A single nucleotide polymorphism (SNP) assay for population ...
African Journals Online (AJOL)
A single nucleotide polymorphism (SNP) assay for population stratification test ... phenotypes and unlinked candidate loci in case-control and cohort studies of ... Key words: Chinese, Japanese, population stratification, ancestry informative ...
Directory of Open Access Journals (Sweden)
Sven Stringer
Full Text Available Complex diseases are often highly heritable. However, for many complex traits only a small proportion of the heritability can be explained by observed genetic variants in traditional genome-wide association (GWA studies. Moreover, for some of those traits few significant SNPs have been identified. Single SNP association methods test for association at a single SNP, ignoring the effect of other SNPs. We show using a simple multi-locus odds model of complex disease that moderate to large effect sizes of causal variants may be estimated as relatively small effect sizes in single SNP association testing. This underestimation effect is most severe for diseases influenced by numerous risk variants. We relate the underestimation effect to the concept of non-collapsibility found in the statistics literature. As described, continuous phenotypes generated with linear genetic models are not affected by this underestimation effect. Since many GWA studies apply single SNP analysis to dichotomous phenotypes, previously reported results potentially underestimate true effect sizes, thereby impeding identification of true effect SNPs. Therefore, when a multi-locus model of disease risk is assumed, a multi SNP analysis may be more appropriate.
Development of a single nucleotide polymorphism (SNP) marker for ...
African Journals Online (AJOL)
The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...
SNP-PHAGE – High throughput SNP discovery pipeline
Directory of Open Access Journals (Sweden)
Cregan Perry B
2006-10-01
Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs as defined here are single base sequence changes or short insertion/deletions between or within individuals of a given species. As a result of their abundance and the availability of high throughput analysis technologies SNP markers have begun to replace other traditional markers such as restriction fragment length polymorphisms (RFLPs, amplified fragment length polymorphisms (AFLPs and simple sequence repeats (SSRs or microsatellite markers for fine mapping and association studies in several species. For SNP discovery from chromatogram data, several bioinformatics programs have to be combined to generate an analysis pipeline. Results have to be stored in a relational database to facilitate interrogation through queries or to generate data for further analyses such as determination of linkage disequilibrium and identification of common haplotypes. Although these tasks are routinely performed by several groups, an integrated open source SNP discovery pipeline that can be easily adapted by new groups interested in SNP marker development is currently unavailable. Results We developed SNP-PHAGE (SNP discovery Pipeline with additional features for identification of common haplotypes within a sequence tagged site (Haplotype Analysis and GenBank (-dbSNP submissions. This tool was applied for analyzing sequence traces from diverse soybean genotypes to discover over 10,000 SNPs. This package was developed on UNIX/Linux platform, written in Perl and uses a MySQL database. Scripts to generate a user-friendly web interface are also provided with common queries for preliminary data analysis. A machine learning tool developed by this group for increasing the efficiency of SNP discovery is integrated as a part of this package as an optional feature. The SNP-PHAGE package is being made available open source at http://bfgl.anri.barc.usda.gov/ML/snp-phage/. Conclusion SNP-PHAGE provides a bioinformatics
SNP genotyping by DNA photoligation: application to SNP detection of genes from food crops
Energy Technology Data Exchange (ETDEWEB)
Yoshimura, Yoshinaga; Ohtake, Tomoko; Okada, Hajime; Fujimoto, Kenzo [School of Materials Science, Japan Advanced Institute of Science and Technology, 1-1 Asahidai, Nomi, Ishikawa 923-1292 (Japan); Ami, Takehiro [Innovation Plaza Ishikawa, Japan Science and Technology Agency, 2-13 Asahidai, Nomi, Ishikawa 923-1211 (Japan); Tsukaguchi, Tadashi, E-mail: kenzo@jaist.ac.j [Faculty of Bioresources and Environmental Sciences, Ishikawa Prefectural University, 1-308 Suematsu, Nonoichi, Ishikawa 921-8836 (Japan)
2009-06-15
We describe a simple and inexpensive single-nucleotide polymorphism (SNP) typing method, using DNA photoligation with 5-carboxyvinyl-2'-deoxyuridine and two fluorophores. This SNP-typing method facilitates qualitative determination of genes from indica and japonica rice, and showed a high degree of single nucleotide specificity up to 10 000. This method can be used in the SNP typing of actual genomic DNA samples from food crops.
SNP genotyping by DNA photoligation: application to SNP detection of genes from food crops
Directory of Open Access Journals (Sweden)
Yoshinaga Yoshimura, Tomoko Ohtake, Hajime Okada, Takehiro Ami, Tadashi Tsukaguchi and Kenzo Fujimoto
2009-01-01
Full Text Available We describe a simple and inexpensive single-nucleotide polymorphism (SNP typing method, using DNA photoligation with 5-carboxyvinyl-2'-deoxyuridine and two fluorophores. This SNP-typing method facilitates qualitative determination of genes from indica and japonica rice, and showed a high degree of single nucleotide specificity up to 10 000. This method can be used in the SNP typing of actual genomic DNA samples from food crops.
Directory of Open Access Journals (Sweden)
Cheng-Hong Yang
2012-07-01
Full Text Available Cancers often involve the synergistic effects of gene–gene interactions, but identifying these interactions remains challenging. Here, we present an odds ratio-based genetic algorithm (OR-GA that is able to solve the problems associated with the simultaneous analysis of multiple independent single nucleotide polymorphisms (SNPs that are associated with oral cancer. The SNP interactions between four SNPs—namely rs1799782, rs2040639, rs861539, rs2075685, and belonging to four genes (XRCC1, XRCC2, XRCC3, and XRCC4—were tested in this study, respectively. The GA decomposes the SNPs sets into different SNP combinations with their corresponding genotypes (called SNP barcodes. The GA can effectively identify a specific SNP barcode that has an optimized fitness value and uses this to calculate the difference between the case and control groups. The SNP barcodes with a low fitness value are naturally removed from the population. Using two to four SNPs, the best SNP barcodes with maximum differences in occurrence between the case and control groups were generated by GA algorithm. Subsequently, the OR provides a quantitative measure of the multiple SNP synergies between the oral cancer and control groups by calculating the risk related to the best SNP barcodes and others. When these were compared to their corresponding non-SNP barcodes, the estimated ORs for oral cancer were found to be great than 1 [approx. 1.72–2.23; confidence intervals (CIs: 0.94–5.30, p < 0.03–0.07] for various specific SNP barcodes with two to four SNPs. In conclusion, the proposed OR-GA method successfully generates SNP barcodes, which allow oral cancer risk to be evaluated and in the process the OR-GA method identifies possible SNP–SNP interactions.
DEFF Research Database (Denmark)
Studer, Bruno; Kölliker, Roland
2013-01-01
In the recent years, single nucleotide polymorphism (SNP) markers have emerged as the marker technology of choice for plant genetics and breeding applications. Besides the efficient technologies available for SNP discovery even in complex genomes, one of the main reasons for this is the availabil...
Directory of Open Access Journals (Sweden)
Qian You
2018-02-01
Full Text Available Polypoid species play significant roles in agriculture and food production. Many crop species are polyploid, such as potato, wheat, strawberry, and sugarcane. Genotyping has been a daunting task for genetic studies of polyploid crops, which lags far behind the diploid crop species. Single nucleotide polymorphism (SNP array is considered to be one of, high-throughput, relatively cost-efficient and automated genotyping approaches. However, there are significant challenges for SNP identification in complex, polyploid genomes, which has seriously slowed SNP discovery and array development in polyploid species. Ploidy is a significant factor impacting SNP qualities and validation rates of SNP markers in SNP arrays, which has been proven to be a very important tool for genetic studies and molecular breeding. In this review, we (1 discussed the pros and cons of SNP array in general for high throughput genotyping, (2 presented the challenges of and solutions to SNP calling in polyploid species, (3 summarized the SNP selection criteria and considerations of SNP array design for polyploid species, (4 illustrated SNP array applications in several different polyploid crop species, then (5 discussed challenges, available software, and their accuracy comparisons for genotype calling based on SNP array data in polyploids, and finally (6 provided a series of SNP array design and genotype calling recommendations. This review presents a complete overview of SNP array development and applications in polypoid crops, which will benefit the research in molecular breeding and genetics of crops with complex genomes.
The clinical application of single-sperm-based SNP haplotyping for PGD of osteogenesis imperfecta.
Chen, Linjun; Diao, Zhenyu; Xu, Zhipeng; Zhou, Jianjun; Yan, Guijun; Sun, Haixiang
2018-05-15
Osteogenesis imperfecta (OI) is a genetically heterogeneous disorder, presenting either autosomal dominant, autosomal recessive or X-linked inheritance patterns. The majority of OI cases are autosomal dominant and are caused by heterozygous mutations in either the COL1A1 or COL1A2 gene. In these dominant disorders, allele dropout (ADO) can lead to misdiagnosis in preimplantation genetic diagnosis (PGD). Polymorphic markers linked to the mutated genes have been used to establish haplotypes for identifying ADO and ensuring the accuracy of PGD. However, the haplotype of male patients cannot be determined without data from affected relatives. Here, we developed a method for single-sperm-based single-nucleotide polymorphism (SNP) haplotyping via next-generation sequencing (NGS) for the PGD of OI. After NGS, 10 informative polymorphic SNP markers located upstream and downstream of the COL1A1 gene and its pathogenic mutation site were linked to individual alleles in a single sperm from an affected male. After haplotyping, a normal blastocyst was transferred to the uterus for a subsequent frozen embryo transfer cycle. The accuracy of PGD was confirmed by amniocentesis at 19 weeks of gestation. A healthy infant weighing 4,250 g was born via vaginal delivery at the 40th week of gestation. Single-sperm-based SNP haplotyping can be applied for PGD of any monogenic disorders or de novo mutations in males in whom the haplotype of paternal mutations cannot be determined due to a lack of affected relatives. ADO: allele dropout; DI: dentinogenesis imperfect; ESHRE: European Society of Human Reproduction and Embryology; FET: frozen embryo transfer; gDNA: genomic DNA; ICSI: intracytoplasmic sperm injection; IVF: in vitro fertilization; MDA: multiple displacement amplification; NGS: next-generation sequencing; OI: osteogenesis imperfect; PBS: phosphate buffer saline; PCR: polymerase chain reaction; PGD: preimplantation genetic diagnosis; SNP: single-nucleotide polymorphism; STR
Directory of Open Access Journals (Sweden)
Jari Louhelainen
2016-10-01
Full Text Available The papers published in this Special Issue “SNP arrays” (Single Nucleotide Polymorphism Arrays focus on several perspectives associated with arrays of this type. The range of papers vary from a case report to reviews, thereby targeting wider audiences working in this field. The research focus of SNP arrays is often human cancers but this Issue expands that focus to include areas such as rare conditions, animal breeding and bioinformatics tools. Given the limited scope, the spectrum of papers is nothing short of remarkable and even from a technical point of view these papers will contribute to the field at a general level. Three of the papers published in this Special Issue focus on the use of various SNP array approaches in the analysis of three different cancer types. Two of the papers concentrate on two very different rare conditions, applying the SNP arrays slightly differently. Finally, two other papers evaluate the use of the SNP arrays in the context of genetic analysis of livestock. The findings reported in these papers help to close gaps in the current literature and also to give guidelines for future applications of SNP arrays.
Directory of Open Access Journals (Sweden)
Steve Davis
2015-08-01
Full Text Available The analysis of next-generation sequence (NGS data is often a fragmented step-wise process. For example, multiple pieces of software are typically needed to map NGS reads, extract variant sites, and construct a DNA sequence matrix containing only single nucleotide polymorphisms (i.e., a SNP matrix for a set of individuals. The management and chaining of these software pieces and their outputs can often be a cumbersome and difficult task. Here, we present CFSAN SNP Pipeline, which combines into a single package the mapping of NGS reads to a reference genome with Bowtie2, processing of those mapping (BAM files using SAMtools, identification of variant sites using VarScan, and production of a SNP matrix using custom Python scripts. We also introduce a Python package (CFSAN SNP Mutator that when given a reference genome will generate variants of known position against which we validate our pipeline. We created 1,000 simulated Salmonella enterica sp. enterica Serovar Agona genomes at 100× and 20× coverage, each containing 500 SNPs, 20 single-base insertions and 20 single-base deletions. For the 100× dataset, the CFSAN SNP Pipeline recovered 98.9% of the introduced SNPs and had a false positive rate of 1.04 × 10−6; for the 20× dataset 98.8% of SNPs were recovered and the false positive rate was 8.34 × 10−7. Based on these results, CFSAN SNP Pipeline is a robust and accurate tool that it is among the first to combine into a single executable the myriad steps required to produce a SNP matrix from NGS data. Such a tool is useful to those working in an applied setting (e.g., food safety traceback investigations as well as for those interested in evolutionary questions.
Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor
DEFF Research Database (Denmark)
Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin
2013-01-01
We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from...... the sensor bias current to magnetize magnetic beads in the vicinity of the sensor. The method allows for real-time measurements of the specific bead binding to the sensor surface during DNA hybridization and washing. Compared to other magnetic biosensing platforms, our approach eliminates the need...... for external electromagnets and thus allows for miniaturization of the sensor platform....
SNP-SNP interactions in breast cancer susceptibility
Directory of Open Access Journals (Sweden)
Wang Yuanyuan
2006-05-01
Full Text Available Abstract Background Breast cancer predisposition genes identified to date (e.g., BRCA1 and BRCA2 are responsible for less than 5% of all breast cancer cases. Many studies have shown that the cancer risks associated with individual commonly occurring single nucleotide polymorphisms (SNPs are incremental. However, polygenic models suggest that multiple commonly occurring low to modestly penetrant SNPs of cancer related genes might have a greater effect on a disease when considered in combination. Methods In an attempt to identify the breast cancer risk conferred by SNP interactions, we have studied 19 SNPs from genes involved in major cancer related pathways. All SNPs were genotyped by TaqMan 5'nuclease assay. The association between the case-control status and each individual SNP, measured by the odds ratio and its corresponding 95% confidence interval, was estimated using unconditional logistic regression models. At the second stage, two-way interactions were investigated using multivariate logistic models. The robustness of the interactions, which were observed among SNPs with stronger functional evidence, was assessed using a bootstrap approach, and correction for multiple testing based on the false discovery rate (FDR principle. Results None of these SNPs contributed to breast cancer risk individually. However, we have demonstrated evidence for gene-gene (SNP-SNP interaction among these SNPs, which were associated with increased breast cancer risk. Our study suggests cross talk between the SNPs of the DNA repair and immune system (XPD-[Lys751Gln] and IL10-[G(-1082A], cell cycle and estrogen metabolism (CCND1-[Pro241Pro] and COMT-[Met108/158Val], cell cycle and DNA repair (BARD1-[Pro24Ser] and XPD-[Lys751Gln], and within carcinogen metabolism (GSTP1-[Ile105Val] and COMT-[Met108/158Val] pathways. Conclusion The importance of these pathways and their communication in breast cancer predisposition has been emphasized previously, but their
SNP-SNP interactions in breast cancer susceptibility
International Nuclear Information System (INIS)
Onay, Venüs Ümmiye; Ozcelik, Hilmi; Briollais, Laurent; Knight, Julia A; Shi, Ellen; Wang, Yuanyuan; Wells, Sean; Li, Hong; Rajendram, Isaac; Andrulis, Irene L
2006-01-01
Breast cancer predisposition genes identified to date (e.g., BRCA1 and BRCA2) are responsible for less than 5% of all breast cancer cases. Many studies have shown that the cancer risks associated with individual commonly occurring single nucleotide polymorphisms (SNPs) are incremental. However, polygenic models suggest that multiple commonly occurring low to modestly penetrant SNPs of cancer related genes might have a greater effect on a disease when considered in combination. In an attempt to identify the breast cancer risk conferred by SNP interactions, we have studied 19 SNPs from genes involved in major cancer related pathways. All SNPs were genotyped by TaqMan 5'nuclease assay. The association between the case-control status and each individual SNP, measured by the odds ratio and its corresponding 95% confidence interval, was estimated using unconditional logistic regression models. At the second stage, two-way interactions were investigated using multivariate logistic models. The robustness of the interactions, which were observed among SNPs with stronger functional evidence, was assessed using a bootstrap approach, and correction for multiple testing based on the false discovery rate (FDR) principle. None of these SNPs contributed to breast cancer risk individually. However, we have demonstrated evidence for gene-gene (SNP-SNP) interaction among these SNPs, which were associated with increased breast cancer risk. Our study suggests cross talk between the SNPs of the DNA repair and immune system (XPD-[Lys751Gln] and IL10-[G(-1082)A]), cell cycle and estrogen metabolism (CCND1-[Pro241Pro] and COMT-[Met108/158Val]), cell cycle and DNA repair (BARD1-[Pro24Ser] and XPD-[Lys751Gln]), and within carcinogen metabolism (GSTP1-[Ile105Val] and COMT-[Met108/158Val]) pathways. The importance of these pathways and their communication in breast cancer predisposition has been emphasized previously, but their biological interactions through SNPs have not been described
U.S. Department of Health & Human Services — dbSNP is a database of single nucleotide polymorphisms (SNPs) and multiple small-scale variations that include insertions/deletions, microsatellites, and...
Directory of Open Access Journals (Sweden)
Dana B Hancock
Full Text Available Genome-wide association studies have identified numerous genetic loci for spirometic measures of pulmonary function, forced expiratory volume in one second (FEV(1, and its ratio to forced vital capacity (FEV(1/FVC. Given that cigarette smoking adversely affects pulmonary function, we conducted genome-wide joint meta-analyses (JMA of single nucleotide polymorphism (SNP and SNP-by-smoking (ever-smoking or pack-years associations on FEV(1 and FEV(1/FVC across 19 studies (total N = 50,047. We identified three novel loci not previously associated with pulmonary function. SNPs in or near DNER (smallest P(JMA = 5.00×10(-11, HLA-DQB1 and HLA-DQA2 (smallest P(JMA = 4.35×10(-9, and KCNJ2 and SOX9 (smallest P(JMA = 1.28×10(-8 were associated with FEV(1/FVC or FEV(1 in meta-analysis models including SNP main effects, smoking main effects, and SNP-by-smoking (ever-smoking or pack-years interaction. The HLA region has been widely implicated for autoimmune and lung phenotypes, unlike the other novel loci, which have not been widely implicated. We evaluated DNER, KCNJ2, and SOX9 and found them to be expressed in human lung tissue. DNER and SOX9 further showed evidence of differential expression in human airway epithelium in smokers compared to non-smokers. Our findings demonstrated that joint testing of SNP and SNP-by-environment interaction identified novel loci associated with complex traits that are missed when considering only the genetic main effects.
Report on ISFG SNP Panel Discussion
DEFF Research Database (Denmark)
Butler, John M.; Budowle, B.; Gill, P.
2008-01-01
Six scientists presented their views and experience with single nucleotide polymorphism (SNP) markers, multiplexes, and methods regarding their potential application in forensic identity and relationship testing. Benefits and limitations of SNPs were reviewed, as were different SNP marker...
Directory of Open Access Journals (Sweden)
Yadav Sapkota
Full Text Available Genome-wide association studies (GWASs have identified low-penetrance common variants (i.e., single nucleotide polymorphisms, SNPs associated with breast cancer susceptibility. Although GWASs are primarily focused on single-locus effects, gene-gene interactions (i.e., epistasis are also assumed to contribute to the genetic risks for complex diseases including breast cancer. While it has been hypothesized that moderately ranked (P value based weak single-locus effects in GWASs could potentially harbor valuable information for evaluating epistasis, we lack systematic efforts to investigate SNPs showing consistent associations with weak statistical significance across independent discovery and replication stages. The objectives of this study were i to select SNPs showing single-locus effects with weak statistical significance for breast cancer in a GWAS and/or candidate-gene studies; ii to replicate these SNPs in an independent set of breast cancer cases and controls; and iii to explore their potential SNP-SNP interactions contributing to breast cancer susceptibility. A total of 17 SNPs related to DNA repair, modification and metabolism pathway genes were selected since these pathways offer a priori knowledge for potential epistatic interactions and an overall role in breast carcinogenesis. The study design included predominantly Caucasian women (2,795 cases and 4,505 controls from Alberta, Canada. We observed two two-way SNP-SNP interactions (APEX1-rs1130409 and RPAP1-rs2297381; MLH1-rs1799977 and MDM2-rs769412 in logistic regression that conferred elevated risks for breast cancer (P(interaction<7.3 × 10(-3. Logic regression identified an interaction involving four SNPs (MBD2-rs4041245, MLH1-rs1799977, MDM2-rs769412, BRCA2-rs1799943 (P(permutation = 2.4 × 10(-3. SNPs involved in SNP-SNP interactions also showed single-locus effects with weak statistical significance, while BRCA2-rs1799943 showed stronger statistical significance (P
saSNP Approach for Scalable SNP Analyses of Multiple Bacterial or Viral Genomes
Energy Technology Data Exchange (ETDEWEB)
Gardner, Shea [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Slezak, Tom [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)
2010-07-27
With the flood of whole genome finished and draft microbial sequences, we need faster, more scalable bioinformatics tools for sequence comparison. An algorithm is described to find single nucleotide polymorphisms (SNPs) in whole genome data. It scales to hundreds of bacterial or viral genomes, and can be used for finished and/or draft genomes available as unassembled contigs. The method is fast to compute, finding SNPs and building a SNP phylogeny in seconds to hours. We use it to identify thousands of putative SNPs from all publicly available Filoviridae, Poxviridae, foot-and-mouth disease virus, Bacillus, and Escherichia coli genomes and plasmids. The SNP-based trees that result are consistent with known taxonomy and trees determined in other studies. The approach we describe can handle as input hundreds of gigabases of sequence in a single run. The algorithm is based on k-mer analysis using a suffix array, so we call it saSNP.
SNPServer: a real-time SNP discovery tool.
Savage, David; Batley, Jacqueline; Erwin, Tim; Logan, Erica; Love, Christopher G; Lim, Geraldine A C; Mongin, Emmanuel; Barker, Gary; Spangenberg, German C; Edwards, David
2005-07-01
SNPServer is a real-time flexible tool for the discovery of SNPs (single nucleotide polymorphisms) within DNA sequence data. The program uses BLAST, to identify related sequences, and CAP3, to cluster and align these sequences. The alignments are parsed to the SNP discovery software autoSNP, a program that detects SNPs and insertion/deletion polymorphisms (indels). Alternatively, lists of related sequences or pre-assembled sequences may be entered for SNP discovery. SNPServer and autoSNP use redundancy to differentiate between candidate SNPs and sequence errors. For each candidate SNP, two measures of confidence are calculated, the redundancy of the polymorphism at a SNP locus and the co-segregation of the candidate SNP with other SNPs in the alignment. SNPServer is available at http://hornbill.cspp.latrobe.edu.au/snpdiscovery.html.
Exhaustive Genome-Wide Search for SNP-SNP Interactions Across 10 Human Diseases
Directory of Open Access Journals (Sweden)
William Murk
2016-07-01
Full Text Available The identification of statistical SNP-SNP interactions may help explain the genetic etiology of many human diseases, but exhaustive genome-wide searches for these interactions have been difficult, due to a lack of power in most datasets. We aimed to use data from the Resource for Genetic Epidemiology Research on Adult Health and Aging (GERA study to search for SNP-SNP interactions associated with 10 common diseases. FastEpistasis and BOOST were used to evaluate all pairwise interactions among approximately N = 300,000 single nucleotide polymorphisms (SNPs with minor allele frequency (MAF ≥ 0.15, for the dichotomous outcomes of allergic rhinitis, asthma, cardiac disease, depression, dermatophytosis, type 2 diabetes, dyslipidemia, hemorrhoids, hypertensive disease, and osteoarthritis. A total of N = 45,171 subjects were included after quality control steps were applied. These data were divided into discovery and replication subsets; the discovery subset had > 80% power, under selected models, to detect genome-wide significant interactions (P < 10−12. Interactions were also evaluated for enrichment in particular SNP features, including functionality, prior disease relevancy, and marginal effects. No interaction in any disease was significant in both the discovery and replication subsets. Enrichment analysis suggested that, for some outcomes, interactions involving SNPs with marginal effects were more likely to be nominally replicated, compared to interactions without marginal effects. If SNP-SNP interactions play a role in the etiology of the studied conditions, they likely have weak effect sizes, involve lower-frequency variants, and/or involve complex models of interaction that are not captured well by the methods that were utilized.
Directory of Open Access Journals (Sweden)
Johnson Peter W
2006-03-01
Full Text Available Abstract Background The MDM2 gene encodes a negative regulator of the p53 tumour suppressor protein. A single nucleotide polymorphism (SNP in the MDM2 promoter (a T to G exchange at nucleotide 309 has been reported to produce accelerated tumour formation in individuals with inherited p53 mutations. We have investigated the effect of the MDM2 SNP309 on clinical outcome in a cohort of patients with germline mutations of BRCA1. Methods Genomic DNA was obtained for 102 healthy controls and 116 patients with established pathogenic mutations of BRCA1 and Pyrosequencing technology™ was used to determine the genotype at the MDM2 SNP309 locus. Results The polymorphism was present in 52.9% of the controls (G/T in 37.3% and G/G in 15.6% and 58.6% of the BRCA1 mutation carriers (47.4% G/T and 11.2% G/G. Incidence of malignancy in female BRCA1 carriers was not significantly higher in SNP309 carriers than in wildtype (T/T individuals (72.7% vs. 75.6%, p = 1.00. Mean age of diagnosis of first breast cancer was 41.2 years in the SNP309 G/G genotype carriers, 38.6 years in those with the SNP309 G/T genotype and 39.0 years in wildtype subjects (p = 0.80. Conclusion We found no evidence that the MDM2 SNP309 accelerates tumour development in carriers of known pathogenic germline mutations of BRCA1.
Detecting imbalanced expression of SNP alleles by minisequencing on microarrays
Directory of Open Access Journals (Sweden)
Dahlgren Andreas
2004-10-01
Full Text Available Abstract Background Each of the human genes or transcriptional units is likely to contain single nucleotide polymorphisms that may give rise to sequence variation between individuals and tissues on the level of RNA. Based on recent studies, differential expression of the two alleles of heterozygous coding single nucleotide polymorphisms (SNPs may be frequent for human genes. Methods with high accuracy to be used in a high throughput setting are needed for systematic surveys of expressed sequence variation. In this study we evaluated two formats of multiplexed, microarray based minisequencing for quantitative detection of imbalanced expression of SNP alleles. We used a panel of ten SNPs located in five genes known to be expressed in two endothelial cell lines as our model system. Results The accuracy and sensitivity of quantitative detection of allelic imbalance was assessed for each SNP by constructing regression lines using a dilution series of mixed samples from individuals of different genotype. Accurate quantification of SNP alleles by both assay formats was evidenced for by R2 values > 0.95 for the majority of the regression lines. According to a two sample t-test, we were able to distinguish 1–9% of a minority SNP allele from a homozygous genotype, with larger variation between SNPs than between assay formats. Six of the SNPs, heterozygous in either of the two cell lines, were genotyped in RNA extracted from the endothelial cells. The coefficient of variation between the fluorescent signals from five parallel reactions was similar for cDNA and genomic DNA. The fluorescence signal intensity ratios measured in the cDNA samples were compared to those in genomic DNA to determine the relative expression levels of the two alleles of each SNP. Four of the six SNPs tested displayed a higher than 1.4-fold difference in allelic ratios between cDNA and genomic DNA. The results were verified by allele-specific oligonucleotide hybridisation and
An improved PSO algorithm for generating protective SNP barcodes in breast cancer.
Directory of Open Access Journals (Sweden)
Li-Yeh Chuang
Full Text Available BACKGROUND: Possible single nucleotide polymorphism (SNP interactions in breast cancer are usually not investigated in genome-wide association studies. Previously, we proposed a particle swarm optimization (PSO method to compute these kinds of SNP interactions. However, this PSO does not guarantee to find the best result in every implement, especially when high-dimensional data is investigated for SNP-SNP interactions. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we propose IPSO algorithm to improve the reliability of PSO for the identification of the best protective SNP barcodes (SNP combinations and genotypes with maximum difference between cases and controls associated with breast cancer. SNP barcodes containing different numbers of SNPs were computed. The top five SNP barcode results are retained for computing the next SNP barcode with a one-SNP-increase for each processing step. Based on the simulated data for 23 SNPs of six steroid hormone metabolisms and signalling-related genes, the performance of our proposed IPSO algorithm is evaluated. Among 23 SNPs, 13 SNPs displayed significant odds ratio (OR values (1.268 to 0.848; p<0.05 for breast cancer. Based on IPSO algorithm, the jointed effect in terms of SNP barcodes with two to seven SNPs show significantly decreasing OR values (0.84 to 0.57; p<0.05 to 0.001. Using PSO algorithm, two to four SNPs show significantly decreasing OR values (0.84 to 0.77; p<0.05 to 0.001. Based on the results of 20 simulations, medians of the maximum differences for each SNP barcode generated by IPSO are higher than by PSO. The interquartile ranges of the boxplot, as well as the upper and lower hinges for each n-SNP barcode (n = 3∼10 are more narrow in IPSO than in PSO, suggesting that IPSO is highly reliable for SNP barcode identification. CONCLUSIONS/SIGNIFICANCE: Overall, the proposed IPSO algorithm is robust to provide exact identification of the best protective SNP barcodes for breast cancer.
Mouse SNP Miner: an annotated database of mouse functional single nucleotide polymorphisms
Directory of Open Access Journals (Sweden)
Ramensky Vasily E
2007-01-01
Full Text Available Abstract Background The mapping of quantitative trait loci in rat and mouse has been extremely successful in identifying chromosomal regions associated with human disease-related phenotypes. However, identifying the specific phenotype-causing DNA sequence variations within a quantitative trait locus has been much more difficult. The recent availability of genomic sequence from several mouse inbred strains (including C57BL/6J, 129X1/SvJ, 129S1/SvImJ, A/J, and DBA/2J has made it possible to catalog DNA sequence differences within a quantitative trait locus derived from crosses between these strains. However, even for well-defined quantitative trait loci ( Description To help identify functional DNA sequence variations within quantitative trait loci we have used the Ensembl annotated genome sequence to compile a database of mouse single nucleotide polymorphisms (SNPs that are predicted to cause missense, nonsense, frameshift, or splice site mutations (available at http://bioinfo.embl.it/SnpApplet/. For missense mutations we have used the PolyPhen and PANTHER algorithms to predict whether amino acid changes are likely to disrupt protein function. Conclusion We have developed a database of mouse SNPs predicted to cause missense, nonsense, frameshift, and splice-site mutations. Our analysis revealed that 20% and 14% of missense SNPs are likely to be deleterious according to PolyPhen and PANTHER, respectively, and 6% are considered deleterious by both algorithms. The database also provides gene expression and functional annotations from the Symatlas, Gene Ontology, and OMIM databases to further assess candidate phenotype-causing mutations. To demonstrate its utility, we show that Mouse SNP Miner successfully finds a previously identified candidate SNP in the taste receptor, Tas1r3, that underlies sucrose preference in the C57BL/6J strain. We also use Mouse SNP Miner to derive a list of candidate phenotype-causing mutations within a previously
Chuang, Li-Yeh; Lane, Hsien-Yuan; Lin, Yu-Da; Lin, Ming-Teng; Yang, Cheng-Hong; Chang, Hsueh-Wei
2014-01-01
Facial emotion perception (FEP) can affect social function. We previously reported that parts of five tested single-nucleotide polymorphisms (SNPs) in the MET and AKT1 genes may individually affect FEP performance. However, the effects of SNP-SNP interactions on FEP performance remain unclear. This study compared patients with high and low FEP performances (n = 89 and 93, respectively). A particle swarm optimization (PSO) algorithm was used to identify the best SNP barcodes (i.e., the SNP combinations and genotypes that revealed the largest differences between the high and low FEP groups). The analyses of individual SNPs showed no significant differences between the high and low FEP groups. However, comparisons of multiple SNP-SNP interactions involving different combinations of two to five SNPs showed that the best PSO-generated SNP barcodes were significantly associated with high FEP score. The analyses of the joint effects of the best SNP barcodes for two to five interacting SNPs also showed that the best SNP barcodes had significantly higher odds ratios (2.119 to 3.138; P < 0.05) compared to other SNP barcodes. In conclusion, the proposed PSO algorithm effectively identifies the best SNP barcodes that have the strongest associations with FEP performance. This study also proposes a computational methodology for analyzing complex SNP-SNP interactions in social cognition domains such as recognition of facial emotion.
Population genetic analysis of ascertained SNP data
Directory of Open Access Journals (Sweden)
Nielsen Rasmus
2004-03-01
Full Text Available Abstract The large single nucleotide polymorphism (SNP typing projects have provided an invaluable data resource for human population geneticists. Almost all of the available SNP loci, however, have been identified through a SNP discovery protocol that will influence the allelic distributions in the sampled loci. Standard methods for population genetic analysis based on the available SNP data will, therefore, be biased. This paper discusses the effect of this ascertainment bias on allelic distributions and on methods for quantifying linkage disequilibrium and estimating demographic parameters. Several recently developed methods for correcting for the ascertainment bias will also be discussed.
SAQC: SNP Array Quality Control
Directory of Open Access Journals (Sweden)
Li Ling-Hui
2011-04-01
Full Text Available Abstract Background Genome-wide single-nucleotide polymorphism (SNP arrays containing hundreds of thousands of SNPs from the human genome have proven useful for studying important human genome questions. Data quality of SNP arrays plays a key role in the accuracy and precision of downstream data analyses. However, good indices for assessing data quality of SNP arrays have not yet been developed. Results We developed new quality indices to measure the quality of SNP arrays and/or DNA samples and investigated their statistical properties. The indices quantify a departure of estimated individual-level allele frequencies (AFs from expected frequencies via standardized distances. The proposed quality indices followed lognormal distributions in several large genomic studies that we empirically evaluated. AF reference data and quality index reference data for different SNP array platforms were established based on samples from various reference populations. Furthermore, a confidence interval method based on the underlying empirical distributions of quality indices was developed to identify poor-quality SNP arrays and/or DNA samples. Analyses of authentic biological data and simulated data show that this new method is sensitive and specific for the detection of poor-quality SNP arrays and/or DNA samples. Conclusions This study introduces new quality indices, establishes references for AFs and quality indices, and develops a detection method for poor-quality SNP arrays and/or DNA samples. We have developed a new computer program that utilizes these methods called SNP Array Quality Control (SAQC. SAQC software is written in R and R-GUI and was developed as a user-friendly tool for the visualization and evaluation of data quality of genome-wide SNP arrays. The program is available online (http://www.stat.sinica.edu.tw/hsinchou/genetics/quality/SAQC.htm.
DEFF Research Database (Denmark)
Børsting, Claus; Rockenbauer, Eszter; Morling, Niels
2009-01-01
cases and 33 twin cases were typed at least twice for the 49 SNPs. All electropherograms were analysed independently by two expert analysts prior to approval. Based on these results, detailed guidelines for analysis of the SBE products were developed. With these guidelines, the peak height ratio...... of a heterozygous allele call or the signal to noise ratio of a homozygous allele call is compared with previously obtained ratios. A laboratory protocol for analysis of SBE products was developed where allele calls with unusual ratios were highlighted to facilitate the analysis of difficult allele calls......A multiplex assay with 49 autosomal single nucleotide polymorphisms (SNPs) developed for human identification was validated for forensic genetic casework and accredited according to the ISO 17025 standard. The multiplex assay was based on the SNPforID 52plex SNP assay [J.J. Sanchez, C. Phillips, C...
SNP mining porcine ESTs with MAVIANT, a novel tool for SNP evaluation and annotation
DEFF Research Database (Denmark)
Panitz, Frank; Stengaard, Henrik; Hornshoj, Henrik
2007-01-01
MOTIVATION: Single nucleotide polymorphisms (SNPs) analysis is an important means to study genetic variation. A fast and cost-efficient approach to identify large numbers of novel candidates is the SNP mining of large scale sequencing projects. The increasing availability of sequence trace data...... manual annotation, which is immediately accessible and can be easily shared with external collaborators. RESULTS: Large-scale SNP mining of polymorphisms bases on porcine EST sequences yielded more than 7900 candidate SNPs in coding regions (cSNPs), which were annotated relative to the human genome. Non...
Gardner, Shea N; Hall, Barry G
2013-01-01
Effective use of rapid and inexpensive whole genome sequencing for microbes requires fast, memory efficient bioinformatics tools for sequence comparison. The kSNP v2 software finds single nucleotide polymorphisms (SNPs) in whole genome data. kSNP v2 has numerous improvements over kSNP v1 including SNP gene annotation; better scaling for draft genomes available as assembled contigs or raw, unassembled reads; a tool to identify the optimal value of k; distribution of packages of executables for Linux and Mac OS X for ease of installation and user-friendly use; and a detailed User Guide. SNP discovery is based on k-mer analysis, and requires no multiple sequence alignment or the selection of a single reference genome. Most target sets with hundreds of genomes complete in minutes to hours. SNP phylogenies are built by maximum likelihood, parsimony, and distance, based on all SNPs, only core SNPs, or SNPs present in some intermediate user-specified fraction of targets. The SNP-based trees that result are consistent with known taxonomy. kSNP v2 can handle many gigabases of sequence in a single run, and if one or more annotated genomes are included in the target set, SNPs are annotated with protein coding and other information (UTRs, etc.) from Genbank file(s). We demonstrate application of kSNP v2 on sets of viral and bacterial genomes, and discuss in detail analysis of a set of 68 finished E. coli and Shigella genomes and a set of the same genomes to which have been added 47 assemblies and four "raw read" genomes of H104:H4 strains from the recent European E. coli outbreak that resulted in both bloody diarrhea and hemolytic uremic syndrome (HUS), and caused at least 50 deaths.
Joseph, S; Schmidt, L M; Danquah, W B; Timper, P; Mekete, T
2017-02-01
To generate single spore lines of a population of bacterial parasite of root-knot nematode (RKN), Pasteuria penetrans, isolated from Florida and examine genotypic variation and virulence characteristics exist within the population. Six single spore lines (SSP), 16SSP, 17SSP, 18SSP, 25SSP, 26SSP and 30SSP were generated. Genetic variability was evaluated by comparing single-nucleotide polymorphisms (SNPs) in six protein-coding genes and the 16S rRNA gene. An average of one SNP was observed for every 69 bp in the 16S rRNA, whereas no SNPs were observed in the protein-coding sequences. Hierarchical cluster analysis of 16S rRNA sequences placed the clones into three distinct clades. Bio-efficacy analysis revealed significant heterogeneity in the level virulence and host specificity between the individual clones. The SNP markers developed to the 5' hypervariable region of the 16S rRNA gene may be useful in biotype differentiation within a population of P. penetrans. This study demonstrates an efficient method for generating single spore lines of P. penetrans and gives a deep insight into genetic heterogeneity and varying level of virulence exists within a population parasitizing a specific Meloidogyne sp. host. The results also suggest that the application of generalist spore lines in nematode management may achieve broad RKN control. © 2016 The Society for Applied Microbiology.
Wei, Yi-Liang; Wei, Li; Zhao, Lei; Sun, Qi-Fan; Jiang, Li; Zhang, Tao; Liu, Hai-Bo; Chen, Jian-Gang; Ye, Jian; Hu, Lan; Li, Cai-Xia
2016-01-01
A single-tube multiplex assay of a small set of ancestry-informative markers (AIMs) for effectively estimating individual ancestry and admixture is an ideal forensic tool to trace the population origin of an unknown DNA sample. We present a newly developed 27-plex single nucleotide polymorphism (SNP) panel with highly robust and balanced differential power to perfectly assign individuals to African, European, and East Asian ancestries. Evaluating 968 previously described intercontinental AIMs from three HapMap population genotyping datasets (Yoruban in Ibadan, Nigeria (YRI); Utah residents with Northern and Western European ancestry from the Centre de'Etude du Polymorphism Humain (CEPH) collection (CEU); and Han Chinese in Beijing, China (CHB)), the best set of markers was selected on the basis of Hardy-Weinberg equilibrium (p > 0.00001), population-specific allele frequency (two of three δ values >0.5), according to linkage disequilibrium (r (2) ancestry of the 11 populations in the HapMap project. Then, we tested the 27-plex SNP assay with 1164 individuals from 17 additional populations. The results demonstrated that the SNP panel was successful for ancestry inference of individuals with African, European, and East Asian ancestry. Furthermore, the system performed well when inferring the admixture of Eurasians (EUR/EAS) after analyzing admixed populations from Xinjiang (Central Asian) as follows: Tajik (68:27), Uyghur (49:46), Kirgiz (40:57), and Kazak (36:60). For individual analyses, we interpreted each sample with a three-ancestry component percentage and a population match probability sequence. This multiplex assay is a convenient and cost-effective tool to assist in criminal investigations, as well as to correct for the effects of population stratification for case-control studies.
Snap: an integrated SNP annotation platform
DEFF Research Database (Denmark)
Li, Shengting; Ma, Lijia; Li, Heng
2007-01-01
Snap (Single Nucleotide Polymorphism Annotation Platform) is a server designed to comprehensively analyze single genes and relationships between genes basing on SNPs in the human genome. The aim of the platform is to facilitate the study of SNP finding and analysis within the framework of medical...
(SNP) markers for the Chinese black sleeper, Bostrychus sinensis
African Journals Online (AJOL)
We characterized 11 single nucleotide ploymorphism (SNP) markers for the Chinese black sleeper, Bostrychus sinensis. These markers were isolated from a genomic library and tested in ten geographically distant individuals of B. sinensis. Polymorphisms of these SNP loci were assessed using a wild population including ...
Tri-allelic SNP markers enable analysis of mixed and degraded DNA samples.
Westen, Antoinette A; Matai, Anuska S; Laros, Jeroen F J; Meiland, Hugo C; Jasper, Mandy; de Leeuw, Wiljo J F; de Knijff, Peter; Sijen, Titia
2009-09-01
For the analysis of degraded DNA in disaster victim identification (DVI) and criminal investigations, single nucleotide polymorphisms (SNPs) have been recognized as promising markers mainly because they can be analyzed in short sized amplicons. Most SNPs are bi-allelic and are thereby ineffective to detect mixtures, which may lead to incorrect genotyping. We developed an algorithm to find non-binary (i.e. tri-allelic or tetra-allelic) SNPs in the NCBI dbSNP database. We selected 31 potential tri-allelic SNPs with a minor allele frequency of at least 10%. The tri-allelic nature was confirmed for 15 SNPs residing on 14 different chromosomes. Multiplex SNaPshot assays were developed, and the allele frequencies of 16 SNPs were determined among 153 Dutch and 111 Netherlands Antilles reference samples. Using these multiplex SNP assays, the presence of a mixture of two DNA samples in a ratio up to 1:8 could be recognized reliably. Furthermore, we compared the genotyping efficiency of the tri-allelic SNP markers and short tandem repeat (STR) markers by analyzing artificially degraded DNA and DNA from 30 approximately 500-year-old bone and molar samples. In both types of degraded DNA samples, the larger sized STR amplicons failed to amplify whereas the tri-allelic SNP markers still provided valuable information. In conclusion, tri-allelic SNP markers are suited for the analysis of degraded DNA and enable the detection of a second DNA source in a sample.
Directory of Open Access Journals (Sweden)
Gwilym D Haynes
Full Text Available Single nucleotide polymorphisms (SNPs are growing in popularity as a genetic marker for investigating evolutionary processes. A panel of SNPs is often developed by comparing large quantities of DNA sequence data across multiple individuals to identify polymorphic sites. For non-model species, this is particularly difficult, as performing the necessary large-scale genomic sequencing often exceeds the resources available for the project. In this study, we trial the Bovine SNP50 BeadChip developed in cattle (Bos taurus for identifying polymorphic SNPs in cervids Odocoileus hemionus (mule deer and black-tailed deer and O. virginianus (white-tailed deer in the Pacific Northwest. We found that 38.7% of loci could be genotyped, of which 5% (n = 1068 were polymorphic. Of these 1068 polymorphic SNPs, a mixture of putatively neutral loci (n = 878 and loci under selection (n = 190 were identified with the F(ST-outlier method. A range of population genetic analyses were implemented using these SNPs and a panel of 10 microsatellite loci. The three types of deer could readily be distinguished with both the SNP and microsatellite datasets. This study demonstrates that commercially developed SNP chips are a viable means of SNP discovery for non-model organisms, even when used between very distantly related species (the Bovidae and Cervidae families diverged some 25.1-30.1 million years before present.
Differentiation of drug and non-drug Cannabis using a single nucleotide polymorphism (SNP) assay.
Rotherham, D; Harbison, S A
2011-04-15
Cannabis sativa is both an illegal drug and a legitimate crop. The differentiation of illegal drug Cannabis from non-drug forms of Cannabis is relevant in the context of the growth of fibre and seed oil varieties of Cannabis for commercial purposes. This differentiation is currently determined based on the levels of tetrahydrocannabinol (THC) in adult plants. DNA based methods have the potential to assay Cannabis material unsuitable for analysis using conventional means including seeds, pollen and severely degraded material. The purpose of this research was to develop a single nucleotide polymorphism (SNP) assay for the differentiation of "drug" and "non-drug"Cannabis plants. An assay was developed based on four polymorphisms within a 399 bp fragment of the tetrahydrocannabinolic acid (THCA) synthase gene, utilising the snapshot multiplex kit. This SNP assay was tested on 94 Cannabis plants, which included 10 blind samples, and was able to differentiate between "drug" and "non-drug"Cannabis in all cases, while also differentiating between Cannabis and other species. Non-drug plants were found to be homozygous at the four sites assayed while drug Cannabis plants were either homozygous or heterozygous. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Heterogeneous computing architecture for fast detection of SNP-SNP interactions.
Sluga, Davor; Curk, Tomaz; Zupan, Blaz; Lotric, Uros
2014-06-25
The extent of data in a typical genome-wide association study (GWAS) poses considerable computational challenges to software tools for gene-gene interaction discovery. Exhaustive evaluation of all interactions among hundreds of thousands to millions of single nucleotide polymorphisms (SNPs) may require weeks or even months of computation. Massively parallel hardware within a modern Graphic Processing Unit (GPU) and Many Integrated Core (MIC) coprocessors can shorten the run time considerably. While the utility of GPU-based implementations in bioinformatics has been well studied, MIC architecture has been introduced only recently and may provide a number of comparative advantages that have yet to be explored and tested. We have developed a heterogeneous, GPU and Intel MIC-accelerated software module for SNP-SNP interaction discovery to replace the previously single-threaded computational core in the interactive web-based data exploration program SNPsyn. We report on differences between these two modern massively parallel architectures and their software environments. Their utility resulted in an order of magnitude shorter execution times when compared to the single-threaded CPU implementation. GPU implementation on a single Nvidia Tesla K20 runs twice as fast as that for the MIC architecture-based Xeon Phi P5110 coprocessor, but also requires considerably more programming effort. General purpose GPUs are a mature platform with large amounts of computing power capable of tackling inherently parallel problems, but can prove demanding for the programmer. On the other hand the new MIC architecture, albeit lacking in performance reduces the programming effort and makes it up with a more general architecture suitable for a wider range of problems.
Single tube genotyping of sickle cell anaemia using PCR-based SNP analysis.
Waterfall, C M; Cobb, B D
2001-12-01
Allele-specific amplification (ASA) is a generally applicable technique for the detection of known single nucleotide polymorphisms (SNPs), deletions, insertions and other sequence variations. Conventionally, two reactions are required to determine the zygosity of DNA in a two-allele system, along with significant upstream optimisation to define the specific test conditions. Here, we combine single tube bi-directional ASA with a 'matrix-based' optimisation strategy, speeding up the whole process in a reduced reaction set. We use sickle cell anaemia as our model SNP system, a genetic disease that is currently screened using ASA methods. Discriminatory conditions were rapidly optimised enabling the unambiguous identification of DNA from homozygous sickle cell patients (HbS/S), heterozygous carriers (HbA/S) or normal DNA in a single tube. Simple downstream mathematical analyses based on product yield across the optimisation set allow an insight into the important aspects of priming competition and component interactions in this competitive PCR. This strategy can be applied to any polymorphism, defining specific conditions using a multifactorial approach. The inherent simplicity and low cost of this PCR-based method validates bi-directional ASA as an effective tool in future clinical screening and pharmacogenomic research where more expensive fluorescence-based approaches may not be desirable.
Directory of Open Access Journals (Sweden)
Shijun Xiao
2016-12-01
Full Text Available Whole-genome single-nucleotide polymorphism (SNP markers are valuable genetic resources for the association and conservation studies. Genome-wide SNP development in many teleost species are still challenging because of the genome complexity and the cost of re-sequencing. Genotyping-By-Sequencing (GBS provided an efficient reduced representative method to squeeze cost for SNP detection; however, most of recent GBS applications were reported on plant organisms. In this work, we used an EcoRI-NlaIII based GBS protocol to teleost large yellow croaker, an important commercial fish in China and East-Asia, and reported the first whole-genome SNP development for the species. 69,845 high quality SNP markers that evenly distributed along genome were detected in at least 80% of 500 individuals. Nearly 95% randomly selected genotypes were successfully validated by Sequenom MassARRAY assay. The association studies with the muscle eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA content discovered 39 significant SNP markers, contributing as high up to ∼63% genetic variance that explained by all markers. Functional genes that involved in fat digestion and absorption pathway were identified, such as APOB, CRAT and OSBPL10. Notably, PPT2 Gene, previously identified in the association study of the plasma n-3 and n-6 polyunsaturated fatty acid level in human, was re-discovered in large yellow croaker. Our study verified that EcoRI-NlaIII based GBS could produce quality SNP markers in a cost-efficient manner in teleost genome. The developed SNP markers and the EPA and DHA associated SNP loci provided invaluable resources for the population structure, conservation genetics and genomic selection of large yellow croaker and other fish organisms.
Forensic SNP genotyping with SNaPshot
DEFF Research Database (Denmark)
Fondevila, M; Børsting, C; Phillips, C
2017-01-01
to routine STR profiling, use of SNaPshot is an important part of the development of SNP sets for a wide range of forensic applications with these markers, from genotyping highly degraded DNA with very short amplicons to the introduction of SNPs to ascertain the ancestry and physical characteristics......This review explores the key factors that influence the optimization, routine use, and profile interpretation of the SNaPshot single-base extension (SBE) system applied to forensic single-nucleotide polymorphism (SNP) genotyping. Despite being a mainly complimentary DNA genotyping technique...... of an unidentified contact trace donor. However, this technology, as resourceful as it is, displays several features that depart from the usual STR genotyping far enough to demand a certain degree of expertise from the forensic analyst before tackling the complex casework on which SNaPshot application provides...
Tian, Hong-Li; Wang, Feng-Ge; Zhao, Jiu-Ran; Yi, Hong-Mei; Wang, Lu; Wang, Rui; Yang, Yang; Song, Wei
2015-01-01
Single nucleotide polymorphisms (SNPs) are abundant and evenly distributed throughout the maize ( Zea mays L.) genome. SNPs have several advantages over simple sequence repeats, such as ease of data comparison and integration, high-throughput processing of loci, and identification of associated phenotypes. SNPs are thus ideal for DNA fingerprinting, genetic diversity analysis, and marker-assisted breeding. Here, we developed a high-throughput and compatible SNP array, maizeSNP3072, containing 3072 SNPs developed from the maizeSNP50 array. To improve genotyping efficiency, a high-quality cluster file, maizeSNP3072_GT.egt, was constructed. All 3072 SNP loci were localized within different genes, where they were distributed in exons (43 %), promoters (21 %), 3' untranslated regions (UTRs; 22 %), 5' UTRs (9 %), and introns (5 %). The average genotyping failure rate using these SNPs was only 6 %, or 3 % using the cluster file to call genotypes. The genotype consistency of repeat sample analysis on Illumina GoldenGate versus Infinium platforms exceeded 96.4 %. The minor allele frequency (MAF) of the SNPs averaged 0.37 based on data from 309 inbred lines. The 3072 SNPs were highly effective for distinguishing among 276 examined hybrids. Comparative analysis using Chinese varieties revealed that the 3072SNP array showed a better marker success rate and higher average MAF values, evaluation scores, and variety-distinguishing efficiency than the maizeSNP50K array. The maizeSNP3072 array thus can be successfully used in DNA fingerprinting identification of Chinese maize varieties and shows potential as a useful tool for germplasm resource evaluation and molecular marker-assisted breeding.
HRM and SNaPshot as alternative forensic SNP genotyping methods.
Mehta, Bhavik; Daniel, Runa; McNevin, Dennis
2017-09-01
Single nucleotide polymorphisms (SNPs) have been widely used in forensics for prediction of identity, biogeographical ancestry (BGA) and externally visible characteristics (EVCs). Single base extension (SBE) assays, most notably SNaPshot® (Thermo Fisher Scientific), are commonly used for forensic SNP genotyping as they can be employed on standard instrumentation in forensic laboratories (e.g. capillary electrophoresis). High resolution melt (HRM) analysis is an alternative method and is a simple, fast, single tube assay for low throughput SNP typing. This study compares HRM and SNaPshot®. HRM produced reproducible and concordant genotypes at 500 pg, however, difficulties were encountered when genotyping SNPs with high GC content in flanking regions and differentiating variants of symmetrical SNPs. SNaPshot® was reproducible at 100 pg and is less dependent on SNP choice. HRM has a shorter processing time in comparison to SNaPshot®, avoids post PCR contamination risk and has potential as a screening tool for many forensic applications.
Directory of Open Access Journals (Sweden)
Devita Tetriana
2015-09-01
Full Text Available Cervical cancer is the most fatal disease among Indonesian women. In recognition of the substantial variation in the intrinsic response of individuals to radiation, an effort had been done to identify the genetic markers, primarily Single Nucleotide polymorphisms (SNPs, which are associated with responsiveness of cancer cells to radiation therapy. One of these SNPs is X-ray repair cross-complementing protein 1 (XRCC1 that is one of the most important genes in deoxyribonucleic acid (DNA repair pathways. Meta-analysis in the determination of the association of XRCC1 polymorphisms with cervical cancer revealed the potential role of XRCC1 polymorphisms in predicting cell response to radiotherapy.Our preliminary study with real-time polymerase chain reaction (RT-PCR showed that radiotherapy affected the XRCC1 gene analyzed in blood of cervical cancer patient. Other published study found three SNPs of XRCC1 (Arg194Trp, Arg280His, and Arg399Gln that cause amino acid substitutions. Arg194Trp is only SNPs that associated with high risk of cervical cancer but not others. Additionally, structure and function of this protein can be altered by functional SNPs, which may lead to the susceptibility of individuals to cancers. Anotherstudy found G399A polymorphisms. We concluded that SNP of this DNA repair genes have been found to be good predictors of efficacy of radiotherapy.Kanker serviks adalah penyakit yang paling fatal pada perempuan di Indonesia. Untuk memahami variasi substansial respon intrinsik individual terhadap radiasi, suatu usaha telah dilakukan untuk mengidentifikasi petanda genetik, terutama Single Nucleotide polymorphism (SNP, yang berkaitan dengan responsel kanker terhadap terapi radiasi. Satu dari SNP tersebut adalah X-ray repair cross-complementing protein 1 (XRCC1 yang merupakan satu dari gen paling penting dalam lajur perbaikan asam deoksiribonukleat (DNA. Meta-analysis dalam penentuan hubungan polimorfisme XRCC1 dengan kanker serviks
V-MitoSNP: visualization of human mitochondrial SNPs
Directory of Open Access Journals (Sweden)
Tsui Ke-Hung
2006-08-01
Full Text Available Abstract Background Mitochondrial single nucleotide polymorphisms (mtSNPs constitute important data when trying to shed some light on human diseases and cancers. Unfortunately, providing relevant mtSNP genotyping information in mtDNA databases in a neatly organized and transparent visual manner still remains a challenge. Amongst the many methods reported for SNP genotyping, determining the restriction fragment length polymorphisms (RFLPs is still one of the most convenient and cost-saving methods. In this study, we prepared the visualization of the mtDNA genome in a way, which integrates the RFLP genotyping information with mitochondria related cancers and diseases in a user-friendly, intuitive and interactive manner. The inherent problem associated with mtDNA sequences in BLAST of the NCBI database was also solved. Description V-MitoSNP provides complete mtSNP information for four different kinds of inputs: (1 color-coded visual input by selecting genes of interest on the genome graph, (2 keyword search by locus, disease and mtSNP rs# ID, (3 visualized input of nucleotide range by clicking the selected region of the mtDNA sequence, and (4 sequences mtBLAST. The V-MitoSNP output provides 500 bp (base pairs flanking sequences for each SNP coupled with the RFLP enzyme and the corresponding natural or mismatched primer sets. The output format enables users to see the SNP genotype pattern of the RFLP by virtual electrophoresis of each mtSNP. The rate of successful design of enzymes and primers for RFLPs in all mtSNPs was 99.1%. The RFLP information was validated by actual agarose electrophoresis and showed successful results for all mtSNPs tested. The mtBLAST function in V-MitoSNP provides the gene information within the input sequence rather than providing the complete mitochondrial chromosome as in the NCBI BLAST database. All mtSNPs with rs number entries in NCBI are integrated in the corresponding SNP in V-MitoSNP. Conclusion V-MitoSNP is a web
Development and application of a 20K SNP array in potato
Vos, Peter
2016-01-01
In this thesis the results are described of investigations of various application of genome wide SNP (single nucleotide polymorphism) markers. The set of SNP markers was identified by GBS (genotyping by sequencing) strategy. The resulting dataset of 129,156 SNPs across 83 tetraploid varieties was
Qin, Feng-qin; Yu, Li-hua; Hu, Wen-ting; Guo, Jian; Chen, Ning; Guo, Jiang; Fang, Jing-huan; He, Li
2015-07-01
To investigate the relationship between single nucleotide polymorphism (SNP) rs6007897 of CELSR1 and acute ischemic stroke in Western China Han population. All subjects (759 acute ischemic stroke patients and 786 controls) were genotyped using ligation detection reaction (LDR). We analyzed the differences between SNP rs6007897 genotypes and allele frequencies between two groups. Two genotypes (AA, AG) of rs6007897 were found in both stroke and control group. There was no statistically significance between two groups about genotype and allele frequency. After adjusting for risk factors, we found there was no significant association between rs6007897 and ischemic stroke CP = 0.797, odds ratio (OR) = 0.886, 95% confidence interval (CI) = 0.352-2.227). SNP rs6007897 of CELSR1 was not significantly associated with ischemic stroke in Western China Han population.
Directory of Open Access Journals (Sweden)
Matthew C. McClure
2018-03-01
Full Text Available A major use of genetic data is parentage verification and identification as inaccurate pedigrees negatively affect genetic gain. Since 2012 the international standard for single nucleotide polymorphism (SNP verification in Bos taurus cattle has been the ISAG SNP panels. While these ISAG panels provide an increased level of parentage accuracy over microsatellite markers (MS, they can validate the wrong parent at ≤1% misconcordance rate levels, indicating that more SNP are needed if a more accurate pedigree is required. With rapidly increasing numbers of cattle being genotyped in Ireland that represent 61 B. taurus breeds from a wide range of farm types: beef/dairy, AI/pedigree/commercial, purebred/crossbred, and large to small herd size the Irish Cattle Breeding Federation (ICBF analyzed different SNP densities to determine that at a minimum ≥500 SNP are needed to consistently predict only one set of parents at a ≤1% misconcordance rate. For parentage validation and prediction ICBF uses 800 SNP (ICBF800 selected based on SNP clustering quality, ISAG200 inclusion, call rate (CR, and minor allele frequency (MAF in the Irish cattle population. Large datasets require sample and SNP quality control (QC. Most publications only deal with SNP QC via CR, MAF, parent-progeny conflicts, and Hardy-Weinberg deviation, but not sample QC. We report here parentage, SNP QC, and a genomic sample QC pipelines to deal with the unique challenges of >1 million genotypes from a national herd such as SNP genotype errors from mis-tagging of animals, lab errors, farm errors, and multiple other issues that can arise. We divide the pipeline into two parts: a Genotype QC and an Animal QC pipeline. The Genotype QC identifies samples with low call rate, missing or mixed genotype classes (no BB genotype or ABTG alleles present, and low genotype frequencies. The Animal QC handles situations where the genotype might not belong to the listed individual by identifying: >1 non
Directory of Open Access Journals (Sweden)
Voorrips Roeland E
2006-10-01
Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are important tools in studying complex genetic traits and genome evolution. Computational strategies for SNP discovery make use of the large number of sequences present in public databases (in most cases as expressed sequence tags (ESTs and are considered to be faster and more cost-effective than experimental procedures. A major challenge in computational SNP discovery is distinguishing allelic variation from sequence variation between paralogous sequences, in addition to recognizing sequencing errors. For the majority of the public EST sequences, trace or quality files are lacking which makes detection of reliable SNPs even more difficult because it has to rely on sequence comparisons only. Results We have developed a new algorithm to detect reliable SNPs and insertions/deletions (indels in EST data, both with and without quality files. Implemented in a pipeline called QualitySNP, it uses three filters for the identification of reliable SNPs. Filter 1 screens for all potential SNPs and identifies variation between or within genotypes. Filter 2 is the core filter that uses a haplotype-based strategy to detect reliable SNPs. Clusters with potential paralogs as well as false SNPs caused by sequencing errors are identified. Filter 3 screens SNPs by calculating a confidence score, based upon sequence redundancy and quality. Non-synonymous SNPs are subsequently identified by detecting open reading frames of consensus sequences (contigs with SNPs. The pipeline includes a data storage and retrieval system for haplotypes, SNPs and alignments. QualitySNP's versatility is demonstrated by the identification of SNPs in EST datasets from potato, chicken and humans. Conclusion QualitySNP is an efficient tool for SNP detection, storage and retrieval in diploid as well as polyploid species. It is available for running on Linux or UNIX systems. The program, test data, and user manual are available at
SNP-RFLPing 2: an updated and integrated PCR-RFLP tool for SNP genotyping
Directory of Open Access Journals (Sweden)
Chang Hsueh-Wei
2010-04-01
Full Text Available Abstract Background PCR-restriction fragment length polymorphism (RFLP assay is a cost-effective method for SNP genotyping and mutation detection, but the manual mining for restriction enzyme sites is challenging and cumbersome. Three years after we constructed SNP-RFLPing, a freely accessible database and analysis tool for restriction enzyme mining of SNPs, significant improvements over the 2006 version have been made and incorporated into the latest version, SNP-RFLPing 2. Results The primary aim of SNP-RFLPing 2 is to provide comprehensive PCR-RFLP information with multiple functionality about SNPs, such as SNP retrieval to multiple species, different polymorphism types (bi-allelic, tri-allelic, tetra-allelic or indels, gene-centric searching, HapMap tagSNPs, gene ontology-based searching, miRNAs, and SNP500Cancer. The RFLP restriction enzymes and the corresponding PCR primers for the natural and mutagenic types of each SNP are simultaneously analyzed. All the RFLP restriction enzyme prices are also provided to aid selection. Furthermore, the previously encountered updating problems for most SNP related databases are resolved by an on-line retrieval system. Conclusions The user interfaces for functional SNP analyses have been substantially improved and integrated. SNP-RFLPing 2 offers a new and user-friendly interface for RFLP genotyping that can be used in association studies and is freely available at http://bio.kuas.edu.tw/snp-rflping2.
SNP-RFLPing 2: an updated and integrated PCR-RFLP tool for SNP genotyping.
Chang, Hsueh-Wei; Cheng, Yu-Huei; Chuang, Li-Yeh; Yang, Cheng-Hong
2010-04-08
PCR-restriction fragment length polymorphism (RFLP) assay is a cost-effective method for SNP genotyping and mutation detection, but the manual mining for restriction enzyme sites is challenging and cumbersome. Three years after we constructed SNP-RFLPing, a freely accessible database and analysis tool for restriction enzyme mining of SNPs, significant improvements over the 2006 version have been made and incorporated into the latest version, SNP-RFLPing 2. The primary aim of SNP-RFLPing 2 is to provide comprehensive PCR-RFLP information with multiple functionality about SNPs, such as SNP retrieval to multiple species, different polymorphism types (bi-allelic, tri-allelic, tetra-allelic or indels), gene-centric searching, HapMap tagSNPs, gene ontology-based searching, miRNAs, and SNP500Cancer. The RFLP restriction enzymes and the corresponding PCR primers for the natural and mutagenic types of each SNP are simultaneously analyzed. All the RFLP restriction enzyme prices are also provided to aid selection. Furthermore, the previously encountered updating problems for most SNP related databases are resolved by an on-line retrieval system. The user interfaces for functional SNP analyses have been substantially improved and integrated. SNP-RFLPing 2 offers a new and user-friendly interface for RFLP genotyping that can be used in association studies and is freely available at http://bio.kuas.edu.tw/snp-rflping2.
Shang, Junliang; Sun, Yan; Li, Shengjun; Liu, Jin-Xing; Zheng, Chun-Hou; Zhang, Junying
2015-01-01
SNP-SNP interactions have been receiving increasing attention in understanding the mechanism underlying susceptibility to complex diseases. Though many works have been done for the detection of SNP-SNP interactions, the algorithmic development is still ongoing. In this study, an improved opposition-based learning particle swarm optimization (IOBLPSO) is proposed for the detection of SNP-SNP interactions. Highlights of IOBLPSO are the introduction of three strategies, namely, opposition-based learning, dynamic inertia weight, and a postprocedure. Opposition-based learning not only enhances the global explorative ability, but also avoids premature convergence. Dynamic inertia weight allows particles to cover a wider search space when the considered SNP is likely to be a random one and converges on promising regions of the search space while capturing a highly suspected SNP. The postprocedure is used to carry out a deep search in highly suspected SNP sets. Experiments of IOBLPSO are performed on both simulation data sets and a real data set of age-related macular degeneration, results of which demonstrate that IOBLPSO is promising in detecting SNP-SNP interactions. IOBLPSO might be an alternative to existing methods for detecting SNP-SNP interactions. PMID:26236727
SNP interaction pattern identifier (SIPI)
DEFF Research Database (Denmark)
Lin, Hui Yi; Chen, Dung Tsa; Huang, Po Yu
2017-01-01
Motivation: Testing SNP-SNP interactions is considered as a key for overcoming bottlenecks of genetic association studies. However, related statistical methods for testing SNP-SNP interactions are underdeveloped. Results: We propose the SNP Interaction Pattern Identifier (SIPI), which tests 45...
VCS: Tool for Visualizing Copy Number Variation and Single Nucleotide Polymorphism
Directory of Open Access Journals (Sweden)
HyoYoung Kim
2014-12-01
Full Text Available Copy number variation (CNV or single nucleotide phlyorphism (SNP is useful genetic resource to aid in understanding complex phenotypes or deseases susceptibility. Although thousands of CNVs and SNPs are currently avaliable in the public databases, they are somewhat difficult to use for analyses without visualization tools. We developed a web-based tool called the VCS (visualization of CNV or SNP to visualize the CNV or SNP detected. The VCS tool can assist to easily interpret a biological meaning from the numerical value of CNV and SNP. The VCS provides six visualization tools: i the enrichment of genome contents in CNV; ii the physical distribution of CNV or SNP on chromosomes; iii the distribution of log2 ratio of CNVs with criteria of interested; iv the number of CNV or SNP per binning unit; v the distribution of homozygosity of SNP genotype; and vi cytomap of genes within CNV or SNP region.
De La Vega, Francisco M; Dailey, David; Ziegle, Janet; Williams, Julie; Madden, Dawn; Gilbert, Dennis A
2002-06-01
Since public and private efforts announced the first draft of the human genome last year, researchers have reported great numbers of single nucleotide polymorphisms (SNPs). We believe that the availability of well-mapped, quality SNP markers constitutes the gateway to a revolution in genetics and personalized medicine that will lead to better diagnosis and treatment of common complex disorders. A new generation of tools and public SNP resources for pharmacogenomic and genetic studies--specifically for candidate-gene, candidate-region, and whole-genome association studies--will form part of the new scientific landscape. This will only be possible through the greater accessibility of SNP resources and superior high-throughput instrumentation-assay systems that enable affordable, highly productive large-scale genetic studies. We are contributing to this effort by developing a high-quality linkage disequilibrium SNP marker map and an accompanying set of ready-to-use, validated SNP assays across every gene in the human genome. This effort incorporates both the public sequence and SNP data sources, and Celera Genomics' human genome assembly and enormous resource ofphysically mapped SNPs (approximately 4,000,000 unique records). This article discusses our approach and methodology for designing the map, choosing quality SNPs, designing and validating these assays, and obtaining population frequency ofthe polymorphisms. We also discuss an advanced, high-performance SNP assay chemisty--a new generation of the TaqMan probe-based, 5' nuclease assay-and high-throughput instrumentation-software system for large-scale genotyping. We provide the new SNP map and validation information, validated SNP assays and reagents, and instrumentation systems as a novel resource for genetic discoveries.
Genome wide in silico SNP-tumor association analysis
International Nuclear Information System (INIS)
Qiu, Ping; Wang, Luquan; Kostich, Mitch; Ding, Wei; Simon, Jason S; Greene, Jonathan R
2004-01-01
Carcinogenesis occurs, at least in part, due to the accumulation of mutations in critical genes that control the mechanisms of cell proliferation, differentiation and death. Publicly accessible databases contain millions of expressed sequence tag (EST) and single nucleotide polymorphism (SNP) records, which have the potential to assist in the identification of SNPs overrepresented in tumor tissue. An in silico SNP-tumor association study was performed utilizing tissue library and SNP information available in NCBI's dbEST (release 092002) and dbSNP (build 106). A total of 4865 SNPs were identified which were present at higher allele frequencies in tumor compared to normal tissues. A subset of 327 (6.7%) SNPs induce amino acid changes to the protein coding sequences. This approach identified several SNPs which have been previously associated with carcinogenesis, as well as a number of SNPs that now warrant further investigation This novel in silico approach can assist in prioritization of genes and SNPs in the effort to elucidate the genetic mechanisms underlying the development of cancer
Schmidt-Lebuhn, Alexander N; Aitken, Nicola C; Chuah, Aaron
2017-11-01
Datasets of hundreds or thousands of SNPs (Single Nucleotide Polymorphisms) from multiple individuals per species are increasingly used to study population structure, species delimitation and shallow phylogenetics. The principal software tool to infer species or population trees from SNP data is currently the BEAST template SNAPP which uses a Bayesian coalescent analysis. However, it is computationally extremely demanding and tolerates only small amounts of missing data. We used simulated and empirical SNPs from plants (Australian Craspedia, Asteraceae, and Pelargonium, Geraniaceae) to compare species trees produced (1) by SNAPP, (2) using SVD quartets, and (3) using Bayesian and parsimony analysis with several different approaches to summarising data from multiple samples into one set of traits per species. Our aims were to explore the impact of tree topology and missing data on the results, and to test which data summarising and analyses approaches would best approximate the results obtained from SNAPP for empirical data. SVD quartets retrieved the correct topology from simulated data, as did SNAPP except in the case of a very unbalanced phylogeny. Both methods failed to retrieve the correct topology when large amounts of data were missing. Bayesian analysis of species level summary data scoring the two alleles of each SNP as independent characters and parsimony analysis of data scoring each SNP as one character produced trees with branch length distributions closest to the true trees on which SNPs were simulated. For empirical data, Bayesian inference and Dollo parsimony analysis of data scored allele-wise produced phylogenies most congruent with the results of SNAPP. In the case of study groups divergent enough for missing data to be phylogenetically informative (because of additional mutations preventing amplification of genomic fragments or bioinformatic establishment of homology), scoring of SNP data as a presence/absence matrix irrespective of allele
Directory of Open Access Journals (Sweden)
Yang Yu
Full Text Available The application of next generation sequencing technology has greatly facilitated high throughput single nucleotide polymorphism (SNP discovery and genotyping in genetic research. In the present study, SNPs were discovered based on two transcriptomes of Litopenaeus vannamei (L. vannamei generated from Illumina sequencing platform HiSeq 2000. One transcriptome of L. vannamei was obtained through sequencing on the RNA from larvae at mysis stage and its reference sequence was de novo assembled. The data from another transcriptome were downloaded from NCBI and the reads of the two transcriptomes were mapped separately to the assembled reference by BWA. SNP calling was performed using SAMtools. A total of 58,717 and 36,277 SNPs with high quality were predicted from the two transcriptomes, respectively. SNP calling was also performed using the reads of two transcriptomes together, and a total of 96,040 SNPs with high quality were predicted. Among these 96,040 SNPs, 5,242 and 29,129 were predicted as non-synonymous and synonymous SNPs respectively. Characterization analysis of the predicted SNPs in L. vannamei showed that the estimated SNP frequency was 0.21% (one SNP per 476 bp and the estimated ratio for transition to transversion was 2.0. Fifty SNPs were randomly selected for validation by Sanger sequencing after PCR amplification and 76% of SNPs were confirmed, which indicated that the SNPs predicted in this study were reliable. These SNPs will be very useful for genetic study in L. vannamei, especially for the high density linkage map construction and genome-wide association studies.
MAFsnp: A Multi-Sample Accurate and Flexible SNP Caller Using Next-Generation Sequencing Data
Hu, Jiyuan; Li, Tengfei; Xiu, Zidi; Zhang, Hong
2015-01-01
Most existing statistical methods developed for calling single nucleotide polymorphisms (SNPs) using next-generation sequencing (NGS) data are based on Bayesian frameworks, and there does not exist any SNP caller that produces p-values for calling SNPs in a frequentist framework. To fill in this gap, we develop a new method MAFsnp, a Multiple-sample based Accurate and Flexible algorithm for calling SNPs with NGS data. MAFsnp is based on an estimated likelihood ratio test (eLRT) statistic. In practical situation, the involved parameter is very close to the boundary of the parametric space, so the standard large sample property is not suitable to evaluate the finite-sample distribution of the eLRT statistic. Observing that the distribution of the test statistic is a mixture of zero and a continuous part, we propose to model the test statistic with a novel two-parameter mixture distribution. Once the parameters in the mixture distribution are estimated, p-values can be easily calculated for detecting SNPs, and the multiple-testing corrected p-values can be used to control false discovery rate (FDR) at any pre-specified level. With simulated data, MAFsnp is shown to have much better control of FDR than the existing SNP callers. Through the application to two real datasets, MAFsnp is also shown to outperform the existing SNP callers in terms of calling accuracy. An R package “MAFsnp” implementing the new SNP caller is freely available at http://homepage.fudan.edu.cn/zhangh/softwares/. PMID:26309201
Dynamic variable selection in SNP genotype autocalling from APEX microarray data
Directory of Open Access Journals (Sweden)
Zamar Ruben H
2006-11-01
Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are DNA sequence variations, occurring when a single nucleotide – adenine (A, thymine (T, cytosine (C or guanine (G – is altered. Arguably, SNPs account for more than 90% of human genetic variation. Our laboratory has developed a highly redundant SNP genotyping assay consisting of multiple probes with signals from multiple channels for a single SNP, based on arrayed primer extension (APEX. This mini-sequencing method is a powerful combination of a highly parallel microarray with distinctive Sanger-based dideoxy terminator sequencing chemistry. Using this microarray platform, our current genotype calling system (known as SNP Chart is capable of calling single SNP genotypes by manual inspection of the APEX data, which is time-consuming and exposed to user subjectivity bias. Results Using a set of 32 Coriell DNA samples plus three negative PCR controls as a training data set, we have developed a fully-automated genotyping algorithm based on simple linear discriminant analysis (LDA using dynamic variable selection. The algorithm combines separate analyses based on the multiple probe sets to give a final posterior probability for each candidate genotype. We have tested our algorithm on a completely independent data set of 270 DNA samples, with validated genotypes, from patients admitted to the intensive care unit (ICU of St. Paul's Hospital (plus one negative PCR control sample. Our method achieves a concordance rate of 98.9% with a 99.6% call rate for a set of 96 SNPs. By adjusting the threshold value for the final posterior probability of the called genotype, the call rate reduces to 94.9% with a higher concordance rate of 99.6%. We also reversed the two independent data sets in their training and testing roles, achieving a concordance rate up to 99.8%. Conclusion The strength of this APEX chemistry-based platform is its unique redundancy having multiple probes for a single SNP. Our
SNP markers retrieval for a non-model species: a practical approach
Directory of Open Access Journals (Sweden)
Shahin Arwa
2012-01-01
Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism markers are rapidly becoming the markers of choice for applications in breeding because of next generation sequencing technology developments. For SNP development by NGS technologies, correct assembly of the huge amounts of sequence data generated is essential. Little is known about assembler's performance, especially when dealing with highly heterogeneous species that show a high genome complexity and what the possible consequences are of differences in assemblies on SNP retrieval. This study tested two assemblers (CAP3 and CLC on 454 data from four lily genotypes and compared results with respect to SNP retrieval. Results CAP3 assembly resulted in higher numbers of contigs, lower numbers of reads per contig, and shorter average read lengths compared to CLC. Blast comparisons showed that CAP3 contigs were highly redundant. Contrastingly, CLC in rare cases combined paralogs in one contig. Redundant and chimeric contigs may lead to erroneous SNPs. Filtering for redundancy can be done by blasting selected SNP markers to the contigs and discarding all the SNP markers that show more than one blast hit. Results on chimeric contigs showed that only four out of 2,421 SNP markers were selected from chimeric contigs. Conclusion In practice, CLC performs better in assembling highly heterogeneous genome sequences compared to CAP3, and consequently SNP retrieval is more efficient. Additionally a simple flow scheme is suggested for SNP marker retrieval that can be valid for all non-model species.
Directory of Open Access Journals (Sweden)
Watson-Haigh Nathan S
2010-06-01
Full Text Available Abstract Background Whole genome association studies using highly dense single nucleotide polymorphisms (SNPs are a set of methods to identify DNA markers associated with variation in a particular complex trait of interest. One of the main outcomes from these studies is a subset of statistically significant SNPs. Finding the potential biological functions of such SNPs can be an important step towards further use in human and agricultural populations (e.g., for identifying genes related to susceptibility to complex diseases or genes playing key roles in development or performance. The current challenge is that the information holding the clues to SNP functions is distributed across many different databases. Efficient bioinformatics tools are therefore needed to seamlessly integrate up-to-date functional information on SNPs. Many web services have arisen to meet the challenge but most work only within the framework of human medical research. Although we acknowledge the importance of human research, we identify there is a need for SNP annotation tools for other organisms. Description We introduce an R package called FunctSNP, which is the user interface to custom built species-specific databases. The local relational databases contain SNP data together with functional annotations extracted from online resources. FunctSNP provides a unified bioinformatics resource to link SNPs with functional knowledge (e.g., genes, pathways, ontologies. We also introduce dbAutoMaker, a suite of Perl scripts, which can be scheduled to run periodically to automatically create/update the customised SNP databases. We illustrate the use of FunctSNP with a livestock example, but the approach and software tools presented here can be applied also to human and other organisms. Conclusions Finding the potential functional significance of SNPs is important when further using the outcomes from whole genome association studies. FunctSNP is unique in that it is the only R
A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff
Cingolani, Pablo; Platts, Adrian; Wang, Le Lily; Coon, Melissa; Nguyen, Tung; Wang, Luan; Land, Susan J.; Lu, Xiangyi; Ruden, Douglas M.
