Rapid detection, characterization, and enumeration of foodborne pathogens.
Hoorfar, J
2011-11-01
As food safety management further develops, microbiological testing will continue to play an important role in assessing whether Food Safety Objectives are achieved. However, traditional microbiological culture-based methods are limited, particularly in their ability to provide timely data. The present review discusses the reasons for the increasing interest in rapid methods, current developments in the field, the research needs, and the future trends. The advent of biotechnology has introduced new technologies that led to the emergence of rapid diagnostic methods and altered food testing practices. Rapid methods are comprised of many different detection technologies, including specialized enzyme substrates, antibodies and DNA, ranging from simple differential plating media to the use of sophisticated instruments. The use of non-invasive sampling techniques for live animals especially came into focus with the 1990s outbreak of bovine spongiform encephalopathy that was linked to the human outbreak of Creutzfeldt Jakob's Disease. Serology is still an important tool in preventing foodborne pathogens to enter the human food supply through meat and milk from animals. One of the primary uses of rapid methods is for fast screening of large number of samples, where most of them are expected to be test-negative, leading to faster product release for sale. This has been the main strength of rapid methods such as real-time Polymerase Chain Reaction (PCR). Enrichment PCR, where a primary culture broth is tested in PCR, is the most common approach in rapid testing. Recent reports show that it is possible both to enrich a sample and enumerate by pathogen-specific real-time PCR, if the enrichment time is short. This can be especially useful in situations where food producers ask for the level of pathogen in a contaminated product. Another key issue is automation, where the key drivers are miniaturization and multiple testing, which mean that not only one instrument is flexible
Rapid detection, characterization, and enumeration of foodborne pathogens
DEFF Research Database (Denmark)
Hoorfar, Jeffrey
2011-01-01
. The present review discusses the reasons for the increasing interest in rapid methods; current developments in the field, the research needs, and the future trends. The advent of biotechnology has introduced new technologies that led to the emergence of rapid diagnostic methods and altered food testing...... of rapid methods is for fast screening of large number of samples, where most of them are expected to be test-negative, leading to faster product release for sale. This has been the main strength of rapid methods such as real-time Polymerase Chain Reaction (PCR). Enrichment PCR, where a primary culture...... of pathogen in a contaminated product. Another key issue is automation, where the key drivers are miniaturization and multiple testing, which mean that not only one instrument is flexible enough to test for many pathogens but also many pathogens can be detected with one test. The review is mainly based...
Biocontrol and Rapid Detection of Food-borne Pathogens Using Bacteriophages and Endolysins
Directory of Open Access Journals (Sweden)
Jaewoo eBai
2016-04-01
Full Text Available Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Staphylococcus aureus, Cronobacter sakazakii, and Vibrio spp. revealed that they have great potential to control various food-borne pathogens and may be alternative for conventional food preservatives. In addition, phage-derived endolysins with high host specificity and host lysis activities may be preferred to food applications rather than phages. For rapid detection of food-borne pathogens, cell-wall binding domains (CBDs from endolysins have been suggested due to their high host-specific binding. Fluorescence-tagged CBDs have been successfully evaluated and suggested to be alternative materials of expensive antibodies for various detection applications. Most recently, reporter phage systems have been developed and tested to confirm their usability and accuracy for specific detection. These systems revealed some advantages like rapid detection of only viable pathogenic cells without interference by food components in a very short reaction time, suggesting that these systems may be suitable for monitoring of pathogens in foods. Consequently, phage is the next-generation biocontrol agent as well as rapid detection tool to confirm and even identify the food-borne pathogens present in various foods.
Directory of Open Access Journals (Sweden)
Law eJodi Woan-Fei
2015-01-01
Full Text Available The incidence of foodborne diseases has increased over the years and resulted in major public health problem globally. Foodborne pathogens can be found in various foods and it is important to detect foodborne pathogens to provide safe food supply and to prevent foodborne diseases. The conventional methods used to detect foodborne pathogen are time consuming and laborious. Hence, a variety of methods have been developed for rapid detection of foodborne pathogens as it is required in many food analyses. Rapid detection methods can be categorized into nucleic acid-based, biosensor-based and immunological-based methods. This review emphasizes on the principles and application of recent rapid methods for the detection of foodborne bacterial pathogens. Detection methods included are simple polymerase chain reaction (PCR, multiplex PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP and oligonucleotide DNA microarray which classified as nucleic acid-based methods; optical, electrochemical and mass-based biosensors which classified as biosensor-based methods; enzyme-linked immunosorbent assay (ELISA and lateral flow immunoassay which classified as immunological-based methods. In general, rapid detection methods are generally time-efficient, sensitive, specific and labor-saving. The developments of rapid detection methods are vital in prevention and treatment of foodborne diseases.
Microfluidic devices for sample preparation and rapid detection of foodborne pathogens.
Kant, Krishna; Shahbazi, Mohammad-Ali; Dave, Vivek Priy; Ngo, Tien Anh; Chidambara, Vinayaka Aaydha; Than, Linh Quyen; Bang, Dang Duong; Wolff, Anders
2018-03-10
Rapid detection of foodborne pathogens at an early stage is imperative for preventing the outbreak of foodborne diseases, known as serious threats to human health. Conventional bacterial culturing methods for foodborne pathogen detection are time consuming, laborious, and with poor pathogen diagnosis competences. This has prompted researchers to call the current status of detection approaches into question and leverage new technologies for superior pathogen sensing outcomes. Novel strategies mainly rely on incorporating all the steps from sample preparation to detection in miniaturized devices for online monitoring of pathogens with high accuracy and sensitivity in a time-saving and cost effective manner. Lab on chip is a blooming area in diagnosis, which exploits different mechanical and biological techniques to detect very low concentrations of pathogens in food samples. This is achieved through streamlining the sample handling and concentrating procedures, which will subsequently reduce human errors and enhance the accuracy of the sensing methods. Integration of sample preparation techniques into these devices can effectively minimize the impact of complex food matrix on pathogen diagnosis and improve the limit of detections. Integration of pathogen capturing bio-receptors on microfluidic devices is a crucial step, which can facilitate recognition abilities in harsh chemical and physical conditions, offering a great commercial benefit to the food-manufacturing sector. This article reviews recent advances in current state-of-the-art of sample preparation and concentration from food matrices with focus on bacterial capturing methods and sensing technologies, along with their advantages and limitations when integrated into microfluidic devices for online rapid detection of pathogens in foods and food production line. Copyright © 2018. Published by Elsevier Inc.
Luciferase-Zinc-Finger System for the Rapid Detection of Pathogenic Bacteria.
Shi, Chu; Xu, Qing; Ge, Yue; Jiang, Ling; Huang, He
2017-08-09
Rapid and reliable detection of pathogenic bacteria is crucial for food safety control. Here, we present a novel luciferase-zinc finger system for the detection of pathogens that offers rapid and specific profiling. The system, which uses a zinc-finger protein domain to probe zinc finger recognition sites, was designed to bind the amplified conserved regions of 16S rDNA, and the obtained products were detected using a modified luciferase. The luciferase-zinc finger system not only maintained luciferase activity but also allowed the specific detection of different bacterial species, with a sensitivity as low as 10 copies and a linear range from 10 to 10 4 copies per microliter of the specific PCR product. Moreover, the system is robust and rapid, enabling the simultaneous detection of 6 species of bacteria in artificially contaminated samples with excellent accuracy. Thus, we envision that our luciferase-zinc finger system will have far-reaching applications.
Microfluidic devices for sample preparation and rapid detection of foodborne pathogens
DEFF Research Database (Denmark)
Kant, Krishna; Shahbazi, Mohammad-Ali; Dave, Vivek Priy
2018-01-01
and improve the limit of detections. Integration of pathogen capturing bio-receptors on microfluidic devices is a crucial step, which can facilitate recognition abilities in harsh chemical and physical conditions, offering a great commercial benefit to the food-manufacturing sector. This article reviews...... diagnosis competences. This has prompted researchers to call the current status of detection approaches into question and leverage new technologies for superior pathogen sensing outcomes. Novel strategies mainly rely on incorporating all the steps from sample preparation to detection in miniaturized devices...... recent advances in current state-of-the-art of sample preparation and concentration from food matrices with focus on bacterial capturing methods and sensing technologies, along with their advantages and limitations when integrated into microfluidic devices for online rapid detection of pathogens in foods...
Zhao, Yong; Wang, Haoran; Zhang, Pingping; Sun, Chongyun; Wang, Xiaochen; Wang, Xinrui; Yang, Ruifu; Wang, Chengbin; Zhou, Lei
2016-01-01
The rapid high-throughput detection of foodborne pathogens is essential in controlling food safety. In this study, a 10-channel up-converting phosphor technology-based lateral flow (TC-UPT-LF) assay was established for the rapid and simultaneous detection of 10 epidemic foodborne pathogens. Ten different single-target UPT-LF strips were developed and integrated into one TC-UPT-LF disc with optimization. Without enrichment the TC-UPT-LF assay had a detection sensitivity of 104 CFU mL−1 or 105 CFU mL−1 for each pathogen, and after sample enrichment it was 10 CFU/0.6 mg. The assay also showed good linearity, allowing quantitative detection, with a linear fitting coefficient of determination (R2) of 0.916–0.998. The 10 detection channels did not cross-react, so multiple targets could be specifically detected. When 279 real food samples were tested, the assay was highly consistent (100%) with culture-based methods. The results for 110 food samples artificially contaminated with single or multiple targets showed a high detection rate (≥80%) for most target bacteria. Overall, the TC-UPT-LF assay allows the rapid, quantitative, and simultaneous detection of 10 kinds of foodborne pathogens within 20 min, and is especially suitable for the rapid detection and surveillance of foodborne pathogens in food and water. PMID:26884128
Multifunctional Nanotechnology-Enabled Sensors for Rapid Capture and Detection of Pathogens.
Mustafa, Fatima; Hassan, Rabeay Y A; Andreescu, Silvana
2017-09-15
Nanomaterial-based sensing approaches that incorporate different types of nanoparticles (NPs) and nanostructures in conjunction with natural or synthetic receptors as molecular recognition elements provide opportunities for the design of sensitive and selective assays for rapid detection of contaminants. This review summarizes recent advancements over the past ten years in the development of nanotechnology-enabled sensors and systems for capture and detection of pathogens. The most common types of nanostructures and NPs, their modification with receptor molecules and integration to produce viable sensing systems with biorecognition, amplification and signal readout are discussed. Examples of all-in-one systems that combine multifunctional properties for capture, separation, inactivation and detection are also provided. Current trends in the development of low-cost instrumentation for rapid assessment of food contamination are discussed as well as challenges for practical implementation and directions for future research.
Rapid detection of pathogenic bacteria by volatile organic compound (VOC) analysis
Senecal, Andre G.; Magnone, Joshua; Yeomans, Walter; Powers, Edmund M.
2002-02-01
Developments in rapid detection technologies have made countless improvements over the years. However, because of the limited sample that these technologies can process in a single run, the chance of capturing and identifying a small amount of pathogens is difficult. The problem is further magnified by the natural random distribution of pathogens in foods. Methods to simplify pathogenic detection through the identification of bacteria specific VOC were studied. E. coli O157:H7 and Salmonella typhimurium were grown on selected agar medium to model protein, and carbohydrate based foods. Pathogenic and common spoilage bacteria (Pseudomonas and Morexella) were screened for unique VOC production. Bacteria were grown on agar slants in closed vials. Headspace sampling was performed at intervals up to 24 hours using Solid Phase Micro-Extraction (SPME) techniques followed by GC/MS analysis. Development of unique volatiles was followed to establish sensitivity of detection. E. coli produced VOC not found in either Trypticase Soy Yeast (TSY) agar blanks or spoilage organism samples were - indole, 1-decanol, and 2-nonanone. Salmonella specific VOC grown on TSY were 3-methyl-1-butanol, dimethyl sulfide, 2-undecanol, 2-pentadecanol and 1-octanol. Trials on potato dextrose agar (PDA) slants indicated VOC specific for E. coli and Salmonella when compared to PDA blanks and Pseudomonas samples. However, these VOC peaks were similar for both pathogens. Morexella did not grow on PDA slants. Work will continue with model growth mediums at various temperatures, and mixed flora inoculums. As well as, VOC production based on the dynamics of bacterial growth.
Che, Yulan; Xu, Yi; Wang, Renjie; Chen, Li
2017-08-01
A rapid and sensitive analytical method was developed to detect pathogenic bacteria which combined magnetic enrichment, fluorescence labeling with polyethylene glycol (PEG) magnetophoretic chromatography. As pathogenic bacteria usually exist in complex matrixes at low concentration, an efficient enrichment is essential for diagnosis. In order to capture series types of pathogenic bacteria in samples, amino-modified magnetic nanoparticles (Fe 3 O 4 @SiO 2 -NH 2 ) were prepared for efficient enrichment by the electrostatic interaction with pathogenic bacteria. It was shown that the capture efficiency reached up to 95.4% for Escherichia coli (E. coli). Furthermore, quantitative analysis of the bacteria was achieved by using acridine orange (AO) as a fluorescence probe for the captured E. coli due to its ability of staining series types of bacteria and rapid labeling. In order to remove the free magnetic nanoparticles and redundant fluorescent reagent, the labeled suspension was poured into a PEG separation column and was separated by applying an external magnetic field. The presence of 100 cfu mL -1 E. coli could be detected for semi-quantitative analysis by observing the separation column with the naked eye, and the concentration could be further evaluated by fluorescence detection. All the above processes were finished within 80 min. It was demonstrated that a good linear relationship existed between the fluorescence intensity and the concentration of E. coli ranging from 10 2 to 10 6 cfu mL -1 , with a detection limit of 100 cfu mL -1 when E. coli acted as target bacteria. The recovery rate of E. coli was 93.6∼102.0% in tap water and cooked meat samples, and the RSD was lower than 7% (n = 6); the result coincided with the conventional plate count method. Graphical abstract ᅟ.
A Rapid and Simple Real-Time PCR Assay for Detecting Foodborne Pathogenic Bacteria in Human Feces.
Hanabara, Yutaro; Ueda, Yutaka
2016-11-22
A rapid, simple method for detecting foodborne pathogenic bacteria in human feces is greatly needed. Here, we examined the efficacy of a method that employs a combination of a commercial PCR master mix, which is insensitive to PCR inhibitors, and a DNA extraction method which used sodium dodecyl benzene sulfonate (SDBS), and Tween 20 to counteract the inhibitory effects of SDBS on the PCR assay. This method could detect the target genes (stx1 and stx2 of enterohemorrhagic Escherichia coli, invA of Salmonella Enteritidis, tdh of Vibrio parahaemolyticus, gyrA of Campylobacter jejuni, ceuE of Campylobacter coli, SEA of Staphylococcus aureus, ces of Bacillus cereus, and cpe of Clostridium perfringens) in a fecal suspension containing 1.0 × 10 1 to 1.0 × 10 3 CFU/ml. Furthermore, the assay was neither inhibited nor influenced by individual differences among the fecal samples of 10 subjects or fecal concentration (40-160 mg/ml in the fecal suspension). When we attempted to detect the genes of pathogenic bacteria in 4 actual clinical cases, we found that this method was more sensitive than standard culture method. These results showed that this assay is a rapid, simple detection method for foodborne pathogenic bacteria in human feces.
Rapid identification and detection of pathogenic Fungi by padlock probes
Tsui, C.K.M.; Wang, B.; Schoen, C.D.; Hamelin, R.C.
2013-01-01
Fungi are important pathogens of human diseases, as well as to agricultural crop and trees. Molecular diagnostics can detect diseases early, and improve identification accuracy and follow-up disease management. The use of padlock probe is effective to facilitate these detections and pathogen
DEFF Research Database (Denmark)
Sun, Yi; Phuoc Long, Truong; Wolff, Anders
2016-01-01
Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers...
Rapid detection of food pathogens using RNA aptamers-immobilized slide.
Maeng, Jin-Soo; Kim, Namsoo; Kim, Chong-Tai; Han, Seung Ryul; Lee, Young Ju; Lee, Seong-Wook; Lee, Myung-Hyun; Cho, Yong-Jin
2012-07-01
The purpose of this study was to develop a simple and rapid detection system for foodborne bacteria, which consisted of an optical microscope and its slide chip with artificial antibodies, or RNA aptamers. From an RNA pool, three each RNA aptamers were built by the method of SELEX (systematic evolution of ligands by exponential enrichment) for components of cell wall, LPS (lipopolysaccharide) from E. coli O157:H7, teichoic acid from Staphylococcus aureus and a cell membrane protein of OmpC from Salmonella typhimurium, respectively. These aptamers were hybridized with thiol-conjugated 16 dT-linker molecules in order to be immobilized on silver surface which was, in advance, fabricated on glass slide, using a spin-coating method. To confirm that each aptamers retained its specific binding activities to their antigenic live bacteria, microscopic view of bound cells immobilized on silver film were observed. Furthermore, we observed the fluorescence-emitting bacteria-aptamer complex immobilized on silver film after adding RNA aptamers hybridized with fluorophore, FAM-conjugated 16 dT-linker molecules. As a result, the RNA aptamers-immobilized slide system developed in this study was a useful new tool to rapidly monitor individual food pathogens.
Exploration of Simple Analytical Approaches for Rapid Detection of Pathogenic Bacteria
Energy Technology Data Exchange (ETDEWEB)
Rahman, Salma [Iowa State Univ., Ames, IA (United States)
2005-01-01
Many of the current methods for pathogenic bacterial detection require long sample-preparation and analysis time, as well as complex instrumentation. This dissertation explores simple analytical approaches (e.g., flow cytometry and diffuse reflectance spectroscopy) that may be applied towards ideal requirements of a microbial detection system, through method and instrumentation development, and by the creation and characterization of immunosensing platforms. This dissertation is organized into six sections. In the general Introduction section a literature review on several of the key aspects of this work is presented. First, different approaches for detection of pathogenic bacteria will be reviewed, with a comparison of the relative strengths and weaknesses of each approach, A general overview regarding diffuse reflectance spectroscopy is then presented. Next, the structure and function of self-assembled monolayers (SAMs) formed from organosulfur molecules at gold and micrometer and sub-micrometer patterning of biomolecules using SAMs will be discussed. This section is followed by four research chapters, presented as separate manuscripts. Chapter 1 describes the efforts and challenges towards the creation of imunosensing platforms that exploit the flexibility and structural stability of SAMs of thiols at gold. 1H, 1H, 2H, 2H-perfluorodecyl-1-thiol SAM (PFDT) and dithio-bis(succinimidyl propionate)-(DSP)-derived SAMs were used to construct the platform. Chapter 2 describes the characterization of the PFDT- and DSP-derived SAMs, and the architectures formed when it is coupled to antibodies as well as target bacteria. These studies used infrared reflection spectroscopy (IRS), X-ray photoelectron spectroscopy (XPS), and electrochemical quartz crystal microbalance (EQCM), Chapter 3 presents a new sensitive, and portable diffuse reflection based technique for the rapid identification and quantification of pathogenic bacteria. Chapter 4 reports research efforts in the
Aptamer-Based Technologies in Foodborne Pathogen Detection.
Teng, Jun; Yuan, Fang; Ye, Yingwang; Zheng, Lei; Yao, Li; Xue, Feng; Chen, Wei; Li, Baoguang
2016-01-01
Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX); and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make the accurate assessments on the risks of infections (humans and animals) or contaminations (foods and other commodities) caused by various pathogens. This article reviews the development in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development in aptamer-based biosensors including optical biosensors for multiple pathogen detection by multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors and lateral chromatography test strips, and their applications in pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening remain to be overcome.
Aptamer-Based Technologies in Foodborne Pathogen Detection
Directory of Open Access Journals (Sweden)
Jun Teng
2016-09-01
Full Text Available Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX; and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the first and critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make to accurate assessments on the risk of infections (humans and animals or contaminations (foods and other commodities caused by various pathogens. This article reviews the developments in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development of aptamer-based biosensors including optical biosensors for multiple pathogen detection in multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors, and lateral chromatography test strips, and their applications in the pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening, remain to be overcome.
Zhang, D F; Zhang, Q Q; Li, A H
2014-11-01
Species of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus are the most common fish pathogenic bacteria that cause economically devastating losses in aquaculture. A multiplex polymerase chain reaction (mPCR) was developed for the simultaneous detection and differentiation of the four genera of fish pathogenic bacteria. Through the use of genus-specific primers instead of species-specific ones, the current mPCR covered much more target bacterial species compared with previously reported species-specific mPCR methods. The specificity of the four putative genus-specific primers was validated experimentally while used exclusively (uniplex PCR) or combined (mPCR) against bacterial genomic DNA templates of the target bacteria and nontarget bacteria. The PCR amplicons for the following genera were obtained as expected: Aeromonas (875 bp), Vibrio (524 bp), Edwardsiella (302 bp) and Streptococcus (197 bp), and the fragments could be separated clearly on the agarose gel electrophoresis. The mPCR did not produce nonspecific amplification products when used to amplify 21 nontarget species of bacteria. The mPCR detection limits for each target bacterial genera were 50 colony-forming units (CFU) in pure culture and 100 CFU in fish tissue samples. In conclusion, the mPCR assay was proven to be a powerful alternative to the conventional culture-based method, given its rapid, specific, sensitive and reliable detection of target pathogens. The fish pathogenic bacteria of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus frequently cause severe outbreaks of diseases in cultured fish, and the genus-specific multiplex PCR assay developed in this study can detect the bacteria of the four genera when present in the samples either alone or mixed. The mPCR assay is expected to identify the causative agents more efficiently than uniplex PCR or species-specific multiplex PCR for clinical diagnosis, resulting in the earlier implementation of control measures. This m
Biosensors for plant pathogen detection.
Khater, Mohga; de la Escosura-Muñiz, Alfredo; Merkoçi, Arben
2017-07-15
Infectious plant diseases are caused by pathogenic microorganisms such as fungi, bacteria, viruses, viroids, phytoplasma and nematodes. Worldwide, plant pathogen infections are among main factors limiting crop productivity and increasing economic losses. Plant pathogen detection is important as first step to manage a plant disease in greenhouses, field conditions and at the country boarders. Current immunological techniques used to detect pathogens in plant include enzyme-linked immunosorbent assays (ELISA) and direct tissue blot immunoassays (DTBIA). DNA-based techniques such as polymerase chain reaction (PCR), real time PCR (RT-PCR) and dot blot hybridization have also been proposed for pathogen identification and detection. However these methodologies are time-consuming and require complex instruments, being not suitable for in-situ analysis. Consequently, there is strong interest for developing new biosensing systems for early detection of plant diseases with high sensitivity and specificity at the point-of-care. In this context, we revise here the recent advancement in the development of advantageous biosensing systems for plant pathogen detection based on both antibody and DNA receptors. The use of different nanomaterials such as nanochannels and metallic nanoparticles for the development of innovative and sensitive biosensing systems for the detection of pathogens (i.e. bacteria and viruses) at the point-of-care is also shown. Plastic and paper-based platforms have been used for this purpose, offering cheap and easy-to-use really integrated sensing systems for rapid on-site detection. Beside devices developed at research and development level a brief revision of commercially available kits is also included in this review. Copyright © 2016 Elsevier B.V. All rights reserved.
Continuous-Flow Detector for Rapid Pathogen Identification
Energy Technology Data Exchange (ETDEWEB)
Barrett, Louise M. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics; Skulan, Andrew J. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics; Singh, Anup K. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics; Cummings, Eric B. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics; Fiechtner, Gregory J. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics
2006-09-01
This report describes the continued development of a low-power, portable detector for the rapid identification of pathogens such as B. anthracis and smallpox. Based on our successful demonstration of the continuous filter/concentrator inlet, we believe strongly that the inlet section will enable differentiation between viable and non-viable populations, between types of cells, and between pathogens and background contamination. Selective, continuous focusing of particles in a microstream enables highly selective and sensitive identification using fluorescently labeled antibodies and other receptors such as peptides, aptamers, or small ligands to minimize false positives. Processes such as mixing and lysing will also benefit from the highly localized particle streams. The concentrator is based on faceted prisms to contract microfluidic flows while maintaining uniform flowfields. The resulting interfaces, capable of high throughput, serve as high-, low-, and band-pass filters to direct selected bioparticles to a rapid, affinity-based detection system. The proposed device is superior to existing array-based detectors as antibody-pathogen binding can be accomplished in seconds rather than tens of minutes or even hours. The system is being designed to interface with aerosol collectors under development by the National Laboratories or commercial systems. The focused stream is designed to be interrogated using diode lasers to differentiate pathogens by light scattering. Identification of particles is done using fluorescently labeled antibodies to tag the particles, followed by multiplexed laser-induced fluorescence (LIF) detection (achieved by labeling each antibody with a different dye).
Ghosh, Raju; Nagavardhini, Avuthu; Sengupta, Anindita; Sharma, Mamta
2015-02-11
Fusarium oxysporum f. sp. ciceris (Foc), the causal agent of Fusarium wilt is a devastating pathogen of chickpea. In chickpea, various soil borne pathogens produce (s) similar symptoms, therefore cannot be distinguished easily at field level. There is real need for a rapid, inexpensive, and easy to operate and maintain genotyping tool to facilitate accurate disease diagnosis and surveillance for better management of Fusarium wilt outbreaks. In this study, we developed a loop-mediated isothermal amplification (LAMP) assay targeting the elongation factor 1 alpha gene sequence for visual detection of Foc. The LAMP reaction was optimal at 63°C for 60 min. When hydroxynaphthol blue (HNB) was added before amplification, samples with Foc DNA developed a characteristic sky blue colour but those without DNA or with the DNA of six other plant pathogenic fungi did not. Results obtained with LAMP and HNB were confirmed when LAMP products were subjected to gel electrophoresis. The detection limit of this LAMP assay for Foc was 10 fg of genomic DNA per reaction, while that of conventional PCR was 100 pg. In conclusion, it was found that a LAMP assay combined with HNB is simple, rapid, sensitive, and specific. The LAMP assay does not require specialized equipment, hence can be used in the field for the rapid detection of Foc. This is the first report of the use of LAMP assay for the detection of Foc. The presented LAMP method provides a specific, sensitive and rapid diagnostic tool for the distinction of Foc, with the potential to be standardized as a detection method for Foc in endemic areas and will be very useful for monitoring the disease complex in the field further suggesting the management strategies.
Straub, Julia; Paula, Helga; Mayr, Michaela; Kasper, David; Assadian, Ojan; Berger, Angelika; Rittenschober-Böhm, Judith
2017-01-01
Diagnosis of neonatal sepsis remains a major challenge in neonatology. Most molecular-based methods are not customized for neonatal requirements. The aim of the present study was to assess the diagnostic accuracy of a modified multiplex PCR protocol for the detection of neonatal sepsis using small blood volumes. 212 episodes of suspected neonatal late onset sepsis were analyzed prospectively using the Roche SeptiFast® MGRADE PCR with a modified DNA extraction protocol and software-handling tool. Results were compared to blood culture, laboratory biomarkers and clinical signs of sepsis. Of 212 episodes, 85 (40.1%) were categorized as "not infected". Among these episodes, 1 was false positive by blood culture (1.2%) and 23 were false positive by PCR (27.1%). Of 51 (24.1%) episodes diagnosed as "culture proven sepsis", the same pathogen was detected by blood culture and PCR in 39 episodes (76.5%). In 8 episodes, more pathogens were detected by PCR compared to blood culture, and in 4 episodes the pathogen detected by blood culture was not found by PCR. One of these episodes was caused by Bacillus cereus, a pathogen not included in the PCR panel. In 76/212 (35.8%) episodes, clinical sepsis was diagnosed. Among these, PCR yielded positive results in 39.5% of episodes (30/76 episodes). For culture-positive sepsis, PCR showed a sensitivity of 90.2% (95%CI 86.2-94.2%) and a specificity of 72.9% (95%CI 67.0-79.0%). The Roche SeptiFast® MGRADE PCR using a modified DNA extraction protocol showed acceptable results for rapid detection of neonatal sepsis in addition to conventional blood culture. The benefit of rapid pathogen detection has to be balanced against the considerable risk of contamination, loss of information on antibiotic sensitivity pattern and increased costs.
Progress in rapid detection and identification of unknown human and agricultural pathogens
International Nuclear Information System (INIS)
Barnes, T; Holzrichter, J F; Milanovich, F P
1999-01-01
The medical industry is driving pathogen detection technology from its present characteristics of$50/sample, 100 sample capability systems, with several day time responses, having several percent error rates in reported outcomes. The systems described above are capable of providing samples at and lt;$5/test, managing several million samples, and lt; 1-hour cycle times, (or just minutes in some cases) and and lt; 0.1% error rates. Because of their importance to the medical and agricultural communities, all ''important'' pathogens will have detection kits available (within air transport times, anywhere in the world) by 2020, and the most well known pathogens will have kits available within a few years. Many are available now. Because of the importance of the food supply to modern nations, these technologies will be employed everywhere in this industry. For example, the United States imports 30 B tons of food a year, but inspects and lt; 1%. Portable inspection systems will make it possible to test for dangerous pathogens in feed lots, food processing plants, markets, and points of use. Outbreaks of animal or plant disease will be immediately detectable using field instrumentation, and more complex samples can be sent to central testing laboratories where more sophisticated test systems will be available. Unusual pathogens either naturally or purposefully selected or developed, will require special attention because there is not a commercial economic driver for the development of detection systems and curative agents. Their development, and production for sufficient availability, will require significant investments by the world community. The strategy and costs for developing vaccines or curative drugs will be very expensive and will need special attention. However it is important that attention be directed to these problems because such attention has a strong deterrent effect on potential developers or users. The capacity to use the full information content
Advances and Challenges in Viability Detection of Foodborne Pathogens
Directory of Open Access Journals (Sweden)
Dexin Zeng
2016-11-01
Full Text Available Foodborne outbreaks are a serious public health and food safety concern worldwide. There is a great demand for rapid, sensitive, specific, and accurate methods to detect microbial pathogens in foods. Conventional methods based on cultivation of pathogens have been the gold standard protocols; however, they take up to a week to complete. Molecular assays such as polymerase chain reaction (PCR, sequencing, microarray technologies have been widely used in detection of foodborne pathogens. Among molecular assays, PCR technology conventional and real-time PCR (qPCR is most commonly used in the foodborne pathogen detection because of its high sensitivity and specificity. However, a major drawback of PCR is its inability to differentiate the DNA from dead and viable cells, and this is a critical factor for the food industry, regulatory agencies and the consumer. To remedy this shortcoming, researchers have used biological dyes such as ethidium monoazide (EMA and propidium monoazide (PMA to pretreat samples before DNA extraction to intercalate the DNA of dead cells in food samples, and then proceed with regular DNA preparation and qPCR. By combining PMA treatment with qPCR (PMA-qPCR, scientists have applied this technology to detect viable cells of various bacterial pathogens in foods. The incorporation of PMA into PCR-based assays for viability detection of pathogens in foods has increased significantly in the last decade. On the other hand, some downsides with this approach have been noted, particularly to achieve complete suppression of signal of DNA from the dead cells present in some particular food matrix. Nowadays, there is a tendency of more and more researchers adapting this approach for viability detection; and a few commercial kits based on PMA are available in the market. As time goes on, more scientists apply this approach to a broader range of pathogen detections, this viability approach (PMA or other chemicals such as platinum compound
Rapid detection and identification of pathogenic microorganisms naturally occurring during food processing are important in developing intervention and verification strategies. In the poultry industry, contamination of poultry meat with foodborne pathogens (especially, Salmonella and Campylobacter) ...
Rapid Magnetic Nanobiosensor for the detection of Serratia marcescen
Aljabali, Alaa A. A.; Hussein, Emad; Aljumaili, Omar; Zoubi, Mazhar Al; Altrad, Bahaa; Albatayneh, Khaled; Al-razaq, Mutaz A. Abd
2018-02-01
The development of rapid, sensitive, accurate and reliable bacterial detection methods are of keen interest to ensure food safety and hospital security. Therefore, the development of a fast, specific, low-cost and trusted methods is in high demand. Magnetic nanoparticles with their unique material properties have been utilized as a tool for pathogen detection. Here, we present a novel iron oxide nanoparticles labeled with specific targeting antibodies to improve specificity and extend the use of nanoparticles as nanosensors. The results indicated that antibody labeled iron oxide platform that binds specifically to Serriata marcescenst in a straightforward method is very specific and sensitive. The system is capable of rapid and specific detection of various clinically relevant bacterial species, with sensitivity down to single bacteria. The generic platform could be used to identify pathogens for a variety of applications rapidly.
Rapid Detection and Characterization of Emerging Foreign Animal Disease Pathogens
Energy Technology Data Exchange (ETDEWEB)
Jaing, C. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)
2016-11-18
To best safeguard human and animal health requires early detection and characterization of disease events. This must include effective surveillance for emerging infectious diseases. Both deliberate and natural outbreaks have enormous economic and public health impacts, and can present serious threats to national security. In this project, we developed novel next generation detection technologies to protect the agricultural economy and biosecurity. The first technology is a multiplexed assay to simultaneously detection 10 swine viral and bacterial pathogens. The second one is the Lawrence Livermore Microbial Detection Array (LLMDA) which can detect more than 10,000 microbial species including 4219 viruses, 5367 bacteria, 265 fungi, 117 protozoa and 293 archaea. We analyzed a series of swine clinical samples from past disease events to demonstrate the utility of the assays for faster and cheaper detection of emerging and foreign animal disease pathogens, and their utility as s routine diagnosis and surveillance tool. A second goal of the study is to better understand mechanisms of African swine fever virus (ASFV) infection in pigs to aid the development of countermeasures and diagnostics. There is no vaccine available for ASF. ASF outbreak is on the rise on several European countries. Though ASF is not currently in the U.S., a potential outbreak in the U.S. would be detrimental to the swine industry and the US agricultural economy. We pursued a genome-wide approach to characterize the pig immune responses after ASFV infection. We used RNA sequencing and bioinformatics methods to identify genes and pathways that are affected during ASF infection. We have identified a list of most differentially expressed genes that are in the immune response pathways.
Barreda-García, Susana; Miranda-Castro, Rebeca; de-Los-Santos-Álvarez, Noemí; Miranda-Ordieres, Arturo J; Lobo-Castañón, María Jesús
2018-01-01
Highly sensitive testing of nucleic acids is essential to improve the detection of pathogens, which pose a major threat for public health worldwide. Currently available molecular assays, mainly based on PCR, have a limited utility in point-of-need control or resource-limited settings. Consequently, there is a strong interest in developing cost-effective, robust, and portable platforms for early detection of these harmful microorganisms. Since its description in 2004, isothermal helicase-dependent amplification (HDA) has been successfully applied in the development of novel molecular-based technologies for rapid, sensitive, and selective detection of viruses and bacteria. In this review, we highlight relevant analytical systems using this simple nucleic acid amplification methodology that takes place at a constant temperature and that is readily compatible with microfluidic technologies. Different strategies for monitoring HDA amplification products are described. In addition, we present technological advances for integrating sample preparation, HDA amplification, and detection. Future perspectives and challenges toward point-of-need use not only for clinical diagnosis but also in food safety testing and environmental monitoring are also discussed. Graphical Abstract Expanding the analytical toolbox for the detection of DNA sequences specific of pathogens with isothermal helicase dependent amplification (HDA).
Multiplex detection of plant pathogens using a microsphere immunoassay technology.
Directory of Open Access Journals (Sweden)
Ratthaphol Charlermroj
Full Text Available Plant pathogens are a serious problem for seed export, plant disease control and plant quarantine. Rapid and accurate screening tests are urgently required to protect and prevent plant diseases spreading worldwide. A novel multiplex detection method was developed based on microsphere immunoassays to simultaneously detect four important plant pathogens: a fruit blotch bacterium Acidovorax avenae subsp. citrulli (Aac, chilli vein-banding mottle virus (CVbMV, potyvirus, watermelon silver mottle virus (WSMoV, tospovirus serogroup IV and melon yellow spot virus (MYSV, tospovirus. An antibody for each plant pathogen was linked on a fluorescence-coded magnetic microsphere set which was used to capture corresponding pathogen. The presence of pathogens was detected by R-phycoerythrin (RPE-labeled antibodies specific to the pathogens. The assay conditions were optimized by identifying appropriate antibody pairs, blocking buffer, concentration of RPE-labeled antibodies and assay time. Once conditions were optimized, the assay was able to detect all four plant pathogens precisely and accurately with substantially higher sensitivity than enzyme-linked immunosorbent assay (ELISA when spiked in buffer and in healthy watermelon leaf extract. The assay time of the microsphere immunoassay (1 hour was much shorter than that of ELISA (4 hours. This system was also shown to be capable of detecting the pathogens in naturally infected plant samples and is a major advancement in plant pathogen detection.
Multiplex detection of plant pathogens using a microsphere immunoassay technology.
Charlermroj, Ratthaphol; Himananto, Orawan; Seepiban, Channarong; Kumpoosiri, Mallika; Warin, Nuchnard; Oplatowska, Michalina; Gajanandana, Oraprapai; Grant, Irene R; Karoonuthaisiri, Nitsara; Elliott, Christopher T
2013-01-01
Plant pathogens are a serious problem for seed export, plant disease control and plant quarantine. Rapid and accurate screening tests are urgently required to protect and prevent plant diseases spreading worldwide. A novel multiplex detection method was developed based on microsphere immunoassays to simultaneously detect four important plant pathogens: a fruit blotch bacterium Acidovorax avenae subsp. citrulli (Aac), chilli vein-banding mottle virus (CVbMV, potyvirus), watermelon silver mottle virus (WSMoV, tospovirus serogroup IV) and melon yellow spot virus (MYSV, tospovirus). An antibody for each plant pathogen was linked on a fluorescence-coded magnetic microsphere set which was used to capture corresponding pathogen. The presence of pathogens was detected by R-phycoerythrin (RPE)-labeled antibodies specific to the pathogens. The assay conditions were optimized by identifying appropriate antibody pairs, blocking buffer, concentration of RPE-labeled antibodies and assay time. Once conditions were optimized, the assay was able to detect all four plant pathogens precisely and accurately with substantially higher sensitivity than enzyme-linked immunosorbent assay (ELISA) when spiked in buffer and in healthy watermelon leaf extract. The assay time of the microsphere immunoassay (1 hour) was much shorter than that of ELISA (4 hours). This system was also shown to be capable of detecting the pathogens in naturally infected plant samples and is a major advancement in plant pathogen detection.
Multiplex PCR assay for simultaneous detection of six major bacterial pathogens of rice.
Cui, Z; Ojaghian, M R; Tao, Z; Kakar, K U; Zeng, J; Zhao, W; Duan, Y; Vera Cruz, C M; Li, B; Zhu, B; Xie, G
2016-05-01
The aim of this study was to develop a multiplex PCR (mPCR) assay for rapid, sensitive and simultaneous detection of six important rice pathogens: Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, Pseudomonas fuscovaginae, Burkholderia glumae, Burkholderia gladioli and Acidovorax avenae subsp. avenae. Specific primers were designed through a bioinformatics pipeline. Sensitivity of detection was established using both traditional PCR and quantitative real-time PCR on isolated DNA and on bacterial cells both in vitro and in simulated diseased seeds and the parameters were optimized for an mPCR assay. A total of 150 bacterial strains were tested for specificity. The mPCR assay accurately predicted the presence of pathogens among 44 symptomatic and asymptomatic rice seed, sheath and leaf samples. This study confirmed that this mPCR assay is a rapid, reliable and simple tool for the simultaneous detection of six important rice bacterial pathogens. This study is the first report of a method allowing simultaneous detection of six major rice pathogens. The ability to use crude extracts from plants without bacterial isolation or DNA extraction enhances the value of this mPCR technology for rapid detection and aetiological/epidemiological studies. © 2016 The Society for Applied Microbiology.
Liu, Yu; Zhou, Haibo; Hu, Ziwei; Yu, Guangxia; Yang, Danting; Zhao, Jinshun
2017-08-15
Rapid, accurate detection of pathogen bacteria is a highly topical research area for the sake of food safety and public health. Surface-enhanced Raman scattering (SERS) is being considered as a powerful and attractive technique for pathogen bacteria detection, due to its sensitivity, high speed, comparatively low cost, multiplexing ability and portability. This contribution aims to give a comprehensive overview of SERS as a technique for rapid detection of pathogen bacteria based on label and label-free strategies. A brief tutorial on SERS is given first of all. Then we summarize the recent trends and developments of label and label-free based SERS applied to detection of pathogen bacteria, including the relatively complete interpretation of SERS spectra. In addition, multifunctional SERS platforms for pathogen bacteria in matrix are discussed as well. Furthermore, an outlook of the work done and a perspective on the future directions of SERS as a reliable tool for real-time pathogen bacteria detection are given. Copyright © 2017 Elsevier B.V. All rights reserved.
Sexton, D Joseph; Bentz, Meghan L; Welsh, Rory M; Litvintseva, Anastasia P
2018-06-25
Candida auris is a multidrug-resistant pathogenic yeast whose recent emergence is of increasing public-health concern. C. auris can colonize multiple body sites, including patients' skin, and survive for weeks in the healthcare environment, facilitating patient-to-patient transmission and fueling healthcare-associated outbreaks. Rapid and accurate detection of C. auris colonization is essential for timely implementation of infection control measures and prevent transmission. Currently, axilla/groin composite swabs, used to assess colonization status, are processed using a culture-based method that is sensitive and specific but requires 14 days. This delay limits the opportunity to respond and highlights the need for a faster alternative. The culture-independent T2 Magnetic Resonance (T2MR) system is a rapid diagnostic platform shown to detect target pathogens of interest from unprocessed blood samples in T2 assay was evaluated for screening of the skin surveillance samples. Inclusivity and limit of detection of the T2 C. auris assay were assessed with spiked samples in a representative skin flora background. The T2 C. auris assay recognized isolates from each of the 4 known clades of C. auris and consistently detected cells at 5 CFU/mL. Finally, 89 clinical axilla/groin swab samples were processed with the T2 C. auris assay. The culture-based diagnostic assay was used as a gold standard to determine performance statistics including sensitivity (0.89) and specificity (0.98). Overall, the T2 C. auris assay performed well as a rapid diagnostic and could help expedite the detection of C. auris in patient skin swabs. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Deoxyribonucleic Acid Probes Analyses for the Detection of Periodontal Pathogens.
Al Yahfoufi, Zoubeida; Hadchiti, Wahib; Berberi, Antoine
2015-09-01
In clinical microbiology several techniques have been used to identify bacteria. Recently, Deoxyribonucleic acid (DNA)-based techniques have been introduced to detect human microbial pathogens in periodontal diseases. Deoxyribonucleic acid probes can detect bacteria at a very low level if we compared with the culture methods. These probes have shown rapid and cost-effective microbial diagnosis, good sensitivity and specificity for some periodontal pathogens in cases of severe periodontitis. Eighty-five patients were recruited for the study. Twenty-one subjects ranging between 22 and 48 years of age fulfilled the inclusion and exclusion criteria. Seventy-eight samples became available for DNA probe analysis from the deepest pockets in each quadrant. All 21 patients showed positive results for Prevotella intermedia; also, Prevotella gingivalis was identified in 19 subjects, Aggregatibacter actinomycetemcomitans in 6 subjects. P. intermedia was diagnosed positive in 82% of the subgingival samples taken, 79% for P. gingivalis, and 23% for A. actinomycetemcomitans. This study shows a high frequency of putative periodontal pathogens by using DNA probe technology, which is semi-quantitative in this study. Deoxyribonucleic acid probes can detect bacteria at very low level about 10(3) which is below the detection level of culture methods. The detection threshold of cultural methods. The three types of bacteria can be detected rapidly with high sensitivity by using the DNA probe by general practitioners, and thus can help in the diagnosis process and the treatment.
A new oligonucleotide microarray for detection of pathogenic and non-pathogenic Legionella spp.
Directory of Open Access Journals (Sweden)
Boyang Cao
Full Text Available Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp.
A New Oligonucleotide Microarray for Detection of Pathogenic and Non-Pathogenic Legionella spp.
Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei
2014-01-01
Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp. PMID:25469776
Rapid Detection of Salmonella enterica in Food Using a Compact Disc-Shaped Device
Directory of Open Access Journals (Sweden)
Shunsuke Furutani
2016-01-01
Full Text Available Rapid detection of food-borne pathogens is essential to public health and the food industry. Although the conventional culture method is highly sensitive, it takes at least a few days to detect food-borne pathogens. Even though polymerase chain reaction (PCR can detect food-borne pathogens in a few hours, it is more expensive and unsatisfactorily sensitive relative to the culture method. We have developed a method to rapidly detect Salmonella enterica by using a compact disc (CD-shaped device that can reduce reagent consumption in conventional PCR. The detection method, which combines culture and PCR, is more rapid than the conventional culture method and is more sensitive and cheaper than PCR. In this study, we also examined a sample preparation method that involved collecting bacterial cells from food. The bacteria collected from chicken meat spiked with S. enterica were mixed with PCR reagents, and PCR was performed on the device. At a low concentration of S. enterica, the collected S. enterica was cultured before PCR for sensitive detection. After cultivation for 4 h, S. enterica at 1.7 × 104 colony-forming units (CFUs·g−1 was detected within 8 h, which included the time needed for sample preparation and detection. Furthermore, the detection of 30 CFUs·g−1 of S. enterica was possible within 12 h including 8 h for cultivation.
Directory of Open Access Journals (Sweden)
Lemieux Bertrand
2011-05-01
Full Text Available Abstract Background In the past decades the rapid growth of molecular diagnostics (based on either traditional PCR or isothermal amplification technologies meet the demand for fast and accurate testing. Although isothermal amplification technologies have the advantages of low cost requirements for instruments, the further improvement on sensitivity, speed and robustness is a prerequisite for the applications in rapid pathogen detection, especially at point-of-care diagnostics. Here, we describe and explore several strategies to improve one of the isothermal technologies, helicase-dependent amplification (HDA. Results Multiple strategies were approached to improve the overall performance of the isothermal amplification: the restriction endonuclease-mediated DNA helicase homing, macromolecular crowding agents, and the optimization of reaction enzyme mix. The effect of combing all strategies was compared with that of the individual strategy. With all of above methods, we are able to detect 50 copies of Neisseria gonorrhoeae DNA in just 20 minutes of amplification using a nearly instrument-free detection platform (BESt™ cassette. Conclusions The strategies addressed in this proof-of-concept study are independent of expensive equipments, and are not limited to particular primers, targets or detection format. However, they make a large difference in assay performance. Some of them can be adjusted and applied to other formats of nucleic acid amplification. Furthermore, the strategies to improve the in vitro assays by maximally simulating the nature conditions may be useful in the general field of developing molecular assays. A new fast molecular assay for Neisseria gonorrhoeae has also been developed which has great potential to be used at point-of-care diagnostics.
Nano-particle enhanced impedimetric biosensor for detection of foodborne pathogens
International Nuclear Information System (INIS)
Kim, G; Om, A S; Mun, J H
2007-01-01
Recent outbreaks of foodborne illness have been increased the need for rapid and sensitive methods for detection of these pathogens. Conventional methods for pathogens detection and identification involve prolonged multiple enrichment steps. Even though some immunological rapid assays are available, these assays still need enrichment steps result in delayed detection. Biosensors have shown great potential for rapid detection of foodborne pathogens. They are capable of direct monitoring the antigen-antibody reactions in real time. Among the biosensors, impedimetric biosensors have been widely adapted as an analysis tool for the study of various biological binding reactions because of their high sensitivity and reagentless operation. In this study a nanoparticle-enhanced impedimetric biosensor for Salmonella enteritidis detection was developed which detected impedance changes caused by the attachment of the cells to the anti-Salmonella antibodies immobilized on interdigitated gold electrodes. Successive immobilization of neutravidin followed by anti-Salmonella antibodies was performed to the sensing area to create a biological detection surface. To enhance the impedance responses generated by antigen-antibody reactions, anti-Salmonella antibody conjugated nanoparticles were introduced on the sensing area. Using a portable impedance analyzer, the impedance across the interdigital electrodes was measured after the series of antigen-antibody bindings. Bacteria cells present in solution attached to capture antibodies and became tethered to the sensor surface. Attached bacteria cells changed the dielectric constant of the media between the electrodes thereby causing a change in measured impedance. Optimum input frequency was determined by analyzing frequency characteristics of the biosensor over ranges of applied frequencies from 10 Hz to 400 Hz. At 100 Hz of input frequency, the biosensor was most sensitive to the changes of the bacteria concentration and this frequency
Increased detection of mastitis pathogens by real-time PCR compared to bacterial culture.
Keane, O M; Budd, K E; Flynn, J; McCoy, F
2013-09-21
Rapid and accurate identification of mastitis pathogens is important for disease control. Bacterial culture and isolate identification is considered the gold standard in mastitis diagnosis but is time consuming and results in many culture-negative samples. Identification of mastitis pathogens by PCR has been proposed as a fast and sensitive alternative to bacterial culture. The results of bacterial culture and PCR for the identification of the aetiological agent of clinical mastitis were compared. The pathogen identified by traditional culture methods was also detected by PCR in 98 per cent of cases indicating good agreement between the positive results of bacterial culture and PCR. A mastitis pathogen could not be recovered from approximately 30 per cent of samples by bacterial culture, however, an aetiological agent was identified by PCR in 79 per cent of these samples. Therefore, a mastitis pathogen was detected in significantly more milk samples by PCR than by bacterial culture (92 per cent and 70 per cent, respectively) although the clinical relevance of PCR-positive culture-negative results remains controversial. A mixed infection of two or more mastitis pathogens was also detected more commonly by PCR. Culture-negative samples due to undetected Staphylococcus aureus infections were rare. The use of PCR technology may assist in rapid mastitis diagnosis, however, accurate interpretation of PCR results in the absence of bacterial culture remains problematic.
System for rapid detection of antibiotic resistance of airborne pathogens
Fortin, M.; Noiseux, I.; Mouslinkina, L.; Vernon, M. L.; Laflamme, C.; Filion, G.; Duchaine, C.; Ho, J.
2009-05-01
This project uses function-based detection via a fundamental understanding of the genetic markers of AR to distinguish harmful organisms from innocuous ones. This approach circumvents complex analyses to unravel the taxonomic details of 1399 pathogen species, enormously simplifying detection requirements. Laval Hospital's fast permeabilization strategy enables AR revelation in <1hr. Packaging the AR protocols in liquid-processing cartridges and coupling these to our in-house miniature fiber optic flow cell (FOFC) provides first responders with timely information on-site. INO's FOFC platform consists of a specialty optical fiber through which a hole is transversally bored by laser micromachining. The analyte solution is injected into the hole of the fiber and the particles are detected and counted. The advantage with respect to classic free space FC is that alignment occurs in the fabrication process only and complex excitation and collection optics are replaced by optical fibers. Moreover, we use a sheathless configuration which has the advantage of increase the portability of the system, to reduce excess biohazard material and the need for weekly maintenance. In this paper we present the principle of our FOFC along with a, demonstration of the basic capability of the platform for detection of bacillus cereus spores using permeabilized staining.
Nucleic Acid-based Detection of Bacterial Pathogens Using Integrated Microfluidic Platform Systems
Directory of Open Access Journals (Sweden)
Carl A. Batt
2009-05-01
Full Text Available The advent of nucleic acid-based pathogen detection methods offers increased sensitivity and specificity over traditional microbiological techniques, driving the development of portable, integrated biosensors. The miniaturization and automation of integrated detection systems presents a significant advantage for rapid, portable field-based testing. In this review, we highlight current developments and directions in nucleic acid-based micro total analysis systems for the detection of bacterial pathogens. Recent progress in the miniaturization of microfluidic processing steps for cell capture, DNA extraction and purification, polymerase chain reaction, and product detection are detailed. Discussions include strategies and challenges for implementation of an integrated portable platform.
Wu, Qingzhong; Prager, Katherine C; Goldstein, Tracey; Alt, David P; Galloway, Renee L; Zuerner, Richard L; Lloyd-Smith, James O; Schwacke, Lori
2014-08-11
Several real-time PCR assays are currently used for detection of pathogenic Leptospira spp.; however, few methods have been described for the successful evaluation of clinical urine samples. This study reports a rapid assay for the detection of pathogenic Leptospira spp. in California sea lions Zalophus californianus using real-time PCR with primers and a probe targeting the lipL32 gene. The PCR assay had high analytic sensitivity-the limit of detection was 3 genome copies per PCR volume using L. interrogans serovar Pomona DNA and 100% analytic specificity; it detected all pathogenic leptospiral serovars tested and none of the non-pathogenic Leptospira species (L. biflexa and L. meyeri serovar Semaranga), the intermediate species L. inadai, or the non-Leptospira pathogens tested. Our assay had an amplification efficiency of 1.00. Comparisons between the real-time PCR assay and culture isolation for detection of pathogenic Leptospira spp. in urine and kidney tissue samples from California sea lions showed that samples were more often positive by real-time PCR than by culture methods. Inclusion of an internal amplification control in the real-time PCR assay showed no inhibitory effects in PCR negative samples. These studies indicated that our real-time PCR assay has high analytic sensitivity and specificity for the rapid detection of pathogenic Leptospira species in urine and kidney tissue samples.
Microbial Biosensor for the Detection of Protease-Virulent Factors from Pathogens
2017-04-28
pathogen signalling molecules. With that goal in mind , researchers have developed various types of biosensors that detect infectious determinants...life to boost their capability for rapid determination of clean water sources during field deployment. Despite the promising results of these studies
Electrochemical Methodologies for the Detection of Pathogens.
Amiri, Mandana; Bezaatpour, Abolfazl; Jafari, Hamed; Boukherroub, Rabah; Szunerits, Sabine
2018-05-25
Bacterial infections remain one of the principal causes of morbidity and mortality worldwide. The number of deaths due to infections is declining every year by only 1% with a forecast of 13 million deaths in 2050. Among the 1400 recognized human pathogens, the majority of infectious diseases is caused by just a few, about 20 pathogens only. While the development of vaccinations and novel antibacterial drugs and treatments are at the forefront of research, and strongly financially supported by policy makers, another manner to limit and control infectious outbreaks is targeting the development and implementation of early warning systems, which indicate qualitatively and quantitatively the presence of a pathogen. As toxin contaminated food and drink are a potential threat to human health and consequently have a significant socioeconomic impact worldwide, the detection of pathogenic bacteria remains not only a big scientific challenge but also a practical problem of enormous significance. Numerous analytical methods, including conventional culturing and staining techniques as well as molecular methods based on polymerase chain reaction amplification and immunological assays, have emerged over the years and are used to identify and quantify pathogenic agents. While being highly sensitive in most cases, these approaches are highly time, labor, and cost consuming, requiring trained personnel to perform the frequently complex assays. A great challenge in this field is therefore to develop rapid, sensitive, specific, and if possible miniaturized devices to validate the presence of pathogens in cost and time efficient manners. Electrochemical sensors are well accepted powerful tools for the detection of disease-related biomarkers and environmental and organic hazards. They have also found widespread interest in the last years for the detection of waterborne and foodborne pathogens due to their label free character and high sensitivity. This Review is focused on the current
Energy Technology Data Exchange (ETDEWEB)
Cary,; Bruce, R [Santa Fe, NM; Stubben, Christopher J [Los Alamos, NM
2011-03-22
The invention provides highly sensitive and specific assays for the major citrus pathogens Xylella fastidiosa and Xanthomonas axonopodis, including a field deployable multiplexed assay capable of rapidly assaying for both pathogens simultaneously. The assays are directed at particular gene targets derived from pathogenic strains that specifically cause the major citrus diseases of citrus variegated chlorosis (Xylella fastidiosa 9a5c) and citrus canker (Xanthomonas axonopodis pv citri). The citrus pathogen assays of the invention offer femtomole sensitivity, excellent linear dynamic range, and rapid and specific detection.
Rapid methods: the detection of foodborne pathogens
Beumer, R.R.; Hazeleger, W.C.
2009-01-01
Although bacteria are the first type of microorganisms that come to mind when discussing microbial food safety, they are by no means the only pathogenic foodborne microorganisms. Mycotoxin producing moulds, human enteric viruses, protozoan parasites and marine biotoxins are also of importance.
Singh, Gulshan; Manohar, Murli; Adegoke, Anthony Ayodeji; Stenström, Thor Axel; Shanker, Rishi
2017-01-01
The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1-100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.
International Nuclear Information System (INIS)
Singh, Gulshan; Manohar, Murli; Adegoke, Anthony Ayodeji; Stenström, Thor Axel; Shanker, Rishi
2017-01-01
The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1–100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.
Energy Technology Data Exchange (ETDEWEB)
Singh, Gulshan, E-mail: gsingh.gulshan@gmail.com [Durban University of Technology, Institute for Water and Wastewater Technology (IWWT) (South Africa); Manohar, Murli [Jamia Hamdard (Hamdard University), Department of Biochemistry (India); Adegoke, Anthony Ayodeji; Stenström, Thor Axel [Durban University of Technology, Institute for Water and Wastewater Technology (IWWT) (South Africa); Shanker, Rishi [Ahmedabad University, Division of Biological & Life Sciences, School of Arts & Sciences (India)
2017-01-15
The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1–100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.
Vásquez, Gersson; Rey, Alba; Rivera, Camilo; Iregui, Carlos; Orozco, Jahir
2017-01-15
Pathogenic bacteria are responsible for several diseases in humans and in a variety of hosts. Detection of pathogenic bacteria is imperative to avoid and/or fight their potential harmful effects. This work reports on the first amperometric biosensor for the rapid detection of Streptococcus agalactiae (S. agalactiae). The biosensor relies on a single biotinylated antibody that immobilizes the bacteria on a screen-printed carbon electrode while is further linked to a streptavidin-conjugated HRP reporter. The biotinylated antibody provides selectivity to the biosensor whereas serves as an anchoring point to the reporter for further amplification of the electrochemical signal. The resultant immunosensor is simple, responds rapidly, and allows for the selective and highly sensitive quantification of S. agalactiae cells in a concentration range of 10 1 -10 7 CFUml -1 , with a detection limit of 10CFUml -1 . The approach not only enables a rapid detection and quantification of S. agalactiae in environmental samples but also opens up new opportunities for the simple fabrication of electrochemical immunosensors for different target pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Jeslin J L Tan
Full Text Available Tropical pathogens often cause febrile illnesses in humans and are responsible for considerable morbidity and mortality. The similarities in clinical symptoms provoked by these pathogens make diagnosis difficult. Thus, early, rapid and accurate diagnosis will be crucial in patient management and in the control of these diseases. In this study, a microfluidic lab-on-chip integrating multiplex molecular amplification and DNA microarray hybridization was developed for simultaneous detection and species differentiation of 26 globally important tropical pathogens. The analytical performance of the lab-on-chip for each pathogen ranged from 102 to 103 DNA or RNA copies. Assay performance was further verified with human whole blood spiked with Plasmodium falciparum and Chikungunya virus that yielded a range of detection from 200 to 4×105 parasites, and from 250 to 4×107 PFU respectively. This lab-on-chip was subsequently assessed and evaluated using 170 retrospective patient specimens in Singapore and Thailand. The lab-on-chip had a detection sensitivity of 83.1% and a specificity of 100% for P. falciparum; a sensitivity of 91.3% and a specificity of 99.3% for P. vivax; a positive 90.0% agreement and a specificity of 100% for Chikungunya virus; and a positive 85.0% agreement and a specificity of 100% for Dengue virus serotype 3 with reference methods conducted on the samples. Results suggested the practicality of an amplification microarray-based approach in a field setting for high-throughput detection and identification of tropical pathogens.
