012-01-01

    In light of the known ability of the BSE agent to cross the animal/human species barrier, the evidence establishing the presence of BSE in goat is especially alarming, as it represents a potential risk of food-born contamination to human consumers of goat milk and meat products. The main objective

  5. Comparison of Surti goat milk with cow and buffalo milk for physicochemical characteristics, selected processing-related parameters and activity of selected enzymes

    Science.gov (United States)

    Prajapati, Darshna B.; Kapadiya, Dharti B.; Jain, Amit Kumar; Mehta, Bhavbhuti M.; Darji, Vijaykumar B.; Aparnathi, Kishorkumar D.

    2017-01-01

    Aim: The study was undertaken to find out the physicochemical characteristics, selected processing-related parameters and activity of selected enzymes in Surti goat milk. Materials and Methods: Milk samples from Surti goats and buffalo milk samples were collected during the period from July 2013 to January 2014 at Reproductive Biology Research Unit, Anand Agricultural University (AAU), Anand. Milk samples from Kankrej cows were collected from Livestock Research Station, AAU, Anand. Samples were analyzed for physicochemical characteristics such as acidity, viscosity, surface tension, specific gravity, refractive index, freezing point, and electrical conductivity. Samples were also analyzed for selected processing-related parameters such as heat coagulation time (HCT), rennet coagulation time (RCT), rate of acid production by starter culture, alcohol stability, and activity of selected enzymes such as alkaline phosphatase activity, catalase activity, proteolytic activity, and lipase activity. Results: Goat milk had the highest acidity, viscosity and surface tension, followed by cow milk and buffalo milk. However, the differences in acidity, specific gravity, surface tension, refractive index, electrical conductivity, HCT and lipase activity of three types of milk studied, viz., goat, cow, and buffalo milk were found statistically non-significant (pmilk had the highest specific gravity, followed by those found in cow and goat milk. The viscosity, freezing point and RCT of goat milk was significantly lower (p>0.05) than that of the buffalo milk. However, the difference in viscosity, freezing point and RCT of goat milk and that of the cow milk was statistically non-significant. The cow milk had the highest refractive index, followed by goat and buffalo milk. The cow milk had the highest proteolytic activity and heat coagulation time (HCT), followed by those found in buffalo and goat milk. The goat milk had the lowest freezing point, lipase activity, and RCT, followed by

  6. The Effects of the Types of Milk (Cow, Goat, Soya and Enzymes (Rennet, Papain, Bromelain Toward Cheddar Cheese Production

    Directory of Open Access Journals (Sweden)

    Ariestya Arlene

    2015-04-01

    Full Text Available The objectives of this research are to study the effects of different types of milk and enzymes toward the yield and quality (moisture, ash, protein, fat content, and texture of cheddar cheese and the interaction between those two variables during the process. The types of milk are cow, goat, and soya milk, while the types of enzymes are rennet, papain, and bromelain enzymes. Regarding the procedure, the milk is first pasteurized before CaCl2 and Lactobacillus lactis that acts as the acidifier starter as much as 0.2% (w/v and 0.5% of the milk volume are added respectively. The amount of enzyme added is appropriate for the determination of enzyme dose. The curd is separated from the whey and then 2.5 grams of salt is added to 100 grams of curd. Afterwards, the curd is pressed until the water content decreases (cheese, then ripened for 1 month. The analyses conducted are moisture, ash, protein, fat content, and texture (hardness. The conclusion is the goat milk and the rennet enzyme are the suitable raw material for cheddar cheese production. Furthermore, different types of milk and enzymes affect the yield. However, there is no interaction between the types of milk and enzymes to the yield.

  7. Ultrafiltration of skimmed goat milk increases its nutritional value by concentrating nonfat solids such as proteins, Ca, P, Mg, and Zn.

    Science.gov (United States)

    Moreno-Montoro, Miriam; Olalla, Manuel; Giménez-Martínez, Rafael; Bergillos-Meca, Triana; Ruiz-López, María Dolores; Cabrera-Vique, Carmen; Artacho, Reyes; Navarro-Alarcón, Miguel

    2015-11-01

    Goat milk has been reported to possess good nutritional and health-promoting properties. Usually, it must be concentrated before fermented products can be obtained. The aim of this study was to compare physicochemical and nutritional variables among raw (RM), skimmed (SM), and ultrafiltration-concentrated skimmed (UFM) goat milk. The density, acidity, ash, protein, casein, whey protein, Ca, P, Mg, and Zn values were significantly higher in UFM than in RM or SM. Dry extract and fat levels were significantly higher in UFM than in SM, and Mg content was significantly higher in UFM than in RM. Ultrafiltration also increased the solubility of Ca and Mg, changing their distribution in the milk. The higher concentrations of minerals and proteins, especially caseins, increase the nutritional value of UFM, which may therefore be more appropriate for goat milk yogurt manufacturing in comparison to RM or SM. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  8. Isolation and molecular identification of Mycobacterium from commercially available pasteurized milk and raw milk samples collected from two infected cattle farms in Alborz Province, Iran.

    Science.gov (United States)

    Eftekhari, Mohsen; Mosavari, Nader

    2016-12-01

    Mycobacterium avium subsp. paratuberculosis (MAP) is an etiological agent of Johne's disease in ruminant including cattle, sheep and goats. This disease is considered an economically important disease in cattle. Animals with paratuberculosis shed viable MAP, particularly in their milk and feces. MAP may be involved in the development of Crohn's disease in humans through the consumption of contaminated milk and dairy products. Common methods of pasteurization are not enough to kill all MAP present in the milk and the bacterium has been isolated from raw milk, pasteurized milk and cheese samples. The purpose of this study was to evaluate two different methods for detecting MAP in milk and milk products. We analyzed the commonly used methods such as culture and molecular biology for identification of MAP. For this study, 50 milk samples from cows with suspected Johne's disease located in two dairy farms and 10 commercially available pasteurized milk and cheese samples from the market in Karaj city, Iran were selected. Following Ziehl-Neelsen staining of milk samples, direct microscopic detection of MAP was performed. All milk samples were centrifuged, and the concentrated samples were decontaminated using hexadecyl pyridinium chloride. The decontaminated milk suspensions were washed three times by centrifuging, and the collected filtrates were cultivated on Herrold's egg yolk medium enriched by Mycobactin J. Finally, identification and confirmation of isolates to MAP was performed using IS900-nested polymerase chain reaction (PCR). According to the obtained results by culture and PCR methods, none of the pasteurized milk and cheese samples showed the presence of MAP. However, 10% of the tested raw milk samples collected from suspected cattle showed the presence of MAP by both culture and PCR methods. Culture and PCR methods are reliable for identification of MAP from milk samples. Copyright © 2016.

  9. Effects of conjugated linoleic acid supplementation and feeding level on dairy performance, milk fatty acid composition, and body fat changes in mid-lactation goats.

    Science.gov (United States)

    Ghazal, S; Berthelot, V; Friggens, N C; Schmidely, P

    2014-11-01

    The objective of this trial was to study the interaction between the supplementation of lipid-encapsulated conjugated linoleic acid (CLA; 4.5 g of cis-9,trans-11 C18:2 and 4.5 g of trans-10,cis-12 C18:2) and feeding level to test if milk performance or milk fatty acid (FA) profile are affected by the interaction between CLA and feeding level. Twenty-four dairy goats were used in an 8-wk trial with a 3-wk adaptation to the experimental ration that contained corn silage, beet pulp, barley, and a commercial concentrate. During the third week, goats were assigned into blocks of 2 goats according to their dry matter intake (DMI), raw milk yield, and fat yield. Each block was randomly allocated to control (45 g of Ca salt of palm oil/d) or CLA treatment. Within each block, one goat was fed to cover 100% (FL100) of the calculated energy requirements and the other was fed 85% of the DMI of the first goat (FL85). Individual milk production and composition were recorded weekly, and milk FA composition was analyzed in wk 3, 5, and 7. Conjugated linoleic acid supplementation reduced milk fat content and fat yield by 17 and 19%, respectively, independent of the feeding level. It reduced both the secretion of milk FA synthesized de novo, and those taken up from the blood. No interaction between CLA and feeding level was observed on milk secretion of any group of FA. The CLA supplementation had no effect on DMI, milk yield, protein, and lactose yields but it improved calculated net energy for lactation balance. Goats fed the FL100 × CLA diet tended to have the highest DMI and protein yield. The interaction between CLA and feeding level was not significant for any other variables. Compared with the goats fed FL100, those fed FL85 had lower DMI, lower net energy for lactation balance, and lower digestible protein in the intestine balance. The body weight; milk yield; milk fat, protein, and lactose yields; and fat, protein, lactose, and urea contents in milk were not affected by

  10. Results from raw milk microbiological tests do not predict the shelf-life performance of commercially pasteurized fluid milk.

    Science.gov (United States)

    Martin, N H; Ranieri, M L; Murphy, S C; Ralyea, R D; Wiedmann, M; Boor, K J

    2011-03-01

    Analytical tools that accurately predict the performance of raw milk following its manufacture into commercial food products are of economic interest to the dairy industry. To evaluate the ability of currently applied raw milk microbiological tests to predict the quality of commercially pasteurized fluid milk products, samples of raw milk and 2% fat pasteurized milk were obtained from 4 New York State fluid milk processors for a 1-yr period. Raw milk samples were examined using a variety of tests commonly applied to raw milk, including somatic cell count, standard plate count, psychrotrophic bacteria count, ropy milk test, coliform count, preliminary incubation count, laboratory pasteurization count, and spore pasteurization count. Differential and selective media were used to identify groups of bacteria present in raw milk. Pasteurized milk samples were held at 6°C for 21 d and evaluated for standard plate count, coliform count, and sensory quality throughout shelf-life. Bacterial isolates from select raw and pasteurized milk tests were identified using 16S ribosomal DNA sequencing. Linear regression analysis of raw milk test results versus results reflecting pasteurized milk quality consistently showed low R(2) values (tests and results from tests used to evaluate pasteurized milk quality. Our findings suggest the need for new raw milk tests that measure the specific biological barriers that limit shelf-life and quality of fluid milk products. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  11. Distribution of protein fraction in the milk of West African dwarf goat ...

    African Journals Online (AJOL)

    Milks from lactating West African dwarf goat and white Fulani cow were analysed for total protein, casein, whey protein, non protein nitrogen, Globulin and albumin and proteose peptone contents. Milk samples were from healthy goats and cows (n=24) in mid-lactation. The data were grouped and analysed as treatment 1 ...

  12. Molecular detection of Coxiella burnetii in goat bulk milk samples in ...

    African Journals Online (AJOL)

    . The objective of this study was to determine the prevalence rate of C. burnetii in bulk milk samples from dairy goat herds in Fars, Ghom, Kerman, Khuzestan and Yazd provinces, Iran. In this study, 296 bulk milk samples from 89 dairy goat ...

  13. Depletion of long-acting ampicillin in goat milk following intramuscular administration.

    Science.gov (United States)

    Ferrini, Anna Maria; Trenta, Simona; Mannoni, Veruscka; Rosati, Remo; Coni, Ettore

    2010-12-08

    Although goat milk production represents today a very small percentage of the world milk market, this percentage has been growing continuously during the past 20 years. Goat milk is the basic milk supply in many developing countries and provides tasteful derivative products in developed countries. Goats, as well as all milk-producing animals, can be affected by mastitis, but goats being considered a minor species, few drugs are specifically registered for these animals; most, at least for mastitis treatment, are usually tested and registered for use in cows. This situation leads often to the adoption for goat milk of withdrawal periods defined for cows even if these extrapolations prove almost never valid for goats. In the present study, the elimination of the β-lactam antibacterial agent ampicillin in goat milk was investigated. Ampicillin was chosen because it is one of the most common antibiotics used by goat farmers against mastitis due to the fact that it is well tolerated and has short elimination times in cows. Goats were treated with long-acting ampicillin at 15 mg (kg of body weight)(-1) by double intramuscular injection at 72 h interval. Milk was collected in a 12 h milking scheme. The method used to determine the levels of ampicillin in goat milk was based on a liquid-liquid extraction of this drug from the matrix, successive derivatization with formaldehyde, and final separation by HPLC with fluorescence detection. The results point out a slow depletion of ampicillin and, consequently, a withdrawal period (13 milkings) longer than that extrapolated and authorized for cows and sheep.

  14. Improved growth of preterm infants receiving mother's own raw milk compared with pasteurized donor milk.

    Science.gov (United States)

    Montjaux-Régis, N; Cristini, C; Arnaud, C; Glorieux, I; Vanpee, M; Casper, C

    2011-12-01

    To determine whether growth, feeding tolerance and infectious events of preterm infants is related to the proportion of intake of mother's own raw milk (maternal milk) versus pooled pasteurized banked breast milk (donor milk). This is a prospective observational study of 55 premature infants born less than 32 weeks of gestational age admitted to the neonatal intensive care unit at the Children's Hospital of Toulouse during two 6-month periods from 2003 to 2005. Enrolled infants were exclusively on enteral feeds with maternal milk ± donor milk. Mean gestational age was 28.6 weeks (SD 1.5) and mean birth weight 1105 grams (SD 282). During the time of exclusively breast milk feeds, weight gain (g/kg/day) was correlated to the proportion of maternal milk consumed (p = 0.0048, r = 0.4). Necrotizing enterocolitis was inversely correlated to the amount of maternal milk. The amount of maternal milk did not impact on infectious events. Mother's own raw milk improves weight gain compared with donor milk in preterm infants. Lactation strategies should be sought that helps mothers to increase their milk production. © 2011 The Author(s)/Acta Paediatrica © 2011 Foundation Acta Paediatrica.

  15. Effect of supplementary glycerin on milk composition and heat stability in dairy goats

    Directory of Open Access Journals (Sweden)

    Deela Thoh

    2017-12-01

    Full Text Available Objective This experiment was studied the effects of various levels of crude glycerin (CG in dairy goat diet on daily intake, milk yield, milk composition, some physical properties and some quality changes of goat milk after sterilization. Methods Twelve 75% Saanen dairy goats (body weight = 49±3 kg; days in milk = 60±12 d were randomly assigned in a completely randomized design to evaluate the effects of three experimental diets consisting of 0%, 5%, and 10% CG (dry matter basis which were formulated to meet or exceed the nutrient requirements of goats. Experimental dairy goats were evaluated for feed and milk yield. Milk samples were analyzed for their composition, including fatty acids, casein profile, fat globule size, and color, and were sterilized to evaluate milk heat stability. Results There were no significant differences between 0% and 5% CG treatments infeed. Increasing CG supplementation from 0% to 5% increased milk yield from 2.38±0.12 to 2.64±0.23 kg/goat/d. In addition, milk samples from 5% CG treatment had the highest total solids, fat content and lactose content, and largest fat globule size. Increasing CG to 10% resulted in a decrease in milk fat. After sterilizing at 116°C, F0 = 3 min, goat milk samples from 5% CG treatment had slightly higher sediment content and comparatively higher degree of browning. Conclusion Considering milk yield, milk fat content and quality of sterilized milk, 5% CG supplementation in a total mixed ration has a potential for implementation in dairy goats.

  16. Comparison of Surti goat milk with cow and buffalo milk for physicochemical characteristics, selected processing-related parameters and activity of selected enzymes

    Directory of Open Access Journals (Sweden)

    Darshna B. Prajapati

    2017-05-01

    Full Text Available Aim: The study was undertaken to find out the physicochemical characteristics, selected processing-related parameters and activity of selected enzymes in Surti goat milk. Materials and Methods: Milk samples from Surti goats and buffalo milk samples were collected during the period from July 2013 to January 2014 at Reproductive Biology Research Unit, Anand Agricultural University (AAU, Anand. Milk samples from Kankrej cows were collected from Livestock Research Station, AAU, Anand. Samples were analyzed for physicochemical characteristics such as acidity, viscosity, surface tension, specific gravity, refractive index, freezing point, and electrical conductivity. Samples were also analyzed for selected processing-related parameters such as heat coagulation time (HCT, rennet coagulation time (RCT, rate of acid production by starter culture, alcohol stability, and activity of selected enzymes such as alkaline phosphatase activity, catalase activity, proteolytic activity, and lipase activity. Results: Goat milk had the highest acidity, viscosity and surface tension, followed by cow milk and buffalo milk. However, the differences in acidity, specific gravity, surface tension, refractive index, electrical conductivity, HCT and lipase activity of three types of milk studied, viz., goat, cow, and buffalo milk were found statistically non-significant (p0.05 than that of the buffalo milk. However, the difference in viscosity, freezing point and RCT of goat milk and that of the cow milk was statistically non-significant. The cow milk had the highest refractive index, followed by goat and buffalo milk. The cow milk had the highest proteolytic activity and heat coagulation time (HCT, followed by those found in buffalo and goat milk. The goat milk had the lowest freezing point, lipase activity, and RCT, followed by those found in cow and buffalo milk. The goat milk had the highest electrical conductivity, followed by those found in buffalo and cow milk. The

  17. Is Leptospira able to survive in raw milk? Study on the inactivation at different storage times and temperatures.

    Science.gov (United States)

    Fratini, Filippo; Turchi, Barbara; Ferrone, Martina; Galiero, Alessia; Nuvoloni, Roberta; Torracca, Beatrice; Cerri, Domenico

    2016-09-01

    The consumption of raw milk is currently increasing due to several beneficial aspects, such as nutritional qualities, taste, and health benefits. However, some authors highlight the potential risk associated with raw milk consumption. In Italy, while the absence of some pathogen microorganisms is set by the regional regulation DGR 381/2007, for other microorganisms, such as Leptospira, no recommendations are provided. Leptospira is not ascribed among classical milk pathogens; however, it can potentially be present in raw milk. The aim of this study was to evaluate the survival in raw milk of six serovars of Leptospira after storage at different temperatures (4 °C ± 2 °C, 20 °C ± 2 °C, and 30 °C ± 2 °C) for different incubation times (20 min, 45 min, 1 h, and 1 h and 30 min), in order to determine the potential risk for consumers. Moreover, the immediate effect of bovine, goat, and donkey raw milk on tested Leptospira serovars was visually evaluated. After incubation, all samples were subcultured in EMJH and incubated aerobically at 30 °C for 3 months. All inoculated media were weekly examined by dark-field microscope in order to assess Leptospira survival. Extemporary observation of strains' behavior in milk allowed to detect an almost immediate motility loss, and no leptospires were detected by microscopic observations carried out weekly during the trial period. According to our results, it could be possible to exclude raw milk as a source of Leptospira infection for consumers.

  18. Changes in cisternal udder compartment induced by milking interval in dairy goats milked once or twice daily

    DEFF Research Database (Denmark)

    Salama, A A K; Caja, G; Such, X

    2004-01-01

    from wk 2 of lactation. Average milk yields for wk 4 and 8 were 1.76 and 2.24 L/d, for goats milked 1x and 2x, respectively. For each half udder, cisternal area was measured by ultrasonography and cisternal milk was measured by machine milking after i.v. injection of an OT receptor blocking agent...... multiparous goats at all milking intervals. Cisternal recoil was studied in a sample of multiparous goats milked 1x (n = 4) and 2x (n = 4) by scanning cisterns by ultrasonography at 0, 5, 15, and 30 min after an OT challenge for each milking interval. Cisternal area increased after OT injection for the 8...

  19. Decreased antibiotic susceptibility and enhanced probiotic production potential of goat milk fermented curd in comparison with cow and buffalo milk

    Directory of Open Access Journals (Sweden)

    Jyoti Lakhanpal

    2017-07-01

    Full Text Available The present study was carried out to characterize and compare the production potential and antibiotic susceptibility of probiotics isolated from goat, cow and buffalo milk. The probiotics isolated from milk fermented curd were compared with regard to their number, morphology, gram staining, motility, bile salt tolerance, pH-resistance, catalase activity, oxidase production and antibiotic resistance. We demonstrated that the probiotics isolated from milk fermented curd of all three species were gram positive, motile, catalase negative, and oxidase negative and were able to produce lactic acid. Further, we observed that buffalo milk is more potent in forming curd with the highest count of probiotics per ml (3.53 × 10!5 as compared to cow (5.8 × 10!6 and goat milk (7×10!7; moreover, goat milk bacterial isolates were more tolerant to acidic pH but were less bile-salt tolerant than cow milk. Also, probiotics isolated from goat milk curd were more resistant to antibiotics (resistant to 12 out of 15 screened antibiotics than those from cow and buffalo milk (resistant to 8-9 antibiotics. This report shows that goat milk fermented products possess the highest antibacterial potential and are highly acid-tolerant.

  20. The Formulation of Binding Agent Concentration on Raw Restructured Goat Meat Trimming Product

    Directory of Open Access Journals (Sweden)

    Rini Mastuti

    2012-02-01

    Full Text Available The utilization of raw materials and formulation method would affect the quality of the processed meat product. Therefore, a research on the processing method to produce a raw structured product should be conducted. The research was testing a single factor comprises of following parameters: control (without binding agent; 0.3%, 0.5% and 0.7% sodium alginat and 0.3%, 0.5% and 0.7% carragenan, respectively. The results showed that the goat meat trimming could be used as raw materials in the production of the best restructured meat using 0.5% carragenan. This raw restructured meat produced had a loss weight of 1.67%, pH value  7.89, WHC  48.345, and moisture content  75.20%.   Keywords : sodium alginat, carragenan, raw restructured goat meat trimming.

  1. Spoilage potential of Paenibacillussp. in Brazilian raw milk

    Directory of Open Access Journals (Sweden)

    José Carlos Ribeiro Júnior

    2016-04-01

    Full Text Available ABSTRACT: Bacterial spores are widespread in the environment and can contaminate milk. Spores are resistant to thermal conditions and your germination reduces milk shelf-life because the aerobic bacteria that are sporulated produce proteases and lipases. The aim of this study was identify Paenibacillus sp., the spoilage microbiota, arising from the germination of spores in raw milk and your spoilage potential. Twenty different milk samples were treated at 80°C/12min and plated to isolate spore-forming bacteria. These strains were picked in milk agar and tributyrin agar for verification of their potential proteolytic and lipolytic activities, respectively. Amplification and sequencing of the 16S rRNA gene of the strains for identification by similarity to the DNA sequences deposited in GenBank was performed. One hundred and thirty-seven isolates were obtained, of which 40 (29.2% showed spoilage activity for milk. Of these, three (7.5% were identified as strains of Paenibacillus sp., and all were lipolytic. Paenibacillus sp. have been identified as primarily responsible for the spoilage of pasteurized milk with a long shelf-life in other countries. To increase the shelf-life of Brazilian pasteurized milk, it is important to identify the sporulated microbes to determine their origin and to control the contamination of milk by vegetative forms such as spores.

  2. APPLICATION EXPERIENCE OF GOAT'S MILK BASED PRODUCTS AMONG CHILDREN, SUFFERING FROM ATOPIC DERMATITIS

    Directory of Open Access Journals (Sweden)

    T.G. Malanicheva

    2007-01-01

    Full Text Available The purpose of the work is to study the efficiency of the diet therapy against atopic dermatitis by means of the goat's milk based products among children at different age. The researchers observed 188 children aged between 3 months and 18 years, suffering from atopic dermatitis aggravated by the mycotic infection. Patients of the main group (102 children under 3 received goat's milk based products within the hypo allergic diet — «Nanny» and «Nanny — Zolotaya Kozochka» adapted milk formulas, while children over 3 received «Amal Tea» instant goat's milk. The research findings have showed that the introduction of the goat's milk based products into the food ration leads not only to the positive short term results — achievement of the clinical remission on 12th–20th day from the moment the therapy starts, but also to the positive long term effect — remission extension, reduction of the disease recurrences, reduction of the general IgE level in blood serum and offending IgE allergens to the cow milk proteins and casein. Thus, the replacement of the cow milk based products within the ration of patients for «Nanny» and «Nanny — Zolotaya Kozochka» adapted milk formulas and «Amal Tea» instant goat's milk allows for optimization of the atopic dermatitis diet therapy among children at different age.Key words: atopic dermatitis, diet therapy, goat's milk.

  3. LAMP assay for rapid diagnosis of cow DNA in goat milk and meat samples.

    Science.gov (United States)

    Deb, R; Sengar, G S; Singh, U; Kumar, S; Raja, T V; Alex, R; Alyethodi, R R; Prakash, B

    2017-01-01

    Animal species detection is one of the crucial steps for consumer's food analysis. In the present study we developed an in-house built loop-mediated isothermal amplification (LAMP) assay for rapid detection of adulterated cow DNA in goat milk/meat samples. The cow milk/tissue DNA in goat milk/meat samples were identified in the developed LAMP assay by either naked eye visualizing with SYBR Green I dyes or by detecting the typical ladder pattern on gel electrophoresis. This test can detect up to minimum 5% level of cow components admixed in goat milk/meat samples and can be completed within 1 h 40 min starting from DNA extraction from milk/meat samples and can be performed in a water bath. Developed LAMP methodology is simple; rapid and sensitive techniques that can detect adulterant like cow components in goat milk/meat are more accurate than other existing DNA based technologies.

  4. Niclosamide residues in milk and organs of lactating goats

    International Nuclear Information System (INIS)

    El Hindi, A.M.; Sidra, M.S.

    1986-01-01

    14 C-Niclosamide was administered to two groups of lactating goats at levels of 2ppm for five consecutive days and 10ppm as a single dose. Residues of the molluscicide in milk, if at all present, did not exceed 0.001 ppm at any time. About 50% of the administered activity was excreted in faeces, while 30% excreted through urine in animals surviving 6 days after withdrawal. The unchanged molluscicide is present only in relatively trace amounts. The highest residues in organs were found in the liver of both groups (0.01-0.04 ppm). From the results it could be concluded that absorbed niclosamide is completely metabolised and rapidly eliminated through urine, leaving little or no residues of the unchanged molluscicide. Little or no residues were detected in lean muscles and milk which are consumed by humans. There is no preferential deposition of the molluscicide or its metabolites in fat

  5. Detection and identification of Staphylococcus aureus in raw milk by ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-04-12

    Apr 12, 2010 ... detection and identification of S. aureus in raw milk demonstrated high sensitivity and specificity. Key words: Microarray .... sterile after screening for S. aureus contamination according to the procedure described by Wang ... methods, the microarray method is high throughput, specific, and sensitive and also ...

  6. Near Infrared Spectroscopy (NIRS) for the determination of the milk fat fatty acid profile of goats.

    Science.gov (United States)

    Núñez-Sánchez, N; Martínez-Marín, A L; Polvillo, O; Fernández-Cabanás, V M; Carrizosa, J; Urrutia, B; Serradilla, J M

    2016-01-01

    Milk fatty acid (FA) composition is important for the goat dairy industry because of its influence on cheese properties and human health. The aim of the present work was to evaluate the feasibility of NIRS reflectance (oven-dried milk using the DESIR method) and transflectance (liquid milk) analysis to predict milk FA profile and groups of fats in milk samples from individual goats. NIRS analysis of milk samples allowed to estimate FA contents and their ratios and indexes in fat with high precision and accuracy. In general, transflectance analysis gave better or similar results than reflectance mode. Interestingly, NIRS analysis allowed direct prediction of the Atherogenicity and Thrombogenicity indexes, which are useful for the interpretation of the nutritional value of goat milk. Therefore, the calibrations obtained in the present work confirm the viability of NIRS as a fast, reliable and effective analytical method to provide nutritional information of milk samples. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Relationship between milk production and some blood constituents in Egyptian Baladi goats.

    Science.gov (United States)

    Hassan, G A; el-Nouty, F D; Samak, M A; Salem, M H

    1986-01-01

    Under the conditions of a high ambient temperature and the lack of green fodder goats are very important for milk production. During 16 weeks of lactation period, the milk yield of 10 Baladi goats was 55 kg. The amount of milk exhibited a positive relation to the globulin and glucose content of the blood. There was a highly negative correlation with the albumin content and the number of leucocytes.

  8. Effect of leaving milk trucks empty and idle for 6 h between raw milk loads.

    Science.gov (United States)

    Kuhn, Eva; Meunier-Goddik, Lisbeth; Waite-Cusic, Joy G

    2018-02-01

    The US Pasteurized Milk Ordinance (PMO) allows milk tanker trucks to be used repeatedly for 24 h before mandatory clean-in-place cleaning, but no specifications are given for the length of time a tanker can be empty between loads. We defined a worst-case hauling scenario as a hauling vessel left empty and dirty (idle) for extended periods between loads, especially in warm weather. Initial studies were conducted using 5-gallon milk cans (pilot-scale) as a proof-of-concept and to demonstrate that extended idle time intervals could contribute to compromised raw milk quality. Based on pilot-scale results, a commercial hauling study was conducted through partnership with a Pacific Northwest dairy co-op to verify that extended idle times of 6 h between loads have minimal influence on the microbiological populations and enzyme activity in subsequent loads of milk. Milk cans were used to haul raw milk (load 1), emptied, incubated at 30°C for 3, 6, 10, and 20 h, and refilled with commercially pasteurized whole milk (load 2) to measure cross-contamination. For the commercial-scale study, a single tanker was filled with milk from a farm known to have poorer quality milk (farm A, load 1), emptied, and refilled immediately (0 h) or after a delay (6 h) with milk from a farm known to have superior quality milk (farm B, load 2). In both experiments, milk samples were obtained from each farm's bulk tank and from the milk can or tanker before unloading. Each sample was microbiologically assessed for standard plate count (SPC), lactic acid bacteria (LAB), and coliform counts. Selected isolates were assessed for lipolytic and proteolytic activity using spirit blue agar and skim milk agar, respectively. The pilot-scale experiment effectively demonstrated that extended periods of idle (>3 h) of soiled hauling vessels can significantly affect the microbiological quality of raw milk in subsequent loads; however, extended idle times of 6 h or less would not measurably compromise milk

  9. Consumer perception, health information, and instrumental parameters of cupuassu (Theobroma grandiflorum) goat milk yogurts.

    Science.gov (United States)

    Costa, Marion P; Monteiro, Maria Lucia G; Frasao, Beatriz S; Silva, Vitor L M; Rodrigues, Bruna L; Chiappini, Claudete C J; Conte-Junior, Carlos A

    2017-01-01

    Although the demand for goat milk products has been growing, they have lower consumer acceptability than products derived from cow milk. However, the addition of cupuassu pulp can be used to improve the formulation of these products. For this reason, the aim of this study was to investigate the influence of new goat milk yogurt manufactured with cupuassu pulp on physicochemical properties, consumers' perceptions, and overall consumer acceptance. In addition, the effect of antioxidant health information on consumer acceptance and purchase intention of cupuassu goat milk yogurts was evaluated. The results demonstrated a positive expectation regarding linking and familiarity to goat milk products and products with cupuassu pulp. The pH, total phenolic content, lightness, redness, yellowness, and apparent viscosity were potentially affected by the addition of cupuassu, with the highest concentration of cupuassu (10%) exhibiting the greatest changes in parameters. Based on principal component analysis, partial least squares regression, and just-about-right and penalty analysis, the addition of cupuassu pulp improved some sensory attributes of goat milk yogurt, such as cupuassu aroma, cupuassu flavor, yellow color, consistency, and viscosity, which positively influenced product acceptance. In addition, antioxidant health information increased the acceptance and purchase intention of cupuassu goat milk yogurts. Taking into account the parameters investigated in this study, the best scoring formulation was goat milk yogurt with 10% cupuassu pulp. Our results suggest that cupuassu pulp can be considered a potential ingredient to improve the sensory and texture properties of goat milk yogurt. Furthermore, the antioxidant health information could be a sensory strategy to increase the acceptance of cupuassu goat milk yogurts. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  10. XENOBIOTICS AND BIOGENIC ELEMENTS IN RAW COW'S MILK

    Directory of Open Access Journals (Sweden)

    Agnieszka Greń

    2012-12-01

    Full Text Available Normal 0 21 false false false SK X-NONE X-NONE This paper presents the concentration some toxic and biogenic elements in milk from Nitra region. The aim of this investigation was to evaluate 30 samples of raw milk with fat contents 3.8% obtained from milk machine in the Nitra region. Samples were analyzed for metal contents using atomic absorption spectrophotometry (AAS. In comparison with maximum acceptable concentration for milk in the food codex of the Slovak republic, the level of contamination with cadmium was exceeded and reached the value 0.221 µg.ml-1. The copper content ranged from 1.201 µg.ml-1 to 5.810 µg.ml-1 and the average concentration reached 3.793 µg.ml-1.  Iron had an average of 1.824 µg.ml-1. Overall in all milk samples high correlations were found. Between positive correlation (0.7019 and negative correlation between of nickel and potassium concentration in raw milk (-0.72 was found. doi:10.5219/246

  11. A case of bovine raw milk contamination with Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Hunt Karen

    2012-07-01

    Full Text Available Abstract During routine sampling of bulk raw milk on a dairy farm, the pathogenic bacteria Listeria monocytogenes was found to be a contaminant, at numbers L. monocytogenes, indicating a possible case of excretion of the L. monocytogenes directly into the milk. Milk samples were collected from the individual cows and analysed, resulting in the identification of L. monocytogenes excretion (at 280 cfu/ml from one of the 4 mammary quarters of one dairy cow out of 180. When the infected cow was isolated from the herd, no L. monocytogenes was detected from the remaining herd. The pulsed-field gel electrophoresis pattern of the strain from the individual cow was indistinguishable from that originally isolated from the bulk milk. The infected cow did not show any clinical signs of disease, nor did the appearance of the milk have any physical abnormalities. Antibiotic treatment of the infected mammary quarter was found to be ineffective. This study shows that there can be risks associated with direct contamination of raw milk with L. monocytogenes.

  12. ISOLATION, MOLECULAR AND BIOCHEMICAL CHARACTERIZATION OF GOAT MILK CASEIN AND ITS FRACTIONS

    Directory of Open Access Journals (Sweden)

    Samir Ahmed Salem

    2009-06-01

    Full Text Available The SDS-PAGE electrophoretic pattern of goats´ milk has a unique pattern compared to those of cow and human milk. β-casein is the major fraction and comprises 70.2% of total goat-milk caseins, while αs- is a minor fraction (29.85 %. This pattern is similar to that of human casein but different to that of cow casein. Purified casein fractions of goat milk showed different electrophoretic migration compared to those of bovine milk. The corresponding Mr(s of goat αs- and β-casein were estimated at 30.2 for αs and 26.6 & 23.9 for β1 and β2 versus 32.6 and 26.6 for bovine αs- and β-casein, respectively. The amino acid composition of goat-milk whole casein appeared to be similar to those of cow, sheep and camel caseins. Meanwhile, goat casein has the satisfactory balance of essential amino acids equal to or exceeding the FAO/ WHO/ UNU requirements for each amino acid. Goat αs-casein was characterized by the presence of higher contents of both acidic and basic amino acids than β-casein. Peptide mapping profiles of goat, cow and human caseins were completely different. This means that each protein has its own unique peptide mapping.

  13. PRODUKSI DAN EVALUASI KUALITAS SUSU BUBUK ASAL KAMBING PERANAKAN ETTAWA (PE [Production and Quality Evaluation of Ettawa-Crossbred Goat Milk Powder

    Directory of Open Access Journals (Sweden)

    I Gede Suparta Budisatria

    2012-12-01

    Full Text Available The objective of this study was to produce milk powder from Ettawa-crossbred goat milk and subsequently evaluate the quality of the products. The raw material used was Ettawa-crossbred goat fresh milk with total solid, lactose, fat, and protein content of 15.93%, 4.2%, 4.8% and 4.7%, respectively. Milk with final total solid of 17.5% and 20% were prepared for spray drying by adding skim milk powder. Drying was carried out using a spray dryer type Lamp having nozzle size of 0.05 mm with an inlet temperature of 90°C and an outlet temperature of 45°C. Parameters observed were chemical, physical and microbiological qualities. The data showed that milk powder produced from Ettawa-crossbred goat milk had water content of 1.5-1.7%. Further analysis showed that the acidity, proteins, lactose, and fat content were 0.90%, 28.4%, 21.7%, and 22.5%, respectively. The physical analysis showed that milk powder produced from Ettawa-crossbred goat milk had a higher wettability score (143 seconds as compared to that of commercial products (29 seconds, a higher sieve test score (0.6 g vs 0.004 g, but similar index of insolubility (1.4 ml vs.1.6 ml. The microbiological analysis showed that the Total Plate Count (TPC, Enterobacteriaceae (EB and presumptive coliforms increased during storage either in refrigerator or room temperature. The increase in TPC, EB and coliforms was substantially higher when products were kept at room temperature than in refrigerator. In conclusion, Ettawa-crossbred goat milk powder had a good nutrition quality, but still need improvement for the physicochemical characteristic including wettability and nutritional enrichment for vitamins and minerals by means of fortification.

  14. Milk proteins interact with goat Binder of SPerm (BSP) proteins and decrease their binding to sperm.

    Science.gov (United States)

    de Menezes, Erika Bezerra; van Tilburg, Mauricio; Plante, Geneviève; de Oliveira, Rodrigo V; Moura, Arlindo A; Manjunath, Puttaswamy

    2016-11-01

    Seminal plasma Binder of SPerm (BSP) proteins bind to sperm at ejaculation and promote capacitation. When in excess, however, BSP proteins damage the sperm membrane. It has been suggested that milk components of semen extenders associate with BSP proteins, potentially protecting sperm. Thus, this study was conducted to investigate if milk proteins interact with BSP proteins and reduce BSP binding to goat sperm. Using gel filtration chromatography, milk was incubated with goat seminal plasma proteins and loaded onto columns with and without calcium. Milk was also fractionated into parts containing mostly whey proteins or mostly caseins, incubated with seminal plasma proteins and subjected to gel filtration. Eluted fractions were evaluated by immunoblot using anti-goat BSP antibodies, confirming milk protein-BSP protein interactions. As determined by ELISA, milk proteins coated on polystyrene wells bound to increasing of goat BSP proteins. Far-western dot blots confirmed that BSP proteins bound to caseins and β-lactoglobulin in a concentration-dependent manner. Then, cauda epididymal sperm from five goats was incubated with seminal plasma; seminal plasma followed by milk; and milk followed by seminal plasma. Sperm membrane proteins were extracted and evaluated by immunoblotting. The pattern of BSP binding to sperm membrane proteins was reduced by 59.3 % when epididymal sperm were incubated with seminal plasma and then with skimmed milk (p  0.05). In conclusion, goat BSP proteins have an affinity for caseins and whey proteins. Milk reduces BSP binding to goat sperm, depending whether or not sperm had been previously exposed to seminal plasma. Such events may explain the protective effect of milk during goat sperm preservation.

  15. PRELIMINARY RESULTS USING ANEW METHOD TO OPTIMIZE A SPRAY DRYER PROCESS FOR PRODUCING HIGH QUALITY MILK POWDER FROM COW, GOAT AND SHE-ASS MILK CONCENTRATES

    Directory of Open Access Journals (Sweden)

    Giuseppe Altieri

    2008-12-01

    Full Text Available As quality is a very important factor in milk powder produced by drying, the optimal process must protect both nutritional and sensorial properties. Although heat damage indices (namely the insolubility index (IINS, thermal damage (IDT, protein denaturation could be used to evaluate the correct processing of milk, they are very time-consuming. Hence a chemical marker, like vitamin C, is proposed for rapid assessment of the overall damage to the quality of the produced milk powder. Trials were carried out on milk concentrates from cow, goat and she-ass so as to optimize the process performance of the spray dryer, for each kind of milk, at three inlet temperatures (120, 150, 185 °C; the feed flow rate was set at 0.5 dm3/h with outlet air RH% in the range 10-40%; raw milk was concentrated using a low pressure evaporator until an average level of 23% dry matter was reached. As expected, the thermal damage of the milk powder increased as the inlet air temperature increased; the outlet powder RH% was 96-98% poorly correlated with the mass flow rate of the concentrate inlet. Moreover, the destruction kinetic of vitamin C was found highly correlated with the thermal damage to the milk powder. At 175 °C inlet air temperature the overall thermal treatment on the she-ass milk concentrate, which is very heat-sensitive due to its high lactose content, was “weak” (IDT<80 and the milk powder of “premium or extra” quality (IINS<1.25ml and lactic acid = 0.07% < 0.15% ADMI. The titratable acidity values are uncorrelated with the process air temperature but depend uniquely from the raw milk freshness.

  16. Antidiabetic Potential of Kefir Combination from Goat Milk and Soy Milk in Rats Induced with Streptozotocin-Nicotinamide

    Science.gov (United States)

    Harmayani, Eni; Sunarti

    2015-01-01

    The study aimed to evaluate the effect of kefir combination from goat milk and soy milk on lipid profile, plasma glucose, glutathione peroxidase (GPx) activity and the improvement of pancreatic β-cell in diabetic rats. Male rats were divided into five treatments: normal control, diabetic control, goat milk kefir, combination of goat milk-soy milk kefir and soy milk kefir. All rats were induced by streptooztocin-nicotinamide (STZ-NA), except for normal control. After 35 d experiment, the rats were sampled for blood, sacrificed and sampled for pancreatic tissues. Results showed that diabetic rats fed kefir combination had higher (p<0.05) triglyceride than the rats fed goat milk or soy milk kefir. Decreasing of plasma glucose in diabetic rats fed kefir combination was higher (p<0.05) than rats fed goat millk kefir. The activity of GPx in diabetic rats fed three kinds of kefir were higher (p<0.01) than untreated diabetic rats. The average number of Langerhans and β-cells in diabetic rats fed kefir combination was the same as the normal control, but it was higher than diabetic control. It was concluded that kefir combination can be used as antidiabetic through maintaining in serum triglyceride, decreasing in plasma glucose, increasing in GPx activity and improving in pancreatic β-cells. PMID:26877646

  17. Effect of choline chloride supplementation on milk production and milk composition of Etawah grade goats

    Directory of Open Access Journals (Sweden)

    Supriyati

    2016-08-01

    Full Text Available Abstract Background The effect of choline chloride supplementation through forced drinking combined with concentrate diets containing Ca-fish oil on milk production and milk composition of Etawah Grade goats was evaluated. Choline chloride is an essential component in ruminant diets as it is required for fat metabolism. Method The experiment was conducted in a completely randomized block design with three types of treatments and eight replications. The trial had two successive experimental periods; the first, during the eight weeks of late pregnancy, and the second, during the first 12 weeks of lactation. Twenty-four Etawah Grade does in the second gestation period were divided into three treatment groups. Commercial choline chloride 60 % in corncobs-based powder was used as a source of choline chloride. The treatments were no supplementation (control and supplemented with either 4 g or 8 g/2days of choline chloride. Choline chloride was given to the animals through a forced drinking technique, after dissolving it in 60 ml drinking water. The initial body weight of does was 38.81 ± 3.66 kg. The does were penned individually, and were given fresh chopped King Grass ad libitum and 700 g/day of concentrate diets containing Ca-fish oil, starting eight weeks prior to expecting kidding and continuing for 12 weeks of parturition. Results All nutrient intakes were not significantly different (p > 0.05 among the treatments during the late pregnancy and the lactation periods. Supplementation did not affect (p > 0.05 the average daily gains and feed conversion ratio during pregnancy but gave effects (p < 0.05 on the average daily gains, feed conversion ratio and income over feed cost during lactation. The highest average daily milk yields and 4 % fat corrected milk yields were found in goats supplemented with 4 g/2days of choline chloride and increased by 17.00 % and 24.67 %, respectively, compared to the control. Moreover, milk

  18. Physicochemical and sensory characteristics of milk from goats supplemented with castor or licuri oil.

    Science.gov (United States)

    Pereira, R A G; Oliveira, C J B; Medeiros, A N; Costa, R G; Bomfim, M A D; Queiroga, R C R E

    2010-02-01

    The purpose of this study was to evaluate the influence of castor and licuri palm oils supplemented to milking goats on the physical, chemical, and sensory characteristics of milk. A double Latin square experimental design (5x5) using 10 confined crossbred Moxotó-Alpine goats was performed according to the following treatments: nonsupplemented (control), 3% castor oil, 5% castor oil, 3% licuri oil, and 5% licuri oil. Oils in each treatment were supplemented in the dry matter. Castor oil supplementation reduced the fat content and increased the lactose and density of milk. Considering the sensory analysis, a lower acceptability was observed for milk from goats supplemented with castor oil. On the other hand, licuri oil supplementation led to higher acceptability scores for flavor and odor of goat milk. Copyright 2010 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  19. Quantitative determination of casein genetic variants in goat milk: Application in Girgentana dairy goat breed.

    Science.gov (United States)

    Montalbano, Maria; Segreto, Roberta; Di Gerlando, Rosalia; Mastrangelo, Salvatore; Sardina, Maria Teresa

    2016-02-01

    The study was conducted to develop a high-performance liquid chromatographic (HPLC) method to quantify casein genetic variants (αs2-, β-, and κ-casein) in milk of homozygous individuals of Girgentana goat breed. For calibration experiments, pure genetic variants were extracted from individual milk samples of animals with known genotypes. The described HPLC approach was precise, accurate and highly suitable for quantification of goat casein genetic variants of homozygous individuals. The amount of each casein per allele was: αs2-casein A = 2.9 ± 0.8 g/L and F = 1.8 ± 0.4 g/L; β-casein C = 3.0 ± 0.8 g/L and C1 = 2.0 ± 0.7 g/L and κ-casein A = 1.6 ± 0.3 g/L and B = 1.1 ± 0.2 g/L. A good correlation was found between the quantities of αs2-casein genetic variants A and F, and β-casein C and C1 with other previously described method. The main important result was obtained for κ-casein because, till now, no data were available on quantification of single genetic variants for this protein. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Factors affecting consumers' preferences for and purchasing decisions regarding pasteurized and raw milk specialty cheeses.

    Science.gov (United States)

    Colonna, A; Durham, C; Meunier-Goddik, L

    2011-10-01

    Eight hundred ninety consumers at a local food festival were surveyed about their specialty cheese purchasing behavior and asked to taste and rate, through nonforced choice preference, 1 of 4 cheese pairs (Cheddar and Gouda) made from pasteurized and raw milks. The purpose of the survey was to examine consumers' responses to information on the safety of raw milk cheeses. The associated consumer test provided information about specialty cheese consumers' preferences and purchasing behavior. Half of the consumers tested were provided with cheese pairs that were identified as being made from unpasteurized and pasteurized milk. The other half evaluated samples that were identified only with random 3-digit codes. Overall, more consumers preferred the raw milk cheeses than the pasteurized milk cheeses. A larger portion of consumers indicated preferences for the raw milk cheese when the cheeses were labeled and thus they knew which samples were made from raw milk. Most of the consumers tested considered the raw milk cheeses to be less safe or did not know if raw milk cheeses were less safe. After being informed that the raw milk cheeses were produced by a process approved by the FDA (i.e., 60-d ripening), most consumers with concerns stated that they believed raw milk cheeses to be safe. When marketing cheese made from raw milk, producers should inform consumers that raw milk cheese is produced by an FDA-approved process. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  1. Production and chemical composition of two dehydrated fermented dairy products based on cow or goat milk.

    Science.gov (United States)

    Moreno-Fernández, Jorge; Díaz-Castro, Javier; Alférez, Maria J M; Hijano, Silvia; Nestares, Teresa; López-Aliaga, Inmaculada

    2016-02-01

    The aim of this study was to identify the differences between the main macro and micronutrients including proteins, fat, minerals and vitamins in cow and goat dehydrated fermented milks. Fermented goat milk had higher protein and lower ash content. All amino acids (except for Ala), were higher in fermented goat milk than in fermented cow milk. Except for the values of C11:0, C13:0, C16:0, C18:0, C20:5, C22:5 and the total quantity of saturated and monounsaturated fatty acids, all the other fatty acid studied were significantly different in both fermented milks. Ca, Mg, Zn, Fe, Cu and Se were higher in fermented goat milk. Fermented goat milk had lower amounts of folic acid, vitamin E and C, and higher values of vitamin A, D3, B6 and B12. The current study demonstrates the better nutritional characteristics of fermented goat milk, suggesting a potential role of this dairy product as a high nutritional value food.

  2. Impact of Freezing Time on Dornic Acidity in Three Types of Milk: Raw Donor Milk, Mother's Own Milk, and Pasteurized Donor Milk.

    Science.gov (United States)

    Vázquez-Román, Sara; Escuder-Vieco, Diana; García-Lara, Nadia Raquel; Alonso-Díaz, Clara; Lora, David; Martín-Pelegrina, María Dolores; Pallás-Alonso, Carmen Rosa

    2016-03-01

    Although under certain circumstances it is necessary to express milk, there are not many recommendations about the ideal storage conditions for human milk. The objectives of this study were to analyze the effects on Dornic acidity of frozen storage at -20 °C in three types of milk: raw donor milk, mother's own raw milk, and pasteurized donor milk. Forty-three samples of raw donor milk, 40 samples of pasteurized donor milk, and 16 samples of mother's own milk were analyzed. Dornic acidity was measured at time 0, before freezing. The remaining aliquots were frozen and analyzed after 1, 2, 3, and 4 weeks and after 2 and 3 months. In raw donor milk, the median acidity at the start was 3 °D (interquartile range [IQR] 2-3 °D); after 3 months, it was 5 °D (IQR 3-7 °D), with a significant increase in acidity after the second week. In mother's own milk, the mean acidity at the start was 3 °D (IQR 2-4 °D) and 7 °D (IQR 4-8 °D) at 3 months. The increase was significant after the third week. In pasteurized donor milk, the mean acidity was 3 °D (IQR 2-3 °D) at the start and 2 °D (IQR 2-3 °D) at the end. When comparing the three types of milk, there were significant differences from the first week between the two types of raw milk and the pasteurized milk (p raw milks (p = 0.77). Dornic acidity in unpasteurized milk significantly increases with the duration of freezing, probably due to the action of lipases, which is lost with pasteurization. It would be advisable to reduce the length of freezing time for unpasteurized milk.

  3. COMPARISON BETWEEN SOME PHYSICAL - CHEMICAL CHARACTERISTICS OF CACAO MILK AND RAW MILK

    OpenAIRE

    Florin Roman

    2009-01-01

    The paper presents a comparison between some physical - chemical characteristics of the cacao milk and of the raw milk. For this comparison we made the following determinations for both types of milk: the determination of the dry substance using the drying oven with a 102 °C temperature, the determination of the proteic substance by titration with sodium hydroxide ( NaOH ) N/10, the milk pasteurization control by the starch and potassium iodide test and the pH determination using the indicato...

  4. Traceability of Plant Diet Contents in Raw Cow Milk Samples

    Science.gov (United States)

    Ponzoni, Elena; Mastromauro, Francesco; Gianì, Silvia; Breviario, Diego

    2009-01-01

    The use of molecular marker in the dairy sector is gaining large acceptance as a reliable diagnostic approach for food authenticity and traceability. Using a PCR approach, the rbcL marker, a chloroplast-based gene, was selected to amplify plant DNA fragments in raw cow milk samples collected from stock farms or bought on the Italian market. rbcL-specific DNA fragments could be found in total milk, as well as in the skimmed and the cream fractions. When the PCR amplified fragments were sent to sequence, the nucleotide composition of the chromatogram reflected the multiple contents of the polyphytic diet. PMID:22253982

  5. Brucella contamination in raw milk by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Khalili

    2016-10-01

    Full Text Available Background: Human brucellosis is a significant public health problem in many middle east countries including Iran. Brucella organisms, which are small aerobic, facultative intracellular coccobacilli, localize in the reproductive organs of host animals, causing abortions and sterility. They are shed in large numbers in the animal’s urine, milk, placental fluid, and other fluids. Dairy product from raw milk are a potential threat to public health in endemic developing countries. The gold standard for the diagnosis of brucellosis is isolation of Brucella species. However, isolation Brucella species is time consuming and needed to level 3 biocontainment facilities and highly skilled technical personnel to handle samples and live bacteria for eventual identification. Handling Brucella species increase risk of laboratory infection. Polymerase chain reaction (PCR with high sensitivity and specifity overcomed to these disadvantages. The aim of this study was to detect Brucella species in milk from dairy cattle farms in Kerman province, Iran by PCR technique. Methods: Forty and eight bulk tank milk (BTM were collected from October 2015 to March 2016 from 48 dairy cattle farm including 4200 cows. DNA of milk samples extracted by lysis buffer and proteinase K method. All milk samples were examined by PCR to detect Brucella-specific DNA targeting IS 711. Positive samples must be showed 317 bp amplified, corresponding to the expected size of the IS 711 genome region in all Brucella species. Results: Using IS711 primer were detected in 4 samples (8.3% Brucella spp. from 48 BTM samples in this area. Conclusion: The results indicate that brucellosis by Brucella species is endemic in the Kerman province dairy farms. Consumption of raw milk dairy products by individual farmers operating under poor hygienic conditions represents an high risk to public health. The need for implementing control measures and raising public awareness on zoonotic transmission of

  6. Chemical Contaminants in Raw and Pasteurized Human Milk.

    Science.gov (United States)

    Hartle, Jennifer C; Cohen, Ronald S; Sakamoto, Pauline; Barr, Dana Boyd; Carmichael, Suzan L

    2018-05-01

    Environmental contaminants ranging from legacy chemicals like p,p'-dichlorodiphenyltrichloroethane (DDT) to emerging chemicals like phthalates are ubiquitous. Research aims/questions: This research aims to examine the presence and co-occurrence of contaminants in human milk and effects of pasteurization on human milk chemical contaminants. We analyzed human milk donated by 21 women to a milk bank for 23 chemicals, including the persistent organic pollutants (POPs) polychlorinated biphenyls (PCBs), polybrominated diphenyl ethers (PBDEs), dichlorodiphenyltrichloroethane (DDT), and dichlorodiphenyldichloroethylene (DDE) isomers that are known to sequester in adipose tissue, along with the current-use and nonpersistent pesticides chlorpyrifos and permethrin, phthalates, and bisphenol A (BPA). Human milk was analyzed raw and pasteurized for these chemicals using gas chromatography-tandem mass spectrometry for the POPs and high-performance liquid chromatography-tandem mass spectrometry for non-POPs. Within the different chemical classes, PBDE47, PCB153, ppDDE, and MEHHP (phthalate metabolite) had the highest median concentrations and were observed in all samples. We also observed chlorpyrifos and BPA in all samples and permethrin in 90% of the samples tested. Only two chemicals, chlorpyrifos and permethrin, were susceptible to substantial degradation from pasteurization, a standard method for processing donated human milk. We detected 19 of 23 chemicals in all of our prepasteurized milk and 18 of 23 chemicals in all of our pasteurized milk. Pasteurization did not affect the presence of most of the chemicals. Future research should continue to explore human milk for potential chemical contamination and as a means to surveil exposures among women and children.