2012-01-01
We describe a new computer program, SnpEff, for rapidly categorizing the effects of variants in genome sequences. Once a genome is sequenced, SnpEff annotates variants based on their genomic locations and predicts coding effects. Annotated genomic locations include intronic, untranslated region, upstream, downstream, splice site, or intergenic regions. Coding effects such as synonymous or non-synonymous amino acid replacement, start codon gains or losses, stop codon gains or losses, or frame shifts can be predicted. Here the use of SnpEff is illustrated by annotating ~356,660 candidate SNPs in ~117 Mb unique sequences, representing a substitution rate of ~1/305 nucleotides, between the Drosophila melanogaster w1118; iso-2; iso-3 strain and the reference y1; cn1 bw1 sp1 strain. We show that ~15,842 SNPs are synonymous and ~4,467 SNPs are non-synonymous (N/S ~0.28). The remaining SNPs are in other categories, such as stop codon gains (38 SNPs), stop codon losses (8 SNPs), and start codon gains (297 SNPs) in the 5′UTR. We found, as expected, that the SNP frequency is proportional to the recombination frequency (i.e., highest in the middle of chromosome arms). We also found that start-gain or stop-lost SNPs in Drosophila melanogaster often result in additions of N-terminal or C-terminal amino acids that are conserved in other Drosophila species. It appears that the 5′ and 3′ UTRs are reservoirs for genetic variations that changes the termini of proteins during evolution of the Drosophila genus. As genome sequencing is becoming inexpensive and routine, SnpEff enables rapid analyses of whole-genome sequencing data to be performed by an individual laboratory. PMID:22728672
A large-scale chromosome-specific SNP discovery guideline.
Akpinar, Bala Ani; Lucas, Stuart; Budak, Hikmet
2017-01-01
Single-nucleotide polymorphisms (SNPs) are the most prevalent type of variation in genomes that are increasingly being used as molecular markers in diversity analyses, mapping and cloning of genes, and germplasm characterization. However, only a few studies reported large-scale SNP discovery in Aegilops tauschii, restricting their potential use as markers for the low-polymorphic D genome. Here, we report 68,592 SNPs found on the gene-related sequences of the 5D chromosome of Ae. tauschii genotype MvGB589 using genomic and transcriptomic sequences from seven Ae. tauschii accessions, including AL8/78, the only genotype for which a draft genome sequence is available at present. We also suggest a workflow to compare SNP positions in homologous regions on the 5D chromosome of Triticum aestivum, bread wheat, to mark single nucleotide variations between these closely related species. Overall, the identified SNPs define a density of 4.49 SNPs per kilobyte, among the highest reported for the genic regions of Ae. tauschii so far. To our knowledge, this study also presents the first chromosome-specific SNP catalog in Ae. tauschii that should facilitate the association of these SNPs with morphological traits on chromosome 5D to be ultimately targeted for wheat improvement.
Heckmann, J M
2009-08-13
Complement activation in myasthenia gravis (MG) may damage muscle endplate and complement regulatory proteins such as decay-accelerating factor (DAF) or CD55 may be protective. We hypothesize that the increased prevalence of severe extraocular muscle (EOM) dysfunction among African MG subjects reported earlier may result from altered DAF expression. To test this hypothesis, we screened the DAF gene sequences relevant to the classical complement pathway and found an association between myasthenics with EOM paresis and the DAF regulatory region c.-198CG SNP (odds ratio8.6; P0.0003). This single nucleotide polymorphism (SNP) results in a twofold activation of a DAF 5?-flanking region luciferase reporter transfected into three different cell lines. Direct matching of the surrounding SNP sequence within the DAF regulatory region with the known transcription factor-binding sites suggests a loss of an Sp1-binding site. This was supported by the observation that the c.-198CG SNP did not show the normal lipopolysaccharide-induced DAF transcriptional upregulation in lymphoblasts from four patients. Our findings suggest that at critical periods during autoimmune MG, this SNP may result in inadequate DAF upregulation with consequent complement-mediated EOM damage. Susceptible individuals may benefit from anti-complement therapy in addition to immunosuppression. © 2010 Macmillan Publishers Limited. All rights reserved.
Brown, Allan F; Yousef, Gad G; Chebrolu, Kranthi K; Byrd, Robert W; Everhart, Koyt W; Thomas, Aswathy; Reid, Robert W; Parkin, Isobel A P; Sharpe, Andrew G; Oliver, Rebekah; Guzman, Ivette; Jackson, Eric W
2014-09-01
A high-resolution genetic linkage map of B. oleracea was developed from a B. napus SNP array. The work will facilitate genetic and evolutionary studies in Brassicaceae. A broccoli population, VI-158 × BNC, consisting of 150 F2:3 families was used to create a saturated Brassica oleracea (diploid: CC) linkage map using a recently developed rapeseed (Brassica napus) (tetraploid: AACC) Illumina Infinium single nucleotide polymorphism (SNP) array. The map consisted of 547 non-redundant SNP markers spanning 948.1 cM across nine chromosomes with an average interval size of 1.7 cM. As the SNPs are anchored to the genomic reference sequence of the rapid cycling B. oleracea TO1000, we were able to estimate that the map provides 96 % coverage of the diploid genome. Carotenoid analysis of 2 years data identified 3 QTLs on two chromosomes that are associated with up to half of the phenotypic variation associated with the accumulation of total or individual compounds. By searching the genome sequences of the two related diploid species (B. oleracea and B. rapa), we further identified putative carotenoid candidate genes in the region of these QTLs. This is the first description of the use of a B. napus SNP array to rapidly construct high-density genetic linkage maps of one of the constituent diploid species. The unambiguous nature of these markers with regard to genomic sequences provides evidence to the nature of genes underlying the QTL, and demonstrates the value and impact this resource will have on Brassica research.
snpTree - a web-server to identify and construct SNP trees from whole genome sequence data
DEFF Research Database (Denmark)
Leekitcharoenphon, Pimlapas; Kaas, Rolf Sommer; Thomsen, Martin Christen Frølund
2012-01-01
identify SNPs and construct phylogenetic trees from WGS as well as from assembled genomes or contigs. WGS data in fastq format are aligned to reference genomes by BWA while contigs in fasta format are processed by Nucmer. SNPs are concatenated based on position on reference genome and a tree is constructed...... to differentiate and classify isolates. One of the successfully and broadly used methods is analysis of single nucletide polymorphisms (SNPs). Currently, there are different tools and methods to identify SNPs including various options and cut-off values. Furthermore, all current methods require bioinformatic...... skills. Thus, we lack a standard and simple automatic tool to determine SNPs and construct phylogenetic tree from WGS data. Results Here we introduce snpTree, a server for online-automatic SNPs analysis. This tool is composed of different SNPs analysis suites, perl and python scripts. snpTree can...
Compression and fast retrieval of SNP data.
Sambo, Francesco; Di Camillo, Barbara; Toffolo, Gianna; Cobelli, Claudio
2014-11-01
The increasing interest in rare genetic variants and epistatic genetic effects on complex phenotypic traits is currently pushing genome-wide association study design towards datasets of increasing size, both in the number of studied subjects and in the number of genotyped single nucleotide polymorphisms (SNPs). This, in turn, is leading to a compelling need for new methods for compression and fast retrieval of SNP data. We present a novel algorithm and file format for compressing and retrieving SNP data, specifically designed for large-scale association studies. Our algorithm is based on two main ideas: (i) compress linkage disequilibrium blocks in terms of differences with a reference SNP and (ii) compress reference SNPs exploiting information on their call rate and minor allele frequency. Tested on two SNP datasets and compared with several state-of-the-art software tools, our compression algorithm is shown to be competitive in terms of compression rate and to outperform all tools in terms of time to load compressed data. Our compression and decompression algorithms are implemented in a C++ library, are released under the GNU General Public License and are freely downloadable from http://www.dei.unipd.it/~sambofra/snpack.html. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Interim report on updated microarray probes for the LLNL Burkholderia pseudomallei SNP array
Energy Technology Data Exchange (ETDEWEB)
Gardner, S; Jaing, C
2012-03-27
The overall goal of this project is to forensically characterize 100 unknown Burkholderia isolates in the US-Australia collaboration. We will identify genome-wide single nucleotide polymorphisms (SNPs) from B. pseudomallei and near neighbor species including B. mallei, B. thailandensis and B. oklahomensis. We will design microarray probes to detect these SNP markers and analyze 100 Burkholderia genomic DNAs extracted from environmental, clinical and near neighbor isolates from Australian collaborators on the Burkholderia SNP microarray. We will analyze the microarray genotyping results to characterize the genetic diversity of these new isolates and triage the samples for whole genome sequencing. In this interim report, we described the SNP analysis and the microarray probe design for the Burkholderia SNP microarray.
SNP typing on the NanoChip electronic microarray
DEFF Research Database (Denmark)
Børsting, Claus; Sanchez Sanchez, Juan Jose; Morling, Niels
2005-01-01
We describe a single nucleotide polymorphism (SNP) typing protocol developed for the NanoChip electronic microarray. The NanoChip array consists of 100 electrodes covered by a thin hydrogel layer containing streptavidin. An electric currency can be applied to one, several, or all electrodes...
Kobayashi, Masaaki; Ohyanagi, Hajime; Takanashi, Hideki; Asano, Satomi; Kudo, Toru; Kajiya-Kanegae, Hiromi; Nagano, Atsushi J.; Tainaka, Hitoshi; Tokunaga, Tsuyoshi; Sazuka, Takashi; Iwata, Hiroyoshi; Tsutsumi, Nobuhiro; Yano, Kentaro
2017-01-01
and GP depends on not only their mathematical models, but the quality and quantity of variants employed in the analysis. In NGS single nucleotide polymorphism (SNP) calling, conventional tools ideally require more reads for higher SNP sensitivity
Imputation of microsatellite alleles from dense SNP genotypes for parental verification
Directory of Open Access Journals (Sweden)
Matthew eMcclure
2012-08-01
Full Text Available Microsatellite (MS markers have recently been used for parental verification and are still the international standard despite higher cost, error rate, and turnaround time compared with Single Nucleotide Polymorphisms (SNP-based assays. Despite domestic and international interest from producers and research communities, no viable means currently exist to verify parentage for an individual unless all familial connections were analyzed using the same DNA marker type (MS or SNP. A simple and cost-effective method was devised to impute MS alleles from SNP haplotypes within breeds. For some MS, imputation results may allow inference across breeds. A total of 347 dairy cattle representing 4 dairy breeds (Brown Swiss, Guernsey, Holstein, and Jersey were used to generate reference haplotypes. This approach has been verified (>98% accurate for imputing the International Society of Animal Genetics (ISAG recommended panel of 12 MS for cattle parentage verification across a validation set of 1,307 dairy animals.. Implementation of this method will allow producers and breed associations to transition to SNP-based parentage verification utilizing MS genotypes from historical data on parents where SNP genotypes are missing. This approach may be applicable to additional cattle breeds and other species that wish to migrate from MS- to SNP- based parental verification.
Large SNP arrays for genotyping in crop plants
Indian Academy of Sciences (India)
Genotyping with large numbers of molecular markers is now an indispensable tool within plant genetics and breeding. Especially through the identification of large numbers of single nucleotide polymorphism (SNP) markers using the novel high-throughput sequencing technologies, it is now possible to reliably identify many ...
Typing of 48 autosomal SNPs and amelogenin with GenPlex SNP genotyping system in forensic genetics
DEFF Research Database (Denmark)
Tomas Mas, Carmen; Stangegaard, Michael; Børsting, Claus
2008-01-01
, Somalia and Greenland were investigated with GenPlex using a Biomek 3000 (Beckman Coulter) robot. The results were compared to results obtained with an ISO 17025 accredited SNP typing assay based on single base extension (SBE). With the GenPlex SNP genotyping system, full SNP profiles were obtained in 97.......6% of the investigations. Perfect concordance was obtained in duplicate investigations and the SNP genotypes obtained with the GenPlex system were concordant with those of the accredited SBE based SNP typing system except for one result in rs901398 in one of 286 individuals most likely due to a mutation 6 bp downstream...
Directory of Open Access Journals (Sweden)
Keum-Ju Lee
2011-01-01
Full Text Available We demonstrate that Au-cluster-decorated single-walled carbon nanotubes (SWNTs may be used to discriminate single nucleotide polymorphism (SNP. Nanoscale Au clusters were formed on the side walls of carbon nanotubes in a transistor geometry using electrochemical deposition. The effect of Au cluster decoration appeared as hole doping when electrical transport characteristics were examined. Thiolated single-stranded probe peptide nucleic acid (PNA was successfully immobilized on Au clusters decorating single-walled carbon nanotube field-effect transistors (SWNT-FETs, resulting in a conductance decrease that could be explained by a decrease in Au work function upon adsorption of thiolated PNA. Although a target single-stranded DNA (ssDNA with a single mismatch did not cause any change in electrical conductance, a clear decrease in conductance was observed with matched ssDNA, thereby showing the possibility of SNP (single nucleotide polymorphism detection using Au-cluster-decorated SWNT-FETs. However, a power to discriminate SNP target is lost in high ionic environment. We can conclude that observed SNP discrimination in low ionic environment is due to the hampered binding of SNP target on nanoscale surfaces in low ionic conditions.
Partitioned learning of deep Boltzmann machines for SNP data.
Hess, Moritz; Lenz, Stefan; Blätte, Tamara J; Bullinger, Lars; Binder, Harald
2017-10-15
Learning the joint distributions of measurements, and in particular identification of an appropriate low-dimensional manifold, has been found to be a powerful ingredient of deep leaning approaches. Yet, such approaches have hardly been applied to single nucleotide polymorphism (SNP) data, probably due to the high number of features typically exceeding the number of studied individuals. After a brief overview of how deep Boltzmann machines (DBMs), a deep learning approach, can be adapted to SNP data in principle, we specifically present a way to alleviate the dimensionality problem by partitioned learning. We propose a sparse regression approach to coarsely screen the joint distribution of SNPs, followed by training several DBMs on SNP partitions that were identified by the screening. Aggregate features representing SNP patterns and the corresponding SNPs are extracted from the DBMs by a combination of statistical tests and sparse regression. In simulated case-control data, we show how this can uncover complex SNP patterns and augment results from univariate approaches, while maintaining type 1 error control. Time-to-event endpoints are considered in an application with acute myeloid leukemia patients, where SNP patterns are modeled after a pre-screening based on gene expression data. The proposed approach identified three SNPs that seem to jointly influence survival in a validation dataset. This indicates the added value of jointly investigating SNPs compared to standard univariate analyses and makes partitioned learning of DBMs an interesting complementary approach when analyzing SNP data. A Julia package is provided at 'http://github.com/binderh/BoltzmannMachines.jl'. binderh@imbi.uni-freiburg.de. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com
SNP-based typing: a useful tool to study Bordetella pertussis populations.
Directory of Open Access Journals (Sweden)
Marjolein van Gent
Full Text Available To monitor changes in Bordetella pertussis populations, mainly two typing methods are used; Pulsed-Field Gel Electrophoresis (PFGE and Multiple-Locus Variable-Number Tandem Repeat Analysis (MLVA. In this study, a single nucleotide polymorphism (SNP typing method, based on 87 SNPs, was developed and compared with PFGE and MLVA. The discriminatory indices of SNP typing, PFGE and MLVA were found to be 0.85, 0.95 and 0.83, respectively. Phylogenetic analysis, using SNP typing as Gold Standard, revealed false homoplasies in the PFGE and MLVA trees. Further, in contrast to the SNP-based tree, the PFGE- and MLVA-based trees did not reveal a positive correlation between root-to-tip distance and the isolation year of strains. Thus PFGE and MLVA do not allow an estimation of the relative age of the selected strains. In conclusion, SNP typing was found to be phylogenetically more informative than PFGE and more discriminative than MLVA. Further, in contrast to PFGE, it is readily standardized allowing interlaboratory comparisons. We applied SNP typing to study strains with a novel allele for the pertussis toxin promoter, ptxP3, which have a worldwide distribution and which have replaced the resident ptxP1 strains in the last 20 years. Previously, we showed that ptxP3 strains showed increased pertussis toxin expression and that their emergence was associated with increased notification in The Netherlands. SNP typing showed that the ptxP3 strains isolated in the Americas, Asia, Australia and Europe formed a monophyletic branch which recently diverged from ptxP1 strains. Two predominant ptxP3 SNP types were identified which spread worldwide. The widespread use of SNP typing will enhance our understanding of the evolution and global epidemiology of B. pertussis.
SNP-Based Typing: A Useful Tool to Study Bordetella pertussis Populations
van der Heide, Han G. J.; Heuvelman, Kees J.; Kallonen, Teemu; He, Qiushui; Mertsola, Jussi; Advani, Abdolreza; Hallander, Hans O.; Janssens, Koen; Hermans, Peter W.; Mooi, Frits R.
2011-01-01
To monitor changes in Bordetella pertussis populations, mainly two typing methods are used; Pulsed-Field Gel Electrophoresis (PFGE) and Multiple-Locus Variable-Number Tandem Repeat Analysis (MLVA). In this study, a single nucleotide polymorphism (SNP) typing method, based on 87 SNPs, was developed and compared with PFGE and MLVA. The discriminatory indices of SNP typing, PFGE and MLVA were found to be 0.85, 0.95 and 0.83, respectively. Phylogenetic analysis, using SNP typing as Gold Standard, revealed false homoplasies in the PFGE and MLVA trees. Further, in contrast to the SNP-based tree, the PFGE- and MLVA-based trees did not reveal a positive correlation between root-to-tip distance and the isolation year of strains. Thus PFGE and MLVA do not allow an estimation of the relative age of the selected strains. In conclusion, SNP typing was found to be phylogenetically more informative than PFGE and more discriminative than MLVA. Further, in contrast to PFGE, it is readily standardized allowing interlaboratory comparisons. We applied SNP typing to study strains with a novel allele for the pertussis toxin promoter, ptxP3, which have a worldwide distribution and which have replaced the resident ptxP1 strains in the last 20 years. Previously, we showed that ptxP3 strains showed increased pertussis toxin expression and that their emergence was associated with increased notification in the Netherlands. SNP typing showed that the ptxP3 strains isolated in the Americas, Asia, Australia and Europe formed a monophyletic branch which recently diverged from ptxP1 strains. Two predominant ptxP3 SNP types were identified which spread worldwide. The widespread use of SNP typing will enhance our understanding of the evolution and global epidemiology of B. pertussis. PMID:21647370
Gonçalves da Silva, Anders; Barendse, William; Kijas, James W; Barris, Wes C; McWilliam, Sean; Bunch, Rowan J; McCullough, Russell; Harrison, Blair; Hoelzel, A Rus; England, Phillip R
2015-07-01
Single nucleotide polymorphisms (SNPs) have become the marker of choice for genetic studies in organisms of conservation, commercial or biological interest. Most SNP discovery projects in nonmodel organisms apply a strategy for identifying putative SNPs based on filtering rules that account for random sequencing errors. Here, we analyse data used to develop 4723 novel SNPs for the commercially important deep-sea fish, orange roughy (Hoplostethus atlanticus), to assess the impact of not accounting for systematic sequencing errors when filtering identified polymorphisms when discovering SNPs. We used SAMtools to identify polymorphisms in a velvet assembly of genomic DNA sequence data from seven individuals. The resulting set of polymorphisms were filtered to minimize 'bycatch'-polymorphisms caused by sequencing or assembly error. An Illumina Infinium SNP chip was used to genotype a final set of 7714 polymorphisms across 1734 individuals. Five predictors were examined for their effect on the probability of obtaining an assayable SNP: depth of coverage, number of reads that support a variant, polymorphism type (e.g. A/C), strand-bias and Illumina SNP probe design score. Our results indicate that filtering out systematic sequencing errors could substantially improve the efficiency of SNP discovery. We show that BLASTX can be used as an efficient tool to identify single-copy genomic regions in the absence of a reference genome. The results have implications for research aiming to identify assayable SNPs and build SNP genotyping assays for nonmodel organisms. © 2014 John Wiley & Sons Ltd.
SNP calling using genotype model selection on high-throughput sequencing data
You, Na
2012-01-16
Motivation: A review of the available single nucleotide polymorphism (SNP) calling procedures for Illumina high-throughput sequencing (HTS) platform data reveals that most rely mainly on base-calling and mapping qualities as sources of error when calling SNPs. Thus, errors not involved in base-calling or alignment, such as those in genomic sample preparation, are not accounted for.Results: A novel method of consensus and SNP calling, Genotype Model Selection (GeMS), is given which accounts for the errors that occur during the preparation of the genomic sample. Simulations and real data analyses indicate that GeMS has the best performance balance of sensitivity and positive predictive value among the tested SNP callers. © The Author 2012. Published by Oxford University Press. All rights reserved.
Sanchez, J J; Børsting, C; Balogh, K; Berger, B; Bogus, M; Butler, J M; Carracedo, A; Court, D Syndercombe; Dixon, L A; Filipović, B; Fondevila, M; Gill, P; Harrison, C D; Hohoff, C; Huel, R; Ludes, B; Parson, W; Parsons, T J; Petkovski, E; Phillips, C; Schmitter, H; Schneider, P M; Vallone, P M; Morling, N
2008-06-01
We report the results of an inter-laboratory exercise on typing of autosomal single nucleotide polymorphisms (SNP) for forensic genetic investigations in crime cases. The European DNA Profiling Group (EDNAP), a working group under the International Society for Forensic Genetics (ISFG), organised the exercise. A total of 11 European and one US forensic genetic laboratories tested a subset of a 52 SNP-multiplex PCR kit developed by the SNPforID consortium. The 52 SNP-multiplex kit amplifies 52 DNA fragments with 52 autosomal SNP loci in one multiplex PCR. The 52 SNPs are detected in two separate single base extension (SBE) multiplex reactions with 29 and 23 SNPs, respectively, using SNaPshot kit, capillary electrophoresis and multicolour fluorescence detection. For practical reasons, only the 29 SBE multiplex reaction was carried out by the participating laboratories. A total of 11 bloodstains on FTA cards including a sample of poor quality and a negative control were sent to the laboratories together with the essential reagents for the initial multiplex PCR and the multiplex SBE reaction. The total SNP locus dropout rate was 2.8% and more than 50% of the dropouts were observed with the poor quality sample. The overall rate of discrepant SNP allele assignments was 2.0%. Two laboratories reported 60% of all the discrepancies. Two laboratories reported all 29 SNP alleles in all 10 positive samples correctly. The results of the collaborative exercise were surprisingly good and demonstrate that SNP typing with SBE, capillary electrophoresis and multicolour detection methods can be developed for forensic genetics.
A SNP-Based Molecular Barcode for Characterization of Common Wheat.
Directory of Open Access Journals (Sweden)
LiFeng Gao
Full Text Available Wheat is grown as a staple crop worldwide. It is important to develop an effective genotyping tool for this cereal grain both to identify germplasm diversity and to protect the rights of breeders. Single-nucleotide polymorphism (SNP genotyping provides a means for developing a practical, rapid, inexpensive and high-throughput assay. Here, we investigated SNPs as robust markers of genetic variation for typing wheat cultivars. We identified SNPs from an array of 9000 across a collection of 429 well-known wheat cultivars grown in China, of which 43 SNP markers with high minor allele frequency and variations discriminated the selected wheat varieties and their wild ancestors. This SNP-based barcode will allow for the rapid and precise identification of wheat germplasm resources and newly released varieties and will further assist in the wheat breeding program.
Quantification of within-sample genetic heterogeneity from SNP-array data
DEFF Research Database (Denmark)
Martinez, Pierre; Kimberley, Christopher; Birkbak, Nicolai Juul
2017-01-01
Intra-tumour genetic heterogeneity (ITH) fosters drug resistance and is a critical hurdle to clinical treatment. ITH can be well-measured using multi-region sampling but this is costly and challenging to implement. There is therefore a need for tools to estimate ITH in individual samples, using...... standard genomic data such as SNP-arrays, that could be implemented routinely. We designed two novel scores S and R, respectively based on the Shannon diversity index and Ripley's L statistic of spatial homogeneity, to quantify ITH in single SNP-array samples. We created in-silico and in-vitro mixtures...... sequencing data but heterogeneity in the fraction of tumour cells present across samples hampered accurate quantification. The prognostic potential of both scores was moderate but significantly predictive of survival in several tumour types (corrected p = 0.03). Our work thus shows how individual SNP...
Jiang, Chao; Huang, Lu-Qi; Yuan, Yuan; Chen, Min; Hou, Jing-Yi; Wu, Zhi-Gang; Lin, Shu-Fang
2014-04-01
Single nucleotide polymorphisms (SNP) is an important molecular marker in traditional Chinese medicine research, and it is widely used in TCM authentication. The present study created a new genotyping method by combining restriction endonuclease digesting with melting curve analysis, which is a stable, rapid and easy doing SNP genotyping method. The new method analyzed SNP genotyping of two chloroplast SNP which was located in or out of the endonuclease recognition site, the results showed that when attaching a 14 bp GC-clamp (cggcgggagggcgg) to 5' end of the primer and selecting suited endonuclease to digest the amplification products, the melting curve of Lonicera japonica and Atractylodes macrocephala were all of double peaks and the adulterants Shan-yin-hua and A. lancea were of single peaks. The results indicated that the method had good stability and reproducibility for identifying authentic medicines from its adulterants. It is a potential SNP genotyping method and named restriction endonuclease digest - melting curve analysis.
Phenylethynylpyrene excimer forming hybridization probes for fluorescence SNP detection
DEFF Research Database (Denmark)
Prokhorenko, Igor A.; Astakhova, Irina V.; Momynaliev, Kuvat T.
2009-01-01
Excimer formation is a unique feature of some fluorescent dyes (e.g., pyrene) which can be used for probing the proximity of biomolecules. Pyrene excimer fluorescence has previously been used for homogeneous detection of single nucleotide polymorphism (SNP) on DNA. 1-Phenylethynylpyrene (1-1-PEPy...
Genetic Polymorphism of MDM2 SNP309 in Patients with Helicobacter Pylori-Associated Gastritis.
Tongtawee, Taweesak; Dechsukhum, Chavaboon; Leeanansaksiri, Wilairat; Kaewpitoon, Soraya; Kaewpitoon, Natthawut; Loyd, Ryan A; Matrakool, Likit; Panpimanmas, Sukij
2015-01-01
Helicobacter pylori plays an important role in gastric cancer, which has a relatively low inciduence in Thailand. MDM2 is a major negative regulator of p53, the key tumor suppressor involved in tumorigenesis of the majority of human cancers. Whether its expression might explain the relative lack of gastric cancer in Thailand was assessed here. This single-center study was conducted in the northeast region of Thailand. Gastric mucosa from 100 patients with Helicobacter pylori associated gastritis was analyzed for MDM2 SNP309 using real-time PCR hybridization (light-cycler) probes. In the total 100 Helicobacter pylori associated gastritis cases the incidence of SNP 309 T/T homozygous was 78 % with SNP309 G/T heterozygous found in 19% and SNP309 G/G homozygous in 3%. The result show SNP 309 T/T and SNP 309 G/T to be rather common in the Thai population. Our study indicates that the MDM2 SNP309 G/G homozygous genotype might be a risk factor for gastric cancer in Thailand and the fact that it is infrequent could explain to some extent the low incidence of gastric cancer in the Thai population.
Interest in genomic SNP testing for prostate cancer risk: a pilot survey.
Hall, Michael J; Ruth, Karen J; Chen, David Yt; Gross, Laura M; Giri, Veda N
2015-01-01
Advancements in genomic testing have led to the identification of single nucleotide polymorphisms (SNPs) associated with prostate cancer. The clinical utility of SNP tests to evaluate prostate cancer risk is unclear. Studies have not examined predictors of interest in novel genomic SNP tests for prostate cancer risk in a diverse population. Consecutive participants in the Fox Chase Prostate Cancer Risk Assessment Program (PRAP) (n = 40) and unselected men from surgical urology clinics (n = 40) completed a one-time survey. Items examined interest in genomic SNP testing for prostate cancer risk, knowledge, impact of unsolicited findings, and psychosocial factors including health literacy. Knowledge of genomic SNP tests was low in both groups, but interest was higher among PRAP men (p testing in both groups. Multivariable modeling identified several predictors of higher interest in a genomic SNP test including higher perceived risk (p = 0.025), indicating zero reasons for not wanting testing (vs ≥1 reason) (p = 0.013), and higher health literacy (p = 0.016). Knowledge of genomic SNP testing was low in this sample, but higher among high-risk men. High-risk status may increase interest in novel genomic tests, while low literacy may lessen interest.
US Agency for International Development — Polymorphism of SNP Markers (single nucleotide polymorphisms) was assessed on 24 parental lines of the ISRA sorghum breeding program . About 1300 SNP have been used...
Polygenic analysis of genome-wide SNP data identifies common variants on allergic rhinitis
DEFF Research Database (Denmark)
Mohammadnejad, Afsaneh; Brasch-Andersen, Charlotte; Haagerup, Annette
Background: Allergic Rhinitis (AR) is a complex disorder that affects many people around the world. There is a high genetic contribution to the development of the AR, as twins and family studies have estimated heritability of more than 33%. Due to the complex nature of the disease, single SNP...... analysis has limited power in identifying the genetic variations for AR. We combined genome-wide association analysis (GWAS) with polygenic risk score (PRS) in exploring the genetic basis underlying the disease. Methods: We collected clinical data on 631 Danish subjects with AR cases consisting of 434...... sibling pairs and unrelated individuals and control subjects of 197 unrelated individuals. SNP genotyping was done by Affymetrix Genome-Wide Human SNP Array 5.0. SNP imputation was performed using "IMPUTE2". Using additive effect model, GWAS was conducted in discovery sample, the genotypes...
Direct inference of SNP heterozygosity rates and resolution of LOH detection.
Directory of Open Access Journals (Sweden)
Xiaohong Li
2007-11-01
Full Text Available Single nucleotide polymorphisms (SNPs have been increasingly utilized to investigate somatic genetic abnormalities in premalignancy and cancer. LOH is a common alteration observed during cancer development, and SNP assays have been used to identify LOH at specific chromosomal regions. The design of such studies requires consideration of the resolution for detecting LOH throughout the genome and identification of the number and location of SNPs required to detect genetic alterations in specific genomic regions. Our study evaluated SNP distribution patterns and used probability models, Monte Carlo simulation, and real human subject genotype data to investigate the relationships between the number of SNPs, SNP HET rates, and the sensitivity (resolution for detecting LOH. We report that variances of SNP heterozygosity rate in dbSNP are high for a large proportion of SNPs. Two statistical methods proposed for directly inferring SNP heterozygosity rates require much smaller sample sizes (intermediate sizes and are feasible for practical use in SNP selection or verification. Using HapMap data, we showed that a region of LOH greater than 200 kb can be reliably detected, with losses smaller than 50 kb having a substantially lower detection probability when using all SNPs currently in the HapMap database. Higher densities of SNPs may exist in certain local chromosomal regions that provide some opportunities for reliably detecting LOH of segment sizes smaller than 50 kb. These results suggest that the interpretation of the results from genome-wide scans for LOH using commercial arrays need to consider the relationships among inter-SNP distance, detection probability, and sample size for a specific study. New experimental designs for LOH studies would also benefit from considering the power of detection and sample sizes required to accomplish the proposed aims.
MDM2 SNP309, gene-gene interaction, and tumor susceptibility: an updated meta-analysis
Directory of Open Access Journals (Sweden)
Wu Wei
2011-05-01
Full Text Available Abstract Background The tumor suppressor gene p53 is involved in multiple cellular pathways including apoptosis, transcriptional control, and cell cycle regulation. In the last decade it has been demonstrated that the single nucleotide polymorphism (SNP at codon 72 of the p53 gene is associated with the risk for development of various neoplasms. MDM2 SNP309 is a single nucleotide T to G polymorphism located in the MDM2 gene promoter. From the time that this well-characterized functional polymorphism was identified, a variety of case-control studies have been published that investigate the possible association between MDM2 SNP309 and cancer risk. However, the results of the published studies, as well as the subsequent meta-analyses, remain contradictory. Methods To investigate whether currently published epidemiological studies can clarify the potential interaction between MDM2 SNP309 and the functional genetic variant in p53 codon72 (Arg72Pro and p53 mutation status, we performed a meta-analysis of the risk estimate on 27,813 cases with various tumor types and 30,295 controls. Results The data we reviewed indicated that variant homozygote 309GG and heterozygote 309TG were associated with a significant increased risk of all tumor types (homozygote comparison: odds ratio (OR = 1.25, 95% confidence interval (CI = 1.13-1.37; heterozygote comparison: OR = 1.10, 95% CI = 1.03-1.17. We also found that the combination of GG and Pro/Pro, TG and Pro/Pro, GG and Arg/Arg significantly increased the risk of cancer (OR = 3.38, 95% CI = 1.77-6.47; OR = 1.88, 95% CI = 1.26-2.81; OR = 1.96, 95% CI = 1.01-3.78, respectively. In a stratified analysis by tumor location, we also found a significant increased risk in brain, liver, stomach and uterus cancer (OR = 1.47, 95% CI = 1.06-2.03; OR = 2.24, 95%CI = 1.57-3.18; OR = 1.54, 95%CI = 1.04-2.29; OR = 1.34, 95%CI = 1.07-1.29, respectively. However, no association was seen between MDM2 SNP309 and tumor susceptibility
Interference of Homologous Sequences on the SNP Study of CYP2A13 Gene
Directory of Open Access Journals (Sweden)
Qinghua ZHOU
2010-02-01
Full Text Available Background and objective It has been proven that cytochrome P450 enzyme 2A13 (CYP2A13 played an important role in the association between single nucleotide polymorphisms (SNP and human diseases. Cytochrome P450 enzymes are a group of isoenzymes, whose sequence homology may interfere with the study for SNP. The aim of this study is to explore the interference on the SNP study of CYP2A13 caused by homologous sequences. Methods Taqman probe was applied to detect distribution of rs8192789 sites in 573 subjects, and BLAST method was used to analyze the amplified sequences. Partial sequences of CYP2A13 were emplified by PCR from 60 cases. The emplified sequences were TA cloned and sequenced. Results For rs8192789 loci in 573 cases, only 3 cases were TT, while the rest were CT heterozygotes, which was caused by homologous sequences. There are a large number of overlapping peaks in identical sequences of 60 cases, and the SNP of 101 amino acid site reported in the SNP database is not found. The cloned sequences are 247 bp, 235 bp fragments. Conclusion The homologous sequences may interfere the study for SNP of CYP2A13, and some SNP may not exist.
Identification of Laying-Related SNP Markers in Geese Using RAD Sequencing.
Directory of Open Access Journals (Sweden)
ShiGang Yu
Full Text Available Laying performance is an important economical trait of goose production. As laying performance is of low heritability, it is of significance to develop a marker-assisted selection (MAS strategy for this trait. Definition of sequence variation related to the target trait is a prerequisite of quantitating MAS, but little is presently known about the goose genome, which greatly hinders the identification of genetic markers for the laying traits of geese. Recently developed restriction site-associated DNA (RAD sequencing is a possible approach for discerning large-scale single nucleotide polymorphism (SNP and reducing the complexity of a genome without having reference genomic information available. In the present study, we developed a pooled RAD sequencing strategy for detecting geese laying-related SNP. Two DNA pools were constructed, each consisting of equal amounts of genomic DNA from 10 individuals with either high estimated breeding value (HEBV or low estimated breeding value (LEBV. A total of 139,013 SNP were obtained from 42,291,356 sequences, of which 18,771,943 were for LEBV and 23,519,413 were for HEBV cohorts. Fifty-five SNP which had different allelic frequencies in the two DNA pools were further validated by individual-based AS-PCR genotyping in the LEBV and HEBV cohorts. Ten out of 55 SNP exhibited distinct allele distributions in these two cohorts. These 10 SNP were further genotyped in a goose population of 492 geese to verify the association with egg numbers. The result showed that 8 of 10 SNP were associated with egg numbers. Additionally, liner regression analysis revealed that SNP Record-111407, 106975 and 112359 were involved in a multiplegene network affecting laying performance. We used IPCR to extend the unknown regions flanking the candidate RAD tags. The obtained sequences were subjected to BLAST to retrieve the orthologous genes in either ducks or chickens. Five novel genes were cloned for geese which harbored the
A robust SNP barcode for typing Mycobacterium tuberculosis complex strains
Coll, Francesc
2014-09-01
Strain-specific genomic diversity in the Mycobacterium tuberculosis complex (MTBC) is an important factor in pathogenesis that may affect virulence, transmissibility, host response and emergence of drug resistance. Several systems have been proposed to classify MTBC strains into distinct lineages and families. Here, we investigate single-nucleotide polymorphisms (SNPs) as robust (stable) markers of genetic variation for phylogenetic analysis. We identify ∼92k SNP across a global collection of 1,601 genomes. The SNP-based phylogeny is consistent with the gold-standard regions of difference (RD) classification system. Of the ∼7k strain-specific SNPs identified, 62 markers are proposed to discriminate known circulating strains. This SNP-based barcode is the first to cover all main lineages, and classifies a greater number of sublineages than current alternatives. It may be used to classify clinical isolates to evaluate tools to control the disease, including therapeutics and vaccines whose effectiveness may vary by strain type. © 2014 Macmillan Publishers Limited.
A 50 SNP-multiplex mass spectrometry assay for human identification
DEFF Research Database (Denmark)
Wächter, Andrea; Mengel-From, Jonas; Børsting, Claus
2008-01-01
We developed a 50 SNP-multiplex assay for detection on a MALDI-TOF MS platform based on the SNPs in the 52 SNP-multiplex assay recently developed by the SNPforID Consortium. After PCR amplification, the products were purified on Qiagen columns and used as templates in one single base extension (SBE...... primers were extended with biotin labelled ddNTPs and purified on avidin beads ensuring that only the extended SBE primers were isolated and spotted on the MALDI-TOF anchor target. Detection of the 50 extended primers from the SBE reaction was performed in a mass range between 3000 and 10,000 m/z...
Deben, Christophe; Op de Beeck, Ken; Van den Bossche, Jolien; Jacobs, Julie; Lardon, Filip; Wouters, An; Peeters, Marc; Van Camp, Guy; Rolfo, Christian; Deschoolmeester, Vanessa; Pauwels, Patrick
2017-01-01
Objectives: Two functional polymorphisms in the MDM2 promoter region, SNP309T>G and SNP285G>C, have been shown to impact MDM2 expression and cancer risk. Currently available data on the prognostic value of MDM2 SNP309 in non-small cell lung cancer (NSCLC) is contradictory and unavailable for SNP285. The goal of this study was to clarify the role of these MDM2 SNPs in the outcome of NSCLC patients. Materials and Methods: In this study we genotyped SNP309 and SNP285 in 98 NSCLC adenocarcinoma patients and determined MDM2 mRNA and protein levels. In addition, we assessed the prognostic value of these common SNPs on overall and progression free survival, taking into account the TP53 status of the tumor. Results and Conclusion: We found that the SNP285C allele, but not the SNP309G allele, was significantly associated with increased MDM2 mRNA expression levels (p = 0.025). However, we did not observe an association with MDM2 protein levels for SNP285. The SNP309G allele was significantly associated with the presence of wild type TP53 (p = 0.047) and showed a strong trend towards increased MDM2 protein levels (p = 0.068). In addition, patients harboring the SNP309G allele showed a worse overall survival, but only in the presence of wild type TP53. The SNP285C allele was significantly associated with an early age of diagnosis and metastasis. Additionally, the SNP285C allele acted as an independent predictor for worse progression free survival (HR = 3.97; 95% CI = 1.51 - 10.42; p = 0.005). Our data showed that both SNP309 (in the presence of wild type TP53) and SNP285 act as negative prognostic markers for NSCLC patients, implicating a prominent role for these variants in the outcome of these patients. PMID:28819417
SNPhylo: a pipeline to construct a phylogenetic tree from huge SNP data.
Lee, Tae-Ho; Guo, Hui; Wang, Xiyin; Kim, Changsoo; Paterson, Andrew H
2014-02-26
Phylogenetic trees are widely used for genetic and evolutionary studies in various organisms. Advanced sequencing technology has dramatically enriched data available for constructing phylogenetic trees based on single nucleotide polymorphisms (SNPs). However, massive SNP data makes it difficult to perform reliable analysis, and there has been no ready-to-use pipeline to generate phylogenetic trees from these data. We developed a new pipeline, SNPhylo, to construct phylogenetic trees based on large SNP datasets. The pipeline may enable users to construct a phylogenetic tree from three representative SNP data file formats. In addition, in order to increase reliability of a tree, the pipeline has steps such as removing low quality data and considering linkage disequilibrium. A maximum likelihood method for the inference of phylogeny is also adopted in generation of a tree in our pipeline. Using SNPhylo, users can easily produce a reliable phylogenetic tree from a large SNP data file. Thus, this pipeline can help a researcher focus more on interpretation of the results of analysis of voluminous data sets, rather than manipulations necessary to accomplish the analysis.
Chen, Xin; Wu, Qiong; Sun, Ruimin; Zhang, Louxin
2012-01-01
The discovery of single-nucleotide polymorphisms (SNPs) has important implications in a variety of genetic studies on human diseases and biological functions. One valuable approach proposed for SNP discovery is based on base-specific cleavage and mass spectrometry. However, it is still very challenging to achieve the full potential of this SNP discovery approach. In this study, we formulate two new combinatorial optimization problems. While both problems are aimed at reconstructing the sample sequence that would attain the minimum number of SNPs, they search over different candidate sequence spaces. The first problem, denoted as SNP - MSP, limits its search to sequences whose in silico predicted mass spectra have all their signals contained in the measured mass spectra. In contrast, the second problem, denoted as SNP - MSQ, limits its search to sequences whose in silico predicted mass spectra instead contain all the signals of the measured mass spectra. We present an exact dynamic programming algorithm for solving the SNP - MSP problem and also show that the SNP - MSQ problem is NP-hard by a reduction from a restricted variation of the 3-partition problem. We believe that an efficient solution to either problem above could offer a seamless integration of information in four complementary base-specific cleavage reactions, thereby improving the capability of the underlying biotechnology for sensitive and accurate SNP discovery.
Robust Demographic Inference from Genomic and SNP Data
Excoffier, Laurent; Dupanloup, Isabelle; Huerta-Sánchez, Emilia; Sousa, Vitor C.; Foll, Matthieu
2013-01-01
We introduce a flexible and robust simulation-based framework to infer demographic parameters from the site frequency spectrum (SFS) computed on large genomic datasets. We show that our composite-likelihood approach allows one to study evolutionary models of arbitrary complexity, which cannot be tackled by other current likelihood-based methods. For simple scenarios, our approach compares favorably in terms of accuracy and speed with , the current reference in the field, while showing better convergence properties for complex models. We first apply our methodology to non-coding genomic SNP data from four human populations. To infer their demographic history, we compare neutral evolutionary models of increasing complexity, including unsampled populations. We further show the versatility of our framework by extending it to the inference of demographic parameters from SNP chips with known ascertainment, such as that recently released by Affymetrix to study human origins. Whereas previous ways of handling ascertained SNPs were either restricted to a single population or only allowed the inference of divergence time between a pair of populations, our framework can correctly infer parameters of more complex models including the divergence of several populations, bottlenecks and migration. We apply this approach to the reconstruction of African demography using two distinct ascertained human SNP panels studied under two evolutionary models. The two SNP panels lead to globally very similar estimates and confidence intervals, and suggest an ancient divergence (>110 Ky) between Yoruba and San populations. Our methodology appears well suited to the study of complex scenarios from large genomic data sets. PMID:24204310
Tag SNP selection via a genetic algorithm.
Mahdevar, Ghasem; Zahiri, Javad; Sadeghi, Mehdi; Nowzari-Dalini, Abbas; Ahrabian, Hayedeh
2010-10-01
Single Nucleotide Polymorphisms (SNPs) provide valuable information on human evolutionary history and may lead us to identify genetic variants responsible for human complex diseases. Unfortunately, molecular haplotyping methods are costly, laborious, and time consuming; therefore, algorithms for constructing full haplotype patterns from small available data through computational methods, Tag SNP selection problem, are convenient and attractive. This problem is proved to be an NP-hard problem, so heuristic methods may be useful. In this paper we present a heuristic method based on genetic algorithm to find reasonable solution within acceptable time. The algorithm was tested on a variety of simulated and experimental data. In comparison with the exact algorithm, based on brute force approach, results show that our method can obtain optimal solutions in almost all cases and runs much faster than exact algorithm when the number of SNP sites is large. Our software is available upon request to the corresponding author.
Gilbey, John; Cauwelier, Eef; Coulson, Mark W.; Stradmeyer, Lee; Sampayo, James N.; Armstrong, Anja; Verspoor, Eric; Corrigan, Laura; Shelley, Jonathan; Middlemas, Stuart
2016-01-01
Understanding the habitat use patterns of migratory fish, such as Atlantic salmon (Salmo salar L.), and the natural and anthropogenic impacts on them, is aided by the ability to identify individuals to their stock of origin. Presented here are the results of an analysis of informative single nucleotide polymorphic (SNP) markers for detecting genetic structuring in Atlantic salmon in Scotland and NE England and their ability to allow accurate genetic stock identification. 3,787 fish from 147 sites covering 27 rivers were screened at 5,568 SNP markers. In order to identify a cost-effective subset of SNPs, they were ranked according to their ability to differentiate between fish from different rivers. A panel of 288 SNPs was used to examine both individual assignments and mixed stock fisheries and eighteen assignment units were defined. The results improved greatly on previously available methods and, for the first time, fish caught in the marine environment can be confidently assigned to geographically coherent units within Scotland and NE England, including individual rivers. As such, this SNP panel has the potential to aid understanding of the various influences acting upon Atlantic salmon on their marine migrations, be they natural environmental variations and/or anthropogenic impacts, such as mixed stock fisheries and interactions with marine power generation installations. PMID:27723810
Directory of Open Access Journals (Sweden)
Yan Ting-Ting
2011-12-01
Full Text Available Abstract Background The association of rs16996148 single nucleotide polymorphism (SNP in NCAN/CILP2/PBX4 and serum lipid levels is inconsistent. Furthermore, little is known about the association of rs16996148 SNP and serum lipid levels in the Chinese population. We therefore aimed to detect the association of rs16996148 SNP and several environmental factors with serum lipid levels in the Guangxi Mulao and Han populations. Method A total of 712 subjects of Mulao nationality and 736 participants of Han nationality were randomly selected from our stratified randomized cluster samples. Genotyping of the rs16996148 SNP was performed by polymerase chain reaction and restriction fragment length polymorphism combined with gel electrophoresis, and then confirmed by direct sequencing. Results The levels of apolipoprotein (Apo B were higher in Mulao than in Han (P P 0.05; respectively. The frequencies of GG, GT and TT genotypes were 76.0%, 22.5% and 1.5% in Mulao, and 81.2%, 17.4% and 1.4% in Han (P 0.05; respectively. There were no significant differences in the genotypic and allelic frequencies between males and females in both ethnic groups. The levels of HDL-C, ApoAI, and the ratio of ApoAI to ApoB in Mulao were different between the GG and GT/TT genotypes in males but not in females (P P P P P Conclusions The genotypic and allelic frequencies of rs16996148 SNP and the associations of the SNP and serum lipid levels are different in the Mulao and Han populations. Sex (male-specific association of rs16996148 SNP in the NCAN/CILP2/PBX4 and serum lipid levels is also observed in the both ethnic groups.
Genome-wide SNP detection, validation, and development of an 8K SNP array for apple.
Directory of Open Access Journals (Sweden)
David Chagné
Full Text Available As high-throughput genetic marker screening systems are essential for a range of genetics studies and plant breeding applications, the International RosBREED SNP Consortium (IRSC has utilized the Illumina Infinium® II system to develop a medium- to high-throughput SNP screening tool for genome-wide evaluation of allelic variation in apple (Malus×domestica breeding germplasm. For genome-wide SNP discovery, 27 apple cultivars were chosen to represent worldwide breeding germplasm and re-sequenced at low coverage with the Illumina Genome Analyzer II. Following alignment of these sequences to the whole genome sequence of 'Golden Delicious', SNPs were identified using SoapSNP. A total of 2,113,120 SNPs were detected, corresponding to one SNP to every 288 bp of the genome. The Illumina GoldenGate® assay was then used to validate a subset of 144 SNPs with a range of characteristics, using a set of 160 apple accessions. This validation assay enabled fine-tuning of the final subset of SNPs for the Illumina Infinium® II system. The set of stringent filtering criteria developed allowed choice of a set of SNPs that not only exhibited an even distribution across the apple genome and a range of minor allele frequencies to ensure utility across germplasm, but also were located in putative exonic regions to maximize genotyping success rate. A total of 7867 apple SNPs was established for the IRSC apple 8K SNP array v1, of which 5554 were polymorphic after evaluation in segregating families and a germplasm collection. This publicly available genomics resource will provide an unprecedented resolution of SNP haplotypes, which will enable marker-locus-trait association discovery, description of the genetic architecture of quantitative traits, investigation of genetic variation (neutral and functional, and genomic selection in apple.
Genome-Wide SNP Detection, Validation, and Development of an 8K SNP Array for Apple
Chagné, David; Crowhurst, Ross N.; Troggio, Michela; Davey, Mark W.; Gilmore, Barbara; Lawley, Cindy; Vanderzande, Stijn; Hellens, Roger P.; Kumar, Satish; Cestaro, Alessandro; Velasco, Riccardo; Main, Dorrie; Rees, Jasper D.; Iezzoni, Amy; Mockler, Todd; Wilhelm, Larry; Van de Weg, Eric; Gardiner, Susan E.; Bassil, Nahla; Peace, Cameron
2012-01-01
As high-throughput genetic marker screening systems are essential for a range of genetics studies and plant breeding applications, the International RosBREED SNP Consortium (IRSC) has utilized the Illumina Infinium® II system to develop a medium- to high-throughput SNP screening tool for genome-wide evaluation of allelic variation in apple (Malus×domestica) breeding germplasm. For genome-wide SNP discovery, 27 apple cultivars were chosen to represent worldwide breeding germplasm and re-sequenced at low coverage with the Illumina Genome Analyzer II. Following alignment of these sequences to the whole genome sequence of ‘Golden Delicious’, SNPs were identified using SoapSNP. A total of 2,113,120 SNPs were detected, corresponding to one SNP to every 288 bp of the genome. The Illumina GoldenGate® assay was then used to validate a subset of 144 SNPs with a range of characteristics, using a set of 160 apple accessions. This validation assay enabled fine-tuning of the final subset of SNPs for the Illumina Infinium® II system. The set of stringent filtering criteria developed allowed choice of a set of SNPs that not only exhibited an even distribution across the apple genome and a range of minor allele frequencies to ensure utility across germplasm, but also were located in putative exonic regions to maximize genotyping success rate. A total of 7867 apple SNPs was established for the IRSC apple 8K SNP array v1, of which 5554 were polymorphic after evaluation in segregating families and a germplasm collection. This publicly available genomics resource will provide an unprecedented resolution of SNP haplotypes, which will enable marker-locus-trait association discovery, description of the genetic architecture of quantitative traits, investigation of genetic variation (neutral and functional), and genomic selection in apple. PMID:22363718
Directory of Open Access Journals (Sweden)
Morten Bo Johansen
Full Text Available We have developed a sequence conservation-based artificial neural network predictor called NetDiseaseSNP which classifies nsSNPs as disease-causing or neutral. Our method uses the excellent alignment generation algorithm of SIFT to identify related sequences and a combination of 31 features assessing sequence conservation and the predicted surface accessibility to produce a single score which can be used to rank nsSNPs based on their potential to cause disease. NetDiseaseSNP classifies successfully disease-causing and neutral mutations. In addition, we show that NetDiseaseSNP discriminates cancer driver and passenger mutations satisfactorily. Our method outperforms other state-of-the-art methods on several disease/neutral datasets as well as on cancer driver/passenger mutation datasets and can thus be used to pinpoint and prioritize plausible disease candidates among nsSNPs for further investigation. NetDiseaseSNP is publicly available as an online tool as well as a web service: http://www.cbs.dtu.dk/services/NetDiseaseSNP.
Directory of Open Access Journals (Sweden)
Stephen N Carmichael
Full Text Available The salmon louse (Lepeophtheirus salmonis (Krøyer, 1837 is a parasitic copepod that can, if untreated, cause considerable damage to Atlantic salmon (Salmo salar Linnaeus, 1758 and incurs significant costs to the Atlantic salmon mariculture industry. Salmon lice are gonochoristic and normally show sex ratios close to 1:1. While this observation suggests that sex determination in salmon lice is genetic, with only minor environmental influences, the mechanism of sex determination in the salmon louse is unknown. This paper describes the identification of a sex-linked Single Nucleotide Polymorphism (SNP marker, providing the first evidence for a genetic mechanism of sex determination in the salmon louse. Restriction site-associated DNA sequencing (RAD-seq was used to isolate SNP markers in a laboratory-maintained salmon louse strain. A total of 85 million raw Illumina 100 base paired-end reads produced 281,838 unique RAD-tags across 24 unrelated individuals. RAD marker Lsa101901 showed complete association with phenotypic sex for all individuals analysed, being heterozygous in females and homozygous in males. Using an allele-specific PCR assay for genotyping, this SNP association pattern was further confirmed for three unrelated salmon louse strains, displaying complete association with phenotypic sex in a total of 96 genotyped individuals. The marker Lsa101901 was located in the coding region of the prohibitin-2 gene, which showed a sex-dependent differential expression, with mRNA levels determined by RT-qPCR about 1.8-fold higher in adult female than adult male salmon lice. This study's observations of a novel sex-linked SNP marker are consistent with sex determination in the salmon louse being genetic and following a female heterozygous system. Marker Lsa101901 provides a tool to determine the genetic sex of salmon lice, and could be useful in the development of control strategies.
Dozmorov, Mikhail G; Cara, Lukas R; Giles, Cory B; Wren, Jonathan D
2016-08-01
The growing amount of regulatory data from the ENCODE, Roadmap Epigenomics and other consortia provides a wealth of opportunities to investigate the functional impact of single nucleotide polymorphisms (SNPs). Yet, given the large number of regulatory datasets, researchers are posed with a challenge of how to efficiently utilize them to interpret the functional impact of SNP sets. We developed the GenomeRunner web server to automate systematic statistical analysis of SNP sets within a regulatory context. Besides defining the functional impact of SNP sets, GenomeRunner implements novel regulatory similarity/differential analyses, and cell type-specific regulatory enrichment analysis. Validated against literature- and disease ontology-based approaches, analysis of 39 disease/trait-associated SNP sets demonstrated that the functional impact of SNP sets corresponds to known disease relationships. We identified a group of autoimmune diseases with SNPs distinctly enriched in the enhancers of T helper cell subpopulations, and demonstrated relevant cell type-specificity of the functional impact of other SNP sets. In summary, we show how systematic analysis of genomic data within a regulatory context can help interpreting the functional impact of SNP sets. GenomeRunner web server is freely available at http://www.integrativegenomics.org/ mikhail.dozmorov@gmail.com Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
RS-SNP: a random-set method for genome-wide association studies
Directory of Open Access Journals (Sweden)
Mukherjee Sayan
2011-03-01
Full Text Available Abstract Background The typical objective of Genome-wide association (GWA studies is to identify single-nucleotide polymorphisms (SNPs and corresponding genes with the strongest evidence of association (the 'most-significant SNPs/genes' approach. Borrowing ideas from micro-array data analysis, we propose a new method, named RS-SNP, for detecting sets of genes enriched in SNPs moderately associated to the phenotype. RS-SNP assesses whether the number of significant SNPs, with p-value P ≤ α, belonging to a given SNP set is statistically significant. The rationale of proposed method is that two kinds of null hypotheses are taken into account simultaneously. In the first null model the genotype and the phenotype are assumed to be independent random variables and the null distribution is the probability of the number of significant SNPs in greater than observed by chance. The second null model assumes the number of significant SNPs in depends on the size of and not on the identity of the SNPs in . Statistical significance is assessed using non-parametric permutation tests. Results We applied RS-SNP to the Crohn's disease (CD data set collected by the Wellcome Trust Case Control Consortium (WTCCC and compared the results with GENGEN, an approach recently proposed in literature. The enrichment analysis using RS-SNP and the set of pathways contained in the MSigDB C2 CP pathway collection highlighted 86 pathways rich in SNPs weakly associated to CD. Of these, 47 were also indicated to be significant by GENGEN. Similar results were obtained using the MSigDB C5 pathway collection. Many of the pathways found to be enriched by RS-SNP have a well-known connection to CD and often with inflammatory diseases. Conclusions The proposed method is a valuable alternative to other techniques for enrichment analysis of SNP sets. It is well founded from a theoretical and statistical perspective. Moreover, the experimental comparison with GENGEN highlights that it is
Vitis phylogenomics: hybridization intensities from a SNP array outperform genotype calls.
Directory of Open Access Journals (Sweden)
Allison J Miller
Full Text Available Understanding relationships among species is a fundamental goal of evolutionary biology. Single nucleotide polymorphisms (SNPs identified through next generation sequencing and related technologies enable phylogeny reconstruction by providing unprecedented numbers of characters for analysis. One approach to SNP-based phylogeny reconstruction is to identify SNPs in a subset of individuals, and then to compile SNPs on an array that can be used to genotype additional samples at hundreds or thousands of sites simultaneously. Although powerful and efficient, this method is subject to ascertainment bias because applying variation discovered in a representative subset to a larger sample favors identification of SNPs with high minor allele frequencies and introduces bias against rare alleles. Here, we demonstrate that the use of hybridization intensity data, rather than genotype calls, reduces the effects of ascertainment bias. Whereas traditional SNP calls assess known variants based on diversity housed in the discovery panel, hybridization intensity data survey variation in the broader sample pool, regardless of whether those variants are present in the initial SNP discovery process. We apply SNP genotype and hybridization intensity data derived from the Vitis9kSNP array developed for grape to show the effects of ascertainment bias and to reconstruct evolutionary relationships among Vitis species. We demonstrate that phylogenies constructed using hybridization intensities suffer less from the distorting effects of ascertainment bias, and are thus more accurate than phylogenies based on genotype calls. Moreover, we reconstruct the phylogeny of the genus Vitis using hybridization data, show that North American subgenus Vitis species are monophyletic, and resolve several previously poorly known relationships among North American species. This study builds on earlier work that applied the Vitis9kSNP array to evolutionary questions within Vitis vinifera
Optimal Design of Low-Density SNP Arrays for Genomic Prediction: Algorithm and Applications.
Directory of Open Access Journals (Sweden)
Xiao-Lin Wu
Full Text Available Low-density (LD single nucleotide polymorphism (SNP arrays provide a cost-effective solution for genomic prediction and selection, but algorithms and computational tools are needed for the optimal design of LD SNP chips. A multiple-objective, local optimization (MOLO algorithm was developed for design of optimal LD SNP chips that can be imputed accurately to medium-density (MD or high-density (HD SNP genotypes for genomic prediction. The objective function facilitates maximization of non-gap map length and system information for the SNP chip, and the latter is computed either as locus-averaged (LASE or haplotype-averaged Shannon entropy (HASE and adjusted for uniformity of the SNP distribution. HASE performed better than LASE with ≤1,000 SNPs, but required considerably more computing time. Nevertheless, the differences diminished when >5,000 SNPs were selected. Optimization was accomplished conditionally on the presence of SNPs that were obligated to each chromosome. The frame location of SNPs on a chip can be either uniform (evenly spaced or non-uniform. For the latter design, a tunable empirical Beta distribution was used to guide location distribution of frame SNPs such that both ends of each chromosome were enriched with SNPs. The SNP distribution on each chromosome was finalized through the objective function that was locally and empirically maximized. This MOLO algorithm was capable of selecting a set of approximately evenly-spaced and highly-informative SNPs, which in turn led to increased imputation accuracy compared with selection solely of evenly-spaced SNPs. Imputation accuracy increased with LD chip size, and imputation error rate was extremely low for chips with ≥3,000 SNPs. Assuming that genotyping or imputation error occurs at random, imputation error rate can be viewed as the upper limit for genomic prediction error. Our results show that about 25% of imputation error rate was propagated to genomic prediction in an Angus
A SNP Genotyping Array for Hexaploid Oat
Directory of Open Access Journals (Sweden)
Nicholas A. Tinker
2014-11-01
Full Text Available Recognizing a need in cultivated hexaploid oat ( L. for a reliable set of reference single nucleotide polymorphisms (SNPs, we have developed a 6000 (6K BeadChip design containing 257 Infinium I and 5486 Infinium II designs corresponding to 5743 SNPs. Of those, 4975 SNPs yielded successful assays after array manufacturing. These SNPs were discovered based on a variety of bioinformatics pipelines in complementary DNA (cDNA and genomic DNA originating from 20 or more diverse oat cultivars. The array was validated in 1100 samples from six recombinant inbred line (RIL mapping populations and sets of diverse oat cultivars and breeding lines, and provided approximately 3500 discernible Mendelian polymorphisms. Here, we present an annotation of these SNPs, including methods of discovery, gene identification and orthology, population-genetic characteristics, and tentative positions on an oat consensus map. We also evaluate a new cluster-based method of calling SNPs. The SNP design sequences are made publicly available, and the full SNP genotyping platform is available for commercial purchase from an independent third party.
Genome-Wide SNP Detection, Validation, and Development of an 8K SNP Array for Apple
Chagné, D.; Crowhurst, R.N.; Troggio, M.; Davey, M.W.; Gilmore, B.; Lawley, C.; Vanderzande, S.; Hellens, R.P.; Kumar, S.; Cestaro, A.; Velasco, R.; Main, D.; Rees, J.D.; Iezzoni, A.F.; Mockler, T.; Wilhelm, L.; Weg, van de W.E.; Gardiner, S.E.; Bassil, N.; Peace, C.
2012-01-01
As high-throughput genetic marker screening systems are essential for a range of genetics studies and plant breeding applications, the International RosBREED SNP Consortium (IRSC) has utilized the Illumina Infinium® II system to develop a medium- to high-throughput SNP screening tool for genome-wide
Prediction of a deletion copy number variant by a dense SNP panel
Kadri, N.K.; Koks, P.D.; Meuwissen, T.H.E.
2012-01-01
Background: A newly recognized type of genetic variation, Copy Number Variation (CNV), is detected in mammalian genomes, e.g. the cattle genome. This form of variation can potentially cause phenotypic variation. Our objective was to determine whether dense SNP (single nucleotide polymorphisms)
Directory of Open Access Journals (Sweden)
Zhen Wu
2013-10-01
Full Text Available A recent chordoma cancer genotyping study reveals that the rs2305089, a single nucleotide polymorphism (SNP located in brachyury gene and a key gene in the development of notochord, is significantly associated with chordoma risk. The brachyury gene is believed to be one of the key genes involved in the pathogenesis of chordoma, a rare primary bone tumor originating along the spinal column or at the base of the skull. The association between the brachyury Gly177Asp single nucleotide polymorphism (SNP and the risk of skull base chordoma in Chinese populations is currently unknown. We investigated the genotype distribution of this SNP in 65 skull-base chordoma cases and 120 healthy subjects. Comparisons of the genotype distributions and allele frequencies did not reveal any significant difference between the groups. Our data suggest that the brachyury Gly177Asp SNP is not involved in the risks of skull-base chordoma, at least in the Chinese population.
Guo, Liyuan; Wang, Jing
2018-01-04
Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
An abbreviated SNP panel for ancestry assignment of honeybees (Apis mellifera)
This paper examines whether an abbreviated panel of 37 single nucleotide polymorphisms (SNPs) has the same power as a larger and more expensive panel of 95 SNPs to assign ancestry of honeybees (Apis mellifera) to three ancestral lineages. We selected 37 SNPs from the original 95 SNP panel using alle...
Comparison of three PCR-based assays for SNP genotyping in sugar beet
Background: PCR allelic discrimination technologies have broad applications in the detection of single nucleotide polymorphisms (SNPs) in genetics and genomics. The use of fluorescence-tagged probes is the leading method for targeted SNP detection, but assay costs and error rates could be improved t...
Ascertainment biases in SNP chips affect measures of population divergence
DEFF Research Database (Denmark)
Albrechtsen, Anders; Nielsen, Finn Cilius; Nielsen, Rasmus
2010-01-01
Chip-based high-throughput genotyping has facilitated genome-wide studies of genetic diversity. Many studies have utilized these large data sets to make inferences about the demographic history of human populations using measures of genetic differentiation such as F(ST) or principal component...... on direct sequencing. In addition, we also analyze publicly available genome-wide data. We demonstrate that the ascertainment biases will distort measures of human diversity and possibly change conclusions drawn from these measures in some times unexpected ways. We also show that details of the genotyping...... analyses. However, the single nucleotide polymorphism (SNP) chip data suffer from ascertainment biases caused by the SNP discovery process in which a small number of individuals from selected populations are used as discovery panels. In this study, we investigate the effect of the ascertainment bias...
Bruno, Damien L; Stark, Zornitza; Amor, David J; Burgess, Trent; Butler, Kathy; Corrie, Sylvea; Francis, David; Ganesamoorthy, Devika; Hills, Louise; James, Paul A; O'Rielly, Darren; Oertel, Ralph; Savarirayan, Ravi; Prabhakara, Krishnamurthy; Salce, Nicholas; Slater, Howard R
2011-12-01
Microarray analysis has provided significant advances in the diagnosis of conditions resulting from submicroscopic chromosome abnormalities. It has been recommended that array testing should be a "first tier" test in the evaluation of individuals with intellectual disability, developmental delay, congenital anomalies, and autism. The availability of arrays with increasingly high probe coverage and resolution has increased the detection of decreasingly small copy number changes (CNCs) down to the intragenic or even exon level. Importantly, arrays that genotype SNPs also detect extended regions of homozygosity. We describe 14 examples of single gene disorders caused by intragenic changes from a consecutive set of 6,500 tests using high-resolution SNP microarrays. These cases illustrate the increased scope of cytogenetic testing beyond dominant chromosome rearrangements that typically contain many genes. Nine of the cases confirmed the clinical diagnosis, that is, followed a "phenotype to genotype" approach. Five were diagnosed by the laboratory analysis in the absence of a specific clinical diagnosis, that is, followed a "genotype to phenotype" approach. Two were clinically significant, incidental findings. The importance of astute clinical assessment and laboratory-clinician consultation is emphasized to optimize the value of microarrays in the diagnosis of disorders caused by single gene copy number and sequence mutations. © 2011 Wiley-Liss, Inc.
Erdoğan, Onur; Aydin Son, Yeşim
2014-01-01
Single Nucleotide Polymorphisms (SNPs) are the most common genomic variations where only a single nucleotide differs between individuals. Individual SNPs and SNP profiles associated with diseases can be utilized as biological markers. But there is a need to determine the SNP subsets and patients' clinical data which is informative for the diagnosis. Data mining approaches have the highest potential for extracting the knowledge from genomic datasets and selecting the representative SNPs as well as most effective and informative clinical features for the clinical diagnosis of the diseases. In this study, we have applied one of the widely used data mining classification methodology: "decision tree" for associating the SNP biomarkers and significant clinical data with the Alzheimer's disease (AD), which is the most common form of "dementia". Different tree construction parameters have been compared for the optimization, and the most accurate tree for predicting the AD is presented.
Farris, M Heath; Scott, Andrew R; Texter, Pamela A; Bartlett, Marta; Coleman, Patricia; Masters, David
2018-04-11
Single nucleotide polymorphisms (SNPs) located within the human genome have been shown to have utility as markers of identity in the differentiation of DNA from individual contributors. Massively parallel DNA sequencing (MPS) technologies and human genome SNP databases allow for the design of suites of identity-linked target regions, amenable to sequencing in a multiplexed and massively parallel manner. Therefore, tools are needed for leveraging the genotypic information found within SNP databases for the discovery of genomic targets that can be evaluated on MPS platforms. The SNP island target identification algorithm (TIA) was developed as a user-tunable system to leverage SNP information within databases. Using data within the 1000 Genomes Project SNP database, human genome regions were identified that contain globally ubiquitous identity-linked SNPs and that were responsive to targeted resequencing on MPS platforms. Algorithmic filters were used to exclude target regions that did not conform to user-tunable SNP island target characteristics. To validate the accuracy of TIA for discovering these identity-linked SNP islands within the human genome, SNP island target regions were amplified from 70 contributor genomic DNA samples using the polymerase chain reaction. Multiplexed amplicons were sequenced using the Illumina MiSeq platform, and the resulting sequences were analyzed for SNP variations. 166 putative identity-linked SNPs were targeted in the identified genomic regions. Of the 309 SNPs that provided discerning power across individual SNP profiles, 74 previously undefined SNPs were identified during evaluation of targets from individual genomes. Overall, DNA samples of 70 individuals were uniquely identified using a subset of the suite of identity-linked SNP islands. TIA offers a tunable genome search tool for the discovery of targeted genomic regions that are scalable in the population frequency and numbers of SNPs contained within the SNP island regions
Development and characterization of a high density SNP genotyping assay for cattle.
Directory of Open Access Journals (Sweden)
Lakshmi K Matukumalli
Full Text Available The success of genome-wide association (GWA studies for the detection of sequence variation affecting complex traits in human has spurred interest in the use of large-scale high-density single nucleotide polymorphism (SNP genotyping for the identification of quantitative trait loci (QTL and for marker-assisted selection in model and agricultural species. A cost-effective and efficient approach for the development of a custom genotyping assay interrogating 54,001 SNP loci to support GWA applications in cattle is described. A novel algorithm for achieving a compressed inter-marker interval distribution proved remarkably successful, with median interval of 37 kb and maximum predicted gap of <350 kb. The assay was tested on a panel of 576 animals from 21 cattle breeds and six outgroup species and revealed that from 39,765 to 46,492 SNP are polymorphic within individual breeds (average minor allele frequency (MAF ranging from 0.24 to 0.27. The assay also identified 79 putative copy number variants in cattle. Utility for GWA was demonstrated by localizing known variation for coat color and the presence/absence of horns to their correct genomic locations. The combination of SNP selection and the novel spacing algorithm allows an efficient approach for the development of high-density genotyping platforms in species having full or even moderate quality draft sequence. Aspects of the approach can be exploited in species which lack an available genome sequence. The BovineSNP50 assay described here is commercially available from Illumina and provides a robust platform for mapping disease genes and QTL in cattle.
Rippe, Ralph Christian Alexander
2012-01-01
Fluorescence bias in in signals from individual SNP arrays can be calibrated using linear models. Given the data, the system of equations is very large, so a specialized symbolic algorithm was developed. These models are also used to illustrate that genomic waves do not exist, but are merely an
A SNP-centric database for the investigation of the human genome
Directory of Open Access Journals (Sweden)
Kohane Isaac S
2004-03-01
Full Text Available Abstract Background Single Nucleotide Polymorphisms (SNPs are an increasingly important tool for genetic and biomedical research. Although current genomic databases contain information on several million SNPs and are growing at a very fast rate, the true value of a SNP in this context is a function of the quality of the annotations that characterize it. Retrieving and analyzing such data for a large number of SNPs often represents a major bottleneck in the design of large-scale association studies. Description SNPper is a web-based application designed to facilitate the retrieval and use of human SNPs for high-throughput research purposes. It provides a rich local database generated by combining SNP data with the Human Genome sequence and with several other data sources, and offers the user a variety of querying, visualization and data export tools. In this paper we describe the structure and organization of the SNPper database, we review the available data export and visualization options, and we describe how the architecture of SNPper and its specialized data structures support high-volume SNP analysis. Conclusions The rich annotation database and the powerful data manipulation and presentation facilities it offers make SNPper a very useful online resource for SNP research. Its success proves the great need for integrated and interoperable resources in the field of computational biology, and shows how such systems may play a critical role in supporting the large-scale computational analysis of our genome.
SNP high-throughput screening in grapevine using the SNPlex™ genotyping system
Directory of Open Access Journals (Sweden)
Velasco Riccardo
2008-01-01
Full Text Available Abstract Background Until recently, only a small number of low- and mid-throughput methods have been used for single nucleotide polymorphism (SNP discovery and genotyping in grapevine (Vitis vinifera L.. However, following completion of the sequence of the highly heterozygous genome of Pinot Noir, it has been possible to identify millions of electronic SNPs (eSNPs thus providing a valuable source for high-throughput genotyping methods. Results Herein we report the first application of the SNPlex™ genotyping system in grapevine aiming at the anchoring of an eukaryotic genome. This approach combines robust SNP detection with automated assay readout and data analysis. 813 candidate eSNPs were developed from non-repetitive contigs of the assembled genome of Pinot Noir and tested in 90 progeny of Syrah × Pinot Noir cross. 563 new SNP-based markers were obtained and mapped. The efficiency rate of 69% was enhanced to 80% when multiple displacement amplification (MDA methods were used for preparation of genomic DNA for the SNPlex assay. Conclusion Unlike other SNP genotyping methods used to investigate thousands of SNPs in a few genotypes, or a few SNPs in around a thousand genotypes, the SNPlex genotyping system represents a good compromise to investigate several hundred SNPs in a hundred or more samples simultaneously. Therefore, the use of the SNPlex assay, coupled with whole genome amplification (WGA, is a good solution for future applications in well-equipped laboratories.
Santoro, Stephanie L; Hashimoto, Sayaka; McKinney, Aimee; Mihalic Mosher, Theresa; Pyatt, Robert; Reshmi, Shalini C; Astbury, Caroline; Hickey, Scott E
2017-01-01
Maternal uniparental disomy (UPD) 15 is one of the molecular causes of Prader-Willi syndrome (PWS), a multisystem disorder which presents with neonatal hypotonia and feeding difficulty. Current diagnostic algorithms differ regarding the use of SNP microarray to detect PWS. We retrospectively examined the frequency with which SNP microarray could identify regions of homozygosity (ROH) in patients with PWS. We determined that 7/12 (58%) patients with previously confirmed PWS by methylation analysis and microsatellite-positive UPD studies had ROH (>10 Mb) by SNP microarray. Additional assessment of 5,000 clinical microarrays, performed from 2013 to present, determined that only a single case of ROH for chromosome 15 was not caused by an imprinting disorder or identity by descent. We observed that ROH for chromosome 15 is rarely incidental and strongly associated with hypotonic infants having features of PWS. Although UPD microsatellite studies remain essential to definitively establish the presence of UPD, SNP microarray has important utility in the timely diagnostic algorithm for PWS. © 2017 S. Karger AG, Basel.
Directory of Open Access Journals (Sweden)
Daniel Ian Jacobs
2012-10-01
Full Text Available Objectives: Using a novel candidate SNP approach, we aimed to identify a possible genetic basis for the higher glioma incidence in Whites relative to East Asians and African-Americans. Methods: We hypothesized that genetic regions containing SNPs with extreme differences in allele frequencies across ethnicities are most likely to harbor susceptibility variants. We used International HapMap Project data to identify 3,961 candidate SNPs with the largest allele frequency differences in Whites compared to East Asians and Africans and tested these SNPs for association with glioma risk in a set of White cases and controls. Top SNPs identified in the discovery dataset were tested for association with glioma in five independent replication datasets. Results: No SNP achieved statistical significance in either the discovery or replication datasets after accounting for multiple testing. However, the most strongly associated SNP, rs879471, was found to be in linkage disequilibrium with a previously identified risk SNP, rs6010620, in RTEL1. We estimate rs6010620 to account for a glioma incidence rate ratio of 1.34 for Whites relative to East Asians. Conclusions: We explored genetic susceptibility to glioma using a novel candidate SNP method which may be applicable to other diseases with appropriate epidemiologic patterns.
Analysis of SNP rs16754 of WT1 gene in a series of de novo acute myeloid leukemia patients.
Luna, Irene; Such, Esperanza; Cervera, Jose; Barragán, Eva; Jiménez-Velasco, Antonio; Dolz, Sandra; Ibáñez, Mariam; Gómez-Seguí, Inés; López-Pavía, María; Llop, Marta; Fuster, Óscar; Oltra, Silvestre; Moscardó, Federico; Martínez-Cuadrón, David; Senent, M Leonor; Gascón, Adriana; Montesinos, Pau; Martín, Guillermo; Bolufer, Pascual; Sanz, Miguel A
2012-12-01
The single nucleotide polymorphism (SNP) rs16754 of the WT1 gene has been previously described as a possible prognostic marker in normal karyotype acute myeloid leukemia (AML) patients. Nevertheless, the findings in this field are not always reproducible in different series. One hundred and seventy-five adult de novo AML patients were screened with two different methods for the detection of SNP rs16754: high-resolution melting (HRM) and FRET hybridization probes. Direct sequencing was used to validate both techniques. The SNP was detected in 52 out of 175 patients (30 %), both by HRM and hybridization probes. Direct sequencing confirmed that every positive sample in the screening methods had a variation in the DNA sequence. Patients with the wild-type genotype (WT1(AA)) for the SNP rs16754 were significantly younger than those with the heterozygous WT1(AG) genotype. No other difference was observed for baseline characteristic or outcome between patients with or without the SNP. Both techniques are equally reliable and reproducible as screening methods for the detection of the SNP rs16754, allowing for the selection of those samples that will need to be sequenced. We were unable to confirm the suggested favorable outcome of SNP rs16754 in de novo AML.
An integrated SNP mining and utilization (ISMU) pipeline for next generation sequencing data.
Azam, Sarwar; Rathore, Abhishek; Shah, Trushar M; Telluri, Mohan; Amindala, BhanuPrakash; Ruperao, Pradeep; Katta, Mohan A V S K; Varshney, Rajeev K
2014-01-01
Open source single nucleotide polymorphism (SNP) discovery pipelines for next generation sequencing data commonly requires working knowledge of command line interface, massive computational resources and expertise which is a daunting task for biologists. Further, the SNP information generated may not be readily used for downstream processes such as genotyping. Hence, a comprehensive pipeline has been developed by integrating several open source next generation sequencing (NGS) tools along with a graphical user interface called Integrated SNP Mining and Utilization (ISMU) for SNP discovery and their utilization by developing genotyping assays. The pipeline features functionalities such as pre-processing of raw data, integration of open source alignment tools (Bowtie2, BWA, Maq, NovoAlign and SOAP2), SNP prediction (SAMtools/SOAPsnp/CNS2snp and CbCC) methods and interfaces for developing genotyping assays. The pipeline outputs a list of high quality SNPs between all pairwise combinations of genotypes analyzed, in addition to the reference genome/sequence. Visualization tools (Tablet and Flapjack) integrated into the pipeline enable inspection of the alignment and errors, if any. The pipeline also provides a confidence score or polymorphism information content value with flanking sequences for identified SNPs in standard format required for developing marker genotyping (KASP and Golden Gate) assays. The pipeline enables users to process a range of NGS datasets such as whole genome re-sequencing, restriction site associated DNA sequencing and transcriptome sequencing data at a fast speed. The pipeline is very useful for plant genetics and breeding community with no computational expertise in order to discover SNPs and utilize in genomics, genetics and breeding studies. The pipeline has been parallelized to process huge datasets of next generation sequencing. It has been developed in Java language and is available at http://hpc.icrisat.cgiar.org/ISMU as a standalone
DEFF Research Database (Denmark)
Milman, Nils; Nielsen, Ole Haagen; Hviid, Thomas Vauvert F
2007-01-01
and SNP13, respectively, were performed by capillary electrophoresis single-strand confirmation polymorphism in 53 patients with histologically verified sarcoidosis and in 103 healthy controls. RESULTS: The frequencies of CARD15 mutations in sarcoidosis patients were: SNP8, 4/106 chromosomes (3.8%); SNP12...... with Crohn's disease. OBJECTIVES: To evaluate whether ethnic Danes with sarcoidosis have an increased frequency of CARD15 mutations compared to healthy control subjects. METHODS: Genotyping for CARD15 mutations R702W, G908R, and L1007fsinsC, also designated single nucleotide polymorphism (SNP) SNP8, SNP12......, 2/106 chromosomes (1.9%); SNP13, 2/106 chromosomes (1.9%); SNP8+SNP12+SNP13, 8/106 chromosomes (7.6%). All 8 patients were heterozygous. The frequencies in controls were: SNP8, 9/206 chromosomes (4.4%); SNP12, 2/206 chromosomes (1.0%); SNP13, 4/206 chromosomes (1.9%); SNP8+SNP12+SNP13, 15...