Portable microfluidic raman system for rapid, label-free early disease signature detection
Energy Technology Data Exchange (ETDEWEB)
Wu, Meiye [Sandia National Laboratories (SNL-CA), Livermore, CA (United States); Davis, Ryan Wesley [Sandia National Laboratories (SNL-CA), Livermore, CA (United States); Hatch, Anson [Sandia National Laboratories (SNL-CA), Livermore, CA (United States)
2015-09-01
In the early stages of infection, patients develop non-specific or no symptoms at all. While waiting for identification of the infectious agent, precious window of opportunity for early intervention is lost. The standard diagnostics require affinity reagents and sufficient pathogen titers to reach the limit of detection. In the event of a disease outbreak, triaging the at-risk population rapidly and reliably for quarantine and countermeasure is more important than the identification of the pathogen by name. To expand Sandia's portfolio of Biological threat management capabilities, we will utilize Raman spectrometry to analyze immune subsets in whole blood to rapidly distinguish infected from non-infected, and bacterial from viral infection, for the purpose of triage during an emergency outbreak. The goal of this one year LDRD is to determine whether Raman spectroscopy can provide label-free detection of early disease signatures, and define a miniaturized Raman detection system meeting requirements for low- resource settings.
Waterborne Pathogens: Detection Methods and Challenges
Directory of Open Access Journals (Sweden)
Flor Yazmín Ramírez-Castillo
2015-05-01
Full Text Available Waterborne pathogens and related diseases are a major public health concern worldwide, not only by the morbidity and mortality that they cause, but by the high cost that represents their prevention and treatment. These diseases are directly related to environmental deterioration and pollution. Despite the continued efforts to maintain water safety, waterborne outbreaks are still reported globally. Proper assessment of pathogens on water and water quality monitoring are key factors for decision-making regarding water distribution systems’ infrastructure, the choice of best water treatment and prevention waterborne outbreaks. Powerful, sensitive and reproducible diagnostic tools are developed to monitor pathogen contamination in water and be able to detect not only cultivable pathogens but also to detect the occurrence of viable but non-culturable microorganisms as well as the presence of pathogens on biofilms. Quantitative microbial risk assessment (QMRA is a helpful tool to evaluate the scenarios for pathogen contamination that involve surveillance, detection methods, analysis and decision-making. This review aims to present a research outlook on waterborne outbreaks that have occurred in recent years. This review also focuses in the main molecular techniques for detection of waterborne pathogens and the use of QMRA approach to protect public health.
Efficiency of Airborne Sample Analysis Platform (ASAP Bioaerosol Sampler for Pathogen Detection
Directory of Open Access Journals (Sweden)
Anurag eSharma
2015-05-01
Full Text Available The threat of bioterrorism and pandemics has highlighted the urgency for rapid and reliable bioaerosol detection in different environments. Safeguarding against such threats requires continuous sampling of the ambient air for pathogen detection. In this study we investigated the efficacy of the Airborne Sample Analysis Platform (ASAP 2800 bioaerosol sampler to collect representative samples of air and identify specific viruses suspended as bioaerosols. To test this concept, we aerosolized an innocuous replication-defective bovine adenovirus serotype 3 (BAdV3 in a controlled laboratory environment. The ASAP efficiently trapped the surrogate virus at 5×10E3 plaque-forming units (p.f.u. [2×10E5 genome copy equivalent] concentrations or more resulting in the successful detection of the virus using quantitative PCR. These results support the further development of ASAP for bioaerosol pathogen detection.
Palomino-Camargo, Carolina; Instituto de Ciencia y Tecnología de Alimentos, Facultad de Ciencias, Universidad Central de Venezuela. Caracas, Venezuela. Magíster en Ciencia y Tecnología de los Alimentos licenciada en Biología; González-Muñoz, Yuniesky; Instituto de Ciencia y Tecnología de Alimentos, Facultad de Ciencias, Universidad Central de Venezuela. Caracas, Venezuela. Ministerio del Poder Popular para la Alimentación. Caracas, Venezuela. licenciado en Ciencias de los Alimentos.
2014-01-01
Foodborne diseases, caused by pathogenic microorganisms, are a major public health problem worldwide. Microbiological methods commonly used in the detection of these foodborne pathogens are laborious and time consuming. This situation, coupled with the demand for immediate results and with technological advances, has led to the development of a wide range of rapid methods in recent decades. On this basis, this review describes the advantages and limitations of the main molecular methods used ...
Zuo, Peng; Li, XiuJun; Dominguez, Delfina C; Ye, Bang-Ce
2013-10-07
Infectious pathogens often cause serious public health concerns throughout the world. There is an increasing demand for simple, rapid and sensitive approaches for multiplexed pathogen detection. In this paper we have developed a polydimethylsiloxane (PDMS)/paper/glass hybrid microfluidic system integrated with aptamer-functionalized graphene oxide (GO) nano-biosensors for simple, one-step, multiplexed pathogen detection. The paper substrate used in this hybrid microfluidic system facilitated the integration of aptamer biosensors on the microfluidic biochip, and avoided complicated surface treatment and aptamer probe immobilization in a PDMS or glass-only microfluidic system. Lactobacillus acidophilus was used as a bacterium model to develop the microfluidic platform with a detection limit of 11.0 cfu mL(-1). We have also successfully extended this method to the simultaneous detection of two infectious pathogens - Staphylococcus aureus and Salmonella enterica. This method is simple and fast. The one-step 'turn on' pathogen assay in a ready-to-use microfluidic device only takes ~10 min to complete on the biochip. Furthermore, this microfluidic device has great potential in rapid detection of a wide variety of different other bacterial and viral pathogens.
Flow cytometry for rapid detection of Salmonella spp. in seed sprouts
Directory of Open Access Journals (Sweden)
Bledar Bisha
2014-12-01
Full Text Available Seed sprouts (alfalfa, mung bean, radish, etc. have been implicated in several recent national and international outbreaks of salmonellosis. Conditions used for sprouting are also conducive to the growth of Salmonella. As a result, this pathogen can quickly grow to very high cell densities during sprouting without any detectable organoleptic impact. Seed sprouts typically also support heavy growth (~108 CFU g−1 of a heterogeneous microbiota consisting of various bacterial, yeast, and mold species, often dominated by non-pathogenic members of the family Enterobacteriaceae. This heavy background may present challenges to the detection of Salmonella, especially if this pathogen is present in relatively low numbers. We combined DNA-based fluorescence in situ hybridization (FISH with flow cytometry (FCM for the rapid molecular detection of Salmonella enterica ser. Typhimurium in artificially contaminated alfalfa and other seed sprouts. Components of the assay included a set of cooperatively binding probes, a chemical blocking treatment intended to reduce non-specific background, and sample concentration via tangential flow filtration (TFF. We were able to detect S. Typhimurium in sprout wash at levels as low as 103 CFU ml−1 sprout wash (104 CFU g−1 sprouts against high microbial backgrounds (~108 CFU g−1 sprouts. Hybridization times were typically 30 min, with additional washing, but we ultimately found that S. Typhimurium could be readily detected using hybridization times as short as 2 min, without a wash step. These results clearly demonstrate the potential of combined DNA-FISH and FCM for rapid detection of Salmonella in this challenging food matrix and provide industry with a useful tool for compliance with sprout production standards proposed in the Food Safety Modernization Act (FSMA.
Sperschneider, Jana; Gardiner, Donald M.; Thatcher, Louise F.; Lyons, Rebecca; Singh, Karam B.; Manners, John M.; Taylor, Jennifer M.
2015-01-01
Pathogens and hosts are in an ongoing arms race and genes involved in host–pathogen interactions are likely to undergo diversifying selection. Fusarium plant pathogens have evolved diverse infection strategies, but how they interact with their hosts in the biotrophic infection stage remains puzzling. To address this, we analyzed the genomes of three Fusarium plant pathogens for genes that are under diversifying selection. We found a two-speed genome structure both on the chromosome and gene group level. Diversifying selection acts strongly on the dispensable chromosomes in Fusarium oxysporum f. sp. lycopersici and on distinct core chromosome regions in Fusarium graminearum, all of which have associations with virulence. Members of two gene groups evolve rapidly, namely those that encode proteins with an N-terminal [SG]-P-C-[KR]-P sequence motif and proteins that are conserved predominantly in pathogens. Specifically, 29 F. graminearum genes are rapidly evolving, in planta induced and encode secreted proteins, strongly pointing toward effector function. In summary, diversifying selection in Fusarium is strongly reflected as genomic footprints and can be used to predict a small gene set likely to be involved in host–pathogen interactions for experimental verification. PMID:25994930
Huang, Fengchun; Zhang, Huilin; Wang, Lei; Lai, Weihua; Lin, Jianhan
2018-02-15
Combining double-layer capillary based high gradient immunomagnetic separation, invertase-nanocluster based signal amplification and glucose meter based signal detection, a novel biosensor was developed for sensitive and rapid detection of E. coli O157:H7 in this study. The streptavidin modified magnetic nanobeads (MNBs) were conjugated with the biotinylated polyclonal antibodies against E. coli O157:H7 to form the immune MNBs, which were captured by the high gradient magnetic field in the double-layer capillary to specifically separate and efficiently concentrate the target bacteria. Calcium chloride was used with the monoclonal antibodies against E. coli O157:H7 and the invertase to form the immune invertase-nanoclusters (INCs), which were used to react with the target bacteria to form the MNB-bacteria-INC complexes in the capillary. The sucrose was then injected into the capillary and catalyzed by the invertase on the complexes into the glucose, which was detected using the glucose meter to obtain the concentration of the glucose for final determination of the E. coli O157:H7 cells in the sample. A linear relationship between the readout of the glucose meter and the concentration of the E. coli O157:H7 cells (from 10 2 to 10 7 CFU/mL) was found and the lower detection limit of this biosensor was 79 CFU/mL. This biosensor might be extended for the detection of other foodborne pathogens by changing the antibodies and has shown the potential for the detection of foodborne pathogens in a large volume of sample to further increase the sensitivity. Copyright © 2017 Elsevier B.V. All rights reserved.
A duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains.
Benacer, Douadi; Zain, Siti Nursheena Mohd; Lewis, John W; Khalid, Mohd Khairul Nizam Mohd; Thong, Kwai Lin
2017-01-01
This study aimed to develop a duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains. Primers were designed to target the rrs (LG1/LG2) and ligB (LP1/LP2) genes to confirm the presence of the Leptospira genus and the pathogenic species, respectively. The assay showed 100% specificity against 17 Leptospira strains with a limit of detection of 23.1pg/µl of leptospiral DNA and sensitivity of 103 leptospires/ml in both spiked urine and water. Our duplex endpoint PCR assay is suitable for rapid early detection of Leptospira with high sensitivity and specificity.
Zuo, Peng; Li, XiuJun; Dominguez, Delfina C.; Ye, Bang-Ce
2013-01-01
Infectious pathogens often cause serious public health concerns throughout the world. There is an increasing demand for simple, rapid and sensitive approaches for multiplexed pathogen detection. In this paper we have developed a polydimethylsiloxane (PDMS)/paper/glass hybrid microfluidic system integrated with aptamer-functionalized graphene oxide (GO) nano-biosensors for simple, one-step, multiplexed pathogen detection. The paper substrate used in this hybrid microfluidic system facilitated ...
Molecular detection of human bacterial pathogens
National Research Council Canada - National Science Library
Liu, Dongyou
2011-01-01
.... Molecular Detection of Human Bacterial Pathogens addresses this issue, with international scientists in respective bacterial pathogen research and diagnosis providing expert summaries on current...
Rapid colorimetric sensing platform for the detection of Listeria monocytogenes foodborne pathogen.
Alhogail, Sahar; Suaifan, Ghadeer A R Y; Zourob, Mohammed
2016-12-15
Listeria monocytogenes is a serious cause of human foodborne infections worldwide, which needs spending billions of dollars for inspection of bacterial contamination in food every year. Therefore, there is an urgent need for rapid, in-field and cost effective detection techniques. In this study, rapid, low-cost and simple colorimetric assay was developed using magnetic nanoparticles for the detection of listeria bacteria. The protease from the listeria bacteria was detected using D-amino acid substrate. D-amino acid substrate was linked to the carboxylic acid on the magnetic nanoparticles using EDC/NHS chemistry. The cysteine residue at the C-terminal of the substrate was used for the self-assembled monolayer formation on the gold sensor surface, which in turn the black magnetic nanobeads will mask the golden color. The color will change from black to golden color upon the cleavage of the specific peptide sequence by the Listeria protease. The sensor was tested with serial dilutions of Listeria bacteria. It was found that the appearance of the gold surface area is proportional to the bacterial concentrations in CFU/ml. The lowest detection limit of the developed sensor for Listeria was found to be 2.17×10(2) colony forming unit/ml (CFU/ml). The specificity of the biosensor was tested against four different foodborne associated bacteria (Escherichia coli, Salmonella, Shigella flexnerii and Staphylococcus aureus). Finally, the sensor was tested with artificially spiked whole milk and ground meat spiked with listeria. Copyright © 2016 Elsevier B.V. All rights reserved.
Advanced biosensors for detection of pathogens related to livestock and poultry.
Vidic, Jasmina; Manzano, Marisa; Chang, Chung-Ming; Jaffrezic-Renault, Nicole
2017-02-21
Infectious animal diseases caused by pathogenic microorganisms such as bacteria and viruses threaten the health and well-being of wildlife, livestock, and human populations, limit productivity and increase significantly economic losses to each sector. The pathogen detection is an important step for the diagnostics, successful treatment of animal infection diseases and control management in farms and field conditions. Current techniques employed to diagnose pathogens in livestock and poultry include classical plate-based methods and conventional biochemical methods as enzyme-linked immunosorbent assays (ELISA). These methods are time-consuming and frequently incapable to distinguish between low and highly pathogenic strains. Molecular techniques such as polymerase chain reaction (PCR) and real time PCR (RT-PCR) have also been proposed to be used to diagnose and identify relevant infectious disease in animals. However these DNA-based methodologies need isolated genetic materials and sophisticated instruments, being not suitable for in field analysis. Consequently, there is strong interest for developing new swift point-of-care biosensing systems for early detection of animal diseases with high sensitivity and specificity. In this review, we provide an overview of the innovative biosensing systems that can be applied for livestock pathogen detection. Different sensing strategies based on DNA receptors, glycan, aptamers and antibodies are presented. Besides devices still at development level some are validated according to standards of the World Organization for Animal Health and are commercially available. Especially, paper-based platforms proposed as an affordable, rapid and easy to perform sensing systems for implementation in field condition are included in this review.
Matrix approach to the simultaneous detection of multiple potato pathogens by real-time PCR.
Nikitin, M M; Statsyuk, N V; Frantsuzov, P A; Dzhavakhiya, V G; Golikov, A G
2018-03-01
Create a method for highly sensitive, selective, rapid and easy-to-use detection and identification of economically significant potato pathogens, including viruses, bacteria and oomycetes, be it single pathogen, or a range of various pathogens occurring simultaneously. Test-systems for real-time PCR, operating in the unified amplification regime, have been developed for Phytophthora infestans, Pectobacterium atrosepticum, Dickeya dianthicola, Dickeya solani, Ralstonia solanacearum, Pectobacterium carotovorum, Clavibacter michiganensis subsp. sepedonicus, potato viruses Y (ordinary and necrotic forms as well as indiscriminative test system, detecting all forms), A, X, S, M, potato leaf roll virus, potato mop top virus and potato spindle tuber viroid. The test-systems (including polymerase and revertase) were immobilized and lyophilized in miniature microreactors (1·2 μl) on silicon DNA/RNA microarrays (micromatrices) to be used with a mobile AriaDNA ® amplifier. Preloaded 30-reaction micromatrices having shelf life of 3 and 6 months (for RNA- and DNA-based pathogens, respectively) at room temperature with no special conditions were successfully tested on both reference and field samples in comparison with traditional ELISA and microbiological methods, showing perfect performance and sensitivity (1 pg). The accurate, rapid and user-friendly diagnostic system in a micromatrix format may significantly contribute to pathogen screening and phytopathological studies. © 2018 The Authors. Journal of Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.
A Spectral Mapping Signature for the Rapid Ohia Death (ROD Pathogen in Hawaiian Forests
Directory of Open Access Journals (Sweden)
Gregory P. Asner
2018-03-01
Full Text Available Pathogenic invasions are a major source of change in both agricultural and natural ecosystems. In forests, fungal pathogens can kill habitat-generating plant species such as canopy trees, but methods for remote detection, mapping and monitoring of such outbreaks are poorly developed. Two novel species of the fungal genus Ceratocystis have spread rapidly across humid and mesic forests of Hawaiʻi Island, causing widespread mortality of the keystone endemic canopy tree species, Metrosideros polymorpha (common name: ʻōhiʻa. The process, known as Rapid Ohia Death (ROD, causes browning of canopy leaves in weeks to months following infection by the pathogen. An operational mapping approach is needed to track the spread of the disease. We combined field studies of leaf spectroscopy with laboratory chemical studies and airborne remote sensing to develop a spectral signature for ROD. We found that close to 80% of ROD-infected plants undergo marked decreases in foliar concentrations of chlorophyll, water and non-structural carbohydrates, which collectively result in strong consistent changes in leaf spectral reflectance in the visible (400–700 nm and shortwave-infrared (1300–2500 nm wavelength regions. Leaf-level results were replicated at the canopy level using airborne laser-guided imaging spectroscopy, with quantitative spectral separability of normal green-leaf canopies from suspected ROD-infected brown-leaf canopies in the visible and shortwave-infrared spectrum. Our results provide the spectral–chemical basis for detection, mapping and monitoring of the spread of ROD in native Hawaiian forests.
Koedrith, Preeyaporn; Thasiphu, Thalisa; Weon, Jong-Il; Boonprasert, Rattana; Tuitemwong, Kooranee; Tuitemwong, Pravate
2015-01-01
Of global concern, environmental pollution adversely affects human health and socioeconomic development. The presence of environmental contaminants, especially bacterial, viral, and parasitic pathogens and their toxins as well as chemical substances, poses serious public health concerns. Nanoparticle-based biosensors are considered as potential tools for rapid, specific, and highly sensitive detection of the analyte of interest (both biotic and abiotic contaminants). In particular, there are several limitations of conventional detection methods for water-borne pathogens due to low concentrations and interference with various enzymatic inhibitors in the environmental samples. The increase of cells to detection levels requires long incubation time. This review describes current state of biosensor nanotechnology, the advantage over conventional detection methods, and the challenges due to testing of environmental samples. The major approach is to use nanoparticles as signal reporter to increase output rather than spending time to increase cell concentrations. Trends in future development of novel detection devices and their advantages over other environmental monitoring methodologies are also discussed. PMID:25884032
Rapid Molecular detection of citrus brown spot disease using ACT gene in Alternaria alternata
Directory of Open Access Journals (Sweden)
Hamid Moghimi
2017-06-01
Full Text Available Introduction:Using rapid detection methods is important for detection of plant pathogens and also prevention through spreading pests in agriculture. Citrus brown spot disease caused by pathogenic isolates of Alternaria alternata is a common disease in Iran. Materials and methods: In this study, for the first time a PCR based molecular method was used for rapid diagnosis of brown spot disease. Nine isolates of A. Alternata were isolated in PDA medium from different citrus gardens. The plant pathogenic activity was examined in tangerine leaves for isolates. Results showed that these isolates are the agents of brown spot disease. PCR amplification of specific ACT-toxin gene was performed for DNA extracted from A. alternata isolates, with 11 different fungal isolates as negative controls and 5 DNA samples extracted from soil. Results: Results showed that A. alternata, the causal agent of brown spot disease, can be carefully distinguished from other pathogenic agents by performing PCR amplification with specific primers for ACT toxin gene. Also, the results from Nested-PCR method confirmed the primary reaction and the specificity of A. alternata for brown spot disease. PCR results to control samples of the other standard fungal isolates, showed no amplification band. In addition, PCR with the DNA extracted from contaminated soils confirmed the presence of ACT toxin gene. Discussion and conclusion: Molecular procedure presented here can be used in rapid identification and prevention of brown spot infection in citrus gardens all over the country.
Jiang, Lu Xi; Ren, Hong Yu; Zhou, Hai Jian; Zhao, Si Hong; Hou, Bo Yan; Yan, Jian Ping; Qin, Tian; Chen, Yu
2017-08-01
Lower respiratory tract infections continue to pose a significant threat to human health. It is important to accurately and rapidly detect respiratory bacteria. To compensate for the limits of current respiratory bacteria detection methods, we developed a combination of multiplex polymerase chain reaction (PCR) and capillary electrophoresis (MPCE) assay to detect thirteen bacterial pathogens responsible for lower respiratory tract infections, including Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Mycoplasma pneumoniae, Legionella spp., Bordetella pertussis, Mycobacterium tuberculosis complex, Corynebacterium diphtheriae, and Streptococcus pyogenes. Three multiplex PCR reactions were built, and the products were analyzed by capillary electrophoresis using the high-throughput DNA analyzer. The specificity of the MPCE assay was examined and the detection limit was evaluated using DNA samples from each bacterial strain and the simulative samples of each strain. This assay was further evaluated using 152 clinical specimens and compared with real-time PCR reactions. For this assay, three nested-multiplex-PCRs were used to detect these clinical specimens. The detection limits of the MPCE assay for the 13 pathogens were very low and ranged from 10-7 to 10-2 ng/μL. Furthermore, analysis of the 152 clinical specimens yielded a specificity ranging from 96.5%-100.0%, and a sensitivity of 100.0% for the 13 pathogens. This study revealed that the MPCE assay is a rapid, reliable, and high-throughput method with high specificity and sensitivity. This assay has great potential in the molecular epidemiological survey of respiratory pathogens. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
Rapid and high-throughput detection of highly pathogenic bacteria by Ibis PLEX-ID technology.
Directory of Open Access Journals (Sweden)
Daniela Jacob
Full Text Available In this manuscript, we describe the identification of highly pathogenic bacteria using an assay coupling biothreat group-specific PCR with electrospray ionization mass spectrometry (PCR/ESI-MS run on an Ibis PLEX-ID high-throughput platform. The biothreat cluster assay identifies most of the potential bioterrorism-relevant microorganisms including Bacillus anthracis, Francisella tularensis, Yersinia pestis, Burkholderia mallei and pseudomallei, Brucella species, and Coxiella burnetii. DNA from 45 different reference materials with different formulations and different concentrations were chosen and sent to a service screening laboratory that uses the PCR/ESI-MS platform to provide a microbial identification service. The standard reference materials were produced out of a repository built up in the framework of the EU funded project "Establishment of Quality Assurances for Detection of Highly Pathogenic Bacteria of Potential Bioterrorism Risk" (EQADeBa. All samples were correctly identified at least to the genus level.
Du, Xin-Jun; Zhou, Tian-Jiao; Li, Ping; Wang, Shuo
2017-08-01
Salmonella is a major foodborne pathogen that is widespread in the environment and can cause serious human and animal disease. Since conventional culture methods to detect Salmonella are time-consuming and laborious, rapid and accurate techniques to detect this pathogen are critically important for food safety and diagnosing foodborne illness. In this study, we developed a rapid, simple and portable Salmonella detection strategy that combines thermophilic helicase-dependent amplification (tHDA) with a lateral flow assay to provide a detection result based on visual signals within 90 min. Performance analyses indicated that the method had detection limits for DNA and pure cultured bacteria of 73.4-80.7 fg and 35-40 CFU, respectively. Specificity analyses showed no cross reactions with Escherichia coli, Staphylococcus aureus, Listeria monocytogenes, Enterobacter aerogenes, Shigella and Campylobacter jejuni. The results for detection in real food samples showed that 1.3-1.9 CFU/g or 1.3-1.9 CFU/mL of Salmonella in contaminated chicken products and infant nutritional cereal could be detected after 2 h of enrichment. The same amount of Salmonella in contaminated milk could be detected after 4 h of enrichment. This tHDA-strip can be used for the rapid detection of Salmonella in food samples and is particularly suitable for use in areas with limited equipment. Copyright © 2017 Elsevier Ltd. All rights reserved.
Genome-Enhanced Detection and Identification (GEDI of plant pathogens
Directory of Open Access Journals (Sweden)
Nicolas Feau
2018-02-01
Full Text Available Plant diseases caused by fungi and Oomycetes represent worldwide threats to crops and forest ecosystems. Effective prevention and appropriate management of emerging diseases rely on rapid detection and identification of the causal pathogens. The increase in genomic resources makes it possible to generate novel genome-enhanced DNA detection assays that can exploit whole genomes to discover candidate genes for pathogen detection. A pipeline was developed to identify genome regions that discriminate taxa or groups of taxa and can be converted into PCR assays. The modular pipeline is comprised of four components: (1 selection and genome sequencing of phylogenetically related taxa, (2 identification of clusters of orthologous genes, (3 elimination of false positives by filtering, and (4 assay design. This pipeline was applied to some of the most important plant pathogens across three broad taxonomic groups: Phytophthoras (Stramenopiles, Oomycota, Dothideomycetes (Fungi, Ascomycota and Pucciniales (Fungi, Basidiomycota. Comparison of 73 fungal and Oomycete genomes led the discovery of 5,939 gene clusters that were unique to the targeted taxa and an additional 535 that were common at higher taxonomic levels. Approximately 28% of the 299 tested were converted into qPCR assays that met our set of specificity criteria. This work demonstrates that a genome-wide approach can efficiently identify multiple taxon-specific genome regions that can be converted into highly specific PCR assays. The possibility to easily obtain multiple alternative regions to design highly specific qPCR assays should be of great help in tackling challenging cases for which higher taxon-resolution is needed.
Energy Technology Data Exchange (ETDEWEB)
Chung, Myung; Dong, Li; Fu, Rong; Liotta, Lance; Narayanan, Aarthi; Petricoin, Emanuel; Ross, Mark; Russo, Paul; Zhou, Weidong; Luchini, Alessandra; Manes, Nathan; Chertow, Jessica; Han, Suhua; Kidd, Jessica; Senina, Svetlana; Groves, Stephanie
2007-01-01
Basic technologies have been successfully developed within this project: rapid collection of aerosols and a rapid ultra-sensitive immunoassay technique. Water-soluble, humidity-resistant polyacrylamide nano-filters were shown to (1) capture aerosol particles as small as 20 nm, (2) work in humid air and (3) completely liberate their captured particles in an aqueous solution compatible with the immunoassay technique. The immunoassay technology developed within this project combines electrophoretic capture with magnetic bead detection. It allows detection of as few as 150-600 analyte molecules or viruses in only three minutes, something no other known method can duplicate. The technology can be used in a variety of applications where speed of analysis and/or extremely low detection limits are of great importance: in rapid analysis of donor blood for hepatitis, HIV and other blood-borne infections in emergency blood transfusions, in trace analysis of pollutants, or in search of biomarkers in biological fluids. Combined in a single device, the water-soluble filter and ultra-sensitive immunoassay technique may solve the problem of early warning type detection of aerosolized pathogens. These two technologies are protected with five patent applications and are ready for commercialization.
Fluorescent Silica Nanoparticles in the Detection and Control of the Growth of Pathogen
International Nuclear Information System (INIS)
Chitra, K.; Annadurai, G.
2013-01-01
In this present study the bio conjugated fluorescent silica nanoparticles give an efficient fluorescent-based immunoassay for the detection of pathogen. The synthesized silica nanoparticles were poly dispersed and the size of the silica nanoparticles was in the range of 114-164 nm. The energy dispersive X-ray spectrophotometer showed the presence of silica at 1.8 keV and the selected area diffractometer showed amorphous nature of silica nanoparticles. The FTIR spectrum confirmed the attachment of dye and carboxyl group onto the silica nanoparticles surface. The fluorescent silica nanoparticles showed highly efficient fluorescence and the fluorescent emission of silica nanoparticles occurred at 536 nm. The SEM image showed the aggregation of nanoparticles and bacteria. The growth of the pathogenic E. coli was controlled using silica nanoparticles; therefore silica nanoparticles could be used in food packaging material, biomedical material, and so forth. This work provides a rapid, simple, and accurate method for the detection of pathogen using fluorescent-based immunoassay.
New Trends in Impedimetric Biosensors for the Detection of Foodborne Pathogenic Bacteria
Wang, Yixian; Ye, Zunzhong; Ying, Yibin
2012-01-01
The development of a rapid, sensitive, specific method for the foodborne pathogenic bacteria detection is of great importance to ensure food safety and security. In recent years impedimetric biosensors which integrate biological recognition technology and impedance have gained widespread application in the field of bacteria detection. This paper presents an overview on the progress and application of impedimetric biosensors for detection of foodborne pathogenic bacteria, particularly the new trends in the past few years, including the new specific bio-recognition elements such as bacteriophage and lectin, the use of nanomaterials and microfluidics techniques. The applications of these new materials or techniques have provided unprecedented opportunities for the development of high-performance impedance bacteria biosensors. The significant developments of impedimetric biosensors for bacteria detection in the last five years have been reviewed according to the classification of with or without specific bio-recognition element. In addition, some microfluidics systems, which were used in the construction of impedimetric biosensors to improve analytical performance, are introduced in this review. PMID:22737018
Rapid and robust detection methods for poison and microbial contamination.
Hoehl, Melanie M; Lu, Peter J; Sims, Peter A; Slocum, Alexander H
2012-06-27
Real-time on-site monitoring of analytes is currently in high demand for food contamination, water, medicines, and ingestible household products that were never tested appropriately. Here we introduce chemical methods for the rapid quantification of a wide range of chemical and microbial contaminations using a simple instrument. Within the testing procedure, we used a multichannel, multisample, UV-vis spectrophotometer/fluorometer that employs two frequencies of light simultaneously to interrogate the sample. We present new enzyme- and dye-based methods to detect (di)ethylene glycol in consumables above 0.1 wt % without interference and alcohols above 1 ppb. Using DNA intercalating dyes, we can detect a range of pathogens ( E. coli , Salmonella , V. Cholera, and a model for Malaria) in water, foods, and blood without background signal. We achieved universal scaling independent of pathogen size above 10(4) CFU/mL by taking advantage of the simultaneous measurement at multiple wavelengths. We can detect contaminants directly, without separation, purification, concentration, or incubation. Our chemistry is stable to ± 1% for >3 weeks without refrigeration, and measurements require <5 min.
Cao, Jing; Feng, Chao; Liu, Yan; Wang, Shouyu; Liu, Fei
2014-07-15
Since many diseases are caused by pathogenic bacterial infections, accurate and rapid detection of pathogenic bacteria is in urgent need to timely apply appropriate treatments and to reduce economic costs. To end this, we designed molecular beacon-Au nanoparticle hybrid nanoprobes to improve the bacterial detection efficiency and sensitivity. Here, we show that the designed molecular beacon modified Au nanoparticles could specifically recognize synthetic DNAs targets and can readily detect targets in clinical samples. Moreover, the hybrid nanoprobes can recognize Escherichia coli within an hour at a concentration of 10(2) cfu/ml, which is 1000-folds sensitive than using molecular beacon directly. Our results show that the molecular beacon-Au nanoparticle hybrid nanoprobes have great potential in medical and biological applications. Copyright © 2014 Elsevier B.V. All rights reserved.
Abeyrathne, Chathurika D; Huynh, Duc H; Mcintire, Thomas W; Nguyen, Thanh C; Nasr, Babak; Zantomio, Daniela; Chana, Gursharan; Abbott, Iain; Choong, Peter; Catton, Mike; Skafidas, Efstratios
2016-03-21
The Gram-positive bacterium, Staphylococcus aureus (S. aureus), is a major pathogen responsible for a variety of infectious diseases ranging from cellulitis to more serious conditions such as septic arthritis and septicaemia. Timely treatment with appropriate antibiotic therapy is essential to ensure clinical defervescence and to prevent further complications such as infective endocarditis or organ impairment due to septic shock. To date, initial antibiotic choice is empirical, using a "best guess" of likely organism and sensitivity- an approach adopted due to the lack of rapid identification methods for bacteria. Current culture based methods take up to 5 days to identify the causative bacterial pathogen and its antibiotic sensitivity. This paper provides proof of concept for a biosensor, based on interdigitated electrodes, to detect the presence of S. aureus and ascertain its sensitivity to flucloxacillin rapidly (within 2 hours) in a cost effective manner. The proposed method is label-free and uses non-faradic measurements. This is the first study to successfully employ interdigitated electrodes for the rapid detection of antibiotic resistance. The method described has important potential outcomes of faster definitive antibiotic treatment and more rapid clinical response to treatment.
Directory of Open Access Journals (Sweden)
Xiefeng Yao
2016-08-01
Full Text Available Didymella bryoniae is a pathogenic fungus that causes gummy stem blight (GSB in Cucurbitaceae crops (e.g. cantaloupe, muskmelon, cucumber, and watermelon. GSB produces lesions on the stems and leaves, and can also be spread by seeds. Here, we developed a rapid, visual, and sensitive loop-mediated amplification (LAMP assay for D. bryoniae detection based on sequence-characterized amplified regions (GenBank accession nos GQ872461 and GQ872462 common to the two random amplification of polymorphic DNA group genotypes (RGI and RGII of D. bryoniae; ideal conditions for detection were optimized for completion in 45 min at 63°C. The sensitivity and specificity of the LAMP assay were further analyzed in comparison with those of a conventional polymerase chain reaction (PCR. The sensitivity of the LAMP assay was 1000-fold higher than that of conventional PCR with a detection limit of 0.1 fg μL−1 of targeted DNA. The LAMP assay could be accomplished in about 45 min, with the results visible to the naked eye. The assay showed high specificity in discriminating all D. bryoniae isolates from seven other fungal pathogens that occur in Cucurbitaceae crops. The LAMP assay also detected D. bryoniae infection in young muskmelon leaves with suspected early symptoms of GSB disease. Hence, the technique has great potential for developing rapid and sensitive visual detection methods for the D. bryoniae pathogen in crops and seeds. This method has potential application in early prediction of disease and reducing the risk of epidemics.
Charlermroj, Ratthaphol; Himananto, Orawan; Seepiban, Channarong; Kumpoosiri, Mallika; Warin, Nuchnard; Gajanandana, Oraprapai; Elliott, Christopher T; Karoonuthaisiri, Nitsara
2014-07-15
The global seed market is considered to be an important industry with a total value of $10,543 million US dollars in 2012. Because plant pathogens such as bacteria and viruses cause a significant economic loss to both producers and exporters, the seed export industry urgently requires rapid, sensitive, and inexpensive testing for the pathogens to prevent disease spreading worldwide. This study developed an antibody array in a multiwell plate format to simultaneously detect four crucial plant pathogens, namely, a bacterial fruit blotch bacterium Acidovorax avenae subsp. citrulli (Aac), Chilli veinal mottle virus (ChiVMV, potyvirus), Watermelon silver mottle virus (WSMoV, tospovirus serogroup IV), and Melon yellow spot virus (MYSV, tospovirus). The capture antibodies specific to the pathogens were immobilized on each well at preassigned positions by an automatic microarrayer. The antibodies on the arrays specifically captured the corresponding pathogens present in the sample extracts. The presence of pathogens bound on the capture antibodies was subsequently detected by a cocktail of fluorescently conjugated secondary antibodies. The limits of detection of the developed antibody array for the detection of Aac, ChiVMV, WSMoV, and MYSV were 5 × 10(5) CFU/mL, 30 ng/mL, 1000 ng/mL, and 160 ng/mL, respectively, which were very similar to those of the conventional ELISA method. The antibody array in a multiwell plate format accurately detected plant pathogens in single and multiple detections. Moreover, this format enables easy handling of the assay at a higher speed of operation.
Cartwright, Mark; Rottman, Martin; Shapiro, Nathan I; Seiler, Benjamin; Lombardo, Patrick; Gamini, Nazita; Tomolonis, Julie; Watters, Alexander L; Waterhouse, Anna; Leslie, Dan; Bolgen, Dana; Graveline, Amanda; Kang, Joo H; Didar, Tohid; Dimitrakakis, Nikolaos; Cartwright, David; Super, Michael; Ingber, Donald E
2016-07-01
Blood cultures, and molecular diagnostic tests that directly detect pathogen DNA in blood, fail to detect bloodstream infections in most infected patients. Thus, there is a need for a rapid test that can diagnose the presence of infection to triage patients, guide therapy, and decrease the incidence of sepsis. An Enzyme-Linked Lectin-Sorbent Assay (ELLecSA) that uses magnetic microbeads coated with an engineered version of the human opsonin, Mannose Binding Lectin, containing the Fc immunoglobulin domain linked to its carbohydrate recognition domain (FcMBL) was developed to quantify pathogen-associated molecular patterns (PAMPs) in whole blood. This assay was tested in rats and pigs to explore whether it can detect infections and monitor disease progression, and in prospectively enrolled, emergency room patients with suspected sepsis. These results were also compared with data obtained from non-infected patients with or without traumatic injuries. The FcMBL ELLecSA was able to detect PAMPS present on, or released by, 85% of clinical isolates representing 47 of 55 different pathogen species, including the most common causes of sepsis. The PAMP assay rapidly (animals, even when blood cultures were negative and bacteriocidal antibiotics were administered. In patients with suspected sepsis, the FcMBL ELLecSA detected infection in 55 of 67 patients with high sensitivity (>81%), specificity (>89%), and diagnostic accuracy of 0·87. It also distinguished infection from trauma-related inflammation in the same patient cohorts with a higher specificity than the clinical sepsis biomarker, C-reactive Protein. The FcMBL ELLecSA-based PAMP assay offers a rapid, simple, sensitive and specific method for diagnosing infections, even when blood cultures are negative and antibiotic therapy has been initiated. It may help to triage patients with suspected systemic infections, and serve as a companion diagnostic to guide administration of emerging dialysis-like sepsis therapies
Molecular detection of pathogens in water--the pros and cons of molecular techniques.
Girones, Rosina; Ferrús, Maria Antonia; Alonso, José Luis; Rodriguez-Manzano, Jesus; Calgua, Byron; Corrêa, Adriana de Abreu; Hundesa, Ayalkibet; Carratala, Anna; Bofill-Mas, Sílvia
2010-08-01
Pollution of water by sewage and run-off from farms produces a serious public health problem in many countries. Viruses, along with bacteria and protozoa in the intestine or in urine are shed and transported through the sewer system. Even in highly industrialized countries, pathogens, including viruses, are prevalent throughout the environment. Molecular methods are used to monitor viral, bacterial, and protozoan pathogens, and to track pathogen- and source-specific markers in the environment. Molecular techniques, specifically polymerase chain reaction-based methods, provide sensitive, rapid, and quantitative analytical tools with which to study such pathogens, including new or emerging strains. These techniques are used to evaluate the microbiological quality of food and water, and to assess the efficiency of virus removal in drinking and wastewater treatment plants. The range of methods available for the application of molecular techniques has increased, and the costs involved have fallen. These developments have allowed the potential standardization and automation of certain techniques. In some cases they facilitate the identification, genotyping, enumeration, viability assessment, and source-tracking of human and animal contamination. Additionally, recent improvements in detection technologies have allowed the simultaneous detection of multiple targets in a single assay. However, the molecular techniques available today and those under development require further refinement in order to be standardized and applicable to a diversity of matrices. Water disinfection treatments may have an effect on the viability of pathogens and the numbers obtained by molecular techniques may overestimate the quantification of infectious microorganisms. The pros and cons of molecular techniques for the detection and quantification of pathogens in water are discussed. (c) 2010 Elsevier Ltd. All rights reserved.
Campuzano, Susana; Yáñez-Sedeño, Paloma; Pingarrón, José Manuel
2017-11-03
Rapid and reliable diagnosis of infectious diseases caused by pathogens, and timely initiation of appropriate treatment are critical determinants to promote optimal clinical outcomes and general public health. Conventional in vitro diagnostics for infectious diseases are time-consuming and require centralized laboratories, experienced personnel and bulky equipment. Recent advances in electrochemical affinity biosensors have demonstrated to surpass conventional standards in regards to time, simplicity, accuracy and cost in this field. The tremendous potential offered by electrochemical affinity biosensors to detect on-site infectious pathogens at clinically relevant levels in scarcely treated body fluids is clearly stated in this review. The development and application of selected examples using different specific receptors, assay formats and electrochemical approaches focusing on the determination of specific circulating biomarkers of different molecular (genetic, regulatory and functional) levels associated with bacterial and viral pathogens are critically discussed. Existing challenges still to be addressed and future directions in this rapidly advancing and highly interesting field are also briefly pointed out.
Development of a nested-PCR assay for the rapid detection of Pilidiella granati in pomegranate fruit
Yang, Xue; Hameed, Uzma; Zhang, Ai-Fang; Zang, Hao-Yu; Gu, Chun-Yan; Chen, Yu; Xu, Yi-Liu
2017-01-01
Pilidiella granati, a causal agent of twig blight and crown rot of pomegranate, is an emerging threat that may cause severe risk to the pomegranate industry in the future. Development of a rapid assay for the timely and accurate detection of P. granati will be helpful in the active surveillance and management of the disease caused by this pathogen. In this study, a nested PCR method was established for the detection of P. granati. Comparative analysis of genetic diversity within 5.8S rDNA internal transcribed spacer (ITS) sequences of P. granati and 21 other selected fungal species was performed to design species-specific primers (S1 and S2). This primer pair successfully amplified a 450 bp product exclusively from the genomic DNA of P. granati. The developed method can detect 10 pg genomic DNA of the pathogen in about 6 h. This technique was successfully applied to detect the natural infection of P. granati in the pomegranate fruit. The designed protocol is rapid and precise with a high degree of sensitivity. PMID:28106107
Kawai, Kazuhiro; Inada, Mika; Ito, Keiko; Hashimoto, Koji; Nikaido, Masaru; Hata, Eiji; Katsuda, Ken; Kiku, Yoshio; Tagawa, Yuichi; Hayashi, Tomohito
2017-12-22
Bovine mastitis causes significant economic losses in the dairy industry. Effective prevention of bovine mastitis requires an understanding of the infection status of a pathogenic microorganism in a herd that has not yet shown clinical signs of mastitis and appropriate treatment specific for the pathogenic microorganism. However, bacterial identification by culture has drawbacks in that the sensitivity may be low and the procedure can be complex. In this study, we developed a genetic detection method to identify mastitis pathogens using a simple and highly sensitive electrochemical DNA chip which can specifically detect bacterial DNA in milk specimens. First, we selected microorganisms belonging to 12 families and/or genera associated with mastitis for which testing should be performed. Next, we optimized the conditions for amplifying microorganism DNA by loop-mediated isothermal amplification (LAMP) using 32 primers and the use of a DNA chip capable of measuring all pathogens simultaneously. Sample detection could be completed in just a few hours using this method. Comparison of the results obtained with our DNA chip method and those obtained by bacterial culture verified that when the culture method was set to 100%, the total positive concordance rate of the DNA chip was 85.0% and the total negative concordance rate was 86.9%. Furthermore, the proposed method allows both rapid and highly sensitive detection of mastitis pathogens. We believe that this method will contribute to the development of an effective mastitis control program.
DEFF Research Database (Denmark)
Lievens, B.; Frans, I.; Heusdens, C.
2011-01-01
for the simultaneous detection and identification of all cyprinid herpesviruses (CyHV‐1, CyHV‐2 and CyHV‐3) and some of the most important fish pathogenic Flavobacterium species, including F. branchiophilum, F. columnare and F. psychrophilum. For virus identification, the DNA polymerase and helicase genes were...
Human pathogens in plant biofilms: Formation, physiology, and detection.
Ximenes, Eduardo; Hoagland, Lori; Ku, Seockmo; Li, Xuan; Ladisch, Michael
2017-07-01
Fresh produce, viewed as an essential part of a healthy life style is usually consumed in the form of raw or minimally processed fruits and vegetables, and is a potentially important source of food-borne human pathogenic bacteria and viruses. These are passed on to the consumer since the bacteria can form biofilms or otherwise populate plant tissues, thereby using plants as vectors to infect animal hosts. The life cycle of the bacteria in plants differs from those in animals or humans and results in altered physiochemical and biological properties (e.g., physiology, immunity, native microflora, physical barriers, mobility, and temperature). Mechanisms by which healthy plants may become contaminated by microorganisms, develop biofilms, and then pass on their pathogenic burden to people are explored in the context of hollow fiber microfiltration by which plant-derived microorganisms may be recovered and rapidly concentrated to facilitate study of their properties. Enzymes, when added to macerated plant tissues, hydrolyze or alter macromolecules that would otherwise foul hollow-fiber microfiltration membranes. Hence, microfiltration may be used to quickly increase the concentration of microorganisms to detectable levels. This review discusses microbial colonization of vegetables, formation and properties of biofilms, and how hollow fiber microfiltration may be used to concentrate microbial targets to detectable levels. The use of added enzymes helps to disintegrate biofilms and minimize hollow fiber membrane fouling, thereby providing a new tool for more time effectively elucidating mechanisms by which biofilms develop and plant tissue becomes contaminated with human pathogens. Biotechnol. Bioeng. 2017;114: 1403-1418. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Rapid deployment intrusion detection system
International Nuclear Information System (INIS)
Graham, R.H.
1997-01-01
A rapidly deployable security system is one that provides intrusion detection, assessment, communications, and annunciation capabilities; is easy to install and configure; can be rapidly deployed, and is reusable. A rapidly deployable intrusion detection system (RADIDS) has many potential applications within the DOE Complex: back-up protection for failed zones in a perimeter intrusion detection and assessment system, intrusion detection and assessment capabilities in temporary locations, protection of assets during Complex reconfiguration, and protection in hazardous locations, protection of assets during Complex reconfiguration, and protection in hazardous locations. Many DOE user-need documents have indicated an interest in a rapidly deployable intrusion detection system. The purpose of the RADIDS project is to design, develop, and implement such a system. 2 figs
Directory of Open Access Journals (Sweden)
Hadi Ravan
2017-09-01
Discussion and conclusion: As a result of a high sensitivity and specificity of the method as well as its low cost per assay, it could be concluded that the present LAMP assay is a powerful, accurate, and efficient method for detecting pathogenic serovar Salmonella typhimurium in food-processing industries and diagnostic laboratories.
Nurul Najian, A B; Engku Nur Syafirah, E A R; Ismail, Nabilah; Mohamed, Maizan; Yean, Chan Yean
2016-01-15
In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10(-1) genomic equivalent ml(-1). An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. Copyright © 2015 Elsevier B.V. All rights reserved.
Cartwright, Mark; Rottman, Martin; Shapiro, Nathan I.; Seiler, Benjamin; Lombardo, Patrick; Gamini, Nazita; Tomolonis, Julie; Watters, Alexander L.; Waterhouse, Anna; Leslie, Dan; Bolgen, Dana; Graveline, Amanda; Kang, Joo H.; Didar, Tohid; Dimitrakakis, Nikolaos
2016-01-01
Background: Blood cultures, and molecular diagnostic tests that directly detect pathogen DNA in blood, fail to detect bloodstream infections in most infected patients. Thus, there is a need for a rapid test that can diagnose the presence of infection to triage patients, guide therapy, and decrease the incidence of sepsis. Methods: An Enzyme-Linked Lectin-Sorbent Assay (ELLecSA) that uses magnetic microbeads coated with an engineered version of the human opsonin, Mannose Binding Lectin, contai...
International Nuclear Information System (INIS)
Nurul Najian, A.B.; Engku Nur Syafirah, E.A.R.; Ismail, Nabilah; Mohamed, Maizan; Yean, Chan Yean
2016-01-01
In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10 −1 genomic equivalent ml −1 . An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. - Highlights: • We develop multiplex LAMP label-based lateral flow dipstick biosensor for detection of pathogenic Leptospira. • We design primers for multiplex LAMP targeting the conserved LipL32 gene of pathogenic Leptospira and LAMP internal
Energy Technology Data Exchange (ETDEWEB)
Nurul Najian, A.B.; Engku Nur Syafirah, E.A.R.; Ismail, Nabilah [Department of Medical Microbiology & Parasitology, School of Medical Sciences, Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia); Mohamed, Maizan [Faculty of Veterinary Medicine, Universiti Malaysia Kelantan, City Campus, Pengkalan Chepa, Locked Bag 36, 16100 Kota Bharu, Kelantan (Malaysia); Yean, Chan Yean, E-mail: yeancyn@yahoo.com [Department of Medical Microbiology & Parasitology, School of Medical Sciences, Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia); Institute for Research in Molecular Medicine (INFORMM), Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia)
2016-01-15
In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10{sup −1} genomic equivalent ml{sup −1}. An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. - Highlights: • We develop multiplex LAMP label-based lateral flow dipstick biosensor for detection of pathogenic Leptospira. • We design primers for multiplex LAMP targeting the conserved LipL32 gene of pathogenic Leptospira and LAMP
Digital PCR for detection of citrus pathogens
Citrus trees are often infected with multiple pathogens of economic importance, especially those with insect or mite vectors. Real-time/quantitative PCR (qPCR) has been used for high-throughput detection and relative quantification of pathogens; however, target reference or standards are required. I...
Directory of Open Access Journals (Sweden)
Jeffrey W Koehler
Full Text Available A detailed understanding of the circulating pathogens in a particular geographic location aids in effectively utilizing targeted, rapid diagnostic assays, thus allowing for appropriate therapeutic and containment procedures. This is especially important in regions prevalent for highly pathogenic viruses co-circulating with other endemic pathogens such as the malaria parasite. The importance of biosurveillance is highlighted by the ongoing Ebola virus disease outbreak in West Africa. For example, a more comprehensive assessment of the regional pathogens could have identified the risk of a filovirus disease outbreak earlier and led to an improved diagnostic and response capacity in the region. In this context, being able to rapidly screen a single sample for multiple pathogens in a single tube reaction could improve both diagnostics as well as pathogen surveillance. Here, probes were designed to capture identifying filovirus sequence for the ebolaviruses Sudan, Ebola, Reston, Taï Forest, and Bundibugyo and the Marburg virus variants Musoke, Ci67, and Angola. These probes were combined into a single probe panel, and the captured filovirus sequence was successfully identified using the MiSeq next-generation sequencing platform. This panel was then used to identify the specific filovirus from nonhuman primates experimentally infected with Ebola virus as well as Bundibugyo virus in human sera samples from the Democratic Republic of the Congo, thus demonstrating the utility for pathogen detection using clinical samples. While not as sensitive and rapid as real-time PCR, this panel, along with incorporating additional sequence capture probe panels, could be used for broad pathogen screening and biosurveillance.
Ahmad, Faheem; Babalola, Olubukola O; Tak, Hamid I
2012-09-01
Plant diseases caused by plant pathogens substantially reduce crop production every year, resulting in massive economic losses throughout the world. Accurate detection and identification of plant pathogens is fundamental to plant pathogen diagnostics and, thus, plant disease management. Diagnostics and disease-management strategies require techniques to enable simultaneous detection and quantification of a wide range of pathogenic and non-pathogenic microorganisms. Over the past decade, rapid development of matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) techniques for characterization of microorganisms has enabled substantially improved detection and identification of microorganisms. In the biological sciences, MALDI-TOF MS is used to analyze specific peptides or proteins directly desorbed from intact bacteria, fungal spores, nematodes, and other microorganisms. The ability to record biomarker ions, in a broad m/z range, which are unique to and representative of individual microorganisms, forms the basis of taxonomic identification of microorganisms by MALDI-TOF MS. Recent advances in mass spectrometry have initiated new research, i.e. analysis of more complex microbial communities. Such studies are just beginning but have great potential for elucidation not only of the interactions between microorganisms and their host plants but also those among different microbial taxa living in association with plants. There has been a recent effort by the mass spectrometry community to make data from large scale mass spectrometry experiments publicly available in the form of a centralized repository. Such a resource could enable the use of MALDI-TOF MS as a universal technique for detection of plant pathogens and non-pathogens. The effects of experimental conditions are sufficiently understood, reproducible spectra can be obtained from computational database search, and microorganisms can be rapidly characterized by genus, species
Rapid single cell detection of Staphylococcus aureus by aptamer-conjugated gold nanoparticles.
Chang, Yi-Chung; Yang, Chia-Ying; Sun, Ruei-Lin; Cheng, Yi-Feng; Kao, Wei-Chen; Yang, Pan-Chyr
2013-01-01
Staphylococcus aureus is one of the most important human pathogens, causing more than 500,000 infections in the United States each year. Traditional methods for bacterial culture and identification take several days, wasting precious time for patients who are suffering severe bacterial infections. Numerous nucleic acid-based detection methods have been introduced to address this deficiency; however, the costs and requirement for expensive equipment may limit the widespread use of such technologies. Thus, there is an unmet demand of new platform technology to improve the bacterial detection and identification in clinical practice. In this study, we developed a rapid, ultra-sensitive, low cost, and non-polymerase chain reaction (PCR)-based method for bacterial identification. Using this method, which measures the resonance light-scattering signal of aptamer-conjugated gold nanoparticles, we successfully detected single S. aureus cell within 1.5 hours. This new platform technology may have potential to develop a rapid and sensitive bacterial testing at point-of-care.
Directory of Open Access Journals (Sweden)
Jin Gui
2011-01-01
Full Text Available Yersinia enterocolitica is an important zoonotic pathogen that can cause yersiniosis in humans and animals. Food has been suggested to be the main source of yersiniosis. It is critical for the researchers to be able to detect Yersinia or any other foodborne pathogen with increased sensitivity and specificity, as well as in real-time, in the case of a foodborne disease outbreak. Conventional detection methods are known to be labor intensive, time consuming, or expensive. On the other hand, more sensitive molecular-based detection methods like next generation sequencing, microarray, and many others are capable of providing faster results. DNA testing is now possible on a single molecule, and high-throughput analysis allows multiple detection reactions to be performed at once, thus allowing a range of characteristics to be rapidly and simultaneously determined. Despite better detection efficiencies, results derived using molecular biology methods can be affected by the various food matrixes. With the improvements in sample preparation, data analysis, and testing procedures, molecular detection techniques will likely continue to simplify and increase the speed of detection while simultaneously improving the sensitivity and specificity for tracking pathogens in food matrices.
Directory of Open Access Journals (Sweden)
Il-Hoon Cho
2017-09-01
Full Text Available The development of novel and high-tech solutions for rapid, accurate, and non-laborious microbial detection methods is imperative to improve the global food supply. Such solutions have begun to address the need for microbial detection that is faster and more sensitive than existing methodologies (e.g., classic culture enrichment methods. Multiple reviews report the technical functions and structures of conventional microbial detection tools. These tools, used to detect pathogens in food and food homogenates, were designed via qualitative analysis methods. The inherent disadvantage of these analytical methods is the necessity for specimen preparation, which is a time-consuming process. While some literature describes the challenges and opportunities to overcome the technical issues related to food industry legal guidelines, there is a lack of reviews of the current trials to overcome technological limitations related to sample preparation and microbial detection via nano and micro technologies. In this review, we primarily explore current analytical technologies, including metallic and magnetic nanomaterials, optics, electrochemistry, and spectroscopy. These techniques rely on the early detection of pathogens via enhanced analytical sensitivity and specificity. In order to introduce the potential combination and comparative analysis of various advanced methods, we also reference a novel sample preparation protocol that uses microbial concentration and recovery technologies. This technology has the potential to expedite the pre-enrichment step that precedes the detection process.
Cho, Il-Hoon; Ku, Seockmo
2017-09-30
The development of novel and high-tech solutions for rapid, accurate, and non-laborious microbial detection methods is imperative to improve the global food supply. Such solutions have begun to address the need for microbial detection that is faster and more sensitive than existing methodologies (e.g., classic culture enrichment methods). Multiple reviews report the technical functions and structures of conventional microbial detection tools. These tools, used to detect pathogens in food and food homogenates, were designed via qualitative analysis methods. The inherent disadvantage of these analytical methods is the necessity for specimen preparation, which is a time-consuming process. While some literature describes the challenges and opportunities to overcome the technical issues related to food industry legal guidelines, there is a lack of reviews of the current trials to overcome technological limitations related to sample preparation and microbial detection via nano and micro technologies. In this review, we primarily explore current analytical technologies, including metallic and magnetic nanomaterials, optics, electrochemistry, and spectroscopy. These techniques rely on the early detection of pathogens via enhanced analytical sensitivity and specificity. In order to introduce the potential combination and comparative analysis of various advanced methods, we also reference a novel sample preparation protocol that uses microbial concentration and recovery technologies. This technology has the potential to expedite the pre-enrichment step that precedes the detection process.
Detection of Pathogen Exposure in African Buffalo Using Non-Specific Markers of Inflammation
Directory of Open Access Journals (Sweden)
Caroline K. Glidden
2018-01-01
Full Text Available Detecting exposure to new or emerging pathogens is a critical challenge to protecting human, domestic animal, and wildlife health. Yet, current techniques to detect infections typically target known pathogens of humans or economically important animals. In the face of the current surge in infectious disease emergence, non-specific disease surveillance tools are urgently needed. Tracking common host immune responses indicative of recent infection may have potential as a non-specific diagnostic approach for disease surveillance. The challenge to immunologists is to identify the most promising markers, which ideally should be highly conserved across pathogens and host species, become upregulated rapidly and consistently in response to pathogen invasion, and remain elevated beyond clearance of infection. This study combined an infection experiment and a longitudinal observational study to evaluate the utility of non-specific markers of inflammation [NSMI; two acute phase proteins (haptoglobin and serum amyloid A, two pro-inflammatory cytokines (IFNγ and TNF-α] as indicators of pathogen exposure in a wild mammalian species, African buffalo (Syncerus caffer. Specifically, in the experimental study, we asked (1 How quickly do buffalo mount NSMI responses upon challenge with an endemic pathogen, foot-and-mouth disease virus; (2 for how long do NSMI remain elevated after viral clearance and; (3 how pronounced is the difference between peak NSMI concentration and baseline NSMI concentration? In the longitudinal study, we asked (4 Are elevated NSMI associated with recent exposure to a suite of bacterial and viral respiratory pathogens in a wild population? Among the four NSMI that we tested, haptoglobin showed the strongest potential as a surveillance marker in African buffalo: concentrations quickly and consistently reached high levels in response to experimental infection, remaining elevated for almost a month. Moreover, elevated haptoglobin was
Molecular diagnostics for the detection and characterization of microbial pathogens.