  7. Differences in sheep and goats milk fatty acid profile between conventional and organic farming systems.

    Science.gov (United States)

    Tsiplakou, Eleni; Kotrotsios, Vaios; Hadjigeorgiou, Ioannis; Zervas, George

    2010-08-01

    The objective of this study was to investigate whether there is a difference in chemical composition and particularly in fatty acid (FA) profile, with emphasis on cis-9, trans-11 CLA, of milk obtained from conventional and organic dairy sheep and goats farms under the farming conditions practiced in Greece. Four dairy sheep and four dairy goat farms, representing common conventional production systems and another four dairy sheep and four dairy goat farms, organically certified, representing organic production and feeding systems were selected from all over Greece. One hundred and sixty two individual milk samples were collected from those farms in January-February 2009, about three months after parturition. The milk samples were analyzed for their main chemical constituents and their FA profile. The results showed that the production system affected milk chemical composition: in particular fat content was lower in the organic sheep and goats milk compared with the corresponding conventional. Milk from organic sheep had higher content in MUFA, PUFA, alpha-LNA, cis-9, trans-11 CLA, and omega-3 FA, whereas in milk from organic goats alpha-LNA and omega-3 FA content was higher than that in conventional one. These differences are, mainly, attributed to different feeding practices used by the two production systems. The results of this study show that the organic milk produced under the farming conditions practiced in Greece has higher nutritional value, due to its FA profile, compared with the respective conventional milk.

  8. Production optimization of probiotic soft cheese made from goat's and cow's milk

    Directory of Open Access Journals (Sweden)

    Ida Drgalić

    2006-07-01

    Full Text Available The aim of this study was to determine optimal rennet share and fat content in milk for probiotic soft cheeseproduction made from goat's and cow's milk using DVS mixed probiotic culture ABT-4 (Lactobacillus acidophilus, Bifidobacterium spp. and Streptococcus thermophilus, with desirable sensory properties, which will be acceptable by consumers. The best sensory scores had samples of probiotic soft cheese produced in laboratory conditions from milk with 1% of milk fat, pasteurized at 65°C/30 min., fermented at 38°C with 2% culture. To achieve characteristic consistency of traditional soft cheese, 0.01% of rennet was added to goat's milk. Probiotic soft cheese made from cow's and goat's milk, produced under optimal conditions, were 100% acceptable by the tested consumers.

  9. Radiometric determination of the bacteriological quality of raw milk

    International Nuclear Information System (INIS)

    Cogan, T.M.; O'Connor, F.

    1977-01-01

    The usefulness of 14 CO 2 production from (U- 14 C) glucose, (U- 14 C) glutamate and ( 14 C) formate as an index of raw milk quality was investigated. Development work showed that the volume of milk sample influenced the detection of radioactivity. The regression coefficient between Log 10 of the inital bacterial count and the detection time (the time to reach 2000 cpm) in the presence of 0.13 μCi (U- 14 C) glucose/ml was -0.55 (n=119 samples) and the relationship was y=-0.11x+-0.46. The addition of 0.5 μCi (U- 14 C) glutamate and 0.5 μCi of ( 14 C) formate decreased the detection times but did not result in greater predictability. Further study is required before the method could be used to determine the bacteriological quality of milk

  10. Short communication: Determination of withdrawal time for oxytetracycline in different types of goats for milk consumption.

    Science.gov (United States)

    Attaie, Rahmat; Bsharat, Mohammed; Mora-Gutierrez, Adela; Woldesenbet, Sela

    2015-07-01

    Antibiotics are widely used in animal husbandry and the presence of antibiotics in milk is a health hazard. The objective of this study was to determine residual amounts of oxytetracycline in fresh, aged, and pasteurized milk of 3 breeds of goats using HPLC analysis. It was also essential to determine the safe withdrawal period of oxytetracycline in lactating goats. The quantitative results obtained using the HPLC system were compared with the tolerance limit of oxytetracycline in milk in the United States. Fifteen milking does, 5 Nubians, 5 Alpines, and 5 LaManchas were randomly selected from the milking herd at the International Goat Research Center at Prairie View A&M University. A simple sample preparation and isocratic HPLC method using ultraviolet detection was used for analysis of milk samples. The HPLC results indicated that the withdrawal period of oxytetracycline in treated Alpine does was 82h (7 milking), whereas for Nubian does the period was 58h (5 milking), and for LaManchas the period was 72h (6 milking) after drug administration. The overall withdrawal period for all the treated goats of 3 breeds was 72h. Although these results indicated that the depletion rate of this antibiotic was faster in goats than the reported data for cows, the 96-h withdrawal period that is currently used for lactating cows is still necessary for these 3 breeds of goats. Additionally, our results indicated that oxytetracycline is not stable in goat milk at refrigeration temperature or during pasteurization and will decrease significantly. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  11. Milk yield and rectal temperature in West African Dwarf goats as ...

    African Journals Online (AJOL)

    This study was conducted to investigate milk yield and rectal temperature in West African Dwarf (WAD) goats as affected by wattle and litter size. A total of 28 lactating does were used for the experiment. 13 does had wattle (bilateral) while 15 had no wattle. 14 does had twin birth while the other 14 had single birth. The goats ...

  12. Seroprevalence of Toxoplasma gondii infection in goats from the south-west region of Poland and the detection of T. gondii DNA in goat milk.

    Science.gov (United States)

    Sroka, Jacek; Kusyk, Pawel; Bilska-Zajac, Ewa; Karamon, Jacek; Dutkiewicz, Jacek; Wojcik-Fatla, Angelina; Zajac, Violetta; Stojecki, Krzysztof; Rozycki, Miroslaw; Cencek, Tomasz

    2017-07-11

    Toxoplasma gondii (Nicolle et Manceaux, 1908) is an obligatory intracellular protozoan parasite prevalent in animals and humans worldwide having medical and veterinary importance on account of causing abortion or congenital disease in intermediate hosts, including man. Since T. gondii has already been identified in the milk of goats, Capra aegagrus hircus (Linnaeus), the possibility of acquiring infection by ingesting unpasteurised goat milk should be taken into consideration. Thus, the aim of the present study was to determine the presence of T. gondii DNA in goat milk. First, 73 goats (females) from 36 farms located in Poland were examined serologically by direct agglutination test (DAT) to estimate the T. gondii serological status. Milk samples from 60 selected lactating females were examined for the presence of T. gondii DNA by Real time PCR and nested PCR (B1 gene). To estimate the clonal type of detected T. gondii, multiplex PCR was performed using 6 markers. In DAT, positive results were found in 70% of 73 goats. Among examined 60 milk samples, 65% were positive in Real time PCR and 43% in nested PCR. It is noteworthy that 11 samples positive in PCR were collected from seronegative goats. The multilocus PCR analysis mostly revealed the occurrence of genotype III, which is relatively rare in Europe. The recorded high prevalence of anti-Toxoplasma antibodies in tested goats (70%), associated with a high prevalence of T. gondii DNA in goat milk samples (65%), indicates a potential risk of the parasite transmission through goat milk ingestion.

  13. Chosen biotic factors influencing raw cow milk freezing point

    Directory of Open Access Journals (Sweden)

    Oto Hanuš

    2011-01-01

    Full Text Available The milk freezing point depression (FPD is important physical property. FPD is influenced by milk composition especially by components with osmotic pressure activity and by other physiological factors. There is possible to indicate a foreign (extraneous water addition into milk by FPD. This is necessary to have a good estimated legislative FPD discrimination limit (FPD–L for purpose of milk quality control. This paper was aimed at obtaining information to improve such estimation. Impacts factors as season variations, estimated state of dairy cow nutrition and some milk components and properties on milk FPD and their relations to FPD were quantified (n 11 540 – 72 607 bulk raw cow milk samples. The highest FPD was in Spring (−0.52097 ± 0.004877 °C, the lowest in Autumn (−0.52516 ± 0.005725 °C; P < 0.001. Correlation between FPD and lactose was 0.35 (P < 0.001. 12% and 5.4% of FPD variability is explainable by lactose and casein variability. Relationship between FPD and urea (U was 0.26 (P < 0.001 in March. The worst FPD was in group with presupposed (according to milk urea and protein combination nitrogen matter (NM and energy (E insufficiency (−0.51855 ± 0.007288 °C. The best FPD was in group with presupposed NM and E surplus in feeding ration (−0.52536 ± 0.004785 °C; P < 0.001. The FPD was worse in suspicion on E deficiency (on the basis of fat/crude protein ratio as compared to presumption for balanced E nourishment of dairy herds (−0.52105 ± 0.006436 °C > −0.52244 ± 0.005367 °C; P < 0.001. Results can improve the estimation of objective FPD–L.

  14. Haptoglobin and serum amyloid A in bulk tank milk in relation to raw milk quality.

    Science.gov (United States)

    Akerstedt, Maria; Waller, Karin Persson; Sternesjö, Ase

    2009-11-01

    The aim of the present study was to evaluate relationships between the presence of the two major bovine acute phase proteins haptoglobin (Hp) and serum amyloid A (SAA) and raw milk quality parameters in bulk tank milk samples. Hp and SAA have been suggested as specific markers of mastitis but recently also as markers for raw milk quality. Since mastitis has detrimental effects on milk quality, it is important to investigate whether the presence of Hp or SAA indicates such changes in the composition and properties of the milk. Bulk tank milk samples (n=91) were analysed for Hp, SAA, total protein, casein, whey protein, proteolysis, fat, lactose, somatic cell count and coagulating properties. Samples with detectable levels of Hp had lower casein content, casein number and lactose content, but higher proteolysis than samples without Hp. Samples with detectable levels of SAA had lower casein number and lactose content, but higher whey protein content than samples without SAA. The presence of acute phase proteins in bulk tank milk is suggested as an indicator for unfavourable changes in the milk composition, e.g. protein quality, due to udder health disturbances, with economical implications for the dairy industry.

  15. CYTOLOGICAL QUALITY OF GOAT MILK ON THE BASIS OF THE SOMATIC CELL COUNT

    Directory of Open Access Journals (Sweden)

    Henryka BERNACKA

    2007-07-01

    Full Text Available The aim of the present paper was to evaluate the cytological quality of goat milk based on the somatic cell count in respective months of lactation. Besides there was defined the effect of somatic cell on the milk production and chemical composition of milk. The research covered goats of color improved breed in the 2nd and 3rd lactation. Daily milk yield, chemical composition of milk and its somatic cell count were defined based on monthly morning and evening control milkings from both teats, following the A4 method applied in District Animal Evaluation Stations. The research indicated that the greater the somatic cell count in milk, the lower the daily milk yield, however the greater the somatic cell count, the greater the percentage content of fat and dry matter and the lower the content of lactose.

  16. Prevalence, characterization, and antimicrobial resistance of Yersinia species and Yersinia enterocolitica isolated from raw milk in farm bulk tanks.

    Science.gov (United States)

    Jamali, Hossein; Paydar, Mohammadjavad; Radmehr, Behrad; Ismail, Salmah

    2015-02-01

    The aims of this study were to investigate the prevalence and to characterize and determine the antibiotic resistance of Yersinia spp. isolates from raw milk. From September 2008 to August 2010, 446 raw milk samples were obtained from farm bulk milk tanks in Varamin, Iran. Yersinia spp. were detected in 29 (6.5%) samples, out of which 23 (79.3%), 5 (17.2%), and 1 (3.4%) were isolated from cow, sheep, and goat raw milk, respectively. The most common species isolated was Yersinia enterocolitica (65.5%), followed by Yersinia frederiksenii (31%), and Yersinia kristensenii (3.4%). Of the 19 Y. enterocolitica isolates, 14 (73.7%) were grouped into bioserotype 1A/O:9, 4 (21.1%) belonged to bioserotype 1B:O8, 1 (5.3%) belonged to bioserotype 4/O:3, and 1 isolate (biotype 1A) was not typable. All the isolates of biotypes 1B and 4harbored both the ystA and ail genes. However, all the isolates of biotype 1A were only positive for the ystB gene. The tested Yersinia spp. showed the highest percentages of resistance to tetracycline (48.3%), followed by ciprofloxacin and cephalothin (each 17.2%), ampicillin (13.8%), streptomycin (6.9%), and amoxicillin and nalidixic acid (each 3.4%). All of the tested isolates demonstrated significant sensitivity to gentamicin and chloramphenicol. Recovery of potentially pathogenic Y. enterocolitica from raw milk indicates high risks of yersiniosis associated with consumption of raw milk. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  17. The prevalence of pathogenic bacteria and antimicrobial resistance in milk of Ettawa Grade goat

    Directory of Open Access Journals (Sweden)

    A. Andriani

    2018-05-01

    Full Text Available Ettawa Grade (PE are potentially developed goats to produce milk and meat. Milk is food of animal that is rich in nutrients, but it is a perishable food easily contaminated by microorganisms. Contaminated pathogenic bacteria in milk can decrease the quality and has an organoleptic effect on milk, as well as endangers human health. Milk contaminated with bacteria antimicrobial resistance (AMR in which is resistant to antibiotics, may adversely affect the response to treatment with antibiotics in humans when suffering from infectious diseases and using antibiotics in therapy. In this study Ettawa Grade's samples of fresh milk and other dairy products were taken from some of the goat farms in Yogyakarta Sleman district. The samples were tested for the presence of pathogenic bacteria and for its resistance to several kinds of antibiotics. In this study 35 Ettawa Grade's samples of fresh milk and other dairy products (fresh milk, milk powder, ice cream, and yoghurt were taken from some of the goat farms in Sleman district-Yogyakarta. The samples were tested for the presence of pathogenic bacteria and for its resistance to several kinds of antibiotics. The result of the prevalence of pathogenic bacteria in goat fresh milk and other dairy products was 15% Escherichia coli and had multi resistance to multiple antibiotics, namely ampicillin, colistin sulphate, cefixime, kanamycin, oxytetracycline, tetracycline and sulfonamide.

  18. Carbon footprint of dairy goat milk production in New Zealand.

    Science.gov (United States)

    Robertson, Kimberly; Symes, Wymond; Garnham, Malcolm

    2015-07-01

    The aim of this study was to assess the cradle-to-farm gate carbon footprint of indoor and outdoor dairy goat farming systems in New Zealand, identifying hotspots and discussing variability and methodology. Our study was based on the International Organization for Standardization standards for life cycle assessment, although only results for greenhouse gas emissions are presented. Two functional units were included: tonnes of CO2-equivalents (CO2e) per hectare (ha) and kilograms of CO2e per kilogram of fat- and protein-corrected milk (FPCM). The study covered 5 farms, 2 farming systems, and 3yr. Two methods for the calculation of enteric methane emissions were assessed. The Lassey method, as used in the New Zealand greenhouse gas inventory, provided a more robust estimate of emissions from enteric fermentation and was used in the final calculations. The alternative dry matter intake method was shown to overestimate emissions due to use of anecdotal assumptions around actual consumption of feed. Economic allocation was applied to milk and co-products. Scenario analysis was performed on the allocation method, nitrogen content of manure, manure management, and supplementary feed choice. The average carbon footprint for the indoor farms (n=3) was 11.05 t of CO2e/ha and 0.81kg of CO2e/kg of FPCM. For the outdoor farms (n=2), the average was 5.38 t of CO2e/ha and 1.03kg of CO2e/kg of FPCM. The average for all 5 farms was 8.78 t of CO2e/ha and 0.90kg of CO2e/kg of FPCM. The results showed relatively high variability due to differences in management practices between farms. The 5 farms covered 10% of the total dairy goat farms but may not be representative of an average farm. Methane from enteric fermentation was a major emission source. The use of supplementary feed was highly variable but an important contributor to the carbon footprint. Nitrous oxide can contribute up to 18% of emissions. Indoor goat farming systems produced milk with a significantly higher carbon

  19. Incidence of Nocardia species in raw milk collected from different localities of Assiut City of Egypt

    Directory of Open Access Journals (Sweden)

    Nahed Mohamad Wahba

    2011-10-01

    Full Text Available This study aimed to isolate and enumerate Nocardiae from the examined raw milk samples. 240 random milk samples were collected from cows, buffaloes, sheep and goats from different localities in Assiut city- Egypt. The incidences of Nocardia spp. were 47.8, 43.3, 53.3 and 66.7% with average counts of 3.8 x104, 4.5x104, 1.4x104 and 7.6x103/CFUmL of the examined samples, respectively. Pathogenicity of the isolates was also studied. N. otitidiscavarium and N. brasiliensis caused sudden death of rats while, N. farcinica and N. carnea strains were non pathogenic. Other species caused several lesions. It was concluded from the study that, Nocardia species are existed in retailed and fresh milk of different farm animals. Most of the isolated strains were highly pathogenic to rats. Consequently, preventive measures should be taken to protect consumers from being infected. [Vet. World 2011; 4(5.000: 201-204

  20. GOAT MILK: A CHALLENGE FOR RESEARCH AND DEVELOPMENT SECTOR FROM ROMANIA

    Directory of Open Access Journals (Sweden)

    F.D. POP

    2008-10-01

    Full Text Available In the past 20 years the study of goat caseins genetic polymorphisms received a considerable research interest. In particular the researches were focused on CSN1S1 locus which is the most polymorphic, 17 alleles being known so far. These alleles are associated with four different levels of protein synthesis, affecting significantly goat milk quality and its technological properties. In this context the present review is describing recent literature data at international and national level, which allow the understanding of goat milk quality variation in relation with its physical-chemical characteristics, milk protein genetic polymorphisms and physiological factors. We also describe the current stage of researches concerning the use of milk protein polymorphisms in identifying possible adulterations from dairy industry and also studies on milk allergenic potency.

  1. [EFFICIENCY OF HAEMOGLOBIN REGENERATION IN THE NUTRITIONAL FERROPENIC ANAEMIA RECOVERY WITH GOAT MILK-BASED DIETS].

    Science.gov (United States)

    Serrano Reina, José Antonio; Nestares Pleguezuelo, Teresa; Muñoz Alférez, Ma José; Díaz Castro, Javier; López Aliaga, Ma Inmaculada

    2015-10-01

    in spite of the high incidence/prevalence of iron deficiency anemia (IDA) and the beneficial effects derived from the consumption of goat milk, scarce is known about the recovery of the anemia following a balanced diet accompanied by the intake of goat milk of goat. The aim of the current study is to assess, in rats with experimentally induced nutritional iron deficiency anemia, the effects of goat or cow milk-based diets, supplied during 30 days, on the recovery of the anemia and the efficiency of regeneration of the hemoglobin. 40 male Wistar albino rats newly weaned were divided at random in two experimental groups and they were fed ad libitum for 40 days with AIN-93G diet, either with normal iron content (control group, 45 mg/kg diet), or low iron content (anaemic group, 5 mg/kg diet). Samples of blood form the caudal vein were collected for the hematologic control of the anemia. Later, both experimental groups (control and iron deficient) were fed for 30 days with goat or cow milk- based diets. After finishing the experimental period and previous anesthesia the animals were withdrawn by canulation of the abdominal aorta, and the obtained blood was gathered in tubes with EDTA as anticoagulant for the later determination of hematologic parameters and the efficiency of regeneration of the hemoglobin. after the consumption of a diet with low iron content during 40 days, the rats were anaemic, with a concentration of hemoglobin, hematocrit, serum iron, mean corpuscular volume (MCV), serum ferritin and low transferrin (p hemoglobin was higher in control and anaemic rats fed goat milk-based diet in comparison with those fed cow milk-based diet (p hemoglobin, and to the best nutritive utilization of iron in the animals that consumed the goat milk-based diet thanks to the excellent nutritional characteristics of this type of milk. the consumption during 30 days of goat or cow milk-based diets favors the recovery of the iron deficiency anemia, especially with the goat

  2. Microbiological quality of raw donkey milk from Campania Region

    Directory of Open Access Journals (Sweden)

    Nicola Costanzo

    2012-07-01

    Full Text Available Microbiological quality of raw milk from eight healthy donkeys reared in Campania Region was investigated. A total of 152 samples were analyzed in order to evaluate the milk safety status trough monitoring mesophilic total bacterial count (TBC at 32°C and 20°C, psychrophilic TBC at 5°C, Enterobacteriaceae, Salmonella spp., Listeria monocytogenes, Staphylococcus aureus and somatic cell count (SCC. The ranges for mesophilic bacteria at 32°C, 20°C and psychrophilic bacteria at 5°C were, respectively, 2.80-4.00 Log CFU/mL, 2.84-3.92 Log CFU/mL and 1.27-2.12 Log CFU/mL. Enterobacteriaceae showed a load ranging between 0.68-1.93 Log CFU/mL. No pathogenic bacteria were isolated. Estimated SCC values were always under 50,000 cells/mL. Additionally quantitative changes of bacterial population in raw bulk milk during eight storing days at 8°C and 3°C, were evaluated. Firstly, fresh bulk milk was contaminated by bacteria with a mean TBC at 32°C and 20°C of 2.71 Log CFU/mL and 2.64 Log CFU/mL, respectively, whereas TBC at 5°C and Enterobacteriaceae were not detected. After eight days of storage at 8°C, TBC at 32°C, 20°C and Enterobacteriaceae increased by three Log and TBC at 5°C by five Log. On the other side, after eight days of storage at 3°C no gradual Log increase was detected. Our results showed that donkey milk could be a good healthy ingredient for feeding where good hygienic procedures are applied and storage is kept at temperature lower than 3°C.

  3. Control of Listeria monocytogenes in goat's milk and goat's jben by the bacteriocinogenic Enterococcus faecium F58 strain.

    Science.gov (United States)

    Achemchem, Fouad; Abrini, Jamal; Martínez-Bueno, Manuel; Valdivia, Eva; Maqueda, Mercedes

    2006-10-01

    The bacteriocinogenic Enterococcus faecium F58 strain, a natural goat's jben cheese isolate, lacks decarboxylase activity involved in most biogenic amine formation. It was also sensitive to 13 antibiotics assayed and free of virulence and vancomycin resistance genes. The F58 strain reached the stationary phase after 12 h of growth in sterile goat's milk, and the production of enterocin F-58 (Ent L50) was first detected after 48 h (400 AU/ml), thereafter remaining stable up to 5 days. The effectiveness of the F58 strain in controlling Listeria monocytogenes serovar 4b in reduced fat and whole goat's milk, and in goat's jben has been examined. Coculture experiments of F58-L. monocytogenes in both types of milk demonstrated that listeriae were not eliminated, although reductions by 1 to 4 log units were found. Nevertheless, when the F58 strain was previously inoculated in whole milk and left to grow for 12 h before contamination, the pathogen was completely eliminated after 130 h of coculture. Production of jben cheese contaminated with L. monocytogenes prior to packaging, using preparations of F58-producer strain, caused a significant decrease in the number of viable listeriae, which were undetectable after 1 week of cheese storage at 22 degrees C. Altogether, results from this study suggest that E. faecium F58 strain may be used as an adjunct culture in cheese to control contamination and growth of L. monocytogenes by in situ enterocin production, thus providing an additional hurdle to enhance control of this pathogen.

  4. Comparison of manual versus semiautomatic milk recording systems in dairy goats.

    Science.gov (United States)

    Ait-Saidi, A; Caja, G; Carné, S; Salama, A A K; Ghirardi, J J

    2008-04-01

    A total of 24 Murciano-Granadina dairy goats in early-midlactation were used to compare the labor time and data collection efficiency of using manual (M) vs. semiautomated (SA) systems for milk recording. Goats were milked once daily in a 2 x 12 parallel platform, with 6 milking units on each side. The M system used visual identification (ID) by large plastic ear tags, on-paper data recording, and data manually uploaded to a computer. The SA system used electronic ID, automatic ID, manual data recording on reader keyboard, and automatic data uploading to computer by Bluetooth connection. Data were collected for groups of 2 x 12 goats for 15 test days of each system during a period of 70 d. Time data were converted to a decimal scale. No difference in milk recording time between M and SA (1.32 +/- 0.03 and 1.34 +/- 0.03 min/goat, respectively) was observed. Time needed for transferring data to the computer was greater for M when compared with SA (0.20 +/- 0.01 and 0.05 +/- 0.01 min/goat). Overall milk recording time was greater in M than in SA (1.52 +/- 0.04 vs. 1.39 +/- 0.04 min/goat), the latter decreasing with operator training. Time for transferring milk recording data to the computer was 4.81 +/- 0.34 and 1.09 +/- 0.10 min for M and SA groups of 24 goats, respectively, but only increased by 0.19 min in SA for each additional 24 goats. No difference in errors of data acquisition was detected between M and SA systems during milk recording (0.6%), but an additional 1.1% error was found in the M system during data uploading. Predicted differences between M and SA increased with the number of goats processed on the test-day. Reduction in labor time cost ranged from euro0.5 to 12.9 (US$0.7 to 17.4) per milk recording, according to number of goats from 24 to 480 goats and accounted for 40% of the electronic ID costs. In conclusion, electronic ID was more efficient for labor costs and resulted in fewer data errors, the benefit being greater with trained operators and

  5. Viscosity and Analytical Differences between Raw Milk and UHT Milk of Czech Cows

    Directory of Open Access Journals (Sweden)

    Kumbár V.

    2015-06-01

    Full Text Available Viscosity and analytical differences in four milk samples from Czech cows were described. Three samples of UHT milk (0.5%, 1.5%, and 3.5% fat and one sample of raw milk from a Czech bio-farm were analyzed. The following analytical properties were observed: titratable acidity, fat content, dry matter content, and protein content. Titratable acidity and dry matter content decreased in dependence upon the increasing milk fat content. The protein content ranged 3.51-3.57 g per 100 g milk. The milk flow behaviour represented by density, dynamic and kinematic viscosity, as well as the dependence of the milk flow behaviour on temperature were investigated. These properties were measured using a digital densitometer and a rotary viscometer. Milk density was studied at temperatures ranging 0-60 °C and dynamic viscosity at 0-100 °C. With increasing temperature, the density and dynamic viscosity of the studied milk samples decreased. The temperature dependence of dynamic viscosity was manifested in all samples. Kinematic viscosity was calculated from experimental data. Furthermore, mathematical models using Power law and Gaussian fitting were constructed. Determination coefficients achieved high values (0.843-0.997.

  6. Milk production, raw milk quality and fertility of dromedary camels (Camelus Dromedarius) under intensive management.

    Science.gov (United States)

    Nagy, Péter; Thomas, Sonia; Markó, Orsolya; Juhász, Jutka

    2013-03-01

    In many arid countries, dromedaries play an important role as a milk source in rural areas. However, the milk and meat production potential of this species is not well understood and documented. A large-scale camel dairy farm was established in 2006 in the United Arab Emirates. This study summarises the most important data on milk production, raw milk quality and reproductive efficiency collected on this farm during the first three years of operation. The average daily milk production, the mean length of lactation and the mean total milk production per lactation of 174 dromedaries were 6.0 ± 0.12 kg (± SEM), 586 ± 11.0 days (± SEM) and 3314 ± 98.5 kg (± SEM), respectively. The lactation curve reached its peak during the 4th month after parturition (mean ± SEM, 8.9 ± 0.04 kg), then it declined gradually, falling to 50% of the maximum by the 16th month postpartum (mean ± SEM, 4.3 ± 0.06 kg). Milking three times a day did not increase daily milk production compared to two times milking. Mean total viable bacterial count (TVC) and mean somatic cell count (SCC, ± SEM) of bulk raw camel milk were 4,403 ± 94 CFU/cm3 and 392,602 ± 5,999 cells/cm3 for a one-year period, respectively. There was a significant difference among months (P fat, protein, lactose, total solids (TS) and solid-non-fat (SNF) concentrations of individual milk samples were 2.51 ± 0.03%, 2.60 ± 0.01%, 4.03 ± 0.03%, 9.98 ± 0.03% and 7.56 ± 0.03%, respectively. Lactation period, average daily milk production and morning vs. evening milking significantly influenced milk chemical composition. For the 470 camels in the breeding programme, end-of-season pregnancy rate and birth rate were 87.0% and 82.6%, respectively, after natural mating. We have demonstrated that sustainable milk production is possible from a traditional species, the dromedary camel, under an intensive management system.

  7. Repeatability of differential goat bulk milk culture and associations with somatic cell count, total bacterial count, and standard plate count

    NARCIS (Netherlands)

    Koop, G.; Dik, N.; Nielen, M.; Lipman, L.J.A.

    2010-01-01

    The aims of this study were to assess how different bacterial groups in bulk milk are related to bulk milk somatic cell count (SCC), bulk milk total bacterial count (TBC), and bulk milk standard plate count (SPC) and to measure the repeatability of bulk milk culturing. On 53 Dutch dairy goat farms,

  8. Total milk fat extraction and quantification of polar and neutral lipids of cow, goat, and ewe milk by using a pressurized liquid system and chromatographic techniques.

    Science.gov (United States)

    Castro-Gómez, M P; Rodriguez-Alcalá, L M; Calvo, M V; Romero, J; Mendiola, J A; Ibañez, E; Fontecha, J

    2014-11-01

    Although milk polar lipids such as phospholipids and sphingolipids located in the milk fat globule membrane constitute 0.1 to 1% of the total milk fat, those lipid fractions are gaining increasing interest because of their potential beneficial effects on human health and technological properties. In this context, the accurate quantification of the milk polar lipids is crucial for comparison of different milk species, products, or dairy treatments. Although the official International Organization for Standardization-International Dairy Federation method for milk lipid extraction gives satisfactory results for neutral lipids, it has important disadvantages in terms of polar lipid losses. Other methods using mixtures of solvents such as chloroform:methanol are highly efficient for extracting polar lipids but are also associated with low sample throughput, long time, and large solvent consumption. As an alternative, we have optimized the milk fat extraction yield by using a pressurized liquid extraction (PLE) method at different temperatures and times in comparison with those traditional lipid extraction procedures using 2:1 chloroform:methanol as a mixture of solvents. Comparison of classical extraction methods with the developed PLE procedure were carried out using raw whole milk from different species (cows, ewes, and goats) and considering fat yield, fatty acid methyl ester composition, triacylglyceride species, cholesterol content, and lipid class compositions, with special attention to polar lipids such as phospholipids and sphingolipids. The developed PLE procedure was validated for milk fat extraction and the results show that this method performs a complete or close to complete extraction of all lipid classes and in less time than the official and Folch methods. In conclusion, the PLE method optimized in this study could be an alternative to carry out milk fat extraction as a routine method. Copyright © 2014 American Dairy Science Association. Published by

  9. Influence of goats feeding on the fatty acids content in milk

    Directory of Open Access Journals (Sweden)

    Željka Klir

    2012-12-01

    Full Text Available Numerous studies have demonstrated the possibility of modeling the content of fatty acids of milk fat, in order to increase the contents of desirable n-3 unsaturated fatty acids and decrease saturated fatty acid with adequate nutrition of goats. Previous studies showed that the milk of goats on pasture increased content of caproic (C6:0, caprylic (C8:0, conjugated linoleic acid (CLA, rumenic acid, cis-9, trans-11 C18:2, linolenic (C18:3, eicosapentaenoic (C20:5 and docosahexaenoic (C22:6 and total content of polyunsaturated fatty acids (PUFA. In the same group of goats lower content of palmitoleic (C16:1, linoleic (C18:2 and total n-6 unsaturated fatty acids was found, as well as lower n-6/n-3 ratio compared with group of goats kept indoors and fed with alfalfa hay. In milk of goats fed with diets supplemented with safflower oil, content of CLA significantly increased, while goats fed with diets supplement with linseed oil had significantly higher content of C18:3 in milk, compared with group of goats fed without addition of these oils. Goats fed with addition of protected fish oil had significant transfer of eicosapentaenoic-EPA and docosahexaenoic-DHA fatty acids in milk. Protected fish oil reduced the negative impact of long chain fatty acids on the activity of ruminal microorganisms, consumption and digestibility of fiber, as well as inhibition of synthesis of fatty acids in milk gland. When adding unprotected fish oil, increase of stearic (C18:0 and oleic (C18:1 fatty acids occurred, because of the biohydrogenation of polyunsaturated fatty acids in rumen.

  10. Rheological, texture and sensory properties of kefir from mare’s milk and its mixtures with goat and sheep milk

    Directory of Open Access Journals (Sweden)

    Dorota Cais-Sokolińska

    2016-11-01

    Full Text Available The aim of this study was to conduct lactic acid-alcoholic fermentation using mesophilic lactic acid bacteria (LAB for mare’s milk and its mixture with goat and sheep milk, followed by instrumental and sensory characteristic of the texture profile in the produced kefirs. It was shown that kefirs made from a mixture of goat and sheep milk are firmer, have greater values of consistency and the viscosity index than those produced from mare’s milk alone. Kefir storage for 3 weeks causes changes in their mechanical properties. Exceptions are found for firmness of kefirs made from both mixtures and the viscosity index of kefir made from sheep milk, which remained stable. The most divergent texture profile of the tested kefirs was reflected in the sensory examined descriptors of prickling, dense and mouth-coating sensation.

  11. Clotting of cow (Bos taurus) and goat milk ( Capra hircus ) using ...

    African Journals Online (AJOL)

    The ease to locally produce kid rennet contrary to that of calve has led us to compare the proteolytic and clotting activities of these two rennets depending on their action on goat (Capra hircus) milk and cow (Bos taurus) milk. The proteolysis was measured by determining the increase of non-protein nitrogen according to the ...

  12. the composition of the milk of the african dwarf goat, springbok

    African Journals Online (AJOL)

    portant, particularly the composition of the mother's milk. Ben-Shaul (1963) has given the composition of the milk of a large number of wild animals but those of the blue duiker. (CephaJophus monticola), springbok (Antidorcas morsupialis) and the African dwarf goat (Caprine spp.) were not included. These three animals are.

  13. Protein carbonylation sites in bovine raw milk and processed milk products.

    Science.gov (United States)

    Milkovska-Stamenova, Sanja; Mnatsakanyan, Ruzanna; Hoffmann, Ralf

    2017-08-15

    During thermal treatment of milk, proteins are oxidized, which may reduce the nutritional value of milk, abolish protein functions supporting human health, especially important for newborns, and yield potentially harmful products. The side chains of several amino acids can be oxidized to reactive carbonyls, which are often used to monitor oxidative stress in organisms. Here we mapped protein carbonylation sites in raw milk and different brands of pasteurized, ultra high temperature (UHT) treated milk, and infant formulas (IFs) after digesting the precipitated proteins with trypsin. Reactive carbonyls were derivatized with O-(biotinylcarbazoylmethyl)hydroxylamine to enrich the modified peptides by avidin-biotin affinity chromatography and analyze them by nanoRP-UPLC-ESI-MS. Overall, 53 unique carbonylated peptides (37 carbonylation sites, 15 proteins) were identified. Most carbonyls were derived from dicarbonyls (mainly glyoxal). The number of carbonylation sites increased with the harsher processing from raw milk (4) to pasteurized (16) and UHT milk (16) and to IF (24). Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Seasonal variations of Saanen goat milk composition and the impact of climatic conditions.

    Science.gov (United States)

    Kljajevic, Nemanja V; Tomasevic, Igor B; Miloradovic, Zorana N; Nedeljkovic, Aleksandar; Miocinovic, Jelena B; Jovanovic, Snezana T

    2018-01-01

    The aim of this research was to investigate the effect of climatic conditions and their impact on seasonal variations of physico-chemical characteristics of Saanen goat milk produced over a period of 4 years. Lactation period (early, mid and late) and year were considered as factors that influence physico-chemical composition of milk. Pearson's coefficient of correlation was calculated between the physico-chemical characteristics of milk (fat, proteins, lactose, non-fat dry matter, density, freezing point, pH, titrable acidity) and climatic condition parameters (air temperature, temperature humidity index-THI, solar radiation duration, relative humidity). Results showed that all physico-chemical characteristics of Saanen goat milk varied significantly throughout the lactation period and years. The decrease of fat, protein, non-fat dry matter and lactose content in goat milk during the mid-lactation period was more pronounced than was previously reported in the literature. The highest values for these characteristics were recorded in the late lactation period. Observed variations were explained by negative correlation between THI and the physico-chemical characteristics of Saanen goat milk. This indicated that Saanen goats were very prone to heat stress, which implied the decrease of physico-chemical characteristics during hot summers.

  15. Quality of raw milk from a farm with automatic milking system in the Czech Republic

    Directory of Open Access Journals (Sweden)

    Bohumíra Janštová

    2011-01-01

    Full Text Available The aim of this study was to assess the quality of raw cow’s milk from an automatic milking system. Samples of milk (48 were analyzed chemically and microbiologically and the somatic cell count, freezing point and inhibitor residues were determined. For comparison purposes, milk analysis data from two farms using conventional machine milking and 2008 milk analysis report data for the Czech Republic were used. All physical and chemical characteristics of the study samples were within the established limits. The average content (% of chemical indicators was following: fat 3.79 ± 0.18, protein 3.46 ± 0.06, casein 2.67 ± 0.09, lactose 4.82 ± 0.04 and NFS 8.96 ± 0.11. The values for freezing point and somatic cells count were 221 ± 46.103·ml-1 and -0.521 ± 0.003 °C respectively. No inhibitor residue was detected in any of the samples. Microbiological values were lower than the limits: the total microbial count (2.3·104 CFU·ml-1, psychrotrophic count (6.3·103 CFU·ml-1, coliform count (2.4·101 CFU·ml-1, Escherichia coli count (3.2·101 CFU·ml-1, enterococci count (8.5·101 CFU·ml-1 and Staphylococcus aureus count (1.1·101 CFU·ml-1. The study provides a comprehensive view on the quality of milk produced by robotic milking. The automatic milking system seems to be excellent in terms of milking and milk hygiene.

  16. Fermented goats' milk produced with selected multiple starters as a potentially functional food.

    Science.gov (United States)

    Minervini, Fabio; Bilancia, Maria Teresa; Siragusa, Sonya; Gobbetti, Marco; Caponio, Francesco

    2009-09-01

    A screening among five lactic acid bacteria, used alone or in combination, led to select a mixed starter (Streptococcus thermophilus CR12, Lactobacillus casei LC01, Lactobacillus helveticus PR4, Lactobacillus plantarum 1288) capable to produce a fermented goats' milk containing gamma-aminobutyric acid (GABA) and angiotensin-I converting enzyme (ACE)-inhibitory peptides. The fermented milk was characterized by cell counts of lactic acid bacteria not lower than 7.0 log cfu g(-1), even after 45 days of storage at 4 degrees C. Fermentation of goats' milk resulted in the production of ca. 28 mg kg(-1) of GABA. Furthermore the fermented goats' milk had an in vitro ACE-inhibitory activity of ca. 73%. Prolonged cold storage did not significantly affect both the concentration of GABA and the ACE-inhibitory activity. Moreover, the taurine content did not significantly vary during both fermentation and the entire storage period.

  17. Prevalence, pathogenic capability, virulence genes, biofilm formation, and antibiotic resistance of Listeria in goat and sheep milk confirms need of hygienic milking conditions

    OpenAIRE

    Osman, Kamelia M; Zolnikov, Tara Rava; Samir, Ahmed; Orabi, Ahmed

    2014-01-01

    Goat and sheep milk is consumed by human populations throughout the world; as a result, it has been proposed as an alternative, nutrient-rich milk to feed infants allergic to cow’s milk. Unfortunately, potentially harmful bacteria have not been thoroughly tested in goat or sheep milk. Listeria monocytogenes is a harmful bacterium that causes adverse health effects if ingested by humans. The purpose of this study was to estimate the prevalence and characterize the phenotype, genotype, virulenc...

  18. Formation of volatile compounds in kefir made of goat and sheep milk with high polyunsaturated fatty acid content.

    Science.gov (United States)

    Cais-Sokolińska, D; Wójtowski, J; Pikul, J; Danków, R; Majcher, M; Teichert, J; Bagnicka, E

    2015-10-01

    This article explored the formation of volatile compounds during the production of kefir from goat and sheep milks with high polyunsaturated fatty acids (PUFA) as a result of feeding animals forage supplemented with maize dried distillers grains with solubles (DDGS). The increased PUFA content of the goat and sheep milks resulted in significant changes to the fermentation process. In particular, apart from an increase in the time taken to ferment sheep milk, fermentation yielded less 2,3-butanedione. The highest quantities of this compound were assayed in kefir produced from goat milk with an increased content of PUFA. An increase of PUFA significantly elevated ethanal synthesis during lactose-alcohol fermentation of sheep milk. Neither the origin of milk (sheep or goat) nor the level of PUFA had any statistical effect on the amount of ethanal assayed during the fermentation of milk and within the finished product. The proportion of l(+)-lactic acid was higher in kefirs produced using goat milk compared with sheep milk and did not depend on the content of PUFA in milk fat. The content of PUFA had a significant effect on the aroma profile of the resulting kefirs. An increase in PUFA content resulted in the loss of whey aroma in goat milk kefirs and the animal odor in sheep milk kefirs, and a creamy aroma became more prevalent in kefirs made from sheep milk. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  19. Quantitative structure activity relationship and risk analysis of some pesticides in the goat milk.

    Science.gov (United States)

    Muhammad, Faqir; Awais, Mian Muhammad; Akhtar, Masood; Anwar, Muhammad Irfan

    2013-01-04

    The detection and quantification of different pesticides in the goat milk samples collected from different localities of Faisalabad, Pakistan was performed by HPLC using solid phase microextraction. The analysis showed that about 50% milk samples were contaminated with pesticides. The mean±SEM levels (ppm) of cyhalothrin, endosulfan, chlorpyrifos and cypermethrin were 0.34±0.007, 0.063±0.002, 0.034±0.002 and 0.092±0.002, respectively; whereas, methyl parathion was not detected in any of the analyzed samples. Quantitative structure activity relationship (QSAR) models were suggested to predict the residues of unknown pesticides in the goat milk using their known physicochemical characteristics including molecular weight (MW), melting point (MP), and log octanol to water partition coefficient (Ko/w) in relation to the characteristics such as pH, % fat, specific gravity and refractive index of goat milk. The analysis revealed good correlation coefficient (R2 = 0.985) for goat QSAR model. The coefficients for Ko/w and refractive index for the studied pesticides were higher in goat milk. This suggests that these are better determinants for pesticide residue prediction in the milk of these animals. Based upon the determined pesticide residues and their provisional tolerable daily intakes, risk analysis was also conducted which showed that daily intake levels of pesticide residues including cyhalothrin, chlorpyrifos and cypermethrin in present study are 2.68, 5.19 and 2.71 times higher, respectively in the goat milk. This intake of pesticide contaminated milk might pose health hazards to humans in this locality.

  20. Quantitative Structure Activity Relationship and Risk Analysis of Some Pesticides in the Goat milk

    Directory of Open Access Journals (Sweden)

    Faqir Muhammad

    2013-01-01

    Full Text Available The detection and quantification of different pesticides in the goat milk samples collected from different localities of Faisalabad, Pakistan was performed by HPLC using solid phase microextraction. The analysis showed that about 50% milk samples were contaminated with pesticides. The mean+/-SEM levels (ppm of cyhalothrin, endosulfan, chlorpyrifos and cypermethrin were 0.34+/-0.007, 0.063+/-0.002, 0.034+/-0.002 and 0.092+/-0.002, respectively; whereas, methyl parathion was not detected in any of the analyzed samples. Quantitative structure activity relationship (QSAR models were suggested to predict the residues of unknown pesticides in the goat milk using their known physicochemical characteristics including molecular weight (MW, melting point (MP, and log octanol to water partition coefficient (Ko/w in relation to the characteristics such as pH, % fat, specific gravity and refractive index of goat milk. The analysis revealed good correlation coefficient (R2 = 0.985 for goat QSAR model. The coefficients for Ko/w and refractive index for the studied pesticides were higher in goat milk. This suggests that these are better determinants for pesticide residue prediction in the milk of these animals. Based upon the determined pesticide residues and their provisional tolerable daily intakes, risk analysis was also conducted which showed that daily intake levels of pesticide residues including cyhalothrin, chlorpyrifos and cypermethrin in present study are 2.68, 5.19 and 2.71 times higher, respectively in the goat milk. This intake of pesticide contaminated milk might pose health hazards to humans in this locality.

  1. Evaluation of the Influence of Frequency of Milk Collection and Milking Dayshift on the Microbiological Quality of Raw Milk

    Directory of Open Access Journals (Sweden)

    Lucía Reguillo

    2018-01-01

    Full Text Available The aim of this study was to analyze the influence of milk collection frequency (24 h versus 48 h and milking dayshift (morning and evening on total mesophilic aerobic bacteria (MAB and psychrotrophic bacteria (PSY counts in raw milk samples. MAB counts were determined by flow cytometry (BactoScan and PSY counts by the plate counting agar method. An univariate statistical analysis was performed to find out significant differences among the studied factors. Results obtained showed that collecting milk every 24 h was effective in reducing MAB and PSY counts by 32 and 18%, respectively, compared to 48 h milk collection. This positive impact allowed reducing up to 4°C the temperature of the heat treatment in the dairy industry, thus involving energy savings of 22%. Milking during the mornings showed a significant reduction of MAB counts in comparison to milking performed during the evenings (P<0.05. These results are highly useful for the improvement of milk quality through the optimization of collection and milking systems set at primary production.

  2. Validation and application of FTIR spectroscopy in raw milk analysis

    Directory of Open Access Journals (Sweden)

    Kučević Denis S.

    2017-01-01

    Full Text Available The aim of this study was to investigate whether FTIR spectroscopy is an accurate and valid technique for the assessment of quality parameters in raw cow's milk: fat, protein, lactose, and total solids. The assessment was based on calibration series and comparison with reference material. Furthermore, it takes into account the results obtained in the inter-laboratory comparisons (proficiency testing. The calibration samples were purchased from the accredited regional reference laboratories. The validation parameters included linearity, accuracy, repeatability, reproducibility, and robustness. The linearity ratio was 0.95%. The biases calculated for the fat, protein, lactose and dry matter were -0.33, 0.31, -0.25, and 0.06 respectively. The F value from the F-test was used to determine the significant differences between two independent sets of the results. The obtained results were as follows: 1.469 for fat, 1.634 for protein, 1.192 for lactose, and 0.528 for dry matter. The intra-laboratory reproducibility calculated as the Horwitz Ratios for all parameters were within the criterion limits (0.5 to 0.8. The data obtained for carry-over were 0.27% for fat, 0.52% for protein, 0.47% for lactose, and 0.47% for dry matter. Based on the obtained results it can be concluded that the FTIR spectroscopy is a reliable instrumental technique for the determination of fat, protein, lactose and total solids in raw cow's milk.

  3. Manufacturing of Camembert type cheese made from goat's and cow's milk and their mixtures

    Directory of Open Access Journals (Sweden)

    Katarina Tonković

    2003-10-01

    Full Text Available The aim of this research was to examine the influence of goat's and cow's milk and their mixtures on the quality of the Camembert type cheese within 30 days of its preservation. Cheeses were made of a mixture of goat's and cow's milk in the following ratios: 0:100, 30:70, 50:50, 80:20 and 100:0. They were analysed on the twelfth and thirtieth day of the cheese production. The chemical analysis of milk for cheese production, as well as the chemical composition, pH and sensorial evaluation of cheeses have been determined. It has been proven that the chemical content and type of milk influencesm sensorial evaluation of cheeses and their shelf life. The analysed cheeses, after 12th day of processing, obtained better sensorial scores than those after the 30th day. Cheeses made of goat's milk have obtained the best sensorial evaluation, although their shelf life was shorter than the rest of the cheese samples made of cow's milk and mixtures of goat's and cow's milk. The chosen storage temperature (10-11 ºC was not adequate for Camembert cheeses. Therefore, in order to prolong the shelf life above the 30-day-period and to preserve sensorial properties of the cheeses, the temperature should be lower, i.e. 5 ºC.

  4. MILK QUALITY OF DAIRY GOAT BY GIVING FEED SUPPLEMENT AS ANTIOXIDANT SOURCE

    Directory of Open Access Journals (Sweden)

    M. Mardalena

    2014-10-01

    Full Text Available Free radical levels can be higher than the level of endogenous antioxidants in the body so thatuncomfortable conditions in the body of dairy goats could happen. To anticipate this uncomfortableconditions will be given feed supplement (FS as source of antioxidants (AOX. FS contain mixturepineapple rind meal and antioxidant minerals (AOXM each 25 ppm Zn and 10 ppm Cu. Thisexperiment was carried out to investigate the effect of feed supplements as antioxidant source on milkquality of dairy goats. Sixteen Etawah dairy goats in the second lactation were used in the experimentthat conducted using randomized block design with 4 treatments and 4 replicates. The treatments wereR0 (grass + concentrate, R1 (R0 + FS containing 0.04 % AOX, R2 (R0 + FS containing 0.06% AOX,R3 (R0 + FS containing 0.08 % AOX. The data collected were analyzed using Anova. The result ofphytochemicals analysis indicated that feed supplement contained flavonoid, polyphenols, sesqiuterpen,mopnoterpen, steroids, quinones and saponins. The results of study showed that there were difference(p<0.05 among treatments on blood and milk cholesterol and milk lactose, but there were no difference(P>0.05 on milk yield, milk fat, milk protein and milk antioxidant. The conclusion of this study was thefeed supplements containing 0.08 AOX produced the best response to milk quality of dairy goats.

  5. The effect of raw milk microbial flora on the sensory characteristics of salers-type cheeses

    OpenAIRE

    Callon, Cecile; Berdagué, Jean-Louis; Montel, Marie-Christine

    2005-01-01

    The sensory characteristics of Salers Protected Denomination of Origin raw-milk cheeses are linked to the biochemical composition of the raw material (milk) and to the resultant microbial community. To evaluate the influence of the microbial community on sensory characteristics, Salers-type cheeses were manufactured with the same pasteurized milk, reinoculated with 3 different microbial communities from 3 different filtrates from microfiltered milks. Each cheese was subjected to microbial cou...

  6. Gamma ray irradiated goat milk: comparative sensorial analysis with pasteurized goat milk; Leite de cabra irradiado com raios gama: analise sensorial comparativa com o leite de cabra pasteurizado

    Energy Technology Data Exchange (ETDEWEB)

    Gurgel, Maria Sylvia de C.C. do Amaral; Domarco, Rachel E.; Spoto, Marta H.F. [Centro de Energia Nuclear na Agricultura (CENA), Piracicaba, SP (Brazil). Lab. de Irradiacao de Alimentos

    2002-07-01

    Goat milk consumption has increased in the last years, due to its better digestibility and for constituting a good alternative to cow milk for intolerant people. Brazil has over 10 millions goats, mainly in the Northeast area. Considering that it is very important to increase the shelf-life for this product, this work was done to test the gamma-radiation as a preservation method, evaluating acceptability by sensorial analysis compared with pasteurized milk. The goat milk was bought in the Animal Production Department/ESALQ/USP, Piracicaba, and irradiated with 3,5 kGy in the Food Irradiation Laboratory/CENA/USP, using a cobalt-60 irradiator, type Gammabeam-650, from Nordion, Canada. After irradiation, the samples were maintained under refrigeration at 5 deg C and submitted to sensorial analysis at 1{sup st}, 7{sup th} and 15{sup th} days by 30 untrained tasters. The results indicated, by Tukey test, a significant preference for the pasteurized milk in comparison to the irradiated one, because a hard caprine flavor was developed by the irradiation. (author)

  7. Comparison of the compositions of the stool microbiotas of infants fed goat milk formula, cow milk-based formula, or breast milk.