Anglicheau, Dany; Verstuyft, Céline; Laurent-Puig, Pierre; Becquemont, Laurent; Schlageter, Marie-Hélène; Cassinat, Bruno; Beaune, Philippe; Legendre, Christophe; Thervet, Eric
2003-07-01
The immunosuppressive drug tacrolimus, whose pharmacokinetic characteristics display large interindividual variations, is a substrate for P-glycoprotein (P-gp), the product of the multidrug resistance-1 (MDR1) gene. Some of the single nucleotide polymorphisms (SNP) of MDR1 reported correlated with the in vivo activity of P-gp. Because P-gp is known to control tacrolimus intestinal absorption, it was postulated that these polymorphisms are associated with tacrolimus pharmacokinetic variations in renal transplant recipients. The objective of this study was to evaluate in a retrospective study of 81 renal transplant recipients the effect on tacrolimus dosages and concentration/dose ratio of four frequent MDR1 SNP possibly associated with P-gp function (T-129C in exon 1b, 1236C>T in exon 12, 2677G>T,A in exon 21, and 3435C>T in exon 26). As in the general population, the SNP in exons 12, 21, and 26 were frequent (16, 17.3, and 22.2% for the variant homozygous genotype, respectively) and exhibited incomplete linkage disequilibrium. One month after tacrolimus introduction, exon 21 SNP correlated significantly with the daily tacrolimus dose (P < or = 0.05) and the concentration/dose ratio (P < or = 0.02). Tacrolimus dose requirements were 40% higher in homozygous than wild-type patients for this SNP. The concentration/dose ratio was 36% lower in the wild-type patients, suggesting that, for a given dose, their tacrolimus blood concentration is lower. Haplotype analysis substantiated these results and suggested that exons 26 and 21 SNP may be associated with tacrolimus dose requirements. Genotype monitoring of the MDR1 gene reliably predicts the optimal dose of tacrolimus in renal transplant recipients and may predict the initial daily dose needed by individual patients to obtain adequate immunosuppression.
Casein SNP in Norwegian goats: additive and dominance effects on milk composition and quality
2011-01-01
Background The four casein proteins in goat milk are encoded by four closely linked casein loci (CSN1S1, CSN2, CSN1S2 and CSN3) within 250 kb on caprine chromosome 6. A deletion in exon 12 of CSN1S1, so far reported only in Norwegian goats, has been found at high frequency (0.73). Such a high frequency is difficult to explain because the national breeding goal selects against the variant's effect. Methods In this study, 575 goats were genotyped for 38 Single Nucleotide Polymorphisms (SNP) located within the four casein genes. Milk production records of these goats were obtained from the Norwegian Dairy Goat Control. Test-day mixed models with additive and dominance fixed effects of single SNP were fitted in a model including polygenic effects. Results Significant additive effects of single SNP within CSN1S1 and CSN3 were found for fat % and protein %, milk yield and milk taste. The allele with the deletion showed additive and dominance effects on protein % and fat %, and overdominance effects on milk quantity (kg) and lactose %. At its current frequency, the observed dominance (overdominance) effects of the deletion allele reduced its substitution effect (and additive genetic variance available for selection) in the population substantially. Conclusions The selection pressure of conventional breeding on the allele with the deletion is limited due to the observed dominance (overdominance) effects. Inclusion of molecular information in the national breeding scheme will reduce the frequency of this deletion in the population. PMID:21864407
Multiplex target enrichment using DNA indexing for ultra-high throughput SNP detection.
LENUS (Irish Health Repository)
Kenny, Elaine M
2011-02-01
Screening large numbers of target regions in multiple DNA samples for sequence variation is an important application of next-generation sequencing but an efficient method to enrich the samples in parallel has yet to be reported. We describe an advanced method that combines DNA samples using indexes or barcodes prior to target enrichment to facilitate this type of experiment. Sequencing libraries for multiple individual DNA samples, each incorporating a unique 6-bp index, are combined in equal quantities, enriched using a single in-solution target enrichment assay and sequenced in a single reaction. Sequence reads are parsed based on the index, allowing sequence analysis of individual samples. We show that the use of indexed samples does not impact on the efficiency of the enrichment reaction. For three- and nine-indexed HapMap DNA samples, the method was found to be highly accurate for SNP identification. Even with sequence coverage as low as 8x, 99% of sequence SNP calls were concordant with known genotypes. Within a single experiment, this method can sequence the exonic regions of hundreds of genes in tens of samples for sequence and structural variation using as little as 1 μg of input DNA per sample.
Directory of Open Access Journals (Sweden)
Chao Shiaoman
2011-01-01
Full Text Available Abstract Background Genetic markers are pivotal to modern genomics research; however, discovery and genotyping of molecular markers in oat has been hindered by the size and complexity of the genome, and by a scarcity of sequence data. The purpose of this study was to generate oat expressed sequence tag (EST information, develop a bioinformatics pipeline for SNP discovery, and establish a method for rapid, cost-effective, and straightforward genotyping of SNP markers in complex polyploid genomes such as oat. Results Based on cDNA libraries of four cultivated oat genotypes, approximately 127,000 contigs were assembled from approximately one million Roche 454 sequence reads. Contigs were filtered through a novel bioinformatics pipeline to eliminate ambiguous polymorphism caused by subgenome homology, and 96 in silico SNPs were selected from 9,448 candidate loci for validation using high-resolution melting (HRM analysis. Of these, 52 (54% were polymorphic between parents of the Ogle1040 × TAM O-301 (OT mapping population, with 48 segregating as single Mendelian loci, and 44 being placed on the existing OT linkage map. Ogle and TAM amplicons from 12 primers were sequenced for SNP validation, revealing complex polymorphism in seven amplicons but general sequence conservation within SNP loci. Whole-amplicon interrogation with HRM revealed insertions, deletions, and heterozygotes in secondary oat germplasm pools, generating multiple alleles at some primer targets. To validate marker utility, 36 SNP assays were used to evaluate the genetic diversity of 34 diverse oat genotypes. Dendrogram clusters corresponded generally to known genome composition and genetic ancestry. Conclusions The high-throughput SNP discovery pipeline presented here is a rapid and effective method for identification of polymorphic SNP alleles in the oat genome. The current-generation HRM system is a simple and highly-informative platform for SNP genotyping. These techniques provide
Psoriasis prediction from genome-wide SNP profiles
Directory of Open Access Journals (Sweden)
Fang Xiangzhong
2011-01-01
Full Text Available Abstract Background With the availability of large-scale genome-wide association study (GWAS data, choosing an optimal set of SNPs for disease susceptibility prediction is a challenging task. This study aimed to use single nucleotide polymorphisms (SNPs to predict psoriasis from searching GWAS data. Methods Totally we had 2,798 samples and 451,724 SNPs. Process for searching a set of SNPs to predict susceptibility for psoriasis consisted of two steps. The first one was to search top 1,000 SNPs with high accuracy for prediction of psoriasis from GWAS dataset. The second one was to search for an optimal SNP subset for predicting psoriasis. The sequential information bottleneck (sIB method was compared with classical linear discriminant analysis(LDA for classification performance. Results The best test harmonic mean of sensitivity and specificity for predicting psoriasis by sIB was 0.674(95% CI: 0.650-0.698, while only 0.520(95% CI: 0.472-0.524 was reported for predicting disease by LDA. Our results indicate that the new classifier sIB performs better than LDA in the study. Conclusions The fact that a small set of SNPs can predict disease status with average accuracy of 68% makes it possible to use SNP data for psoriasis prediction.
ChIP on SNP-chip for genome-wide analysis of human histone H4 hyperacetylation
Directory of Open Access Journals (Sweden)
Porter Christopher J
2007-09-01
Full Text Available Abstract Background SNP microarrays are designed to genotype Single Nucleotide Polymorphisms (SNPs. These microarrays report hybridization of DNA fragments and therefore can be used for the purpose of detecting genomic fragments. Results Here, we demonstrate that a SNP microarray can be effectively used in this way to perform chromatin immunoprecipitation (ChIP on chip as an alternative to tiling microarrays. We illustrate this novel application by mapping whole genome histone H4 hyperacetylation in human myoblasts and myotubes. We detect clusters of hyperacetylated histone H4, often spanning across up to 300 kilobases of genomic sequence. Using complementary genome-wide analyses of gene expression by DNA microarray we demonstrate that these clusters of hyperacetylated histone H4 tend to be associated with expressed genes. Conclusion The use of a SNP array for a ChIP-on-chip application (ChIP on SNP-chip will be of great value to laboratories whose interest is the determination of general rules regarding the relationship of specific chromatin modifications to transcriptional status throughout the genome and to examine the asymmetric modification of chromatin at heterozygous loci.
New tools and methods for direct programmatic access to the dbSNP relational database.
Saccone, Scott F; Quan, Jiaxi; Mehta, Gaurang; Bolze, Raphael; Thomas, Prasanth; Deelman, Ewa; Tischfield, Jay A; Rice, John P
2011-01-01
Genome-wide association studies often incorporate information from public biological databases in order to provide a biological reference for interpreting the results. The dbSNP database is an extensive source of information on single nucleotide polymorphisms (SNPs) for many different organisms, including humans. We have developed free software that will download and install a local MySQL implementation of the dbSNP relational database for a specified organism. We have also designed a system for classifying dbSNP tables in terms of common tasks we wish to accomplish using the database. For each task we have designed a small set of custom tables that facilitate task-related queries and provide entity-relationship diagrams for each task composed from the relevant dbSNP tables. In order to expose these concepts and methods to a wider audience we have developed web tools for querying the database and browsing documentation on the tables and columns to clarify the relevant relational structure. All web tools and software are freely available to the public at http://cgsmd.isi.edu/dbsnpq. Resources such as these for programmatically querying biological databases are essential for viably integrating biological information into genetic association experiments on a genome-wide scale.
Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap
DEFF Research Database (Denmark)
Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey
2011-01-01
A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technolo...
Esteras, Cristina; Gómez, Pedro; Monforte, Antonio J; Blanca, José; Vicente-Dólera, Nelly; Roig, Cristina; Nuez, Fernando; Picó, Belén
2012-02-22
Cucurbita pepo is a member of the Cucurbitaceae family, the second- most important horticultural family in terms of economic importance after Solanaceae. The "summer squash" types, including Zucchini and Scallop, rank among the highest-valued vegetables worldwide. There are few genomic tools available for this species.The first Cucurbita transcriptome, along with a large collection of Single Nucleotide Polymorphisms (SNP), was recently generated using massive sequencing. A set of 384 SNP was selected to generate an Illumina GoldenGate assay in order to construct the first SNP-based genetic map of Cucurbita and map quantitative trait loci (QTL). We herein present the construction of the first SNP-based genetic map of Cucurbita pepo using a population derived from the cross of two varieties with contrasting phenotypes, representing the main cultivar groups of the species' two subspecies: Zucchini (subsp. pepo) × Scallop (subsp. ovifera). The mapping population was genotyped with 384 SNP, a set of selected EST-SNP identified in silico after massive sequencing of the transcriptomes of both parents, using the Illumina GoldenGate platform. The global success rate of the assay was higher than 85%. In total, 304 SNP were mapped, along with 11 SSR from a previous map, giving a map density of 5.56 cM/marker. This map was used to infer syntenic relationships between C. pepo and cucumber and to successfully map QTL that control plant, flowering and fruit traits that are of benefit to squash breeding. The QTL effects were validated in backcross populations. Our results show that massive sequencing in different genotypes is an excellent tool for SNP discovery, and that the Illumina GoldenGate platform can be successfully applied to constructing genetic maps and performing QTL analysis in Cucurbita. This is the first SNP-based genetic map in the Cucurbita genus and is an invaluable new tool for biological research, especially considering that most of these markers are located in
SNPdetector: a software tool for sensitive and accurate SNP detection.
Directory of Open Access Journals (Sweden)
Jinghui Zhang
2005-10-01
Full Text Available Identification of single nucleotide polymorphisms (SNPs and mutations is important for the discovery of genetic predisposition to complex diseases. PCR resequencing is the method of choice for de novo SNP discovery. However, manual curation of putative SNPs has been a major bottleneck in the application of this method to high-throughput screening. Therefore it is critical to develop a more sensitive and accurate computational method for automated SNP detection. We developed a software tool, SNPdetector, for automated identification of SNPs and mutations in fluorescence-based resequencing reads. SNPdetector was designed to model the process of human visual inspection and has a very low false positive and false negative rate. We demonstrate the superior performance of SNPdetector in SNP and mutation analysis by comparing its results with those derived by human inspection, PolyPhred (a popular SNP detection tool, and independent genotype assays in three large-scale investigations. The first study identified and validated inter- and intra-subspecies variations in 4,650 traces of 25 inbred mouse strains that belong to either the Mus musculus species or the M. spretus species. Unexpected heterozygosity in CAST/Ei strain was observed in two out of 1,167 mouse SNPs. The second study identified 11,241 candidate SNPs in five ENCODE regions of the human genome covering 2.5 Mb of genomic sequence. Approximately 50% of the candidate SNPs were selected for experimental genotyping; the validation rate exceeded 95%. The third study detected ENU-induced mutations (at 0.04% allele frequency in 64,896 traces of 1,236 zebra fish. Our analysis of three large and diverse test datasets demonstrated that SNPdetector is an effective tool for genome-scale research and for large-sample clinical studies. SNPdetector runs on Unix/Linux platform and is available publicly (http://lpg.nci.nih.gov.
Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology.
Directory of Open Access Journals (Sweden)
Chandra Shekhar Pareek
Full Text Available RNA-seq is a useful next-generation sequencing (NGS technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits.The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM SNP genotyping assay. The
Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology.
Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Pierzchała, Mariusz; Feng, Yaping; Kadarmideen, Haja N; Kumar, Dibyendu
2017-01-01
RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF) and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits. The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel) positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs) with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM) SNP genotyping assay. The comprehensive
Directory of Open Access Journals (Sweden)
Xie LG
2015-12-01
Full Text Available Linguo Xie,1,2,* Yan Sun,2,* Tao Chen,1,2,* Dawei Tian,1,2 Yujuan Li,3 Yu Zhang,1,2 Na Ding,2 Zhonghua Shen,1,2 Hao Xu,1,2 Xuewu Nian,4 Nan Sha,1,2 Ruifa Han,1,2 Hailong Hu,1,2 Changli Wu1,2 Objective: Human murine double minute 2 protein (MDM2 is mainly a negative regulator of p53 tumor suppressor pathway. We aimed to investigate the association between MDM2 SNP309 polymorphism and bladder cancer risk. Methods: A total of 535 bladder cancer patients and 649 health controls were recruited for our study. MDM2 SNP309 T>G polymorphism was genotyped by polymerase chain reaction-ligase detection reaction method. Logistic regression was used to analyze the relationship between the genotype and susceptibility of bladder cancer. Kaplan–Meier estimates and log-rank test were obtained to analyze the association between the genotype and risk of recrudesce in nonmuscle-invasive bladder cancer patients. A multivariable Cox proportional hazards model was fitted to identify independent prognostic factors. To further investigate the association, we conducted a meta-analysis including six studies. Results: The frequency of the MDM2 SNP309 T>G polymorphism showed no significant difference between cases and controls (all P>0.05. In the stratification analysis, the results showed that G allele carriers were prone to have a significant decrease in risk of low-grade bladder cancer (adjusted odds ratio: 0.613, 95% confidence interval: 0.427–0.881, and G variant was associated with a significantly reduced risk of recurrence in nonmuscle-invasive bladder cancer patients with or without chemotherapy (P<0.05. The results of the meta-analysis showed that G allele and GG genotype of MDM2 SNP309 polymorphism were significantly associated with increased risk of bladder cancer in Caucasians (both P<0.05, and no association was observed in total populations and Asians (P>0.05. Conclusion: MDM2 SNP309 T>G polymorphism has no influence on bladder cancer risk in Asians, but
Association of single nucleotide polymorphisms with carcass traits in Nellore cattle.
Ferraz, J B S; Pinto, L F B; Meirelles, F V; Eler, J P; de Rezende, F M; Oliveira, E C M; Almeida, H B; Woodward, B; Nkrumah, D
2009-11-17
The association between two single nucleotide polymorphisms (SNPs), T945M and UCP1SNP1, with hot carcass weight (HCW, kg, N = 618), longissimus dorsi muscle area (REA, cm(2), N = 633), and backfat thickness (BF, mm, N = 625), measured in Nellore cattle in Brazil, was evaluated. Likelihood ratio tests were used to evaluate reduced (fixed effects of general mean, contemporary group, yearling weight, age at slaughter, and random effect of infinitesimal genetic value) and full model (reduced model effects plus quantitative trait locus effects). Additive and dominance effects were tested for each SNP. Genotypic and gene frequencies were also obtained for the SNPs and a descriptive phenotype analysis was made. Mean values for HCW, REA and BF were equal to 288.13 +/- 0.55 kg, 73.14 +/- 0.27 cm(2), and 4.28 +/- 0.07 mm, respectively; the coefficients of variation were 4.74, 9.24, and 42.43%, respectively. Gene frequencies for T945M and UCP1SNP1 were f(C) = 0.89, f(T) = 0.11, f(C) = 0.81, and f(G) = 0.19. The SNP T945M had a genotypic frequency of only three animals for TT genotype. Additive effects were observed for T945M on REA and BF, while UCP1SNP1 affected HCW and BF. Based on the significant additive effects of the SNPs and the gene frequencies that we found, we can expect genetic gains with marker assisted selection.
Babushok, Daria V; Xie, Hongbo M; Roth, Jacquelyn J; Perdigones, Nieves; Olson, Timothy S; Cockroft, Joshua D; Gai, Xiaowu; Perin, Juan C; Li, Yimei; Paessler, Michele E; Hakonarson, Hakon; Podsakoff, Gregory M; Mason, Philip J; Biegel, Jaclyn A; Bessler, Monica
2014-01-01
The bone marrow failure syndromes (BMFS) are a heterogeneous group of rare blood disorders characterized by inadequate haematopoiesis, clonal evolution, and increased risk of leukaemia. Single nucleotide polymorphism arrays (SNP-A) have been proposed as a tool for surveillance of clonal evolution in BMFS. To better understand the natural history of BMFS and to assess the clinical utility of SNP-A in these disorders, we analysed 124 SNP-A from a comprehensively characterized cohort of 91 patients at our BMFS centre. SNP-A were correlated with medical histories, haematopathology, cytogenetic and molecular data. To assess clonal evolution, longitudinal analysis of SNP-A was performed in 25 patients. We found that acquired copy number-neutral loss of heterozygosity (CN-LOH) was significantly more frequent in acquired aplastic anaemia (aAA) than in other BMFS (odds ratio 12·2, P < 0·01). Homozygosity by descent was most common in congenital BMFS, frequently unmasking autosomal recessive mutations. Copy number variants (CNVs) were frequently polymorphic, and we identified CNVs enriched in neutropenia and aAA. Our results suggest that acquired CN-LOH is a general phenomenon in aAA that is probably mechanistically and prognostically distinct from typical CN-LOH of myeloid malignancies. Our analysis of clinical utility of SNP-A shows the highest yield of detecting new clonal haematopoiesis at diagnosis and at relapse. © 2013 John Wiley & Sons Ltd.
A novel approach to analyzing fMRI and SNP data via parallel independent component analysis
Liu, Jingyu; Pearlson, Godfrey; Calhoun, Vince; Windemuth, Andreas
2007-03-01
There is current interest in understanding genetic influences on brain function in both the healthy and the disordered brain. Parallel independent component analysis, a new method for analyzing multimodal data, is proposed in this paper and applied to functional magnetic resonance imaging (fMRI) and a single nucleotide polymorphism (SNP) array. The method aims to identify the independent components of each modality and the relationship between the two modalities. We analyzed 92 participants, including 29 schizophrenia (SZ) patients, 13 unaffected SZ relatives, and 50 healthy controls. We found a correlation of 0.79 between one fMRI component and one SNP component. The fMRI component consists of activations in cingulate gyrus, multiple frontal gyri, and superior temporal gyrus. The related SNP component is contributed to significantly by 9 SNPs located in sets of genes, including those coding for apolipoprotein A-I, and C-III, malate dehydrogenase 1 and the gamma-aminobutyric acid alpha-2 receptor. A significant difference in the presences of this SNP component is found between the SZ group (SZ patients and their relatives) and the control group. In summary, we constructed a framework to identify the interactions between brain functional and genetic information; our findings provide new insight into understanding genetic influences on brain function in a common mental disorder.
PredictSNP: robust and accurate consensus classifier for prediction of disease-related mutations.
Directory of Open Access Journals (Sweden)
Jaroslav Bendl
2014-01-01
Full Text Available Single nucleotide variants represent a prevalent form of genetic variation. Mutations in the coding regions are frequently associated with the development of various genetic diseases. Computational tools for the prediction of the effects of mutations on protein function are very important for analysis of single nucleotide variants and their prioritization for experimental characterization. Many computational tools are already widely employed for this purpose. Unfortunately, their comparison and further improvement is hindered by large overlaps between the training datasets and benchmark datasets, which lead to biased and overly optimistic reported performances. In this study, we have constructed three independent datasets by removing all duplicities, inconsistencies and mutations previously used in the training of evaluated tools. The benchmark dataset containing over 43,000 mutations was employed for the unbiased evaluation of eight established prediction tools: MAPP, nsSNPAnalyzer, PANTHER, PhD-SNP, PolyPhen-1, PolyPhen-2, SIFT and SNAP. The six best performing tools were combined into a consensus classifier PredictSNP, resulting into significantly improved prediction performance, and at the same time returned results for all mutations, confirming that consensus prediction represents an accurate and robust alternative to the predictions delivered by individual tools. A user-friendly web interface enables easy access to all eight prediction tools, the consensus classifier PredictSNP and annotations from the Protein Mutant Database and the UniProt database. The web server and the datasets are freely available to the academic community at http://loschmidt.chemi.muni.cz/predictsnp.
Singh, Nivedita; Choudhury, Debjani Roy; Singh, Amit Kumar; Kumar, Sundeep; Srinivasan, Kalyani; Tyagi, R K; Singh, N K; Singh, Rakesh
2013-01-01
Simple sequence repeat (SSR) and Single Nucleotide Polymorphic (SNP), the two most robust markers for identifying rice varieties were compared for assessment of genetic diversity and population structure. Total 375 varieties of rice from various regions of India archived at the Indian National GeneBank, NBPGR, New Delhi, were analyzed using thirty six genetic markers, each of hypervariable SSR (HvSSR) and SNP which were distributed across 12 rice chromosomes. A total of 80 alleles were amplified with the SSR markers with an average of 2.22 alleles per locus whereas, 72 alleles were amplified with SNP markers. Polymorphic information content (PIC) values for HvSSR ranged from 0.04 to 0.5 with an average of 0.25. In the case of SNP markers, PIC values ranged from 0.03 to 0.37 with an average of 0.23. Genetic relatedness among the varieties was studied; utilizing an unrooted tree all the genotypes were grouped into three major clusters with both SSR and SNP markers. Analysis of molecular variance (AMOVA) indicated that maximum diversity was partitioned between and within individual level but not between populations. Principal coordinate analysis (PCoA) with SSR markers showed that genotypes were uniformly distributed across the two axes with 13.33% of cumulative variation whereas, in case of SNP markers varieties were grouped into three broad groups across two axes with 45.20% of cumulative variation. Population structure were tested using K values from 1 to 20, but there was no clear population structure, therefore Ln(PD) derived Δk was plotted against the K to determine the number of populations. In case of SSR maximum Δk was at K=5 whereas, in case of SNP maximum Δk was found at K=15, suggesting that resolution of population was higher with SNP markers, but SSR were more efficient for diversity analysis.
Liu, Chengzhang; Wang, Xia; Xiang, Jianhai; Li, Fuhua
2012-09-01
Pacific white shrimp has become a major aquaculture and fishery species worldwide. Although a large scale EST resource has been publicly available since 2008, the data have not yet been widely used for SNP discovery or transcriptome-wide assessment of selective pressure. In this study, a set of 155 411 expressed sequence tags (ESTs) from the NCBI database were computationally analyzed and 17 225 single nucleotide polymorphisms (SNPs) were predicted, including 9 546 transitions, 5 124 transversions and 2 481 indels. Among the 7 298 SNP substitutions located in functionally annotated contigs, 58.4% (4 262) are non-synonymous SNPs capable of introducing amino acid mutations. Two hundred and fifty nonsynonymous SNPs in genes associated with economic traits have been identified as candidates for markers in selective breeding. Diversity estimates among the synonymous nucleotides were on average 3.49 times greater than those in non-synonymous, suggesting negative selection. Distribution of non-synonymous to synonymous substitutions (Ka/Ks) ratio ranges from 0 to 4.01, (average 0.42, median 0.26), suggesting that the majority of the affected genes are under purifying selection. Enrichment analysis identified multiple gene ontology categories under positive or negative selection. Categories involved in innate immune response and male gamete generation are rich in positively selected genes, which is similar to reports in Drosophila and primates. This work is the first transcriptome-wide assessment of selective pressure in a Penaeid shrimp species. The functionally annotated SNPs provide a valuable resource of potential molecular markers for selective breeding.
Directory of Open Access Journals (Sweden)
Hand Melanie L
2012-06-01
Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs provide essential tools for the advancement of research in plant genomics, and the development of SNP resources for many species has been accelerated by the capabilities of second-generation sequencing technologies. The current study aimed to develop and use a novel bioinformatic pipeline to generate a comprehensive collection of SNP markers within the agriculturally important pasture grass tall fescue; an outbreeding allopolyploid species displaying three distinct morphotypes: Continental, Mediterranean and rhizomatous. Results A bioinformatic pipeline was developed that successfully identified SNPs within genotypes from distinct tall fescue morphotypes, following the sequencing of 414 polymerase chain reaction (PCR – generated amplicons using 454 GS FLX technology. Equivalent amplicon sets were derived from representative genotypes of each morphotype, including six Continental, five Mediterranean and one rhizomatous. A total of 8,584 and 2,292 SNPs were identified with high confidence within the Continental and Mediterranean morphotypes respectively. The success of the bioinformatic approach was demonstrated through validation (at a rate of 70% of a subset of 141 SNPs using both SNaPshot™ and GoldenGate™ assay chemistries. Furthermore, the quantitative genotyping capability of the GoldenGate™ assay revealed that approximately 30% of the putative SNPs were accessible to co-dominant scoring, despite the hexaploid genome structure. The sub-genome-specific origin of each SNP validated from Continental tall fescue was predicted using a phylogenetic approach based on comparison with orthologous sequences from predicted progenitor species. Conclusions Using the appropriate bioinformatic approach, amplicon resequencing based on 454 GS FLX technology is an effective method for the identification of polymorphic SNPs within the genomes of Continental and Mediterranean tall fescue. The
Light whole genome sequence for SNP discovery across domestic cat breeds
Directory of Open Access Journals (Sweden)
Driscoll Carlos
2010-06-01
Full Text Available Abstract Background The domestic cat has offered enormous genomic potential in the veterinary description of over 250 hereditary disease models as well as the occurrence of several deadly feline viruses (feline leukemia virus -- FeLV, feline coronavirus -- FECV, feline immunodeficiency virus - FIV that are homologues to human scourges (cancer, SARS, and AIDS respectively. However, to realize this bio-medical potential, a high density single nucleotide polymorphism (SNP map is required in order to accomplish disease and phenotype association discovery. Description To remedy this, we generated 3,178,297 paired fosmid-end Sanger sequence reads from seven cats, and combined these data with the publicly available 2X cat whole genome sequence. All sequence reads were assembled together to form a 3X whole genome assembly allowing the discovery of over three million SNPs. To reduce potential false positive SNPs due to the low coverage assembly, a low upper-limit was placed on sequence coverage and a high lower-limit on the quality of the discrepant bases at a potential variant site. In all domestic cats of different breeds: female Abyssinian, female American shorthair, male Cornish Rex, female European Burmese, female Persian, female Siamese, a male Ragdoll and a female African wildcat were sequenced lightly. We report a total of 964 k common SNPs suitable for a domestic cat SNP genotyping array and an additional 900 k SNPs detected between African wildcat and domestic cats breeds. An empirical sampling of 94 discovered SNPs were tested in the sequenced cats resulting in a SNP validation rate of 99%. Conclusions These data provide a large collection of mapped feline SNPs across the cat genome that will allow for the development of SNP genotyping platforms for mapping feline diseases.
SNP_tools: A compact tool package for analysis and conversion of genotype data for MS-Excel.
Chen, Bowang; Wilkening, Stefan; Drechsel, Marion; Hemminki, Kari
2009-10-23
Single nucleotide polymorphism (SNP) genotyping is a major activity in biomedical research. Scientists prefer to have a facile access to the results which may require conversions between data formats. First hand SNP data is often entered in or saved in the MS-Excel format, but this software lacks genetic and epidemiological related functions. A general tool to do basic genetic and epidemiological analysis and data conversion for MS-Excel is needed. The SNP_tools package is prepared as an add-in for MS-Excel. The code is written in Visual Basic for Application, embedded in the Microsoft Office package. This add-in is an easy to use tool for users with basic computer knowledge (and requirements for basic statistical analysis). Our implementation for Microsoft Excel 2000-2007 in Microsoft Windows 2000, XP, Vista and Windows 7 beta can handle files in different formats and converts them into other formats. It is a free software.
Sabourin, Jeremy; Nobel, Andrew B.; Valdar, William
2014-01-01
Genomewide association studies sometimes identify loci at which both the number and identities of the underlying causal variants are ambiguous. In such cases, statistical methods that model effects of multiple SNPs simultaneously can help disentangle the observed patterns of association and provide information about how those SNPs could be prioritized for follow-up studies. Current multi-SNP methods, however, tend to assume that SNP effects are well captured by additive genetics; yet when genetic dominance is present, this assumption translates to reduced power and faulty prioritizations. We describe a statistical procedure for prioritizing SNPs at GWAS loci that efficiently models both additive and dominance effects. Our method, LLARRMA-dawg, combines a group LASSO procedure for sparse modeling of multiple SNP effects with a resampling procedure based on fractional observation weights; it estimates for each SNP the robustness of association with the phenotype both to sampling variation and to competing explanations from other SNPs. In producing a SNP prioritization that best identifies underlying true signals, we show that: our method easily outperforms a single marker analysis; when additive-only signals are present, our joint model for additive and dominance is equivalent to or only slightly less powerful than modeling additive-only effects; and, when dominance signals are present, even in combination with substantial additive effects, our joint model is unequivocally more powerful than a model assuming additivity. We also describe how performance can be improved through calibrated randomized penalization, and discuss how dominance in ungenotyped SNPs can be incorporated through either heterozygote dosage or multiple imputation. PMID:25417853
Bianco, Luca; Cestaro, Alessandro; Sargent, Daniel James; Banchi, Elisa; Derdak, Sophia; Di Guardo, Mario; Salvi, Silvio; Jansen, Johannes; Viola, Roberto; Gut, Ivo; Laurens, Francois; Chagné, David; Velasco, Riccardo; van de Weg, Eric; Troggio, Michela
2014-01-01
High-density SNP arrays for genome-wide assessment of allelic variation have made high resolution genetic characterization of crop germplasm feasible. A medium density array for apple, the IRSC 8K SNP array, has been successfully developed and used for screens of bi-parental populations. However, the number of robust and well-distributed markers contained on this array was not sufficient to perform genome-wide association analyses in wider germplasm sets, or Pedigree-Based Analysis at high precision, because of rapid decay of linkage disequilibrium. We describe the development of an Illumina Infinium array targeting 20K SNPs. The SNPs were predicted from re-sequencing data derived from the genomes of 13 Malus × domestica apple cultivars and one accession belonging to a crab apple species (M. micromalus). A pipeline for SNP selection was devised that avoided the pitfalls associated with the inclusion of paralogous sequence variants, supported the construction of robust multi-allelic SNP haploblocks and selected up to 11 entries within narrow genomic regions of ±5 kb, termed focal points (FPs). Broad genome coverage was attained by placing FPs at 1 cM intervals on a consensus genetic map, complementing them with FPs to enrich the ends of each of the chromosomes, and by bridging physical intervals greater than 400 Kbps. The selection also included ∼3.7K validated SNPs from the IRSC 8K array. The array has already been used in other studies where ∼15.8K SNP markers were mapped with an average of ∼6.8K SNPs per full-sib family. The newly developed array with its high density of polymorphic validated SNPs is expected to be of great utility for Pedigree-Based Analysis and Genomic Selection. It will also be a valuable tool to help dissect the genetic mechanisms controlling important fruit quality traits, and to aid the identification of marker-trait associations suitable for the application of Marker Assisted Selection in apple breeding programs.
Directory of Open Access Journals (Sweden)
Luca Bianco
Full Text Available High-density SNP arrays for genome-wide assessment of allelic variation have made high resolution genetic characterization of crop germplasm feasible. A medium density array for apple, the IRSC 8K SNP array, has been successfully developed and used for screens of bi-parental populations. However, the number of robust and well-distributed markers contained on this array was not sufficient to perform genome-wide association analyses in wider germplasm sets, or Pedigree-Based Analysis at high precision, because of rapid decay of linkage disequilibrium. We describe the development of an Illumina Infinium array targeting 20K SNPs. The SNPs were predicted from re-sequencing data derived from the genomes of 13 Malus × domestica apple cultivars and one accession belonging to a crab apple species (M. micromalus. A pipeline for SNP selection was devised that avoided the pitfalls associated with the inclusion of paralogous sequence variants, supported the construction of robust multi-allelic SNP haploblocks and selected up to 11 entries within narrow genomic regions of ±5 kb, termed focal points (FPs. Broad genome coverage was attained by placing FPs at 1 cM intervals on a consensus genetic map, complementing them with FPs to enrich the ends of each of the chromosomes, and by bridging physical intervals greater than 400 Kbps. The selection also included ∼3.7K validated SNPs from the IRSC 8K array. The array has already been used in other studies where ∼15.8K SNP markers were mapped with an average of ∼6.8K SNPs per full-sib family. The newly developed array with its high density of polymorphic validated SNPs is expected to be of great utility for Pedigree-Based Analysis and Genomic Selection. It will also be a valuable tool to help dissect the genetic mechanisms controlling important fruit quality traits, and to aid the identification of marker-trait associations suitable for the application of Marker Assisted Selection in apple breeding programs.
Bianco, Luca; Cestaro, Alessandro; Sargent, Daniel James; Banchi, Elisa; Derdak, Sophia; Di Guardo, Mario; Salvi, Silvio; Jansen, Johannes; Viola, Roberto; Gut, Ivo; Laurens, Francois; Chagné, David; Velasco, Riccardo; van de Weg, Eric; Troggio, Michela
2014-01-01
High-density SNP arrays for genome-wide assessment of allelic variation have made high resolution genetic characterization of crop germplasm feasible. A medium density array for apple, the IRSC 8K SNP array, has been successfully developed and used for screens of bi-parental populations. However, the number of robust and well-distributed markers contained on this array was not sufficient to perform genome-wide association analyses in wider germplasm sets, or Pedigree-Based Analysis at high precision, because of rapid decay of linkage disequilibrium. We describe the development of an Illumina Infinium array targeting 20K SNPs. The SNPs were predicted from re-sequencing data derived from the genomes of 13 Malus × domestica apple cultivars and one accession belonging to a crab apple species (M. micromalus). A pipeline for SNP selection was devised that avoided the pitfalls associated with the inclusion of paralogous sequence variants, supported the construction of robust multi-allelic SNP haploblocks and selected up to 11 entries within narrow genomic regions of ±5 kb, termed focal points (FPs). Broad genome coverage was attained by placing FPs at 1 cM intervals on a consensus genetic map, complementing them with FPs to enrich the ends of each of the chromosomes, and by bridging physical intervals greater than 400 Kbps. The selection also included ∼3.7K validated SNPs from the IRSC 8K array. The array has already been used in other studies where ∼15.8K SNP markers were mapped with an average of ∼6.8K SNPs per full-sib family. The newly developed array with its high density of polymorphic validated SNPs is expected to be of great utility for Pedigree-Based Analysis and Genomic Selection. It will also be a valuable tool to help dissect the genetic mechanisms controlling important fruit quality traits, and to aid the identification of marker-trait associations suitable for the application of Marker Assisted Selection in apple breeding programs. PMID:25303088
DEFF Research Database (Denmark)
Ferchaud, Anne-Laure; Pedersen, Susanne H.; Bekkevold, Dorte
2014-01-01
for rapid and cost efficient analysis of genetic divergence between freshwater and marine sticklebacks, we generated a low-density SNP (Single Nucleotide Polymorphism) array encompassing markers of chromosome regions under putative directional selection, along with neutral markers for background. Results......: RAD (Restriction site Associated DNA) sequencing of sixty individuals representing two freshwater and one marine population led to the identification of 33,993 SNP markers. Ninety-six of these were chosen for the low-density SNP array, among which 70 represented SNPs under putatively directional...... selection in freshwater vs. marine environments, whereas 26 SNPs were assumed to be neutral. Annotation of these regions revealed several genes that are candidates for affecting stickleback phenotypic variation, some of which have been observed in previous studies whereas others are new. Conclusions: We...
Directory of Open Access Journals (Sweden)
Struan F A Grant
2008-03-01
Full Text Available Recently an association was demonstrated between the single nucleotide polymorphism (SNP, rs9939609, within the FTO locus and obesity as a consequence of a genome wide association (GWA study of type 2 diabetes in adults. We examined the effects of two perfect surrogates for this SNP plus 11 other SNPs at this locus with respect to our childhood obesity cohort, consisting of both Caucasians and African Americans (AA. Utilizing data from our ongoing GWA study in our cohort of 418 Caucasian obese children (BMI>or=95th percentile, 2,270 Caucasian controls (BMI<95th percentile, 578 AA obese children and 1,424 AA controls, we investigated the association of the previously reported variation at the FTO locus with the childhood form of this disease in both ethnicities. The minor allele frequencies (MAF of rs8050136 and rs3751812 (perfect surrogates for rs9939609 i.e. both r(2 = 1 in the Caucasian cases were 0.448 and 0.443 respectively while they were 0.391 and 0.386 in Caucasian controls respectively, yielding for both an odds ratio (OR of 1.27 (95% CI 1.08-1.47; P = 0.0022. Furthermore, the MAFs of rs8050136 and rs3751812 in the AA cases were 0.449 and 0.115 respectively while they were 0.436 and 0.090 in AA controls respectively, yielding an OR of 1.05 (95% CI 0.91-1.21; P = 0.49 and of 1.31 (95% CI 1.050-1.643; P = 0.017 respectively. Investigating all 13 SNPs present on the Illumina HumanHap550 BeadChip in this region of linkage disequilibrium, rs3751812 was the only SNP conferring significant risk in AA. We have therefore replicated and refined the association in an AA cohort and distilled a tag-SNP, rs3751812, which captures the ancestral origin of the actual mutation. As such, variants in the FTO gene confer a similar magnitude of risk of obesity to children as to their adult counterparts and appear to have a global impact.
Measurement of the anisotropy ratios in MgB2 single crystals
International Nuclear Information System (INIS)
Kim, Heon-Jung; Kang, Byeongwon; Lee, Hyun-Sook; Lee, Sung-Ik
2006-01-01
We present our recent measurements on the anisotropy ratios of MgB 2 single crystals. Our measurements indicate that the anisotropy ratios of the penetration depth and of the upper critical field have different magnitudes and temperature dependences, as predicted by theoretical calculations. These results imply that the two-gap nature can strongly influence the superconducting properties of MgB 2
Making a chocolate chip: development and evaluation of a 6K SNP array for Theobroma cacao.
Theobroma cacao, the key ingredient in chocolate production, is one of the world's most important tree fruit crops, with ~4,000,000 metric tons produced across 50 countries. To move towards gene discovery and marker-assisted breeding in cacao, a single-nucleotide polymorphism (SNP) identification pr...
Functional characterization of the Thr946Ala SNP at the type 1 diabetes IFIH1 locus.
Zouk, Hana; Marchand, Luc; Li, Quan; Polychronakos, Constantin
2014-02-01
The Thr allele at the Thr946Ala non-synonymous single-nucleotide polymorphism (nsSNP) in the IFIH1 gene confers risk for type 1 diabetes (T1D). IFIH1 binds viral double-stranded RNA (dsRNA), inducing a type I interferon (IFN) response. Reports of this nsSNP's role in IFIH1 expression regulation have produced conflicting results and a study evaluating transfected Thr946Ala protein alleles in an artificial system overexpressing IFIH1 shows that the SNP does not affect IFH1 function. In this study, we examine the effects of the Thr946Ala polymorphism on IFN-α response in a cell line that endogenously expresses physiological levels of IFIH1. Eleven lymphoblastoid cell lines (LCLs) homozygous for the major predisposing allele (Thr/Thr) and 6 LCLs homozygous for the minor protective allele (Ala/Ala) were electroporated with the viral dsRNA mimic, poly I:C, in three independent experiments. Media were collected 24 hours later and measured for IFN-α production by ELISA. Basal IFN response is minimal in mock-transfected cells from both genotypes and increases by about 8-fold in cells treated with poly I:C. LCLs with the Ala/Ala genotype have slightly higher IFN-α levels than their Thr/Thr counterparts but this did not reach statistical significance because of the large variability of the IFN response, due mostly to two high outliers (biological, not technical). A larger sample size would be needed to determine whether the Thr946Ala SNP affects the poly I:C-driven IFN-α response. Additionally, the possibility that this nsSNP recognizes viral dsRNA specificities cannot be ruled out. Thus, the mechanism of the observed association of this SNP with T1D remains to be determined.
Design and characterization of a 52K SNP chip for goats.
Directory of Open Access Journals (Sweden)
Gwenola Tosser-Klopp
Full Text Available The success of Genome Wide Association Studies in the discovery of sequence variation linked to complex traits in humans has increased interest in high throughput SNP genotyping assays in livestock species. Primary goals are QTL detection and genomic selection. The purpose here was design of a 50-60,000 SNP chip for goats. The success of a moderate density SNP assay depends on reliable bioinformatic SNP detection procedures, the technological success rate of the SNP design, even spacing of SNPs on the genome and selection of Minor Allele Frequencies (MAF suitable to use in diverse breeds. Through the federation of three SNP discovery projects consolidated as the International Goat Genome Consortium, we have identified approximately twelve million high quality SNP variants in the goat genome stored in a database together with their biological and technical characteristics. These SNPs were identified within and between six breeds (meat, milk and mixed: Alpine, Boer, Creole, Katjang, Saanen and Savanna, comprising a total of 97 animals. Whole genome and Reduced Representation Library sequences were aligned on >10 kb scaffolds of the de novo goat genome assembly. The 60,000 selected SNPs, evenly spaced on the goat genome, were submitted for oligo manufacturing (Illumina, Inc and published in dbSNP along with flanking sequences and map position on goat assemblies (i.e. scaffolds and pseudo-chromosomes, sheep genome V2 and cattle UMD3.1 assembly. Ten breeds were then used to validate the SNP content and 52,295 loci could be successfully genotyped and used to generate a final cluster file. The combined strategy of using mainly whole genome Next Generation Sequencing and mapping on a contig genome assembly, complemented with Illumina design tools proved to be efficient in producing this GoatSNP50 chip. Advances in use of molecular markers are expected to accelerate goat genomic studies in coming years.
Directory of Open Access Journals (Sweden)
Landt Olfert
2008-04-01
Full Text Available Abstract Background SNP309 T/G (rs2279744 causes higher levels of MDM2, the most important negative regulator of the p53 tumor suppressor. SNP72 G/C (rs1042522 gives rise to a p53 protein with a greatly reduced capacity to induce apoptosis. Both polymorphisms have been implicated in cancer. The SNP309 G-allele has recently been reported to accelerate diffuse large B-cell lymphoma (DLBCL formation in pre-menopausal women and suggested to constitute a genetic basis for estrogen affecting human tumorigenesis. Here we asked whether SNP309 and SNP72 are associated with DLBCL in women and are correlated with age of onset, diagnosis, or patient's survival. Methods SNP309 and SNP72 were PCR-genotyped in a case-control study that included 512 controls and 311 patients diagnosed with aggressive NHL. Of these, 205 were diagnosed with DLBCL. Results The age of onset was similar in men and women. The control and patients group showed similar SNP309 and SNP72 genotype frequencies. Importantly and in contrast to the previous findings, similar genotype frequencies were observed in female patients diagnosed by 51 years of age and those diagnosed later. Specifically, 3/20 female DLBCL patients diagnosed by 51 years of age were homozygous for SNP309 G and 2/20 DLBCL females in that age group were homozygous for SNP72 C. Neither SNP309 nor SNP72 had a significant influence on event-free and overall survival in multivariate analyses. Conclusion In contrast to the previous study on Ashkenazi Jewish Caucasians, DLBCL in pre-menopausal women of central European Caucasian ethnicity was not associated with SNP309 G. Neither SNP309 nor SNP72 seem to be correlated with age of onset, diagnosis, or survival of patients.
DEFF Research Database (Denmark)
Hoeffding, L. K.; Kock, K. F.; Johnsen, Iben Birgit Gade
2015-01-01
The single nucleotide polymorphism (SNP) microarray technology has emerged as a powerful tool to screen the whole genome for sub-microscopic duplications and deletions that are not detectable by traditional cytogenetic analysis. Case: We report a case of a female twin born at 27th week of gestation...
Miyata, Hirofumi; Itoh, Rika; Sato, Fumio; Takebe, Naoya; Hada, Tetsuro; Tozaki, Teruaki
2017-10-20
Variants of the Myostatin gene have been shown to have an influence on muscle hypertrophy phenotypes in a wide range of mammalian species. Recently, a Thoroughbred horse with a C-Allele at the g.66493737C/T single-nucleotide polymorphism (SNP) has been reported to be suited to short-distance racing. In this study, we examined the effect of the Myostatin SNP on muscle fiber properties in young Thoroughbred horses during a training period. To investigate the effect of the Myostatin SNP on muscle fiber before training, several mRNA expressions were relatively quantified in biopsy samples from the middle gluteal muscle of 27 untrained male Thoroughbred horses (1.5 years old) using real-time RT-PCR analysis. The remaining muscle samples were used for immunohistochemical analysis to determine the population and area of each fiber type. All measurements were revaluated in biopsy samples of the same horses after a 5-month period of conventional training. Although the expressions of Myostatin mRNA decreased in all SNP genotypes, a significant decrease was found in only the C/C genotype after training. While, expression of VEGFa, PGC1α, and SDHa mRNAs, which relate to the biogenesis of mitochondria and capillaries, was significantly higher (54-82%) in the T/T than the C/C genotypes after training. It is suggested that hypertrophy of muscle fiber is directly associated with a decrease in Myostatin mRNA expression in the C/C genotype, and that increased expressions of VEGFa, PGC1α, and SDHa in the T/T genotype might be indirectly caused by the Myostatin SNP.
Determination of the mass-ratio distribution, I: single-lined spectroscopic binary stars
Hogeveen, S.J.
1992-01-01
For single-lined spectroscopic binary stars (sbi), the mass ratio q = Msec=Mprim is calculated from the mass function f(m), which is determined from observations. For statistical investigations of the mass-ratio distribution, the term sin^3 i, that remains in the cubic equation from which q is
COLE-TOBIAN, JENNIFER L.; ZIMMERMAN, PETER A.; KING, CHRISTOPHER L.
2013-01-01
Individuals living in malaria endemic areas are often infected with multiple parasite clones. Currently used single nucleotide polymorphism (SNP) genotyping methods for malaria parasites are cumbersome; furthermore, few methods currently exist that can rapidly determine the most abundant clone in these complex infections. Here we describe an oligonucleotide ligation assay (OLA) to distinguish SNPs in the Plasmodium vivax Duffy binding protein gene (Pvdbp) at 14 polymorphic residues simultaneously. Allele abundance is determined by the highest mean fluorescent intensity of each allele. Using mixtures of plasmids encoding known haplotypes of the Pvdbp, single clones of P. vivax parasites from infected Aotus monkeys, and well-defined mixed infections from field samples, we were able to identify the predominant Pvdbp genotype with > 93% accuracy when the dominant clone is twice as abundant as a lesser genotype and > 97% of the time if the ratio was 5:1 or greater. Thus, the OLA can accurately, reproducibly, and rapidly determine the predominant parasite haplotype in complex blood stage infections. PMID:17255222
Directory of Open Access Journals (Sweden)
Sarah L. Nickerson
2015-10-01
Full Text Available Autosomal recessive cerebellar ataxia encompasses a large and heterogeneous group of neurodegenerative disorders. We employed single nucleotide polymorphism (SNP analysis and whole exome sequencing to investigate a consanguineous Maori pedigree segregating ataxia. We identified a novel mutation in exon 10 of the SACS gene: c.7962T>G p.(Tyr2654*, establishing the diagnosis of autosomal recessive spastic ataxia of Charlevoix-Saguenay (ARSACS. Our findings expand both the genetic and phenotypic spectrum of this rare disorder, and highlight the value of high-density SNP analysis and whole exome sequencing as powerful and cost-effective tools in the diagnosis of genetically heterogeneous disorders such as the hereditary ataxias.
arXiv Tensor to scalar ratio from single field magnetogenesis
Giovannini, Massimo
2017-08-10
The tensor to scalar ratio is affected by the evolution of the large-scale gauge fields potentially amplified during an inflationary stage of expansion. After deriving the exact evolution equations for the scalar and tensor modes of the geometry in the presence of dynamical gauge fields, it is shown that the tensor to scalar ratio is bounded from below by the dominance of the adiabatic contribution and it cannot be smaller than one thousands whenever the magnetogenesis is driven by a single inflaton field.
Zheng, Jie; Gaunt, Tom R; Day, Ian N M
2013-01-01
Genome-Wide Association Studies (GWAS) frequently incorporate meta-analysis within their framework. However, conditional analysis of individual-level data, which is an established approach for fine mapping of causal sites, is often precluded where only group-level summary data are available for analysis. Here, we present a numerical and graphical approach, "sequential sentinel SNP regional association plot" (SSS-RAP), which estimates regression coefficients (beta) with their standard errors using the meta-analysis summary results directly. Under an additive model, typical for genes with small effect, the effect for a sentinel SNP can be transformed to the predicted effect for a possibly dependent SNP through a 2×2 2-SNP haplotypes table. The approach assumes Hardy-Weinberg equilibrium for test SNPs. SSS-RAP is available as a Web-tool (http://apps.biocompute.org.uk/sssrap/sssrap.cgi). To develop and illustrate SSS-RAP we analyzed lipid and ECG traits data from the British Women's Heart and Health Study (BWHHS), evaluated a meta-analysis for ECG trait and presented several simulations. We compared results with existing approaches such as model selection methods and conditional analysis. Generally findings were consistent. SSS-RAP represents a tool for testing independence of SNP association signals using meta-analysis data, and is also a convenient approach based on biological principles for fine mapping in group level summary data. © 2012 Blackwell Publishing Ltd/University College London.
Directory of Open Access Journals (Sweden)
Nivedita Singh
Full Text Available Simple sequence repeat (SSR and Single Nucleotide Polymorphic (SNP, the two most robust markers for identifying rice varieties were compared for assessment of genetic diversity and population structure. Total 375 varieties of rice from various regions of India archived at the Indian National GeneBank, NBPGR, New Delhi, were analyzed using thirty six genetic markers, each of hypervariable SSR (HvSSR and SNP which were distributed across 12 rice chromosomes. A total of 80 alleles were amplified with the SSR markers with an average of 2.22 alleles per locus whereas, 72 alleles were amplified with SNP markers. Polymorphic information content (PIC values for HvSSR ranged from 0.04 to 0.5 with an average of 0.25. In the case of SNP markers, PIC values ranged from 0.03 to 0.37 with an average of 0.23. Genetic relatedness among the varieties was studied; utilizing an unrooted tree all the genotypes were grouped into three major clusters with both SSR and SNP markers. Analysis of molecular variance (AMOVA indicated that maximum diversity was partitioned between and within individual level but not between populations. Principal coordinate analysis (PCoA with SSR markers showed that genotypes were uniformly distributed across the two axes with 13.33% of cumulative variation whereas, in case of SNP markers varieties were grouped into three broad groups across two axes with 45.20% of cumulative variation. Population structure were tested using K values from 1 to 20, but there was no clear population structure, therefore Ln(PD derived Δk was plotted against the K to determine the number of populations. In case of SSR maximum Δk was at K=5 whereas, in case of SNP maximum Δk was found at K=15, suggesting that resolution of population was higher with SNP markers, but SSR were more efficient for diversity analysis.
Directory of Open Access Journals (Sweden)
Difei Wang
2015-01-01
Full Text Available One of the long-standing challenges in biology is to understand how non-synonymous single nucleotide polymorphisms (nsSNPs change protein structure and further affect their function. While it is impractical to solve all the mutated protein structures experimentally, it is quite feasible to model the mutated structures in silico. Toward this goal, we built a publicly available structure database resource (SNP2Structure, https://apps.icbi.georgetown.edu/snp2structure focusing on missense mutations, msSNP. Compared with web portals with similar aims, SNP2Structure has the following major advantages. First, our portal offers direct comparison of two related 3D structures. Second, the protein models include all interacting molecules in the original PDB structures, so users are able to determine regions of potential interaction changes when a protein mutation occurs. Third, the mutated structures are available to download locally for further structural and functional analysis. Fourth, we used Jsmol package to display the protein structure that has no system compatibility issue. SNP2Structure provides reliable, high quality mapping of nsSNPs to 3D protein structures enabling researchers to explore the likely functional impact of human disease-causing mutations.
RASSF1A and the rs2073498 Cancer Associated SNP
International Nuclear Information System (INIS)
Donninger, Howard; Barnoud, Thibaut; Nelson, Nick; Kassler, Suzanna; Clark, Jennifer; Cummins, Timothy D.; Powell, David W.; Nyante, Sarah; Millikan, Robert C.; Clark, Geoffrey J.
2011-01-01
RASSF1A is one of the most frequently inactivated tumor suppressors yet identified in human cancer. It is pro-apoptotic and appears to function as a scaffolding protein that interacts with a variety of other tumor suppressors to modulate their function. It can also complex with the Ras oncoprotein and may serve to integrate pro-growth and pro-death signaling pathways. A SNP has been identified that is present in approximately 29% of European populations [rs2073498, A(133)S]. Several studies have now presented evidence that this SNP is associated with an enhanced risk of developing breast cancer. We have used a proteomics based approach to identify multiple differences in the pattern of protein/protein interactions mediated by the wild type compared to the SNP variant protein. We have also identified a significant difference in biological activity between wild type and SNP variant protein. However, we have found only a very modest association of the SNP with breast cancer predisposition.
High-throughput genotyping of single nucleotide polymorphisms with rolling circle amplification
Directory of Open Access Journals (Sweden)
Sun Zhenyu
2001-08-01
Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are the foundation of powerful complex trait and pharmacogenomic analyses. The availability of large SNP databases, however, has emphasized a need for inexpensive SNP genotyping methods of commensurate simplicity, robustness, and scalability. We describe a solution-based, microtiter plate method for SNP genotyping of human genomic DNA. The method is based upon allele discrimination by ligation of open circle probes followed by rolling circle amplification of the signal using fluorescent primers. Only the probe with a 3' base complementary to the SNP is circularized by ligation. Results SNP scoring by ligation was optimized to a 100,000 fold discrimination against probe mismatched to the SNP. The assay was used to genotype 10 SNPs from a set of 192 genomic DNA samples in a high-throughput format. Assay directly from genomic DNA eliminates the need to preamplify the target as done for many other genotyping methods. The sensitivity of the assay was demonstrated by genotyping from 1 ng of genomic DNA. We demonstrate that the assay can detect a single molecule of the circularized probe. Conclusions Compatibility with homogeneous formats and the ability to assay small amounts of genomic DNA meets the exacting requirements of automated, high-throughput SNP scoring.
Presence of sequence and SNP variation in the IRF6 gene in healthy residents of Guangdong Province
Directory of Open Access Journals (Sweden)
Wu Wenli
2016-01-01
Full Text Available This study was to investigate the single nucleotide polymorphism (SNP in the interferon regulatory factor 6 (IRF6 gene in healthy residents of Guangdong Province, China, for further analysis of their associations with the development of cleft lip with or without palate (CL/P.
SNP-VISTA: An Interactive SNPs Visualization Tool
Energy Technology Data Exchange (ETDEWEB)
Shah, Nameeta; Teplitsky, Michael V.; Pennacchio, Len A.; Hugenholtz, Philip; Hamann, Bernd; Dubchak, Inna L.
2005-07-05
Recent advances in sequencing technologies promise better diagnostics for many diseases as well as better understanding of evolution of microbial populations. Single Nucleotide Polymorphisms(SNPs) are established genetic markers that aid in the identification of loci affecting quantitative traits and/or disease in a wide variety of eukaryotic species. With today's technological capabilities, it is possible to re-sequence a large set of appropriate candidate genes in individuals with a given disease and then screen for causative mutations.In addition, SNPs have been used extensively in efforts to study the evolution of microbial populations, and the recent application of random shotgun sequencing to environmental samples makes possible more extensive SNP analysis of co-occurring and co-evolving microbial populations. The program is available at http://genome.lbl.gov/vista/snpvista.
Report on the development of putative functional SSR and SNP markers in passion fruits.
da Costa, Zirlane Portugal; Munhoz, Carla de Freitas; Vieira, Maria Lucia Carneiro
2017-09-06
Passionflowers Passiflora edulis and Passiflora alata are diploid, outcrossing and understudied fruit bearing species. In Brazil, passion fruit cultivation began relatively recently and has earned the country an outstanding position as the world's top producer of passion fruit. The fruit's main economic value lies in the production of juice, an essential exotic ingredient in juice blends. Currently, crop improvement strategies, including those for underexploited tropical species, tend to incorporate molecular genetic approaches. In this study, we examined a set of P. edulis transcripts expressed in response to infection by Xanthomonas axonopodis, (the passion fruit's main bacterial pathogen that attacks the vines), aiming at the development of putative functional markers, i.e. SSRs (simple sequence repeats) and SNPs (single nucleotide polymorphisms). A total of 210 microsatellites were found in 998 sequences, and trinucleotide repeats were found to be the most frequent (31.4%). Of the sequences selected for designing primers, 80.9% could be used to develop SSR markers, and 60.6% SNP markers for P. alata. SNPs were all biallelic and found within 15 gene fragments of P. alata. Overall, gene fragments generated 10,003 bp. SNP frequency was estimated as one SNP every 294 bp. Polymorphism rates revealed by SSR and SNP loci were 29.4 and 53.6%, respectively. Passiflora edulis transcripts were useful for the development of putative functional markers for P. alata, suggesting a certain level of sequence conservation between these cultivated species. The markers developed herein could be used for genetic mapping purposes and also in diversity studies.
Directory of Open Access Journals (Sweden)
Douglas Mark Ruden
2012-03-01
Full Text Available This paper describes a new program SnpSift for filtering differential DNA sequence variants between two or more experimental genomes after genotoxic chemical exposure. Here, we illustrate how SnpSift can be used to identify candidate phenotype-relevant variants including single nucleotide polymorphisms (SNPs, multiple nucleotide polymorphisms (MNPs, insertions and deletions (InDels in mutant strains isolated from genome-wide chemical mutagenesis of Drosophila melanogaster. First, the genomes of two independently-isolated mutant fly strains that are allelic for a novel recessive male-sterile locus generated by genotoxic chemical exposure were sequenced using the Illumina next-generation DNA sequencer to obtain 20- to 29-fold coverage of the euchromatic sequences. The sequencing reads were processed and variants were called using standard bioinformatic tools. Next, SnpEff was used to annotate all sequence variants and their potential mutational effects on associated genes. Then, SnpSift was used to filter and select differential variants that potentially disrupt a common gene in the two allelic mutant strains. The potential causative DNA lesions were partially validated by capillary sequencing of PCR-amplified DNA in the genetic interval as defined by meiotic mapping and deletions that remove defined regions of the chromosome. Of the five candidate genes located in the genetic interval, the Pka-like gene CG12069 was found to carry a separate premature stop codon mutation in each of the two allelic mutants whereas the other 4 candidate genes within the interval have wild-type sequences. The Pka-like gene is therefore a strong candidate gene for the male-sterile locus. These results demonstrate that combining SnpEff and SnpSift can expedite the identification of candidate phenotype-causative mutations in chemically-mutagenized Drosophila strains. This technique can also be used to characterize the variety of mutations generated by genotoxic
SNIT: SNP identification for strain typing
Directory of Open Access Journals (Sweden)
Reifman Jaques
2011-09-01
Full Text Available Abstract With ever-increasing numbers of microbial genomes being sequenced, efficient tools are needed to perform strain-level identification of any newly sequenced genome. Here, we present the SNP identification for strain typing (SNIT pipeline, a fast and accurate software system that compares a newly sequenced bacterial genome with other genomes of the same species to identify single nucleotide polymorphisms (SNPs and small insertions/deletions (indels. Based on this information, the pipeline analyzes the polymorphic loci present in all input genomes to identify the genome that has the fewest differences with the newly sequenced genome. Similarly, for each of the other genomes, SNIT identifies the input genome with the fewest differences. Results from five bacterial species show that the SNIT pipeline identifies the correct closest neighbor with 75% to 100% accuracy. The SNIT pipeline is available for download at http://www.bhsai.org/snit.html
Lomonaco, Sara; Furumoto, Emily J; Loquasto, Joseph R; Morra, Patrizia; Grassi, Ausilia; Roberts, Robert F
2015-02-01
Identification at the genus, species, and strain levels is desirable when a probiotic microorganism is added to foods. Strains of Bifidobacterium animalis ssp. lactis (BAL) are commonly used worldwide in dairy products supplemented with probiotic strains. However, strain discrimination is difficult because of the high degree of genome identity (99.975%) between different genomes of this subspecies. Typing of monomorphic species can be carried out efficiently by targeting informative single nucleotide polymorphisms (SNP). Findings from a previous study analyzing both reference and commercial strains of BAL identified SNP that could be used to discriminate common strains into 8 groups. This paper describes development of a minisequencing assay based on the primer extension reaction (PER) targeting multiple SNP that can allow strain differentiation of BAL. Based on previous data, 6 informative SNP were selected for further testing, and a multiplex preliminary PCR was optimized to amplify the DNA regions containing the selected SNP. Extension primers (EP) annealing immediately adjacent to the selected SNP were developed and tested in simplex and multiplex PER to evaluate their performance. Twenty-five strains belonging to 9 distinct genomic clusters of B. animalis ssp. lactis were selected and analyzed using the developed minisequencing assay, simultaneously targeting the 6 selected SNP. Fragment analysis was subsequently carried out in duplicate and demonstrated that the assay yielded 8 specific profiles separating the most commonly used commercial strains. This novel multiplex PER approach provides a simple, rapid, flexible SNP-based subtyping method for proper characterization and identification of commercial probiotic strains of BAL from fermented dairy products. To assess the usefulness of this method, DNA was extracted from yogurt manufactured with and without the addition of B. animalis ssp. lactis BB-12. Extracted DNA was then subjected to the minisequencing
Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)
Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.
We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database
Evaluation of the Ion Torrent™ HID SNP 169-plex
DEFF Research Database (Denmark)
Børsting, Claus; Fordyce, Sarah L; Olofsson, Jill Katharina
2014-01-01
The Ion Torrent™ HID SNP assay amplified 136 autosomal SNPs and 33 Y-chromosome markers in one PCR and the markers were subsequently typed using the Ion PGM™ second generation sequencing platform. A total of 51 of the autosomal SNPs were selected from the SNPforID panel that is routinely used...... in our ISO 17025 accredited laboratory. Concordance between the Ion Torrent™ HID SNP assay and the SNPforID assay was tested by typing 44 Iraqis twice with the Ion Torrent™ HID SNP assay. The same samples were previously typed with the SNPforID assay and the Y-chromosome haplogroups of the individuals...
Study on the ratio of signal to noise for single photon resolution time spectrometer
International Nuclear Information System (INIS)
Wang Zhaomin; Huang Shengli; Xu Zizong; Wu Chong
2001-01-01
The ratio of signal to noise for single photon resolution time spectrometer and their influence factors were studied. A method to depress the background, to shorten the measurement time and to increase the ratio of signal to noise was discussed. Results show that ratio of signal to noise is proportional to solid angle of detector to source and detection efficiency, and inverse proportional to electronics noise. Choose the activity of the source was important for decreasing of random coincidence counting. To use a coincidence gate and a discriminator of single photon were an effective way of increasing measurement accuracy and detection efficiency
International Nuclear Information System (INIS)
Bashir, Mustafa R.; Merkle, Elmar M.; Smith, Alastair D.; Boll, Daniel T.
2012-01-01
Objective: To assess whether in vivo dual-ratio Dixon discrimination can improve detection of diffuse liver disease, specifically steatosis, iron deposition and combined disease over traditional single-ratio in/opposed phase analysis. Methods: Seventy-one patients with biopsy-proven (17.7 ± 17.0 days) hepatic steatosis (n = 16), iron deposition (n = 11), combined deposition (n = 3) and neither disease (n = 41) underwent MR examinations. Dual-echo in/opposed-phase MR with Dixon water/fat reconstructions were acquired. Analysis consisted of: (a) single-ratio hepatic region-of-interest (ROI)-based assessment of in/opposed ratios; (b) dual-ratio hepatic ROI assessment of in/opposed and fat/water ratios; (c) computer-aided dual-ratio assessment evaluating all hepatic voxels. Disease-specific thresholds were determined; statistical analyses assessed disease-dependent voxel ratios, based on single-ratio (a) and dual-ratio (b and c) techniques. Results: Single-ratio discrimination succeeded in identifying iron deposition (I/O Ironthreshold Fatthreshold>1.15 ) from normal parenchyma, sensitivity 70.0%; it failed to detect combined disease. Dual-ratio discrimination succeeded in identifying abnormal hepatic parenchyma (F/W Normalthreshold > 0.05), sensitivity 96.7%; logarithmic functions for iron deposition (I/O Iron d iscriminator (0.01−F/W Iron )/0.48 ) and for steatosis (I/O Fatdiscriminator > e (F/W Fat −0.01)/0.48 ) differentiated combined from isolated diseases, sensitivity 100.0%; computer-aided dual-ratio analysis was comparably sensitive but less specific, 90.2% vs. 97.6%. Conclusion: MR two-point-Dixon imaging using dual-ratio post-processing based on in/opposed and fat/water ratios improved in vivo detection of hepatic steatosis, iron deposition, and combined storage disease beyond traditional in/opposed analysis.
SNP Discovery and Development of a High-Density Genotyping Array for Sunflower
Bachlava, Eleni; Taylor, Christopher A.; Tang, Shunxue; Bowers, John E.; Mandel, Jennifer R.; Burke, John M.; Knapp, Steven J.
2012-01-01
Recent advances in next-generation DNA sequencing technologies have made possible the development of high-throughput SNP genotyping platforms that allow for the simultaneous interrogation of thousands of single-nucleotide polymorphisms (SNPs). Such resources have the potential to facilitate the rapid development of high-density genetic maps, and to enable genome-wide association studies as well as molecular breeding approaches in a variety of taxa. Herein, we describe the development of a SNP genotyping resource for use in sunflower (Helianthus annuus L.). This work involved the development of a reference transcriptome assembly for sunflower, the discovery of thousands of high quality SNPs based on the generation and analysis of ca. 6 Gb of transcriptome re-sequencing data derived from multiple genotypes, the selection of 10,640 SNPs for inclusion in the genotyping array, and the use of the resulting array to screen a diverse panel of sunflower accessions as well as related wild species. The results of this work revealed a high frequency of polymorphic SNPs and relatively high level of cross-species transferability. Indeed, greater than 95% of successful SNP assays revealed polymorphism, and more than 90% of these assays could be successfully transferred to related wild species. Analysis of the polymorphism data revealed patterns of genetic differentiation that were largely congruent with the evolutionary history of sunflower, though the large number of markers allowed for finer resolution than has previously been possible. PMID:22238659
Novel approach for deriving genome wide SNP analysis data from archived blood spots
2012-01-01
Background The ability to transport and store DNA at room temperature in low volumes has the advantage of optimising cost, time and storage space. Blood spots on adapted filter papers are popular for this, with FTA (Flinders Technology Associates) Whatman™TM technology being one of the most recent. Plant material, plasmids, viral particles, bacteria and animal blood have been stored and transported successfully using this technology, however the method of porcine DNA extraction from FTA Whatman™TM cards is a relatively new approach, allowing nucleic acids to be ready for downstream applications such as PCR, whole genome amplification, sequencing and subsequent application to single nucleotide polymorphism microarrays has hitherto been under-explored. Findings DNA was extracted from FTA Whatman™TM cards (following adaptations of the manufacturer’s instructions), whole genome amplified and subsequently analysed to validate the integrity of the DNA for downstream SNP analysis. DNA was successfully extracted from 288/288 samples and amplified by WGA. Allele dropout post WGA, was observed in less than 2% of samples and there was no clear evidence of amplification bias nor contamination. Acceptable call rates on porcine SNP chips were also achieved using DNA extracted and amplified in this way. Conclusions DNA extracted from FTA Whatman cards is of a high enough quality and quantity following whole genomic amplification to perform meaningful SNP chip studies. PMID:22974252
He, Hongbin; Argiro, Laurent; Dessein, Helia; Chevillard, Christophe
2007-01-01
FTA technology is a novel method designed to simplify the collection, shipment, archiving and purification of nucleic acids from a wide variety of biological sources. The number of punches that can normally be obtained from a single specimen card are often however, insufficient for the testing of the large numbers of loci required to identify genetic factors that control human susceptibility or resistance to multifactorial diseases. In this study, we propose an improved technique to perform large-scale SNP genotyping. We applied a whole genome amplification method to amplify DNA from buccal cell samples stabilized using FTA technology. The results show that using the improved technique it is possible to perform up to 15,000 genotypes from one buccal cell sample. Furthermore, the procedure is simple. We consider this improved technique to be a promising methods for performing large-scale SNP genotyping because the FTA technology simplifies the collection, shipment, archiving and purification of DNA, while whole genome amplification of FTA card bound DNA produces sufficient material for the determination of thousands of SNP genotypes.
Gimode, Davis; Odeny, Damaris A; de Villiers, Etienne P; Wanyonyi, Solomon; Dida, Mathews M; Mneney, Emmarold E; Muchugi, Alice; Machuka, Jesse; de Villiers, Santie M
2016-01-01
Finger millet is an important cereal crop in eastern Africa and southern India with excellent grain storage quality and unique ability to thrive in extreme environmental conditions. Since negligible attention has been paid to improving this crop to date, the current study used Next Generation Sequencing (NGS) technologies to develop both Simple Sequence Repeat (SSR) and Single Nucleotide Polymorphism (SNP) markers. Genomic DNA from cultivated finger millet genotypes KNE755 and KNE796 was sequenced using both Roche 454 and Illumina technologies. Non-organelle sequencing reads were assembled into 207 Mbp representing approximately 13% of the finger millet genome. We identified 10,327 SSRs and 23,285 non-homeologous SNPs and tested 101 of each for polymorphism across a diverse set of wild and cultivated finger millet germplasm. For the 49 polymorphic SSRs, the mean polymorphism information content (PIC) was 0.42, ranging from 0.16 to 0.77. We also validated 92 SNP markers, 80 of which were polymorphic with a mean PIC of 0.29 across 30 wild and 59 cultivated accessions. Seventy-six of the 80 SNPs were polymorphic across 30 wild germplasm with a mean PIC of 0.30 while only 22 of the SNP markers showed polymorphism among the 59 cultivated accessions with an average PIC value of 0.15. Genetic diversity analysis using the polymorphic SNP markers revealed two major clusters; one of wild and another of cultivated accessions. Detailed STRUCTURE analysis confirmed this grouping pattern and further revealed 2 sub-populations within wild E. coracana subsp. africana. Both STRUCTURE and genetic diversity analysis assisted with the correct identification of the new germplasm collections. These polymorphic SSR and SNP markers are a significant addition to the existing 82 published SSRs, especially with regard to the previously reported low polymorphism levels in finger millet. Our results also reveal an unexploited finger millet genetic resource that can be included in the regional
Directory of Open Access Journals (Sweden)
Davis Gimode
Full Text Available Finger millet is an important cereal crop in eastern Africa and southern India with excellent grain storage quality and unique ability to thrive in extreme environmental conditions. Since negligible attention has been paid to improving this crop to date, the current study used Next Generation Sequencing (NGS technologies to develop both Simple Sequence Repeat (SSR and Single Nucleotide Polymorphism (SNP markers. Genomic DNA from cultivated finger millet genotypes KNE755 and KNE796 was sequenced using both Roche 454 and Illumina technologies. Non-organelle sequencing reads were assembled into 207 Mbp representing approximately 13% of the finger millet genome. We identified 10,327 SSRs and 23,285 non-homeologous SNPs and tested 101 of each for polymorphism across a diverse set of wild and cultivated finger millet germplasm. For the 49 polymorphic SSRs, the mean polymorphism information content (PIC was 0.42, ranging from 0.16 to 0.77. We also validated 92 SNP markers, 80 of which were polymorphic with a mean PIC of 0.29 across 30 wild and 59 cultivated accessions. Seventy-six of the 80 SNPs were polymorphic across 30 wild germplasm with a mean PIC of 0.30 while only 22 of the SNP markers showed polymorphism among the 59 cultivated accessions with an average PIC value of 0.15. Genetic diversity analysis using the polymorphic SNP markers revealed two major clusters; one of wild and another of cultivated accessions. Detailed STRUCTURE analysis confirmed this grouping pattern and further revealed 2 sub-populations within wild E. coracana subsp. africana. Both STRUCTURE and genetic diversity analysis assisted with the correct identification of the new germplasm collections. These polymorphic SSR and SNP markers are a significant addition to the existing 82 published SSRs, especially with regard to the previously reported low polymorphism levels in finger millet. Our results also reveal an unexploited finger millet genetic resource that can be included
Institute of Scientific and Technical Information of China (English)
Zhen-lin ZHANG; Jin-wei HE; Yue-juan QIN; Yun-qiu HU; Miao LI; Yu-juan LIU; Hao ZHANG; Wei-wei HU
2007-01-01
Aim: To assess the contribution of single nucleotide polymorphisms (SNP) and haplotypes in the peroxisome proliferator-activated receptor-γ co-activator-1(PPARGC1) and adiponectin genes to normal bone mineral density (BMD) variation in healthy Chinese women and men. Methods: We performed population-based (ANOVA) and family-based (quantitative trait locus transmission disequi-librium test) association studies of PPARGC1 and adiponectin genes. SNP in the 2 genes were genotyped. BMD was measured using dual-energy X-ray absorptiometry in the lumbar spine and hip in 401 nuclear families with a total of1260 subjects, including 458 premenopausal women, 20-40 years of age; 401 post-menopausal women (mothers), 43-74 years of age; and 401 men (fathers), 49-76years of age. Results: Significant within-family association was found between the Thr394Thr polymorphism in the PPGAGC1 gene and peak BMD in the femoral neck (P=0.026). Subsequent permutations were in agreement with this significant within-family association result (P=0.016), but Thr394Thr SNP only accounted for0.7% of the variation in femoral neck peak BMD. However, no significant within-family association was detected between each SNP in the adiponect in gene and peak BMD. Although no significant association was found between BMD and SNP in the PPARGC1 and adiponectin genes in both men and postmenopausal women, haplotype 2 (T-T) in the adiponect in gene was associated with lumbar spine BMD in postmenopausal women (P=0.019). Conclusion: Our findings sug-gest that Thr394Thr SNP in the PPARGC1 gene was associated with peak BMD in the femoral neck in Chinese women. Confirmation of our results is needed in other populations and with more functional markers within and flanking the PPARGC1 or adiponectin genes region.
Climer, Sharlee; Yang, Wei; de las Fuentes, Lisa; Dávila-Román, Victor G; Gu, C Charles
2014-11-01
Complex diseases are often associated with sets of multiple interacting genetic factors and possibly with unique sets of the genetic factors in different groups of individuals (genetic heterogeneity). We introduce a novel concept of custom correlation coefficient (CCC) between single nucleotide polymorphisms (SNPs) that address genetic heterogeneity by measuring subset correlations autonomously. It is used to develop a 3-step process to identify candidate multi-SNP patterns: (1) pairwise (SNP-SNP) correlations are computed using CCC; (2) clusters of so-correlated SNPs identified; and (3) frequencies of these clusters in disease cases and controls compared to identify disease-associated multi-SNP patterns. This method identified 42 candidate multi-SNP associations with hypertensive heart disease (HHD), among which one cluster of 22 SNPs (six genes) included 13 in SLC8A1 (aka NCX1, an essential component of cardiac excitation-contraction coupling) and another of 32 SNPs had 29 from a different segment of SLC8A1. While allele frequencies show little difference between cases and controls, the cluster of 22 associated alleles were found in 20% of controls but no cases and the other in 3% of controls but 20% of cases. These suggest that both protective and risk effects on HHD could be exerted by combinations of variants in different regions of SLC8A1, modified by variants from other genes. The results demonstrate that this new correlation metric identifies disease-associated multi-SNP patterns overlooked by commonly used correlation measures. Furthermore, computation time using CCC is a small fraction of that required by other methods, thereby enabling the analyses of large GWAS datasets. © 2014 WILEY PERIODICALS, INC.