Procop, Gary W
2007-09-01
New and advanced methods of molecular diagnostics are changing the way we practice clinical microbiology, which affects the practice of medicine. Signal amplification and real-time nucleic acid amplification technologies offer a sensitive and specific result with a more rapid turnaround time than has ever before been possible. Numerous methods of postamplification analysis afford the simultaneous detection and differentiation of numerous microbial pathogens, their mechanisms of resistance, and the construction of disease-specific assays. The technical feasibility of these assays has already been demonstrated. How these new, often more expensive tests will be incorporated into routine practice and the impact they will have on patient care remain to be determined. One of the most attractive uses for such techniques is to achieve a more rapid characterization of the infectious agent so that a narrower-spectrum antimicrobial agent may be used, which should have an impact on resistance patterns.
Rehse, Steven J.; Miziolek, Andrzej W.
2012-06-01
Laser-induced breakdown spectroscopy (LIBS) has made tremendous progress in becoming a viable technology for rapid bacterial pathogen detection and identification. The significant advantages of LIBS include speed (present the latest advances achieved in LIBS-based bacterial sensing including the ability to uniquely identify species from more than five bacterial genera with high-sensitivity and specificity. Bacterial identifications are completely unaffected by environment, nutrition media, or state of growth and accurate diagnoses can be made on autoclaved or UV-irradiated specimens. Efficient discrimination of bacteria at the strain level has been demonstrated. A rapid urinary tract infection diagnosis has been simulated with no sample preparation and a one second diagnosis of a pathogen surrogate has been demonstrated using advanced chemometric analysis with a simple "stop-light" user interface. Stand-off bacterial identification at a 20-m distance has been demonstrated on a field-portable instrument. This technology could be implemented in doctors' offices, clinics, or hospital laboratories for point-of-care medical specimen analysis; mounted on military medical robotic platforms for in-the- field diagnostics; or used in stand-off configuration for remote sensing and detection.
Validation of Metagenomic Next-Generation Sequencing Tests for Universal Pathogen Detection.
Schlaberg, Robert; Chiu, Charles Y; Miller, Steve; Procop, Gary W; Weinstock, George
2017-06-01
- Metagenomic sequencing can be used for detection of any pathogens using unbiased, shotgun next-generation sequencing (NGS), without the need for sequence-specific amplification. Proof-of-concept has been demonstrated in infectious disease outbreaks of unknown causes and in patients with suspected infections but negative results for conventional tests. Metagenomic NGS tests hold great promise to improve infectious disease diagnostics, especially in immunocompromised and critically ill patients. - To discuss challenges and provide example solutions for validating metagenomic pathogen detection tests in clinical laboratories. A summary of current regulatory requirements, largely based on prior guidance for NGS testing in constitutional genetics and oncology, is provided. - Examples from 2 separate validation studies are provided for steps from assay design, and validation of wet bench and bioinformatics protocols, to quality control and assurance. - Although laboratory and data analysis workflows are still complex, metagenomic NGS tests for infectious diseases are increasingly being validated in clinical laboratories. Many parallels exist to NGS tests in other fields. Nevertheless, specimen preparation, rapidly evolving data analysis algorithms, and incomplete reference sequence databases are idiosyncratic to the field of microbiology and often overlooked.
Ferreira, Ana Sofia; Costa, Pedro; Rocha, Teresa; Amaro, Ana; Vieira, Maria Luísa; Ahmed, Ahmed; Thompson, Gertrude; Hartskeerl, Rudy A.; Inácio, João
2014-01-01
Leptospirosis is a growing public and veterinary health concern caused by pathogenic species of Leptospira. Rapid and reliable laboratory tests for the direct detection of leptospiral infections in animals are in high demand not only to improve diagnosis but also for understanding the epidemiology of the disease. In this work we describe a novel and simple TaqMan-based multi-gene targeted real-time PCR approach able to detect and differentiate Leptospira interrogans, L. kirschneri, L. borgpeteresenii and L. noguchii, which constitute the veterinary most relevant pathogenic species of Leptospira. The method uses sets of species-specific probes, and respective flanking primers, designed from ompL1 and secY gene sequences. To monitor the presence of inhibitors, a duplex amplification assay targeting both the mammal β-actin and the leptospiral lipL32 genes was implemented. The analytical sensitivity of all primer and probe sets was estimated to be <10 genome equivalents (GE) in the reaction mixture. Application of the amplification reactions on genomic DNA from a variety of pathogenic and non-pathogenic Leptospira strains and other non-related bacteria revealed a 100% analytical specificity. Additionally, pathogenic leptospires were successfully detected in five out of 29 tissue samples from animals (Mus spp., Rattus spp., Dolichotis patagonum and Sus domesticus). Two samples were infected with L. borgpetersenii, two with L. interrogans and one with L. kirschneri. The possibility to detect and identify these pathogenic agents to the species level in domestic and wildlife animals reinforces the diagnostic information and will enhance our understanding of the epidemiology of leptopirosis. PMID:25398140
Whole-bacterium SELEX of DNA aptamers for rapid detection of E.coli O157:H7 using a QCM sensor.
Yu, Xiaofan; Chen, Fang; Wang, Ronghui; Li, Yanbin
2018-01-20
The rapid detection of foodborne pathogens is critical to ensure food safety. The objective of this study is to select aptamers specifically bound to Escherichia coli O157:H7 using the whole-bacterium SELEX (Systematic Evolution of Ligands by Exponential Enrichment) and apply the selected aptamer to a QCM (quartz crystal microbalance) sensor for rapid and sensitive detection of target bacteria. A total of 19 rounds of selection against live E. coli O157:H7 and 6 rounds of counter selection against a mixture of Staphylococcus aureus, Listeria monocytogenes, and Salmonella Typhimurium, were performed. The aptamer pool from the last round was cloned and sequenced. One sequence S1 that appeared 16 times was characterized and a dissociation constant (K d ) of 10.30nM was obtained. Subsequently, a QCM aptasensor was developed for the rapid detection of E. coli O157:H7. The limit of detection (LOD) and the detection time of the aptasensor was determined to be 1.46×10 3 CFU/ml and 50min, respectively. This study demonstrated that the ssDNA aptamer selected by the whole-bacterium SELEX possessed higher sensitivity than previous work and the potential use of the constructed QCM aptasensor in rapid screening of foodborne pathogens. Copyright © 2017 Elsevier B.V. All rights reserved.
Wagner, Karoline; Springer, Burkard; Imkamp, Frank; Opota, Onya; Greub, Gilbert; Keller, Peter M
2018-04-01
Pneumonia is a severe infectious disease. In addition to common viruses and bacterial pathogens (e.g. Streptococcus pneumoniae), fastidious respiratory pathogens like Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella spp. can cause severe atypical pneumonia. They do not respond to penicillin derivatives, which may cause failure of antibiotic empirical therapy. The same applies for infections with B. pertussis and B. parapertussis, the cause of pertussis disease, that may present atypically and need to be treated with macrolides. Moreover, these fastidious bacteria are difficult to identify by culture or serology, and therefore often remain undetected. Thus, rapid and accurate identification of bacterial pathogens causing atypical pneumonia is crucial. We performed a retrospective method evaluation study to evaluate the diagnostic performance of the new, commercially available Lightmix ® multiplex RT-PCR assay that detects these fastidious bacterial pathogens causing atypical pneumonia. In this retrospective study, 368 clinical respiratory specimens, obtained from patients suffering from atypical pneumonia that have been tested negative for the presence of common agents of pneumonia by culture and viral PCR, were investigated. These clinical specimens have been previously characterized by singleplex RT-PCR assays in our diagnostic laboratory and were used to evaluate the diagnostic performance of the respiratory multiplex Lightmix ® RT-PCR. The multiplex RT-PCR displayed a limit of detection between 5 and 10 DNA copies for different in-panel organisms and showed identical performance characteristics with respect to specificity and sensitivity as in-house singleplex RT-PCRs for pathogen detection. The Lightmix ® multiplex RT-PCR assay represents a low-cost, time-saving and accurate diagnostic tool with high throughput potential. The time-to-result using an automated DNA extraction device for respiratory specimens followed by multiplex RT-PCR detection was
Xiao, Di; Zhang, Cuicai; Zhang, Huifang; Li, Xiuwen; Jiang, Xiugao; Zhang, Jianzhong
2015-04-24
disease that has become an important public health problem. Traditional serological methods are the gold standard for the detection of pathogenic strains of Leptospira. However, serological procedures are cumbersome, require more complex experimental techniques, and are based on a large number of international and domestic reference strains. Additionally, these experiments involve the immunization of animals with antigens from different serotypes to produce immune serum, and improper techniques may result in a rapid decrease in antibody titer, which would affect the final results. It is difficult to perform cumbersome detection procedures in a basic laboratory. Therefore, the use of conventional serological methods is limited, which significantly impacts daily leptospirosis epidemic surveillance, prevention, and control. Molecular biology methods, such as 16S rRNA and PCR-based methods, can be used to identify the pathogenic Leptospira. However, DNA extraction and gene sequencing methods are laborious and time consuming. Therefore, more rapid and reliable high-throughput identification methods are urgently needed for the clinical diagnosis of leptospirosis to improve epidemic control. Here, molecular fingerprinting technique was use to identify the pathogenicity. We constructed the reference spectra database and the super reference spectra of pathogenic and non-pathogenic Leptospira, which can rapidly identified Leptospira at the species level and the pathogenicity of these isolates can be simultaneously confirmed. Furthermore, the protein components of Leptospira pathogenicity were revealed. These findings thus provide a new way for Leptospira pathogenicity identification. Copyright © 2014. Published by Elsevier B.V.
Severns, Virginia; Branch, Darren W.; Edwards, Thayne L.; Larson, Richard S.
2013-01-01
Disasters can create situations in which blood donations can save lives. However, in emergency situations and when resources are depleted, on-site blood donations require the rapid and accurate detection of blood-borne pathogens, including human immunodeficiency virus types 1 and 2 (HIV-1 and HIV-2). Techniques such as PCR and antibody capture by an enzyme-linked immunosorbent assay (ELISA) for HIV-1 and HIV-2 are precise but time-consuming and require sophisticated equipment that is not compatible with emergency point-of-care requirements. We describe here a prototype biosensor based on piezoelectric materials functionalized with specific antibodies against HIV-1 and HIV-2. We show the rapid and accurate detection of HIV-1 and HIV-2 in both simple and complex solutions, including human serum, and in the presence of a cross-confounding virus. We report detection limits of 12 50% tissue culture infective doses (TCID50s) for HIV-1 and 87 TCID50s for HIV-2. The accuracy, precision of measurements, and operation of the prototype biosensor compared favorably to those for nucleic acid amplification. We conclude that the biosensor has significant promise as a successful point-of-care diagnostic device for use in emergency field applications requiring rapid and reliable testing for blood-borne pathogens. PMID:23515541
Roine, Antti; Saviauk, Taavi; Kumpulainen, Pekka; Karjalainen, Markus; Tuokko, Antti; Aittoniemi, Janne; Vuento, Risto; Lekkala, Jukka; Lehtimäki, Terho; Tammela, Teuvo L; Oksala, Niku K J
2014-01-01
Urinary tract infection (UTI) is a common disease with significant morbidity and economic burden, accounting for a significant part of the workload in clinical microbiology laboratories. Current clinical chemisty point-of-care diagnostics rely on imperfect dipstick analysis which only provides indirect and insensitive evidence of urinary bacterial pathogens. An electronic nose (eNose) is a handheld device mimicking mammalian olfaction that potentially offers affordable and rapid analysis of samples without preparation at athmospheric pressure. In this study we demonstrate the applicability of ion mobility spectrometry (IMS) -based eNose to discriminate the most common UTI pathogens from gaseous headspace of culture plates rapidly and without sample preparation. We gathered a total of 101 culture samples containing four most common UTI bacteries: E. coli, S. saprophyticus, E. faecalis, Klebsiella spp and sterile culture plates. The samples were analyzed using ChemPro 100i device, consisting of IMS cell and six semiconductor sensors. Data analysis was conducted by linear discriminant analysis (LDA) and logistic regression (LR). The results were validated by leave-one-out and 5-fold cross validation analysis. In discrimination of sterile and bacterial samples sensitivity of 95% and specificity of 97% were achieved. The bacterial species were identified with sensitivity of 95% and specificity of 96% using eNose as compared to urine bacterial cultures. These findings strongly demonstrate the ability of our eNose to discriminate bacterial cultures and provides a proof of principle to use this method in urinanalysis of UTI.
The development and application of the two real-time RT-PCR assays to detect the pathogen of HFMD.
Directory of Open Access Journals (Sweden)
Aili Cui
Full Text Available Large-scale Hand, Foot, and Mouth Disease (HFMD outbreaks have frequently occurred in China since 2008, affecting more than one million children and causing several hundred children deaths every year. The pathogens of HFMD are mainly human enteroviruses (HEVs. Among them, human enterovirus 71 (HEV71 and coxsackievirus A16 (CVA16 are the most common pathogens of HFMD. However, other HEVs could also cause HFMD. To rapidly detect HEV71 and CVA16, and ensure detection of all HEVs causing HFMD, two real-time hybridization probe-based RT-PCR assays were developed in this study. One is a multiplex real-time RT-PCR assay, which was developed to detect and differentiate HEV71 specifically from CVA16 directly from clinical specimens within 1-2 h, and the other is a broad-spectrum real-time RT-PCR assay, which targeted almost all HEVs. The experiments confirmed that the two assays have high sensitivity and specificity, and the sensitivity was up to 0.1 TCID50/ml for detection of HEVs, HEV71, and CVA16, respectively. A total of 213 clinical specimens were simultaneously detected by three kinds of assays, including the two real-time RT-PCR assays, direct conventional RT-PCR assay, and virus isolation assay on human rhabdomyosarcoma cells (RD cells. The total positive rate of both HEV71 and CVA16 was 69.48% with real-time RT-PCR assay, 47.42% with RT-PCR assay, and 34.58% with virus isolation assay. One HFMD clinical specimen was positive for HEV, but negative for HEV71 or CVA16, which was identified as Echovirus 11 (Echo11 by virus isolation, RT-PCR, and sequencing for the VP1 gene. The two real-time RT-PCR assays had been applied in 31 provincial HFMD labs to detect the pathogens of HFMD, which has contributed to the rapid identification of the pathogens in the early stages of HFMD outbreaks, and helped to clarify the etiologic agents of HFMD in China.
FISHing for bacteria in food--a promising tool for the reliable detection of pathogenic bacteria?
Rohde, Alexander; Hammerl, Jens Andre; Appel, Bernd; Dieckmann, Ralf; Al Dahouk, Sascha
2015-04-01
Foodborne pathogens cause millions of infections every year and are responsible for considerable economic losses worldwide. The current gold standard for the detection of bacterial pathogens in food is still the conventional cultivation following standardized and generally accepted protocols. However, these methods are time-consuming and do not provide fast information about food contaminations and thus are limited in their ability to protect consumers in time from potential microbial hazards. Fluorescence in situ hybridization (FISH) represents a rapid and highly specific technique for whole-cell detection. This review aims to summarize the current data on FISH-testing for the detection of pathogenic bacteria in different food matrices and to evaluate its suitability for the implementation in routine testing. In this context, the use of FISH in different matrices and their pretreatment will be presented, the sensitivity and specificity of FISH tests will be considered and the need for automation shall be discussed as well as the use of technological improvements to overcome current hurdles for a broad application in monitoring food safety. In addition, the overall economical feasibility will be assessed in a rough calculation of costs, and strengths and weaknesses of FISH are considered in comparison with traditional and well-established detection methods. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Bao, Hongmei; Wang, Xiurong; Zhao, Yuhui; Sun, Xiaodong; Li, Yanbing; Xiong, Yongzhong; Chen, Hualan
2012-01-01
A rapid and sensitive reverse transcription loop-mediated isothermal amplification (RT-LAMP) method for the detection of the H7 avian influenza virus (H7 AIV) isotype was developed. The minimum detection limit of the RT-LAMP assay was 0.1-0.01 PFU per reaction for H7 AIV RNA, making this assay 100-fold more sensitive than the conventional RT-PCR method. This RT-LAMP assay also has the capacity to detect both high- and low-pathogenic H7 AIV strains. Using a pool of RNAs extracted from influenza viruses corresponding to all 15 HA subtypes (in addition to other avian pathogenic viruses), the RT-LAMP system was confirmed to amplify only H7 AIV RNA. Furthermore, specific pathogen free (SPF) chickens were infected artificially with H7 AIV, throat and cloacal swabs were collected, and viral shedding was examined using viral isolation, RT-PCR and RT-LAMP. Shedding was detected following viral isolation and RT-LAMP one day after infection, whereas viral detection using RT-PCR was effective only on day 3 post-infection. These results indicate that the RT-LAMP method could facilitate epidemiological surveillance and the rapid diagnosis of the avian influenza subtype H7. Copyright © 2011 Elsevier B.V. All rights reserved.
Zhou, Qian-Jin; Wang, Lei; Chen, Jiong; Wang, Rui-Na; Shi, Yu-Hong; Li, Chang-Hong; Zhang, De-Min; Yan, Xiao-Jun; Zhang, Yan-Jun
2014-09-01
Rapid, low-cost, and user-friendly strategies are urgently needed for early disease diagnosis and timely treatment, particularly for on-site screening of pathogens in aquaculture. In this study, we successfully developed a real-time fluorogenic loop-mediated isothermal amplification assay integrated on a microfluidic disc chip (on-chip LAMP), which was capable of simultaneously detecting 10 pathogenic bacteria in aquatic animals, i.e., Nocardia seriolae, Pseudomonas putida, Streptococcus iniae, Vibrio alginolyticus, Vibrio anguillarum, Vibrio fluvialis, Vibrio harveyi, Vibrio parahaemolyticus, Vibrio rotiferianus, and Vibrio vulnificus. The assay provided a nearly-automated approach, with only a single pipetting step per chip for sample dispensing. This technique could achieve limits of detection (LOD) ranging from 0.40 to 6.42pg per 1.414μL reaction in less than 30 min. The robust reproducibility was demonstrated by a little variation among duplications for each bacterium with the coefficient of variation (CV) for time to positive (Tp) value less than 0.10. The clinical sensitivity and specificity of this on-chip LAMP assay in detecting field samples were 96.2% and 93.8% by comparison with conventional microbiological methods. Compared with other well-known techniques, on-chip LAMP assay provides low sample and reagent consumption, ease-of-use, accelerated analysis, multiple bacteria and on-site detection, and high reproducibility, indicating that such a technique would be applicable for on-site detection and routine monitoring of multiple pathogens in aquaculture. Copyright © 2014 Elsevier B.V. All rights reserved.
A Portable Impedance Immunosensing System for Rapid Detection of Salmonella Typhimurium.
Wen, Tao; Wang, Ronghui; Sotero, America; Li, Yanbin
2017-08-28
Salmonella Typhimurium is one of the most dangerous foodborne pathogens and poses a significant threat to human health. The objective of this study was to develop a portable impedance immunosensing system for rapid and sensitive detection of S . Typhimurium in poultry. The developed portable impedance immunosensing system consisted of a gold interdigitated array microelectrode (IDAM), a signal acquisitive interface and a laptop computer with LabVIEW software. The IDAM was first functionalized with 16-Mercaptohexadecanoic acid, and streptavidin was immobilized onto the electrode surface through covalent bonding. Then, biotin-labelled S . Typhimurium -antibody was immobilized onto the IDAM surface. Samples were dropped on the surface of the IDAM and the S . Typhimurium cells in the samples were captured by the antibody on the IDAM. This resulted in impedance changes that were measured and displayed with the LabVIEW software. An equivalent circuit of the immunosensor demonstrated that the largest change in impedance was due to the electron-transfer resistance. The equivalent circuit showed an increase of 35% for the electron-transfer resistance value compared to the negative control. The calibration result indicated that the portable impedance immunosensing system could be used to measure the standard impedance elements, and it had a maximum error of measurement of approximately 13%. For pure culture detection, the system had a linear relationship between the impedance change and the logarithmic value of S . Typhimurium cells ranging from 76 to 7.6 × 10⁶ CFU (colony-forming unit) (50 μL) -1 . The immunosensor also had a correlation coefficient of 0.98, and a high specificity for detection of S . Typhimurium cells with a limit of detection (LOD) of 10² CFU (50 μL) -1 . The detection time from the moment a sample was introduced to the display of the results was 1 h. To conclude, the portable impedance immunosensing system for detection of S . Typhimurium achieved
A Portable Impedance Immunosensing System for Rapid Detection of Salmonella Typhimurium
Directory of Open Access Journals (Sweden)
Tao Wen
2017-08-01
Full Text Available Salmonella Typhimurium is one of the most dangerous foodborne pathogens and poses a significant threat to human health. The objective of this study was to develop a portable impedance immunosensing system for rapid and sensitive detection of S. Typhimurium in poultry. The developed portable impedance immunosensing system consisted of a gold interdigitated array microelectrode (IDAM, a signal acquisitive interface and a laptop computer with LabVIEW software. The IDAM was first functionalized with 16-Mercaptohexadecanoic acid, and streptavidin was immobilized onto the electrode surface through covalent bonding. Then, biotin-labelled S. Typhimurium-antibody was immobilized onto the IDAM surface. Samples were dropped on the surface of the IDAM and the S. Typhimurium cells in the samples were captured by the antibody on the IDAM. This resulted in impedance changes that were measured and displayed with the LabVIEW software. An equivalent circuit of the immunosensor demonstrated that the largest change in impedance was due to the electron-transfer resistance. The equivalent circuit showed an increase of 35% for the electron-transfer resistance value compared to the negative control. The calibration result indicated that the portable impedance immunosensing system could be used to measure the standard impedance elements, and it had a maximum error of measurement of approximately 13%. For pure culture detection, the system had a linear relationship between the impedance change and the logarithmic value of S. Typhimurium cells ranging from 76 to 7.6 × 106 CFU (colony-forming unit (50 μL−1. The immunosensor also had a correlation coefficient of 0.98, and a high specificity for detection of S. Typhimurium cells with a limit of detection (LOD of 102 CFU (50 μL−1. The detection time from the moment a sample was introduced to the display of the results was 1 h. To conclude, the portable impedance immunosensing system for detection of S. Typhimurium
Balachandran, Priya; Friberg, Maria; Vanlandingham, V; Kozak, K; Manolis, Amanda; Brevnov, Maxim; Crowley, Erin; Bird, Patrick; Goins, David; Furtado, Manohar R; Petrauskene, Olga V; Tebbs, Robert S; Charbonneau, Duane
2012-02-01
Reducing the risk of Salmonella contamination in pet food is critical for both companion animals and humans, and its importance is reflected by the substantial increase in the demand for pathogen testing. Accurate and rapid detection of foodborne pathogens improves food safety, protects the public health, and benefits food producers by assuring product quality while facilitating product release in a timely manner. Traditional culture-based methods for Salmonella screening are laborious and can take 5 to 7 days to obtain definitive results. In this study, we developed two methods for the detection of low levels of Salmonella in pet food using real-time PCR: (i) detection of Salmonella in 25 g of dried pet food in less than 14 h with an automated magnetic bead-based nucleic acid extraction method and (ii) detection of Salmonella in 375 g of composite dry pet food matrix in less than 24 h with a manual centrifugation-based nucleic acid preparation method. Both methods included a preclarification step using a novel protocol that removes food matrix-associated debris and PCR inhibitors and improves the sensitivity of detection. Validation studies revealed no significant differences between the two real-time PCR methods and the standard U.S. Food and Drug Administration Bacteriological Analytical Manual (chapter 5) culture confirmation method.
Directory of Open Access Journals (Sweden)
Antti Roine
Full Text Available Urinary tract infection (UTI is a common disease with significant morbidity and economic burden, accounting for a significant part of the workload in clinical microbiology laboratories. Current clinical chemisty point-of-care diagnostics rely on imperfect dipstick analysis which only provides indirect and insensitive evidence of urinary bacterial pathogens. An electronic nose (eNose is a handheld device mimicking mammalian olfaction that potentially offers affordable and rapid analysis of samples without preparation at athmospheric pressure. In this study we demonstrate the applicability of ion mobility spectrometry (IMS -based eNose to discriminate the most common UTI pathogens from gaseous headspace of culture plates rapidly and without sample preparation. We gathered a total of 101 culture samples containing four most common UTI bacteries: E. coli, S. saprophyticus, E. faecalis, Klebsiella spp and sterile culture plates. The samples were analyzed using ChemPro 100i device, consisting of IMS cell and six semiconductor sensors. Data analysis was conducted by linear discriminant analysis (LDA and logistic regression (LR. The results were validated by leave-one-out and 5-fold cross validation analysis. In discrimination of sterile and bacterial samples sensitivity of 95% and specificity of 97% were achieved. The bacterial species were identified with sensitivity of 95% and specificity of 96% using eNose as compared to urine bacterial cultures.These findings strongly demonstrate the ability of our eNose to discriminate bacterial cultures and provides a proof of principle to use this method in urinanalysis of UTI.
DNA microarray technique for detecting food-borne pathogens
Directory of Open Access Journals (Sweden)
Xing GAO
2012-08-01
Full Text Available Objective To study the application of DNA microarray technique for screening and identifying multiple food-borne pathogens. Methods The oligonucleotide probes were designed by Clustal X and Oligo 6.0 at the conserved regions of specific genes of multiple food-borne pathogens, and then were validated by bioinformatic analyses. The 5' end of each probe was modified by amino-group and 10 Poly-T, and the optimized probes were synthesized and spotted on aldehyde-coated slides. The bacteria DNA template incubated with Klenow enzyme was amplified by arbitrarily primed PCR, and PCR products incorporated into Aminoallyl-dUTP were coupled with fluorescent dye. After hybridization of the purified PCR products with DNA microarray, the hybridization image and fluorescence intensity analysis was acquired by ScanArray and GenePix Pro 5.1 software. A series of detection conditions such as arbitrarily primed PCR and microarray hybridization were optimized. The specificity of this approach was evaluated by 16 different bacteria DNA, and the sensitivity and reproducibility were verified by 4 food-borne pathogens DNA. The samples of multiple bacteria DNA and simulated water samples of Shigella dysenteriae were detected. Results Nine different food-borne bacteria were successfully discriminated under the same condition. The sensitivity of genomic DNA was 102 -103pg/ μl, and the coefficient of variation (CV of the reproducibility of assay was less than 15%. The corresponding specific hybridization maps of the multiple bacteria DNA samples were obtained, and the detection limit of simulated water sample of Shigella dysenteriae was 3.54×105cfu/ml. Conclusions The DNA microarray detection system based on arbitrarily primed PCR can be employed for effective detection of multiple food-borne pathogens, and this assay may offer a new method for high-throughput platform for detecting bacteria.
Directory of Open Access Journals (Sweden)
Rosemary S Turingan
Full Text Available BACKGROUND: The intentional release of Bacillus anthracis in the United States in 2001 has heightened concern about the use of pathogenic microorganisms in bioterrorism attacks. Many of the deadliest bacteria, including the Class A Select Agents Bacillus anthracis, Francisella tularensis, and Yersinia pestis, are highly infectious via the pulmonary route when released in aerosolized form. Hence, rapid, sensitive, and reliable methods for detection of these biothreats and characterization of their potential impact on the exposed population are of critical importance to initiate and support rapid military, public health, and clinical responses. METHODOLOGY/PRINCIPAL FINDINGS: We have developed microfluidic multiplexed PCR and sequencing assays based on the simultaneous interrogation of three pathogens per assay and ten loci per pathogen. Microfluidic separation of amplified fluorescently labeled fragments generated characteristic electrophoretic signatures for identification of each agent. The three sets of primers allowed significant strain typing and discrimination from non-pathogenic closely-related species and environmental background strains based on amplicon sizes alone. Furthermore, sequencing of the 10 amplicons per pathogen, termed "Rapid Focused Sequencing," allowed an even greater degree of strain discrimination and, in some cases, can be used to determine virulence. Both amplification and sequencing assays were performed in microfluidic biochips developed for fast thermal cycling and requiring 7 µL per reaction. The 30-plex sequencing assay resulted in genotypic resolution of 84 representative strains belonging to each of the three biothreat species. CONCLUSIONS/SIGNIFICANCE: The microfluidic multiplexed assays allowed identification and strain differentiation of the biothreat agents Bacillus anthracis, Francisella tularensis, and Yersinia pestis and clear discrimination from closely-related species and several environmental
Detection and treatment of chemical weapons and/or biological pathogens
Mariella Jr., Raymond P.
2004-09-07
A system for detection and treatment of chemical weapons and/or biological pathogens uses a detector system, an electrostatic precipitator or scrubber, a circulation system, and a control. The precipitator or scrubber is activated in response to a signal from the detector upon the detection of chemical weapons and/or biological pathogens.
Directory of Open Access Journals (Sweden)
Laura C Bonney
2017-10-01
Full Text Available Crimean-Congo Haemorrhagic fever Virus (CCHFV is a rapidly emerging vector-borne pathogen and the cause of a virulent haemorrhagic fever affecting large parts of Europe, Africa, the Middle East and Asia.An isothermal recombinase polymerase amplification (RPA assay was successfully developed for molecular detection of CCHFV. The assay showed rapid (under 10 minutes detection of viral extracts/synthetic virus RNA of all 7 S-segment clades of CCHFV, with high target specificity. The assay was shown to tolerate the presence of inhibitors in crude preparations of mock field samples, indicating that this assay may be suitable for use in the field with minimal sample preparation. The CCHFV RPA was successfully used to screen and detect CCHFV positives from a panel of clinical samples from Tajikistan.The assay is a rapid, isothermal, simple-to-perform molecular diagnostic, which can be performed on a light, portable real-time detection device. It is ideally placed therefore for use as a field-diagnostic or in-low resource laboratories, for monitoring of CCHF outbreaks at the point-of-need, such as in remote rural regions in affected countries.
Directory of Open Access Journals (Sweden)
Berit Schulte
Full Text Available Severe pneumonia remains an important cause of morbidity and mortality. Polymerase chain reaction (PCR has been shown to be more sensitive than current standard microbiological methods--particularly in patients with prior antibiotic treatment--and therefore, may improve the accuracy of microbiological diagnosis for hospitalized patients with pneumonia. Conventional detection techniques and multiplex PCR for 14 typical bacterial pneumonia-associated pathogens were performed on respiratory samples collected from adult hospitalized patients enrolled in a prospective multi-center study. Patients were enrolled from March until September 2012. A total of 739 fresh, native samples were eligible for analysis, of which 75 were sputa, 421 aspirates, and 234 bronchial lavages. 276 pathogens were detected by microbiology for which a valid PCR result was generated (positive or negative detection result by Curetis prototype system. Among these, 120 were identified by the prototype assay, 50 pathogens were not detected. Overall performance of the prototype for pathogen identification was 70.6% sensitivity (95% confidence interval (CI lower bound: 63.3%, upper bound: 76.9% and 95.2% specificity (95% CI lower bound: 94.6%, upper bound: 95.7%. Based on the study results, device cut-off settings were adjusted for future series production. The overall performance with the settings of the CE series production devices was 78.7% sensitivity (95% CI lower bound: 72.1% and 96.6% specificity (95% CI lower bound: 96.1%. Time to result was 5.2 hours (median for the prototype test and 43.5 h for standard-of-care. The Pneumonia Application provides a rapid and moderately sensitive assay for the detection of pneumonia-causing pathogens with minimal hands-on time.Deutsches Register Klinischer Studien (DRKS DRKS00005684.
Quantitative multiplex detection of pathogen biomarkers
Energy Technology Data Exchange (ETDEWEB)
Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I.; Martinez, Jennifer; Grace, Wynne K.
2016-02-09
The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.
Quantitative multiplex detection of pathogen biomarkers
Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I; Martinez, Jennifer; Grace, Wynne K
2014-10-14
The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.
Pandey, Ashish; Gurbuz, Yasar; Ozguz, Volkan; Niazi, Javed H; Qureshi, Anjum
2017-05-15
E. coli O157:H7 is an enterohemorrhagic bacteria responsible for serious foodborne outbreaks that causes diarrhoea, fever and vomiting in humans. Recent foodborne E. coli outbreaks has left a serious concern to public health. Therefore, there is an increasing demand for a simple, rapid and sensitive method for pathogen detection in contaminated foods. In this study, we developed a label-free electrical biosensor interfaced with graphene for sensitive detection of pathogenic bacteria. This biosensor was fabricated by interfacing graphene with interdigitated microelectrodes of capacitors that were biofunctionalized with E. coli O157:H7 specific antibodies for sensitive pathogenic bacteria detection. Here, graphene nanostructures on the sensor surface provided superior chemical properties such as high carrier mobility and biocompatibility with antibodies and bacteria. The sensors transduced the signal based on changes in dielectric properties (capacitance) through (i) polarization of captured cell-surface charges, (ii) cells' internal bioactivity, (iii) cell-wall's electronegativity or dipole moment and their relaxation and (iv) charge carrier mobility of graphene that modulated the electrical properties once the pathogenic E. coli O157:H7 captured on the sensor surface. Sensitive capacitance changes thus observed with graphene based capacitors were specific to E. coli O157:H7 strain with a sensitivity as low as 10-100 cells/ml. The proposed graphene based electrical biosensor provided advantages of speed, sensitivity, specificity and in-situ bacterial detection with no chemical mediators, represents a versatile approach for detection of a wide variety of other pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.
A portable cell-based optical detection device for rapid detection of Listeria and Bacillus toxins
Banerjee, Pratik; Banada, Padmapriya P.; Rickus, Jenna L.; Morgan, Mark T.; Bhunia, Arun K.
2005-11-01
A mammalian cell-based optical biosensor was built to detect pathogenic Listeria and Bacillus species. This sensor measures the ability of the pathogens to infect and induce cytotoxicity on hybrid lymphocyte cell line (Ped-2E9) resulting in the release of alkaline phosphatase (ALP) that can be detected optically using a portable spectrophotometer. The Ped-2E9 cells were encapsulated in collagen gel matrices and grown in 48-well plates or in specially designed filtration tube units. Toxin preparations or bacterial cells were introduced and ALP release was assayed after 3-5 h. Pathogenic L. monocytogenes strains or the listeriolysin toxins preparation showed cytotoxicity ranging from 55% - 92%. Toxin preparations (~20 μg/ml) from B. cereus strains showed 24 - 98% cytotoxicity. In contrast, a non-pathogenic L. innocua (F4247) and a B. substilis induced only 2% and 8% cytotoxicity, respectively. This cell-based detection device demonstrates its ability to detect the presence of pathogenic Listeria and Bacillus species and can potentially be used onsite for food safety or in biosecurity application.
Rapid methods for detection of bacteria
DEFF Research Database (Denmark)
Corfitzen, Charlotte B.; Andersen, B.Ø.; Miller, M.
2006-01-01
Traditional methods for detection of bacteria in drinking water e.g. Heterotrophic Plate Counts (HPC) or Most Probable Number (MNP) take 48-72 hours to give the result. New rapid methods for detection of bacteria are needed to protect the consumers against contaminations. Two rapid methods...
Rehse, Steven; Trojand, Daniel; Putnam, Russell; Gillies, Derek; Woodman, Ryan; Sheikh, Khadija; Daabous, Andrew
2013-05-01
There is a well-known and urgent need in the fields of medicine, environmental health and safety, food-processing, and defense/security to develop new 21st Century technologies for the rapid and sensitive identification of bacterial pathogens. In only the last five years, the use of a real-time elemental (atomic) analysis performed with laser-induced breakdown spectroscopy (LIBS) has made tremendous progress in becoming a viable technology for rapid bacterial pathogen detection and identification. In this talk we will show how this laser-based optical emission spectroscopic technique is able to sensitively assay the elemental composition of bacterial cells in situ. We will also present the latest achievements of our lab to fully develop LIBS-based bacterial sensing including simulation of a rapid urinary tract infection diagnosis and investigation of a variety of autonomous multivariate analysis algorithms. Lastly, we will show how this technology is now ready to be transitioned from the laboratory to field-portable and potentially man-portable instrumentation. The introduction of such a technology into popular use could very well transform the field of bacterial biosensing - a market valued at approximately 10 billion/year world-wide. Funding for this project was provided in part by a Natural Sciences and Engineering Research Council of Canada Discovery Grant.
Rapid screening for entry inhibitors of highly pathogenic viruses under low-level biocontainment.
Directory of Open Access Journals (Sweden)
Aparna Talekar
Full Text Available Emerging viruses including Nipah, Hendra, Lujo, and Junin viruses have enormous potential to spread rapidly. Nipah virus, after emerging as a zoonosis, has also evolved the capacity for human-to-human transmission. Most of the diseases caused by these pathogens are untreatable and require high biocontainment conditions. Universal methods for rapidly identifying and screening candidate antivirals are urgently needed. We have developed a modular antiviral platform strategy that relies on simple bioinformatic and genetic information about each pathogen. Central to this platform is the use of envelope glycoprotein cDNAs to establish multi-cycle replication systems under BSL2 conditions for viral pathogens that normally require BSL3 and BSL4 facilities. We generated monoclonal antibodies against Nipah G by cDNA immunization in rats, and we showed that these antibodies neutralize both Nipah and Hendra live viruses. We then used these effective Henipavirus inhibitors to validate our screening strategy. Our proposed strategy should contribute to the response capability for emerging infectious diseases, providing a way to initiate antiviral development immediately upon identifying novel viruses.
Multiplex TaqMan® detection of pathogenic and multi-drug resistant Salmonella.
Singh, Prashant; Mustapha, Azlin
2013-09-02
Overuse of antibiotics in the medical and animal industries is one of the major causes for the development of multi-drug-resistant (MDR) food pathogens that are often difficult to treat. In the past few years, higher incidences of outbreaks caused by MDR Salmonella have been increasingly documented. The objective of this study was to develop a rapid multiplex real-time polymerase chain reaction (PCR) assay for simultaneous detection of pathogenic and MDR Salmonella spp. A multiplex TaqMan®real-time PCR was designed by targeting the invasin virulence gene (invA), and four commonly found antibiotic resistance genes, viz. ampicillin, chloramphenicol, streptomycin and tetracycline. To avoid false negative results and to increase the reliability of the assay, an internal amplification control (IAC) was added which was detected using a locked nucleic acid (LNA) probe. In serially diluted (5 ng-50 fg) DNA samples, the assay was able to detect 100 genomic equivalents of Salmonella, while in a multiplex format, the sensitivity was 1000 genomic equivalents. The assay performed equally well on artificially contaminated samples of beef trim, ground beef of different fat contents (73:27, 80:20, 85:15 and 93:7), chicken rinse, ground chicken, ground turkey, egg, spinach and tomato. While the detection limit for un-enriched inoculated food samples was 10(4) CFU/g, this was improved to 10 CFU/g after a 12-h enrichment in buffered peptone water, with 100% reproducibility. The multiplex real-time assay developed in this study can be used as a valuable tool to detect MDR virulent Salmonella, thus enhancing the safety of food. © 2013.
[Detection of biofilm formation by selected pathogens relevant to the food industry].
Šilhová-Hrušková, L; Moťková, P; Šilha, D; Vytřasová, J
2015-09-01
Detection of biofilm formation by microbial pathogens relevant to the food industry and comparison of biofilm formation under different conditions of culture. The following microorganisms were selected for the study: Staphylococcus aureus, Listeria innocua, Listeria ivanovii, Cronobacter sakazakii, Cronobacter muytjensii, Arcobacter butzleri, Arcobacter cryaerophilus, Campylobacter jejuni, and Campylobacter coli. To detect biofilm formation the microtiter plate assay, as described by Christensen and culture on stainless steel coupons were used. The biofilm forming capacity was confirmed in all microorganisms tested, both on the microtiter plates and stainless steel coupons. Biofilm formation was influenced by the culture medium, material used, and culture duration as well as by the test microorganism. It was found that different species and strains of the same genus differ in biofilm formation. Differences were also found between the collection strains and isolates from the environment. Some bacteria tended to form biofilm more readily on the surface of the polyethylene microtiter plates and less readily on stainless steel coupons while others appeared to have an opposite tendency. Some pathogens were able to increase the planktonic cell density in the initial suspension even by three orders of magnitude within 72 hours while producing plenty of biofilm. The study of biofilm formation by high risk pathogens is of utmost importance, not only to the food industry. From the obtained results, it is evident that bacterial biofilms form rapidly (within 24 hours in the present study). Due to their architecture, these biofilms are difficult to eradicate, and therefore, it is crucial to prevent biofilm formation.
Pierson, Duane; Botkin, Douglas; Gazda, Daniel
2014-01-01
Microbial control in the spacecraft environment is a daunting task, especially in the presence of human crew members. Currently, assessing the potential crew health risk associated with a microbial contamination event requires return of representative environmental samples that are analyzed in a ground-based laboratory. It is therefore not currently possible to quickly identify microbes during spaceflight. This project addresses the unmet need for spaceflight-compatible microbial identification technology. The electrochemical detection and identification platform is expected to provide a sensitive, specific, and rapid sample-to-answer capability for in-flight microbial monitoring that can distinguish between related microorganisms (pathogens and non-pathogens) as well as chemical contaminants. This will dramatically enhance our ability to monitor the spacecraft environment and the health risk to the crew. Further, the project is expected to eliminate the need for sample return while significantly reducing crew time required for detection of multiple targets. Initial work will focus on the optimization of bacterial detection and identification. The platform is designed to release nucleic acids (DNA and RNA) from microorganisms without the use of harmful chemicals. Bacterial DNA or RNA is captured by bacteria-specific probe molecules that are bound to a microelectrode, and that capture event can generate a small change in the electrical current (Lam, et al. 2012. Anal. Chem. 84(1): 21-5.). This current is measured, and a determination is made whether a given microbe is present in the sample analyzed. Chemical detection can be accomplished by directly applying a sample to the microelectrode and measuring the resulting current change. This rapid microbial and chemical detection device is designed to be a low-cost, low-power platform anticipated to be operated independently of an external power source, characteristics optimal for manned spaceflight and areas where power
Ashraf, Aqeela; Imran, Muhammad; Yaqub, Tahir; Tayyab, Muhammad; Shehzad, Wasim; Thomson, Peter C
2017-06-01
For rapid and simultaneous detection of nine bovine mastitic pathogens, a sensitive and specific multiplex PCR assay was developed. The assay was standardized using reference strains and validated on mastitic milk cultures which were identified to species level based on 16S rRNA sequencing. Multiplex PCR assay also efficiently detected the target bacterial strains directly from milk. The detection limit of the assay was up to 50 pg for DNA isolated from pure cultures and 10 4 CFU/ml for spiked milk samples. As estimated by latent class analysis, the assay was sensitive up to 88% and specific up to 98% for targeted mastitic pathogens, compared with the bacterial culture method and the 16S rRNA sequence analysis. This novel molecular assay could be useful for monitoring and maintaining the bovine udder health, ensuring the bacteriological safety of milk, and conducting epidemiological studies. Copyright © 2017 Elsevier Ltd. All rights reserved.
A real-time loop-mediated isothermal amplification assay for rapid detection of Shigella species.
Liew, P S; Teh, C S J; Lau, Y L; Thong, K L
2014-12-01
Shigellosis is a foodborne illness caused by the genus Shigella and is an important global health issue. The development of effective techniques for rapid detection of this pathogen is essential for breaking the chain of transmission. Therefore, we have developed a novel loop-mediated isothermal amplification (LAMP) assay targeting the invasion plasmid antigen H (ipaH) gene to rapidly detect Shigella species. This assay could be performed in 90 min at an optimal temperature of 64ºC, with endpoint results visualized directly. Notably, the method was found to be more sensitive than conventional PCR. Indeed, the detection limit for the LAMP assay on pure bacterial cultures was 5.9 x 10(5) CFU/ml, while PCR displayed a limit of 5.9 x 10(7) CFU/ml. In spiked lettuce samples, the sensitivity of the LAMP assay was 3.6 x 10(4) CFU/g, whereas PCR was 3.6 x 10(5) CFU/g. Overall, the assay accurately identified 32 Shigella spp. with one enteroinvasive Escherichia coli displaying positive reaction while the remaining 32 non-Shigella strains tested were negative.
Rapid and label-free detection of protein a by aptamer-tethered porous silicon nanostructures.
Urmann, Katharina; Reich, Peggy; Walter, Johanna-Gabriela; Beckmann, Dieter; Segal, Ester; Scheper, Thomas
2017-09-10
Protein A, which is secreted by and displayed on the cell membrane of Staphylococcus aureus is an important biomarker for S. aureus. Thus, its rapid and specific detection may facilitate the pathogen identification and initiation of proper treatment. Herein, we present a simple, label-free and rapid optical biosensor enabling specific detection of protein A. Protein A-binding aptamer serves as the capture probe and is immobilized onto a nanostructured porous silicon thin film, which serves as the optical transducer element. We demonstrate high sensitivity of the biosensor with a linear detection range between 8 and 23μM. The apparent dissociation constant was determined as 13.98μM and the LoD is 3.17μM. Harnessing the affinity between protein A and antibodies, a sandwich assay format was developed to amplify the optical signal associated with protein A capture by the aptamer. Using this approach, we increase the sensitivity of the biosensor, resulting in a three times lower LoD. Copyright © 2017 Elsevier B.V. All rights reserved.
Time is of essence; rapid identification of veterinary pathogens using MALDI TOF
DEFF Research Database (Denmark)
Nonnemann, Bettina; Dalsgaard, Inger; Pedersen, Karl
Rapid and accurate identification of microbial pathogens is a cornerstone for timely and correct treatment of diseases of livestock and fish. The utility of the MALDI-TOF technique in the diagnostic laboratory is directly related to the quality of mass spectra and quantity of different microbial...
Energy Technology Data Exchange (ETDEWEB)
Lamour, Kurt H.; Mudge, Joann; Gobena, Daniel; Hurtado-Gonzales, Oscar P.; Schmutz, Jeremy; Kuo, Alan; Miller, Neil A.; Rice, Brandon J.; Raffaele, Sylvain; Cano, Liliana M.; Bharti, Arvind K.; Donahoo, Ryan S.; Finely, Sabra; Huitema, Edgar; Hulvey, Jon; Platt, Darren; Salamov, Asaf; Savidor, Alon; Sharma, Rahul; Stam, Remco; Sotrey, Dylan; Thines, Marco; Win, Joe; Haas, Brian J.; Dinwiddie, Darrell L.; Jenkins, Jerry; Knight, James R.; Affourtit, Jason P.; Han, Cliff S.; Chertkov, Olga; Lindquist, Erika A.; Detter, Chris; Grigoriev, Igor V.; Kamoun, Sophien; Kingsmore, Stephen F.
2012-02-07
The oomycete vegetable pathogen Phytophthora capsici has shown remarkable adaptation to fungicides and new hosts. Like other members of this destructive genus, P. capsici has an explosive epidemiology, rapidly producing massive numbers of asexual spores on infected hosts. In addition, P. capsici can remain dormant for years as sexually recombined oospores, making it difficult to produce crops at infested sites, and allowing outcrossing populations to maintain significant genetic variation. Genome sequencing, development of a high-density genetic map, and integrative genomic or genetic characterization of P. capsici field isolates and intercross progeny revealed significant mitotic loss of heterozygosity (LOH) in diverse isolates. LOH was detected in clonally propagated field isolates and sexual progeny, cumulatively affecting >30percent of the genome. LOH altered genotypes for more than 11,000 single-nucleotide variant sites and showed a strong association with changes in mating type and pathogenicity. Overall, it appears that LOH may provide a rapid mechanism for fixing alleles and may be an important component of adaptability for P. capsici.
Abubakar, I; Irvine, L; Aldus, C F; Wyatt, G M; Fordham, R; Schelenz, S; Shepstone, L; Howe, A; Peck, M; Hunter, P R
2007-09-01
analysis, on many occasions the rapid test outperforms culture, detecting additional 'truly' positive cases of food-borne illness. The significance of these additional positives requires further investigation. Economic modelling suggests that adoption of rapid tests in combination with routine culture is unlikely to be cost-effective, however, as the cost of rapid technologies decreases; total replacement with rapid technologies may be feasible. Despite the relatively poor quality of reporting of studies evaluating rapid detection methods, the reviewed evidence shows that PCR for Campylobacter, Salmonella and E. coli O157 is potentially very successful in identifying pathogens, possibly detecting more than the number currently reported using culture. Less is known about the benefits of testing for B. cereus, C. perfringens and S. aureus. Further investigation is needed on how clinical outcomes may be altered if test results are available more quickly and at a greater precision than in the current practice of bacterial culture.
Directory of Open Access Journals (Sweden)
Zhan Lu
2017-02-01
Full Text Available A simple, highly-automated instrument system used for on-site detection of foodborne pathogens based on fluorescence was designed, fabricated, and preliminarily tested in this paper. A corresponding method has been proved effective in our previous studies. This system utilizes a light-emitting diode (LED to excite fluorescent labels and a spectrometer to record the fluorescence signal from samples. A rotation stage for positioning and switching samples was innovatively designed for high-throughput detection, ten at most in one single run. We also developed software based on LabVIEW for data receiving, processing, and the control of the whole system. In the test of using a pure quantum dot (QD solution as a standard sample, detection results from this home-made system were highly-relevant with that from a well-commercialized product and even slightly better reproducibility was found. And in the test of three typical kinds of food-borne pathogens, fluorescence signals recorded by this system are highly proportional to the variation of the sample concentration, with a satisfied limit of detection (LOD (nearly 102–103 CFU·mL−1 in food samples. Additionally, this instrument system is low-cost and easy-to-use, showing a promising potential for on-site rapid detection of food-borne pathogens.
Jin, Lian-Qun; Li, Jun-Wen; Wang, Sheng-Qi; Chao, Fu-Huan; Wang, Xin-Wei; Yuan, Zheng-Quan
2005-01-01
AIM: To detect the common intestinal pathogenic bacteria quickly and accurately. METHODS: A rapid (<3 h) experimental procedure was set up based upon the gene chip technology. Target genes were amplified and hybridized by oligonucleotide microarrays. RESULTS: One hundred and seventy strains of bacteria in pure culture belonging to 11 genera were successfully discriminated under comparatively same conditions, and a series of specific hybridization maps corresponding to each kind of bacteria were obtained. When this method was applied to 26 divided cultures, 25 (96.2%) were identified. CONCLUSION: Salmonella sp., Escherichia coli, Shigella sp., Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, Proteus sp., Bacillus cereus, Vibrio cholerae, Enterococcus faecalis, Yersinia enterocolitica, and Campylobacter jejuni can be detected and identified by our microarrays. The accuracy, range, and discrimination power of this assay can be continually improved by adding further oligonucleotides to the arrays without any significant increase of complexity or cost. PMID:16437687
Binet, Rachel; Deer, Deanne M; Uhlfelder, Samantha J
2014-06-01
Faster detection of contaminated foods can prevent adulterated foods from being consumed and minimize the risk of an outbreak of foodborne illness. A sensitive molecular detection method is especially important for Shigella because ingestion of as few as 10 of these bacterial pathogens can cause disease. The objectives of this study were to compare the ability of four DNA extraction methods to detect Shigella in six types of produce, post-enrichment, and to evaluate a new and rapid conventional multiplex assay that targets the Shigella ipaH, virB and mxiC virulence genes. This assay can detect less than two Shigella cells in pure culture, even when the pathogen is mixed with background microflora, and it can also differentiate natural Shigella strains from a control strain and eliminate false positive results due to accidental laboratory contamination. The four DNA extraction methods (boiling, PrepMan Ultra [Applied Biosystems], InstaGene Matrix [Bio-Rad], DNeasy Tissue kit [Qiagen]) detected 1.6 × 10(3)Shigella CFU/ml post-enrichment, requiring ∼18 doublings to one cell in 25 g of produce pre-enrichment. Lower sensitivity was obtained, depending on produce type and extraction method. The InstaGene Matrix was the most consistent and sensitive and the multiplex assay accurately detected Shigella in less than 90 min, outperforming, to the best of our knowledge, molecular assays currently in place for this pathogen. Published by Elsevier Ltd.
Karthik, K; Rathore, Rajesh; Thomas, Prasad; Arun, T R; Viswas, K N; Agarwal, R K; Manjunathachar, H V; Dhama, Kuldeep
2014-01-01
Brucella abortus, the major causative agent of abortion in cattle and a zoonotic pathogen, needs to be diagnosed at an early stage. Loop-mediated isothermal amplification (LAMP) test is easy to perform and also promising to be adapted at field level. To develop a LAMP assay for specific and rapid detection of B. abortus from clinical samples of cattle. LAMP primers were designed targeting BruAb2_0168 region using specific software tool and LAMP was optimized. The developed LAMP was tested for its specificity with 3 Brucella spp. and 11 other non-Brucella spp. Sensitivity of the developed LAMP was also carried out with known quantity of DNA. Cattle whole blood samples and aborted fetal stomach contents were collected and used for testing with developed LAMP assay and results were compared with polymerase chain reaction (PCR). The developed LAMP assay works at 61 °C for 60 min and the detection limit was observed to be 100-fold more than the conventional PCR that is commonly used for diagnosis of B. abortus. Clinical sensitivity and specificity of the developed LAMP assay was 100% when compared with Rose Bengal plate test and standard tube agglutination test. SYB® green dye I was used to visualize the result with naked eye. The novelty of the developed LAMP assay for specifically detecting B. abortus infection in cattle along with its inherent rapidness and high sensitivity can be employed for detecting this economically important pathogen of cattle at field level as well be exploited for screening of human infections.
RAPID MONITORING BY QPCR FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL
Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polymerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventi...
Rapid detection of salmonella using SERS with silver nano-substrate
Sundaram, J.; Park, B.; Hinton, A., Jr.; Windham, W. R.; Yoon, S. C.; Lawrence, K. C.
2011-06-01
Surface Enhanced Raman Scattering (SERS) can detect the pathogen in rapid and accurate. In SERS weak Raman scattering signals are enhanced by many orders of magnitude. In this study silver metal with biopolymer was used. Silver encapsulated biopolymer polyvinyl alcohol nano-colloid was prepared and deposited on stainless steel plate. This was used as metal substrate for SERS. Salmonella typhimurium a common food pathogen was selected for this study. Salmonella typhimurium bacteria cells were prepared in different concentrations in cfu/mL. Small amount of these cells were loaded on the metal substrate individually, scanned and spectra were recorded using confocal Raman microscope. The cells were exposed to laser diode at 785 nm excitation and object 50x was used to focus the laser light on the sample. Raman shifts were obtained from 400 to 2400 cm-1. Multivariate data analysis was carried to predict the concentration of unknown sample using its spectra. Concentration prediction gave an R2 of 0.93 and standard error of prediction of 0.21. The results showed that it could be possible to find out the Salmonella cells present in a low concentration in food samples using SERS.
Wachiralurpan, Sirirat; Sriyapai, Thayat; Areekit, Supatra; Sriyapai, Pichapak; Augkarawaritsawong, Suphitcha; Santiwatanakul, Somchai; Chansiri, Kosum
2018-04-01
ABSTRACT Listeria monocytogenes is a major foodborne pathogen of global health concern. Herein, the rapid diagnosis of L. monocytogenes has been achieved using loop-mediated isothermal amplification (LAMP) based on the phosphatidylcholine-phospholipase C gene (plcB). Colorimetric detection was then performed through the formation of DNA concatemers and a gold nanoparticle/DNA probe complex (GNP/DNA probe). The overall detection process was accomplished within approximately 1 h with no need for complicated equipment. The limits of detection for L. monocytogenes in the forms of purified genomic DNA and pure culture were 800 fg and 2.82 CFU mL-1, respectively. No cross reactions were observed from closely related bacteria species. The LAMP-GNP/DNA probe assay was applied to the detection of 200 raw chicken meat samples and compared to routine standard methods. The data revealed that the specificity, sensitivity and accuracy were 100%, 90.20% and 97.50%, respectively. The present assay was 100% in conformity with LAMP-agarose gel electrophoresis assay. Five samples that were negative by both assays appeared to have the pathogen at below the level of detection. The assay can be applied as a rapid direct screening method for L. monocytogenes.
Directory of Open Access Journals (Sweden)
B. Stephen Inbaraj
2016-01-01
Full Text Available Food safety draws considerable attention in the modern pace of the world owing to rapid-changing food recipes and food habits. Foodborne illnesses associated with pathogens, toxins, and other contaminants pose serious threat to human health. Besides, a large amount of money is spent on both analyses and control measures, which causes significant loss to the food industry. Conventional detection methods for bacterial pathogens and toxins are time consuming and laborious, requiring certain sophisticated instruments and trained personnel. In recent years, nanotechnology has emerged as a promising field for solving food safety issues in terms of detecting contaminants, enabling controlled release of preservatives to extend the shelf life of foods, and improving food-packaging strategies. Nanomaterials including metal oxide and metal nanoparticles, carbon nanotubes, and quantum dots are gaining a prominent role in the design of sensors and biosensors for food analysis. In this review, various nanomaterial-based sensors reported in the literature for detection of several foodborne bacterial pathogens and toxins are summarized highlighting their principles, advantages, and limitations in terms of simplicity, sensitivity, and multiplexing capability. In addition, the application through a noncross-linking method without the need for any surface modification is also presented for detection of pork adulteration in meat products.
A rapid two dot filter assay for the detection of E. coli O157 in water samples.
Kamma, Sujatha; Tang, Lily; Leung, Kelvin; Ashton, Edie; Newman, Norman; Suresh, Mavanur R
2008-07-31
E. coli O157:H7 is an enterohemorrhagic bacteria that cause deadly water-borne infections implicated in outbreaks of a wide spectrum of human gastrointestinal diseases. It is therefore important to have a rapid convenient, simple and sensitive range of detection of E. coli O157:H7. A new E. coli O157 MAb designated P124 was developed for ultrasensitive detection of E. coli O157 in water, apple juice and beef for routine use. A prototype filter dot assay was designed with anti-E. coli O157 MAb bound to 0.2 microm nitrocellulose filter disk as the capture antibody. A 100 ml water sample spiked with 1-50 CFU of E. coli O157 either in the presence or absence of other non-specific bacteria were filtered for capture of the pathogen on the antibody coated nitrocellulose disk. The detection of the pathogen was successfully accomplished by the same antibody both as a capture and detecting antibody as a homosandwich. In a non-enriched format, detection of E. coli was possible with a sensitivity of 2500 CFU/100 ml. Ultrasensitive detection of ~1 CFU/100 ml sample could be achieved by a prior pathogen enrichment step before the addition of the labeled antibody. The design of this diagnostic test is based on the common architecture of all bacteria, viruses and spores, namely the manifestation of repeat lipopolysaccharide epitopes on the surface. We have developed an easy-to-use two dot visual filter assay for translation into current water testing in public health laboratories to detect E. coli O157:H7. In a 5 h assay approximately 1 CFU and approximately 5 CFU of E. coli O157 could be detected in 100 ml of water or juice and lake samples respectively. This simple homosandwich enrichment strategy can also be used to detect low levels of other water-borne pathogens.