    Science.gov (United States)

    Tannock, Gerald W; Lawley, Blair; Munro, Karen; Gowri Pathmanathan, Siva; Zhou, Shao J; Makrides, Maria; Gibson, Robert A; Sullivan, Thomas; Prosser, Colin G; Lowry, Dianne; Hodgkinson, Alison J

    2013-05-01

    The aim of the study was to compare the compositions of the fecal microbiotas of infants fed goat milk formula to those of infants fed cow milk formula or breast milk as the gold standard. Pyrosequencing of 16S rRNA gene sequences was used in the analysis of the microbiotas in stool samples collected from 90 Australian babies (30 in each group) at 2 months of age. Beta-diversity analysis of total microbiota sequences and Lachnospiraceae sequences revealed that they were more similar in breast milk/goat milk comparisons than in breast milk/cow milk comparisons. The Lachnospiraceae were mostly restricted to a single species (Ruminococcus gnavus) in breast milk-fed and goat milk-fed babies compared to a more diverse collection in cow milk-fed babies. Bifidobacteriaceae were abundant in the microbiotas of infants in all three groups. Bifidobacterium longum, Bifidobacterium breve, and Bifidobacterium bifidum were the most commonly detected bifidobacterial species. A semiquantitative PCR method was devised to differentiate between B. longum subsp. longum and B. longum subsp. infantis and was used to test stool samples. B. longum subsp. infantis was seldom present in stools, even of breast milk-fed babies. The presence of B. bifidum in the stools of breast milk-fed infants at abundances greater than 10% of the total microbiota was associated with the highest total abundances of Bifidobacteriaceae. When Bifidobacteriaceae abundance was low, Lachnospiraceae abundances were greater. New information about the composition of the fecal microbiota when goat milk formula is used in infant nutrition was thus obtained.

  8. Casein SNP in Norwegian goats: additive and dominance effects on milk composition and quality

    Science.gov (United States)

    2011-01-01

    Background The four casein proteins in goat milk are encoded by four closely linked casein loci (CSN1S1, CSN2, CSN1S2 and CSN3) within 250 kb on caprine chromosome 6. A deletion in exon 12 of CSN1S1, so far reported only in Norwegian goats, has been found at high frequency (0.73). Such a high frequency is difficult to explain because the national breeding goal selects against the variant's effect. Methods In this study, 575 goats were genotyped for 38 Single Nucleotide Polymorphisms (SNP) located within the four casein genes. Milk production records of these goats were obtained from the Norwegian Dairy Goat Control. Test-day mixed models with additive and dominance fixed effects of single SNP were fitted in a model including polygenic effects. Results Significant additive effects of single SNP within CSN1S1 and CSN3 were found for fat % and protein %, milk yield and milk taste. The allele with the deletion showed additive and dominance effects on protein % and fat %, and overdominance effects on milk quantity (kg) and lactose %. At its current frequency, the observed dominance (overdominance) effects of the deletion allele reduced its substitution effect (and additive genetic variance available for selection) in the population substantially. Conclusions The selection pressure of conventional breeding on the allele with the deletion is limited due to the observed dominance (overdominance) effects. Inclusion of molecular information in the national breeding scheme will reduce the frequency of this deletion in the population. PMID:21864407

  9. Effect on milk production of F1 crossbreds resulted from Alpine breed (♂ x Albanian local goat breed (♀

    Directory of Open Access Journals (Sweden)

    Kristaq Kume

    2012-07-01

    Full Text Available About 950,000 goats, farmed mostly in hilly and mountainous areas of Albania, contribute about 8% of the country’s total milk production. In order to increase milk production, farmers are currently using crosses of the local goat breed with exotic breeds, mainly the Alpine breed from France. This study examines milk production data of first lactation from 45 goats of the local breed, 82 goats of the Alpine breed and 58 F1 crosses (♂Alpine breed x ♀local breed. The goats were kept on small-scale farms according to the traditional Albanian system. Milking was carried out in the morning and evening. Kids were weaned at 65 days of age after which milking started. Milk yield was recorded twice with a 15-day interval between the two readings. Total milk yield was calculated using the Fleischmann method. The F1 goats produced 37.8 kg more milk than local breed goats although the lactation length (P<0.05 of F1 goats was six days shorter compared to that of local breed goats (P<0.05. Analysis of variance showed a highly significant effect (P<0.01 of the genotype factor on milk production. The average Cappio-Borlino curves of three genotypes indicated that the lactation curves of local breed and F1 crosses were similar. Although the F1 cross goats had 50% of their genomes from a genetically improved breed they were still able to deal with the difficult conditions that characterize the traditional extensive farming systems in Albania. Breeding pure Alpine breed or its crosses with the local goat breed improved milk production in an extensive traditional system.

  10. Raw cow’s milk relatively inhibits quorum sensing activity of Cromobacterium violaceum in comparison to raw she-camel’s milk

    Directory of Open Access Journals (Sweden)

    A.A. Moawad

    2011-10-01

    Full Text Available Milk from different animal species has variable levels of antimicrobial factors against some of spoilage bacteria. For example, they are significantly present in higher concentration in she-camel’s milk than in cattle or buffalo and they are more heat-resistant than their counterparts in cattle and buffalo. Spoilage bacteria are known to communicate with each other by release of signaling molecules, a phenomenon described as quorum sensing (QS. Some food matrices inhibit these signaling compounds. In this study we screened QS inhibitory activities in raw milk of cattle and camel. Ten samples each of fresh raw cow’s milk and she-camel’s milk from apparently healthy animals were screened using the bacterial model Cromobacterium violaceum. The tested cow’s raw milk samples were able to inhibit the production of QS signalling molecules acyl-homoserine lactones (AHLs produced by C. violaceum. However, she-camel’s milk samples were less effective in inhibiting such AHLs. Thus, one of the factors which influence the inhibitory activity could be derived from variation in milk chemical composition, especially in the percentage of fat which is significantly higher in tested cow’s milk samples (2.22±0.12 than in tested she-camel’s milk samples (1.44±0.35. Natural inhibition of QS signaling by cow’s milk may offer a unique means to control foodborne pathogens and reduce microbial spoilage.

  11. Influence of raw milk quality on processed dairy products: How do raw milk quality test results relate to product quality and yield?

    Science.gov (United States)

    Murphy, Steven C; Martin, Nicole H; Barbano, David M; Wiedmann, Martin

    2016-12-01

    This article provides an overview of the influence of raw milk quality on the quality of processed dairy products and offers a perspective on the merits of investing in quality. Dairy farmers are frequently offered monetary premium incentives to provide high-quality milk to processors. These incentives are most often based on raw milk somatic cell and bacteria count levels well below the regulatory public health-based limits. Justification for these incentive payments can be based on improved processed product quality and manufacturing efficiencies that provide the processor with a return on their investment for high-quality raw milk. In some cases, this return on investment is difficult to measure. Raw milks with high levels of somatic cells and bacteria are associated with increased enzyme activity that can result in product defects. Use of raw milk with somatic cell counts >100,000cells/mL has been shown to reduce cheese yields, and higher levels, generally >400,000 cells/mL, have been associated with textural and flavor defects in cheese and other products. Although most research indicates that fairly high total bacteria counts (>1,000,000 cfu/mL) in raw milk are needed to cause defects in most processed dairy products, receiving high-quality milk from the farm allows some flexibility for handling raw milk, which can increase efficiencies and reduce the risk of raw milk reaching bacterial levels of concern. Monitoring total bacterial numbers in regard to raw milk quality is imperative, but determining levels of specific types of bacteria present has gained increasing importance. For example, spores of certain spore-forming bacteria present in raw milk at very low levels (e.g., products to levels that result in defects. With the exception of meeting product specifications often required for milk powders, testing for specific spore-forming groups is currently not used in quality incentive programs in the United States but is used in other countries (e.g., the

  12. Studies on folate binding and a radioassay for serum and whole blood folate using goat milk as binding agent

    International Nuclear Information System (INIS)

    Piyasena, R.D.; Weerasekera, D.A.; Hettiaratchi, N.; Wikramanayake, T.W.; Sri Lanka Univ., Peradeniya Campus. Nuclear Medicine Unit)

    1977-01-01

    Preparations of cow, goat, buffalo, and human milk in addition to pig plasma were tested for folate binding properties. Of these, only pig plasma and goat milk showed sufficient binding to enable use as binding agents in a radioassay for serum and whole blood folate. The binding of folate by cow mild preparations in particular was found to be very poor. (orig.) [de

  13. Hydrolytic potential of a psychrotrophic Pseudomonas isolated from refrigerated raw milk

    Directory of Open Access Journals (Sweden)

    Ana Paula F. Corrêa

    2011-12-01

    Full Text Available The production of extracellular hydrolases by a psychrotrophic bacterium isolated from refrigerated raw milk, and identified as a Pseudomonas sp. belonging to the Pseudomonas jenssenii group, was studied. This bacterium produced proteolytic and lipolytic enzymes in all media investigated (skim milk, cheese whey, casein broth, and tryptone soy broth. High levels of α-glucosidase were produced in skim milk broth. Hydrolytic enzymes detected in skim milk broth are of particular concern, indicating that these enzymes could be produced by Pseudomonas sp. during the cold storage of raw milk, contributing to the spoilage problem in milk and dairy products.

  14. MILK QUALITY OF DAIRY GOAT BY GIVING FEED SUPPLEMENT AS ANTIOXIDANT SOURCE

    Directory of Open Access Journals (Sweden)

    Mardalena

    2011-09-01

    Full Text Available Free radical levels can be higher than the level of endogenous antioxidants in the body so that uncomfortable conditions in the body of dairy goats could happen. To anticipate this uncomfortable conditions will be given feed supplement (FS as source of antioxidants (AOX. FS contain mixture pineapple rind meal and antioxidant minerals (AOXM each 25 ppm Zn and 10 ppm Cu. This experiment was carried out to investigate the effect of feed supplements as antioxidant source on milk quality of dairy goats. Sixteen Etawah dairy goats in the second lactation were used in the experiment that conducted using randomized block design with 4 treatments and 4 replicates. The treatments were R0 (grass + concentrate, R1 (R0 + FS containing 0.04 % AOX, R2 (R0 + FS containing 0.06% AOX, R3 (R0 + FS containing 0.08 % AOX. The data collected were analyzed using Anova. The result of phytochemicals analysis indicated that feed supplement contained flavonoid, polyphenols, sesqiuterpen, mopnoterpen, steroids, quinones and saponins. The results of study showed that there were difference (p0.05 on milk yield, milk fat, milk protein and milk antioxidant. The conclusion of this study was the feed supplements containing 0.08 AOX produced the best response to milk quality of dairy goats.

  15. Comparison of composition and whey protein fractions of human, camel, donkey, goat and cow milk

    Directory of Open Access Journals (Sweden)

    Halima El-Hatmi

    2015-07-01

    Full Text Available The aim of this study was to compare the physicochemical parameters of milk samples of five different species: cow, goat, donkey, camel and human. Also the analysis of whey protein profile in different milk samples was performed by anion-exchange fast protein liquid chromatography (FPLC while polyacrylamide gel electrophoresis was used to identify a single fraction. Camel milk was the most acid (pH 6.460±0.005 and the richest in total proteins (3.41±0.31 % and ash (0.750±0.102 %, whereas donkey milk had a neutral pH (7.03±0.02 and characterised by low proteins (1.12±0.40 % and fat (0.97±0.03 % content, being very close to human milk. Proteomic analysis of cow, goat, donkey, camel and human milk highlighted significant interspecies differences. Camel milk was similar to human milk in lacking of β-lactoglobulin and richness of α-lactalbumin. The knowledge gained from the proteomic comparison of the milk samples analysed within this study might be of relevance, both, in terms of identifying sources of hypoallergenic alternatives to bovine milk and detection of adulteration of milk samples and products.

  16. Effect of forage/concentrate ratio and soybean oil supplementation on milk yield and quality from dairy goats

    Directory of Open Access Journals (Sweden)

    P. Secchiari

    2010-01-01

    Full Text Available Dietary energy level is a limiting factor of milk production mainly in early lactation goats. Energy intake may be increased by incorporation of fat in ration. Currently, rumen protected fat is mainly adopted in goats nutrition, since the several studies have clearly confirmed that supplies of protected fat markedly improved the fat percentage of goat milk (Schmidely and Sauvant, 2001; Chilliard et al., 2003.

  17. Influence of pumpkin seed cake and extruded linseed on milk production and milk fatty acid profile in Alpine goats.

    Science.gov (United States)

    Klir, Z; Castro-Montoya, J M; Novoselec, J; Molkentin, J; Domacinovic, M; Mioc, B; Dickhoefer, U; Antunovic, Z

    2017-10-01

    The aim was to determine the effect of substituting pumpkin seed cake (PSC) or extruded linseed (ELS) for soya bean meal in goats' diets on milk yield, milk composition and fatty acids profile of milk fat. In total, 28 dairy goats were divided into three groups. They were fed with concentrate mixtures containing soya bean meal (Control; n=9), ELS (n=10) or PSC (n=9) as main protein sources in the trial lasting 75 days. Addition of ELS or PSC did not influence milk yield and milk gross composition in contrast to fatty acid profile compared with Control. Supplementation of ELS resulted in greater branched-chain fatty acids (BCFA) and total n-3 fatty acids compared with Control and PSC (PLA, C18:2n-6; 2.10 and 2.28 g/100 g fatty acids, respectively) proportions compared with Control (2.80 g/100 g fatty acids; PLA/ALA ratio (3.81 v. 7.44 or 6.92, respectively; Psoya bean meal with ELS in hay-based diets may increase beneficial n-3 fatty acids and BCFA accompanied by lowering LA/ALA ratio and increased C18:0. Pumpkin seed cake completely substituted soya bean meal in the diet of dairy goats without any decrease in milk production or sharp changes in fatty acid profile that may have a commercial or a human health relevancy.

  18. Antidiabetic Potential of Kefir Combination from Goat Milk and Soy Milk in Rats Induced with Streptozotocin-Nicotinamide.

    Science.gov (United States)

    Nurliyani; Harmayani, Eni; Sunarti

    2015-01-01

    The study aimed to evaluate the effect of kefir combination from goat milk and soy milk on lipid profile, plasma glucose, glutathione peroxidase (GPx) activity and the improvement of pancreatic β-cell in diabetic rats. Male rats were divided into five treatments: normal control, diabetic control, goat milk kefir, combination of goat milk-soy milk kefir and soy milk kefir. All rats were induced by streptooztocin-nicotinamide (STZ-NA), except for normal control. After 35 d experiment, the rats were sampled for blood, sacrificed and sampled for pancreatic tissues. Results showed that diabetic rats fed kefir combination had higher (pkefir. Decreasing of plasma glucose in diabetic rats fed kefir combination was higher (pkefir. The activity of GPx in diabetic rats fed three kinds of kefir were higher (pkefir combination was the same as the normal control, but it was higher than diabetic control. It was concluded that kefir combination can be used as antidiabetic through maintaining in serum triglyceride, decreasing in plasma glucose, increasing in GPx activity and improving in pancreatic β-cells.

  19. Physico-chemical and organoleptic comparison of buffalo, cow and goat milk and their yogurt samples

    Energy Technology Data Exchange (ETDEWEB)

    Ahmed, N.; Elahi, S. [Kinnaird College for Women, Lahore (Pakistan). Dept. of Biotechnology

    2014-09-15

    The physico-chemical and organoleptic properties of buffalo, cow and goat milk and their respective yogurt samples were analyzed. Milk samples, 200ml each, were inoculated with sucrose, skimmed milk powder, carboxymethyl cellulose (CMC) along with varying concentrations of starter culture and incubated at 45 degree C for 5 hours for yogurt preparation. The physico-chemical parameters studied were pH, tritable acidity, ash, moisture, fat, solid-non fat, total solids, crude protein, specific gravity and total energy, whereas the organoleptic analysis included texture, taste, colour and odor. Results revealed that commercial starter culture, sucrose, CMC and skimmed milk powder, in the concentrations of 0.05%, 0.5%, 0.075% and 0.5% respectively, was the best composition for fermentation. The milk and yogurt of buffalo was found to be physico-chemically and organoleptically superior. However, results showed that goat milk and yogurt could be a valuable substitute, especially in comparison to cow milk and yogurt. goat, milk, yogurt, physico-chemical analysis, organoleptic analysis, carboxymethyl cellulose. (author)

  20. Physico-chemical and organoleptic comparison of buffalo, cow and goat milk and their yogurt samples

    International Nuclear Information System (INIS)

    Ahmed, N.; Elahi, S.

    2014-01-01

    The physico-chemical and organoleptic properties of buffalo, cow and goat milk and their respective yogurt samples were analyzed. Milk samples, 200ml each, were inoculated with sucrose, skimmed milk powder, carboxymethyl cellulose (CMC) along with varying concentrations of starter culture and incubated at 45 degree C for 5 hours for yogurt preparation. The physico-chemical parameters studied were pH, tritable acidity, ash, moisture, fat, solid-non fat, total solids, crude protein, specific gravity and total energy, whereas the organoleptic analysis included texture, taste, colour and odor. Results revealed that commercial starter culture, sucrose, CMC and skimmed milk powder, in the concentrations of 0.05%, 0.5%, 0.075% and 0.5% respectively, was the best composition for fermentation. The milk and yogurt of buffalo was found to be physico-chemically and organoleptically superior. However, results showed that goat milk and yogurt could be a valuable substitute, especially in comparison to cow milk and yogurt. goat, milk, yogurt, physico-chemical analysis, organoleptic analysis, carboxymethyl cellulose. (author)

  1. Allergic reactions to raw, pasteurized, and homogenized/pasteurized cow milk

    DEFF Research Database (Denmark)

    Høst, A; Samuelsson, E G

    1988-01-01

    Five children aged 12-40 months with IgE-mediated adverse reactions to cow milk (immediate onset clinical pattern of cow milk allergy) were orally challenged double-blind in random order with three different milk preparations processed from the same batch of milk 1) raw untreated cow milk, 2......) pasteurized cow milk, 3) homogenized and pasteurized cow milk, and 4) Nutramigen (a commercial hypoallergenic infant formula based on hydrolysed casein) as placebo. Skin prick tests with the same preparations were also performed. On oral challenge the three different processed milk types provoked significant...... and similar allergic reactions in each child, and no adverse reactions followed the challenge with placebo (Nutramigen). Skin prick test with the same milk products were positive in all children and comparable to the results with an extract of purified raw cow milk protein (Soluprick), whereas Nutramigen did...

  2. Short communication: survival of the characteristic microbiota in probiotic fermented camel, cow, goat, and sheep milks during refrigerated storage.

    Science.gov (United States)

    Varga, L; Süle, J; Nagy, P

    2014-01-01

    The objective of this study was to monitor the viability during storage of Lactobacillus acidophilus LA-5 (A), Bifidobacterium animalis ssp. lactis BB-12 (B), and Streptococcus thermophilus CHCC 742/2130 (T) in probiotic cultured dairy foods made from pasteurized camel, cow, goat, and sheep milks fermented by an ABT-type culture. The products manufactured were stored at 4°C for 42d. Microbiological analyses were performed at weekly intervals. Streptococcus thermophilus CHCC 742/2130 was the most numerous culture component in all 4 products both at the beginning and at the end of storage. The viable counts of streptococci showed no significant decline in fermented camel milk throughout the entire storage period. The initial numbers of Lb. acidophilus LA-5 were over 2 orders of magnitude lower than those of Strep. thermophilus CHCC 742/2130. With the progress of time, a slow and constant decrease was observed in lactobacilli counts; however, the final viability percentages of this organism did not differ significantly in the probiotic fermented milks tested. The cultured dairy foods made from cow, sheep, and goat milks had comparable B. animalis ssp. lactis BB-12 counts on d 0, exceeding by approximately 0.5 log10 cycle those in the camel milk-based product. No significant losses occurred in viability of bifidobacteria in fermented camel, cow, and sheep milks during 6wk of refrigerated storage. In conclusion, all 4 varieties of milk proved to be suitable raw materials for the manufacture of ABT-type fermented dairy products that were microbiologically safe and beneficial for human consumption. It was suggested that milk from small ruminants be increasingly used to produce probiotic fermented dairy foods. The development of camel milk-based probiotic cultured milks appears to be even more promising because new markets could thus be conquered. It must be emphasized, however, that further microbiological and sensory studies, technology development activities, and

  3. Influence of udder infection status on milk enzyme activities and somatic cell count throughout early lactation in goats

    DEFF Research Database (Denmark)

    Stuhr, T; Aulrich, K; Barth, K

    2013-01-01

    At present the analysis of somatic cell count (SCC) used for the detection of intramammary infections (IMI) in bovine milk is also recommended for goat milk, but due to the various factors influencing SCC it allows only limited conclusions on the udder health of goats. The research on enzyme...... activity in milk appears to show promise in finding an approach with more suitable indicators of the early detection of IMI in goats. Therefore, the present study aimed to investigate the influence of goat udder infection status on different milk enzyme activities and SCC throughout early lactation....... A total of 60 dairy goats were sampled at weekly intervals over a period of 6 weeks after kidding and the bacteriological status, milk SCC and the activity of N-acetyl-β-d-glucosaminidase (NAGase), β-glucuronidase and lactate dehydrogenase (LDH) of udder halves were analysed. Infections with minor...

  4. EFSA BIOHAZ Panel (EFSA Panel on Biological Hazards), 2015. Scientific Opinion on the public health risks related to the consumption of raw drinking milk

    DEFF Research Database (Denmark)

    Hald, Tine

    Raw drinking milk (RDM) has a diverse microbial flora which can include pathogens transmissible to humans. The main microbiological hazards associated with RDM from cows, sheep and goats, horses and donkeys and camels were identified using a decision tree approach. This considered evidence of milk...... can arise from animals with systemic infection as well as from localised infections such as mastitis. Extrinsic contamination can arise from faecal contamination and from the wider farm environment. It was not possible to rank control options as no single step could be identified which would...

  5. Bacterial subclinical mastitis and its effect on milk yield in low-input dairy goat herds.

    Science.gov (United States)

    Gelasakis, A I; Angelidis, A S; Giannakou, R; Filioussis, G; Kalamaki, M S; Arsenos, G

    2016-05-01

    The objectives of this study were (1) to record the major pathogens associated with subclinical mastitis (SCM), (2) to calculate their incidence during the milking period, and (3) to estimate the effect of SCM on daily milk yield (DMY) for goats reared under low-input management schemes. Dairy goats (n=590) of Skopelos and indigenous Greek breeds from 4 herds were randomly selected for the study. The study included monthly monitoring, milk yield recording, and bacteriological analyses of milk of individual goats during the course of 2 successive milking periods. Incidence and cumulative incidence were calculated for SCM cases. Moreover, 2 mixed linear regression models were built to assess the effects of (1) SCM and (2) different pathogens isolated from SCM cases, on DMY. The estimated incidence and cumulative incidence of SCM for the first and the second year of the study were 69.5 and 96.4 new cases of SCM/1,000 goat-months, and 24.1 and 31.7%, respectively. A total of 755 milk samples were subjected to microbiological examination, resulting in 661 positive cultures. Coagulase-negative and coagulase-positive staphylococci were isolated from 50.2 and 34.5% of the positive cultures, respectively. The incidence of infections (new infections per 1,000 goat-months) for the first and the second year of the study were 34 and 53 for coagulase-negative staphylococci, 23 and 28 for coagulase-positive staphylococci, 3 and 5 for Streptococcus/Enterococcus spp., and 5.5 and 9.1 for gram-negative bacteria. Goats with SCM had lower DMY when compared with goats without SCM (ca. 47g/d, corresponding to a 5.7% decrease in DMY). In particular, goats with SCM due to coagulase-positive staphylococci infection produced approximately 80g/d less milk (a reduction of ca. 9.7%) compared with uninfected ones, whereas SCM due to gram-negative bacteria resulted in approximately 15% reduction in DMY. Investigating the epidemiology of SCM and its effects on production traits is critical for

  6. Repeatability of differential goat bulk milk culture and associations with somatic cell count, total bacterial count, and standard plate count

    OpenAIRE

    Koop, G.; Dik, N.; Nielen, M.; Lipman, L.J.A.

    2010-01-01

    The aims of this study were to assess how different bacterial groups in bulk milk are related to bulk milk somatic cell count (SCC), bulk milk total bacterial count (TBC), and bulk milk standard plate count (SPC) and to measure the repeatability of bulk milk culturing. On 53 Dutch dairy goat farms, 3 bulk milk samples were collected at intervals of 2 wk. The samples were cultured for SPC, coliform count, and staphylococcal count and for the presence of Staphylococcus aureus. Furthermore, SCC ...

  7. [Evaluation of the health aspects of goat milk].

    Science.gov (United States)

    Gajewska, R; Nabrzyski, M; Ganowiak, Z; Kucharska, D

    1996-01-01

    The work contains results of determinations of protein, fat, lactose, vitamin C and minerals: Ca, P, Fe, Mn, Cu, Zn, Na, K, Cl as well as toxic metals like Hg, Cd and Pb in goat milk. The nonmineral components were determined by general approved analytical methods. Minerals like Ca, P, Fe, Mn, Cu, Zn, Na, K, Cd and Pb were determined by the flame ASA method and mercury by "cold vapour" technique. Chloride were determined by Mohr method and phosphorus as phosphates by colorimetric method with ammonium molybdate. Mean percentage content of protein, fat, lactose and ash were: 3.2 (range 2.7-3.7); 3.9 (3.2-6.5); 4.1 (3.9-4.9); 0.87 (0.84-1.00) respectively. Mean content of ascorbic acid amounted 0.53 mg/100 g (range 0.19-1.42), and the content of minerals were as follows: Ca 130 (range 102-150); P 127 (115-151); Mg 14.1 (12.6-16.3); Mn 0.026 (0.019-0.037); Cu 0.04 (0.02-0.08); Zn 0.54 (0.40-1.25); Fe 0.047 (0.020-0.097); Na 42.4 (20.8-59.5); K 163 (138-190); Cl 168 (128-180). The levels of toxic metals were mostly below the allowable limits, mercury from 3.8 to 14.5 micrograms/kg, cadmium < 0.01 micrograms/kg. In the case of lead a 40% of investigated samples were above the allowable limits.

  8. Improving characteristics of goat milk yogurt drink fortified by mangosteen rind (Garcinia mangostana Lin.) extract

    Science.gov (United States)

    Wibawanti, J. M. W.; Rinawidiastuti; Arifin, H. D.; Zulfanita

    2018-01-01

    Peranakan Etawah (PE) milk is highly nutritive goaty flavour make it not preferable by consumer. Processing of yogurt drink made PE goat milk enhances palatability. Goat yogurt drink can be supplemented high antioxidantive activity by mangosteen rind extract. Comletely Randomized Design (CRD) was throughout the research with different concentrations of mangosteen rind extract (0, 1, 2, 3, and 4% (v/v). The organoleptic analysis showed the significant enhancement by fortification with mangosteen rind extract. The highest antioxidant activity was shown on the yogurt drink 4% v/v of mangosteen extract. In conclusion, the fortification of mangosteen rind extract was enhanced of characteristics of yogurt drink.

  9. Proteolysis during ripening of Manchego cheese made from raw or pasteurized ewes' milk. Seasonal variation.

    Science.gov (United States)

    Gaya, Pilar; Sánchez, Carmen; Nuñez, Manuel; Fernández-García, Estrella

    2005-08-01

    Changes in nitrogen compounds during ripening of 40 batches of Manchego cheese made from raw milk (24 batches) or pasteurized milk (16 batches) at five different dairies throughout the year were investigated. After ripening for six months, degradation of p-kappa- and beta-caseins was more intense in raw milk cheese and degradation of alpha(s2)-casein in pasteurized milk cheese. Milk pasteurization had no significant effect on breakdown of alpha(s1)-casein. Hydrophobic peptide content did not differ between raw and pasteurized milk cheese, whereas hydrophilic peptide content was higher in raw milk cheese. There were no significant differences between seasons for residual caseins, but hydrophobic peptides were at a higher level in cheese made in autumn and winter and hydrophilic peptides in cheese made in winter and spring. Raw milk cheese had a higher content of total free amino acids and of most individual free amino acids than pasteurized milk cheese. The relative percentages of the individual free amino acids were significantly different for raw milk and pasteurized milk cheeses. The relative percentages of Lys and lie increased, while those of Val, Leu and Phe decreased during ripening. There were also seasonal variations within the relative percentages of free amino acids. In raw milk cheeses, Asp and Cys were relatively more abundant in those made in autumn, Glu and Arg in cheeses made in winter, and Lys and Ile in cheeses made in spring and summer. Biogenic amines were detected only in raw milk cheese, with the highest levels of histamine, tryptamine and tyramine in cheeses made in spring, winter and spring, respectively.

  10. Isolation and Molecular Characterization of Local Goat Milk Casein for Nutraceutical Value

    Directory of Open Access Journals (Sweden)

    Azhar Mohd Akmal

    2017-01-01

    Full Text Available Bioactive peptide from casein play a very important role in biological functionalities such as antioxidant and antimicrobial activities. Casein is the main protein that derived from goat milk which consists of alpha (α, beta (β and kappa (κ casein. Dietary protein such as casein from animal can provide rich source of bioactive peptide. However, the macromolecular protein such as cow milk can cause allergic response to certain individuals. On the other hand, goat milk have been known for its hypoallergenic and therapeutic properties in human nutrition and health. The purpose of this study is to extract casein from local breed goat milk and identify the molecular characterization of casein for nutraceutical value. The casein was successfully extracted using extraction method. Extraction is a common technique used to separate a desired substance when it is mixed with other components. The average percentage of casein obtained was 24.25%. Then, the casein was analysed by running it in the SDS-Page. The major fraction is β-casein and the minor is α-casein that can be seen between 20kDa and 30kDa respectively. There is no contaminated protein appear in the purified α-amylase. The result obtained in this study indicates that isolated casein from Malaysian goat milk was pure and can be used as bioactive peptide for nutraceutical value.

  11. Comparison of the Antibacterial Activity of Cow Milk Kefir and Goat Milk Kefir Against Bacteria Bacillus Cereus

    OpenAIRE

    Suhartanti, Dwi; Septian, Ryan

    2014-01-01

    Background: Kefir is fermented milk and comes from the Caucasus. Kefir is made by inoculating cow milk, goat or sheep with kefir grain. Kefir contains 0.5–1.0% alcohol and 0.9 to 1.1% lactic acid. This product is very popular in the Soviet Union, where the consumption of kefir reach 4.5 kg per capita per year. Kefir made from pasteurized milk and fermented with kefir grain, kefir grain is white seeds from bacteria colony, such as Streptococcus sp., Lactobacilli and some types of yeast/yeast a...

  12. Effects of cyclodextrins on the flavor of goat milk and its yogurt.

    Science.gov (United States)

    Young, O A; Gupta, R B; Sadooghy-Saraby, S

    2012-02-01

    Goat milk fat includes several branched chain fatty acids (BCFAs), like 4-methyloctanoic acid, which when free, are responsible for goaty flavor. This flavor limits the market opportunities for goat milk. Prior research showed that cyclodextrins (CDs) can reduce goaty flavor, presumably by binding free fatty acids. This research extends that observation. In odor ranking trials in citrate buffer at pH 4.8, β-CD concentrations between 0% and 0.35% were increasingly effective in reducing odor intensity due to 4-methyloctanoic acid, but only when present in high molar excess. α-CD was also effective, but γ-CD was not. In lipase-treated goat milk only β-CD was effective but at much lower molar excess, a difference potentially explained by several factors. One was that BCFAs bind to CDs in marked preference to their straight chain isomers. Displacement experiments with phenolphthalein disproved that hypothesis. The ability of β-CD to reduce goaty flavor intensity extended to yogurt. An analytical panel showed that flavor of goat yogurt was reduced by addition of β-CD, but only if added before heating and fermentation. A hedonic trial showed that consumers preferred unsweetened and sweet/vanilla-flavored goat yogurt more when β-CD was included, P = 0.004 and 0.016, respectively. Males liked all yogurts more than females (P yogurt: sweet/vanilla masked the goaty flavor for males but not females. This results parallels previously demonstrated gender effects for sheepmeat flavor caused by BCFAs. β-Cyclodextrin masks goaty flavor in yogurt, and with its GRAS status means it could be used in commercial goat yogurts and similar products so the real or perceived nutritional advantages of goat milk are not lost to goaty flavor. © 2012 Institute of Food Technologists®

  13. Residues of legacy organochlorine contaminants in the milk of Alpine and Saanen goats from the central region of Mexico.

    Science.gov (United States)

    Schettino, Beatriz; Gutiérrez, Rey; Ortiz, Rutilio; Vega, Salvador; Urban, Georgina; Ramírez, Acacia

    2013-08-01

    This study investigated a suite of legacy organochlorine contaminants in the milk of two breeds of goats raised in the central region of Mexico, where this agricultural production is of national (Mexican) economic importance. Forty milk samples from Alpine and Saanen goats were assessed. It was found that the concentrations of the majority of organochlorine pesticides in milk samples were lower than those stipulated in Mexican and international regulation. The values in both breeds of goat exceeded the upper permissible limits of Codex Alimentarius for delta hexachloro cyclohexane (HCH) (17.3 of samples of Saanen) and heptachlor plus heptachlor epoxide (50 % and 13 % of samples). It may be concluded that milk from these goat breeds from central Mexico showed some risks of contamination in certain times of the year (dry season). However, under further assessment and use of pesticides the goat's milk will likely be safe for human consumption and for use in products such as cheeses, regional candies and desserts (cajeta). In recent years, goat milk production has increased in the central regions and it is an economic alternative to milk from livestock. It is necessary to continue the monitoring of goat's milk to assess the presence and control of HCHs through best management practices.

  14. Prevalence, seasonality, and growth of enterococci in raw and pasteurized milk in Victoria, Australia.

    Science.gov (United States)

    McAuley, Catherine M; Britz, Margaret L; Gobius, Kari S; Craven, Heather M

    2015-12-01

    This study investigated the prevalence, seasonality, and species variety of enterococci present in raw milk factory silos and pasteurized milk in 3 dairying regions in Victoria, Australia, over a 1-yr period. Additionally, the growth ability of thermoduric enterococci isolated in this study (Enterococcus faecalis, E. faecium, E. hirae, and E. durans) was determined in milk at temperatures likely to occur during storage, transport, and distribution, and before domestic consumption (4 and 7°C). Enterococci were detected in 96% of 211 raw milk samples, with an average count of 2.48 log10 cfu/mL. Counts were significantly lower in winter than summer (average 1.84 log10 cfu/mL) and were different between factories but not regions. Enterococcus faecalis was the most prevalent species isolated from raw milk in every factory, comprising between 61.5 and 83.5% of enterococcal species across each season. Enterococci were detected in lower numbers in pasteurized milk than in raw milk and were below the limit of detection on spread plates (pasteurization. Residual viable cells were only detected following enrichment using 100-mL samples of milk, with 20.8% of the samples testing positive; this equated to a decrease in the average raw milk enterococci count of >4 log10 cfu/mL following pasteurization. Although E. faecalis predominated in raw milk and E. durans was found in only 2.9% of raw milk samples, E. durans was the most prevalent species detected in pasteurized milk. The detection of enterococci in the pasteurized milk did not correlate with higher enterococci counts in the raw milk. This suggested that the main enterococci populations in raw milk were heat-sensitive and that thermoduric enterococci survived pasteurization in a small numbers of instances. All of the thermoduric enterococci that were assessed for growth at likely refrigeration temperatures were able to grow at both 4 and 7°C in sterile milk, with generation times of 35 to 41h and 16 to 22h, respectively

  15. Bacteriocinogenic Lactococcus lactis subsp. lactis DF04Mi isolated from goat milk: Application in the control of Listeria monocytogenes in fresh Minas-type goat cheese

    Directory of Open Access Journals (Sweden)

    Danielle N. Furtado

    2015-03-01

    Full Text Available Listeria monocytogenes is a pathogen frequently found in dairy products. Its control in fresh cheeses is difficult, due to the psychrotrophic properties and salt tolerance. Bacteriocinogenic lactic acid bacteria (LAB with proven in vitro antilisterial activity can be an innovative technological approach but their application needs to be evaluated by means of in situ tests. In this study, a novel bacteriocinogenic Lactococcus lactis strain (Lc. lactis DF4Mi, isolated from raw goat milk, was tested for control of growth of L. monocytogenes in artificially contaminated fresh Minas type goat cheese during storage under refrigeration. A bacteriostatic effect was achieved, and counts after 10 days were 3 log lower than in control cheeses with no added LAB. However, this effect did not differ significantly from that obtained with a non-bacteriocinogenic Lc. lactis strain. Addition of nisin (12.5 mg/kg caused a rapid decrease in the number of viable L. monocytogenes in the cheeses, suggesting that further studies with the purified bacteriocin DF4Mi may open new possibilities for this strain as biopreservative in dairy products.

  16. The continuing debate over increasing consumption of raw (unpasteurised) milk: is it safe?

    DEFF Research Database (Denmark)

    Jordan, K. N.; Hunt, K.; Hoorfar, Jeffrey

    2012-01-01

    The debate on the consumption of raw (unpasteurised) milk continues. On one side there is the risk of illness associated with pathogenic bacteria that may be in the milk, a risk that can be mitigated by pasteurisation of the milk prior to consumption. On the other side, there are those who believ...

  17. Raw bovine milk improves gut responses to feeding relative to infant formula in preterm piglets

    DEFF Research Database (Denmark)

    Li, Yanqi; Jensen, Mikkel Lykke; Chatterton, Dereck Edward Winston

    2014-01-01

    For preterm neonates, the quality of the first milk is crucial for intestinal maturation and resistance to necrotizing enterocolitis (NEC). Among other factors, milk quality is determined by the stage of lactation and processing. We hypothesized that unprocessed mature bovine milk (BM, raw bovine...

  18. Use of Electrical Coductivity Sensors to monitor Health Status and Quality of Milk in Dairy Goats

    Directory of Open Access Journals (Sweden)

    Mauro Zaninelli

    2015-11-01

    Full Text Available Intramammary infection (IMI can adversely affect, in dairy goats, milk quality and milk yield leading to high economical losses. Although somatic cell count (SCC and microbiological tests could be valid approaches to detect IMI, other methods of IMI early detection may be useful to detect infected animals and to improve milk quality. The aim of this study was to test a new multivariate model developed with the fuzzy logic technology and based on the milk EC - acquired on-line for each gland by dedicated sensors - and on new qualitative and quantitative indexes derived from the spectrum of the recorded signals. Results obtained showed that the fuzzy logic model tested could achive better results than those already reached in dairy goat research. Nevertheless, further experiment and more field data could be useful to reach the best possible accuracy that this multivariate approach could show.

  19. CONCENTRATION OF SELECTED ELEMENTS IN RAW AND ULTRA HEAT TREATED COW MILK

    Directory of Open Access Journals (Sweden)

    Lukáčová Anetta

    2012-10-01

    Full Text Available The potential presence of toxic metals in food is being recognized as a priority by standards organizations and constitutes an analytical challenge. The toxic metal content of milk and dairy products is due to several factors: environmental conditions, the manufacturing process and the possible contamination during several steps of the manufacturing processes. The aim of this study was to evaluate samples of raw milk with fat contents 3.8% obtained at randomly from animal farms in around Nitra, western Slovakia region and ultra – heat treated cow milk (UHT with fat contents 1.5% commercially available from local market in Nitra. Samples of milk were analysed for metal contents using atomic absorption spectrophotometry (AAS. UHT milk showed higher levels of cadmium, nickel and iron. Higher levels of zinc, copper were detected in raw milk. Significant differences in the concentration of copper between raw and UHT cow milk were found.

  20. Factors Influencing the Concentration of Certain Liposoluble Components in Cow and Goat Milk: A Review

    Directory of Open Access Journals (Sweden)

    Anamaria COZMA

    2014-09-01

    Full Text Available Milk fat contains a large number of fatty acids (FA and other liposoluble components that exhibit various effects on human health. The present article reviews some of the factors affecting FA, vitamin A and cholesterol concentrations in milk from dairy cow and goat. Milk fat composition is linked to many factors, both intrinsic (animal species, breed, lactation stage and extrinsic (environmental. The effect of animal species on milk fat composition is important, as reflected by higher concentrations of short- and medium-chain FA, vitamin A and cholesterol in goat than in cow milk. In a given ruminant species, the effects linked to breed are significant but limited and they can only be achieved over long periods of time. The lactation stage has an important effect on milk FA composition, mainly linked to body fat mobilisation in early lactation, but it only lasts a few weeks each year. Furthermore, changes in feeding have a marked influence on milk fat composition. Changing the forages in the diet of ruminants, pasture in particular, or supplementing lipids to the diet, represent an efficient mean to modify milk fat composition by decreasing saturated FA and cholesterol, and increasing cis-9,trans-11-CLA and vitamin A. Nutrition therefore constitutes a natural strategy to rapidly modulate milk FA, vitamin A and cholesterol composition, with the overall aim of improving the long-term health of consumers.

  1. Physicochemical Characteristic of Fermented Goat Milk Added with Different Starters Lactic Acid Bacteria

    OpenAIRE

    Anif Mukaromah Wati; Mei Jen Lin; Lilik Eka Radiati

    2018-01-01

    Development of traditional food including dadih to be commercial fermented milk was needed to achieve efficiency and effective of products. Dadih with natural starter needs to be changed with starters because starters can be produced commercially. This study aims to evaluate physicochemical characteristic of fermented goat milk that added with different starters Lactic Acid Bacteria (LAB) isolated from dadih. The materials used for this research were starters LAB that isolated from dadih. In ...

  2. Quantitative structure activity relationship and risk analysis of some pesticides in the goat milk

    OpenAIRE

    Muhammad, Faqir; Awais, Mian Muhammad; Akhtar, Masood; Anwar, Muhammad Irfan

    2013-01-01

    The detection and quantification of different pesticides in the goat milk samples collected from different localities of Faisalabad, Pakistan was performed by HPLC using solid phase microextraction. The analysis showed that about 50% milk samples were contaminated with pesticides. The mean+/-SEM levels (ppm) of cyhalothrin, endosulfan, chlorpyrifos and cypermethrin were 0.34+/-0.007, 0.063+/-0.002, 0.034+/-0.002 and 0.092+/-0.002, respectively; whereas, methyl parathion was not detected in an...

  3. Effect of goat milk on hepatotoxicity induced by antitubercular drugs in rats

    Directory of Open Access Journals (Sweden)

    Sonam Miglani

    2016-10-01

    Full Text Available Aim of the present study was to assess the hepatoprotective activity of goat milk on antitubercular drug-induced hepatotoxicity in rats. Hepatotoxicity was induced in rats using a combination of isoniazid, rifampicin, and pyrazinamide given orally as a suspension for 30 days. Treatment groups received goat milk along with antitubercular drugs. Liver damage was assessed using biochemical and histological parameters. Administration of goat milk (20 mL/kg along with antitubercular drugs (Group III reversed the levels of serum alanine aminotransferase (82 ± 25.1 vs. 128.8 ± 8.9 units/L and aspartate aminotransferase (174.7 ± 31.5 vs. 296.4 ± 56.4 units/L, p<0.01 compared with antitubercular drug treatment Group II. There was a significant decrease in serum alanine aminotransferase (41.8 ± 4.1 vs. 128.8 ± 8.9 ​ units/L, p<0.01 and aspartate aminotransferase (128.8 ± 8.54 vs. 296.4 ± 56.4 units/L, p<0.001 levels in Group IV (goat milk 40 mL/kg compared with antitubercular drug treatment Group II. Goat milk (20 mL/kg and 40 mL/kg was effective in reversing the rise in malondialdehyde level compared with the antitubercular drug suspension groups (58.5 ± 2 vs. 89.88 ± 2.42 μmol/mL of tissue homogenate, p<0.001 and 69.7 ± 0.78 vs. 89.88 ± 2.42 μmol/mL of tissue homogenate, p<0.001, respectively. Similarly, both doses of milk significantly prevented a fall in superoxide dismutase level (6.23 ± 0.29 vs. 3.1 ± 0.288 units/mL, p<0.001 and 7.8 ± 0.392 vs. 3.1 ± 0.288 units/mL, p<0.001 compared with the group receiving antitubercular drugs alone. Histological examination indicated that goat milk reduced inflammation and necrotic changes in hepatocytes in the treatment groups. The results indicated that goat milk prevented the antitubercular drug-induced hepatotoxicity and is an effective hepatoprotective agent.

  4. Milk yield, quality, and coagulation properties of 6 breeds of goats: Environmental and individual variability.

    Science.gov (United States)

    Vacca, Giuseppe M; Stocco, Giorgia; Dettori, Maria L; Pira, Emanuela; Bittante, Giovanni; Pazzola, Michele

    2018-05-09

    Goat milk and cheese production is continuously increasing and milk composition and coagulation properties (MCP) are useful tools to predict cheesemaking aptitude. The present study was planned to investigate the extension of lactodynamographic analysis up to 60 min in goat milk, to measure the farm and individual factors, and to investigate differences among 6 goat breeds. Daily milk yield (dMY) was recorded and milk samples collected from 1,272 goats reared in 35 farms. Goats were of 6 different breeds: Saanen and Camosciata delle Alpi for the Alpine type, and Murciano-Granadina, Maltese, Sarda, and Sarda Primitiva for the Mediterranean type. Milk composition (fat, protein, lactose, pH; somatic cell score; logarithmic bacterial count) and MCP [rennet coagulation time (RCT, min), curd-firming time (k 20 , min), curd firmness at 30, 45, and 60 min after rennet addition (a 30 , a 45 , and a 60 , mm)] were recorded, and daily fat and protein yield (dFPY g/d) was calculated as the sum of fat and protein concentration multiplied by the dMY. Data were analyzed using different statistical models to measure the effects of farm, parity, stage of lactation and breed; lastly, the direct and the indirect effect of breed were quantified by comparing the variance of breed from models with or without the inclusion of linear regression of fat, protein, lactose, pH, bacterial, somatic cell counts, and dMY. Orthogonal contrasts were performed to compare least squares means. Almost all traits exhibited high variability, with coefficients of variation between 32 (for RCT) and 63% (for a 30 ). The proportion of variance regarding dMY, dFPY, and milk composition due to the farm was moderate, whereas for MCP it was low, except for a 60 , at 69%. Parity affected both yield and quality traits of milk, with least squares means of dMY and dFPY showing an increase and RCT and curd firmness traits a decrease from the first to the last parity class. All milk quality traits, excluding fat, were

  5. Detection of Taste Change of Bovine and Goat Milk in Room Ambient Using Electronic Tongue

    Directory of Open Access Journals (Sweden)

    Imam Tazi

    2017-11-01

    Full Text Available An electronic tongue (e-tongue based on an array of lipid/polymer membranes has been successfully developed for measuring the taste evolution of natural milk. The e-tongue consisted of 16 different lipid/polymer membranes combined with or without a pH sensor. The natural milk of bovine and goat were purchased from the local farming store in Malang-Indonesia. The taste measurement was carried out, from fresh (0 h to stale (12 h, every two hours under room ambient without any treatment. The responses of the e-tongue were evaluated using a Principal Component Analysis (PCA and a Linear Discriminant Analysis (LDA. From PCA results, the taste of both milk samples tends to change by time although some groups show a partial overlapping. LDA results show the high precision of the e-tongue in clustering taste evolution. The correctly classified groups after the cross-validation procedure were achieved 95.7 and 87.1% for bovine and goat milk, respectively. The improvement of the classification using LDA was obtained by adding data from a pH sensor of each measurement as 100 and 98.6% for bovine and goat milk, respectively. This work indicates that the lab-made e-tongue may be useful to predict the quality of natural milk for the food industry.

  6. Assessment of safety and interferon gamma responses of Mycobacterium bovis BCG vaccine in goat kids and milking goats.

    Science.gov (United States)

    Pérez de Val, Bernat; Vidal, Enric; López-Soria, Sergio; Marco, Alberto; Cervera, Zoraida; Martín, Maite; Mercader, Irene; Singh, Mahavir; Raeber, Alex; Domingo, Mariano

    2016-02-10

    Vaccination of domestic animals has emerged as an alternative long-term strategy for the control of tuberculosis (TB). A trial under field conditions was conducted in a TB-free goat herd to assess the safety of the Mycobacterium bovis BCG vaccine. Eleven kids and 10 milking goats were vaccinated with BCG. Bacterial shedding and interferon gamma (IFN-γ) responses were monitored throughout the study. Comprehensive pathological examination and mycobacterial culture of target tissues were performed. BCG vaccine strain was only isolated from the draining lymph node of the injection site of a kid euthanized at week 8 post-vaccination. The remaining animals were euthanized at week 24. Six out of 20 showed small granulomas at the injection site. BCG shedding was not detected in either faeces or in milk throughout the study. All vaccinated kids showed BCG-induced IFN-γ responses at week 8 post-vaccination. BCG vaccination of goats showed no lack of biological safety for the animals, environment and public health, and local adverse reactions were negligible. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Molecular detection of Brucella melitensis in sheep and goat milk in ...

    African Journals Online (AJOL)

    2Department of Food Hygiene, Faculty of Veterinary Medicine, 3Faculty of ... Methods: A total of 225 milk samples (sheep = 125; goat = 100) were collected from Isfahan and ... economic and health impact of brucellosis [9,10]. ... and the risk of laboratory personnel being ... or the minutest Brucella gene copies in samples.

  8. Reduction in heat-induced gastrointestinal hyperpermeability in rats by bovine colostrum and goat milk powders.

    Science.gov (United States)

    Prosser, C; Stelwagen, K; Cummins, R; Guerin, P; Gill, N; Milne, C

    2004-02-01

    Male Sprague-Dawley rats were assigned to one of three dietary groups [standard diet (Cont; n = 8), standard diet plus bovine colostrum powder (BColost 1.7 g/kg; n = 8), or goat milk powder (GMilk 1.7 g/kg; n = 8)] to determine the ability of these supplements to reduce gastrointestinal hyperpermeability induced by heat. Raising core body temperature of rats to 41.5 degrees C increased transfer of (51)Cr-EDTA from gut into blood 34-fold relative to the ambient temperature value (P transferred into the blood of rats in either the BColost (27% of Cont) or GMilk group (10% of Cont) after heating, showing that prior supplementation with either bovine colostrum or goat milk powder significantly reduced the impact of heat stress on gastrointestinal permeability. The changes in the BColost group were not significantly different than those of the GMilk group. The potential mechanism of the protective effect of bovine colostrum and goat milk powders may involve modulation of tight junction permeability, because both powders were able to maintain transepithelial resistance in Madin Darby canine kidney cells challenged with EGTA compared with cells maintained in media only. The results show that bovine colostrum powder can partially alleviate the effects of hyperthermia on gastrointestinal permeability in the intact animal. Moreover, goat milk powder was equally as effective as bovine colostrum powder, and both may be of benefit in other situations where gastrointestinal barrier function is compromised.

  9. CHARACTERISTICS OF PROBIOTIC KOUMISS FROM GOAT MILK WITH ADDITION OF ROSELLE EXTRACT (Hibiscus Sabdariffa Linn

    Directory of Open Access Journals (Sweden)

    E. Nuraeni

    2015-04-01

    Full Text Available Goat milk and roselle (Hibiscus sabdariffa Linn are food ingredients with health functionalproperties. This research used Lactobacillus acidophilus RRAM-01 and Lactococcus lactis RRAM-01which had been proven as probiotic, and Saccharomyces cereviceae. Saccharomyces cereviseae wasused to produce specific flavor components in koumiss (bacterial fermentation product. The objectiveof this research was to study the characteristics of goat milk probiotic koumiss added that with roselleextract. The results showed that the addition of different concentration of roselle extract (0%, 0.5%, and1% in the goat milk probiotic koumiss had no effect on chemical and microbiological characteristics ofkoumiss. Goat milk processed into koumiss had ability to suppress the growth of coliform and hadstrong inhibition activity against Escherichia coli ATCC 25922 as tested by agar diffusion test.Microbiological analysis used in this research was the pour plate method. Population of lactic acidbacteria indicated that the product fulfilled standards as probiotics koumiss (1011 cfu/mL, coliform wasnot detected in the products, therefore the products met the criteria of The National Agency of Drug andFood Control (NA-DFC as probiotic functional food. Sensory evaluation was conducted by usinghedonic quality test. Based on the hedonic quality test, addition of different concentrations of roselleextract increased the intensity of red color and koumiss viscosity, but had no effect to the aroma andsourness of koumiss.

  10. The effect of subclinical mastitis on milk yield in dairy goats

    NARCIS (Netherlands)

    Koop, G.; Werven, van T.; Schuiling, H.J.; Nielen, van M.

    2010-01-01

    The aims of this study were to estimate milk yield (MY) losses associated with subclinical intramammary infection (IMI) in dairy goats and to assess if somatic cell count (SCC) can be used to estimate such MY losses. We used 2 data sets to study these questions. The first data set consisted of 5

  11. Biological transfer of plutonium via in vivo labeled goat's milk. Final report

    International Nuclear Information System (INIS)

    Sutton, W.W.; Mullen, A.A.; Lloyd, S.R.; Mosley, R.E.