Ramos, Antonio M.; Crooijmans, Richard P. M. A.; Affara, Nabeel A.; Amaral, Andreia J.; Archibald, Alan L.; Beever, Jonathan E.; Bendixen, Christian; Churcher, Carol; Clark, Richard; Dehais, Patrick; Hansen, Mark S.; Hedegaard, Jakob; Hu, Zhi-Liang; Kerstens, Hindrik H.; Law, Andy S.; Megens, Hendrik-Jan; Milan, Denis; Nonneman, Danny J.; Rohrer, Gary A.; Rothschild, Max F.; Smith, Tim P. L.; Schnabel, Robert D.; Van Tassell, Curt P.; Taylor, Jeremy F.; Wiedmann, Ralph T.; Schook, Lawrence B.; Groenen, Martien A. M.
2009-01-01
Background The dissection of complex traits of economic importance to the pig industry requires the availability of a significant number of genetic markers, such as single nucleotide polymorphisms (SNPs). This study was conducted to discover several hundreds of thousands of porcine SNPs using next generation sequencing technologies and use these SNPs, as well as others from different public sources, to design a high-density SNP genotyping assay. Methodology/Principal Findings A total of 19 reduced representation libraries derived from four swine breeds (Duroc, Landrace, Large White, Pietrain) and a Wild Boar population and three restriction enzymes (AluI, HaeIII and MspI) were sequenced using Illumina's Genome Analyzer (GA). The SNP discovery effort resulted in the de novo identification of over 372K SNPs. More than 549K SNPs were used to design the Illumina Porcine 60K+SNP iSelect Beadchip, now commercially available as the PorcineSNP60. A total of 64,232 SNPs were included on the Beadchip. Results from genotyping the 158 individuals used for sequencing showed a high overall SNP call rate (97.5%). Of the 62,621 loci that could be reliably scored, 58,994 were polymorphic yielding a SNP conversion success rate of 94%. The average minor allele frequency (MAF) for all scorable SNPs was 0.274. Conclusions/Significance Overall, the results of this study indicate the utility of using next generation sequencing technologies to identify large numbers of reliable SNPs. In addition, the validation of the PorcineSNP60 Beadchip demonstrated that the assay is an excellent tool that will likely be used in a variety of future studies in pigs. PMID:19654876
Psifidi, Androniki; Dovas, Chrysostomos; Banos, Georgios
2011-01-01
Background Single nucleotide polymorphisms (SNP) have proven to be powerful genetic markers for genetic applications in medicine, life science and agriculture. A variety of methods exist for SNP detection but few can quantify SNP frequencies when the mutated DNA molecules correspond to a small fraction of the wild-type DNA. Furthermore, there is no generally accepted gold standard for SNP quantification, and, in general, currently applied methods give inconsistent results in selected cohorts. In the present study we sought to develop a novel method for accurate detection and quantification of SNP in DNA pooled samples. Methods The development and evaluation of a novel Ligase Chain Reaction (LCR) protocol that uses a DNA-specific fluorescent dye to allow quantitative real-time analysis is described. Different reaction components and thermocycling parameters affecting the efficiency and specificity of LCR were examined. Several protocols, including gap-LCR modifications, were evaluated using plasmid standard and genomic DNA pools. A protocol of choice was identified and applied for the quantification of a polymorphism at codon 136 of the ovine PRNP gene that is associated with susceptibility to a transmissible spongiform encephalopathy in sheep. Conclusions The real-time LCR protocol developed in the present study showed high sensitivity, accuracy, reproducibility and a wide dynamic range of SNP quantification in different DNA pools. The limits of detection and quantification of SNP frequencies were 0.085% and 0.35%, respectively. Significance The proposed real-time LCR protocol is applicable when sensitive detection and accurate quantification of low copy number mutations in DNA pools is needed. Examples include oncogenes and tumour suppressor genes, infectious diseases, pathogenic bacteria, fungal species, viral mutants, drug resistance resulting from point mutations, and genetically modified organisms in food. PMID:21283808
An updated meta-analysis on the association of MDM2 SNP309 polymorphism with colorectal cancer risk.
Directory of Open Access Journals (Sweden)
Xue Qin
Full Text Available The mouse double minute 2 (MDM2 gene encodes a phosphoprotein that interacts with P53 and negatively regulates its activity. The SNP309 polymorphism (T-G in the promoter of MDM2 gene has been reported to be associated with enhanced MDM2 expression and tumor development. Studies investigating the association between MDM2 SNP309 polymorphism and colorectal cancer (CRC risk reported conflicting results. We performed a meta-analysis of all available studies to explore the association of this polymorphism with CRC risk.All studies published up to July 2013 on the association between MDM2 SNP309 polymorphism and CRC risk were identified by searching electronic databases PubMed, EMBASE, and Chinese Biomedical Literature database (CBM databases. The association between the MDM2 SNP309 polymorphism and CRC risk was assessed by odds ratios (ORs together with their 95% confidence intervals (CIs.A total of 14 case-control studies including 4460 CRC cases and 4828 controls were identified. We did not find a significant association between the MDM2 SNP309 polymorphism and CRC risk in all genetic models in overall population. However, in subgroup analysis by ethnicity, significant associations were found in Asians (TG vs. TT: OR = 1.197, 95% CI = 1.055-1.358, P=0.005; GG+TG vs. TT: OR = 1.246, 95% CI = 1.106-1.404, P=0.000 and Africans. When stratified by HWE in controls, significantly increased risk was also found among the studies consistent with HWE (TG vs. TT: OR = 1.166, 95% CI = 1.037-1.311, P= 0.010. In subgroup analysis according to p53 mutation status, and gender, no any significant association was detected.The present meta-analysis suggests that the MDM2 is a candidate gene for CRC susceptibility. The MDM2 SNP309 polymorphism may be a risk factor for CRC in Asians.
Reliable Single Chip Genotyping with Semi-Parametric Log-Concave Mixtures
R.C.A. Rippe (Ralph); J.J. Meulman (Jacqueline); P.H.C. Eilers (Paul)
2012-01-01
textabstractThe common approach to SNP genotyping is to use (model-based) clustering per individual SNP, on a set of arrays. Genotyping all SNPs on a single array is much more attractive, in terms of flexibility, stability and applicability, when developing new chips. A new semi-parametric method,
A set of 14 DIP-SNP markers to detect unbalanced DNA mixtures.
Liu, Zhizhen; Liu, Jinding; Wang, Jiaqi; Chen, Deqing; Liu, Zidong; Shi, Jie; Li, Zeqin; Li, Wenyan; Zhang, Gengqian; Du, Bing
2018-03-04
Unbalanced DNA mixture is still a difficult problem for forensic practice. DIP-STRs are useful markers for detection of minor DNA but they are not widespread in the human genome and having long amplicons. In this study, we proposed a novel type of genetic marker, termed DIP-SNP. DIP-SNP refers to the combination of INDEL and SNP in less than 300bp length of human genome. The multiplex PCR and SNaPshot assay were established for 14 DIP-SNP markers in a Chinese Han population from Shanxi, China. This novel compound marker allows detection of the minor DNA contributor with sensitivity from 1:50 to 1:1000 in a DNA mixture of any gender with 1 ng-10 ng DNA template. Most of the DIP-SNP markers had a relatively high probability of informative alleles with an average I value of 0.33. In all, we proposed DIP-SNP as a novel kind of genetic marker for detection of minor contributor from unbalanced DNA mixture and established the detection method by associating the multiplex PCR and SNaPshot assay. DIP-SNP polymorphisms are promising markers for forensic or clinical mixture examination because they are shorter, widespread and higher sensitive. Copyright © 2018 Elsevier Inc. All rights reserved.
Making a chocolate chip: development and evaluation of a 6K SNP array for Theobroma cacao.
Livingstone, Donald; Royaert, Stefan; Stack, Conrad; Mockaitis, Keithanne; May, Greg; Farmer, Andrew; Saski, Christopher; Schnell, Ray; Kuhn, David; Motamayor, Juan Carlos
2015-08-01
Theobroma cacao, the key ingredient in chocolate production, is one of the world's most important tree fruit crops, with ∼4,000,000 metric tons produced across 50 countries. To move towards gene discovery and marker-assisted breeding in cacao, a single-nucleotide polymorphism (SNP) identification project was undertaken using RNAseq data from 16 diverse cacao cultivars. RNA sequences were aligned to the assembled transcriptome of the cultivar Matina 1-6, and 330,000 SNPs within coding regions were identified. From these SNPs, a subset of 6,000 high-quality SNPs were selected for inclusion on an Illumina Infinium SNP array: the Cacao6kSNP array. Using Cacao6KSNP array data from over 1,000 cacao samples, we demonstrate that our custom array produces a saturated genetic map and can be used to distinguish among even closely related genotypes. Our study enhances and expands the genetic resources available to the cacao research community, and provides the genome-scale set of tools that are critical for advancing breeding with molecular markers in an agricultural species with high genetic diversity. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Direct uranium isotope ratio analysis of single micrometer-sized glass particles
Kappel, Stefanie; Boulyga, Sergei F.; Prohaska, Thomas
2012-01-01
We present the application of nanosecond laser ablation (LA) coupled to a ‘Nu Plasma HR’ multi collector inductively coupled plasma mass spectrometer (MC-ICP-MS) for the direct analysis of U isotope ratios in single, 10–20 μm-sized, U-doped glass particles. Method development included studies with respect to (1) external correction of the measured U isotope ratios in glass particles, (2) the applied laser ablation carrier gas (i.e. Ar versus He) and (3) the accurate determination of lower abu...
UPD detection using homozygosity profiling with a SNP genotyping microarray.
Papenhausen, Peter; Schwartz, Stuart; Risheg, Hiba; Keitges, Elisabeth; Gadi, Inder; Burnside, Rachel D; Jaswaney, Vikram; Pappas, John; Pasion, Romela; Friedman, Kenneth; Tepperberg, James
2011-04-01
Single nucleotide polymorphism (SNP) based chromosome microarrays provide both a high-density whole genome analysis of copy number and genotype. In the past 21 months we have analyzed over 13,000 samples primarily referred for developmental delay using the Affymetrix SNP/CN 6.0 version array platform. In addition to copy number, we have focused on the relative distribution of allele homozygosity (HZ) throughout the genome to confirm a strong association of uniparental disomy (UPD) with regions of isoallelism found in most confirmed cases of UPD. We sought to determine whether a long contiguous stretch of HZ (LCSH) greater than a threshold value found only in a single chromosome would correlate with UPD of that chromosome. Nine confirmed UPD cases were retrospectively analyzed with the array in the study, each showing the anticipated LCSH with the smallest 13.5 Mb in length. This length is well above the average longest run of HZ in a set of control patients and was then set as the prospective threshold for reporting possible UPD correlation. Ninety-two cases qualified at that threshold, 46 of those had molecular UPD testing and 29 were positive. Including retrospective cases, 16 showed complete HZ across the chromosome, consistent with total isoUPD. The average size LCSH in the 19 cases that were not completely HZ was 46.3 Mb with a range of 13.5-127.8 Mb. Three patients showed only segmental UPD. Both the size and location of the LCSH are relevant to correlation with UPD. Further studies will continue to delineate an optimal threshold for LCSH/UPD correlation. Copyright © 2011 Wiley-Liss, Inc.
LS-SNP/PDB: annotated non-synonymous SNPs mapped to Protein Data Bank structures.
Ryan, Michael; Diekhans, Mark; Lien, Stephanie; Liu, Yun; Karchin, Rachel
2009-06-01
LS-SNP/PDB is a new WWW resource for genome-wide annotation of human non-synonymous (amino acid changing) SNPs. It serves high-quality protein graphics rendered with UCSF Chimera molecular visualization software. The system is kept up-to-date by an automated, high-throughput build pipeline that systematically maps human nsSNPs onto Protein Data Bank structures and annotates several biologically relevant features. LS-SNP/PDB is available at (http://ls-snp.icm.jhu.edu/ls-snp-pdb) and via links from protein data bank (PDB) biology and chemistry tabs, UCSC Genome Browser Gene Details and SNP Details pages and PharmGKB Gene Variants Downloads/Cross-References pages.
Rodríguez-Ezpeleta, Naiara
2016-03-03
Restriction-site associated DNA sequencing (RAD-seq) and related methods are revolutionizing the field of population genomics in non-model organisms as they allow generating an unprecedented number of single nucleotide polymorphisms (SNPs) even when no genomic information is available. Yet, RAD-seq data analyses rely on assumptions on nature and number of nucleotide variants present in a single locus, the choice of which may lead to an under- or overestimated number of SNPs and/or to incorrectly called genotypes. Using the Atlantic mackerel (Scomber scombrus L.) and a close relative, the Atlantic chub mackerel (Scomber colias), as case study, here we explore the sensitivity of population structure inferences to two crucial aspects in RAD-seq data analysis: the maximum number of mismatches allowed to merge reads into a locus and the relatedness of the individuals used for genotype calling and SNP selection. Our study resolves the population structure of the Atlantic mackerel, but, most importantly, provides insights into the effects of alternative RAD-seq data analysis strategies on population structure inferences that are directly applicable to other species.
International Nuclear Information System (INIS)
Sun, Ying-Fang; Leu, Jyh-Der; Chen, Su-Mei; Lin, I-Feng; Lee, Yi-Jang
2009-01-01
It has been suggested that the single nucleotide polymorphism 309 (SNP309, T -> G) in the promoter region of the MDM2 gene is important for tumor development; however, with regards to breast cancer, inconsistent associations have been reported worldwide. It is speculated that these conflicting results may have arisen due to different patient subgroups and ethnicities studied. For the first time, this study explores the effect of the MDM2 SNP309 genotype on Taiwanese breast cancer patients. Genomic DNA was obtained from the whole blood of 124 breast cancer patients and 97 cancer-free healthy women living in Taiwan. MDM2 SNP309 genotyping was carried out by restriction fragment length polymorphism (RFLP) assay. The multivariate logistic regression and the Kaplan-Meier method were used for analyzing the risk association and significance of age at diagnosis among different MDM2 SNP309 genotypes, respectively. Compared to the TT genotype, an increased risk association with breast cancer was apparent for the GG genotype (OR = 3.05, 95% CI = 1.04 to 8.95), and for the TG genotype (OR = 2.12, 95% CI = 0.90 to 5.00) after adjusting for age, cardiovascular disease/diabetes, oral contraceptive usage, and body mass index, which exhibits significant difference between cases and controls. Furthermore, the average ages at diagnosis for breast cancer patients were 53.6, 52 and 47 years for those harboring TT, TG and GG genotypes, respectively. A significant difference in median age of onset for breast cancer between GG and TT+TG genotypes was obtained by the log-rank test (p = 0.0067). Findings based on the current sample size suggest that the MDM2 SNP309 GG genotype may be associated with both the risk of breast cancer and an earlier age of onset in Taiwanese women
Filippi, Carla V; Aguirre, Natalia; Rivas, Juan G; Zubrzycki, Jeremias; Puebla, Andrea; Cordes, Diego; Moreno, Maria V; Fusari, Corina M; Alvarez, Daniel; Heinz, Ruth A; Hopp, Horacio E; Paniego, Norma B; Lia, Veronica V
2015-02-13
Argentina has a long tradition of sunflower breeding, and its germplasm is a valuable genetic resource worldwide. However, knowledge of the genetic constitution and variability levels of the Argentinean germplasm is still scarce, rendering the global map of cultivated sunflower diversity incomplete. In this study, 42 microsatellite loci and 384 single nucleotide polymorphisms (SNPs) were used to characterize the first association mapping population used for quantitative trait loci mapping in sunflower, along with a selection of allied open-pollinated and composite populations from the germplasm bank of the National Institute of Agricultural Technology of Argentina. The ability of different kinds of markers to assess genetic diversity and population structure was also evaluated. The analysis of polymorphism in the set of sunflower accessions studied here showed that both the microsatellites and SNP markers were informative for germplasm characterization, although to different extents. In general, the estimates of genetic variability were moderate. The average genetic diversity, as quantified by the expected heterozygosity, was 0.52 for SSR loci and 0.29 for SNPs. Within SSR markers, those derived from non-coding regions were able to capture higher levels of diversity than EST-SSR. A significant correlation was found between SSR and SNP- based genetic distances among accessions. Bayesian and multivariate methods were used to infer population structure. Evidence for the existence of three different genetic groups was found consistently across data sets (i.e., SSR, SNP and SSR + SNP), with the maintainer/restorer status being the most prevalent characteristic associated with group delimitation. The present study constitutes the first report comparing the performance of SSR and SNP markers for population genetics analysis in cultivated sunflower. We show that the SSR and SNP panels examined here, either used separately or in conjunction, allowed consistent
Humble, Emily; Thorne, Michael A S; Forcada, Jaume; Hoffman, Joseph I
2016-08-26
Single nucleotide polymorphism (SNP) discovery is an important goal of many studies. However, the number of 'putative' SNPs discovered from a sequence resource may not provide a reliable indication of the number that will successfully validate with a given genotyping technology. For this it may be necessary to account for factors such as the method used for SNP discovery and the type of sequence data from which it originates, suitability of the SNP flanking sequences for probe design, and genomic context. To explore the relative importance of these and other factors, we used Illumina sequencing to augment an existing Roche 454 transcriptome assembly for the Antarctic fur seal (Arctocephalus gazella). We then mapped the raw Illumina reads to the new hybrid transcriptome using BWA and BOWTIE2 before calling SNPs with GATK. The resulting markers were pooled with two existing sets of SNPs called from the original 454 assembly using NEWBLER and SWAP454. Finally, we explored the extent to which SNPs discovered using these four methods overlapped and predicted the corresponding validation outcomes for both Illumina Infinium iSelect HD and Affymetrix Axiom arrays. Collating markers across all discovery methods resulted in a global list of 34,718 SNPs. However, concordance between the methods was surprisingly poor, with only 51.0 % of SNPs being discovered by more than one method and 13.5 % being called from both the 454 and Illumina datasets. Using a predictive modeling approach, we could also show that SNPs called from the Illumina data were on average more likely to successfully validate, as were SNPs called by more than one method. Above and beyond this pattern, predicted validation outcomes were also consistently better for Affymetrix Axiom arrays. Our results suggest that focusing on SNPs called by more than one method could potentially improve validation outcomes. They also highlight possible differences between alternative genotyping technologies that could be
In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...
African Journals Online (AJOL)
Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.
Nondestructive measurement of the grid ratio using a single image
International Nuclear Information System (INIS)
Pasciak, A. S.; Jones, A. Kyle
2009-01-01
The antiscatter grid is an essential part of modern radiographic systems. Since the introduction of the antiscatter grid, however, there have been few methods proposed for acceptance testing and verification of manufacturer-supplied grid specifications. The grid ratio (r) is an important parameter describing the antiscatter grid because it affects many other grid quality metrics, such as the contrast improvement ratio (K), primary transmission (T p ), and scatter transmission (T s ). Also, the grid ratio in large part determines the primary clinical use of the grid. To this end, the authors present a technique for the nondestructive measurement of the grid ratio of antiscatter grids. They derived an equation that can be used to calculate the grid ratio from a single off-focus flat field image by exploiting the relationship between grid cutoff and off-focus distance. The calculation can be performed by hand or with included analysis software. They calculated the grid ratios of several different grids throughout the institution, and afterward they destructively measured the grid ratio of a nominal r8 grid previously evaluated with the method. They also studied the sensitivity of the method to technical factors and choice of parameters. With one exception, the results for the grids found in the institution were in agreement with the manufacturer's specifications and international standards. The nondestructive evaluation of the r8 grid indicated a ratio of 7.3, while the destructive measurement indicated a ratio of 7.53±0.28. Repeated evaluations of the same grid yielded consistent results. The technique provides the medical physicist with a new tool for quantitative evaluation of the grid ratio, an important grid performance criterion. The method is robust and repeatable when appropriate choices of technical factors and other parameters are made.
fcGENE: a versatile tool for processing and transforming SNP datasets.
Directory of Open Access Journals (Sweden)
Nab Raj Roshyara
Full Text Available Modern analysis of high-dimensional SNP data requires a number of biometrical and statistical methods such as pre-processing, analysis of population structure, association analysis and genotype imputation. Software used for these purposes often rely on specific and incompatible input and output data formats. Therefore extensive data management including multiple format conversions is necessary during analyses.In order to support fast and efficient management and bio-statistical quality control of high-dimensional SNP data, we developed the publically available software fcGENE using C++ object-oriented programming language. This software simplifies and automates the use of different existing analysis packages, especially during the workflow of genotype imputations and corresponding analyses.fcGENE transforms SNP data and imputation results into different formats required for a large variety of analysis packages such as PLINK, SNPTEST, HAPLOVIEW, EIGENSOFT, GenABEL and tools used for genotype imputation such as MaCH, IMPUTE, BEAGLE and others. Data Management tasks like merging, splitting, extracting SNP and pedigree information can be performed. fcGENE also supports a number of bio-statistical quality control processes and quality based filtering processes at SNP- and sample-wise level. The tool also generates templates of commands required to run specific software packages, especially those required for genotype imputation. We demonstrate the functionality of fcGENE by example workflows of SNP data analyses and provide a comprehensive manual of commands, options and applications.We have developed a user-friendly open-source software fcGENE, which comprehensively supports SNP data management, quality control and analysis workflows. Download statistics and corresponding feedbacks indicate that software is highly recognised and extensively applied by the scientific community.
Qin, Sisi; Ingle, James N; Liu, Mohan; Yu, Jia; Wickerham, D Lawrence; Kubo, Michiaki; Weinshilboum, Richard M; Wang, Liewei
2017-08-18
We previously performed a case-control genome-wide association study in women treated with selective estrogen receptor modulators (SERMs) for breast cancer prevention and identified single nucleotide polymorphisms (SNPs) in ZNF423 as potential biomarkers for response to SERM therapy. The ZNF423rs9940645 SNP, which is approximately 200 bp away from the estrogen response elements, resulted in the SNP, estrogen, and SERM-dependent regulation of ZNF423 expression and, "downstream", that of BRCA1. Electrophoretic mobility shift assay-mass spectrometry was performed to identify proteins binding to the ZNF423 SNP and coordinating with estrogen receptor alpha (ERα). Clustered, regularly interspaced short palindromic repeats (CRISPR)/Cas9 genome editing was applied to generate ZR75-1 breast cancer cells with different ZNF423 SNP genotypes. Both cultured cells and mouse xenograft models with different ZNF423 SNP genotypes were used to study the cellular responses to SERMs and poly(ADP-ribose) polymerase (PARP) inhibitors. We identified calmodulin-like protein 3 (CALML3) as a key sensor of this SNP and a coregulator of ERα, which contributes to differential gene transcription regulation in an estrogen and SERM-dependent fashion. Furthermore, using CRISPR/Cas9-engineered ZR75-1 breast cancer cells with different ZNF423 SNP genotypes, striking differences in cellular responses to SERMs and PARP inhibitors, alone or in combination, were observed not only in cells but also in a mouse xenograft model. Our results have demonstrated the mechanism by which the ZNF423 rs9940645 SNP might regulate gene expression and drug response as well as its potential role in achieving more highly individualized breast cancer therapy.
Development and validation of a high density SNP genotyping array for Atlantic salmon (Salmo salar)
2014-01-01
Background Dense single nucleotide polymorphism (SNP) genotyping arrays provide extensive information on polymorphic variation across the genome of species of interest. Such information can be used in studies of the genetic architecture of quantitative traits and to improve the accuracy of selection in breeding programs. In Atlantic salmon (Salmo salar), these goals are currently hampered by the lack of a high-density SNP genotyping platform. Therefore, the aim of the study was to develop and test a dense Atlantic salmon SNP array. Results SNP discovery was performed using extensive deep sequencing of Reduced Representation (RR-Seq), Restriction site-Associated DNA (RAD-Seq) and mRNA (RNA-Seq) libraries derived from farmed and wild Atlantic salmon samples (n = 283) resulting in the discovery of > 400 K putative SNPs. An Affymetrix Axiom® myDesign Custom Array was created and tested on samples of animals of wild and farmed origin (n = 96) revealing a total of 132,033 polymorphic SNPs with high call rate, good cluster separation on the array and stable Mendelian inheritance in our sample. At least 38% of these SNPs are from transcribed genomic regions and therefore more likely to include functional variants. Linkage analysis utilising the lack of male recombination in salmonids allowed the mapping of 40,214 SNPs distributed across all 29 pairs of chromosomes, highlighting the extensive genome-wide coverage of the SNPs. An identity-by-state clustering analysis revealed that the array can clearly distinguish between fish of different origins, within and between farmed and wild populations. Finally, Y-chromosome-specific probes included on the array provide an accurate molecular genetic test for sex. Conclusions This manuscript describes the first high-density SNP genotyping array for Atlantic salmon. This array will be publicly available and is likely to be used as a platform for high-resolution genetics research into traits of evolutionary and economic importance in
Directory of Open Access Journals (Sweden)
Martina Miluchová
2012-05-01
Full Text Available Canine atopic dermatitis (cAD is a common inflammatory skin disease that is considered to be a naturally occurring, spontaneous model of human atopic dermatitis (eczema. The aim of the paper was to identify of the SNP rs22114085 in different dog breeds. The material involved 52 dogs from 5 different breeds. Canine genomic DNA was isolated from saliva by modified method with using DNAzol® and linear polyacrylamide (LPA carrier and from blood by using commercial kit NucleospinBlood and used in order to estimate rs22114085 SNP genotypes by PCR-RFLP method. The PCR products were digested with DdeI restriction enzyme. The C allele was distributed in Czech Pointer, Chihuahua, German Wirehaired Pointer with an allele frequency ranging from 0.4545 to 1.00. In the population of Czech Pointer we detected all genotypes CC, CT and TT with frequency in male 0.25, 0.5833 and 0.1667, and in female 0.2728, 0.3636 and 0.3636, subsequently. In German Wirehaired Pointer was detected homozygote genotype CC in male and heterozygote genotype CT in female with frequency 1 and 1. In Chihuahua was observed homozygote genotype CC and heterozygote genotype CT with frequency 0.3333 and 0.6667, subsequently. In Golden retriever and Pincher we detected genotype TT with frequency 1.
Directory of Open Access Journals (Sweden)
Martina Miluchová
2014-05-01
Full Text Available The aim of the paper was to identify of the SNP rs23472497 associated with canine atopic dermatitis (cAD. cAD is a common inflammatory skin disease that is considered to be a naturally occurring, spontaneous model of human atopic dermatitis (eczema. The material involved 60 dogs from 6 different breeds. Canine genomic DNA was isolated from saliva by modified method with using DNAzol® and linear polyacrylamide (LPA carrier and from blood by using commercial kit NucleospinBlood and used in order to estimate rs23472497 SNP genotypes by ACRS-PCR method. The PCR products were digested with NlaIII restriction enzyme. In the population of Czech Pointer and Slovak Wirehaired Pointer we detected all genotypes AA, AG and GG with frequency 0.0732, 0.5122 and 0.4146 for Czech Pointer and 0.1818, 0.5455 and 0.2727 for Slovak Wirehaired Pointer. In Border Collie was observed heterozygote genotype AG and homozygote genotype GG with frequency 0.6667 and 0.3333, subsequently. In German Wirehaired Pointer, Australian Shepherd dog and American Staffordshire terrier we detected only genotype AG with frequency 1. The A allele was distributed with an allele frequency ranging from 0.3293 to 0.5. The G allele was distributed with an allele frequency ranging from 0.5 to 0.6707.
Directory of Open Access Journals (Sweden)
Sara Lindstrom
2011-02-01
Full Text Available Genome-wide association studies (GWAS have identified multiple single nucleotide polymorphisms (SNPs associated with prostate cancer risk. However, whether these associations can be consistently replicated, vary with disease aggressiveness (tumor stage and grade and/or interact with non-genetic potential risk factors or other SNPs is unknown. We therefore genotyped 39 SNPs from regions identified by several prostate cancer GWAS in 10,501 prostate cancer cases and 10,831 controls from the NCI Breast and Prostate Cancer Cohort Consortium (BPC3. We replicated 36 out of 39 SNPs (P-values ranging from 0.01 to 10⁻²⁸. Two SNPs located near KLK3 associated with PSA levels showed differential association with Gleason grade (rs2735839, P = 0.0001 and rs266849, P = 0.0004; case-only test, where the alleles associated with decreasing PSA levels were inversely associated with low-grade (as defined by Gleason grade < 8 tumors but positively associated with high-grade tumors. No other SNP showed differential associations according to disease stage or grade. We observed no effect modification by SNP for association with age at diagnosis, family history of prostate cancer, diabetes, BMI, height, smoking or alcohol intake. Moreover, we found no evidence of pair-wise SNP-SNP interactions. While these SNPs represent new independent risk factors for prostate cancer, we saw little evidence for effect modification by other SNPs or by the environmental factors examined.
Facile fabrication of single-crystal-diamond nanostructures with ultrahigh aspect ratio.
Tao Ye; Degen Christian
2013-01-01
A robust and facile approach for making single crystal diamond MEMS and NEMS devices is presented. The approach relies entirely on commercial diamond material and standard cleanroom processes. As an example batch fabrication of cantilever beams of thickness down to 45 nm and aspect ratios exceeding 2000:1 is demonstrated.
Rapid detection of SNP (c.309T>G in the MDM2 gene by the Duplex SmartAmp method.
Directory of Open Access Journals (Sweden)
Yasuaki Enokida
Full Text Available BACKGROUND: Genetic polymorphisms in the human MDM2 gene are suggested to be a tumor susceptibility marker and a prognostic factor for cancer. It has been reported that a single nucleotide polymorphism (SNP c.309T>G in the MDM2 gene attenuates the tumor suppressor activity of p53 and accelerates tumor formation in humans. METHODOLOGY: In this study, to detect the SNP c.309T>G in the MDM2 gene, we have developed a new SNP detection method, named "Duplex SmartAmp," which enabled us to simultaneously detect both 309T and 309G alleles in one tube. To develop this new method, we introduced new primers i.e., nBP and oBPs, as well as two different fluorescent dyes that separately detect those genetic polymorphisms. RESULTS AND CONCLUSIONS: By the Duplex SmartAmp method, the genetic polymorphisms of the MDM2 gene were detected directly from a small amount of genomic DNA or blood samples. We used 96 genomic DNA and 24 blood samples to validate the Duplex SmartAmp by comparison with results of the conventional PCR-RFLP method; consequently, the Duplex SmartAmp results agreed totally with those of the PCR-RFLP method. Thus, the new SNP detection method is considered useful for detecting the SNP c.309T>G in the MDM2 gene so as to judge cancer susceptibility against some cellular stress in the clinical setting, and also to handle a large number of samples and enable rapid clinical diagnosis.
International Nuclear Information System (INIS)
Manson, S.T.
1994-01-01
In this paper the author derives expressions for the ratio of double to single ionization of helium from its ground state, by both single photons, and charged particle impact. He shows that in the limit of large reduced incident energy T of a charged particle, that the ratio of the double to single ionization cross sections at some energy transfer ΔE is equal to the ratio of photoionization cross sections for a photon of energy hν = ΔE, independent of T. He then goes on to find a relationship for this ionization ratio which is not restricted to some specific energy transfer, and shows that the double to single ionization cross section ratio approaches an asymtotic limit for large enough T
Non-invasive prenatal detection of trisomy 21 using tandem single nucleotide polymorphisms.
Directory of Open Access Journals (Sweden)
Sujana Ghanta
Full Text Available BACKGROUND: Screening tests for Trisomy 21 (T21, also known as Down syndrome, are routinely performed for the majority of pregnant women. However, current tests rely on either evaluating non-specific markers, which lead to false negative and false positive results, or on invasive tests, which while highly accurate, are expensive and carry a risk of fetal loss. We outline a novel, rapid, highly sensitive, and targeted approach to non-invasively detect fetal T21 using maternal plasma DNA. METHODS AND FINDINGS: Highly heterozygous tandem Single Nucleotide Polymorphism (SNP sequences on chromosome 21 were analyzed using High-Fidelity PCR and Cycling Temperature Capillary Electrophoresis (CTCE. This approach was used to blindly analyze plasma DNA obtained from peripheral blood from 40 high risk pregnant women, in adherence to a Medical College of Wisconsin Institutional Review Board approved protocol. Tandem SNP sequences were informative when the mother was heterozygous and a third paternal haplotype was present, permitting a quantitative comparison between the maternally inherited haplotype and the paternally inherited haplotype to infer fetal chromosomal dosage by calculating a Haplotype Ratio (HR. 27 subjects were assessable; 13 subjects were not informative due to either low DNA yield or were not informative at the tandem SNP sequences examined. All results were confirmed by a procedure (amniocentesis/CVS or at postnatal follow-up. Twenty subjects were identified as carrying a disomy 21 fetus (with two copies of chromosome 21 and seven subjects were identified as carrying a T21 fetus. The sensitivity and the specificity of the assay was 100% when HR values lying between 3/5 and 5/3 were used as a threshold for normal subjects. CONCLUSIONS: In summary, a targeted approach, based on calculation of Haplotype Ratios from tandem SNP sequences combined with a sensitive and quantitative DNA measurement technology can be used to accurately detect fetal
SNP-SNP interaction analysis of NF-κB signaling pathway on breast cancer survival
DEFF Research Database (Denmark)
Jamshidi, Maral; Fagerholm, Rainer; Khan, Sofia
2015-01-01
of SNP pairs without and with an interaction term. We found two interacting pairs associating with prognosis: patients simultaneously homozygous for the rare alleles of rs5996080 and rs7973914 had worse survival (HRinteraction 6.98, 95% CI=3.3-14.4, P=1.42E-07), and patients carrying at least one rare...
Fang, Wanping; Meinhardt, Lyndel W; Mischke, Sue; Bellato, Cláudia M; Motilal, Lambert; Zhang, Dapeng
2014-01-15
Cacao (Theobroma cacao L.), the source of cocoa, is an economically important tropical crop. One problem with the premium cacao market is contamination with off-types adulterating raw premium material. Accurate determination of the genetic identity of single cacao beans is essential for ensuring cocoa authentication. Using nanofluidic single nucleotide polymorphism (SNP) genotyping with 48 SNP markers, we generated SNP fingerprints for small quantities of DNA extracted from the seed coat of single cacao beans. On the basis of the SNP profiles, we identified an assumed adulterant variety, which was unambiguously distinguished from the authentic beans by multilocus matching. Assignment tests based on both Bayesian clustering analysis and allele frequency clearly separated all 30 authentic samples from the non-authentic samples. Distance-based principle coordinate analysis further supported these results. The nanofluidic SNP protocol, together with forensic statistical tools, is sufficiently robust to establish authentication and to verify gourmet cacao varieties. This method shows significant potential for practical application.
Zhang, Han; Wheeler, William; Song, Lei; Yu, Kai
2017-07-07
As meta-analysis results published by consortia of genome-wide association studies (GWASs) become increasingly available, many association summary statistics-based multi-locus tests have been developed to jointly evaluate multiple single-nucleotide polymorphisms (SNPs) to reveal novel genetic architectures of various complex traits. The validity of these approaches relies on the accurate estimate of z-score correlations at considered SNPs, which in turn requires knowledge on the set of SNPs assessed by each study participating in the meta-analysis. However, this exact SNP coverage information is usually unavailable from the meta-analysis results published by GWAS consortia. In the absence of the coverage information, researchers typically estimate the z-score correlations by making oversimplified coverage assumptions. We show through real studies that such a practice can generate highly inflated type I errors, and we demonstrate the proper way to incorporate correct coverage information into multi-locus analyses. We advocate that consortia should make SNP coverage information available when posting their meta-analysis results, and that investigators who develop analytic tools for joint analyses based on summary data should pay attention to the variation in SNP coverage and adjust for it appropriately. Published by Oxford University Press 2017. This work is written by US Government employees and is in the public domain in the US.
Directory of Open Access Journals (Sweden)
Shiro Maeda
2010-02-01
Full Text Available It has been suggested that genetic susceptibility plays an important role in the pathogenesis of diabetic nephropathy. A large-scale genotyping analysis of gene-based single nucleotide polymorphisms (SNPs in Japanese patients with type 2 diabetes identified the gene encoding acetyl-coenzyme A carboxylase beta (ACACB as a candidate for a susceptibility to diabetic nephropathy; the landmark SNP was found in the intron 18 of ACACB (rs2268388: intron 18 +4139 C > T, p = 1.4x10(-6, odds ratio = 1.61, 95% confidence interval [CI]: 1.33-1.96. The association of this SNP with diabetic nephropathy was examined in 9 independent studies (4 from Japan including the original study, one Singaporean, one Korean, and two European with type 2 diabetes. One case-control study involving European patients with type 1 diabetes was included. The frequency of the T allele for SNP rs2268388 was consistently higher among patients with type 2 diabetes and proteinuria. A meta-analysis revealed that rs2268388 was significantly associated with proteinuria in Japanese patients with type 2 diabetes (p = 5.35 x 10(-8, odds ratio = 1.61, 95% Cl: 1.35-1.91. Rs2268388 was also associated with type 2 diabetes-associated end-stage renal disease (ESRD in European Americans (p = 6 x 10(-4, odds ratio = 1.61, 95% Cl: 1.22-2.13. Significant association was not detected between this SNP and nephropathy in those with type 1 diabetes. A subsequent in vitro functional analysis revealed that a 29-bp DNA fragment, including rs2268388, had significant enhancer activity in cultured human renal proximal tubular epithelial cells. Fragments corresponding to the disease susceptibility allele (T had higher enhancer activity than those of the major allele. These results suggest that ACACB is a strong candidate for conferring susceptibility for proteinuria in patients with type 2 diabetes.
Yang, Yao-Joe; Kuo, Wen-Cheng; Fan, Kuang-Chao
2006-01-01
In this work, we present a single-run single-mask (SRM) process for fabricating suspended high-aspect-ratio structures on standard silicon wafers using an inductively coupled plasma-reactive ion etching (ICP-RIE) etcher. This process eliminates extra fabrication steps which are required for structure release after trench etching. Released microstructures with 120 μm thickness are obtained by this process. The corresponding maximum aspect ratio of the trench is 28. The SRM process is an extended version of the standard process proposed by BOSCH GmbH (BOSCH process). The first step of the SRM process is a standard BOSCH process for trench etching, then a polymer layer is deposited on trench sidewalls as a protective layer for the subsequent structure-releasing step. The structure is released by dry isotropic etching after the polymer layer on the trench floor is removed. All the steps can be integrated into a single-run ICP process. Also, only one mask is required. Therefore, the process complexity and fabrication cost can be effectively reduced. Discussions on each SRM step and considerations for avoiding undesired etching of the silicon structures during the release process are also presented.
High-density SNP assay development for genetic analysis in maritime pine (Pinus pinaster).
Plomion, C; Bartholomé, J; Lesur, I; Boury, C; Rodríguez-Quilón, I; Lagraulet, H; Ehrenmann, F; Bouffier, L; Gion, J M; Grivet, D; de Miguel, M; de María, N; Cervera, M T; Bagnoli, F; Isik, F; Vendramin, G G; González-Martínez, S C
2016-03-01
Maritime pine provides essential ecosystem services in the south-western Mediterranean basin, where it covers around 4 million ha. Its scattered distribution over a range of environmental conditions makes it an ideal forest tree species for studies of local adaptation and evolutionary responses to climatic change. Highly multiplexed single nucleotide polymorphism (SNP) genotyping arrays are increasingly used to study genetic variation in living organisms and for practical applications in plant and animal breeding and genetic resource conservation. We developed a 9k Illumina Infinium SNP array and genotyped maritime pine trees from (i) a three-generation inbred (F2) pedigree, (ii) the French breeding population and (iii) natural populations from Portugal and the French Atlantic coast. A large proportion of the exploitable SNPs (2052/8410, i.e. 24.4%) segregated in the mapping population and could be mapped, providing the densest ever gene-based linkage map for this species. Based on 5016 SNPs, natural and breeding populations from the French gene pool exhibited similar level of genetic diversity. Population genetics and structure analyses based on 3981 SNP markers common to the Portuguese and French gene pools revealed high levels of differentiation, leading to the identification of a set of highly differentiated SNPs that could be used for seed provenance certification. Finally, we discuss how the validated SNPs could facilitate the identification of ecologically and economically relevant genes in this species, improving our understanding of the demography and selective forces shaping its natural genetic diversity, and providing support for new breeding strategies. © 2015 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Zewdu Edea
2012-09-01
Full Text Available Although a large number of single nucleotide polymorphisms (SNPs have been identified from the bovine genome-sequencing project, few of these have been validated at large in Bos indicus breeds. We have genotyped 192 animals, representing 5 cattle populations of Ethiopia, with the Illumina Bovine 8K SNP BeadChip. These include 1 Sanga (Danakil, 3 zebu (Borana, Arsi and Ambo, and 1 zebu × Sanga intermediate (Horro breeds. The Hanwoo (Bos taurus was included for comparison purposes. Analysis of 7,045 SNP markers revealed that the mean minor allele frequency (MAF was 0.23, 0.22, 0.21, 0.21, 0.23, and 0.29 for Ambo, Arsi, Borana, Danakil, Horro, and Hanwoo, respectively. Significant differences of MAF were observed between the indigenous Ethiopian cattle populations and Hanwoo breed (p < 0.001. Across the Ethiopian cattle populations, a common variant MAF (≥0.10 and ≤0.5 accounted for an overall estimated 73.79% of the 7,045 SNPs. The Hanwoo displayed a higher proportion of common variant SNPs (90%. Investigation within Ethiopian cattle populations showed that on average, 16.64% of the markers were monomorphic, but in the Hanwoo breed, only 6% of the markers were monomorphic. Across the sampled Ethiopian cattle populations, the mean observed and expected heterozygosities were 0.314 and 0.313, respectively. The level of SNP variation identified in this particular study highlights that these markers can be potentially used for genetic studies in African cattle breeds.
Directory of Open Access Journals (Sweden)
Özgür GÜNAL
2017-12-01
Full Text Available Objective: We aimed to review the influence of host genetic factors on the clinical course, treatment response as well as fibrosis progression in patients with viral hepatitis C genotype 1. Materials and Methods: Ninety-five patients with chronic hepatitis C virus (HCV infection and 97 controls were enrolled. The patients received pegylated interferon (Peg-IFN+ribavirin therapy for 48 weeks and were followed up for the next 48 weeks. Aspartat aminotransferase/platelet ratio (APRI was used to detect liver fibrosis DNA specimens were extracted from the peripheral blood mononuclear cells and the tumor necrosis factor-alpha (TNF-α 308 rs3091256 was genotyped by the polymerase chain reaction-restriction fragment length polymorphism method. Results: All patients included in the study were infected with HCV genotype 1. of the 95 HCV-positive patients, spontaneous viral clearence was observed in 25.5%, rapid viral response in 44.2%, early viral response in 91.8%, and sustained viral response was found in 73.3% of patients. The allele and genotype were not significant between patients and controls. There was no significant difference in virologic response as well. However, TNF-α-308 single nucleotide polymorphisms (SNP rs3091256 GG genotype was strongly associated with fibrosis and alanine aminotransferase (ALT levels (p=0.006 and p=0.017, respectively. Conclusion: TNF-α-308 polymorphisms may reveal different results among countries. Patients having SNP rs3091256 GG are prone to have higher ALT levels and fibrosis score but have better treatment outcome.
Effects of Single Nucleotide Polymorphism Marker Density on Haplotype Block Partition
Directory of Open Access Journals (Sweden)
Sun Ah Kim
2016-12-01
Full Text Available Many researchers have found that one of the most important characteristics of the structure of linkage disequilibrium is that the human genome can be divided into non-overlapping block partitions in which only a small number of haplotypes are observed. The location and distribution of haplotype blocks can be seen as a population property influenced by population genetic events such as selection, mutation, recombination and population structure. In this study, we investigate the effects of the density of markers relative to the full set of all polymorphisms in the region on the results of haplotype partitioning for five popular haplotype block partition methods: three methods in Haploview (confidence interval, four gamete test, and solid spine, MIG++ implemented in PLINK 1.9 and S-MIG++. We used several experimental datasets obtained by sampling subsets of single nucleotide polymorphism (SNP markers of chromosome 22 region in the 1000 Genomes Project data and also the HapMap phase 3 data to compare the results of haplotype block partitions by five methods. With decreasing sampling ratio down to 20% of the original SNP markers, the total number of haplotype blocks decreases and the length of haplotype blocks increases for all algorithms. When we examined the marker-independence of the haplotype block locations constructed from the datasets of different density, the results using below 50% of the entire SNP markers were very different from the results using the entire SNP markers. We conclude that the haplotype block construction results should be used and interpreted carefully depending on the selection of markers and the purpose of the study.
Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.
Black, W C; Gorrochotegui-Escalante, N; Duteau, N M
2006-03-01
Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.
Directory of Open Access Journals (Sweden)
Du Ye
2012-02-01
Full Text Available Abstract Background Restriction Enzyme-based Reduced Representation Library (RRL method represents a relatively feasible and flexible strategy used for Single Nucleotide Polymorphism (SNP identification in different species. It has remarkable advantage of reducing the complexity of the genome by orders of magnitude. However, comprehensive evaluation for actual efficacy of SNP identification by this method is still unavailable. Results In order to evaluate the efficacy of Restriction Enzyme-based RRL method, we selected Tsp 45I enzyme which covers 266 Mb flanking region of the enzyme recognition site according to in silico simulation on human reference genome, then we sequenced YH RRL after Tsp 45I treatment and obtained reads of which 80.8% were mapped to target region with an 20-fold average coverage, about 96.8% of target region was covered by at least one read and 257 K SNPs were identified in the region using SOAPsnp software. Compared with whole genome resequencing data, we observed false discovery rate (FDR of 13.95% and false negative rate (FNR of 25.90%. The concordance rate of homozygote loci was over 99.8%, but that of heterozygote were only 92.56%. Repeat sequences and bases quality were proved to have a great effect on the accuracy of SNP calling, SNPs in recognition sites contributed evidently to the high FNR and the low concordance rate of heterozygote. Our results indicated that repeat masking and high stringent filter criteria could significantly decrease both FDR and FNR. Conclusions This study demonstrates that Restriction Enzyme-based RRL method was effective for SNP identification. The results highlight the important role of bias and the method-derived defects represented in this method and emphasize the special attentions noteworthy.
A high-density SNP map for accurate mapping of seed fibre QTL in Brassica napus L.
Directory of Open Access Journals (Sweden)
Liezhao Liu
Full Text Available A high density genetic linkage map for the complex allotetraploid crop species Brassica napus (oilseed rape was constructed in a late-generation recombinant inbred line (RIL population, using genome-wide single nucleotide polymorphism (SNP markers assayed by the Brassica 60 K Infinium BeadChip Array. The linkage map contains 9164 SNP markers covering 1832.9 cM. 1232 bins account for 7648 of the markers. A subset of 2795 SNP markers, with an average distance of 0.66 cM between adjacent markers, was applied for QTL mapping of seed colour and the cell wall fiber components acid detergent lignin (ADL, cellulose and hemicellulose. After phenotypic analyses across four different environments a total of 11 QTL were detected for seed colour and fiber traits. The high-density map considerably improved QTL resolution compared to the previous low-density maps. A previously identified major QTL with very high effects on seed colour and ADL was pinpointed to a narrow genome interval on chromosome A09, while a minor QTL explaining 8.1% to 14.1% of variation for ADL was detected on chromosome C05. Five and three QTL accounting for 4.7% to 21.9% and 7.3% to 16.9% of the phenotypic variation for cellulose and hemicellulose, respectively, were also detected. To our knowledge this is the first description of QTL for seed cellulose and hemicellulose in B. napus, representing interesting new targets for improving oil content. The high density SNP genetic map enables navigation from interesting B. napus QTL to Brassica genome sequences, giving useful new information for understanding the genetics of key seed quality traits in rapeseed.
Directory of Open Access Journals (Sweden)
Dilip Kumar
2017-02-01
Full Text Available Abstract Background Expression quantitative trait loci (eQTL databases represent a valuable resource to link disease-associated SNPs to specific candidate genes whose gene expression is significantly modulated by the SNP under investigation. We previously identified signal inhibitory receptor on leukocytes-1 (SIRL-1 as a powerful regulator of human innate immune cell function. While it is constitutively high expressed on neutrophils, on monocytes the SIRL-1 surface expression varies strongly between individuals. The underlying mechanism of regulation, its genetic control as well as potential clinical implications had not been explored yet. Methods Whole blood eQTL data of a Chinese cohort was used to identify SNPs regulating the expression of VSTM1, the gene encoding SIRL-1. The genotype effect was validated by flow cytometry (cell surface expression, correlated with electrophoretic mobility shift assay (EMSA, chromatin immunoprecipitation (ChIP and bisulfite sequencing (C-methylation and its functional impact studied the inhibition of reactive oxygen species (ROS. Results We found a significant association of a single CpG-SNP, rs612529T/C, located in the promoter of VSTM1. Through flow cytometry analysis we confirmed that primarily in the monocytes the protein level of SIRL-1 is strongly associated with genotype of this SNP. In monocytes, the T allele of this SNP facilitates binding of the transcription factors YY1 and PU.1, of which the latter has been recently shown to act as docking site for modifiers of DNA methylation. In line with this notion rs612529T associates with a complete demethylation of the VSTM1 promoter correlating with the allele-specific upregulation of SIRL-1 expression. In monocytes, this upregulation strongly impacts the IgA-induced production of ROS by these cells. Through targeted association analysis we found a significant Meta P value of 1.14 × 10–6 for rs612529 for association to atopic dermatitis (AD
SNP detection for massively parallel whole-genome resequencing
DEFF Research Database (Denmark)
Li, Ruiqiang; Li, Yingrui; Fang, Xiaodong
2009-01-01
-genome or target region resequencing. Here, we have developed a consensus-calling and SNP-detection method for sequencing-by-synthesis Illumina Genome Analyzer technology. We designed this method by carefully considering the data quality, alignment, and experimental errors common to this technology. All...... of this information was integrated into a single quality score for each base under Bayesian theory to measure the accuracy of consensus calling. We tested this methodology using a large-scale human resequencing data set of 36x coverage and assembled a high-quality nonrepetitive consensus sequence for 92.......25% of the diploid autosomes and 88.07% of the haploid X chromosome. Comparison of the consensus sequence with Illumina human 1M BeadChip genotyped alleles from the same DNA sample showed that 98.6% of the 37,933 genotyped alleles on the X chromosome and 98% of 999,981 genotyped alleles on autosomes were covered...
A general SNP-based molecular barcode for Plasmodium falciparum identification and tracking
Directory of Open Access Journals (Sweden)
Rosen David
2008-10-01
Full Text Available Abstract Background Single nucleotide polymorphism (SNP genotyping provides the means to develop a practical, rapid, inexpensive assay that will uniquely identify any Plasmodium falciparum parasite using a small amount of DNA. Such an assay could be used to distinguish recrudescence from re-infection in drug trials, to monitor the frequency and distribution of specific parasites in a patient population undergoing drug treatment or vaccine challenge, or for tracking samples and determining purity of isolates in the laboratory during culture adaptation and sub-cloning, as well as routine passage. Methods A panel of twenty-four SNP markers has been identified that exhibit a high minor allele frequency (average MAF > 35%, for which robust TaqMan genotyping assays were constructed. All SNPs were identified through whole genome sequencing and MAF was estimated through Affymetrix array-based genotyping of a worldwide collection of parasites. These assays create a "molecular barcode" to uniquely identify a parasite genome. Results Using 24 such markers no two parasites known to be of independent origin have yet been found to have the same allele signature. The TaqMan genotyping assays can be performed on a variety of samples including cultured parasites, frozen whole blood, or whole blood spotted onto filter paper with a success rate > 99%. Less than 5 ng of parasite DNA is needed to complete a panel of 24 markers. The ability of this SNP panel to detect and identify parasites was compared to the standard molecular methods, MSP-1 and MSP-2 typing. Conclusion This work provides a facile field-deployable genotyping tool that can be used without special skills with standard lab equipment, and at reasonable cost that will unambiguously identify and track P. falciparum parasites both from patient samples and in the laboratory.
Canovas, Fernando; Mota, Catarina; Ferreira-Costa, Joana; Serrao, Ester; Coyer, Jim; Olsen, Jeanine; Pearson, Gareth
2011-01-01
We characterized 35 single nucleotide polymorphism (SNP) markers for the brown alga Fucus vesiculosus. Based on existing Fucus Expressed Sequence Tag libraries for heat and desiccation-stressed tissue, SNPs were developed and confirmed by re-sequencing cDNA from a diverse panel of individuals. SNP
Henshall, John M; Dierens, Leanne; Sellars, Melony J
2014-09-02
While much attention has focused on the development of high-density single nucleotide polymorphism (SNP) assays, the costs of developing and running low-density assays have fallen dramatically. This makes it feasible to develop and apply SNP assays for agricultural species beyond the major livestock species. Although low-cost low-density assays may not have the accuracy of the high-density assays widely used in human and livestock species, we show that when combined with statistical analysis approaches that use quantitative instead of discrete genotypes, their utility may be improved. The data used in this study are from a 63-SNP marker Sequenom® iPLEX Platinum panel for the Black Tiger shrimp, for which high-density SNP assays are not currently available. For quantitative genotypes that could be estimated, in 5% of cases the most likely genotype for an individual at a SNP had a probability of less than 0.99. Matrix formulations of maximum likelihood equations for parentage assignment were developed for the quantitative genotypes and also for discrete genotypes perturbed by an assumed error term. Assignment rates that were based on maximum likelihood with quantitative genotypes were similar to those based on maximum likelihood with perturbed genotypes but, for more than 50% of cases, the two methods resulted in individuals being assigned to different families. Treating genotypes as quantitative values allows the same analysis framework to be used for pooled samples of DNA from multiple individuals. Resulting correlations between allele frequency estimates from pooled DNA and individual samples were consistently greater than 0.90, and as high as 0.97 for some pools. Estimates of family contributions to the pools based on quantitative genotypes in pooled DNA had a correlation of 0.85 with estimates of contributions from DNA-derived pedigree. Even with low numbers of SNPs of variable quality, parentage testing and family assignment from pooled samples are
DEFF Research Database (Denmark)
Ramírez-Soriano, Anna; Nielsen, Rasmus
2009-01-01
Most single-nucleotide polymorphism (SNP) data suffer from an ascertainment bias caused by the process of SNP discovery followed by SNP genotyping. The final genotyped data are biased toward an excess of common alleles compared to directly sequenced data, making standard genetic methods of analysis...... the variances and covariances of these estimators and provide a corrected version of Tajima's D statistic. We reanalyze a human genomewide SNP data set and find substantial differences in the results with or without ascertainment bias correction....
Direct uranium isotope ratio analysis of single micrometer-sized glass particles.
Kappel, Stefanie; Boulyga, Sergei F; Prohaska, Thomas
2012-11-01
We present the application of nanosecond laser ablation (LA) coupled to a 'Nu Plasma HR' multi collector inductively coupled plasma mass spectrometer (MC-ICP-MS) for the direct analysis of U isotope ratios in single, 10-20 μm-sized, U-doped glass particles. Method development included studies with respect to (1) external correction of the measured U isotope ratios in glass particles, (2) the applied laser ablation carrier gas (i.e. Ar versus He) and (3) the accurate determination of lower abundant (236)U/(238)U isotope ratios (i.e. 10(-5)). In addition, a data processing procedure was developed for evaluation of transient signals, which is of potential use for routine application of the developed method. We demonstrate that the developed method is reliable and well suited for determining U isotope ratios of individual particles. Analyses of twenty-eight S1 glass particles, measured under optimized conditions, yielded average biases of less than 0.6% from the certified values for (234)U/(238)U and (235)U/(238)U ratios. Experimental results obtained for (236)U/(238)U isotope ratios deviated by less than -2.5% from the certified values. Expanded relative total combined standard uncertainties U(c) (k = 2) of 2.6%, 1.4% and 5.8% were calculated for (234)U/(238)U, (235)U/(238)U and (236)U/(238)U, respectively. Copyright © 2012 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Shannon M Clarke
Full Text Available Accurate pedigree information is critical to animal breeding systems to ensure the highest rate of genetic gain and management of inbreeding. The abundance of available genomic data, together with development of high throughput genotyping platforms, means that single nucleotide polymorphisms (SNPs are now the DNA marker of choice for genomic selection studies. Furthermore the superior qualities of SNPs compared to microsatellite markers allows for standardization between laboratories; a property that is crucial for developing an international set of markers for traceability studies. The objective of this study was to develop a high throughput SNP assay for use in the New Zealand sheep industry that gives accurate pedigree assignment and will allow a reduction in breeder input over lambing. This required two phases of development--firstly, a method of extracting quality DNA from ear-punch tissue performed in a high throughput cost efficient manner and secondly a SNP assay that has the ability to assign paternity to progeny resulting from mob mating. A likelihood based approach to infer paternity was used where sires with the highest LOD score (log of the ratio of the likelihood given parentage to likelihood given non-parentage are assigned. An 84 "parentage SNP panel" was developed that assigned, on average, 99% of progeny to a sire in a problem where there were 3,000 progeny from 120 mob mated sires that included numerous half sib sires. In only 6% of those cases was there another sire with at least a 0.02 probability of paternity. Furthermore dam information (either recorded, or by genotyping possible dams was absent, highlighting the SNP test's suitability for paternity testing. Utilization of this parentage SNP assay will allow implementation of progeny testing into large commercial farms where the improved accuracy of sire assignment and genetic evaluations will increase genetic gain in the sheep industry.
MDM2 promoter SNP344T>A (rs1196333 status does not affect cancer risk.
Directory of Open Access Journals (Sweden)
Stian Knappskog
Full Text Available The MDM2 proto-oncogene plays a key role in central cellular processes like growth control and apoptosis, and the gene locus is frequently amplified in sarcomas. Two polymorphisms located in the MDM2 promoter P2 have been shown to affect cancer risk. One of these polymorphisms (SNP309T>G; rs2279744 facilitates Sp1 transcription factor binding to the promoter and is associated with increased cancer risk. In contrast, SNP285G>C (rs117039649, located 24 bp upstream of rs2279744, and in complete linkage disequilibrium with the SNP309G allele, reduces Sp1 recruitment and lowers cancer risk. Thus, fine tuning of MDM2 expression has proven to be of significant importance with respect to tumorigenesis. We assessed the potential functional effects of a third MDM2 promoter P2 polymorphism (SNP344T>A; rs1196333 located on the SNP309T allele. While in silico analyses indicated SNP344A to modulate TFAP2A, SPIB and AP1 transcription factor binding, we found no effect of SNP344 status on MDM2 expression levels. Assessing the frequency of SNP344A in healthy Caucasians (n = 2,954 and patients suffering from ovarian (n = 1,927, breast (n = 1,271, endometrial (n = 895 or prostatic cancer (n = 641, we detected no significant difference in the distribution of this polymorphism between any of these cancer forms and healthy controls (6.1% in healthy controls, and 4.9%, 5.0%, 5.4% and 7.2% in the cancer groups, respectively. In conclusion, our findings provide no evidence indicating that SNP344A may affect MDM2 transcription or cancer risk.
Clee, S. M.; Loubser, O.; Collins, J.; Kastelein, J. J.; Hayden, M. R.
2001-01-01
Linkage of the lipoprotein lipase (LPL) gene to blood pressure levels has been reported. The LPL S447X single nucleotide polymorphism (cSNP) has been associated with decreased triglycerides (TG), increased high density lipoprotein cholesterol, and a decreased risk of coronary artery disease (CAD),
International Nuclear Information System (INIS)
Ban, Hiroshi; Tanaka, Akinobu; Kawai, Yoshio; Deguchi, Kimiyoshi
1989-01-01
A new silicone-based negative photoresist (SNP) developable with alkaline aqueous solutions is prepared. SNP composed of acetylated phenylsilsesquioxane oligomer and azidopyrene is applied to deep UV, electron beam (EB), and X-ray lithographies. SNP slightly swells in alkaline developers, thus exhibiting exceptionally high resolution characteristics for a negative resist. The resistance of SNP to oxygen reactive ion etching is approximately 30 times greater than that of conventional novolac resists. (author)
Directory of Open Access Journals (Sweden)
Danai Jattawa
2016-04-01
Full Text Available The objective of this study was to investigate the accuracy of imputation from low density (LDC to moderate density SNP chips (MDC in a Thai Holstein-Other multibreed dairy cattle population. Dairy cattle with complete pedigree information (n = 1,244 from 145 dairy farms were genotyped with GeneSeek GGP20K (n = 570, GGP26K (n = 540 and GGP80K (n = 134 chips. After checking for single nucleotide polymorphism (SNP quality, 17,779 SNP markers in common between the GGP20K, GGP26K, and GGP80K were used to represent MDC. Animals were divided into two groups, a reference group (n = 912 and a test group (n = 332. The SNP markers chosen for the test group were those located in positions corresponding to GeneSeek GGP9K (n = 7,652. The LDC to MDC genotype imputation was carried out using three different software packages, namely Beagle 3.3 (population-based algorithm, FImpute 2.2 (combined family- and population-based algorithms and Findhap 4 (combined family- and population-based algorithms. Imputation accuracies within and across chromosomes were calculated as ratios of correctly imputed SNP markers to overall imputed SNP markers. Imputation accuracy for the three software packages ranged from 76.79% to 93.94%. FImpute had higher imputation accuracy (93.94% than Findhap (84.64% and Beagle (76.79%. Imputation accuracies were similar and consistent across chromosomes for FImpute, but not for Findhap and Beagle. Most chromosomes that showed either high (73% or low (80% imputation accuracies were the same chromosomes that had above and below average linkage disequilibrium (LD; defined here as the correlation between pairs of adjacent SNP within chromosomes less than or equal to 1 Mb apart. Results indicated that FImpute was more suitable than Findhap and Beagle for genotype imputation in this Thai multibreed population. Perhaps additional increments in imputation accuracy could be achieved by increasing the completeness of pedigree information.
Drop-out probabilities of IrisPlex SNP alleles
DEFF Research Database (Denmark)
Andersen, Jeppe Dyrberg; Tvedebrink, Torben; Mogensen, Helle Smidt
2013-01-01
In certain crime cases, information about a perpetrator's phenotype, including eye colour, may be a valuable tool if no DNA profile of any suspect or individual in the DNA database matches the DNA profile found at the crime scene. Often, the available DNA material is sparse and allelic drop-out...... of true alleles is possible. As part of the validation of the IrisPlex assay in our ISO17025 accredited, forensic genetic laboratory, we estimated the probability of drop-out of specific SNP alleles using 29 and 30 PCR cycles and 25, 50 and 100 Single Base Extension (SBE) cycles. We observed no drop-out...... when the amount of DNA was greater than 125 pg for 29 cycles of PCR and greater than 62 pg for 30 cycles of PCR. With the use of a logistic regression model, we estimated the allele specific probability of drop-out in heterozygote systems based on the signal strength of the observed allele...
Direct uranium isotope ratio analysis of single micrometer-sized glass particles
International Nuclear Information System (INIS)
Kappel, Stefanie; Boulyga, Sergei F.; Prohaska, Thomas
2012-01-01
We present the application of nanosecond laser ablation (LA) coupled to a ‘Nu Plasma HR’ multi collector inductively coupled plasma mass spectrometer (MC-ICP-MS) for the direct analysis of U isotope ratios in single, 10–20 μm-sized, U-doped glass particles. Method development included studies with respect to (1) external correction of the measured U isotope ratios in glass particles, (2) the applied laser ablation carrier gas (i.e. Ar versus He) and (3) the accurate determination of lower abundant 236 U/ 238 U isotope ratios (i.e. 10 −5 ). In addition, a data processing procedure was developed for evaluation of transient signals, which is of potential use for routine application of the developed method. We demonstrate that the developed method is reliable and well suited for determining U isotope ratios of individual particles. Analyses of twenty-eight S1 glass particles, measured under optimized conditions, yielded average biases of less than 0.6% from the certified values for 234 U/ 238 U and 235 U/ 238 U ratios. Experimental results obtained for 236 U/ 238 U isotope ratios deviated by less than −2.5% from the certified values. Expanded relative total combined standard uncertainties U c (k = 2) of 2.6%, 1.4% and 5.8% were calculated for 234 U/ 238 U, 235 U/ 238 U and 236 U/ 238 U, respectively. - Highlights: ► LA-MC-ICP-MS was fully validated for the direct analysis of individual particles. ► Traceability was established by using an IRMM glass particle reference material. ► Measured U isotope ratios were in agreement with the certified range. ► A comprehensive total combined uncertainty evaluation was performed. ► The analysis of 236 U/ 238 U isotope ratios was improved by using a deceleration filter.
International Nuclear Information System (INIS)
Choudhury, Sayantan
2015-01-01
In this paper my prime objective is to explain the generation of large tensor-to-scalar ratio from the single field sub-Planckian inflationary paradigm within Randall–Sundrum (RS) single braneworld scenario in a model independent fashion. By explicit computation I have shown that the effective field theory prescription of brane inflation within RS single brane setup is consistent with sub-Planckian excursion of the inflaton field, which will further generate large value of tensor-to-scalar ratio, provided the energy density for inflaton degrees of freedom is high enough compared to the brane tension in high energy regime. Finally, I have mentioned the stringent theoretical constraint on positive brane tension, cut-off of the quantum gravity scale and bulk cosmological constant to get sub-Planckian field excursion along with large tensor-to-scalar ratio as recently observed by BICEP2 or at least generates the tensor-to-scalar ratio consistent with the upper bound of Planck (2013 and 2015) data and Planck+BICEP2+Keck Array joint constraint
Yi, Liuxi; Gao, Fengyun; Siqin, Bateer; Zhou, Yu; Li, Qiang; Zhao, Xiaoqing; Jia, Xiaoyun; Zhang, Hui
2017-01-01
Flax is an important crop for oil and fiber, however, no high-density genetic maps have been reported for this species. Specific length amplified fragment sequencing (SLAF-seq) is a high-resolution strategy for large scale de novo discovery and genotyping of single nucleotide polymorphisms. In this study, SLAF-seq was employed to develop SNP markers in an F2 population to construct a high-density genetic map for flax. In total, 196.29 million paired-end reads were obtained. The average sequencing depth was 25.08 in male parent, 32.17 in the female parent, and 9.64 in each F2 progeny. In total, 389,288 polymorphic SLAFs were detected, from which 260,380 polymorphic SNPs were developed. After filtering, 4,638 SNPs were found suitable for genetic map construction. The final genetic map included 4,145 SNP markers on 15 linkage groups and was 2,632.94 cM in length, with an average distance of 0.64 cM between adjacent markers. To our knowledge, this map is the densest SNP-based genetic map for flax. The SNP markers and genetic map reported in here will serve as a foundation for the fine mapping of quantitative trait loci (QTLs), map-based gene cloning and marker assisted selection (MAS) for flax.
Grouping preprocess for haplotype inference from SNP and CNV data
International Nuclear Information System (INIS)
Shindo, Hiroyuki; Chigira, Hiroshi; Nagaoka, Tomoyo; Inoue, Masato; Kamatani, Naoyuki
2009-01-01
The method of statistical haplotype inference is an indispensable technique in the field of medical science. The authors previously reported Hardy-Weinberg equilibrium-based haplotype inference that could manage single nucleotide polymorphism (SNP) data. We recently extended the method to cover copy number variation (CNV) data. Haplotype inference from mixed data is important because SNPs and CNVs are occasionally in linkage disequilibrium. The idea underlying the proposed method is simple, but the algorithm for it needs to be quite elaborate to reduce the calculation cost. Consequently, we have focused on the details on the algorithm in this study. Although the main advantage of the method is accuracy, in that it does not use any approximation, its main disadvantage is still the calculation cost, which is sometimes intractable for large data sets with missing values.
Grouping preprocess for haplotype inference from SNP and CNV data
Energy Technology Data Exchange (ETDEWEB)
Shindo, Hiroyuki; Chigira, Hiroshi; Nagaoka, Tomoyo; Inoue, Masato [Department of Electrical Engineering and Bioscience, School of Advanced Science and Engineering, Waseda University, 3-4-1, Okubo, Shinjuku-ku, Tokyo 169-8555 (Japan); Kamatani, Naoyuki, E-mail: masato.inoue@eb.waseda.ac.j [Institute of Rheumatology, Tokyo Women' s Medical University, 10-22, Kawada-cho, Shinjuku-ku, Tokyo 162-0054 (Japan)
2009-12-01
The method of statistical haplotype inference is an indispensable technique in the field of medical science. The authors previously reported Hardy-Weinberg equilibrium-based haplotype inference that could manage single nucleotide polymorphism (SNP) data. We recently extended the method to cover copy number variation (CNV) data. Haplotype inference from mixed data is important because SNPs and CNVs are occasionally in linkage disequilibrium. The idea underlying the proposed method is simple, but the algorithm for it needs to be quite elaborate to reduce the calculation cost. Consequently, we have focused on the details on the algorithm in this study. Although the main advantage of the method is accuracy, in that it does not use any approximation, its main disadvantage is still the calculation cost, which is sometimes intractable for large data sets with missing values.
Cingolani, Pablo; Platts, Adrian; Wang, Le Lily; Coon, Melissa; Nguyen, Tung; Wang, Luan; Land, Susan J; Lu, Xiangyi; Ruden, Douglas M
2012-01-01
We describe a new computer program, SnpEff, for rapidly categorizing the effects of variants in genome sequences. Once a genome is sequenced, SnpEff annotates variants based on their genomic locations and predicts coding effects. Annotated genomic locations include intronic, untranslated region, upstream, downstream, splice site, or intergenic regions. Coding effects such as synonymous or non-synonymous amino acid replacement, start codon gains or losses, stop codon gains or losses, or frame shifts can be predicted. Here the use of SnpEff is illustrated by annotating ~356,660 candidate SNPs in ~117 Mb unique sequences, representing a substitution rate of ~1/305 nucleotides, between the Drosophila melanogaster w(1118); iso-2; iso-3 strain and the reference y(1); cn(1) bw(1) sp(1) strain. We show that ~15,842 SNPs are synonymous and ~4,467 SNPs are non-synonymous (N/S ~0.28). The remaining SNPs are in other categories, such as stop codon gains (38 SNPs), stop codon losses (8 SNPs), and start codon gains (297 SNPs) in the 5'UTR. We found, as expected, that the SNP frequency is proportional to the recombination frequency (i.e., highest in the middle of chromosome arms). We also found that start-gain or stop-lost SNPs in Drosophila melanogaster often result in additions of N-terminal or C-terminal amino acids that are conserved in other Drosophila species. It appears that the 5' and 3' UTRs are reservoirs for genetic variations that changes the termini of proteins during evolution of the Drosophila genus. As genome sequencing is becoming inexpensive and routine, SnpEff enables rapid analyses of whole-genome sequencing data to be performed by an individual laboratory.
A SNP resource for Douglas-fir: de novo transcriptome assembly and SNP detection and validation.
Howe, Glenn T; Yu, Jianbin; Knaus, Brian; Cronn, Richard; Kolpak, Scott; Dolan, Peter; Lorenz, W Walter; Dean, Jeffrey F D
2013-02-28
Douglas-fir (Pseudotsuga menziesii), one of the most economically and ecologically important tree species in the world, also has one of the largest tree breeding programs. Although the coastal and interior varieties of Douglas-fir (vars. menziesii and glauca) are native to North America, the coastal variety is also widely planted for timber production in Europe, New Zealand, Australia, and Chile. Our main goal was to develop a SNP resource large enough to facilitate genomic selection in Douglas-fir breeding programs. To accomplish this, we developed a 454-based reference transcriptome for coastal Douglas-fir, annotated and evaluated the quality of the reference, identified putative SNPs, and then validated a sample of those SNPs using the Illumina Infinium genotyping platform. We assembled a reference transcriptome consisting of 25,002 isogroups (unique gene models) and 102,623 singletons from 2.76 million 454 and Sanger cDNA sequences from coastal Douglas-fir. We identified 278,979 unique SNPs by mapping the 454 and Sanger sequences to the reference, and by mapping four datasets of Illumina cDNA sequences from multiple seed sources, genotypes, and tissues. The Illumina datasets represented coastal Douglas-fir (64.00 and 13.41 million reads), interior Douglas-fir (80.45 million reads), and a Yakima population similar to interior Douglas-fir (8.99 million reads). We assayed 8067 SNPs on 260 trees using an Illumina Infinium SNP genotyping array. Of these SNPs, 5847 (72.5%) were called successfully and were polymorphic. Based on our validation efficiency, our SNP database may contain as many as ~200,000 true SNPs, and as many as ~69,000 SNPs that could be genotyped at ~20,000 gene loci using an Infinium II array-more SNPs than are needed to use genomic selection in tree breeding programs. Ultimately, these genomic resources will enhance Douglas-fir breeding and allow us to better understand landscape-scale patterns of genetic variation and potential responses to
Elbaz, Alexis; Nelson, Lorene M; Payami, Haydeh; Ioannidis, John P A; Fiske, Brian K; Annesi, Grazia; Belin, Andrea Carmine; Factor, Stewart A; Ferrarese, Carlo; Hadjigeorgiou, Georgios M; Higgins, Donald S; Kawakami, Hideshi; Krüger, Rejko; Marder, Karen S; Mayeux, Richard P; Mellick, George D; Nutt, John G; Ritz, Beate; Samii, Ali; Tanner, Caroline M; Van Broeckhoven, Christine; Van Den Eeden, Stephen K; Wirdefeldt, Karin; Zabetian, Cyrus P; Dehem, Marie; Montimurro, Jennifer S; Southwick, Audrey; Myers, Richard M; Trikalinos, Thomas A
2013-01-01
Summary Background A genome-wide association study identified 13 single-nucleotide polymorphisms (SNPs) significantly associated with Parkinson’s disease. Small-scale replication studies were largely non-confirmatory, but a meta-analysis that included data from the original study could not exclude all SNP associations, leaving relevance of several markers uncertain. Methods Investigators from three Michael J Fox Foundation for Parkinson’s Research-funded genetics consortia—comprising 14 teams—contributed DNA samples from 5526 patients with Parkinson’s disease and 6682 controls, which were genotyped for the 13 SNPs. Most (88%) participants were of white, non-Hispanic descent. We assessed log-additive genetic effects using fixed and random effects models stratified by team and ethnic origin, and tested for heterogeneity across strata. A meta-analysis was undertaken that incorporated data from the original genome-wide study as well as subsequent replication studies. Findings In fixed and random-effects models no associations with any of the 13 SNPs were identified (odds ratios 0·89 to 1·09). Heterogeneity between studies and between ethnic groups was low for all SNPs. Subgroup analyses by age at study entry, ethnic origin, sex, and family history did not show any consistent associations. In our meta-analysis, no SNP showed significant association (summary odds ratios 0·95 to 1.08); there was little heterogeneity except for SNP rs7520966. Interpretation Our results do not lend support to the finding that the 13 SNPs reported in the original genome-wide association study are genetic susceptibility factors for Parkinson’s disease. PMID:17052658
Directory of Open Access Journals (Sweden)
Doran Anthony G
2013-02-01
Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are the most abundant genetic variant found in vertebrates and invertebrates. SNP discovery has become a highly automated, robust and relatively inexpensive process allowing the identification of many thousands of mutations for model and non-model organisms. Annotating large numbers of SNPs can be a difficult and complex process. Many tools available are optimised for use with organisms densely sampled for SNPs, such as humans. There are currently few tools available that are species non-specific or support non-model organism data. Results Here we present SNPdat, a high throughput analysis tool that can provide a comprehensive annotation of both novel and known SNPs for any organism with a draft sequence and annotation. Using a dataset of 4,566 SNPs identified in cattle using high-throughput DNA sequencing we demonstrate the annotations performed and the statistics that can be generated by SNPdat. Conclusions SNPdat provides users with a simple tool for annotation of genomes that are either not supported by other tools or have a small number of annotated SNPs available. SNPdat can also be used to analyse datasets from organisms which are densely sampled for SNPs. As a command line tool it can easily be incorporated into existing SNP discovery pipelines and fills a niche for analyses involving non-model organisms that are not supported by many available SNP annotation tools. SNPdat will be of great interest to scientists involved in SNP discovery and analysis projects, particularly those with limited bioinformatics experience.
Ferchaud, Anne-Laure; Pedersen, Susanne H; Bekkevold, Dorte; Jian, Jianbo; Niu, Yongchao; Hansen, Michael M
2014-10-06
The threespine stickleback (Gasterosteus aculeatus) has become an important model species for studying both contemporary and parallel evolution. In particular, differential adaptation to freshwater and marine environments has led to high differentiation between freshwater and marine stickleback populations at the phenotypic trait of lateral plate morphology and the underlying candidate gene Ectodysplacin (EDA). Many studies have focused on this trait and candidate gene, although other genes involved in marine-freshwater adaptation may be equally important. In order to develop a resource for rapid and cost efficient analysis of genetic divergence between freshwater and marine sticklebacks, we generated a low-density SNP (Single Nucleotide Polymorphism) array encompassing markers of chromosome regions under putative directional selection, along with neutral markers for background. RAD (Restriction site Associated DNA) sequencing of sixty individuals representing two freshwater and one marine population led to the identification of 33,993 SNP markers. Ninety-six of these were chosen for the low-density SNP array, among which 70 represented SNPs under putatively directional selection in freshwater vs. marine environments, whereas 26 SNPs were assumed to be neutral. Annotation of these regions revealed several genes that are candidates for affecting stickleback phenotypic variation, some of which have been observed in previous studies whereas others are new. We have developed a cost-efficient low-density SNP array that allows for rapid screening of polymorphisms in threespine stickleback. The array provides a valuable tool for analyzing adaptive divergence between freshwater and marine stickleback populations beyond the well-established candidate gene Ectodysplacin (EDA).
Directory of Open Access Journals (Sweden)
Yang Zhao
Full Text Available GWAS has facilitated greatly the discovery of risk SNPs associated with complex diseases. Traditional methods analyze SNP individually and are limited by low power and reproducibility since correction for multiple comparisons is necessary. Several methods have been proposed based on grouping SNPs into SNP sets using biological knowledge and/or genomic features. In this article, we compare the linear kernel machine based test (LKM and principal components analysis based approach (PCA using simulated datasets under the scenarios of 0 to 3 causal SNPs, as well as simple and complex linkage disequilibrium (LD structures of the simulated regions. Our simulation study demonstrates that both LKM and PCA can control the type I error at the significance level of 0.05. If the causal SNP is in strong LD with the genotyped SNPs, both the PCA with a small number of principal components (PCs and the LKM with kernel of linear or identical-by-state function are valid tests. However, if the LD structure is complex, such as several LD blocks in the SNP set, or when the causal SNP is not in the LD block in which most of the genotyped SNPs reside, more PCs should be included to capture the information of the causal SNP. Simulation studies also demonstrate the ability of LKM and PCA to combine information from multiple causal SNPs and to provide increased power over individual SNP analysis. We also apply LKM and PCA to analyze two SNP sets extracted from an actual GWAS dataset on non-small cell lung cancer.