Miles, Timothy D; Martin, Frank N; Coffey, Michael D
2015-02-01
Several isothermal amplification techniques recently have been developed that are tolerant of inhibitors present in many plant extracts, which can reduce the need for obtaining purified DNA for running diagnostic assays. One such commercially available technique that has similarities with real-time polymerase chain reaction (PCR) for designing primers and a labeled probe is recombinase polymerase amplification (RPA). This technology was used to develop two simple and rapid approaches for detection of Phytophthora spp.: one genus-specific assay multiplexed with a plant internal control and the other species-specific assays for Phytophthora ramorum and P. kernoviae. All assays were tested for sensitivity (ranging from 3 ng to 1 fg of DNA) and specificity using DNA extracted from more than 136 Phytophthora taxa, 21 Pythium spp., 1 Phytopythium sp., and a wide range of plant species. The lower limit of linear detection using purified DNA was 200 to 300 fg of DNA in all pathogen RPA assays. Six different extraction buffers were tested for use during plant tissue maceration and the assays were validated in the field by collecting 222 symptomatic plant samples from over 50 different hosts. Only 56 samples were culture positive for Phytophthora spp. whereas 91 were positive using the Phytophthora genus-specific RPA test and a TaqMan real-time PCR assay. A technique for the generation of sequencing templates from positive RPA amplifications to confirm species identification was also developed. These RPA assays have added benefits over traditional technologies because they are rapid (results can be obtained in as little as 15 min), do not require DNA extraction or extensive training to complete, use less expensive portable equipment than PCR-based assays, and are significantly more specific than current immunologically based methods. This should provide a rapid, field-deployable capability for pathogen detection that will facilitate point-of-sample collection processing
9 CFR 113.36 - Detection of pathogens by the chicken inoculation test.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Detection of pathogens by the chicken... REQUIREMENTS Standard Procedures § 113.36 Detection of pathogens by the chicken inoculation test. The test for...,000 doses. (b) At least 25 healthy susceptible young chickens, properly identified and obtained from...
Keserue, Hans-Anton; Füchslin, Hans Peter; Egli, Thomas
2011-01-01
Giardia lamblia is an important waterborne pathogen and is among the most common intestinal parasites of humans worldwide. Its fecal-oral transmission leads to the presence of cysts of this pathogen in the environment, and so far, quantitative rapid screening methods are not available for various matrices, such as surface waters, wastewater, or food. Thus, it is necessary to establish methods that enable reliable rapid detection of a single cyst in 10 to 100 liters of drinking water. Conventional detection relies on cyst concentration, isolation, and confirmation by immunofluorescence microscopy (IFM), resulting in low recoveries and high detection limits. Many different immunomagnetic separation (IMS) procedures have been developed for separation and cyst purification, so far with variable but high losses of cysts. A method was developed that requires less than 100 min and consists of filtration, resuspension, IMS, and flow cytometric (FCM) detection. MACS MicroBeads were used for IMS, and a reliable flow cytometric detection approach was established employing 3 different parameters for discrimination from background signals, i.e., green and red fluorescence (resulting from the distinct pattern emitted by the fluorescein dye) and sideward scatter for size discrimination. With spiked samples, recoveries exceeding 90% were obtained, and false-positive results were never encountered for negative samples. Additionally, the method was applicable to naturally occurring cysts in wastewater and has the potential to be automated. PMID:21685159
Colonna, William; Brehm-Stecher, Byron; Shetty, Kalidas; Pometto, Anthony
2017-12-01
This study focused on advancing a rapid turbidimetric bioassay to screen antimicrobials using specific cocktails of targeted foodborne bacterial pathogens. Specifically, to show the relevance of this rapid screening tool, the antimicrobial potential of generally recognized as safe calcium diacetate (DAX) and blends with cranberry (NC) and oregano (OX) natural extracts was evaluated. Furthermore, the same extracts were evaluated against beneficial lactic acid bacteria. The targeted foodborne pathogens evaluated were Escherichia coli O157:H7, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus using optimized initial cocktails (∼10 8 colony-forming unit/mL) containing strains isolated from human food outbreaks. Of all extracts evaluated, 0.51% (w/v) DAX in ethanol was the most effective against all four pathogens. However, DAX when reduced to 0.26% and with added blends from ethanol extractions consisting of DAX:OX (3:1), slightly outperformed or was equal to same levels of DAX alone. Subculture of wells in which no growth occurred after 1 week indicated that all water and ethanol extracts were bacteriostatic against the pathogens tested. All the targeted antimicrobials had no effect on the probiotic organism Lactobacillus plantarum. The use of such rapid screening methods combined with the use of multistrain cocktails of targeted foodborne pathogens from outbreaks will allow rapid large-scale screening of antimicrobials and enable further detailed studies in targeted model food systems.
Shrestha, Nabin K; Lim, Sung H; Wilson, Deborah A; SalasVargas, Ana Victoria; Churi, Yair S; Rhodes, Paul A; Mazzone, Peter J; Procop, Gary W
2017-01-01
A colorimetric sensor array (CSA) has been demonstrated to rapidly detect and identify bacteria growing in blood cultures by obtaining a species-specific "fingerprint" of the volatile organic compounds (VOCs) produced during growth. This capability has been demonstrated in prokaryotes, but has not been reported for eukaryotic cells growing in culture. The purpose of this study was to explore if a disposable CSA could differentially identify 7 species of pathogenic yeasts growing in blood culture. Culture trials of whole blood inoculated with a panel of clinically important pathogenic yeasts at four different microorganism loads were performed. Cultures were done in both standard BacT/Alert and CSA-embedded bottles, after adding 10 mL of spiked blood to each bottle. Color changes in the CSA were captured as images by an optical scanner at defined time intervals. The captured images were analyzed to identify the yeast species. Time to detection by the CSA was compared to that in the BacT/Alert system. One hundred sixty-two yeast culture trials were performed, including strains of several species of Candida (Ca. albicans, Ca. glabrata, Ca. parapsilosis, and Ca. tropicalis), Clavispora (synonym Candida) lusitaniae, Pichia kudriavzevii (synonym Candida krusei) and Cryptococcus neoformans, at loads of 8.2 × 105, 8.3 × 103, 8.5 × 101, and 1.7 CFU/mL. In addition, 8 negative trials (no yeast) were conducted. All negative trials were correctly identified as negative, and all positive trials were detected. Colorimetric responses were species-specific and did not vary by inoculum load over the 500000-fold range of loads tested, allowing for accurate species-level identification. The mean sensitivity for species-level identification by CSA was 74% at detection, and increased with time, reaching almost 95% at 4 hours after detection. At an inoculum load of 1.7 CFU/mL, mean time to detection with the CSA was 6.8 hours (17%) less than with the BacT/Alert platform. The CSA
A Spectral Mapping Signature for the Rapid Ohia Death (ROD) Pathogen in Hawaiian Forests
Pathogenic invasions are a major disruptive source of change in both agricultural and natural ecosystems. In forests, fungal pathogens can kill habitat-generating plant species such as canopy trees, but methods for remote detection, mapping and monitoring of such outbreaks are poorly developed. Cera...
Vaginal microbicides: detecting toxicities in vivo that paradoxically increase pathogen transmission
Directory of Open Access Journals (Sweden)
Abusuwwa Raed
2006-06-01
Full Text Available Abstract Background Microbicides must protect against STD pathogens without causing unacceptable toxic effects. Microbicides based on nonoxynol-9 (N9 and other detergents disrupt sperm, HSV and HIV membranes, and these agents are effective contraceptives. But paradoxically N9 fails to protect women against HIV and other STD pathogens, most likely because it causes toxic effects that increase susceptibility. The mouse HSV-2 vaginal transmission model reported here: (a Directly tests for toxic effects that increase susceptibility to HSV-2, (b Determines in vivo whether a microbicide can protect against HSV-2 transmission without causing toxicities that increase susceptibility, and (c Identifies those toxic effects that best correlate with the increased HSV susceptibility. Methods Susceptibility was evaluated in progestin-treated mice by delivering a low-dose viral inoculum (0.1 ID50 at various times after delivering the candidate microbicide to detect whether the candidate increased the fraction of mice infected. Ten agents were tested – five detergents: nonionic (N9, cationic (benzalkonium chloride, BZK, anionic (sodium dodecylsulfate, SDS, the pair of detergents in C31G (C14AO and C16B; one surface active agent (chlorhexidine; two non-detergents (BufferGel®, and sulfonated polystyrene, SPS; and HEC placebo gel (hydroxyethylcellulose. Toxic effects were evaluated by histology, uptake of a 'dead cell' dye, colposcopy, enumeration of vaginal macrophages, and measurement of inflammatory cytokines. Results A single dose of N9 protected against HSV-2 for a few minutes but then rapidly increased susceptibility, which reached maximum at 12 hours. When applied at the minimal concentration needed for brief partial protection, all five detergents caused a subsequent increase in susceptibility at 12 hours of ~20–30-fold. Surprisingly, colposcopy failed to detect visible signs of the N9 toxic effect that increased susceptibility at 12 hours. Toxic
Benitez, Alvaro J; Winchell, Jonas M
2016-04-01
We developed a single tube multiplex real-time PCR assay that allows for the rapid detection and typing of 9 nonpneumophila Legionella spp. isolates that are clinically relevant. The multiplex assay is capable of simultaneously detecting and discriminating L. micdadei, L. bozemanii, L. dumoffii, L. longbeachae, L. feeleii, L. anisa, L. parisiensis, L. tucsonensis serogroup (sg) 1 and 3, and L. sainthelensis sg 1 and 2 isolates. Evaluation of the assay with nucleic acid from each of these species derived from both clinical and environmental isolates and typing strains demonstrated 100% sensitivity and 100% specificity when tested against 43 other Legionella spp. Typing of L. anisa, L. parisiensis, and L. tucsonensis sg 1 and 3 isolates was accomplished by developing a real-time PCR assay followed by high-resolution melt (HRM) analysis targeting the ssrA gene. Further typing of L. bozemanii, L. longbeachae, and L. feeleii isolates to the serogroup level was accomplished by developing a real-time PCR assay followed by HRM analysis targeting the mip gene. When used in conjunction with other currently available diagnostic tests, these assays may aid in rapidly identifying specific etiologies associated with Legionella outbreaks, clusters, sporadic cases, and potential environmental sources. Published by Elsevier Inc.
Cho, Min Seok; Park, Duck Hwan; Ahn, Tae-Young; Park, Dong Suk
2015-09-01
The aim of this study was to develop a SYBR Green-based real-time PCR assay for the rapid, specific, and sensitive detection of Acidovorax avenae subsp. citrulli, which causes bacterial fruit blotch (BFB), a serious disease of cucurbit plants. The molecular and serological methods currently available for the detection of this pathogen are insufficiently sensitive and specific. Thus, a novel SYBR Green-based real-time PCR assay targeting the YD-repeat protein gene of A. avenae subsp. citrulli was developed. The specificity of the primer set was evaluated using DNA purified from 6 isolates of A. avenae subsp. citrulli, 7 other Acidovorax species, and 22 of non-targeted strains, including pathogens and non-pathogens. The AC158F/R primer set amplified a single band of the expected size from genomic DNA obtained from the A. avenae subsp. citrulli strains but not from the genomic DNA of other Acidovorax species, including that of other bacterial genera. Using this assay, it was possible to detect at least one genomeequivalents of the cloned amplified target DNA using 5 × 10(0) fg/μl of purified genomic DNA per reaction or using a calibrated cell suspension, with 6.5 colony-forming units per reaction being employed. In addition, this assay is a highly sensitive and reliable method for identifying and quantifying the target pathogen in infected samples that does not require DNA extraction. Therefore, we suggest that this approach is suitable for the rapid and efficient diagnosis of A. avenae subsp. citrulli contaminations of seed lots and plants.
Bacteriophages for detection of bacterial pathogens
International Nuclear Information System (INIS)
Kutateladze, M.
2009-01-01
The G. Eliava Institute of Bacteriophages, Microbiology and Virology (Tbilisi, Georgia) is one of the most famous institutions focused on bacteriophage research for the elaboration of appropriate phage methodologies for human and animal protection. The main direction of the institute is the study and production of bacteriophages against intestinal disorders (dysentery, typhoid, intesti) and purulent-septic infections (staphylococcus, streptococcus, pyophage, etc.). These preparations were successfully introduced during the Soviet era, and for decades were used throughout the former Soviet Union and in other Socialist countries for the treatment, prophylaxis, and diagnosis of various infectious diseases, including those caused by antibiotic-resistant bacterial strains. Bacteriophages were widely used for identifying and detecting infections caused by the most dangerous pathogens and causative agents of epidemiological outbreaks. The specific topic of this presentation is the phage typing of bacterial species, which can be an important method for epidemiological diagnostics. Together with different genetic methodologies - such as PCR-based methods, PFGE, plasmid fingerprinting, and ribosomal typing - phage typing is one method for identifying bacterial pathogens. The method has a high percentage of determination of phage types, high specificity of reaction, and is easy for interpretation and use by health workers. Phage typing was applied for inter-species differentiation of different species of Salmonella, S. typhi, Brucella spp, Staphylococcus aureus, E. col,i Clostridium deficile, Vibrio cholerae, Yersinia pestis, Yersinia enterocolitica, Lysteria monocytogenes, Clostridium perfringens, Clostridium tetani, plant pathogens, and other bacterial pathogens. In addition to addressing the utility and efficacy of phage typing, the paper will discuss the isolation and selection of diagnostic typing phages for interspecies differentiation of pathogens that is necessary
Zhang, Shulu; Ravelonandro, Michel; Russell, Paul; McOwen, Nathan; Briard, Pascal; Bohannon, Seven; Vrient, Albert
2014-10-01
Plum pox virus (PPV) causes the most destructive viral disease known as plum pox or Sharka disease in stone fruit trees. As an important regulated pathogen, detection of PPV is thus of critical importance to quarantine and eradication of the spreading disease. In this study, the innovative development of two AmplifyRP(®) tests is reported for a rapid isothermal detection of PPV using reverse transcription-recombinase polymerase amplification. In an AmplifyRP(®) test, all specific recombination and amplification reactions occur at a constant temperature without thermal cycling and the test results are either recorded in real-time with a portable fluorescence reader or displayed using a lateral flow strip contained inside an amplicon detection chamber. The major improvement of this assay is that the entire test from sample preparation to result can be completed in as little as 20min and can be performed easily both in laboratories and in the field. The results from this study demonstrated the ability of the AmplifyRP(®) technique to detect all nine PPV strains (An, C, CR, D, EA, M, Rec, T, or W). Among the economic benefits to pathogen surveys is the higher sensitivity of the AmplifyRP(®) to detect PPV when compared to the conventional ELISA and ImmunoStrip(®) assays. This is the first report describing the use of such an innovative technique to detect rapidly plant viruses affecting perennial crops. Copyright © 2014 Elsevier B.V. All rights reserved.
Zeinhom, Mohamed Maarouf Ali; Wang, Yijia; Song, Yang; Zhu, Mei-Jun; Lin, Yuehe; Du, Dan
2018-01-15
The detection of E. coli O157:H7 in foods has held the attention of many researchers because of the seriousness attributed to this pathogen. In this study, we present a simple, sensitive, rapid and portable smartphone based fluorescence device for E. coli O157:H7 detection. This field-portable fluorescent imager on the smartphone involves a compact laser-diode-based photosource, a long-pass (LP) thin-film interference filter and a high-quality insert lenses. The design of the device provided a low noise to background imaging system. Based on a sandwich ELISA and the specific recognition of antibody to E. coli O157:H7, the sensitive detection of E. coli O157:H7 were realized both in standard samples and real matrix in yoghurt and egg on our device. The detection limit are 1 CFU/mL and 10 CFU/mL correspondingly. Recovery percentages of spiked yogurt and egg samples with 10 3 , 10 4 and 10 5 CFU/mL E. coli O157:H7 were 106.98, 96.52 and 102.65 (in yogurt) and 107.37, 105.64 and 93.84 (in egg) samples using our device, respectively. Most importantly, the entire process could be quickly completed within two hours. This smartphone based device provides a simple, rapid, sensitive detection platform for fluorescent imaging which applied in pathogen detection for food safety monitoring. Copyright © 2017 Elsevier B.V. All rights reserved.
9 CFR 113.37 - Detection of pathogens by the chicken embryo inoculation test.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Detection of pathogens by the chicken... VECTORS STANDARD REQUIREMENTS Standard Procedures § 113.37 Detection of pathogens by the chicken embryo...-serum mixture shall be inoculated into each of at least 20 fully susceptible chicken embryos. (1) Twenty...
Rapid Detection of Microorganisms Based on Active and Passive Modes of QCM
Directory of Open Access Journals (Sweden)
Zdeněk Farka
2014-12-01
Full Text Available Label-free immunosensors are well suited for detection of microorganisms because of their fast response and reasonable sensitivity comparable to infection doses of common pathogens. Active (lever oscillator and frequency counter and passive (impedance analyzer modes of quartz crystal microbalance (QCM were used and compared for rapid detection of three strains of E. coli. Different approaches for antibody immobilization were compared, the immobilization of reduced antibody using Sulfo‑SMCC was most effective achieving the limit of detection (LOD 8 × 104 CFU·mL−1 in 10 min. For the passive mode, software evaluating impedance characteristics in real-time was developed and used. Almost the same results were achieved using both active and passive modes confirming that the sensor properties are not limited by the frequency evaluation method but mainly by affinity of the antibody. Furthermore, reference measurements were done using surface plasmon resonance. Effect of condition of cells on signal was observed showing that cells ruptured by ultrasonication provided slightly higher signal changes than intact microbes.
Saleh, Mona; El-Matbouli, Mansour
2015-06-01
Cyprinid herpesvirus-3 (CyHV-3) is a highly infectious pathogen that causes fatal disease in common and koi carp Cyprinus carpio L. CyHV-3 detection is usually based on virus propagation or amplification of the viral DNA using the PCR or LAMP techniques. However, due to the limited susceptibility of cells used for propagation, it is not always possible to successfully isolate CyHV-3 even from tissue samples that have high virus titres. All previously described detection methods including PCR-based assays are time consuming, laborious and require specialized equipment. To overcome these limitations, gold nanoparticles (AuNPs) have been explored for direct and sensitive detection of DNA. In this study, a label-free colorimetric nanodiagnostic method for direct detection of unamplified CyHV-3 DNA using gold nanoparticles is introduced. Under appropriate conditions, DNA probes hybridize with their complementary target sequences in the sample DNA, which results in aggregation of the gold nanoparticles and a concomitant colour change from red to blue, whereas test samples with non complementary DNA sequences remain red. In this study, gold nanoparticles were used to develop and evaluate a specific and sensitive hybridization assay for direct and rapid detection of the highly infectious pathogen termed Cyprinid herpesvirus-3. Copyright © 2015 Elsevier B.V. All rights reserved.
Lievens, B.; Thomma, B.P.H.J.
2005-01-01
The failure to adequately identify plant pathogens from culture-based morphological techniques has led to the development of culture-independent molecular approaches. Increasingly, diagnostic laboratories are pursuing fast routine methods that provide reliable identification, sensitive detection,
Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria
Kamani, Joshua; Baneth, Gad; Mumcuoglu, Kosta Y.; Waziri, Ndadilnasiya E.; Eyal, Osnat; Guthmann, Yifat; Harrus, Shimon
2013-01-01
Background Only limited information is currently available on the prevalence of vector borne and zoonotic pathogens in dogs and ticks in Nigeria. The aim of this study was to use molecular techniques to detect and characterize vector borne pathogens in dogs and ticks from Nigeria. Methodology/Principal Findings Blood samples and ticks (Rhipicephalus sanguineus, Rhipicephalus turanicus and Heamaphysalis leachi) collected from 181 dogs from Nigeria were molecularly screened for human and animal vector-borne pathogens by PCR and sequencing. DNA of Hepatozoon canis (41.4%), Ehrlichia canis (12.7%), Rickettsia spp. (8.8%), Babesia rossi (6.6%), Anaplasma platys (6.6%), Babesia vogeli (0.6%) and Theileria sp. (0.6%) was detected in the blood samples. DNA of E. canis (23.7%), H. canis (21.1%), Rickettsia spp. (10.5%), Candidatus Neoehrlichia mikurensis (5.3%) and A. platys (1.9%) was detected in 258 ticks collected from 42 of the 181 dogs. Co- infections with two pathogens were present in 37% of the dogs examined and one dog was co-infected with 3 pathogens. DNA of Rickettsia conorii israelensis was detected in one dog and Rhipicephalus sanguineus tick. DNA of another human pathogen, Candidatus N. mikurensis was detected in Rhipicephalus sanguineus and Heamaphysalis leachi ticks, and is the first description of Candidatus N. mikurensis in Africa. The Theileria sp. DNA detected in a local dog in this study had 98% sequence identity to Theileria ovis from sheep. Conclusions/Significance The results of this study indicate that human and animal pathogens are abundant in dogs and their ticks in Nigeria and portray the potential high risk of human exposure to infection with these agents. PMID:23505591
Molecular detection and characterization of tick-borne pathogens in dogs and ticks from Nigeria.
Directory of Open Access Journals (Sweden)
Joshua Kamani
Full Text Available BACKGROUND: Only limited information is currently available on the prevalence of vector borne and zoonotic pathogens in dogs and ticks in Nigeria. The aim of this study was to use molecular techniques to detect and characterize vector borne pathogens in dogs and ticks from Nigeria. METHODOLOGY/PRINCIPAL FINDINGS: Blood samples and ticks (Rhipicephalus sanguineus, Rhipicephalus turanicus and Heamaphysalis leachi collected from 181 dogs from Nigeria were molecularly screened for human and animal vector-borne pathogens by PCR and sequencing. DNA of Hepatozoon canis (41.4%, Ehrlichia canis (12.7%, Rickettsia spp. (8.8%, Babesia rossi (6.6%, Anaplasma platys (6.6%, Babesia vogeli (0.6% and Theileria sp. (0.6% was detected in the blood samples. DNA of E. canis (23.7%, H. canis (21.1%, Rickettsia spp. (10.5%, Candidatus Neoehrlichia mikurensis (5.3% and A. platys (1.9% was detected in 258 ticks collected from 42 of the 181 dogs. Co- infections with two pathogens were present in 37% of the dogs examined and one dog was co-infected with 3 pathogens. DNA of Rickettsia conorii israelensis was detected in one dog and Rhipicephalus sanguineus tick. DNA of another human pathogen, Candidatus N. mikurensis was detected in Rhipicephalus sanguineus and Heamaphysalis leachi ticks, and is the first description of Candidatus N. mikurensis in Africa. The Theileria sp. DNA detected in a local dog in this study had 98% sequence identity to Theileria ovis from sheep. CONCLUSIONS/SIGNIFICANCE: The results of this study indicate that human and animal pathogens are abundant in dogs and their ticks in Nigeria and portray the potential high risk of human exposure to infection with these agents.
Directory of Open Access Journals (Sweden)
Wen-Hsiang Su
2013-03-01
Conclusion: This microarray chip was a rapid, easy, inexpensive and sensitive tool for detecting female lower genital tract Candida infection in a one-time vaginal sampling process, although the data on the four other pathogens were still unavailable. A larger population study is encouraged to test the validity of this multiplexed immunoassay chip.
Lin, Qun; Xu, Pusheng; Li, Jiaowu; Chen, Yin; Feng, Jieyi
2017-08-01
Loop-mediated isothermal amplification based detection assays using bacterial culture or colony for direct detection of methicillin resistant Staphylococcus aureus(MRSA) had been developed and evaluated, followed by its extensive application on a large scale of clinical MRSA isolated from respiratory origins, including nasal swabs and sputums. Six primers, including outer primers, inner primers and loop primers, were specifically designed for recognizing eight distinct sequences on four targets: 16SrRNA, femA, mecA and orfX. Twenty-seven reference strains were used to develop, evaluate and optimize this assay. Then, a total of 532 clinical MRSA isolates were employed for each detected targets. And the results were determined through both visual observation of the color change by naked eye and electrophoresis. The specific of each primer had been confirmed, and the optimal amplification was obtained under 65 °C for 40 min. The limit of detections (LOD) of bacteria culture LAMP assays were determined to be 10 4 CFU/ml for 16S rRNA, femA, as well as orfX and 10 5 CFU/ml for mecA, respectively. The established novel assays on MRSA detection may provide new strategies for rapid detection of foodborne pathogens. Copyright © 2017. Published by Elsevier Ltd.
Detection of pathogens from periodontal lesions
Directory of Open Access Journals (Sweden)
Malheiros Veruska de João
2004-01-01
Full Text Available OBJECTIVE: To comparatively detect A. actinomycetemcomitans and F. nucleatum from periodontal and healthy sites. METHODS: Subgingival clinical samples from 50 periodontitis adult patients and 50 healthy subjects were analyzed. Both organisms were isolated using a trypticase soy agar-bacitracin-vancomycin (TSBV medium and detected by PCR. Conventional biochemical tests were used for bacteria identification. RESULTS: A. actinomycetemcomitans and F. nucleatum were isolated in 18% and 20% of the patients, respectively, and in 2% and 24% of healthy subjects. Among A. actinomycetemcomitans isolates, biotype II was the most prevalent. Primer pair AA was 100% sensitive in the detection of A. actinomycetemcomitans from both subject groups. Primers ASH and FU were also 100% sensitive to detect this organism in healthy subject samples. Primer pair FN5047 was more sensitive to detect F. nucleatum in patients or in healthy samples than primer 5059S. Primers ASH and 5059S were more specific in the detection of A. actinomycetemcomitans and F. nucleatum, respectively, in patients and in healthy subject samples. CONCLUSIONS: PCR is an effective tool for detecting periodontal pathogens in subgingival samples, providing a faster and safer diagnostic tool of periodontal diseases. The method's sensitivity and specificity is conditioned by the choice of the set of primers used.
Nanomaterial-enabled Rapid Detection of Water Contaminants.
Mao, Shun; Chang, Jingbo; Zhou, Guihua; Chen, Junhong
2015-10-28
Water contaminants, e.g., inorganic chemicals and microorganisms, are critical metrics for water quality monitoring and have significant impacts on human health and plants/organisms living in water. The scope and focus of this review is nanomaterial-based optical, electronic, and electrochemical sensors for rapid detection of water contaminants, e.g., heavy metals, anions, and bacteria. These contaminants are commonly found in different water systems. The importance of water quality monitoring and control demands significant advancement in the detection of contaminants in water because current sensing technologies for water contaminants have limitations. The advantages of nanomaterial-based sensing technologies are highlighted and recent progress on nanomaterial-based sensors for rapid water contaminant detection is discussed. An outlook for future research into this rapidly growing field is also provided. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Nabin K Shrestha
Full Text Available A colorimetric sensor array (CSA has been demonstrated to rapidly detect and identify bacteria growing in blood cultures by obtaining a species-specific "fingerprint" of the volatile organic compounds (VOCs produced during growth. This capability has been demonstrated in prokaryotes, but has not been reported for eukaryotic cells growing in culture. The purpose of this study was to explore if a disposable CSA could differentially identify 7 species of pathogenic yeasts growing in blood culture.Culture trials of whole blood inoculated with a panel of clinically important pathogenic yeasts at four different microorganism loads were performed. Cultures were done in both standard BacT/Alert and CSA-embedded bottles, after adding 10 mL of spiked blood to each bottle. Color changes in the CSA were captured as images by an optical scanner at defined time intervals. The captured images were analyzed to identify the yeast species. Time to detection by the CSA was compared to that in the BacT/Alert system.One hundred sixty-two yeast culture trials were performed, including strains of several species of Candida (Ca. albicans, Ca. glabrata, Ca. parapsilosis, and Ca. tropicalis, Clavispora (synonym Candida lusitaniae, Pichia kudriavzevii (synonym Candida krusei and Cryptococcus neoformans, at loads of 8.2 × 105, 8.3 × 103, 8.5 × 101, and 1.7 CFU/mL. In addition, 8 negative trials (no yeast were conducted. All negative trials were correctly identified as negative, and all positive trials were detected. Colorimetric responses were species-specific and did not vary by inoculum load over the 500000-fold range of loads tested, allowing for accurate species-level identification. The mean sensitivity for species-level identification by CSA was 74% at detection, and increased with time, reaching almost 95% at 4 hours after detection. At an inoculum load of 1.7 CFU/mL, mean time to detection with the CSA was 6.8 hours (17% less than with the BacT/Alert platform
Directory of Open Access Journals (Sweden)
J.A. Khan
2013-09-01
Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four
Xu, Yueshuang; Wang, Huan; Luan, Chengxin; Liu, Yuxiao; Chen, Baoan; Zhao, Yuanjin
2018-02-15
Rapid and sensitive diagnosing hematological infections based on the separation and detection of pathogenic bacteria in the patient's blood is a significant challenge. To address this, we herein present a new barcodes technology that can simultaneously capture and detect multiple types of pathogenic bacteria from a complex sample. The barcodes are poly (ethylene glycol) (PEG) hydrogel inverse opal particles with characteristic reflection peak codes that remain stable during bacteria capture on their surfaces. As the spherical surface of the particles has ordered porous nanostructure, the barcodes can provide not only more surface area for probe immobilization and reaction, but also a nanopatterned platform for highly efficient bioreactions. In addition, the PEG hydrogel scaffold could decrease the non-specificity adsorption by its anti-adhesive effect, and the decorated aptamer probes in the scaffolds could increase the sensitivity, reliability, and specificity of the bacteria capture and detection. Moreover, the tagged magnetic nanoparticles in the PEG scaffold could impart the barcodes with controllable movement under magnetic fields, which can be used to significantly increase the reaction speed and simplify the processing of the bioassays. Based on the describe barcodes, it was demonstrated that the bacteria could be captured and identified even at low bacterial concentrations (100 CFU mL -1 ) within 2.5h, which is effectively shortened in comparison with the "gold standard" in clinic. These features make the barcodes ideal for capturing and detecting multiple bacteria from clinical samples for hematological infection diagnostics. Copyright © 2017 Elsevier B.V. All rights reserved.
Biosensor for the detection of Listeria monocytogenes: emerging trends
Soni, Dharmendra Kumar
2018-05-23
The early detection of Listeria monocytogenes (L. monocytogenes) and understanding the disease burden is of paramount interest. The failure to detect pathogenic bacteria in the food industry may have terrible consequences, and poses deleterious effects on human health. Therefore, integration of methods to detect and trace the route of pathogens along the entire food supply network might facilitate elucidation of the main contamination sources. Recent research interest has been oriented towards the development of rapid and affordable pathogen detection tools/techniques. An innovative and new approach like biosensors has been quite promising in revealing the foodborne pathogens. In spite of the existing knowledge, advanced research is still needed to substantiate the expeditious nature and sensitivity of biosensors for rapid and in situ analysis of foodborne pathogens. This review summarizes recent developments in optical, piezoelectric, cell-based, and electrochemical biosensors for Listeria sp. detection in clinical diagnostics, food analysis, and environmental monitoring, and also lists their drawbacks and advantages.
Hyperspectral imaging using a color camera and its application for pathogen detection
Yoon, Seung-Chul; Shin, Tae-Sung; Heitschmidt, Gerald W.; Lawrence, Kurt C.; Park, Bosoon; Gamble, Gary
2015-02-01
This paper reports the results of a feasibility study for the development of a hyperspectral image recovery (reconstruction) technique using a RGB color camera and regression analysis in order to detect and classify colonies of foodborne pathogens. The target bacterial pathogens were the six representative non-O157 Shiga-toxin producing Escherichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) grown in Petri dishes of Rainbow agar. The purpose of the feasibility study was to evaluate whether a DSLR camera (Nikon D700) could be used to predict hyperspectral images in the wavelength range from 400 to 1,000 nm and even to predict the types of pathogens using a hyperspectral STEC classification algorithm that was previously developed. Unlike many other studies using color charts with known and noise-free spectra for training reconstruction models, this work used hyperspectral and color images, separately measured by a hyperspectral imaging spectrometer and the DSLR color camera. The color images were calibrated (i.e. normalized) to relative reflectance, subsampled and spatially registered to match with counterpart pixels in hyperspectral images that were also calibrated to relative reflectance. Polynomial multivariate least-squares regression (PMLR) was previously developed with simulated color images. In this study, partial least squares regression (PLSR) was also evaluated as a spectral recovery technique to minimize multicollinearity and overfitting. The two spectral recovery models (PMLR and PLSR) and their parameters were evaluated by cross-validation. The QR decomposition was used to find a numerically more stable solution of the regression equation. The preliminary results showed that PLSR was more effective especially with higher order polynomial regressions than PMLR. The best classification accuracy measured with an independent test set was about 90%. The results suggest the potential of cost-effective color imaging using hyperspectral image
Pathogen detection by the polymerase chain reaction
Energy Technology Data Exchange (ETDEWEB)
Chitpatima, S T; Settachan, D; Pornsilpatip, J; Visawapoka, U [Pramongkutklao College of Medicine, Bangkok (Thailand). Molecular Biology Lab.; Dvorak, D R [Amersham International Ltd., Singapore (Singapore)
1994-05-01
In recent years, significant advances in the knowledge of DNA and its make up have led to the development of a powerful technique called polymerase chain reaction (PCR). Since the advent of PCR, laboratories around the globe have been exploiting this technology to bridge limitations or to overcome common problems encountered in molecular biology techniques. In addition, this technology has been employed successfully in diagnostic and basic scientific research and development. The true potentials of this technology is realized in early detection of pathogens and genetic abnormalities. In this paper two PCR protocols are described. The first is for detection of HIV-1 DNA in blood, the other for detection of rabies virus RNA in brain cells. 6 refs, 3 figs, 1 tab.
Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR
Directory of Open Access Journals (Sweden)
Hansson Per
2005-11-01
Full Text Available Abstract Background Gremmeniella abietina (Lagerb. Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities.
Molecular biology of Ganoderma pathogenicity and diagnosis in coconut seedlings.
Kandan, A; Radjacommare, R; Ramanathan, A; Raguchander, T; Balasubramanian, P; Samiyappan, R
2009-01-01
The pathogenicity of Ganoderma boninense was tested on coconut seedlings under greenhouse conditions and infection confirmed by using immunological and molecular diagnostic tools. Desiccation of older leaves and the emergence of sporophores were observed from pathogen-inoculated seedlings, whereas a control seedling does not show any pathogenic symptoms. Mature sporophores were formed within 10-13 weeks after inoculation. Polyclonal antibodies raised against mycelial proteins of Ganoderma were used for detection of Ganoderma in infected field palm and seedlings through indirect enzyme-linked immunosorbent assay technique. We adopted dot-immunobinding assay for the detection of Ganoderma from greenhouse and field samples. Under nucleic-acid-based diagnosis, G. boninense (167 bp) was detected from artificially inoculated seedlings and infected field palms by polymerase chain reaction. Apart from these, histopathological studies also support the Ganoderma pathogenicity in coconut seedlings. The pathogenicity test and combination of all the three diagnostic methods for Ganoderma could be highly reliable, rapid, sensitive and effective screening of resistance in planting material in the future.
Qu, X S; Wanner, L A; Christ, B J
2011-03-01
To develop a multiplex real-time PCR assay using TaqMan probes for the simultaneous detection and discrimination of potato powdery scab and common scab, two potato tuber diseases with similar symptoms, and the causal pathogens Spongospora subterranea and plant pathogenic Streptomyces spp. Real-time PCR primers and a probe for S. subterranea were designed based on the DNA sequence of the ribosomal RNA ITS2 region. Primers and a probe for pathogenic Streptomyces were designed based on the DNA sequence of the txtAB genes. The two sets of primer pairs and probes were used in a single real-time PCR assay. The multiplex real-time PCR assay was confirmed to be specific for S. subterranea and pathogenic Streptomyces. The assay detected DNA quantities of 100 fg for each of the two pathogens and linear responses and high correlation coefficients between the amount of DNA and C(t) values for each pathogen were achieved. The presence of two sets of primer pairs and probes and of plant extracts did not alter the sensitivity and efficiency of multiplex PCR amplification. Using the PCR assay, we could discriminate between powdery scab and common scab tubers with similar symptoms. Common scab and powdery scab were detected in some tubers with no visible symptoms. Mixed infections of common scab and powdery scab on single tubers were also revealed. This multiplex real-time PCR assay is a rapid, cost efficient, specific and sensitive tool for the simultaneous detection and discrimination of the two pathogens on infected potato tubers when visual symptoms are inconclusive or not present. Accurate and quick identification and discrimination of the cause of scab diseases on potatoes will provide critical information to potato growers and researchers for disease management. This is important because management strategies for common and powdery scab diseases are very different. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.
Directory of Open Access Journals (Sweden)
L. Schena
2004-08-01
Full Text Available Conventional and Scorpion primers were designed from the ITS regions to identify Rosellinia necatrix, Phytophthora nicotianae, and P. citrophthora and from the IGS regions to identify Verticillium dahliae and V. alboatrum. Specificity of primers and probes was assessed using genomic DNA from a large number of fungi from several hosts and by means of BLAST analyses, to exclude the presence of similar sequences in other micro-organisms among available DNA databases (GenBank. Simple and rapid procedures for DNA extraction from naturally infected matrices (soils, roots, bark, and/or woody tissues were utilised to yield DNA of a purity and quality suitable for PCR assays. Combining these protocols with a double amplification (nested Scorpion-PCR, the real-time detection of these pathogens was possible from naturally infested soils and from infected citrus roots (P. nicotianae and P. citrophthora, from the roots and bark of stone fruits and olive (R. necatrix and from olive branches (V. dahliae. For target pathogens, the limit of detection was 1 pg µl-1 in Scorpion-PCR and 1 fg µl-1 in nested Scorpion-PCR. High and significant correlations between pathogen propagule concentrations and real-time PCR cycle thresholds (Ct were obtained. Moreover, specific tests with R. necatrix seem to indicate that its DNA is quite rapidly degraded in the soil, excluding the risk of false positives due to the presence of dead cells.
Methods for detecting pathogens in the beef food chain: detecting particular pathogens
The main food-borne pathogens of concern in the beef food chain are Shiga toxin-producing Escherichia coli (STEC) and Salmonella spp.; however, the presence of other pathogens, including Listeria monocytogenes, Campylobacter spp., Clostridium spp., Bacillus cereus, and Mycobacterium avium subsp. par...
Nested PCR Assay for Eight Pathogens: A Rapid Tool for Diagnosis of Bacterial Meningitis.
Bhagchandani, Sharda P; Kubade, Sushant; Nikhare, Priyanka P; Manke, Sonali; Chandak, Nitin H; Kabra, Dinesh; Baheti, Neeraj N; Agrawal, Vijay S; Sarda, Pankaj; Mahajan, Parikshit; Ganjre, Ashish; Purohit, Hemant J; Singh, Lokendra; Taori, Girdhar M; Daginawala, Hatim F; Kashyap, Rajpal S
2016-02-01
Bacterial meningitis is a dreadful infectious disease with a high mortality and morbidity if remained undiagnosed. Traditional diagnostic methods for bacterial meningitis pose a challenge in accurate identification of pathogen, making prognosis difficult. The present study is therefore aimed to design and evaluate a specific and sensitive nested 16S rDNA genus-based polymerase chain reaction (PCR) assay using clinical cerebrospinal fluid (CSF) for rapid diagnosis of eight pathogens causing the disease. The present work was dedicated to development of an in-house genus specific 16S rDNA nested PCR covering pathogens of eight genera responsible for causing bacterial meningitis using newly designed as well as literature based primers for respective genus. A total 150 suspected meningitis CSF obtained from the patients admitted to Central India Institute of Medical Sciences (CIIMS), India during the period from August 2011 to May 2014, were used to evaluate clinical sensitivity and clinical specificity of optimized PCR assays. The analytical sensitivity and specificity of our newly designed genus-specific 16S rDNA PCR were found to be ≥92%. With such a high sensitivity and specificity, our in-house nested PCR was able to give 100% sensitivity in clinically confirmed positive cases and 100% specificity in clinically confirmed negative cases indicating its applicability in clinical diagnosis. Our in-house nested PCR system therefore can diagnose the accurate pathogen causing bacterial meningitis and therefore be useful in selecting a specific treatment line to minimize morbidity. Results are obtained within 24 h and high sensitivity makes this nested PCR assay a rapid and accurate diagnostic tool compared to traditional culture-based methods.
Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.
Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R
2001-10-01
Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.
Minguzzi, Stefano; Terlizzi, Federica; Lanzoni, Chiara; Poggi Pollini, Carlo; Ratti, Claudio
2016-01-01
Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum ('Ca. P. prunorum') detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor 'Ca. P. prunorum' infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect 'Ca. P. prunorum' and Plum pox virus (PPV) in Prunus.
SERS based point-of-care detection of food-borne pathogens
International Nuclear Information System (INIS)
Mungroo, Nawfal Adam; Oliveira, Gustavo; Neethirajan, Suresh
2016-01-01
The authors have developed a microfluidic platform for improved detection of pathogenic bacteria by using silver nanoparticles and new platforms for chemometric data analysis, viz. a combination of principle component analysis and linear discriminant analysis. The method can distinguish eight key food borne pathogens (E. coli, S. typhimirium, S. enteritis, Pseudomonas aeruginosa, L. monocytogenes, L. innocua, MRSA 35 and MRSA 86) and, hence, holds good promise for use in the food industry. (author)
Cai, Xian-Quan; Yu, Hai-Qiong; Li, Rong; Yue, Qiao-Yun; Liu, Guo-Hua; Bai, Jian-Shan; Deng, Yan; Qiu, De-Yi; Zhu, Xing-Quan
2014-01-01
Clonorchis sinensis and Opisthorchis viverrini are both important fish-borne pathogens, causing serious public health problem in Asia. The present study developed an assay integrating real-time PCR and high resolution melting (HRM) analysis for the specific detection and rapid identification of C. sinensis and O. viverrini. Primers targeting COX1 gene were highly specific for these liver flukes, as evidenced by the negative amplification of closely related trematodes. Assays using genomic DNA...
CONDUCTING-POLYMER NANOWIRE IMMUNOSENSOR ARRAYS FOR MICROBIAL PATHOGENS
The lack of methods for routine rapid and sensitive detection and quantification of specific pathogens has limited the amount of information available on their occurrence in drinking water and other environmental samples. The nanowire biosensor arrays developed in this study w...
Implementation of microfluidic sandwich ELISA for superior detection of plant pathogens.
Thaitrong, Numrin; Charlermroj, Ratthaphol; Himananto, Orawan; Seepiban, Channarong; Karoonuthaisiri, Nitsara
2013-01-01
Rapid and economical screening of plant pathogens is a high-priority need in the seed industry. Crop quality control and disease surveillance demand early and accurate detection in addition to robustness, scalability, and cost efficiency typically required for selective breeding and certification programs. Compared to conventional bench-top detection techniques routinely employed, a microfluidic-based approach offers unique benefits to address these needs simultaneously. To our knowledge, this work reports the first attempt to perform microfluidic sandwich ELISA for Acidovorax citrulli (Ac), watermelon silver mottle virus (WSMoV), and melon yellow spot virus (MYSV) screening. The immunoassay occurs on the surface of a reaction chamber represented by a microfluidic channel. The capillary force within the microchannel draws a reagent into the reaction chamber as well as facilitates assay incubation. Because the underlying pad automatically absorbs excess fluid, the only operation required is sequential loading of buffers/reagents. Buffer selection, antibody concentrations, and sample loading scheme were optimized for each pathogen. Assay optimization reveals that the 20-folds lower sample volume demanded by the microchannel structure outweighs the 2- to 4-folds higher antibody concentrations required, resulting in overall 5-10 folds of reagent savings. In addition to cutting the assay time by more than 50%, the new platform offers 65% cost savings from less reagent consumption and labor cost. Our study also shows 12.5-, 2-, and 4-fold improvement in assay sensitivity for Ac, WSMoV, and MYSV, respectively. Practical feasibility is demonstrated using 19 real plant samples. Given a standard 96-well plate format, the developed assay is compatible with commercial fluorescent plate readers and readily amendable to robotic liquid handling systems for completely hand-free assay automation.
Implementation of microfluidic sandwich ELISA for superior detection of plant pathogens.
Directory of Open Access Journals (Sweden)
Numrin Thaitrong
Full Text Available Rapid and economical screening of plant pathogens is a high-priority need in the seed industry. Crop quality control and disease surveillance demand early and accurate detection in addition to robustness, scalability, and cost efficiency typically required for selective breeding and certification programs. Compared to conventional bench-top detection techniques routinely employed, a microfluidic-based approach offers unique benefits to address these needs simultaneously. To our knowledge, this work reports the first attempt to perform microfluidic sandwich ELISA for Acidovorax citrulli (Ac, watermelon silver mottle virus (WSMoV, and melon yellow spot virus (MYSV screening. The immunoassay occurs on the surface of a reaction chamber represented by a microfluidic channel. The capillary force within the microchannel draws a reagent into the reaction chamber as well as facilitates assay incubation. Because the underlying pad automatically absorbs excess fluid, the only operation required is sequential loading of buffers/reagents. Buffer selection, antibody concentrations, and sample loading scheme were optimized for each pathogen. Assay optimization reveals that the 20-folds lower sample volume demanded by the microchannel structure outweighs the 2- to 4-folds higher antibody concentrations required, resulting in overall 5-10 folds of reagent savings. In addition to cutting the assay time by more than 50%, the new platform offers 65% cost savings from less reagent consumption and labor cost. Our study also shows 12.5-, 2-, and 4-fold improvement in assay sensitivity for Ac, WSMoV, and MYSV, respectively. Practical feasibility is demonstrated using 19 real plant samples. Given a standard 96-well plate format, the developed assay is compatible with commercial fluorescent plate readers and readily amendable to robotic liquid handling systems for completely hand-free assay automation.
Czech Academy of Sciences Publication Activity Database
Růžička, F.; Holá, V.; Horká, Marie
2004-01-01
Roč. 10, Suppl. 3 (2004), s. 621-622 ISSN 1198-743X. [14th ECCMID. European Congress of Clinical Microbiology and Infectious Diseases /14./. Praha, 01.05.2004-04.05.2004] R&D Projects: GA AV ČR IAA4031302 Institutional research plan: CEZ:AV0Z4031919 Keywords : electromigration techniques * identification * pathogens Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 2.361, year: 2004
Rapid detection of single E. coli bacteria using a graphene-based field-effect transistor device.
Thakur, Bhawana; Zhou, Guihua; Chang, Jingbo; Pu, Haihui; Jin, Bing; Sui, Xiaoyu; Yuan, Xiaochen; Yang, Ching-Hong; Magruder, Matthew; Chen, Junhong
2018-07-01
Contamination of surface and drinking water due to the presence of Escherichia coli bacteria is a major cause of water-borne disease outbreak. To address unmet challenges for practical pathogen detection in contaminated samples, we report fabrication of thermally reduced graphene oxide-based field-effect transistor (rGO FET) passivated with an ultrathin layer of Al 2 O 3 for real-time detection of E. coli bacteria. The sensor could detect a single E. coli cell within 50 s in a 1 µL sample volume. The ultrathin layer of Al 2 O 3 acted as a barrier between rGO and potential interferents present in the sample. E. coli specific antibodies anchored on gold nanoparticles acted as probes for selective capture of E. coli. The high density of negative charge on the surface of E. coli cells strongly modulates the concentration of majority charge carriers in the rGO monolayer, thereby allowing real-time monitoring of E. coli concentration in a given sample. With a low detection limit of single cell, the FET sensor had a linear range of 1-100 CFU in 1 µL volume of sample (i.e., 10 3 to 10 5 CFU/ mL). The biosensor with good selectivity and rapid detection was further successfully demonstrated for E. coli sensing in river water. The rGO-based FET sensor provides a low cost and label-free approach, and can be mass produced for detection of a broad spectrum of pathogens in water or other liquid media. Copyright © 2018 Elsevier B.V. All rights reserved.
Jeon, Jin-Woo; Kim, Jee-Hyun; Lee, Jong-Mook; Lee, Won-Ho; Lee, Do-Young; Paek, Se-Hwan
2014-02-15
To realize an inexpensive, pocket-sized immunosensor system, a rapid test devise based on cross-flow immuno-chromatography was physically combined with a lens-free CMOS image sensor (CIS), which was then applied to the detection of the food-borne pathogen, Salmonella typhimurium (S. typhimurium). Two CISs, each retaining 1.3 mega pixel array, were mounted on a printed circuit board to fabricate a disposable sensing module, being connectable with a signal detection system. For the bacterial analysis, a cellulose membrane-based immunosensing platform, ELISA-on-a-chip (EOC), was employed, being integrated with the CIS module, and the antigen-antibody reaction sites were aligned with the respective sensor. In such sensor construction, the chemiluminescent signals produced from the EOC are transferred directly into the sensors and are converted to electric signals on the detector. The EOC-CIS integrated sensor was capable of detecting a traceable amount of the bacterium (4.22 × 10(3)CFU/mL), nearly comparable to that adopting a sophisticated detector such as cooled-charge-coupled device, while having greatly reduced dimensions and cost. Upon coupling with immuno-magnetic separation, the sensor showed an additional 67-fold enhancement in the detection limit. Furthermore, a real sample test was carried out for fish muscles inoculated with a sample of 3.3CFU S. typhimurium per 10 g, which was able to be detected earlier than 6h after the onset of pre-enrichment by culture. © 2013 Elsevier B.V. All rights reserved.
Fluorescence techniques to detect and to assess viability of plant pathogenic bacteria
Chitarra, L.G.
2001-01-01
Plant pathogenic bacteria cause major economic losses in commercial crop production worldwide every year. The current methods used to detect and to assess the viability of bacterial pathogens and to test seed lots or plants for contamination are usually based on plate assays or on
Genes under positive selection in a model plant pathogenic fungus, Botrytis.
Aguileta, Gabriela; Lengelle, Juliette; Chiapello, Hélène; Giraud, Tatiana; Viaud, Muriel; Fournier, Elisabeth; Rodolphe, François; Marthey, Sylvain; Ducasse, Aurélie; Gendrault, Annie; Poulain, Julie; Wincker, Patrick; Gout, Lilian
2012-07-01
The rapid evolution of particular genes is essential for the adaptation of pathogens to new hosts and new environments. Powerful methods have been developed for detecting targets of selection in the genome. Here we used divergence data to compare genes among four closely related fungal pathogens adapted to different hosts to elucidate the functions putatively involved in adaptive processes. For this goal, ESTs were sequenced in the specialist fungal pathogens Botrytis tulipae and Botrytis ficariarum, and compared with genome sequences of Botrytis cinerea and Sclerotinia sclerotiorum, responsible for diseases on over 200 plant species. A maximum likelihood-based analysis of 642 predicted orthologs detected 21 genes showing footprints of positive selection. These results were validated by resequencing nine of these genes in additional Botrytis species, showing they have also been rapidly evolving in other related species. Twenty of the 21 genes had not previously been identified as pathogenicity factors in B. cinerea, but some had functions related to plant-fungus interactions. The putative functions were involved in respiratory and energy metabolism, protein and RNA metabolism, signal transduction or virulence, similarly to what was detected in previous studies using the same approach in other pathogens. Mutants of B. cinerea were generated for four of these genes as a first attempt to elucidate their functions. Copyright © 2012 Elsevier B.V. All rights reserved.
Rapid qualitative urinary tract infection pathogen identification by SeptiFast real-time PCR.
Directory of Open Access Journals (Sweden)
Lutz E Lehmann
2011-02-01
Full Text Available Urinary tract infections (UTI are frequent in outpatients. Fast pathogen identification is mandatory for shortening the time of discomfort and preventing serious complications. Urine culture needs up to 48 hours until pathogen identification. Consequently, the initial antibiotic regimen is empirical.To evaluate the feasibility of qualitative urine pathogen identification by a commercially available real-time PCR blood pathogen test (SeptiFast® and to compare the results with dipslide and microbiological culture.Pilot study with prospectively collected urine samples.University hospital.82 prospectively collected urine samples from 81 patients with suspected UTI were included. Dipslide urine culture was followed by microbiological pathogen identification in dipslide positive samples. In parallel, qualitative DNA based pathogen identification (SeptiFast® was performed in all samples.61 samples were SeptiFast® positive, whereas 67 samples were dipslide culture positive. The inter-methodological concordance of positive and negative findings in the gram+, gram- and fungi sector was 371/410 (90%, 477/492 (97% and 238/246 (97%, respectively. Sensitivity and specificity of the SeptiFast® test for the detection of an infection was 0.82 and 0.60, respectively. SeptiFast® pathogen identifications were available at least 43 hours prior to culture results.The SeptiFast® platform identified bacterial DNA in urine specimens considerably faster compared to conventional culture. For UTI diagnosis sensitivity and specificity is limited by its present qualitative setup which does not allow pathogen quantification. Future quantitative assays may hold promise for PCR based UTI pathogen identification as a supplementation of conventional culture methods.
Detection of foodborne pathogens by qPCR: A practical approach for food industry applications
Directory of Open Access Journals (Sweden)
María-José Chapela
2015-12-01
Full Text Available Microbiological analysis of food is an integrated part of microbial safety management in the food chain. Monitoring and controlling foodborne pathogens are traditionally carried out by conventional microbiological methods based on culture-dependent approaches in control laboratories and private companies. However, polymerase chain reaction (PCR has revolutionized microbiological analysis allowing detection of pathogenic microorganisms in food, without the necessity of classical isolation and identification. However, at present, PCR and quantitative polymerase chain reaction (qPCR are essential analytical tools for researchers working in the field of foodborne pathogens. This manuscript reviews recently described qPCR methods applied for foodborne bacteria detection, serving as economical, safe, and reliable alternatives for application in the food industry and control laboratories. Multiplex qPCR, which allows the simultaneous detection of more than one pathogen in one single reaction, saving considerable effort, time, and money, is emphasized in the article.
Energy Technology Data Exchange (ETDEWEB)
Hagan, Bethany S.; Bruckner-Lea, Cynthia J.
2002-12-01
This project was focused on developing and testing automated routines for a microfluidic Pathogen Detection System. The basic pathogen detection routine has three primary components; cell concentration, DNA amplification, and detection. In cell concentration, magnetic beads are held in a flow cell by an electromagnet. Sample liquid is passed through the flow cell and bacterial cells attach to the beads. These beads are then released into a small volume of fluid and delivered to the peltier device for cell lysis and DNA amplification. The cells are lysed during initial heating in the peltier device, and the released DNA is amplified using polymerase chain reaction (PCR) or strand displacement amplification (SDA). Once amplified, the DNA is then delivered to a laser induced fluorescence detection unit in which the sample is detected. These three components create a flexible platform that can be used for pathogen detection in liquid and sediment samples. Future developments of the system will include on-line DNA detection during DNA amplification and improved capture and release methods for the magnetic beads during cell concentration.
DEFF Research Database (Denmark)
Sun, Yi; Than Linh, Quyen; Hung, Tran Quang
2015-01-01
was capable to detect Salmonella at concentration of 50 cells per test within 40 min. The simple design, together with high level of integration, isothermal amplification, and quantitative analysis of multiple samples in short time will greatly enhance the practical applicability of the LOC system for rapid...... amplification (LAMP) for rapid and quantitative detection of Salmonella spp. in food samples. The whole diagnostic procedures including DNA isolation, isothermal amplification, and real-time detection were accomplished in a single chamber. Up to eight samples could be handled simultaneously and the system...... and usually take a few hours to days to complete. In response to the demand for rapid on line or at site detection of pathogens, in this study, we describe for the first time an eight-chamber lab-on-a-chip (LOC) system with integrated magnetic beads-based sample preparation and loop-mediated isothermal...
Imperfect pathogen detection from non-invasive skin swabs biases disease inference
DiRenzo, Graziella V.; Grant, Evan H. Campbell; Longo, Ana; Che-Castaldo, Christian; Zamudio, Kelly R.; Lips, Karen
2018-01-01
1. Conservation managers rely on accurate estimates of disease parameters, such as pathogen prevalence and infection intensity, to assess disease status of a host population. However, these disease metrics may be biased if low-level infection intensities are missed by sampling methods or laboratory diagnostic tests. These false negatives underestimate pathogen prevalence and overestimate mean infection intensity of infected individuals. 2. Our objectives were two-fold. First, we quantified false negative error rates of Batrachochytrium dendrobatidis on non-invasive skin swabs collected from an amphibian community in El Copé, Panama. We swabbed amphibians twice in sequence, and we used a recently developed hierarchical Bayesian estimator to assess disease status of the population. Second, we developed a novel hierarchical Bayesian model to simultaneously account for imperfect pathogen detection from field sampling and laboratory diagnostic testing. We evaluated the performance of the model using simulations and varying sampling design to quantify the magnitude of bias in estimates of pathogen prevalence and infection intensity. 3. We show that Bd detection probability from skin swabs was related to host infection intensity, where Bd infections information in advance, we advocate that the most cautious approach is to assume all errors are possible and to accommodate them by adjusting sampling designs. The modeling framework presented here improves the accuracy in estimating pathogen prevalence and infection intensity.
Iván, Kristóf; Maráz, Anna
2015-12-20
Detection and identification of food-borne pathogenic bacteria are key points for the assurance of microbiological food safety. Traditional culture-based methods are more and more replaced by or supplemented with nucleic acid based molecular techniques, targeting specific (preferably virulence) genes in the genomes. Internationally validated DNA amplification - most frequently real-time polymerase chain reaction - methods are applied by the food microbiological testing laboratories for routine analysis, which will result not only in shortening the time for results but they also improve the performance characteristics (e.g. sensitivity, specificity) of the methods. Beside numerous advantages of the polymerase chain reaction based techniques for routine microbiological analysis certain drawbacks have to be mentioned, such as the high cost of the equipment and reagents, as well as the risk of contamination of the laboratory environment by the polymerase chain reaction amplicons, which require construction of an isolated laboratory system. Lab-on-a-chip systems can integrate most of these laboratory processes within a miniaturized device that delivers the same specificity and reliability as the standard protocols. The benefits of miniaturized devices are: simple - often automated - use, small overall size, portability, sterility due to single use possibility. These miniaturized rapid diagnostic tests are being researched and developed at the best research centers around the globe implementing various sample preparation and molecular DNA amplification methods on-chip. In parallel, the aim of the authors' research is to develop microfluidic Lab-on-a-chip devices for the detection and identification of food-borne pathogenic bacteria.