    1976-03-01

    The long physical and biological half-life and high relative toxicity have dictated that considerable effort be devoted to quantifying plutonium transport through the various trophic levels. Despite the fact that biological transport of plutonium has been studied for many years, quantitative values for its transfer to milk, and its subsequent uptake by suckling animals have not been established. Three lactating goats were given intravenous injections of citrate-buffered plutonium nitrate at a rate of 75 microcuries per animal per day for three consecutive days. In all three goats approximately one percent of the total plutonium dose was transferred to the milk by the fifth post-treatment day. Plutonium retained by the tissues was deposited primarily in the liver and bone. In vitro plutonium-labeled milk was also fed to groups of rats and juvenile goats. Tissue concentrations of plutonium from juvenile goats which had received either in vivo or in vitro labeled milk were somewhat variable. Due possibly to this, within group variability and the small number of animals per group (two) there were no clearly discernible differences between treatments. The only comparison point to show a consistent trend was the observation that, as expected, juvenile rats retained more of the ingested dose than the adult animals

  12. Using Goat's Milk, Barley Flour, Honey, and Probiotic to Manufacture of Functional Dairy Product.

    Science.gov (United States)

    Ismail, Magdy Mohamed; Hamad, Mohamed Farid; Elraghy, Esraa Mohamed

    2017-08-23

    Stirred yogurt manufactured using probiotic culture which usually called Rayeb milk in the Middle East region is one of the most important functional fermented milk products. To increase the health and functionality properties to this product, some ingredients like fruits, cereal, and whey protein are used in production. This study was carried out to prepare functional Rayeb milk from goat's milk, barley flour (15%) and honey (4%) mixtures using ABT culture. Also, vanilla and cocoa powder were used as flavorings. Adding barley flour and honey to goat's milk increased curd tension and water-holding capacity and decreased coagulation time and susceptibility to syneresis. The values of carbohydrate, total solids, dietary fiber, ash, total protein, water soluble nitrogen, total volatile fatty acids, unsaturated fatty acids, oleic, linoleic, α-linolenic acids, and antioxidant activity were higher in Rayeb milk supplemented with barley flour and honey than control. The viabilities of Lactobacillus acidophilus and Bifidobacterium lactis Bb12 (Chr. Hansen's Lab A/S) increased in fortified Rayeb milk. The recommended level of 10 7  cfu g -1 of bifidobacteria as a probiotic was exceeded for these samples. Addition of vanilla (0.1%) or cocoa powder (0.5%) improved the sensory properties of fortified Rayeb milk.

  13. Effect of soybean hulls on lactation curves and the composition of goat milk

    Directory of Open Access Journals (Sweden)

    Maximiliane Alavarse Zambom

    Full Text Available ABSTRACT This study aimed to evaluate the effects of soybean hulls (SBH as a ground corn replacement (0, 50, and 100% SBH on the parameters of the lactation curve and on lactation curves and milk composition. Fourteen multiparous Saanen goats were used during their lactation period, from kidding until the drying of their milk on the 228th day of lactation, and were distributed in a completely randomised design. The data was analysed using Bayesian methodology to minimise the effect of the low number of animals and to allow for comparison of the curve parameters estimated by Wood's nonlinear model. The SBH had no effect on the initial milk yield; nevertheless, the SBH reduced the rate of yield until lactation peak and accelerated the declining rate of yield after lactation. The treatments did not affect dry matter intake. The inclusion of SBH increased the fat content in the milk, which was also influenced by the lactation stage of the goats. Effects were observed on polyunsaturated fatty acids (PUFA, PUFA/total AG ratio, and the n-6:n-3 ratio of goat milk fat. The lactation stage changed the content of saturated fatty acid, monounsaturated fatty acid, and C18:2 (conjugated linoleic acid. The SBH can therefore be used as a ground corn replacement in the diets of lactating goats, as changes in the lactation curve parameters did not result in changes in total yields. Nevertheless, if the milk fat increases, then as quality rises, so could payment by quality, and thus an increase in profit margins per liter of milk sold.

  14. Survey of Veterinary Drug Residues in Raw Milk in Hebei Province, China.

    Science.gov (United States)

    Han, Rong-Wei; Yu, Zhong-Na; Zhen, Tian-Yuan; Wang, Jun

    2017-10-17

    The objective of this study was to investigate the occurrence of veterinary drug residues in raw milk from Hebei, the second-largest dairy production province in the People's Republic of China. A total of 192 raw milk samples were collected from 64 milk stations in seven districts. Twenty-eight veterinary drug residues were analyzed by ultraperformance liquid chromatography with tandem mass spectrometry based on a China National Standard. Raw milk samples with multiple residues of veterinary drugs were not found in the present study. Residues of four veterinary drugs, penicillin G, sulfacetamide, trimethoprim, and lincomycin, were detected in 12 (6.25%) raw milk samples, with detection ratios of 1.04, 0.52, 3.13, and 1.56%, respectively. All veterinary drug residues detected were under the maximum residue levels as regulated by China, the European Union, the United States, and the Codex Alimentarius Commission. In general, raw milk from Hebei province was considered relatively safe for human consumption because of the low prevalence of veterinary drug residues. However, stringent control measurements for veterinary drug residues in raw milk are required because some veterinary drugs were detected in milk from some areas of Hebei province.

  15. Comparison of the in vitro digestion of raw pasture milk and commercial HTST and UHT pasteurized milk

    Science.gov (United States)

    Consumption of raw milk from pasture-fed cows, typically purchased at local farms, is steadily increasing in the US because many consumers believe that high-temperature short-time (HTST) or ultrahigh temperature (UHT) pasteurization affects the digestibility of milk proteins and thus the bioavailabi...

  16. Microbiological Characteristic and Nutrition Quality of Goat Milk Kefir Based on Vitamin D3 Fortification Time

    Science.gov (United States)

    Fauziyyah, F.; Panunggal, B.; Afifah, D. N.; Rustanti, N.; Anjani, G.

    2018-02-01

    Goat milk kefir fortified with vitamin D3 is expected to benefit individual with insulin resistance. Different vitamin D3 fortification time allegedly effect microbiological characteristic and nutrition quality of goat milk kefir due to its microbial growth curve, thus this study aimed to analyze those parameters. This study was an experimental research. This study contains five treatments (vitamin D3 fortification at 0, 6, 12, 18, or 24 hours of fermentation) and a group of control. Total lactic acid bacteria, vitamin D3, protein level, fat contain, crude fiber, viscosity, and pH was analyzed by Total Plate Count, spectrophotometry, Bradford method, Babcock method, gravimetric analysis, Ostwald method, and pH meter respectively. Time of vitamin D3 fortification significantly effect vitamin D3 content (p=0,021), fat content (p=0,001), crude fiber (p=0,0001), viscosity (p=0,010), and total lactic acid bacteria (p=0,048). The highest vitamin D3 content was found on the group fortified at 6 hours of fermentation. All treatment groups has lower fat content and crude fiber content than control group. Total LAB in all group meet the Codex standard (≥ 107 CFU/ml). Control group and fortification group at 24 hours of fermentation have higher viscosity than other groups. There was no significant difference found in goat milk kefir protein level (p=0,262) and pH (p=0,056) despite the difference of fortification time. Vitamin D3 fortification time effect vitamin D3 content, fat content, crude fiber, viscosity, and total lactic acid bacteria of goat milk kefir, but did not effect protein content and pH of goat milk kefir.

  17. Proteolytic and antimicrobial activity of lactic acid bacteria grown in goat milk.

    Science.gov (United States)

    Atanasova, Jivka; Moncheva, Penka; Ivanova, Iskra

    2014-11-02

    We examined 62 strains and 21 trade starter cultures from the collection of LB Bulgaricum PLC for proteolytic and antimicrobial activity of lactic acid bacteria (LAB) grown in goat milk. The aim of this study was to investigate the fermentation of caseins, α-lactalbumin and β-lactoglobulin by LAB, using the o -phthaldialdehyde (OPA) spectrophotometric assay and sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE). The proteolysis targeted mainly caseins, especially β-casein. Whey proteins were proteolyzed, essentially β-lactoglobulin. The proteolytic activity of Lactococcus lactis l598, Streptococcus thermophilus t3D1, Dt1, Lactobacillus lactis 1043 and L. delbrueckii subsp. bulgaricus b38, b122 and b24 was notably high. The proteolysis process gave rise to medium-sized peptide populations. Most of the examined strains showed antimicrobial activity against some food pathogens, such as Escherichia coli , Staphylococcus aureus , Salmonella cholere enteridis , Listeria monocytogenes , Listeria innocua and Enterobacter aerogenes . The most active producers of antimicrobial-active peptides were strains of L. delbrueckii subsp. bulgaricus and S. thermophilus , which are of practical importance. The starter cultures containing the examined species showed high proteolytic and antimicrobial activity in skimmed goat milk. The greatest antimicrobial activity of the cultures was detected against E. aerogenes . The obtained results demonstrated the significant proteolytic potential of the examined strains in goat milk and their potential for application in the production of dairy products from goat's milk. The present results could be considered as the first data on the proteolytic capacity of strains and starter cultures in goat milk for the purposes of trade interest of LB Bulgaricum PLC.

  18. Physicochemical and sensory characteristics of fat-free goat milk yogurt with added stabilizers and skim milk powder fortification.

    Science.gov (United States)

    Bruzantin, F P; Daniel, J L P; da Silva, P P M; Spoto, M H F

    2016-05-01

    Goat milk yogurt has a less consistent coagulum compared with cow milk yogurt; furthermore, the presence of goat milk in foodstuffs imparts a characteristic flavor that can restrict its acceptance by consumers. This study aimed to assess and compare the physicochemical and sensory characteristics of fat-free goat milk yogurts with added stabilizers or bovine skim milk powder to improve the final product. Four treatment additions were evaluated: (1) a mixture of 0.1% (wt/vol) carrageenan and 0.1% (wt/vol) pectin (treatment CR); (2) 0.5% (wt/vol) pectin (treatment PE); (3) 4.65% (wt/vol) bovine skim milk powder (treatment BM); and (4) control (no stabilizer; treatment CT). The physicochemical parameters were investigated at on d 1 and 5 of storage. The BM treatment presented higher pH and titratable acidity values, resulting in a buffering capacity effect. The total crude protein (CP) and solids-not-fat (SNF) contents were also higher in BM compared with the other evaluated treatments because of the addition of bovine skim milk powder. We detected a reduction in pH values for all treatments. Lower SNF contents were present in the CR and CT treatments, which might be related to a syneresis process during storage; moreover, an increase in total CP was observed for all treatments due to the proteolytic action of the starter culture. Sensory attributes, including appearance (color, consistency, and presence of lumps), texture (consistency, viscosity, and presence of lumps), flavor (bitter, sweet, and characteristic of commercial plain nonfat yogurt), and overall impression were evaluated by quantitative descriptive analysis. The addition of 0.5% (wt/vol) of pectin (PE treatment) strengthened the curd; however, the visual and oral presence of lumps and a higher bitterness score were noted by trained panelists, which resulted in the lowest overall impression score for the PE treatment. In several sensory attributes, the CR treatment was considered similar to the control

  19. Effects of milk from goat fed Crotalaria spectabilis seeds on growing rats

    Directory of Open Access Journals (Sweden)

    Rosane Maria Trindade de Medeiros

    1999-01-01

    Full Text Available Seeds of Crotalaria spectabilis, containing the pyrrolizidine alkaloid (PA monocrotaline (MCT, were fed to a lactating dairy goat. Milk from this goat was fed to rats for 8 weeks to determine whether MCT or its toxic metabolites are transferred into the goat’s milk. Rats from the experimental group showed significantly higher (p<0.05 serum levels of ALT, AST, GGT and LDH and less weight gains (p<0.05 than control rats. The most significant lesions in rats consuming the experimental ration were mild to moderate interstitial pneumonia and a vacuolar degeneration and occasionally necrosis of periportal hepatocytes. The results of this study indicate that the PA and/or its metabolites are eliminated in milk.

  20. Fractionation of radioactivity in the milk of goats administered 14C-aflatoxin B1

    International Nuclear Information System (INIS)

    Goto, T.; Hsieh, D.P.

    1985-01-01

    A detailed fractionation of radioactivity in the milk of goats administered 14 C-aflatoxin B1 at low doses was performed. The milk collected in the first 24 h following dosing contained radioactivity equivalent to 0.45-1.1% of the dose given. The radioactivity in each sample was partitioned into 4 fractions: ether, protein, dichloromethane, and water-alcohol. Over 80% of the radioactivity was detected in the dichloromethane fraction, of which over 95% was attributable to aflatoxin M1. No aflatoxin B1 or other known aflatoxin metabolites were detected in any fraction. The results indicate that the major metabolite of aflatoxin B1 in goat milk is aflatoxin M1 and that other metabolites, including conjugates, are of minor significance

  1. Prevalence of Clostridium difficile in raw beef, cow, sheep, goat, camel and buffalo meat in Iran.

    Science.gov (United States)

    Rahimi, Ebrahim; Jalali, Mohammad; Weese, J Scott

    2014-02-05

    Clostridium difficile has been shown to be a nosocomial pathogen associated with diarrhoea and pseudomembranous colitis in hospitalised patients and the infection is believed to be acquired nosocomially. Recent studies have shown the occurrence of C. difficile in food animals which may act as a source of infection to humans.The aim of this study was to determine the occurrence of C. difficile in retail raw beef, cow, sheep, goat, camel and buffalo meat in Iran. From April to October 2012, a total of 660 raw meat samples from beef, cow, sheep, goat, camel and buffalo were purchased from 49 butcheries in Isfahan and Khuzestan provinces, Iran, and were evaluated for the presence of C. difficile using a method including selective enrichment in C. difficile broth, subsequent alcohol shock-treatment and plating onto C. difficile selective medium. C. difficile isolates were tested for the presence of toxin genes and were typed using PCR ribotyping. In this study, 13 of 660 meat samples (2%) were contaminated with C. difficile. The highest prevalence of C. difficile was found in buffalo meat (9%), followed by goat meat (3.3%), beef meat (1.7%), cow (0.94%) and sheep meat (0.9%). Seven of the 13C. difficile strains (53.9%) were positive for tcdA, tcdB and cdtB toxin genes and were classified as ribotype 078. Four strains (30.8%) were positive tcdA, and tcdB, and one strain (7.7%) was possessed only tcdB. The remaining isolate was non-toxigenic. Susceptibilities of 13C. difficile isolates were determined for 11 antimicrobial drugs using the disk diffusion assay. Resistance to clindamycin, gentamycin, and nalidixic acid was the most common finding. To our knowledge, the present study is the first report of the isolation of C. difficile from raw buffalo meat. This study indicates the potential importance of food, including buffalo meat, as a source of transmission of C. difficile to humans.

  2. Blood and milk polymorphonuclear leukocyte and monocyte/macrophage functions in naturally caprine arthritis encephalitis virus infection in dairy goats.

    Science.gov (United States)

    Santos, Bruna Parapinski; Souza, Fernando Nogueira; Blagitz, Maiara Garcia; Batista, Camila Freitas; Bertagnon, Heloísa Godoi; Diniz, Soraia Araújo; Silva, Marcos Xavier; Haddad, João Paulo Amaral; Della Libera, Alice Maria Melville Paiva

    2017-06-01

    The exact influence of caprine arthritis encephalitis virus (CAEV) infection on blood and milk polymorphonuclear leukocytes (PMNLs) and monocyte/macrophages of goats remains unclear. Thus, the present study sought to explore the blood and milk PMNL and monocyte/macrophage functions in naturally CAEV-infected goats. The present study used 18 healthy Saanen goats that were segregated according to sera test outcomes into serologically CAEV negative (n=8; 14 halves) and positive (n=10; 14 halves) groups. All milk samples from mammary halves with milk bacteriologically positive outcomes, somatic cell count ≥2×10 6 cellsmL -1 , and abnormal secretions in the strip cup test were excluded. We evaluated the percentage of blood and milk PMNLs and monocyte/macrophages, the viability of PMNLs and monocyte/macrophages, the levels of intracellular reactive oxygen species (ROS) and the nonopsonized phagocytosis of Staphylococcus aureus and Escherichia coli by flow cytometry. In the present study, a higher percentage of milk macrophages (CD14 + ) and milk polymorphonuclear leukocytes undergoing late apoptosis or necrosis (Annexin-V + /Propidium iodide + ) was observed in CAEV-infected goats; we did not find any further alterations in blood and milk PMNL and monocyte/macrophage functions. Thus, regarding our results, the goats naturally infected with CAEV did not reveal pronounced dysfunctions in blood and milk polymorphonuclear leukocytes and monocytes/macrophages. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Differences in the microstructure and rheological properties of low-fat yoghurts from goat, sheep and cow milk.

    Science.gov (United States)

    Nguyen, Hanh T H; Afsar, Saeedeh; Day, Li

    2018-06-01

    Goat and sheep milks have long been used to produce a range of dairy products due to their nutritional value and health benefits. Information about the microstructure and rheology of goat and sheep yoghurts, however, is scarce. In this study, the microstructure, texture and rheological properties of cow, goat and sheep yoghurts were investigated and compared. The results show that a longer fermentation and gelation time was required for goat yoghurt with a lower storage modulus compared to cow and sheep yoghurts. Cooling resulted in an increase in the storage modulus at different magnitudes for cow, goat and sheep yoghurts. Goat yoghurt had a smaller particle size and a softer gel, which is linked with a more porous microstructure. The results obtained here demonstrate the effect of different milk types on the properties of yoghurts and provide a better understanding into the link between the microstructure and physical properties of the product. Copyright © 2018 Elsevier Ltd. All rights reserved.

  4. Organic farming of dairy goats in the Veneto region: feeding management and milk quality

    Directory of Open Access Journals (Sweden)

    Lucia Bailoni

    2010-01-01

    Full Text Available The relationship between the quality of goat milk and the feeding management in organic farms located in the Veneto Region was evaluated. Five organic dairy goat farms with Alpine and Saanen breeds were considered. Samples of bulk milk and feeds were collected monthly and analysed for chemical composition. Milk fatty acids profile was also determined. All data were submitted by ANCOVA analysis using breed (B, time of sampling (ST and B x ST as fixed effects and dry matter intake (DMI, dietary concentrations of crude protein (CPc, NDF (NDFc, starch (starchc, and use of grazing as linear covariates. Milk urea N was positively affected by DMI (r=3.64; P<0.05 and negatively by starchc (r=-5.91; P<0.05 and total bacterial count increased significantly (P<0.05 with the increase of CPc and starchc. DMI affected positively the milk fatty acid (FA profile by increasing of PUFA (P<0.01, n-3 (P<0.001 and n-6 (P<0.05 acids and decreasing of SFA (P<0.05 levels in milk. Opposite effects on FA profile were observed by CPc, NDFc and starchc. The use of grazing only caused a significant increase (P<0.05 in the content of CLA in milk.

  5. Four-year monitoring of foodborne pathogens in raw milk sold by vending machines in Italy.

    Science.gov (United States)

    Giacometti, Federica; Bonilauri, Paolo; Serraino, Andrea; Peli, Angelo; Amatiste, Simonetta; Arrigoni, Norma; Bianchi, Manila; Bilei, Stefano; Cascone, Giuseppe; Comin, Damiano; Daminelli, Paolo; Decastelli, Lucia; Fustini, Mattia; Mion, Renzo; Petruzzelli, Annalisa; Rosmini, Roberto; Rugna, Gianluca; Tamba, Marco; Tonucci, Franco; Bolzoni, Giuseppe

    2013-11-01

    Prevalence data were collected from official microbiological records monitoring four selected foodborne pathogens (Salmonella, Listeria monocytogenes, Escherichia coli O157:H7, and Campylobacter jejuni) in raw milk sold by self-service vending machines in seven Italian regions (60,907 samples from 1,239 vending machines) from 2008 to 2011. Data from samples analyzed by both culture-based and real-time PCR methods were collected in one region. One hundred raw milk consumers in four regions were interviewed while purchasing raw milk from vending machines. One hundred seventy-eight of 60,907 samples were positive for one of the four foodborne pathogens investigated: 18 samples were positive for Salmonella, 83 for L. monocytogenes, 24 for E. coli O157:H7, and 53 for C. jejuni in the seven regions investigated. No significant differences in prevalence were found among regions, but a significant increase in C. jejuni prevalence was observed over the years of the study. A comparison of the two analysis methods revealed that real-time PCR was 2.71 to 9.40 times more sensitive than the culture-based method. Data on consumer habits revealed that some behaviors may enhance the risk of infection linked to raw milk consumption: 37% of consumers did not boil milk before consumption, 93% never used an insulated bag to transport raw milk home, and raw milk was consumed by children younger than 5 years of age. These results emphasize that end-product controls alone are not sufficient to guarantee an adequate level of consumer protection. The beta distribution of positive samples in this study and the data on raw milk consumer habits will be useful for the development of a national quantitative risk assessment of Salmonella, L. monocytogenes, E. coli O157, and C. jejuni infection associated with raw milk consumption.

  6. Determining the source of Bacillus cereus and Bacillus licheniformis isolated from raw milk, pasteurized milk and yoghurt.

    Science.gov (United States)

    Banykó, J; Vyletelová, M

    2009-03-01

    Strain-specific detection of Bacillus cereus and Bacillus licheniformis in raw and pasteurized milk, and yoghurt during processing. Randomly selected isolates of Bacillus spp. were subjected to PCR analysis, where single primer targeting to the repetitive sequence Box elements was used to fingerprint the species. The isolates were separated into six different fingerprint patterns. The results show that isolates clustered together at about the 57% similarity level with two main groups at the 82% and 83% similarity levels, respectively. Contamination with identical strains both of B. cereus and B. licheniformis in raw and pasteurized milk was found as well as contaminated with different strains (in the case of raw milk and yoghurt/pasteurized milk and yoghurt). Several BOX types traced in processed milk samples were not discovered in the original raw milk. BOX-PCR fingerprinting is useful for characterizing Bacillus populations in a dairy environment. It can be used to confirm environmental contamination, eventually clonal transfer of Bacillus strains during the technological processing of milk. Despite the limited number of strains analysed, the two Bacillus species yielded adequately detectable banding profiles, permitting differentiation of bacteria at the strain level and showing their diversity throughout dairy processing.

  7. Raw and Heat-Treated Milk: From Public Health Risks to Nutritional Quality

    Directory of Open Access Journals (Sweden)

    Francesca Melini

    2017-11-01

    Full Text Available Consumers have recently shown a preference for natural food products and ingredients and within that framework, their interest in consuming raw drinking milk has been highlighted, claiming nutritional, organoleptic and health benefits. However, a public debate has simultaneously emerged about the actual risks and benefits of direct human consumption of raw milk. This paper compares the microbiological, nutritional and sensory profile of raw and heat-treated milk, to evaluate the real risks and benefits of its consumption. In detail, it provides an updated overview of the main microbiological risks of raw milk consumption, especially related to the presence of pathogens and the main outputs of risk assessment models are reported. After introducing the key aspects of most commonly used milk heat-treatments, the paper also discusses the effects such technologies have on the microbiological, nutritional and sensory profile of milk. An insight into the scientific evidence behind the claimed protective effects of raw milk consumption in lactose-intolerant subjects and against the onset of asthma and allergy disorders in children is provided. The emergence of novel milk processing technologies, such as ohmic heating, microwave heating, high pressure processing, pulsed electric fields, ultrasound and microfiltration is also presented as an alternative to common thermal treatments.

  8. Raw milk from vending machines: Effects of boiling, microwave treatment, and refrigeration on microbiological quality.

    Science.gov (United States)

    Tremonte, Patrizio; Tipaldi, Luca; Succi, Mariantonietta; Pannella, Gianfranco; Falasca, Luisa; Capilongo, Valeria; Coppola, Raffaele; Sorrentino, Elena

    2014-01-01

    In Italy, the sale of raw milk from vending machines has been allowed since 2004. Boiling treatment before its use is mandatory for the consumer, because the raw milk could be an important source of foodborne pathogens. This study fits into this context with the aim to evaluate the microbiological quality of 30 raw milk samples periodically collected (March 2013 to July 2013) from 3 vending machines located in Molise, a region of southern Italy. Milk samples were stored for 72 h at 4 °C and then subjected to different treatments, such as boiling and microwaving, to simulate domestic handling. The results show that all the raw milk samples examined immediately after their collection were affected by high microbial loads, with values very close to or even greater than those acceptable by Italian law. The microbial populations increased during refrigeration, reaching after 72 h values of about 8.0 log cfu/mL for Pseudomonas spp., 6.5 log cfu/mL for yeasts, and up to 4.0 log cfu/mL for Enterobacteriaceae. Boiling treatment, applied after 72 h to refrigerated milk samples, caused complete decontamination, but negatively affected the nutritional quality of the milk, as demonstrated by a drastic reduction of whey proteins. The microwave treatment at 900 W for 75 s produced microbiological decontamination similar to that of boiling, preserving the content in whey proteins of milk. The microbiological characteristics of raw milk observed in this study fully justify the obligation to boil the raw milk from vending machines before consumption. However, this study also showed that domestic boiling causes a drastic reduction in the nutritional value of milk. Microwave treatment could represent a good alternative to boiling, on the condition that the process variables are standardized for safe domestic application. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  9. Fatty acid profile in milk from goats, Capra aegagrus hircus, exposed to perchlorate and its relationship with perchlorate residues in human milk.

    Science.gov (United States)

    Cheng, Qiuqiong; Smith, Ernest E; Kirk, Andrea B; Liu, Fujun; Boylan, Lee Mallory; McCarty, Michael E; Hart, Sybil; Dong, Linxia; Cobb, George P; Jackson, W Andrew; Anderson, Todd A

    2007-10-01

    Polyunsaturated fatty acids (PUFA) in milk are vital for normal growth and development of infant mammals. Changes in fatty acid composition were observed in milk fat from goats dosed with perchlorate (0.1 and 1 mg/kg body weight/day) for 31 days, but the effect was not persistent. Adaptation may be induced in these goats to compensate for the perchlorate effect. In an analysis of fatty acid composition in human milk samples, a weak negative correlation was observed between perchlorate concentrations and total PUFA in 38 human milk samples.

  10. High-pressure processing of a raw milk cheese improved its food safety maintaining the sensory quality.

    Science.gov (United States)

    Delgado, Francisco José; Delgado, Jonathan; González-Crespo, José; Cava, Ramón; Ramírez, Rosario

    2013-12-01

    The effect of high-pressure treatment (400 or 600 MPa for 7 min) on microbiology, proteolysis, texture and sensory parameters was investigated in a mature raw goat milk cheese. At day 60 of analysis, Mesophilic aerobic, Enterobacteriaceae, lactic acid bacteria and Listeria spp. were inactivated after high-pressure treatment at 400 or 600 MPa. At day 90, mesophilic aerobic, lactic acid bacteria and Micrococacceae counts were significantly lower in high-pressure-treated cheeses than in control ones. In general, nitrogen fractions were significantly modified after high-pressure treatment on day 60 at 600 MPa compared with control cheeses, but this effect was not found in cheeses after 30 days of storage (day 90). On the other hand, high-pressure treatment caused a significant increase of some texture parameters. However, sensory analysis showed that neither trained panellists nor consumers found significant differences between control and high-pressure-treated cheeses.

  11. Milk and hair progesterone contents during the oestrous cycle and gestation in goats

    International Nuclear Information System (INIS)

    Guo Dazhi; Zeng Xianyin; Liu Xianyi; Chen Faju; Song Xuehua

    1991-01-01

    Milk and hair progesterone contents were determined during the oestrous cycle and gestation in Saanen, F1 crosses (Saanen x Chengdu Mah) and F2 (Saanen x (Saanen x Chengdu Mah)) goats using the radioimmunoassay kits provided by the IAEA. Hair samples were collected from the back of the goats every day from day 1 (after oestrus) to day 28 and every 5 days from day 30 to parturition. Foremilk samples were also collected daily from day 1 to day 20. The results showed that there were significant differences in milk progesterone concentration between pregnant and non-pregnant goats during days 19 to 22 after oestrus. Progesterone in goat hair could be detected using the RIA kits. Hair progesterone content was correlated with the milk progesterone profile during the first 20 days of pregnancy in non-pregnant goats; a similar correlation was observed during the oestrous cycle. When milk samples were collected on day 22 post-oestrus and 3.9 ng/mL was taken as the discriminatory level, the accuracy of pregnancy and non-pregnancy diagnosis was 82.4% and 100% respectively. When hair samples were collected on day 22 and 3.7 ng/50 mg hair was taken as the discriminatory level, the accuracy of pregnancy and non-pregnancy diagnosis was 77.8% and 100% respectively. During gestation, hair progesterone contents increased gradually from day 30 to day 120 and decreased rapidly from day -8 before parturition to parturition. 6 refs, 3 figs, 2 tabs

  12. The raw milk quality from organic and conventional agriculture

    Directory of Open Access Journals (Sweden)

    Juraj Čuboň

    2008-01-01

    Full Text Available In the experiment the parameters of milk quality from organic and conventional dairy farm were analyzed. The number of somatic cells was 219. 103 . ml−1 in the organic milk and 242. 103 . ml−1 in the conventional milk. It seems that conditions of organic farming could be able to have a positive effect of health of mammary gland. We found the highest number of somatic cells at the end of the year (336.103 . ml−1 in organic milk in December, respectively 336.103 . ml−1 in conventional milk in November. The total bacteria count was higher in organic milk (86.103 CFU . ml−1 than conventional (51.103 CFU . ml−1 likewise the number of coliform bacteria. Number of coliform bacteria was by conventional milk under 1000 CFU . ml−1 for all samples. The highest number of coliform bacteria in organic milk was achieved in February (1000 CFU . ml−1. We found higher content of fat (4.23 g . 100g−1 and protein (3.41 g . 100g−1 by organic milk in comparison with the conventional milk (4.11 g . 100g−1, resp. 3.39 g . 100g−1. The higher content of protein and fat in organic milk and the higher protein content in conventional milk were determined in December. The heat resistance was determined by 96 % ethanol required to coagulation of 2 ml of milk. The conventional milk has significantly lower heat resistance (1.38 ml than the organic one (1.86 ml. Better heat stability by organic milk and higher content of Ca (144.29 mg . 100g−1 correspond with higher technological quality of organic milk.

  13. Short communication: Microbial quality of raw milk following commercial long-distance hauling.

    Science.gov (United States)

    Darchuk, Emily M; Meunier-Goddik, Lisbeth; Waite-Cusic, Joy

    2015-12-01

    Hauling is a critical part of the commercial milk supply chain, yet very few studies have aimed to understand its effect on raw milk quality. This study focused on the effect of extended-duration tanker use during hauling on raw milk quality at a commercial facility. Standard tanker use [cleaned-in-place (CIP) once per 24h] served as a control and an incremental between-load water rinse with sanitizer treatment (RS) was evaluated to mitigate any effect from extended duration hauling. During this study, 1 commercial truck with 2 trailers was monitored for 10d. The truck collected milk at a large dairy farm, transported the milk to a manufacturing facility, and then returned to the same farm for a second load. Each round-trip journey took between 10 and 12h, allowing for 2 loads per 24-h use period. Following the second delivery, the truck was cleaned by CIP treatment starting a new treatment day. Producer samples were collected from the raw milk bulk tank on the farm before loading milk into the tanker. The same milk was sampled directly out of the tanker truck before unloading at the manufacturer. Effect on individual bacteria count, thermophilic spore count, and preliminary incubation count was quantified through common industry tests. Surface sponge swabs were also used to monitor tanker sanitation and the efficacy of cleaning treatments. Results did not identify a negative effect on raw milk quality due to extended duration hauling. Whereas the addition of RS did not provide any measurable quality benefits for the microbial milk quality, swab results demonstrated that the RS treatment was able to reduce surface bacteria in the tanker, although not to the same level as the full CIP treatment. Based on this study, current CIP practices for long distance milk hauling appear to be effective in mitigating any measurable effect on raw milk quality. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  14. Transfer of 131I and sup(95m)Tc from pasture to goat milk

    International Nuclear Information System (INIS)

    Bondietti, E.A.; Garten, C.T. Jr.

    1986-01-01

    The purpose of this research was to compare the behaviour of 131 I (Tsub(1/2)=8.0d) and sup(95m)Tc (Tsub(1/2)=61d), which were sprayed on to pasture that was subsequently grazed by a herd of dairy goats. The transfer of 131 I to goats milk was about 5600 times more than that of sup(95m)Tc after 5 d of grazing contaminated pasture. Most of the difference appeared to be explained by a progressive immobilisation of technetium on vegetation, which occurred during the first few days of the experiment. (UK)

  15. Effects of fermentation with Lactobacillus rhamnosus GG on product quality and fatty acids of goat milk yogurt.

    Science.gov (United States)

    Jia, Ru; Chen, Han; Chen, Hui; Ding, Wu

    2016-01-01

    The effect of fermentation with Lactobacillus rhamnosus GG on the product quality of goat milk yogurt using traditional yogurt starter was studied through single-factor experiments and orthogonal experiments. The optimum fermentation condition was evaluated by the titratable acidity of goat milk yogurt, water-retaining capability, sensory score, and texture properties; the fatty acids of the fermented goat milk were determined by a gas chromatograph. Results indicate that high product quality of goat milk yogurt can be obtained and the content of short-chain and medium-chain fatty acids can be decreased significantly when amount of sugar added was 7%, inoculation amount was 3%, the ratio of 3 lactic acid bacteria--Lactobacillus delbrueckii ssp. bulgaricus, Streptococcus thermophilus, and L. rhamnosus GG--was 1:1:3, and fermentation temperature was 42°C. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  16. Composition of raw cow milk and artisanal yoghurt collected in ...

    African Journals Online (AJOL)

    PONKA ROGER

    2013-12-04

    Dec 4, 2013 ... The composition of milk is of most importance to the dairy industry and human health. ... fraction was lower in yoghurt while Fe, Cu and Mn levels were lower in ... elements and water. ... blems result to the deterioration of fresh milk before ... milk was heated to boiling to destroy the pathogenic organisms at.

  17. Textural and physico-chemical characteristics of white brined goat cheeses made from frozen milk and curd. The use of square I - distance statistics

    Directory of Open Access Journals (Sweden)

    Nemanja Kljajevic

    2017-01-01

    Full Text Available Objective of this study was to investigate the effect of short term frozen storage of milk and curd on textural properties and physico-chemical composition of white brined goat cheese. Raw milk and curds (at various stages of pressing were frozen and kept for seven days at -27 °C. Following the freezing, all the experimental cheeses were manufactured by the standard procedure, the same that was used for the control cheese sample which did not undergo freezing at any stage of production. The Square I - distance was used in order to rank the cheeses according to their similarity to the control cheese in terms of texture attributes and physico-chemical characteristics. The results show that, in terms of all examined variables, the cheese made from frozen milk is the most similar to the control cheese.

  18. Determination of Heavy Metals in Raw Milk Produced in Tangshan City, China

    Directory of Open Access Journals (Sweden)

    Li Aijun

    2016-01-01

    Full Text Available The objective of this study was to investigate the content of heavy metals (Arsenic, Lead, Chromium and Mercury in raw milk of Tangshan. Samples were obtained directly from dairy farms in Tangshan City. A total of 55 raw milk samples were collected in 2012, a total of 150 raw milk samples and 150 in 2013 and 2014 respectively. All the samples were analyzed by ICP-MS (Inductively Coupled Plasma Mass Spectrometry method-based on China National Standard. In general, heavy metals (Arsenic, Lead, Chromium and Mercury of raw milk in Tangshan were relatively safe for people’s health because none of those heavy metals (Arsenic, Lead, Chromium and Mercury contents exceeded the Maximum Limit set by China.

  19. Evaluation of the Charm maximum residue limit β-lactam and tetracycline test for the detection of antibiotics in ewe and goat milk.

    Science.gov (United States)

    Beltrán, M C; Romero, T; Althaus, R L; Molina, M P

    2013-05-01

    The Charm maximum residue limit β-lactam and tetracycline test (Charm MRL BLTET; Charm Sciences Inc., Lawrence, MA) is an immunoreceptor assay utilizing Rapid One-Step Assay lateral flow technology that detects β-lactam or tetracycline drugs in raw commingled cow milk at or below European Union maximum residue levels (EU-MRL). The Charm MRL BLTET test procedure was recently modified (dilution in buffer and longer incubation) by the manufacturers to be used with raw ewe and goat milk. To assess the Charm MRL BLTET test for the detection of β-lactams and tetracyclines in milk of small ruminants, an evaluation study was performed at Instituto de Ciencia y Tecnologia Animal of Universitat Politècnica de València (Spain). The test specificity and detection capability (CCβ) were studied following Commission Decision 2002/657/EC. Specificity results obtained in this study were optimal for individual milk free of antimicrobials from ewes (99.2% for β-lactams and 100% for tetracyclines) and goats (97.9% for β-lactams and 100% for tetracyclines) along the entire lactation period regardless of whether the results were visually or instrumentally interpreted. Moreover, no positive results were obtained when a relatively high concentration of different substances belonging to antimicrobial families other than β-lactams and tetracyclines were present in ewe and goat milk. For both types of milk, the CCβ calculated was lower or equal to EU-MRL for amoxicillin (4 µg/kg), ampicillin (4 µg/kg), benzylpenicillin (≤ 2 µg/kg), dicloxacillin (30 µg/kg), oxacillin (30 µg/kg), cefacetrile (≤ 63 µg/kg), cefalonium (≤ 10 µg/kg), cefapirin (≤ 30 µg/kg), desacetylcefapirin (≤ 30 µg/kg), cefazolin (≤ 25 µg/kg), cefoperazone (≤ 25 µg/kg), cefquinome (20 µg/kg), ceftiofur (≤ 50 µg/kg), desfuroylceftiofur (≤ 50µg/kg), and cephalexin (≤ 50 µg/kg). However, this test could neither detect cloxacillin nor nafcillin at or below EU-MRL (CCβ >30 µg/kg). The

  20. Real-Time PCR Detection of Paenibacillus spp. in Raw Milk To Predict Shelf Life Performance of Pasteurized Fluid Milk Products

    OpenAIRE

    Ranieri, Matthew L.; Ivy, Reid A.; Mitchell, W. Robert; Call, Emma; Masiello, Stephanie N.; Wiedmann, Martin; Boor, Kathryn J.

    2012-01-01

    Psychrotolerant sporeformers, specifically Paenibacillus spp., are important spoilage bacteria for pasteurized, refrigerated foods such as fluid milk. While Paenibacillus spp. have been isolated from farm environments, raw milk, processing plant environments, and pasteurized fluid milk, no information on the number of Paenibacillus spp. that need to be present in raw milk to cause pasteurized milk spoilage was available. A real-time PCR assay targeting the 16S rRNA gene was designed to detect...

  1. Measurement of Aflatoxin M1 in Raw and Pasteurized Cow Milk Samples by HPLC

    Directory of Open Access Journals (Sweden)

    afshin Nazari

    2007-10-01

    Full Text Available Nazari A1, Noroozi H2, Movahedi M3, Khaksarian M1 1. Instructor, Department of Physiology, Faculty of Medicine, Lorestan University of Medical Sciences 2. Assistant Professor, Department of Mycology, Faculty of Medicine, Iran University of Medical Sciences 3. Assistant Professor, Department of Genetic Epidemiology, Faculty of Medicine, Lorestan University of Medical Sciences Abstract Background: Aflatoxin M1 is a hydroxylated form of aflatoxin B1 which is produced by Aspergillus flavus. This toxin is produced when cows or other ruminants eat foods contaminated with these mycotoxins and then excrete them in the milk. The toxin is a potent liver and kidney carcinogenetic agent. Materials and methods: Forty two raw cows milk samples from local sources of milk collection and forty samples of commercial pasteurized market milk from Khorramabad, Lorestan, Iran were collected in summer and winter season of 2005. Twenty-one cow milk samples and 20 pasteurized milk samples in each season were analyzed for the presence of aflatoxin M1 (AFM1 by HPLC immunoaffinity columns. Results: Four of 21 raw milk samples in summer showed AFM1 levels between 0.017-0.046 ng/ml and all samples (100% in winter showed the presence of AFM1 levels between 0.003-0.041ng/ ml. AFM1 was detected in 55% of market pasteurized cow milk samples ranging from 0.017 to 0.533 ng/ml in summer and 100% ranging from 0.005-0.0054 ng/ml in winter.,Only one of all milk samples of pasteurized milk in summer had toxin level (0.533 ng/ml more than the maximum permissive limit (0.5 ng/ml. No significant difference was observed among mean contamination level of raw and pasteurized cow milk in two seasons. Key words: Aflatoxin M1, raw milk, pasteurized milk, Khoramabad, HPLC

  2. Effects of home-made boiling of bovine raw milk on its microbiological quality

    Directory of Open Access Journals (Sweden)

    Giampaolo Colavita

    2012-10-01

    Full Text Available The consumption of raw milk in Italy is allowed only “after boiling”. The aim of this research was to bet-ter understand how the heat treatment of raw milk performed at home by consumers assures their mi-crobiological safety. 50 samples of raw milk (each sample 500 ml provided to consumers who regularly buy raw milk from self-service automatic vending machines were followed from delivery till to after do-mestic heat treatment. Heating was performed by consumers according to their habits. The 50 samples were exposed to different heat treatments of which the mildest was at 68.5 °C and the most intense was at 97.8 °C before switching off. The average of temperatures used was 89.5 °C and the mode was 93.2 °C. According to the different parameters of heat treatment observed, 35 samples of raw milk and 35 samples of heated milk were selected for microbiological and process indicator analyses. Total Microbial Count (TMC, total and fecal coliforms, Escherichia coli, Staphylococcus aureus and Bacillus cereus loads were determined. E. coli was isolated only from one sample of raw milk. No B. cereus nor S. aure-us were found in all samples. After heat treatment, 4 samples showed a residual TMC ranging between 1,7 CFU/ml and 3,2 CFU/ml, whilst the count of total and fecal coliforms were irrelevant. The test for alkaline phosphatase has showed negative in all samples of heated milk, while the test of lactoperoxi-dase was positive in 3 samples. Results indicated that the microbiological risk attributable to the consumption of home heated raw milk is low, if the consumer applies regularly a good heating process.

  3. Milk production and physiological traits of ewes and goats housed indoor or grazing at different daily timing in summer

    Directory of Open Access Journals (Sweden)

    Massimo Todaro

    2010-01-01

    Full Text Available During a 6 week trial in summer, 3 homogeneous groups, each consisting of 5 Comisana ewes and 5 Rossa Mediterranea goats, grazed watered forage resources during day (D or night (N, or were housed indoor and supplied with mowed herbage(H. Maximum THI peaked at 94 at the end of July, and was almost constantly higher of 80. Milk yield was higher in N than in D and H goats, whereas N ewes produced more milk than H group, but their milk yield was higher than D ewes only in the period with the highest THI values. The lower urea in N goat milk, and the higher casein in N ewe milk, seem to indicate a better efficiency in dietary nitrogen utilization of night grazing animals. N ewes showed lower SCC in milk, and higher incidence of clotting milk samples, in comparison to other ewes. N goats and ewes showed lower rectal temperature and pulse rate in the afternoon and, among metabolic parameters, higher hematic level of sodium. Night grazing was confirmed to be a management practice for increasing heat tolerance, to which goats appeared to be more sensitive in terms of milk yield.

  4. Gross composition, fatty acid profile and sensory characteristics of Saanen goat milk fed with Cacti varieties.

    Science.gov (United States)

    Catunda, Karen Luanna Marinho; de Aguiar, Emerson Moreira; de Góes Neto, Pedro Etelvino; da Silva, José Geraldo Medeiros; Moreira, José Aparecido; do Nascimento Rangel, Adriano Henrique; de Lima Júnior, Dorgival Morais

    2016-08-01

    The use of cactus is an alternative for sustainable production systems in Northeast Brazil. The objective of this research was to evaluate the influence of supplying five cacti species from the Brazilian semi-arid northeast region on the physical-chemical sensory characteristics and the profile of fatty acids of Saanen goat milk. Five multiparous goats were used, confined, and distributed in a Latin square 5 × 5 design, with five experimental diets and five periods. Treatments consisted of 473 to 501 g/kg of a cactaceous mix (Pilosocereus gounellei, Cereus jamacaru, Cereus squamosus, Nopalea cochenillifera, or Opuntia stricta) added to 187.8 to 197.9 g/kg of "Sabiá" (Mimosa caesalpiniifolia) hay and 311 to 329 g/kg of concentrate. No effects of experimental diets (P > 0.05) were evidenced in the physical and chemical composition of milk for fat, total solids, or salt levels. However, protein, lactose, solids-not-fat levels, and cryoscopy point were influenced by diet (P  0.05) in the profile of fatty acids between treatments for all acids found, except for butyric acid. Diets also did not (P > 0.05) confer sensory changes in milk characteristics. The use of the native cacti in the dairy goats' diet did not influence the sensory characteristics or lipid profile of milk.

  5. Antioxidant activity of goat's milk from three different locations in Malaysia

    Science.gov (United States)

    Alyaqoubi, Saif; Abdullah, Aminah; Addai, Zuhair Radhi

    2014-09-01

    This study was conducted to evaluate the antioxidant activities of two types of goat milk obtained from three different farms in Malaysia named: Semenyih, Johor Baharu and Bander Baru Bangi. Milk from Jamnupari goat breed and a crossbred of Jamnupari and Saanen were investigated in terms of antioxidant capacity based on total phenol content (TPC), ferric reducing antioxidant power (FRAP), and 2,2-diphenyl-1-picrylhydrazyl (DPPH). Goat milk samples exhibited a significantly different antioxidant capacity (P>0.05) through all the samples. Jamnupari exhibited the highest capacity parity in TPC, FRAP, and DPPH assays (544.08 mg GA/100 g FW, 481.69 mg TE/100 g FW, and 64.77 %, respectively). By contrast, the milk sample obtained from the crossbred of Saanen and Jamnupari obtained from a UK farm exhibited the lowest values (354.14 mg GA/100 g FW, 313.58 mg TE/100 g FW, and 55.29 %, respectively). The samples obtained from the traditional farm in Bander Baru Bangi exhibited higher average values (523.80 mg GA/100 g FW, 439.33 mg TE/100 g FW, and 63.78%, respectively) than those from other sites.

  6. Mycoplasma agalactiae in semen and milk of goat from Pernambuco state, Brazil

    Directory of Open Access Journals (Sweden)

    Bruno H.L.S. Alves

    2013-11-01

    Full Text Available In goat and sheep flocks, mycoplasmosis is a disease that may cause severe economical losses associated with polyarthritis, mastitis, agalactia, conjunctivitis, pneumonia and reproductive failure. The latter may involve repeat breeding, granular vulvovaginitis, infertility and abortions. The aim of the present study was to assess the occurrence of Mycoplasma agalactiae (Ma in semen and milk samples from naturally infected goat in the semiarid region from Pernambuco State, Northeast from Brazil. Thirty-nine semen samples and 81 milk samples were submitted to DNA extraction using a commercially available kit and following the manufacturer's instructions. The polymerase chain reaction (PCR was then performed in accordance with protocols described in the literature. The results of the present study revealed the presence of Ma in the DNA of 17.9% (7/39 of the semen samples and 3.7% (3/81 of the milk samples. The results obtained in the present study confirm the elimination of the DNA of Ma in the semen and milk samples. The presence of this agent in goat flocks is considered very risky in terms of reproductive disorders and contagious agalactia outbreaks in the Northeast region of Brazil.

  7. Food contamination by PCBs and waste disposal crisis: Evidence from goat milk in Campania (Italy).

    Science.gov (United States)

    Ferrante, M C; Fusco, G; Monnolo, A; Saggiomo, F; Guccione, J; Mercogliano, R; Clausi, M T

    2017-11-01

    The study aims at investigating whether, and if so, to what extent the strong presence of urban and industrial waste in a territory may cause PCB contamination in goat milk produced therein. We compared PCB concentrations in goat milk from three different locations in the Campania region (Italy). One of the three locations, together with its surrounding area, has long suffered from illegal waste disposal and burning mainly by the so-called Ecomafia. The other locations, not involved in these illegal activities, allowed us to create a control group of goats with characteristics very similar to those of main interest. In milk from the waste contaminated area we identified high PCB concentrations (six indicator PCBs amounted to 170 ng g -1 on lipid weight, on average), whereas there was an almost total absence of such pollutants in milk from the control group. Concentrations of the six indicator PCBs were above the current European maximum residue limit fixed by the EU. At the same time, we found a lower average value of lipid content and a negative relationship between lipid content and PCB concentrations. Evidence indicates the potential health risk for consumers living in areas involved in illegal dumping of waste. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Physicochemical and sensory characteristics of goat and cow milk ice cream made with vegetable fat.

    Directory of Open Access Journals (Sweden)

    Alejandro Chacón-Villalobos

    2015-12-01

    Full Text Available The aim of this study was to determine the effect of the amount of goat and cow milk over the physicochemical and sensory characteristics of ice cream flavored with vegetable fat. In Costa Rica in 2010, three inclusion percentages of milk (100% goat, 100% cow, and a mixture of both 50%: 50% were evaluated, as well as the inclusion of different flavors (strawberry, strawberry with topping, and vanilla on the overrun, texture, melting, color, and acceptance of ice cream with vegetable fat. No parameters depended on the type of milk (p>0.05, while overrun varied between batches (p<0.05. There was a flavor*milk interaction for melting rate, texture, and pH attributable to the addition of topping. There was a significant effect on the colorimetric measurement based on the variables of the CIE system L*, a* and C*, on flavor (p<0.05, and an interaction type of milk*flavor for parameters b* and °h (tint or hue was attributed to topping and colorants. Both vegetable fat and topping increased the content of total solids in the mixture; it was associated to a lower rate of aeration, a low melting time, and a more consistency. A cluster analysis for sensory liking, distinguished between three groups: group 1 (15.25%, which liked all products, group 2 (62.71% that moderately liked them all, and group 3 (22.03% who neither show like nor dislike. Groups 2 and 3 showed greater liking for products with topping. The results of the sensory panel as well as the physicochemical and instrumental characterizations show that the type of milk used to make ice cream is not a determining factor, so it is feasible to produce goat milk ice cream and obtain a quality product with good acceptance.

  9. Effect of raw milk on lactose intolerance: a randomized controlled pilot study.

    Science.gov (United States)

    Mummah, Sarah; Oelrich, Beibei; Hope, Jessica; Vu, Quyen; Gardner, Christopher D

    2014-01-01

    This pilot study aimed to determine whether raw milk reduces lactose malabsorption and/or lactose intolerance symptoms relative to pasteurized milk. We performed a crossover trial involving 16 adults with self-reported lactose intolerance and lactose malabsorption confirmed by hydrogen (H2) breath testing. Participants underwent 3, 8-day milk phases (raw vs 2 controls: pasteurized, soy) in randomized order separated by 1-week washout periods. On days 1 and 8 of each phase, milk consumption was 473 mL (16 oz); on days 2 to 7, milk dosage increased daily by 118 mL (4 oz), beginning with 118 mL (4 oz) on day 2 and reaching 710 mL (24 oz) on day 7. Outcomes were area under the breath H2 curve (AUC H2) and self-reported symptom severity (visual analog scales: flatulence/gas, audible bowel sounds, abdominal cramping, diarrhea). AUC H2 (mean ± standard error of the mean) was higher for raw vs pasteurized on day 1 (113 ± 21 vs 71 ± 12 ppm·min·10(-2), respectively, P = .01) but not day 8 (72 ± 14 vs 74 ± 15 ppm·min·10(-2), respectively, P = .9). Symptom severities were not different for raw vs pasteurized on day 7 with the highest dosage (P >.7). AUC H2 and symptom severities were higher for both dairy milks compared with soy milk. Raw milk failed to reduce lactose malabsorption or lactose intolerance symptoms compared with pasteurized milk among adults positive for lactose malabsorption. These results do not support widespread anecdotal claims that raw milk reduces the symptoms of lactose intolerance.

  10. Effect of Raw Milk on Lactose Intolerance: A Randomized Controlled Pilot Study

    Science.gov (United States)

    Mummah, Sarah; Oelrich, Beibei; Hope, Jessica; Vu, Quyen; Gardner, Christopher D.