SNP-based pathway enrichment analysis for genome-wide association studies
Directory of Open Access Journals (Sweden)
Potkin Steven G
2011-04-01
Full Text Available Abstract Background Recently we have witnessed a surge of interest in using genome-wide association studies (GWAS to discover the genetic basis of complex diseases. Many genetic variations, mostly in the form of single nucleotide polymorphisms (SNPs, have been identified in a wide spectrum of diseases, including diabetes, cancer, and psychiatric diseases. A common theme arising from these studies is that the genetic variations discovered by GWAS can only explain a small fraction of the genetic risks associated with the complex diseases. New strategies and statistical approaches are needed to address this lack of explanation. One such approach is the pathway analysis, which considers the genetic variations underlying a biological pathway, rather than separately as in the traditional GWAS studies. A critical challenge in the pathway analysis is how to combine evidences of association over multiple SNPs within a gene and multiple genes within a pathway. Most current methods choose the most significant SNP from each gene as a representative, ignoring the joint action of multiple SNPs within a gene. This approach leads to preferential identification of genes with a greater number of SNPs. Results We describe a SNP-based pathway enrichment method for GWAS studies. The method consists of the following two main steps: 1 for a given pathway, using an adaptive truncated product statistic to identify all representative (potentially more than one SNPs of each gene, calculating the average number of representative SNPs for the genes, then re-selecting the representative SNPs of genes in the pathway based on this number; and 2 ranking all selected SNPs by the significance of their statistical association with a trait of interest, and testing if the set of SNPs from a particular pathway is significantly enriched with high ranks using a weighted Kolmogorov-Smirnov test. We applied our method to two large genetically distinct GWAS data sets of schizophrenia, one
Koning-Boucoiran, Carole F S; Esselink, G Danny; Vukosavljev, Mirjana; van 't Westende, Wendy P C; Gitonga, Virginia W; Krens, Frans A; Voorrips, Roeland E; van de Weg, W Eric; Schulz, Dietmar; Debener, Thomas; Maliepaard, Chris; Arens, Paul; Smulders, Marinus J M
2015-01-01
In order to develop a versatile and large SNP array for rose, we set out to mine ESTs from diverse sets of rose germplasm. For this RNA-Seq libraries containing about 700 million reads were generated from tetraploid cut and garden roses using Illumina paired-end sequencing, and from diploid Rosa multiflora using 454 sequencing. Separate de novo assemblies were performed in order to identify single nucleotide polymorphisms (SNPs) within and between rose varieties. SNPs among tetraploid roses were selected for constructing a genotyping array that can be employed for genetic mapping and marker-trait association discovery in breeding programs based on tetraploid germplasm, both from cut roses and from garden roses. In total 68,893 SNPs were included on the WagRhSNP Axiom array. Next, an orthology-guided assembly was performed for the construction of a non-redundant rose transcriptome database. A total of 21,740 transcripts had significant hits with orthologous genes in the strawberry (Fragaria vesca L.) genome. Of these 13,390 appeared to contain the full-length coding regions. This newly established transcriptome resource adds considerably to the currently available sequence resources for the Rosaceae family in general and the genus Rosa in particular.
International Nuclear Information System (INIS)
Middeldorp, Anneke; Wijnen, Juul T; Wezel, Tom van; Jagmohan-Changur, Shantie; Helmer, Quinta; Klift, Heleen M van der; Tops, Carli MJ; Vasen, Hans FA; Devilee, Peter; Morreau, Hans; Houwing-Duistermaat, Jeanine J
2007-01-01
The apparent dominant model of colorectal cancer (CRC) inheritance in several large families, without mutations in known CRC susceptibility genes, suggests the presence of so far unidentified genes with strong or moderate effect on the development of CRC. Linkage analysis could lead to identification of susceptibility genes in such families. In comparison to classical linkage analysis with multi-allelic markers, single nucleotide polymorphism (SNP) arrays have increased information content and can be processed with higher throughput. Therefore, SNP arrays can be excellent tools for linkage analysis. However, the vast number of SNPs on the SNP arrays, combined with large informative pedigrees (e.g. >35–40 bits), presents us with a computational complexity that is challenging for existing statistical packages or even exceeds their capacity. We therefore setup a procedure for linkage analysis in large pedigrees and validated the method by genotyping using SNP arrays of a colorectal cancer family with a known MLH1 germ line mutation. Quality control of the genotype data was performed in Alohomora, Mega2 and SimWalk2, with removal of uninformative SNPs, Mendelian inconsistencies and Mendelian consistent errors, respectively. Linkage disequilibrium was measured by SNPLINK and Merlin. Parametric linkage analysis using two flanking markers was performed using MENDEL. For multipoint parametric linkage analysis and haplotype analysis, SimWalk2 was used. On chromosome 3, in the MLH1-region, a LOD score of 1.9 was found by parametric linkage analysis using two flanking markers. On chromosome 11 a small region with LOD 1.1 was also detected. Upon linkage disequilibrium removal, multipoint linkage analysis yielded a LOD score of 2.1 in the MLH1 region, whereas the LOD score dropped to negative values in the region on chromosome 11. Subsequent haplotype analysis in the MLH1 region perfectly matched the mutation status of the family members. We developed a workflow for linkage
Directory of Open Access Journals (Sweden)
Peter M Visscher
2014-04-01
Full Text Available We have recently developed analysis methods (GREML to estimate the genetic variance of a complex trait/disease and the genetic correlation between two complex traits/diseases using genome-wide single nucleotide polymorphism (SNP data in unrelated individuals. Here we use analytical derivations and simulations to quantify the sampling variance of the estimate of the proportion of phenotypic variance captured by all SNPs for quantitative traits and case-control studies. We also derive the approximate sampling variance of the estimate of a genetic correlation in a bivariate analysis, when two complex traits are either measured on the same or different individuals. We show that the sampling variance is inversely proportional to the number of pairwise contrasts in the analysis and to the variance in SNP-derived genetic relationships. For bivariate analysis, the sampling variance of the genetic correlation additionally depends on the harmonic mean of the proportion of variance explained by the SNPs for the two traits and the genetic correlation between the traits, and depends on the phenotypic correlation when the traits are measured on the same individuals. We provide an online tool for calculating the power of detecting genetic (covariation using genome-wide SNP data. The new theory and online tool will be helpful to plan experimental designs to estimate the missing heritability that has not yet been fully revealed through genome-wide association studies, and to estimate the genetic overlap between complex traits (diseases in particular when the traits (diseases are not measured on the same samples.
Role of an SNP in Alternative Splicing of Bovine NCF4 and Mastitis Susceptibility.
Directory of Open Access Journals (Sweden)
Zhihua Ju
Full Text Available Neutrophil cytosolic factor 4 (NCF4 is component of the nicotinamide dinucleotide phosphate oxidase complex, a key factor in biochemical pathways and innate immune responses. In this study, splice variants and functional single-nucleotide polymorphism (SNP of NCF4 were identified to determine the variability and association of the gene with susceptibility to bovine mastitis characterized by inflammation. A novel splice variant, designated as NCF4-TV and characterized by the retention of a 48 bp sequence in intron 9, was detected in the mammary gland tissues of infected cows. The expression of the NCF4-reference main transcript in the mastitic mammary tissues was higher than that in normal tissues. A novel SNP, g.18174 A>G, was also found in the retained 48 bp region of intron 9. To determine whether NCF4-TV could be due to the g.18174 A>G mutation, we constructed two mini-gene expression vectors with the wild-type or mutant NCF4 g.18174 A>G fragment. The vectors were then transiently transfected into 293T cells, and alternative splicing of NCF4 was analyzed by reverse transcription-PCR and sequencing. Mini-gene splicing assay demonstrated that the aberrantly spliced NCF4-TV with 48 bp retained fragment in intron 9 could be due to g.18174 A>G, which was associated with milk somatic count score and increased risk of mastitis infection in cows. NCF4 expression was also regulated by alternative splicing. This study proposes that NCF4 splice variants generated by functional SNP are important risk factors for mastitis susceptibility in dairy cows.
Curk, Franck; Ancillo, Gema; Ollitrault, Frédérique; Perrier, Xavier; Jacquemoud-Collet, Jean-Pierre; Garcia-Lor, Andres; Navarro, Luis; Ollitrault, Patrick
2015-01-01
Most cultivated Citrus species originated from interspecific hybridisation between four ancestral taxa (C. reticulata, C. maxima, C. medica, and C. micrantha) with limited further interspecific recombination due to vegetative propagation. This evolution resulted in admixture genomes with frequent interspecific heterozygosity. Moreover, a major part of the phenotypic diversity of edible citrus results from the initial differentiation between these taxa. Deciphering the phylogenomic structure of citrus germplasm is therefore essential for an efficient utilization of citrus biodiversity in breeding schemes. The objective of this work was to develop a set of species-diagnostic single nucleotide polymorphism (SNP) markers for the four Citrus ancestral taxa covering the nine chromosomes, and to use these markers to infer the phylogenomic structure of secondary species and modern cultivars. Species-diagnostic SNPs were mined from 454 amplicon sequencing of 57 gene fragments from 26 genotypes of the four basic taxa. Of the 1,053 SNPs mined from 28,507 kb sequence, 273 were found to be highly diagnostic for a single basic taxon. Species-diagnostic SNP markers (105) were used to analyse the admixture structure of varieties and rootstocks. This revealed C. maxima introgressions in most of the old and in all recent selections of mandarins, and suggested that C. reticulata × C. maxima reticulation and introgression processes were important in edible mandarin domestication. The large range of phylogenomic constitutions between C. reticulata and C. maxima revealed in mandarins, tangelos, tangors, sweet oranges, sour oranges, grapefruits, and orangelos is favourable for genetic association studies based on phylogenomic structures of the germplasm. Inferred admixture structures were in agreement with previous hypotheses regarding the origin of several secondary species and also revealed the probable origin of several acid citrus varieties. The developed species-diagnostic SNP
Núñez-Acuña, Gustavo; Aguilar-Espinoza, Andrea; Chávez-Mardones, Jacqueline; Gallardo-Escárate, Cristian
2012-10-01
Ubiquitin-conjugated E2 enzyme (UBE2) is one of the main components of the proteasome degradation cascade. Previous studies have shown an increase of expression levels in individuals challenged to some pathogen organism such as virus and bacteria. The study was to characterize the immune response of UBE2 gene in the gastropod Concholepas concholepas through expression analysis and single nucleotide polymorphisms (SNP) discovery. Hence, UBE2 was identified from a cDNA library by 454 pyrosequencing, while SNP identification and validation were performed using De novo assembly and high resolution melting analysis. Challenge trials with Vibrio anguillarum was carried out to evaluate the relative transcript abundance of UBE2 gene from two to thirty-three hours post-treatment. The results showed a partial UBE2 sequence of 889 base pair (bp) with a partial coding region of 291 bp. SNP variation (A/C) was observed at the 546th position. Individuals challenged by V. anguillarum showed an overexpression of the UBE2 gene, the expression being significantly higher in homozygous individuals (AA) than (CC) or heterozygous individuals (A/C). This study contributes useful information relating to the UBE2 gene and its association with innate immune response in marine invertebrates. Copyright © 2012 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Yasuko Okano
Full Text Available The transcription factor NRF2 plays a pivotal role in protecting normal cells from external toxic challenges and oxidative stress, whereas it can also endow cancer cells resistance to anticancer drugs. At present little information is available about the genetic polymorphisms of the NRF2 gene and their clinical relevance. We aimed to investigate the single nucleotide polymorphisms in the NRF2 gene as a prognostic biomarker in lung cancer.We prepared genomic DNA samples from 387 Japanese patients with primary lung cancer and detected SNP (c.-617C>A; rs6721961 in the ARE-like loci of the human NRF2 gene by the rapid genetic testing method we developed in this study. We then analyzed the association between the SNP in the NRF2 gene and patients' overall survival.Patients harboring wild-type (WT homozygous (c.-617C/C, SNP heterozygous (c.-617C/A, and SNP homozygous (c.-617A/A alleles numbered 216 (55.8%, 147 (38.0%, and 24 (6.2%, respectively. Multivariate logistic regression models revealed that SNP homozygote (c.-617A/A was significantly related to gender. Its frequency was four-fold higher in female patients than in males (10.8% female vs 2.7% male and was associated with female non-smokers with adenocarcinoma. Interestingly, lung cancer patients carrying NRF2 SNP homozygous alleles (c.-617A/A and the 309T (WT allele in the MDM2 gene exhibited remarkable survival over 1,700 days after surgical operation (log-rank p = 0.021.SNP homozygous (c.-617A/A alleles in the NRF2 gene are associated with female non-smokers with adenocarcinoma and regarded as a prognostic biomarker for assessing overall survival of patients with lung adenocarcinoma.
Performance of the SNPforID 52 SNP-plex assay in paternity testing
DEFF Research Database (Denmark)
Børsting, Claus; Sanchez, Juan Jose; Hansen, Hanna E
2008-01-01
(VNTRs). The typical PIs based on 15 STRs or seven VNTRs were 5-50 times higher than the typical PIs based on 52 SNPs. Six mutations in tandem repeats were detected among the randomly selected trios. In contrast, there was not found any mutations in the SNP loci. The results showed that the 52 SNP...
EvoSNP-DB: A database of genetic diversity in East Asian populations.
Kim, Young Uk; Kim, Young Jin; Lee, Jong-Young; Park, Kiejung
2013-08-01
Genome-wide association studies (GWAS) have become popular as an approach for the identification of large numbers of phenotype-associated variants. However, differences in genetic architecture and environmental factors mean that the effect of variants can vary across populations. Understanding population genetic diversity is valuable for the investigation of possible population specific and independent effects of variants. EvoSNP-DB aims to provide information regarding genetic diversity among East Asian populations, including Chinese, Japanese, and Korean. Non-redundant SNPs (1.6 million) were genotyped in 54 Korean trios (162 samples) and were compared with 4 million SNPs from HapMap phase II populations. EvoSNP-DB provides two user interfaces for data query and visualization, and integrates scores of genetic diversity (Fst and VarLD) at the level of SNPs, genes, and chromosome regions. EvoSNP-DB is a web-based application that allows users to navigate and visualize measurements of population genetic differences in an interactive manner, and is available online at [http://biomi.cdc.go.kr/EvoSNP/].
Anthony, R. M.; Schuitema, A. R. J.; Chan, A. B.; Boender, P. J.; Klatser, P. R.; Oskam, L.
2003-01-01
Oligonucleotide arrays capable of detecting single nucleotide polymorphisms (SNPs) from amplified nucleic acid have many applications. The expected SNP is usually placed approximately in the center of the probe to ensure the maximum shift in Tm between complementary and SNP sequences. Unfortunately,
Electrochemical Li Topotactic Reaction in Layered SnP3 for Superior Li-Ion Batteries
Park, Jae-Wan; Park, Cheol-Min
2016-10-01
The development of new anode materials having high electrochemical performances and interesting reaction mechanisms is highly required to satisfy the need for long-lasting mobile electronic devices and electric vehicles. Here, we report a layer crystalline structured SnP3 and its unique electrochemical behaviors with Li. The SnP3 was simply synthesized through modification of Sn crystallography by combination with P and its potential as an anode material for LIBs was investigated. During Li insertion reaction, the SnP3 anode showed an interesting two-step electrochemical reaction mechanism comprised of a topotactic transition (0.7-2.0 V) and a conversion (0.0-2.0 V) reaction. When the SnP3-based composite electrode was tested within the topotactic reaction region (0.7-2.0 V) between SnP3 and LixSnP3 (x ≤ 4), it showed excellent electrochemical properties, such as a high volumetric capacity (1st discharge/charge capacity was 840/663 mA h cm-3) with a high initial coulombic efficiency, stable cycle behavior (636 mA h cm-3 over 100 cycles), and fast rate capability (550 mA h cm-3 at 3C). This layered SnP3 anode will be applicable to a new anode material for rechargeable LIBs.
SNP discovery in the bovine milk transcriptome using RNA-Seq technology.
Cánovas, Angela; Rincon, Gonzalo; Islas-Trejo, Alma; Wickramasinghe, Saumya; Medrano, Juan F
2010-12-01
High-throughput sequencing of RNA (RNA-Seq) was developed primarily to analyze global gene expression in different tissues. However, it also is an efficient way to discover coding SNPs. The objective of this study was to perform a SNP discovery analysis in the milk transcriptome using RNA-Seq. Seven milk samples from Holstein cows were analyzed by sequencing cDNAs using the Illumina Genome Analyzer system. We detected 19,175 genes expressed in milk samples corresponding to approximately 70% of the total number of genes analyzed. The SNP detection analysis revealed 100,734 SNPs in Holstein samples, and a large number of those corresponded to differences between the Holstein breed and the Hereford bovine genome assembly Btau4.0. The number of polymorphic SNPs within Holstein cows was 33,045. The accuracy of RNA-Seq SNP discovery was tested by comparing SNPs detected in a set of 42 candidate genes expressed in milk that had been resequenced earlier using Sanger sequencing technology. Seventy of 86 SNPs were detected using both RNA-Seq and Sanger sequencing technologies. The KASPar Genotyping System was used to validate unique SNPs found by RNA-Seq but not observed by Sanger technology. Our results confirm that analyzing the transcriptome using RNA-Seq technology is an efficient and cost-effective method to identify SNPs in transcribed regions. This study creates guidelines to maximize the accuracy of SNP discovery and prevention of false-positive SNP detection, and provides more than 33,000 SNPs located in coding regions of genes expressed during lactation that can be used to develop genotyping platforms to perform marker-trait association studies in Holstein cattle.
Zhang, Linsheng; Znoyko, Iya; Costa, Luciano J; Conlin, Laura K; Daber, Robert D; Self, Sally E; Wolff, Daynna J
2011-12-01
Chronic lymphocytic leukemia (CLL) is a clinically heterogeneous disease. The methods currently used for monitoring CLL and determining conditions for treatment are limited in their ability to predict disease progression, patient survival, and response to therapy. Although clonal diversity and the acquisition of new chromosomal abnormalities during the disease course (clonal evolution) have been associated with disease progression, their prognostic potential has been underappreciated because cytogenetic and fluorescence in situ hybridization (FISH) studies have a restricted ability to detect genomic abnormalities and clonal evolution. We hypothesized that whole genome analysis using high resolution single nucleotide polymorphism (SNP) microarrays would be useful to detect diversity and infer clonal evolution to offer prognostic information. In this study, we used the Infinium Omni1 BeadChip (Illumina, San Diego, CA) array for the analysis of genetic variation and percent mosaicism in 25 non-selected CLL patients to explore the prognostic value of the assessment of clonal diversity in patients with CLL. We calculated the percentage of mosaicism for each abnormality by applying a mathematical algorithm to the genotype frequency data and by manual determination using the Simulated DNA Copy Number (SiDCoN) tool, which was developed from a computer model of mosaicism. At least one genetic abnormality was identified in each case, and the SNP data was 98% concordant with FISH results. Clonal diversity, defined as the presence of two or more genetic abnormalities with differing percentages of mosaicism, was observed in 12 patients (48%), and the diversity correlated with the disease stage. Clonal diversity was present in most cases of advanced disease (Rai stages III and IV) or those with previous treatment, whereas 9 of 13 patients without detected clonal diversity were asymptomatic or clinically stable. In conclusion, SNP microarray studies with simultaneous evaluation
DEFF Research Database (Denmark)
Børsting, Claus; Morling, Niels
2012-01-01
and published as case work examples in forensic journals. Here, the cases were reinvestigated by typing the samples for 49 autosomal single-nucleotide polymorphisms (SNPs) using the SNPforID multiplex assay. RESULTS: Three cases were solved by the SNP investigation without the need for any additional testing....... In two cases, the SNP results supported the conclusions based on STRs. In the last case, the SNP results spoke in favor of paternity, and the combined paternity index based on autosomal STRs and SNPs was 12.3 billion. Nevertheless, the alleged father was excluded by X-chromosome typing. CONCLUSION...
Institute of Scientific and Technical Information of China (English)
ZHAI Hui-jie; FENG Zhi-yu; LIU Xin-ye; CHENG Xue-jiao; PENG Hui-ru; YAO Ying-yin; SUN Qi-xin; NI Zhong-fu
2015-01-01
The construction of high density genetic linkage map provides a powerful tool to detect and map quantitative trait loci (QTLs) controlling agronomically important traits. In this study, simple sequence repeat (SSR) markers and Illumina 9K iSelect single nucleotide polymorphism (SNP) genechip were employed to construct one genetic linkage map of common wheat (Triticum aestivum L.) using 191 recombinant inbred lines (RILs) derived from cross Yu 8679xJing 411. This map included 1 901 SNP loci and 178 SSR loci, covering 1 659.9 cM and 1 000 marker bins, with an average interval distance of 1.66 cM. A, B and D genomes covered 719.1,703.5 and 237.3 cM, with an average interval distance of 1.66, 1.45 and 2.9 cM, respectively. Notably, the genetic linkage map covered 20 chromosomes, with the exception of chromosome 5D. Bioinformatics analysis revealed that 1 754 (92.27%) of 1 901 mapped SNP loci could be aligned to 1 215 distinct wheat unigenes, among which 1 184 (97.4%) were located on one single chromosome, and the rest 31 (2.6%) were located on 2 to 3 chromosomes. By performing in silico comparison, 214 chromosome deletion bin-mapped expressed sequence tags (ESTs), 1 043 Brachypodium genes and 1 033 rice genes were further added onto the genetic linkage map. This map not only integrated genetic and physical maps, SSR and SNP loci, respectively, but also provided the information of Brachypodium and rice genes corresponding to 1 754 SNP loci. Therefore, it will be a useful tool for comparative genomics analysis, fine mapping of QTL/gene controlling agronomically important traits and marker-assisted selection breeding in wheat.
Evaluation of the OvineSNP50 chip for use in four South African ...
African Journals Online (AJOL)
Relatively rapid and cost-effective genotyping using the OvineSNP50 chip holds great promise for the South African sheep industry and research partners. However, SNP ascertainment bias may influence inferences from the genotyping results of South African sheep breeds. Therefore, samples from Dorper, Namaqua ...
DEFF Research Database (Denmark)
Brorsson, C.; Hansen, Niclas Tue; Hansen, Kasper Lage
2009-01-01
genes. We have developed a novel method that combines single nucleotide polymorphism (SNP) genotyping data with protein-protein interaction (ppi) networks to identify disease-associated network modules enriched for proteins encoded from the MHC region. Approximately 2500 SNPs located in the 4 Mb MHC......To develop novel methods for identifying new genes that contribute to the risk of developing type 1 diabetes within the Major Histocompatibility Complex (MHC) region on chromosome 6, independently of the known linkage disequilibrium (LD) between human leucocyte antigen (HLA)-DRB1, -DQA1, -DQB1...... region were analysed in 1000 affected offspring trios generated by the Type 1 Diabetes Genetics Consortium (T1DGC). The most associated SNP in each gene was chosen and genes were mapped to ppi networks for identification of interaction partners. The association testing and resulting interacting protein...
Xu, Li-Xin; Holland, Heidrun; Kirsten, Holger; Ahnert, Peter; Krupp, Wolfgang; Bauer, Manfred; Schober, Ralf; Mueller, Wolf; Fritzsch, Dominik; Meixensberger, Jürgen; Koschny, Ronald
2015-04-01
According to the World Health Organization gangliogliomas are classified as well-differentiated and slowly growing neuroepithelial tumors, composed of neoplastic mature ganglion and glial cells. It is the most frequent tumor entity observed in patients with long-term epilepsy. Comprehensive cytogenetic and molecular cytogenetic data including high-resolution genomic profiling (single nucleotide polymorphism (SNP)-array) of gangliogliomas are scarce but necessary for a better oncological understanding of this tumor entity. For a detailed characterization at the single cell and cell population levels, we analyzed genomic alterations of three gangliogliomas using trypsin-Giemsa banding (GTG-banding) and by spectral karyotyping (SKY) in combination with SNP-array and gene expression array experiments. By GTG and SKY, we could confirm frequently detected chromosomal aberrations (losses within chromosomes 10, 13 and 22; gains within chromosomes 5, 7, 8 and 12), and identify so far unknown genetic aberrations like the unbalanced non-reciprocal translocation t(1;18)(q21;q21). Interestingly, we report on the second so far detected ganglioglioma with ring chromosome 1. Analyses of SNP-array data from two of the tumors and respective germline DNA (peripheral blood) identified few small gains and losses and a number of copy-neutral regions with loss of heterozygosity (LOH) in germline and in tumor tissue. In comparison to germline DNA, tumor tissues did not show substantial regions with significant loss or gain or with newly developed LOH. Gene expression analyses of tumor-specific genes revealed similarities in the profile of the analyzed samples regarding different relevant pathways. Taken together, we describe overlapping but also distinct and novel genetic aberrations of three gangliogliomas. © 2014 Japanese Society of Neuropathology.
SNP marker detection and genotyping in tilapia
Bers, van N.E.M.; Crooijmans, R.P.M.A.; Groenen, M.A.M.; Dibbits, B.W.; Komen, J.
2012-01-01
We have generated a unique resource consisting of nearly 175 000 short contig sequences and 3569 SNP markers from the widely cultured GIFT (Genetically Improved Farmed Tilapia) strain of Nile tilapia (Oreochromis niloticus). In total, 384 SNPs were selected to monitor the wider applicability of the
Valenzuela-Muñoz, Valentina; Araya-Garay, José Miguel; Gallardo-Escárate, Cristian
2013-06-01
The California red abalone, Haliotis rufescens that belongs to the Haliotidae family, is the largest species of abalone in the world that has sustained the major fishery and aquaculture production in the USA and Mexico. This native mollusk has not been evaluated or assigned a conservation category even though in the last few decades it was heavily exploited until it disappeared in some areas along the California coast. In Chile, the red abalone was introduced in the 1970s from California wild abalone stocks for the purposes of aquaculture. Considering the number of years that the red abalone has been cultivated in Chile crucial genetic information is scarce and critical issues remain unresolved. This study reports and validates novel single nucleotide polymorphisms (SNP) markers for the red abalone H. rufescens using cDNA pyrosequencing. A total of 622 high quality SNPs were identified in 146 sequences with an estimated frequency of 1 SNP each 1000bp. Forty-five SNPs markers with functional information for gene ontology were selected. Of these, 8 were polymorphic among the individuals screened: Heat shock protein 70 (HSP70), vitellogenin (VTG), lysin, alginate lyase enzyme (AL), Glucose-regulated protein 94 (GRP94), fructose-bisphosphate aldolase (FBA), sulfatase 1A precursor (S1AP) and ornithine decarboxylase antizyme (ODC). Two additional sequences were also identified with polymorphisms but no similarities with known proteins were achieved. To validate the putative SNP markers, High Resolution Melting Analysis (HRMA) was conducted in a wild and hatchery-bred population. Additionally, SNP cross-amplifications were tested in two further native abalone species, Haliotis fulgens and Haliotis corrugata. This study provides novel candidate genes that could be used to evaluate loss of genetic diversity due to hatchery selection or inbreeding effects. Copyright © 2013 Elsevier B.V. All rights reserved.
Identification of Mendelian inconsistencies between SNP and pedigree information of sibs
Directory of Open Access Journals (Sweden)
Calus Mario PL
2011-10-01
Full Text Available Abstract Background Using SNP genotypes to apply genomic selection in breeding programs is becoming common practice. Tools to edit and check the quality of genotype data are required. Checking for Mendelian inconsistencies makes it possible to identify animals for which pedigree information and genotype information are not in agreement. Methods Straightforward tests to detect Mendelian inconsistencies exist that count the number of opposing homozygous marker (e.g. SNP genotypes between parent and offspring (PAR-OFF. Here, we develop two tests to identify Mendelian inconsistencies between sibs. The first test counts SNP with opposing homozygous genotypes between sib pairs (SIBCOUNT. The second test compares pedigree and SNP-based relationships (SIBREL. All tests iteratively remove animals based on decreasing numbers of inconsistent parents and offspring or sibs. The PAR-OFF test, followed by either SIB test, was applied to a dataset comprising 2,078 genotyped cows and 211 genotyped sires. Theoretical expectations for distributions of test statistics of all three tests were calculated and compared to empirically derived values. Type I and II error rates were calculated after applying the tests to the edited data, while Mendelian inconsistencies were introduced by permuting pedigree against genotype data for various proportions of animals. Results Both SIB tests identified animal pairs for which pedigree and genomic relationships could be considered as inconsistent by visual inspection of a scatter plot of pairwise pedigree and SNP-based relationships. After removal of 235 animals with the PAR-OFF test, SIBCOUNT (SIBREL identified 18 (22 additional inconsistent animals. Seventeen animals were identified by both methods. The numbers of incorrectly deleted animals (Type I error, were equally low for both methods, while the numbers of incorrectly non-deleted animals (Type II error, were considerably higher for SIBREL compared to SIBCOUNT. Conclusions
LENUS (Irish Health Repository)
Holt, Kathryn E
2010-05-31
Abstract Background Salmonella Typhi (S. Typhi) causes typhoid fever, which remains an important public health issue in many developing countries. Kathmandu, the capital of Nepal, is an area of high incidence and the pediatric population appears to be at high risk of exposure and infection. Methods We recently defined the population structure of S. Typhi, using new sequencing technologies to identify nearly 2,000 single nucleotide polymorphisms (SNPs) that can be used as unequivocal phylogenetic markers. Here we have used the GoldenGate (Illumina) platform to simultaneously type 1,500 of these SNPs in 62 S. Typhi isolates causing severe typhoid in children admitted to Patan Hospital in Kathmandu. Results Eight distinct S. Typhi haplotypes were identified during the 20-month study period, with 68% of isolates belonging to a subclone of the previously defined H58 S. Typhi. This subclone was closely associated with resistance to nalidixic acid, with all isolates from this group demonstrating a resistant phenotype and harbouring the same resistance-associated SNP in GyrA (Phe83). A secondary clone, comprising 19% of isolates, was observed only during the second half of the study. Conclusions Our data demonstrate the utility of SNP typing for monitoring bacterial populations over a defined period in a single endemic setting. We provide evidence for genotype introduction and define a nalidixic acid resistant subclone of S. Typhi, which appears to be the dominant cause of severe pediatric typhoid in Kathmandu during the study period.
Biomek®-3000 and GenPlex SNP Genotyping in Forensic Genetics
DEFF Research Database (Denmark)
Stangegaard, Michael; Tomas, Carmen; Hansen, Anders J.
2008-01-01
Single nucleotide polymorphism genotyping provides a supplement for conventional short tandem repeats-based kits currently used for human identification. GenPlex (Applied Biosystems (AB), Foster City, CA) is an SNP-genotyping kit based on a multiplex of 48 informative, autosomal SNPs from...... the SNPforID Consortium. Our objective was to setup, implement, and validate a small and affordable automated liquid-handling robot for forensic casework samples (buccal swaps on FTA-paper and Qiagen purified blood). The reaction scheme consisted of numerous steps and was cumbersome to perform consistently...... manually. Automation was accomplished with a Biomek-3000 (Beckmann Coulter) laboratory-automated workstation using five in-house-developed methods. All methods allowed the user to select the number of subsequent injections to the capillary electrophoresis instrument (ABI 3130xl, AB) enabling processing...
Evaluation strategies for isotope ratio measurements of single particles by LA-MC-ICPMS.
Kappel, S; Boulyga, S F; Dorta, L; Günther, D; Hattendorf, B; Koffler, D; Laaha, G; Leisch, F; Prohaska, T
2013-03-01
Data evaluation is a crucial step when it comes to the determination of accurate and precise isotope ratios computed from transient signals measured by multi-collector-inductively coupled plasma mass spectrometry (MC-ICPMS) coupled to, for example, laser ablation (LA). In the present study, the applicability of different data evaluation strategies (i.e. 'point-by-point', 'integration' and 'linear regression slope' method) for the computation of (235)U/(238)U isotope ratios measured in single particles by LA-MC-ICPMS was investigated. The analyzed uranium oxide particles (i.e. 9073-01-B, CRM U010 and NUSIMEP-7 test samples), having sizes down to the sub-micrometre range, are certified with respect to their (235)U/(238)U isotopic signature, which enabled evaluation of the applied strategies with respect to precision and accuracy. The different strategies were also compared with respect to their expanded uncertainties. Even though the 'point-by-point' method proved to be superior, the other methods are advantageous, as they take weighted signal intensities into account. For the first time, the use of a 'finite mixture model' is presented for the determination of an unknown number of different U isotopic compositions of single particles present on the same planchet. The model uses an algorithm that determines the number of isotopic signatures by attributing individual data points to computed clusters. The (235)U/(238)U isotope ratios are then determined by means of the slopes of linear regressions estimated for each cluster. The model was successfully applied for the accurate determination of different (235)U/(238)U isotope ratios of particles deposited on the NUSIMEP-7 test samples.
Construction and evaluation of a high-density SNP array for the Pacific oyster (Crassostrea gigas.
Directory of Open Access Journals (Sweden)
Haigang Qi
Full Text Available Single nucleotide polymorphisms (SNPs are widely used in genetics and genomics research. The Pacific oyster (Crassostrea gigas is an economically and ecologically important marine bivalve, and it possesses one of the highest levels of genomic DNA variation among animal species. Pacific oyster SNPs have been extensively investigated; however, the mechanisms by which these SNPs may be used in a high-throughput, transferable, and economical manner remain to be elucidated. Here, we constructed an oyster 190K SNP array using Affymetrix Axiom genotyping technology. We designed 190,420 SNPs on the chip; these SNPs were selected from 54 million SNPs identified through re-sequencing of 472 Pacific oysters collected in China, Japan, Korea, and Canada. Our genotyping results indicated that 133,984 (70.4% SNPs were polymorphic and successfully converted on the chip. The SNPs were distributed evenly throughout the oyster genome, located in 3,595 scaffolds with a length of ~509.4 million; the average interval spacing was 4,210 bp. In addition, 111,158 SNPs were distributed in 21,050 coding genes, with an average of 5.3 SNPs per gene. In comparison with genotypes obtained through re-sequencing, ~69% of the converted SNPs had a concordance rate of >0.971; the mean concordance rate was 0.966. Evaluation based on genotypes of full-sib family individuals revealed that the average genotyping accuracy rate was 0.975. Carrying 133 K polymorphic SNPs, our oyster 190K SNP array is the first commercially available high-density SNP chip for mollusks, with the highest throughput. It represents a valuable tool for oyster genome-wide association studies, fine linkage mapping, and population genetics.
Loya Méndez, Yolanda; Reyes Leal, Gilberto; Sánchez González, Adriana; Portillo Reyes, Verónica; Reyes Ruvalcaba, David; Bojórquez Rangel, Guillermo
2014-09-28
Diabetes Mellitus (DM) type 2 is a common pathology with multifactorial etiology, which exact genetic bases remain unknown. Some studies suggest that single nucleotides polymorphisms (SNPs) in the CAPN10 gene (Locus 2q37.3) could be associated with the development of this disease, including the insertion/deletion polymorphism SNP-19 (2R→3R). The present study determined the association between the SNP-19 and the risk of developing DM type 2 in Ciudad Juarez population. For this study 107 participants were selected: 43 diabetics type 2 (cases) and 64 non diabetics with no family history of DM type 2 in first grade (control). Anthropometric studies were realized as well as lipids, lipoproteins and serum glucose biochemical profiles. The genotypification of SNP-19 was performed using peripheral blood lymphocytes DNA, polymerase chain reactions (PCR), and electrophoretic analysis in agarose gels. Once obtained the genotypic and allelic frequencies, the Hardy-Weinberg equilibrium test (GenAlEx 6.4) was also performed. Using the X² analysis it was identified the genotypic differences between cases and control with higher frequency of the homozygous genotype 3R of SNP- 19 in the cases group (0.418) compared to control group (0.265). Also, it was observed an association between genotype 2R/3R with elevated weight, body mass index, and waist and hip circumferences, but only in the diabetic group (P=< 0.05). The findings in this study suggest that SNP-19 in CAPN10 may participate in the development of DM type 2 in the studied population. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.
Differential growth of Mycobacterium leprae strains (SNP genotypes) in armadillos.
Sharma, Rahul; Singh, Pushpendra; Pena, Maria; Subramanian, Ramesh; Chouljenko, Vladmir; Kim, Joohyun; Kim, Nayong; Caskey, John; Baudena, Marie A; Adams, Linda B; Truman, Richard W
2018-04-14
Leprosy (Hansen's Disease) has occurred throughout human history, and persists today at a low prevalence in most populations. Caused by Mycobacterium leprae, the infection primarily involves the skin, mucosa and peripheral nerves. The susceptible host range for Mycobacterium leprae is quite narrow. Besides humans, nine banded armadillos (Dasypus novemcinctus) and red squirrels (Sciurus vulgaris) are the only other natural hosts for M. leprae, but only armadillos recapitulate the disease as seen in humans. Armadillos across the Southern United States harbor a single predominant genotypic strain (SNP Type-3I) of M. leprae, which is also implicated in the zoonotic transmission of leprosy. We investigated, whether the zoonotic strain (3I) has any notable growth advantages in armadillos over another genetically distant strain-type (SNP Type-4P) of M. leprae, and if M. leprae strains manifest any notably different pathology among armadillos. We co-infected armadillos (n = 6) with 2 × 10 9 highly viable M. leprae of both strains and assessed the relative growth and dissemination of each strain in the animals. We also analyzed 12 additional armadillos, 6 each individually infected with the same quantity of either strain. The infections were allowed to fulminate and the clinical manifestations of the disease were noted. Animals were humanely sacrificed at the terminal stage of infection and the number of bacilli per gram of liver, spleen and lymph node tissue were enumerated by Q-PCR assay. The growth of M. leprae strain 4P was significantly higher (P leprae strains within armadillos suggest there are notable pathological variations between M. leprae strain-types. Copyright © 2018. Published by Elsevier B.V.
Diversity in 113 cowpea [Vigna unguiculata (L) Walp] accessions assessed with 458 SNP markers.
Egbadzor, Kenneth F; Ofori, Kwadwo; Yeboah, Martin; Aboagye, Lawrence M; Opoku-Agyeman, Michael O; Danquah, Eric Y; Offei, Samuel K
2014-01-01
Single Nucleotide Polymorphism (SNP) markers were used in characterization of 113 cowpea accessions comprising of 108 from Ghana and 5 from abroad. Leaf tissues from plants cultivated at the University of Ghana were genotyped at KBioscience in the United Kingdom. Data was generated for 477 SNPs, out of which 458 revealed polymorphism. The results were used to analyze genetic dissimilarity among the accessions using Darwin 5 software. The markers discriminated among all of the cowpea accessions and the dissimilarity values which ranged from 0.006 to 0.63 were used for factorial plot. Unexpected high levels of heterozygosity were observed on some of the accessions. Accessions known to be closely related clustered together in a dendrogram drawn with WPGMA method. A maximum length sub-tree which comprised of 48 core accessions was constructed. The software package structure was used to separate accessions into three groups, and the programme correctly identified varieties that were known hybrids. The hybrids were those accessions with numerous heterozygous loci. The structure plot showed closely related accessions with similar genome patterns. The SNP markers were more efficient in discriminating among the cowpea germplasm than morphological, seed protein polymorphism and simple sequence repeat studies reported earlier on the same collection.
Ali, Shahin S; Shao, Jonathan; Strem, Mary D; Phillips-Mora, Wilberth; Zhang, Dapeng; Meinhardt, Lyndel W; Bailey, Bryan A
2015-01-01
Moniliophthora roreri is the fungal pathogen that causes frosty pod rot (FPR) disease of Theobroma cacao L., the source of chocolate. FPR occurs in most of the cacao producing countries in the Western Hemisphere, causing yield losses up to 80%. Genetic diversity within the FPR pathogen population may allow the population to adapt to changing environmental conditions and adapt to enhanced resistance in the host plant. The present study developed single nucleotide polymorphism (SNP) markers from RNASeq results for 13 M. roreri isolates and validated the markers for their ability to reveal genetic diversity in an international M. roreri collection. The SNP resources reported herein represent the first study of RNA sequencing (RNASeq)-derived SNP validation in M. roreri and demonstrates the utility of RNASeq as an approach for de novo SNP identification in M. roreri. A total of 88 polymorphic SNPs were used to evaluate the genetic diversity of 172 M. roreri cacao isolates resulting in 37 distinct genotypes (including 14 synonymous groups). Absence of heterozygosity for the 88 SNP markers indicates reproduction in M. roreri is clonal and likely due to a homothallic life style. The upper Magdalena Valley of Colombia showed the highest levels of genetic diversity with 20 distinct genotypes of which 13 were limited to this region, and indicates this region as the possible center of origin for M. roreri.
Directory of Open Access Journals (Sweden)
Carole F S Koning-Boucoiran
2015-04-01
Full Text Available In order to develop a versatile and large SNP array for rose, we set out to mine ESTs from diverse sets of rose germplasm. For this RNA-Seq libraries containing about 700 million reads were generated from tetraploid cut and garden roses using Illumina paired-end sequencing, and from diploid Rosa multiflora using 454 sequencing. Separate de novo assemblies were performed in order to identify single nucleotide polymorphisms (SNPs within and between rose varieties. SNPs among tetraploid roses were selected for constructing a genotyping array that can be employed for genetic mapping and marker-trait association discovery in breeding programs based on tetraploid germplasm, both from cut roses and from garden roses. In total 68,893 SNPs were included on the WagRhSNP Axiom array.Next, an orthology-guided assembly was performed for the construction of a non-redundant rose transcriptome database. A total of 21,740 transcripts had significant hits with orthologous genes in the strawberry (Fragaria vesca L. genome. Of these 13,390 appeared to contain the full-length coding regions. This newly established transcriptome resource adds considerably to the currently available sequence resources for the Rosaceae family in general and the genus Rosa in particular.
[Relationship between genetic polymorphisms of 3 SNP loci in 5-HTT gene and paranoid schizophrenia].
Xuan, Jin-Feng; Ding, Mei; Pang, Hao; Xing, Jia-Xin; Sun, Yi-Hua; Yao, Jun; Zhao, Yi; Li, Chun-Mei; Wang, Bao-Jie
2012-12-01
To investigate the population genetic data of 3 SNP loci (rs25533, rs34388196 and rs1042173) of 5-hydroxytryptamine transporter (5-HTT) gene and the association with paranoid schizophrenia. Three SNP loci of 5-HTT gene were examined in 132 paranoid schizophrenia patients and 150 unrelated healthy individuals of Northern Chinese Han population by PCR-RFLP technique. The Hardy-Weinberg equilibrium test was performed using the chi-square test and the data of haplotype frequency and population genetics parameters were statistically analyzed. Among these three SNP loci, four haplotypes were obtained. There were no statistically significant differences between the patient group and the control group (P > 0.05). The DP values of the 3 SNP loci were 0.276, 0.502 and 0.502. The PIC of them were 0.151, 0.281 and 0.281. The PE of them were 0.014, 0.072 and 0.072. The three SNP loci and four haplotypes of 5-HTT gene have no association with paranoid schizophrenia, while the polymorphism still have high potential application in forensic practice.
FUNCTIONAL IMPLICATIONS OF THE CLOCK 3111T/C SINGLE-NUCLEOTIDE POLYMORPHISM
Directory of Open Access Journals (Sweden)
Angela Renee Ozburn
2016-04-01
Full Text Available Circadian rhythm disruptions are prominently associated with Bipolar Disorder (BD. Circadian rhythms are regulated by the molecular clock, a family of proteins that function together in a transcriptional-translational feedback loop. The CLOCK protein is a key transcription factor of this feedback loop, and previous studies have found that manipulations of the Clock gene are sufficient to produce manic-like behavior in mice (Roybal et al., 2007. The Clock 3111T/C single-nucleotide polymorphism (SNP; rs1801260 is a genetic variation of the human Clock gene that is significantly associated with increased frequency of manic episodes in BD patients (Benedetti et al., 2003. The 3111T/C SNP is located in the 3’ untranslated region of the Clock gene. In this study, we sought to examine the functional implications of the human Clock 3111T/C SNP by transfecting a mammalian cell line (mouse embryonic fibroblasts isolated from Clock -/- knockout mice with pcDNA plasmids containing the human Clock gene with either the T or C SNP at position 3111. We then measured circadian gene expression over a 24 hour time period. We found that the Clock3111C SNP resulted in higher mRNA levels than the Clock 3111T SNP. Further, we found that Per2, a transcriptional target of CLOCK, was also more highly expressed with Clock 3111C expression, indicating the 3’UTR SNP affects the expression, function and stability of Clock mRNA.
Directory of Open Access Journals (Sweden)
Alexandre Rodrigues Caetano
2009-07-01
Full Text Available Os primeiros estudos de identificação, caracterização e utilização de marcadores moleculares para a caracterização de recursos genéticos e geração de ferramentas para o melhoramento animal datam do final da década de 80. Nos últimos 20 anos as tecnologias para geração de dados moleculares passaram por vários ciclos de renovação. A última onda de inovações tecnológicas representa uma verdadeira revolução e trouxe metodologias para identificar e genotipar marcadores SNP (do inglês Single Nucleotide Polimorphism de maneira massal. Chips de DNA de alta densidade foram criados para genotipar de dezenas de milhares até centenas de milhares de marcadores SNP em um único ensaio. Além disso, outras tecnologias de média densidade permitem também a genotipagem de dezenas a centenas de marcadores, em números elevados de amostras, com altíssima velocidade e automação. Essas novas tecnologias permitiram a geração de novas aplicações, como as metodologias para avaliação genética e seleção com base no Valor Genômico (Genomic Estimated Breeding Value- GEBV. Os métodos estatísticos para avaliação e seleção genômica estão em pleno desenvolvimento, mas a tecnologia já se tornou uma realidade com o lançamento do primeiro sumário de touros para a raça Holandesa com GEBVs para características de produção e qualidade do leite em janeiro de 2009. Além disso, essas tecnologias também trouxeram novas opções para desenvolvimento de testes diagnósticos para confirmação de paternidade, identificação individual, rastreabilidade, etc. Além dessas inovações, as novas tecnologias de genotipagem de marcadores SNP facilitaram também o desenvolvimento de serviços terceirizados de geração de dados, permitindo que qualquer grupo realize pesquisas avançadas, sempre com as tecnologias mais avançadas, sem a necessidade de investimentos em equipamentos.The first studies to identify, characterize and use
Application of LogitBoost Classifier for Traceability Using SNP Chip Data.
Kim, Kwondo; Seo, Minseok; Kang, Hyunsung; Cho, Seoae; Kim, Heebal; Seo, Kang-Seok
2015-01-01
Consumer attention to food safety has increased rapidly due to animal-related diseases; therefore, it is important to identify their places of origin (POO) for safety purposes. However, only a few studies have addressed this issue and focused on machine learning-based approaches. In the present study, classification analyses were performed using a customized SNP chip for POO prediction. To accomplish this, 4,122 pigs originating from 104 farms were genotyped using the SNP chip. Several factors were considered to establish the best prediction model based on these data. We also assessed the applicability of the suggested model using a kinship coefficient-filtering approach. Our results showed that the LogitBoost-based prediction model outperformed other classifiers in terms of classification performance under most conditions. Specifically, a greater level of accuracy was observed when a higher kinship-based cutoff was employed. These results demonstrated the applicability of a machine learning-based approach using SNP chip data for practical traceability.
Rodrí guez-Ezpeleta, Naiara; Bradbury, Ian R.; Mendibil, Iñ aki; Á lvarez, Paula; Cotano, Unai; Irigoien, Xabier
2016-01-01
: the maximum number of mismatches allowed to merge reads into a locus and the relatedness of the individuals used for genotype calling and SNP selection. Our study resolves the population structure of the Atlantic mackerel, but, most importantly, provides
The Generalized Higher Criticism for Testing SNP-Set Effects in Genetic Association Studies
Barnett, Ian; Mukherjee, Rajarshi; Lin, Xihong
2017-01-01
It is of substantial interest to study the effects of genes, genetic pathways, and networks on the risk of complex diseases. These genetic constructs each contain multiple SNPs, which are often correlated and function jointly, and might be large in number. However, only a sparse subset of SNPs in a genetic construct is generally associated with the disease of interest. In this article, we propose the generalized higher criticism (GHC) to test for the association between an SNP set and a disease outcome. The higher criticism is a test traditionally used in high-dimensional signal detection settings when marginal test statistics are independent and the number of parameters is very large. However, these assumptions do not always hold in genetic association studies, due to linkage disequilibrium among SNPs and the finite number of SNPs in an SNP set in each genetic construct. The proposed GHC overcomes the limitations of the higher criticism by allowing for arbitrary correlation structures among the SNPs in an SNP-set, while performing accurate analytic p-value calculations for any finite number of SNPs in the SNP-set. We obtain the detection boundary of the GHC test. We compared empirically using simulations the power of the GHC method with existing SNP-set tests over a range of genetic regions with varied correlation structures and signal sparsity. We apply the proposed methods to analyze the CGEM breast cancer genome-wide association study. Supplementary materials for this article are available online. PMID:28736464
Sulovari, Arvis; Li, Dawei
2014-07-19
Genome-wide association studies (GWAS) have successfully identified genes associated with complex human diseases. Although much of the heritability remains unexplained, combining single nucleotide polymorphism (SNP) genotypes from multiple studies for meta-analysis will increase the statistical power to identify new disease-associated variants. Meta-analysis requires same allele definition (nomenclature) and genome build among individual studies. Similarly, imputation, commonly-used prior to meta-analysis, requires the same consistency. However, the genotypes from various GWAS are generated using different genotyping platforms, arrays or SNP-calling approaches, resulting in use of different genome builds and allele definitions. Incorrect assumptions of identical allele definition among combined GWAS lead to a large portion of discarded genotypes or incorrect association findings. There is no published tool that predicts and converts among all major allele definitions. In this study, we have developed a tool, GACT, which stands for Genome build and Allele definition Conversion Tool, that predicts and inter-converts between any of the common SNP allele definitions and between the major genome builds. In addition, we assessed several factors that may affect imputation quality, and our results indicated that inclusion of singletons in the reference had detrimental effects while ambiguous SNPs had no measurable effect. Unexpectedly, exclusion of genotypes with missing rate > 0.001 (40% of study SNPs) showed no significant decrease of imputation quality (even significantly higher when compared to the imputation with singletons in the reference), especially for rare SNPs. GACT is a new, powerful, and user-friendly tool with both command-line and interactive online versions that can accurately predict, and convert between any of the common allele definitions and between genome builds for genome-wide meta-analysis and imputation of genotypes from SNP-arrays or deep
Pacifiplex: an ancestry-informative SNP panel centred on Australia and the Pacific region.
Santos, Carla; Phillips, Christopher; Fondevila, Manuel; Daniel, Runa; van Oorschot, Roland A H; Burchard, Esteban G; Schanfield, Moses S; Souto, Luis; Uacyisrael, Jolame; Via, Marc; Carracedo, Ángel; Lareu, Maria V
2016-01-01
The analysis of human population variation is an area of considerable interest in the forensic, medical genetics and anthropological fields. Several forensic single nucleotide polymorphism (SNP) assays provide ancestry-informative genotypes in sensitive tests designed to work with limited DNA samples, including a 34-SNP multiplex differentiating African, European and East Asian ancestries. Although assays capable of differentiating Oceanian ancestry at a global scale have become available, this study describes markers compiled specifically for differentiation of Oceanian populations. A sensitive multiplex assay, termed Pacifiplex, was developed and optimized in a small-scale test applicable to forensic analyses. The Pacifiplex assay comprises 29 ancestry-informative marker SNPs (AIM-SNPs) selected to complement the 34-plex test, that in a combined set distinguish Africans, Europeans, East Asians and Oceanians. Nine Pacific region study populations were genotyped with both SNP assays, then compared to four reference population groups from the HGDP-CEPH human diversity panel. STRUCTURE analyses estimated population cluster membership proportions that aligned with the patterns of variation suggested for each study population's currently inferred demographic histories. Aboriginal Taiwanese and Philippine samples indicated high East Asian ancestry components, Papua New Guinean and Aboriginal Australians samples were predominantly Oceanian, while other populations displayed cluster patterns explained by the distribution of divergence amongst Melanesians, Polynesians and Micronesians. Genotype data from Pacifiplex and 34-plex tests is particularly well suited to analysis of Australian Aboriginal populations and when combined with Y and mitochondrial DNA variation will provide a powerful set of markers for ancestry inference applied to modern Australian demographic profiles. On a broader geographic scale, Pacifiplex adds highly informative data for inferring the ancestry
van Geest, Geert; Voorrips, Roeland E; Esselink, Danny; Post, Aike; Visser, Richard Gf; Arens, Paul
2017-08-07
Cultivated chrysanthemum is an outcrossing hexaploid (2n = 6× = 54) with a disputed mode of inheritance. In this paper, we present a single nucleotide polymorphism (SNP) selection pipeline that was used to design an Affymetrix Axiom array with 183 k SNPs from RNA sequencing data (1). With this array, we genotyped four bi-parental populations (with sizes of 405, 53, 76 and 37 offspring plants respectively), and a cultivar panel of 63 genotypes. Further, we present a method for dosage scoring in hexaploids from signal intensities of the array based on mixture models (2) and validation of selection steps in the SNP selection pipeline (3). The resulting genotypic data is used to draw conclusions on the mode of inheritance in chrysanthemum (4), and to make an inference on allelic expression bias (5). With use of the mixture model approach, we successfully called the dosage of 73,936 out of 183,130 SNPs (40.4%) that segregated in any of the bi-parental populations. To investigate the mode of inheritance, we analysed markers that segregated in the large bi-parental population (n = 405). Analysis of segregation of duplex x nulliplex SNPs resulted in evidence for genome-wide hexasomic inheritance. This evidence was substantiated by the absence of strong linkage between markers in repulsion, which indicated absence of full disomic inheritance. We present the success rate of SNP discovery out of RNA sequencing data as affected by different selection steps, among which SNP coverage over genotypes and use of different types of sequence read mapping software. Genomic dosage highly correlated with relative allele coverage from the RNA sequencing data, indicating that most alleles are expressed according to their genomic dosage. The large population, genotyped with a very large number of markers, is a unique framework for extensive genetic analyses in hexaploid chrysanthemum. As starting point, we show conclusive evidence for genome-wide hexasomic inheritance.
Directory of Open Access Journals (Sweden)
Theodore S. Kalbfleisch
2018-01-01
Full Text Available Background: Moose (Alces alces colonized the North American continent from Asia less than 15,000 years ago, and spread across the boreal forest regions of Canada and the northern United States (US. Contemporary populations have low genetic diversity, due either to low number of individuals in the original migration (founder effect, and/or subsequent population bottlenecks in North America. Genetic tests based on informative single nucleotide polymorphism (SNP markers are helpful in forensic and wildlife conservation activities, but have been difficult to develop for moose, due to the lack of a reference genome assembly and whole genome sequence (WGS data. Methods: WGS data were generated for four individual moose from the US states of Alaska, Idaho, Wyoming, and Vermont with minimum and average genome coverage depths of 14- and 19-fold, respectively. Cattle and sheep reference genomes were used for aligning sequence reads and identifying moose SNPs. Results: Approximately 11% and 9% of moose WGS reads aligned to cattle and sheep genomes, respectively. The reads clustered at genomic segments, where sequence identity between these species was greater than 95%. In these segments, average mapped read depth was approximately 19-fold. Sets of 46,005 and 36,934 high-confidence SNPs were identified from cattle and sheep comparisons, respectively, with 773 and 552 of those having minor allele frequency of 0.5 and conserved flanking sequences in all three species. Among the four moose, heterozygosity and allele sharing of SNP genotypes were consistent with decreasing levels of moose genetic diversity from west to east. A minimum set of 317 SNPs, informative across all four moose, was selected as a resource for future SNP assay design. Conclusions: All SNPs and associated information are available, without restriction, to support development of SNP-based tests for animal identification, parentage determination, and estimating
Energy Technology Data Exchange (ETDEWEB)
SacconePhD, Scott F [Washington University, St. Louis; Chesler, Elissa J [ORNL; Bierut, Laura J [Washington University, St. Louis; Kalivas, Peter J [Medical College of South Carolina, Charleston; Lerman, Caryn [University of Pennsylvania; Saccone, Nancy L [Washington University, St. Louis; Uhl, George R [Johns Hopkins University; Li, Chuan-Yun [Peking University; Philip, Vivek M [ORNL; Edenberg, Howard [Indiana University; Sherry, Steven [National Center for Biotechnology Information; Feolo, Michael [National Center for Biotechnology Information; Moyzis, Robert K [Johns Hopkins University; Rutter, Joni L [National Institute of Drug Abuse
2009-01-01
Commercial SNP microarrays now provide comprehensive and affordable coverage of the human genome. However, some diseases have biologically relevant genomic regions that may require additional coverage. Addiction, for example, is thought to be influenced by complex interactions among many relevant genes and pathways. We have assembled a list of 486 biologically relevant genes nominated by a panel of experts on addiction. We then added 424 genes that showed evidence of association with addiction phenotypes through mouse QTL mappings and gene co-expression analysis. We demonstrate that there are a substantial number of SNPs in these genes that are not well represented by commercial SNP platforms. We address this problem by introducing a publicly available SNP database for addiction. The database is annotated using numeric prioritization scores indicating the extent of biological relevance. The scores incorporate a number of factors such as SNP/gene functional properties (including synonymy and promoter regions), data from mouse systems genetics and measures of human/mouse evolutionary conservation. We then used HapMap genotyping data to determine if a SNP is tagged by a commercial microarray through linkage disequilibrium. This combination of biological prioritization scores and LD tagging annotation will enable addiction researchers to supplement commercial SNP microarrays to ensure comprehensive coverage of biologically relevant regions.
Cronin, Matthew A; Rincon, Gonzalo; Meredith, Robert W; MacNeil, Michael D; Islas-Trejo, Alma; Cánovas, Angela; Medrano, Juan F
2014-01-01
We assessed the relationships of polar bears (Ursus maritimus), brown bears (U. arctos), and black bears (U. americanus) with high throughput genomic sequencing data with an average coverage of 25× for each species. A total of 1.4 billion 100-bp paired-end reads were assembled using the polar bear and annotated giant panda (Ailuropoda melanoleuca) genome sequences as references. We identified 13.8 million single nucleotide polymorphisms (SNP) in the 3 species aligned to the polar bear genome. These data indicate that polar bears and brown bears share more SNP with each other than either does with black bears. Concatenation and coalescence-based analysis of consensus sequences of approximately 1 million base pairs of ultraconserved elements in the nuclear genome resulted in a phylogeny with black bears as the sister group to brown and polar bears, and all brown bears are in a separate clade from polar bears. Genotypes for 162 SNP loci of 336 bears from Alaska and Montana showed that the species are genetically differentiated and there is geographic population structure of brown and black bears but not polar bears.
Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng
2017-02-01
Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P glycogen content ( P glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.
Cohort analysis of a single nucleotide polymorphism on DNA chips.
Schwonbeck, Susanne; Krause-Griep, Andrea; Gajovic-Eichelmann, Nenad; Ehrentreich-Förster, Eva; Meinl, Walter; Glatt, Hansrüdi; Bier, Frank F
2004-11-15
A method has been developed to determine SNPs on DNA chips by applying a flow-through bioscanner. As a practical application we demonstrated the fast and simple SNP analysis of 24 genotypes in an array of 96 spots with a single hybridisation and dissociation experiment. The main advantage of this methodical concept is the parallel and fast analysis without any need of enzymatic digestion. Additionally, the DNA chip format used is appropriate for parallel analysis up to 400 spots. The polymorphism in the gene of the human phenol sulfotransferase SULT1A1 was studied as a model SNP. Biotinylated PCR products containing the SNP (The SNP summary web site: ) (mutant) and those containing no mutation (wild-type) were brought onto the chips coated with NeutrAvidin using non-contact spotting. This was followed by an analysis which was carried out in a flow-through biochip scanner while constantly rinsing with buffer. After removing the non-biotinylated strand a fluorescent probe was hybridised, which is complementary to the wild-type sequence. If this probe binds to a mutant sequence, then one single base is not fully matching. Thereby, the mismatched hybrid (mutant) is less stable than the full-matched hybrid (wild-type). The final step after hybridisation on the chip involves rinsing with a buffer to start dissociation of the fluorescent probe from the immobilised DNA strand. The online measurement of the fluorescence intensity by the biochip scanner provides the possibility to follow the kinetics of the hybridisation and dissociation processes. According to the different stability of the full-match and the mismatch, either visual discrimination or kinetic analysis is possible to distinguish SNP-containing sequence from the wild-type sequence.
A 48-plex autosomal SNP GenPlex™ assay for human individualization and relationship testing
DEFF Research Database (Denmark)
Tomas Mas, Carmen; Børsting, Claus; Morling, Niels
2012-01-01
SNPs are being increasingly used by forensic laboratories. Different platforms have been developed for SNP typing. We describe the GenPlex™ HID system protocol, a new SNP-typing platform developed by Applied Biosystems where 48 of the 52 SNPforID SNPs and amelogenin are included. The GenPlex™ HID...
Cancer protection elicited by a single nucleotide polymorphism close to the adrenomedullin gene.
Martínez-Herrero, Sonia; Martínez, Alfredo
2013-04-01
The risk of developing cancer is regulated by genetic variants, including polymorphisms. Characterizing such variants may help in developing protocols for personalized medicine. Adrenomedullin is a regulatory peptide involved in cancer promotion and progression. Carriers of a single nucleotide polymorphism (SNP) in the proximity of the adrenomedullin gene have lower levels of circulating peptide. The aim of the present work was to investigate whether carriers of this SNP (rs4910118) are protected against cancer. This was a retrospective study. DNA samples were obtained from the Carlos III DNA National Bank (University of Salamanca, Salamanca, Spain). Samples represent a variety of donors and patients from Spain. DNA from patients with breast cancer (n = 238), patients with lung cancer (n = 348), patients with cardiac insufficiency (n = 474), and healthy donors of advanced age (n = 500) was used. All samples were genotyped using double-mismatch PCR, and confirmation was achieved by direct sequencing. The minor allele frequency was calculated in all groups. The Pearson χ(2) was used to compare SNP frequencies. Of 1560 samples, 14 had the minor allele, with a minor allele frequency in healthy donors of 0.90%. Patients with cancer had a statistically significantly lower frequency than healthy donors (odds ratio = 0.216, 95% confidence interval = 0.048-0.967, P = .028). Carriers of the minor allele have a 4.6-fold lower risk of developing cancer than homozygotes for the major allele. Knowledge of the rs4910118 genotype may be useful for stratifying patients in clinical trials and for designing prevention strategies.
Bjelland, D W; Weigel, K A; Vukasinovic, N; Nkrumah, J D
2013-07-01
The effects of increased pedigree inbreeding in dairy cattle populations have been well documented and result in a negative impact on profitability. Recent advances in genotyping technology have allowed researchers to move beyond pedigree analysis and study inbreeding at a molecular level. In this study, 5,853 animals were genotyped for 54,001 single nucleotide polymorphisms (SNP); 2,913 cows had phenotypic records including a single lactation for milk yield (from either lactation 1, 2, 3, or 4), reproductive performance, and linear type conformation. After removing SNP with poor call rates, low minor allele frequencies, and departure from Hardy-Weinberg equilibrium, 33,025 SNP remained for analyses. Three measures of genomic inbreeding were evaluated: percent homozygosity (FPH), inbreeding calculated from runs of homozygosity (FROH), and inbreeding derived from a genomic relationship matrix (FGRM). Average FPH was 60.5±1.1%, average FROH was 3.8±2.1%, and average FGRM was 20.8±2.3%, where animals with larger values for each of the genomic inbreeding indices were considered more inbred. Decreases in total milk yield to 205d postpartum of 53, 20, and 47kg per 1% increase in FPH, FROH, and FGRM, respectively, were observed. Increases in days open per 1% increase in FPH (1.76 d), FROH (1.72 d), and FGRM (1.06 d) were also noted, as well as increases in maternal calving difficulty (0.09, 0.03, and 0.04 on a 5-point scale for FPH, FROH, and FGRM, respectively). Several linear type traits, such as strength (-0.40, -0.11, and -0.19), rear legs rear view (-0.35, -0.16, and -0.14), front teat placement (0.35, 0.25, 0.18), and teat length (-0.24, -0.14, and -0.13) were also affected by increases in FPH, FROH, and FGRM, respectively. Overall, increases in each measure of genomic inbreeding in this study were associated with negative effects on production and reproductive ability in dairy cows. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc
Development and evaluation of the first high-throughput SNP array for common carp (Cyprinus carpio).
Xu, Jian; Zhao, Zixia; Zhang, Xiaofeng; Zheng, Xianhu; Li, Jiongtang; Jiang, Yanliang; Kuang, Youyi; Zhang, Yan; Feng, Jianxin; Li, Chuangju; Yu, Juhua; Li, Qiang; Zhu, Yuanyuan; Liu, Yuanyuan; Xu, Peng; Sun, Xiaowen
2014-04-24
A large number of single nucleotide polymorphisms (SNPs) have been identified in common carp (Cyprinus carpio) but, as yet, no high-throughput genotyping platform is available for this species. C. carpio is an important aquaculture species that accounts for nearly 14% of freshwater aquaculture production worldwide. We have developed an array for C. carpio with 250,000 SNPs and evaluated its performance using samples from various strains of C. carpio. The SNPs used on the array were selected from two resources: the transcribed sequences from RNA-seq data of four strains of C. carpio, and the genome re-sequencing data of five strains of C. carpio. The 250,000 SNPs on the resulting array are distributed evenly across the reference C.carpio genome with an average spacing of 6.6 kb. To evaluate the SNP array, 1,072 C. carpio samples were collected and tested. Of the 250,000 SNPs on the array, 185,150 (74.06%) were found to be polymorphic sites. Genotyping accuracy was checked using genotyping data from a group of full-siblings and their parents, and over 99.8% of the qualified SNPs were found to be reliable. Analysis of the linkage disequilibrium on all samples and on three domestic C.carpio strains revealed that the latter had the longer haplotype blocks. We also evaluated our SNP array on 80 samples from eight species related to C. carpio, with from 53,526 to 71,984 polymorphic SNPs. An identity by state analysis divided all the samples into three clusters; most of the C. carpio strains formed the largest cluster. The Carp SNP array described here is the first high-throughput genotyping platform for C. carpio. Our evaluation of this array indicates that it will be valuable for farmed carp and for genetic and population biology studies in C. carpio and related species.
Qi, L L; Talukder, Z I; Hulke, B S; Foley, M E
2017-06-01
Diagnostic DNA markers are an invaluable resource in breeding programs for successful introgression and pyramiding of disease resistance genes. Resistance to downy mildew (DM) disease in sunflower is mediated by Pl genes which are known to be effective against the causal fungus, Plasmopara halstedii. Two DM resistance genes, Pl Arg and Pl 8 , are highly effective against P. halstedii races in the USA, and have been previously mapped to the sunflower linkage groups (LGs) 1 and 13, respectively, using simple sequence repeat (SSR) markers. In this study, we developed high-density single nucleotide polymorphism (SNP) maps encompassing the Pl arg and Pl 8 genes and identified diagnostic SNP markers closely linked to these genes. The specificity of the diagnostic markers was validated in a highly diverse panel of 548 sunflower lines. Dissection of a large marker cluster co-segregated with Pl Arg revealed that the closest SNP markers NSA_007595 and NSA_001835 delimited Pl Arg to an interval of 2.83 Mb on the LG1 physical map. The SNP markers SFW01497 and SFW06597 delimited Pl 8 to an interval of 2.85 Mb on the LG13 physical map. We also developed sunflower lines with homozygous, three gene pyramids carrying Pl Arg , Pl 8 , and the sunflower rust resistance gene R 12 using the linked SNP markers from a segregating F 2 population of RHA 340 (carrying Pl 8 )/RHA 464 (carrying Pl Arg and R 12 ). The high-throughput diagnostic SNP markers developed in this study will facilitate marker-assisted selection breeding, and the pyramided sunflower lines will provide durable resistance to downy mildew and rust diseases.
The effect of a single recombination event
DEFF Research Database (Denmark)
Schierup, Mikkel Heide; Jensen, Thomas Mailund; Wiuf, Carsten
We investigate the variance in how visible a single recombination event is in a SNP data set as a function of the type of recombination event and its age. Data is simulated under the coalescent with recombination and inference is by the popular composite likelihood methods. The major determinant...
Reibel, Florence; Chauffour, Aurélie; Brossier, Florence; Jarlier, Vincent; Cambau, Emmanuelle; Aubry, Alexandra
2015-01-01
Between 20 and 30 bacteriologically confirmed cases of leprosy are diagnosed each year at the French National Reference Center for mycobacteria. Patients are mainly immigrants from various endemic countries or living in French overseas territories. We aimed at expanding data regarding the geographical distribution of the SNP genotypes of the M. leprae isolates from these patients. Skin biopsies were obtained from 71 leprosy patients diagnosed between January 2009 and December 2013. Data regarding age, sex and place of birth and residence were also collected. Diagnosis of leprosy was confirmed by microscopic detection of acid-fast bacilli and/or amplification by PCR of the M. leprae-specific RLEP region. Single nucleotide polymorphisms (SNP), present in the M. leprae genome at positions 14 676, 1 642 875 and 2 935 685, were determined with an efficiency of 94% (67/71). Almost all patients were from countries other than France where leprosy is still prevalent (n = 31) or from French overseas territories (n = 36) where leprosy is not totally eradicated, while only a minority (n = 4) was born in metropolitan France but have lived in other countries. SNP type 1 was predominant (n = 33), followed by type 3 (n = 17), type 4 (n = 11) and type 2 (n = 6). SNP types were concordant with those previously reported as prevalent in the patients' countries of birth. SNP types found in patients born in countries other than France (Comoros, Haiti, Benin, Congo, Sri Lanka) and French overseas territories (French Polynesia, Mayotte and La Réunion) not covered by previous work correlated well with geographical location and history of human settlements. The phylogenic analysis of M. leprae strains isolated in France strongly suggests that French leprosy cases are caused by SNP types that are (a) concordant with the geographic origin or residence of the patients (non-French countries, French overseas territories, metropolitan France) or (b) more likely random in regions where diverse
Directory of Open Access Journals (Sweden)
Wong Melissa ML
2012-12-01
Full Text Available Abstract Background Next Generation Sequencing has provided comprehensive, affordable and high-throughput DNA sequences for Single Nucleotide Polymorphism (SNP discovery in Acacia auriculiformis and Acacia mangium. Like other non-model species, SNP detection and genotyping in Acacia are challenging due to lack of genome sequences. The main objective of this study is to develop the first high-throughput SNP genotyping assay for linkage map construction of A. auriculiformis x A. mangium hybrids. Results We identified a total of 37,786 putative SNPs by aligning short read transcriptome data from four parents of two Acacia hybrid mapping populations using Bowtie against 7,839 de novo transcriptome contigs. Given a set of 10 validated SNPs from two lignin genes, our in silico SNP detection approach is highly accurate (100% compared to the traditional in vitro approach (44%. Further validation of 96 SNPs using Illumina GoldenGate Assay gave an overall assay success rate of 89.6% and conversion rate of 37.5%. We explored possible factors lowering assay success rate by predicting exon-intron boundaries and paralogous genes of Acacia contigs using Medicago truncatula genome as reference. This assessment revealed that presence of exon-intron boundary is the main cause (50% of assay failure. Subsequent SNPs filtering and improved assay design resulted in assay success and conversion rate of 92.4% and 57.4%, respectively based on 768 SNPs genotyping. Analysis of clustering patterns revealed that 27.6% of the assays were not reproducible and flanking sequence might play a role in determining cluster compression. In addition, we identified a total of 258 and 319 polymorphic SNPs in A. auriculiformis and A. mangium natural germplasms, respectively. Conclusion We have successfully discovered a large number of SNP markers in A. auriculiformis x A. mangium hybrids using next generation transcriptome sequencing. By using a reference genome from the most closely
Directory of Open Access Journals (Sweden)
Zhan eYe
2014-05-01
Full Text Available Background: We conducted a genome-wide association study (GWAS to identify specific genetic variants that underlie susceptibility to disease caused by Staphylococcus aureus in humans. Methods: Cases (n=309 and controls (n=2,925 were genotyped at 508,921 single nucleotide polymorphisms (SNPs. Cases had at least one laboratory and clinician confirmed disease caused by S. aureus whereas controls did not. R-package (for SNP association, EIGENSOFT (to estimate and adjust for population stratification and gene- (VEGAS and pathway-based (DAVID, PANTHER, and Ingenuity Pathway Analysis analyses were performed.Results: No SNP reached genome-wide significance. Four SNPs exceeded the pConclusion: We identified potential susceptibility genes for S. aureus diseases in this preliminary study but confirmation by other studies is needed. The observed associations could be relevant given the complexity of S. aureus as a pathogen and its ability to exploit multiple biological pathways to cause infections in humans.
Directory of Open Access Journals (Sweden)
Jea-Young Lee
2013-06-01
Full Text Available The purpose of this study was to investigate interaction effects of genes using a Harvester method. A sample of Korean cattle, Hanwoo (n = 476 was chosen from the National Livestock Research Institute of Korea that were sired by 50 Korean proven bulls. The steers were born between the spring of 1998 and the autumn of 2002 and reared under a progeny-testing program at the Daekwanryeong and Namwon branches of NLRI. The steers were slaughtered at approximately 24 months of age and carcass quality traits were measured. A SNP Harvester method was applied with a support vector machine (SVM to detect significant SNPs in the CCDC158 gene and interaction effects between the SNPs that were associated with average daily gains, cold carcass weight, longissimus dorsi muscle area, and marbling scores. The statistical significance of the major SNP combinations was evaluated with x2-statistics. The genotype combinations of three SNPs, g.34425+102 A>T(AA, g.4102636T>G(GT, and g.11614+19G>T(GG had a greater effect than the rest of SNP combinations, e.g. 0.82 vs. 0.75 kg, 343 vs. 314 kg, 80.4 vs 74.7 cm2, and 7.35 vs. 5.01, for the four respective traits (p<0.001. Also, the estimates were greater compared with single SNPs analyzed (the greatest estimates were 0.76 kg, 320 kg, 75.5 cm2, and 5.31, respectively. This result suggests that the SNP Harvester method is a good option when multiple SNPs and interaction effects are tested. The significant SNPs could be applied to improve meat quality of Hanwoo via marker-assisted selection.
Winters, Alexandra H; Levan, Tricia D; Vogel, Stefanie N; Chesko, Kirsty L; Pollin, Toni I; Viscardi, Rose M
2013-08-01
Ureaplasma spp. respiratory tract colonization is a risk factor for bronchopulmonary dysplasia (BPD) in preterm infants, but differences in host susceptibility have not been elucidated. We hypothesized that variants in genes regulating the innate immune response are associated with altered risk for Ureaplasma spp. respiratory colonization and BPD in preterm infants. Twenty-four tag single nucleotide polymorphisms (SNPs) from Toll-like receptor (TLR)1, TLR2, TLR4 and TLR6 were assayed in 298 infants Ureaplasma spp. and were evaluated for BPD. The majority of subjects (N = 205 [70%]) were African-American. One hundred ten (37%) were Ureaplasma positive. Four SNPs in TLR2 and TLR6 were significantly associated with Ureaplasma respiratory tract colonization. Single SNPs in TLR2, TLR4 and TLR6 were associated with BPD. TLR6 SNP rs5743827 was associated with both a decreased risk for Ureaplasma respiratory tract colonization and decreased risk for BPD (odds ratio: 0.54 [0.34-0.86] and odds ratio: 0.54 [0.31-0.95], respectively). There was a significant additive interaction between Ureaplasma colonization and genotype at TLR6 SNP rs5743827 (Padditive = 0.023), with an attributable proportion due to interaction of 0.542. Polymorphisms in host defense genes may alter susceptibility to Ureaplasma infection and severity of the inflammatory response contributing to BPD. These observations implicate host genetic susceptibility as a major factor in BPD pathogenesis in Ureaplasma-infected preterms.
Directory of Open Access Journals (Sweden)
Aung H. Naing
2017-11-01
Full Text Available Longevity of cut flowers of many gerbera cultivars (Gerbera jamesonii is typically short because of stem bending; hence, stem bending that occurs during the early vase life period is a major problem in gerbera. Here, we investigated the effects of sodium nitroprusside (SNP on the delay of stem bending in the gerbera cultivars, Alliance, Rosalin, and Bintang, by examining relative fresh weight, bacterial density in the vase solution, transcriptional analysis of a lignin biosynthesis gene, antioxidant activity, and xylem blockage. All three gerbera cultivars responded to SNP by delaying stem bending, compared to the controls; however, the responses were dose- and cultivar-dependent. Among the treatments, SNP at 20 mg L-1 was the best to delay stem bending in Alliance, while dosages of 10 and 5 mg L-1 were the best for Rosalin and Bintang, respectively. However, stem bending in Alliance and Rosalin was faster than in Bintang, indicating a discrepancy influenced by genotype. According to our analysis of the role of SNP in the delay of stem bending, the results revealed that SNP treatment inhibited bacterial growth and xylem blockage, enhanced expression levels of a lignin biosynthesis gene, and maintained antioxidant activities. Therefore, it is suggested that the cause of stem bending is associated with the above-mentioned parameters and SNP is involved in the mechanism that delays stem bending in the different gerbera cultivars.
The low single nucleotide polymorphism heritability of plasma and saliva cortisol levels.
Neumann, Alexander; Direk, Nese; Crawford, Andrew A; Mirza, Saira; Adams, Hieab; Bolton, Jennifer; Hayward, Caroline; Strachan, David P; Payne, Erin K; Smith, Jennifer A; Milaneschi, Yuri; Penninx, Brenda; Hottenga, Jouke J; de Geus, Eco; Oldehinkel, Albertine J; van der Most, Peter J; de Rijke, Yolanda; Walker, Brian R; Tiemeier, Henning
2017-11-01
Cortisol is an important stress hormone affected by a variety of biological and environmental factors, such as the circadian rhythm, exercise and psychological stress. Cortisol is mostly measured using blood or saliva samples. A number of genetic variants have been found to contribute to cortisol levels with these methods. While the effects of several specific single genetic variants is known, the joint genome-wide contribution to cortisol levels is unclear. Our aim was to estimate the amount of cortisol variance explained by common single nucleotide polymorphisms, i.e. the SNP heritability, using a variety of cortisol measures, cohorts and analysis approaches. We analyzed morning plasma (n=5705) and saliva levels (n=1717), as well as diurnal saliva levels (n=1541), in the Rotterdam Study using genomic restricted maximum likelihood estimation. Additionally, linkage disequilibrium score regression was fitted on the results of genome-wide association studies (GWAS) performed by the CORNET consortium on morning plasma cortisol (n=12,597) and saliva cortisol (n=7703). No significant SNP heritability was detected for any cortisol measure, sample or analysis approach. Point estimates ranged from 0% to 9%. Morning plasma cortisol in the CORNET cohorts, the sample with the most power, had a 6% [95%CI: 0-13%] SNP heritability. The results consistently suggest a low SNP heritability of these acute and short-term measures of cortisol. The low SNP heritability may reflect the substantial environmental and, in particular, situational component of these cortisol measures. Future GWAS will require very large sample sizes. Alternatively, more long-term cortisol measures such as hair cortisol samples are needed to discover further genetic pathways regulating cortisol concentrations. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Nina Melzer
Full Text Available In this study the benefit of metabolome level analysis for the prediction of genetic value of three traditional milk traits was investigated. Our proposed approach consists of three steps: First, milk metabolite profiles are used to predict three traditional milk traits of 1,305 Holstein cows. Two regression methods, both enabling variable selection, are applied to identify important milk metabolites in this step. Second, the prediction of these important milk metabolite from single nucleotide polymorphisms (SNPs enables the detection of SNPs with significant genetic effects. Finally, these SNPs are used to predict milk traits. The observed precision of predicted genetic values was compared to the results observed for the classical genotype-phenotype prediction using all SNPs or a reduced SNP subset (reduced classical approach. To enable a comparison between SNP subsets, a special invariable evaluation design was implemented. SNPs close to or within known quantitative trait loci (QTL were determined. This enabled us to determine if detected important SNP subsets were enriched in these regions. The results show that our approach can lead to genetic value prediction, but requires less than 1% of the total amount of (40,317 SNPs., significantly more important SNPs in known QTL regions were detected using our approach compared to the reduced classical approach. Concluding, our approach allows a deeper insight into the associations between the different levels of the genotype-phenotype map (genotype-metabolome, metabolome-phenotype, genotype-phenotype.