Directory of Open Access Journals (Sweden)
Daniel Spira
Full Text Available To search for imaging characteristics distinguishing patients with successful from those with futile microbiological pathogen detection by CT-guided biopsy in suspected spondylodiscitis.34 consecutive patients with suspected spondylodiscitis underwent CT-guided biopsy for pathogen detection. MR-images were assessed for inflammatory infiltration of disks, adjacent vertebrae, epidural and paravertebral space. CT-images were reviewed for arrosion of adjacent end plates and reduced disk height. Biopsy samples were sent for microbiological examination in 34/34 patients, and for additional histological analysis in 28/34 patients.Paravertebral infiltration was present in all 10/10 patients with positive microbiology and occurred in only 12/24 patients with negative microbiology, resulting in a sensitivity of 100% and a specificity of 50% for pathogen detection. Despite its limited sensitivities, epidural infiltration and paravertebral abscesses showed considerably higher specificities of 83.3% and 90.9%, respectively. Paravertebral infiltration was more extensive in patients with positive as compared to negative microbiology (p = 0.002. Even though sensitivities for pathogen detection were also high in case of vertebral and disk infiltration, or end plate arrosion, specificities remained below 10%.Inflammatory infiltration of the paravertebral space indicated successful pathogen detection by CT-guided biopsy. Specificity was increased by the additional occurrence of epidural infiltration or paravertebral abscesses.
Brown-Elliott, Barbara A.; Wallace, Richard J.
2002-01-01
The history, taxonomy, geographic distribution, clinical disease, and therapy of the pathogenic nonpigmented or late-pigmenting rapidly growing mycobacteria (RGM) are reviewed. Community-acquired disease and health care-associated disease are highlighted for each species. The latter grouping includes health care-associated outbreaks and pseudo-outbreaks as well as sporadic disease cases. Treatment recommendations for each species and type of disease are also described. Special emphasis is on ...
Dobhal, S; Zhang, G; Rohla, C; Smith, M W; Ma, L M
2014-10-01
PCR is widely used in the routine detection of foodborne human pathogens; however, challenges remain in overcoming PCR inhibitors present in some sample matrices. The objective of this study was to develop a simple, sensitive, cost-effective and rapid method for processing large numbers of environmental and pecan samples for Salmonella detection. This study was also aimed at validation of a new protocol for the detection of Salmonella from in-shell pecans. Different DNA template preparation methods, including direct boiling, prespin, multiple washing and commercial DNA extraction kits, were evaluated with pure cultures of Salmonella Typhimurium and with enriched soil, cattle feces and in-shell pecan each spiked individually with Salmonella Typhimurium. PCR detection of Salmonella was conducted using invA and 16S rRNA gene (internal amplification control) specific primers. The effect of amplification facilitators, including bovine serum albumin (BSA), polyvinylpyrrolidone (PVP), polyethylene glycol (PEG) and gelatin on PCR sensitivity, was also evaluated. Conducting a prespin of sample matrices in combination with the addition of 0·4% (w/v) BSA and 1% (w/v) PVP in PCR mix was the simplest, most rapid, cost-effective and sensitive method for PCR detection of Salmonella, with up to 40 CFU Salmonella per reaction detectable in the presence of over 10(9 ) CFU ml(-1) of background micro-organisms from enriched feces soil or pecan samples. The developed method is rapid, cost-effective and sensitive for detection of Salmonella from different matrices. This study provides a method with broad applicability for PCR detection of Salmonella in complex sample matrices. This method has a potential for its application in different research arenas and diagnostic laboratories. © 2014 The Society for Applied Microbiology.
Sooter, Letha J.; Stratis-Cullum, Dimitra N.; Zhang, Yanting; Daugherty, Patrick S.; Soh, H. Tom; Pellegrino, Paul; Stagliano, Nancy
2007-09-01
Immunochromatography is a rapid, reliable, and cost effective method of detecting biowarfare agents. The format is similar to that of an over-the-counter pregnancy test. A sample is applied to one end of a cassette and then a control line, and possibly a sample line, are visualized at the other end of the cassette. The test is based upon a sandwich assay. For the control, a line of Protein A is immobilized on the membrane. Gold nanoparticle bound IgG flows through the membrane and binds the Protein A, creating a visible line on the membrane. For the sample, one epitope is immobilized on the membrane and another epitope is attached to gold nanoparticles. The sample binds gold bound epitope, travels through the membrane, and binds membrane bound epitope. The two epitopes are not cross-reactive, therefore a sample line is only visible if the sample is present. In order to efficiently screen for binders to a sample target, a novel, Continuous Magnetic Activated Cell Sorter (CMACS) has been developed on a disposable, microfluidic platform. The CMACS chip quickly sorts E. coli peptide libraries for target binders with high affinity. Peptide libraries, are composed of approximately ten million bacteria, each displaying a different peptide on their surface. The target of interest is conjugated to a micrometer sized magnetic particle. After the library and the target are incubated together to allow binding, the mixture is applied to the CMACS chip. In the presence of patterned nickel and an external magnet, separation occurs of the bead-bound bacteria from the bulk material. The bead fraction is added to bacterial growth media where any attached E. coli grow and divide. These cells are cloned, sequenced, and the peptides are assayed for target binding affinity. As a proof-of-principle, assays were developed for human C-reactive protein. More defense relevant targets are currently being pursued.
Detection of multiple potentially pathogenic bacteria in Matang mangrove estuaries, Malaysia.
Ghaderpour, Aziz; Mohd Nasori, Khairul Nazrin; Chew, Li Lee; Chong, Ving Ching; Thong, Kwai Lin; Chai, Lay Ching
2014-06-15
The deltaic estuarine system of the Matang Mangrove Forest Reserve of Malaysia is a site where several human settlements and brackish water aquaculture have been established. Here, we evaluated the level of fecal indicator bacteria (FIB) and the presence of potentially pathogenic bacteria in the surface water and sediments. Higher levels of FIB were detected at downstream sampling sites from the fishing village, indicating it as a possible source of anthropogenic pollution to the estuary. Enterococci levels in the estuarine sediments were higher than in the surface water, while total coliforms and E. coli in the estuarine sediments were not detected in all samples. Also, various types of potentially pathogenic bacteria, including Klebsiella pneumoniae, Serratia marcescens and Enterobacter cloacae were isolated. The results indicate that the Matang estuarine system is contaminated with various types of potential human bacterial pathogens which might pose a health risk to the public. Copyright © 2014 Elsevier Ltd. All rights reserved.
Rapid detection of E. coli on goat meat by electronic nose
Much attention has been paid on the foodborne illness of food, which is easily contaminated with bacterial or pathogens. Escherichia coli (E. coli) is one of these bacterial that commonly live in the contaminated animal meat. There is a growing need in the food industry for pathogen detection syst...
Towards On-site Pathogen Detection Using Antibody-based Sensors
DEFF Research Database (Denmark)
Skottrup, Peter Durand; Nicolaisen, Mogens; Justesen, Annemarie Fejer
2008-01-01
In this paper the recent progress within biosensors for plant pathogen detection will be reviewed. Bio-recognition layers on sensors can be designed in various ways, however the most popular approach is to immobilise antibodies for specific capture of analytes. Focus will be put on antibody surfa...
Rapid detection of SMARCB1 sequence variation using high resolution melting
Directory of Open Access Journals (Sweden)
Ashley David M
2009-12-01
Full Text Available Abstract Background Rhabdoid tumors are rare cancers of early childhood arising in the kidney, central nervous system and other organs. The majority are caused by somatic inactivating mutations or deletions affecting the tumor suppressor locus SMARCB1 [OMIM 601607]. Germ-line SMARCB1 inactivation has been reported in association with rhabdoid tumor, epitheloid sarcoma and familial schwannomatosis, underscoring the importance of accurate mutation screening to ascertain recurrence and transmission risks. We describe a rapid and sensitive diagnostic screening method, using high resolution melting (HRM, for detecting sequence variations in SMARCB1. Methods Amplicons, encompassing the nine coding exons of SMARCB1, flanking splice site sequences and the 5' and 3' UTR, were screened by both HRM and direct DNA sequencing to establish the reliability of HRM as a primary mutation screening tool. Reaction conditions were optimized with commercially available HRM mixes. Results The false negative rate for detecting sequence variants by HRM in our sample series was zero. Nine amplicons out of a total of 140 (6.4% showed variant melt profiles that were subsequently shown to be false positive. Overall nine distinct pathogenic SMARCB1 mutations were identified in a total of 19 possible rhabdoid tumors. Two tumors had two distinct mutations and two harbored SMARCB1 deletion. Other mutations were nonsense or frame-shifts. The detection sensitivity of the HRM screening method was influenced by both sequence context and specific nucleotide change and varied from 1: 4 to 1:1000 (variant to wild-type DNA. A novel method involving digital HRM, followed by re-sequencing, was used to confirm mutations in tumor specimens containing associated normal tissue. Conclusions This is the first report describing SMARCB1 mutation screening using HRM. HRM is a rapid, sensitive and inexpensive screening technology that is likely to be widely adopted in diagnostic laboratories to
Rapid detection of SMARCB1 sequence variation using high resolution melting
International Nuclear Information System (INIS)
Dagar, Vinod; Chow, Chung-Wo; Ashley, David M; Algar, Elizabeth M
2009-01-01
Rhabdoid tumors are rare cancers of early childhood arising in the kidney, central nervous system and other organs. The majority are caused by somatic inactivating mutations or deletions affecting the tumor suppressor locus SMARCB1 [OMIM 601607]. Germ-line SMARCB1 inactivation has been reported in association with rhabdoid tumor, epitheloid sarcoma and familial schwannomatosis, underscoring the importance of accurate mutation screening to ascertain recurrence and transmission risks. We describe a rapid and sensitive diagnostic screening method, using high resolution melting (HRM), for detecting sequence variations in SMARCB1. Amplicons, encompassing the nine coding exons of SMARCB1, flanking splice site sequences and the 5' and 3' UTR, were screened by both HRM and direct DNA sequencing to establish the reliability of HRM as a primary mutation screening tool. Reaction conditions were optimized with commercially available HRM mixes. The false negative rate for detecting sequence variants by HRM in our sample series was zero. Nine amplicons out of a total of 140 (6.4%) showed variant melt profiles that were subsequently shown to be false positive. Overall nine distinct pathogenic SMARCB1 mutations were identified in a total of 19 possible rhabdoid tumors. Two tumors had two distinct mutations and two harbored SMARCB1 deletion. Other mutations were nonsense or frame-shifts. The detection sensitivity of the HRM screening method was influenced by both sequence context and specific nucleotide change and varied from 1: 4 to 1:1000 (variant to wild-type DNA). A novel method involving digital HRM, followed by re-sequencing, was used to confirm mutations in tumor specimens containing associated normal tissue. This is the first report describing SMARCB1 mutation screening using HRM. HRM is a rapid, sensitive and inexpensive screening technology that is likely to be widely adopted in diagnostic laboratories to facilitate whole gene mutation screening
High Throughput Sequencing for Detection of Foodborne Pathogens
Directory of Open Access Journals (Sweden)
Camilla Sekse
2017-10-01
Full Text Available High-throughput sequencing (HTS is becoming the state-of-the-art technology for typing of microbial isolates, especially in clinical samples. Yet, its application is still in its infancy for monitoring and outbreak investigations of foods. Here we review the published literature, covering not only bacterial but also viral and Eukaryote food pathogens, to assess the status and potential of HTS implementation to inform stakeholders, improve food safety and reduce outbreak impacts. The developments in sequencing technology and bioinformatics have outpaced the capacity to analyze and interpret the sequence data. The influence of sample processing, nucleic acid extraction and purification, harmonized protocols for generation and interpretation of data, and properly annotated and curated reference databases including non-pathogenic “natural” strains are other major obstacles to the realization of the full potential of HTS in analytical food surveillance, epidemiological and outbreak investigations, and in complementing preventive approaches for the control and management of foodborne pathogens. Despite significant obstacles, the achieved progress in capacity and broadening of the application range over the last decade is impressive and unprecedented, as illustrated with the chosen examples from the literature. Large consortia, often with broad international participation, are making coordinated efforts to cope with many of the mentioned obstacles. Further rapid progress can therefore be prospected for the next decade.
Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...
Directory of Open Access Journals (Sweden)
Stürenburg, Enno
2009-07-01
Full Text Available Methicillin-resistant Staphylococcus aureus (MRSA isolates is a serious public health problem whose ever-increasing rate is commensurate with the pressure it is exerting on the healthcare system. At present, more than 20% of clinical S. aureus isolates in German hospitals are methicillin resistant. Strategies from low-prevalence countries show that this development is not necessarily inevitable. In the Scandinavian countries and the Netherlands, thanks to a rigorous prevention programme, MRSA prevalence has been kept at an acceptably low level (<1–3%. Central to these ‘search and destroy’ control strategies is an admission screening using several MRSA swabs taken from mucocutaneous colonisation sites of high-risk patients (‘MRSA surveillance’. It has also been reported that the speed with which MRSA carriage is detected has an important role to play, as it is a key component of any effective strategy to prevent the pathogen from spreading. Since MRSA culturing involves a 2–3 day delay before the final results are available, rapid detection techniques (commonly referred to as ‘MRSA rapid tests’ using PCR methods and, most recently, rapid culturing methods have been developed. The implementation of rapid tests reduces the time of detection of MRSA carriers from 48–72 to 2–5 h. Clinical evaluation data have shown that MRSA can thus be detected with very high sensitivity. Specificity however is sometimes impaired due to false-positive PCR signals occurring in mixed flora specimens. In order to rule out any false-positive PCR results, a culture screen must always be carried out simultaneously.The data provide preliminary evidence that a PCR assay can reduce nosocomial MRSA transmission in high-risk patients or high-risk areas, whereas an approach that screens all patients admitted to the hospital is probably not effective. Information concerning the cost-effectiveness of rapid MRSA tests is still sparse and thus the issue remains
Directory of Open Access Journals (Sweden)
Lovleen Tina Joshi
Full Text Available Clostridium difficile is the primary cause of antibiotic associated diarrhea in humans and is a significant cause of morbidity and mortality. Thus the rapid and accurate identification of this pathogen in clinical samples, such as feces, is a key step in reducing the devastating impact of this disease. The bacterium produces two toxins, A and B, which are thought to be responsible for the majority of the pathology associated with the disease, although the relative contribution of each is currently a subject of debate. For this reason we have developed a rapid detection assay based on microwave-accelerated metal-enhanced fluorescence which is capable of detecting the presence of 10 bacteria in unprocessed human feces within 40 seconds. These promising results suggest that this prototype biosensor has the potential to be developed into a rapid, point of care, real time diagnostic assay for C. difficile.
DEFF Research Database (Denmark)
Yoo, S. M.; Baek, Y. K.; Shin, S.
2016-01-01
We herein describe the development of a single-walled carbon nanotube (SWNT)-based electrical biosensor consisting of a two-terminal resistor, and report its use for the specific, label-free detection of pathogenic bacteria via changes in conductance. The ability of this biosensor to recognize...... different pathogenic bacteria was analyzed, and conditions were optimized with different probe concentrations. Using this system, the reference strains and clinical isolates of Staphylococcus aureus and Escherichia coli were successfully detected; in both cases, the sensor showed a detection limit of 10 CFU....... This SWNT-based electrical biosensor will prove useful for the development of highly sensitive and specific handheld pathogen detectors....
Directory of Open Access Journals (Sweden)
Kirill V Sergueev
Full Text Available BACKGROUND: Yersinia pestis, the agent of plague, has caused many millions of human deaths and still poses a serious threat to global public health. Timely and reliable detection of such a dangerous pathogen is of critical importance. Lysis by specific bacteriophages remains an essential method of Y. pestis detection and plague diagnostics. METHODOLOGY/PRINCIPAL FINDINGS: The objective of this work was to develop an alternative to conventional phage lysis tests--a rapid and highly sensitive method of indirect detection of live Y. pestis cells based on quantitative real-time PCR (qPCR monitoring of amplification of reporter Y. pestis-specific bacteriophages. Plague diagnostic phages phiA1122 and L-413C were shown to be highly effective diagnostic tools for the detection and identification of Y. pestis by using qPCR with primers specific for phage DNA. The template DNA extraction step that usually precedes qPCR was omitted. phiA1122-specific qPCR enabled the detection of an initial bacterial concentration of 10(3 CFU/ml (equivalent to as few as one Y. pestis cell per 1-microl sample in four hours. L-413C-mediated detection of Y. pestis was less sensitive (up to 100 bacteria per sample but more specific, and thus we propose parallel qPCR for the two phages as a rapid and reliable method of Y. pestis identification. Importantly, phiA1122 propagated in simulated clinical blood specimens containing EDTA and its titer rise was detected by both a standard plating test and qPCR. CONCLUSIONS/SIGNIFICANCE: Thus, we developed a novel assay for detection and identification of Y. pestis using amplification of specific phages monitored by qPCR. The method is simple, rapid, highly sensitive, and specific and allows the detection of only live bacteria.
Detection of mastitis pathogens by analysis of volatile bacterial metabolites
Hettinga, K.A.; Valenberg, van H.J.F.; Lam, T.J.G.M.; Hooijdonk, van A.C.M.
2008-01-01
The ability to detect mastitis pathogens based on their volatile metabolites was studied. Milk samples from cows with clinical mastitis, caused by Staphylococcus aureus, coagulase-negative staphylococci, Streptococcus uberis, Streptococcus dysgalactiae, and Escherichia coli were collected. In
Evaluating the use of dedicated swab for rapid antigen detection ...
African Journals Online (AJOL)
Evaluating the use of dedicated swab for rapid antigen detection testing in group a ... African Journal of Clinical and Experimental Microbiology ... Several generations of rapid antigen detection tests (RADTs) have been developed to facilitate ...
Directory of Open Access Journals (Sweden)
Bettina Stieber
Full Text Available S. aureus is a pathogen in humans and animals that harbors a wide variety of virulence factors and resistance genes. This bacterium can cause a wide range of mild to life-threatening diseases. In the latter case, fast diagnostic procedures are important. In routine diagnostic laboratories, several genotypic and phenotypic methods are available to identify S. aureus strains and determine their resistances. However, there is a demand for multiplex routine diagnostic tests to directly detect staphylococcal toxins and proteins.In this study, an antibody microarray based assay was established and validated for the rapid detection of staphylococcal markers and exotoxins. The following targets were included: staphylococcal protein A, penicillin binding protein 2a, alpha- and beta-hemolysins, Panton Valentine leukocidin, toxic shock syndrome toxin, enterotoxins A and B as well as staphylokinase. All were detected simultaneously within a single experiment, starting from a clonal culture on standard media. The detection of bound proteins was performed using a new fluorescence reading device for microarrays.110 reference strains and clinical isolates were analyzed using this assay, with a DNA microarray for genotypic characterization performed in parallel. The results showed a general high concordance of genotypic and phenotypic data. However, genotypic analysis found the hla gene present in all S. aureus isolates but its expression under given conditions depended on the clonal complex affiliation of the actual isolate.The multiplex antibody assay described herein allowed a rapid and reliable detection of clinically relevant staphylococcal toxins as well as resistance- and species-specific markers.
Wang, Chongwen; Gu, Bing; Liu, Qiqi; Pang, Yuanfeng; Xiao, Rui; Wang, Shengqi
2018-01-01
Pathogenic bacteria have always been a significant threat to human health. The detection of pathogens needs to be rapid, accurate, and convenient. We present a sensitive surface-enhanced Raman scattering (SERS) biosensor based on the combination of vancomycin-modified Ag-coated magnetic nanoparticles (Fe 3 O 4 @Ag-Van MNPs) and Au@Ag nanoparticles (NPs) that can effectively capture and discriminate bacterial pathogens from solution. The high-performance Fe 3 O 4 @Ag MNPs were modified with vancomycin and used as bacteria capturer for magnetic separation and enrichment. The modified MNPS were found to exhibit strong affinity with a broad range of Gram-positive and Gram-negative bacteria. After separating and rinsing bacteria, Fe 3 O 4 @Ag-Van MNPs and Au@Ag NPs were synergistically used to construct a very large number of hot spots on bacteria cells, leading to ultrasensitive SERS detection. The dominant merits of our dual enhanced strategy included high bacterial-capture efficiency (>65%) within a wide pH range (pH 3.0-11.0), a short assay time (<30 min), and a low detection limit (5×10 2 cells/mL). Moreover, the spiked tests show that this method is still valid in milk and blood samples. Owing to these capabilities, the combined system enabled the sensitive and specific discrimination of different pathogens in complex solution, as verified by its detection of Gram-positive bacterium Escherichia coli , Gram-positive bacterium Staphylococcus aureus , and methicillin-resistant S. aureus . This method has great potential for field applications in food safety, environmental monitoring, and infectious disease diagnosis.
Detection and identification of Staphylococcus aureus in raw milk by ...
African Journals Online (AJOL)
Staphylococcus aureus causes foodborne diseases if consumed in contaminated milk products. Rapid detection and characterization of foodborne pathogen S. aureus is crucial for epidemiological investigations and food safety surveillance. It is still a challenge to detect and identify bacterial pathogens quickly and ...
Maxson, Tucker; Mitchell, Douglas A.
2015-01-01
Antibiotics are a cornerstone of modern medicine and have significantly reduced the burden of infectious diseases. However, commonly used broad-spectrum antibiotics can cause major collateral damage to the human microbiome, causing complications ranging from antibiotic-associated colitis to the rapid spread of resistance. Employing narrower spectrum antibiotics targeting specific pathogens may alleviate this predicament as well as provide additional tools to expand an antibiotic repertoire th...
Directory of Open Access Journals (Sweden)
Anderson Messias Rodrigues
2015-12-01
Full Text Available Sporothrix infections are emerging as an important human and animal threat among otherwise healthy patients, especially in Brazil and China. Correct identification of sporotrichosis agents is beneficial for epidemiological surveillance, enabling implementation of adequate public-health policies and guiding antifungal therapy. In areas of limited resources where sporotrichosis is endemic, high-throughput detection methods that are specific and sensitive are preferred over phenotypic methods that usually result in misidentification of closely related Sporothrix species. We sought to establish rolling circle amplification (RCA as a low-cost screening tool for species-specific identification of human-pathogenic Sporothrix. We developed six species-specific padlock probes targeting polymorphisms in the gene encoding calmodulin. BLAST-searches revealed candidate probes that were conserved intraspecifically; no significant homology with sequences from humans, mice, plants or microorganisms outside members of Sporothrix were found. The accuracy of our RCA-based assay was demonstrated through the specificity of probe-template binding to 25 S. brasiliensis, 58 S. schenckii, 5 S. globosa, 1 S. luriei, 4 S. mexicana, and 3 S. pallida samples. No cross reactivity between closely related species was evident in vitro, and padlock probes yielded 100% specificity and sensitivity down to 3 x 10 6 copies of the target sequence. RCA-based speciation matched identifications via phylogenetic analysis of the gene encoding calmodulin and the rDNA operon (kappa 1.0; 95% confidence interval 1.0-1.0, supporting its use as a reliable alternative to DNA sequencing. This method is a powerful tool for rapid identification and specific detection of medically relevant Sporothrix, and due to its robustness has potential for ecological studies.
C. Villari; R.A. Sniezko; L.E. Rodriguez-Saona; P. Bonello
2017-01-01
A strong focus on tree germplasm that can resist threats such as non-native insects and pathogens, or a changing climate, is fundamental for successful genetic conservation efforts. However, the unavailability of tools for rapid screening of tree germplasm for resistance to critical pathogens and insect pests is becoming an increasingly serious bottleneck. Here we...
Zeng, Haijuan; Guo, Wenbo; Liang, Beibei; Li, Jianwu; Zhai, Xuzhao; Song, Chunmei; Zhao, Wenjun; Fan, Enguo; Liu, Qing
2016-09-01
We screened a highly specific monoclonal antibody (McAb), named 6D, against Acidovorax avenae subsp. citrulli (Aac). Single McAb 6D was used as both nanogold-labeled antibody and test antibody to develop a single self-paired colloidal gold immunochromatographic test strip (Sa-GICS). The detection limit achieved using the Sa-GICS approach was 10(5) CFU/mL, with a result that can be observed by the naked eye within 10 min. Moreover, Sa-GICS can detect eight strains of Aac and display no cross-reactions with other pathogenic plant microorganisms. Artificial contamination experiments demonstrated that Sa-GICS would not be affected by impurities in the leaves or stems of the plants and were consistent with the PCR results. This is the first report on the development of a colloidal gold immunoassay strip with self-paired single McAb for the rapid detection of Aac. Graphical Abstract Schematic representation of the test strip.
Directory of Open Access Journals (Sweden)
Kawahara Ryuji
2008-09-01
Full Text Available Abstract Background Vibrio parahaemolyticus is a marine seafood-borne pathogen causing gastrointestinal disorders in humans. Thermostable direct hemolysin (TDH and TDH-related hemolysin (TRH are known as major virulence determinants of V. parahaemolyticus. Most V. parahaemolyticus isolates from the environment do not produce TDH or TRH. Total V. parahaemolyticus has been used as an indicator for control of seafood contamination toward prevention of infection. Detection of total V. parahaemolyticus using conventional culture- and biochemical-based assays is time-consuming and laborious, requiring more than three days. Thus, we developed a novel and highly specific loop-mediated isothermal amplification (LAMP assay for the sensitive and rapid detection of Vibrio parahaemolyticus. Results The assay provided markedly more sensitive and rapid detection of V. parahaemolyticus strains than conventional biochemical and PCR assays. The assay correctly identified 143 V. parahaemolyticus strains, but did not detect 33 non-parahaemolyticus Vibrio and 56 non-Vibrio strains. Sensitivity of the LAMP assay for direct detection of V. parahaemolyticus in pure cultures and in spiked shrimp samples was 5.3 × 102 CFU per ml/g (2.0 CFU per reaction. The sensitivity of the LAMP assay was 10-fold more sensitive than that of the conventional PCR assay. The LAMP assay was markedly faster, requiring for amplification 13–22 min in a single colony on TCBS agar from each of 143 V. parahaemolyticus strains and less than 35 min in spiked shrimp samples. The LAMP assay for detection of V. parahaemolyticus required less than 40 min in a single colony on thiosulfate citrate bile salt sucrose (TCBS agar and 60 min in spiked shrimp samples from the beginning of DNA extraction to final determination. Conclusion The LAMP assay is a sensitive, rapid and simple tool for the detection of V. parahaemolyticus and will facilitate the surveillance for control of contamination of V
Directory of Open Access Journals (Sweden)
Deguo Wang
2015-05-01
Full Text Available Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.
Wang, Deguo; Liu, Yanhong
2015-05-26
Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.
Detection of Salmonella enteritidis Using a Miniature Optical Surface Plasmon Resonance Biosensor
International Nuclear Information System (INIS)
Son, J R; Kim, G; Kothapalli, A; Morgan, M T; Ess, D
2007-01-01
The frequent outbreaks of foodborne illness demand rapid detection of foodborne pathogens. Unfortunately, conventional methods for pathogen detection and identification are labor-intensive and take days to complete. Biosensors have shown great potential for the rapid detection of foodborne pathogens. Surface plasmon resonance (SPR) sensors have been widely adapted as an analysis tool for the study of various biological binding reactions. SPR biosensors could detect antibody-antigen bindings on the sensor surface by measuring either a resonance angle or refractive index value. In this study, the feasibility of a miniature SPR sensor (Spreeta, TI, USA) for detection of Salmonella enteritidis has been evaluated. Anti-Salmonella antibodies were immobilized on the gold sensor surface by using neutravidin. Salmonella could be detected by the Spreeta biosensor at concentrations down to 10 5 cfu/ml
Energy Technology Data Exchange (ETDEWEB)
Krishnan, A
2006-08-30
The threats of bio-terrorism and newly emerging infectious diseases pose serious challenges to the national security infrastructure. Rapid detection and diagnosis of infectious disease in human populations, as well as characterizing pathogen biology, are critical for reducing the morbidity and mortality associated with such threats. One of the key challenges in managing an infectious disease outbreak, whether through natural causes or acts of overt terrorism, is detection early enough to initiate effective countermeasures. Much recent attention has been directed towards the utility of biomarkers or molecular signatures that result from the interaction of the pathogen with the host for improving our ability to diagnose and mitigate the impact of a developing infection during the time window when effective countermeasures can be instituted. Host responses may provide early signals in blood even from localized infections. Multiple innate and adaptive immune molecules, in combination with other biochemical markers, may provide disease-specific information and new targets for countermeasures. The presence of pathogen specific markers and an understanding of the molecular capabilities and adaptations of the pathogen when it interacts with its host may likewise assist in early detection and provide opportunities for targeting countermeasures. An important question that needs to be addressed is whether these molecular-based approaches will prove useful for early diagnosis, complement current methods of direct agent detection, and aid development and use of countermeasures. Lawrence Livermore National Laboratory (LLNL) will host a workshop to explore the utility of host- and pathogen-based molecular diagnostics, prioritize key research issues, and determine the critical steps needed to transition host-pathogen research to tools that can be applied towards a more effective national bio-defense strategy. The workshop will bring together leading researchers/scientists in the
Maximizing the chances of detecting pathogenic leptospires in mammals
DEFF Research Database (Denmark)
Tulsiani, Suhella; Graham, G C; Dohnt, M F
2011-01-01
. In the earlier field investigation, serum, renal tissue and urine were collected from wild mammals, for the detection of pathogenic leptospires by culture, the microscopic agglutination test (MAT), real-time PCR and silver impregnation of smears. Although 27.6% of the rodents investigated were found leptospire....../ml, did not affect the viability or the detection of leptospires in culture, and is therefore unlikely to reduce the chances of isolating leptospires from an animal that has been euthanized with the compound. It appears that collecting multiple samples from each mammal being checked will improve...
Rapid assessment of assignments using plagiarism detection software.
Bischoff, Whitney R; Abrego, Patricia C
2011-01-01
Faculty members most often use plagiarism detection software to detect portions of students' written work that have been copied and/or not attributed to their authors. The rise in plagiarism has led to a parallel rise in software products designed to detect plagiarism. Some of these products are configurable for rapid assessment and teaching, as well as for plagiarism detection.
Colombo, Arnaldo L; Janini, Mario; Salomão, Reinaldo; Medeiros, Eduardo A S; Wey, Sergio B; Pignatari, Antonio C C
2009-09-01
Several epidemiological changes have occurred in the pattern of nosocomial and community acquired infectious diseases during the past 25 years. Social and demographic changes possibly related to this phenomenon include a rapid population growth, the increase in urban migration and movement across international borders by tourists and immigrants, alterations in the habitats of animals and arthropods that transmit disease, as well as the raise of patients with impaired host defense abilities. Continuous surveillance programs of emergent pathogens and antimicrobial resistance are warranted for detecting in real time new pathogens, as well as to characterize molecular mechanisms of resistance. In order to become more effective, surveillance programs of emergent pathogens should be organized as a multicenter laboratory network connected to the main public and private infection control centers. Microbiological data should be integrated to guide therapy, adapting therapy to local ecology and resistance patterns. This paper presents an overview of data generated by the Division of Infectious Diseases, Federal University of São Paulo, along with its participation in different surveillance programs of nosocomial and community acquired infectious diseases.
Rapid detection of small oscillation faults via deterministic learning.
Wang, Cong; Chen, Tianrui
2011-08-01
Detection of small faults is one of the most important and challenging tasks in the area of fault diagnosis. In this paper, we present an approach for the rapid detection of small oscillation faults based on a recently proposed deterministic learning (DL) theory. The approach consists of two phases: the training phase and the test phase. In the training phase, the system dynamics underlying normal and fault oscillations are locally accurately approximated through DL. The obtained knowledge of system dynamics is stored in constant radial basis function (RBF) networks. In the diagnosis phase, rapid detection is implemented. Specially, a bank of estimators are constructed using the constant RBF neural networks to represent the training normal and fault modes. By comparing the set of estimators with the test monitored system, a set of residuals are generated, and the average L(1) norms of the residuals are taken as the measure of the differences between the dynamics of the monitored system and the dynamics of the training normal mode and oscillation faults. The occurrence of a test oscillation fault can be rapidly detected according to the smallest residual principle. A rigorous analysis of the performance of the detection scheme is also given. The novelty of the paper lies in that the modeling uncertainty and nonlinear fault functions are accurately approximated and then the knowledge is utilized to achieve rapid detection of small oscillation faults. Simulation studies are included to demonstrate the effectiveness of the approach.
Directory of Open Access Journals (Sweden)
Peng Tian
2017-08-01
Full Text Available Bacterial pathogens and human norovirus (HuNoV are major cause for acute gastroenteritis caused by contaminated food and water. Public waterways can become contaminated from a variety of sources and flood after heavy rain events, leading to pathogen contamination of produce fields. We initiated a survey of several public watersheds in a major leafy green produce production region of the Central California Coast to determine the prevalence of HuNoV as well as bacterial pathogens. Moore swabs were used to collect environmental samples bi-monthly at over 30 sampling sites in the region. High prevalence of HuNoV and bacterial pathogens were detected in environmental water samples in the region. The overall detection rates of HuNoV, O157 Shiga toxin-producing Escherichia coli (STEC, non-O157 STEC, Salmonella, and Listeria were 25.58, 7.91, 9.42, 59.65, and 44.30%, respectively. The detection rates of Salmonella and L. monocytogenes were significantly higher in the spring. Fall and spring had elevated detection rates of O157 STEC. The overall detection rates of non-O157 STEC in the fall were lower than the other seasons but not significant. The overall detection rates of HuNoV were highest in fall, followed by spring and winter, with summer being lowest and significantly lower than other seasons. This study presented the first study of evaluating the correlation between the detection rate of HuNoV and the detection rates of four bacterial pathogens from environmental water. Overall, there was no significant difference in HuNoV detection rates between samples testing positive or negative for the four bacterial pathogens tested. Pathogens in animal-impacted and human-impacted areas were investigated. There were significant higher detection rates in animal-impacted areas than that of human-impacted areas for bacterial pathogens. However, there was no difference in HuNoV detection rates between these two areas. The overall detection levels of generic E
Energy Technology Data Exchange (ETDEWEB)
Lee, Dae-Young [National Water Research Institute, Environment Canada, 867 Lakeshore Road, Burlington, Ontario, L7R 4A6 (Canada)], E-mail: daeyoung.lee@ec.gc.ca; Lauder, Heather; Cruwys, Heather; Falletta, Patricia [National Water Research Institute, Environment Canada, 867 Lakeshore Road, Burlington, Ontario, L7R 4A6 (Canada); Beaudette, Lee A. [Environmental Science and Technology Centre, Environment Canada, 335 River Road South, Ottawa, Ontario, K1A 0H3 (Canada)], E-mail: lee.beaudette@ec.gc.ca
2008-07-15
Conventional microbial water quality test methods are well known for their technical limitations, such as lack of direct pathogen detection capacity and low throughput capability. The microarray assay has recently emerged as a promising alternative for environmental pathogen monitoring. In this study, bacterial pathogens were detected in municipal wastewater using a microarray equipped with short oligonucleotide probes targeting 16S rRNA sequences. To date, 62 probes have been designed against 38 species, 4 genera, and 1 family of pathogens. The detection sensitivity of the microarray for a waterborne pathogen Aeromonas hydrophila was determined to be approximately 1.0% of the total DNA, or approximately 10{sup 3}A. hydrophila cells per sample. The efficacy of the DNA microarray was verified in a parallel study where pathogen genes and E. coli cells were enumerated using real-time quantitative PCR (qPCR) and standard membrane filter techniques, respectively. The microarray and qPCR successfully detected multiple wastewater pathogen species at different stages of the disinfection process (i.e. secondary effluents vs. disinfected final effluents) and at two treatment plants employing different disinfection methods (i.e. chlorination vs. UV irradiation). This result demonstrates the effectiveness of the DNA microarray as a semi-quantitative, high throughput pathogen monitoring tool for municipal wastewater.
Rapid screening for human-pathogenic Mucorales using rolling circle amplification.
Dolatabadi, S; Najafzadeh, M J; de Hoog, G S
2014-12-01
Mucormycosis has emerged as a relatively common severe mycosis in patients with haematological and allogeneic stem cell transplantation. Source of transmission is from unidentified sources in the environment. Early diagnosis of infection and its source of contamination are paramount for rapid and appropriate therapy. In this study, rolling circle amplification (RCA) is introduced as a sensitive, specific and reproducible isothermal DNA amplification technique for rapid molecular identification of six of the most virulent species (Rhizopus microsporus, R. arrhizus var. arrhizus, R. arrhizus var. delemar, Mucor irregularis, Mucor circinelloides, Lichtheimia ramosa, Lichtheimia corymbifera). DNAs of target species were successfully amplified, with no cross reactivity between species. RCA can be considered as a rapid detection method with high specificity and sensitivity, suitable for large screening. © 2014 Blackwell Verlag GmbH.
Incorporating indel information into phylogeny estimation for rapidly emerging pathogens
Directory of Open Access Journals (Sweden)
Suchard Marc A
2007-03-01
Full Text Available Abstract Background Phylogenies of rapidly evolving pathogens can be difficult to resolve because of the small number of substitutions that accumulate in the short times since divergence. To improve resolution of such phylogenies we propose using insertion and deletion (indel information in addition to substitution information. We accomplish this through joint estimation of alignment and phylogeny in a Bayesian framework, drawing inference using Markov chain Monte Carlo. Joint estimation of alignment and phylogeny sidesteps biases that stem from conditioning on a single alignment by taking into account the ensemble of near-optimal alignments. Results We introduce a novel Markov chain transition kernel that improves computational efficiency by proposing non-local topology rearrangements and by block sampling alignment and topology parameters. In addition, we extend our previous indel model to increase biological realism by placing indels preferentially on longer branches. We demonstrate the ability of indel information to increase phylogenetic resolution in examples drawn from within-host viral sequence samples. We also demonstrate the importance of taking alignment uncertainty into account when using such information. Finally, we show that codon-based substitution models can significantly affect alignment quality and phylogenetic inference by unrealistically forcing indels to begin and end between codons. Conclusion These results indicate that indel information can improve phylogenetic resolution of recently diverged pathogens and that alignment uncertainty should be considered in such analyses.
Detection of mastitis pathogens by analysis of volatile bacterial metabolites.
Hettinga, K A; van Valenberg, H J F; Lam, T J G M; van Hooijdonk, A C M
2008-10-01
The ability to detect mastitis pathogens based on their volatile metabolites was studied. Milk samples from cows with clinical mastitis, caused by Staphylococcus aureus, coagulase-negative staphylococci, Streptococcus uberis, Streptococcus dysgalactiae, and Escherichia coli were collected. In addition, samples from cows without clinical mastitis and with low somatic cell count (SCC) were collected for comparison. All mastitis samples were examined by using classical microbiological methods, followed by headspace analysis for volatile metabolites. Milk from culture-negative samples contained a lower number and amount of volatile components compared with cows with clinical mastitis. Because of variability between samples within a group, comparisons between pathogens were not sufficient for classification of the samples by univariate statistics. Therefore, an artificial neural network was trained to classify the pathogen in the milk samples based on the bacterial metabolites. The trained network differentiated milk from uninfected and infected quarters very well. When comparing pathogens, Staph. aureus produced a very different pattern of volatile metabolites compared with the other samples. Samples with coagulase-negative staphylococci and E. coli had enough dissimilarity with the other pathogens, making it possible to separate these 2 pathogens from each other and from the other samples. The 2 streptococcus species did not show significant differences between each other but could be identified as a different group from the other pathogens. Five groups can thus be identified based on the volatile bacterial metabolites: Staph. aureus, coagulase-negative staphylococci, streptococci (Strep. uberis and Strep. dysgalactiae as one group), E. coli, and uninfected quarters.
Directory of Open Access Journals (Sweden)
Chi Zhang
2018-04-01
Full Text Available Pneumonia and meningitis continue to present an enormous public health burden and pose a major threat to young children. Among the causative organisms of pneumonia and meningitis, bacteria are the most common causes of serious disease and deaths. It is challenging to accurately and rapidly identify these agents. To solve this problem, we developed and validated a 12-plex PCR coupled with matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS method (bacterial pathogen-mass spectrometry, BP-MS that can be used to simultaneously screen for 11 key bacterial pathogens related to pneumonia and meningitis. Forty-six nasopharyngeal swabs and 12 isolates were used to determine the specificity of the method. The results showed that, using the BP-MS method, we could accurately identify the expected bacteria without cross-reactivity with other pathogens. For the 11 target bacterial pathogens, the analytical sensitivity of the BP-MS method was as low as 10 copies/reaction. To further evaluate the clinical effectiveness of this method, 204 nasopharyngeal swabs from hospitalized children with suspected pneumonia were tested using this method. In total, 81.9% (167/204 of the samples were positive for at least one of the 11 target pathogens. Among the 167 bacteria-positive samples, the rate of multiple infections was 55.7% (93/167, and the most frequent combination was Streptococcus pneumoniae with Haemophilus influenzae, representing 46.2% (43/93 two-pathogen mixed infections. We used real-time PCR and nested PCR to confirm positive results, with identical results obtained for 81.4% (136/167 of the samples. The BP-MS method is a sensitive and specific molecular detection technique in a multiplex format and with high sample throughput. Therefore, it will be a powerful tool for pathogen screening and antibiotic selection at an early stage of disease.
Comprehensive and Rapid Real-Time PCR Analysis of 21 Foodborne Outbreaks
Directory of Open Access Journals (Sweden)
Hiroshi Fukushima
2009-01-01
Full Text Available A set of four duplex SYBR Green I PCR (SG-PCR assay combined with DNA extraction using QIAamp DNA Stool Mini kit was evaluated for the detection of foodborne bacteria from 21 foodborne outbreaks. The causative pathogens were detected in almost all cases in 2 hours or less. The first run was for the detection of 8 main foodborne pathogens in 5 stool specimens within 2 hours and the second run was for the detection of other unusual suspect pathogens within a further 45 minutes. After 2 to 4 days, the causative agents were isolated and identified. The results proved that for comprehensive and rapid molecular diagnosis in foodborne outbreaks, Duplex SG-PCR assay is not only very useful, but is also economically viable for one-step differentiation of causative pathogens in fecal specimens obtained from symptomatic patients. This then allows for effective diagnosis and management of foodborne outbreaks.
International Nuclear Information System (INIS)
Kim, G; Morgan, M; Hahm, B K; Bhunia, A; Mun, J H; Om, A S
2008-01-01
Salmonella enteritidis outbreaks continue to occur, and S. enteritidis-related outbreaks from various food sources have increased public awareness of this pathogen. Conventional methods for pathogens detection and identification are labor-intensive and take days to complete. Some immunological rapid assays are developed, but these assays still require prolonged enrichment steps. Recently developed biosensors have shown great potential for the rapid detection of foodborne pathogens. To develop the biosensor, an interdigitated microelectrode (IME) was fabricated by using semiconductor fabrication process. Anti-Salmonella antibodies were immobilized based on avidin-biotin binding on the surface of the IME to form an active sensing layer. To increase the sensitivity of the sensor, three types of sensors that have different electrode gap sizes (2 μm, 5 μm, 10 μm) were fabricated and tested. The impedimetric biosensor could detect 10 3 CFU/mL of Salmonella in pork meat extract with an incubation time of 5 minutes. This method may provide a simple, rapid and sensitive method to detect foodborne pathogens
Energy Technology Data Exchange (ETDEWEB)
Kim, G [National Institute of Agricultural Engineering, 249 Seodun-dong, Suwon, Republic of Korea, 441-100 (Korea, Republic of); Morgan, M; Hahm, B K; Bhunia, A [Department of Food Science, Purdue University, West Lafayette, IN 47907 (United States); Mun, J H; Om, A S [Department of Food and Nutrient, Hanyang University, 17 Haengdang-dong, Seoul, Republic of Korea, 133-791 (Korea, Republic of)], E-mail: giyoungkim@rda.go.kr
2008-03-15
Salmonella enteritidis outbreaks continue to occur, and S. enteritidis-related outbreaks from various food sources have increased public awareness of this pathogen. Conventional methods for pathogens detection and identification are labor-intensive and take days to complete. Some immunological rapid assays are developed, but these assays still require prolonged enrichment steps. Recently developed biosensors have shown great potential for the rapid detection of foodborne pathogens. To develop the biosensor, an interdigitated microelectrode (IME) was fabricated by using semiconductor fabrication process. Anti-Salmonella antibodies were immobilized based on avidin-biotin binding on the surface of the IME to form an active sensing layer. To increase the sensitivity of the sensor, three types of sensors that have different electrode gap sizes (2 {mu}m, 5 {mu}m, 10 {mu}m) were fabricated and tested. The impedimetric biosensor could detect 10{sup 3} CFU/mL of Salmonella in pork meat extract with an incubation time of 5 minutes. This method may provide a simple, rapid and sensitive method to detect foodborne pathogens.
Wilkes, Rebecca P; Lee, Pei-Yu A; Tsai, Yun-Long; Tsai, Chuan-Fu; Chang, Hsiu-Hui; Chang, Hsiao-Fen G; Wang, Hwa-Tang T
2015-08-01
Canine parvovirus type 2 (CPV-2), including subtypes 2a, 2b and 2c, causes an acute enteric disease in both domestic and wild animals. Rapid and sensitive diagnosis aids effective disease management at points of need (PON). A commercially available, field-deployable and user-friendly system, designed with insulated isothermal PCR (iiPCR) technology, displays excellent sensitivity and specificity for nucleic acid detection. An iiPCR method was developed for on-site detection of all circulating CPV-2 strains. Limit of detection was determined using plasmid DNA. CPV-2a, 2b and 2c strains, a feline panleukopenia virus (FPV) strain, and nine canine pathogens were tested to evaluate assay specificity. Reaction sensitivity and performance were compared with an in-house real-time PCR using serial dilutions of a CPV-2b strain and 100 canine fecal clinical samples collected from 2010 to 2014, respectively. The 95% limit of detection of the iiPCR method was 13 copies of standard DNA and detection limits for CPV-2b DNA were equivalent for iiPCR and real-time PCR. The iiPCR reaction detected CPV-2a, 2b and 2c and FPV. Non-targeted pathogens were not detected. Test results of real-time PCR and iiPCR from 99 fecal samples agreed with each other, while one real-time PCR-positive sample tested negative by iiPCR. Therefore, excellent agreement (k = 0.98) with sensitivity of 98.41% and specificity of 100% in detecting CPV-2 in feces was found between the two methods. In conclusion, the iiPCR system has potential to serve as a useful tool for rapid and accurate PON, molecular detection of CPV-2. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Development of genetic methods for detection of pathogenic microorganisms in irradiated food
International Nuclear Information System (INIS)
2010-01-01
The existence of injured microorganisms in food and their recovery during culturing procedures is critical. Injured microorganisms present a potential threat in food safety since they may repair themselves under suitable conditions. This study provides development of recovery methods for detection of injured foodborne microorganisms, after irradiation treatment at different doses. For this purpose, iniatially the methods of recovery were compared at different irradiation doses. At the second step, antibiotic resistance of foodborne pathogens was determined. After determination of antibiotic resistance, recovery methods were modified for reversibly injured foodborne pathogens at different doses after irradiation treatment . Finally, damages of DNA were detected by a spectrophotometric method after 1.0 kGy irradiation treatment
Cai, Xian-Quan; Yu, Hai-Qiong; Li, Rong; Yue, Qiao-Yun; Liu, Guo-Hua; Bai, Jian-Shan; Deng, Yan; Qiu, De-Yi; Zhu, Xing-Quan
2014-01-01
Clonorchis sinensis and Opisthorchis viverrini are both important fish-borne pathogens, causing serious public health problem in Asia. The present study developed an assay integrating real-time PCR and high resolution melting (HRM) analysis for the specific detection and rapid identification of C. sinensis and O. viverrini. Primers targeting COX1 gene were highly specific for these liver flukes, as evidenced by the negative amplification of closely related trematodes. Assays using genomic DNA extracted from the two flukes yielded specific amplification and their identity was confirmed by sequencing, having the accuracy of 100% in reference to conventional methods. The assay was proved to be highly sensitive with a detection limit below 1 pg of purified genomic DNA, 5 EPG, or 1 metacercaria of C. sinensis. Moreover, C. sinensis and O. viverrini were able to be differentiated by their HRM profiles. The method can reduce labor of microscopic examination and the contamination of agarose electrophoresis. Moreover, it can differentiate these two flukes which are difficult to be distinguished using other methods. The established method provides an alternative tool for rapid, simple, and duplex detection of C. sinensis and O. viverrini.
Directory of Open Access Journals (Sweden)
Xian-Quan Cai
2014-01-01
Full Text Available Clonorchis sinensis and Opisthorchis viverrini are both important fish-borne pathogens, causing serious public health problem in Asia. The present study developed an assay integrating real-time PCR and high resolution melting (HRM analysis for the specific detection and rapid identification of C. sinensis and O. viverrini. Primers targeting COX1 gene were highly specific for these liver flukes, as evidenced by the negative amplification of closely related trematodes. Assays using genomic DNA extracted from the two flukes yielded specific amplification and their identity was confirmed by sequencing, having the accuracy of 100% in reference to conventional methods. The assay was proved to be highly sensitive with a detection limit below 1 pg of purified genomic DNA, 5 EPG, or 1 metacercaria of C. sinensis. Moreover, C. sinensis and O. viverrini were able to be differentiated by their HRM profiles. The method can reduce labor of microscopic examination and the contamination of agarose electrophoresis. Moreover, it can differentiate these two flukes which are difficult to be distinguished using other methods. The established method provides an alternative tool for rapid, simple, and duplex detection of C. sinensis and O. viverrini.
Fernandes, António Maximiano; Abdalhai, Mandour H; Ji, Jian; Xi, Bing-Wen; Xie, Jun; Sun, Jiadi; Noeline, Rasoamandrary; Lee, Byong H; Sun, Xiulan
2015-01-15
In this paper, we reported the construction of new high sensitive electrochemical genosensor based on multiwalled carbon nanotubes-chitosan-bismuth complex (MWCNT-Chi-Bi) and lead sulfide nanoparticles for the detection of pathogenic Aeromonas. Lead sulfide nanoparticles capped with 5'-(NH2) oligonucleotides thought amide bond was used as signalizing probe DNA (sz-DNA) and thiol-modified oligonucleotides sequence was used as fixing probe DNA (fDNA). The two probes hybridize with target Aeromonas DNA (tDNA) sequence (fDNA-tDNA-szDNA). The signal of hybridization is detected by differential pulse voltammetry (DPV) after electrodeposition of released lead nanoparticles (PbS) from sz-DNA on the surface of glass carbon electrode decorated with MWCNT-Chi-Bi, which improves the deposition and traducing electrical signal. The optimization of incubation time, hybridization temperature, deposition potential, deposition time and the specificity of the probes were investigated. Our results showed the highest sensibility to detect the target gene when compared with related biosensors and polymerase chain reaction (PCR). The detection limit for this biosensor was 1.0×10(-14) M. We could detect lower than 10(2) CFU mL(-1) of Aeromonas in spiked tap water. This method is rapid and sensitive for the detection of pathogenic bacteria and would become a potential application in biomedical diagnosis, food safety and environmental monitoring. Copyright © 2014 Elsevier B.V. All rights reserved.
Detection of the emerging amphibian pathogens Batrachochytrium dendrobatidis and ranavirus in Russia
Reshetnikov, Andrey N.; Chestnut, Tara E.; Brunner, Jesse L.; Charles, Kaylene M.; Nebergall, Emily E.; Olson, Deanna H.
2014-01-01
In a population of the European common toad Bufo bufo from a rural pond in the region of Lake Glubokoe Regional Reserve in Moscow province, Russia, unexplained mass mortality events involving larvae and metamorphs have been observed over a monitoring period of >20 yr. We tested toads from this and a nearby site for the emerging amphibian pathogens Batrachochytrium dendrobatidis (Bd) and ranavirus (Rv). Both pathogens were detected, and at the rural pond site, with the above-noted losses and decline in toad breeding success, 40% of B. bufo metamorphs were Bd positive, 46% were Rv positive and 20% were co-infected with both pathogens. Toad metamorphs from a neighbouring water body were also Bd and Rv positive (25 and 55%, respectively). This is the first confirmation of these pathogens in Russia. Questions remain as to the origins of these pathogens in Russia and their roles in documented mass mortality events.
Salmonella rarely detected in Mississippi coastal waters and sediment.
Carr, M R; Wang, S Y; McLean, T I; Flood, C J; Ellender, R D
2010-12-01
Standards for the rapid detection of individual pathogens from environmental samples have not been developed, but in their absence, the use of molecular-based detection methods coupled with traditional microbiology techniques allows for rapid and accurate pathogen detection from environmental waters and sediment. The aim of this research was to combine the use of enrichment with PCR for detection of Salmonella in Mississippi coastal waters and sediment and observe if that presence correlated with levels of enterococci and climatological variables. Salmonella were primarily found in samples that underwent nutrient enrichment and were present more frequently in freshwater than marine waters. Salmonella were detected infrequently in marine and freshwater sediments. There was a significant positive correlation between the presence of detectable Salmonella and the average enterococcal count. An inverse relationship, however, was observed between the frequency of detection and the levels of salinity, turbidity and sunlight exposure. Results from this study indicated the presence of Salmonella in Mississippi coastal waters, and sediments are very low with significant differences between freshwater and marine environments. Using pathogenic and novel nonpathogenic molecular markers, Salmonella do not appear to be a significant pathogenic genus along the Mississippi Coast. © 2010 The Authors. Journal of Applied Microbiology © 2010 The Society for Applied Microbiology.
Rapid detection of exotic Lymantriids and Scolytids pilot study
Mary Ellen Dix
2003-01-01
Exotic invasive species, inadvertently introduced into North America through importation and travel, are threatening the integrity of North American forest ecosystems. The National Invasive Species Council in their 2001 Strategic Plan identified a collaborative program for early detection, diagnosis and response to high-risk, exotic, invasive insects, pathogens and...
Zhang, Xin; Zhang, He; Pu, Jinji; Qi, Yanxiang; Yu, Qunfang; Xie, Yixian; Peng, Jun
2013-01-01
Fusarium oxysporum f. sp. cubense (Foc), the causal agent of Fusarium wilt (Panama disease), is one of the most devastating diseases of banana (Musa spp.). The Foc tropical race 4 (TR4) is currently known as a major concern in global banana production. No effective resistance is known in Musa to Foc, and no effective measures for controlling Foc once banana plants have been infected in place. Early and accurate detection of Foc TR4 is essential to protect banana industry and guide banana planting. A real-time fluorescence loop-mediated isothermal amplification assay (RealAmp) was developed for the rapid and quantitative detection of Foc TR4 in soil. The detection limit of the RealAmp assay was approximately 0.4 pg/µl plasmid DNA when mixed with extracted soil DNA or 10(3) spores/g of artificial infested soil, and no cross-reaction with other relative pathogens were observed. The RealAmp assay for quantifying genomic DNA of TR4 was confirmed by testing both artificially and naturally infested samples. Quantification of the soil-borne pathogen DNA of Foc TR4 in naturally infested samples was no significant difference compared to classic real-time PCR (P>0.05). Additionally, RealAmp assay was visual with an improved closed-tube visual detection system by adding SYBR Green I fluorescent dye to the inside of the lid prior to amplification, which avoided the inhibitory effects of the stain on DNA amplification and makes the assay more convenient in the field and could thus become a simple, rapid and effective technique that has potential as an alternative tool for the detection and monitoring of Foc TR4 in field, which would be a routine DNA-based testing service for the soil-borne pathogen in South China.
Directory of Open Access Journals (Sweden)
Xin Zhang
Full Text Available Fusarium oxysporum f. sp. cubense (Foc, the causal agent of Fusarium wilt (Panama disease, is one of the most devastating diseases of banana (Musa spp.. The Foc tropical race 4 (TR4 is currently known as a major concern in global banana production. No effective resistance is known in Musa to Foc, and no effective measures for controlling Foc once banana plants have been infected in place. Early and accurate detection of Foc TR4 is essential to protect banana industry and guide banana planting. A real-time fluorescence loop-mediated isothermal amplification assay (RealAmp was developed for the rapid and quantitative detection of Foc TR4 in soil. The detection limit of the RealAmp assay was approximately 0.4 pg/µl plasmid DNA when mixed with extracted soil DNA or 10(3 spores/g of artificial infested soil, and no cross-reaction with other relative pathogens were observed. The RealAmp assay for quantifying genomic DNA of TR4 was confirmed by testing both artificially and naturally infested samples. Quantification of the soil-borne pathogen DNA of Foc TR4 in naturally infested samples was no significant difference compared to classic real-time PCR (P>0.05. Additionally, RealAmp assay was visual with an improved closed-tube visual detection system by adding SYBR Green I fluorescent dye to the inside of the lid prior to amplification, which avoided the inhibitory effects of the stain on DNA amplification and makes the assay more convenient in the field and could thus become a simple, rapid and effective technique that has potential as an alternative tool for the detection and monitoring of Foc TR4 in field, which would be a routine DNA-based testing service for the soil-borne pathogen in South China.
Ceylan Koydemir, Hatice; Feng, Steve; Liang, Kyle; Nadkarni, Rohan; Benien, Parul; Ozcan, Aydogan
2017-06-01
limit of detection of 12 cysts per 10 ml, an average cyst capture efficiency of 79%, and an accuracy of 95%. Providing rapid detection and quantification of waterborne pathogens without the need for a microbiology expert, this field-portable imaging and sensing platform running on a smartphone could be very useful for water quality monitoring in resource-limited settings.
Ceylan Koydemir, Hatice
2017-06-14
a limit of detection of 12 cysts per 10 ml, an average cyst capture efficiency of ~79%, and an accuracy of ~95%. Providing rapid detection and quantification of waterborne pathogens without the need for a microbiology expert, this field-portable imaging and sensing platform running on a smartphone could be very useful for water quality monitoring in resource-limited settings.
Ceylan Koydemir, Hatice; Feng, Steve; Liang, Kyle; Nadkarni, Rohan; Benien, Parul; Ozcan, Aydogan
2017-01-01
a limit of detection of 12 cysts per 10 ml, an average cyst capture efficiency of ~79%, and an accuracy of ~95%. Providing rapid detection and quantification of waterborne pathogens without the need for a microbiology expert, this field-portable imaging and sensing platform running on a smartphone could be very useful for water quality monitoring in resource-limited settings.
Directory of Open Access Journals (Sweden)
Ceylan Koydemir Hatice
2017-06-01
water and achieved a limit of detection of 12 cysts per 10 ml, an average cyst capture efficiency of ~79%, and an accuracy of ~95%. Providing rapid detection and quantification of waterborne pathogens without the need for a microbiology expert, this field-portable imaging and sensing platform running on a smartphone could be very useful for water quality monitoring in resource-limited settings.