    2014-01-01

    PURPOSE This pilot study aimed to determine whether raw milk reduces lactose malabsorption and/or lactose intolerance symptoms relative to pasteurized milk. METHODS We performed a crossover trial involving 16 adults with self-reported lactose intolerance and lactose malabsorption confirmed by hydrogen (H2) breath testing. Participants underwent 3, 8-day milk phases (raw vs 2 controls: pasteurized, soy) in randomized order separated by 1-week washout periods. On days 1 and 8 of each phase, milk consumption was 473 mL (16 oz); on days 2 to 7, milk dosage increased daily by 118 mL (4 oz), beginning with 118 mL (4 oz) on day 2 and reaching 710 mL (24 oz) on day 7. Outcomes were area under the breath H2 curve (AUC ∆H2) and self-reported symptom severity (visual analog scales: flatulence/gas, audible bowel sounds, abdominal cramping, diarrhea). RESULTS AUC ∆H2 (mean ± standard error of the mean) was higher for raw vs pasteurized on day 1 (113 ± 21 vs 71 ± 12 ppm·min·10−2, respectively, P = .01) but not day 8 (72 ± 14 vs 74 ± 15 ppm·min·10−2, respectively, P = .9). Symptom severities were not different for raw vs pasteurized on day 7 with the highest dosage (P >.7). AUC ∆H2 and symptom severities were higher for both dairy milks compared with soy milk. CONCLUSIONS Raw milk failed to reduce lactose malabsorption or lactose intolerance symptoms compared with pasteurized milk among adults positive for lactose malabsorption. These results do not support widespread anecdotal claims that raw milk reduces the symptoms of lactose intolerance. PMID:24615309

  11. Nutrient Profiles and Volatile Odorous Compounds of Raw Milk After Exposure to Electron Beam Pasteurizing Doses.

    Science.gov (United States)

    Ward, Lindsay R; Kerth, Chris R; Pillai, Suresh D

    2017-07-01

    Raw milk is known to contain relatively high numbers of microorganisms, some of which include microbial pathogens. Electron beam (eBeam) processing is a nonthermal pasteurization food processing technology. The underlying hypothesis was that eBeam processing will not negatively influence the composition, nutrient content, and aroma profile of raw milk. Raw milk samples were exposed to eBeam doses of 1 and 2 kGy, since our studies had shown that 2 kGy is suitable for raw milk pasteurization. The untreated and eBeam-treated raw milk samples were analyzed to detect changes in lactose, vitamin B 2 , vitamin B 12 , and calcium concentrations. The possible breakdown of casein and whey proteins and lipid oxidation were investigated along with the formation of volatile aroma compounds. Even though vitamin B 2 showed a 31.6% decrease in concentration, the B 2 content in eBeam-pasteurized raw milk met all USDA nutritional guidelines. Even though there were no indications of lipid oxidation after the 2.0-kGy eBeam treatment, there was lipid oxidation (58%) after 7 d of refrigerated storage. However, based on the GC-olfactory analysis, the lipid oxidation did not necessarily result in the development of a wide variety of off-odors. © 2017 Institute of Food Technologists®.

  12. Comparative analysis of the microbial communities in raw milk produced in different regions of Korea.

    Science.gov (United States)

    Kim, In Seon; Hur, Yoo Kyung; Kim, Eun Ji; Ahn, Young-Tae; Kim, Jong Geun; Choi, Yun-Jaie; Huh, Chul Sung

    2017-11-01

    The control of psychrotrophic bacteria causing milk spoilage and illness due to toxic compounds is an important issue in the dairy industry. In South Korea, Gangwon-do province is one of the coldest terrains in which eighty percent of the area is mountainous regions, and mainly plays an important role in the agriculture and dairy industries. The purposes of this study were to analyze the indigenous microbiota of raw milk in Gangwon-do and accurately investigate a putative microbial group causing deterioration in milk quality. We collected raw milk from the bulk tank of 18 dairy farms in the Hoengseong and Pyeongchang regions of Gangwon-do. Milk components were analyzed and the number of viable bacteria was confirmed. The V3 and V4 regions of 16S rRNA gene were amplified and sequenced on an Illumina Miseq platform. Sequences were then assigned to operational taxonomic units, followed by the selection of representative sequences using the QIIME software package. The milk samples from Pyeongchang were higher in fat, protein, lactose, total solid, and solid non-fat, and bacterial cell counts were observed only for the Hoengseong samples. The phylum Proteobacteria was detected most frequently in both the Hoengseong and Pyeongchang samples, followed by the phyla Firmicutes and Actinobacteria. Notably, Corynebacterium, Pediococcus, Macrococcus, and Acinetobacter were significantly different from two regions. Although the predominant phylum in raw milk is same, the abundances of major genera in milk samples were different between Hoengseong and Pyeongchang. We assumed that these differences are caused by regional dissimilar farming environments such as soil, forage, and dairy farming equipment so that the quality of milk raw milk from Pyeongchang is higher than that of Hoengseong. These results could provide the crucial information for identifying the microbiota in raw milk of South Korea.

  13. Fatty acid profile and health lipid indices in the raw milk of ...

    African Journals Online (AJOL)

    qw-k

    2015-02-26

    Feb 26, 2015 ... in the raw milk of Simmental and Holstein-Friesian cows from an organic farm. ... as an important source of energy, high-quality protein and essential ... Nevertheless, inter-breed differences in the milk fat composition were ...

  14. Draft Genome Sequence of Bacillus sp. FMQ74, a Dairy-contaminating Isolate from Raw Milk

    DEFF Research Database (Denmark)

    Okshevsky, Mira Ursula; Regina, Viduthalai R.; Marshall, Ian

    2017-01-01

    Representatives of the genus Bacillus are common milk contaminants that cause spoilage and flavor alterations of dairy products. Bacillus sp. FMQ74 was isolated from raw milk on a Danish dairy farm. To elucidate the genomic basis of this strain’s survival in the dairy industry, a high-quality draft...

  15. Estimation of deltamethrin residues in cow's and goat's environment and trials to reduce its level in milk

    Directory of Open Access Journals (Sweden)

    Halla E. K. El Bahgy

    2018-05-01

    Full Text Available Aim: The present study was aimed to estimate deltamethrin residues in cow's and goat's environment over a certain period of time post-application, to identify the role of both feed and water as a source of pesticides, and to conduct some trials to reduce their levels in milk. Materials and Methods: A total of 80 water and feed samples (40 of each and 120 milk samples (80 cow's milk and 40 goat's milk were collected. Fresh milk samples were collected directly from the udder as well as from feed and water before application and 1st, 2nd, 3rd, 7th, 15th, 21st, and 35th days after insecticide application. Results: Deltamethrin residues were detected after its application in both water and feed at different levels up to the first 3 days and in all cow's and goat's milk samples at 35th day. The highest levels were detected in milk samples at the 2nd day then at the 7th day followed at the 15th day after application as such levels were above the maximum residual limits. By microwaving the polluted cow's milk samples, deltamethrin residues were not detected without influencing the chemical composition of the milk. However, on freezing of milk, the deltamethrin residues reached 12.6±3.24 μg/L in association with a significant decline in the concentration of fat. Conclusion: Microwaving of milk is an effective method to decline deltamethrin concentration in milk.

  16. Towards a decision support system for control of multiple food safety hazards in raw milk production

    NARCIS (Netherlands)

    Spiegel, van der M.; Sterrenburg, P.; Haasnoot, W.; Fels-Klerx, van der H.J.

    2013-01-01

    Decision support systems (DSS) for controlling multiple food safety hazards in raw milk production have not yet been developed, but the underlying components are fragmentarily available. This article presents the state-of-the-art of essential DSS elements for judging food safety compliance of raw

  17. THE DIRECT SALE OF RAW MILK: PREVALENCE OF PATHOGENS IN RAW MILK AND BOVINE FAECES COLLECTED IN FARMS WITHIN THE PROVINCE OF PESARO-URBINO

    Directory of Open Access Journals (Sweden)

    F. Tonucci

    2009-09-01

    Full Text Available In the last years, direct sale of raw milk by vending machines has largely increased in several European Countries and Italy. As a consequence, adequate hygienic measures and correct consumer’s information is required in order to reduce any potential risk linked to this product. In the present study, the occurrence of pathogens (Salmonella spp., verocytotoxigenic E.coli, Campylobacter spp., Listeria monocytogenes, S.aureus in raw milk and bovine faeces collected in 4 farms in the province of Pesaro-Urbino (Italy, between January 2007 and March 2009 has been investigated; 99.5% of milk samples resulted negative for the pathogens considered and complying with the regulation S. aureus limits. Campylobacter has been found in 0.44% of the samples, collected during summer, while only one sample resulted positive to a non-verocytotoxigenic E.coli O157. In respect to faeces, 62.6% of the samples resulted negative, 33.6% were contaminated by Campylobacter spp. (68% Campylobacter coli and 32% Campylobacter jejuni and 3.8% by E.coli O157. No samples resulted positive for Salmonella spp. or Listeria monocytogenes. The results highlight the necessity of a strict plan of hygienic and sanitary controls, with particular attention to milking process hygiene and raw milk storage, to reduce the risk of contamination of the product.

  18. ELECTROLYTE AND MINERAL COMPOSITION OF TERM DONOR HUMAN MILK BEFORE AND AFTER PASTEURIZATION AND OF RAW MILK OF PRETERM MOTHERS.

    Science.gov (United States)

    Codo, Carla Regina Bianchi; Caldas, Jamil Pedro de Siqueira; Peixoto, Rafaella Regina Alves; Sanches, Vitor Lacerda; Guiraldelo, Tamara Cristina; Cadore, Solange; Marba, Sérgio Tadeu Martins

    2018-02-22

    To determine and compare the concentrations of electrolytes and minerals in three different types of maternal milk samples: term donor milk before pasteurization, term donor milk after pasteurization and raw milk of mothers of preterm newborns at bedside. Descriptive cross-sectional study. Concentrations of calcium (Ca), phosphorous (P), magnesium (Mg), sodium (Na) and potassium (K) were measured in random samples of three human breast milk groups. Samples were analyzed using acid mineralization assisted by microwave radiation and further analysis by inductively coupled plasma optical emission spectrometry. Concentrations were expressed in mg/L, described as mean and standard deviation. The one-way ANOVA and Tukey's post-test were applied to determine the variability between the means of each group. Significance level was set at 5%. There was a significant reduction in the content of Ca (259.4±96.8 vs. 217.0±54.9; p=0.003), P (139.1±51.7 vs. 116.8±33.3; p=0.004) and K (580.8±177.1 vs. 470.9±109.4; ppasteurization. Samples of raw milk presented higher contents of Na than the donated milk (twice). The elements P and Ca would only reach the daily intake levels recommended by the European Society of Pediatric Gastroenterology, Hepatology and Nutrition if at least 60 mL of milk could be offered every 3 hours. Mg levels were not different between the three groups. There was a significant reduction in Ca, P and K levels in samples after pasteurization. The Na value in raw milk, collected at bedside, was higher than in the samples of donor's milk before pasteurization.

  19. RAW MILK IN AUTOMATIC SALE MACHINES: MONITORING PLAN IN PIEDEMONT REGION

    Directory of Open Access Journals (Sweden)

    S. Gallina

    2010-06-01

    Full Text Available Raw milk at vending machine is surging in popularity amongst consumers of Northern Italy; indeed in Piedmont Region there are more than 100 vending machines. In June 2008 Piedmont Region set out a specific monitoring plan to check the milk quality. From June to December 2008, 113 raw milk samples were collected at vending machines. Samples were analysed for Listeria monocytogenes, Salmonella spp., coagulase positive staphylococci, Staphylococcus aureus and Campylobacter. Moreover, 100 samples were analysed for the quantification of aflatoxin M1. 26 samples have been resulted Not Conform for the hygienic criteria and 1 exceeded the aflatoxin M1 limit.

  20. Gravity separation of fat, somatic cells, and bacteria in raw and pasteurized milks.

    Science.gov (United States)

    Caplan, Z; Melilli, C; Barbano, D M

    2013-04-01

    The objective of experiment 1 was to determine if the extent of gravity separation of milk fat, bacteria, and somatic cells is influenced by the time and temperature of gravity separation or the level of contaminating bacteria present in the raw milk. The objective of experiment 2 was to determine if different temperatures of milk heat treatment affected the gravity separation of milk fat, bacteria, and somatic cells. In raw milk, fat, bacteria, and somatic cells rose to the top of columns during gravity separation. About 50 to 80% of the fat and bacteria were present in the top 8% of the milk after gravity separation of raw milk. Gravity separation for 7h at 12°C or for 22h at 4°C produced equivalent separation of fat, bacteria, and somatic cells. The completeness of gravity separation of fat was influenced by the level of bacteria in the milk before separation. Milk with a high bacterial count had less (about 50 to 55%) gravity separation of fat than milk with low bacteria count (about 80%) in 22h at 4°C. Gravity separation caused fat, bacteria, and somatic cells to rise to the top of columns for raw whole milk and high temperature, short-time pasteurized (72.6°C, 25s) whole milk. Pasteurization at ≥76.9°C for 25s prevented all 3 components from rising, possibly due to denaturation of native bovine immunoglobulins that normally associate with fat, bacteria, and somatic cells during gravity separation. Gravity separation can be used to produce reduced-fat milk with decreased bacterial and somatic cell counts, and may be a critical factor in the history of safe and unique traditional Italian hard cheeses produced from gravity-separated raw milk. A better understanding of the mechanism of this natural process could lead to the development of new nonthermal thermal technology (that does not involve heating the milk to high temperatures) to remove bacteria and spores from milk or other liquids. Copyright © 2013 American Dairy Science Association. Published by

  1. Physicochemical, Nutritional, and Organoleptic Characterization of a Skimmed Goat Milk Fermented with the Probiotic Strain Lactobacillus plantarum C4.

    Science.gov (United States)

    Moreno-Montoro, Miriam; Navarro-Alarcón, Miguel; Bergillos-Meca, Triana; Giménez-Martínez, Rafael; Sánchez-Hernández, Silvia; Olalla-Herrera, Manuel

    2018-05-17

    The benefits of goat milk, fermented milks, and probiotics for the humans are well documented. In this study, a novel fermented goat milk was manufactured with the putative probiotic strain Lactobacillus plantarum C4 together with L. bulgaricus and Streptococcus thermophilus . Ultrafiltration was chosen as the skimmed milk concentration method because it produced the best viscosity and syneresis and a high casein content. The viability rate of all bacterial strains was >10⁷ cfu/mL, even after 5 weeks of storage or after in vitro gastrointestinal digestion, which is especially important for exertion of the probiotic strain functionalities. This fermented milk is also a good source of nutrients, having a low lactose and fat content, high protein proportion, and good mineral concentration. According to these data and the overall acceptability described by panelists, this fermented milk is a healthy dairy product comparable with commercially available fermented milks.

  2. Transfer of 131I and /sup 95m/Tc from pasture to goat milk

    International Nuclear Information System (INIS)

    Bondietti, E.A.; Garten, C.T. Jr.

    1984-01-01

    Field measurements were made in 1983 on the transfer of 131 I and /sup 95m/Tc from spray-contaminated pasture to goat's milk. The transfer of 131 I to milk was similar to that used for mathematical models in US Nuclear Regulatory Commission Regulatory Guide 1.109, which was derived from stall-feeding experiments using capsulized doses. Compared to 131 I, the /sup 95m/Tc transferred to milk was about 5600 times less. The lower transfer resulted from both immobilization of technetium on pasture prior to ingestion as well as reduced gastrointestinal absorption. The results show that the food chain transfer of technetium to milk is much less than that previously expected based on inferences made from metabolism studies. 6 references, 4 figures, 1 table

  3. Comparing the sensitizing capacity of raw and processed cow's milk in a murine sensitization model for food allergy

    NARCIS (Netherlands)

    Abbring, S.; Diks, M.A.P.|info:eu-repo/dai/nl/372617298; Dingjan, G.M.; Baars, T.; Garssen, J.|info:eu-repo/dai/nl/086369962; Van Esch, B.C.A.M.|info:eu-repo/dai/nl/304839256

    2016-01-01

    Background: Epidemiological studies show that the consumption of raw milk early in life is protective against the development of allergies later in life. The effect was found to be limited to raw milk consumption and was not observed when this milk was boiled or when pasteurized and homogenized shop

  4. Bacterial contaminations of informally marketed raw milk in Ghana ...

    African Journals Online (AJOL)

    Background: Milk has an outstanding nutritional quality but is also an excellent medium for bacterial growth and an important source of bacterial infection when consumed without pasteurization. Objective: To estimate the bacterial health risk of milk consumption in Accra and Kumasi, the twomajor cities in Ghana. Method: A ...

  5. Contamination levels of aflatoxin M1 in bulk raw milk of Chaloos and Ramsar

    Directory of Open Access Journals (Sweden)

    A.R Barami

    2012-02-01

    Full Text Available Aflatoxin M1 (AFM1 appears in milk as a direct result of the ingestion of feed contaminated with aflatoxin B1 by cattle. This study was conducted to investigate the contamination rate of raw milk whit aflatoxin M1 in Chaloos and Ramsar raw milk collection centers. Two hundred bulk raw milk samples were collected during winter (January and February and summer (June and July seasons. The milk samples were analyzed by ELISA method for the presence of AFM1. During the winter, AFM1 was detected in 100% and 59/79% of the bulk raw milk samples in Ramsar and Chaloos, respectively; however, during summer 83/52% and 50/1 of the samples was found as positive in Ramsar and Chaloos, respectively. Furthermore, 45% of Ramsar and 30% of Chaloos bulk milk samples showed higher contamination level of AFM1 than maximum tolerance limit (50 ng/l accepted by National Standard as well as European Union. Although, the difference between the contamination rate in samples obtained during summer and winter seasons was not statistically significantly, (p

  6. The effect of Isabel grape addition on the physicochemical, microbiological and sensory characteristics of probiotic goat milk yogurt.

    Science.gov (United States)

    Silva, Francyeli Araújo; de Oliveira, Maria Elieidy Gomes; de Figueirêdo, Rossana Maria Feitosa; Sampaio, Karoliny Brito; de Souza, Evandro Leite; de Oliveira, Carlos Eduardo Vasconcelos; Pintado, Maria Manuela Estevez; Ramos do Egypto Queiroga, Rita de Cássia

    2017-06-21

    Goat milk is an attractive food because of its nutritional properties, easy digestibility and hypoallergenicity. Goat milk yogurt is an appropriate matrix for the inclusion of new ingredients such as probiotic cultures, fruit and its derivatives. Grapes are rich in polyphenols and recognized for their health benefits. The aim of this study was to improve the quality characteristics of probiotic goat milk yogurt by the addition of an Isabel grape (Vitis labrusca L.) preparation (IGP). For this, the influence of the addition of IGP on the physicochemical, microbiological and sensory characteristics of goat milk yogurt containing the probiotic Lactobacillus acidophilus LA-05 was evaluated during 28 days of refrigerated storage (5 ± 0.5 °C). Four yogurt formulations were prepared, each varying in the added IGP amount, as follows: Y0 (not containing IGP), YG15 (containing 15 g per 100 mL of IGP), YG20 (containing 20 g per 100 mL of IGP), and YG25 (containing 25 g per 100 mL of IGP). All formulations showed probiotic counts ranging from 7 to 8 log CFU mL -1 over the assessed storage period. The addition of 20 g per 100 mL of IGP affected positively the colour, viscosity, and sensory acceptance of the yogurt formulations. The production of goat milk yogurt containing L. acidophilus LA-05 and IGP is an option for developing a new goat dairy product with added value due to the inclusion of components with potential functional properties.

  7. Molds contamination of raw milk and dairy products: Occurrence, diversity and contamination source

    Directory of Open Access Journals (Sweden)

    T Moshtaghi Maleki

    2015-11-01

    Full Text Available This study aimed to assess the occurrence and diversity of mold species in raw milk and its products along with the identification of potential contamination sources. For this reason, a total of 260 samples consisting of 80 raw milk, 100 dairy products (i.e., pasteurized milk, yoghurt, cheese and buttermilk and 80 environmental (i.e. ingredients, packaging materials, surface of processing equipments and air specimens were collected. Using culture assay and microscopic observation, the occurrence as well as the diversity of mold species was investigated. According to the results, 82.3% of the samples were identified as positive for mold contamination. The percentage of mold contamination for raw milk was estimated as 97.5%. In the case of pasteurized milk, yoghurt, buttermilk, cheese and environmental samples, it was determined as 52%, 76%, 52%, 56% and 96.25%, respectively. Mold diversity among various samples consisted of Aspergillus, Geotrichum, Penicillium, Mucor, Alternaria, Rhizopus, Stemphylium, Cladosporium, and Fusarium. Results revealed a significant (p < 0.01 correlation between kind of mold species isolated from raw milk and dairy products. Similarly, a correlation was observed between dairy products and environmental sources. Regarding the high occurrence of mold contamination in raw milk and environmental sources, it seems that in some instances heat treatment was not effective enough to inactivate all molds; whereas in some other cases, cross contamination may have resulted in mold contamination. Therefore, it is crucial to maintain hygienic conditions during raw milk handling as well as processing steps. These practices could efficiently reduce the occurrence of mold contaminations in dairy products.

  8. QUALITY OF YOGHURTS FROM GOAT'S MILK ENRICHED WITH MAGNESIUM CHLORIDE

    Directory of Open Access Journals (Sweden)

    Agata Znamirowska

    2015-02-01

    Full Text Available Goat’s milk can be enriched with magnesium in the form of chloride before pasteurization with a save dose, i.e. 20 mg of magnesium for 100 g of milk. Higher doses of magnesium can lead to coagulation of proteins since together with the increase of the dose of fortification there increases general acidity while pH of milk decreases. Together with the increase of the dose of fortification of yoghurts with magnesium there was shown an essential proportional increase of acidity and hardness of curds persisting for 21 days of storage. Enriching goat’s milk yoghurts with magnesium decreased the intensity of „goat” smell and aftertaste and did not cause a change in colour. The most favourable solution is the production of goat’s milk yoghurts enriched with 10-20 mg of magnesium in the form of magnesium chloride. Such doses of enrichment caused successive lowering of perceptibility of „goat” aftertaste and smell together with extension of storage time.

  9. Effect of Fenugreek Supplementation on Physiological Functions and Milk Traits o f Heat Stressed Lactating Baladi Goats

    International Nuclear Information System (INIS)

    El-Tarabany, A.A.; Teama, F.E.I.; Atta, M.A.A.

    2017-01-01

    This experiment was conducted to study the importance of supplementary fenugreek to the diet of lactating local goats in Egypt for ameliorative their some blood biochemical components, milk production and some milk components. Forty two lactating goats were used in the present study which lasted 5 months. The animals were divided randomly into three equal groups, the 1st group was fed basic ration without supplement (control), while the 2nd and the 3rd groups of animals were fed on the same basic ration with supplemented fenugreek at the rate of 50 and 100 g/head/day. Blood samples were withdrawn at the end of experiment to assess blood concentrations. Also, milk yield and some milk components were determined. The results showed that the addition of fenugreek at the rate of 100 g/ head/ day to the diet of lactating goats significantly increased the concentrations of total proteins, albumin, globulin , T4 hormone, total antioxidants and hemoglobin (Hb), red blood cells (RBC) and led to a significant decrease in the levels of total cholesterol, triglyceride, wight blood cells (WBC) and T3 hormone in blood, while significantly increased milk yield and some milk components. It can be concluded that the addition of fenugreek at the rat of (100 g/ h/day) to heat stressed lactating Baladi goats led to modification of all blood components studied here in and led to amending the setraits, milk production and some milk components. Therefore, the use of the fenugreek in lactating stages can be recommended

  10. Short communication: The effect of raw milk cooling on sensory perception and shelf life of high-temperature, short-time (HTST)-pasteurized skim milk.

    Science.gov (United States)

    Lee, A P; Barbano, D M; Drake, M A

    2016-12-01

    The cooling rate of raw milk may influence sensory properties and pasteurized shelf life. Under the Pasteurized Milk Ordinance for grade A milk, raw milk may be cooled instantaneously by on-farm heat exchangers but is also acceptable if "cooled to 10°C or less within four (4) hours of the commencement of the first milking." The objective of this study was to determine the effect of raw milk cooling on consumer perception and shelf life. Raw milk (18-21°C) was obtained and transported within 1h of milking to North Carolina State University (Raleigh). The batch of raw milk was split in 2 portions, and a plate heat exchanger was used to quickly cool one portion to <6°C within 1min. The second portion was stored in a jacketed bulk tank and slowly cooled over 4h to <10°C. Milk from 3 consecutive milkings was collected every 12h, with subsequent milkings added to the previous collections. The bulk milk was kept below 10°C while adding milk for the slow cool milk treatment. After 72h, each whole milk was separated; the skim milk was pasteurized at 73 or 78°C for 20 s, homogenized, and held at 4°C. Difference tests (n=75) and consumer acceptance tests (n=100) were conducted to determine if consumers could detect differences among milks. Descriptive analysis and microbial testing for aerobic, psychrotrophic, and psychrotolerant spore counts were conducted through shelf life. The entire experiment was repeated in triplicate. Raw milks averaged 3.3 logcfu/mL by aerobic plate count, <25cfu/mL coliforms, somatic cell count of 300,000 cells/mL, and 3.15±0.07% protein. Psychrotolerant spores were not found in the raw milk. Consumers could not detect differences between cooling treatments of the same pasteurization temperature or between different temperatures of the same cooling treatment. Milks reached sensory failure 49±4d on average after processing, and aerobic counts were between 5 to 7 logcfu/mL. Cooling treatment had no effect on shelf life. These results suggest

  11. Analysis of Proximate and Protein Profile of Kefir from Fermented Goat and Cow Milk

    Directory of Open Access Journals (Sweden)

    Erwin Hidayat

    2015-09-01

    Full Text Available This research aims to analyze the characteristics of proximate and protein profile in kefir from fermented goat milk and cow milk with different concentration of kefir grains. The research design was true experimental with Completely Randomized Design (CRD of 3 repetitions. The research procedures consisted of kefir production, proximate analysis and protein profile characterization. Proximate assay result was analyzed by using LSD, whereas the protein profile was analyzed by descriptive qualitative method. Based on the analysis of kefir proximate levels, the kefir grain (5% showed the highest proximate level of both kefirs from goat milk and cow milk. The analysis of protein profile of cow milk kefir showed 75 kDa of protein ribbon, while the goat milk kefir showed 48 kDa, 60 kDa and 75 kDa. Therefore it can be concluded that the proximate level of goat and cow milk kefir with different concentration of kefir grains showed significant differences in the nutrition content as well as its protein profiles.Tujuan dari penelitian ini adalah menganalisis karakteristik proksimat dan profil protein pada kefir hasil fermentasi susu kambing dan susu sapi dengan konsentrasi biji kefir yang berbeda-beda. Penelitian ini adalah eksperimen murni, dengan Rancangan Acak Lengkap (RAL 3 kali ulangan. Prosedur penelitian meliputi pembuatan kefir, analisis proksimat dan profil protein. Data hasil proksimat dianalisi uji BNT, sedangkan profil protein dianalisis deskriptif kualitatif. Berdasarkan analisis kadar proksimat kefir, kefir grains 5% menunjukan kadar proksimat paling tinggi baik pada kefir susu kambing dan susu sapi. Sedangkan analisis profil protein kefir susu sapi menunjukan pita protein 75 kDa, pada kefir susu kambing yaitu 48 kDa, 60 kDa dan 75 kDa. Simpulan dari penelitian ini bahwa kadar proksimat kefir susu kambing dan susu sapi dengan konsentrasi kefir grains yang berbeda menunjukan perbedaan kandungan yang berbeda secara signifikan dengan

  12. Identification and Characterization of Bioactive Peptides of Fermented Goat Milk as a Sources of Antioxidant as a Therapeutic Natural Product

    Science.gov (United States)

    Mahdi, Chanif; Untari, Handayu; Cendrakasih Padaga, Masdiana

    2018-01-01

    The increasing of functional food is rising in line with public awareness for healthy food consumption. Provision of functional food source is developed through enhanced bioactive that has a regulatory function for body. Bioactive peptides in milk is known have variety of beneficial function of the body such as immunomodulator, immunostimulatory, anti-hypertension, anti-hyper cholesterol, as well as a variety of other beneficial function. The aim of this study is to obtain fermentation methods to product functional dairy product contain bioactive peptides and beneficial of fermented goat milk. The result of this study showed that goat milk fermented using 3 % commercial starter able to produce the best yoghurt than using local yoghurt starter. Analysis of protein content showed that the fermentation processing increased the amount of protein in goat milk sample. Using SDS-PAGE showed that the breakdown of protein into fraction of fermented goat milk greater than unfermented goat milk. The result of fractional protein was analyzed by LC MS/MS and showed that there were three kind bioactive sequences of bioactive peptides. Each of which consist of 16 amino acids that safely protected from gastrointestinal animal model that fed by dietary treatment of hypercholesterolemia.

  13. Occurrence and antimicrobial sensitivity in staphylococci isolated from goat, sheep and cow’s milk

    Directory of Open Access Journals (Sweden)

    Marcela Vyletělová

    2011-01-01

    Full Text Available The aim of this study was to compare the sensitivity to selected antibiotics in staphylococci isolated from goat (n = 60, sheep (n = 60 and cow’s milk (n = 120. The individual milk samples were inoculated onto Blood agar cultivated at 36 °C/24 h.The isolated species of staphylococci were identified using biochemical tests, namely STAPHYtest and identification program TNW pro 6.5. We examined the sensitivity of strains to the spectrum of antibiotics, as follows: vancomycin (VA, amoxicillin/clavulanic acid (AMC, penicillin (P, rifampicin (RD, oxacillin (OX, tetracycline (TE, erythromycin (E, chloramphenicol (C, clindamycin (DA, gentamicin (CN, ciprofloxacin (CIP, teicoplanin (TEC, cefoxitin (FOX and novobiocin (NOV. Altogether, 97 staphylococcal isolates were obtained; 70 from cow’s milk, 11 from goat’s milk and 16 from sheep’ milk. Staphylococcus aureus was the most frequent species in milk of all animal origin tested, was detected in 54 (45% cow’s milk, 10 (17% goat’s and 15 (25% sheep’ milk samples. S. lentus was identified only in goat’s and sheep’ milk whereas in cow’s milk there were representation of staphylococcal species as follows: S. haemolyticus (n = 7, S. chromogenes (n = 2, S. warneri (n = 2, S. xylosus (n = 2, S. epidermidis (n = 2 and unclassified staphylococci (n = 1. The results of S. aureus sensitivity are similar for all tested antibiotics and for all monitored milk: No resistance to vancomycin, rifampicin, chloramphenicol and teicoplanin was recorded in obtained S. aureus isolates whereas the resistance to ciprofloxacin was found out most often.

  14. The freezing point of raw and heat treated sheep milk and its variation during lactation

    Directory of Open Access Journals (Sweden)

    Bohumíra Janštová

    2013-01-01

    Full Text Available The freezing point of milk is an important indicator of the adulteration of the milk with water, but heat treatment may also affect its value. The aim of this study was determine freezing point of raw and heat treated sheep milk and its variation during lactation. The freezing point was determined in 42 bulk tank raw sheep milk samples and 42 pasteurized milk samples collected during lactation of sheep at one ecofarm in Moravian Walachia (Valašsko in the Czech Republic. The freezing point was determined in accordance with the standard ČSN 57 0538 using a thermistor cryoscope. The average freezing point of raw milk was -0.617 ± 0.052 °C, with a range from -0.560 to -0.875 °C. The freezing point was lower in the first months of lactation and increased at the end of lactation. The freezing point correlated (r = 0.8967 with the content of total non-fat solids. The average freezing point of sheep milk pasteurized at 65 °C for 30 min was -0.614 ± 0.053 °C, with a range from -0.564 to -0.702 °C. The median of freezing point differences between raw and pasteurized milk was 0.004 °C. Our study extends data about physico-chemical properties of sheep milk and registers for the first time specific changes in the freezing point value of sheep milk by heating.

  15. A survey on Aflatoxin M1 content in sheep and goat milk produced in Sardinia Region, Italy (2005-2013

    Directory of Open Access Journals (Sweden)

    Salvatore Virdis

    2014-12-01

    Full Text Available In the present work the results of a survey conducted in Sardinia Region on Aflatoxin M1 (AFM1 contamination in milk of small ruminants from 2005 to 2013 are reported. A total of 517 sheep and 88 goat milk samples from bulk tank, tank trucks and silo tank milk were collected. Analyses were performed by the Regional Farmers Association laboratory using high-performance liquid chromatography following the ISO 14501:1998 standard. None of the sheep milk samples analysed during 2005- 2012 showed AFM1 contamination. In sheep milk samples collected in 2013, 8 out of 172 (4.6% were contaminated by AFM1 with a concentration (mean±SD of 12.59±14.05 ng/L. In one bulk tank milk sample 58.82 ng/L AFM1 was detected, exceeding the EU limit. In none of goat milk samples analysed from 2010 to 2012 AFM1 was detected. In 2013, 9 out of 66 goat milk samples (13.6% showed an AFM1 concentration of 47.21±19.58 ng/L. Two of these samples exceeded the EU limit, with concentrations of 62.09 and 138.6 ng/L. Higher contamination frequency and concentration rates were detected in bulk tank milk samples collected at farm than in bulk milk truck or silo samples, showing a dilution effect on AFM1 milk content along small ruminants supply chain. The rate and levels of AFM1 contamination in sheep and goat milk samples were lower than other countries. However, the small number of milk samples analysed for AFM1 in Sardinia Region in 2005-2013 give evidence that food business operators check programmes should be improved to ensure an adequate monitoring of AFM1 contamination in small ruminant dairy chain.

  16. A Survey on Aflatoxin M1 Content in Sheep and Goat Milk Produced in Sardinia Region, Italy (2005-2013).

    Science.gov (United States)

    Virdis, Salvatore; Scarano, Christian; Spanu, Vincenzo; Murittu, Gavino; Spanu, Carlo; Ibba, Ignazio; De Santis, Enrico Pietro Luigi

    2014-12-09

    In the present work the results of a survey conducted in Sardinia Region on Aflatoxin M 1 (AFM 1 ) contamination in milk of small ruminants from 2005 to 2013 are reported. A total of 517 sheep and 88 goat milk samples from bulk tank, tank trucks and silo tank milk were collected. Analyses were performed by the Regional Farmers Association laboratory using high-performance liquid chromatography following the ISO 14501:1998 standard. None of the sheep milk samples analysed during 2005-2012 showed AFM 1 contamination. In sheep milk samples collected in 2013, 8 out of 172 (4.6%) were contaminated by AFM 1 with a concentration (mean±SD) of 12.59±14.05 ng/L. In one bulk tank milk sample 58.82 ng/L AFM 1 was detected, exceeding the EU limit. In none of goat milk samples analysed from 2010 to 2012 AFM 1 was detected. In 2013, 9 out of 66 goat milk samples (13.6%) showed an AFM 1 concentration of 47.21±19.58 ng/L. Two of these samples exceeded the EU limit, with concentrations of 62.09 and 138.6 ng/L. Higher contamination frequency and concentration rates were detected in bulk tank milk samples collected at farm than in bulk milk truck or silo samples, showing a dilution effect on AFM 1 milk content along small ruminants supply chain. The rate and levels of AFM 1 contamination in sheep and goat milk samples were lower than other countries. However, the small number of milk samples analysed for AFM 1 in Sardinia Region in 2005-2013 give evidence that food business operators check programmes should be improved to ensure an adequate monitoring of AFM 1 contamination in small ruminant dairy chain.

  17. Short communication: Microbiological quality of raw cow milk and its association with herd management practices in Northern China.

    Science.gov (United States)

    Lan, X Y; Zhao, S G; Zheng, N; Li, S L; Zhang, Y D; Liu, H M; McKillip, J; Wang, J Q

    2017-06-01

    Contamination of raw milk with bacterial pathogens is potentially hazardous to human health. The aim of this study was to evaluate the total bacteria count (TBC) and presence of pathogens in raw milk in Northern China along with the associated herd management practices. A total of 160 raw milk samples were collected from 80 dairy herds in Northern China. All raw milk samples were analyzed for TBC and pathogens by culturing. The results showed that the number of raw milk samples with TBC milk samples were Staphylococcus aureus positive, 72 (45.00%) were Escherichia coli positive, 2 (1.25%) were Salmonella positive, 2 (1.25%) were Listeria monocytogenes positive, and 3 (1.88%) were Campylobacter positive. The prevalence of S. aureus was influenced by season, herd size, milking frequency, disinfection frequency, and use of a Dairy Herd Improvement program. The TBC was influenced by season and milk frequency. The correlation between TBC and prevalence of S. aureus or E. coli is significant. The effect size statistical analysis showed that season and herd (but not Dairy Herd Improvement, herd size, milking frequency, disinfection frequency, and area) were the most important factors affecting TBC in raw milk. In conclusion, the presence of bacteria in raw milk was associated with season and herd management practices, and further comprehensive study will be powerful for effectively characterizing various factors affecting milk microbial quality in bulk tanks in China. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  18. Composition of raw cow milk and artisanal yoghurt collected in ...

    African Journals Online (AJOL)

    PONKA ROGER

    2013-12-04

    Dec 4, 2013 ... cribed as being almost a complete food for man. It contains carbohydrates, protein ... For centuries, milk production in Cameroon has been characterized by a ...... and maintenance of the human body. (FAO/WHO/UNU, 2007).

  19. Oligosaccharides in goat milk: structure, health effects and isolation

    NARCIS (Netherlands)

    Kiskini, A.; Difilippo, E.

    2013-01-01

    Oligosaccharides have been widely recognized for their prebiotic and anti-infective properties. Among the different types of mammalian milk, the one of humans is the richest source of naturally derived oligosaccharides. However, their use as a basis for functional foods is hampered, due to their

  20. CONTRIBUTION TO THE DEBATE ON THE MICROBIOLOGICAL QUALITY OF RAW MILK FROM VENDING MACHINES

    Directory of Open Access Journals (Sweden)

    Ján Šnelcer

    2011-07-01

    Full Text Available Normal 0 21 false false false SK X-NONE X-NONE MicrosoftInternetExplorer4 Microbiological quality or raw milk from vending maschine was analyzed in this work. Despite the pathogenic bacteria may be present in raw milk, the analyses and evaluations were focused to bacterial indicators only. Refer to total bacterial counts, the criterion ≤ 100,000 cfu/ml met 12 from 15 samples (80% and all samples complied with the supplementary criterion of 5×104 cfu/ml for psychrotrophs. Numbers of coagulase-positive staphylococci ranged closely around the average value 2.9×102 cfu/ml. Average numbers of coliforms and E. coli in raw milk were found 4.34 ± 0.42 and 3.25 ± 0.83 log CFU/ml, respectively. These values significantly exceeded even the limits applicable in the past. On the basis of unchanged numbers of these bacteria in milk after 24 h at 6 °C, we assume that the high numbers of coliforms and E. coli present in milk are the result of fecal contamination and not growth. As E. coli is an indicator of faecal contamination of raw milk comprising the possible presence of Salmonella sp. Campylobacter sp. and other pathogens, microbiological survey suggested appropriate preventive measures that should be applied in terms of risk management.doi:10.5219/98

  1. Proteolytic and lipolytic microbiota of refrigerated raw milk from northeast and southern regions of Brazil

    Directory of Open Access Journals (Sweden)

    Jose Carlos Ribeiro Junior

    2015-12-01

    Full Text Available The shelf life of milk and milk derivatives is directly related to the microbiological quality of refrigerated raw milk. Spoilage microorganisms with proteolytic and/or lipolytic properties are primarily responsible for the decrease in the quality of milk, which is reflected in the shelf life of pasteurized milk and all derivatives. The aim of this study was to determine the spoilage microbial load of refrigerated raw milk from the northeast and southern regions of Brazil, which have different climatic and technological conditions of production. We evaluated 46 samples of milk from the state of Paraná in the southern region, and 10 samples of milk from the state of Maranhão in the northeast region, totaling 56 samples collected from November 2013 to November 2014. The producers of Paraná were divided into large (20 or small (26 according to the average daily production. All producers of Maranhão were considered small (<500L/day. The proteolytic and lipolytic microorganism counts were conducted in milk agar and tributyrin agar, respectively. Milk from the large producers of Paraná had average counts of 1.4 × 104 CFU/mL for proteolytic microorganisms and 1.2 × 103 CFU/mL for lipolytics microorganisms, significantly (p <0.05 lower than the small producers in the same state, and the producers of Maranhão. Producers of Maranhao had counts of 1.1 × 105 CFU/mL for proteolytic microorganisms and 2 × 105 CFU/mL for lipolytic microorganisms, with the proteolytic count significantly lower than that of small Paraná producers. The amount of proteolytic and lipolytic spoilage microorganisms in milk is influenced by the adaptation of the microorganisms to cold, promoted by the cooling of milk, which is practiced less frequently in the country’s northeastern region. The amount of spoilage microorganisms is also affected by the implementation of milking hygiene practices, which reduce contamination. Such practices are more frequently and efficiently

  2. Assessment of Raw Cow Milk Quality in Smallholder Dairy Farms in Pemba Island Zanzibar, Tanzania

    Directory of Open Access Journals (Sweden)

    S. H. Gwandu

    2018-01-01

    Full Text Available Milk quality depends on the physicochemical characteristics, hygienic standards, and nutritional quality; however, animal husbandry practices, unhygienic harvesting and processing, may affect its quality. A cross-sectional study was conducted between August 2010 and July 2011 to assess the hygiene of cow milk production environment, raw cow milk physicochemical characteristics, and microbial quality and estimate the prevalence of antimicrobial residues using standard methods in Pemba Island. A total of 98 raw cow milk samples from selected smallholder dairy farms were analyzed, and the judgement on the quality used the East African Standards. Generally, the milk production chain was done under the unhygienic condition, and dirty plastic containers were used for collection and storage of milk under room temperature. Some milk samples had abnormal colour (2.1%, abnormal smell (7.1%, and pH below normal (35.7%, clotted on alcohol test (9.2%, and had the specific gravity below normal (13.3%. All the milk samples had mineral contents within the recommended range. Milk samples with butterfat below normal were 29.6%, while 14.3% had total solids below recommended values. The mean total viable count (TVC of milk container surfaces was 9.7±10.5 log CFU/100 cm2, while total coliform count (TCC was 7.8±8.5 log CFU/100 cm2. Up to 55.1% of milk had TVC beyond the recommended levels. The milk mean TVC was 11.02±11.6 log CFU/ml and TCC was 6.7±7.3 log CFU/ml. Up to 26.5% of milk samples had the TCC beyond levels. Results on physicochemical characteristics and nutritional analysis show that the raw cow milk in Pemba Island is of inferior quality. Microbiological results of this study imply heavy contaminations of milk. Antimicrobial residues were detected in 83% of the samples and most of them were from Wete District. Unhygienic milk production chain accelerates microbial contaminations, and antimicrobial residues in milk are a big

  3. Influence of Sunflower Whole Seeds or Oil on Ruminal Fermentation, Milk Production, Composition, and Fatty Acid Profile in Lactating Goats

    Directory of Open Access Journals (Sweden)

    T. A. Morsy

    2015-08-01

    Full Text Available This study aimed to investigate the effect of sunflower seeds, either as whole or as oil, on rumen fermentation, milk production, milk composition and fatty acids profile in dairy goats. Fifteen lactating Damascus goats were divided randomly into three groups (n = 5 fed a basal diet of concentrate feed mixture and fresh Trifolium alexandrinum at 50:50 on dry matter basis (Control in addition to 50 g/head/d sunflower seeds whole (SS or 20 mL/head/d sunflower seeds oil (SO in a complete randomized design. Milk was sampled every two weeks during 90 days of experimental period for chemical analysis and rumen was sampled at 30, 60, and 90 days of the experiment for ruminal pH, volatile fatty acids (tVFA, and ammonia-N determination. Addition of SO decreased (p = 0.017 ruminal pH, whereas SO and SS increased tVFA (p<0.001 and acetate (p = 0.034 concentrations. Serum glucose increased (p = 0.013 in SO and SS goats vs Control. The SO and SS treated goats had improved milk yield (p = 0.007 and milk fat content (p = 0.002. Moreover, SO increased milk lactose content (p = 0.048 and feed efficiency (p = 0.046 compared to Control. Both of SS and SO increased (p<0.05 milk unsaturated fatty acids content specially conjugated linolenic acid (CLA vs Control. Addition of SS and SO increased (p = 0. 021 C18:3N3 fatty acid compared to Control diet. Data suggested that addition of either SS or SO to lactating goats ration had beneficial effects on milk yield and milk composition with enhancing milk content of healthy fatty acids (CLA and omega 3, without detrimental effects on animal performance.

  4. Milk progesterone profiles and the effect of the buck during the anoestrous period in goats

    International Nuclear Information System (INIS)

    Guo Dazhi; Liu Xianyi; Chen Faju; Song Xuehua; Wang Kairong; Liu Xiangmo; Xu Gongyi

    1991-01-01

    Milk progesterone profiles in Chengdu Mah (CM), Saanen (S) and crossbred (CM x S, F1) goats were determined using radioimmunoassay throughout the period from kidding to the beginning of the next breeding season. Different patterns of progesterone profiles were recorded in these does. When milk progesterone concentrations were elevated above 6 ng/mL for at least 6 days they were regarded as signs of ovarian activity. The frequencies of such rises during anoestrus were 4.0, 1.8 and 2.5 per animal in CM, S and F1 goats respectively. The frequencies of progesterone rise were higher than that of behavioural oestrus in the does. After exposing the does to the buck three times during the anoestrus period, no significant 'male effect' was observed on the milk progesterone level or behavioural oestrus during the first six months after kidding. The male effect on behavioural oestrus became apparent only in the seventh month after kidding, while milk progesterone levels did not change markedly compared with those of the control does. (author). 9 refs, 4 figs

  5. The effectiveness of alginates to reduce the transfer of radiostrontium to the milk of dairy goats

    International Nuclear Information System (INIS)

    Beresford, N.A.; Mayes, R.W.; MacEachern, P.J.; Dodd, B.A.; Lamb, C.S.

    1999-01-01

    In the event of a nuclear accident the radiation dose to human populations arising from radiostrontium ingested as contaminated milk is a major cause of concern. We report a study to determine if calcium alginate incorporated into the diet can be used as an effective countermeasure to reduce radiostrontium transfer to the milk of dairy goats. When Ca-alginate was included into a pelleted ration at 5% dry weight the transfer of radiostrontium to the milk of the goats was reduced by approximately 50%. No effects on diet palatability or the absorption of iron or calcium were observed. Ca-alginate was readily fermentable and hence its potential binding capacity is likely to be reduced in ruminants compared to monogastrics. The Ca-alginate also supplied additional calcium to the diet in an amount which may explain the observed reduction in radiostrontium transfer to milk. Therefore, currently, we cannot be certain if the effect we observed was due to alginate or calcium. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  6. Studies on folate binding and a radioassay for serum and whole-blood folate using goat milk as binding agent

    International Nuclear Information System (INIS)

    Piyasena, R.D.; Weerasekera, D.A.; Hettiaratchi, N.; Wikramanayake, T.W.

    1978-01-01

    Preparations of cow, goat, buffalo and human milk in addition to pig plasma were tested for folate binding properties. Of these, only pig plasma and goat milk showed sufficient binding to enable them to be used as binding agents in a radioassay for serum and whole-blood folate. The binding of folate by cow milk preparations in particular was found to be very poor. Goat milk was preferred to pig plasma as a binder for folate radioassay for reasons of convenience, economy and greater stability, and because pteroylglutamic acid (PGA) can be used both as tracer and standard. Where pig plasma is used with the inclusion of folate-free serum in the standard tubes, differences were observed between the standard and serum blanks which themselves varied from sample to sample. By contrast, with goat milk, all blank readings were normally 3% or less. Five out of eight samples of goat milk were seen to contain 'releasing factor' necessary to liberate folate from endogenous binder (FABP). Where present, the factor was found to be stable for at least three months when the partially purified milk was stored freeze dried at 4 0 C. Goat milk binder was found unable to distinguish between PGA and methyltetrahydrofolic acid (MTFA) at pH9.3. This enabled PGA rather than the more unstable MTFA to be used as tracer and standard. The assay employs a one-step incubation procedure at room temperature. It is sensitive to about 0.1 ng of PGA and is reproducible to less than 5% variation. The mean % recovery of inactive added folate was 101+-4%. (author)

  7. Food safety in raw milk production: risk factors associated to bacterial DNA contamination.

    Science.gov (United States)

    Cerva, Cristine; Bremm, Carolina; Reis, Emily Marques dos; Bezerra, André Vinícius Andrade; Loiko, Márcia Regina; Cruz, Cláudio Estêvão Farias da; Cenci, Alexander; Mayer, Fabiana Quoos

    2014-06-01

    While human illness from milkborne pathogens may be linked to contamination of the product after pasteurization or improper pasteurization, such diseases are usually associated with consumption of raw milk or its by-products. Molecular biology tools were applied to investigate contamination by Listeria monocytogenes, Salmonella spp., some pathogenic strains of Escherichia coli, and Campylobacter jejuni in 548 raw milk samples from 125 dairy farms established in two regions from southern Brazil. Moreover, 15 variables were evaluated for their association with raw milk contamination levels, and the risk factors were determined by multiple regression analysis. Salmonella spp. were more frequently detected, followed by pathogenic E. coli. There was difference in contamination index between the regions, in which risk factors such as temporary cattle confinement, low milk production, low milking machine cleaning frequency, and milk storage area without tile walls were identified. The risk factors were specific to each region studied. Nevertheless, the data can be used to improve milk quality of dairy farms/herds with similar management practices.

  8. Impact of applying hygienic practices at farm on bacteriological quality of raw milk

    Directory of Open Access Journals (Sweden)

    N. Pandey

    2014-09-01

    Full Text Available Aim: The present study was carried out to explore the potential source of contamination and the efficacy of different washing practices towards quality milk production. Materials and Methods: Probable sources of contamination viz. stored water, potable water, milker’s hands, milking pail, udder of individual buffalo and milk cans were subjected to different types of bacterial counts before the actual experiment to start. Twenty milch buffaloes thereafter were divided randomly into four treatment groups where washing was performed in each step viz. milker hands, udder of individual buffalo, milking pail and milk cans before milking either with water (T0: stored water, T1: potable water or sanitizers (T2: 200 ppm chlorine solution, T3: 50 ppm iodophore solution for 60 days. Bacterial counts again were performed for last 5 alternate days for all the sources involved along with the microbial load of raw milk. Data obtained were subjected to standard statistical analysis. Results: It was found that for all bacterial count stored water contributed significantly higher as compared to the potable water. Among the other potential sources of contamination (log/6 cm2, standard plate count (SPC and coliform count were significantly highest for milking pail (6.73±0.02 and udder of milch buffaloes (3.77±0.12, respectively, while for Staphylococci count both milking pail (3.24±0.02 and milking can (3.22±0.04 were contributed maximally (p0.05 for most of the parameters, even for the raw milk quality. Conclusion: Study revealed that milker hands, milking pails, udder of animals, milk cans and stored water used for washing of equipment are the potential source of contamination in raw milk. These were counted as critical point which needs attention for the production of high-quality milk. Potable water was found to be better than stored water. The use of either chlorine 200 ppm and iodophor 50 ppm is highly effective in reducing the bacterial population for

  9. Milk quality as affected by grazing time of day in Mediterranean goats.

    Science.gov (United States)

    Avondo, Marcella; Bonanno, Adriana; Pagano, Renato I; Valenti, Bernardo; Grigoli, Antonio Di; Luigia Alicata, M; Galofaro, Vittorio; Pennisi, Pietro

    2008-02-01

    We evaluated the effect of grazing time of day on goat milk chemical composition, renneting properties and milk fatty acid profile in a Mediterranean grazing system. Sixteen lactating Girgentana goats were divided into two experimental groups and housed in individual pens, where they received 500 g/d of barley grain. For 5 weeks the two groups were left to graze in two fenced plots on a ryegrass sward as follows: morning group (AM), from 9.00 to 13.00; afternoon group (PM), from 12.00 to 16.00. In selected herbage, water-soluble carbohydrates (WSC) increased in the afternoon (204 v. 174 g/kg dry matter, DM; P=0.01), whereas crude protein (CP) and linolenic acid decreased (respectively, 16.7 v. 19.8% DM; Ptitrable acidity ( degrees SH) increased in the PM group (respectively 3.56 v. 3.42%; P=0.01; 3.55 v. 3.22 degrees SH/50 ml; P=0.01). In contrast, milk urea content was significantly higher in the AM group (381 v. 358 mg/l; P=0.037). The results seem to indicate that an improvement in ruminal efficiency might be obtained by shifting grazing time from morning to afternoon, as a consequence of a more balanced ratio between nitrogenous compounds and sugars. Indeed, the higher linolenic acid and the lower conjugated linoleic acid (CLA) (respectively 1.02 v. 0.90, P=0.037; 0.71 v. 0.81% of total fatty acids, P=0.022) in the milk of goats grazing in the afternoon seem to indicate a reduced biohydrogenation activity in the PM group.

  10. The effect of subclinical mastitis on milk yield in dairy goats.

    Science.gov (United States)

    Koop, G; van Werven, T; Schuiling, H J; Nielen, M

    2010-12-01

    The aims of this study were to estimate milk yield (MY) losses associated with subclinical intramammary infection (IMI) in dairy goats and to assess if somatic cell count (SCC) can be used to estimate such MY losses. We used 2 data sets to study these questions. The first data set consisted of 5 herds. Milk production and SCC were recorded during 1 lactation. From approximately 100 does in each herd, milk samples were collected on 3 occasions during lactation for bacteriological culture. Linear mixed regression was used to estimate the effect of IMI on MY. The second data set consisted of 6 large herds, in which some of the goats had an extended lactation (≥2 yr). Milk yield and SCC data were recorded without bacteriological culture. The data showed that bacterial infection was related to an increase in SCC. Infections with major pathogens were rare and associated with a decreased MY; infection with coagulase-negative staphylococci did not affect MY, whereas infection with Corynebacterium bovis was associated with increased MY. A negative correlation was observed between SCC and MY, but the data suggested that this negative correlation was attenuated rather than caused by IMI. Furthermore, SCC seemed to be affected by MY via a dilution effect. Hypotheses about biological mechanisms behind these observations are discussed. This paper shows that MY losses caused by subclinical udder infections are limited in goats, and that SCC cannot be used to estimate the magnitude of these losses. Copyright © 2010 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  11. Effect of gamma irradiation on the properties of various kinds of milk fat. II. Fatty acids composition of milk fat

    International Nuclear Information System (INIS)

    Girgis, E.S.; Rady, A.H.; Kamal, T.H.; Shehata, T.E.; Ibrahim, M.K.