Shavrukov, Yuri; Suchecki, Radoslaw; Eliby, Serik; Abugalieva, Aigul; Kenebayev, Serik; Langridge, Peter
2014-09-28
New SNP marker platforms offer the opportunity to investigate the relationships between wheat cultivars from different regions and assess the mechanism and processes that have led to adaptation to particular production environments. Wheat breeding has a long history in Kazakhstan and the aim of this study was to explore the relationship between key varieties from Kazakhstan and germplasm from breeding programs for other regions. The study revealed 5,898 polymorphic markers amongst ten cultivars, of which 2,730 were mapped in the consensus genetic map. Mapped SNP markers were distributed almost equally across the A and B genomes, with between 279 and 484 markers assigned to each chromosome. Marker coverage was approximately 10-fold lower in the D genome. There were 863 SNP markers identified as unique to specific cultivars, and clusters of these markers (regions containing more than three closely mapped unique SNPs) showed specific patterns on the consensus genetic map for each cultivar. Significant intra-varietal genetic polymorphism was identified in three cultivars (Tzelinnaya 3C, Kazakhstanskaya rannespelaya and Kazakhstanskaya 15). Phylogenetic analysis based on inter-varietal polymorphism showed that the very old cultivar Erythrospermum 841 was the most genetically distinct from the other nine cultivars from Kazakhstan, falling in a clade together with the American cultivar Sonora and genotypes from Central and South Asia. The modern cultivar Kazakhstanskaya 19 also fell into a separate clade, together with the American cultivar Thatcher. The remaining eight cultivars shared a single sub-clade but were categorised into four clusters. The accumulated data for SNP marker polymorphisms amongst bread wheat genotypes from Kazakhstan may be used for studying genetic diversity in bread wheat, with potential application for marker-assisted selection and the preparation of a set of genotype-specific markers.
Directory of Open Access Journals (Sweden)
Hanane Akhdar
Full Text Available Glutathione S-transferases (GSTs detoxify toxic molecules by conjugation with reduced glutathione and regulate cell signaling. Single nucleotide polymorphisms (SNPs of GST genes have been suggested to affect GST functions and thus to increase the risk of human hepatocellular carcinoma (HCC. As GSTA1 is expressed in hepatocytes and the rs3957357C>T (TT SNP is known to downregulate GSTA1 mRNA expression, the aims of this study were: (i to explore the relationship between the TT SNP in GSTA1 and the occurrence of HCC; (ii to measure GSTA1 mRNA expression in HCCs. For that purpose, we genotyped non-tumor-tissue-derived DNA from 48 HCC patients and white-blood-cell-derived DNA from 37 healthy individuals by restriction fragment length polymorphism (RFLP. In addition, expression of GSTA1 mRNA was assessed by real-time PCR in 18 matching pairs of HCCs and non-tumor livers. Survival analysis was performed on an annotated microarray dataset containing 247 HCC patients (GSE14520. The GSTA1 TT genotype was more frequent in HCC than in non-HCC patients (27% versus 5%, respectively, suggesting that individuals carrying this genotype could be associated with 2-fold higher risk of developing HCCs (odds ratio = 2.1; p = 0.02. Also, we found that GSTA1 mRNA expression was lower in HCCs than in non-tumor livers. HCCs expressing the highest GSTA1 mRNA levels were the smallest in size (R = -0.67; p = 0.007, expressed the highest levels of liver-enriched genes such as ALB (albumin, R = -0.67; p = 0.007 and COL18A1 (procollagen type XVIII, R = -0.50; p = 0.03 and showed the most favorable disease-free (OR = 0.54; p<0.001 and overall (OR = 0.56; p = 0.006 outcomes. Moreover, GSTA1 was found within a 263-gene network involved in well-differentiated hepatocyte functions. In conclusion, HCCs are characterized by two GSTA1 features: the TT SNP and reduced GSTA1 gene expression in a context of hepatocyte de-differentiation.
(SNP) assay for population stratification test between eastern Asians
African Journals Online (AJOL)
Yomi
2012-01-03
Jan 3, 2012 ... program STRUCTURE 2.0, which uses a Markov chain Monte. Carlo (MCMC) algorithm to cluster individuals into different cryptic ... HapMap project. .... Evaluation of the 124-plex SNP typing microarray for forensic testing.
Gomes, Sónia; Castro, Cláudia; Barrias, Sara; Pereira, Leonor; Jorge, Pedro; Fernandes, José R; Martins-Lopes, Paula
2018-04-11
The wine sector requires quick and reliable methods for Vitis vinifera L. varietal identification. The number of V. vinifera varieties is estimated in about 5,000 worldwide. Single Nucleotide Polymorphisms (SNPs) represent the most basic and abundant form of genetic sequence variation, being adequate for varietal discrimination. The aim of this work was to develop DNA-based assays suitable to detect SNP variation in V. vinifera, allowing varietal discrimination. Genotyping by sequencing allowed the detection of eleven SNPs on two genes of the anthocyanin pathway, the flavanone 3-hydroxylase (F3H, EC: 1.14.11.9), and the leucoanthocyanidin dioxygenase (LDOX, EC 1.14.11.19; synonym anthocyanidin synthase, ANS) in twenty V. vinifera varieties. Three High Resolution Melting (HRM) assays were designed based on the sequencing information, discriminating five of the 20 varieties: Alicante Bouschet, Donzelinho Tinto, Merlot, Moscatel Galego and Tinta Roriz. Sanger sequencing of the HRM assay products confirmed the HRM profiles. Three probes, with different lengths and sequences, were used as bio-recognition elements in an optical biosensor platform based on a long period grating (LPG) fiber optic sensor. The label free platform detected a difference of a single SNP using genomic DNA samples. The two different platforms were successfully applied for grapevine varietal identification.
Sodium nitroprusside (SNP) alleviates the oxidative stress induced ...
African Journals Online (AJOL)
Oxidative damage is often induced by abiotic stress, nitric oxide (NO) is considered as a functional molecule in modulating antioxidant metabolism of plants. In the present study, effects of sodium nitroprusside (SNP), a NO donor, on the phenotype, antioxidant capacity and chloroplast ultrastructure of cucumber leaves were ...
Olive oil DNA fingerprinting by multiplex SNP genotyping on fluorescent microspheres.
Kalogianni, Despina P; Bazakos, Christos; Boutsika, Lemonia M; Targem, Mehdi Ben; Christopoulos, Theodore K; Kalaitzis, Panagiotis; Ioannou, Penelope C
2015-04-01
Olive oil cultivar verification is of primary importance for the competitiveness of the product and the protection of consumers and producers from fraudulence. Single-nucleotide polymorphisms (SNPs) have emerged as excellent DNA markers for authenticity testing. This paper reports the first multiplex SNP genotyping assay for olive oil cultivar identification that is performed on a suspension of fluorescence-encoded microspheres. Up to 100 sets of microspheres, with unique "fluorescence signatures", are available. Allele discrimination was accomplished by primer extension reaction. The reaction products were captured via hybridization on the microspheres and analyzed, within seconds, by a flow cytometer. The "fluorescence signature" of each microsphere is assigned to a specific allele, whereas the signal from a reporter fluorophore denotes the presence of the allele. As a model, a panel of three SNPs was chosen that enabled identification of five common Greek olive cultivars (Adramytini, Chondrolia Chalkidikis, Kalamon, Koroneiki, and Valanolia).
International Nuclear Information System (INIS)
Chen Xiaoyu; Li Xisheng; Lin Xiahong; Gao Hongzhi; Li Qiulan; Zha Jinshun
2012-01-01
Objective: To explore the association of single nucleotide polymorphism at position 45 (SNP45) in adiponectin gene with plasma adiponectin level and insulin resistance in obesity in Quanzhou area of Fujian province. Methods: Two hundred and forty-eight patients with obesity and 225 normal control subjects were enrolled in this study.Fasting insulin (FINS) were measured by radioimmunoassay and fasting plasma glucose (FPG), total cholesterol (TC), triglyceride (TG), high density lipoprotein-cholesterol (HDL-C), low density lipoprotein-cholesterol (LDL-C) were measured by BECKMAN DXC800 biochemistry analyzer. Body mass index (BMI), waist to hip ratio,homeostasis model assessment of insulin resistance (HOMA-IR) were calculated. Plasma adiponectin levels were examined by means of enzyme-linked immunosorbentassy. The adiponectin gene SNP45 was identified by PCR-restriction fragment length polymorphism. Results: (1) Frequencies of GG+GT genotype in obesity group and normal control group were 61% and 44% respectively (χ 2 =14.182, P<0.01), and G allele frequencies were 35% and 25% (χ 2 =10.708, P<0.01). (2) In obesity group,the subjects with SNP45 GG+GT genotype had higher TG and LDL-C levels than those with TT genotype (t=2.604, P<0.01; t=5.507, P<0.01), and had lower adiponectin level than those with TT genotype (t=2.275, P<0.05), and had significantly lower HDL-L level than those with TT genotype (t=10.100, P< 0.01). (3) In normal control group,the subjects with SNP45 GG +GT genotype had significantly lower adiponectin,TG,TC levels than those with TT genotype (t=2.510, P<0.05; t=2.922, P<0.01; t=3.272, P< 0.01). (4) Logistic analysis proved that the SNP45 GG+GT genotype in obesity group was associated with decreased risk of plasma adiponectin level (OR=0.810, 95% CI : 0.673-0.975, P<0.05), and with increased risk of HOMA-IR (OR=1.746, 95% CI : 1.060-2.875, P<0.05). The SNP45 GG+GT genotype in normal control group was associated with increased risk of HOMA-IR (OR=3
(SNP) markers for the Chinese black sleeper, Bostrychus sinensis
African Journals Online (AJOL)
ajl yemi
2011-04-25
Apr 25, 2011 ... Polynesia, north to Japan and south to Australia (Kottelat et al., 1993; Masuda ... developed the first set of SNP markers for Chinese black sleeper which can ... Then, the. 44 primer pairs were designed based on all the cloning.
In silico characterization of functional SNP within the oestrogen ...
Indian Academy of Sciences (India)
MAHA REBAÕ
(polyphen-2, SNAP), as well as by the ESEfinder program, and one nonsense nsSNP was found. For noncoding ... mon type of genetic variation in the human genome that are ...... polymorphisms in type 2 diabetes mellitus and in android type.
Wang, Hongtao; Li, Guisheng; Kwon, Woo-Saeng; Yang, Deok-Chun
2016-06-04
Panax ginseng is one of the most valuable medicinal plants in the Orient. The low level of genetic variation has limited the application of molecular markers for cultivar authentication and marker-assisted selection in cultivated ginseng. To exploit DNA polymorphism within ginseng cultivars, ginseng expressed sequence tags (ESTs) were searched against the potential intron polymorphism (PIP) database to predict the positions of introns. Intron-flanking primers were then designed in conserved exon regions and used to amplify across the more variable introns. Sequencing results showed that single nucleotide polymorphisms (SNPs), as well as indels, were detected in four EST-derived introns, and SNP markers specific to "Gopoong" and "K-1" were first reported in this study. Based on cultivar-specific SNP sites, allele-specific polymerase chain reaction (PCR) was conducted and proved to be effective for the authentication of ginseng cultivars. Additionally, the combination of a simple NaOH-Tris DNA isolation method and real-time allele-specific PCR assay enabled the high throughput selection of cultivars from ginseng fields. The established real-time allele-specific PCR assay should be applied to molecular authentication and marker assisted selection of P. ginseng cultivars, and the EST intron-targeting strategy will provide a potential approach for marker development in species without whole genomic DNA sequence information.
Directory of Open Access Journals (Sweden)
Sabapathy Kanaga
2010-03-01
Full Text Available Abstract Background Single nucleotide polymorphism (SNP 309 resulting in a T or G allele in the promoter of MDM2, the negative regulator of p53, has been suggested to affect cancer predisposition and age of onset, primarily in females. However, findings have been inconsistent in various cancers, and ethnicity appears to be a critical factor influencing the effects of the SNP on cancer risk. An increasing trend has been observed in the prevalence of lung cancers in non-smokers, especially females, though the underlying genetic basis is unclear. Methods We therefore examined the role of the SNPs in the p53 pathway (p53 codon 72 and MDM2 SNP309 on lung cancer risk and prognosis of a life-time non-smoking female Chinese population, in a hospital-based case-control study of 123 cases and 159 age-matched controls, by PCR analysis. Results Our findings reveal that the risk of lung cancer among individuals with the MDM2 SNP309 TT genotype was 2.1 (95% CI 1.01-4.36 relative to the GG genotype, contrary to initial expectations that the GG genotype with elevated MDM2 levels will increase cancer risk. Those who had this genotype in combination with the p53 Pro allele had a risk of 2.5 (95% CI 1.2-5.0. There was however no effect of either polymorphism on age at diagnosis of lung cancer or on overall survival. Conclusions The results thus demonstrate that the MDM2 SNP309 TT rather than the GG genotype is associated with increased risk of lung cancer in this population, suggesting that other mechanisms independent of increased MDM2 levels can influence cancer susceptibility.
Genomic scans for selective sweeps using SNP data
DEFF Research Database (Denmark)
Nielsen, Rasmus; Williamson, Scott; Kim, Yuseob
2005-01-01
of the selection coefficient. To illustrate the method, we apply our approach to data from the Seattle SNP project and to Chromosome 2 data from the HapMap project. In Chromosome 2, the most extreme signal is found in the lactase gene, which previously has been shown to be undergoing positive selection. Evidence...
SNP based heritability estimation using a Bayesian approach
DEFF Research Database (Denmark)
Krag, Kristian; Janss, Luc; Mahdi Shariati, Mohammad
2013-01-01
. Differences in family structure were in general not found to influence the estimation of the heritability. For the sample sizes used in this study, a 10-fold increase of SNP density did not improve precision estimates compared with set-ups with a less dense distribution of SNPs. The methods used in this study...
Do you really know where this SNP goes?
The release of build 10.2 of the swine genome was a marked improvement over previous builds and has proven extremely useful. However, as most know, there are regions of the genome that this particular build does not accurately represent. For instance, nearly 25% of the 62,162 SNP on the Illumina Por...
Directory of Open Access Journals (Sweden)
Piriyapongsa Jittima
2012-12-01
Full Text Available Abstract Background Genome-wide association studies (GWAS do not provide a full account of the heritability of genetic diseases since gene-gene interactions, also known as epistasis are not considered in single locus GWAS. To address this problem, a considerable number of methods have been developed for identifying disease-associated gene-gene interactions. However, these methods typically fail to identify interacting markers explaining more of the disease heritability over single locus GWAS, since many of the interactions significant for disease are obscured by uninformative marker interactions e.g., linkage disequilibrium (LD. Results In this study, we present a novel SNP interaction prioritization algorithm, named iLOCi (Interacting Loci. This algorithm accounts for marker dependencies separately in case and control groups. Disease-associated interactions are then prioritized according to a novel ranking score calculated from the difference in marker dependencies for every possible pair between case and control groups. The analysis of a typical GWAS dataset can be completed in less than a day on a standard workstation with parallel processing capability. The proposed framework was validated using simulated data and applied to real GWAS datasets using the Wellcome Trust Case Control Consortium (WTCCC data. The results from simulated data showed the ability of iLOCi to identify various types of gene-gene interactions, especially for high-order interaction. From the WTCCC data, we found that among the top ranked interacting SNP pairs, several mapped to genes previously known to be associated with disease, and interestingly, other previously unreported genes with biologically related roles. Conclusion iLOCi is a powerful tool for uncovering true disease interacting markers and thus can provide a more complete understanding of the genetic basis underlying complex disease. The program is available for download at http://www4a.biotec.or.th/GI/tools/iloci.
Directory of Open Access Journals (Sweden)
Fei Lu
Full Text Available Switchgrass (Panicum virgatum L. is a perennial grass that has been designated as an herbaceous model biofuel crop for the United States of America. To facilitate accelerated breeding programs of switchgrass, we developed both an association panel and linkage populations for genome-wide association study (GWAS and genomic selection (GS. All of the 840 individuals were then genotyped using genotyping by sequencing (GBS, generating 350 GB of sequence in total. As a highly heterozygous polyploid (tetraploid and octoploid species lacking a reference genome, switchgrass is highly intractable with earlier methodologies of single nucleotide polymorphism (SNP discovery. To access the genetic diversity of species like switchgrass, we developed a SNP discovery pipeline based on a network approach called the Universal Network-Enabled Analysis Kit (UNEAK. Complexities that hinder single nucleotide polymorphism discovery, such as repeats, paralogs, and sequencing errors, are easily resolved with UNEAK. Here, 1.2 million putative SNPs were discovered in a diverse collection of primarily upland, northern-adapted switchgrass populations. Further analysis of this data set revealed the fundamentally diploid nature of tetraploid switchgrass. Taking advantage of the high conservation of genome structure between switchgrass and foxtail millet (Setaria italica (L. P. Beauv., two parent-specific, synteny-based, ultra high-density linkage maps containing a total of 88,217 SNPs were constructed. Also, our results showed clear patterns of isolation-by-distance and isolation-by-ploidy in natural populations of switchgrass. Phylogenetic analysis supported a general south-to-north migration path of switchgrass. In addition, this analysis suggested that upland tetraploid arose from upland octoploid. All together, this study provides unparalleled insights into the diversity, genomic complexity, population structure, phylogeny, phylogeography, ploidy, and evolutionary dynamics
Directory of Open Access Journals (Sweden)
Wagner Mark C
2005-05-01
Full Text Available Abstract Background Microbial forensics is important in tracking the source of a pathogen, whether the disease is a naturally occurring outbreak or part of a criminal investigation. Results A method and SPR Opt (SNP and PCR-RFLP Optimization software to perform a comprehensive, whole-genome analysis to forensically discriminate multiple sequences is presented. Tools for the optimization of forensic typing using Single Nucleotide Polymorphism (SNP and PCR-Restriction Fragment Length Polymorphism (PCR-RFLP analyses across multiple isolate sequences of a species are described. The PCR-RFLP analysis includes prediction and selection of optimal primers and restriction enzymes to enable maximum isolate discrimination based on sequence information. SPR Opt calculates all SNP or PCR-RFLP variations present in the sequences, groups them into haplotypes according to their co-segregation across those sequences, and performs combinatoric analyses to determine which sets of haplotypes provide maximal discrimination among all the input sequences. Those set combinations requiring that membership in the fewest haplotypes be queried (i.e. the fewest assays be performed are found. These analyses highlight variable regions based on existing sequence data. These markers may be heterogeneous among unsequenced isolates as well, and thus may be useful for characterizing the relationships among unsequenced as well as sequenced isolates. The predictions are multi-locus. Analyses of mumps and SARS viruses are summarized. Phylogenetic trees created based on SNPs, PCR-RFLPs, and full genomes are compared for SARS virus, illustrating that purported phylogenies based only on SNP or PCR-RFLP variations do not match those based on multiple sequence alignment of the full genomes. Conclusion This is the first software to optimize the selection of forensic markers to maximize information gained from the fewest assays, accepting whole or partial genome sequence data as input. As
SNP Discovery In Marine Fish Species By 454 Sequencing
DEFF Research Database (Denmark)
Panitz, Frank; Nielsen, Rasmus Ory; van Houdt, Jeroen K J
2011-01-01
Based on the 454 Next-Generation-Sequencing technology (Roche) a high throughput screening method was devised in order to generate novel genetic markers (SNPs). SNP discovery was performed for three target species of marine fish: hake (Merluccius merluccius), herring (Clupea harengus) and sole...
Shavrukov, Yuri; Zhumalin, Aibek; Serikbay, Dauren; Botayeva, Makpal; Otemisova, Ainur; Absattarova, Aiman; Sereda, Grigoriy; Sereda, Sergey; Shvidchenko, Vladimir; Turbekova, Arysgul; Jatayev, Satyvaldy; Lopato, Sergiy; Soole, Kathleen; Langridge, Peter
2016-01-01
A panel of 89 local commercial cultivars of bread wheat was tested in field trials in the dry conditions of Northern Kazakhstan. Two distinct groups of cultivars (six cultivars in each group), which had the highest and the lowest grain yield under drought were selected for further experiments. A dehydration test conducted on detached leaves indicated a strong association between rates of water loss in plants from the first group with highest grain yield production in the dry environment relative to the second group. Modern high-throughput Amplifluor Single Nucleotide Polymorphism (SNP) technology was applied to study allelic variations in a series of drought-responsive genes using 19 SNP markers. Genotyping of an SNP in the TaDREB5 (DREB2-type) gene using the Amplifluor SNP marker KATU48 revealed clear allele distribution across the entire panel of wheat accessions, and distinguished between the two groups of cultivars with high and low yield under drought. Significant differences in expression levels of TaDREB5 were revealed by qRT-PCR. Most wheat plants from the first group of cultivars with high grain yield showed slight up-regulation in the TaDREB5 transcript in dehydrated leaves. In contrast, expression of TaDREB5 in plants from the second group of cultivars with low grain yield was significantly down-regulated. It was found that SNPs did not alter the amino acid sequence of TaDREB5 protein. Thus, a possible explanation is that alternative splicing and up-stream regulation of TaDREB5 may be affected by SNP, but these hypotheses require additional analysis (and will be the focus of future studies). PMID:27917186
Mycobacterium leprae in Colombia described by SNP7614 in gyrA, two minisatellites and geography
Cardona-Castro, Nora; Beltrán-Alzate, Juan Camilo; Romero-Montoya, Irma Marcela; Li, Wei; Brennan, Patrick J; Vissa, Varalakshmi
2013-01-01
New cases of leprosy are still being detected in Colombia after the country declared achievement of the WHO defined ‘elimination’ status. To study the ecology of leprosy in endemic regions, a combination of geographic and molecular tools were applied for a group of 201 multibacillary patients including six multi-case families from eleven departments. The location (latitude and longitude) of patient residences were mapped. Slit skin smears and/or skin biopsies were collected and DNA was extracted. Standard agarose gel electrophoresis following a multiplex PCR-was developed for rapid and inexpensive strain typing of M. leprae based on copy numbers of two VNTR minisatellite loci 27-5 and 12-5. A SNP (C/T) in gyrA (SNP7614) was mapped by introducing a novel PCR-RFLP into an ongoing drug resistance surveillance effort. Multiple genotypes were detected combining the three molecular markers. The two frequent genotypes in Colombia were SNP7614(C)/27-5(5)/12-5(4) [C54] predominantly distributed in the Atlantic departments and SNP7614 (T)/27-5(4)/12-5(5) [T45] associated with the Andean departments. A novel genotype SNP7614 (C)/27-5(6)/12-5(4) [C64] was detected in cities along the Magdalena river which separates the Andean from Atlantic departments; a subset was further characterized showing association with a rare allele of minisatellite 23-3 and the SNP type 1 of M. leprae. The genotypes within intra-family cases were conserved. Overall, this is the first large scale study that utilized simple and rapid assay formats for identification of major strain types and their distribution in Colombia. It provides the framework for further strain type discrimination and geographic information systems as tools for tracing transmission of leprosy. PMID:23291420
Mycobacterium leprae in Colombia described by SNP7614 in gyrA, two minisatellites and geography.
Cardona-Castro, Nora; Beltrán-Alzate, Juan Camilo; Romero-Montoya, Irma Marcela; Li, Wei; Brennan, Patrick J; Vissa, Varalakshmi
2013-03-01
New cases of leprosy are still being detected in Colombia after the country declared achievement of the WHO defined 'elimination' status. To study the ecology of leprosy in endemic regions, a combination of geographic and molecular tools were applied for a group of 201 multibacillary patients including six multi-case families from eleven departments. The location (latitude and longitude) of patient residences were mapped. Slit skin smears and/or skin biopsies were collected and DNA was extracted. Standard agarose gel electrophoresis following a multiplex PCR-was developed for rapid and inexpensive strain typing of Mycobacterium leprae based on copy numbers of two VNTR minisatellite loci 27-5 and 12-5. A SNP (C/T) in gyrA (SNP7614) was mapped by introducing a novel PCR-RFLP into an ongoing drug resistance surveillance effort. Multiple genotypes were detected combining the three molecular markers. The two frequent genotypes in Colombia were SNP7614(C)/27-5(5)/12-5(4) [C54] predominantly distributed in the Atlantic departments and SNP7614 (T)/27-5(4)/12-5(5) [T45] associated with the Andean departments. A novel genotype SNP7614 (C)/27-5(6)/12-5(4) [C64] was detected in cities along the Magdalena river which separates the Andean from Atlantic departments; a subset was further characterized showing association with a rare allele of minisatellite 23-3 and the SNP type 1 of M. leprae. The genotypes within intra-family cases were conserved. Overall, this is the first large scale study that utilized simple and rapid assay formats for identification of major strain types and their distribution in Colombia. It provides the framework for further strain type discrimination and geographic information systems as tools for tracing transmission of leprosy. Copyright © 2012 Elsevier B.V. All rights reserved.
Arenillas, Leonor; Mallo, Mar; Ramos, Fernando; Guinta, Kathryn; Barragán, Eva; Lumbreras, Eva; Larráyoz, María-José; De Paz, Raquel; Tormo, Mar; Abáigar, María; Pedro, Carme; Cervera, José; Such, Esperanza; José Calasanz, María; Díez-Campelo, María; Sanz, Guillermo F; Hernández, Jesús María; Luño, Elisa; Saumell, Sílvia; Maciejewski, Jaroslaw; Florensa, Lourdes; Solé, Francesc
2013-12-01
Cytogenetic aberrations identified by metaphase cytogenetics (MC) have diagnostic, prognostic, and therapeutic implications in myelodysplastic syndromes (MDS). However, in some MDS patients MC study is unsuccesful. Single nucleotide polymorphism array (SNP-A) based karyotyping could be helpful in these cases. We performed SNP-A in 62 samples from bone marrow or peripheral blood of primary MDS with an unsuccessful MC study. SNP-A analysis enabled the detection of aberrations in 31 (50%) patients. We used the copy number alteration information to apply the International Prognostic Scoring System (IPSS) and we observed differences in survival between the low/intermediate-1 and intermediate-2/high risk patients. We also saw differences in survival between very low/low/intermediate and the high/very high patients when we applied the revised IPSS (IPSS-R). In conclusion, SNP-A can be used successfully in PB samples and the identification of CNA by SNP-A improve the diagnostic and prognostic evaluation of this group of MDS patients. Copyright © 2013 Wiley Periodicals, Inc.
Lavania, M; Jadhav, R S; Turankar, R P; Chaitanya, V S; Singh, M; Sengupta, U
2013-11-01
Earlier studies indicate that genotyping of Mycobaterium leprae based on single-nucleotide polymorphisms (SNPs) is useful for analysis of the global spread of leprosy. In the present study, we investigated the diversity of M. leprae at eight SNP loci using 180 clinical isolates obtained from patients with leprosy residing mainly in Delhi and Purulia (West Bengal) regions. It was observed that the frequency of SNP type 1 and subtype D was most predominant in the Indian population. Further, the SNP type 2 subtype E was noted only from East Delhi region and SNP type 2 subtype G was noted only from the nearby areas of Hoogly district of West Bengal. These results indicate the occurrence of focal transmission of M. leprae infection and demonstrate that analysis by SNP typing has great potential to help researchers in understanding the transmission of M. leprae infection in the community. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.
Köhnemann, Stephan; Hohoff, Carsten; Pfeiffer, Heidi
2009-09-01
We had sequenced 329 Caucasian samples in Hypervariable Region 1 (HVR 1) and found that they belong to eleven different mitochondrial DNA (mtDNA) haplotypes. The sample set was further analysed by an mtDNA assay examining 32 single nucleotide polymorphisms (SNPs) for haplogroup discrimination. In a validation study on 160 samples of different origin it was shown that these SNPs were able to discriminate between the evolved superhaplogroups worldwide (L, M and N) and between the nine most common Caucasian haplogroups (H, I, J, K, T, U, V, W and X). The 32 mtDNA SNPs comprised 42 different SNP haplotypes instead of only eleven haplotypes after HVR 1 sequencing. The assay provided stable results in a range of 5ng genomic DNA down to virtually no genomic DNA per reaction. It was possible to detect samples of African, Asian and Eurasian ancestry, respectively. The 32 mtDNA SNP assay is a helpful adjunct to further distinguish between identical HVR 1 sequences of Caucasian origin. Our results suggest that haplogroup prediction using HVR 1 sequencing provides instable results. The use of coding region SNPs for haplogroup assignment is more suited than using HVR 1 haplotypes.
Tiger, Jeffrey H.; Toussaint, Karen A.; Roath, Christopher T.
2010-01-01
The current study compared the effects of choice and no-choice reinforcement conditions on the task responding of 3 children with autism across 2 single-operant paradigm reinforcer assessments. The first assessment employed simple fixed-ratio (FR) schedules; the second used progressive-ratio (PR) schedules. The latter assessment identified the…
Galehdari, Hamid; Saki, Najmaldin; Mohammadi-Asl, Javad; Rahim, Fakher
2013-01-01
Crigler-Najjar syndrome (CNS) type I and type II are usually inherited as autosomal recessive conditions that result from mutations in the UGT1A1 gene. The main objective of the present review is to summarize results of all available evidence on the accuracy of SNP-based pathogenicity detection tools compared to published clinical result for the prediction of in nsSNPs that leads to disease using prediction performance method. A comprehensive search was performed to find all mutations related to CNS. Database searches included dbSNP, SNPdbe, HGMD, Swissvar, ensemble, and OMIM. All the mutation related to CNS was extracted. The pathogenicity prediction was done using SNP-based pathogenicity detection tools include SIFT, PHD-SNP, PolyPhen2, fathmm, Provean, and Mutpred. Overall, 59 different SNPs related to missense mutations in the UGT1A1 gene, were reviewed. Comparing the diagnostic OR, PolyPhen2 and Mutpred have the highest detection 4.983 (95% CI: 1.24 - 20.02) in both, following by SIFT (diagnostic OR: 3.25, 95% CI: 1.07 - 9.83). The highest MCC of SNP-based pathogenicity detection tools, was belong to SIFT (34.19%) followed by Provean, PolyPhen2, and Mutpred (29.99%, 29.89%, and 29.89%, respectively). Hence the highest SNP-based pathogenicity detection tools ACC, was fit to SIFT (62.71%) followed by PolyPhen2, and Mutpred (61.02%, in both). Our results suggest that some of the well-established SNP-based pathogenicity detection tools can appropriately reflect the role of a disease-associated SNP in both local and global structures.
Directory of Open Access Journals (Sweden)
Kourosh Bamdad
2016-12-01
Full Text Available Background & Objective: Single nucleotide polymorphisms are the cause of genetic variation to living organisms. Single nucleotide polymorphisms alter residues in the protein sequence. In this investigation, the relationship between prion protein gene polymorphisms and its relevance to pathogenicity was studied. Material & Method: Amino acid sequence of the main isoform from the human prion protein gene (PRNP was extracted from UniProt database and evaluated by FoldAmyloid and AmylPred servers. All non-synonymous single nucleotide polymorphisms (nsSNPs from SNP database (dbSNP were further analyzed by bioinformatics servers including SIFT, PolyPhen-2, I-Mutant-3.0, PANTHER, SNPs & GO, PHD-SNP, Meta-SNP, and MutPred to determine the most damaging nsSNPs. Results: The results of the first structure analyses by FoldAmyloid and AmylPerd servers implied that regions including 5-15, 174-178, 180-184, 211-217, and 240-252 were the most sensitive parts of the protein sequence to amyloidosis. Screening all nsSNPs of the main protein isoform using bioinformatic servers revealed that substitution of Aspartic acid with Valine at position 178 (ID code: rs11538766 was the most deleterious nsSNP in the protein structure. Conclusion: Substitution of the Aspartic acid with Valine at position 178 (D178V was the most pathogenic mutation in the human prion protein gene. Analyses from the MutPred server also showed that beta-sheets’ increment in the secondary structure was the main reason behind the molecular mechanism of the prion protein aggregation.
Directory of Open Access Journals (Sweden)
Sung-Chur Sim
Full Text Available The effects of selection on genome variation were investigated and visualized in tomato using a high-density single nucleotide polymorphism (SNP array. 7,720 SNPs were genotyped on a collection of 426 tomato accessions (410 inbreds and 16 hybrids and over 97% of the markers were polymorphic in the entire collection. Principal component analysis (PCA and pairwise estimates of F(st supported that the inbred accessions represented seven sub-populations including processing, large-fruited fresh market, large-fruited vintage, cultivated cherry, landrace, wild cherry, and S. pimpinellifolium. Further divisions were found within both the contemporary processing and fresh market sub-populations. These sub-populations showed higher levels of genetic diversity relative to the vintage sub-population. The array provided a large number of polymorphic SNP markers across each sub-population, ranging from 3,159 in the vintage accessions to 6,234 in the cultivated cherry accessions. Visualization of minor allele frequency revealed regions of the genome that distinguished three representative sub-populations of cultivated tomato (processing, fresh market, and vintage, particularly on chromosomes 2, 4, 5, 6, and 11. The PCA loadings and F(st outlier analysis between these three sub-populations identified a large number of candidate loci under positive selection on chromosomes 4, 5, and 11. The extent of linkage disequilibrium (LD was examined within each chromosome for these sub-populations. LD decay varied between chromosomes and sub-populations, with large differences reflective of breeding history. For example, on chromosome 11, decay occurred over 0.8 cM for processing accessions and over 19.7 cM for fresh market accessions. The observed SNP variation and LD decay suggest that different patterns of genetic variation in cultivated tomato are due to introgression from wild species and selection for market specialization.
2011-01-01
Background High-throughput SNP genotyping has become an essential requirement for molecular breeding and population genomics studies in plant species. Large scale SNP developments have been reported for several mainstream crops. A growing interest now exists to expand the speed and resolution of genetic analysis to outbred species with highly heterozygous genomes. When nucleotide diversity is high, a refined diagnosis of the target SNP sequence context is needed to convert queried SNPs into high-quality genotypes using the Golden Gate Genotyping Technology (GGGT). This issue becomes exacerbated when attempting to transfer SNPs across species, a scarcely explored topic in plants, and likely to become significant for population genomics and inter specific breeding applications in less domesticated and less funded plant genera. Results We have successfully developed the first set of 768 SNPs assayed by the GGGT for the highly heterozygous genome of Eucalyptus from a mixed Sanger/454 database with 1,164,695 ESTs and the preliminary 4.5X draft genome sequence for E. grandis. A systematic assessment of in silico SNP filtering requirements showed that stringent constraints on the SNP surrounding sequences have a significant impact on SNP genotyping performance and polymorphism. SNP assay success was high for the 288 SNPs selected with more rigorous in silico constraints; 93% of them provided high quality genotype calls and 71% of them were polymorphic in a diverse panel of 96 individuals of five different species. SNP reliability was high across nine Eucalyptus species belonging to three sections within subgenus Symphomyrtus and still satisfactory across species of two additional subgenera, although polymorphism declined as phylogenetic distance increased. Conclusions This study indicates that the GGGT performs well both within and across species of Eucalyptus notwithstanding its nucleotide diversity ≥2%. The development of a much larger array of informative SNPs across
Family-based multi-SNP X chromosome analysis using parental information
Directory of Open Access Journals (Sweden)
Alison S. Wise
2016-02-01
Full Text Available We propose a method for association analysis of haplotypes on the X chromosome that offers both improved power and robustness to population stratification in studies of affected offspring and their parents if all three have been genotyped. The method makes use of assumed parental haplotype exchangeability, a weaker assumption than Hardy-Weinberg equilibrium. Parental haplotype exchangeability requires that in the source population, of the three X chromosome haplotypes carried by the two parents, each is equally likely to be carried by the father. We propose a pseudo-sibling approach that exploits that exchangeability assumption. Our method extends the single-SNP PIX-LRT method to multiple SNPs in a high linkage block. We describe methods for testing the parental haplotype exchangeability assumption and also for determining how apparent violations can be distinguished from true fetal effects or maternally-mediated effects. We show results of simulations that demonstrate nominal type I error rate and good power. The methods are then applied to dbGaP data on the birth defect oral cleft, using both Asian and Caucasian families with cleft.
Directory of Open Access Journals (Sweden)
Charlotte Tollenaere
Full Text Available Molecular tools may greatly improve our understanding of pathogen evolution and epidemiology but technical constraints have hindered the development of genetic resources for parasites compared to free-living organisms. This study aims at developing molecular tools for Podosphaera plantaginis, an obligate fungal pathogen of Plantago lanceolata. This interaction has been intensively studied in the Åland archipelago of Finland with epidemiological data collected from over 4,000 host populations annually since year 2001.A cDNA library of a pooled sample of fungal conidia was sequenced on the 454 GS-FLX platform. Over 549,411 reads were obtained and annotated into 45,245 contigs. Annotation data was acquired for 65.2% of the assembled sequences. The transcriptome assembly was screened for SNP loci, as well as for functionally important genes (mating-type genes and potential effector proteins. A genotyping assay of 27 SNP loci was designed and tested on 380 infected leaf samples from 80 populations within the Åland archipelago. With this panel we identified 85 multilocus genotypes (MLG with uneven frequencies across the pathogen metapopulation. Approximately half of the sampled populations contain polymorphism. Our genotyping protocol revealed mixed-genotype infection within a single host leaf to be common. Mixed infection has been proposed as one of the main drivers of pathogen evolution, and hence may be an important process in this pathosystem.The developed SNP panel offers exciting research perspectives for future studies in this well-characterized pathosystem. Also, the transcriptome provides an invaluable novel genomic resource for powdery mildews, which cause significant yield losses on commercially important crops annually. Furthermore, the features that render genetic studies in this system a challenge are shared with the majority of obligate parasitic species, and hence our results provide methodological insights from SNP calling to field
Yang, Xiao; Li, Huijian; Hu, Minzheng; Liu, Zeliang; Wärnå, John; Cao, Yuying; Ahuja, Rajeev; Luo, Wei
2018-04-01
A method to obtain the equivalent Poisson's ratio in chemical bonds as classical beams with finite element method was proposed from experimental data. The UFF (Universal Force Field) method was employed to calculate the elastic force constants of Zrsbnd O bonds. By applying the equivalent Poisson's ratio, the mechanical properties of single-wall ZrNTs (ZrO2 nanotubes) were investigated by finite element analysis. The nanotubes' Young's modulus (Y), Poisson's ratio (ν) of ZrNTs as function of diameters, length and chirality have been discussed, respectively. We found that the Young's modulus of single-wall ZrNTs is calculated to be between 350 and 420 GPa.
SNP-Seek II: A resource for allele mining and analysis of big genomic data in Oryza sativa
Directory of Open Access Journals (Sweden)
Locedie Mansueto
2016-11-01
In this paper, we discuss the datasets stored in SNP-Seek, architecture of the database and web application, interoperability methodologies in place, and discuss a few use cases demonstrating the utility of SNP-Seek for diversity analysis and molecular breeding.
Evaluation of Bovine High-Density SNP Genotyping Array in Indigenous Dairy Cattle Breeds.
Dash, S; Singh, A; Bhatia, A K; Jayakumar, S; Sharma, A; Singh, S; Ganguly, I; Dixit, S P
2018-04-03
In total 52 samples of Sahiwal ( 19 ), Tharparkar ( 17 ), and Gir ( 16 ) were genotyped by using BovineHD SNP chip to analyze minor allele frequency (MAF), genetic diversity, and linkage disequilibrium among these cattle. The common SNPs of BovineHD and 54K SNP Chips were also extracted and evaluated for their performance. Only 40%-50% SNPs of these arrays was found informative for genetic analysis in these cattle breeds. The overall mean of MAF for SNPs of BovineHD SNPChip was 0.248 ± 0.006, 0.241 ± 0.007, and 0.242 ± 0.009 in Sahiwal, Tharparkar and Gir, respectively, while that for 54K SNPs was on lower side. The average Reynold's genetic distance between breeds ranged from 0.042 to 0.055 based on BovineHD Beadchip, and from 0.052 to 0.084 based on 54K SNP Chip. The estimates of genetic diversity based on HD and 54K chips were almost same and, hence, low density chip seems to be good enough to decipher genetic diversity of these cattle breeds. The linkage disequilibrium started decaying (r 2 < 0.2) at 140 kb inter-marker distance and, hence, a 20K low density customized SNP array from HD chip could be designed for genomic selection in these cattle else the 54K Bead Chip as such will be useful.
Correlating single nucleotide polymorphisms in the myostatin gene with performance traits in rabbit
Directory of Open Access Journals (Sweden)
E.M. Abdel-Kafy
2016-09-01
Full Text Available The Myostatin (MSTN, or Growth and Differentiation Factor 8 (GDF8, gene has been implicated in the double muscling phenomenon, in which a series of mutations render the gene inactive and unable to properly regulate muscle fibre deposition. Single nucleotide polymorphisms (SNPs in the MSTN gene have been correlated to production traits, making it a candidate target gene to enhance livestock and fowl productivity. This study aimed to assess any association of three SNPs in the rabbit MSTN gene (c.713T>A in exon 2, c.747+34C>T in intron 2, and c.*194A>G in 3’-untranslated region and their combinations, with carcass, production and reproductive traits. The investigated traits included individual body weight, daily body weight gain, carcass traits and reproductive traits. The 3 SNPs were screened using PCR-restriction fragment length polymorphism (RFLP-based analysis and the effects of the different SNP genotypes and their combinations were estimated in a rabbit population. Additionally, additive and dominance effects were estimated for significant traits. The results found no significant association between the c.713 T>A SNP and all the examined traits. Allele T at the c.747+34C>T SNP was only significantly associated (PG, allele G was significantly associated (PG SNP also had positive effects on most carcass traits. The estimated additive genetic effect for the c.*194A>G SNP was significant (PA and c.747+34C>T, GG at the c.*194A>G SNP correlated with highest values in body weight and daily weight gain. In conclusion, the ‘G’ allele at the c.*194A>G SNP had positive effects on growth and carcass traits and so could be used as a favourable allele in planning rabbit selection. Further population-wide studies are necessary to test the association of the c.*194A>G SNP with carcass traits. We also recommend evaluation of the potential effects of the c.*194A>G SNP on MSTN gene expression.
Directory of Open Access Journals (Sweden)
Aubrey E Hill
Full Text Available Like many other ancient genes, the cystic fibrosis transmembrane conductance regulator (CFTR has survived for hundreds of millions of years. In this report, we consider whether such prodigious longevity of an individual gene--as opposed to an entire genome or species--should be considered surprising in the face of eons of relentless DNA replication errors, mutagenesis, and other causes of sequence polymorphism. The conventions that modern human SNP patterns result either from purifying selection or random (neutral drift were not well supported, since extant models account rather poorly for the known plasticity and function (or the established SNP distributions found in a multitude of genes such as CFTR. Instead, our analysis can be taken as a polemic indicating that SNPs in CFTR and many other mammalian genes may have been generated--and continue to accrue--in a fundamentally more organized manner than would otherwise have been expected. The resulting viewpoint contradicts earlier claims of 'directional' or 'intelligent design-type' SNP formation, and has important implications regarding the pace of DNA adaptation, the genesis of conserved non-coding DNA, and the extent to which eukaryotic SNP formation should be viewed as adaptive.
Study of molasses / vinasse waste ratio for single cell protein and total microorganisms
Directory of Open Access Journals (Sweden)
Marcia Luciana Cazetta
2006-02-01
Full Text Available Different molasses/ vinasse ratio were used as substrate to investigate single cell protein and total lipids production by five microorganisms: four yeasts strains: Candida lipolytica, Rhodotorula mucilaginosa, Saccharomyces cerevisiae, a yeast isolated from vinasse lake (denominated LLV98 and a bacterium strain, Corynebacterium glutamicum. The media utilized were: a 50% molasses and 50% vinasse; b 25% molasses and 75% vinasse and c 75% molasses and 25% vinasse. The objective of this work was to study the growth of microorganisms and also evaluate protein and lipids content in the biomass obtained from these by-products. The highest single cell protein production was obtained by S. cerevisiae, 50.35%, followed by R. mucilaginosa, 41.96%. The lowest productions were obtained by C. glutamicum. The higher total lipids productions, more than 26%, were founded in molasses plus vinasse at 50%/50% by S. cerevisiae and C. glutamicum.
Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G
2017-07-19
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.
Reliable single chip genotyping with semi-parametric log-concave mixtures.
Directory of Open Access Journals (Sweden)
Ralph C A Rippe
Full Text Available The common approach to SNP genotyping is to use (model-based clustering per individual SNP, on a set of arrays. Genotyping all SNPs on a single array is much more attractive, in terms of flexibility, stability and applicability, when developing new chips. A new semi-parametric method, named SCALA, is proposed. It is based on a mixture model using semi-parametric log-concave densities. Instead of using the raw data, the mixture is fitted on a two-dimensional histogram, thereby making computation time almost independent of the number of SNPs. Furthermore, the algorithm is effective in low-MAF situations.Comparisons between SCALA and CRLMM on HapMap genotypes show very reliable calling of single arrays. Some heterozygous genotypes from HapMap are called homozygous by SCALA and to lesser extent by CRLMM too. Furthermore, HapMap's NoCalls (NN could be genotyped by SCALA, mostly with high probability. The software is available as R scripts from the website www.math.leidenuniv.nl/~rrippe.
Kobayashi, Masaaki
2017-04-20
Recent availability of large-scale genomic resources enables us to conduct so called genome-wide association studies (GWAS) and genomic prediction (GP) studies, particularly with next-generation sequencing (NGS) data. The effectiveness of GWAS and GP depends on not only their mathematical models, but the quality and quantity of variants employed in the analysis. In NGS single nucleotide polymorphism (SNP) calling, conventional tools ideally require more reads for higher SNP sensitivity and accuracy. In this study, we aimed to develop a tool, Heap, that enables robustly sensitive and accurate calling of SNPs, particularly with a low coverage NGS data, which must be aligned to the reference genome sequences in advance. To reduce false positive SNPs, Heap determines genotypes and calls SNPs at each site except for sites at the both ends of reads or containing a minor allele supported by only one read. Performance comparison with existing tools showed that Heap achieved the highest F-scores with low coverage (7X) restriction-site associated DNA sequencing reads of sorghum and rice individuals. This will facilitate cost-effective GWAS and GP studies in this NGS era. Code and documentation of Heap are freely available from https://github.com/meiji-bioinf/heap (29 March 2017, date last accessed) and our web site (http://bioinf.mind.meiji.ac.jp/lab/en/tools.html (29 March 2017, date last accessed)).
Pearce, Madison E; Alikhan, Nabil-Fareed; Dallman, Timothy J; Zhou, Zhemin; Grant, Kathie; Maiden, Martin C J
2018-06-02
Multi-country outbreaks of foodborne bacterial disease present challenges in their detection, tracking, and notification. As food is increasingly distributed across borders, such outbreaks are becoming more common. This increases the need for high-resolution, accessible, and replicable isolate typing schemes. Here we evaluate a core genome multilocus typing (cgMLST) scheme for the high-resolution reproducible typing of Salmonella enterica (S. enterica) isolates, by its application to a large European outbreak of S. enterica serovar Enteritidis. This outbreak had been extensively characterised using single nucleotide polymorphism (SNP)-based approaches. The cgMLST analysis was congruent with the original SNP-based analysis, the epidemiological data, and whole genome MLST (wgMLST) analysis. Combination of the cgMLST and epidemiological data confirmed that the genetic diversity among the isolates predated the outbreak, and was likely present at the infection source. There was consequently no link between country of isolation and genetic diversity, but the cgMLST clusters were congruent with date of isolation. Furthermore, comparison with publicly available Enteritidis isolate data demonstrated that the cgMLST scheme presented is highly scalable, enabling outbreaks to be contextualised within the Salmonella genus. The cgMLST scheme is therefore shown to be a standardised and scalable typing method, which allows Salmonella outbreaks to be analysed and compared across laboratories and jurisdictions. Copyright © 2018. Published by Elsevier B.V.
Using SNP array to identify aneuploidy and segmental imbalance in translocation carriers
Directory of Open Access Journals (Sweden)
B. Xiong
2014-12-01
In addition to genetic testing techniques, the embryo biopsy stage (polar body, cleavage embryo or blastocyst and the mode of embryo transfer (fresh or frozen embryos can affect the outcome of PGD. It is now generally recommended that blastomere biopsy should be replaced by blastocyst biopsy to avoid a high mosaic rate and biopsy-related damage to cleavage-stage embryos, which might affect embryo development. However, more clinical data are required to confirm that the technique of SNP array-based PGD (SNP-PGD combined with trophectoderm (TE biopsy and frozen embryo transfer (FET is superior to traditional FISH-PGD combined with Day 3 (D3 blastomere biopsy and fresh embryo transfer.
Directory of Open Access Journals (Sweden)
Gómez Marcela
2009-12-01
Full Text Available Abstract Background Expressed sequence tags (ESTs are an important source of gene-based markers such as those based on insertion-deletions (Indels or single-nucleotide polymorphisms (SNPs. Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs, to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction
Galeano, Carlos H; Fernández, Andrea C; Gómez, Marcela; Blair, Matthew W
2009-12-23
Expressed sequence tags (ESTs) are an important source of gene-based markers such as those based on insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs), to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 x G19833 recombinant inbred line (RIL) population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 x 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction of a transcript map and given their high conservation
Directory of Open Access Journals (Sweden)
Carr Steven M
2007-09-01
Full Text Available Abstract Background Iterative DNA "resequencing" on oligonucleotide microarrays offers a high-throughput method to measure intraspecific biodiversity, one that is especially suited to SNP-dense gene regions such as vertebrate mitochondrial (mtDNA genomes. However, costs of single-species design and microarray fabrication are prohibitive. A cost-effective, multi-species strategy is to hybridize experimental DNAs from diverse species to a common microarray that is tiled with oligonucleotide sets from multiple, homologous reference genomes. Such a strategy requires that cross-hybridization between the experimental DNAs and reference oligos from the different species not interfere with the accurate recovery of species-specific data. To determine the pattern and limits of such interspecific hybridization, we compared the efficiency of sequence recovery and accuracy of SNP identification by a 15,452-base human-specific microarray challenged with human, chimpanzee, gorilla, and codfish mtDNA genomes. Results In the human genome, 99.67% of the sequence was recovered with 100.0% accuracy. Accuracy of SNP identification declines log-linearly with sequence divergence from the reference, from 0.067 to 0.247 errors per SNP in the chimpanzee and gorilla genomes, respectively. Efficiency of sequence recovery declines with the increase of the number of interspecific SNPs in the 25b interval tiled by the reference oligonucleotides. In the gorilla genome, which differs from the human reference by 10%, and in which 46% of these 25b regions contain 3 or more SNP differences from the reference, only 88% of the sequence is recoverable. In the codfish genome, which differs from the reference by > 30%, less than 4% of the sequence is recoverable, in short islands ≥ 12b that are conserved between primates and fish. Conclusion Experimental DNAs bind inefficiently to homologous reference oligonucleotide sets on a re-sequencing microarray when their sequences differ by
Meas.of the Ratio Between Double and Single Ionization of Helium for Antiprotons
2002-01-01
The aim of this experiment is to measure the ratio between double and single ionization of helium by antiprotons in the energy range $>$~3~MeV. Comparison with already existing proton data will yield information on the mechanisms for double ionization, which could not be extracted from previous comparisons between ratios measured for equivelocity electrons and protons. The most basic information to be obtained from an antiproton experiment will be the amount of correlation existing between the two electrons in the ground-state helium atom.\\\\ \\\\ The equipment consists of a gas cell, which employs slow-ion collection via the so-called condenser-plate method for the absolute sum of partial-ionization cross sections and determination of the relative contribution of multiple charged ions by TOF. The gas cell has movable entrance and exit slits and a grid system to account for secondary emission from the collection of slow ions. Together with a field of 800~V/cm in the collision region, the potentials of the TOF sp...
2011-09-01
SNP Array v2. A ‘proof-of-concept’ advanced data mining algorithm for unsupervised analysis of genome-wide association study (GWAS) dataset was... Opal F AUS Yes U141 Peggs F AUS Yes U142 Taxi F AUS Yes U143 Riso MI MAL Yes U144 Szarik MI GSD Yes U145 Astor MI MAL Yes U146 Roy MC MAL Yes... mining of genetic studies in general, and especially GWAS. As a proof-of-concept, a classification analysis of the WG SNP typing dataset of a
Directory of Open Access Journals (Sweden)
Kumar Santosh
2012-12-01
Full Text Available Abstract Background Flax (Linum usitatissimum L. is a significant fibre and oilseed crop. Current flax molecular markers, including isozymes, RAPDs, AFLPs and SSRs are of limited use in the construction of high density linkage maps and for association mapping applications due to factors such as low reproducibility, intense labour requirements and/or limited numbers. We report here on the use of a reduced representation library strategy combined with next generation Illumina sequencing for rapid and large scale discovery of SNPs in eight flax genotypes. SNP discovery was performed through in silico analysis of the sequencing data against the whole genome shotgun sequence assembly of flax genotype CDC Bethune. Genotyping-by-sequencing of an F6-derived recombinant inbred line population provided validation of the SNPs. Results Reduced representation libraries of eight flax genotypes were sequenced on the Illumina sequencing platform resulting in sequence coverage ranging from 4.33 to 15.64X (genome equivalents. Depending on the relatedness of the genotypes and the number and length of the reads, between 78% and 93% of the reads mapped onto the CDC Bethune whole genome shotgun sequence assembly. A total of 55,465 SNPs were discovered with the largest number of SNPs belonging to the genotypes with the highest mapping coverage percentage. Approximately 84% of the SNPs discovered were identified in a single genotype, 13% were shared between any two genotypes and the remaining 3% in three or more. Nearly a quarter of the SNPs were found in genic regions. A total of 4,706 out of 4,863 SNPs discovered in Macbeth were validated using genotyping-by-sequencing of 96 F6 individuals from a recombinant inbred line population derived from a cross between CDC Bethune and Macbeth, corresponding to a validation rate of 96.8%. Conclusions Next generation sequencing of reduced representation libraries was successfully implemented for genome-wide SNP discovery from
Nicolazzi, Ezequiel L; Caprera, Andrea; Nazzicari, Nelson; Cozzi, Paolo; Strozzi, Francesco; Lawley, Cindy; Pirani, Ali; Soans, Chandrasen; Brew, Fiona; Jorjani, Hossein; Evans, Gary; Simpson, Barry; Tosser-Klopp, Gwenola; Brauning, Rudiger; Williams, John L; Stella, Alessandra
2015-04-10
In recent years, the use of genomic information in livestock species for genetic improvement, association studies and many other fields has become routine. In order to accommodate different market requirements in terms of genotyping cost, manufacturers of single nucleotide polymorphism (SNP) arrays, private companies and international consortia have developed a large number of arrays with different content and different SNP density. The number of currently available SNP arrays differs among species: ranging from one for goats to more than ten for cattle, and the number of arrays available is increasing rapidly. However, there is limited or no effort to standardize and integrate array- specific (e.g. SNP IDs, allele coding) and species-specific (i.e. past and current assemblies) SNP information. Here we present SNPchiMp v.3, a solution to these issues for the six major livestock species (cow, pig, horse, sheep, goat and chicken). Original data was collected directly from SNP array producers and specific international genome consortia, and stored in a MySQL database. The database was then linked to an open-access web tool and to public databases. SNPchiMp v.3 ensures fast access to the database (retrieving within/across SNP array data) and the possibility of annotating SNP array data in a user-friendly fashion. This platform allows easy integration and standardization, and it is aimed at both industry and research. It also enables users to easily link the information available from the array producer with data in public databases, without the need of additional bioinformatics tools or pipelines. In recognition of the open-access use of Ensembl resources, SNPchiMp v.3 was officially credited as an Ensembl E!mpowered tool. Availability at http://bioinformatics.tecnoparco.org/SNPchimp.
Effects of the physiological parameters on the signal-to-noise ratio of single myoelectric channel
Directory of Open Access Journals (Sweden)
Zhang YT
2007-08-01
Full Text Available Abstract Background An important measure of the performance of a myoelectric (ME control system for powered artificial limbs is the signal-to-noise ratio (SNR at the output of ME channel. However, few studies illustrated the neuron-muscular interactive effects on the SNR at ME control channel output. In order to obtain a comprehensive understanding on the relationship between the physiology of individual motor unit and the ME control performance, this study investigates the effects of physiological factors on the SNR of single ME channel by an analytical and simulation approach, where the SNR is defined as the ratio of the mean squared value estimation at the channel output and the variance of the estimation. Methods Mathematical models are formulated based on three fundamental elements: a motoneuron firing mechanism, motor unit action potential (MUAP module, and signal processor. Myoelectric signals of a motor unit are synthesized with different physiological parameters, and the corresponding SNR of single ME channel is numerically calculated. Effects of physiological multi factors on the SNR are investigated, including properties of the motoneuron, MUAP waveform, recruitment order, and firing pattern, etc. Results The results of the mathematical model, supported by simulation, indicate that the SNR of a single ME channel is associated with the voluntary contraction level. We showed that a model-based approach can provide insight into the key factors and bioprocess in ME control. The results of this modelling work can be potentially used in the improvement of ME control performance and for the training of amputees with powered prostheses. Conclusion The SNR of single ME channel is a force, neuronal and muscular property dependent parameter. The theoretical model provides possible guidance to enhance the SNR of ME channel by controlling physiological variables or conscious contraction level.
In silico characterization of functional SNP within the oestrogen ...
Indian Academy of Sciences (India)
MAHA REBAÕ
found that one SNP in 5 UTR may potentially change protein expression level, nine SNPs were found to affect miRNA binding site and 28 SNPs might affect ..... Riancho et al. 2010), breast cancer (Tapper et al. 2008; Ding et al. .... in postmenopausal women: associations with common estrogen receptor alpha polymorphic ...
Directory of Open Access Journals (Sweden)
Hiroshi Onuma
Full Text Available Insulin resistance is a feature of type 2 diabetes. Resistin, secreted from adipocytes, causes insulin resistance in mice. We previously reported that the G/G genotype of single nucleotide polymorphism (SNP at -420 (rs1862513 in the human resistin gene (RETN increased susceptibility to type 2 diabetes by enhancing its promoter activity. Plasma resistin was highest in Japanese subjects with G/G genotype, followed by C/G, and C/C. In this study, we cross-sectionally analyzed plasma resistin and SNPs in the RETN region in 2,019 community-dwelling Japanese subjects. Plasma resistin was associated with SNP-638 (rs34861192, SNP-537 (rs34124816, SNP-420, SNP-358 (rs3219175, SNP+299 (rs3745367, and SNP+1263 (rs3745369 (P<10(-13 in all cases. SNP-638, SNP -420, SNP-358, and SNP+157 were in the same linkage disequilibrium (LD block. SNP-358 and SNP-638 were nearly in complete LD (r(2 = 0.98, and were tightly correlated with SNP-420 (r(2 = 0.50, and 0.51, respectively. The correlation between either SNP-358 (or SNP-638 or SNP-420 and plasma resistin appeared to be strong (risk alleles for high plasma resistin; A at SNP-358, r(2 = 0.5224, P = 4.94x10(-324; G at SNP-420, r(2 = 0.2616, P = 1.71x10(-133. In haplotypes determined by SNP-420 and SNP-358, the estimated frequencies for C-G, G-A, and G-G were 0.6700, 0.2005, and 0.1284, respectively, and C-A was rare (0.0011, suggesting that subjects with A at -358, generally had G at -420. This G-A haplotype conferred the highest plasma resistin (8.24 ng/ml difference/allele compared to C-G, P<0.0001. In THP-1 cells, the RETN promoter with the G-A haplotype showed the highest activity. Nuclear proteins specifically recognized one base difference at SNP-358, but not at SNP-638. Therefore, A at -358 is required for G at -420 to confer the highest plasma resistin in the general Japanese population. In Caucasians, the association between SNP-420 and plasma resistin is not strong, and A at -358 may not exist
Murine Double Minute 2 SNP T309G Polymorphism and Urinary Tract Cancer Risk: A Meta-Analysis.
Ding, Hui; Dai, Yu; Ning, Zhongyun; Fan, Ning; Wang, Zhiping; Li, Pei; Zhang, Liyuan; Tao, Yan; Wang, Hanzhang
2016-03-01
Urinary tract cancer is a common cause of cancer-related death. The etiology and pathogenesis of urinary tract cancer remain unclear, with genetic and epigenetic factors playing an important role. Studies of the polymorphism of murine double minute 2 (MDM2) have shown inconclusive trends in the risk of urinary tract cancer.To clarify this inconsistency, we conducted updated meta-analyses to evaluate the role of MDM2 T309G polymorphism in urinary tract cancer susceptibility.Data sources were Pubmed (1966-May 2015), Chinese biomedicine literature database (1978-May 2015), and hand searching of the reference lists of included studies:(1) research categories case-control study or a nested case-control study; (2) information evaluating the association between the MDM2 SNP309 and urinary tract cancer risk; (3) studies with sufficient data to perform a meta-analysis.It included the use of odds ratios (ORs) to assess the strength of the association, and 95% confidence intervals (CIs) give a sense of the precision of the estimate. We used I for the assessment of between-study heterogeneity, and publication bias was assessed using the funnel plot and the Egger test. Statistical analyses were performed by Review Manage, version 5.0 and Stata 11.0.A total of 18 studies met the eligibility criteria and were included in our analyses. Overall, there was no statistical association between MDM2 SNP309 and prostate cancer risk for the allele contrast, the GG genotype, the recessive genetic model, the dominant genetic model, and prostate cancer risk in all subjects (OR = 0.96, 95% CI 0.87-1.05, P = 0.36; OR = 0.93, 95% CI 0.75-1.15, P = 0.50; OR = 1.00, 95% CI 0.87-1.15, P = 0.99; OR = 0.93, 95% CI 0.80-1.07, P = 0.30), and between MDM2 SNP309 and bladder cancer risk (the allele contrast: OR = 1.06, 95% CI 0.89-1.27, P = 0.50; the GG genotype: OR = 1.12, 95% CI 0.79-1.61, P = 0.52; the dominant genetic model: OR = 1.03, 95% CI 0
Directory of Open Access Journals (Sweden)
Karin A Vineretsky
Full Text Available A single nucleotide polymorphism (SNP 35 kb upstream of the HLA-C gene is associated with HLA-C expression, and the high expressing genotype (CC has been associated with HIV-I control. HLA-C is unique among the classical MHC class I molecules for its role in the control of viral infections and recognition of abnormal or missing self. This immunosurveillance is central to the pathogenesis of non-melanoma skin cancer (NMSC, and of squamous cell carcinoma (SCC in particular. While sun exposure is a major risk factor for these cancers, cutaneous infections with genus β-HPV have been implicated in the development of SCC. We hypothesized that the high expression HLA-C genotype is associated with β-HPV infections. Therefore, we investigated the association between β-HPV serology and the -35 kb SNP (rs9264942 in a population-based case-control study of 510 SCC cases and 608 controls. Among controls, the high expression -35 kb SNP genotype (CC reduced the likelihood of positive serology for multiple (≥2 β-HPV infections (OR = 0.49, 95% CI: 0.25-0.97, and β-HPV species 2 infection (OR = 0.43, 95% CI: 0.23-0.79. However, no association with β-HPV status was observed among SCC cases. Our findings suggest that underlying immunogenotype plays an important role in differential control of β-HPV in SCC cases and controls.
Mining and Analysis of SNP in Response to Salinity Stress in Upland Cotton (Gossypium hirsutum L.).
Wang, Xiaoge; Lu, Xuke; Wang, Junjuan; Wang, Delong; Yin, Zujun; Fan, Weili; Wang, Shuai; Ye, Wuwei
2016-01-01
Salinity stress is a major abiotic factor that affects crop output, and as a pioneer crop in saline and alkaline land, salt tolerance study of cotton is particularly important. In our experiment, four salt-tolerance varieties with different salt tolerance indexes including CRI35 (65.04%), Kanghuanwei164 (56.19%), Zhong9807 (55.20%) and CRI44 (50.50%), as well as four salt-sensitive cotton varieties including Hengmian3 (48.21%), GK50 (40.20%), Xinyan96-48 (34.90%), ZhongS9612 (24.80%) were used as the materials. These materials were divided into salt-tolerant group (ST) and salt-sensitive group (SS). Illumina Cotton SNP 70K Chip was used to detect SNP in different cotton varieties. SNPv (SNP variation of the same seedling pre- and after- salt stress) in different varieties were screened; polymorphic SNP and SNPr (SNP related to salt tolerance) were obtained. Annotation and analysis of these SNPs showed that (1) the induction efficiency of salinity stress on SNPv of cotton materials with different salt tolerance index was different, in which the induction efficiency on salt-sensitive materials was significantly higher than that on salt-tolerant materials. The induction of salt stress on SNPv was obviously biased. (2) SNPv induced by salt stress may be related to the methylation changes under salt stress. (3) SNPr may influence salt tolerance of plants by affecting the expression of salt-tolerance related genes.
Application of high resolution SNP arrays in patients with congenital ...
Indian Academy of Sciences (India)
clinical experience in implementing whole-genome high-resolution SNP arrays to investigate 33 patients with syndromic and .... Online Mendelian Inheritance in Man database (OMIM, ..... of damaged mitochondria through either autophagy or mito- ..... malformations: associations with maternal and infant character- istics in a ...
International Nuclear Information System (INIS)
Ushijima, Yo; Sugihara, Hiroki; Okuyama, Chio; Okitsu, Sigeyuki; Nii, Takeshi; Nishida, Takuji; Okamoto, Kunio; Maeda, Tomoho
1997-01-01
Measurement of 99m Tc-MAG 3 plasma clearance based on one-compartment model (MPC method) is a non-invasive method using the renal uptake ratio. We evaluated the clinical usefulness of this method, compared with effective renal plasma flow (ERPF) using 123 I-OIH and two single-plasma sample methods using 99m Tc-MAG 3 (Russell method and Bubeck method). The ratio of 99m Tc-MAG 3 clearance to ERPF was 1.00±0.26. MPC method correlated well with Russell and Bubeck methods (r=0.904, r=0.897). We conclude that MPC method is a suitable replacement for single-plasma sample method in routine clinical use. (author)
MDM2 SNP309 promoter polymorphism and p53 mutations in urinary bladder carcinoma stage T1
Directory of Open Access Journals (Sweden)
Olsson Hans
2013-01-01
Full Text Available Abstract Background Urinary bladder carcinoma stage T1 is an unpredictable disease that in some cases has a good prognosis with only local or no recurrence, but in others can appear as a more aggressive tumor with progression to more advanced stages. The aim here was to investigate stage T1 tumors regarding MDM2 promoter SNP309 polymorphism, mutations in the p53 gene, and expression of p53 and p16 measured by immunohistochemistry, and subsequently relate these changes to tumor recurrence and progression. We examined a cohort of patients with primary stage T1 urothelial carcinoma of the bladder and their tumors. Methods After re-evaluation of the original slides and exclusions, the study population comprised 141 patients, all with primary stage T1 urothelial carcinoma of the bladder. The hospital records were screened for clinical parameters and information concerning presence of histologically proven recurrence and progression. The paraffin-embedded tumor material was evaluated by immunohistochemistry. Any mutations found in the p53 gene were studied by single-strand conformation analysis and Sanger sequencing. The MDM2 SNP309 polymorphism was investigated by pyrosequencing. Multivariate analyses concerning association with prognosis were performed, and Kaplan-Meier analysis was conducted for a combination of changes and time to progression. Results Of the 141 patients, 82 had at least one MDM2 SNP309 G allele, and 53 had a mutation in the p53 gene, but neither of those anomalies was associated with a worse prognosis. A mutation in the p53 gene was associated with immunohistochemically visualized p53 protein expression at a cut-off value of 50%. In the group with p53 mutation Kaplan-Meier analysis showed higher rate of progression and shorter time to progression in patients with immunohistochemically abnormal p16 expression compared to them with normal p16 expression (p = 0.038. Conclusions MDM2 SNP309 promoter polymorphism and mutations in
SNP discovery in candidate adaptive genes using exon capture in a free-ranging alpine ungulate
Roffler, Gretchen H.; Amish, Stephen J.; Smith, Seth; Cosart, Ted F.; Kardos, Marty; Schwartz, Michael K.; Luikart, Gordon
2016-01-01
Identification of genes underlying genomic signatures of natural selection is key to understanding adaptation to local conditions. We used targeted resequencing to identify SNP markers in 5321 candidate adaptive genes associated with known immunological, metabolic and growth functions in ovids and other ungulates. We selectively targeted 8161 exons in protein-coding and nearby 5′ and 3′ untranslated regions of chosen candidate genes. Targeted sequences were taken from bighorn sheep (Ovis canadensis) exon capture data and directly from the domestic sheep genome (Ovis aries v. 3; oviAri3). The bighorn sheep sequences used in the Dall's sheep (Ovis dalli dalli) exon capture aligned to 2350 genes on the oviAri3 genome with an average of 2 exons each. We developed a microfluidic qPCR-based SNP chip to genotype 476 Dall's sheep from locations across their range and test for patterns of selection. Using multiple corroborating approaches (lositan and bayescan), we detected 28 SNP loci potentially under selection. We additionally identified candidate loci significantly associated with latitude, longitude, precipitation and temperature, suggesting local environmental adaptation. The three methods demonstrated consistent support for natural selection on nine genes with immune and disease-regulating functions (e.g. Ovar-DRA, APC, BATF2, MAGEB18), cell regulation signalling pathways (e.g. KRIT1, PI3K, ORRC3), and respiratory health (CYSLTR1). Characterizing adaptive allele distributions from novel genetic techniques will facilitate investigation of the influence of environmental variation on local adaptation of a northern alpine ungulate throughout its range. This research demonstrated the utility of exon capture for gene-targeted SNP discovery and subsequent SNP chip genotyping using low-quality samples in a nonmodel species.
Ewing's sarcoma: analysis of single nucleotide polymorphism in the EWS gene.
Silva, Deborah S B S; Sawitzki, Fernanda R; De Toni, Elisa C; Graebin, Pietra; Picanco, Juliane B; Abujamra, Ana Lucia; de Farias, Caroline B; Roesler, Rafael; Brunetto, Algemir L; Alho, Clarice S
2012-11-10
We aimed to investigate single nucleotide polymorphisms (SNPs) in the EWS gene breaking region in order to analyze Ewing's sarcoma susceptibility. The SNPs were investigated in a healthy subject population and in Ewing's sarcoma patients from Southern Brazil. Genotyping was performed by TaqMan® assay for allelic discrimination using Real-Time PCR. The analysis of incidence of SNPs or different SNP-arrangements revealed a higher presence of homozygote TT-rs4820804 in Ewing's sarcoma patients (p=0.02; Chi Square Test). About 300 bp from the rs4820804 SNP lies a palindromic hexamer (5'-GCTAGC-3') and three nucleotides (GTC), which were previously identified to be in close vicinity of the breakpoint junction in both EWS and FLI1 genes. This DNA segment surrounding the rs4820804 SNP is likely to indicate a breakpoint region. If the T-rs4820804 allele predisposes a DNA fragment to breakage, homozygotes (TT-rs4820804) would have double the chance of having a chromosome break, increasing the chances for a translocation to occur. In conclusion, the TT-rs4820804 EWS genotype can be associated with Ewing's sarcoma and the SNP rs4820804 can be a candidate marker to understand Ewing's sarcoma susceptibility. Copyright © 2012 Elsevier B.V. All rights reserved.
Detection of new single nucleotide polymorphisms by means of real ...
Indian Academy of Sciences (India)
Unknown
amplified millions to billions of times by means of a PCR before the PCR product ... Keywords. Single nucleotide polymorphism; real time PCR; DNA melting curve analysis. ... VAL158MET SNP and alcoholism and to test for interac- tions between the .... indicate a heterozygote sample (VAL/MET genotype). The curve with ...
Directory of Open Access Journals (Sweden)
Ravindra Donde
2017-10-01
Full Text Available Recent advances in the area of genomics have led to the development of high throughput genotyping platforms that have immensely contributed to molecular breeding programs. Custom-designed single nucleotide polymorphism (SNP arrays provide an efficient, cost effective, high throughput genotyping tool for QTL/gene mapping, variety identification, marker-assisted selection, etc. In the current study, two interspecific libraries of Chromosome Segment Substitution Lines (CSSLs were evaluated under both drought and control conditions to identify lines with superior yield under drought. The CSSL libraries consisted of 48 BC4F3 lines derived from O. sativa cv. Curinga (tropical japonica x O. rufipogon, and 32 BC4F3 lines derived from O. sativa cv. Curinga (tropical japonica x O. meridionalis. The phenotypic screening of these 80 CSSLs led to the identification of three lines, MER-20, RUF-16, and RUF-44, that yielded well under drought stress. This line was backcrossed with popular rice variety of India, Swarna-Sub1 to introgress wild chromosome segments responsible for reproductive stage drought tolerance. During backcrossing, tracking of wild introgressions and monitoring of recurrent parent genome recovery was facilitated by the use of the Cornell 6K and 7K Infinium rice SNP arrays. The 6K and 7K SNP arrays assayed 5275 SNPs and 7099 SNPs, respectively, distributed across the 12 chromosomes. In our populations of (MER-20X Swarna sub1 BC2F1 lines, 1775 SNPs were polymorphic using the 6K array. The percentage of recurrent parent genome in these backcrossed lines ranged from 33-92% and the percentage of wild donor genome ranged from 8-67%. Using genotypic selection, 5% of plants were identified for further marker assisted backcrossing, based on the presence of the target donor (wild segment and maximum recovery of recurrent parent background. In the next generation, BC3F1 lines were genotyped using the 7K SNP array, which identified 2521 polymorphic SNPs
A novel single neuron perceptron with universal approximation and XOR computation properties.
Lotfi, Ehsan; Akbarzadeh-T, M-R
2014-01-01
We propose a biologically motivated brain-inspired single neuron perceptron (SNP) with universal approximation and XOR computation properties. This computational model extends the input pattern and is based on the excitatory and inhibitory learning rules inspired from neural connections in the human brain's nervous system. The resulting architecture of SNP can be trained by supervised excitatory and inhibitory online learning rules. The main features of proposed single layer perceptron are universal approximation property and low computational complexity. The method is tested on 6 UCI (University of California, Irvine) pattern recognition and classification datasets. Various comparisons with multilayer perceptron (MLP) with gradient decent backpropagation (GDBP) learning algorithm indicate the superiority of the approach in terms of higher accuracy, lower time, and spatial complexity, as well as faster training. Hence, we believe the proposed approach can be generally applicable to various problems such as in pattern recognition and classification.
[A population genetic study of 22 autosomal loci of single nucleotide polymorphisms].
Tang, Jian-pin; Jiang, Feng-hui; Shi, Mei-sen; Xu, Chuan-chao; Chen, Rui; Lai, Xiao-pin
2012-12-01
To evaluate polymorphisms and forensic efficiency of 22 non-binary single nucleotide polymorphism (SNP) loci. One hundred ethnic Han Chinese individuals were recruited from Dongguan, Guangdong. The 22 loci were genotyped with matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS). Nine loci were found with a single allele, 4 loci were found to be biallelic, whilst 9 loci were found to have 3 alleles. For 13 polymorphic loci, the combined discrimination power and power of exclusion were 0.999 98 and 0.9330, respectively. For the 9 non-biallelic loci, the combined discrimination power and power of exclusion were 0.9998 and 0.8956, respectively. For motherless cases, the combined power of exclusion was 0.6405 for 13 polymorphic SNPs and 0.6405 for 9 non-binary SNPs. Non-binary loci have a greater discrimination power and exclusion power per SNP.
Lin, Bochao Danae; Carnero-Montoro, Elena; Bell, Jordana T; Boomsma, Dorret I; de Geus, Eco J; Jansen, Rick; Kluft, Cornelis; Mangino, Massimo; Penninx, Brenda; Spector, Tim D; Willemsen, Gonneke; Hottenga, Jouke-Jan
2017-01-01
Neutrophil-to-lymphocyte ratio (NLR) and platelet-to-lymphocyte ratio (PLR) are important biomarkers for disease development and progression. To gain insight into the genetic causes of variance in NLR and PLR in the general population, we conducted genome-wide association (GWA) analyses and
Directory of Open Access Journals (Sweden)
Yan Zhao
2015-01-01
Full Text Available Aldehyde dehydrogenase (ALDH 2 is a mitochondrial enzyme that is known for its important role in oxidation and detoxification of ethanol metabolite acetaldehyde. ALDH2 also metabolizes other reactive aldehydes such as 4-hydroxy-2-nonenal and acrolein. The Glu504Lys single nucleotide polymorphism (SNP of ALDH2 gene, which is found in approximately 40% of the East Asian populations, causes defect in the enzyme activity of ALDH2, leading to alterations in acetaldehyde metabolism and alcohol-induced “flushing” syndrome. Evidence suggests that ALDH2 Glu504Lys SNP is a potential candidate genetic risk factor for a variety of chronic diseases such as cardiovascular disease, cancer, and late-onset Alzheimer’s disease. In addition, the association between ALDH2 Glu504Lys SNP and the development of these chronic diseases appears to be affected by the interaction between the SNP and lifestyle factors such as alcohol consumption as well as by the presence of other genetic variations.