Phage-based surface plasmon resonance strategies for the detection of pathogens
Tawil, Nancy
MRSA bacteriophages to gold, using several immobilization methods[2]. We found that mixed self-assembled monolayers (SAMs) of L-cysteine and MUA permitted oriented positioning of the phages, thus preserving their biofunctionality and their bacterial lysing efficiency. This was due to the formation of uniform cavity islands on the gold surfaces, permitting an oriented positioning of the phages, thus better exposing their recognition proteins towards the medium containing the bacterial hosts. T4 bacteriophages were then used to detect E. coli, while a novel, highly specific phage was isolated, characterized and used to detect MRSA[3]. We found that our technique, combined with the use of SPR permits label-free, real-time, specific, rapid and cost-effective detection of pathogens, for concentrations of 103 colony forming units/milliliter (CFU/mL), in less than 20 minutes. We then turned our attention towards the differential detection of community-acquired MRSA (CA-MRSA), hospital-acquired MRSA (HA-MRSA), methicillin susceptible S. aureus (MSSA), and borderline resistant oxacillin-resistant S. aureus (BORSA), using SPR[4]. We studied two hundred fifty Staphylococcus aureus clinical isolates to determine their susceptibilities to â- lactam antibiotics. A surface plasmon resonance (SPR) biosensor was used to differentiate among CA-MRSA, HA-MRSA, BORSA and MSSA strains by specifically detecting PBP2a, an altered penicilling binding proteins that confers resistance to S. aureus strains, on whole bacterial cells, without labeling, without recourse to PCR or enrichment steps. We found that the system permits, specific detection of pathogens for concentrations as low as 10 CFU/mL. This approach has the advantages of being simple and rapid, allowing for identification of resistant strains of Staphylococcus aureus up to 48 hours earlier than conventional microbiological techniques. This method could have a significant impact on hospital costs, effective infection control, and
Yang, Hong; Irudayaraj, Joseph
2003-02-01
Fourier transform (FT) Raman spectroscopy was used for non-destructive characterization and differentiation of six different microorganisms including the pathogen Escherichia coli O157:H7 on whole apples. Mahalanobis distance metric was used to evaluate and quantify the statistical differences between the spectra of six different microorganisms. The same procedure was extended to discriminate six different strains of E. coli. The FT-Raman procedure was not only successful in discriminating the different E. coli strain but also accurately differentiated the pathogen from non-pathogens. Results demonstrate that FT-Raman spectroscopy can be an excellent tool for rapid examination of food surfaces for microorganism contamination and for the classification of microbial cultures.
Zhang, Yun; Yan, Chenghui; Yang, Hang; Yu, Junping; Wei, Hongping
2017-11-01
Mammal IgG antibodies are normally used in conventional immunoassays for E. coli O157:H7, which could lead to false positive results from the presence of protein A producing S. aureus. In this study, a natural specific bacteriophage was isolated and then conjugated with magnetic beads as a capture element in a sandwich format for the rapid and selective detection of E. coli O157:H7. To the best of our knowledge, it was the first time to utilize a natural bacteriophage to develop a phagomagnetic separation combined with colorimetric assay for E. coli O157:H7. The method has an overall time less than 2h with a detection limit of 4.9×10 4 CFU/mL. No interference from S. aureus was observed. Furthermore, the proposed method was successfully applied to detect E. coli O157:H7 in spiked skim milk. The proposed detection system provided a potential method for E. coli O157:H7 and other pathogenic bacteria in food samples. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
WANG Hua-cheng
2013-02-01
Full Text Available Background The diagnosis of encephalitis depends on the finding of pathogens in the brain parenchyma or cerebrospinal fluid (CSF. But the success rates of finding pathogens by microscope are low by the traditional specimens handling procedure in which pathogens are detected by direct centrifugation of CSF getting from lumbar puncture. The process of pathogen collection from the CSF such as centrifugation and washing would cause the destruction and loss of pathogens, resulting in a lower rate of pathogen discovery. Therefore, in order to increase the detection rate of pathogenic microorganisms in CSF, these traditional steps need to be improved. Methods CSF samples of 23 patients with suspected viral encephalitis and 10 control patients with fracture were prepared by two methods: traditional specimens handling procedure (TSHP and improved specimens handling procedure (ISHP. In the ISHP, a final concentration of 2.5% glutaraldehyde was added to CSF in a glass tube, mixed and kept not moving in 4 ℃ for 2 to 4 h or in 37 ℃for 1 h. Then a smear was made from the sediment formed in the tube to check pathogens by microscope. As for the TSHP, pathogens were collected by direct centrifugation of CSF which had not been treated after lumbar puncture, and checked through Gimenze staining. Results There was no statistically significant difference between the two dealing procedures in the control group ( P = 1.000. As for the case group, there were 10 cases showing positive in Pandy test after TSHP, and visible sediments were seen in all the 23 cases after ISHP. There was statistically significant difference between two kinds of CSF treatment for the finding of pathogens (P = 0.000. Seven cases presented pathogen growth in CSF and were diagosed as rickettsial infections by Gimenze staining, immunofluorescence assay (IFA and polymerase chain reaction (PCR. Conclusion Improved specimens handling procedures of CSF contribute to the seperation of cells
Directory of Open Access Journals (Sweden)
Manas K Akmatov
Full Text Available BACKGROUND: The need for the timely collection of diagnostic biosamples during symptomatic episodes represents a major obstacle to large-scale studies on acute respiratory infection (ARI epidemiology. This may be circumvented by having the participants collect their own nasal swabs. We compared self- and staff-collected swabs in terms of swabbing quality and detection of viral respiratory pathogens. METHODOLOGY/PRINCIPAL FINDINGS: We conducted a prospective study among employees of our institution during the ARI season 2010/2011 (December-March. Weekly emails were sent to the participants (n = 84, reminding them to come to the study center in case of new symptoms. The participants self-collected an anterior nasal swab from one nostril, and trained study personnel collected one from the other nostril. The participants self-collected another two swabs (one from each nostril on a subsequent day. Human β-actin DNA concentration was determined in the swabs as a quality control. Viral respiratory pathogens were detected by multiplex RT-PCR (Seeplex RV15 kit, Seegene, Eschborn, Germany. Of 84 participants, 56 (67% reported at least one ARI episode, 18 participants two, and one participant three. Self-swabbing was highly accepted by the participants. The amount of β-actin DNA per swab was higher in the self- than in the staff-collected swabs (p = 0.008. β-actin concentration was lower in the self-swabs collected on day 1 than in those collected on a subsequent day (p<0.0001. A respiratory viral pathogen was detected in 31% (23/75 of staff- and in 35% (26/75 of self-collected swabs (p = 0.36. With both approaches, the most frequently identified pathogens were human rhinoviruses A/B/C (12/75 swabs, 16% and human coronavirus OC43 (4/75 swabs, 5%. There was almost perfect agreement between self- and staff-collected swabs in terms of pathogen detection (agreement = 93%, kappa = 0.85, p<0.0001. CONCLUSIONS/SIGNIFICANCE: Nasal self
Globally, foodborne pathogens are a major public health concern. In this chapter, we provide a broad description of the problem of food-borne diseases and current and future detection technologies for food safety assurance and prevention of foodborne illnesses. Current detection approaches include s...
Monoclonal antibody-based Surface Plasmon Resonance sensors for pathogen detection
DEFF Research Database (Denmark)
Skottrup, Peter Durand
2007-01-01
essentially transforms molecular interactions into a digital signal, thereby making detection of analytes label-free. Biosensors are used for detection of analytes ranging from small drug molecules to food- and waterborne microorganisms as well as biowarfare pathogens. In future farming, plant production......A biosensor is an analytical device, which incorporates a biological sensing element integrated within a physicochemical transducer. The aim of a biosensor is to produce an electronic signal, which is proportional to the interaction of analytes with the sensing element. This means that the sensor...
International Nuclear Information System (INIS)
Hu, Zu-Quan; Li, He-Ping; Zhang, Jing-Bo; Huang, Tao; Liu, Jin-Long; Xue, Sheng; Wu, Ai-Bo; Liao, Yu-Cai
2013-01-01
Graphical abstract: A phage-displayed chicken scFv antibody, FvSG7, binds on the surface antigen of conidiospores and the mycelia of F. verticillioides. Its fusion with alkaline phosphatase (AP) through a 218 linker displayed a 4-fold higher affinity compared with the parent scFv antibody and efficiently detected toxigenic Fusarium pathogens in cereal grains. Highlights: ► Generation of a highly reactive scFv antibody against F. verticillioides. ► Localization of the antibody binding to the surface target of F. verticillioides. ► Expression of the antibody–alkaline phosphatase (AP) fusion linked by a 218 linker. ► The antibody–AP fusion has a higher affinity than the parental antibody. ► The antibody–AP fusion detects toxigenic Fusarium pathogens in cereal grains. -- Abstract: Fusarium and its poisonous mycotoxins are distributed worldwide and are of particular interest in agriculture and food safety. A simple analytical method to detect pathogens is essential for forecasting diseases and controlling mycotoxins. This article describes a proposed method for convenient and sensitive detection of Fusarium pathogens that uses the fusion of single-chain variable fragment (scFv) and alkaline phosphatase (AP). A highly reactive scFv antibody specific to soluble cell wall-bound proteins (SCWPs) of F. verticillioides was selected from an immunized chicken phagemid library by phage display. The antibody was verified to bind on the surface of ungerminated conidiospores and mycelia of F. verticillioides. The scFv–AP fusion was constructed, and soluble expression in bacteria was confirmed. Both the antibody properties and enzymatic activity were retained, and the antigen-binding capacity of the fusion was enhanced by the addition of a linker. Surface plasmon resonance measurements confirmed that the fusion displayed 4-fold higher affinity compared with the fusion's parental scFv antibody. Immunoblot analyses showed that the fusion had good binding capacity to
Energy Technology Data Exchange (ETDEWEB)
Hu, Zu-Quan [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); Li, He-Ping [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); Zhang, Jing-Bo [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); College of Plant Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); Huang, Tao [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); Liu, Jin-Long; Xue, Sheng [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); Wu, Ai-Bo [Institute for Agri-food Standards and Testing Technology, Laboratory of Quality and Safety Risk Assessment for Agro-products, Ministry of Agriculture, Shanghai Academy of Agricultural Sciences, 1000 Jinqi Road, Shanghai 201403 (China); Liao, Yu-Cai, E-mail: ycliao06@yahoo.com.cn [Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan 430070 (China); College of Plant Science and Technology, Huazhong Agricultural University, Wuhan 430070 (China); National Center of Plant Gene Research, Wuhan 430070 (China)
2013-02-18
Graphical abstract: A phage-displayed chicken scFv antibody, FvSG7, binds on the surface antigen of conidiospores and the mycelia of F. verticillioides. Its fusion with alkaline phosphatase (AP) through a 218 linker displayed a 4-fold higher affinity compared with the parent scFv antibody and efficiently detected toxigenic Fusarium pathogens in cereal grains. Highlights: ► Generation of a highly reactive scFv antibody against F. verticillioides. ► Localization of the antibody binding to the surface target of F. verticillioides. ► Expression of the antibody–alkaline phosphatase (AP) fusion linked by a 218 linker. ► The antibody–AP fusion has a higher affinity than the parental antibody. ► The antibody–AP fusion detects toxigenic Fusarium pathogens in cereal grains. -- Abstract: Fusarium and its poisonous mycotoxins are distributed worldwide and are of particular interest in agriculture and food safety. A simple analytical method to detect pathogens is essential for forecasting diseases and controlling mycotoxins. This article describes a proposed method for convenient and sensitive detection of Fusarium pathogens that uses the fusion of single-chain variable fragment (scFv) and alkaline phosphatase (AP). A highly reactive scFv antibody specific to soluble cell wall-bound proteins (SCWPs) of F. verticillioides was selected from an immunized chicken phagemid library by phage display. The antibody was verified to bind on the surface of ungerminated conidiospores and mycelia of F. verticillioides. The scFv–AP fusion was constructed, and soluble expression in bacteria was confirmed. Both the antibody properties and enzymatic activity were retained, and the antigen-binding capacity of the fusion was enhanced by the addition of a linker. Surface plasmon resonance measurements confirmed that the fusion displayed 4-fold higher affinity compared with the fusion's parental scFv antibody. Immunoblot analyses showed that the fusion had good binding
Individual differences in detecting rapidly presented fearful faces.
Directory of Open Access Journals (Sweden)
Dandan Zhang
Full Text Available Rapid detection of evolutionarily relevant threats (e.g., fearful faces is important for human survival. The ability to rapidly detect fearful faces exhibits high variability across individuals. The present study aimed to investigate the relationship between behavioral detection ability and brain activity, using both event-related potential (ERP and event-related oscillation (ERO measurements. Faces with fearful or neutral facial expressions were presented for 17 ms or 200 ms in a backward masking paradigm. Forty-two participants were required to discriminate facial expressions of the masked faces. The behavioral sensitivity index d' showed that the detection ability to rapidly presented and masked fearful faces varied across participants. The ANOVA analyses showed that the facial expression, hemisphere, and presentation duration affected the grand-mean ERP (N1, P1, and N170 and ERO (below 20 Hz and lasted from 100 ms to 250 ms post-stimulus, mainly in theta band brain activity. More importantly, the overall detection ability of 42 subjects was significantly correlated with the emotion effect (i.e., fearful vs. neutral on ERP (r = 0.403 and ERO (r = 0.552 measurements. A higher d' value was corresponding to a larger size of the emotional effect (i.e., fearful--neutral of N170 amplitude and a larger size of the emotional effect of the specific ERO spectral power at the right hemisphere. The present results suggested a close link between behavioral detection ability and the N170 amplitude as well as the ERO spectral power below 20 Hz in individuals. The emotional effect size between fearful and neutral faces in brain activity may reflect the level of conscious awareness of fearful faces.
Chen, Jia; Lin, Yuexin; Wang, Yu; Jia, Li
2015-06-01
Pathogenic bacteria cause significant morbidity and mortality to humans. There is a pressing need to establish a simple and reliable method to detect them. Herein, we show that magnetic particles (MPs) can be functionalized by poly(diallyl dimethylammonium chloride) (PDDA), and the particles (PDDA-MPs) can be utilized as adsorbents for capture of pathogenic bacteria from aqueous solution based on electrostatic interaction. The as-prepared PDDA-MPs were characterized by Fourier-transform infrared spectroscopy, zeta potential, vibrating sample magnetometry, X-ray diffraction spectrometry, scanning electron microscopy, and transmission electron microscopy. The adsorption equilibrium time can be achieved in 3min. According to the Langmuir adsorption isotherm, the maximum adsorption capacities for E. coli O157:H7 (Gram-negative bacteria) and L. monocytogenes (Gram-positive bacteria) were calculated to be 1.8×10(9) and 3.1×10(9)cfumg(-1), respectively. The bacteria in spiked mineral water (1000mL) can be completely captured when applying 50mg of PDDA-MPs and an adsorption time of 5min. In addition, PDDA-MPs-based magnetic separation method in combination with polymerase chain reaction and capillary electrophoresis allows for rapid detection of 10(1)cfumL(-1) bacteria. Copyright © 2015 Elsevier B.V. All rights reserved.
Multiplex detection of plant pathogens through the luminex magplex bead system
Vlugt, van der R.A.A.; Raaij, van H.M.G.; Weerdt, de M.; Bergervoet, J.H.W.
2015-01-01
Here we describe a versatile multiplex method for both the serological and molecular detection of plant pathogens. The Luminex MagPlex bead system uses small paramagnetic microspheres (“beads”), either coated with specific antibodies or oligonucleotides, which capture respectively viruses and/or
Simultaneous Detection of Five Pathogens from Cerebrospinal Fluid Specimens Using Luminex Technology
Directory of Open Access Journals (Sweden)
Linfu Zhou
2016-02-01
Full Text Available Early diagnosis and treatment are crucial for the outcome of central nervous system (CNS infections. In this study, we developed a multiplex PCR-Luminex assay for the simultaneous detection of five major pathogens, including Mycobacterium tuberculosis, Cryptococcus neoformans, Streptococcus pneumoniae, and herpes simplex virus types 1 and 2, which frequently cause CNS infections. Through the hybridization reaction between multiplex PCR-amplified targets and oligonucleotide “anti-TAG” sequences, we found that the PCR-Luminex assay could detect as low as 101–102 copies of synthetic pathogen DNAs. Furthermore, 163 cerebrospinal fluid (CSF specimens from patients with suspected CNS infections were used to evaluate the efficiency of this multiplex PCR-Luminex method. Compared with Ziehl-Neelsen stain, this assay showed a high diagnostic accuracy for tuberculosis meningitis (sensitivity, 90.7% and specificity, 99.1%. For cryptococcal meningitis, the sensitivity and specificity were 92% and 97.1%, respectively, compared with the May Grunwald Giemsa (MGG stain. For herpes simplex virus types 1 and 2 encephalitis, the sensitivities were 80.8% and 100%, and the specificities were 94.2% and 99%, respectively, compared with Enzyme Linked Immunosorbent Assay (ELISA assays. Taken together, this multiplex PCR-Luminex assay showed potential efficiency for the simultaneous detection of five pathogens and may be a promising supplement to conventional methods for diagnosing CNS infections.
Task 1.5 Genomic Shift and Drift Trends of Emerging Pathogens
Energy Technology Data Exchange (ETDEWEB)
Borucki, M
2010-01-05
The Lawrence Livermore National Laboratory (LLNL) Bioinformatics group has recently taken on a role in DTRA's Transformation Medical Technologies Initiative (TMTI). The high-level goal of TMTI is to accelerate the development of broad-spectrum countermeasures. To achieve those goals, TMTI has a near term need to conduct analyses of genomic shift and drift trends of emerging pathogens, with a focused eye on select agent pathogens, as well as antibiotic and virulence markers. Most emerging human pathogens are zoonotic viruses with a genome composed of RNA. The high mutation rate of the replication enzymes of RNA viruses contributes to sequence drift and provides one mechanism for these viruses to adapt to diverse hosts (interspecies transmission events) and cause new human and zoonotic diseases. Additionally, new viral pathogens frequently emerge due to genetic shift (recombination and segment reassortment) which allows for dramatic genotypic and phenotypic changes to occur rapidly. Bacterial pathogens also evolve via genetic drift and shift, although sequence drift generally occurs at a much slower rate for bacteria as compared to RNA viruses. However, genetic shift such as lateral gene transfer and inter- and intragenomic recombination enables bacteria to rapidly acquire new mechanisms of survival and antibiotic resistance. New technologies such as rapid whole genome sequencing of bacterial genomes, ultra-deep sequencing of RNA virus populations, metagenomic studies of environments rich in antibiotic resistance genes, and the use of microarrays for the detection and characterization of emerging pathogens provide mechanisms to address the challenges posed by the rapid emergence of pathogens. Bioinformatic algorithms that enable efficient analysis of the massive amounts of data generated by these technologies as well computational modeling of protein structures and evolutionary processes need to be developed to allow the technology to fulfill its potential.
Impact of Aerosol Dust on xMAP Multiplex Detection of Different Class Pathogens
Directory of Open Access Journals (Sweden)
Denis A. Kleymenov
2017-11-01
Full Text Available Environmental or city-scale bioaerosol surveillance can provide additional value for biodefense and public health. Efficient bioaerosol monitoring should rely on multiplex systems capable of detecting a wide range of biologically hazardous components potentially present in air (bacteria, viruses, toxins and allergens. xMAP technology from LuminexTM allows multiplex bead-based detection of antigens or nucleic acids, but its use for simultaneous detection of different classes of pathogens (bacteria, virus, toxin is questionable. Another problem is the detection of pathogens in complex matrices, e.g., in the presence of dust. In the this research, we developed the model xMAP multiplex test-system aiRDeTeX 1.0, which enables detection of influenza A virus, Adenovirus type 6 Salmonella typhimurium, and cholera toxin B subunit representing RNA virus, DNA virus, gram-negative bacteria and toxin respectively as model organisms of biologically hazardous components potentially present in or spreadable through the air. We have extensively studied the effect of matrix solution (PBS, distilled water, environmental dust and ultrasound treatment for monoplex and multiplex detection efficiency of individual targets. All targets were efficiently detectable in PBS and in the presence of dust. Ultrasound does not improve the detection except for bacterial LPS.
Directory of Open Access Journals (Sweden)
Ya-Bing Duan
Full Text Available Botrytis cinerea is a devastating plant pathogen that causes grey mould disease. In this study, we developed a visual detection method of B. cinerea based on the Bcos5 sequence using loop-mediated isothermal amplification (LAMP with hydroxynaphthol blue dye (HNB. The LAMP reaction was optimal at 63 °C for 45 min. When HNB was added prior to amplification, samples with B. cinerea DNA developed a characteristic sky blue color after the reaction but those without DNA or with DNA of other plant pathogenic fungi did not. Results of HNB staining method were reconfirmed when LAMP products were subjected to gel electrophoresis. The detection limit of this LAMP assay for B. cinerea was 10(-3 ng µL(-1 of genomic DNA per reaction, which was 10-fold more sensitive than conventional PCR (10(-2 ng µL(-1. Detection of the LAMP assay for inoculum of B. cinerea was possible in the inoculated tomato and strawberry petals. In the 191 diseased samples, 180 (94.2% were confirmed as positive by LAMP, 172 (90.1% positive by the tissue separation, while 147 (77.0% positive by PCR. Because the LAMP assay performed well in aspects of sensitivity, specificity, repeatability, reliability, and visibility, it is suitable for rapid detection of B. cinerea in infected plant materials prior to storage and during transportation, such as cut flowers, fruits and vegetables.
Nucleic acid detection system and method for detecting influenza
Cai, Hong; Song, Jian
2015-03-17
The invention provides a rapid, sensitive and specific nucleic acid detection system which utilizes isothermal nucleic acid amplification in combination with a lateral flow chromatographic device, or DNA dipstick, for DNA-hybridization detection. The system of the invention requires no complex instrumentation or electronic hardware, and provides a low cost nucleic acid detection system suitable for highly sensitive pathogen detection. Hybridization to single-stranded DNA amplification products using the system of the invention provides a sensitive and specific means by which assays can be multiplexed for the detection of multiple target sequences.
Amperometric immunosensor for rapid detection of Mycobacterium tuberculosis
International Nuclear Information System (INIS)
Hiraiwa, Morgan; Lee, Hyun-Boo; Inoue, Shinnosuke; Chung, Jae-Hyun; Kim, Jong-Hoon; Becker, Annie L; Weigel, Kris M; Cangelosi, Gerard A; Lee, Kyong-Hoon
2015-01-01
Tuberculosis (TB) has been a major public health problem, which can be better controlled by using accurate and rapid diagnosis in low-resource settings. A simple, portable, and sensitive detection method is required for point-of-care (POC) settings. This paper studies an amperometric biosensor using a microtip immunoassay for a rapid and low-cost detection of Mycobacterium tuberculosis (MTB) in sputum. MTB in sputum is specifically captured on the functionalized microtip surface and detected by electric current. According to the numerical study, the current signal on the microtip surface is linearly changed with increasing immersion depth. Using a reference microtip, the immersion depth is compensated for a sensing microtip. On the microtip surface, target bacteria are concentrated and organized by a coffee-ring effect, which amplifies the electric current. To enhance the signal-to-noise ratio, both the sample processing and rinsing steps are presented with the use of deionized water as a medium for the amperometric measurement. When applied to cultured MTB cells spiked into human sputum, the detection limit was 100 CFU mL −1 , comparable to a more labor-intensive fluorescence detection method reported previously. (paper)
Amperometric immunosensor for rapid detection of Mycobacterium tuberculosis
Hiraiwa, Morgan; Kim, Jong-Hoon; Lee, Hyun-Boo; Inoue, Shinnosuke; Becker, Annie L.; Weigel, Kris M.; Cangelosi, Gerard A.; Lee, Kyong-Hoon; Chung, Jae-Hyun
2015-05-01
Tuberculosis (TB) has been a major public health problem, which can be better controlled by using accurate and rapid diagnosis in low-resource settings. A simple, portable, and sensitive detection method is required for point-of-care (POC) settings. This paper studies an amperometric biosensor using a microtip immunoassay for a rapid and low-cost detection of Mycobacterium tuberculosis (MTB) in sputum. MTB in sputum is specifically captured on the functionalized microtip surface and detected by electric current. According to the numerical study, the current signal on the microtip surface is linearly changed with increasing immersion depth. Using a reference microtip, the immersion depth is compensated for a sensing microtip. On the microtip surface, target bacteria are concentrated and organized by a coffee-ring effect, which amplifies the electric current. To enhance the signal-to-noise ratio, both the sample processing and rinsing steps are presented with the use of deionized water as a medium for the amperometric measurement. When applied to cultured MTB cells spiked into human sputum, the detection limit was 100 CFU mL-1, comparable to a more labor-intensive fluorescence detection method reported previously.
Rapid detection of EBOLA VP40 in microchip immunofiltration assay
Miethe, Peter; Gary, Dominik; Hlawatsch, Nadine; Gad, Anne-Marie
2015-05-01
In the spring of 2014, the Ebola virus (EBOV) strain Zaire caused a dramatic outbreak in several regions of West Africa. The RT-PCR and antigen capture diagnostic proved to be effective for detecting EBOV in blood and serum. In this paper, we present data of a rapid antigen capture test for the detection of VP40. The test was performed in a microfluidic chip for immunofiltration analysis. The chip integrates all necessary assay components. The analytical sensitivity of the rapid test was 8 ng/ml for recombinant VP40. In serum and whole blood samples spiked with virus culture material, the detection limit was 2.2 x 102 PFU/ml. The performance data of the rapid test (15 min) are comparable to that of the VP40 laboratory ELISA.
Huo, Ya-Yun; Li, Gui-Fen; Qiu, Yan-Hong; Li, Wei-Min; Zhang, Yong-Jiang
2017-11-23
Prunus necrotic ringspot virus (PNRSV) is one of the most devastating viruses to Prunus spp. In this study, we developed a diagnostic system RT-CPA-NATSC, wherein reverse transcription-cross-priming amplification (RT-CPA) is coupled with nucleic acid test strip cassette (NATSC), a vertical flow (VF) visualization, for PNRSV detection. The RT-CPA-NATSC assay targets the encoding gene of the PNRSV coat protein with a limit of detection of 72 copies per reaction and no cross-reaction with the known Prunus pathogenic viruses and viroids, demonstrating high sensitivity and specificity. The reaction is performed on 60 °C and can be completed less than 90 min with the prepared template RNA. Field sample test confirmed the reliability of RT-CPA-NATSC, indicating the potential application of this simple and rapid detection method in routine test of PNRSV.
Gritzfeld, Jenna F; Roberts, Paul; Roche, Lorna; El Batrawy, Sherouk; Gordon, Stephen B
2011-04-13
Nasopharyngeal carriage of potential pathogens is important as it is both the major source of transmission and the prerequisite of invasive disease. New methods for detecting carriage could improve comfort, accuracy and laboratory utility. The aims of this study were to compare the sensitivities of a nasopharyngeal swab (NPS) and a nasal wash (NW) in detecting potential respiratory pathogens in healthy adults using microbiological culture and PCR. Healthy volunteers attended for nasal washing and brushing of the posterior nasopharynx. Conventional and real-time PCR were used to detect pneumococcus and meningococcus. Statistical differences between the two nasal sampling methods were determined using a nonparametric Mann-Whitney U test; differences between culture and PCR methods were determined using the McNemar test.Nasal washing was more comfortable for volunteers than swabbing (n = 24). In detection by culture, the NW was significantly more likely to detect pathogens than the NPS (p < 0.00001). Overall, there was a low carriage rate of pathogens in this sample; no significant difference was seen in the detection of bacteria between culture and PCR methods. Nasal washing and PCR may provide effective alternatives to nasopharyngeal swabbing and classical microbiology, respectively.
Waggoner, Jesse J; Balassiano, Ilana; Abeynayake, Janaki; Sahoo, Malaya K; Mohamed-Hadley, Alisha; Liu, Yuanyuan; Vital-Brazil, Juliana Magalhães; Pinsky, Benjamin A
2014-01-01
Bacteria of the genus Leptospira, the causative agents of leptospirosis, are categorized into pathogenic and non-pathogenic species. However, the benefit of using a clinical diagnostic that is specific for pathogenic species remains unclear. In this study, we present the development of a real-time PCR (rtPCR) for the detection of pathogenic Leptospira (the pathogenic rtPCR), and we perform a comparison of the pathogenic rtPCR with a published assay that detects all Leptospira species [the undifferentiated febrile illness (UFI) assay] and a reference 16S Leptospira rtPCR, which was originally designed to detect pathogenic species. For the pathogenic rtPCR, a new hydrolysis probe was designed for use with primers from the UFI assay, which targets the 16S gene. The pathogenic rtPCR detected Leptospira DNA in 37/37 cultured isolates from 5 pathogenic and one intermediate species. Two strains of the non-pathogenic L. biflexa produced no signal. Clinical samples from 65 patients with suspected leptospirosis were then tested using the pathogenic rtPCR and a reference Leptospira 16S rtPCR. All 65 samples had tested positive for Leptospira using the UFI assay; 62 (95.4%) samples tested positive using the pathogenic rtPCR (p = 0.24). Only 24 (36.9%) samples tested positive in the reference 16S rtPCR (pLeptospira species in 49/50 cases, including 3 cases that were only detected using the UFI assay. The pathogenic rtPCR displayed similar sensitivity to the UFI assay when testing clinical specimens with no difference in specificity. Both assays proved significantly more sensitive than a real-time molecular test used for comparison. Future studies are needed to investigate the clinical and epidemiologic significance of more sensitive Leptospira detection using these tests.
Pathogenic microbial ancient DNA: a problem or an opportunity?
DEFF Research Database (Denmark)
Willerslev, Eske; Cooper, Alan
2006-01-01
cloning. Yet these studies have used mobile insertion elements (e.g. IS 6110 in tuberculosis) or conserved loci (e.g. 16S) to detect the presence of pathogens, and very similar or identical sequences have been reported from environmental bacteria (Gilbert et al. 2004). For example, Rollo & Marota (1999......We agree with Donoghue & Spigelman (2005) that, although pathogen studies hold great potential, any discussion requires a critical assessment of the results to date. However, we did note, as did Pääbo et al. (2004), that the field of ancient pathogen DNA still lacks a series of well......-controlled and rigorous studies that address technical issues and reliability criteria. This is unfortunate, as the rapid evolutionary rate of many pathogens offers a unique means to establish the authenticity of ancient pathogen sequences-since they should clearly be ancestral to modern genetic diversity (e.g. Reid et...
Directory of Open Access Journals (Sweden)
Bradley J. Hernlem
2014-05-01
Full Text Available Protozoa are known to harbor bacterial pathogens, alter their survival in the environment and make them hypervirulent. Rapid non-culture based detection methods are required to determine the environmental survival and transport of enteric pathogens from point sources such as dairies and feedlots to food crops grown in proximity. Grazing studies were performed on a soil isolate of Tetrahymena fed green fluorescent protein (GFP expressing Escherichia coli O157:H7 to determine the suitability of the use of such fluorescent prey bacteria to locate and sort bacterivorous protozoa by flow cytometry. In order to overcome autofluorescence of the target organism and to clearly discern Tetrahymena with ingested prey versus those without, a ratio of prey to host of at least 100:1 was determined to be preferable. Under these conditions, we successfully sorted the two populations using short 5 to 45 min exposures of the prey and verified the internalization of E. coli O157:H7 cells in protozoa by confocal microscopy. This technique can be easily adopted for environmental monitoring of rates of enteric pathogen destruction versus protection in protozoa.
Canine Detection of the Volatilome: A Review of Implications for Pathogen and Disease Detection.
Angle, Craig; Waggoner, Lowell Paul; Ferrando, Arny; Haney, Pamela; Passler, Thomas
2016-01-01
The volatilome is the entire set of volatile organic compounds (VOC) produced by an organism. The accumulation of VOC inside and outside of the body reflects the unique metabolic state of an organism. Scientists are developing technologies to non-invasively detect VOC for the purposes of medical diagnosis, therapeutic monitoring, disease outbreak containment, and disease prevention. Detection dogs are proven to be a valuable real-time mobile detection technology for the detection of VOC related to explosives, narcotics, humans, and many other targets of interests. Little is known about what dogs are detecting when searching for biological targets. It is important to understand where biological VOC originates and how dogs might be able to detect biological targets. This review paper discusses the recent scientific literature involving VOC analysis and postulates potential biological targets for canine detection. Dogs have shown their ability to detect pathogen and disease-specific VOC. Future research will determine if dogs can be employed operationally in hospitals, on borders, in underserved areas, on farms, and in other operational environments to give real-time feedback on the presence of a biological target.
Nicklas Samils; Malin Elfstrand; Daniel L. Lindner Czederpiltz; Jan Fahleson; Ake Olson; Christina Dixelius; Jan Stenlid
2006-01-01
Heterobasidion annosum causes root and butt-rot in trees and is the most serious forest pathogen in the northern hemisphere. We developed a rapid and simple Agrobacterium-mediated method of gene delivery into H. annosum to be used in functional studies of candidate genes and for visualization of mycelial interactions. Heterobasidion annosum TC 32-1 was cocultivated at...
Wang, Zhenzhen; Chen, Zhaowei; Gao, Nan; Ren, Jinsong; Qu, Xiaogang
2015-10-07
Herein, for the first time, we presented a simple and general approach by using personal glucose meters (PGM) for portable and ultrasensitive detection of microbial pathogens. Upon addition of pathogenic bacteria, glucoamylase-quaternized magnetic nanoparticles (GA-QMNPS) conjugates were disrupted by the competitive multivalent interactions between bacteria and QMNPS, resulting in the release of GA. After magnetic separation, the free GA could catalyze the hydrolysis of amylose into glucose for quantitative readout by PGM. In such way, PGM was transmuted into a bacterial detection device and extremely low detection limits down to 20 cells mL(-1) was achieved. More importantly, QMNPS could inhibit the growth of the bacteria and destroy its cellular structure, which enabled bacteria detection and inhibition simultaneously. The simplicity, portability, sensitivity and low cost of presented work make it attractive for clinical applications. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Shinnosuke Inoue
Full Text Available An occupationally safe (biosafe sputum liquefaction protocol was developed for use with a semi-automated antibody-based microtip immunofluorescence sensor. The protocol effectively liquefied sputum and inactivated microorganisms including Mycobacterium tuberculosis, while preserving the antibody-binding activity of Mycobacterium cell surface antigens. Sputum was treated with a synergistic chemical-thermal protocol that included moderate concentrations of NaOH and detergent at 60°C for 5 to 10 min. Samples spiked with M. tuberculosis complex cells showed approximately 10(6-fold inactivation of the pathogen after treatment. Antibody binding was retained post-treatment, as determined by analysis with a microtip immunosensor. The sensor correctly distinguished between Mycobacterium species and other cell types naturally present in biosafe-treated sputum, with a detection limit of 100 CFU/mL for M. tuberculosis, in a 30-minute sample-to-result process. The microtip device was also semi-automated and shown to be compatible with low-cost, LED-powered fluorescence microscopy. The device and biosafe sputum liquefaction method opens the door to rapid detection of tuberculosis in settings with limited laboratory infrastructure.
The diagnosis of plant pathogenic bacteria: a state of art.
Scala, Valeria; Pucci, Nicoletta; Loreti, Stefania
2018-03-01
Plant protection plays an important role in agriculture for the food quality and quantity. The diagnosis of plant diseases and the identification of the pathogens are essential prerequisites for their understanding and control. Among the plant pests, the bacterial pathogens have devastating effects on plant productivity and yield. Different techniques (microscopy, serology, biochemical, physiological, molecular tools and culture propagation) are currently used to detect and identify bacterial pathogens. Detection and identification are critical steps for the appropriate application of phytosanitary measures. The "harmonization of phytosanitary regulations and all other areas of official plant protection action" mean the good practices for plant protection and plant material certification. The prevention of diseases progression and spread by early detection are a valuable strategy for proper pest management and disease control. For this purpose, innovative methods aim achieving results within a shorter time and higher performance, to provide rapidly, accurately and reliably diagnosis. In this review, we focus on the techniques for plant bacterial diagnosis and on the regulations for harmonizing plant protection issue.
Rapid detection of the positive side reactions in vanadium flow batteries
International Nuclear Information System (INIS)
Liu, Le; Li, Zhaohua; Xi, Jingyu; Zhou, Haipeng; Wu, Zenghua; Qiu, Xinping
2017-01-01
Highlights: • A method for rapid measurement of the positive side reactions in VFB is presented. • The SOC of positive electrolytes can be detected with resolution of 0.002%. • Side reaction ratios at different charge currents, flow rates are obtained. - Abstract: We present an optical detection method for rapid measurement of the positive side reactions in vanadium flow batteries (VFB). By measuring the transmittance of the positive electrolytes in VFB, the states of charge (SOC) of the positive electrolytes can be detected at very high resolution (better than 0.002% in the SOC range from 98% to 100%), due to the nonlinear transmittance spectra caused by the interactions between V(IV) and V(V) ions. The intensity of the positive side reactions of a VFB can be rapidly measured by a few steps, attributing to the fact that the positive side reactions occur only during the high voltage charging process. The ratios of the positive side reactions at different charge currents and different flow rates are obtained while causing no damage to the battery. This optical detection method can rapidly determine the optimal parameters of the VFB system, providing new means for studying the electrochemical reactions in the VFB system and rapid test in industrial production of VFBs.
Kajiwara, Hideyuki
2016-01-01
The plant pathogens Burkholderia glumae, Burkholderia gladioli pv. gladioli, and Erwinia chrysanthemi pv. zeae were directly detected in extracts from infected rice seedlings by matrix assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). This method did not require culturing of the pathogens on artificial medium. In the MALDI-TOF MS analysis, peaks originating from bacteria were found in extracts from infected rice seedlings. The spectral peaks showed significantly high scores, in spite of minor differences in spectra. The spectral peaks originating from host plant tissues did not affect this direct MALDI-TOF MS analysis for the rapid identification of plant pathogens. Copyright © 2015 Elsevier B.V. All rights reserved.
Freeman, S.; Rodriguez, R.J.
1993-01-01
A continuous-dip inoculation technique for rapid assessment of pathogenicity of Fusarium oxysporum f. sp. niveum and F. o. melonis was developed. The method, adapted from a similar procedure for determining pathogenicity of Colletotrichum magna (causal agent of anthracnose of cucurbits), involves constant exposure of seedlings and cuttings (seedlings with root systems excised) of watermelon and muskmelon to conidial suspensions contained in small scintillation vials. Disease development in intact seedlings corresponded well to disease responses observed with the standard root-dip inoculation/pot assay. The continuous-dip inoculation technique resulted in rapid disease development, with 50% of watermelon cuttings dying after 4–6 days of exposure to F. o. niveum. A mortality of 30% also was observed in watermelon cuttings exposed to conidia of F. o. melonis, as opposed to only a 0–2.5% mortality in seedlings with intact roots. Disease response was similar with muskmelon seedlings and cuttings continuously dip-inoculated with F. o. melonis isolates. However, no disease symptoms were observed in muskmelon seedlings or cuttings inoculated with F. o. niveum. Four nonpathogenic isolates of F. oxysporum did not cause disease symptoms in either watermelon or muskmelon cuttings and seedlings when assayed by this technique. The proposed method enables a rapid screening of pathogenicity and requires less time, labor, and greenhouse space than the standard root-dip inoculation/pot assay. The reliability of the continuous-dip inoculation technique is limited, however, to exposure of intact seedlings at a concentration of 1 × 106conidia per milliliter; the method is not accurate at this range for excised seedlings.
Yang, Xiang; Noyes, Noelle R.; Doster, Enrique; Martin, Jennifer N.; Linke, Lyndsey M.; Magnuson, Roberta J.; Yang, Hua; Geornaras, Ifigenia; Woerner, Dale R.; Jones, Kenneth L.; Ruiz, Jaime; Boucher, Christina; Morley, Paul S.; Belk, Keith E.
2016-01-01
Foodborne illnesses associated with pathogenic bacteria are a global public health and economic challenge. The diversity of microorganisms (pathogenic and nonpathogenic) that exists within the food and meat industries complicates efforts to understand pathogen ecology. Further, little is known about the interaction of pathogens within the microbiome throughout the meat production chain. Here, a metagenomic approach and shotgun sequencing technology were used as tools to detect pathogenic bact...
Rapid detection of food-borne Salmonella contamination using IMBs-qPCR method based on pagC gene
Directory of Open Access Journals (Sweden)
Jiashun Wang
Full Text Available Abstract Detection of Salmonella is very important to minimize the food safety risk. In this study, the recombinant PagC protein and PagC antibody were prepared and coupled with immunomagnetic beads (IMBs to capture Salmonella cells from pork and milk samples. And then the SYBR Green qualitative PCR was developed to detect the pathogenic Salmonella. The results showed that the PagC polyclonal antiserum is of good specificity and the capture rate of 0.1 mg IMBs for Salmonella tended to be stable at the range of 70-74% corresponding to the concentrations between 101 and 104 CFU/mL. The method developed demonstrated high specificity for the positive Salmonella samples when compared to non-specific DNA samples, such as Escherichia coli, Staphylococcus aureus, Yersinia enterocolitica, and Yersinia pseudotuberculosis. The limit of detection of this assay was 18 CFU/mL. Detection and quantitative enumeration of Salmonella in samples of pork or milk shows good recoveries of 54.34% and 52.07%. In conclusion, the polyclonal antibody of recombinant PagC protein is effective to capture Salmonella from detected samples. The developed pagC antibody IMBs-qPCR method showed efficiency, sensitivity and specificity for 30 Salmonella detection, enabling detection within 10 h, which is a promising rapid method to detect Salmonella in emergency.
2014-01-01
Background Yersiniosis is a zoonotic disease reported worldwide. Culture and PCR based protocols are the most common used methods for detection of pathogenic Yersinia species in animal samples. PCR sensitivity could be increased by an initial enrichment step. This step is particularly useful in surveillance programs, where PCR is applied to samples from asymptomatic animals. The aim of this study was to evaluate the improvement in pathogenic Yersinia species detection using a suitable enrichment method prior to the real time PCR (rtPCR). Nine different enrichment protocols were evaluated including six different broth mediums (CASO, ITC, PSB, PBS, PBSMSB and PBSSSB). Results The analysis of variance showed significant differences in Yersinia detection by rtPCR according to the enrichment protocol used. These differences were higher for Y. pseudotuberculosis than for Y. enterocolitica. In general, samples incubated at lower temperatures yielded the highest detection rates. The best results were obtained with PBSMSB and PBS2. Application of PBSMSB protocol to free-ranging wild board samples improved the detection of Y. enterocolitica by 21.2% when compared with direct rtPCR. Y. pseudotuberculosis detection was improved by 10.6% when results obtained by direct rtPCR and by PBSMSB enrichment before rtPCR were analyzed in combination. Conclusions The data obtained in the present study indicate a difference in Yersinia detection by rtPCR related to the enrichment protocol used, being PBSMSB enrichment during 15 days at 4°C and PBS during 7 days at 4°C the most efficient. The use of direct rtPCR in combination with PBSMSB enrichment prior to rtPCR resulted in an improvement in the detection rates of pathogenic Yersinia in wild boar and could be useful for application in other animal samples. PMID:25168886
Wambua, Lillian; Schneider, Bernd; Okwaro, Allan; Wanga, Joseph Odhiambo; Imali, Olive; Wambua, Peninah Nduku; Agutu, Lavender; Olds, Cassandra; Jones, Chris Stephen; Masiga, Daniel; Midega, Charles; Khan, Zeyaur; Jores, Joerg; Fischer, Anne
2017-10-01
Napier grass Stunt Disease (NSD) is a severe disease of Napier grass (Pennisetum purpureum) in Eastern Africa, caused by the leafhopper-transmitted bacterium Candidatus Phytoplasma oryzae. The pathogen severely impairs the growth of Napier grass, the major fodder for dairy cattle in Eastern Africa. NSD is associated with biomass losses of up to 70% of infected plants. Diagnosis of NSD is done by nested PCR targeting the phytoplasma DNA, which is difficult to perform in developing countries with little infrastructure. We report the development of an easy to use, rapid, sensitive and specific molecular assay for field diagnosis of NSD. The procedure is based on recombinase polymerase amplification and targets the imp gene encoding a pathogen-specific immunodominant membrane protein. Therefore we followed a two-step process. First we developed an isothermal DNA amplification method for real time fluorescence application and then transferred this assay to a lateral flow format. The limit of detection for both procedures was estimated to be 10 organisms. We simplified the template preparation procedure by using freshly squeezed phloem sap from Napier grass. Additionally, we developed a laboratory serological assay with the potential to be converted to a lateral flow assay. Two murine monoclonal antibodies with high affinity and specificity to the immunodominant membrane protein IMP of Candidatus Phytoplasma oryzae were generated. Both antibodies specifically reacted with the denatured or native 17 kDa IMP protein. In dot blot experiments of extracts from infected plant, phytoplasmas were detected in as little as 12,5 μg of fresh plant material. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Detection of Emerging and Re-Emerging Pathogens in Surface Waters Close to an Urban Area
Directory of Open Access Journals (Sweden)
Stefania Marcheggiani
2015-05-01
Full Text Available Current knowledge about the spread of pathogens in aquatic environments is scarce probably because bacteria, viruses, algae and their toxins tend to occur at low concentrations in water, making them very difficult to measure directly. The purpose of this study was the development and validation of tools to detect pathogens in freshwater systems close to an urban area. In order to evaluate anthropogenic impacts on water microbiological quality, a phylogenetic microarray was developed in the context of the EU project µAQUA to detect simultaneously numerous pathogens and applied to samples from two different locations close to an urban area located upstream and downstream of Rome in the Tiber River. Furthermore, human enteric viruses were also detected. Fifty liters of water were collected and concentrated using a hollow-fiber ultrafiltration approach. The resultant concentrate was further size-fractionated through a series of decreasing pore size filters. RNA was extracted from pooled filters and hybridized to the newly designed microarray to detect pathogenic bacteria, protozoa and toxic cyanobacteria. Diatoms as indicators of the water quality status, were also included in the microarray to evaluate water quality. The microarray results gave positive signals for bacteria, diatoms, cyanobacteria and protozoa. Cross validation of the microarray was performed using standard microbiological methods for the bacteria. The presence of oral-fecal transmitted human enteric-viruses were detected using q-PCR. Significant concentrations of Salmonella, Clostridium, Campylobacter and Staphylococcus as well as Hepatitis E Virus (HEV, noroviruses GI (NoGGI and GII (NoGII and human adenovirus 41 (ADV 41 were found in the Mezzocammino site, whereas lower concentrations of other bacteria and only the ADV41 virus was recovered at the Castel Giubileo site. This study revealed that the pollution level in the Tiber River was considerably higher downstream rather than
Inoue, Daisuke; Hinoura, Takuji; Suzuki, Noriko; Pang, Junqin; Malla, Rabin; Shrestha, Sadhana; Chapagain, Saroj Kumar; Matsuzawa, Hiroaki; Nakamura, Takashi; Tanaka, Yasuhiro; Ike, Michihiko; Nishida, Kei; Sei, Kazunari
2015-01-01
Because of heavy dependence on groundwater for drinking water and other domestic use, microbial contamination of groundwater is a serious problem in the Kathmandu Valley, Nepal. This study investigated comprehensively the occurrence of pathogenic bacteria in shallow well groundwater in the Kathmandu Valley by applying DNA microarray analysis targeting 941 pathogenic bacterial species/groups. Water quality measurements found significant coliform (fecal) contamination in 10 of the 11 investigated groundwater samples and significant nitrogen contamination in some samples. The results of DNA microarray analysis revealed the presence of 1-37 pathogen species/groups, including 1-27 biosafety level 2 ones, in 9 of the 11 groundwater samples. While the detected pathogens included several feces- and animal-related ones, those belonging to Legionella and Arthrobacter, which were considered not to be directly associated with feces, were detected prevalently. This study could provide a rough picture of overall pathogenic bacterial contamination in the Kathmandu Valley, and demonstrated the usefulness of DNA microarray analysis as a comprehensive screening tool of a wide variety of pathogenic bacteria.
Nordmann, Patrice; Jayol, Aurélie; Dobias, Jan; Poirel, Laurent
2017-04-01
The rapid aminoglycoside NP (Nordmann/Poirel) test was developed to rapidly identify multiple aminoglycoside (AG) resistance in Enterobacteriaceae It is based on the detection of the glucose metabolism related to enterobacterial growth in the presence of a defined concentration of amikacin plus gentamicin. Formation of acid metabolites was evidenced by a color change (orange to yellow) of the red phenol pH indicator. The rapid aminoglycoside NP test was evaluated by using bacterial colonies of 18 AG-resistant isolates producing 16S rRNA methylases, 20 AG-resistant isolates expressing AG-modifying enzymes (acetyl-, adenyl-, and phosphotransferases), and 10 isolates susceptible to AG. Its sensitivity and specificity were 100% and 97%, respectively, compared to the broth dilution method, which was taken as the gold standard for determining aminoglycoside resistance. The test is inexpensive, rapid (<2 h), and implementable worldwide. Copyright © 2017 American Society for Microbiology.
The detection and differentiation of canine respiratory pathogens using oligonucleotide microarrays.
Wang, Lih-Chiann; Kuo, Ya-Ting; Chueh, Ling-Ling; Huang, Dean; Lin, Jiunn-Horng
2017-05-01
Canine respiratory diseases are commonly seen in dogs along with co-infections with multiple respiratory pathogens, including viruses and bacteria. Virus infections in even vaccinated dogs were also reported. The clinical signs caused by different respiratory etiological agents are similar, which makes differential diagnosis imperative. An oligonucleotide microarray system was developed in this study. The wild type and vaccine strains of canine distemper virus (CDV), influenza virus, canine herpesvirus (CHV), Bordetella bronchiseptica and Mycoplasma cynos were detected and differentiated simultaneously on a microarray chip. The detection limit is 10, 10, 100, 50 and 50 copy numbers for CDV, influenza virus, CHV, B. bronchiseptica and M. cynos, respectively. The clinical test results of nasal swab samples showed that the microarray had remarkably better efficacy than the multiplex PCR-agarose gel method. The positive detection rate of microarray and agarose gel was 59.0% (n=33) and 41.1% (n=23) among the 56 samples, respectively. CDV vaccine strain and pathogen co-infections were further demonstrated by the microarray but not by the multiplex PCR-agarose gel. The oligonucleotide microarray provides a highly efficient diagnosis alternative that could be applied to clinical usage, greatly assisting in disease therapy and control. Copyright © 2017 Elsevier B.V. All rights reserved.
Weidemaier, Kristin; Carruthers, Erin; Curry, Adam; Kuroda, Melody; Fallows, Eric; Thomas, Joseph; Sherman, Douglas; Muldoon, Mark
2015-04-02
We describe a new approach for the real-time detection and identification of pathogens in food and environmental samples undergoing culture. Surface Enhanced Raman Scattering (SERS) nanoparticles are combined with a novel homogeneous immunoassay to allow sensitive detection of pathogens in complex samples such as stomached food without the need for wash steps or extensive sample preparation. SERS-labeled immunoassay reagents are present in the cultural enrichment vessel, and the signal is monitored real-time through the wall of the vessel while culture is ongoing. This continuous monitoring of pathogen load throughout the enrichment process enables rapid, hands-free detection of food pathogens. Furthermore, the integration of the food pathogen immunoassay directly into the enrichment vessel enables fully biocontained food safety testing, thereby significantly reducing the risk of contaminating the surrounding environment with enriched pathogens. Here, we present experimental results showing the detection of E. coli, Salmonella, or Listeria in several matrices (raw ground beef, raw ground poultry, chocolate milk, tuna salad, spinach, brie cheese, hot dogs, deli turkey, orange juice, cola, and swabs and sponges used to sample a stainless steel surface) using the SERS system and demonstrate the accuracy of the approach compared to plating results. Copyright © 2014 Elsevier B.V. All rights reserved.
Analysis of bacterial metagenomes from the Southwestern Gulf of Mexico for pathogens detection.
Escobedo-Hinojosa, Wendy; Pardo-López, Liliana
2017-07-31
Little is known about the diversity of bacteria in the Southwestern Gulf of Mexico. The aim of the study illustrated in this perspective was to search for the presence of bacterial pathogens in this ecosystem, using metagenomic data recently generated by the Mexican research group known as the Gulf of Mexico Research Consortium. Several genera of bacteria annotated as pathogens were detected in water and sediment marine samples. As expected, native and ubiquitous pathogenic bacteria genera such as Burkolderia, Halomonas, Pseudomonas, Shewanella and Vibrio were highly represented. Surprisingly, non-native genera of public health concern were also detected, including Borrelia, Ehrlichia, Leptospira, Mycobacterium, Mycoplasma, Salmonella, Staphylococcus, Streptococcus and Treponema. While there are no previous metagenomics studies of this environment, the potential influences of natural, anthropogenic and ecological factors on the diversity of putative pathogenic bacteria found in it are reviewed. The taxonomic annotation herein reported provides a starting point for an improved understanding of bacterial biodiversity in the Southwestern Gulf of Mexico. It also represents a useful tool in public health as it may help identify infectious diseases associated with exposure to marine water and ingestion of fish or shellfish, and thus may be useful in predicting and preventing waterborne disease outbreaks. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Integrated Detection of Pathogens and Host Biomarkers for Wounds
Energy Technology Data Exchange (ETDEWEB)
Jaing, C
2012-03-19
The increasing incidence and complications arising from combat wounds has necessitated a reassessment of methods for effective treatment. Infection, excessive inflammation, and incidence of drug-resistant organisms all contribute toward negative outcomes for afflicted individuals. The organisms and host processes involved in wound progression, however, are incompletely understood. We therefore set out, using our unique technical resources, to construct a profile of combat wounds which did or did not successfully resolve. We employed the Lawrence Livermore Microbial Detection Array and identified a number of nosocomial pathogens present in wound samples. Some of these identities corresponded with bacterial isolates previously cultured, while others were not obtained via standard microbiology. Further, we optimized proteomics protocols for the identification of host biomarkers indicative of various stages in wound progression. In combination with our pathogen data, our biomarker discovery efforts will provide a profile corresponding to wound complications, and will assist significantly in treatment of these complex cases.
Bauer, Beth A; Besch-Williford, Cynthia; Livingston, Robert S; Crim, Marcus J; Riley, Lela K; Myles, Matthew H
2016-11-01
Sampling of bedding debris within the exhaust systems of ventilated racks may be a mechanism for detecting murine pathogens in colony animals. This study examined the effectiveness of detecting pathogens by PCR analysis of exhaust debris samples collected from ventilated racks of 2 different rack designs, one with unfiltered air flow from within the cage to the air-exhaust pathway, and the other had a filter between the cage and the air-exhaust pathway. For 12 wk, racks were populated with either 1 or 5 cages of mice (3 mice per cage) infected with one of the following pathogens: mouse norovirus (MNV), mouse parvovirus (MPV), mouse hepatitis virus (MHV), Helicobacter spp., Pasteurella pneumotropica, pinworms, Entamoeba muris, Tritrichomonas muris, and fur mites. Pathogen shedding by infected mice was monitored throughout the study. In the filter-containing rack, PCR testing of exhaust plenums yielded negative results for all pathogens at all time points of the study. In the rack with open air flow, pathogens detected by PCR analysis of exhaust debris included MHV, Helicobacter spp., P. pneumotropica, pinworms, enteric protozoa, and fur mites; these pathogens were detected in racks housing either 1 or 5 cages of infected mice. Neither MPV nor MNV was detected in exhaust debris, even though prolonged viral shedding was confirmed. These results demonstrate that testing rack exhaust debris from racks with unfiltered air flow detected MHV, enteric bacteria and parasites, and fur mites. However, this method failed to reliably detect MNV or MPV infection of colony animals.
Developing nucleic acid-based electrical detection systems
Directory of Open Access Journals (Sweden)
Gabig-Ciminska Magdalena
2006-03-01
Full Text Available Abstract Development of nucleic acid-based detection systems is the main focus of many research groups and high technology companies. The enormous work done in this field is particularly due to the broad versatility and variety of these sensing devices. From optical to electrical systems, from label-dependent to label-free approaches, from single to multi-analyte and array formats, this wide range of possibilities makes the research field very diversified and competitive. New challenges and requirements for an ideal detector suitable for nucleic acid analysis include high sensitivity and high specificity protocol that can be completed in a relatively short time offering at the same time low detection limit. Moreover, systems that can be miniaturized and automated present a significant advantage over conventional technology, especially if detection is needed in the field. Electrical system technology for nucleic acid-based detection is an enabling mode for making miniaturized to micro- and nanometer scale bio-monitoring devices via the fusion of modern micro- and nanofabrication technology and molecular biotechnology. The electrical biosensors that rely on the conversion of the Watson-Crick base-pair recognition event into a useful electrical signal are advancing rapidly, and recently are receiving much attention as a valuable tool for microbial pathogen detection. Pathogens may pose a serious threat to humans, animal and plants, thus their detection and analysis is a significant element of public health. Although different conventional methods for detection of pathogenic microorganisms and their toxins exist and are currently being applied, improvements of molecular-based detection methodologies have changed these traditional detection techniques and introduced a new era of rapid, miniaturized and automated electrical chip detection technologies into pathogen identification sector. In this review some developments and current directions in
Rapid Detection of the Varicella Zoster Virus
Lewis, Michelle P.; Harding, Robert
2011-01-01
1.Technology Description-Researchers discovered that when the Varicella Zoster Virus (VZV) reactivates from latency in the body, the virus is consistently present in saliva before the appearance of skin lesions. A small saliva sample is mixed with a specialized reagent in a test kit. If the virus is present in the saliva sample, the mixture turns a red color. The sensitivity and specificity emanates from an antibody-antigen reaction. This technology is a rapid, non-invasive, point of-of-care testing kit for detecting the virus from a saliva sample. The device is easy to use and can be used in clinics and in remote locations to quickly detect VZV and begin treatment with antiviral drugs. 2.Market Opportunity- RST Bioscience will be the first and only company to market a rapid, same day test kit for the detection of VZV in saliva. The RST detection test kit will have several advantages over existing, competitive technology. The test kit is self contained and laboratory equipment is not required for analysis of the sample. Only a single saliva sample is required to be taken instead of blood or cerebral spinal fluid. The test kit is portable, sterile and disposable after use. RST detection test kits require no electrical power or expensive storage equipment and can be used in remote locations. 3.Market Analysis- According to the CDC, it is estimated that 1 million cases of shingles occur each year in the U.S. with more than half over the age of sixty. There is a high demand for rapid diagnostics by the public. The point-of-care testing (POCT) market is growing faster than other segments of in vitro diagnostics. According to a July 2007 InteLab Corporation industry report the overall market for POCT was forecast to increase from $10.3 billion in 2005 to $18.7 billion by 2011. The market value of this test kit has not been determined. 4.Competition- The VZV vaccine prevents 50% of cases and reduces neuralgia by 66%. The most popular test detects VZV-specific IgM antibody
Minuzzi-Souza, Thaís Tâmara Castro; Nitz, Nadjar; Cuba, César Augusto Cuba; Hagström, Luciana; Hecht, Mariana Machado; Santana, Camila; Ribeiro, Marcelle; Vital, Tamires Emanuele; Santalucia, Marcelo; Knox, Monique; Obara, Marcos Takashi; Abad-Franch, Fernando; Gurgel-Gonçalves, Rodrigo
2018-01-09
Vector-borne pathogens threaten human health worldwide. Despite their critical role in disease prevention, routine surveillance systems often rely on low-complexity pathogen detection tests of uncertain accuracy. In Chagas disease surveillance, optical microscopy (OM) is routinely used for detecting Trypanosoma cruzi in its vectors. Here, we use replicate T. cruzi detection data and hierarchical site-occupancy models to assess the reliability of OM-based T. cruzi surveillance while explicitly accounting for false-negative and false-positive results. We investigated 841 triatomines with OM slides (1194 fresh, 1192 Giemsa-stained) plus conventional (cPCR, 841 assays) and quantitative PCR (qPCR, 1682 assays). Detections were considered unambiguous only when parasitologists unmistakably identified T. cruzi in Giemsa-stained slides. qPCR was >99% sensitive and specific, whereas cPCR was ~100% specific but only ~55% sensitive. In routine surveillance, examination of a single OM slide per vector missed ~50-75% of infections and wrongly scored as infected ~7% of the bugs. qPCR-based and model-based infection frequency estimates were nearly three times higher, on average, than OM-based indices. We conclude that the risk of vector-borne Chagas disease may be substantially higher than routine surveillance data suggest. The hierarchical modelling approach we illustrate can help enhance vector-borne disease surveillance systems when pathogen detection is imperfect.