    1986-01-01

    Fresh cow's, buffalo's and goat's milk fat were subjected to ascendent doses of 8-rays of 250, 500 and 750 K.rad as compared to raw milk samples (control). The methyl esters of fats separated from these samples were analyzed using gas liquid chromatographic technique. Total saturated fatty acids (T.S.F.A.) were 70.46%, 67.44% and 72.85%, while total unsaturated fatty acid (T.U.F.A.) were 29.51%, 32.54% and 27.15% for cow's buffalo's and goat's raw milk fats, respectively. Water insoluble volatile fatty acids (W.I.V.F.A.) were much higher in goat's raw milk fat (23.24%) than in cows (6.34%) and buffaloes (5.25%) ones. Palmitic acid represents the predominant saturated fatty acid, while oleic acid represents the major unsaturated fatty acids in the three kinds of milk fat. Linoleic acid was present only in buffalo's and goat's raw milk fat. The exposure of buffalo's and goat's milk to 8-rays doses increased TSFA and decreased TUFA of their fats. Meanwhile the same doses induced a minor change in both TSFA and TUFA of cow's milk one. Also, 8-irradiation increased the relative percentage of Palmitic acid in the three types of milk fat, while linoleic acid decreased in buffalo's and goat's milk fat. Besides, W.I.V.F.A. showed a gradual decrease, when the three types of milk were exposed to ascendent doses of 8-rays

  12. Escherichia coli O26 IN RAW BUFFALO MILK: PRELIMINARY RESULTS

    Directory of Open Access Journals (Sweden)

    A. Rella

    2013-02-01

    Full Text Available Escherichia coli O26 is considered to be one of the most important food-borne pathogen. In this study, 120 buffalo milk samples collected in Lazio and in Apulia regions were tested for the presence of E. coli O26. One buffalo milk sample (0,8% tested positive for E. coli O26; the isolate was positive at the verocytotoxicity test and it showed resistance properties to different antimicrobial classes. These preliminary results highlight the need to monitor the foods of animal origin used for production and eaten by a wide range of persons, respect VTEC organism.

  13. Effect of incubation time, inoculum size, temperature, pasteurization time, goat milk powder and whey powder on ACE inhibitory activity in fermented milk by L. plantarum LP69.

    Science.gov (United States)

    Shu, Guowei; Yang, Hui; Chen, He; Zhang, Qiuhong; Tian, Yue

    2015-01-01

    Angiotensin I converting enzyme (ACE) plays an important physiological role in regulating hypertension. Lactic acid bacteria are known to produce ACE inhibitory peptides which can lower hypertension during fermentation. The effect of incubation time (0~36 h), inoculum size (3, 4, 5, 6 and 7%, v/v), temperature (25, 30, 35, 40 and 45°C), sterilization time (5, 10, 15, 20 and 25 min), concentration of goat milk powder (8, 10, 12, 14 and 16%, w/v) and whey powder (0.5, 0.6, 0.7, 0.8 and 0.9%, w/v) on ACE inhibitory peptides fermented from goat milk by Lactobacillus plantarum LP69 was investigated using single factor experiment. The optimal incubation time, inoculum size, temperature, pasteurization time, goat milk powder and whey powder in fermented milk by L. plantarum LP69 was 14 h, 3.0%, 35°C, 20 min, 14% and 0.70% for ACE inhibitory activity and 22 h, 3.0%, 40°C, 25 min, 16% and 0.60% for viable cell counts, respectively. The incubation time, inoculum size, temperature, pasteurization time, goat milk powder and whey powder had a significant influence on ACE inhibitory activity in fermented milk by Lactobacillus plantarum LP69, the results are beneficial for further screening of main factors by using fractional factorial designs.

  14. Importance of Decision Support Systems About Food Safety in Raw Milk Production

    Directory of Open Access Journals (Sweden)

    Ecem Akan

    2015-12-01

    Full Text Available In raw milk production decision support systems for control of food safety hazards has not been developed but main points of this system are available. The decision support systems’ elements include data identification at critical points in the milk supply chain, an information management system and data exchange. Decision supports systems has been developed on the basis of these elements. In dairy sector decision support systems are significant for controlling of food safety hazards and preferred by producers. When these systems are implemented in the milk supply chain, it can be prevented unnecessary sampling and analysis. In this article it will be underlined effects of decision support system elements on food safety of raw milk.

  15. Microbiological quality of retail cheeses made from raw, thermized or pasteurized milk in the UK.

    Science.gov (United States)

    Little, C L; Rhoades, J R; Sagoo, S K; Harris, J; Greenwood, M; Mithani, V; Grant, K; McLauchlin, J

    2008-04-01

    Two studies of retail fresh, ripened and semi-hard cheeses made from raw, thermized or pasteurized milk were undertaken in the UK during 2004 and 2005 to determine the microbiological quality of these products. Using microbiological criteria in European Commission Recommendations 2004/24/EC and 2005/175/EC, 2% of both raw, thermized (37/1819 samples) and pasteurized (51/2618 samples) milk cheeses were of unsatisfactory quality. Raw or thermized milk cheeses were of unsatisfactory quality due to levels of Staphylococcus aureus at 10(4)cfu g(-1), Escherichia coli at 10(5)cfu g(-1), and/or Listeria monocytogenes at 10(2)cfu g(-1), whereas pasteurized milk cheeses were of unsatisfactory quality due to S. aureus at 10(3)cfu g(-1) and/or E. coli at 10(3)cfu g(-1). Salmonella was not detected in any samples. Cheeses were of unsatisfactory quality more frequently when sampled from premises rated as having little or no confidence in management and control systems, and stored/displayed at above 8 degrees C. Raw or thermized milk cheeses were also more likely to be of unsatisfactory quality when they were unripened types, and pasteurized milk cheeses when they were: semi-hard types; from specialist cheese shops or delicatessens; cut to order. These results emphasize the need for applying and maintaining good hygiene practices throughout the food chain to prevent contamination and/or bacterial growth. Labelling of cheeses with clear information on whether the cheese was prepared from raw milk also requires improvement.

  16. Detection and identification of Staphylococcus aureus in raw milk by ...

    African Journals Online (AJOL)

    Staphylococcus aureus causes foodborne diseases if consumed in contaminated milk products. Rapid detection and characterization of foodborne pathogen S. aureus is crucial for epidemiological investigations and food safety surveillance. It is still a challenge to detect and identify bacterial pathogens quickly and ...

  17. Proteolysis produced within biofilms of bacterial isolates from raw milk tankers.

    Science.gov (United States)

    Teh, Koon Hoong; Flint, Steve; Palmer, Jon; Andrewes, Paul; Bremer, Phil; Lindsay, Denise

    2012-06-15

    In this study, six bacterial isolates that produced thermo-resistant enzymes isolated from the internal surfaces of raw milk tankers were evaluated for their ability to produce proteolysis within either single culture biofilms or co-culture biofilms. Biofilms were formed in an in vitro model system that simulated the upper internal surface of a raw milk tanker during a typical summer's day of milk collection in New Zealand. The bacterial isolates were further evaluated for their ability to form biofilms at 25, 30 and 37°C. Mutual and competitive effects were observed in some of the co-culture biofilms, with all isolates being able to form biofilms in either single culture or co-culture at the three temperatures. The proteolysis was also evaluated in both biofilms and corresponding planktonic cultures. The proteolysis per cell decreased as the temperature of incubation (20-37°C) increased. Furthermore, mutualistic interactions in terms of proteolysis were observed when cultures were grown as co-culture biofilms. This is the first study to show that proteolytic enzymes can be produced in biofilms on the internal surfaces of raw milk tankers. This has important implications for the cleaning and the temperature control of raw milk transport tankers. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Selected abiotic factors that influence raw cow milk freezing point depression

    Directory of Open Access Journals (Sweden)

    Oto Hanuš

    2012-01-01

    Full Text Available Freezing point depression (FPD is an important property of milk that is influenced primarily by milk components connected to osmotic pressure. Under certain conditions it is possible to detect the addition of water to milk. It is necessary to have the right FPD limit in legislation for milk quality control. The aim of this study was to improve the estimation procedure of this limit. Apart from factors related to dairy cow nutrition, cattle breed and milk yield, it is important to take into account CO2 (6%, water steam evaporation and pasteurization under technological conditions. Bulk milk samples (1, 30, 6, 6, 10, 1 according to experiment from Holstein and Czech Fleckvieh breed (1:1 were used in the experiments and technologically treated. The effects of water addition (water saturated and unsaturated by CO2, carbon dioxide evaporation and pasteurization (80 °C for 22 min were quantified. Pasteurization aggravation of FPD was -0.00394 ± 0.00171 ºC (P P < 0.001 depending on practice. Increase in FPD is recorded after milking during technological procedures of milk storage, mixing, pumping, transport shaking and warming. During FPD shift, the acuteness of FPD data sets increases. This fact should be considered in the process of deriving standard raw cow milk FPD limits. Similar experimental analysis of milk FPD technological shifts has not been performed in this way until now.

  19. Behaviour of Listeria monocytogenes in artisanal raw milk Pecorino Umbro cheese: a microbiological challenge test

    Directory of Open Access Journals (Sweden)

    Roberta Ortenzi

    2015-09-01

    Full Text Available In the present study, a microbiological challenge test in artificially contaminated raw milk Pecorino Umbro cheese during cheese-making was carried out. Raw ewe milk was contaminated by a suspension of particular Listeria monocytogenes strains. The number of L. monocytogenes and L. monocytogenes dynamic growth were evaluated during cheese-making and storage. A significant decrease of the viable count of L. monocytogenes was observed during ripening and L. monocytogenes viable count was below the limit of quantification during storage. The results show that the product is unable to support the growth of the pathogen.

  20. Effect of medicinal plants, Heavy metals and antibiotics against pathogenic bacteria isolated from raw, Boiled and pasteurized milk.

    Science.gov (United States)

    Ali, Nazish Mazhar; Sarwar, Khadija; Mazhar, Syed Abdullah; Liaqat, Iram; Andleeb, Saiqa; Mazhar, Bushra; Kalim, Bushra

    2017-11-01

    Present study has been undertaken to isolate and identify the bacterial flora in raw, boiled and pasteurized milk. Agar disc diffusion method was used to determine their sensitivity using medicinal plants, antibiotics and heavy metals. Methylene blue reduction test was used to test the quality of milk samples. Total 10 pathogenic strains were isolated, five strains were isolated from raw milk, three from boiled milk and 2 two from pasteurized milk. To determine optimum conditions for growth, these pathogenic microorganisms were incubated at various temperatures and pH. Gram's staining and biochemical tests revealed that these pathogenic bacteria include Lactobacillus sp., E. coli, Salmonella sp., Pseudomonas sp., Streptococcus sp. and Staphylococcus. Ribotyping revealed S2 as Pseudomonas fluorescens, S5 as Lactococcus lactis and S9 as Lactobacillus acidophilus. Prevalence of pathogenic organisms provided the evidence that contamination of milk arises during milking, transportation and storage of milk. Raw milk is more contaminated than other two types of milk because it contains highest percentage of pathogenic organisms and pasteurized milk was found to be of best quality among three types. So it is recommended to drink milk after proper boiling or pasteurization. Proper pasteurization and hygienic packing of milk is essential to minimize contamination in milk which can save human beings from many milk borne diseases. Our study suggests that antimicrobial use in animal husbandry should be minimized to reduce the hazard of antibiotic resistance. Plant extracts are better alternative against pathogenic bacteria in milk.

  1. Occurrence of Staphylococcus aureus in raw milk produced in dairy farms in São Paulo state, Brazil

    Directory of Open Access Journals (Sweden)

    Helena Fagundes

    2010-06-01

    Full Text Available The objective of the present study was to evaluate the occurrence of Staphylococcus aureus in milk produced in 37 farms located in the regions of Ribeirão Preto and São Carlos, state of São Paulo, Brazil. Two-hundred and eight samples of milk from individual cows showing subclinical mastitis, and 37 samples of bulk tank milk were analyzed. S. aureus strains were detected in 18 (7.3% milk samples: 14 (6.7% from samples of individual cows, and 4 (10.8% from bulk tank milk. Two individual milk samples (14.3% and two bulk milk samples contained enterotoxigenic S. aureus. PFGE analysis revealed the genetic heterogeneity of the strains isolated from raw milk, which presented to 13 S. aureus patterns. Results confirmed the potential transmission of staphylococcal food poisoning to consumers via milk of cows affected by subclinical mastitis, mainly when raw milk is ingested.

  2. Uptake of Heavy Metal Residues from Sewerage Sludge in the Milk of Goat and Cattle during Summer Season

    Directory of Open Access Journals (Sweden)

    Bilal Aslam, Ijaz Javed*, Faqir Hussain Khan and Zia-ur-Rahman

    2011-01-01

    Full Text Available Uptake of different heavy metal residues including cadmium (Cd, chromium (Cr, nickel (Ni, led (Pb, arsenic (As, and mercury (Hg were determined in goat and cattle milk collected from two areas, each consisted of three sites. Area 1 was selected in the North-East and Area 2 in the North-West of Faisalabad city along the main sewerage drains. Levels of Cd, Cr, Ni, Pb, As and Hg in the milk of goat and cattle were higher than the most reported values in the literature. The levels of heavy metal residues in the milk of cattle from Area 1 were higher than those present in cattle milk from Area 2. However, in case of goat milk the residual values from Area 1 and Area 2 were non-significantly different. It was concluded that the levels of Cd, Cr, Ni, Pb, As and Hg in the milk of goat and cattle were higher than reported values in the literature.

  3. Dietary supplementation of Butyrivibrio fibrisolvens alters fatty acids of milk and rumen fluid in lactating goats.

    Science.gov (United States)

    Shivani, Swati; Srivastava, Anima; Shandilya, Umesh K; Kale, Vishnu; Tyagi, Amrish K

    2016-03-30

    Conjugated linoleic acid (CLA) isomers have high health amelioration potential and hence it is of great interest to increase the CLA content in dairy products. The present study was conducted to investigate the effect of administration of high CLA producing Butyrivibrio fibrisolvens In-1 on fatty acid composition of milk and rumen fluid in lactating goats. Four groups (n = 5) of lactating goats were assigned the following treatments: Control (C) (basal diet); T1 (basal diet + linoleic acid source), T2 (basal diet + suspension of Butyrivibrio fibrisolvens In-1, 10(9) CFU head(-1)) and T3 (basal diet + linoleic acid source + suspension of Butyrivibrio fibrisolvens In-1, 10(9) CFU head(-1)). Rumen liquor and milk samples were collected on days 0, 15, 30, 60 and 90 of the experiment and linoleic isomerase enzyme (LA-I) activity and fatty acid profiles were elucidated. Major effects of treatments were seen on day 30 of the experiment. Total CLA content of rumen fluid increased (P content was lowered (P content increased (P rumen that subsequently decreased SFA content while increased CLA and unsaturated fatty acids in ruminant's milk. © 2015 Society of Chemical Industry.

  4. Physicochemical Characteristic of Fermented Goat Milk Added with Different Starters Lactic Acid Bacteria

    Directory of Open Access Journals (Sweden)

    Anif Mukaromah Wati

    2018-03-01

    Full Text Available Development of traditional food including dadih to be commercial fermented milk was needed to achieve efficiency and effective of products. Dadih with natural starter needs to be changed with starters because starters can be produced commercially. This study aims to evaluate physicochemical characteristic of fermented goat milk that added with different starters Lactic Acid Bacteria (LAB isolated from dadih. The materials used for this research were starters LAB that isolated from dadih. In this experiment, treatments were used different starters that namely starter 11, starter 21, starter 25, starter 29, and starter 41 then analized about water content, ash content, fat content, syneresis, and viscosity. The experiment was carried out with three replications. The data were analyzed by ANOVA using the basic design of Completely Randomized Design (CRD and continued by Duncan's Multiple Range Test (DMRT if there was a significantly different. The results showed that different starters had influence on water content, ash content, fat content, syneresis, and viscosity. It could be concluded that starters 11 and 41 were the best starter that can be applied in fermented goat milk product based on physical quality with lower syneresis and higher viscosity. But based on chemical quality, starter 11 was the best starter with lower water content and higher ash content.

  5. Radioactivity in sheep meat, cow and goat milk, 1988-2004

    International Nuclear Information System (INIS)

    Gjelsvik, R.

    2005-09-01

    The report summarizes the results of monitoring 137Cs in sheep, cow and goats milk from selected farms in 2004 and long-term effects from 1988-2004.The results give a basis for this years slaughter forecasts in 2004 and give information about the levels, variation and long-term effects of 137Cs in some of Norway's most important food chains. Sheep classification zones made clean feeding necessary wholly or partially in 34 municipalities in 2004. Effective ecological half-times for 137Cs in goat milk from Nord-Trondelag and Oppland were 9-10 years for the period 1989-2004. Effective ecological half-times for 137Cs in cow milk were 7 years in farms from Nordland county and 10 years in farms from Oppland county. Concentration of 137Cs in sheep meat from Oppland county measured in 1989-2004, showed an estimated effective ecological half-time of 10 years for ewes and 11 years for lambs. (Author)

  6. Detection of Listeria in raw milk in Syria

    International Nuclear Information System (INIS)

    Al-Mariri, A.; Abou-Younes, A.

    2010-01-01

    The 66 milk collected from all province of Syria, were examined for the presence of Listeria sp. using a several technique, and L. monocytogenes serotypes associated with human listeriosis were also identified in the product. The PCR based method identified 117 strains of Listeria, L. monocytogenes, L. innocua, L. ivanovii, L. gravi, and L. welshimeri. The API Listeria system identified 94% of the isolates whereas FTIR identification was 98% for all Listeria species. (author)

  7. Characterisation of Lactobacilli from eweʼs and goatʼs milk for their further processing re-utilisation

    Directory of Open Access Journals (Sweden)

    Miroslav Kološta

    2014-02-01

    Full Text Available Raw ewe's and goat's milk is a good source for isolation of wild lactobacilli which are able to bring unique processing properties in development of dairy products - cheeses or fermented dairy products. 34 strains of lactobacilli were isolated, purified and identified from fermented ewe's and goat's dairy products. These products were processed without thermal treatment and without using of any commercial starters. After preliminary selection, the final collection of 5 strains was established. The strains were identified as: Lbc. plantarum (2, Lbc. paraplantarum (1, Lbc. paracasei (1 and Lbc. johnsonii (1. Except two strains, all were able to coagulate milk. After hydrolysis of lactose in milk, two strains were able to form sensorial attractive coagulate too. All of the strains were homofermentative, they produced lactic acid but they did not produce CO2. Their ability to produce diacetyl was low. They did not show strong proteolytic activity. All strains grew at 30 °C and 37 °C, however Lbc. johnsonii much slower at 30 °C than the others. Except Lbc. johnsonii, all strains tolerated 2% concentration of NaCl and even in presence of 5% concentration of NaCl their growth was inhibited only moderately. All of characterized strains can be provisionally used as starter or starter adjuncts in dairy technology, during production of cheeses or fermented milk products from pasteurised milk. These results will be used in further processing studies of isolated strains and will be supplemented with other properties e.g. safety, probiotic and antimicrobial properties.

  8. Characterization of Staphylococcus species isolated from raw milk and milk products (lben and jben) in North Morocco.

    Science.gov (United States)

    Bendahou, Abdrezzak; Lebbadi, Mariam; Ennanei, Latifa; Essadqui, Fatima Z; Abid, Mohammed

    2008-06-01

    To investigate the incidence and antibiotic resistance of staphylococcal strains isolated from milk and milk products and to trace the ecological origin of the Staphylococcus aureus isolated. Eighty-one samples of raw milk, lben (whey) and jben (cheese) were analyzed for the presence of staphylococcal strains. Isolates were identified by Gram stains, tests for coagulase, the API staph system and the WalkAway 40/96, which also determines the antimicrobial susceptibility profiles. The S. aureus strains were biotyped, and variable regions of the coagulase gene were amplified using the polymerase chain reaction. The identification results showed a predominance of coagulase-negative staphylococci (54 %). Coagulase-positive staphylococci that were identified were divided into 3 groups comprising S. aureus (40%), Staphylococcus intermedius (2 %) and Staphylococcus hyicus (4%). Among the S. aureus that was isolated, biotype C was the predominant biotype. Among 40 coagulase gene PCR-amplification products, 37 produced a single band, while 3 isolates produced two bands. The antimicrobial susceptibility-profile of the staphylococcal strains revealed a high incidence of S. aureus to penicillin G. In addition, Staphylococcus lentus presented considerable resistance to the oxacillin, erythromycin and lincomycin. The presence of staphylococci in raw milk, lben and jben in areas of northern Morocco poses a health hazard, so it is necessary for the public health inspectors to properly examine the conditions during production, storage and commercialization of all products made with unpasteurized milk.

  9. High prevalence of hepatitis E virus infection in goats.

    Science.gov (United States)

    Long, Feiyan; Yu, Wenhai; Yang, Chenchen; Wang, Jue; Li, Yunlong; Li, Yi; Huang, Fen

    2017-11-01

    Hepatitis E virus (HEV) is a major cause of acute hepatitis worldwide, primarily transmitted by fecal-oral route. Zoonotic transmission of HEV from HEV-infected pigs (pork) or cows (milk) to human or non-human primate has been confirmed, but the risk of HEV in goat is still rarely assessed. In the present study, stool, blood, tissues, and milk of goat were collected for HEV infection investigation from Dali City of Yunnan Province in China, where raw mutton and goat milk are traditionally consumed. Surprisingly, a high prevalence of HEV infection in goat was found. Phylogenetic analysis revealed that all HEV isolates from goat belong to genotype 4 and subtype 4h, and shared a high similarity homology (>99.6%) with HEV isolated from human, swine, and cows in the same area. Results suggested that goats are a previously unrecognized HEV host. © 2017 Wiley Periodicals, Inc.

  10. Nitrogen balance in a goat farm producing milk in the county of Barva, Costa Rica

    Directory of Open Access Journals (Sweden)

    José P. Jiménez

    2014-06-01

    Full Text Available The objective of this study was to quantify the use of N in a goat milk producer farm located in the province of Heredia. Data such as feed purchases, milk sales, pur¬chase and removal of animals was compiled and analyzed between January and December 2012. In order to evaluate the use of N, three indicators that allowed analyzing farm efficiency were used. Total number of animals was 102. Annual milk production was 22.417,5 kg. The farm imported 729,8 kg of nitrogen, of which 71% came from feed and only 29% from fertilizers. Farm exported 113,3 kg of nitrogen, of which 85,3% was exported as milk and only 14,7% as animals. The farm imported 38,7 g of N per kg of milk produced. In general, N balance was positive for all farms, indicating that more N entered the farm that came out in the form of product, showing that up to 84,5% of all imported N remained in the farms. Our results suggests that strategies to reduce N excretion should be developed, including improvements in the diet, since the largest N input is through imported feed.

  11. Digestibility, Milk Production, and Udder Health of Etawah Goats Fed with Fermented Coffee Husk

    Directory of Open Access Journals (Sweden)

    I. Badarina

    2015-04-01

    Full Text Available This study was carried out to assess the utilization of coffee husk fermented by Pleurotus ostreatus as feed supplement by measuring the digestibility, milk production and udder health of Etawah goats suffered from subclinical mastitis (+1. There were three experimental diets consisted of T0 (control diet/basal diet without fermented coffee husk, T1 (basal diet with 6% fermented coffee husk and T2 (basal diet with 6% fermented coffee husk soaked in crude palm oil for an hour before using. Basal diet consisted of napier grass (60% and concentrate (40%. The results showed that supplementation of lactating Etawah does with fermented coffee husk did not affect the palatability of the diets, but increased the protein and crude fiber consumption (P<0.05. There was no significant effect on nutrient digestibility and milk production while milk composition (protein, fat, total solid increased in supplemented groups (P<0.05. The persistency of milk production and the somatic cells count were not different. There was an improvement of somatic cells count on supplemented groups. In conclusion, fermented coffee husk could be used as feed supplement without any negative effects on digestibility and milk production. The positive effects to udder health could be expected from including fermented coffee husk in diets.

  12. Effect of ultraviolet light on water- and fat-soluble vitamins in cow and goat milk.

    Science.gov (United States)

    Guneser, O; Karagul Yuceer, Y

    2012-11-01

    The objective of this study was to investigate and compare the effects of UV light and heat treatment on vitamins A, B(2), C, and E in cow and goat milk. Vitamins were analyzed by reverse-phase high-pressure liquid chromatography. Ultraviolet and pasteurization treatments caused loss in vitamin C in milk. Pasteurization did not have any significant effect on vitamin B(2). However, UV light treatment decreased the amount of vitamin B(2) after several passes of milk through the UV system. In addition, UV light treatment decreased the amount of vitamins A and E. Vitamins C and E are more sensitive to UV light. UV light sensitivities of vitamins were C>E>A>B(2). These results show that UV light treatment decreases the vitamin content in milk. Also, the number of passes through the UV system and the initial amount of vitamins in milk are important factors affecting vitamin levels. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  13. Assessment of raw milk quality and stakeholders' awareness on milk-borne health risks in Arusha City and Meru District, Tanzania.

    Science.gov (United States)

    Ngasala, J Uma Bukuku; Nonga, Hezron Emmanuel; Mtambo, Mkumbukwa Madundo Angelo

    2015-06-01

    A cross-sectional study was conducted to assess the quality of raw milk and stakeholders' awareness on milk-borne health risks and factors for poor milk hygiene in Arusha City and Meru District, Tanzania between October and December 2012. A total of 105 smallholder dairy farmers, milk vendors and milk retailers were interviewed, and milk samples were collected for physical, microbial and antibiotic residue analysis using standard procedures. Questionnaire results indicated high level of awareness (94 %) that drinking raw milk can predispose consumers to milk-borne diseases; nevertheless, 65 % of respondents consumed raw milk. Physicochemical analyses showed some of the milk had sediments (20 %), bad smell (21 %) and had clotted on alcohol test (27 %). About 36 % of milk samples had pH below 6.6, and 25 % had specific gravity below 1.028 g/ml. The mean total viable count (TVC) of milk from vendors is significantly (P milk samples assessed had a higher TVC than the level recommended (2.0 × 10(5) cfu/ml) by the East African Community (EAC) standards. Up to 91 % of the milk samples had bacterial growth that included Eschericia coli (66 %), Staphylococcus aureus (33 %), Corynebacterium (11 %) and Pseudomonas (10 %). All smallholder dairy farmers were aware of drug residues, but majority (57 %) were unaware of human health effects caused by veterinary drug residues in milk. Up to 97 % of respondents reported to comply with drug withdrawal periods. This possibly led to all milk samples analysed to be negative from detectable levels of antibiotic residues. It is concluded that the level of awareness on milk quality is high, although practices associated with milking and post-harvest handling predispose milk to bacterial contamination which is a public health risk to milk consumers.

  14. Lipolytic Changes in the Milk Fat of Raw Milk and Their Effects on the Quality of Milk Products

    OpenAIRE

    Kirst, E.

    1986-01-01

    Lipolytic changes in milk rat affect sensory attributes and techno logicaI properties of milk and milk products. They are affectcd by physiologal, thermal . and biochemical factors as well as by the mechanics of fluids Lipolytic processes in milk are intensified by modern processing methods. In this review. special attention has been paid to runinant- related feeding of dairy cows. foaming of milk. mechanical and thermal influences and the growth of psycllrotrophic bacteria. Feeds defic...

  15. Rapid detection of Streptococcus uberis in raw milk by loop-mediated isothermal amplification

    NARCIS (Netherlands)

    Cornelissen, J.B.W.J.; Greeff, De A.; Heuvelink, A.E.; Swarts, M.; Smith, H.E.; Wal, Van der F.J.

    2016-01-01

    A loop-mediated isothermal amplification (LAMP) method to detect Streptococcus uberis in raw milk was developed and evaluated. Three genes (sodA, pauA, cpn60) were assessed for their suitability as targets in LAMP. The analytical sensitivity was 120, 120, and 12 fg per assay for the sodA, pauA,

  16. Optimized enrichment for the detection of Escherichia coli O26 in French raw milk cheeses.

    Science.gov (United States)

    Savoye, F; Rozand, C; Bouvier, M; Gleizal, A; Thevenot, D

    2011-06-01

    Our main objective was to optimize the enrichment of Escherichia coli O26 in raw milk cheeses for their subsequent detection with a new automated immunological method. Ten enrichment broths were tested for the detection of E. coli O26. Two categories of experimentally inoculated raw milk cheeses, semi-hard uncooked cheese and 'Camembert' type cheese, were initially used to investigate the relative efficacy of the different enrichments. The enrichments that were considered optimal for the growth of E. coli O26 in these cheeses were then challenged with other types of raw milk cheeses. Buffered peptone water supplemented with cefixim-tellurite and acriflavin was shown to optimize the growth of E. coli O26 artificially inoculated in the cheeses tested. Despite the low inoculum level (1-10 CFU per 25 g) in the cheeses, E. coli O26 counts reached at least 5.10(4) CFU ml(-1) after 24-h incubation at 41.5 °C in this medium. All the experimentally inoculated cheeses were found positive by the immunological method in the enrichment broth selected. Optimized E. coli O26 enrichment and rapid detection constitute the first steps of a complete procedure that could be used in routine to detect E. coli O26 in raw milk cheeses. © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.

  17. Prevalence of Listeria monocytogenes in raw milk in North Lebanon

    International Nuclear Information System (INIS)

    Al Kassaa, I; El Omari, Kh.; Esmail, B.; Hamze, M; Saati, M.

    2016-01-01

    Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressedby febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptableto the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France). The results obtained revealed the absence of Listeria monocytogenes inall analyzed samples. (Author)

  18. Evaluation of raw milk quality in three subregions of the department of Sucre, Colombia

    Directory of Open Access Journals (Sweden)

    Alberto Romero P

    2018-03-01

    Full Text Available The objective was to evaluate the physicochemical, microbiological quality, somatic cell count and presence of inhibitors in raw milks in the department of Sucre. 150 samples of raw milk from six storage centers or processing plants from three subregions of the department of Sucre (Sabanas, San Jorge and Gulf of Morrosquillo were taken using a descriptive cross-sectional study. 25 samples in each collection center that correspond to 25 producers from the different subregions of the department were taken. Microbiological and physiochemical parameters and udder health were determined of a total of 50 samples for each subregion. The data obtained were analyzed according to accepted standards in Colombia. For the most part of the physicochemical parameters, were within the accepted values established in decree 616 of 2006 and decree 1880of 2011(protein ≥2.9%, fat ≥3.0%, density (15oC ≥1.030, TS ≥11.30, SNF ≥8.30. The count of colony forming units (CFU/mL in the different subregions was greater than 600,000 CFU/mL. The somatic cell count (SCC/mL was greater than 500,000 SCC/mL. In 8% of the sampled milks showed presence of inhibitors. Overall, the raw milk had good physicochemical quality but, the microbiological quality and health of the udder were poor, which requires immediate implementation of programs in order to obtain high quality hygienic milk.

  19. Contribution of natural milk culture to microbiota, safety and hygiene of raw milk cheese produced in alpine malga

    Directory of Open Access Journals (Sweden)

    Rosaria Lucchini

    2018-04-01

    Full Text Available Processing of alpine milk in malga farms is carried out under conditions that can favor contamination by coliforms, coagulase-positive staphylococci, or pathogens such as Listeria monocytogenes. With the aim to improve the hygienic characteristics and safety of cheese produced in four malga farms the use of lyophilized Natural Milk Culture prepared with selected strains was tested. Two cheesemaking tests were carried out in the same day always starting from the same milk: in the first case following the malga recipe that uses either Natural Whey Culture or without the addition of a starter, in the second one using a Natural Milk Culture. Cheesemaking were carried out in four malga farms located in the west area of Trentino region within the same week. For hygienic and safety evaluation, aerobic colony count, coagulase-positive staphylococci, Escherichia coli, staphylococcal toxins, Listeria monocytogenes , and Salmonella spp, pH and aw were determined in raw milk from evening and morning milking, curd in vat, curd after extraction and two months-ripened cheese. Pathogens or toxins, high values of coagulase- positive staphylococci and E. coli were not found in cheese samples. However, in the curd coagulase-positive staphylococci reached values almost of 5 Log CFU/g in the two malga without starter cultures. The use of Natural Milk Culture reduced E. coli counts. In addition, DNA was extracted from cheese samples and from Natural Milk Culture and the composition of the microbial community determined by Next Generation Sequencing method. The determination of cheese microbial communities demonstrated that the use of Natural Milk Culture exerted different effects in the different malga, in any case preserving bacterial biodiversity.

  20. Influence of Sunflower Whole Seeds or Oil on Ruminal Fermentation, Milk Production, Composition, and Fatty Acid Profile in Lactating Goats.

    Science.gov (United States)

    Morsy, T A; Kholif, S M; Kholif, A E; Matloup, O H; Salem, A Z M; Elella, A Abu

    2015-08-01

    This study aimed to investigate the effect of sunflower seeds, either as whole or as oil, on rumen fermentation, milk production, milk composition and fatty acids profile in dairy goats. Fifteen lactating Damascus goats were divided randomly into three groups (n = 5) fed a basal diet of concentrate feed mixture and fresh Trifolium alexandrinum at 50:50 on dry matter basis (Control) in addition to 50 g/head/d sunflower seeds whole (SS) or 20 mL/head/d sunflower seeds oil (SO) in a complete randomized design. Milk was sampled every two weeks during 90 days of experimental period for chemical analysis and rumen was sampled at 30, 60, and 90 days of the experiment for ruminal pH, volatile fatty acids (tVFA), and ammonia-N determination. Addition of SO decreased (p = 0.017) ruminal pH, whereas SO and SS increased tVFA (pcontent (p = 0.002). Moreover, SO increased milk lactose content (p = 0.048) and feed efficiency (p = 0.046) compared to Control. Both of SS and SO increased (pcontent specially conjugated linolenic acid (CLA) vs Control. Addition of SS and SO increased (p = 0. 021) C18:3N3 fatty acid compared to Control diet. Data suggested that addition of either SS or SO to lactating goats ration had beneficial effects on milk yield and milk composition with enhancing milk content of healthy fatty acids (CLA and omega 3), without detrimental effects on animal performance.

  1. Comparison of heat stability of goat milk subjected to ultra-high temperature and in-container sterilization.

    Science.gov (United States)

    Chen, B Y; Grandison, A S; Lewis, M J

    2012-03-01

    Goat milk with and without stabilizing salt was subjected to in-container and UHT sterilization. Heat stability was assessed by measuring the amount of sediment in the milk. Without stabilizing salts, goat milk usually produced less sediment when subjected to in-container sterilization compared with UHT processing. Addition of stabilizing salts up to 12.8mM resulted in a progressive increase in sediment for in-container sterilization. In contrast, adding stabilizing salts at 6.4mM initially reduced sediment formation in UHT-treated milk but addition of stabilizing salts at 12.8mM increased sediment formation. Adding stabilizing salts to goat milk increased pH, decreased ionic calcium, and increased ethanol stability. Adding up to 2mM calcium chloride increased sediment formation more after UHT treatment than after in-container sterilization. These results suggest that no single mechanism or set of reactions causes milk to produce sediment during heating and that the favored pathway is different for UHT and in-container sterilization processes. Poor heat stability could be induced both by increasing ionic calcium and by decreasing it. Ethanol stability is not a good indicator of heat stability for in-container sterilization, but it may be for UHT sterilization, if milk does not enter the region of poor heat stability found at low concentrations of ionic calcium. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  2. A rumen unprotected conjugated linoleic acid supplement inhibits milk fat synthesis and improves energy balance in lactating goats.

    Science.gov (United States)

    Baldin, M; Gama, M A S; Dresch, R; Harvatine, K J; Oliveira, D E

    2013-07-01

    Feeding trans-10, cis-12 CLA supplements in a rumen-protected form has been shown to cause milk fat depression (MFD) in cows, ewes, and goats. Methyl esters of CLA were shown to be as effective as FFA in inducing MFD when infused postruminally, but their efficacy as a feed supplement has not been addressed in studies with lactating ruminants. In the present study, we investigated the effects of an unprotected trans-10, cis-12 CLA supplement as methyl esters on performance, milk composition, and energy status of dairy goats. Eighteen multiparous Toggenburg goats were randomly assigned to dietary treatments in a crossover experimental design (14 d treatment periods separated by a 7 d washout interval): 30 g/d of calcium salts of fatty acids (Control) or 30 g/d of a rumen unprotected CLA supplement containing 29.9% of trans-10, cis-12 CLA as methyl esters (CLA). Lipid supplements were mixed into a concentrate and fed individually to animals 3 times a day as a total mixed ration component. The DMI, milk yield, milk protein and lactose content and secretion, and somatic cell count were unaffected by CLA treatment. On the other hand, milk fat content and yield were reduced by 19.9 and 17.9% in CLA-fed goats. Reduced milk fat yield in CLA-fed goats was a consequence of a lower secretion of both preformed and de novo synthesized fatty acids. The CLA treatment also changed the milk fatty acid profile, which included a reduction in the concentration of SFA (2.5%), increased MUFA and PUFA (5.6 and 5.4%, respectively), and a pronounced increase (1576%) in milk fat trans-10, cis-12 CLA. Consistent with the high milk fat trans-10, cis-12 CLA content, all desaturase indexes were reduced in milk fat from CLA-fed goats. The MFD induced by CLA reduced the energy required for milk production by 22%, which was accompanied by an improvement in the estimated energy balance (P rumen biohydrogenation and indirect comparisons with data obtained from other studies suggest equivalent MFD

  3. RAW MILK AT VENDING MACHINES: EVALUATION OF E. SAKAZAKII, COXIELLA BURNETII AND M. PARATUBERCULOSIS IN PIEDMONT EXPERIENCE

    Directory of Open Access Journals (Sweden)

    S. Gallina

    2009-12-01

    Full Text Available Italian consumers changed their food habits in the last period; the increase of raw milk consuming is also related to the high number of self service vending machines that have been authorized, particularly in Northern Italy. According to national rules on raw milk hygienic conditions, the most important bacteria are checked by Veterinary Services; the aim of this study was to investigate some emerging or re-emerging hazards in raw milk at vending machines. For this reason 100 raw milk samples were collected and analyzed in order to detect E. sakazakii, Coxiella burnetii and M. avium subsp paratuberculosis. One milk sample resulted to be positive with PCR method for E. sakazakii (no cultural confirmation was possible; 49% of samples resulted posivite for the presence of Coxiella burnetii specific DNA, and 5% of milk samples came out positive to the presence of M. paratuberuclosis antibodies with ELISA methods.

  4. Microelements and heavy metals in raw cow milk from various regions in Serbia

    Directory of Open Access Journals (Sweden)

    Živkov-Baloš Milica

    2013-01-01

    Full Text Available In this study, the investigation results of raw milk and animal feed samples from farms located around industrial areas and from rural areas in Serbia are presented. Various microelements and heavy metals (Zn, Cu, Fe, Pb and Cd were determined by atomic absorption spectrophotometry (AAS. Mean concentration of Zn, Cu, Fe and Cd in raw milk were 5.94, 0.239, 2.034 and below 0.005 mg/kg, respectively. The mean lead concentration found in milk from a farm located near industrial area was 0.242±0.166 mg/kg (mean Pb concentrations for other four investigated farms were below 0.05 mg/kg. The obtained results indicate that particular attention should be paid to control of Pb residues in food, water and environment. [Projekat Ministarstva nauke Republike Srbije, br. TR 31084

  5. Analysis of the Kanamycin in Raw Milk Using the Suspension Array

    Directory of Open Access Journals (Sweden)

    Yanfei Wang

    2013-01-01

    Full Text Available With the monoclonal antibody against kanamycin being prepared successfully, a bead-based indirect competitive fluorescent immunoassay was developed to detect kanamycin in milk. The fact that there was no significant cross-reaction with other aminoglycoside antibiotics implied that the monoclonal antibody was highly specific for kanamycin. The limit of detection (LOD and the 50% inhibition concentration (IC50 in raw milk were 3.2 ng/mL and 52.5 ng/mL, respectively. Using the method developed in this study, the kanamycin concentrations were monitored in raw milk after the intramuscular administration of kanamycin in sick cows. Compared to the conventional enzyme-linked immunosorbent assay (ELISA, the method using the suspension array system was more sensitive. The results obtained in the present study showed a good correlation with that of the ELISA.

  6. Differences in sheep and goats milk microbiological profile between conventional and organic farming systems in Greece.

    Science.gov (United States)

    Malissiova, Eleni; Papadopoulos, Theofilos; Kyriazi, Aikaterini; Mparda, Maria; Sakorafa, Christina; Katsioulis, Antonios; Katsiaflaka, Anna; Kyritsi, Maria; Zdragas, Antonios; Hadjichristodoulou, Christos

    2017-05-01

    The aim of this study was to examine differences in the microbiological profile and antimicrobial resistance of bacteria isolated from milk from organic and conventional sheep and goat farms. Twenty-five organic and 25 conventional sheep and goat farms in the region of Thessaly, Greece participated in this study. A standardised detailed questionnaire was used to describe farming practices. A total of 50 samples were collected and analysed for total viable count (TVC), total coliform count (TCC) and somatic cell count (SCC), while Staphylococcus aureus and Escherichia coli were isolated using standard methods. Isolates were identified at species level by Api-test and Matrix-Assisted Laser Desorption/Ionisation-Time of Flight Mass Spectrometry (MALDI-TOF MS). Susceptibility to a panel of 20 for E. coli and 16 for S. aureus antimicrobials was determined by the agar dilution method. Pulsed Field Gel Electrophoresis (PFGE) was performed for S. aureus and E. coli isolates to determine predominant clones. Lower counts of TVC, TCC and SCC were identified in milk from the organic farms, possibly due to differences in the hygienic farming practices found on those farms. API-tests and MALDI-TOF MS showed no significant differences in the S. aureus and E. coli isolates. Overall, antimicrobial resistance rates were low, while a statistically higher percentage was estimated among strains originating from conventional farms in comparison with organic farms, possibly due to the restriction of antibiotic use in organic farming. PFGE revealed diversity among S. aureus and E. coli populations in both organic and conventional farms indicating circulation of 2-3 main clones changing slightly during their evolution. Consequently, there is evidence that milk from the organic farms presents a better microbiological profile when compared with milk from conventional farms.

  7. Evaluation of goat milk as storage media to preserve viability of human periodontal ligament cells in vitro.

    Science.gov (United States)

    Ulusoy, Ayça Tuba; Kalyoncuoglu, Elif; Kaya, Senay; Cehreli, Zafer Cavit

    2016-08-01

    The purpose of this study was to evaluate the effectiveness of goat milk as a storage media for maintenance of periodontal ligament (PDL) cell viability of avulsed teeth and compare it with commonly used and/or investigated storage media. PDL cells were obtained from the root surface of healthy premolars and were cultured in Eagle's maintenance medium (EMM). Cell cultures were treated with the following storage media: tap water (negative control); EMM (positive control); Hank's balanced salt solution; ultra high temperature (UHT) long-shelf-life lactose-free cow milk; UHT long-shelf-life whole cow milk; UHT long-shelf-life skimmed cow milk; UHT long-shelf-life soy milk; UHT long-shelf-life goat milk, UHT long-shelf-life follow on milk with probiotic, 20% propolis, and egg white. Culture plates were incubated with experimental media at 20°C for 1, 3, 6, 12, and 24 h. PDL cell viability was assessed by tetrazolium salt-based colorimetric (MTT) assay at each test period. One-way anova was used to evaluate the effects of storage solutions at each time point, followed by post hoc Duncan's multiple comparison test (P = 0.05). A dendrogram was constructed to show the arrangement of hierarchical clustering. Goat milk displayed the highest capacity to maintain cell viability at all test intervals (P milk with the probiotic showed the lowest time-dependent PDL cell viability among all test media (P milks, HBSS performed significantly less effectively in maintaining PDL cell viability during the entire test period (P milk can be recommended as a suitable storage medium for avulsed teeth. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. Prevalence of Listeria species in raw milk and traditional dairy products in Isfahan, Iran

    Directory of Open Access Journals (Sweden)

    Ehsan Shamloo

    2015-01-01

    Full Text Available Aim: The study aimed to assess the prevalence of Listeria spp. in raw milk and traditional non-pasteurized dairy products in Isfahan, Iran. Materials and Methods: A total of 292 samples of raw milk and traditional dairy were examined for the presence of Listeria spp. using a two-step selective enrichment recommended by the United States Department of Agriculture. All isolates were subjected to standard biochemical tests. L. monocytogenes strains were further confirmed by polymerase chain reaction (PCR amplification. Results: Of 292 samples, 21 (7.14% and 4 (1.47% were positive for Listeria spp. and pathogenic L. monocytogenes, respectively. The prevalence of Listeria spp. in raw milk, ice cream, cream, and freni were 5.91 (5.49%, 12.63 (19.04%, 3.27 (11.11% and 1.25 (4%, respectively. Listeria was not detected from yogurt, butter, Kashk, and cheese. Listeria innocua at 16.21 (5.44% was the most prevalent species isolated, followed by L. monocytogenes at 4.21 (19% and L. seeligeri at 1.21 (4.7%. All strains of L. monocytogenes identified by biochemical tests were also confirmed by PCR. Conclusion: The study shows the prevalence of L. monocytogenes in raw milk and traditional dairy products sold in the market. Consumption of raw milk with mild heat treatment or its usage in traditional dishes could pose serious health problems due to lack of appropriate control measures. The lack of knowledge on the risks of listeriosis transmission indicates the need for implementation of a food safety education program. In addition, the Iranian food safety authorities should urgently set up an effective standard to screen all susceptible food products for the presence of Listeria.

  9. Antimicrobial activity of Algerian honey on subclinical mastitis pathogens isolated from goat's milk

    Directory of Open Access Journals (Sweden)

    A. Bourabah

    2014-04-01

    Full Text Available Aim: The aim of the present study was to determine the susceptibility of subclinical mastitis pathogens isolated from goat's milk and to evaluate the antimicrobial activity of Algerian honey on mastitis causing bacteria. Materials and Methods: The antibacterial activity against the isolated bacteria was evaluated by determining the Minimal Inhibitory Concentration (MIC, using the agar incorporation method. Results: The results showed that both Micrococcus spp. and Klebsiella spp. were susceptible to Streptomycin and tetracycline, while Pseudomonas aeruginosa, E coli, Enterobacter spp., Bacillus spp., and Coagulase Negative Staphyloccoci (CNS were preferentially susceptible to Streptomycin. However, Streptococcus D was the most resistant to the tested antibiotics whereas Staphylococcus aureus was the most susceptible to all the studied antibiotics. As regards to the antimicrobial activity of honey, the measured values were comprised between 11 and 14%. Conclusion: The results reveal that antimicrobial drugs susceptibility tests in goat subclinical mastitis might be necessary before the treatment. Algerian honey exhibited in vitro antimicrobial activity against different isolated bacteria in goat mastitis.

  10. The effect of raw milk microbial flora on the sensory characteristics of Salers-type cheeses.

    Science.gov (United States)

    Callon, C; Berdagué, J L; Dufour, E; Montel, M C

    2005-11-01

    The sensory characteristics of Salers Protected Denomination of Origin raw-milk cheeses are linked to the biochemical composition of the raw material (milk) and to the resultant microbial community. To evaluate the influence of the microbial community on sensory characteristics, Salers-type cheeses were manufactured with the same pasteurized milk, reinoculated with 3 different microbial communities from 3 different filtrates from microfiltered milks. Each cheese was subjected to microbial counts (on selective media), biochemical tests, and volatile and sensory component analyses at different times of ripening. Adding different microbial communities to specimens of the same (biochemically identical) pasteurized milk lead to different sensory characteristics of the cheeses. Cheeses with fresh cream, hazelnut, and caramel attributes were opposed to those with fermented cream, chemical, and garlic flavors. The aromatic compounds identified (esters, acids, alcohols, and aldehydes) in these cheeses were quite similar. Nevertheless, one milk was distinguished by a higher content of acetoin, and lower 2-butanone and 3-methylpentanone concentrations. Over the production period of 1 mo, the different cheeses were characterized by the same balance of the microbial population assessed by microbial counts on different media. This was associated with the stability of some sensory attributes describing these cheeses. Nevertheless, there was no linear correlation between microbial flora data and sensory characteristics as measured in this study.

  11. Milk Technological Properties as Affected by Including Artichoke By-Products Silages in the Diet of Dairy Goats

    Directory of Open Access Journals (Sweden)

    Raquel Muelas

    2017-12-01

    Full Text Available Traditional farming practices include the use of local agricultural by-products in the diet of ruminants. Artichoke harvesting and transformation yield high amounts of by-products that, if properly used, may reduce farming costs and the environmental impact of farming. The present study tests the inclusion of silages from artichoke by-products (plant and outer bracts in the diet of dairy goats (0%, 12.5% and 25% inclusion on the technological and sensory properties of milk during a five-month study. Milk composition, color, stability, coagulation and fermentation properties remained unaffected by diet changes. Panelists were not able to differentiate among yogurts obtained from those milks by discriminant triangular sensory tests. Silages of artichoke by-products can be included in isoproteic and isoenergetic diets for dairy goats, up to a 25% (feed dry matter, without negatively affecting milk technological and sensory properties whereas reducing feeding costs.

  12. Real Deal or No Deal? A Comparative Analysis of Raw Milk Cheese Regulation in Australia and France

    OpenAIRE

    William van Caenegem; Madeline Elizabeth Taylor

    2017-01-01

    Australia’s regulatory framework has resulted in the standardisation of cheese production based on pasteurisation. Up until early 2015, regulations effectively prohibited raw milk cheese-making in Australia and thus stifled artisanal on-farm production. Although the introduction of Food Standards Australia New Zealand Standard 4.2.4 has allowed the production of certain hard, low-moisture raw milk cheeses, the new standard is rigid and does not encourage new entrants into the emerging raw mil...

  13. The Evaluation of Aflatoxin M1 Level in Collected Raw Milk for Pasteurized Dairy

    Directory of Open Access Journals (Sweden)

    Ehsan Sadeghi

    2013-03-01

    Full Text Available Background: Aflatoxins are fungal toxins that have carcinogenic, cellular mutations and malformation effects. Aflatoxin M1 resists pasteurization, autoclave and the other methods that make foodstuff healthy. This study aims to determine the contents of aflatoxin M1 in raw milk of milk factories in Kermanshah province.Materials and Methods: This research is carried out through the descriptive-cross sectional method. Among the raw milk received by four pasteurized milk factories in Kermanshah, coded by (A, B, C, D labels, six samples, totally 320 samples (80 samples from each factory, were taken within four seasons. The concentration of aflatoxin M1 was examined by Enzyme-Linked Immunosorbent Assay (ELISA. The mean difference was analyzed statistically through t-test using SPSS software. Results: The content of aflatoxin was higher than Codex standard (0.5 µg/l in 295 samples. The total mean was 1.21, which exceeds two times the Codex standard. The highest and lowest contents of aflatoxin M1 were observed in “Factory D” in spring and in “Factory A” in autumn, respectively. There was a significant difference between contamination of aflatoxin M1 and different seasons (p< 0.05.Conclusion: High content of aflatoxin M1 in raw milk is worrying. Measuring the content of aflatoxin M1 is essential to reduce the toxin entering the daily food of animals and the other related factors. The considerable difference of aflatoxin M1 content between Factory D and Factory A can be attributed to the amount of the local milk and the industrial milk received by the factories.

  14. GENETIC POLYMORPHISM OF SOME PROTEINS IN THE MILK OF CARPATHIAN GOAT

    Directory of Open Access Journals (Sweden)

    MIHAELA ZAULET

    2008-05-01

    Full Text Available The paper presents some aspects of the polymorphism of some Carpathian goat milk proteins. The Carpathian breed is the main breed of goats reared in Romania. The optimal working conditions were determined for the identification of the casein phenotypes. The technique of the polyacrylamide gel electrophoresis was used. The milk samples were processed to remove the fat and whey and the migration was done in the presence of a standard sample which contained proteins with different molecular weights. The interpretation of the electrophoresis migrations revealed the presence of two genotypes, the homozygous genotype β-Cn BB and the heterozygous β-Cn AB. The homozygous genotype β-Cn AA was not identified in any individual. The heterozygous genotype β-Cn AB displayed a high frequency (59% and it was observed in 10 individuals. The homozygous genotype β-Cn BB was observed in 7 individuals and it had a frequency of 41%. The homozygous genotype β-Cn AA has not been identified in the studied population. The distribution of these genotypes showed that allele β-CnB was predominant (70% over allele β-can (30%.