Directory of Open Access Journals (Sweden)
K. V. Derkach
2017-08-01
Full Text Available The objective of this article is the grouping and clustering of maize inbred lines based on the results of SNP-genotyping for the verification of a separate cluster of Lancaster germplasm inbred lines. As material for the study, we used 91 maize (Zea mays L. inbred lines, including 31 Lancaster germplasm lines and 60 inbred lines of other germplasms (23 Iodent inbreds, 15 Reid inbreds, 7 Lacon inbreds, 12 Mix inbreds and 3 exotic inbreds. The majority of the given inbred lines are included in the Dnipro breeding programme. The SNP-genotyping of these inbred lines was conducted using BDI-III panel of 384 SNP-markers developed by BioDiagnostics, Inc. (USA on the base of Illumina VeraCode Bead Plate. The SNP-markers of this panel are biallelic and are located on all 10 maize chromosomes. Their range of conductivity was >0.6. The SNP-analysis was made in completely automated regime on Illumina BeadStation equipment at BioDiagnostics, Inc. (USA. A principal component analysis was applied to group a general set of 91 inbreds according to allelic states of SNP-markers and to identify a cluster of Lancaster inbreds. The clustering and determining hierarchy in 31 Lancaster germplasm inbreds used quantitative cluster analysis. The share of monomorphic markers in the studied set of 91 inbred lines equaled 0.7%, and the share of dimorphic markers equaled 99.3%. Minor allele frequency (MAF > 0.2 was observed for 80.6% of dimorphic markers, the average index of shift of gene diversity equaled 0.2984, PIC on average reached 0.3144. The index of gene diversity of markers varied from 0.1701 to 0.1901, pairwise genetic distances between inbred lines ranged from 0.0316–0.8000, the frequencies of major alleles of SNP-markers were within 0.5085–0.9821, and the frequencies of minor alleles were within 0.0179–0.4915. The average homozygosity of inbred lines was 98.8%. The principal component analysis of SNP-distances confirmed the isolation of the Lancaster
Maslow, Bat-Sheva L; Budinetz, Tara; Sueldo, Carolina; Anspach, Erica; Engmann, Lawrence; Benadiva, Claudio; Nulsen, John C
2015-07-01
To compare the analysis of chromosome number from paraffin-embedded products of conception using single-nucleotide polymorphism (SNP) microarray with the recommended screening for the evaluation of couples presenting with recurrent pregnancy loss who do not have previous fetal cytogenetic data. We performed a retrospective cohort study including all women who presented for a new evaluation of recurrent pregnancy loss over a 2-year period (January 1, 2012, to December 31, 2013). All participants had at least two documented first-trimester losses and both the recommended screening tests and SNP microarray performed on at least one paraffin-embedded products of conception sample. Single-nucleotide polymorphism microarray identifies all 24 chromosomes (22 autosomes, X, and Y). Forty-two women with a total of 178 losses were included in the study. Paraffin-embedded products of conception from 62 losses were sent for SNP microarray. Single-nucleotide polymorphism microarray successfully diagnosed fetal chromosome number in 71% (44/62) of samples, of which 43% (19/44) were euploid and 57% (25/44) were noneuploid. Seven of 42 (17%) participants had abnormalities on recurrent pregnancy loss screening. The per-person detection rate for a cause of pregnancy loss was significantly higher in the SNP microarray (0.50; 95% confidence interval [CI] 0.36-0.64) compared with recurrent pregnancy loss evaluation (0.17; 95% CI 0.08-0.31) (P=.002). Participants with one or more euploid loss identified on paraffin-embedded products of conception were significantly more likely to have an abnormality on recurrent pregnancy loss screening than those with only noneuploid results (P=.028). The significance remained when controlling for age, number of losses, number of samples, and total pregnancies. These results suggest that SNP microarray testing of paraffin-embedded products of conception is a valuable tool for the evaluation of recurrent pregnancy loss in patients without prior fetal
Directory of Open Access Journals (Sweden)
Gilbert Gwendolyn L
2008-08-01
Full Text Available Abstract Background Streptococcus agalactiae (Group B Streptococcus (GBS is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP based method for assigning GBS isolates to multilocus sequence typing (MLST-defined clonal complexes. Results It was found that a SNP set derived from the MLST database on the basis of maximisation of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. Conclusion A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.
Honsa, Erin; Fricke, Thomas; Stephens, Alex J; Ko, Danny; Kong, Fanrong; Gilbert, Gwendolyn L; Huygens, Flavia; Giffard, Philip M
2008-08-19
Streptococcus agalactiae (Group B Streptococcus (GBS)) is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP) based method for assigning GBS isolates to multilocus sequence typing (MLST)-defined clonal complexes. It was found that a SNP set derived from the MLST database on the basis of maximization of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.
Analyzing a single nucleotide polymorphism in schizophrenia: a meta-analysis approach
Directory of Open Access Journals (Sweden)
Falola O
2017-08-01
Full Text Available Oluwadamilare Falola,1 Victor Chukwudi Osamor,1,2 Marion Adebiyi,1,2 Ezekiel Adebiyi1,2 1Covenant University Bioinformatics Research (CUBRe, 2Department of Computer and Information Sciences, College of Science and Technology, Covenant University, Ota, Ogun State, Nigeria Background: Schizophrenia is a severe mental disorder affecting >21 million people worldwide. Some genetic studies reported that single nucleotide polymorphism (SNP involving variant rs1344706 from the ZNF804A gene in human beings is associated with the risk of schizophrenia in several populations. Similar results tend to conflict with other reports in literature, indicating that no true significant association exists between rs1344706 and schizophrenia. We seek to determine the level of association of this SNP with schizophrenia in the Asian population using more recent genome-wide association study (GWAS datasets. Methods: Applying a computational approach with inclusion of more recent GWAS datasets, we conducted a meta-analysis to examine the level of association of SNP rs1344706 and the risk of schizophrenia disorder among the Asian population constituting Chinese, Indonesians, Japanese, Kazakhs and Singaporeans. For a total of 21 genetic studies, including a total of 28,842 cases and 35,630 controls, regression analysis, publication bias, Cochran’s Q and I2 tests were performed. The DerSimonian and Laird random-effects model was used to assess the association of the genetic variant to schizophrenia. Leave-one-out sensitivity analysis was also conducted to determine the influence of each study on the final outcome of the association study. Results: Our summarized analysis for Asian population revealed a pooled odds ratio of 1.06, 95% confidence interval of 1.01–1.11 and two-tailed P-value of 0.0228. Our test for heterogeneity showed the presence of large heterogeneity (I2=53.44%, P =0.00207 and Egger’s regression test (P =0.8763 and Begg’s test (P =0
This study was conducted as an initial assessment of a newly available genotyping assay containing about 34,000 common SNP included on previous SNP chips, and 199,000 sequence variants predicted to affect gene function. Objectives were to identify functional variants associated with birth weight in...
Mourad, Amira M I; Sallam, Ahmed; Belamkar, Vikas; Wegulo, Stephen; Bowden, Robert; Jin, Yue; Mahdy, Ezzat; Bakheit, Bahy; El-Wafaa, Atif A; Poland, Jesse; Baenziger, Peter S
2018-01-01
Stem rust (caused by Puccinia graminis f. sp. tritici Erikss. & E. Henn.), is a major disease in wheat ( Triticum aestivium L.). However, in recent years it occurs rarely in Nebraska due to weather and the effective selection and gene pyramiding of resistance genes. To understand the genetic basis of stem rust resistance in Nebraska winter wheat, we applied genome-wide association study (GWAS) on a set of 270 winter wheat genotypes (A-set). Genotyping was carried out using genotyping-by-sequencing and ∼35,000 high-quality SNPs were identified. The tested genotypes were evaluated for their resistance to the common stem rust race in Nebraska (QFCSC) in two replications. Marker-trait association identified 32 SNP markers, which were significantly (Bonferroni corrected P < 0.05) associated with the resistance on chromosome 2D. The chromosomal location of the significant SNPs (chromosome 2D) matched the location of Sr6 gene which was expected in these genotypes based on pedigree information. A highly significant linkage disequilibrium (LD, r 2 ) was found between the significant SNPs and the specific SSR marker for the Sr6 gene ( Xcfd43 ). This suggests the significant SNP markers are tagging Sr6 gene. Out of the 32 significant SNPs, eight SNPs were in six genes that are annotated as being linked to disease resistance in the IWGSC RefSeq v1.0. The 32 significant SNP markers were located in nine haplotype blocks. All the 32 significant SNPs were validated in a set of 60 different genotypes (V-set) using single marker analysis. SNP markers identified in this study can be used in marker-assisted selection, genomic selection, and to develop KASP (Kompetitive Allele Specific PCR) marker for the Sr6 gene. Novel SNPs for Sr6 gene, an important stem rust resistant gene, were identified and validated in this study. These SNPs can be used to improve stem rust resistance in wheat.
International Nuclear Information System (INIS)
Zheng, Y P; Choi, A P C; Ling, H Y; Huang, Y P
2009-01-01
Indentation is commonly used to determine the mechanical properties of different kinds of biological tissues and engineering materials. With the force–deformation data obtained from an indentation test, Young's modulus of the tissue can be calculated using a linear elastic indentation model with a known Poisson's ratio. A novel method for simultaneous estimation of Young's modulus and Poisson's ratio of the tissue using a single indentation was proposed in this study. Finite element (FE) analysis using 3D models was first used to establish the relationship between Poisson's ratio and the deformation-dependent indentation stiffness for different aspect ratios (indentor radius/tissue original thickness) in the indentation test. From the FE results, it was found that the deformation-dependent indentation stiffness linearly increased with the deformation. Poisson's ratio could be extracted based on the deformation-dependent indentation stiffness obtained from the force–deformation data. Young's modulus was then further calculated with the estimated Poisson's ratio. The feasibility of this method was demonstrated in virtue of using the indentation models with different material properties in the FE analysis. The numerical results showed that the percentage errors of the estimated Poisson's ratios and the corresponding Young's moduli ranged from −1.7% to −3.2% and 3.0% to 7.2%, respectively, with the aspect ratio (indentor radius/tissue thickness) larger than 1. It is expected that this novel method can be potentially used for quantitative assessment of various kinds of engineering materials and biological tissues, such as articular cartilage
Schütz, Ekkehard; Brenig, Bertram
2015-02-05
Parentage control is moving from short tandem repeats- to single nucleotide polymorphism (SNP) systems. For SNP-based parentage control in cattle, the ISAG-ICAR Committee proposes a set of 100/200 SNPs but quality criteria are lacking. Regarding German Holstein-Friesian cattle with only a limited number of evaluated individuals, the exclusion probability is not well-defined. We propose a statistical procedure for excluding single SNPs from parentage control, based on case-by-case evaluation of the GenCall score, to minimize parentage exclusion, based on miscalled genotypes. Exclusion power of the ISAG-ICAR SNPs used for the German Holstein-Friesian population was adjusted based on the results of more than 25,000 individuals. Experimental data were derived from routine genomic selection analyses of the German Holstein-Friesian population using the Illumina BovineSNP50 v2 BeadChip (20,000 individuals) or the EuroG10K variant (7000 individuals). Averages and standard deviations of GenCall scores for the 200 SNPs of the ISAG-ICAR recommended panel were calculated and used to calculate the downward Z-value. Based on minor allelic frequencies in the Holstein-Friesian population, one minus exclusion probability was equal to 1.4×10⁻¹⁰ and 7.2×10⁻²⁶, with one and two parents, respectively. Two monomorphic SNPs from the 100-SNP ISAG-ICAR core-panel did not contribute. Simulation of 10,000 parentage control combinations, using the GenCall score data from both BeadChips, showed that with a Z-value greater than 3.66 only about 2.5% parentages were excluded, based on the ISAG-ICAR recommendations (core-panel: ≥ 90 SNPs for one, ≥ 85 SNPs for two parents). When applied to real data from 1750 single parentage assessments, the optimal threshold was determined to be Z = 5.0, with only 34 censored cases and reduction to four (0.2%) doubtful parentages. About 70 parentage exclusions due to weak genotype calls were avoided, whereas true exclusions (n = 34) were
SNP calling using genotype model selection on high-throughput sequencing data
You, Na; Murillo, Gabriel; Su, Xiaoquan; Zeng, Xiaowei; Xu, Jian; Ning, Kang; Zhang, ShouDong; Zhu, Jian-Kang; Cui, Xinping
2012-01-01
calling SNPs. Thus, errors not involved in base-calling or alignment, such as those in genomic sample preparation, are not accounted for.Results: A novel method of consensus and SNP calling, Genotype Model Selection (GeMS), is given which accounts
Directory of Open Access Journals (Sweden)
Samantha A Brooks
2010-04-01
Full Text Available Lavender Foal Syndrome (LFS is a lethal inherited disease of horses with a suspected autosomal recessive mode of inheritance. LFS has been primarily diagnosed in a subgroup of the Arabian breed, the Egyptian Arabian horse. The condition is characterized by multiple neurological abnormalities and a dilute coat color. Candidate genes based on comparative phenotypes in mice and humans include the ras-associated protein RAB27a (RAB27A and myosin Va (MYO5A. Here we report mapping of the locus responsible for LFS using a small set of 36 horses segregating for LFS. These horses were genotyped using a newly available single nucleotide polymorphism (SNP chip containing 56,402 discriminatory elements. The whole genome scan identified an associated region containing these two functional candidate genes. Exon sequencing of the MYO5A gene from an affected foal revealed a single base deletion in exon 30 that changes the reading frame and introduces a premature stop codon. A PCR-based Restriction Fragment Length Polymorphism (PCR-RFLP assay was designed and used to investigate the frequency of the mutant gene. All affected horses tested were homozygous for this mutation. Heterozygous carriers were detected in high frequency in families segregating for this trait, and the frequency of carriers in unrelated Egyptian Arabians was 10.3%. The mapping and discovery of the LFS mutation represents the first successful use of whole-genome SNP scanning in the horse for any trait. The RFLP assay can be used to assist breeders in avoiding carrier-to-carrier matings and thus in preventing the birth of affected foals.
Wang, Xingang; Yin, Ningbei; Song, Tao; Li, Haidong; Zhang, Feng; Zhang, Yongbiao; Ye, Zhenqing; Yu, Jun; Wang, Duen-Mei; Zhao, Zhenmin
2012-01-01
Cleft lip with or without palate (CL/P) is a common congenital anomaly with a high birth prevalence in China. Based on a previous linkage signal of nonsyndromic CL/P (NSCL/P) on the chromosomal region 4q31–q32 from the Chinese populations, we screened the 4q31–q32 region for susceptibility genes in 214 trios of Han Chinese. PDGF-C, an important developmental factor, resides in the region and has been implicated in NSCL/P. However, in our family-based association test (transmission disequilibrium test; TDT), we could not conclude an association between PDGF-C and NSCL/P as previously suggested. Instead, we found strong evidence for parent-of-origin effect at a PDGF-C SNP, rs17035464, by a likelihood ratio test (unadjusted p-value = 0.0018; Im = 2.46). The location of rs17035464 is 13 kb downstream of a previously reported, NSCL/P-associated SNP, rs28999109. Furthermore, a patient from our sample trios was observed with a maternal segmental uniparental isodisomy (UPD) in a region containing rs17035464. Our findings support the involvement of PDGF-C in the development of oral clefts; moreover, the UPD case report contributes to the collective knowledge of rare variants in the human genome. PMID:23029525
Genome-wide SNP data unveils the globalization of domesticated pigs.
Yang, Bin; Cui, Leilei; Perez-Enciso, Miguel; Traspov, Aleksei; Crooijmans, Richard P M A; Zinovieva, Natalia; Schook, Lawrence B; Archibald, Alan; Gatphayak, Kesinee; Knorr, Christophe; Triantafyllidis, Alex; Alexandri, Panoraia; Semiadi, Gono; Hanotte, Olivier; Dias, Deodália; Dovč, Peter; Uimari, Pekka; Iacolina, Laura; Scandura, Massimo; Groenen, Martien A M; Huang, Lusheng; Megens, Hendrik-Jan
2017-09-21
Pigs were domesticated independently in Eastern and Western Eurasia early during the agricultural revolution, and have since been transported and traded across the globe. Here, we present a worldwide survey on 60K genome-wide single nucleotide polymorphism (SNP) data for 2093 pigs, including 1839 domestic pigs representing 122 local and commercial breeds, 215 wild boars, and 39 out-group suids, from Asia, Europe, America, Oceania and Africa. The aim of this study was to infer global patterns in pig domestication and diversity related to demography, migration, and selection. A deep phylogeographic division reflects the dichotomy between early domestication centers. In the core Eastern and Western domestication regions, Chinese pigs show differentiation between breeds due to geographic isolation, whereas this is less pronounced in European pigs. The inferred European origin of pigs in the Americas, Africa, and Australia reflects European expansion during the sixteenth to nineteenth centuries. Human-mediated introgression, which is due, in particular, to importing Chinese pigs into the UK during the eighteenth and nineteenth centuries, played an important role in the formation of modern pig breeds. Inbreeding levels vary markedly between populations, from almost no runs of homozygosity (ROH) in a number of Asian wild boar populations, to up to 20% of the genome covered by ROH in a number of Southern European breeds. Commercial populations show moderate ROH statistics. For domesticated pigs and wild boars in Asia and Europe, we identified highly differentiated loci that include candidate genes related to muscle and body development, central nervous system, reproduction, and energy balance, which are putatively under artificial selection. Key events related to domestication, dispersal, and mixing of pigs from different regions are reflected in the 60K SNP data, including the globalization that has recently become full circle since Chinese pig breeders in the past
McClure, Matthew C; Bickhart, Derek; Null, Dan; Vanraden, Paul; Xu, Lingyang; Wiggans, George; Liu, George; Schroeder, Steve; Glasscock, Jarret; Armstrong, Jon; Cole, John B; Van Tassell, Curtis P; Sonstegard, Tad S
2014-01-01
The recent discovery of bovine haplotypes with negative effects on fertility in the Brown Swiss, Holstein, and Jersey breeds has allowed producers to identify carrier animals using commercial single nucleotide polymorphism (SNP) genotyping assays. This study was devised to identify the causative mutations underlying defective bovine embryo development contained within three of these haplotypes (Brown Swiss haplotype 1 and Holstein haplotypes 2 and 3) by combining exome capture with next generation sequencing. Of the 68,476,640 sequence variations (SV) identified, only 1,311 genome-wide SNP were concordant with the haplotype status of 21 sequenced carriers. Validation genotyping of 36 candidate SNP identified only 1 variant that was concordant to Holstein haplotype 3 (HH3), while no variants located within the refined intervals for HH2 or BH1 were concordant. The variant strictly associated with HH3 is a non-synonymous SNP (T/C) within exon 24 of the Structural Maintenance of Chromosomes 2 (SMC2) on Chromosome 8 at position 95,410,507 (UMD3.1). This polymorphism changes amino acid 1135 from phenylalanine to serine and causes a non-neutral, non-tolerated, and evolutionarily unlikely substitution within the NTPase domain of the encoded protein. Because only exome capture sequencing was used, we could not rule out the possibility that the true causative mutation for HH3 might lie in a non-exonic genomic location. Given the essential role of SMC2 in DNA repair, chromosome condensation and segregation during cell division, our findings strongly support the non-synonymous SNP (T/C) in SMC2 as the likely causative mutation. The absence of concordant variations for HH2 or BH1 suggests either the underlying causative mutations lie within a non-exomic region or in exome regions not covered by the capture array.
Directory of Open Access Journals (Sweden)
Matthew C McClure
Full Text Available The recent discovery of bovine haplotypes with negative effects on fertility in the Brown Swiss, Holstein, and Jersey breeds has allowed producers to identify carrier animals using commercial single nucleotide polymorphism (SNP genotyping assays. This study was devised to identify the causative mutations underlying defective bovine embryo development contained within three of these haplotypes (Brown Swiss haplotype 1 and Holstein haplotypes 2 and 3 by combining exome capture with next generation sequencing. Of the 68,476,640 sequence variations (SV identified, only 1,311 genome-wide SNP were concordant with the haplotype status of 21 sequenced carriers. Validation genotyping of 36 candidate SNP identified only 1 variant that was concordant to Holstein haplotype 3 (HH3, while no variants located within the refined intervals for HH2 or BH1 were concordant. The variant strictly associated with HH3 is a non-synonymous SNP (T/C within exon 24 of the Structural Maintenance of Chromosomes 2 (SMC2 on Chromosome 8 at position 95,410,507 (UMD3.1. This polymorphism changes amino acid 1135 from phenylalanine to serine and causes a non-neutral, non-tolerated, and evolutionarily unlikely substitution within the NTPase domain of the encoded protein. Because only exome capture sequencing was used, we could not rule out the possibility that the true causative mutation for HH3 might lie in a non-exonic genomic location. Given the essential role of SMC2 in DNA repair, chromosome condensation and segregation during cell division, our findings strongly support the non-synonymous SNP (T/C in SMC2 as the likely causative mutation. The absence of concordant variations for HH2 or BH1 suggests either the underlying causative mutations lie within a non-exomic region or in exome regions not covered by the capture array.
Effect of Tryptophan Hydroxylase-2 rs7305115 SNP on suicide attempts risk in major depression
Directory of Open Access Journals (Sweden)
Zhang Yuqi
2010-08-01
Full Text Available Abstract Background Suicide and major depressive disorders (MDD are strongly associated, and genetic factors are responsible for at least part of the variability in suicide risk. We investigated whether variation at the tryptophan hydroxylase-2 (TPH2 gene rs7305115 SNP may predispose to suicide attempts in MDD. Methods We genotyped TPH2 gene rs7305115 SNP in 215 MDD patients with suicide and matched MDD patients without suicide. Differences in behavioral and personality traits according to genotypic variation were investigated by logistic regression analysis. Results There were no significant differences between MDD patients with suicide and controls in genotypic (AG and GG frequencies for rs7305115 SNP, but the distribution of AA genotype differed significantly (14.4% vs. 29.3%, p p p Conclusions The study suggested that hopelessness, negative life events and family history of suicide were risk factors of attempted suicide in MDD while the TPH2 rs7305115A remained a significant protective predictor of suicide attempts.
Allele specific LAMP- gold nanoparticle for characterization of single nucleotide polymorphisms
Directory of Open Access Journals (Sweden)
Fábio Ferreira Carlos
2017-12-01
Full Text Available Due to their relevance as disease biomarkers and for diagnostics, screening of single nucleotide polymorphism (SNPs requires simple and straightforward strategies capable to provide results in medium throughput settings. Suitable approaches relying on isothermal amplification techniques have been evolving to substitute the cumbersome and highly specialized PCR amplification detection schemes. Nonetheless, identification of an individualâs genotype still requires sophisticated equipment and laborious methods.Here, we present a low-cost and reliable approach based on the allele specific loop-mediated isothermal amplification (AS-LAMP coupled to ssDNA functionalized gold nanoparticle (Au-nanoprobe colorimetric sequence discrimination. The Au-nanoprobe integration allows for the colorimetric detection of AS-LAMP amplification product that can be easily interpreted in less than 15Â min. We targeted a clinical relevant SNP responsible for lactose intolerance (-13910C/T dbSNP rs#: 4988235 to demonstrate its proof of concept and full potential of this novel approach. Keywords: SNP, Isothermal amplification, Gold nanoparticles, Gold nanoprobes, Lactose intolerance
Directory of Open Access Journals (Sweden)
Tyas Utami1*
2012-06-01
Full Text Available Aflatoxins are carcinogenic mycotoxins that commonly contaminate foods and feed. There are many different forms of aflatoxin and its metabolites. Of these, aflatoxin B1 (AFB1 is the most prevalent and toxic. Lactobacillus acidophilus SNP-2 has previously been shown to remove AFB1 from liquid solution of phosphate saline buffer. However, the ability of lactic acid bacteria to reduce AFB1 content in soymilk has not been studied yet. The objective of this study was to investigate the ability of viable and heat-killed cells of L. acidophilus SNP-2 to reduce AFB1 in soymilk and fermented soymilk. Soymilk contaminated with Aspergillus flavus was inoculated with culture of L. acidophilus SNP-2, and incubated at 37C for 12 hours. Fermented soymilk, then, was heat sterilized and stored at cool room (4°C. Heat-killed cells were introduced to soy milk and then kept at cool room for 3 days. During soymilk fermentation, there was reduction of AFB1 content in soymilk related to the growth of lactic acid bacteria and the reduction of pH. The initial concentration of AFB1 in the soymilk was 4.9 ppb. Lactobacillus acidophilus SNP-2 reduced 67.58% of AFB1 in the soymilk after 12 hoursof fermentation. In cool environment, the binding of AFB1 to heat-killed cell after soymilk fermentation was relatively more stable than that of soymilk without fermentation.
Directory of Open Access Journals (Sweden)
Min Wang
2018-01-01
Full Text Available A single-layer, dual-port, dual-band, and dual circularly polarized (CP microstrip array is designed for satellite communication in this paper. The operating frequencies are 8.2 and 8.6 GHz with a very low ratio of 1.05. First, a rectangular patch element is fed through microstrip lines at two orthogonal edges to excite two orthogonal dominant modes of TM01 and TM10. The very low frequency ratio can be realized with high polarization isolations. Then, a 2-by-2 dual-band dual-CP subarray is constructed by two independent sets of sequentially rotated (SR feed structures. An 8-by-8 array is designed on the single-layer thin substrate. Finally, by utilizing one-to-four power dividers and semirigid coaxial cables, a 16-by-16 array is developed to achieve higher gain. Measured results show that the 16-by-16 array has 15 dB return loss (RL bandwidths of 4.81% and 6.75% and 3 dB axial ratio (AR bandwidths of 2.84% and 1.57% in the lower and the upper bands, respectively. Isolations of 18.6 dB and 19.4 dB and peak gains of 25.1 dBic and 25.6 dBic are obtained at 8.2 and 8.6 GHz, respectively.
Analysis of single nucleotide polymorphisms in case-control studies.
Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer
2011-01-01
Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.
Single Nucleotide Polymorphism Discovery in Bovine Pituitary Gland Using RNA-Seq Technology.
Pareek, Chandra Shekhar; Smoczyński, Rafał; Kadarmideen, Haja N; Dziuba, Piotr; Błaszczyk, Paweł; Sikora, Marcin; Walendzik, Paulina; Grzybowski, Tomasz; Pierzchała, Mariusz; Horbańczuk, Jarosław; Szostak, Agnieszka; Ogluszka, Magdalena; Zwierzchowski, Lech; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Wąsowicz, Krzysztof; Gelfand, Brian; Feng, Yaping; Kumar, Dibyendu
2016-01-01
Examination of bovine pituitary gland transcriptome by strand-specific RNA-seq allows detection of putative single nucleotide polymorphisms (SNPs) within potential candidate genes (CGs) or QTLs regions as well as to understand the genomics variations that contribute to economic trait. Here we report a breed-specific model to successfully perform the detection of SNPs in the pituitary gland of young growing bulls representing Polish Holstein-Friesian (HF), Polish Red, and Hereford breeds at three developmental ages viz., six months, nine months, and twelve months. A total of 18 bovine pituitary gland polyA transcriptome libraries were prepared and sequenced using the Illumina NextSeq 500 platform. Sequenced FastQ databases of all 18 young bulls were submitted to NCBI-SRA database with NCBI-SRA accession numbers SRS1296732. For the investigated young bulls, a total of 113,882,3098 raw paired-end reads with a length of 156 bases were obtained, resulting in an approximately 63 million paired-end reads per library. Breed-wise, a total of 515.38, 215.39, and 408.04 million paired-end reads were obtained for Polish HF, Polish Red, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed 93.04%, 94.39%, and 83.46% of the mapped sequencing reads were properly paired to the Polish HF, Polish Red, and Hereford breeds, respectively. Constructed breed-specific SNP-db of three cattle breeds yielded at 13,775,885 SNPs. On an average 765,326 breed-specific SNPs per young bull were identified. Using two stringent filtering parameters, i.e., a minimum 10 SNP reads per base with an accuracy ≥ 90% and a minimum 10 SNP reads per base with an accuracy = 100%, SNP-db records were trimmed to construct a highly reliable SNP-db. This resulted in a reduction of 95,7% and 96,4% cut-off mark of constructed raw SNP-db. Finally, SNP discoveries using RNA-Seq data were validated by KASP™ SNP genotyping assay. The comprehensive QTLs/CGs analysis of 76 QTLs
Single Nucleotide Polymorphism Discovery in Bovine Pituitary Gland Using RNA-Seq Technology.
Directory of Open Access Journals (Sweden)
Chandra Shekhar Pareek
Full Text Available Examination of bovine pituitary gland transcriptome by strand-specific RNA-seq allows detection of putative single nucleotide polymorphisms (SNPs within potential candidate genes (CGs or QTLs regions as well as to understand the genomics variations that contribute to economic trait. Here we report a breed-specific model to successfully perform the detection of SNPs in the pituitary gland of young growing bulls representing Polish Holstein-Friesian (HF, Polish Red, and Hereford breeds at three developmental ages viz., six months, nine months, and twelve months. A total of 18 bovine pituitary gland polyA transcriptome libraries were prepared and sequenced using the Illumina NextSeq 500 platform. Sequenced FastQ databases of all 18 young bulls were submitted to NCBI-SRA database with NCBI-SRA accession numbers SRS1296732. For the investigated young bulls, a total of 113,882,3098 raw paired-end reads with a length of 156 bases were obtained, resulting in an approximately 63 million paired-end reads per library. Breed-wise, a total of 515.38, 215.39, and 408.04 million paired-end reads were obtained for Polish HF, Polish Red, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA read alignments showed 93.04%, 94.39%, and 83.46% of the mapped sequencing reads were properly paired to the Polish HF, Polish Red, and Hereford breeds, respectively. Constructed breed-specific SNP-db of three cattle breeds yielded at 13,775,885 SNPs. On an average 765,326 breed-specific SNPs per young bull were identified. Using two stringent filtering parameters, i.e., a minimum 10 SNP reads per base with an accuracy ≥ 90% and a minimum 10 SNP reads per base with an accuracy = 100%, SNP-db records were trimmed to construct a highly reliable SNP-db. This resulted in a reduction of 95,7% and 96,4% cut-off mark of constructed raw SNP-db. Finally, SNP discoveries using RNA-Seq data were validated by KASP™ SNP genotyping assay. The comprehensive QTLs/CGs analysis
Identification of Mendelian inconsistencies between SNP and pedigree Information of Sibs
Calus, M.P.L.; Mulder, H.A.; Bastiaansen, J.W.M.
2011-01-01
Background Using SNP genotypes to apply genomic selection in breeding programs is becoming common practice. Tools to edit and check the quality of genotype data are required. Checking for Mendelian inconsistencies makes it possible to identify animals for which pedigree information and genotype
Mapping of a major QTL for salt tolerance of mature field-grown maize plants based on SNP markers.
Luo, Meijie; Zhao, Yanxin; Zhang, Ruyang; Xing, Jinfeng; Duan, Minxiao; Li, Jingna; Wang, Naishun; Wang, Wenguang; Zhang, Shasha; Chen, Zhihui; Zhang, Huasheng; Shi, Zi; Song, Wei; Zhao, Jiuran
2017-08-15
Salt stress significantly restricts plant growth and production. Maize is an important food and economic crop but is also a salt sensitive crop. Identification of the genetic architecture controlling salt tolerance facilitates breeders to select salt tolerant lines. However, the critical quantitative trait loci (QTLs) responsible for the salt tolerance of field-grown maize plants are still unknown. To map the main genetic factors contributing to salt tolerance in mature maize, a double haploid population (240 individuals) and 1317 single nucleotide polymorphism (SNP) markers were employed to produce a genetic linkage map covering 1462.05 cM. Plant height of mature maize cultivated in the saline field (SPH) and plant height-based salt tolerance index (ratio of plant height between saline and control fields, PHI) were used to evaluate salt tolerance of mature maize plants. A major QTL for SPH was detected on Chromosome 1 with the LOD score of 22.4, which explained 31.2% of the phenotypic variation. In addition, the major QTL conditioning PHI was also mapped at the same position on Chromosome 1, and two candidate genes involving in ion homeostasis were identified within the confidence interval of this QTL. The detection of the major QTL in adult maize plant establishes the basis for the map-based cloning of genes associated with salt tolerance and provides a potential target for marker assisted selection in developing maize varieties with salt tolerance.
Directory of Open Access Journals (Sweden)
Garnier-Géré Pauline
2011-07-01
Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are the most abundant source of genetic variation among individuals of a species. New genotyping technologies allow examining hundreds to thousands of SNPs in a single reaction for a wide range of applications such as genetic diversity analysis, linkage mapping, fine QTL mapping, association studies, marker-assisted or genome-wide selection. In this paper, we evaluated the potential of highly-multiplexed SNP genotyping for genetic mapping in maritime pine (Pinus pinaster Ait., the main conifer used for commercial plantation in southwestern Europe. Results We designed a custom GoldenGate assay for 1,536 SNPs detected through the resequencing of gene fragments (707 in vitro SNPs/Indels and from Sanger-derived Expressed Sequenced Tags assembled into a unigene set (829 in silico SNPs/Indels. Offspring from three-generation outbred (G2 and inbred (F2 pedigrees were genotyped. The success rate of the assay was 63.6% and 74.8% for in silico and in vitro SNPs, respectively. A genotyping error rate of 0.4% was further estimated from segregating data of SNPs belonging to the same gene. Overall, 394 SNPs were available for mapping. A total of 287 SNPs were integrated with previously mapped markers in the G2 parental maps, while 179 SNPs were localized on the map generated from the analysis of the F2 progeny. Based on 98 markers segregating in both pedigrees, we were able to generate a consensus map comprising 357 SNPs from 292 different loci. Finally, the analysis of sequence homology between mapped markers and their orthologs in a Pinus taeda linkage map, made it possible to align the 12 linkage groups of both species. Conclusions Our results show that the GoldenGate assay can be used successfully for high-throughput SNP genotyping in maritime pine, a conifer species that has a genome seven times the size of the human genome. This SNP-array will be extended thanks to recent sequencing effort using
Using SNP markers to estimate additive, dominance and imprinting genetic variance
DEFF Research Database (Denmark)
Lopes, M S; Bastiaansen, J W M; Janss, Luc
The contributions of additive, dominance and imprinting effects to the variance of number of teats (NT) were evaluated in two purebred pig populations using SNP markers. Three different random regression models were evaluated, accounting for the mean and: 1) additive effects (MA), 2) additive...... and dominance effects (MAD) and 3) additive, dominance and imprinting effects (MADI). Additive heritability estimates were 0.30, 0.28 and 0.27-0.28 in both lines using MA, MAD and MADI, respectively. Dominance heritability ranged from 0.06 to 0.08 using MAD and MADI. Imprinting heritability ranged from 0.......01 to 0.02. Dominance effects make an important contribution to the genetic variation of NT in the two lines evaluated. Imprinting effects appeared less important for NT than additive and dominance effects. The SNP random regression model presented and evaluated in this study is a feasible approach...
Qu, Wei-ping; Liu, Wen-qing; Liu, Jian-guo; Lu, Yi-huai; Zhu, Jun; Qin, Min; Liu, Cheng
2006-11-01
In satellite remote-sensing detection, cloud as an interference plays a negative role in data retrieval. How to discern the cloud fields with high fidelity thus comes as a need to the following research. A new method rooting in atmospheric radiation characteristics of cloud layer, in the present paper, presents a sort of solution where single-band brightness variance ratio is used to detect the relative intensity of cloud clutter so as to delineate cloud field rapidly and exactly, and the formulae of brightness variance ratio of satellite image, image reflectance variance ratio, and brightness temperature variance ratio of thermal infrared image are also given to enable cloud elimination to produce data free from cloud interference. According to the variance of the penetrating capability for different spectra bands, an objective evaluation is done on cloud penetration of them with the factors that influence penetration effect. Finally, a multi-band data fusion task is completed using the image data of infrared penetration from cirrus nothus. Image data reconstruction is of good quality and exactitude to show the real data of visible band covered by cloud fields. Statistics indicates the consistency of waveband relativity with image data after the data fusion.
Cooper, T A; Wiggans, G R; VanRaden, P M
2013-05-01
Call rates on both a single nucleotide polymorphism (SNP) basis and an animal basis are used as measures of data quality and as screening tools for genomic studies and evaluations of dairy cattle. To investigate the relationship of SNP call rate and genotype accuracy for individual SNP, the correlation between percentages of missing genotypes and parent-progeny conflicts for each SNP was calculated for 103,313 Holsteins. Correlations ranged from 0.14 to 0.38 for the BovineSNP50 and BovineLD (Illumina Inc., San Diego, CA) and GeneSeek Genomic Profiler (Neogen Corp., Lincoln, NE) chips, with lower correlations for newer chips. For US genomic evaluations, genotypes are excluded for animals with a call rate of call rate for 220,175 Holstein, Jersey, and Brown Swiss genotypes was 99.6%. Animal genotypes with a call rate of ≤99% were examined from the US Department of Agriculture genotype database to determine how genotype call rate is related to accuracy of calls on an animal basis. Animal call rate was determined from SNP used in genomic evaluation and is the number of called autosomal and X-specific SNP genotypes divided by the number of SNP from that type of chip. To investigate the relationship of animal call rate and parentage validation, conflicts between a genotyped animal and its sire or dam were determined through a duo test (opposite homozygous SNP genotypes between sire and progeny; 1,374 animal genotypes) and a trio test (also including conflicts with dam and heterozygous SNP genotype for the animal when both parents are the same homozygote; 482 animal genotypes). When animal call rate was ≤ 80%, parentage validation was no longer reliable with the duo test. With the trio test, parentage validation was no longer reliable when animal call rate was ≤ 90%. To investigate how animal call rate was related to genotyping accuracy for animals with multiple genotypes, concordance between genotypes for 1,216 animals that had a genotype with a call rate of ≤ 99
Cuzick, Jack; Brentnall, Adam R; Segal, Corrinne; Byers, Helen; Reuter, Caroline; Detre, Simone; Lopez-Knowles, Elena; Sestak, Ivana; Howell, Anthony; Powles, Trevor J; Newman, William G; Dowsett, Mitchell
2017-03-01
Purpose At least 94 common single nucleotide polymorphisms (SNPs) are associated with breast cancer. The extent to which an SNP panel can refine risk in women who receive preventive therapy has not been directly assessed previously. Materials and Methods A risk score on the basis of 88 SNPs (SNP88) was investigated in a nested case-control study of women enrolled in the International Breast Intervention Study (IBIS-I) or the Royal Marsden study. A total of 359 women who developed cancer were matched to 636 controls by age, trial, follow-up time, and treatment arm. Genotyping was done using the OncoArray. Conditional logistic regression and matched concordance indices (mC) were used to measure the performance of SNP88 alone and with other breast cancer risk factors assessed using the Tyrer-Cuzick (TC) model. Results SNP88 was predictive of breast cancer risk overall (interquartile range odds ratio [IQ-OR], 1.37; 95% CI, 1.14 to 1.66; mC, 0.55), but mainly for estrogen receptor-positive disease (IQ-OR, 1.44; 95% CI, 1.16 to 1.79; P for heterogeneity = .10) versus estrogen receptor-negative disease. However, the observed risk of SNP88 was only 46% (95% CI, 19% to 74%) of expected. No significant interaction was observed with treatment arm (placebo IQ-OR, 1.46; 95% CI, 1.13 to 1.87; tamoxifen IQ-OR, 1.25; 95% CI, 0.96 to 1.64; P for heterogeneity = .5). The predictive power was similar to the TC model (IQ-OR, 1.45; 95% CI, 1.21 to 1.73; mC, 0.55), but SNP88 was independent of TC (Spearman rank-order correlation, 0.012; P = .7), and when combined multiplicatively, a substantial improvement was seen (IQ-OR, 1.64; 95% CI, 1.36 to 1.97; mC, 0.60). Conclusion A polygenic risk score may be used to refine risk from the TC or similar models in women who are at an elevated risk of breast cancer and considering preventive therapy. Recalibration may be necessary for accurate risk assessment.
Directory of Open Access Journals (Sweden)
Sumiko Anno
2007-01-01
Full Text Available This study was undertaken to clarify the molecular basis for human skin color variation and the environmental adaptability to ultraviolet irradiation, with the ultimate goal of predicting the impact of changes in future environments on human health risk. One hundred twenty-two Caucasians living in Toledo, Ohio participated. Back and cheek skin were assayed for melanin as a quantitative trait marker. Buccal cell samples were collected and used for DNA extraction. DNA was used for SNP genotyping using the Masscode™ system, which entails two-step PCR amplification and a platform chemistry which allows cleavable mass spectrometry tags. The results show gene-gene interaction between SNP alleles at multiple loci (not necessarily on the same chromosome contributes to inter-individual skin color variation while suggesting a high probability of linkage disequilibrium. Confirmation of these findings requires further study with other ethic groups to analyze the associations between SNP alleles at multiple loci and human skin color variation. Our overarching goal is to use remote sensing data to clarify the interaction between atmospheric environments and SNP allelic frequency and investigate human adaptability to ultraviolet irradiation. Such information should greatly assist in the prediction of the health effects of future environmental changes such as ozone depletion and increased ultraviolet exposure. If such health effects are to some extent predictable, it might be possible to prepare for such changes in advance and thus reduce the extent of their impact.
Marin-Valencia, Isaac; Hooshyar, M Ali; Pichumani, Kumar; Sherry, A Dean; Malloy, Craig R
2015-01-01
The (13) C-labeling patterns in glutamate and glutamine from brain tissue are quite different after infusion of a mixture of (13) C-enriched glucose and acetate. Two processes contribute to this observation, oxidation of acetate by astrocytes but not neurons, and preferential incorporation of α-ketoglutarate into glutamate in neurons, and incorporation of α-ketoglutarate into glutamine in astrocytes. The acetate:glucose ratio, introduced previously for analysis of a single (13) C NMR spectrum, provides a useful index of acetate and glucose oxidation in the brain tissue. However, quantitation of relative substrate oxidation at the cell compartment level has not been reported. A simple mathematical method is presented to quantify the ratio of acetate-to-glucose oxidation in astrocytes, based on the standard assumption that neurons do not oxidize acetate. Mice were infused with [1,2-(13) C]acetate and [1,6-(13) C]glucose, and proton decoupled (13) C NMR spectra of cortex extracts were acquired. A fit of those spectra to the model indicated that (13) C-labeled acetate and glucose contributed approximately equally to acetyl-CoA (0.96) in astrocytes. As this method relies on a single (13) C NMR spectrum, it can be readily applied to multiple physiologic and pathologic conditions. Differences in (13) C labeling of brain glutamate and glutamine have been attributed to metabolic compartmentation. The acetate:glucose ratio, introduced for description of a (13) C NMR (nuclear magnetic resonance) spectrum, is an index of glucose and acetate oxidation in brain tissue. A simple mathematical method is presented to quantify the ratio of acetate-to-glucose oxidation in astrocytes from a single NMR spectrum. As kinetic analysis is not required, the method is readily applicable to analysis of tissue extracts. α-KG = alpha-ketoglutarate; CAC = citric acid cycle; GLN = glutamine; GLU = glutamate. © 2014 International Society for Neurochemistry.
Directory of Open Access Journals (Sweden)
Endang S Rahayu1
2004-08-01
Full Text Available Functional food is defined as any potentially healthful food or food ingredient that may provide a health benefit beyond the traditional nutrients it contains. Many researches have been conducted on the health benefit of probiotic (life bacterial cells, one of the ingredient of functional foods. One of the potential bacteria used for probiotic agent and also involved in traditional fermented foods are lactic acid bacteria (LAB. Previous research showed that Lactobacillus acidophilus SNP-2 isolated from faecal material of healthy infant is resistant to acid and bile salt, and has an antagonistic effect against several enteric bacterial pathogens. The objective of this research was to study the effect of L. acidophilus SNP-2 as probiotic agent to the health benefits. These bacteria were supplemented into tape ketan (fermented sticky rice, the indigenous Indonesian fermented food. Tape ketan was chosen as the carrier of probiotic biomass based on the high population of LAB in this product, i.e., 1.3 x 108 CFU/g. Addition of L. acidophilus SNP-2 biomass prior to fermentation of tape ketan resulted in a higher total of LAB cells, i.e. 2.1 x 109 CFU/g compared to the amount of 1.5 x 108 CFU/g when the addition was done after fermentation. Consumption of tape ketan containing probiotic agent by the volunteers increased the population of lactobacilli (from 1.7x107 CFU/g to 9.9x107 CFU/g and decreased the population of enterobacteriacea (from 5.4x109 CFU/g to 4.4x108 in their faecal material. This phenomenon revealed that probiotic agent was able to colonize and inhibit the growth of enterobacteriaceae in the gastrointestinal tract. The result implied that tape ketan can be used as a carrier for probiotic agent and it can be categorized as functional food
Geraldes, A; Difazio, S P; Slavov, G T; Ranjan, P; Muchero, W; Hannemann, J; Gunter, L E; Wymore, A M; Grassa, C J; Farzaneh, N; Porth, I; McKown, A D; Skyba, O; Li, E; Fujita, M; Klápště, J; Martin, J; Schackwitz, W; Pennacchio, C; Rokhsar, D; Friedmann, M C; Wasteneys, G O; Guy, R D; El-Kassaby, Y A; Mansfield, S D; Cronk, Q C B; Ehlting, J; Douglas, C J; Tuskan, G A
2013-03-01
Genetic mapping of quantitative traits requires genotypic data for large numbers of markers in many individuals. For such studies, the use of large single nucleotide polymorphism (SNP) genotyping arrays still offers the most cost-effective solution. Herein we report on the design and performance of a SNP genotyping array for Populus trichocarpa (black cottonwood). This genotyping array was designed with SNPs pre-ascertained in 34 wild accessions covering most of the species latitudinal range. We adopted a candidate gene approach to the array design that resulted in the selection of 34 131 SNPs, the majority of which are located in, or within 2 kb of, 3543 candidate genes. A subset of the SNPs on the array (539) was selected based on patterns of variation among the SNP discovery accessions. We show that more than 95% of the loci produce high quality genotypes and that the genotyping error rate for these is likely below 2%. We demonstrate that even among small numbers of samples (n = 10) from local populations over 84% of loci are polymorphic. We also tested the applicability of the array to other species in the genus and found that the number of polymorphic loci decreases rapidly with genetic distance, with the largest numbers detected in other species in section Tacamahaca. Finally, we provide evidence for the utility of the array to address evolutionary questions such as intraspecific studies of genetic differentiation, species assignment and the detection of natural hybrids. © 2013 Blackwell Publishing Ltd.
Silva, Felipe Carneiro; Torrezan, Giovana Tardin; Brianese, Rafael Canfield; Stabellini, Raquel; Carraro, Dirce Maria
2017-07-01
Hereditary breast and ovarian cancer is characterized by mutations in BRCA1 or BRCA2 genes and PCR-based screening techniques, such as capillary sequencing and next-generation sequencing (NGS), are considered gold standard methods for detection of pathogenic mutations in these genes. Single-nucleotide polymorphisms (SNPs) constitute a vast source of variation in the human genome and represent a risk for misdiagnosis in genetic testing, since the presence of a SNP in primer-annealing sites may cause false negative results due to allele dropout. However, few reports are available and the frequency of this phenomenon in diagnostic assays remains unknown. In this article, we investigated the causes of a false negative capillary sequencing result in BRCA1 involving a mother-daughter dyad. Using several molecular strategies, including different DNA polymerases, primer redesign, allele-specific PCR and NGS, we established that the initial misdiagnosis was caused by a SNP located in the primer-annealing region, leading to allele dropout of the mutated allele. Assuming that this problem can also occur in any PCR-based method that are widely used in diagnostic settings, the clinical report presented here draws attention for one of the limitations of genetic testing in general, for which medical and laboratory communities need to be aware.
Design and Characterization of a 52K SNP Chip for Goats
Tosser-klopp, G.; Bardou, P.; Bouchez, O.; Cabau, C.; Crooijmans, R.P.M.A.; Dong, Y.; Donnadieu-Tonon, C.; Eggen, A.; Heuven, H.C.M.; Jamli, S.; Jiken, A.J.; Klopp, C.; Lawley, C.T.; McEwen, J.; Martin, P.; Moreno, C.R.; Mulsant, P.; Nabihoudine, I.; Pailhoux, E.; Palhiere, I.; Rupp, R.; Sarry, J.; Sayre, B.L.; Tircazes, A.; Wang, J.; Wang, W.; Zhang, W.G.
2014-01-01
The success of Genome Wide Association Studies in the discovery of sequence variation linked to complex traits in humans has increased interest in high throughput SNP genotyping assays in livestock species. Primary goals are QTL detection and genomic selection. The purpose here was design of a
Affymetrix SNP array data for wild Dutch great tits (Parus major)
Silva, Da Vinicius; Laine, Veronika N.; Bosse, M.; Oers, C.H.J.; Dibbits, B.W.; Visser, M.E.; Crooijmans, R.P.M.A.; Groenen, M.
2018-01-01
The great tit is a widely studied passerine bird species in ecology that, in the past decades, has provided important insights into speciation, phenology, behavior and microevolution. After completion of the great tit genome sequence, a customized high density 650k SNP array was developed enabling
Ortega, M Sofia; Denicol, Anna C; Cole, John B; Null, Daniel J; Taylor, Jeremy F; Schnabel, Robert D; Hansen, Peter J
2017-05-01
Many genetic markers related to health or production traits are not evaluated in populations independent of the discovery population or related to phenotype. Here we evaluated 68 single nucleotide polymorphisms (SNP) in candidate genes previously associated with genetic merit for fertility and production traits for association with phenotypic measurements of fertility in a population of Holstein cows that was selected based on predicted transmitting ability (PTA) for daughter pregnancy rate (DPR; high, ≥1, n = 989; low, ≤ -1.0, n = 1,285). Cows with a high PTA for DPR had higher pregnancy rate at first service, fewer services per conception, and fewer days open than cows with a low PTA for DPR. Of the 68 SNP, 11 were associated with pregnancy rate at first service, 16 with services per conception, and 19 with days open. Single nucleotide polymorphisms in 12 genes (BDH2, BSP3, CAST, CD2, CD14, FUT1, FYB, GCNT3, HSD17B7, IBSP, OCLN, and PCCB) had significant associations with 2 fertility traits, and SNP in 4 genes (CSPP1, FCER1G, PMM2, and TBC1D24) had significant associations with each of the 3 traits. Results from this experiment were compared with results from 2 earlier studies in which the SNP were associated with genetic estimates of fertility. One study involved the same animals as used here, and the other study was of an independent population of bulls. A total of 13 SNP associated with 1 or more phenotypic estimates of fertility were directionally associated with genetic estimates of fertility in the same cow population. Moreover, 14 SNP associated with reproductive phenotype were directionally associated with genetic estimates of fertility in the bull population. Nine SNP (located in BCAS, BSP3, CAST, FUT1, HSD17B7, OCLN, PCCB, PMM2, and TBC1D24) had a directional association with fertility in all 3 studies. Examination of the function of the genes with SNP associated with reproduction in more than one study indicates the importance of steroid hormones
van Binsbergen, R; Veerkamp, R F; Calus, M P L
2012-04-01
The correlated responses between traits may differ depending on the makeup of genetic covariances, and may differ from the predictions of polygenic covariances. Therefore, the objective of the present study was to investigate the makeup of the genetic covariances between the well-studied traits: milk yield, fat yield, protein yield, and their percentages in more detail. Phenotypic records of 1,737 heifers of research farms in 4 different countries were used after homogenizing and adjusting for management effects. All cows had a genotype for 37,590 single nucleotide polymorphisms (SNP). A bayesian stochastic search variable selection model was used to estimate the SNP effects for each trait. About 0.5 to 1.0% of the SNP had a significant effect on 1 or more traits; however, the SNP without a significant effect explained most of the genetic variances and covariances of the traits. Single nucleotide polymorphism correlations differed from the polygenic correlations, but only 10 regions were found with an effect on multiple traits; in 1 of these regions the DGAT1 gene was previously reported with an effect on multiple traits. This region explained up to 41% of the variances of 4 traits and explained a major part of the correlation between fat yield and fat percentage and contributes to asymmetry in correlated response between fat yield and fat percentage. Overall, for the traits in this study, the infinitesimal model is expected to be sufficient for the estimation of the variances and covariances. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Eko Handiwirawan
2012-12-01
Full Text Available In the population, there are aggressive sheep in a small number which requires special management those specific animal house and routine management. The purpose of this study was to identify the variation of DNA marker SNP (single nucleotide polymorphism as a genetic marker for the aggressive trait in several of sheep breed. The identification of point mutations in exon 8 of MAO-A gene associated with aggressive behavior in sheep may be further useful to become of DNA markers for the aggressive trait in sheep. Five of sheep breed were used, i.e.: Barbados Black belly Cross sheep (BC, Composite Garut (KG, Local Garut (LG, Composite Sumatra (KS and St. Cross Croix (SC. Duration of ten behavior traits, blood serotonin concentrations and DNA sequence of exon 8 of MAO-A gene from the sheep aggressive and nonaggressive were observed. PROC GLM of SAS Ver. 9.0 program was used to analyze variable behavior and blood serotonin concentrations. DNA polymorphism in exon 8 of MAO-A gene was analyzed using the MEGA software Ver. 4.0. The results show that the percentage of the aggressive rams of each breed was less than 10 percent; except for the KS sheep is higher (23%. Based on the duration of behavior, aggressive sheep group was not significantly different with non aggressive sheep group, except duration of care giving and drinking behavior. It is known that concentration of blood serotonin in aggressive and non aggressive rams was not significantly different. The aggressive trait in sheep has a mechanism or a different cause like that occurs in mice and humans. In this study, aggressive behavior in sheep was not associated with a mutation in exon 8 of MAO-A gene.
Design of a bovine low-density SNP array optimized for imputation.
Directory of Open Access Journals (Sweden)
Didier Boichard
Full Text Available The Illumina BovineLD BeadChip was designed to support imputation to higher density genotypes in dairy and beef breeds by including single-nucleotide polymorphisms (SNPs that had a high minor allele frequency as well as uniform spacing across the genome except at the ends of the chromosome where densities were increased. The chip also includes SNPs on the Y chromosome and mitochondrial DNA loci that are useful for determining subspecies classification and certain paternal and maternal breed lineages. The total number of SNPs was 6,909. Accuracy of imputation to Illumina BovineSNP50 genotypes using the BovineLD chip was over 97% for most dairy and beef populations. The BovineLD imputations were about 3 percentage points more accurate than those from the Illumina GoldenGate Bovine3K BeadChip across multiple populations. The improvement was greatest when neither parent was genotyped. The minor allele frequencies were similar across taurine beef and dairy breeds as was the proportion of SNPs that were polymorphic. The new BovineLD chip should facilitate low-cost genomic selection in taurine beef and dairy cattle.
Cho, Young-Il; Ahn, Yul-Kyun; Tripathi, Swati; Kim, Jeong-Ho; Lee, Hye-Eun; Kim, Do-Sun
2015-01-01
Numerous studies using single nucleotide polymorphisms (SNPs) have been conducted in humans, and other animals, and in major crops, including rice, soybean, and Chinese cabbage. However, the number of SNP studies in cabbage is limited. In this present study, we evaluated whether 7,645 SNPs previously identified as molecular markers linked to disease resistance in the Brassica rapa genome could be applied to B. oleracea. In a BLAST analysis using the SNP sequences of B. rapa and B. oleracea genomic sequence data registered in the NCBI database, 256 genes for which SNPs had been identified in B. rapa were found in B. oleracea. These genes were classified into three functional groups: molecular function (64 genes), biological process (96 genes), and cellular component (96 genes). A total of 693 SNP markers, including 145 SNP markers [BRH—developed from the B. rapa genome for high-resolution melt (HRM) analysis], 425 SNP markers (BRP—based on the B. rapa genome that could be applied to B. oleracea), and 123 new SNP markers (BRS—derived from BRP and designed for HRM analysis), were investigated for their ability to amplify sequences from cabbage genomic DNA. In total, 425 of the SNP markers (BRP-based on B. rapa genome), selected from 7,645 SNPs, were successfully applied to B. oleracea. Using PCR, 108 of 145 BRH (74.5%), 415 of 425 BRP (97.6%), and 118 of 123 BRS (95.9%) showed amplification, suggesting that it is possible to apply SNP markers developed based on the B. rapa genome to B. oleracea. These results provide valuable information that can be utilized in cabbage genetics and breeding programs using molecular markers derived from other Brassica species. PMID:25790283
International Nuclear Information System (INIS)
Tarnovsky, V.; Becker, K.
1992-01-01
We report new measurements of the absolute electron-impact double ionization cross sections for Ar and Kr and of the ratios of double-to-single ionization for impact energies from threshold to 200 eV using the crossed electron-beam - fast-atom-beam technique. The work was motivated by the recently highlighted spread of about 30% in the Ar 2+ /Ar + ionization cross section ratios obtained by several groups using different experimental techniques. Such a spread is inconsistent with statistical uncertainties of typically 3% or less that were quoted for the various reported ratios. A similar situation exists for Kr where the spread among the recently published Kr 2+ /Kr + ionization cross section ratios is about 15%. We made an attempt to identify all potential systematic errors inherent to the fast-beam technique that could affect the measurement of cross section ratios with special emphasis on those systematic errors that could influence the detection of singly and doubly charged product ions differently. We found Ar 2+ /Ar + and Kr 2+ /Kr + cross section ratios of, respectively 0.066±0.007 and 0.087±0.008 at 100 eV which confirm earlier measurements using the same experimental technique. The error limits on cross sections ratios of multiple-to-single ionization for the same target atom and at least ±10% for ratios of single ionization cross sections for different target species. Our error limits are dominated by systematic uncertainties of the apparatus which do not cancel when cross section ratios are measured, since the ratios are obtained under similar, but not identical experimental conditions. (orig.)
Caetano,Alexandre Rodrigues
2009-01-01
Os primeiros estudos de identificação, caracterização e utilização de marcadores moleculares para a caracterização de recursos genéticos e geração de ferramentas para o melhoramento animal datam do final da década de 80. Nos últimos 20 anos as tecnologias para geração de dados moleculares passaram por vários ciclos de renovação. A última onda de inovações tecnológicas representa uma verdadeira revolução e trouxe metodologias para identificar e genotipar marcadores SNP (do inglês Single Nucleo...
Bogomolovas, J.; Fleming, J.R.; Anderson, B.R.; Williams, R.; Lange, S.; Simon, B.; Khan, M.M.; Rudolf, R.; Franke, B.; Bullard, B.; Rigden, D.J.; Granzier, H.; Labeit, S.; Mayans, O.
2016-01-01
Missense single-nucleotide polymorphisms (mSNPs) in titin are emerging as a main causative factor of heart failure. However, distinguishing between benign and disease-causing mSNPs is a substantial challenge. Here, we research the question of whether a single mSNP in a generic domain of titin can
International Nuclear Information System (INIS)
Barnett, Gillian C.; Elliott, Rebecca M.; Alsner, Jan; Andreassen, Christian N.; Abdelhay, Osama; Burnet, Neil G.; Chang-Claude, Jenny; Coles, Charlotte E.; Gutiérrez-Enríquez, Sara; Fuentes-Raspall, Maria J.; Alonso-Muñoz, Maria C.; Kerns, Sarah; Raabe, Annette; Symonds, R. Paul; Seibold, Petra; Talbot, Chris J.; Wenz, Frederik; Wilkinson, Jennifer; Yarnold, John; Dunning, Alison M.
2012-01-01
Background and purpose: Reported associations between risk of radiation-induced normal tissue injury and single nucleotide polymorphisms (SNPs) in TGFB1, encoding the pro-fibrotic cytokine transforming growth factor-beta 1 (TGF-β1), remain controversial. To overcome publication bias, the international Radiogenomics Consortium collected and analysed individual patient level data from both published and unpublished studies. Materials and methods: TGFB1 SNP rs1800469 c.-1347T>C (previously known as C-509T) genotype, treatment-related data, and clinically-assessed fibrosis (measured at least 2 years after therapy) were available in 2782 participants from 11 cohorts. All received adjuvant breast radiotherapy. Associations between late fibrosis or overall toxicity, reported by STAT (Standardised Total Average Toxicity) score, and rs1800469 genotype were assessed. Results: No statistically significant associations between either fibrosis or overall toxicity and rs1800469 genotype were observed with univariate or multivariate regression analysis. The multivariate odds ratio (OR), obtained from meta-analysis, for an increase in late fibrosis grade with each additional rare allele of rs1800469 was 0.98 (95% Confidence Interval (CI) 0.85–1.11). This CI is sufficiently narrow to rule out any clinically relevant effect on toxicity risk in carriers vs. non-carriers with a high probability. Conclusion: This meta-analysis has not confirmed previous reports of association between fibrosis or overall toxicity and rs1800469 genotype in breast cancer patients. It has demonstrated successful collaboration within the Radiogenomics Consortium.
Development of a set of SNP markers present in expressed genes of the apple.
Chagné, David; Gasic, Ksenija; Crowhurst, Ross N; Han, Yuepeng; Bassett, Heather C; Bowatte, Deepa R; Lawrence, Timothy J; Rikkerink, Erik H A; Gardiner, Susan E; Korban, Schuyler S
2008-11-01
Molecular markers associated with gene coding regions are useful tools for bridging functional and structural genomics. Due to their high abundance in plant genomes, single nucleotide polymorphisms (SNPs) are present within virtually all genomic regions, including most coding sequences. The objective of this study was to develop a set of SNPs for the apple by taking advantage of the wealth of genomics resources available for the apple, including a large collection of expressed sequenced tags (ESTs). Using bioinformatics tools, a search for SNPs within an EST database of approximately 350,000 sequences developed from a variety of apple accessions was conducted. This resulted in the identification of a total of 71,482 putative SNPs. As the apple genome is reported to be an ancient polyploid, attempts were made to verify whether those SNPs detected in silico were attributable either to allelic polymorphisms or to gene duplication or paralogous or homeologous sequence variations. To this end, a set of 464 PCR primer pairs was designed, PCR was amplified using two subsets of plants, and the PCR products were sequenced. The SNPs retrieved from these sequences were then mapped onto apple genetic maps, including a newly constructed map of a Royal Gala x A689-24 cross and a Malling 9 x Robusta 5, map using a bin mapping strategy. The SNP genotyping was performed using the high-resolution melting (HRM) technique. A total of 93 new markers containing 210 coding SNPs were successfully mapped. This new set of SNP markers for the apple offers new opportunities for understanding the genetic control of important horticultural traits using quantitative trait loci (QTL) or linkage disequilibrium analysis. These also serve as useful markers for aligning physical and genetic maps, and as potential transferable markers across the Rosaceae family.
Yang, Cheng-Hong; Wu, Kuo-Chuan; Dahms, Hans-Uwe; Chuang, Li-Yeh; Chang, Hsueh-Wei
2017-07-01
DNA barcodes are widely used in taxonomy, systematics, species identification, food safety, and forensic science. Most of the conventional DNA barcode sequences contain the whole information of a given barcoding gene. Most of the sequence information does not vary and is uninformative for a given group of taxa within a monophylum. We suggest here a method that reduces the amount of noninformative nucleotides in a given barcoding sequence of a major taxon, like the prokaryotes, or eukaryotic animals, plants, or fungi. The actual differences in genetic sequences, called single nucleotide polymorphism (SNP) genotyping, provide a tool for developing a rapid, reliable, and high-throughput assay for the discrimination between known species. Here, we investigated SNPs as robust markers of genetic variation for identifying different pigeon species based on available cytochrome c oxidase I (COI) data. We propose here a decision tree-based SNP barcoding (DTSB) algorithm where SNP patterns are selected from the DNA barcoding sequence of several evolutionarily related species in order to identify a single species with pigeons as an example. This approach can make use of any established barcoding system. We here firstly used as an example the mitochondrial gene COI information of 17 pigeon species (Columbidae, Aves) using DTSB after sequence trimming and alignment. SNPs were chosen which followed the rule of decision tree and species-specific SNP barcodes. The shortest barcode of about 11 bp was then generated for discriminating 17 pigeon species using the DTSB method. This method provides a sequence alignment and tree decision approach to parsimoniously assign a unique and shortest SNP barcode for any known species of a chosen monophyletic taxon where a barcoding sequence is available.
International Nuclear Information System (INIS)
Bjoerheim, Jens; Abrahamsen, Torveig Weum; Kristensen, Annette Torgunrud; Gaudernack, Gustav; Ekstroem, Per O.
2003-01-01
Melting gel techniques have proven to be amenable and powerful tools in point mutation and single nucleotide polymorphism (SNP) analysis. With the introduction of commercially available capillary electrophoresis instruments, a partly automated platform for denaturant capillary electrophoresis with potential for routine screening of selected target sequences has been established. The aim of this article is to demonstrate the use of automated constant denaturant capillary electrophoresis (ACDCE) in single nucleotide polymorphism analysis of various target sequences. Optimal analysis conditions for different single nucleotide polymorphisms on ACDCE are evaluated with the Poland algorithm. Laboratory procedures include only PCR and electrophoresis. For direct genotyping of individual SNPs, the samples are analyzed with an internal standard and the alleles are identified by co-migration of sample and standard peaks. In conclusion, SNPs suitable for melting gel analysis based on theoretical thermodynamics were separated by ACDCE under appropriate conditions. With this instrumentation (ABI 310 Genetic Analyzer), 48 samples could be analyzed without any intervention. Several institutions have capillary instrumentation in-house, thus making this SNP analysis method accessible to large groups of researchers without any need for instrument modification
SNP Discovery for mapping alien introgressions in wheat
2014-01-01
Background Monitoring alien introgressions in crop plants is difficult due to the lack of genetic and molecular mapping information on the wild crop relatives. The tertiary gene pool of wheat is a very important source of genetic variability for wheat improvement against biotic and abiotic stresses. By exploring the 5Mg short arm (5MgS) of Aegilops geniculata, we can apply chromosome genomics for the discovery of SNP markers and their use for monitoring alien introgressions in wheat (Triticum aestivum L). Results The short arm of chromosome 5Mg of Ae. geniculata Roth (syn. Ae. ovata L.; 2n = 4x = 28, UgUgMgMg) was flow-sorted from a wheat line in which it is maintained as a telocentric chromosome. DNA of the sorted arm was amplified and sequenced using an Illumina Hiseq 2000 with ~45x coverage. The sequence data was used for SNP discovery against wheat homoeologous group-5 assemblies. A total of 2,178 unique, 5MgS-specific SNPs were discovered. Randomly selected samples of 59 5MgS-specific SNPs were tested (44 by KASPar assay and 15 by Sanger sequencing) and 84% were validated. Of the selected SNPs, 97% mapped to a chromosome 5Mg addition to wheat (the source of t5MgS), and 94% to 5Mg introgressed from a different accession of Ae. geniculata substituting for chromosome 5D of wheat. The validated SNPs also identified chromosome segments of 5MgS origin in a set of T5D-5Mg translocation lines; eight SNPs (25%) mapped to TA5601 [T5DL · 5DS-5MgS(0.75)] and three (8%) to TA5602 [T5DL · 5DS-5MgS (0.95)]. SNPs (gsnp_5ms83 and gsnp_5ms94), tagging chromosome T5DL · 5DS-5MgS(0.95) with the smallest introgression carrying resistance to leaf rust (Lr57) and stripe rust (Yr40), were validated in two released germplasm lines with Lr57 and Yr40 genes. Conclusion This approach should be widely applicable for the identification of species/genome-specific SNPs. The development of a large number of SNP markers will facilitate the precise introgression and
SNP Discovery for mapping alien introgressions in wheat.
Tiwari, Vijay K; Wang, Shichen; Sehgal, Sunish; Vrána, Jan; Friebe, Bernd; Kubaláková, Marie; Chhuneja, Praveen; Doležel, Jaroslav; Akhunov, Eduard; Kalia, Bhanu; Sabir, Jamal; Gill, Bikram S
2014-04-10
Monitoring alien introgressions in crop plants is difficult due to the lack of genetic and molecular mapping information on the wild crop relatives. The tertiary gene pool of wheat is a very important source of genetic variability for wheat improvement against biotic and abiotic stresses. By exploring the 5Mg short arm (5MgS) of Aegilops geniculata, we can apply chromosome genomics for the discovery of SNP markers and their use for monitoring alien introgressions in wheat (Triticum aestivum L). The short arm of chromosome 5Mg of Ae. geniculata Roth (syn. Ae. ovata L.; 2n = 4x = 28, UgUgMgMg) was flow-sorted from a wheat line in which it is maintained as a telocentric chromosome. DNA of the sorted arm was amplified and sequenced using an Illumina Hiseq 2000 with ~45x coverage. The sequence data was used for SNP discovery against wheat homoeologous group-5 assemblies. A total of 2,178 unique, 5MgS-specific SNPs were discovered. Randomly selected samples of 59 5MgS-specific SNPs were tested (44 by KASPar assay and 15 by Sanger sequencing) and 84% were validated. Of the selected SNPs, 97% mapped to a chromosome 5Mg addition to wheat (the source of t5MgS), and 94% to 5Mg introgressed from a different accession of Ae. geniculata substituting for chromosome 5D of wheat. The validated SNPs also identified chromosome segments of 5MgS origin in a set of T5D-5Mg translocation lines; eight SNPs (25%) mapped to TA5601 [T5DL · 5DS-5MgS(0.75)] and three (8%) to TA5602 [T5DL · 5DS-5MgS (0.95)]. SNPs (gsnp_5ms83 and gsnp_5ms94), tagging chromosome T5DL · 5DS-5MgS(0.95) with the smallest introgression carrying resistance to leaf rust (Lr57) and stripe rust (Yr40), were validated in two released germplasm lines with Lr57 and Yr40 genes. This approach should be widely applicable for the identification of species/genome-specific SNPs. The development of a large number of SNP markers will facilitate the precise introgression and monitoring of alien segments in crop
Application of high resolution SNP arrays in patients with congenital ...
Indian Academy of Sciences (India)
TING-YING LEI
lent oligonucleotide-based array-CGH to determine the exact breakpoints in 14 patients with partial deletions of chromo- some 13q21.1-qter. They were able to refine the smallest deletion region linked to cleft lip/palate (13q31.3–13q33.1). Except for the arrays that measure DNA copy number differ- ences only, SNP arrays, ...
DEFF Research Database (Denmark)
Santos, C; Fondevila, M; Ballard, D
2015-01-01
that analyzes the genotype data alongside calculation of Bayes likelihood ratios. Exercise results indicated consistent genotyping performance from both tests, reaching a particularly high level of reliability for the Indel test. SNP genotyping gave 93.5% concordance (compared to the organizing laboratory...... relationship between input DNA and signal strength as each marker is detected with a single dye, so mixed DNA is more reliably detected. We report the results of a collaborative inter-laboratory exercise of 19 participants (15 from the EDNAP European DNA Profiling group) that assessed a 34-plex SNP test using...... the correct ancestry to the other samples using Snipper, with the exception of one laboratory with SNP miscalls that incorrectly assigned ancestry of two samples and did not obtain informative likelihood ratios for a third. Therefore, successful ancestry assignments were achieved by participants in 92 of 95...
Energy Technology Data Exchange (ETDEWEB)
Chung, Jin Il; Kim, Dong Ik; Lee, Byung In; Lee, Seung Ik; Yoon, Pyeong Ho [Medical College, Yonsei University, Seoul (Korea, Republic of)
2000-08-01
To compare hippocampal and neocortical metabolite ratios using single-voxel proton MR spectroscopy with different echo times in patients with complex partial seizure. Using a GE Signa 1.5T scanner with STEAM and PRESS sequences, automated single voxel proton MRS was used to determine metabolite ratio differences in the hippocampus and neocortex of nine complex partial seizure patients (mesial temporal sclerosis (n=3D5), status epilepticus (n=3D1), tumor (n=3D1), cortical dysplasia (n=3D1), occipital lobe epilepsy (n=3D1)). A total of 20 examinations were performed in the region of the hippocampus (n=3D17), temporal neocortex (n=3D1), and parieto-occipital gray matter (n=3D1). Voxel size range was 5.2-17.4 cm{sup 3}. The calculated creatine (Cr) peak was employed as an internal reference and the relative ratio of N-acetylaspartate (NAA) and choline (Cho) was calculated for both short and long echo times using an automated PROBE/SV (GE Medical Systems) package. Each NAA/Cho ratio obtained using both PRESS and STEAM techniques was compared by means of statistical analysis (paired Student t-test). Using PRESS (long TE, 272 ms), NAA/Cho ratios were successfully calculated in 16 of 20 examinations; in four this was not possible due to noise levels of the Cr and Cho peaks. Using STEAM (short TE, 30 ms) NAA/Cho ratios were successfully calculated in 19 of 20 examinations; in one, the Cho peak could not be measured. Using PRESS and STEAM, mean and standard deviations for the NAA/Cho ratio were 1.22{+-}0.50 and 1.16{+-}0.36, respectively. There were no statistically significant differences in this ratio between the short and long TE method (p less than 0.01). In complex partial seizure patients, no significant metabolite differences were found between short and long echo times of single voxel proton MR spectroscopy. The metabolite ratio at different echo times can be reliably obtained using this simplified and automated PROBE/SV quantitation method. (author)
Xu, Qian; Wu, Ye-Feng; Li, Ying; He, Cai-Yun; Sun, Li-Ping; Liu, Jing-Wei; Yuan, Yuan
2016-04-26
Gastric cancer (GC) is a multistep complex disease involving multiple genes, and gene-gene interactions have a greater effect than a single gene in determining cancer susceptibility. This study aimed to explore the interaction of the let-7e rs8111742, miR-365b rs121224, and miR-4795 rs1002765 single nucleotide polymorphisms (SNPs) with SNPs of the predicted target gene PGC and Helicobacter pylori status in GC and atrophic gastritis (AG) risk. Three miRNA SNPs and seven PGC SNPs were detected in 2448 cases using the Sequenom MassArray platform. Two pairwise combinations of miRNA and PGC SNPs were associated with increased AG risk (let-7e rs8111742 - PGC rs6458238 and miR-4795 rs1002765 - PGC rs9471643). Singly, miR-365b rs121224 and PGC rs6912200 had no effect individually but in combination they demonstrated an epistatic interaction associated with AG risk. Similarly, let-7e rs8111742 and miR-4795 rs1002765 SNPs interacted with H. pylori infection to increase GC risk (rs8111742: Pinteraction = 0.024; rs1002765: Pinteraction = 0.031, respectively). A three-dimensional interaction analysis found miR-4795 rs1002765, PGC rs9471643, and H. pylori infection positively interacted to increase AG risk (Pinteraction = 0.027). Also, let-7e rs8111742, PGC rs6458238, and H. pylori infection positively interacted to increase GC risk (Pinteraction = 0.036). Furthermore, both of these three-dimensional interactions had a dosage-effect correspondence (Ptrend < 0.001) and were verified by MDR. In conclusion, the miRNAs SNPs (let-7e rs8111742 and miR-4795 rs1002765) might have more superior efficiency when combined with PGC SNPs and/or H. pylori for GC or AG risk than a single SNP on its own.
Directory of Open Access Journals (Sweden)
Guangtu Gao
2018-04-01
Full Text Available Single-nucleotide polymorphisms (SNPs are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout (Oncorhynchus mykiss, SNP discovery has been previously done through sequencing of restriction-site associated DNA (RAD libraries, reduced representation libraries (RRL and RNA sequencing. Recently we have performed high coverage whole genome resequencing with 61 unrelated samples, representing a wide range of rainbow trout and steelhead populations, with 49 new samples added to 12 aquaculture samples from AquaGen (Norway that we previously used for SNP discovery. Of the 49 new samples, 11 were double-haploid lines from Washington State University (WSU and 38 represented wild and hatchery populations from a wide range of geographic distribution and with divergent migratory phenotypes. We then mapped the sequences to the new rainbow trout reference genome assembly (GCA_002163495.1 which is based on the Swanson YY doubled haploid line. Variant calling was conducted with FreeBayes and SAMtools mpileup, followed by filtering of SNPs based on quality score, sequence complexity, read depth on the locus, and number of genotyped samples. Results from the two variant calling programs were compared and genotypes of the double haploid samples were used for detecting and filtering putative paralogous sequence variants (PSVs and multi-sequence variants (MSVs. Overall, 30,302,087 SNPs were identified on the rainbow trout genome 29 chromosomes and 1,139,018 on unplaced scaffolds, with 4,042,723 SNPs having high minor allele frequency (MAF > 0.25. The average SNP density on the chromosomes was one SNP per 64 bp, or 15.6 SNPs per 1 kb. Results from the phylogenetic analysis that we conducted indicate that the SNP markers contain enough population-specific polymorphisms for recovering population relationships despite the small sample size used. Intra-Population polymorphism assessment revealed high level of polymorphism and
Two-temperature LATE-PCR endpoint genotyping
Directory of Open Access Journals (Sweden)
Reis Arthur H
2006-12-01
Full Text Available Abstract Background In conventional PCR, total amplicon yield becomes independent of starting template number as amplification reaches plateau and varies significantly among replicate reactions. This paper describes a strategy for reconfiguring PCR so that the signal intensity of a single fluorescent detection probe after PCR thermal cycling reflects genomic composition. The resulting method corrects for product yield variations among replicate amplification reactions, permits resolution of homozygous and heterozygous genotypes based on endpoint fluorescence signal intensities, and readily identifies imbalanced allele ratios equivalent to those arising from gene/chromosomal duplications. Furthermore, the use of only a single colored probe for genotyping enhances the multiplex detection capacity of the assay. Results Two-Temperature LATE-PCR endpoint genotyping combines Linear-After-The-Exponential (LATE-PCR (an advanced form of asymmetric PCR that efficiently generates single-stranded DNA and mismatch-tolerant probes capable of detecting allele-specific targets at high temperature and total single-stranded amplicons at a lower temperature in the same reaction. The method is demonstrated here for genotyping single-nucleotide alleles of the human HEXA gene responsible for Tay-Sachs disease and for genotyping SNP alleles near the human p53 tumor suppressor gene. In each case, the final probe signals were normalized against total single-stranded DNA generated in the same reaction. Normalization reduces the coefficient of variation among replicates from 17.22% to as little as 2.78% and permits endpoint genotyping with >99.7% accuracy. These assays are robust because they are consistent over a wide range of input DNA concentrations and give the same results regardless of how many cycles of linear amplification have elapsed. The method is also sufficiently powerful to distinguish between samples with a 1:1 ratio of two alleles from samples comprised of
Lack of an association of miR-938 SNP in IDDM10 with human type 1 diabetes
Directory of Open Access Journals (Sweden)
Mi Xiaofan
2011-10-01
Full Text Available Abstract MicroRNAs (miRNAs are a newly discovered type of small non-protein coding RNA that function in the inhibition of effective mRNA translation, and may serve as susceptibility genes for various disease developments. The SNP rs12416605, located in human type 1 diabetes IDDM10 locus, changes the seeding sequence (UGU[G/A]CCC of miRNA miR-938 and potentially alters miR-938 targets, including IL-16 and IL-17A. In an attempt to test whether miR-938 may be a susceptibility gene for IDDM10, we assessed the possible association of the miR-938 SNP with T1D in an American Caucasian cohort of 622 patients and 723 healthy controls by TaqMan assay. Our current data do not support the association between the SNP in miR-938 and type 1 diabetes.