Ranjan, R K; Singh, Dinesh; Baranwal, V K
2016-11-01
Ralstonia solanacearum (Smith) Yabuuchi et al. and Erwinia carotovora subsp. carotovora (Jones) Bergey et al. (Pectobacterium carotovorum subsp. carotovorum) are the two major bacterial pathogens of potato causing brown rot (wilt) and soft rot diseases, respectively, in the field and during storage. Reliable and early detection of these pathogens are keys to avoid occurrence of these diseases in potato crops and reduce yield loss. In the present study, multiplex polymerase chain reaction (PCR) protocol was developed for simultaneous detection of R. solanacearum and E. carotovora subsp. carotovora from potato tubers. A set of oligos targeting the pectatelyase (pel) gene of E. carotovora subsp. carotovora and the universal primers based on 16S r RNA gene of R. solanacearum were used. The standardized multiplex PCR protocol could detect R. solanacearum and E. carotovora subsp. carotovora up to 0.01 and 1.0 ng of genomic DNA, respectively. The protocol was further validated on 96 stored potato tuber samples, collected from different potato-growing states of India, viz. Uttarakhand, Odisha, Meghalaya and Delhi. 53.1 % tuber samples were positive for R. solanacearum, and 15.1 % of samples were positive for E. carotovora subsp. carotovora, and both the pathogens were positive in 26.0 % samples when BIO-PCR was used. This method offers sensitive, specific, reliable and fast detection of two major bacterial pathogens from potato tubers simultaneously, particularly pathogen-free seed certification in large scale.
Zamani, Parichehr; Sajedi, Reza H; Hosseinkhani, Saman; Zeinoddini, Mehdi; Bakhshi, Bita
2016-05-15
In this study, a hybridoma based biosensor was developed for rapid, sensitive and selective detection of Vibrio cholerae O1 which converts the antibody-antigen binding to bioluminescence light. After investigation on hybridoma performance, the biosensor was constructed by transfecting specific hybridoma cells with aequorin reporter gene and the bioluminescence activities of stable biosensor were measured. The sensitivity of biosensor was as few as 50 CFU/ml and it showed no responses to other entric bacteria. Moreover, the response time of biosensor was estimated in 7th second which means this method is considerably faster than many available detection assays. In addition, this biosensor was successfully applied to V. cholerae detection in environmental samples with no significant loss in sensitivity, demonstrating our proposed biosensor provides a sensitive and reliable method for detection of V. cholerae in natural samples. The application of whole hybridoma cell directly as a sensing element in biosensor construction which mentioned for the first time in present study suggests that hybridoma cells could provide a valuable tool for future studies in both basic and diagnostic sciences and could be considered as a fast and specific sensing element for detection of other pathogens in different applications. Copyright © 2015 Elsevier B.V. All rights reserved.
Airborne Detection of H5N8 Highly Pathogenic Avian Influenza Virus Genome in Poultry Farms, France.
Scoizec, Axelle; Niqueux, Eric; Thomas, Rodolphe; Daniel, Patrick; Schmitz, Audrey; Le Bouquin, Sophie
2018-01-01
In southwestern France, during the winter of 2016-2017, the rapid spread of highly pathogenic avian influenza H5N8 outbreaks despite the implementation of routine control measures, raised the question about the potential role of airborne transmission in viral spread. As a first step to investigate the plausibility of that transmission, air samples were collected inside, outside and downwind from infected duck and chicken facilities. H5 avian influenza virus RNA was detected in all samples collected inside poultry houses, at external exhaust fans and at 5 m distance from poultry houses. For three of the five flocks studied, in the sample collected at 50-110 m distance, viral genomic RNA was detected. The measured viral air concentrations ranged between 4.3 and 6.4 log 10 RNA copies per m 3 , and their geometric mean decreased from external exhaust fans to the downwind measurement point. These findings are in accordance with the possibility of airborne transmission and question the procedures for outbreak depopulation.
Airborne Detection of H5N8 Highly Pathogenic Avian Influenza Virus Genome in Poultry Farms, France
Directory of Open Access Journals (Sweden)
Axelle Scoizec
2018-02-01
Full Text Available In southwestern France, during the winter of 2016–2017, the rapid spread of highly pathogenic avian influenza H5N8 outbreaks despite the implementation of routine control measures, raised the question about the potential role of airborne transmission in viral spread. As a first step to investigate the plausibility of that transmission, air samples were collected inside, outside and downwind from infected duck and chicken facilities. H5 avian influenza virus RNA was detected in all samples collected inside poultry houses, at external exhaust fans and at 5 m distance from poultry houses. For three of the five flocks studied, in the sample collected at 50–110 m distance, viral genomic RNA was detected. The measured viral air concentrations ranged between 4.3 and 6.4 log10 RNA copies per m3, and their geometric mean decreased from external exhaust fans to the downwind measurement point. These findings are in accordance with the possibility of airborne transmission and question the procedures for outbreak depopulation.
An integrated micro-chip for rapid detection of magnetic particles
Gooneratne, Chinthaka P.; Liang, Cai; Giouroudi, Ioanna; Kosel, Jü rgen
2012-01-01
This paper proposes an integrated micro-chip for the manipulation and detection of magnetic particles (MPs). A conducting ring structure is used to manipulate MPs toward giant magnetoresistance(GMR) sensing elements for rapid detection
Galehdari, Hamid; Saki, Najmaldin; Mohammadi-Asl, Javad; Rahim, Fakher
2013-01-01
Crigler-Najjar syndrome (CNS) type I and type II are usually inherited as autosomal recessive conditions that result from mutations in the UGT1A1 gene. The main objective of the present review is to summarize results of all available evidence on the accuracy of SNP-based pathogenicity detection tools compared to published clinical result for the prediction of in nsSNPs that leads to disease using prediction performance method. A comprehensive search was performed to find all mutations related to CNS. Database searches included dbSNP, SNPdbe, HGMD, Swissvar, ensemble, and OMIM. All the mutation related to CNS was extracted. The pathogenicity prediction was done using SNP-based pathogenicity detection tools include SIFT, PHD-SNP, PolyPhen2, fathmm, Provean, and Mutpred. Overall, 59 different SNPs related to missense mutations in the UGT1A1 gene, were reviewed. Comparing the diagnostic OR, PolyPhen2 and Mutpred have the highest detection 4.983 (95% CI: 1.24 - 20.02) in both, following by SIFT (diagnostic OR: 3.25, 95% CI: 1.07 - 9.83). The highest MCC of SNP-based pathogenicity detection tools, was belong to SIFT (34.19%) followed by Provean, PolyPhen2, and Mutpred (29.99%, 29.89%, and 29.89%, respectively). Hence the highest SNP-based pathogenicity detection tools ACC, was fit to SIFT (62.71%) followed by PolyPhen2, and Mutpred (61.02%, in both). Our results suggest that some of the well-established SNP-based pathogenicity detection tools can appropriately reflect the role of a disease-associated SNP in both local and global structures.
Lab-on-a-chip for rapid electrochemical detection of nerve agent Sarin
DEFF Research Database (Denmark)
Tan, Hsih-Yin; Loke, Weng Keong; Nguyen, Nam-Trung
2014-01-01
This paper reports a lab-on-a-chip for the detection of Sarin nerve agent based on rapid electrochemical detection. The chemical warfare agent Sarin (C4H10FO2P, O-isopropyl methylphosphonofluoridate) is a highly toxic organophosphate that induces rapid respiratory depression, seizures and death...
Advances in developing rapid, reliable and portable detection systems for alcohol.
Thungon, Phurpa Dema; Kakoti, Ankana; Ngashangva, Lightson; Goswami, Pranab
2017-11-15
Development of portable, reliable, sensitive, simple, and inexpensive detection system for alcohol has been an instinctive demand not only in traditional brewing, pharmaceutical, food and clinical industries but also in rapidly growing alcohol based fuel industries. Highly sensitive, selective, and reliable alcohol detections are currently amenable typically through the sophisticated instrument based analyses confined mostly to the state-of-art analytical laboratory facilities. With the growing demand of rapid and reliable alcohol detection systems, an all-round attempt has been made over the past decade encompassing various disciplines from basic and engineering sciences. Of late, the research for developing small-scale portable alcohol detection system has been accelerated with the advent of emerging miniaturization techniques, advanced materials and sensing platforms such as lab-on-chip, lab-on-CD, lab-on-paper etc. With these new inter-disciplinary approaches along with the support from the parallel knowledge growth on rapid detection systems being pursued for various targets, the progress on translating the proof-of-concepts to commercially viable and environment friendly portable alcohol detection systems is gaining pace. Here, we summarize the progress made over the years on the alcohol detection systems, with a focus on recent advancement towards developing portable, simple and efficient alcohol sensors. Copyright © 2017 Elsevier B.V. All rights reserved.
Mritunjay, Sujeet K; Kumar, Vipin
2017-01-01
Consumption of ready-to-eat fresh vegetables has increased worldwide, with a consequent increase in outbreaks caused by foodborne pathogens. In the Indian subcontinent, raw fresh vegetables are usually consumed without washing or other decontamination procedures, thereby leading to new food safety threats. In this study, the microbiological quality and pathogenic profile of raw salad vegetables was evaluated through standard protocols. In total, 480 samples (60 each of eight different salad vegetables) of cucumber, tomato, carrot, coriander, cabbage, beetroot, radish, and spinach were collected from different locations in Dhanbad, a city famous for its coal fields and often called the "Coal Capital of India." The samples were analyzed for total plate count, total coliforms, Escherichia coli , E. coli O157:H7, Listeria monocytogenes , and Salmonella spp. Incidences of pathogens were detected through quantitative PCR subsequent to isolation. Results showed that 46.7% (for total plate counts) and 30% (for total coliforms) of samples were unacceptable for consumption per the Food Safety and Standards Authority of India. Pathogenic microorganisms were detected in 3.7% of total samples. E. coli O157:H7 was detected in three samples of spinach (2) and beetroot ( 1 ); L. monocytogenes was detected in 14 samples of spinach ( 8 ), tomato ( 3 ), cucumber ( 2 ), and radish ( 1 ); and Salmonella spp. were detected in 16 samples of spinach ( 7 ), tomato ( 3 ), beetroot ( 2 ), cucumber ( 2 ), carrot ( 1 ), and radish ( 1 ). Pathogens were not detected in any of the cabbage and coriander samples.
Rapid detection of hepatitis A virus and murine norovirus in hemocytes of contaminated oysters
The human enteric pathogens, hepatitis A virus and human norovirus, have been shown to contaminate molluscan shellfish and cause foodborne disease in consumers. Rapid viral extraction methods are needed to replace current time consuming methods, which use whole oysters or dissected tissues. In our ...
International Nuclear Information System (INIS)
Xie, Yunxuan; Qiu, Ning; Wang, Guangyi
2017-01-01
Prosperous development in marine-based tourism has raised increasing concerns over the sanitary quality of coastal waters with potential microbial contamination. The World Health Organization has set stringent standards over a list of pathogenic microorganisms posing potential threats to people with frequent coastal water exposure and has asked for efficient detection procedures for pathogen facile identification. Inspection of survey events regarding the occurrence of marine pathogens in recreational beaches in recent years has reinforced the need for the development of a rapid identification procedure. In this review, we examine the possibility of recruiting uniform molecular assays to identify different marine pathogens and the feasibility of appropriate biomarkers, including enterochelin biosynthetic genes, for general toxicity assays. The focus is not only on bacterial pathogens but also on other groups of infectious pathogens. The ultimate goal is the development of a handy method to more efficiently and rapidly detect marine pathogens. - Highlights: • Culture-based approaches and molecular approaches can be used to describe pathogenic microbial distribution in coastal area. • Beach sand is a hidden habitat for pathogenic microorganisms. • qPCR is an efficient detection technique to identify pathogenic microbes and their potential pathogenicity. • Enterochelin synthase gene can be used as single molecular biomarker for multiple pathogen identification.
Research advance in rapid detection of foodborne Staphylococcus aureus
Xihong Zhao; Caijiao Wei; Junliang Zhong; Shiwei Jin
2016-01-01
Staphylococcus aureus is a gram-positive, coccus-shaped facultative anaerobe and a member of the Staphylococcaceae family. In recent years, alimentary toxicosis caused by S. aureus is a very serious problem worldwide, which constitutes a great threat to public health. In this review, we tried to summarize the conventional methods and newly developed rapid detection techniques of S. aureus (traditional detection method, biochemical detection, immunology method, molecular biology, and biosensor...
Sakata, Junko; Yonekita, Taro; Kawatsu, Kentaro
2018-01-02
Thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH) are major virulence factors of enteropathogenic Vibrio parahaemolyticus. TDH and TRH are bacterial exotoxins, and their presence in culture medium serves as a specific marker for detecting this significant pathogen. Here, we developed and evaluated an immunochromatographic assay (TDH/TRH-ICA) to simultaneously or individually detect TDH and TRH. The TDH/TRH-ICA detected TDH in all broth cultures of 47 V. parahaemolyticus strains carrying tdh. The genes encoding TRH are classified as variants trh1 and trh2, and TRH was detected in all broth cultures of 25 V. parahaemolyticus strains carrying trh1 and certain proportion (5/31) of broth cultures of V. parahaemolyticus strains carrying trh2. In contrast, TDH and TRH were not detected in broth cultures of 12 non-enteropathogenic V. parahaemolyticus strains without tdh and trh. It was difficult to detect TRH2 using the TDH/TRH-ICA. However, TRH2 may not serve as a suitable marker for detecting enteropathogenic V. parahaemolyticus, and evidence indicates that TRH2 may not contribute to enteropathogenesis. Further, a screening method using a combination of TDH/TRH-ICA and SPP medium supplemented with 1.5% NaCl (modified-SPP medium) detected oyster samples artificially spiked with 1.1-22 colony-forming units of enteropathogenic V. parahaemolyticus per 25g of oysters within approximately 8.5h, including the enrichment culture. The assay may serve as a method that facilitates the rapid and easy detection of raw oysters contaminated with enteropathogenic V. parahaemolyticus. Copyright © 2017. Published by Elsevier B.V.
Das, Amaresh; Spackman, Erica; Thomas, Colleen; Swayne, David E; Suarez, David L
2008-03-01
The Asian H5N1 highly pathogenic avian influenza (HPAI) virus causes a systemic disease with high mortality of poultry and is potentially zoonotic. In both chickens and ducks, the virus has been demonstrated to replicate in both cardiac and skeletal muscle cells. Experimentally, H5N1 HPAI virus has been transmitted to chickens through the consumption of raw infected meat. In this study, we investigated virus replication in cardiac and skeletal muscle and in the trachea of chickens after experimental intranasal inoculation with the H5N1 HPAI virus. The virus was detected in tissues by real-time reverse transcription-polymerase chain reaction (RRT-PCR) and virus isolation, and in the trachea by RRT-PCR and a commercial avian influenza (AI) viral antigen detection test. A modified RNA extraction protocol was developed for rapid detection of the virus in tissues by RRT-PCR. The H5N1 HPAI virus was sporadically detected in meat and the tracheas of infected birds without any clinical sign of disease as early as 6 hr postinfection (PI), and was detected in all samples tested at 24 hr PI and later. No differences in sensitivity were seen between virus isolation and RRT-PCR in meat samples. The AI viral antigen detection test on tracheal swabs was a useful method for identifying infected chickens when they were sick or dead, but was less sensitive in detecting infected birds when they were preclinical. This study provides data indicating that preslaughter tracheal swab testing can identify birds infected with HPAI among the daily mortality and prevent infected flocks from being sent to processing plants. In addition, the modified RNA extraction and RRT-PCR test on meat samples provide a rapid and sensitive method of identifying HPAI virus in illegal contraband or domestic meat samples.
Specific detection of Pectobacterium carotovorum by loop-mediated isothermal amplification.
Yasuhara-Bell, Jarred; Marrero, Glorimar; De Silva, Asoka; Alvarez, Anne M
2016-12-01
Potatoes are an important agroeconomic crop worldwide and maceration diseases caused by pectolytic bacterial pathogens result in significant pre- and post-harvest losses. Pectobacterium carotovorum shares a common host range with other Pectobacterium spp. and other members of the Enterobacteriaceae, such as Dickeya spp. As these pathogens cannot be clearly differentiated on the basis of the symptoms they cause, improved methods of identification are critical for the determination of sources of contamination. Current standardized methods for the differentiation of pectolytic species are time consuming and require trained personnel, as they rely on traditional bacteriological practices that do not always produce conclusive results. In this growing world market, there is a need for rapid diagnostic tests that can differentiate between pectolytic pathogens, as well as separate them from non-pectolytic enteric bacteria associated with soft rots of potato. An assay has been designed previously to detect the temperate pathogen Pectobacterium atrosepticum, but there is currently no recognized rapid assay for the detection of the tropical/subtropical counterpart, Pectobacterium carotovorum. This report describes the development of a loop-mediated isothermal amplification (LAMP) assay that detects P. carotovorum with high specificity. The assay was evaluated using all known species of Pectobacterium and only showed positive reactions for P. carotovorum. This assay was also tested against 15 non-target genera of plant-associated bacteria and did not produce any false positives. The LAMP assay described here can be used as a rapid test for the differentiation of P. carotovorum from other pectolytic pathogens, and its gene target can be the basis for the development of other molecular-based detection assays. © 2016 BSPP and John Wiley & Sons Ltd.
Bacterial and viral pathogens detected in sea turtles stranded along the coast of Tuscany, Italy.
Fichi, G; Cardeti, G; Cersini, A; Mancusi, C; Guarducci, M; Di Guardo, G; Terracciano, G
2016-03-15
During 2014, six loggerhead turtles, Caretta caretta and one green turtle, Chelonia mydas, found stranded on the Tuscany coast of Italy, were examined for the presence of specific bacterial and viral agents, along with their role as carriers of fish and human pathogens. Thirteen different species of bacteria, 10 Gram negative and 3 Gram positive, were identified. Among them, two strains of Vibrio parahaemolyticus and one strain of Lactococcus garviae were recovered and confirmed by specific PCR protocols. No trh and tdh genes were detected in V. parahaemolyticus. The first isolation of L. garviae and the first detection of Betanodavirus in sea turtles indicate the possibility for sea turtles to act as carriers of fish pathogens. Furthermore, the isolation of two strains of V. parahaemolyticus highlights the possible role of these animals in human pathogens' diffusion. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Shruti Shukla
2016-10-01
Full Text Available The current scenario regarding the widespread Zika virus (ZIKV has resulted in numerous diagnostic studies, specifically in South America and in locations where there is frequent entry of travelers returning from ZIKV-affected areas, including pregnant women with or without clinical symptoms of ZIKV infection. The World Health Organization, WHO, announced that millions of cases of ZIKV are likely to occur in the United States of America in the near future. This situation has created an alarming public health emergency of international concern requiring the detection of this life-threatening viral candidate due to increased cases of newborn microcephaly associated with ZIKV infection. Hence, this review reports possible methods and strategies for the fast and reliable detection of ZIKV with particular emphasis on current updates, knowledge and new hypotheses that might be helpful for medical professionals in poor and developing countries that urgently need to address this problem. In particular, we emphasize liposome-based biosensors. Although these biosensors are currently among the less popular tools for human disease detection, they have become useful tools for the screening and detection of pathogenic bacteria, fungi and viruses because of their versatile advantageous features compared to other sensing devices. This review summarizes the currently available methods employed for the rapid detection of ZIKV and suggests an innovative approach involving the application of a liposome-based hypothesis for the development of new strategies for ZIKV detection and their use as effective biomedicinal tools.
Directory of Open Access Journals (Sweden)
Shah Mukim Uddin
2015-03-01
Full Text Available In recent years, many improvements have been made in foodborne pathogen detection methods to reduce the impact of food contamination. Several rapid methods have been developed with biosensor devices to improve the way of performing pathogen detection. This paper presents an automated endpoint detection system for amplicons generated by loop mediated isothermal amplification (LAMP on a microfluidic compact disk platform. The developed detection system utilizes a monochromatic ultraviolet (UV emitter for excitation of fluorescent labeled LAMP amplicons and a color sensor to detect the emitted florescence from target. Then it processes the sensor output and displays the detection results on liquid crystal display (LCD. The sensitivity test has been performed with detection limit up to 2.5 × 10−3 ng/µL with different DNA concentrations of Salmonella bacteria. This system allows a rapid and automatic endpoint detection which could lead to the development of a point-of-care diagnosis device for foodborne pathogens detection in a resource-limited environment.
Goller, K V; Dill, V; Madi, M; Martin, P; Van der Stede, Y; Vandenberge, V; Haas, B; Van Borm, S; Koenen, F; Kasanga, C J; Ndusilo, N; Beer, M; Liu, L; Mioulet, V; Armson, B; King, D P; Fowler, V L
2018-04-01
Highly contagious transboundary animal diseases such as foot-and-mouth disease (FMD) are major threats to the productivity of farm animals. To limit the impact of outbreaks and to take efficient steps towards a timely control and eradication of the disease, rapid and reliable diagnostic systems are of utmost importance. Confirmatory diagnostic assays are typically performed by experienced operators in specialized laboratories, and access to this capability is often limited in the developing countries with the highest disease burden. Advances in molecular technologies allow implementation of modern and reliable techniques for quick and simple pathogen detection either in basic laboratories or even at the pen-side. Here, we report on a study to evaluate a fully automated cartridge-based real-time RT-PCR diagnostic system (Enigma MiniLab ® ) for the detection of FMD virus (FMDV). The modular system integrates both nucleic acid extraction and downstream real-time RT-PCR (rRT-PCR). The analytical sensitivity of this assay was determined using serially diluted culture grown FMDV, and the performance of the assay was evaluated using a selected range of FMDV positive and negative clinical samples of bovine, porcine and ovine origin. The robustness of the assay was evaluated in an international inter-laboratory proficiency test and by deployment into an African laboratory. It was demonstrated that the system is easy to use and can detect FMDV with high sensitivity and specificity, roughly on par with standard laboratory methods. This cartridge-based automated real-time RT-PCR system for the detection of FMDV represents a reliable and easy to use diagnostic tool for the early and rapid disease detection of acutely infected animals even in remote areas. This type of system could be easily deployed for routine surveillance within endemic regions such as Africa or could alternatively be used in the developed world. © 2017 The Authors. Transboundary and Emerging Diseases
Directory of Open Access Journals (Sweden)
Dafni-Maria Kagkli
Full Text Available Escherichia coli is a group of bacteria which has raised a lot of safety concerns in recent years. Five major intestinal pathogenic groups have been recognized amongst which the verocytotoxin or shiga-toxin (stx1 and/or stx2 producing E. coli (VTEC or STEC respectively have received a lot of attention recently. Indeed, due to the high number of outbreaks related to VTEC strains, the European Food Safety Authority (EFSA has requested the monitoring of the "top-five" serogroups (O26, O103, O111, O145 and O157 most often encountered in food borne diseases and addressed the need for validated VTEC detection methods. Here we report the development of a set of intercalating dye Real-time PCR methods capable of rapidly detecting the presence of the toxin genes together with intimin (eae in the case of VTEC, or aggregative protein (aggR, in the case of the O104:H4 strain responsible for the outbreak in Germany in 2011. All reactions were optimized to perform at the same annealing temperature permitting the multiplex application in order to minimize the need of material and to allow for high-throughput analysis. In addition, High Resolution Melting (HRM analysis allowing the discrimination among strains possessing similar virulence traits was established. The development, application to food samples and the flexibility in use of the methods are thoroughly discussed. Together, these Real-time PCR methods facilitate the detection of VTEC in a new highly efficient way and could represent the basis for developing a simple pathogenic E. coli platform.
Research advance in rapid detection of foodborne Staphylococcus aureus
Directory of Open Access Journals (Sweden)
Xihong Zhao
2016-09-01
Full Text Available Staphylococcus aureus is a gram-positive, coccus-shaped facultative anaerobe and a member of the Staphylococcaceae family. In recent years, alimentary toxicosis caused by S. aureus is a very serious problem worldwide, which constitutes a great threat to public health. In this review, we tried to summarize the conventional methods and newly developed rapid detection techniques of S. aureus (traditional detection method, biochemical detection, immunology method, molecular biology, and biosensor method for their principles, advantages, disadvantages, and applications. Furthermore, the future perspectives of S. aureus detection methods were forecasted at last.
Detection of hepatitis E virus and other livestock-related pathogens in Iowa streams
Givens, Carrie E.; Kolpin, Dana W.; Borchardt, Mark A.; Duris, Joseph W.; Moorman, Thomas B.; Spencer, Susan K.
2016-01-01
Manure application is a source of pathogens to the environment. Through overland runoff and tile drainage, zoonotic pathogens can contaminate surface water and streambed sediment and could affect both wildlife and human health. This study examined the environmental occurrence of gene markers for livestock-related bacterial, protozoan, and viral pathogens and antibiotic resistance in surface waters within the South Fork Iowa River basin before and after periods of swine manure application on agricultural land. Increased concentrations of indicator bacteria after manure application exceeding Iowa's state bacteria water quality standards suggest that swine manure contributes to diminished water quality and may pose a risk to human health. Additionally, the occurrence of HEV and numerous bacterial pathogen genes for Escherichia coli, Enterococcus spp., Salmonella sp., and Staphylococcus aureus in both manure samples and in corresponding surface water following periods of manure application suggests a potential role for swine in the spreading of zoonotic pathogens to the surrounding environment. During this study, several zoonotic pathogens were detected including Shiga-toxin producing E. coli, Campylobacter jejuni, pathogenic enterococci, and S. aureus; all of which can pose mild to serious health risks to swine, humans, and other wildlife. This research provides the foundational understanding required for future assessment of the risk to environmental health from livestock-related zoonotic pathogen exposures in this region. This information could also be important for maintaining swine herd biosecurity and protecting the health of wildlife near swine facilities.
Directory of Open Access Journals (Sweden)
Owen Higgins
2018-02-01
Full Text Available Bacterial meningitis infection is a leading global health concern for which rapid and accurate diagnosis is essential to reduce associated morbidity and mortality. Loop-mediated isothermal amplification (LAMP offers an effective low-cost diagnostic approach; however, multiplex LAMP is difficult to achieve, limiting its application. We have developed novel real-time multiplex LAMP technology, TEC-LAMP, using Tth endonuclease IV and a unique LAMP primer/probe. This study evaluates the analytical specificity, limit of detection (LOD and clinical application of an internally controlled multiplex TEC-LAMP assay for detection of leading bacterial meningitis pathogens: Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae. Analytical specificities were established by testing 168 bacterial strains, and LODs were determined using Probit analysis. The TEC-LAMP assay was 100% specific, with LODs for S. pneumoniae, N. meningitidis and H. influenzae of 39.5, 17.3 and 25.9 genome copies per reaction, respectively. Clinical performance was evaluated by testing 65 archived PCR-positive samples. Compared to singleplex real-time PCR, the multiplex TEC-LAMP assay demonstrated diagnostic sensitivity and specificity of 92.3% and 100%, respectively. This is the first report of a single-tube internally controlled multiplex LAMP assay for bacterial meningitis pathogen detection, and the first report of Tth endonuclease IV incorporation into nucleic acid amplification diagnostic technology.
Clancy, Eoin; Cormican, Martin; Boo, Teck Wee; Cunney, Robert
2018-01-01
Bacterial meningitis infection is a leading global health concern for which rapid and accurate diagnosis is essential to reduce associated morbidity and mortality. Loop-mediated isothermal amplification (LAMP) offers an effective low-cost diagnostic approach; however, multiplex LAMP is difficult to achieve, limiting its application. We have developed novel real-time multiplex LAMP technology, TEC-LAMP, using Tth endonuclease IV and a unique LAMP primer/probe. This study evaluates the analytical specificity, limit of detection (LOD) and clinical application of an internally controlled multiplex TEC-LAMP assay for detection of leading bacterial meningitis pathogens: Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae. Analytical specificities were established by testing 168 bacterial strains, and LODs were determined using Probit analysis. The TEC-LAMP assay was 100% specific, with LODs for S. pneumoniae, N. meningitidis and H. influenzae of 39.5, 17.3 and 25.9 genome copies per reaction, respectively. Clinical performance was evaluated by testing 65 archived PCR-positive samples. Compared to singleplex real-time PCR, the multiplex TEC-LAMP assay demonstrated diagnostic sensitivity and specificity of 92.3% and 100%, respectively. This is the first report of a single-tube internally controlled multiplex LAMP assay for bacterial meningitis pathogen detection, and the first report of Tth endonuclease IV incorporation into nucleic acid amplification diagnostic technology. PMID:29425124
Directory of Open Access Journals (Sweden)
El Batrawy Sherouk
2011-04-01
Full Text Available Abstract Background Nasopharyngeal carriage of potential pathogens is important as it is both the major source of transmission and the prerequisite of invasive disease. New methods for detecting carriage could improve comfort, accuracy and laboratory utility. The aims of this study were to compare the sensitivities of a nasopharyngeal swab (NPS and a nasal wash (NW in detecting potential respiratory pathogens in healthy adults using microbiological culture and PCR. Results Healthy volunteers attended for nasal washing and brushing of the posterior nasopharynx. Conventional and real-time PCR were used to detect pneumococcus and meningococcus. Statistical differences between the two nasal sampling methods were determined using a nonparametric Mann-Whitney U test; differences between culture and PCR methods were determined using the McNemar test. Nasal washing was more comfortable for volunteers than swabbing (n = 24. In detection by culture, the NW was significantly more likely to detect pathogens than the NPS (p Conclusions Nasal washing and PCR may provide effective alternatives to nasopharyngeal swabbing and classical microbiology, respectively.
Rapidly expanding range of highly pathogenic avian influenza viruses
Hall, Jeffrey S.; Dusek, Robert J.; Spackman, Erica
2015-01-01
The movement of highly pathogenic avian influenza (H5N8) virus across Eurasia and into North America and the virus’ propensity to reassort with co-circulating low pathogenicity viruses raise concerns among poultry producers, wildlife biologists, aviculturists, and public health personnel worldwide. Surveillance, modeling, and experimental research will provide the knowledge required for intelligent policy and management decisions.
Jadhav, Snehal; Sevior, Danielle; Bhave, Mrinal; Palombo, Enzo A
2014-01-31
Conventional methods used for primary detection of Listeria monocytogenes from foods and subsequent confirmation of presumptive positive samples involve prolonged incubation and biochemical testing which generally require four to five days to obtain a result. In the current study, a simple and rapid proteomics-based MALDI-TOF MS approach was developed to detect L. monocytogenes directly from selective enrichment broths. Milk samples spiked with single species and multiple species cultures were incubated in a selective enrichment broth for 24h, followed by an additional 6h secondary enrichment. As few as 1 colony-forming unit (cfu) of L. monocytogenes per mL of initial selective broth culture could be detected within 30h. On applying the same approach to solid foods previously implicated in listeriosis, namely chicken pâté, cantaloupe and Camembert cheese, detection was achieved within the same time interval at inoculation levels of 10cfu/mL. Unlike the routine application of MALDI-TOF MS for identification of bacteria from solid media, this study proposes a cost-effective and time-saving detection scheme for direct identification of L. monocytogenes from broth cultures.This article is part of a Special Issue entitled: Trends in Microbial Proteomics. Globally, foodborne diseases are major causes of illness and fatalities in humans. Hence, there is a continual need for reliable and rapid means for pathogen detection from food samples. Recent applications of MALDI-TOF MS for diagnostic microbiology focused on detection of microbes from clinical specimens. However, the current study has emphasized its use as a tool for detecting the major foodborne pathogen, Listeria monocytogenes, directly from selective enrichment broths. This proof-of-concept study proposes a detection scheme that is more rapid and simple compared to conventional methods of Listeria detection. Very low levels of the pathogen could be identified from different food samples post-enrichment in
Riediger, Irina N; Stoddard, Robyn A; Ribeiro, Guilherme S; Nakatani, Sueli M; Moreira, Suzana D R; Skraba, Irene; Biondo, Alexander W; Reis, Mitermayer G; Hoffmaster, Alex R; Vinetz, Joseph M; Ko, Albert I; Wunder, Elsio A
2017-09-01
With a conservatively estimated 1 million cases of leptospirosis worldwide and a 5-10% fatality rate, the rapid diagnosis of leptospirosis leading to effective clinical and public health decision making is of high importance, and yet remains a challenge. Based on parallel, population-based studies in two leptospirosis-endemic regions in Brazil, a real-time PCR assay which detects lipL32, a gene specifically present in pathogenic Leptospira, was assessed for the diagnostic effectiveness and accuracy. Patients identified by active hospital-based surveillance in Salvador and Curitiba during large urban leptospirosis epidemics were tested. Real-time PCR reactions were performed with DNA-extracted samples obtained from 127 confirmed and 23 unconfirmed cases suspected of leptospirosis, 122 patients with an acute febrile illness other than leptospirosis, and 60 healthy blood donors. The PCR assay had a limit of detection of 280 Leptospira genomic equivalents/mL. Sensitivity for confirmed cases was 61% for whole blood and 29% for serum samples. Sensitivity was higher (86%) for samples collected within the first 6 days after onset of illness compared to those collected after 7 days (34%). The real-time PCR assay was able to detect leptospiral DNA in blood from 56% of serological non-confirmed cases. The overall specificity of the assay was 99%. These findings indicate that real-time PCR may be a reliable tool for early diagnosis of leptospirosis, which is decisive for clinical management of severe and life-threatening cases and for public health decision making.
Rapid In-Place Composite Rotor Damage Detection, Phase II
National Aeronautics and Space Administration — Luna Innovations is proposing to further develop the Rapid In-Place Composite Rotor Damage Detection (RIPCoRDD) System for determining and tracking the structural...
Rapid In-Place Composite Rotor Damage Detection, Phase I
National Aeronautics and Space Administration — Luna Innovations is proposing to develop the Rapid In-Place Composite Rotor Damage Detection (RIPCoRDD) for determining and tracking the structural health of...
A quantum-dot-based fluoroassay for detection of food-borne pathogens.
Mohamadi, Elaheh; Moghaddasi, Mohammadali; Farahbakhsh, Afshin; Kazemi, Abbass
2017-09-01
Evaluation of the distribution capability of food-borne pathogens existing in food products by taking the advantage of quantum dots (QDs) for their photoluminescence properties was carried out. Bacteria namely Escherichia coli (E. coli) labelled with CdSe-QDs were examined both on an Agar nutrient and ground fish substrates in order to observe their growth rate in different environments in the Lab. A sample with an appropriate concentration ratio 10 7 CFU/mL of bacteria/CdSe-QDs was empirically selected from the samples which were grown on the Agar containing plates. The selected sample was also tested on a ground fish substrate as a real food sample. The bacterial growth was observed under the irradiation of UV light and the growth patterns were investigated for 3 successive days. The growth patterns indicated that E. coli can stay alive and can be distributed on food products so that the growth can be easily monitored. This approach makes bacterial growth on food products detectable so that it can be used as a bacteria-QD assay for an easy detection of food borne pathogens grown on a food sample. Copyright © 2017 Elsevier B.V. All rights reserved.
Quantitative Real-Time PCR (QRT-PCR) technology, incorporating fluorigenic 5' nuclease (TaqMan?) chemistry, was developed for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C....
Isothermal Amplification and Lateral-Flow Assay for Detecting Crown-Gall-Causing Agrobacterium spp.
Fuller, Skylar L; Savory, Elizabeth A; Weisberg, Alexandra J; Buser, Jessica Z; Gordon, Michael I; Putnam, Melodie L; Chang, Jeff H
2017-09-01
Agrobacterium is a genus of soilborne gram-negative bacteria. Members carrying oncogenic plasmids can cause crown gall disease, which has significant economic costs, especially for the orchard and nursery industries. Early and rapid detection of pathogenic Agrobacterium spp. is key to the management of crown gall disease. To this end, we designed oligonucleotide primers and probes to target virD2 for use in a molecular diagnostic tool that relies on isothermal amplification and lateral-flow-based detection. The oligonucleotide tools were tested in the assay and evaluated for detection limit and specificity in detecting alleles of virD2. One set of primers that successfully amplified virD2 when used with an isothermal recombinase was selected. Both tested probes had detection limits in picogram amounts of DNA. Probe 1 could detect all tested pathogenic isolates that represented most of the diversity of virD2. Finally, the coupling of lateral-flow detection to the use of these oligonucleotide primers in isothermal amplification helped to reduce the onerousness of the process, and alleviated reliance on specialized tools necessary for molecular diagnostics. The assay is an advancement for the rapid molecular detection of pathogenic Agrobacterium spp.
Evaluation of the Specificity and Sensitivity of a Potential Rapid Influenza Screening System
2013-01-01
misuse of antibiotic therapy for treatment of influenza infections. Rapid identification of influenza infections would further reduce transmission of...amplification tests in combination with Type I BESt™ Cassette have been developed and used to rapidly detect other pathogenic microorgan- isms including herpes ... simplex virus types 1 and 2 (Kim et al., 2011), Mycobacterium tuberculosis (Motre et al., 2011), human immunode- ficiency virus (Tang et al., 2010), and
Radiometric method for the rapid detection of Leptospira organisms
International Nuclear Information System (INIS)
Manca, N.; Verardi, R.; Colombrita, D.; Ravizzola, G.; Savoldi, E.; Turano, A.
1986-01-01
A rapid and sensitive radiometric method for detection of Leptospira interrogans serovar pomona and Leptospira interrogans serovar copenhageni is described. Stuart's medium and Middlebrook TB (12A) medium supplemented with bovine serum albumin, catalase, and casein hydrolysate and labeled with 14 C-fatty acids were used. The radioactivity was measured in a BACTEC 460. With this system, Leptospira organisms were detected in human blood in 2 to 5 days, a notably shorter time period than that required for the majority of detection techniques
Abdelsalam, Mohamed; Elgendy, Mamdouh Y; Shaalan, Mohamed; Moustafa, Mohamed; Fujino, Masayuki
2017-03-01
Accurate and rapid identification of bacterial pathogens of fish is essential for the effective treatment and speedy control of infections. Massive mortalities in market-sized red tilapia (Oreochromis spp.) were noticed in mariculture concrete ponds in northern Egypt. Histopathological examination revealed marked congestion in the central vein of the liver with the presence of bacterial aggregates inside the lumen and in the vicinity of the central vein. A total of 12 isolates of streptococci were obtained from the moribund fish. This study documented the ability of the MicroSeq 500 16S bacterial sequencing method to accurately identify Streptococcus agalactiae and S. dysgalactiae mixed infections from moribund red tilapia that were difficult to be recognised by the commercial biochemical systems. The continuously decreasing cost of the sequencing technique should encourage its application in routine diagnostic procedures.
Autonomous system for pathogen detection and identification
International Nuclear Information System (INIS)
Belgrader, P.; Benett, W.; Langlois, R.; Long, G.; Mariella, R.; Milanovich, F.; Miles, R.; Nelson, W.; Venkateswaran, K.
1998-01-01
This purpose of this project is to build a prototype instrument that will, running unattended, detect, identify, and quantify BW agents. In order to accomplish this, we have chosen to start with the world s leading, proven, assays for pathogens: surface-molecular recognition assays, such as antibody-based assays, implemented on a high-performance, identification (ID)-capable flow cytometer, and the polymerase chain reaction (PCR) for nucleic-acid based assays. With these assays, we must integrate the capability to: l collect samples from aerosols, water, or surfaces; l perform sample preparation prior to the assays; l incubate the prepared samples, if necessary, for a period of time; l transport the prepared, incubated samples to the assays; l perform the assays; l interpret and report the results of the assays. Issues such as reliability, sensitivity and accuracy, quantity of consumables, maintenance schedule, etc. must be addressed satisfactorily to the end user. The highest possible sensitivity and specificity of the assay must be combined with no false alarms. Today, we have assays that can, in under 30 minutes, detect and identify stimulants for BW agents at concentrations of a few hundred colony-forming units per ml of solution. If the bio-aerosol sampler of this system collects 1000 Ymin and concentrates the respirable particles into 1 ml of solution with 70% processing efficiency over a period of 5 minutes, then this translates to a detection/ID capability of under 0.1 agent-containing particle/liter of air
Sibley, Christopher D; Peirano, Gisele; Church, Deirdre L
2012-04-01
Clinical microbiology laboratories worldwide have historically relied on phenotypic methods (i.e., culture and biochemical tests) for detection, identification and characterization of virulence traits (e.g., antibiotic resistance genes, toxins) of human pathogens. However, limitations to implementation of molecular methods for human infectious diseases testing are being rapidly overcome allowing for the clinical evaluation and implementation of diverse technologies with expanding diagnostic capabilities. The advantages and limitation of molecular techniques including real-time polymerase chain reaction, partial or whole genome sequencing, molecular typing, microarrays, broad-range PCR and multiplexing will be discussed. Finally, terminal restriction fragment length polymorphism (T-RFLP) and deep sequencing are introduced as technologies at the clinical interface with the potential to dramatically enhance our ability to diagnose infectious diseases and better define the epidemiology and microbial ecology of a wide range of complex infections. Copyright © 2012 Elsevier B.V. All rights reserved.
A Plant Immune Receptor Detects Pathogen Effectors that Target WRKY Transcription Factors.
Sarris, Panagiotis F; Duxbury, Zane; Huh, Sung Un; Ma, Yan; Segonzac, Cécile; Sklenar, Jan; Derbyshire, Paul; Cevik, Volkan; Rallapalli, Ghanasyam; Saucet, Simon B; Wirthmueller, Lennart; Menke, Frank L H; Sohn, Kee Hoon; Jones, Jonathan D G
2015-05-21
Defense against pathogens in multicellular eukaryotes depends on intracellular immune receptors, yet surveillance by these receptors is poorly understood. Several plant nucleotide-binding, leucine-rich repeat (NB-LRR) immune receptors carry fusions with other protein domains. The Arabidopsis RRS1-R NB-LRR protein carries a C-terminal WRKY DNA binding domain and forms a receptor complex with RPS4, another NB-LRR protein. This complex detects the bacterial effectors AvrRps4 or PopP2 and then activates defense. Both bacterial proteins interact with the RRS1 WRKY domain, and PopP2 acetylates lysines to block DNA binding. PopP2 and AvrRps4 interact with other WRKY domain-containing proteins, suggesting these effectors interfere with WRKY transcription factor-dependent defense, and RPS4/RRS1 has integrated a "decoy" domain that enables detection of effectors that target WRKY proteins. We propose that NB-LRR receptor pairs, one member of which carries an additional protein domain, enable perception of pathogen effectors whose function is to target that domain. Copyright © 2015 Elsevier Inc. All rights reserved.
Radiometric method for the rapid detection of Leptospira organisms
Energy Technology Data Exchange (ETDEWEB)
Manca, N.; Verardi, R.; Colombrita, D.; Ravizzola, G.; Savoldi, E.; Turano, A.
1986-02-01
A rapid and sensitive radiometric method for detection of Leptospira interrogans serovar pomona and Leptospira interrogans serovar copenhageni is described. Stuart's medium and Middlebrook TB (12A) medium supplemented with bovine serum albumin, catalase, and casein hydrolysate and labeled with /sup 14/C-fatty acids were used. The radioactivity was measured in a BACTEC 460. With this system, Leptospira organisms were detected in human blood in 2 to 5 days, a notably shorter time period than that required for the majority of detection techniques.
Directory of Open Access Journals (Sweden)
Kerstin Wernike
Full Text Available Porcine reproductive and respiratory syndrome (PRRS causes economic losses in the pig industry worldwide, and PRRS viruses (PRRSV are classified into the two distinct genotypes "North American (NA, type 2" and "European (EU, type 1". In 2006, a highly pathogenic NA strain of PRRSV (HP-PRRSV, characterized by high fever as well as high morbidity and mortality, emerged in swine farms in China. Therefore, a real-time reverse transcription polymerase chain reaction (RT-qPCR assay specific for HP-PRRSV was developed and combined with type 1- and type 2-specific RT-qPCR systems. Furthermore, an internal control, based on a heterologous RNA, was successfully introduced. This final multiplex PRRSV RT-qPCR, detecting and typing PRRSV, had an analytical sensitivity of less than 200 copies per µl for the type 1-assay and 20 copies per µl for the type 2- and HP assays and a high diagnostic sensitivity. A panel of reference strains and field isolates was reliably detected and samples from an animal trial with a Chinese HP-PRRS strain were used for test validation. The new multiplex PRRSV RT-qPCR system allows for the first time the highly sensitive detection and rapid differentiation of PRRSV of both genotypes as well as the direct detection of HP-PRRSV.
Humic substances interfere with detection of pathogenic prion protein
Smith, Christen B.; Booth, Clarissa J.; Wadzinski, Tyler J.; Legname, Giuseppe; Chappell, Rick; Johnson, Christopher J.; Pedersen, Joel A.
2014-01-01
Studies examining the persistence of prions (the etiological agent of transmissible spongiform encephalopathies) in soil require accurate quantification of pathogenic prion protein (PrPTSE) extracted from or in the presence of soil particles. Here, we demonstrate that natural organic matter (NOM) in soil impacts PrPTSE detection by immunoblotting. Methods commonly used to extract PrPTSE from soils release substantial amounts of NOM, and NOM inhibited PrPTSE immunoblot signal. The degree of immunoblot interference increased with increasing NOM concentration and decreasing NOM polarity. Humic substances affected immunoblot detection of prion protein from both deer and hamsters. We also establish that after interaction with humic acid, PrPTSE remains infectious to hamsters inoculated intracerebrally, and humic acid appeared to slow disease progression. These results provide evidence for interactions between PrPTSE and humic substances that influence both accurate measurement of PrPTSE in soil and disease transmission.
ETV Tech Brief: Rapid Fungi and Bacteria Detection Technologies
Technical brief that summarizes the results for Mycometer, Inc. Mycometer®-test and Bactiquant®-test, which are rapid detection technologies for fungi and bacteria. The brief summarizes the results of the verification report and statement.
Manjunatha, C; Sharma, Sapna; Kulshreshtha, Deepika; Gupta, Sangeeta; Singh, Kartar; Bhardwaj, Subhash C; Aggarwal, Rashmi
2018-01-01
Leaf rust of wheat caused by Puccinia triticina has significant impact on wheat production worldwide. Effective and quick detection methodologies are required to mitigate yield loss and time constraints associated with monitoring and management of leaf rust of wheat. In the present study, detection of P. triticina has been simplified by developing a rapid, reliable, efficient and visual colorimetric method i.e., loop mediated isothermal amplification of DNA (LAMP). Based on in silico analysis of P. triticina genome, PTS68, a simple sequence repeat was found highly specific to leaf rust fungus. A marker (PtRA68) was developed and its specificity was validated through PCR technique which gave a unique and sharp band of 919 bp in P. triticina pathotypes only. A novel gene amplification method LAMP which enables visual detection of pathogen by naked eye was developed for leaf rust pathogen. A set of six primers was designed from specific region of P. triticina and conditions were optimised to complete the observation process in 60 minutes at 65o C. The assay developed in the study could detect presence of P. triticina on wheat at 24 hpi (pre-symptomatic stage) which was much earlier than PCR without requiring thermal cycler. Sensitivity of LAMP assay developed in the study was 100 fg which was more sensitive than conventional PCR (50 pg) and equivalent to qPCR (100 fg). The protocol developed in the study was utilized for detection of leaf rust infected samples collected from different wheat fields. LAMP based colorimetric detection assay showed sky blue color in positive reaction and violet color in negative reaction after addition of 120 μM hydroxyl napthol blue (HNB) solution to reaction mixture. Similarly, 0.6 mg Ethidium bromide/ml was added to LAMP products, placed on transilluminator to witness full brightness in positive reaction and no such brightness could be seen in negative reaction mixture. Further, LAMP products spread in a ladder like banding pattern in
Cloke, Jonathan; Matheny, Sharon; Swimley, Michelle; Tebbs, Robert; Burrell, Angelia; Flannery, Jonathan; Bastin, Benjamin; Bird, Patrick; Benzinger, M Joseph; Crowley, Erin; Agin, James; Goins, David; Salfinger, Yvonne; Brodsky, Michael; Fernandez, Maria Cristina
2016-11-01
The Applied Biosystems™ RapidFinder™ STEC Detection Workflow (Thermo Fisher Scientific) is a complete protocol for the rapid qualitative detection of Escherichia coli (E. coli) O157:H7 and the "Big 6" non-O157 Shiga-like toxin-producing E. coli (STEC) serotypes (defined as serogroups: O26, O45, O103, O111, O121, and O145). The RapidFinder STEC Detection Workflow makes use of either the automated preparation of PCR-ready DNA using the Applied Biosystems PrepSEQ™ Nucleic Acid Extraction Kit in conjunction with the Applied Biosystems MagMAX™ Express 96-well magnetic particle processor or the Applied Biosystems PrepSEQ Rapid Spin kit for manual preparation of PCR-ready DNA. Two separate assays comprise the RapidFinder STEC Detection Workflow, the Applied Biosystems RapidFinder STEC Screening Assay and the Applied Biosystems RapidFinder STEC Confirmation Assay. The RapidFinder STEC Screening Assay includes primers and probes to detect the presence of stx1 (Shiga toxin 1), stx2 (Shiga toxin 2), eae (intimin), and E. coli O157 gene targets. The RapidFinder STEC Confirmation Assay includes primers and probes for the "Big 6" non-O157 STEC and E. coli O157:H7. The use of these two assays in tandem allows a user to detect accurately the presence of the "Big 6" STECs and E. coli O157:H7. The performance of the RapidFinder STEC Detection Workflow was evaluated in a method comparison study, in inclusivity and exclusivity studies, and in a robustness evaluation. The assays were compared to the U.S. Department of Agriculture (USDA), Food Safety and Inspection Service (FSIS) Microbiology Laboratory Guidebook (MLG) 5.09: Detection, Isolation and Identification of Escherichia coli O157:H7 from Meat Products and Carcass and Environmental Sponges for raw ground beef (73% lean) and USDA/FSIS-MLG 5B.05: Detection, Isolation and Identification of Escherichia coli non-O157:H7 from Meat Products and Carcass and Environmental Sponges for raw beef trim. No statistically significant
This study examined persistence and decay of bacterial pathogens, fecal indicator bacteria (FIB), and emerging real-time quantitative PCR (qPCR) genetic markers for rapid detection of fecal pollution in manure-amended agricultural soils. Known concentrations of transformed green...
This study examined persistence and decay of bacterial pathogens, fecal indicator bacteria, and emerging real-time quantitative PCR (qPCR) genetic markers for rapid detection of fecal pollution in manre-amended agricultural soils. Known concentrations of transformed green fluore...
Use of Tethered Enzymes as a Platform Technology for Rapid Analyte Detection.
Directory of Open Access Journals (Sweden)
Roy Cohen
Full Text Available Rapid diagnosis for time-sensitive illnesses such as stroke, cardiac arrest, and septic shock is essential for successful treatment. Much attention has therefore focused on new strategies for rapid and objective diagnosis, such as Point-of-Care Tests (PoCT for blood biomarkers. Here we use a biomimicry-based approach to demonstrate a new diagnostic platform, based on enzymes tethered to nanoparticles (NPs. As proof of principle, we use oriented immobilization of pyruvate kinase (PK and luciferase (Luc on silica NPs to achieve rapid and sensitive detection of neuron-specific enolase (NSE, a clinically relevant biomarker for multiple diseases ranging from acute brain injuries to lung cancer. We hypothesize that an approach capitalizing on the speed and catalytic nature of enzymatic reactions would enable fast and sensitive biomarker detection, suitable for PoCT devices.We performed in-vitro, animal model, and human subject studies. First, the efficiency of coupled enzyme activities when tethered to NPs versus when in solution was tested, demonstrating a highly sensitive and rapid detection of physiological and pathological concentrations of NSE. Next, in rat stroke models the enzyme-based assay was able in minutes to show a statistically significant increase in NSE levels in samples taken 1 hour before and 0, 1, 3 and 6 hours after occlusion of the distal middle cerebral artery. Finally, using the tethered enzyme assay for detection of NSE in samples from 20 geriatric human patients, we show that our data match well (r = 0.815 with the current gold standard for biomarker detection, ELISA-with a major difference being that we achieve detection in 10 minutes as opposed to the several hours required for traditional ELISA.Oriented enzyme immobilization conferred more efficient coupled activity, and thus higher assay sensitivity, than non-tethered enzymes. Together, our findings provide proof of concept for using oriented immobilization of active
Leydet, Brian F; Liang, Fang-Ting
2013-04-01
There are 4 major human-biting tick species in the northeastern United States, which include: Amblyomma americanum, Amblyomma maculatum, Dermacentor variabilis, and Ixodes scapularis. The black bear is a large mammal that has been shown to be parasitized by all the aforementioned ticks. We investigated the bacterial infections in ticks collected from Louisiana black bears (Ursus americanus subspecies luteolus). Eighty-six ticks were collected from 17 black bears in Louisiana from June 2010 to March 2011. All 4 common human-biting tick species were represented. Each tick was subjected to polymerase chain reaction (PCR) targeting select bacterial pathogens and symbionts. Bacterial DNA was detected in 62% of ticks (n=53). Rickettsia parkeri, the causative agent of an emerging spotted fever group rickettsiosis, was identified in 66% of A. maculatum, 28% of D. variabilis, and 11% of I. scapularis. The Lyme disease bacterium, Borrelia burgdorferi, was detected in 2 I. scapularis, while one A. americanum was positive for Borrelia bissettii, a putative human pathogen. The rickettsial endosymbionts Candidatus Rickettsia andeanae, rickettsial endosymbiont of I. scapularis, and Rickettsia amblyommii were detected in their common tick hosts at 21%, 39%, and 60%, respectively. All ticks were PCR-negative for Anaplasma phagocytophilum, Ehrlichia spp., and Babesia microti. This is the first reported detection of R. parkeri in vector ticks in Louisiana; we also report the novel association of R. parkeri with I. scapularis. Detection of both R. parkeri and B. burgdorferi in their respective vectors in Louisiana demands further investigation to determine potential for human exposure to these pathogens. Copyright © 2013 Elsevier GmbH. All rights reserved.
Directory of Open Access Journals (Sweden)
Brett E. Etchebarne
2017-12-01
Full Text Available Battling infection is a major healthcare objective. Untreated infections can rapidly evolve toward the condition of sepsis in which the body begins to fail and resuscitation becomes critical and tenuous. Identification of infection followed by rapid antimicrobial treatment are primary goals of medical care, but precise identification of offending organisms by current methods is slow and broad spectrum empirical therapy is employed to cover most potential pathogens. Current methods for identification of bacterial pathogens in a clinical setting typically require days of time, or a 4- to 8-h growth phase followed by DNA extraction, purification and PCR-based amplification. We demonstrate rapid (70–120 min genetic diagnostics methods utilizing loop-mediated isothermal amplification (LAMP to test for 15 common infection pathogen targets, called the Infection Diagnosis Panel (In-Dx. The method utilizes filtration to rapidly concentrate bacteria in sample matrices with lower bacterial loads and direct LAMP amplification without DNA purification from clinical blood, urine, wound, sputum and stool samples. The In-Dx panel was tested using two methods of detection: (1 real-time thermocycler fluorescent detection of LAMP amplification and (2 visual discrimination of color change in the presence of Eriochrome Black T (EBT dye following amplification. In total, 239 duplicate samples were collected (31 blood, 122 urine, 73 mucocutaneous wound/swab, 11 sputum and two stool from 229 prospectively enrolled hospital patients with suspected clinical infection and analyzed both at the hospital and by In-Dx. Sensitivity (Se of the In-Dx panel targets pathogens from urine samples by In-Dx was 91.1% and specificity (Sp was 97.3%, with a positive predictive value (PPV of 53.7% and a negative predictive value (NPV of 99.7% as compared to clinical microbial detection methods. Sensitivity of detection of the In-Dx panel from mucocutaneous swab samples was 65.5% with a
Direct colorimetric detection of unamplified pathogen DNA by dextrin-capped gold nanoparticles.
Baetsen-Young, Amy M; Vasher, Matthew; Matta, Leann L; Colgan, Phil; Alocilja, Evangelyn C; Day, Brad
2018-03-15
The interaction between gold nanoparticles (AuNPs) and nucleic acids has facilitated a variety of diagnostic applications, with further diversification of synthesis match bio-applications while reducing biotoxicity. However, DNA interactions with unique surface capping agents have not been fully defined. Using dextrin-capped AuNPs (d-AuNPs), we have developed a novel unamplified genomic DNA (gDNA) nanosensor, exploiting dispersion and aggregation characteristics of d-AuNPs, in the presence of gDNA, for sequence-specific detection. We demonstrate that d-AuNPs are stable in a five-fold greater salt concentration than citrate-capped AuNPs and the d-AuNPs were stabilized by single stranded DNA probe (ssDNAp). However, in the elevated salt concentrations of the DNA detection assay, the target reactions were surprisingly further stabilized by the formation of a ssDNAp-target gDNA complex. The results presented herein lead us to propose a mechanism whereby genomic ssDNA secondary structure formation during ssDNAp-to-target gDNA binding enables d-AuNP stabilization in elevated ionic environments. Using the assay described herein, we were successful in detecting as little as 2.94 fM of pathogen DNA, and using crude extractions of a pathogen matrix, as few as 18 spores/µL. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Irina N Riediger
2017-09-01
Full Text Available With a conservatively estimated 1 million cases of leptospirosis worldwide and a 5-10% fatality rate, the rapid diagnosis of leptospirosis leading to effective clinical and public health decision making is of high importance, and yet remains a challenge.Based on parallel, population-based studies in two leptospirosis-endemic regions in Brazil, a real-time PCR assay which detects lipL32, a gene specifically present in pathogenic Leptospira, was assessed for the diagnostic effectiveness and accuracy. Patients identified by active hospital-based surveillance in Salvador and Curitiba during large urban leptospirosis epidemics were tested. Real-time PCR reactions were performed with DNA-extracted samples obtained from 127 confirmed and 23 unconfirmed cases suspected of leptospirosis, 122 patients with an acute febrile illness other than leptospirosis, and 60 healthy blood donors.The PCR assay had a limit of detection of 280 Leptospira genomic equivalents/mL. Sensitivity for confirmed cases was 61% for whole blood and 29% for serum samples. Sensitivity was higher (86% for samples collected within the first 6 days after onset of illness compared to those collected after 7 days (34%. The real-time PCR assay was able to detect leptospiral DNA in blood from 56% of serological non-confirmed cases. The overall specificity of the assay was 99%.These findings indicate that real-time PCR may be a reliable tool for early diagnosis of leptospirosis, which is decisive for clinical management of severe and life-threatening cases and for public health decision making.