  15. Genetic characterization of Shiga toxin-producing Escherichia coli (STEC) and atypical enteropathogenic Escherichia coli (EPEC) isolates from goat's milk and goat farm environment.

    Science.gov (United States)

    Álvarez-Suárez, María-Elena; Otero, Andrés; García-López, María-Luisa; Dahbi, Ghizlane; Blanco, Miguel; Mora, Azucena; Blanco, Jorge; Santos, Jesús A

    2016-11-07

    The aim of this study was to characterize a collection of 44 Shiga toxin-producing (STEC) and enteropathogenic Escherichia coli (EPEC) isolated from goat milk and goat farm environment. Of the 19 STEC isolates, five (26.3%) carried the stx1 gene, four (21.1%) the stx2 gene and 10 (52.6%) presented both stx genes. Six (31.6%) STEC strains were eae-positive and belonged to serotypes related to severe human disease (O157:H7 and O5:HNM). Another seven STEC strains were of serotype O146:H21 and three of serotype O166:H28, also linked to human disease. The STEC strains isolated from goat milk were of serotypes potentially pathogenic for humans. All the 25 EPEC isolates were considered atypical (aEPEC) and one aEPEC strain was of serotype O26:H11, a serotype frequently isolated in children with diarrhea. Multilocus sequence typing (MLST) was carried out with seven housekeeping genes and 23 sequence types (ST) were detected, 14 of them newly described. Twelve STs grouped STEC isolates and 11 STs grouped EPEC isolates. Genetic typing by pulsed field gel electrophoresis (PFGE) resulted in 38 patterns which grouped in 10 clusters. Well-defined groups were also observed for strains of pathogenic serotypes. In conclusion, strains of STEC and aEPEC belonging to serotypes related to severe human disease have been detected in goat milk and the goat farm environment. Ruminants are an important reservoir of STEC strains and the role of these animals as carriers of other pathogenic types of E. coli seems to be an emerging concern. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Prevalence and antimicrobial resistance of Campylobacter species isolated from raw camel, beef, lamb, and goat meat in Iran.

    Science.gov (United States)

    Rahimi, Ebrahim; Ameri, Mehrdad; Kazemeini, Hamid Reza

    2010-04-01

    Campylobacter spp. are one of the most common causes of acute bacterial gastroenteritis in human beings which are transmitted mostly via food originating from animals. This study was conducted to determine the prevalence and antimicrobial resistance of Campylobacter spp. isolated from retail raw meats in Iran. From June 2008 to June 2009, a total of 722 raw meat samples from camel (n = 107), beef (n = 190), lamb (n = 225), and goat (n = 180) were purchased from randomly selected retail outlets in Isfahan and Yazd, Iran, and were evaluated for the presence of Campylobacter spp. In this study, 50 of the 722 meat samples (6.9%) were contaminated with Campylobacter spp. The highest prevalence of Campylobacter spp. was found in lamb meat (12.0%), followed by goat meat (9.4%), beef meat (2.4%), and camel meat (0.9%). The most prevalent Campylobacter spp. isolated from the meat samples was Campylobacter jejuni (84.0%); the remaining isolates were Campylobacter coli (16.0%). Susceptibilities of 50 Campylobacter isolates were determined for 10 antimicrobial drugs using the disk-diffusion assay. Resistance to tetracycline was the most common finding (68.0%), followed by resistance to ciprofloxacin (46.0%) and nalidixic acid (40.0%). All of the isolates were susceptible to erythromycin, gentamicin, and chloramphenicol. Significantly higher prevalence rates of Campylobacter spp. (p meat samples taken in spring (20.0%) and summer (18.9%). To our knowledge, this study is the first report of the isolation of Campylobacter spp. from raw camel, lamb, and goat meat in Iran.

  17. Replacement of raw soybean with roasted soybean increased milk production in Holstein cows

    Directory of Open Access Journals (Sweden)

    Gilson Sebastião Dias Júnior

    Full Text Available ABSTRACT: The aim of this study was to evaluate the effect of total replacement of raw whole soybean (RAW for roastedwhole soybean (ROS on the production performance of Holstein cows. Two experiments were carried out usinga simple reversal design where RAW has been completely replaced by ROS. In experiment 1, 22 cows (175±60 days in milkwere used, and the dietary inclusion level of RAW or ROS was 3.7% of dry matter (DM. In experiment 2, 16 cows (130±50 days in milkwere used, and thedietary inclusion level of RAW or ROS was 11% of DM. In both experiments, ROS increased milk production by 1.1kgday-1 without changing fat and protein production. Dry matter intake or milk urea nitrogenwere not affected by dietary soy source. In experiment 2, plasma glucose concentration was decreased, and allantoin/creatinine ratio in urine tended to decreasein ROS. Experiment 2 also evaluated the nutrient digestibility and ruminal degradation kinetics of crude protein in two soybean sources. Roasting had no effect on the digestibility of DM, organic matter, and neutral detergent fiber. Roasted whole soybean hadgreater fraction B and lower protein degradation rate than did RAW; this showed that heat treatment was effective in increasing therumen undegradable amino acid flowto the animal, which suggesteda potential mechanism of action for improved performance observed in ROS.

  18. Genetic Variation and Population Structure in Jamunapari Goats Using Microsatellites, Mitochondrial DNA, and Milk Protein Genes

    Science.gov (United States)

    Rout, P. K.; Thangraj, K.; Mandal, A.; Roy, R.

    2012-01-01

    Jamunapari, a dairy goat breed of India, has been gradually declining in numbers in its home tract over the years. We have analysed genetic variation and population history in Jamunapari goats based on 17 microsatellite loci, 2 milk protein loci, mitochondrial hypervariable region I (HVRI) sequencing, and three Y-chromosomal gene sequencing. We used the mitochondrial DNA (mtDNA) mismatch distribution, microsatellite data, and bottleneck tests to infer the population history and demography. The mean number of alleles per locus was 9.0 indicating that the allelic variation was high in all the loci and the mean heterozygosity was 0.769 at nuclear loci. Although the population size is smaller than 8,000 individuals, the amount of variability both in terms of allelic richness and gene diversity was high in all the microsatellite loci except ILST 005. The gene diversity and effective number of alleles at milk protein loci were higher than the 10 other Indian goat breeds that they were compared to. Mismatch analysis was carried out and the analysis revealed that the population curve was unimodal indicating the expansion of population. The genetic diversity of Y-chromosome genes was low in the present study. The observed mean M ratio in the population was above the critical significance value (Mc) and close to one indicating that it has maintained a slowly changing population size. The mode-shift test did not detect any distortion of allele frequency and the heterozygosity excess method showed that there was no significant departure from mutation-drift equilibrium detected in the population. However, the effects of genetic bottlenecks were observed in some loci due to decreased heterozygosity and lower level of M ratio. There were two observed genetic subdivisions in the population supporting the observations of farmers in different areas. This base line information on genetic diversity, bottleneck analysis, and mismatch analysis was obtained to assist the conservation

  19. Effect of Modified Pre-Milking Sanitizing Approaches on Raw Milk Quality Obtained from the Dairy Farmers of Tawau Area, Sabah

    Directory of Open Access Journals (Sweden)

    Sim Kheng Yuen

    2016-01-01

    Full Text Available The aim of the study was to investigate the raw milk hygiene and quality among the small holder dairy farmers in Tawau area. A total of 216 samples were collected from the respective dairy farmers and milk collecting centre located at Mile 15, Tawau. Preliminary results indicated that the quality of the raw milks obtained at farm level contained were inferior with high bacteria load (> than 107 CFU/ml. The total coliform (2.9-3.8 CFU/mL and Staphylococcus count (2.3-3.6 CFU/mL were relatively high in certain samples. However, none of the food borne pathogens was found. Trace back study revealed that the causes of contamination were attributed by poor hygienic handling among the dairy farmers and insufficient for immediate chilling of raw milk. A significant reduction in bacteria load was observed if the raw milk chilled immediately at farm. The implementation of modified pre-milking sanitizing practices improved the microbiology quality of the raw milks obtained from respective dairy farms. Future study will focus more on the effect of prolong storage towards the microbiological quality of raw milk.

  20. Identification of goat milk powder by manufacturer using multiple chemical parameters.

    Science.gov (United States)

    McLeod, Rebecca J; Prosser, Colin G; Wakefield, Joshua W

    2016-02-01

    Concentrations of multiple elements and ratios of stable isotopes of carbon and nitrogen were measured and combined to create a chemical fingerprint of production batches of goat whole milk powder (WMP) produced by different manufacturers. Our objectives were to determine whether or not differences exist in the chemical fingerprint among samples of goat WMP produced at different sites, and assess temporal changes in the chemical fingerprint in product manufactured at one site. In total, 58 samples of goat WMP were analyzed by inductively coupled plasma-mass spectrometry as well as isotope ratio mass spectrometry and a suite of 13 elements (Li, Na, Mg, K, Ca, Mn, Cu, Zn, Rb, Sr, Mo, Cs, and Ba), δ(13)C, and δ(15)N selected to create the chemical fingerprint. Differences in the chemical fingerprint of samples between sites and over time were assessed using principal components analysis and canonical analysis of principal coordinates. Differences in the chemical fingerprints of samples between production sites provided a classification success rate (leave-one-out classification) of 98.1%, providing a basis for using the approach to test the authenticity of product manufactured at a site. Within one site, the chemical fingerprint of samples produced at the beginning of the production season differed from those produced in the middle and late season, driven predominantly by lower concentrations of Na, Mg, K, Mn, and Rb, and higher concentrations of Ba and Cu. This observed temporal variability highlights the importance of obtaining samples from throughout the season to ensure a representative chemical fingerprint is obtained for goat WMP from a single manufacturing site. The reconstitution and spray drying of samples from one manufacturer by the other manufacturer enabled the relative influence of the manufacturing process on the chemical fingerprint to be examined. It was found that such reprocessing altered the chemical fingerprint, although the degree of alteration

  1. The effects of first gestation and lactation on bone metabolism in dairy goats and milk sheep.

    Science.gov (United States)

    Liesegang, A; Risteli, J; Wanner, M

    2006-06-01

    The goal of the present study was to compare mobilization rate of calcium (Ca) from bone in pregnant and lactating goats and sheep. Blood samples were collected from goats and sheep monthly during pregnancy and at 1, 2, and 4 weeks postpartum (pp) and monthly during lactation until 6 months after parturition. Total bone mineral content (BMC) and total bone mineral density (BMD) were quantified using peripheral quantitative computed tomography at the same intervals as the blood was taken. Bone resorption was assessed by immunoassays quantitating two epitopes of the carboxyterminal telopeptide of type I collagen (ICTP, CTX). Bone formation was estimated by quantifying serum osteocalcin (OC) and bone-specific alkaline phosphatase (bAP). In addition, Ca and 1,25-dihydroxy vitamin D (1,25-VITD) concentrations were determined in serum. Mean ICTP and CTX concentrations of both animal species increased the first week after parturition. By the second week pp, the concentrations of both markers had decreased toward early gestation levels. In contrast, mean OC concentrations continually decreased until the 1st week pp. By the 2nd week pp, the mean concentrations of OC started to increase again. Mean bAP activities decreased during gestation and reached a nadir in the first week pp in goats and 4 weeks pp in sheep. Afterwards, mean bAP activities increased again in goats and sheep. 1,25-VITD concentrations peaked the first week pp and returned to early gestation values thereafter. Total BMC and BMD decreased from the 4th month of pregnancy until the 1st week pp in both species. Afterwards, BMC increased throughout the first month pp in goats and the first 3 months pp in sheep. BMD levels of sheep and goats returned to prepartum levels during lactation. The resorptive phase of bone remodeling is accelerated at parturition and in early lactation and is uncoupled from the process of bone formation. This allows the animal to achieve Ca homeostasis at the expense of bone. Increased

  2. Occurrence of Listeria monocytogens in raw milk of ruminants in Basrah province

    Directory of Open Access Journals (Sweden)

    B. A. Abbas

    2012-01-01

    Full Text Available The present study was performed on three hundred raw milk samples, 100 each from cows, sheep and buffaloes were collected from different places of Basrah city. 7.3 % of the samples were found to be positive for Listeria spp. Cow's milk was found to be more infected than other animals milk with this bacteria. All bacterial isolates were confirmed as L. monocytogens by colony characteristics, beta haemolysis, cold enrichment procedure, selective media, Anton test, tumbling and inverted pine tree motility and sugar fermentation tests. Most isolates were found to be sensitive to cefotaxine, sulfamethoxazol, chloramphenical and tobramycin. rifampicin was found to have less effect on these isolates. Effects of pH and temperature on bacterial growth were also studied to test the ability of this microorganism to survive in milk under severe conditions. The pH range for growth was from 4 to 9.5. The temperature range was between 4 – 45 ºC.

  3. Effects of pistachio by-products on digestibility, milk production, milk fatty acid profile and blood metabolites in Saanen dairy goats.

    Science.gov (United States)

    Sedighi-Vesagh, R; Naserian, A A; Ghaffari, M H; Petit, H V

    2015-08-01

    The objective of this study was to investigate the effects of pistachio by-products (PBP) on nutrient digestibility, blood metabolites and milk fatty acid (FA) profile in Saanen dairy goats. Nine multiparous lactating Saanen goats (on day 90 post-partum, 45 ± 2/kg BW) were randomly assigned to a 3 × 3 Latin square design with three treatment diets: 1) control diet (alfalfa hay based), 2) 32% PBP and 3) 32% PBP + polyethylene glycol (PEG-4000; 1 g/kg dry matter). Each period lasted 21 days, including 14 day for treatment adaptation and 7 day for data collection. Pistachio by-products significantly decreased (p < 0.01) crude protein (CP) digestibility compared with the control diet (64.4% vs. 58.7%), but PEG addition did not differ for CP digestibility of goats fed 32% PBP + PEG and those fed the two other diets. The digestibility of NDF tended (p = 0.06) to decrease for goats fed PBP compared with those fed the control diet. Yields of milk and 4% fat-corrected milk were not affected by dietary treatments. Compared with the control diet, PBP supplementation appreciably changed the proportions of almost all the milk FA measured; the main effects were decreases (p < 0.01) in FA from 8:0 to 16:0 and increases (p < 0.01) proportions of cis-9, trans-11 18:2 and trans-11 18:1, monounsaturated FA, polyunsaturated FA and long-chain FA. The saturated FA, short-chain FA and medium-chain FA proportions were lower (p < 0.01) in goats fed the two PBP supplemented diet than in those fed the control diet and PEG addition led to intermediate proportions of saturated FA, unsaturated and monounsaturated FA. Inclusion of PBP in the diet decreased (p < 0.01) plasma concentrations of glucose and urea nitrogen compared with the control diet. It was concluded that PBP can be used as forage in the diet of dairy goats without interfering with milk yield. Inclusion of 32% PBP in the diet of dairy goats had beneficial effects on milk FA profile but PEG addition to PBP

  4. Quality and fatty acid profile of the milk of indigenous goats subjected to different local diets in Tunisian arid lands.

    Science.gov (United States)

    Ayeb, N; Addis, M; Fiori, M; Khorchani, S; Atigui, M; Khorchani, T

    2016-02-01

    The study tested the hypothesis that certain pastoral forages and olive by-products, available in arid areas, may positively influence fatty acid composition and physicochemical properties of goat's milk. Thirty indigenous goats (body weight = 25.2 kg; age = 4.1 years) were allocated to three groups. During 60 days, the goats received ad libitum either dried olive leaves + Stipa tenacissima (group OL), khortane grass hay (group Ko) or oat hay (control diet, group OH). Milk samples were collected and analysed for total solids, fat, protein, lactose and ash content and fatty acid profile. Average milk yield did not statistically differ among groups. Milk total solids from OL group were higher in comparison with Ko and C groups (15.3, 14.7 and 14.5%, respectively; p < 0.05). Fat content was also higher for the OL group as compared to the other groups (5.44 vs. 5.01 and 4.66%, respectively, for Ko and OH). No significant differences were observed for the milk content of lactose, protein and ash. The percentage of saturated fatty acids of total milk fat was higher in OL and Ko groups compared to the C group (p < 0.001); the milk whereof was characterized by the highest percentage of monounsaturated (p < 0.01) and total unsaturated fatty acids. Milk fat of Ko and C groups showed significantly higher proportions of rumenic (CLA cis-9 trans-11) and vaccenic acids (C18:1 trans-11) compared to OL milk. The feeding system based on Stipa tenacissima and dried olive leaves resulted in the milk lowest proportion of trans-fatty acids and the highest proportion of polyunsaturated ω3-fatty acids (p < 0.05). Journal of Animal Physiology and Animal Nutrition © 2015 Blackwell Verlag GmbH.

  5. QUALITY AND SAFETY OF RAW COW’S MILK IN SLOVAKIA IN 2011

    Directory of Open Access Journals (Sweden)

    Jozef Čurlej

    2012-04-01

    Full Text Available The quality and safety of raw cow’s milk is very important for dairy companies and consumers of milk products. Due to the methods of production, it is impossible to completely eliminate contamination of milk with microorganisms, therefore the microbial content of milk is a major feature in determining its quality. Other important factors to consider include somatic cells count, veterinary drug residues, milk composition and freezing point. Somatic cells represent the udder health and can be used for monitoring of subclinical mastitis. A high level of somatic cells can increase proteolysis in milk which affects technological processes. Veterinary drugs administered to cows may lead to residues in the milk which are harmful to humans. The content of fat, protein and solids-non-fat are the main indicators used by dairies for technological purposes. In this article we discuss the quality and safety of raw cow’s milk in Slovakia during 2011. We found that 73.53% of samples tested for somatic cell count, and 84.54% of samples tested for total bacterial count, met the European Union legislation limits. We found the largest decrease in fat and protein content was during the summer period and the largest increase was in the winter period. We found that 92.14 %, 98.7% and 91.38% of samples met the limit presented in STN 570529:1999 for fat content, protein content and freezing point respectively. The percentage of drug positive samples was 0.087%.doi:10.5219/189

  6. Comparison of the acidifying activity of Lactococcus lactis subsp. lactis strains isolated from goat's milk and Valdeteja cheese.

    Science.gov (United States)

    Alonso-Calleja, C; Carballo, J; Capita, R; Bernardo, A; García-López, M L

    2002-01-01

    This work was carried out to study the acid production by Lactococcus lactis subsp. lactis strains isolated from goat's milk and goat cheese (Valdeteja variety) in order to select a suitable starter culture for industrial goat cheese manufacturing. The titrable acidity of 45 Lactococcus lactis subsp. lactis strains isolated from a home-made batch of Valdeteja cheese with excellent sensory characteristics was measured over a period of 18 h. The strains were divided into two groups depending on the acid production rate: 20 fast acid producer (F) strains and 25 slow acid producer (S) strains. The kinetic parameters (lag phase, maximum acid production rate and value of upper asymptote curve) of the acid production curves for F and S strains were significantly (P titrable acidity of F and S strains were observed after the second hour of incubation. An F strain acetoin producer (Lactococcus lactis subsp. lactis 470Ch2) was selected as autochthonous starter culture for industrial Valdeteja goat cheese manufacturing.

  7. Characteristics and fatty acid composition of milk fat from Saudi Aradi goat

    Directory of Open Access Journals (Sweden)

    Sbihi, H. M.

    2015-12-01

    Full Text Available Goat milk is the second most prevalent edible milk in Saudi Arabia and is one of the most prominently produced milks in the world. Few studies have focused on the physicochemical properties of goat milk fat (GMF. Samples of Saudi Aradi goat milk were obtained during the spring dairy season to determine the physicochemical characteristics and fatty acid composition of the GMF. The physicochemical properties of Saudi Aradi GMF were as follows: iodine value, 23.2 g of I2·100 g−1 of fat; saponification value, 213.2 mg KOH·g−1 of fat; refractive index (25 °C, 1.4583; unsaponifiable matter, 0.54%; acidity, 0.52%; and peroxide value, 2.07 meq O2·kg−1 of fat. α-Tocopherol was the major tocol (70.9%, followed by β-tocopherol (22.02%. GMF had significant contents of polyunsaturated fatty acid (FA (6.16%, conjugated linolenic acid (0.36%, saturated FA (67.04% and branched FA (1.98%. The thermal profiles of the Saudi Aradi GMF samples were examined using a thermal gravimetric analysis (TGA and differential scanning calorimetry (DSC. Saudi Aradi GMF showed some absorbance in the UV-C range. This study demonstrated that the milk fat from the Saudi goat has physically and chemically favorable properties, as well as good nutritional properties, as a source of essential fatty acids and fat-soluble vitamin E.La leche de cabra es la segunda leche comestible predominante en Arabia Saudí y es una de las leches de mayor producción en el mundo. Pocos estudios se han centrado en las propiedades físico-químicas de la grasa de leche de cabra (GLC. Muestras de leche de cabra Arabia Saudí fueron obtenidas durante la temporada de mayor producción lechera, durante la primavera, y se determinaron sus características físico- químicas y la composición de ácidos grasos de la GLC. Las propiedades fisicoquímicas determinadas de la GLC de Arabia Aradi fueron las siguientes: índice de yodo, 23,2 g de I2·100 g−1 de grasa; índice de saponificación: 213

  8. β-Galactosidase activity of commercial lactase samples in raw and pasteurized milk at refrigerated temperatures.

    Science.gov (United States)

    Horner, T W; Dunn, M L; Eggett, D L; Ogden, L V

    2011-07-01

    Many consumers are unable to enjoy the benefits of milk due to lactose intolerance. Lactose-free milk is available but at about 2 times the cost of regular milk or greater, it may be difficult for consumers to afford. The high cost of lactose-free milk is due in part to the added cost of the lactose hydrolysis process. Hydrolysis at refrigerated temperatures, possibly in the bulk tank or package, could increase the flexibility of the process and potentially reduce the cost. A rapid β-galactosidase assay was used to determine the relative activity of commercially available lactase samples at different temperatures. Four enzymes exhibited low-temperature activity and were added to refrigerated raw and pasteurized milk at various concentrations and allowed to react for various lengths of time. The degree of lactose hydrolysis by each of the enzymes as a function of time and enzyme concentration was determined by HPLC. The 2 most active enzymes, as determined by the β-galactosidase assay, hydrolyzed over 98% of the lactose in 24h at 2°C using the supplier's recommended dosage. The other 2 enzymes hydrolyzed over 95% of the lactose in 24h at twice the supplier's recommended dosage at 2°C. Results were consistent in all milk types tested. The results show that it is feasible to hydrolyze lactose during refrigerated storage of milk using currently available enzymes. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  9. The microbial content of raw and pasteurized cow milk as determined by molecular approaches.

    Science.gov (United States)

    Quigley, Lisa; McCarthy, Robert; O'Sullivan, Orla; Beresford, Tom P; Fitzgerald, Gerald F; Ross, R Paul; Stanton, Catherine; Cotter, Paul D

    2013-08-01

    The microbial composition of raw and pasteurized milk is assessed on a daily basis. However, many such tests are culture-dependent, and, thus, bacteria that are present at subdominant levels, or that cannot be easily grown in the laboratory, may be overlooked. To address this potential bias, we have used several culture-independent techniques, including flow cytometry, real-time quantitative PCR, and high-throughput DNA sequencing, to assess the microbial population of milk from a selection of commercial milk producers, pre- and postpasteurization. The combination of techniques employed reveals the presence of a previously unrecognized and diverse bacterial population in unpasteurized cow milk. Most notably, the use of high-throughput DNA sequencing resulted in several bacterial genera being identified in milk samples for the first time. These included Bacteroides, Faecalibacterium, Prevotella, and Catenibacterium. Our culture-independent analyses also indicate that the bacterial population of pasteurized milk is more diverse than previously appreciated, and that nonthermoduric bacteria within these populations are likely to be in a damaged, nonculturable form. It is thus apparent that the application of state-of-the-art approaches can provide a detailed insight into the bacterial composition of milk and could potentially be employed in the future to investigate the factors that influence the composition of these populations. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  10. Examining trust factors in online food risk information: The case of unpasteurized or 'raw' milk.

    Science.gov (United States)

    Sillence, Elizabeth; Hardy, Claire; Medeiros, Lydia C; LeJeune, Jeffrey T

    2016-04-01

    The internet has become an increasingly important way of communicating with consumers about food risk information. However, relatively little is known about how consumers evaluate and come to trust the information they encounter online. Using the example of unpasteurized or raw milk this paper presents two studies exploring the trust factors associated with online information about the risks and benefits of raw milk consumption. In the first study, eye-tracking data was collected from 33 pasteurised milk consumers whilst they viewed six different milk related websites. A descriptive analysis of the eye-tracking data was conducted to explore viewing patterns. Reports revealed the importance of images as a way of capturing initial attention and foregrounding other features and highlighted the significance of introductory text within a homepage. In the second, qualitative study, 41 consumers, some of whom drank raw milk, viewed a selection of milk related websites before participating in either a group discussion or interview. Seventeen of the participants also took part in a follow up telephone interview 2 weeks later. The qualitative data supports the importance of good design whilst noting that balance, authorship agenda, the nature of evidence and personal relevance were also key factors affecting consumers trust judgements. The results of both studies provide support for a staged approach to online trust in which consumers engage in a more rapid, heuristic assessment of a site before moving on to a more in-depth evaluation of the information available. Findings are discussed in relation to the development of trustworthy online food safety resources. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Iodine in raw and pasteurized milk of dairy cows fed different amounts of potassium iodide.

    Science.gov (United States)

    Norouzian, M A

    2011-02-01

    Relation between iodine (I) intake by lactating Holstein cows and iodine concentrations in raw and pasteurized milk were investigated. Four treatment groups with eight cows assigned to each treatment were fed a basal diet containing 0.534 mg I/kg alone or supplemented with potassium iodide at 2.5, 5 or 7.5 mg/kg in 7-week period. Iodine concentrations in raw milk increased with each increase in dietary I from 162.2 ng/ml for basal diet to 534.5, 559.8 and 607.5 ng/ml when 2.5, 5 and 7.5 mg/kg was fed as potassium iodide (P HTST) pasteurization process reduced I concentration. The mean iodine content found in the milk prior to heating processing was 466.0 ± 205.0 ng/ml, whereas for the processed milk this level was 349.5 ± 172.8 ng/ml. It was concluded that iodine supplementation above of NRC recommendation (0.5 mg/kg diet DM) resulted in significant increases in iodine concentrations in milk, although the effect of heating in HTST pasteurization process on iodine concentration was not negligible.

  12. Aflatoxin M1 contamination of raw and pasteurized milk produced in Sanandaj, Iran

    Directory of Open Access Journals (Sweden)

    Mafakheri, Sh.

    2010-07-01

    Full Text Available This study was conducted to evaluate and compare the levels of aflatoxin M1 in raw and pasteurized milk samples during different seasons by Enzyme- Linked Immuno Sorbent Assay in Sanandaj, Iran. In 257 (94.49% out of 272 milk samples the presence of aflatoxin M1 was detected in concentrations ranging between 0.007 and 115.930 ng/l. AFM1 level in 12 (4.4% of positive samples were higher than the maximum tolerance limit (50 ng/l accepted by Iran and European Union countries. Statistical evaluations showed that the differences between raw and pasteurized samples were not significant (p<0.05. There was no significant difference between spring and summer but the differences between other seasons were statistically significant. Winter samples with 22.35 ng/l and summer samples with 5.14 ng/l had the highest and lowest concentration, respectively (p<0.05. Since contamination of milk with aflatoxin is a potential risk for human health, milk and milk products should be controlled periodically for Aflatoxin contamination.

  13. Microbiological quality and antibiotic residues in informally marketed raw cow milk within the coastal savannah zone of Ghana.

    Science.gov (United States)

    Addo, K K; Mensah, G I; Aning, K G; Nartey, N; Nipah, G K; Bonsu, C; Akyeh, M L; Smits, H L

    2011-02-01

    To investigate the microbiological quality and the presence of antibiotic residues in raw cow milk and in some indigenous milk products produced and marketed by the informal sector in the coastal savannah zone of Ghana. Milk samples were aseptically collected from 224 kraals and samples of 26 indigenous milk products were purchased from processors and retailers. Total plate counts, total coliform counts and the presence of Escherichia coli and E. coli O157:H7 were determined in all 250 samples. Milk samples were also tested for antibiotic residues. Total plate counts exceeded 10⁵ CFU/ml in 45.2% of the samples while coliforms exceeded 10³ CFU/ml in 66.0% and E. coli was detected in 11.2%. E. coli was present in raw cow milk but not in the indigenous products and all E. coli isolates were negative for E. coli O157:H7. Antibiotic residues were detected in 3.1% of the raw cow milk samples. Bulk milk contains unacceptable levels of hygiene indicators and antibiotic residues and is a potential source of milk-borne infections. The detection of E. coli and antibiotic residues raises public health concerns about the safety of fresh unpasteurized cow milk in the coastal savannah zone of Ghana and calls for improved farm hygiene, the need for milk pasteurization and the sensible use of antibiotics in the milk industry. © 2010 Blackwell Publishing Ltd.

  14. Bacteriological quality of raw camel milk along the market value chain in Fafen zone, Ethiopian Somali regional state.

    Science.gov (United States)

    Abera, Tsegalem; Legesse, Yoseph; Mummed, Behar; Urga, Befekadu

    2016-05-26

    The camel is a multipurpose animal with a huge productive potential. Camel milk is a key food in arid and semi-arid areas of the African and Asian countries. The quality of milk is influenced by different bacteria present in milk. This study was conducted to evaluate total bacterial content in raw camel milk along the market chain in Fafen zone, Ethiopian Somali Regional State. One hundred twenty-six raw camel milk samples were collected from Gursum (47.1 %) and Babile (52.9 %) districts. The three sampling levels included were udder (14.7 %), milking bucket (29.4 %) and market (55.9 %). Milk samples were analyzed for total bacterial counts (TBC) and coliform counts (CC). Furthermore, major pathogens were isolated and identified. 108 (85.7 %) of raw camel milk samples demonstrated bacterial contamination. The overall mean TBC and CC of contaminated raw camel milk samples was 4.75 ± 0.17 and 4.03 ± 0.26 log CFU/ml, respectively. TBC increased from udder to market level and was higher in Gursum compared to Babile district (P < 0.05). Around 38.9 % of TBCs and 88.2 % CCs in contaminated raw camel milk samples were in the range considered unsafe for human utility. Staphylococcus spp. (89.8 %), Streptococcus spp. (53.7 %), E. coli (31.5 %), Salmonella spp. (17.6 %), Klebsiella spp. (5.6 %) and Enterobacter spp. (5.6 %) were the major bacterial microorganisms isolated. The majority of the bacterial isolates in this study showed high incidence in market as compared to production level. These results indicate a lack of compliance with good production practices and hygiene at milking, transportation and market of raw camel milk.

  15. High-throughput metataxonomic characterization of the raw milk microbiota identifies changes reflecting lactation stage and storage conditions.

    Science.gov (United States)

    Doyle, Conor J; Gleeson, David; O'Toole, Paul W; Cotter, Paul D

    2017-08-16

    Low temperature is used to control the growth of bacteria in milk, both pre- and post-pasteurization. As the duration of refrigerated storage extends, psychrotrophs dominate the milk microbiota, that can produce heat stable lipases which negatively impact the organoleptic qualities of milk. Here we examine the influence that refrigeration temperature (2°C, 4°C and 6°C) and storage duration (96h) have on the microbiota composition (16S profiling) of raw bulk tank milk (BTM). To reflect a proposed change to current farming practices, raw milk was blended after each milking (8 milkings) and stored for five consecutive days in each temperature-specific tank. Here 16S rRNA-based microbiota compositional analysis was performed after milk was collected on day 1 and again after the final addition of milk at day 5. In addition to assessing the impact of the duration and temperature of storage, the influence of lactation stage, i.e. mid- versus late-lactation, on the microbiota of the blended BTM was also examined. Overall, both temperature and length of storage had surprisingly little influence on the raw milk microbiota, other than an increase in proportions of Gammaproteobacteria in the blended milk samples collected after pooling on day 5, and in samples stored at 6°C. However, lactation stage had a considerable influence on microbiota composition, with milk from mid-lactation containing higher proportions of Bacteroides, Faecalibacterium, Campylobacter and Rhodanobacter, and late-lactation milk containing higher proportions of Actinobacteria. Overall, the study demonstrates that current temperature and storage duration practises impact the microbiota of raw milk, but these impacts are modest relative to the more considerable differences between mid and late-lactation milk. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Real Deal or No Deal? A Comparative Analysis of Raw Milk Cheese Regulation in Australia and France

    Directory of Open Access Journals (Sweden)

    William van Caenegem

    2017-04-01

    cheeses, the new standard is rigid and does not encourage new entrants into the emerging raw milk cheese consumer market. This article compares the Australian system with the French raw milk cheese regulation and production system, and argues that its approach in encouraging and supporting small farmhouse artisanal traditional raw milk cheese is beneficial to both producer and consumer, and has not resulted in any significant health risks. The Australian approach amounts to a missed opportunity to encourage the emergence of a value-added industry with local and export potential, and is at odds with important movements in food policy, such as recognition of the value of localism and terroir.

  17. Bioaccessible peptides released by in vitro gastrointestinal digestion of fermented goat milks.

    Science.gov (United States)

    Moreno-Montoro, Miriam; Jauregi, Paula; Navarro-Alarcón, Miguel; Olalla-Herrera, Manuel; Giménez-Martínez, Rafael; Amigo, Lourdes; Miralles, Beatriz

    2018-06-01

    In this study, ultrafiltered goat milks fermented with the classical starter bacteria Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus salivarus subsp. thermophilus or with the classical starter plus the Lactobacillus plantarum C4 probiotic strain were analyzed using ultra-high performance liquid chromatography-quadrupole-time-of-flight tandem mass spectrometry (UPLC-Q-TOF-MS/MS) and/or high performance liquid chromatography-ion trap (HPLC-IT-MS/MS). Partial overlapping of the identified sequences with regard to fermentation culture was observed. Evaluation of the cleavage specificity suggested a lower proteolytic activity of the probiotic strain. Some of the potentially identified peptides had been previously reported as angiotensin-converting enzyme (ACE) inhibitory, antioxidant, and antibacterial and might account for the in vitro activity previously reported for these fermented milks. Simulated digestion of the products was conducted in the presence of a dialysis membrane to retrieve the bioaccessible peptide fraction. Some sequences with reported physiological activity resisted digestion but were found in the non-dialyzable fraction. However, new forms released by digestion, such as the antioxidant α s1 -casein 144 YFYPQL 149 , the antihypertensive α s2 -casein 90 YQKFPQY 96 , and the antibacterial α s2 -casein 165 LKKISQ 170 , were found in the dialyzable fraction of both fermented milks. Moreover, in the fermented milk including the probiotic strain, the k-casein dipeptidyl peptidase IV inhibitor (DPP-IV) 51 INNQFLPYPY 60 as well as additional ACE inhibitory or antioxidant sequences could be identified. With the aim of anticipating further biological outcomes, quantitative structure activity relationship (QSAR) analysis was applied to the bioaccessible fragments and led to potential ACE inhibitory sequences being proposed. Graphical abstract Ultrafiltered goat milks were fermented with the classical starter bacteria (St) and with St plus the

  18. On-line monitoring of milk electrical conductivity by fuzzy logic technology to characterise health status in dairy goats

    Directory of Open Access Journals (Sweden)

    Mauro Zaninelli

    2014-04-01

    Full Text Available Intramammary infection affects the quality and quantity of dairy goat milk. Health status (HS and milk quality can be monitored by electrical conductivity (EC. The aim of the study was to determine the detection potential of EC when measured on-line on a daily basis and compared with readings from previous milkings. Milk yields (MYs were investigated with the same approach. To evaluate these relative traits, a multivariate model based on fuzzy logic technology – which provided interesting results in cows – was used. Two foremilk samples from 8 healthy Saanen goats were measured daily over the course of six months. Bacteriological tests and somatic cells counts were used to define the HS. On-line EC measurements for each gland and MYs were also considered. Predicted deviations of EC and MY were calculated using a moving-average model and entered in the fuzzy logic model. The reported accuracy has a sensitivity of 81% and a specificity of 69%. Conclusions show that fuzzy logic is an interesting approach for dairy goats, since it offered better accuracy than other methods previously published. Nevertheless, specificity was lower than in dairy cows, probably due to the lack of a significant decrease of MY in diseased glands. Still, results show that the detection of the HS characteristics with EC is improved, when measured on-line, daily and compared with the readings from previous milkings.

  19. Seasonal dynamics of endoparasitic infections at an organic goat farm and the impact of detected infections on milk production.

    Science.gov (United States)

    Kyriánová, Iveta A; Vadlejch, Jaroslav; Kopecký, Oldřich; Langrová, Iva

    2017-11-01

    This study evaluated patterns and species composition of parasitic infections detected over a 1-year period at an organic goat farm. As a result of coprological examination, the overall prevalence of observed strongylids (99%), coccidia of the genus Eimeria (98%), and Muellerius capillaris lungworms (93%) was calculated. The most prevalent strongylids recovered from incubated fecal samples were Haemonchus contortus (42%), genera Trichostrongylus (23%), Oesophagostomum columbianum (13%), and Teladorsagia circumcincta (11%). A maximum intensity of coccidia infection 5150 oocysts per gram, strongylids infection 9900 eggs per gram and lungworm infection 867.26 larvae per gram were detected. The various effects (including environment, host, and parasites) on milk yield, lactose, protein, and fat were evaluated using generalized linear mixed models. Milk yield (P goat. With the intensity of infection detected in our study, only protein content was affected (P goat itself can substantially decrease protein content but has much less of an effect on fat, milk yield, and lactose. Based on our results, we can conclude that a low intensity of parasitic infections does not significantly affect milk yield and the qualitative parameters of milk.

  20. Molecular characterization of Aspergillus fumigatus isolated from raw cow milk in Argentina: Molecular typing of A. fumigatus from raw cow milk.

    Science.gov (United States)

    Pena, Gabriela A; Alonso, Verónica; Manini, Marina Velasco; Pellegrino, M; Cavaglieri, Lilia R

    2018-06-20

    Aspergillus fumigatus, the major etiological agent of human and animal aspergillosis, is a gliotoxinogenic species into section Fumigati commonly found in contaminated animal environments. In dairy herds, exposed areas of lactating cows, as mammalian glandule, can be easily contaminated by them. This study was aimed to identify A. fumigatus sensu lato strains (identified based on morphology) isolated from raw cow milk at species level, by morphological and molecular techniques, and to estimate their genetic variability. Forty-five A. fumigatus strains showed similar RAPD profiles (generated with PELF and URP1F primers) to each other and to A. fumigatus sensu stricto reference strains; also, they were almost identical to clinical human and feed-borne A. fumigatus strains included in the assay, since their similarity coefficient ranged from 0.7 to 1.00. Therefore, all strains were characterized as belonging to A. fumigatus sensu stricto species. This result was supported by sequencing the benA gene of selected strains and by maximum parsimony analysis. In addition, RAPD fingerprinting demonstrated intra-specific genetic variability into the A. fumigatus sensu stricto cluster. The results found in this study strengthen the fact that A. fumigatus sensu stricto is the predominant species in the Aspergillus section Fumigati found in animal environments such as dairy herd environments, while other species such as A. novofumigatus, A. fumigatiaffinis, A. udagawae and A. lentulus may be rarely isolated. Since no differences between animal and human strains were observed they can become pathogenic also for farm handlers'. Moreover, the presence of A. fumigatus sensu stricto in raw cow milk is probably a very important risk factor since milk and its by-products are generally indented for human consumption, then gliotoxin could be transferred to them. Copyright © 2018. Published by Elsevier B.V.

  1. Isolation, identification and characterization of yeasts from fermented goat milk of the Yaghnob Valley in Tajikistan

    Directory of Open Access Journals (Sweden)

    Linnea Annie Qvirist

    2016-11-01

    Full Text Available The geographically isolated region of the Yaghnob Valley, Tajikistan, has allowed its inhabitants to maintain a unique culture and lifestyle. Their fermented goat milk constitutes one of the staple foods for the Yaghnob population, and is produced by backslopping, i.e. using the previous fermentation batch to inoculate the new one. This study addresses the yeast composition of the fermented milk, assessing genotypic and phenotypic properties.The 52 isolates included in this study revealed small species diversity, belonging to Kluyveromyces marxianus, Pichia fermentans, Saccharomyces cerevisiae and one Kazachstania unispora. The K. marxianus strains showed two different genotypes, one of which never described previously. The two genetically different groups also differed significantly in several phenotypic characteristics, such as tolerance towards high temperatures, low pH, and presence of acid. Microsatellite analysis of the S. cerevisiae strains from this study, compared to 350 previously described strains, attributed the Yaghnobi S. cerevisiae to two different ancestry origins, both distinct from the wine and beer strains, and similar to strains isolated from human and insects faeces, suggesting a peculiar origin of these strains, and the existence of a gut reservoir for S. cerevisiae.Our work constitutes a foundation for strain selection for future applications as starter cultures in food fermentations. This work is the first ever on yeast diversity from fermented milk of the previously unexplored area of the Yaghnob Valley.

  2. Research And Practice: Quantification Of Raw And Heat-Treated Cow Milk in Sheep Milk, Cheese And Bryndza By ELISA Method

    Directory of Open Access Journals (Sweden)

    Lucia Zeleňáková

    2016-01-01

    Full Text Available The aim of this study was to test the reliability of commercial ELISA tests (RC-bovino within raw and heat treated cow milk detection in sheep milk and cheese in order to obtain a high-quality, reliable and economically beneficial method suitable for routine application in practice. These tests were subsequently used for quantification of cow milk in commercial "Bryndza". Raw sheep milk, cow milk and heat-treated cow milk (pasteurisation at 72 °C for 15 sec or at 85 °C for 3 sec were mixed in precisely defined proportions (0 - 100% cow milk in sheep milk. The milk mixtures were sampled to detect adulteration and subsequently cheese was made. By ELISA tests was possible to determine these amounts of raw cow milk in sheep milk: 0.5% (0.2%, 5 % (4.81%, 50% (42.08% and 75% (56.52%. The pasteurized samples in different combinations gave lower optical density responses than those prepared from raw milk (by approximately 60%. In context with the above mentioned, the relationship between the real and detected amount of cow milk (% in different production stages (milk, cheese using a regression analysis was examined. However, a lower reliability of the detection was indicated by R2 values, which ranged from 0.4058 (cheese to 0.5175 (milk. In practice this means that although individual percentage (% of cow milk in the sample can be detected, but in the unknown sample it can not be clearly confirm whether the cow milk was raw or heat-treated. In this context, the results can be inaccurate and may not correspond to the real situation. Within monitoring phase of this research, 9 samples of bryndza were analysed with the results of detected cow milk ranged from 11.56% to 14.3%. The obtained results confirm that the appropriate selection of ELISA tests can become an important factor in the setting of analytical capabilities for the detection of milk and cheese adulteration.

  3. Investigation of some additive residues in bulk raw milk collected from Pakdasht area in 2009

    Directory of Open Access Journals (Sweden)

    T Moosavi

    2011-05-01

    Full Text Available Milk is one of the most important sources of human nutrition and because of high nutrient content; it is a very suitable medium for microbial growth and spoilage. Sometimes farmers cheat and add some additives to milk in order to cover the spoilage or other defects in milk. In this study 120 samples of bulk raw milk (10 samples each month were collected from dairy farms of Pakdasht under sterile condition and send to veterinary faculty of GarmsarUniversity. The following tests were done on each sample: Anti-microbial residues, residues milk acidity neutralizer, evaluation of sugar, formalin, Hydrogen peroxide, Salicylic acid and salt presence. Results were analyzed with Spss software and the results of the first six months of the year were compared statistically with the results of the second six months of the year. The mean of antimicrobial agents, milk acid neutralizer, formalin, hydrogen peroxide and salicylic acid showed no significant difference. But sugar in first semester were more than second semester (p

  4. Expression of Recombinant Human Alpha-Lactalbumin in the Milk of Transgenic Goats Using a Hybrid Pomoter/Enhancer

    Directory of Open Access Journals (Sweden)

    Yu-Guo Yuan

    2014-01-01

    Full Text Available To improve nutrient content of goat milk, we describe the construction of a vector (pBLAC containing a hybrid goat β-lactoglobulin (BLG promoter/cytomegalovirus (CMV enhancer. We also describe the generation of transgenic goats expressing rhLA by somatic cell nuclear transfer (SCNT. Of 334 one-cell stage embryos derived from three transgenic cell lines and 99 embryos derived from non-transgenic (NT cells surgically transferred to the oviducts of 37 recipients, two recipients delivered two kids (2% from the non-transfected line and five recipients delivered six kids (1.8% from transgenic cell lines, three of which died within 2 days. Compared to the NT donor cells, transfection of donor cells does not negatively affect the development of nuclear transfer embryos into viable transgenic offspring. However, the clone efficiency in cell line number 1 was lower than that in numbers 2 and 3, and in the NT lines (0.9% versus 1.9% 2.4% and 2%; P<0.05. Two transgenic cloned goats expressed rhLA in the milk at 0.1–0.9 mg/mL. The mammary gland-specific expression vector pBLAC with hybrid BLG/CMV can drive the hLA gene to express in vitro and in vivo. These data establish the basis for use of a hybrid promoter/enhancer strategy to produce rhLA transgenic goats.

  5. GENETIC DIVERSITY AMONG YERSINIA ENTEROCOLITICA ISOLATED FROM SEWAGE, RAW MILK AND PACKED FOODS

    Directory of Open Access Journals (Sweden)

    Shanmuga Priya Seshadhri

    2014-12-01

    Full Text Available A total of 90 isolates (40 from sewage, 30 from raw milk and 20 from packed foods collected to study the incidence of Yersinia enterocolitica. It was observed that 61 isolates (32 from sewage, 19 from raw milk and 10 from packed foods were found contaminated with the bacterium. All the isolated strains were confirmed to Yersinia enterocolitica, by using 16S rRNA PCR. Of 61 strains, only five strains (two from sewage and two from packed foods and one from raw milk were found to be the producers of haemolysin at 37 oC, while among the five strains only two strains from packed foods produced haemolysin at 28 oC. All the isolates showed resistance to amoxicillin and found sensitive to chloramphenicol. Seven strains were producer of High molecular weight proteins (HMWP. 53 strains have produced rough LPS, while the smooth LPS has been observed for 8 isolates. Eleven and six different profiles observed in outermembrane proteins and lipopolysaccaride respectively. Combined primer 1 and 2 RAPD-PCR dendogram shows eight different genotypic patterns.

  6. Transfer coefficients of selected radionuclides to animal products. I. Comparison of milk and meat from dairy cows and goats

    International Nuclear Information System (INIS)

    Johnson, J.E.; Ward, G.M.; Ennis, M.E. Jr.; Boamah, K.N.

    1988-01-01

    The diet-milk transfer coefficient, Fm (Bq L-1 output in milk divided by Bq d-1 intake to the animal) was studied for eight radionuclides that previously had been given little attention. The Fm values for cows and goats, respectively, were: 2.3 x 10(-5) and 1.5 x 10(-4) for /sup 99m/Tc, 1.4 x 10(-4) and 8.5 x 10(-4) for /sup 95m/Tc, 1.1 x 10(-2) for 99 Tc (goats only); 1.7 x 10(-3) and 9 x 10(-3) for 99 Mo; 4.8 x 10(-4) and 4.4 x 10(-3) for /sup 123m/Te; 4.8 x 10(-4) and 4.6 x 10(-3) for 133 Ba; 5.5 x 10(-7) and 5.5 x 10(-6) for 95 Zr; and 4.1 x 10(-7) and 6.4 x 10(-6) for 95 Nb. The goat/cow transfer coefficient ratios for milk were approximately 10, but the goat/cow ratios for meat varied by three orders of magnitude

  7. Milk Production, Physiological Condition and Performance of Etawa Crossbreed Goats Feed by Ration Supplemented with Mangosteen Peel Flour

    Science.gov (United States)

    Dzarnisa; Rachmadi, D.; Azhar, A.; Fakhrur Riza, R.; Hidayati, A.

    2018-02-01

    Study on the effect of the addition of mangosteen (Garcinia mangostana L.) peel flour on physiological condition and performance of Etawa crossbreed goats was done. This was to grant the use of mangosteen peel flour that rich of antioxidants and has variety good benefits for health as feed additive for cattle. This study used a Complete Randomized Block Design consisting of 4 treatment groups and 4 replications each. Subjects were 16 female Etawa crossbreed goats randomly designed into treatments group based on lactation periods. Subjects were feed with traditional rations (control, A), traditional rations and 2.5% mangosteen peel flour (B), tradition rations and 5% mangosteen peel flour (C), and traditional rations and 7,5 % mangosteen peel flour (D). Data on performance (milk production) and physiological condition (respiratory frequency, rectal temperature, and heart rate) obtained were analyzed using analysis of variance (ANOVA). The results showed that the addition of mangosteen peel flour as food additive in the rations resulted in variations in the milk production, physiological condition (rectal temperature, heart rate and respiration frequency) and performances (daily weigh gain, food consumption, ration conversion and breast volume) of Etawa crossbreed goats, but significant effect was only observed in the respiration frequency. The addition of 2.5% mangosteen peel flour in the ration caused the best, expected effects on milk production physiological condition and performance of Etawa crossbreed goats.

  8. Total bacterial count and somatic cell count in refrigerated raw milk stored in communal tanks

    Directory of Open Access Journals (Sweden)

    Edmar da Costa Alves

    2014-09-01

    Full Text Available The current industry demand for dairy products with extended shelf life has resulted in new challenges for milk quality maintenance. The processing of milk with high bacterial counts compromises the quality and performance of industrial products. The study aimed to evaluate the total bacteria counts (TBC and somatic cell count (SCC in 768 samples of refrigerated raw milk, from 32 communal tanks. Samples were collected in the first quarter of 2010, 2011, 2012 and 2013 and analyzed by the Laboratory of Milk Quality - LQL. Results showed that 62.5%, 37.5%, 15.6% and 27.1% of the means for TBC in 2010, 2011, 2012 and 2013, respectively, were above the values established by legislation. However, we observed a significant reduction in the levels of total bacterial count (TBC in the studied periods. For somatic cell count, 100% of the means indicated values below 600.000 cells/mL, complying with the actual Brazilian legislation. The values found for the somatic cell count suggests the adoption of effective measures for the sanitary control of the herd. However, the results must be considered with caution as it highlights the need for quality improvements of the raw material until it achieves reliable results effectively.

  9. Bacteriocinogenic Lactococcus lactis subsp. lactis DF04Mi isolated from goat milk: characterization of the bacteriocin

    Directory of Open Access Journals (Sweden)

    Danielle N. Furtado

    2014-12-01

    Full Text Available Lactic acid bacteria capable of producing bacteriocins and presenting probiotic potential open innovative technological applications in the dairy industry. In this study, a bacteriocinogenic strain (Lactococcus lactis subsp. lactis DF4Mi was isolated from goat milk, and studied for its antimicrobial activity. The bacteriocin presented a broad spectrum of activity, was sensitive to proteolytic enzymes, resistant to heat and pH extremes, and not affected by the presence of SDS, Tween 20, Tween 80, EDTA or NaCl. Bacteriocin production was dependent on the components of the culture media, especially nitrogen source and salts. When tested by PCR, the bacteriocin gene presented 100% homology to nisin Z gene. These properties indicate that this L. lactis subsp. lactis DF4Mi can be used for enhancement of dairy foods safety and quality.

  10. Bacteriocinogenic Lactococcus lactis subsp. lactis DF04Mi isolated from goat milk: Characterization of the bacteriocin

    Science.gov (United States)

    Furtado, Danielle N.; Todorov, Svetoslav D.; Landgraf, Mariza; Destro, Maria T.; Franco, Bernadette D.G.M.