Single-nucleotide polymorphism discovery by high-throughput sequencing in sorghum
Directory of Open Access Journals (Sweden)
White Frank F
2011-07-01
Full Text Available Abstract Background Eight diverse sorghum (Sorghum bicolor L. Moench accessions were subjected to short-read genome sequencing to characterize the distribution of single-nucleotide polymorphisms (SNPs. Two strategies were used for DNA library preparation. Missing SNP genotype data were imputed by local haplotype comparison. The effect of library type and genomic diversity on SNP discovery and imputation are evaluated. Results Alignment of eight genome equivalents (6 Gb to the public reference genome revealed 283,000 SNPs at ≥82% confirmation probability. Sequencing from libraries constructed to limit sequencing to start at defined restriction sites led to genotyping 10-fold more SNPs in all 8 accessions, and correctly imputing 11% more missing data, than from semirandom libraries. The SNP yield advantage of the reduced-representation method was less than expected, since up to one fifth of reads started at noncanonical restriction sites and up to one third of restriction sites predicted in silico to yield unique alignments were not sampled at near-saturation. For imputation accuracy, the availability of a genomically similar accession in the germplasm panel was more important than panel size or sequencing coverage. Conclusions A sequence quantity of 3 million 50-base reads per accession using a BsrFI library would conservatively provide satisfactory genotyping of 96,000 sorghum SNPs. For most reliable SNP-genotype imputation in shallowly sequenced genomes, germplasm panels should consist of pairs or groups of genomically similar entries. These results may help in designing strategies for economical genotyping-by-sequencing of large numbers of plant accessions.
Lopes, F B; Wu, X-L; Li, H; Xu, J; Perkins, T; Genho, J; Ferretti, R; Tait, R G; Bauck, S; Rosa, G J M
2018-02-01
Reliable genomic prediction of breeding values for quantitative traits requires the availability of sufficient number of animals with genotypes and phenotypes in the training set. As of 31 October 2016, there were 3,797 Brangus animals with genotypes and phenotypes. These Brangus animals were genotyped using different commercial SNP chips. Of them, the largest group consisted of 1,535 animals genotyped by the GGP-LDV4 SNP chip. The remaining 2,262 genotypes were imputed to the SNP content of the GGP-LDV4 chip, so that the number of animals available for training the genomic prediction models was more than doubled. The present study showed that the pooling of animals with both original or imputed 40K SNP genotypes substantially increased genomic prediction accuracies on the ten traits. By supplementing imputed genotypes, the relative gains in genomic prediction accuracies on estimated breeding values (EBV) were from 12.60% to 31.27%, and the relative gain in genomic prediction accuracies on de-regressed EBV was slightly small (i.e. 0.87%-18.75%). The present study also compared the performance of five genomic prediction models and two cross-validation methods. The five genomic models predicted EBV and de-regressed EBV of the ten traits similarly well. Of the two cross-validation methods, leave-one-out cross-validation maximized the number of animals at the stage of training for genomic prediction. Genomic prediction accuracy (GPA) on the ten quantitative traits was validated in 1,106 newly genotyped Brangus animals based on the SNP effects estimated in the previous set of 3,797 Brangus animals, and they were slightly lower than GPA in the original data. The present study was the first to leverage currently available genotype and phenotype resources in order to harness genomic prediction in Brangus beef cattle. © 2018 Blackwell Verlag GmbH.
Li, Faji; Wen, Weie; He, Zhonghu; Liu, Jindong; Jin, Hui; Cao, Shuanghe; Geng, Hongwei; Yan, Jun; Zhang, Pingzhi; Wan, Yingxiu; Xia, Xianchun
2018-06-01
We identified 21 new and stable QTL, and 11 QTL clusters for yield-related traits in three bread wheat populations using the wheat 90 K SNP assay. Identification of quantitative trait loci (QTL) for yield-related traits and closely linked molecular markers is important in order to identify gene/QTL for marker-assisted selection (MAS) in wheat breeding. The objectives of the present study were to identify QTL for yield-related traits and dissect the relationships among different traits in three wheat recombinant inbred line (RIL) populations derived from crosses Doumai × Shi 4185 (D × S), Gaocheng 8901 × Zhoumai 16 (G × Z) and Linmai 2 × Zhong 892 (L × Z). Using the available high-density linkage maps previously constructed with the wheat 90 K iSelect single nucleotide polymorphism (SNP) array, 65, 46 and 53 QTL for 12 traits were identified in the three RIL populations, respectively. Among them, 34, 23 and 27 were likely to be new QTL. Eighteen common QTL were detected across two or three populations. Eleven QTL clusters harboring multiple QTL were detected in different populations, and the interval 15.5-32.3 cM around the Rht-B1 locus on chromosome 4BS harboring 20 QTL is an important region determining grain yield (GY). Thousand-kernel weight (TKW) is significantly affected by kernel width and plant height (PH), whereas flag leaf width can be used to select lines with large kernel number per spike. Eleven candidate genes were identified, including eight cloned genes for kernel, heading date (HD) and PH-related traits as well as predicted genes for TKW, spike length and HD. The closest SNP markers of stable QTL or QTL clusters can be used for MAS in wheat breeding using kompetitive allele-specific PCR or semi-thermal asymmetric reverse PCR assays for improvement of GY.
Xu, L; Shi, Y; Gu, J; Wang, Y; Wang, L; You, L; Qi, X; Ye, Y; Chen, Z
2014-03-01
To investigate the association between 2 single nucleotide polymorphisms (SNP501A/C and 604 G/A) in the promoter of the ghrelin gene and the hormonal and metabolic phenotypes of polycystic ovary syndrome (PCOS) in a Chinese population. 285 patients with PCOS and 260 healthy controls were selected for a prospective, case-control study at Shandong Provincial Hospital, Jinan, China. All subjects underwent genotype analysis of the 2 single nucleotide polymorphisms of the ghrelin gene. Measurements were also taken of blood lipids, glucose, and hormone levels, and calculations of body mass index (BMI) and waist-to-hip ratio (WHR) were performed to detect hormonal and metabolic phenotypes. No significant diff erences in polymorphism genotypes were found between PCOS patients and healthy controls. However, the frequency of the -501 A/C A allele was significantly higher in the PCOS group than in the control group. PCOS -501 A/C A carriers had significantly higher BMI and WHR than PCOS women with the CC genotype. -604 G/A polymorphisms were not associated with clinical or biochemical characteristics of PCOS. The -501 A/C polymorphism of the ghrelin gene is associated with metabolic features of PCOS in a Chinese population. © J. A. Barth Verlag in Georg Thieme Verlag KG Stuttgart · New York.
International Nuclear Information System (INIS)
Levin, J.C.; Lindle, D.W.; Keller, N.; Miller, R.D.; Azuma, Y.; Mansour, N.B.; Berry, H.G.; Sellin, I.A.
1991-01-01
We report the first measurement of the ratio of double-to-single photoionization of helium well above the double-ionization threshold. Using a time-of-flight technique, we find He ++ /He + =1.6±0.3% at hν=2.8 keV. This value lies between calculations by Amusia (2.3%) and by Samson, who predicts 1.2% by analogy with electron-impact ionization cross sections of singly charged ions. Good agreement is obtained with older shake calculations of Byron and Joachain, and of Aberg, who predict 1.7%
McClure, Matthew C.; Bickhart, Derek; Null, Dan; VanRaden, Paul; Xu, Lingyang; Wiggans, George; Liu, George; Schroeder, Steve; Glasscock, Jarret; Armstrong, Jon; Cole, John B.; Van Tassell, Curtis P.; Sonstegard, Tad S.
2014-01-01
The recent discovery of bovine haplotypes with negative effects on fertility in the Brown Swiss, Holstein, and Jersey breeds has allowed producers to identify carrier animals using commercial single nucleotide polymorphism (SNP) genotyping assays. This study was devised to identify the causative mutations underlying defective bovine embryo development contained within three of these haplotypes (Brown Swiss haplotype 1 and Holstein haplotypes 2 and 3) by combining exome capture with next gener...
Miyakawa, Hiroe; Miyamoto, Toshinobu; Koh, Eitetsu; Tsujimura, Akira; Miyagawa, Yasushi; Saijo, Yasuaki; Namiki, Mikio; Sengoku, Kazuo
2012-01-01
Genetic mechanisms have been implicated as a cause of some cases of male infertility. Recently, 10 novel genes involved in human spermatogenesis, including human SEPTIN12, were identified by expression microarray analysis of human testicular tissue. Septin12 is a member of the septin family of conserved cytoskeletal GTPases that form heteropolymeric filamentous structures in interphase cells. It is expressed specifically in the testis. Therefore, we hypothesized that mutation or polymorphisms of SEPTIN12 participate in male infertility, especially Sertoli cell-only syndrome (SCOS). To investigate whether SEPTIN12 gene defects are associated with azoospermia caused by SCOS, mutational analysis was performed in 100 Japanese patients by direct sequencing of coding regions. Statistical analysis was performed in patients with SCOS and in 140 healthy control men. No mutations were found in SEPTIN12 ; however, 8 coding single-nucleotide polymorphisms (SNP1-SNP8) could be detected in the patients with SCOS. The genotype and allele frequencies in SNP3, SNP4, and SNP6 were notably higher in the SCOS group than in the control group (P < .001). These results suggest that SEPTIN12 might play a critical role in human spermatogenesis.
Craig, Darren G; Kitto, Laura; Zafar, Sara; Reid, Thomas W D J; Martin, Kirsty G; Davidson, Janice S; Hayes, Peter C; Simpson, Kenneth J
2014-09-01
The innate immune system is profoundly dysregulated in paracetamol (acetaminophen)-induced liver injury. The neutrophil-lymphocyte ratio (NLR) is a simple bedside index with prognostic value in a number of inflammatory conditions. To evaluate the prognostic accuracy of the NLR in patients with significant liver injury following single time-point and staggered paracetamol overdoses. Time-course analysis of 100 single time-point and 50 staggered paracetamol overdoses admitted to a tertiary liver centre. Timed laboratory samples were correlated with time elapsed after overdose or admission, respectively, and the NLR was calculated. A total of 49/100 single time-point patients developed hepatic encephalopathy (HE). Median NLRs were higher at both 72 (P=0.0047) and 96 h after overdose (P=0.0041) in single time-point patients who died or were transplanted. Maximum NLR values by 96 h were associated with increasing HE grade (P=0.0005). An NLR of more than 16.7 during the first 96 h following overdose was independently associated with the development of HE [odds ratio 5.65 (95% confidence interval 1.67-19.13), P=0.005]. Maximum NLR values by 96 h were strongly associated with the requirement for intracranial pressure monitoring (Pparacetamol overdoses. Future studies should assess the value of incorporating the NLR into existing prognostic and triage indices of single time-point paracetamol overdose.
Manichaikul, Ani; Hoffman, Eric A.; Smolonska, Joanna; Gao, Wei; Cho, Michael H.; Baumhauer, Heather; Budoff, Matthew; Austin, John H. M.; Washko, George R.; Carr, J. Jeffrey; Kaufman, Joel D.; Pottinger, Tess; Powell, Charles A.; Wijmenga, Cisca; Zanen, Pieter; Groen, Harry J. M.; Postma, Dirkje S.; Wanner, Adam; Rouhani, Farshid N.; Brantly, Mark L.; Powell, Rhea; Smith, Benjamin M.; Rabinowitz, Dan; Raffel, Leslie J.; Hinckley Stukovsky, Karen D.; Crapo, James D.; Beaty, Terri H.; Hokanson, John E.; Silverman, Edwin K.; Dupuis, Josée; O’Connor, George T.; Boezen, H. Marike; Rich, Stephen S.
2014-01-01
Rationale: Pulmonary emphysema overlaps partially with spirometrically defined chronic obstructive pulmonary disease and is heritable, with moderately high familial clustering. Objectives: To complete a genome-wide association study (GWAS) for the percentage of emphysema-like lung on computed tomography in the Multi-Ethnic Study of Atherosclerosis (MESA) Lung/SNP Health Association Resource (SHARe) Study, a large, population-based cohort in the United States. Methods: We determined percent emphysema and upper-lower lobe ratio in emphysema defined by lung regions less than −950 HU on cardiac scans. Genetic analyses were reported combined across four race/ethnic groups: non-Hispanic white (n = 2,587), African American (n = 2,510), Hispanic (n = 2,113), and Chinese (n = 704) and stratified by race and ethnicity. Measurements and Main Results: Among 7,914 participants, we identified regions at genome-wide significance for percent emphysema in or near SNRPF (rs7957346; P = 2.2 × 10−8) and PPT2 (rs10947233; P = 3.2 × 10−8), both of which replicated in an additional 6,023 individuals of European ancestry. Both single-nucleotide polymorphisms were previously implicated as genes influencing lung function, and analyses including lung function revealed independent associations for percent emphysema. Among Hispanics, we identified a genetic locus for upper-lower lobe ratio near the α-mannosidase–related gene MAN2B1 (rs10411619; P = 1.1 × 10−9; minor allele frequency [MAF], 4.4%). Among Chinese, we identified single-nucleotide polymorphisms associated with upper-lower lobe ratio near DHX15 (rs7698250; P = 1.8 × 10−10; MAF, 2.7%) and MGAT5B (rs7221059; P = 2.7 × 10−8; MAF, 2.6%), which acts on α-linked mannose. Among African Americans, a locus near a third α-mannosidase–related gene, MAN1C1 (rs12130495; P = 9.9 × 10−6; MAF, 13.3%) was associated with percent emphysema. Conclusions: Our results suggest that some genes previously identified as
Role of the DGAT gene C79T single-nucleotide polymorphism in French obese subjects.
Coudreau, Sylvie Kipfer; Tounian, Patrick; Bonhomme, Geneviève; Froguel, Philippe; Girardet, Jean-Philippe; Guy-Grand, Bernard; Basdevant, Arnaud; Clément, Karine
2003-10-01
Acyl-coenzyme A, diacylglycerol acyltransferase (DGAT), is a key enzyme involved in adipose-cell triglyceride storage. A 79-bp T-to-C single-nucleotide polymorphism (SNP) on the 3' region of the DGAT transcriptional site has been reported to increase promoter activity and is associated with higher BMI in Turkish women. To validate the possible role of this genetic variant in obesity, as well as the variant's possible cellular-functional significance, we performed an association study between the T79C change and several obesity-related phenotypes in 1357 obese French adults and children. The prevalence of the T79C SNP was similar between obese adults and children when each group was compared with the controls. (CC genotype carrier frequencies were 0.25 to 0.29 in the obese groups and 0.21 in controls; p > 0.05.) In each of the obese adult and child groups studied, the T79C variant was not found to be associated with any of the obesity-related phenotypes tested. Although the T79C SNP of the DGAT gene was studied in several groups of white subjects, the association between this SNP and obesity-related phenotypes, previously described, was not confirmed in our population.
Single Nucleotide Polymorphism Identification, Characterization, and Linkage Mapping in Quinoa
Directory of Open Access Journals (Sweden)
P. J. Maughan
2012-11-01
Full Text Available Quinoa ( Willd. is an important seed crop throughout the Andean region of South America. It is important as a regional food security crop for millions of impoverished rural inhabitants of the Andean Altiplano (high plains. Efforts to improve the crop have led to an increased focus on genetic research. We report the identification of 14,178 putative single nucleotide polymorphisms (SNPs using a genomic reduction protocol as well as the development of 511 functional SNP assays. The SNP assays are based on KASPar genotyping chemistry and were detected using the Fluidigm dynamic array platform. A diversity screen of 113 quinoa accessions showed that the minor allele frequency (MAF of the SNPs ranged from 0.02 to 0.50, with an average MAF of 0.28. Structure analysis of the quinoa diversity panel uncovered the two major subgroups corresponding to the Andean and coastal quinoa ecotypes. Linkage mapping of the SNPs in two recombinant inbred line populations produced an integrated linkage map consisting of 29 linkage groups with 20 large linkage groups, spanning 1404 cM with a marker density of 3.1 cM per SNP marker. The SNPs identified here represent important genomic tools needed in emerging plant breeding programs for advanced genetic analysis of agronomic traits in quinoa.
Fine-scaled human genetic structure revealed by SNP microarrays.
Xing, Jinchuan; Watkins, W Scott; Witherspoon, David J; Zhang, Yuhua; Guthery, Stephen L; Thara, Rangaswamy; Mowry, Bryan J; Bulayeva, Kazima; Weiss, Robert B; Jorde, Lynn B
2009-05-01
We report an analysis of more than 240,000 loci genotyped using the Affymetrix SNP microarray in 554 individuals from 27 worldwide populations in Africa, Asia, and Europe. To provide a more extensive and complete sampling of human genetic variation, we have included caste and tribal samples from two states in South India, Daghestanis from eastern Europe, and the Iban from Malaysia. Consistent with observations made by Charles Darwin, our results highlight shared variation among human populations and demonstrate that much genetic variation is geographically continuous. At the same time, principal components analyses reveal discernible genetic differentiation among almost all identified populations in our sample, and in most cases, individuals can be clearly assigned to defined populations on the basis of SNP genotypes. All individuals are accurately classified into continental groups using a model-based clustering algorithm, but between closely related populations, genetic and self-classifications conflict for some individuals. The 250K data permitted high-level resolution of genetic variation among Indian caste and tribal populations and between highland and lowland Daghestani populations. In particular, upper-caste individuals from Tamil Nadu and Andhra Pradesh form one defined group, lower-caste individuals from these two states form another, and the tribal Irula samples form a third. Our results emphasize the correlation of genetic and geographic distances and highlight other elements, including social factors that have contributed to population structure.
The Association of FTO SNP rs9939609 with Weight Gain at University
Meisel, S.F.; Beeken, R.J.; Jaarsveld, C.H.M. van; Wardle, J.
2015-01-01
AIM: We tested the hypothesis that the obesity-associated FTO SNP rs9939609 would be associated with clinically significant weight gain (>/= 5% of initial body weight) in the first year of university; a time identified as high risk for weight gain. METHODS: We collected anthropometric data from
Use of SNP markers to conserve genome-wide genetic diversity in livestock
Engelsma, K.A.
2012-01-01
Conservation of genetic diversity in livestock breeds is important since it is, both within and between breeds, under threat. The availability of large numbers of SNP markers has resulted in new opportunities to estimate genetic diversity in more detail, and to improve prioritization of animals
Directory of Open Access Journals (Sweden)
Steven Y C Tong
Full Text Available We have developed a single nucleotide polymorphism (SNP nucleated high-resolution melting (HRM technique to genotype Enterococcus faecium. Eight SNPs were derived from the E. faecium multilocus sequence typing (MLST database and amplified fragments containing these SNPs were interrogated by HRM. We tested the HRM genotyping scheme on 85 E. faecium bloodstream isolates and compared the results with MLST, pulsed-field gel electrophoresis (PFGE and an allele specific real-time PCR (AS kinetic PCR SNP typing method. In silico analysis based on predicted HRM curves according to the G+C content of each fragment for all 567 sequence types (STs in the MLST database together with empiric data from the 85 isolates demonstrated that HRM analysis resolves E. faecium into 231 "melting types" (MelTs and provides a Simpson's Index of Diversity (D of 0.991 with respect to MLST. This is a significant improvement on the AS kinetic PCR SNP typing scheme that resolves 61 SNP types with D of 0.95. The MelTs were concordant with the known ST of the isolates. For the 85 isolates, there were 13 PFGE patterns, 17 STs, 14 MelTs and eight SNP types. There was excellent concordance between PFGE, MLST and MelTs with Adjusted Rand Indices of PFGE to MelT 0.936 and ST to MelT 0.973. In conclusion, this HRM based method appears rapid and reproducible. The results are concordant with MLST and the MLST based population structure.
Ali, Shahin S.; Shao, Jonathan; Strem, Mary D.; Phillips-Mora, Wilberth; Zhang, Dapeng; Meinhardt, Lyndel W.; Bailey, Bryan A.
2015-01-01
Moniliophthora roreri is the fungal pathogen that causes frosty pod rot (FPR) disease of Theobroma cacao L., the source of chocolate. FPR occurs in most of the cacao producing countries in the Western Hemisphere, causing yield losses up to 80%. Genetic diversity within the FPR pathogen population may allow the population to adapt to changing environmental conditions and adapt to enhanced resistance in the host plant. The present study developed single nucleotide polymorphism (SNP) markers fro...
Ren, Jing; Chen, Liang; Jin, Xiaoli; Zhang, Miaomiao; You, Frank M; Wang, Jirui; Frenkel, Vladimir; Yin, Xuegui; Nevo, Eviatar; Sun, Dongfa; Luo, Ming-Cheng; Peng, Junhua
2017-01-01
Whole-genome scans with large number of genetic markers provide the opportunity to investigate local adaptation in natural populations and identify candidate genes under positive selection. In the present study, adaptation genetic differentiation associated with solar radiation was investigated using 695 polymorphic SNP markers in wild emmer wheat originated in a micro-site at Yehudiyya, Israel. The test involved two solar radiation niches: (1) sun, in-between trees; and (2) shade, under tree canopy, separated apart by a distance of 2-4 m. Analysis of molecular variance showed a small (0.53%) but significant portion of overall variation between the sun and shade micro-niches, indicating a non-ignorable genetic differentiation between sun and shade habitats. Fifty SNP markers showed a medium (0.05 ≤ F ST ≤ 0.15) or high genetic differentiation ( F ST > 0.15). A total of 21 outlier loci under positive selection were identified by using four different F ST -outlier testing algorithms. The markers and genome locations under positive selection are consistent with the known patterns of selection. These results suggested that genetic differentiation between sun and shade habitats is substantial, radiation-associated, and therefore ecologically determined. Hence, the results of this study reflected effects of natural selection through solar radiation on EST-related SNP genetic diversity, resulting presumably in different adaptive complexes at a micro-scale divergence. The present work highlights the evolutionary theory and application significance of solar radiation-driven natural selection in wheat improvement.
Teh, Soon Li; Fresnedo-Ramírez, Jonathan; Clark, Matthew D; Gadoury, David M; Sun, Qi; Cadle-Davidson, Lance; Luby, James J
2017-01-01
Quantitative trait locus (QTL) identification in perennial fruit crops is impeded largely by their lengthy generation time, resulting in costly and labor-intensive maintenance of breeding programs. In a grapevine (genus Vitis ) breeding program, although experimental families are typically unreplicated, the genetic backgrounds may contain similar progenitors previously selected due to their contribution of favorable alleles. In this study, we investigated the utility of joint QTL identification provided by analyzing half-sib families. The genetic control of powdery mildew was studied using two half-sib F 1 families, namely GE0711/1009 (MN1264 × MN1214; N = 147) and GE1025 (MN1264 × MN1246; N = 125) with multiple species in their ancestry. Maternal genetic maps consisting of 1077 and 1641 single nucleotide polymorphism (SNP) markers, respectively, were constructed using a pseudo-testcross strategy. Ratings of field resistance to powdery mildew were obtained based on whole-plant evaluation of disease severity. This 2-year analysis uncovered two QTLs that were validated on a consensus map in these half-sib families with improved precision relative to the parental maps. Examination of haplotype combinations based on the two QTL regions identified strong association of haplotypes inherited from 'Seyval blanc', through MN1264, with powdery mildew resistance. This investigation also encompassed the use of microsatellite markers to establish a correlation between 206-bp (UDV-015b) and 357-bp (VViv67) fragment sizes with resistance-carrying haplotypes. Our work is one of the first reports in grapevine demonstrating the use of SNP-based maps and haplotypes for QTL identification and tagging of powdery mildew resistance in half-sib families.
Lager, Malin; Mernelius, Sara; Löfgren, Sture; Söderman, Jan
2016-01-01
Healthcare-associated infections caused by Escherichia coli and antibiotic resistance due to extended-spectrum beta-lactamase (ESBL) production constitute a threat against patient safety. To identify, track, and control outbreaks and to detect emerging virulent clones, typing tools of sufficient discriminatory power that generate reproducible and unambiguous data are needed. A probe based real-time PCR method targeting multiple single nucleotide polymorphisms (SNP) was developed. The method was based on the multi locus sequence typing scheme of Institute Pasteur and by adaptation of previously described typing assays. An 8 SNP-panel that reached a Simpson's diversity index of 0.95 was established, based on analysis of sporadic E. coli cases (ESBL n = 27 and non-ESBL n = 53). This multi-SNP assay was used to identify the sequence type 131 (ST131) complex according to the Achtman's multi locus sequence typing scheme. However, it did not fully discriminate within the complex but provided a diagnostic signature that outperformed a previously described detection assay. Pulsed-field gel electrophoresis typing of isolates from a presumed outbreak (n = 22) identified two outbreaks (ST127 and ST131) and three different non-outbreak-related isolates. Multi-SNP typing generated congruent data except for one non-outbreak-related ST131 isolate. We consider multi-SNP real-time PCR typing an accessible primary generic E. coli typing tool for rapid and uniform type identification.
Genetic Diversity in Jatropha curcas L. Assessed with SSR and SNP Markers
Directory of Open Access Journals (Sweden)
Juan M. Montes
2014-08-01
Full Text Available Jatropha curcas L. (jatropha is an undomesticated plant that has recently received great attention for its utilization in biofuel production, rehabilitation of wasteland, and rural development. Knowledge of genetic diversity and marker-trait associations is urgently needed for the design of breeding strategies. The main goal of this study was to assess the genetic structure and diversity in jatropha germplasm with co-dominant markers (Simple Sequence Repeats (SSR and Single Nucleotide Polymorphism (SNP in a diverse, worldwide, germplasm panel of 70 accessions. We found a high level of homozygosis in the germplasm that does not correspond to the purely outcrossing mating system assumed to be present in jatropha. We hypothesize that the prevalent mating system of jatropha comprise a high level of self-fertilization and that the outcrossing rate is low. Genetic diversity in accessions from Central America and Mexico was higher than in accession from Africa, Asia, and South America. We identified makers associated with the presence of phorbol esters. We think that the utilization of molecular markers in breeding of jatropha will significantly accelerate the development of improved cultivars.
Directory of Open Access Journals (Sweden)
Yang Hsin-Chou
2012-07-01
Full Text Available Abstract Background Ancestry informative markers (AIMs are a type of genetic marker that is informative for tracing the ancestral ethnicity of individuals. Application of AIMs has gained substantial attention in population genetics, forensic sciences, and medical genetics. Single nucleotide polymorphisms (SNPs, the materials of AIMs, are useful for classifying individuals from distinct continental origins but cannot discriminate individuals with subtle genetic differences from closely related ancestral lineages. Proof-of-principle studies have shown that gene expression (GE also is a heritable human variation that exhibits differential intensity distributions among ethnic groups. GE supplies ethnic information supplemental to SNPs; this motivated us to integrate SNP and GE markers to construct AIM panels with a reduced number of required markers and provide high accuracy in ancestry inference. Few studies in the literature have considered GE in this aspect, and none have integrated SNP and GE markers to aid classification of samples from closely related ethnic populations. Results We integrated a forward variable selection procedure into flexible discriminant analysis to identify key SNP and/or GE markers with the highest cross-validation prediction accuracy. By analyzing genome-wide SNP and/or GE markers in 210 independent samples from four ethnic groups in the HapMap II Project, we found that average testing accuracies for a majority of classification analyses were quite high, except for SNP-only analyses that were performed to discern study samples containing individuals from two close Asian populations. The average testing accuracies ranged from 0.53 to 0.79 for SNP-only analyses and increased to around 0.90 when GE markers were integrated together with SNP markers for the classification of samples from closely related Asian populations. Compared to GE-only analyses, integrative analyses of SNP and GE markers showed comparable testing
International Nuclear Information System (INIS)
Chung, Jin Il; Kim, Dong Ik; Lee, Byung In; Lee, Seung Ik; Yoon, Pyeong Ho
2000-01-01
To compare hippocampal and neocortical metabolite ratios using single-voxel proton MR spectroscopy with different echo times in patients with complex partial seizure. Using a GE Signa 1.5T scanner with STEAM and PRESS sequences, automated single voxel proton MRS was used to determine metabolite ratio differences in the hippocampus and neocortex of nine complex partial seizure patients (mesial temporal sclerosis (n=3D5), status epilepticus (n=3D1), tumor (n=3D1), cortical dysplasia (n=3D1), occipital lobe epilepsy (n=3D1)). A total of 20 examinations were performed in the region of the hippocampus (n=3D17), temporal neocortex (n=3D1), and parieto-occipital gray matter (n=3D1). Voxel size range was 5.2-17.4 cm 3 . The calculated creatine (Cr) peak was employed as an internal reference and the relative ratio of N-acetylaspartate (NAA) and choline (Cho) was calculated for both short and long echo times using an automated PROBE/SV (GE Medical Systems) package. Each NAA/Cho ratio obtained using both PRESS and STEAM techniques was compared by means of statistical analysis (paired Student t-test). Using PRESS (long TE, 272 ms), NAA/Cho ratios were successfully calculated in 16 of 20 examinations; in four this was not possible due to noise levels of the Cr and Cho peaks. Using STEAM (short TE, 30 ms) NAA/Cho ratios were successfully calculated in 19 of 20 examinations; in one, the Cho peak could not be measured. Using PRESS and STEAM, mean and standard deviations for the NAA/Cho ratio were 1.22±0.50 and 1.16±0.36, respectively. There were no statistically significant differences in this ratio between the short and long TE method (p less than 0.01). In complex partial seizure patients, no significant metabolite differences were found between short and long echo times of single voxel proton MR spectroscopy. The metabolite ratio at different echo times can be reliably obtained using this simplified and automated PROBE/SV quantitation method. (author)
Directory of Open Access Journals (Sweden)
Peter Steinbacher
Full Text Available PGC-1α (peroxisome proliferator-activated receptor γ co-activator 1α is an important regulator of mitochondrial biogenesis and a master regulator of enzymes involved in oxidative phosphorylation. Recent evidence demonstrated that the Gly482Ser single nucleotide polymorphism (SNP in the PGC-1α gene affects insulin sensitivity, blood lipid metabolism and binding to myocyte enhancer factor 2 (MEF2. Individuals carrying this SNP were shown to have a reduced cardiorespiratory fitness and a higher risk to develop type 2 diabetes. Here, we investigated the responses of untrained men with the Gly482Ser SNP to a 10 week programme of endurance training (cycling, 3 x 60 min/week, heart rate at 70-90% VO2peak. Quantitative data from analysis of biopsies from vastus lateralis muscle revealed that the SNP group, in contrast to the control group, lacked a training-induced increase in content of slow contracting oxidative fibres. Capillary supply, mitochondrial density, mitochondrial enzyme activities and intramyocellular lipid content increased similarly in both groups. These results indicate that the impaired binding of MEF2 to PGC-1α in humans with this SNP impedes exercise-induced fast-to-slow muscle fibre transformation.
Steinbacher, Peter; Feichtinger, René G; Kedenko, Lyudmyla; Kedenko, Igor; Reinhardt, Sandra; Schönauer, Anna-Lena; Leitner, Isabella; Sänger, Alexandra M; Stoiber, Walter; Kofler, Barbara; Förster, Holger; Paulweber, Bernhard; Ring-Dimitriou, Susanne
2015-01-01
PGC-1α (peroxisome proliferator-activated receptor γ co-activator 1α) is an important regulator of mitochondrial biogenesis and a master regulator of enzymes involved in oxidative phosphorylation. Recent evidence demonstrated that the Gly482Ser single nucleotide polymorphism (SNP) in the PGC-1α gene affects insulin sensitivity, blood lipid metabolism and binding to myocyte enhancer factor 2 (MEF2). Individuals carrying this SNP were shown to have a reduced cardiorespiratory fitness and a higher risk to develop type 2 diabetes. Here, we investigated the responses of untrained men with the Gly482Ser SNP to a 10 week programme of endurance training (cycling, 3 x 60 min/week, heart rate at 70-90% VO2peak). Quantitative data from analysis of biopsies from vastus lateralis muscle revealed that the SNP group, in contrast to the control group, lacked a training-induced increase in content of slow contracting oxidative fibres. Capillary supply, mitochondrial density, mitochondrial enzyme activities and intramyocellular lipid content increased similarly in both groups. These results indicate that the impaired binding of MEF2 to PGC-1α in humans with this SNP impedes exercise-induced fast-to-slow muscle fibre transformation.
Directory of Open Access Journals (Sweden)
Fang Gang
2008-09-01
Full Text Available Abstract Background We have engaged in an international program designated the Bank On A Cure, which has established DNA banks from multiple cooperative and institutional clinical trials, and a platform for examining the association of genetic variations with disease risk and outcomes in multiple myeloma. We describe the development and content of a novel custom SNP panel that contains 3404 SNPs in 983 genes, representing cellular functions and pathways that may influence disease severity at diagnosis, toxicity, progression or other treatment outcomes. A systematic search of national databases was used to identify non-synonymous coding SNPs and SNPs within transcriptional regulatory regions. To explore SNP associations with PFS we compared SNP profiles of short term (less than 1 year, n = 70 versus long term progression-free survivors (greater than 3 years, n = 73 in two phase III clinical trials. Results Quality controls were established, demonstrating an accurate and robust screening panel for genetic variations, and some initial racial comparisons of allelic variation were done. A variety of analytical approaches, including machine learning tools for data mining and recursive partitioning analyses, demonstrated predictive value of the SNP panel in survival. While the entire SNP panel showed genotype predictive association with PFS, some SNP subsets were identified within drug response, cellular signaling and cell cycle genes. Conclusion A targeted gene approach was undertaken to develop an SNP panel that can test for associations with clinical outcomes in myeloma. The initial analysis provided some predictive power, demonstrating that genetic variations in the myeloma patient population may influence PFS.
Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah
Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.
Directory of Open Access Journals (Sweden)
María Muñoz-Amatriaín
2011-11-01
Full Text Available Recent advances in high-throughput genotyping have made it easier to combine information from different mapping populations into consensus genetic maps, which provide increased marker density and genome coverage compared to individual maps. Previously, a single nucleotide polymorphism (SNP-based genotyping platform was developed and used to genotype 373 individuals in four barley ( L. mapping populations. This led to a 2943 SNP consensus genetic map with 975 unique positions. In this work, we add data from six additional populations and more individuals from one of the original populations to develop an improved consensus map from 1133 individuals. A stringent and systematic analysis of each of the 10 populations was performed to achieve uniformity. This involved reexamination of the four populations included in the previous map. As a consequence, we present a robust consensus genetic map that contains 2994 SNP loci mapped to 1163 unique positions. The map spans 1137.3 cM with an average density of one marker bin per 0.99 cM. A novel application of the genotyping platform for gene detection allowed the assignment of 2930 genes to flow-sorted chromosomes or arms, confirmed the position of 2545 SNP-mapped loci, added chromosome or arm allocations to an additional 370 SNP loci, and delineated pericentromeric regions for chromosomes 2H to 7H. Marker order has been improved and map resolution has been increased by almost 20%. These increased precision outcomes enable more optimized SNP selection for marker-assisted breeding and support association genetic analysis and map-based cloning. It will also improve the anchoring of DNA sequence scaffolds and the barley physical map to the genetic map.
Pröfrock, Daniel; Irrgeher, Johanna; Prohaska, Thomas
2016-01-01
The performance and validation characteristics of different single collector inductively coupled plasma mass spectrometers based on different technical principles (ICP-SFMS, ICP-QMS in reaction and collision modes, and ICP-MS/MS) were evaluated in comparison to the performance of MC ICP-MS for fast and reliable S isotope ratio measurements. The validation included the determination of LOD, BEC, measurement repeatability, within-lab reproducibility and deviation from certified values as well as a study on instrumental isotopic fractionation (IIF) and the calculation of the combined standard measurement uncertainty. Different approaches of correction for IIF applying external intra-elemental IIF correction (aka standard-sample bracketing) using certified S reference materials and internal inter-elemental IIF (aka internal standardization) correction using Si isotope ratios in MC ICP-MS are explained and compared. The resulting combined standard uncertainties of examined ICP-QMS systems were not better than 0.3–0.5% (uc,rel), which is in general insufficient to differentiate natural S isotope variations. Although the performance of the single collector ICP-SFMS is better (single measurement uc,rel = 0.08%), the measurement reproducibility (>0.2%) is the major limit of this system and leaves room for improvement. MC ICP-MS operated in the edge mass resolution mode, applying bracketing for correction of IIF, provided isotope ratio values with the highest quality (relative combined measurement uncertainty: 0.02%; deviation from the certified value: <0.002%). PMID:27812369
Hsieh, Li-En; Chueh, Ling-Ling
2014-05-21
Feline infectious peritonitis (FIP) is an immune-mediated, highly lethal disease caused by feline coronavirus (FCoV) infection. Currently, no protective vaccine or effective treatment for the disease is available. Studies have found that some cats survive the challenge of virulent FCoV isolates. Since cellular immunity is thought to be critical in preventing FIP and because diseased cats often show a significant decrease in interferon-γ (IFN-γ) production, we investigated whether single nucleotide polymorphisms (SNP) in the feline IFN-γ gene (fIFNG) are associated with the outcome of infection. A total of 82 asymptomatic and 63 FIP cats were analyzed, and 16 SNP were identified in intron 1 of fIFNG. Among these SNP, the fFING + 428 T allele was shown to be a FIP-resistant allele (p = 0.03), and the heterozygous genotypes 01C/T and +408C/T were found to be FIP-susceptible factors (p = 0.004). Furthermore, an fIFNG + 428 resistant allele also showed a clear correlation with the plasma level of IFN-γ in FIP cats. For the identification of these three FIP-related SNP, genotyping methods were established using amplification refractory mutation system PCR (ARMS-PCR) and restriction fragment length polymorphisms (RFLP), and the different genotypes could easily be identified without sequencing. The identification of additional FIP-related SNP will allow the selection of resistant cats and decrease the morbidity of the cat population to FIP.
Yang, Cheng-Hong; Wu, Kuo-Chuan; Chuang, Li-Yeh; Chang, Hsueh-Wei
2018-01-01
DNA barcode sequences are accumulating in large data sets. A barcode is generally a sequence larger than 1000 base pairs and generates a computational burden. Although the DNA barcode was originally envisioned as straightforward species tags, the identification usage of barcode sequences is rarely emphasized currently. Single-nucleotide polymorphism (SNP) association studies provide us an idea that the SNPs may be the ideal target of feature selection to discriminate between different species. We hypothesize that SNP-based barcodes may be more effective than the full length of DNA barcode sequences for species discrimination. To address this issue, we tested a r ibulose diphosphate carboxylase ( rbcL ) S NP b arcoding (RSB) strategy using a decision tree algorithm. After alignment and trimming, 31 SNPs were discovered in the rbcL sequences from 38 Brassicaceae plant species. In the decision tree construction, these SNPs were computed to set up the decision rule to assign the sequences into 2 groups level by level. After algorithm processing, 37 nodes and 31 loci were required for discriminating 38 species. Finally, the sequence tags consisting of 31 rbcL SNP barcodes were identified for discriminating 38 Brassicaceae species based on the decision tree-selected SNP pattern using RSB method. Taken together, this study provides the rational that the SNP aspect of DNA barcode for rbcL gene is a useful and effective sequence for tagging 38 Brassicaceae species.
Directory of Open Access Journals (Sweden)
Huiyu eWang
2014-05-01
Full Text Available The purpose of this study was to compare results obtained from various methodologies for genome-wide association studies, when applied to real data, in terms of number and commonality of regions identified and their genetic variance explained, computational speed, and possible pitfalls in interpretations of results. Methodologies include: two iteratively reweighted single-step genomic BLUP procedures (ssGWAS1 and ssGWAS2, a single-marker model (CGWAS, and BayesB. The ssGWAS methods utilize genomic breeding values (GEBVs based on combined pedigree, genomic and phenotypic information, while CGWAS and BayesB only utilize phenotypes from genotyped animals or pseudo-phenotypes. In this study, ssGWAS was performed by converting GEBVs to SNP marker effects. Unequal variances for markers were incorporated for calculating weights into a new genomic relationship matrix. SNP weights were refined iteratively. The data was body weight at 6 weeks on 274,776 broiler chickens, of which 4553 were genotyped using a 60k SNP chip. Comparison of genomic regions was based on genetic variances explained by local SNP regions (20 SNPs. After 3 iterations, the noise was greatly reduced of ssGWAS1 and results are similar to that of CGWAS, with 4 out of the top 10 regions in common. In contrast, for BayesB, the plot was dominated by a single region explaining 23.1% of the genetic variance. This same region was found by ssGWAS1 with the same rank, but the amount of genetic variation attributed to the region was only 3%. These finding emphasize the need for caution when comparing and interpreting results from various methods, and highlight that detected associations, and strength of association, strongly depends on methodologies and details of implementations. BayesB appears to overly shrink regions to zero, while overestimating the amount of genetic variation attributed to the remaining SNP effects. The real world is most likely a compromise between methods and remains to
Directory of Open Access Journals (Sweden)
Beng Hooi Phang
Full Text Available Multiple single nucleotide polymorphisms (SNPs have been identified in the tumor suppressor gene p53, though the relevance of many of them is unclear. Some of them are also differentially distributed in various ethnic populations, suggesting selective functionality. We have therefore sequenced all exons and flanking regions of p53 from the Singaporean Chinese population and report here the characterization of some novel and uncharacterized SNPs - four in intron 1 (nucleotide positions 8759/10361/10506/11130, three in intron 3 (11968/11969/11974 and two in the 3'UTR (19168/19514. Allelic frequencies were determined for all these and some known SNPs, and were compared in a limited scale to leukemia and lung cancer patient samples. Intron 2 (11827 and 7 (14181/14201 SNPs were found to have a high minor allele frequency of between 26-47%, in contrast to the lower frequencies found in the US population, but similar in trend to the codon 72 polymorphism (SNP12139 that shows a distribution pattern correlative with latitude. Several of the SNPs were linked, such as those in introns 1, 3 and 7. Most interestingly, we noticed the co-segregation of the intron 2 and the codon 72 SNPs, the latter which has been shown to be expressed in an allele-specific manner, suggesting possible regulatory cross-talk. Association analysis indicated that the T/G alleles in both the co-segregating intron 7 SNPs and a 4tagSNP haplotype was strongly associated increased susceptibility to lung cancer in non-smoker females [OR: 1.97 (1.32, 3.394]. These data together demonstrate high SNP diversity in p53 gene between different populations, highlighting ethnicity-based differences, and their association with cancer risk.
Directory of Open Access Journals (Sweden)
Rebekah E Oliver
Full Text Available A physically anchored consensus map is foundational to modern genomics research; however, construction of such a map in oat (Avena sativa L., 2n = 6x = 42 has been hindered by the size and complexity of the genome, the scarcity of robust molecular markers, and the lack of aneuploid stocks. Resources developed in this study include a modified SNP discovery method for complex genomes, a diverse set of oat SNP markers, and a novel chromosome-deficient SNP anchoring strategy. These resources were applied to build the first complete, physically-anchored consensus map of hexaploid oat. Approximately 11,000 high-confidence in silico SNPs were discovered based on nine million inter-varietal sequence reads of genomic and cDNA origin. GoldenGate genotyping of 3,072 SNP assays yielded 1,311 robust markers, of which 985 were mapped in 390 recombinant-inbred lines from six bi-parental mapping populations ranging in size from 49 to 97 progeny. The consensus map included 985 SNPs and 68 previously-published markers, resolving 21 linkage groups with a total map distance of 1,838.8 cM. Consensus linkage groups were assigned to 21 chromosomes using SNP deletion analysis of chromosome-deficient monosomic hybrid stocks. Alignments with sequenced genomes of rice and Brachypodium provide evidence for extensive conservation of genomic regions, and renewed encouragement for orthology-based genomic discovery in this important hexaploid species. These results also provide a framework for high-resolution genetic analysis in oat, and a model for marker development and map construction in other species with complex genomes and limited resources.
Buckling of ZnS-filled single-walled carbon nanotubes – The influence of aspect ratio
Monteiro, André O.
2014-08-16
The mechanical response of single-walled carbon nanotubes (SWCNT) filled with crystalline zinc sulphide (ZnS) nanowires under uniaxial compression is studied using classical molecular dynamics. These simulations were used to analyse the behaviour of SWCNT, with and without ZnS filling, in terms of critical force and critical strain. Force versus strain curves have been computed for hollow and filled systems, the latter clearly showing an improvement of the mechanical behaviour caused by the ZnS nanowire. The same simulations were repeated for a large range of dimensions in order to evaluate the influence of the aspect ratio on the mechanical response of the tubes.
Hess, Jon E; Campbell, Nathan R; Docker, Margaret F; Baker, Cyndi; Jackson, Aaron; Lampman, Ralph; McIlraith, Brian; Moser, Mary L; Statler, David P; Young, William P; Wildbill, Andrew J; Narum, Shawn R
2015-01-01
Next-generation sequencing data can be mined for highly informative single nucleotide polymorphisms (SNPs) to develop high-throughput genomic assays for nonmodel organisms. However, choosing a set of SNPs to address a variety of objectives can be difficult because SNPs are often not equally informative. We developed an optimal combination of 96 high-throughput SNP assays from a total of 4439 SNPs identified in a previous study of Pacific lamprey (Entosphenus tridentatus) and used them to address four disparate objectives: parentage analysis, species identification and characterization of neutral and adaptive variation. Nine of these SNPs are FST outliers, and five of these outliers are localized within genes and significantly associated with geography, run-timing and dwarf life history. Two of the 96 SNPs were diagnostic for two other lamprey species that were morphologically indistinguishable at early larval stages and were sympatric in the Pacific Northwest. The majority (85) of SNPs in the panel were highly informative for parentage analysis, that is, putatively neutral with high minor allele frequency across the species' range. Results from three case studies are presented to demonstrate the broad utility of this panel of SNP markers in this species. As Pacific lamprey populations are undergoing rapid decline, these SNPs provide an important resource to address critical uncertainties associated with the conservation and recovery of this imperiled species. © 2014 John Wiley & Sons Ltd.
Courtney, D G; Moore, J E; Atkinson, S D; Maurizi, E; Allen, E H A; Pedrioli, D M L; McLean, W H I; Nesbit, M A; Moore, C B T
2016-01-01
CRISPR/Cas9-based therapeutics hold the possibility for permanent treatment of genetic disease. The potency and specificity of this system has been used to target dominantly inherited conditions caused by heterozygous missense mutations through inclusion of the mutated base in the short-guide RNA (sgRNA) sequence. This research evaluates a novel approach for targeting heterozygous single-nucleotide polymorphisms (SNPs) using CRISPR/Cas9. We determined that a mutation within KRT12, which causes Meesmann's epithelial corneal dystrophy (MECD), leads to the occurrence of a novel protospacer adjacent motif (PAM). We designed an sgRNA complementary to the sequence adjacent to this SNP-derived PAM and evaluated its potency and allele specificity both in vitro and in vivo. This sgRNA was found to be highly effective at reducing the expression of mutant KRT12 mRNA and protein in vitro. To assess its activity in vivo we injected a combined Cas9/sgRNA expression construct into the corneal stroma of a humanized MECD mouse model. Sequence analysis of corneal genomic DNA revealed non-homologous end-joining repair resulting in frame-shifting deletions within the mutant KRT12 allele. This study is the first to demonstrate in vivo gene editing of a heterozygous disease-causing SNP that results in a novel PAM, further highlighting the potential for CRISPR/Cas9-based therapeutics.
Jang, Ho-Kyun; Choi, Jun Hee; Kim, Do-Hyun; Kim, Gyu Tae
2018-06-01
Single-walled carbon nanotube (SWCNT) is generally used as a networked structure in the fabrication of a field-effect transistor (FET) since it is known that one-third of SWCNT is electrically metallic and the remains are semiconducting. In this case, the presence of metallic paths by metallic SWCNT (m-SWCNT) becomes a significant technical barrier which hinders the networks from achieving a semiconducting behavior, resulting in a low on/off ratio. Here, we report on an easy method of controlling the on/off ratio of a FET where semiconducting SWCNT (s-SWCNT) and m-SWCNT constitute networks between source and drain electrodes. A FET with SWCNT networks was simply sonicated under water to control the on/off ratio and network density. As a result, the FET having an almost metallic behavior due to the metallic paths by m-SWCNT exhibited a p-type semiconducting behavior. The on/off ratio ranged from 1 to 9.0 × 104 along sonication time. In addition, theoretical calculations based on Monte-Carlo method and circuit simulation were performed to understand and explain the phenomenon of a change in the on/off ratio and network density by sonication. On the basis of experimental and theoretical results, we found that metallic paths contributed to a high off-state current which leads to a low on/off ratio and that sonication formed sparse SWCNT networks where metallic paths of m-SWCNT were removed, resulting in a high on/off ratio. This method can open a chance to save the device which has been considered as a failed one due to a metallic behavior by a high network density leading to a low on/off ratio.
Aslani, Saeed; Mahmoudi, Mahdi; Salmaninejad, Arash; Poursani, Shiva; Ziaee, Vahid; Rezaei, Nima
2017-06-01
Juvenile rheumatoid arthritis (JRA) is a common chronic systemic autoimmune disease in children. Single nucleotide polymorphisms (SNPs) of signal transducer and activator of transcription 4 (STAT4) gene are suspected to have association with the risk of autoimmune diseases. Previous investigations have indicated that the STAT4 rs7574865 T allele was significantly associated with rheumatoid arthritis. In this study, we aimed to evaluate the association of STAT4 SNPs with JRA in Iranian population. T allele of STAT4 rs7574865 SNP was less frequent in patients than in controls, and the difference was not significant (p = 0.19, OR = 0.72, 95% CI: 0.44 -1.17). In addition, G allele of this SNP was frequent but not significant in JRA patients (p = 0.19, OR = 1.38, 95% CI: 0.85-2.25). Neither alleles nor genotypes of rs7601754 SNP of STAT4 gene demonstrated associations with JRA. We recognize that gene variants of STAT4 did not affect JRA susceptibility in Iranian population.
International Nuclear Information System (INIS)
Shinozaki, Miyuki; Ariyama, Kaoru; Kawasaki, Akira; Hirata, Takafumi
2010-01-01
A method for determining strontium and lead isotope ratios of grains was developed. The samples investigated in this study were rice, barley and wheat. The samples were digested with nitric acid and hydrogen peroxide, and heated in a heating block. Strontium and lead were separated from the matrix by adding an acid digested solution into a column packed with Sr resin, which has selectivity for the absorption of strontium and lead. Strontium and lead isotope ratios were determined using a high-resolution inductively coupled plasma mass spectrometer (HR-ICP-MS) with a single collector. The intraday relative standard deviations of 87 Sr/ 86 Sr and lead isotope ratios ( 204 Pb/ 206 Pb, 207 Pb/ 206 Pb, 208 Pb/ 206 Pb) by HR-ICP-MS measurements were < 0.06% and around 0.1%, respectively. This method enabled us to determine strontium and lead isotope ratios in two days. (author)
Hall, Barry G
2014-01-01
SNP-association studies are a starting point for identifying genes that may be responsible for specific phenotypes, such as disease traits. The vast bulk of tools for SNP-association studies are directed toward SNPs in the human genome, and I am unaware of any tools designed specifically for such studies in bacterial or viral genomes. The PPFS (Predict Phenotypes From SNPs) package described here is an add-on to kSNP , a program that can identify SNPs in a data set of hundreds of microbial genomes. PPFS identifies those SNPs that are non-randomly associated with a phenotype based on the χ² probability, then uses those diagnostic SNPs for two distinct, but related, purposes: (1) to predict the phenotypes of strains whose phenotypes are unknown, and (2) to identify those diagnostic SNPs that are most likely to be causally related to the phenotype. In the example illustrated here, from a set of 68 E. coli genomes, for 67 of which the pathogenicity phenotype was known, there were 418,500 SNPs. Using the phenotypes of 36 of those strains, PPFS identified 207 diagnostic SNPs. The diagnostic SNPs predicted the phenotypes of all of the genomes with 97% accuracy. It then identified 97 SNPs whose probability of being causally related to the pathogenic phenotype was >0.999. In a second example, from a set of 116 E. coli genome sequences, using the phenotypes of 65 strains PPFS identified 101 SNPs that predicted the source host (human or non-human) with 90% accuracy.
Energy Technology Data Exchange (ETDEWEB)
Garzillo, Valerio; Grigutis, Robertas [Dipartimento di Scienza e Alta Tecnologia, University of Insubria, Via Valleggio 11, I-22100 Como (Italy); Jukna, Vytautas [Centre de Physique Theorique, CNRS, Ecole Polytechnique, Université Paris-Saclay, F-91128 Palaiseau (France); LOA, ENSTA-ParisTech, CNRS, Ecole Polytechnique, Université Paris Saclay, F-91762 Palaiseau (France); Couairon, Arnaud [Centre de Physique Theorique, CNRS, Ecole Polytechnique, Université Paris-Saclay, F-91128 Palaiseau (France); Di Trapani, Paolo [Dipartimento di Scienza e Alta Tecnologia, University of Insubria and CNISM UdR Como, Via Valleggio 11, I-22100 Como (Italy); Jedrkiewicz, Ottavia, E-mail: ottavia.jedrkiewicz@ifn.cnr.it [Istituto di Fotonica e Nanotecnologie, CNR and CNISM UdR Como, Via Valleggio 11, I-22100 Como (Italy)
2016-07-07
We investigate the generation of high aspect ratio microstructures across 0.7 mm thick glass by means of single shot Bessel beam laser direct writing. We study the effect on the photoinscription of the cone angle, as well as of the energy and duration of the ultrashort laser pulse. The aim of the study is to optimize the parameters for the writing of a regular microstructure due to index modification along the whole sample thickness. By using a spectrally resolved single pulse transmission diagnostics at the output surface of the glass, we correlate the single shot material modification with observations of the absorption in different portions of the retrieved spectra, and with the absence or presence of spectral modulation. Numerical simulations of the evolution of the Bessel pulse intensity and of the energy deposition inside the sample help us interpret the experimental results that suggest to use picosecond pulses for an efficient and more regular energy deposition. Picosecond pulses take advantage of nonlinear plasma absorption and avoid temporal dynamics effects which can compromise the stationarity of the Bessel beam propagation.
Directory of Open Access Journals (Sweden)
Wan-Yu eLin
2012-06-01
Full Text Available The presence of missing single-nucleotide polymorphism (SNP genotypes is common in genetic data. For studies with low-density SNPs, the most commonly used approach to deal with genotype missingness is to simply remove the observations with missing genotypes from the analyses. This naïve method is straightforward but is appropriate only when the missingness is random. However, a given assay often has a different capability in genotyping heterozygotes and homozygotes, causing the phenomenon of ‘differential dropout’ in the sense that the missing rates of heterozygotes and homozygotes are different. In practice, differential dropout among genotypes exists in even carefully designed studies, such as the data from the HapMap project and the Wellcome Trust Case Control Consortium. In this study, we propose a statistical method to model the differential dropout among different genotypes. Compared with the naïve method, our method provides more accurate allele frequency estimates when the differential dropout is present. To demonstrate its practical use, we further apply our method to the HapMap data and a scleroderma data set.
Highly effective SNP-based association mapping and management of recessive defects in livestock
DEFF Research Database (Denmark)
Charlier, Carole; Coppieters, Wouter; Rollin, Frédéric
2008-01-01
The widespread use of elite sires by means of artificial insemination in livestock breeding leads to the frequent emergence of recessive genetic defects, which cause significant economic and animal welfare concerns. Here we show that the availability of genome-wide, high-density SNP panels, combi...
Directory of Open Access Journals (Sweden)
Maider Ibarrola-Villava
Full Text Available As the incidence of Malignant Melanoma (MM reflects an interaction between skin colour and UV exposure, variations in genes implicated in pigmentation and tanning response to UV may be associated with susceptibility to MM. In this study, 363 SNPs in 65 gene regions belonging to the pigmentation pathway have been successfully genotyped using a SNP array. Five hundred and ninety MM cases and 507 controls were analyzed in a discovery phase I. Ten candidate SNPs based on a p-value threshold of 0.01 were identified. Two of them, rs35414 (SLC45A2 and rs2069398 (SILV/CKD2, were statistically significant after conservative Bonferroni correction. The best six SNPs were further tested in an independent Spanish series (624 MM cases and 789 controls. A novel SNP located on the SLC45A2 gene (rs35414 was found to be significantly associated with melanoma in both phase I and phase II (P<0.0001. None of the other five SNPs were replicated in this second phase of the study. However, three SNPs in TYR, SILV/CDK2 and ADAMTS20 genes (rs17793678, rs2069398 and rs1510521 respectively had an overall p-value<0.05 when considering the whole DNA collection (1214 MM cases and 1296 controls. Both the SLC45A2 and the SILV/CDK2 variants behave as protective alleles, while the TYR and ADAMTS20 variants seem to function as risk alleles. Cumulative effects were detected when these four variants were considered together. Furthermore, individuals carrying two or more mutations in MC1R, a well-known low penetrance melanoma-predisposing gene, had a decreased MM risk if concurrently bearing the SLC45A2 protective variant. To our knowledge, this is the largest study on Spanish sporadic MM cases to date.
The objective of this study is to investigate single nucleotide polymorphism (SNP) genotypes imputation of Hereford cattle. Purebred Herefords were from two sources, Line 1 Hereford (N=240) and representatives of Industry Herefords (N=311). Using different reference panels of 62 and 494 males with 1...
Rice genetic marker database: An identification of single nucleotide ...
African Journals Online (AJOL)
based genetic marker system to provide information about SNP and QTL markers in rice. The SNP marker database provides 7,227 SNP markers including location information on chromosomes by using genetic map. It allows users to access a ...
DEFF Research Database (Denmark)
Milne, Roger L; Benítez, Javier; Nevanlinna, Heli
2009-01-01
BACKGROUND: A recent genome-wide association study identified single-nucleotide polymorphism (SNP) 2q35-rs13387042 as a marker of susceptibility to estrogen receptor (ER)-positive breast cancer. We attempted to confirm this association using the Breast Cancer Association Consortium. METHODS: 2q35...
A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.
Zeng, Lingwen; Xiao, Zhuo
2017-01-01
A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.
Oliveira, Hugo R; Hagenblad, Jenny; Leino, Matti W; Leigh, Fiona J; Lister, Diane L; Penã-Chocarro, Leonor; Jones, Martin K
2014-05-08
Single Nucleotide Polymorphism (SNP) panels recently developed for the assessment of genetic diversity in wheat are primarily based on elite varieties, mostly those of bread wheat. The usefulness of such SNP panels for studying wheat evolution and domestication has not yet been fully explored and ascertainment bias issues can potentially affect their applicability when studying landraces and tetraploid ancestors of bread wheat. We here evaluate whether population structure and evolutionary history can be assessed in tetraploid landrace wheats using SNP markers previously developed for the analysis of elite cultivars of hexaploid wheat. We genotyped more than 100 tetraploid wheat landraces and wild emmer wheat accessions, some of which had previously been screened with SSR markers, for an existing SNP panel and obtained publically available genotypes for the same SNPs for hexaploid wheat varieties and landraces. Results showed that quantification of genetic diversity can be affected by ascertainment bias but that the effects of ascertainment bias can at least partly be alleviated by merging SNPs to haplotypes. Analyses of population structure and genetic differentiation show strong subdivision between the tetraploid wheat subspecies, except for durum and rivet that are not separable. A more detailed population structure of durum landraces could be obtained than with SSR markers. The results also suggest an emmer, rather than durum, ancestry of bread wheat and with gene flow from wild emmer. SNP markers developed for elite cultivars show great potential for inferring population structure and can address evolutionary questions in landrace wheat. Issues of marker genome specificity and mapping need, however, to be addressed. Ascertainment bias does not seem to interfere with the ability of a SNP marker system developed for elite bread wheat accessions to detect population structure in other types of wheat.
Association of ESR1 gene tagging SNPs with breast cancer risk
Dunning, Alison M.; Healey, Catherine S.; Baynes, Caroline; Maia, Ana-Teresa; Scollen, Serena; Vega, Ana; Rodríguez, Raquel; Barbosa-Morais, Nuno L.; Ponder, Bruce A.J.; Low, Yen-Ling; Bingham, Sheila; Haiman, Christopher A.; Le Marchand, Loic; Broeks, Annegien; Schmidt, Marjanka K.; Hopper, John; Southey, Melissa; Beckmann, Matthias W.; Fasching, Peter A.; Peto, Julian; Johnson, Nichola; Bojesen, Stig E.; Nordestgaard, Børge; Milne, Roger L.; Benitez, Javier; Hamann, Ute; Ko, Yon; Schmutzler, Rita K.; Burwinkel, Barbara; Schürmann, Peter; Dörk, Thilo; Heikkinen, Tuomas; Nevanlinna, Heli; Lindblom, Annika; Margolin, Sara; Mannermaa, Arto; Kosma, Veli-Matti; Chen, Xiaoqing; Spurdle, Amanda; Change-Claude, Jenny; Flesch-Janys, Dieter; Couch, Fergus J.; Olson, Janet E.; Severi, Gianluca; Baglietto, Laura; Børresen-Dale, Anne-Lise; Kristensen, Vessela; Hunter, David J.; Hankinson, Susan E.; Devilee, Peter; Vreeswijk, Maaike; Lissowska, Jolanta; Brinton, Louise; Liu, Jianjun; Hall, Per; Kang, Daehee; Yoo, Keun-Young; Shen, Chen-Yang; Yu, Jyh-Cherng; Anton-Culver, Hoda; Ziogoas, Argyrios; Sigurdson, Alice; Struewing, Jeff; Easton, Douglas F.; Garcia-Closas, Montserrat; Humphreys, Manjeet K.; Morrison, Jonathan; Pharoah, Paul D.P.; Pooley, Karen A.; Chenevix-Trench, Georgia
2009-01-01
We have conducted a three-stage, comprehensive single nucleotide polymorphism (SNP)-tagging association study of ESR1 gene variants (SNPs) in more than 55 000 breast cancer cases and controls from studies within the Breast Cancer Association Consortium (BCAC). No large risks or highly significant associations were revealed. SNP rs3020314, tagging a region of ESR1 intron 4, is associated with an increase in breast cancer susceptibility with a dominant mode of action in European populations. Carriers of the c-allele have an odds ratio (OR) of 1.05 [95% Confidence Intervals (CI) 1.02–1.09] relative to t-allele homozygotes, P = 0.004. There is significant heterogeneity between studies, P = 0.002. The increased risk appears largely confined to oestrogen receptor-positive tumour risk. The region tagged by SNP rs3020314 contains sequence that is more highly conserved across mammalian species than the rest of intron 4, and it may subtly alter the ratio of two mRNA splice forms. PMID:19126777
Directory of Open Access Journals (Sweden)
Y.-M. Lee
2012-12-01
Full Text Available The purpose of this study was to detect significant SNPs for blood components that were related to immunity using high single nucleotide polymorphism (SNP density panels in a Korean native pig (KNP×Yorkshire (YK cross population. A reciprocal design of KNP×YK produced 249 F2 individuals that were genotyped for a total of 46,865 available SNPs in the Illumina porcine 60K beadchip. To perform whole genome association analysis (WGA, phenotypes were regressed on each SNP under a simple linear regression model after adjustment for sex and slaughter age. To set up a significance threshold, 0.1% point-wise p value from F distribution was used for each SNP test. Among the significant SNPs for a trait, the best set of SNP markers were determined using a stepwise regression procedure with the rates of inclusion and exclusion of each SNP out of the model at 0.001 level. A total of 54 SNPs were detected; 10, 6, 4, 4, 5, 4, 5, 10, and 6 SNPs for neutrophil, lymphocyte, monocyte, eosinophil, basophil, atypical lymph, immunoglobulin, insulin, and insulin-like growth factor-I, respectively. Each set of significant SNPs per trait explained 24 to 42% of phenotypic variance. Several pleiotropic SNPs were detected on SSCs 4, 13, 14 and 15.
Directory of Open Access Journals (Sweden)
Kamau Edwin
2012-01-01
Full Text Available Abstract Background Anti-malarial drug resistance poses a threat to current global efforts towards control and elimination of malaria. Several methods are used in monitoring anti-malarial drug resistance. Molecular markers such as single nucleotide polymorphism (SNP for example are increasingly being used to identify genetic mutations related to anti-malarial drug resistance. Several methods are currently being used in analysis of SNP associated with anti-malarial drug resistance and although each one of these methods has unique strengths and shortcoming, there is still need to improve and/or develop new methods that will close the gap found in the current methods. Methods TaqMan Allelic Discrimination assays for detection of SNPs associated with anti-malarial drug resistance were designed for analysis on Applied Biosystems PCR platform. These assays were designed by submitting SNP sequences associated with anti-malarial drug resistance to Applied Biosystems website. Eleven SNPs associated with resistance to anti-malarial drugs were selected and tested. The performance of each SNP assay was tested by creating plasmid DNAs carrying codons of interests and analysing them for analysis. To test the sensitivity and specificity of each SNP assay, 12 clinical samples were sequenced at codons of interest and used in the analysis. Plasmid DNAs were used to establish the Limit of Detection (LoD for each assay. Results Data from genetic profiles of the Plasmodium falciparum laboratory strains and sequence data from 12 clinical samples was used as the reference method with which the performance of the SNP assays were compared to. The sensitivity and specificity of each SNP assay was establish at 100%. LoD for each assay was established at 2 GE, equivalent to less than 1 parasite/μL. SNP assays performed well in detecting mixed infection and analysis of clinical samples. Conclusion TaqMan Allelic Discrimination assay provides a good alternative tool in
LD2SNPing: linkage disequilibrium plotter and RFLP enzyme mining for tag SNPs
Directory of Open Access Journals (Sweden)
Cheng Yu-Huei
2009-06-01
Full Text Available Abstract Background Linkage disequilibrium (LD mapping is commonly used to evaluate markers for genome-wide association studies. Most types of LD software focus strictly on LD analysis and visualization, but lack supporting services for genotyping. Results We developed a freeware called LD2SNPing, which provides a complete package of mining tools for genotyping and LD analysis environments. The software provides SNP ID- and gene-centric online retrievals for SNP information and tag SNP selection from dbSNP/NCBI and HapMap, respectively. Restriction fragment length polymorphism (RFLP enzyme information for SNP genotype is available to all SNP IDs and tag SNPs. Single and multiple SNP inputs are possible in order to perform LD analysis by online retrieval from HapMap and NCBI. An LD statistics section provides D, D', r2, δQ, ρ, and the P values of the Hardy-Weinberg Equilibrium for each SNP marker, and Chi-square and likelihood-ratio tests for the pair-wise association of two SNPs in LD calculation. Finally, 2D and 3D plots, as well as plain-text output of the results, can be selected. Conclusion LD2SNPing thus provides a novel visualization environment for multiple SNP input, which facilitates SNP association studies. The software, user manual, and tutorial are freely available at http://bio.kuas.edu.tw/LD2NPing.
A SNP uncoupling Mina expression from the TGFβ signaling pathway.
Lian, Shang L; Mihi, Belgacem; Koyanagi, Madoka; Nakayama, Toshinori; Bix, Mark
2018-03-01
Mina is a JmjC family 2-oxoglutarate oxygenase with pleiotropic roles in cell proliferation, cancer, T cell differentiation, pulmonary inflammation, and intestinal parasite expulsion. Although Mina expression varies according to cell-type, developmental stage and activation state, its transcriptional regulation is poorly understood. Across inbred mouse strains, Mina protein level exhibits a bimodal distribution, correlating with inheritance of a biallelic haplotype block comprising 21 promoter/intron 1-region SNPs. We previously showed that heritable differences in Mina protein level are transcriptionally regulated. Accordingly, we decided to test the hypothesis that at least one of the promoter/intron 1-region SNPs perturbs a Mina cis-regulatory element (CRE). Here, we have comprehensively scanned for CREs across a Mina locus-spanning 26-kilobase genomic interval. We discovered 8 potential CREs and functionally validated 4 of these, the strongest of which (E2), residing in intron 1, contained a SNP whose BALB/c-but not C57Bl/6 allele-abolished both Smad3 binding and transforming growth factor beta (TGFβ) responsiveness. Our results demonstrate the TGFβ signaling pathway plays a critical role in regulating Mina expression and SNP rs4191790 controls heritable variation in Mina expression level, raising important questions regarding the evolution of an allele that uncouples Mina expression from the TGFβ signaling pathway. © 2017 The Authors. Immunity, Inflammation and Disease Published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Ariel M Pani
2010-08-01
Full Text Available Intellectual disability (ID affects 2-3% of the population and may occur with or without multiple congenital anomalies (MCA or other medical conditions. Established genetic syndromes and visible chromosome abnormalities account for a substantial percentage of ID diagnoses, although for approximately 50% the molecular etiology is unknown. Individuals with features suggestive of various syndromes but lacking their associated genetic anomalies pose a formidable clinical challenge. With the advent of microarray techniques, submicroscopic genome alterations not associated with known syndromes are emerging as a significant cause of ID and MCA.High-density SNP microarrays were used to determine genome wide copy number in 42 individuals: 7 with confirmed alterations in the WS region but atypical clinical phenotypes, 31 with ID and/or MCA, and 4 controls. One individual from the first group had the most telomeric gene in the WS critical region deleted along with 2 Mb of flanking sequence. A second person had the classic WS deletion and a rearrangement on chromosome 5p within the Cri du Chat syndrome (OMIM:123450 region. Six individuals from the ID/MCA group had large rearrangements (3 deletions, 3 duplications, one of whom had a large inversion associated with a deletion that was not detected by the SNP arrays.Combining SNP microarray analyses and qPCR allowed us to clone and sequence 21 deletion breakpoints in individuals with atypical deletions in the WS region and/or ID or MCA. Comparison of these breakpoints to databases of genomic variation revealed that 52% occurred in regions harboring structural variants in the general population. For two probands the genomic alterations were flanked by segmental duplications, which frequently mediate recurrent genome rearrangements; these may represent new genomic disorders. While SNP arrays and related technologies can identify potentially pathogenic deletions and duplications, obtaining sequence information
Influence of La/W ratio on electrical conductivity of lanthanum tungstate with high La/W ratio
International Nuclear Information System (INIS)
Kojo, Gen; Shono, Yohei; Ushiyama, Hiroshi; Oshima, Yoshito; Otomo, Junichiro
2017-01-01
The proton-conducting properties of lanthanum tungstates (LWOs) with high La/W ratios were investigated using electrochemical measurements and quantum chemical calculations. Single phases of LWOs with high La/W ratios (6.3≤La/W≤6.7) were synthesized by high-temperature sintering at around 1700 °C. The electrical conductivity of LWO increased with increasing La/W ratio in the single-phase region. The LWO synthesized at the optimum sintering temperature and time, and with the optimum La/W ratio gave the maximum conductivity, i.e., 2.7×10 −3 S cm −1 with La/W=6.7 at 500 °C. Density functional theory calculations, using the nudged elastic band method, were performed to investigate the proton diffusion barrier. The results suggest that the proton diffusion paths around La sites have the lowest proton diffusion barrier. These findings improve our understanding of LWO synthesis and the proton-conducting mechanism and provide a strategy for improving proton conduction in LWOs. - Graphical abstract: The LWOs with high La/W ratios were synthesized for the first time. The optimum La/W ratio gave the maximum conductivity with La/W=6.7 at 500 °C. The proton diffusion paths were also considered with density functional theory calculations. - Highlights: • The proton-conducting properties of lanthanum tungstates (LWOs) were investigated. • Single phase LWOs with high La/W ratios (6.3≤La/W≤6.7) were synthesized successfully. • LWOs with the high La/W ratios showed high proton conductivity. • The DFT calculation suggested the lowest proton diffusion barrier in the path around La sites.
Eduardoff, M; Gross, T E; Santos, C; de la Puente, M; Ballard, D; Strobl, C; Børsting, C; Morling, N; Fusco, L; Hussing, C; Egyed, B; Souto, L; Uacyisrael, J; Syndercombe Court, D; Carracedo, Á; Lareu, M V; Schneider, P M; Parson, W; Phillips, C; Parson, W; Phillips, C
2016-07-01
The EUROFORGEN Global ancestry-informative SNP (AIM-SNPs) panel is a forensic multiplex of 128 markers designed to differentiate an individual's ancestry from amongst the five continental population groups of Africa, Europe, East Asia, Native America, and Oceania. A custom multiplex of AmpliSeq™ PCR primers was designed for the Global AIM-SNPs to perform massively parallel sequencing using the Ion PGM™ system. This study assessed individual SNP genotyping precision using the Ion PGM™, the forensic sensitivity of the multiplex using dilution series, degraded DNA plus simple mixtures, and the ancestry differentiation power of the final panel design, which required substitution of three original ancestry-informative SNPs with alternatives. Fourteen populations that had not been previously analyzed were genotyped using the custom multiplex and these studies allowed assessment of genotyping performance by comparison of data across five laboratories. Results indicate a low level of genotyping error can still occur from sequence misalignment caused by homopolymeric tracts close to the target SNP, despite careful scrutiny of candidate SNPs at the design stage. Such sequence misalignment required the exclusion of component SNP rs2080161 from the Global AIM-SNPs panel. However, the overall genotyping precision and sensitivity of this custom multiplex indicates the Ion PGM™ assay for the Global AIM-SNPs is highly suitable for forensic ancestry analysis with massively parallel sequencing. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms
Drago, Francesca; Karpasitou, Katerina; Poli, Francesca
2009-01-01
We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jka/Jkb, Fya/Fyb, S/s, K/k, Kpa/Kpb, Jsa/Jsb, Coa/Cob and Lua/Lub alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplif...
Micciché, Maurizio; Arzt, Eduard; Kroner, Elmar
2014-05-28
The goal of our study is to better understand the design parameters of bioinspired dry adhesives inspired by geckos. For this, we fabricated single macroscopic pillars of 400 μm diameter with different aspect ratios and different tip shapes (i.e., flat tips, spherical tips with different radii, and mushroom tips with different diameters). Tilt-angle-dependent adhesion measurements showed that although the tip shape of the pillars strongly influences the pull-off force, the pull-off strength is similar for flat and mushroom-shaped tips. We found no tilt-angle dependency of adhesion for spherical tip structures and, except for high tilt angle and low preload experiments, no tilt-angle effect for mushroom-tip pillars. For flat-tip pillars, we found a strong influence of tilt angle on adhesion, which decreased linearly with increasing aspect ratio. The experiments show that for the tested aspect ratios between 1 and 5, a linear decrease of tilt-angle dependency is found. The results of our studies will help to design bioinspired adhesives for application on smooth and rough surfaces.
Chen, Rui; Wang, Haotian; Shi, Jun; Hu, Pei
2016-05-01
CYP2D6 is a high polymorphic enzyme. Determining its phenotype before CYP2D6 substrate treatment can avoid dose-dependent adverse events or therapeutic failures. Alternative phenotyping methods of CYP2D6 were compared to aluate the appropriate and precise time points for phenotyping after single-dose and ultiple-dose of 30-mg controlled-release (CR) dextromethorphan (DM) and to explore the antimodes for potential sampling methods. This was an open-label, single and multiple-dose study. 21 subjects were assigned to receive a single dose of CR DM 30 mg orally, followed by a 3-day washout period prior to oral administration of CR DM 30 mg every 12 hours for 6 days. Metabolic ratios (MRs) from AUC∞ after single dosing and from AUC0-12h at steady state were taken as the gold standard. The correlations of metabolic ratios of DM to dextrorphan (MRDM/DX) values based on different phenotyping methods were assessed. Linear regression formulas were derived to calculate the antimodes for potential sample methods. In the single-dose part of the study statistically significant correlations were found between MRDM/DX from AUC∞ and from serial plasma points from 1 to 30 hours or from urine (all p-values < 0.001). In the multiple-dose part, statistically significant correlations were found between MRDM/DX from AUC0-12h on day 6 and MRDM/DX from serial plasma points from 0 to 36 hours after the last dosing (all p-values < 0.001). Based on reported urinary antimode and linear regression analysis, the antimodes of AUC and plasma points were derived to profile the trend of antimodes as the drug concentrations changed. MRDM/DX from plasma points had good correlations with MRDM/DX from AUC. Plasma points from 1 to 30 hours after single dose of 30-mg CR DM and any plasma point at steady state after multiple doses of CR DM could potentially be used for phenotyping of CYP2D6.
Likelihood-ratio-based biometric verification
Bazen, A.M.; Veldhuis, Raymond N.J.
2002-01-01
This paper presents results on optimal similarity measures for biometric verification based on fixed-length feature vectors. First, we show that the verification of a single user is equivalent to the detection problem, which implies that for single-user verification the likelihood ratio is optimal.
Likelihood Ratio-Based Biometric Verification
Bazen, A.M.; Veldhuis, Raymond N.J.
The paper presents results on optimal similarity measures for biometric verification based on fixed-length feature vectors. First, we show that the verification of a single user is equivalent to the detection problem, which implies that, for single-user verification, the likelihood ratio is optimal.
SNPpy--database management for SNP data from genome wide association studies.
Directory of Open Access Journals (Sweden)
Faheem Mitha
Full Text Available BACKGROUND: We describe SNPpy, a hybrid script database system using the Python SQLAlchemy library coupled with the PostgreSQL database to manage genotype data from Genome-Wide Association Studies (GWAS. This system makes it possible to merge study data with HapMap data and merge across studies for meta-analyses, including data filtering based on the values of phenotype and Single-Nucleotide Polymorphism (SNP data. SNPpy and its dependencies are open source software. RESULTS: The current version of SNPpy offers utility functions to import genotype and annotation data from two commercial platforms. We use these to import data from two GWAS studies and the HapMap Project. We then export these individual datasets to standard data format files that can be imported into statistical software for downstream analyses. CONCLUSIONS: By leveraging the power of relational databases, SNPpy offers integrated management and manipulation of genotype and phenotype data from GWAS studies. The analysis of these studies requires merging across GWAS datasets as well as patient and marker selection. To this end, SNPpy enables the user to filter the data and output the results as standardized GWAS file formats. It does low level and flexible data validation, including validation of patient data. SNPpy is a practical and extensible solution for investigators who seek to deploy central management of their GWAS data.
mrsFAST-Ultra: a compact, SNP-aware mapper for high performance sequencing applications.
Hach, Faraz; Sarrafi, Iman; Hormozdiari, Farhad; Alkan, Can; Eichler, Evan E; Sahinalp, S Cenk
2014-07-01
High throughput sequencing (HTS) platforms generate unprecedented amounts of data that introduce challenges for processing and downstream analysis. While tools that report the 'best' mapping location of each read provide a fast way to process HTS data, they are not suitable for many types of downstream analysis such as structural variation detection, where it is important to report multiple mapping loci for each read. For this purpose we introduce mrsFAST-Ultra, a fast, cache oblivious, SNP-aware aligner that can handle the multi-mapping of HTS reads very efficiently. mrsFAST-Ultra improves mrsFAST, our first cache oblivious read aligner capable of handling multi-mapping reads, through new and compact index structures that reduce not only the overall memory usage but also the number of CPU operations per alignment. In fact the size of the index generated by mrsFAST-Ultra is 10 times smaller than that of mrsFAST. As importantly, mrsFAST-Ultra introduces new features such as being able to (i) obtain the best mapping loci for each read, and (ii) return all reads that have at most n mapping loci (within an error threshold), together with these loci, for any user specified n. Furthermore, mrsFAST-Ultra is SNP-aware, i.e. it can map reads to reference genome while discounting the mismatches that occur at common SNP locations provided by db-SNP; this significantly increases the number of reads that can be mapped to the reference genome. Notice that all of the above features are implemented within the index structure and are not simple post-processing steps and thus are performed highly efficiently. Finally, mrsFAST-Ultra utilizes multiple available cores and processors and can be tuned for various memory settings. Our results show that mrsFAST-Ultra is roughly five times faster than its predecessor mrsFAST. In comparison to newly enhanced popular tools such as Bowtie2, it is more sensitive (it can report 10 times or more mappings per read) and much faster (six times or