    2014-01-01

    Lactic acid bacteria capable of producing bacteriocins and presenting probiotic potential open innovative technological applications in the dairy industry. In this study, a bacteriocinogenic strain (Lactococcus lactis subsp. lactis DF4Mi) was isolated from goat milk, and studied for its antimicrobial activity. The bacteriocin presented a broad spectrum of activity, was sensitive to proteolytic enzymes, resistant to heat and pH extremes, and not affected by the presence of SDS, Tween 20, Tween 80, EDTA or NaCl. Bacteriocin production was dependent on the components of the culture media, especially nitrogen source and salts. When tested by PCR, the bacteriocin gene presented 100% homology to nisin Z gene. These properties indicate that this L. lactis subsp. lactis DF4Mi can be used for enhancement of dairy foods safety and quality. PMID:25763065

  11. Traceability of Functional Bioactive Compounds in Fresh and Pasteurized Milk Obtained from Goats Fed with Orange Pulp

    Directory of Open Access Journals (Sweden)

    Maria Simona Chiş

    2015-11-01

    Full Text Available Traceability is the ability to identify and trace the history, distribution, location, and application of products, parts, and materials. A traceability system records and follows the trail as products, parts, and materials come from suppliers and are processed and ultimately distributed as end products (Prache et al, 2002. In this work, were studied the bioactive compounds (total vitamin C, ascorbic acid, total phenols, flavonoids, carotenoids, vitamin A and vitamin E and antioxidant activity of goat fresh milk and pasteurized one. The goats were fed with a standard diet (control diet and then with a diet that incorporates orange pulp. The control diet (CD corresponded with a standard ration (a ration wich provide the energetic and proteic values, daily food for milking animals. From that ration, the Department of Animal Science, from Politechnic University of Valencia replaced the different proportions of the ingredients for incorporating orange pulp diet (OPD. The results of the present study show that the citrus pulp silage mixture used can be fed to goats without any negative effects on the performance of the animals. Results of this study indicate that citrus pulp silage can replace part of the conventional ration of goats, thus lowering the cost of production. The first aim of this study was to compare the two types of goat diets: a standard diet and a diet with orange pulp, by analyzing the bioactive compounds in fresh and pasteurized milk. The results demonstrate that all the bioactive compounds are bigger in the orange pulp diet than in the control diet. The second objective of this study was to analyze the bioavailability and traceability of bioactive compounds in fresh milk

  12. Prevalence and Characterization of Listeria Species from Raw Milk and Dairy Products from Çanakkale Province

    Directory of Open Access Journals (Sweden)

    Pınar Şanlıbaba

    2018-02-01

    Full Text Available The objective of this study was to determine the prevalence of Listeria species, specifically Listeria monocytogenes, in raw milk, pasteurized milk, white cheese, and homemade cheese. A total of 200 food samples were collected and analyzed to examine the presence of Listeria spp. The EN ISO 11290-1 method was used for isolation of Listeria. API Listeria test kit was used for biochemically characterization. Listeria spp. were isolated in 25 of the 200 samples (12.5%. The largest number of Listeria spp. was detected in homemade cheese (24%, followed by raw milk (18%, and white cheese (8%. Listeria spp. were not isolated from the pasteurized milk. The most common species isolated were Listeria innocua (5.5%; the remaining Listeria isolates were Listeria ivanovi (3.5%, Listeria welshimeri (3%, and Listeria monocytogenes (0.5%. Listeria monocytogenes was detected in only raw milk.

  13. [On-site evaluation of raw milk qualities by portable Vis/NIR transmittance technique].

    Science.gov (United States)

    Wang, Jia-Hua; Zhang, Xiao-Wei; Wang, Jun; Han, Dong-Hai

    2014-10-01

    To ensure the material safety of dairy products, visible (Vis)/near infrared (NIR) spectroscopy combined with che- mometrics methods was used to develop models for fat, protein, dry matter (DM) and lactose on-site evaluation. A total of 88 raw milk samples were collected from individual livestocks in different years. The spectral of raw milk were measured by a porta- ble Vis/NIR spectrometer with diffused transmittance accessory. To remove the scatter effect and baseline drift, the diffused transmittance spectra were preprocessed by 2nd order derivative with Savitsky-Golay (polynomial order 2, data point 25). Changeable size moving window partial least squares (CSMWPLS) and genetic algorithms partial least squares (GAPLS) meth- ods were suggested to select informative regions for PLS calibration. The PLS and multiple linear regression (MLR) methods were used to develop models for predicting quality index of raw milk. The prediction performance of CSMWPLS models were similar to GAPLS models for fat, protein, DM and lactose evaluation, the root mean standard errors of prediction (RMSEP) were 0.115 6/0.103 3, 0.096 2/0.113 7, 0.201 3/0.123 7 and 0.077 4/0.066 8, and the relative standard deviations of prediction (RPD) were 8.99/10.06, 3.53/2.99, 5.76/9.38 and 1.81/2.10, respectively. Meanwhile, the MLR models were also cal- ibrated with 8, 10, 9 and 7 variables for fat, protein, DM and lactose, respectively. The prediction performance of MLR models was better than or close to PLS models. The MLR models to predict fat, protein, DM and lactose yielded the RMSEP of 0.107 0, 0.093 0, 0.136 0 and 0.065 8, and the RPD of 9.72, 3.66, 8.53 and 2.13, respectively. The results demonstrated the usefulness of Vis/NIR spectra combined with multivariate calibration methods as an objective and rapid method for the quality evaluation of complicated raw milks. And the results obtained also highlight the potential of portable Vis/NIR instruments for on-site assessing quality indexes of

  14. High-protein goat's milk diet identified through newborn screening: clinical warning of a potentially dangerous dietetic practice.

    Science.gov (United States)

    Maines, Evelina; Gugelmo, Giorgia; Tadiotto, Elisa; Pietrobelli, Angelo; Campostrini, Natascia; Pasini, Andrea; Ion-Popa, Florina; Vincenzi, Monica; Teofoli, Francesca; Camilot, Marta; Bordugo, Andrea

    2017-10-01

    Breast-feeding is an unequalled way of providing optimal food for infants' healthy growth and development and the WHO recommends that infants should be exclusively breast-fed for the first 6 months of life. For mothers who are unable to breast-feed or who decide not to, infant formulas are the safest alternative. Despite recommendations, it is possible that parents make potentially harmful nutritional choices for their children because of cultural beliefs or misinformation on infant nutrition. We describe a possible health risk of not breast-feeding, highlighting a potentially dangerous dietetic practice. Design/Setting/Subjects We report the case of a newborn who was fed with undiluted goat's milk because her mother could not breast-feed and was not aware of infant formulas. The dietary mistake was detected because of a positive expanded newborn screening result, characterized by severe hypertyrosinaemia with high methionine and phenylalanine levels, a pattern suggestive of severe liver impairment. The pattern of plasma amino acids was related to a goat's milk diet, because of its very different composition compared with human milk and infant formula. Our experience demonstrates that, when breast-feeding is not possible or is not exclusive, infants may be at risk of dangerous nutritional practices, including diets with very high protein content, such as a goat's milk diet. Families of not breast-fed infants may need appropriate advice on safe alternatives for infant nutrition to avoid the risks of inappropriate diets.

  15. Dairy goat kids fed liquid diets in substitution of goat milk and slaughtered at different ages: an economic viability analysis using Monte Carlo techniques.

    Science.gov (United States)

    Knupp, L S; Veloso, C M; Marcondes, M I; Silveira, T S; Silva, A L; Souza, N O; Knupp, S N R; Cannas, A

    2016-03-01

    The aim of this study was to analyze the economic viability of producing dairy goat kids fed liquid diets in alternative of goat milk and slaughtered at two different ages. Forty-eight male newborn Saanen and Alpine kids were selected and allocated to four groups using a completely randomized factorial design: goat milk (GM), cow milk (CM), commercial milk replacer (CMR) and fermented cow colostrum (FC). Each group was then divided into two groups: slaughter at 60 and 90 days of age. The animals received Tifton hay and concentrate ad libitum. The values of total costs of liquid and solid feed plus labor, income and average gross margin were calculated. The data were then analyzed using the Monte Carlo techniques with the @Risk 5.5 software, with 1000 iterations of the variables being studied through the model. The kids fed GM and CMR generated negative profitability values when slaughtered at 60 days (US$ -16.4 and US$ -2.17, respectively) and also at 90 days (US$ -30.8 and US$ -0.18, respectively). The risk analysis showed that there is a 98% probability that profitability would be negative when GM is used. In this regard, CM and FC presented low risk when the kids were slaughtered at 60 days (8.5% and 21.2%, respectively) and an even lower risk when animals were slaughtered at 90 days (5.2% and 3.8%, respectively). The kids fed CM and slaughtered at 90 days presented the highest average gross income (US$ 67.88) and also average gross margin (US$ 18.43/animal). For the 60-day rearing regime to be economically viable, the CMR cost should not exceed 11.47% of the animal-selling price. This implies that the replacer cannot cost more than US$ 0.39 and 0.43/kg for the 60- and 90-day feeding regimes, respectively. The sensitivity analysis showed that the variables with the greatest impact on the final model's results were animal selling price, liquid diet cost, final weight at slaughter and labor. In conclusion, the production of male dairy goat kids can be economically

  16. [Occurrence and typing of Listeria monocytogenes isolated from raw cow's milk collected on farms and from vending machines].

    Science.gov (United States)

    Gelbícová, T; Karpísková, R

    2012-04-01

    Evaluation of the incidence and characteristics of L. monocytogenes in samples of raw cow's milk collected on farms (bulk tank milk samples) and from vending machines. Detection of L. monocytogenes and enumeration were carried out according to EN/ISO 11290--1, 2. Strains were characterised by serotyping and macrorestriction analysis using pulsed-field gel electrophoresis. The presence of L. monocytogenes was detected in 3,2 % (11/346) of bulk tank milk samples and 1,8 % (4/219) samples of raw cow's milk from vending machines. Findings of L. monocytogenes in raw milk were sporadic. Only on one farm strains of L. monocytogenes were detected repeatedly. Thirteen strains of L. monocytogenes belonged to serotype 1/2a, two strains to serotype 1/2b and one to serotype 4b. Macrorestriction analysis revealed considerable heterogeinity of profiles, with nine different pulsotypes being detected. Pulsotype 711 was the most frequent. This pulsotype was found on three different farms. The incidence of L. monocytogenes in raw cow's milk is relatively low in the Czech Republic. The results confirmed that some clones of L. monocytogenes from raw milk are identical with food and human strains.

  17. Real-time PCR detection of Paenibacillus spp. in raw milk to predict shelf life performance of pasteurized fluid milk products.

    Science.gov (United States)

    Ranieri, Matthew L; Ivy, Reid A; Mitchell, W Robert; Call, Emma; Masiello, Stephanie N; Wiedmann, Martin; Boor, Kathryn J

    2012-08-01

    Psychrotolerant sporeformers, specifically Paenibacillus spp., are important spoilage bacteria for pasteurized, refrigerated foods such as fluid milk. While Paenibacillus spp. have been isolated from farm environments, raw milk, processing plant environments, and pasteurized fluid milk, no information on the number of Paenibacillus spp. that need to be present in raw milk to cause pasteurized milk spoilage was available. A real-time PCR assay targeting the 16S rRNA gene was designed to detect Paenibacillus spp. in fluid milk and to discriminate between Paenibacillus and other closely related spore-forming bacteria. Specificity was confirmed using 16 Paenibacillus and 17 Bacillus isolates. All 16 Paenibacillus isolates were detected with a mean cycle threshold (C(T)) of 19.14 ± 0.54. While 14/17 Bacillus isolates showed no signal (C(T) > 40), 3 Bacillus isolates showed very weak positive signals (C(T) = 38.66 ± 0.65). The assay provided a detection limit of approximately 3.25 × 10(1) CFU/ml using total genomic DNA extracted from raw milk samples inoculated with Paenibacillus. Application of the TaqMan PCR to colony lysates obtained from heat-treated and enriched raw milk provided fast and accurate detection of Paenibacillus. Heat-treated milk samples where Paenibacillus (≥1 CFU/ml) was detected by this colony TaqMan PCR showed high bacterial counts (>4.30 log CFU/ml) after refrigerated storage (6°C) for 21 days. We thus developed a tool for rapid detection of Paenibacillus that has the potential to identify raw milk with microbial spoilage potential as a pasteurized product.

  18. Determination of heavy metals concentration in raw sheep milk from mercury polluted area

    Directory of Open Access Journals (Sweden)

    Radovan Stanovič

    2016-01-01

    Full Text Available The paper focuses on determining the content of monitored contaminants (Cd, Cu, Hg, Pb and Zn in 53 samples of raw sheep milk collected in 2013 and 2014 on the sites Poráč and Matejovce nad Hornádom (middle Spiš. The area is characterized by historical mining and metalworking activity (mining and processing of polymetallic ores rich in Hg, Cd and Pb. Currently, the area is one of the most mercury contaminated areas in Central Europe. All statistical analyses were carried out using the statistical software Statistica 10.0 (Statsoft, USA. Descriptive data analysis included minimum value, maximum value, arithmetic mean and standard deviation. The results of the studied contaminant content show that the limit value for cadmium (10 μg.kg-1 was exceeded in 25 samples. In the case of lead, the limit value of 20 μg.kg-1 was exceeded in 16 cases. The limit value for copper (0.4 mg.kg-1 was exceeded in one case. The limit value for zinc is not defined by a legislative standard. The risk level of the studied contaminants in the samples of raw sheep milk decreases as follows: Cd > Pb > Hg > Cu > Zn. It can be concluded that frequent and long-term consumption of the raw sheep milk originating from the studied sites poses a health risk. The content of the contaminants in the milk and their eventual transition into dairy products should be monitored over a longer term in more detail. Normal 0 21 false false false CS JA X-NONE

  19. In vitro digestibility of goat milk and kefir with a new standardised static digestion method (INFOGEST cost action) and bioactivities of the resultant peptides.

    Science.gov (United States)

    Nehir El, Sedef; Karakaya, Sibel; Simsek, Sebnem; Dupont, Didier; Menfaatli, Esra; Eker, Alper Tolga

    2015-07-01

    The hydrolysis degrees of goat milk and kefir during simulated gastrointestinal digestion and some bioactivities of the resulting peptides after fermentation and digestion were studied. A static in vitro digestion method by the COST FA1005 Action INFOGEST was used and goat milk and kefir were partially hydrolyzed during the gastric phase and had above 80% hydrolysis after duodenal digestion. There were no differences between the digestibility of goat milk and kefir (p > 0.05). Goat milk and kefir displayed about 7-fold antioxidant activity after digestion (p 0.05), however, after in vitro digestion calcium-binding capacity of the goat milk and kefir increased 2 and 5 fold, respectively (p < 0.05). Digested goat milk and kefir showed a higher dose-dependent inhibitory effect on α-amylase compared to undigested samples (p < 0.05). α-Glucosidase inhibitory activities and in vitro bile acid-binding capacities of the samples were not determined at the studied concentrations.

  20. Determination of lactose in raw milks by means of the combined He-Ne laser optothermal window

    NARCIS (Netherlands)

    Bakos, P.; Doka, O.; Ajtony, Z.; Bicanic, D.; Szucs, D.

    2002-01-01

    The concept of OW (with 632.8 nm He–Ne laser), combined with colorimetry based on a reaction of anthrone-sulphuric acid, was proposed as a new tool for determination of lactose in raw milk. Data obtained from various milk samples by OW colorimetry were compared to those acquired from the MilkoScan

  1. Bacteriological study of raw and unexpired pasteurized cow's milk collected at the dairy farms and super markets in Sari city in 2011

    OpenAIRE

    VAHEDI, M.; NASROLAHEI, M.; SHARIF, M.; MIRABI, A.M.

    2013-01-01

    Summary Introduction. The quality of milk is influenced by different bacteria present in milk. This study was undertaken to investigate the bacterial contamination of raw and pasteurized milk in Sari Township, Iran, 2011. Methods. In this investigation, 100 pasteurized milk samples were collected randomly from the super markets in the city and 100 raw milk samples from 4 dairy farms from suburb areas and evaluated for the presence of coliforms, Escherichia coli, Staphylococcus aureus and List...

  2. Determination of the concentrations of lead in raw milk in the Valley of Toluca

    International Nuclear Information System (INIS)

    Rosas Vilchis, E.

    1991-01-01

    The object of the present work, undertaken under the program of Regional and Cooperative Agreement for Nuclear Science and Technology in Latin America (ARCAL IV), was to determine the amounts of lead found in raw milk using the analytic techniques of Atomic Absorption Spectrophotometry (AAS), Inductively Coupled Plasma Atomic Emission Spectrometry (ICP-AES) and X-ray Fluorescence (FRX); so as to aid in solving problems of public health originating from elevated amounts of heavy metals in foods of animal origin. A total of thirty samples of raw milk were collected in the Valley of Toluca in Mexico, where heavy metal contaminants in the environment due to effects of rapid industrialization and urbanization, are known to have entered the food chain. The methodology, consisting in destroying organic matter in the samples by calcination, and included, in the case of AAS and ICP-AES, acid digestion. In the case of FRX, lead was extracted by ammonium 1-pyrrolidine carboditioate (APDC). The equipment to be used was calibrated and both blank and working solutions prepared in order to perform quantitative analysis. The concentrations of lead which were found in all the milk samples ranged from <0.03 to 0.31 μg/ml milk. These amounts within the maximum permissible limits, 0.5 μg/ml for all types of milk, established by the FDA. In the analysis ICP-AES gave best results as to sensitivity, precision and accuracy, followed by AAS which gave reliable results. FRX failed to detect lower limits and was, therefore, less reliable. (Author)

  3. PCR detection of staphylococcal enterotoxin genes in Staphylococcus aureus strains isolated from raw and pasteurized milk.

    Science.gov (United States)

    Rall, V L M; Vieira, F P; Rall, R; Vieitis, R L; Fernandes, A; Candeias, J M G; Cardoso, K F G; Araújo, J P

    2008-12-10

    Milk is considered a nutritious food because it contains several important nutrients including proteins and vitamins. Conversely, it can be a vehicle for several pathogenic bacteria such as Staphylococcus aureus. This study aimed to analyze the frequency of genes encoding the staphylococcal enterotoxins (SEs) SEA, SEB, SEC, SED, SEE, SEG, SEH, SEI and SEJ in S. aureus strains isolated from raw or pasteurized bovine milk. S. aureus was found in 38 (70.4%) out of 54 raw milk samples at concentrations of up to 8.9 x 10(5) CFU/ml. This microorganism was present in eight samples of pasteurized milk before the expiration date and in 11 samples analyzed on the expiration date. Of the 57 strains studied, 68.4% were positive for one or more genes encoding the enterotoxins, and 12 different genotypes were identified. The gene coding for enterotoxin A, sea, was the most frequent (16 strains, 41%), followed by sec (8 strains, 20.5%), sed (5 strains, 12.8%), seb (3 strains, 7.7%) and see (2 strains, 5.1%). Among the genes encoding the other enterotoxins, seg was the most frequently observed (11 strains, 28.2%), followed by sei (10 strains) and seh and sej (3 strains each). With the recent identification of new SEs, the perceived frequency of enterotoxigenic strains has increased, suggesting that the pathogenic potential of staphylococci may be higher than previously thought; however, further studies are required to assess the expression of these new SEs by S. aureus, and their impact in foodborne disease. The quality of Brazilian milk is still low, and efforts from the government and the entire productive chain are required to attain consumer safety.

  4. EFFECTS OF HIGH SOYBEAN OIL FOR GOATS IN LATE LACTATION ON INTAKE, MILK COMPOSITION AND FATTY ACID PROFILE

    Directory of Open Access Journals (Sweden)

    Brou Kouakou

    2009-06-01

    Full Text Available Animal fat and vegetable oils are generally added to livestock diets to increase energy density. Unlike other ruminants, goats can tolerate more than 6% dietary fat. Feeding a diet containing soybean oil (SO, rich in polyunsaturated fatty acids (PUFA to goats can change the milk fat composition, thereby modifying the nutritional quality of the milk. PUFA such as linoleic acids are considered healthier fats since they have been shown to reduce the risk of cardiovascular diseases in humans. Eighteen dairy goats (3 - 4 yr.; BW = 40 kg; 9 Saanen and 9 Alpine in late lactation were used in an experiment to determine the effect of high PUFA (12% soybean oil; 12% SO on feed intake, milk composition and fatty acid profile. Does were group fed once a day (2 pens per treatment a 16% CP and 3.5 Mcal DE/kg diets containing either 6 or 12% SO for 24 d. Feed intake was recorded daily during the trial and milk yield was recorded from d-10 to d-24. Milk samples were collected 3 times a week and analyzed for protein, fat, lactose, and total solids. Milk fat was extracted and prepared for fatty acid methyl esters (FAME. The FAMEs were analyzed using a gas chromatography (GC unit, fitted with a 60 m x 0.25 mm i.d. fused silica SP 2380 (Sigma-Aldrich capillary column. The data were analyzed using MIXED procedures in SAS as a completely randomized design with repeated measures. Dietary treatments did not affect (P > 0.05 pen feed intake, milk yield or milk composition (fat, protein, lactose and total solids. Diet containing 12% SO decreased (P < 0.05 the proportion of saturated fatty acids (SFA; C6:0, C8:0, C10:0, C12:0, C14:0, C16:0 and increased (P < 0.01 the proportions of monounsaturated fat (MUFA; C18:1n9; C18:1t, and the predominant PUFA, linoleic acid (C18:2n6. The results indicate that goats consuming diet with 12% SO (high PUFA in late lactation produced milk with higher proportions of PUFA and MUFA and lower proportions of SFA compared to 6% SO.

  5. The effect of dietary Chlorella vulgaris inclusion on goat's milk chemical composition, fatty acids profile and enzymes activities related to oxidation.

    Science.gov (United States)

    Tsiplakou, E; Abdullah, M A M; Mavrommatis, A; Chatzikonstantinou, M; Skliros, D; Sotirakoglou, K; Flemetakis, E; Labrou, N E; Zervas, G

    2018-02-01

    The impact of dietary supplementation with microalgae on goat's milk chemical composition, fatty acids (FA) profile and enzymes activities related to antioxidant mechanism has not been well documented. Thus, this study aimed to investigate the effects of dietary inclusion of Chlorella vulgaris on the following: (i) milk yield, chemical composition and FA profile, (ii) the activities of superoxide dismutase (SOD), catalase (CAT), glutathione reductase (GR), glutathione transferase (GST) and glutathione peroxidase (GSH-Px) in blood plasma and (iii) the activities of SOD, GR and lactoperoxidase (LPO) in milk of goats. Furthermore, the oxidative stress indicators for measuring total antioxidant and free radical scavenging activity [ferric reducing ability of plasma (FRAP) and 2, 2'-azino-bis (3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) assays] and oxidative stress biomarkers [malondialdehyde (MDA) and protein carbonyls (PC)] were also determined in blood plasma and milk of the animals. For this purpose, 16 cross-bred goats were divided into two homogenous groups. Each goat of both groups was fed individually with alfalfa hay and concentrates separately. The concentrates of the control group (Control) had no microalgae, while those of the Chlorella group were supplemented with 10 g lyophilized Chlorella vulgaris/kg concentrates (Chlorella). Thus, the average intake was 5.15 g Chlorella vulgaris/kg DM. The results showed that the dietary inclusion of Chlorella vulgaris had not noticeable impact on goat's milk yield, chemical composition and FA profile. Significantly higher SOD (by 10.31%) and CAT (by 18.66%) activities in the blood plasma of goats fed with Chlorella vulgaris compared with the control were found. Moreover, the dietary supplementation with Chlorella vulgaris caused a significant increase in SOD (by 68.84%) activity and a reduction in PC (by 24.07%) content in goat's milk. In conclusion, the Chlorella vulgaris inclusion in goat's diets improved the

  6. Detection of aflatoxin M1 in raw and commercial pasteurized milk in Urmia, Iran.

    Science.gov (United States)

    Tajik, Hossein; Rohani, Seyed Mehdi Razavi; Moradi, Mehran

    2007-11-15

    During the years 2005 and 2006, samples of raw and of pasteurized milk (72 samples each) were collected randomly from various parts of Urmia city in Iran for the detection of aflatoxin M1. Aflatoxin M1 levels were assessed by Enzyme Linked Immuno Sorbent Assay (ELISA). There was a high incidence of AFM1 (100%), in both raw and pasteurized milk samples. The AFM1 levels in 6.25% of samples were higher than the maximum tolerance limit accepted by European Union (50 ng L(-1)), while the observed mean ofAFM1 was lower than those proposed for European diets. Maximum level ofAFM1 in raw and pasteurized samples were 91.8 and 28.5 ng L(-1), while minimum levels were 4.3 and 5.1 ng L(-1), respectively. The levels ofAFM1 in total samples indicated that feeds for cows in this region were contaminated with AFB1 in such a level that appears to be a serious public health problem at the moment. Therefore, there is a need to limit exposure to aflatoxins by imposing regulatory limits.

  7. Contribution of hydrogen peroxide to the inhibition of Staphylococcus aureus by Lactococcus garvieae in interaction with raw milk microbial community

    OpenAIRE

    Delbes, Céline; Dorchies, Géraud; Chaabna, Zineddine; Callon, Cecile; Montel, Marie-Christine

    2010-01-01

    The response of Staphylococcus aureus growth inhibition by Lactococcus garvieae to catalase and milk lactoperoxidase, and its efficiency in raw milk cheese were evaluated. S. aureus and L. garvieae were co-cultivated in broth buffered at pH 6.8, and in raw, pasteurized and microfiltered milk, in presence and absence of catalase. Although H(2)O(2) production by L garvieae was detected only in agitated broth, the inhibition of S. aureus by L garvieae was reduced by catalase both in stati...

  8. Characterization of the indigenous microflora in raw and pasteurized buffalo milk during storage at refrigeration temperature by high-throughput sequencing

    Science.gov (United States)

    The effect of refrigeration on bacterial communities within raw and pasteurized buffalo milk was studied using high-throughput sequencing. High quality samples of raw buffalo milk were obtained from five dairy farms in the Guangxi province of China. A sample of each milk was pasteurized, and both r...

  9. Protein Digestion and Quality of Goat and Cow Milk Infant Formula and Human Milk Under Simulated Infant Conditions.

    Science.gov (United States)

    Maathuis, Annet; Havenaar, Robert; He, Tao; Bellmann, Susann

    2017-12-01

    The aim of this study was to determine the kinetics of true ileal protein digestion and digestible indispensable amino acid score (DIAAS) of a goat milk-based infant formula (GIF), a cow milk-based infant formula (CIF), and human milk (HM). The GIF, CIF, and HM were investigated in an in vitro gastrointestinal model simulating infant conditions. Digested compounds were dialyzed from the intestinal compartment as bioaccessible fraction. Dialysate was collected in 15 to 60-minute periods for 4 hours. True ileal protein digestibility and DIAAS were determined as bioaccessible nitrogen (N) and amino acids. N bioaccessibility from the GIF showed similar kinetics to that of HM. The CIF showed a delay in N bioaccessibility versus the GIF and HM. In the 1st hour of digestion, N bioaccessibility was 19.9% ± 3.5% and 23.3% ± 1.3% for the GIF and HM, respectively, and 11.2% ± 0.6% for CIF (P < 0.05 vs HM). In the 3rd hour of digestion, the N bioaccessibility was higher (P < 0.05) for the CIF (28.9% ± 1.2%) than for the GIF (22.5% ± 1.6%) and HM (20.6% ± 1.0%). After 4 hours, the true ileal protein digestibility of the GIF, CIF, and HM was 78.3% ± 3.7%, 73.4% ± 2.7%, and 77.9% ± 4.1%, respectively. The DIAAS for the GIF, CIF, and HM for 0- to 6-month-old infants was 83%, 75%, and 77% for aromatic AA. The protein quality is not different between the GIF, CIF, and HM, but the kinetics of protein digestion of the GIF is more comparable to that of HM than that of the CIF.

  10. Milk Iodine Content in Slovakia

    Directory of Open Access Journals (Sweden)

    I. Paulíková

    2008-01-01

    Full Text Available The aim of this work was to map actual iodine status and its seasonal differences in raw milk of dairy cows, sheep, and goats in various regions of Slovakia. Iodine concentrations were determined in 457 samples of raw milk from dairy cows, 78 samples of sheep, and 16 samples of goat milk collected in various regions of Slovakia from 2002 to 2007. Among all the 457 samples of bovine milk, iodine content below 50 μg l-1 was recorded in 114 samples (24.94%; 294 samples (64.33% ranged between 50 and 200 μg l-1; 19 samples (4.16% from 200 to 500 μg l-1; 17 samples (3.72% between 500 and 1 000 μg l-1, and 13 samples (2.85% showed iodine concentrations over 1 000 μg l-1. regional concentrations showed the highest values in the Western, then Middle and Eastern Slovakia, and the lowest values in Northern Slovakia (p p -1 in 49 sheep (62.8% and in 6 goats below 60 μg l-1 (37.5%, which are indicative of iodine deficiency. When comparing seasonal differences, sheep and goat milk had higher iodine content during the winter feeding period, however, in dairy cows we recorded the opposite ratio. Except for goat milk (p < 0.01 the seasonal differences were not significant.

  11. Relationships between the daily intake of unsaturated plant lipids and the contents of major milk fatty acids in dairy goats

    Energy Technology Data Exchange (ETDEWEB)

    Martínez Marín, A.L.; Núñez Sánchez, N.; Garzón Sigler, A. I.; Peña Blanco, F.; Fuente, M.A. de la

    2015-07-01

    A meta-regression of the effects of the amount of plant lipids consumed by dairy goats on the contents of some milk fat fatty acids (FA) was carried out. Fourteen peer-reviewed published papers reporting 17 experiments were used in the study. Those experiments compared control diets without added fat with diets that included plant lipids rich in unsaturated FA, summing up to 64 treatments. The results showed that increasing daily intake of plant lipids linearly reduced the contents of all medium chain saturated FA in milk fat. Moreover, it was observed that the longer the chain of the milk saturated FA, the greater the negative effect of the plant lipid intake on their contents. On the other hand, the contents of stearic acid and the sum of oleic, linoleic and α-linolenic acids in milk fat linearly increased as daily plant lipid intake rose. The results obtained corroborate previous reports on the effects of feeding dairy goats with increasing amounts of unsaturated plant lipids on milk FA profile. (Author)

  12. Comparative in vitro efficacy of kefir produced from camel, goat, ewe and cow milk on Haemonchus contortus.

    Science.gov (United States)

    Alimi, D; Rekik, M; Akkari, H

    2018-04-18

    One of the great challenges of veterinary parasitology is the search for alternative methods for controlling gastrointestinal parasites in small ruminants. Milk kefir is a traditional source of probiotic, with great therapeutic potential. The objective of this study was to investigate the anthelmintic effects of kefir on the abomasal nematode Haemonchus contortus from sheep. The study used camel, goat, ewe and cow milk as a starting material, to produce camel, goat, cow and ewe milk kefir. All kefirs showed a significant concentration-dependent effect on H. contortus egg hatching at all tested concentrations. The highest inhibition (100%) of eggs was observed with camel milk kefir at a concentration 0.125 mg/ml. In relation to the effect of kefirs on the survival of adult parasites, all kefirs induced concentration-dependent mortality in adults, with variable results. The complete mortality (100%) of adults of H. contortus occurred at concentrations in the range 0.25-2 mg/ml. The highest inhibition of motility (100%) of worms was observed after 8 h post exposure with camel milk kefir at 0.25 mg/ml. These findings indicate that kefir can be considered a potential tool to control haemonchosis in sheep. Further investigations are needed to assess the active molecules in kefir responsible for its anthelmintic properties and to investigate similar in vivo effects.

  13. Effects on goat milk quality of the presence of Mycoplasma spp. in herds without symptoms of contagious agalactia.

    Science.gov (United States)

    de la Fe, Christian; Sánchez, Antonio; Gutierrez, Aldo; Contreras, Antonio; Carlos Corrales, Juan; Assunçao, Patricia; Poveda, Carlos; Poveda, José B

    2009-02-01

    This study was designed to assess the possible effects of mycoplasmas on the quality of milk produced by goat herds in a contagious agalactia (CA) endemic area with absence of classical symptoms. Several factors related to milk quality (percentages of fat, total protein, lactose and total solids, standard plate counts (SPC) and presence of Staphylococcus aureus) were compared in mycoplasma-infected and non-infected herds. To define the CA status of 26 herds on the island of Lanzarote (Spain), where CA is endemic, 570 individual milk samples and 266 bulk tank milk (BTM) samples were microbiologically analysed for the presence of Mycoplasma spp. A herd was considered infected by mycoplasmas when at least a sample (individual or BTM) was positive. BTM samples were also used to determine milk quality parameters. Mycoplasma infection was confirmed in 13 herds. A total of 31, 10 and 11 strains of Mycoplasma mycoides subsp. mycoides LC (MmmLC), Mp. agalactiae and Mp. capricolum subsp. capricolum were isolated. No significant differences were observed between the least square means of the variables fat, total protein, lactose and total solids or SPC recorded for the infected v. non-infected herds. The Staph. aureus status of a herd was also found to be independent of the presence of Mycoplasma spp. Our findings indicate that neither the presence of mycoplasmas in a goat herd with absence of classical symptoms seem to compromise the quality of the BTM.

  14. A new comprehensive index for discriminating adulteration in bovine raw milk.

    Science.gov (United States)

    Liu, Jing; Ren, Jing; Liu, Zhen-Min; Guo, Ben-Heng

    2015-04-01

    This paper proposes a new comprehensive index, called Q, which can effectively discriminate artificial adulterated milk from unadulterated milk. Both normal and adulterated samples of bovine raw milk were analysed by Fourier transform infrared spectroscopic instrument to measure the traditional indices of quality, including fat (FAT), protein (PRO), lactose (LAC), total solids (TS), non-fat solid (NFS), freezing point (FP) and somatic cell counts (SCC). From these traditional indices, this paper elaborates a method to build the index Q. First, correlated analysis and principle component analysis were used to select parameter pairs TS-FAT and FP-LAC as predominant variables. Second, linear-regression analysis and residual analysis are applied to determine the index Q and its discriminating ranges. The verification and two-blind trial results suggested that index Q could accurately detect milk adulteration with maltodextrin and water (as low as 1.0% of adulteration proportions), and with other nine kinds of synthetic adulterants (as low as 0.5% of adulteration proportions). Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Semi-Quantitative Method for Streptococci Magnetic Detection in Raw Milk

    Directory of Open Access Journals (Sweden)

    Carla Duarte

    2016-04-01

    Full Text Available Bovine mastitis is the most costly disease for dairy farmers and the most frequent reason for the use of antibiotics in dairy cattle; thus, control measures to detect and prevent mastitis are crucial for dairy farm sustainability. The aim of this study was to develop and validate a sensitive method to magnetically detect Streptococcus agalactiae (a Group B streptococci and Streptococcus uberis in raw milk samples. Mastitic milk samples were collected aseptically from 44 cows with subclinical mastitis, from 11 Portuguese dairy farms. Forty-six quarter milk samples were selected based on bacterial identification by conventional microbiology. All samples were submitted to PCR analysis. In parallel, these milk samples were mixed with a solution combining specific antibodies and magnetic nanoparticles, to be analyzed using a lab-on-a-chip magnetoresistive cytometer, with microfluidic sample handling. This paper describes a point of care methodology used for detection of bacteria, including analysis of false positive/negative results. This immunological recognition was able to detect bacterial presence in samples spiked above 100 cfu/mL, independently of antibody and targeted bacteria used in this work. Using PCR as a reference, this method correctly identified 73% of positive samples for streptococci species with an anti-S. agalactiae antibody, and 41% of positive samples for an anti-GB streptococci antibody.

  16. Chemical composition and viability of goat milk whey for the production of lactic acid with Lactobacillus helveticus.

    Directory of Open Access Journals (Sweden)

    Alejandra Plata Pinzón

    2012-10-01

    Full Text Available Goat milk whey is a byproduct of low economic value, and is perceived within Colombia as industrial waste with a negative environmental impact on ecosystems (BOD and COD of 60,000 ppm and 80,000 ppm respectively. Therefore this paper seeks to characterize this whey, and evaluate the effectiveness of the Lactobacillus Helveticus (LH strain from 0 to 0.91 for the production of lactic acid from whey goat milk enriched with three nutrients. The variables studied follow a Greco-Latin model. To this effect, 16 kinetics were conducted in an intermittent bio-fermenter containing 250 milliliters of goat milk whey wherein the highest production of lactic acid, 17.72 grams per liter, is achieved after 50 hours for a medium containing 2.5% yeast, 0.6% riboflavin, 0.45% ammonium sulfate, and the bio-fermenter operating at 42 ° C. The study concludes that apart from producing lactic acid, LH is an alternative towards avoiding contamination of ecosystems in as much as it would generate an added value to the cheese industry

  17. Nutrition Quality and Microbiology of Goat Milk Kefir Fortified with Vitamin B12 and Vitamin D3 during Storage

    Science.gov (United States)

    Dianti, EP; Anjani, G.; Afifah, DN; Rustanti, N.; Panunggal, B.

    2018-02-01

    Goat milk kefir fortified vitamin B12 and vitamin D3 can be an alternative to improve insulin resistance. Fortification of vitamin B12 and vitamin D3 could affect the balance of complex ecosystems of bacteria and yeasts in goat milk kefir. We analyzed the nutritional quality and microbiology of goat milk kefir during storage. This experiment was done with completely randomized design consisted of five treatments, ie storage day 0, 3rd, 6th, 9th, and 15th. Vitamin B12, vitamin D3, protein were analyzed using spectrophotometric, fat using babcock method, total lactic acid bacteria using total plate count, pH with pH meter, and viscosity using ostwald method. During 15 days in refrigerated storage, there was no significant difference (p>0,05) of vitamin B12 concentration, protein, fat, and viscosity of kefir. Storage time of the final product caused the decrease of vitamin D3 concentration between day 9 and 15 (p=0,038), pH (p=0,023), and total lactic acid of kefir (p=0,0001). Total lactic acid bacteria increased until 9 days of storage (6161 ± 1.296x107cfu / ml), but decreased to 24% on day 15 (150 ±7.78x107cfu/ml). pH kefir tends to fluctuate during storage with the highest pH value of 4,38 on day-3, and lowest 4.13 on day-9.

  18. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  19. RESEARCHES REGARDING THE MICROBIOLOGIC PARAMETERS VALUE FROM RAW MILK USED IN TELEMEA CHEESE TECHNOLOGICAL PROCESS

    Directory of Open Access Journals (Sweden)

    ANDRA SULER

    2008-10-01

    Full Text Available An important faze for food quality control is verification of microbiological parameters of food products. In this way is assuring the prevention of alimentation toxicological infections to consumer, avoiding the technological and economical losses as well as increasing the products conservation period. In this paper are presents the microbiological exam results from raw milk used in Telemea cheese technological process, for 5 stations studied. The determinations were made on 2 series with 57 samples each of them, prelevated in reception fase, in summer and winter season.

  20. Effect of seasonal variation on the composition and properties of raw milk destined for processing in the UK.

    Science.gov (United States)

    Chen, Biye; Lewis, Michael J; Grandison, Alistair S

    2014-09-01

    The composition and physical properties of raw milk from a commercial herd were studied over a 1 year period in order to understand how best to utilise milk for processing throughout the year. Protein and fat levels demonstrated seasonal trends, while minerals and many physical properties displayed considerable variations, which were apparently unrelated to season. However, rennet clotting time, ethanol stability and foaming ability were subject to seasonal variation. Many significant interrelationships in physico-chemical properties were found. It is clear that the milk supply may be more suited to the manufacture of different products at different times of the year or even on a day to day basis. Subsequent studies will report on variation in production and quality of products manufactured from the same milk samples described in the current study and will thus highlight potential advantages of seasonal processing of raw milk. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. A systematic review and meta-analysis of the effects of pasteurization on milk vitamins, and evidence for raw milk consumption and other health-related outcomes.

    Science.gov (United States)

    Macdonald, Lauren E; Brett, James; Kelton, David; Majowicz, Shannon E; Snedeker, Kate; Sargeant, Jan M

    2011-11-01

    Pasteurization of milk ensures safety for human consumption by reducing the number of viable pathogenic bacteria. Although the public health benefits of pasteurization are well established, pro-raw milk advocate organizations continue to promote raw milk as "nature's perfect food." Advocacy groups' claims include statements that pasteurization destroys important vitamins and that raw milk consumption can prevent and treat allergies, cancer, and lactose intolerance. A systematic review and meta-analysis was completed to summarize available evidence for these selected claims. Forty studies assessing the effects of pasteurization on vitamin levels were found. Qualitatively, vitamins B12 and E decreased following pasteurization, and vitamin A increased. Random effects meta-analysis revealed no significant effect of pasteurization on vitamin B6 concentrations (standardized mean difference [SMD], -2.66; 95% confidence interval [CI], -5.40, 0.8; P = 0.06) but a decrease in concentrations of vitamins B1 (SMD, -1.77; 95% CI, -2.57, -0.96; P pasteurization on milk's nutritive value was minimal because many of these vitamins are naturally found in relatively low levels. However, milk is an important dietary source of vitamin B2, and the impact of heat treatment should be further considered. Raw milk consumption may have a protective association with allergy development (six studies), although this relationship may be potentially confounded by other farming-related factors. Raw milk consumption was not associated with cancer (two studies) or lactose intolerance (one study). Overall, these findings should be interpreted with caution given the poor quality of reported methodology in many of the included studies.

  2. Surveillance of bulk raw and commercially pasteurized cows' milk from approved Irish liquid-milk pasteurization plants to determine the incidence of Mycobacterium paratuberculosis.

    Science.gov (United States)

    O'Reilly, Ciara E; O'Connor, Lisa; Anderson, Wayne; Harvey, Peter; Grant, Irene R; Donaghy, John; Rowe, Michael; O'Mahony, Pat

    2004-09-01

    Over the 13-month period from October 2000 to November 2001 (inclusive), the Food Safety Authority of Ireland (FSAI) carried out surveillance of Irish bulk raw (n = 389) and commercially pasteurized (n = 357) liquid-milk supplies to determine the incidence of Mycobacterium paratuberculosis. The pasteurization time-temperature conditions were recorded for all pasteurized samples. Overall, 56% of whole-milk pasteurized samples had been heat treated at or above a time-temperature combination of 75 degrees C for 25 s. All analyses were undertaken at the Department of Food Science (Food Microbiology) laboratory at Queen's University Belfast. Each milk sample was subjected to two tests for M. paratuberculosis: immunomagnetic separation-PCR (IMS-PCR; to detect the presence of M. paratuberculosis cells, live or dead) and chemical decontamination and culture (to confirm the presence of viable M. paratuberculosis). Overall, M. paratuberculosis DNA was detected by IMS-PCR in 50 (12.9%; 95% confidence interval, 9.9 to 16.5%) raw-milk samples and 35 (9.8%; 95% confidence interval, 7.1 to 13.3%) pasteurized-milk samples. Confirmed M. paratuberculosis was cultured from one raw-milk sample and no pasteurized-milk samples. It is concluded that M. paratuberculosis DNA is occasionally present at low levels in both raw and commercially pasteurized cows' milk. However, since no viable M. paratuberculosis was isolated from commercially pasteurized cows' milk on retail sale in the Republic of Ireland, current pasteurization procedures are considered to be effective.

  3. LC-MS/MS analysis of permethylated free oligosaccharides and N-glycans derived from human, bovine, and goat milk samples.

    Science.gov (United States)

    Dong, Xue; Zhou, Shiyue; Mechref, Yehia

    2016-06-01

    Oligosaccharides in milk not only provide nutrition to the infants but also have significant immune biofunctions such as inhibition of pathogen binding to the host cell. The main component in milk oligosaccharides is free oligosaccharides. Since the proteins in milk are highly glycosylated, N-glycans in milk also play an import role. In this study, we investigated the permethylated free oligosaccharides and N-glycans extracted from bovine, goat, and human milks using LC-MS/MS. Quantitation profiles of free oligosaccharides and N-glycans were reported. The number of free oligosaccharides observed in bovine, goat, and human milk samples (without isomeric consideration) were 11, 8, and 11, respectively. Human milk had more complex free oligosaccharides structures than the other two milk samples. Totally 58, 21, and 43 N-glycan structures (without isomeric consideration) were associated with whey proteins extracted from bovine, goat, and human milk samples, respectively. Bovine milk free oligosaccharides and N-glycans from whey proteins were highly sialylated and to a lesser extend fucosylated. Goat and human milk free oligosaccharides and N-glycans from whey proteins were both highly fucosylated. Also, the isomeric glycans in milk samples were determined by porous graphitic carbon LC at elevated temperatures. For example, separation of human milk free oligosaccharide Gal-GlcNAc-(Fuc)-Gal-Glc and Gal-GlcNAc-Gal-Glc-Fuc isomers was achieved using porous graphitic carbon column. Permethylation of the glycan structures facilitated the interpretation of MS/MS. For example, internal cleavage and glycosidic bond cleavage are readily distinguished in the tandem mass spectra of permethylated glycans. This feature resulted in the identification of several isomers. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Behavior of Arcobacter butzleri and Arcobacter cryaerophilus in ultrahigh-temperature, pasteurized, and raw cow's milk under different temperature conditions.

    Science.gov (United States)

    Giacometti, Federica; Serraino, Andrea; Pasquali, Frederique; De Cesare, Alessandra; Bonerba, Elisabetta; Rosmini, Roberto

    2014-01-01

    The growth and survival of Arcobacter butzleri and Arcobacter cryaerophilus in milk were investigated at different storage temperatures. Three strains of each Arcobacter species were inoculated into ultrahigh-temperature (UHT), pasteurized, and raw cow's milk and stored at 4, 10, and 20°C for 6 days. The survival of Arcobacter spp. during storage was evaluated by a culture method. Results clearly showed that A. butzleri and A. cryaerophilus remained viable in milk when stored at 4°C and 10°C for a period of 6 days. When UHT and pasteurized milk were stored at 20°C, the A. butzleri count increased, with a longer lag-phase in pasteurized milk, whereas the A. cryaerophilus count increased in the first 48 h and then rapidly decreased to below the detection limit on the sixth storage day. When raw milk was stored at 20°C, the A. butzleri and A. cryaerophilus counts decreased from the first day of storage and no viable bacteria were recovered on the last day of storage. Generally, A. butzleri displayed a significantly better growth and survival capacity than A. cryaerophilus in milk. The present study is the first to assess the survival and/or growth of A. butzleri and A. cryaerophilus in milk. The evidence suggests that in case of primary contamination of milk or secondary contamination due to postprocessing contamination, milk can act as a potential source of Arcobacter infection in humans and could have public health implications, especially for raw milk consumption.

  5. Occurrence and characterization of Shiga toxin-producing Escherichia coli in raw meat, raw milk, and street vended juices in Bangladesh.

    Science.gov (United States)

    Islam, Mohammad A; Mondol, Abdus S; Azmi, Ishrat J; de Boer, Enne; Beumer, Rijkelt R; Zwietering, Marcel H; Heuvelink, Annet E; Talukder, Kaisar A

    2010-11-01

    The major objective of this study was to investigate the prevalence of Shiga toxin (Stx)-producing Escherichia coli (STEC) in different types of food samples and to compare their genetic relatedness with STEC strains previously isolated from animal sources in Bangladesh. We investigated a total of 213 food samples, including 90 raw meat samples collected from retail butcher shops, 20 raw milk samples from domestic cattle, and 103 fresh juice samples from street vendors in Dhaka city. We found that more than 68% (n = 62) of the raw meat samples were positive for the stx gene(s); 34% (n = 21) of buffalo meats and 66% (n = 41) of beef. Approximately 10% (n = 2) of the raw milk and 8% (n = 8) of the fresh juice samples were positive for stx. We isolated STEC O157 from seven meat samples (7.8%), of which two were from buffalo meats and five from beef; and no other STEC serotypes could be isolated. We could not isolate STEC from any of the stx-positive raw milk and juice samples. The STEC O157 isolates from raw meats were positive for the stx(2), eae, katP, etpD, and enterohemorrhagic E. coli hly virulence genes, and they belonged to three different phage types: 8 (14.3%), 31 (42.8%), and 32 (42.8%). Pulsed-field gel electrophoresis (PFGE) typing revealed six distinct patterns among seven isolates of STEC O157, suggesting a heterogeneous clonal diversity. Of the six PFGE patterns, one was identical and the other two were ≥90% related to PFGE patterns of STEC O157 strains previously isolated from animal feces, indicating that raw meats are readily contaminated with fecal materials. This study represents the first survey of STEC in the food chain in Bangladesh.

  6. Developing a predictive model for the energy content of goat milk as the basis for a functional unit formulation to be used in the life cycle assessment of dairy goat production systems.

    Science.gov (United States)

    Danieli, P P; Ronchi, B

    2018-02-01

    Recent reports on livestock environmental impact based on life cycle assessment (LCA) did not fully consider the case of the dairy goat. Assignment of an environmental impact (e.g. global warming potential) to a specific product needs to be related to the appropriate 'unitary amount' or functional unit (FU). For milk, the energy content may provide a common basis for a definition of the FU. To date, no ad hoc formulations for the FU of goat milk have been proposed. For these reasons, this study aimed to develop and test one or more predictive models (DPMs) for the gross energy (GE) content of goat milk, based on published compositional data, such as fat (F), protein, total solids (TS), solid non-fat matter (SNF), lactose (Lac) and ash. The DPMs were developed, selected and tested using a linear regression approach, as a meta-analysis (i.e. meta-regression) was not applicable. However, in the final stage, a control procedure for spurious findings was carried out using a Monte Carlo permutation test. Because several published predictive models (PPMs) for GE in cow milk and goat milk were found in the literature, they were tested on the same data set with which the DPMs were developed. The best-performing DPMs and PPMs were compared directly with a subset of the individual data retrieved from the literature. Overall, the paucity of direct measurements of the GE in goat milk was a limiting factor in collecting data from the literature; thus, only a small data set (n=26) was established, even though it was considered sufficiently representative of milks from different goat breeds. The three best PPMs based on F alone gave more biased estimates of the GE content of the goat milk than the three new DPMs based on F, F and SNF and F and TS, respectively. Accordingly, three different formulations of FU are proposed, depending on the availability of data including both F and TS (or F and SNF) or F alone. Even though several metrics can be used in defining the FU for milk to

  7. Functional Properties of Lactobacillus mucosae Strains Isolated from Brazilian Goat Milk.

    Science.gov (United States)

    de Moraes, Georgia Maciel Dias; de Abreu, Louricélia Rodrigues; do Egito, Antônio Silvio; Salles, Hévila Oliveira; da Silva, Liana Maria Ferreira; Nero, Luís Augusto; Todorov, Svetoslav Dimitrov; Dos Santos, Karina Maria Olbrich

    2017-09-01

    The search for probiotic candidates among lactic acid bacteria (LAB) isolated from food may uncover new strains with promising health and technological properties. Lactobacillus mucosae strains attracted recent research attention due to their ability to adhere to intestinal mucus and to inhibit pathogens in the gastrointestinal tract, both related to a probiotic potential. Properties of interest and safety aspects of three Lb. mucosae strains (CNPC006, CNPC007, and CNPC009) isolated from goat milk were investigated employing in vitro tests. The presence of genetic factors related to bile salt hydrolase production (bsh), intestinal adhesion properties (msa, map, mub, and ef-tu), virulence, and biogenic amine production were also verified. All strains exhibited the target map, mub, and ef-tu sequences; the msa gene was detected in CNPC006 and CNPC007 strains. Some of the searched sequences for virulence factors were detected, especially in the CNPC009 strain; all strains carried the hyl gene, related to the production of hyaluronidase. Lb. mucosae CNPC007 exhibited a high survival rate in simulated gastric and enteric conditions. Besides, all strains exhibited the bsh sequence, and CNPC006 and CNPC007 were able to deconjugate salts of glycodeoxycholic acid (GDC). Regarding technological properties for dairy product applications, a relatively higher milk acidification and clotting capacity, diacetyl production, and proteolytic activity were registered for CNPC007 in comparison to the other strains. Collectively, the results aim at Lb. mucosae CNPC007 as a promising probiotic candidate for application in dairy products, deserving further studies to confirm and explore its potential.

  8. Potential probiotic properties of Lactobacilli isolated from goat´s milk

    Directory of Open Access Journals (Sweden)

    Martin Tomáška

    2015-05-01

    Full Text Available The three strains of lactobacilli isolated from goat's milk - Lactobacillus (Lbc. casei 21L10, Lbc. johnsonii KB2-1 and Lbc. plantarum 25/1L were selected in previous studies because they showed good processing and protective properties in production of cheeses or lactic acid beverages from heat-treated milk or in model conditions. The aim of this study was to evaluate their potential probiotic properties: resistance to lysozyme, survival in gastrointestinal tract, and hydrophobicity. Testing was carried out in vitro methods: comparison of growth and metabolic characteristics of the strains when cultivated in Man, Rogosa and Sharpe medium with and without the addition of lysozyme (400 mg.mL-1; viability of strains after incubation in simulated environment of gastric juice (pH = 2.0, pepsin and subsequently in simulated small intestinal juice (pH = 8.0, pancreatin, bile salts and an ability to adhere to the non-polar solvent in the two-phase system: xylene-water. Lbc. casei 21L10 and Lbc. johnsonii KB2-1 were resistant to the effect of lysozyme, the strain Lbc. plantarum 25/1L was moderately susceptible. To the action of simulated gastric juice was resistant only the Lbc. johnsonii KB2-1, that was subsequently inhibited in simulated small intestinal juice. When using xylene as a model agent, all strains were not hydrophobic. From all the tested strains, Lbc. johnsonii KB2-1 showed good potential probiotic properties, particularly in relation to resistance to lysozyme and the simulated environment of gastric juice.

  9. [Instinct therapy--raw food with meat with exclusion of milk products. Report No. 16].

    Science.gov (United States)

    Jallut, O

    1989-06-13

    Instinct therapy is a diet consisting exclusively of food in its natural form, which has not been subjected to cooking, preserving or seasoning. Dairy products are forbidden. Indications are numerous and rather imprecise including especially cancer. Burger developed Instinct therapy in 1964 as a diet according to his own philosophy. 1980 he left Switzerland because the practice of "metasexuality" had caused him problems with the law. He founded a school of Instinct therapy in 1982 in France and published his book "La guerre du cru" (The Raw Food Fi