Khurana, Surender; Sasono, Pretty; Fox, Annette; Nguyen, Van Kinh; Le, Quynh Mai; Pham, Quang Thai; Nguyen, Tran Hien; Nguyen, Thanh Liem; Horby, Peter; Golding, Hana
2011-12-01
Continuing evolution of highly pathogenic (HP) H5N1 influenza viruses in wild birds with transmission to domestic poultry and humans poses a pandemic threat. There is an urgent need for a simple and rapid serological diagnostic assay which can differentiate between antibodies to seasonal and H5N1 strains and that could provide surveillance tools not dependent on virus isolation and nucleic acid technologies. Here we describe the establishment of H5N1 SeroDetect enzyme-linked immunosorbent assay (ELISA) and rapid test assays based on three peptides in HA2 (488-516), PB1-F2 (2-75), and M2e (2-24) that are highly conserved within H5N1 strains. These peptides were identified by antibody repertoire analyses of H5N1 influenza survivors in Vietnam using whole-genome-fragment phage display libraries (GFPDLs). To date, both platforms have demonstrated high levels of sensitivity and specificity in detecting H5N1 infections (clade 1 and clade 2.3.4) in Vietnamese patients as early as 7 days and up to several years postinfection. H5N1 virus-uninfected individuals in Vietnam and the United States, including subjects vaccinated with seasonal influenza vaccines or with confirmed seasonal virus infections, did not react in the H5N1-SeroDetect assays. Moreover, sera from individuals vaccinated with H5N1 subunit vaccine with moderate anti-H5N1 neutralizing antibody titers did not react positively in the H5N1-SeroDetect ELISA or rapid test assays. The simple H5N1-SeroDetect ELISA and rapid tests could provide an important tool for large-scale surveillance for potential exposure to HP H5N1 strains in both humans and birds.
Zhuo, Xunhui; Yu, Yingchao; Chen, Xueqiu; Zhang, Zhuangzhi; Yang, Yi; Du, Aifang
2017-06-15
Echinococcus granulosus is the causative pathogen of cystic echinococcosis, a serious disease endangering human and animal health. In this study, an immunochromatographic strip was developed based on the recombinant protein Heat shock protein 70 (HSP70) for the serological detection of E. granulosus. The protocol completes within 20min requiring no specialized equipment or chemical reagents, while specificity tests confirmed no cross-reactivity with positive serum of Fasciola hepatica, Haemonchus contortus, Peste des petits ruminants virus (PPRV) and Foot-and-mouth disease virus (FMDV). The strips remained stable after storage at 4°C for up to 8 months. Both immunochromatographic strip and ELISA tests were applied to detect E. granulosus antibody in a total of 728 serum samples obtained from slaughter houses in Zhejiang Province. Our data revealed positive rates of 2.61 and 1.65% by immunochromatographic strip and ELISA methods, respectively. The immunochromatographic strip test developed in this study provides a simple, specific and rapid method of E. granulosus antibody detection and infected sheep monitoring. Copyright © 2017. Published by Elsevier B.V.
Using molecular techniques for rapid detection of Salmonella ...
African Journals Online (AJOL)
PRECIOUS
2010-02-01
Feb 1, 2010 ... A total of 152 samples of chicken and chicken products ... detection of Salmonella species in the collected field samples ... that 16 million new cases of typhoid fever occur each ... vative methods for the rapid identification of Salmonella ... saved for the PCR-Non Selective test (PCR-NS) and 1 ml of the.
Chung, Boram; Park, Chulmin; Cho, Sung-Yeon; Shin, Juyoun; Shin, Sun; Yim, Seon-Hee; Lee, Dong-Gun; Chung, Yeun-Jung
2018-02-01
Early and accurate detection of bacterial pathogens in the blood is the most crucial step for sepsis management. Gram-negative bacteria are the most common organisms causing severe sepsis and responsible for high morbidity and mortality. We aimed to develop a method for rapid multiplex identification of clinically important Gram-negative pathogens and also validated whether our system can identify Gram-negative pathogens with the cell-free plasm DNA from infected blood. We designed five MLPA probe sets targeting the genes specific to major Gram-negative pathogens (uidA and lacY for E. coli, ompA for A. baumannii, phoE for K. pneumoniae, and ecfX for P. aeruginosa) and one set targeting the CTX-M group 1 to identify the ESBL producing Gram-negative pathogens. All six target-specific peaks were clearly separated without any non-specific peaks in a multiplex reaction condition. The minimum detection limit was 100 fg of pathogen DNA. When we tested 28 Gram-negative clinical isolates, all of them were successfully identified without any non-specific peaks. To evaluate the clinical applicability, we tested seven blood samples from febrile patients. Three blood culture positive cases showed E. coli specific peaks, while no peak was detected in the other four culture negative samples. This technology can be useful for detection of major sepsis-causing, drug-resistant Gram-negative pathogens and also the major ESBL producing Gram-negatives from the blood of sepsis patients in a clinical setting. This system can help early initiation of effective antimicrobial treatment against Gram-negative pathogens for sepsis patients, which is very crucial for better treatment outcomes. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Time course of radiometric detection of positive blood cultures in childhood
International Nuclear Information System (INIS)
Meadow, W.L.; Schwartz, I.K.
1986-01-01
We have determined the time course of radiometric detection of microbial growth in 2348 positive blood culture specimens obtained at Wyler Children's Hospital during a 5-year interval. Overall 72 and 88% of isolates were detected within 48 and 72 hours after sampling, respectively. For pathogenic organisms aerobic detection was generally more rapid and more inclusive than anaerobic detection. At 48 hours of incubation the detection of six potential pathogens (Salmonella sp., Haemophilus influenzae, Group D streptococci, Neisseria meningitidis, coagulase-negative staphylococci, Candida sp.) was significantly delayed compared with detection of other pathogenic organisms recovered from blood. At 72 hours of incubation the detection rates remained less than 95% for H. influenzae, Staphylococcus aureus, Klebsiella sp., coagulase-negative staphylococci, Group D streptococci and Candida sp. These data should assist clinical decisions regarding duration of antibiotic therapy for the presumptive diagnosis of bacteremia in children
Time course of radiometric detection of positive blood cultures in childhood
Energy Technology Data Exchange (ETDEWEB)
Meadow, W.L.; Schwartz, I.K.
1986-05-01
We have determined the time course of radiometric detection of microbial growth in 2348 positive blood culture specimens obtained at Wyler Children's Hospital during a 5-year interval. Overall 72 and 88% of isolates were detected within 48 and 72 hours after sampling, respectively. For pathogenic organisms aerobic detection was generally more rapid and more inclusive than anaerobic detection. At 48 hours of incubation the detection of six potential pathogens (Salmonella sp., Haemophilus influenzae, Group D streptococci, Neisseria meningitidis, coagulase-negative staphylococci, Candida sp.) was significantly delayed compared with detection of other pathogenic organisms recovered from blood. At 72 hours of incubation the detection rates remained less than 95% for H. influenzae, Staphylococcus aureus, Klebsiella sp., coagulase-negative staphylococci, Group D streptococci and Candida sp. These data should assist clinical decisions regarding duration of antibiotic therapy for the presumptive diagnosis of bacteremia in children.
Metagenomic Detection Methods in Biopreparedness Outbreak Scenarios
DEFF Research Database (Denmark)
Karlsson, Oskar Erik; Hansen, Trine; Knutsson, Rickard
2013-01-01
In the field of diagnostic microbiology, rapid molecular methods are critically important for detecting pathogens. With rapid and accurate detection, preventive measures can be put in place early, thereby preventing loss of life and further spread of a disease. From a preparedness perspective...... of a clinical sample, creating a metagenome, in a single week of laboratory work. As new technologies emerge, their dissemination and capacity building must be facilitated, and criteria for use, as well as guidelines on how to report results, must be established. This article focuses on the use of metagenomics...
Indigenous people's detection of rapid ecological change.
Aswani, Shankar; Lauer, Matthew
2014-06-01
When sudden catastrophic events occur, it becomes critical for coastal communities to detect and respond to environmental transformations because failure to do so may undermine overall ecosystem resilience and threaten people's livelihoods. We therefore asked how capable of detecting rapid ecological change following massive environmental disruptions local, indigenous people are. We assessed the direction and periodicity of experimental learning of people in the Western Solomon Islands after a tsunami in 2007. We compared the results of marine science surveys with local ecological knowledge of the benthos across 3 affected villages and 3 periods before and after the tsunami. We sought to determine how people recognize biophysical changes in the environment before and after catastrophic events such as earthquakes and tsunamis and whether people have the ability to detect ecological changes over short time scales or need longer time scales to recognize changes. Indigenous people were able to detect changes in the benthos over time. Detection levels differed between marine science surveys and local ecological knowledge sources over time, but overall patterns of statistically significant detection of change were evident for various habitats. Our findings have implications for marine conservation, coastal management policies, and disaster-relief efforts because when people are able to detect ecological changes, this, in turn, affects how they exploit and manage their marine resources. © 2014 Society for Conservation Biology.
A novel nanoprobe for the sensitive detection of Francisella tularensis
Energy Technology Data Exchange (ETDEWEB)
Kim, Ji-eun; Seo, Youngmin; Jeong, Yoon [Department of Bionano Technology, Graduate School, Hanyang University, Seoul 133-791 (Korea, Republic of); Hwang, Mintai P. [Center for Biomaterials, Korea Institute of Science and Technology, Seoul 136-791 (Korea, Republic of); Hwang, Jangsun [Department of Bionano Technology, Graduate School, Hanyang University, Seoul 133-791 (Korea, Republic of); Choo, Jaebum; Hong, Jong Wook [Department of Bionano Technology, Graduate School, Hanyang University, Seoul 133-791 (Korea, Republic of); Department of Bionano Engineering, Hanyang University ERICA, Ansan 426-791 (Korea, Republic of); Jeon, Jun Ho; Rhie, Gi-eun [Division of High-risk Pathogen Research, Center for Infectious Disease, Korea National Institute of Health, Cheongju 363-951 (Korea, Republic of); Choi, Jonghoon, E-mail: jonghchoi@hanyang.ac.kr [Department of Bionano Technology, Graduate School, Hanyang University, Seoul 133-791 (Korea, Republic of); Department of Bionano Engineering, Hanyang University ERICA, Ansan 426-791 (Korea, Republic of)
2015-11-15
Highlights: • We prepare apoferritin nanoprobes decorated with antibodies and nanoparticles. • We examine nanoprobes for the sensitive detection of Francisella tularensis. • 10-fold decrease of minimum concentration of pathogen was achieved. • Simultaneous detection of multiple high-risk pathogens was obtained. - Abstract: Francisella tularensis is a human zoonotic pathogen and the causative agent of tularemia, a severe infectious disease. Given the extreme infectivity of F. tularensis and its potential to be used as a biological warfare agent, a fast and sensitive detection method is highly desirable. Herein, we construct a novel detection platform composed of two units: (1) Magnetic beads conjugated with multiple capturing antibodies against F. tularensis for its simple and rapid separation and (2) Genetically-engineered apoferritin protein constructs conjugated with multiple quantum dots and a detection antibody against F. tularensis for the amplification of signal. We demonstrate a 10-fold increase in the sensitivity relative to traditional lateral flow devices that utilize enzyme-based detection methods. We ultimately envision the use of our novel nanoprobe detection platform in future applications that require the highly-sensitive on-site detection of high-risk pathogens.
A novel nanoprobe for the sensitive detection of Francisella tularensis
International Nuclear Information System (INIS)
Kim, Ji-eun; Seo, Youngmin; Jeong, Yoon; Hwang, Mintai P.; Hwang, Jangsun; Choo, Jaebum; Hong, Jong Wook; Jeon, Jun Ho; Rhie, Gi-eun; Choi, Jonghoon
2015-01-01
Highlights: • We prepare apoferritin nanoprobes decorated with antibodies and nanoparticles. • We examine nanoprobes for the sensitive detection of Francisella tularensis. • 10-fold decrease of minimum concentration of pathogen was achieved. • Simultaneous detection of multiple high-risk pathogens was obtained. - Abstract: Francisella tularensis is a human zoonotic pathogen and the causative agent of tularemia, a severe infectious disease. Given the extreme infectivity of F. tularensis and its potential to be used as a biological warfare agent, a fast and sensitive detection method is highly desirable. Herein, we construct a novel detection platform composed of two units: (1) Magnetic beads conjugated with multiple capturing antibodies against F. tularensis for its simple and rapid separation and (2) Genetically-engineered apoferritin protein constructs conjugated with multiple quantum dots and a detection antibody against F. tularensis for the amplification of signal. We demonstrate a 10-fold increase in the sensitivity relative to traditional lateral flow devices that utilize enzyme-based detection methods. We ultimately envision the use of our novel nanoprobe detection platform in future applications that require the highly-sensitive on-site detection of high-risk pathogens
Rapid detection of Avian Influenza Virus - Towards point of care diagnosis
DEFF Research Database (Denmark)
Dhumpa, Raghuram
barcode and fluorescent beads were also developed for rapid detection and identification of the AIV. In both methods, the detection involved sandwiching of the target AIV between monoclonal antibodies for nucleoproteins and for matrix proteins. In the fluorescent DNA barcode-based immunoassay, fluorophore...
Smith, Eric E; Malik, Harmit S
2009-05-01
Apolipoprotein L1 (APOL1) is a human protein that confers immunity to Trypanosoma brucei infections but can be countered by a trypanosome-encoded antagonist SRA. APOL1 belongs to a family of programmed cell death genes whose proteins can initiate host apoptosis or autophagic death. We report here that all six members of the APOL gene family (APOL1-6) present in humans have rapidly evolved in simian primates. APOL6, furthermore, shows evidence of an adaptive sweep during recent human evolution. In each APOL gene tested, we found rapidly evolving codons in or adjacent to the SRA-interacting protein domain (SID), which is the domain of APOL1 that interacts with SRA. In APOL6, we also found a rapidly changing 13-amino-acid cluster in the membrane-addressing domain (MAD), which putatively functions as a pH sensor and regulator of cell death. We predict that APOL genes are antagonized by pathogens by at least two distinct mechanisms: SID antagonists, which include SRA, that interact with the SID of various APOL proteins, and MAD antagonists that interact with the MAD hinge base of APOL6. These antagonists either block or prematurely cause APOL-mediated programmed cell death of host cells to benefit the infecting pathogen. These putative interactions must occur inside host cells, in contrast to secreted APOL1 that trafficks to the trypanosome lysosome. Hence, the dynamic APOL gene family appears to be an important link between programmed cell death of host cells and immunity to pathogens.
gmos: Rapid Detection of Genome Mosaicism over Short Evolutionary Distances.
Domazet-Lošo, Mirjana; Domazet-Lošo, Tomislav
2016-01-01
Prokaryotic and viral genomes are often altered by recombination and horizontal gene transfer. The existing methods for detecting recombination are primarily aimed at viral genomes or sets of loci, since the expensive computation of underlying statistical models often hinders the comparison of complete prokaryotic genomes. As an alternative, alignment-free solutions are more efficient, but cannot map (align) a query to subject genomes. To address this problem, we have developed gmos (Genome MOsaic Structure), a new program that determines the mosaic structure of query genomes when compared to a set of closely related subject genomes. The program first computes local alignments between query and subject genomes and then reconstructs the query mosaic structure by choosing the best local alignment for each query region. To accomplish the analysis quickly, the program mostly relies on pairwise alignments and constructs multiple sequence alignments over short overlapping subject regions only when necessary. This fine-tuned implementation achieves an efficiency comparable to an alignment-free tool. The program performs well for simulated and real data sets of closely related genomes and can be used for fast recombination detection; for instance, when a new prokaryotic pathogen is discovered. As an example, gmos was used to detect genome mosaicism in a pathogenic Enterococcus faecium strain compared to seven closely related genomes. The analysis took less than two minutes on a single 2.1 GHz processor. The output is available in fasta format and can be visualized using an accessory program, gmosDraw (freely available with gmos).
gmos: Rapid Detection of Genome Mosaicism over Short Evolutionary Distances.
Directory of Open Access Journals (Sweden)
Mirjana Domazet-Lošo
Full Text Available Prokaryotic and viral genomes are often altered by recombination and horizontal gene transfer. The existing methods for detecting recombination are primarily aimed at viral genomes or sets of loci, since the expensive computation of underlying statistical models often hinders the comparison of complete prokaryotic genomes. As an alternative, alignment-free solutions are more efficient, but cannot map (align a query to subject genomes. To address this problem, we have developed gmos (Genome MOsaic Structure, a new program that determines the mosaic structure of query genomes when compared to a set of closely related subject genomes. The program first computes local alignments between query and subject genomes and then reconstructs the query mosaic structure by choosing the best local alignment for each query region. To accomplish the analysis quickly, the program mostly relies on pairwise alignments and constructs multiple sequence alignments over short overlapping subject regions only when necessary. This fine-tuned implementation achieves an efficiency comparable to an alignment-free tool. The program performs well for simulated and real data sets of closely related genomes and can be used for fast recombination detection; for instance, when a new prokaryotic pathogen is discovered. As an example, gmos was used to detect genome mosaicism in a pathogenic Enterococcus faecium strain compared to seven closely related genomes. The analysis took less than two minutes on a single 2.1 GHz processor. The output is available in fasta format and can be visualized using an accessory program, gmosDraw (freely available with gmos.
Use of rapid-scan EPR to improve detection sensitivity for spin-trapped radicals.
Mitchell, Deborah G; Rosen, Gerald M; Tseitlin, Mark; Symmes, Breanna; Eaton, Sandra S; Eaton, Gareth R
2013-07-16
The short lifetime of superoxide and the low rates of formation expected in vivo make detection by standard continuous wave (CW) electron paramagnetic resonance (EPR) challenging. The new rapid-scan EPR method offers improved sensitivity for these types of samples. In rapid-scan EPR, the magnetic field is scanned through resonance in a time that is short relative to electron spin relaxation times, and data are processed to obtain the absorption spectrum. To validate the application of rapid-scan EPR to spin trapping, superoxide was generated by the reaction of xanthine oxidase and hypoxanthine with rates of 0.1-6.0 μM/min and trapped with 5-tert-butoxycarbonyl-5-methyl-1-pyrroline-N-oxide (BMPO). Spin trapping with BMPO to form the BMPO-OOH adduct converts the very short-lived superoxide radical into a more stable spin adduct. There is good agreement between the hyperfine splitting parameters obtained for BMPO-OOH by CW and rapid-scan EPR. For the same signal acquisition time, the signal/noise ratio is >40 times higher for rapid-scan than for CW EPR. Rapid-scan EPR can detect superoxide produced by Enterococcus faecalis at rates that are too low for detection by CW EPR. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Evolution and genome architecture in fungal plant pathogens.
Möller, Mareike; Stukenbrock, Eva H
2017-12-01
The fungal kingdom comprises some of the most devastating plant pathogens. Sequencing the genomes of fungal pathogens has shown a remarkable variability in genome size and architecture. Population genomic data enable us to understand the mechanisms and the history of changes in genome size and adaptive evolution in plant pathogens. Although transposable elements predominantly have negative effects on their host, fungal pathogens provide prominent examples of advantageous associations between rapidly evolving transposable elements and virulence genes that cause variation in virulence phenotypes. By providing homogeneous environments at large regional scales, managed ecosystems, such as modern agriculture, can be conducive for the rapid evolution and dispersal of pathogens. In this Review, we summarize key examples from fungal plant pathogen genomics and discuss evolutionary processes in pathogenic fungi in the context of molecular evolution, population genomics and agriculture.
Fluorescence immunoassay for detecting periodontal bacterial pathogens in plaque.
Wolff, L F; Anderson, L; Sandberg, G P; Aeppli, D M; Shelburne, C E
1991-01-01
A particle concentration fluorescence immunoassay has been modified into a bacterial concentration fluorescence immunoassay (BCFIA) to rapidly detect periodontopathic bacteria in human plaque samples. The BCFIA utilizes fluorescently tagged monoclonal antibodies (MAbs) directed against the lipopolysaccharide of selected gram-negative plaque bacteria. Microorganisms closely associated with periodontal disease that can be identified in plaque with the BCFIA include Porphyromonas gingivalis, Bac...
Wang, Junping; Xie, Xinfang; Feng, Jinsong; Chen, Jessica C; Du, Xin-jun; Luo, Jiangzhao; Lu, Xiaonan; Wang, Shuo
2015-07-02
Listeria monocytogenes is a facultatively anaerobic, Gram-positive, rod-shape foodborne bacterium causing invasive infection, listeriosis, in susceptible populations. Rapid and high-throughput detection of this pathogen in dairy products is critical as milk and other dairy products have been implicated as food vehicles in several outbreaks. Here we evaluated confocal micro-Raman spectroscopy (785 nm laser) coupled with chemometric analysis to distinguish six closely related Listeria species, including L. monocytogenes, in both liquid media and milk. Raman spectra of different Listeria species and other bacteria (i.e., Staphylococcus aureus, Salmonella enterica and Escherichia coli) were collected to create two independent databases for detection in media and milk, respectively. Unsupervised chemometric models including principal component analysis and hierarchical cluster analysis were applied to differentiate L. monocytogenes from Listeria and other bacteria. To further evaluate the performance and reliability of unsupervised chemometric analyses, supervised chemometrics were performed, including two discriminant analyses (DA) and soft independent modeling of class analogies (SIMCA). By analyzing Raman spectra via two DA-based chemometric models, average identification accuracies of 97.78% and 98.33% for L. monocytogenes in media, and 95.28% and 96.11% in milk were obtained, respectively. SIMCA analysis also resulted in satisfied average classification accuracies (over 93% in both media and milk). This Raman spectroscopic-based detection of L. monocytogenes in media and milk can be finished within a few hours and requires no extensive sample preparation. Copyright © 2015 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong
2011-01-01
of RNA extract in the liquid phase with sequence-specific nested PCR on the solid phase. A simple ultraviolet cross-linking method was used to immobilize the DNA probes over an unmodified glass surface, which makes solid-phase PCR a convenient possibility for AIV screening. The testing of 33 avian fecal....... In this article, a DNA microarray-based solid-phase polymerase chain reaction (PCR) approach has been developed for rapid detection of influenza virus type A and for simultaneous identification of pathogenic virus subtypes H5 and H7. This solid-phase RT-PCR method combined reverse-transcription amplification...
Use of Tethered Enzymes as a Platform Technology for Rapid Analyte Detection
Cohen, Roy; Lata, James P.; Lee, Yurim; Hernández, Jean C. Cruz; Nishimura, Nozomi; Schaffer, Chris B.; Mukai, Chinatsu; Nelson, Jacquelyn L.; Brangman, Sharon A.; Agrawal, Yash; Travis, Alexander J.
2015-01-01
Background Rapid diagnosis for time-sensitive illnesses such as stroke, cardiac arrest, and septic shock is essential for successful treatment. Much attention has therefore focused on new strategies for rapid and objective diagnosis, such as Point-of-Care Tests (PoCT) for blood biomarkers. Here we use a biomimicry-based approach to demonstrate a new diagnostic platform, based on enzymes tethered to nanoparticles (NPs). As proof of principle, we use oriented immobilization of pyruvate kinase (PK) and luciferase (Luc) on silica NPs to achieve rapid and sensitive detection of neuron-specific enolase (NSE), a clinically relevant biomarker for multiple diseases ranging from acute brain injuries to lung cancer. We hypothesize that an approach capitalizing on the speed and catalytic nature of enzymatic reactions would enable fast and sensitive biomarker detection, suitable for PoCT devices. Methods and findings We performed in-vitro, animal model, and human subject studies. First, the efficiency of coupled enzyme activities when tethered to NPs versus when in solution was tested, demonstrating a highly sensitive and rapid detection of physiological and pathological concentrations of NSE. Next, in rat stroke models the enzyme-based assay was able in minutes to show a statistically significant increase in NSE levels in samples taken 1 hour before and 0, 1, 3 and 6 hours after occlusion of the distal middle cerebral artery. Finally, using the tethered enzyme assay for detection of NSE in samples from 20 geriatric human patients, we show that our data match well (r = 0.815) with the current gold standard for biomarker detection, ELISA—with a major difference being that we achieve detection in 10 minutes as opposed to the several hours required for traditional ELISA. Conclusions Oriented enzyme immobilization conferred more efficient coupled activity, and thus higher assay sensitivity, than non-tethered enzymes. Together, our findings provide proof of concept for using
Comin, Arianna; Stegeman, Arjan; Marangon, Stefano; Klinkenberg, Don
2012-01-01
In recent years, the early detection of low pathogenicity avian influenza (LPAI) viruses in poultry has become increasingly important, given their potential to mutate into highly pathogenic viruses. However, evaluations of LPAI surveillance have mainly focused on prevalence and not on the ability to act as an early warning system. We used a simulation model based on data from Italian LPAI epidemics in turkeys to evaluate different surveillance strategies in terms of their performance as early warning systems. The strategies differed in terms of sample size, sampling frequency, diagnostic tests, and whether or not active surveillance (i.e., routine laboratory testing of farms) was performed, and were also tested under different epidemiological scenarios. We compared surveillance strategies by simulating within-farm outbreaks. The output measures were the proportion of infected farms that are detected and the farm reproduction number (R(h)). The first one provides an indication of the sensitivity of the surveillance system to detect within-farm infections, whereas R(h) reflects the effectiveness of outbreak detection (i.e., if detection occurs soon enough to bring an epidemic under control). Increasing the sampling frequency was the most effective means of improving the timeliness of detection (i.e., it occurs earlier), whereas increasing the sample size increased the likelihood of detection. Surveillance was only effective in preventing an epidemic if actions were taken within two days of sampling. The strategies were not affected by the quality of the diagnostic test, although performing both serological and virological assays increased the sensitivity of active surveillance. Early detection of LPAI outbreaks in turkeys can be achieved by increasing the sampling frequency for active surveillance, though very frequent sampling may not be sustainable in the long term. We suggest that, when no LPAI virus is circulating yet and there is a low risk of virus introduction
Directory of Open Access Journals (Sweden)
Arianna Comin
Full Text Available In recent years, the early detection of low pathogenicity avian influenza (LPAI viruses in poultry has become increasingly important, given their potential to mutate into highly pathogenic viruses. However, evaluations of LPAI surveillance have mainly focused on prevalence and not on the ability to act as an early warning system. We used a simulation model based on data from Italian LPAI epidemics in turkeys to evaluate different surveillance strategies in terms of their performance as early warning systems. The strategies differed in terms of sample size, sampling frequency, diagnostic tests, and whether or not active surveillance (i.e., routine laboratory testing of farms was performed, and were also tested under different epidemiological scenarios. We compared surveillance strategies by simulating within-farm outbreaks. The output measures were the proportion of infected farms that are detected and the farm reproduction number (R(h. The first one provides an indication of the sensitivity of the surveillance system to detect within-farm infections, whereas R(h reflects the effectiveness of outbreak detection (i.e., if detection occurs soon enough to bring an epidemic under control. Increasing the sampling frequency was the most effective means of improving the timeliness of detection (i.e., it occurs earlier, whereas increasing the sample size increased the likelihood of detection. Surveillance was only effective in preventing an epidemic if actions were taken within two days of sampling. The strategies were not affected by the quality of the diagnostic test, although performing both serological and virological assays increased the sensitivity of active surveillance. Early detection of LPAI outbreaks in turkeys can be achieved by increasing the sampling frequency for active surveillance, though very frequent sampling may not be sustainable in the long term. We suggest that, when no LPAI virus is circulating yet and there is a low risk of virus
Modified DNA extraction for rapid PCR detection of methicillin-resistant staphylococci
International Nuclear Information System (INIS)
Japoni, A.; Alborzi, A.; Rasouli, M.; Pourabbas, B.
2004-01-01
Nosocomial infection caused by methicillin-resistant staphylococci poses a serious problem in many countries. The aim of this study was to rapidly and reliably detect methicillin-resistant-staphylococci in order to suggest appropriate therapy. The presence or absence of the methicillin-resistance gene in 115 clinical isolates of staphylococcus aureus and 50 isolates of coagulase negative staphylococci was examined by normal PCR. DNA extraction for PCR performance was then modified by omission of achromopeptadiase and proteinase K digestion, phenol/chloroform extraction and ethanol precipitation. All isolates with Mic>8 μ g/ml showed positive PCR. No differences in PCR detection have been observed when normal and modified DNA extractions have been performed. Our modified DNA extraction can quickly detect methicillin-resistant staphylococci by PCR. The advantage of rapid DNA extraction extends to both reduction of time and cost of PCR performance. This modified DNA extraction is suitable for different PCR detection, when staphylococci are the subject of DNA analysis
Rapid and specific detection of Asian- and African-lineage Zika viruses.
Chotiwan, Nunya; Brewster, Connie D; Magalhaes, Tereza; Weger-Lucarelli, James; Duggal, Nisha K; Rückert, Claudia; Nguyen, Chilinh; Garcia Luna, Selene M; Fauver, Joseph R; Andre, Barb; Gray, Meg; Black, William C; Kading, Rebekah C; Ebel, Gregory D; Kuan, Guillermina; Balmaseda, Angel; Jaenisch, Thomas; Marques, Ernesto T A; Brault, Aaron C; Harris, Eva; Foy, Brian D; Quackenbush, Sandra L; Perera, Rushika; Rovnak, Joel
2017-05-03
Understanding the dynamics of Zika virus transmission and formulating rational strategies for its control require precise diagnostic tools that are also appropriate for resource-poor environments. We have developed a rapid and sensitive loop-mediated isothermal amplification (LAMP) assay that distinguishes Zika viruses of Asian and African lineages. The assay does not detect chikungunya virus or flaviviruses such as dengue, yellow fever, or West Nile viruses. The assay conditions allowed direct detection of Zika virus RNA in cultured infected cells; in mosquitoes; in virus-spiked samples of human blood, plasma, saliva, urine, and semen; and in infected patient serum, plasma, and semen samples without the need for RNA isolation or reverse transcription. The assay offers rapid, specific, sensitive, and inexpensive detection of the Asian-lineage Zika virus strain that is currently circulating in the Western hemisphere, and can also detect the African-lineage Zika virus strain using separate, specific primers. Copyright © 2017, American Association for the Advancement of Science.
Rapid and specific detection of Asian- and African-lineage Zika viruses
Chotiwan, Nunya; Brewster, Connie D.; Magalhaes, Tereza; Weger-Lucarelli, James; Duggal, Nisha K.; Rückert, Claudia; Nguyen, Chilinh; Garcia Luna, Selene M.; Fauver, Joseph R.; Andre, Barb; Gray, Meg; Black, William C.; Kading, Rebekah C.; Ebel, Gregory D.; Kuan, Guillermina; Balmaseda, Angel; Jaenisch, Thomas; Marques, Ernesto T. A.; Brault, Aaron C.; Harris, Eva; Foy, Brian D.; Quackenbush, Sandra L.; Perera, Rushika; Rovnak, Joel
2017-01-01
Understanding the dynamics of Zika virus transmission and formulating rational strategies for its control require precise diagnostic tools that are also appropriate for resource-poor environments. We have developed a rapid and sensitive loop-mediated isothermal amplification (LAMP) assay that distinguishes Zika viruses of Asian and African lineages. The assay does not detect chikungunya virus or flaviviruses such as dengue, yellow fever, or West Nile viruses. The assay conditions allowed direct detection of Zika virus RNA in cultured infected cells; in mosquitoes; in virus-spiked samples of human blood, plasma, saliva, urine, and semen; and in infected patient serum, plasma, and semen samples without the need for RNA isolation or reverse transcription. The assay offers rapid, specific, sensitive, and inexpensive detection of the Asian-lineage Zika virus strain that is currently circulating in the Western hemisphere, and can also detect the African-lineage Zika virus strain using separate, specific primers. PMID:28469032
Leach, L; Zhu, Y; Chaturvedi, S
2018-02-01
Candida auris is an emerging multidrug-resistant yeast causing invasive health care-associated infection with high mortality worldwide. Rapid identification of C. auris is of primary importance for the implementation of public health measures to control the spread of infection. To achieve these goals, we developed and validated a TaqMan-based real-time PCR assay targeting the internal transcribed spacer 2 ( ITS 2) region of the ribosomal gene. The assay was highly specific, reproducible, and sensitive, with the detection limit of 1 C. auris CFU/PCR. The performance of the C. auris real-time PCR assay was evaluated by using 623 surveillance samples, including 365 patient swabs and 258 environmental sponges. Real-time PCR yielded positive results from 49 swab and 58 sponge samples, with 89% and 100% clinical sensitivity with regard to their respective culture-positive results. The real-time PCR also detected C. auris DNA from 1% and 12% of swab and sponge samples with culture-negative results, indicating the presence of dead or culture-impaired C. auris The real-time PCR yielded results within 4 h of sample processing, compared to 4 to 14 days for culture, reducing turnaround time significantly. The new real-time PCR assay allows for accurate and rapid screening of C. auris and can increase effective control and prevention of this emerging multidrug-resistant fungal pathogen in health care facilities. Copyright © 2018 Leach et al.
Laser diagnostic technology for early detection of pathogen infestation in orange fruits
International Nuclear Information System (INIS)
Giubileo, Gianfranco; Lai, Antonella; Piccinelli, Delinda; Puiu, Adriana
2010-01-01
Due to an increased expectation of food products that respect high quality and safety standards, there is a need for the growth of accurate, fast, objective and non-destructive technologies for quality determination of food and agricultural products. For this purpose, a diagnostic system based on laser photoacoustic spectroscopy (LPAS) was developed at ENEA Frascati Molecular Spectroscopy Laboratory (Italy). In the design of the photoacoustic detector, particular emphasis was placed in attaining a high sensitivity in detecting ethylene (ET) down to sub-parts per billion level (minimum detectable concentration 0.2 ppb). This was required due to the necessity to monitor and follow up ET production at a single fruit scale. ET is normally synthesised in very low amounts by healthy citrus fruits; however stress conditions such as pathogen attack may induce a substantial increase in the synthesised ET. In the present paper, the comparison between the ET emitted by healthy oranges (Citrus sinensis L. Osbeck) cv Navel and by Phytophthora citrophthora infested Navel orange fruits are reported. The obtained results show a well evident increase in ET emission from the infested fruit with respect to the healthy one, even 24 h after the inoculation with the pathogen; at that time the tissue necrosis was not yet visible, and the fruit was also not yet damaged. The possibility to perform a real time non-destructive detection of ET traces makes the LPAS a powerful tool for monitoring the healthy state of the citrus fruits.
Laser diagnostic technology for early detection of pathogen infestation in orange fruits
Giubileo, Gianfranco; Lai, Antonella; Piccinelli, Delinda; Puiu, Adriana
2010-11-01
Due to an increased expectation of food products that respect high quality and safety standards, there is a need for the growth of accurate, fast, objective and non-destructive technologies for quality determination of food and agricultural products. For this purpose, a diagnostic system based on laser photoacoustic spectroscopy (LPAS) was developed at ENEA Frascati Molecular Spectroscopy Laboratory (Italy). In the design of the photoacoustic detector, particular emphasis was placed in attaining a high sensitivity in detecting ethylene (ET) down to sub-parts per billion level (minimum detectable concentration 0.2 ppb). This was required due to the necessity to monitor and follow up ET production at a single fruit scale. ET is normally synthesised in very low amounts by healthy citrus fruits; however stress conditions such as pathogen attack may induce a substantial increase in the synthesised ET. In the present paper, the comparison between the ET emitted by healthy oranges ( Citrus sinensis L. Osbeck) cv Navel and by Phytophthora citrophthora infested Navel orange fruits are reported. The obtained results show a well evident increase in ET emission from the infested fruit with respect to the healthy one, even 24 h after the inoculation with the pathogen; at that time the tissue necrosis was not yet visible, and the fruit was also not yet damaged. The possibility to perform a real time non-destructive detection of ET traces makes the LPAS a powerful tool for monitoring the healthy state of the citrus fruits.
Laser diagnostic technology for early detection of pathogen infestation in orange fruits
Energy Technology Data Exchange (ETDEWEB)
Giubileo, Gianfranco, E-mail: gianfranco.giubileo@frascati.enea.i [ENEA Frascati, Via E. Fermi 45, 00044 (Italy); Lai, Antonella; Piccinelli, Delinda [ENEA Frascati, Via E. Fermi 45, 00044 (Italy); Puiu, Adriana [Tor Vergata University of Rome, Faculty of Engineering, Via del Politecnico 1, 00133 Rome (Italy)
2010-11-11
Due to an increased expectation of food products that respect high quality and safety standards, there is a need for the growth of accurate, fast, objective and non-destructive technologies for quality determination of food and agricultural products. For this purpose, a diagnostic system based on laser photoacoustic spectroscopy (LPAS) was developed at ENEA Frascati Molecular Spectroscopy Laboratory (Italy). In the design of the photoacoustic detector, particular emphasis was placed in attaining a high sensitivity in detecting ethylene (ET) down to sub-parts per billion level (minimum detectable concentration 0.2 ppb). This was required due to the necessity to monitor and follow up ET production at a single fruit scale. ET is normally synthesised in very low amounts by healthy citrus fruits; however stress conditions such as pathogen attack may induce a substantial increase in the synthesised ET. In the present paper, the comparison between the ET emitted by healthy oranges (Citrus sinensis L. Osbeck) cv Navel and by Phytophthora citrophthora infested Navel orange fruits are reported. The obtained results show a well evident increase in ET emission from the infested fruit with respect to the healthy one, even 24 h after the inoculation with the pathogen; at that time the tissue necrosis was not yet visible, and the fruit was also not yet damaged. The possibility to perform a real time non-destructive detection of ET traces makes the LPAS a powerful tool for monitoring the healthy state of the citrus fruits.
Malla, Javed Ahmed; Chakravarti, Soumendu; Gupta, Vikas; Chander, Vishal; Sharma, Gaurav Kumar; Qureshi, Salauddin; Mishra, Adhiraj; Gupta, Vivek Kumar; Nandi, Sukdeb
2018-02-20
Bovine herpesvirus-1 (BHV-1) is a major viral pathogen affecting bovines leading to various clinical manifestations and causes significant economic impediment in modern livestock production system. Rapid, accurate and sensitive detection of BHV-1 infection at frozen semen stations or at dairy herds remains a priority for control of BHV-1 spread to susceptible population. Polymerase Spiral Reaction (PSR), a novel addition in the gamut of isothermal techniques, has been successfully implemented in initial optimization for detection of BHV-1 genomic DNA and further validated in clinical samples. The developed PSR assay has been validated for detection of BHV-1 from bovine semen (n=99), a major source of transmission of BHV-1 from breeding bulls to susceptible dams in artificial insemination programs. The technique has also been used for screening of BHV-1 DNA from suspected aborted fetal tissues (n=25). The developed PSR technique is 100 fold more sensitive than conventional PCR and comparable to real-time PCR. The PSR technique has been successful in detecting 13 samples positive for BHV-1 DNA in bovine semen, 4 samples more than conventional PCR. The aborted fetal tissues were negative for presence of BHV-1 DNA. The presence of BHV-1 in bovine semen samples raises a pertinent concern for extensively screening of semen from breeding bulls before been used for artificial insemination process. PSR has all the attributes for becoming a method of choice for rapid, accurate and sensitive detection of BHV-1 DNA at frozen semen stations or at dairy herds in resource constrained settings. Copyright © 2017 Elsevier B.V. All rights reserved.
Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K
2015-02-01
A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.
Effector-triggered immunity: from pathogen perception to robust defense.
Cui, Haitao; Tsuda, Kenichi; Parker, Jane E
2015-01-01
In plant innate immunity, individual cells have the capacity to sense and respond to pathogen attack. Intracellular recognition mechanisms have evolved to intercept perturbations by pathogen virulence factors (effectors) early in host infection and convert it to rapid defense. One key to resistance success is a polymorphic family of intracellular nucleotide-binding/leucine-rich-repeat (NLR) receptors that detect effector interference in different parts of the cell. Effector-activated NLRs connect, in various ways, to a conserved basal resistance network in order to transcriptionally boost defense programs. Effector-triggered immunity displays remarkable robustness against pathogen disturbance, in part by employing compensatory mechanisms within the defense network. Also, the mobility of some NLRs and coordination of resistance pathways across cell compartments provides flexibility to fine-tune immune outputs. Furthermore, a number of NLRs function close to the nuclear chromatin by balancing actions of defense-repressing and defense-activating transcription factors to program cells dynamically for effective disease resistance.
Rapid antemortem detection of CWD prions in deer saliva.
Directory of Open Access Journals (Sweden)
Davin M Henderson
Full Text Available Chronic wasting disease (CWD is an efficiently transmitted prion disease of cervids, now identified in 22 United States, 2 Canadian provinces and Korea. One hallmark of CWD is the shedding of infectious prions in saliva, as demonstrated by bioassay in deer. It is also clear that the concentration of prions in saliva, blood, urine and feces is much lower than in the nervous system or lymphoid tissues. Rapid in vitro detection of CWD (and other prions in body fluids and excreta has been problematic due to the sensitivity limits of direct assays (western blotting, ELISA and the presence of inhibitors in these complex biological materials that hamper detection. Here we use real-time quaking induced conversion (RT-QuIC to demonstrate CWD prions in both diluted and prion-enriched saliva samples from asymptomatic and symptomatic white-tailed deer. CWD prions were detected in 14 of 24 (58.3% diluted saliva samples from CWD-exposed white-tailed deer, including 9 of 14 asymptomatic animals (64.2%. In addition, a phosphotungstic acid enrichment enhanced the RT-QuIC assay sensitivity, enabling detection in 19 of 24 (79.1% of the above saliva samples. Bioassay in Tg[CerPrP] mice confirmed the presence of infectious prions in 2 of 2 RT-QuIC-positive saliva samples so examined. The modified RT-QuIC analysis described represents a non-invasive, rapid ante-mortem detection of prions in complex biologic fluids, excreta, or environmental samples as well as a tool for exploring prion trafficking, peripheralization, and dissemination.
Fink, Jamie M; Moore, George E; Landau, Ruth; Vemulapalli, Ramesh
2015-03-01
Leptospirosis is caused by several pathogenic Leptospira species, and is an important infectious disease of dogs. Early detection of infection is crucial for an effective antibiotic treatment of the disease. Though different polymerase chain reaction (PCR) assays have been developed for detection of pathogenic Leptospira spp., thorough evaluation of the performance of these assays using dog urine samples has not been carried out. In the current study, the performance of 3 real-time PCR (qPCR) assays was assessed, 1 targeting the 16S ribosomal RNA (rRNA) gene and the other 2 targeting the lipL32 gene, a gene for the LipL32 outer membrane protein. With DNA extracted from laboratory-cultured pathogenic Leptospira spp., all 3 qPCR assays showed 100% specificity and had identical lower limits of detection. Compared to a conventional, gel-based PCR assay, all 3 qPCR assays were 100-fold more sensitive. There was a 100% agreement in the results of the 3 assays when tested on urine samples collected aseptically from 30 dogs suspected for leptospirosis. However, when tested on 30 urine samples that were collected by the free-catch method, the 16S rRNA-based assay falsely detected 13.3% of the samples as positive for pathogenic Leptospira spp. Nucleotide sequence analysis of the amplified DNA fragments showed that the assay resulted in false positives because of unrelated bacteria. All urine samples collected from 100 apparently healthy dogs at a local animal shelter tested negative for pathogenic Leptospira spp. These results highlight the importance of sample-specific validation of PCR-based diagnostic assays and the application of appropriately validated assays for more reliable pathogen detection. © 2015 The Author(s).
Zhao, Zhixun; Fan, Bin; Wu, Guohua; Yan, Xinmin; Li, Yingguo; Zhou, Xiaoli; Yue, Hua; Dai, Xueling; Zhu, Haixia; Tian, Bo; Li, Jian; Zhang, Qiang
2014-01-17
Capripox viruses are economically important pathogens in goat and sheep producing areas of the world, with specific focus on goat pox virus (GTPV), sheep pox virus (SPPV) and the Lumpy Skin Disease virus (LSDV). Clinically, sheep pox and goat pox have the same symptoms and cannot be distinguished serologically. This presents a real need for a rapid, inexpensive, and easy to operate and maintain genotyping tool to facilitate accurate disease diagnosis and surveillance for better management of Capripox outbreaks. A LAMP method was developed for the specific differential detection of GTPV and SPPV using three sets of LAMP primers designed on the basis of ITR sequences. Reactions were performed at 62°C for either 45 or 60 min, and specificity confirmed by successful differential detection of several GTPV and SPPV isolates. No cross reactivity with Orf virus, foot-and-mouth disease virus (FMDV), A. marginale Lushi isolate, Mycoplasma mycoides subsp. capri, Chlamydophila psittaci, Theileria ovis, T. luwenshuni, T. uilenbergi or Babesia sp was noted. RFLP-PCR analysis of 135 preserved epidemic materials revealed 48 samples infected with goat pox and 87 infected with sheep pox, with LAMP test results showing a positive detection for all samples. When utilizing GTPV and SPPV genomic DNA, the universal LAMP primers (GSPV) and GTPV LAMP primers displayed a 100% detection rate; while the SPPV LAMP detection rate was 98.8%, consistent with the laboratory tested results. In summary, the three sets of LAMP primers when combined provide an analytically robust method able to fully distinguish between GTPV and SPPV. The presented LAMP method provides a specific, sensitive and rapid diagnostic tool for the distinction of GTPV and SPPV infections, with the potential to be standardized as a detection method for Capripox viruses in endemic areas.
Directory of Open Access Journals (Sweden)
Michael eSteinert
2014-01-01
Full Text Available Different species inhabit different sensory worlds and thus have evolved diverse means of processing information, learning and memory. In the escalated arms race with host defense, each pathogenic bacterium not only has evolved its individual cellular sensing and behaviour, but also collective sensing, interbacterial communication, distributed information processing, joint decision making, dissociative behaviour, and the phenotypic and genotypic heterogeneity necessary for epidemiologic success. Moreover, pathogenic populations take advantage of dormancy strategies and rapid evolutionary speed, which allow them to save co-generated intelligent traits in a collective genomic memory. This review discusses how these mechanisms add further levels of complexity to bacterial pathogenicity and transmission, and how mining for these mechanisms could help to develop new anti-infective strategies.
The application of automatic chemiluminescence machine in rapid immune detection
International Nuclear Information System (INIS)
Lin Aizhen; Li Xuanwei; Chen Binhong; Li Zhenqian; Chen Zhaoxuan
2004-01-01
Objective: To provide high-quality, rapid and dependable result for clinical practice, and give satisfactory service to patients of different economical status by supplementation with other labeling immune examination. With an innovative attitude, we carried out efficient technical reform on ACS180 automatic chemiluminescence machine, making it possible for patients to complete the whole process including examination, check-out, diagnosis and getting drugs. The reported will be issued within an hour, thus a rapid immune detection service was established in out-patients department. Methods: 1. ACS-180 automatic chemiluminescence machine is used based on the principle of chemiluminescence immune methods. 2. The reagents are provided by Ciba-Comig Company of USA, composed of anti acridinium ester antibody of liquid phase and particulate antigen of solid phase wrapped in magnetic powder. 3. Calibration and quality control: high and low concentration are set for each calibration fluid with attached standard curve. Product for quality controlling includes three concentration of low, moderate and high. Results: 1. rapid machine detection for sample: serum is replaced with plasma coagulated by heparin, and comparison among series of methods using serum or plasma suggest no significant difference exists. 2. The problem about fasting detection: chemiluminescence machine measure optical density directly, with the results hardly being influenced by turbidity. But attention should be paid to the treatment of lipid turbid samples. 3. Other innovations: (1) direct placement of sample tube on machine: a cushion is placed on sample plate to transfer sample to machine directly after centrifugation, saving time and reducing the accident in sample transference. (2) for HCG quantification in blood and urine, 'gold criteria' is used firstly in screening to determine approximately the dilution range, with an advantage of saving time and reagent as well as accuracy. (3) we design a
Novel Eurasian highly pathogenic influenza A H5 viruses in wild birds, Washington, USA
Ip, Hon S.; Kim Torchetti, Mia; Crespo, Rocio; Kohrs, Paul; DeBruyn, Paul; Mansfield, Kristin G.; Baszler, Timothy; Badcoe, Lyndon; Bodenstein, Barbara L.; Shearn-Bochsler, Valerie I.; Killian, Mary Lea; Pederson, Janice C.; Hines, Nichole; Gidlewski, Thomas; DeLiberto, Thomas; Sleeman, Jonathan M.
2015-01-01
Novel Eurasian lineage avian influenza A(H5N8) virus has spread rapidly and globally since January 2014. In December 2014, H5N8 and reassortant H5N2 viruses were detected in wild birds in Washington, USA, and subsequently in backyard birds. When they infect commercial poultry, these highly pathogenic viruses pose substantial trade issues.
Classification of human pathogen bacteria for early screening using electronic nose
Zulkifli, Syahida Amani; Mohamad, Che Wan Syarifah Robiah; Abdullah, Abu Hassan
2017-10-01
This paper present human pathogen bacteria for early screening using electronic nose. Electronic nose (E-nose) known as gas sensor array is a device that analyze the odor measurement give the fast response and less time consuming for clinical diagnosis. Many bacterial pathogens could lead to life threatening infections. Accurate and rapid diagnosis is crucial for the successful management of these infections disease. The conventional method need more time to detect the growth of bacterial. Alternatively, the bacteria are Pseudomonas aeruginosa and Shigella cultured on different media agar can be detected and classifies according to the volatile compound in shorter time using electronic nose (E-nose). Then, the data from electronic nose (E-nose) is processed using statistical method which is principal component analysis (PCA). The study shows the capability of electronic nose (E-nose) for early screening for bacterial infection in human stomach.
Hiramatsu, Kotaro; Luo, Yizhi; Ideguchi, Takuro; Goda, Keisuke
2017-11-01
High-speed Raman spectroscopy has become increasingly important for analyzing chemical dynamics in real time. To address the need, rapid-scan Fourier-transform coherent anti-Stokes Raman scattering (FT-CARS) spectroscopy has been developed to realize broadband CARS measurements at a scan rate of more than 20,000 scans/s. However, the detection sensitivity of FT-CARS spectroscopy is inherently low due to the limited number of photons detected during each scan. In this Letter, we show our experimental demonstration of enhanced sensitivity in rapid-scan FT-CARS spectroscopy by heterodyne detection. Specifically, we implemented heterodyne detection by superposing the CARS electric field with an external local oscillator (LO) for their interference. The CARS signal was amplified by simply increasing the power of the LO without the need for increasing the incident power onto the sample. Consequently, we achieved enhancement in signal intensity and the signal-to-noise ratio by factors of 39 and 5, respectively, compared to FT-CARS spectroscopy with homodyne detection. The sensitivity-improved rapid-scan FT-CARS spectroscopy is expected to enable the sensitive real-time observation of chemical dynamics in a broad range of settings, such as combustion engines and live biological cells.
Consequences of organ choice in describing bacterial pathogen assemblages in a rodent population.
Villette, P; Afonso, E; Couval, G; Levret, A; Galan, M; Tatard, C; Cosson, J F; Giraudoux, P
2017-10-01
High-throughput sequencing technologies now allow for rapid cost-effective surveys of multiple pathogens in many host species including rodents, but it is currently unclear if the organ chosen for screening influences the number and identity of bacteria detected. We used 16S rRNA amplicon sequencing to identify bacterial pathogens in the heart, liver, lungs, kidneys and spleen of 13 water voles (Arvicola terrestris) collected in Franche-Comté, France. We asked if bacterial pathogen assemblages within organs are similar and if all five organs are necessary to detect all of the bacteria present in an individual animal. We identified 24 bacteria representing 17 genera; average bacterial richness for each organ ranged from 1·5 ± 0·4 (mean ± standard error) to 2·5 ± 0·4 bacteria/organ and did not differ significantly between organs. The average bacterial richness when organ assemblages were pooled within animals was 4·7 ± 0·6 bacteria/animal; Operational Taxonomic Unit accumulation analysis indicates that all five organs are required to obtain this. Organ type influences bacterial assemblage composition in a systematic way (PERMANOVA, 999 permutations, pseudo-F 4,51 = 1·37, P = 0·001). Our results demonstrate that the number of organs sampled influences the ability to detect bacterial pathogens, which can inform sampling decisions in public health and wildlife ecology.
Miller, Melissa A; Byrne, Barbara A; Jang, Spencer S; Dodd, Erin M; Dorfmeier, Elene; Harris, Michael D; Ames, Jack; Paradies, David; Worcester, Karen; Jessup, David A; Miller, Woutrina A
2010-01-01
Although protected for nearly a century, California's sea otters have been slow to recover, in part due to exposure to fecally-associated protozoal pathogens like Toxoplasma gondii and Sarcocystis neurona. However, potential impacts from exposure to fecal bacteria have not been systematically explored. Using selective media, we examined feces from live and dead sea otters from California for specific enteric bacterial pathogens (Campylobacter, Salmonella, Clostridium perfringens, C. difficile and Escherichia coli O157:H7), and pathogens endemic to the marine environment (Vibrio cholerae, V. parahaemolyticus and Plesiomonas shigelloides). We evaluated statistical associations between detection of these pathogens in otter feces and demographic or environmental risk factors for otter exposure, and found that dead otters were more likely to test positive for C. perfringens, Campylobacter and V. parahaemolyticus than were live otters. Otters from more urbanized coastlines and areas with high freshwater runoff (near outflows of rivers or streams) were more likely to test positive for one or more of these bacterial pathogens. Other risk factors for bacterial detection in otters included male gender and fecal samples collected during the rainy season when surface runoff is maximal. Similar risk factors were reported in prior studies of pathogen exposure for California otters and their invertebrate prey, suggesting that land-sea transfer and/or facilitation of pathogen survival in degraded coastal marine habitat may be impacting sea otter recovery. Because otters and humans share many of the same foods, our findings may also have implications for human health.
Rapid detection of urinary polyomavirus BK by heterodyne-based surface plasmon resonance biosensor
Su, Li-Chen; Tian, Ya-Chung; Chang, Ying-Feng; Chou, Chien; Lai, Chao-Sung
2014-01-01
In renal transplant patients, immunosuppressive therapy may result in the reactivation of polyomavirus BK (BKV), leading to polyomavirus-associated nephropathy (PVAN), which inevitably causes allograft failure. Since the treatment outcomes of PVAN remain unsatisfactory, early identification and continuous monitoring of BKV reactivation and reduction of immunosuppressants are essential to prevent PVAN development. The present study demonstrated that the developed dual-channel heterodyne-based surface plasmon resonance (SPR) biosensor is applicable for the rapid detection of urinary BKV. The use of a symmetrical reference channel integrated with the poly(ethylene glycol)-based low-fouling self-assembled monolayer to reduce the environmental variations and the nonspecific noise was proven to enhance the sensitivity in urinary BKV detection. Experimentally, the detection limit of the biosensor for BKV detection was estimated to be around 8500 copies/mL. In addition, urine samples from five renal transplant patients were tested to rapidly distinguish PVAN-positive and PVAN-negative renal transplant patients. By virtue of its simplicity, rapidity, and applicability, the SPR biosensor is a remarkable potential to be used for continuous clinical monitoring of BKV reactivation.
A biosensor platform for rapid detection of E. coli in drinking water.
Hesari, Nikou; Alum, Absar; Elzein, Mohamad; Abbaszadegan, Morteza
2016-02-01
There remains a need for rapid, specific and sensitive assays for the detection of bacterial indicators for water quality monitoring. In this study, a strategy for rapid detection of Escherichia coli in drinking water has been developed. This strategy is based on the use of the substrate 4-methylumbelliferyl-β-d-glucuronide (MUG), which is hydrolyzed rapidly by the action of E. coli β-d-glucuronidase (GUD) enzyme to yield a fluorogenic 4-methylumbelliferone (4-MU) product that can be quantified and related to the number of E. coli cells present in water samples. In this study, the detection time required for the biosensor response ranged between 20 and 120 min, depending on the number of bacteria in the sample. This approach does not need extensive sample processing with a rapid detection capability. The specificity of the MUG substrate was examined in both, pure cultures of non-target bacterial genera such as Klebsiella, Salmonella, Enterobacter and Bacillus. Non-target substrates that included 4-methylumbelliferyl-β-d-galactopyranoside (MUGal) and l-leucine β-naphthylamide aminopeptidase (LLβ-N) were also investigated to identify nonspecific patterns of enzymatic activities in E. coli. GUD activity was found to be specific for E. coli and no further enzymatic activity was detected by other species. In addition, fluorescence assays were performed for the detection of E. coli to generate standard curves; and the sensitivity of the GUD enzymatic response was measured and repeatedly determined to be less than 10 E. coli cells in a reaction vial. The applicability of the method was tested by performing multiple fluorescence assays under pure and mixed bacterial flora in environmental samples. The results of this study showed that the fluorescence signals generated in samples using specific substrate molecules can be utilized to develop a bio-sensing platform for the detection of E. coli in drinking water. Furthermore, this system can be applied independently or
Faria, Vítor G; Martins, Nelson E; Paulo, Tânia; Teixeira, Luís; Sucena, Élio; Magalhães, Sara
2015-11-01
Pathogens exert a strong selective pressure on hosts, entailing host adaptation to infection. This adaptation often affects negatively other fitness-related traits. Such trade-offs may underlie the maintenance of genetic diversity for pathogen resistance. Trade-offs can be tested with experimental evolution of host populations adapting to parasites, using two approaches: (1) measuring changes in immunocompetence in relaxed-selection lines and (2) comparing life-history traits of evolved and control lines in pathogen-free environments. Here, we used both approaches to examine trade-offs in Drosophila melanogaster populations evolving for over 30 generations under infection with Drosophila C Virus or the bacterium Pseudomonas entomophila, the latter through different routes. We find that resistance is maintained after up to 30 generations of relaxed selection. Moreover, no differences in several classical life-history traits between control and evolved populations were found in pathogen-free environments, even under stresses such as desiccation, nutrient limitation, and high densities. Hence, we did not detect any maintenance costs associated with resistance to pathogens. We hypothesize that extremely high selection pressures commonly used lead to the disproportionate expression of costs relative to their actual occurrence in natural systems. Still, the maintenance of genetic variation for pathogen resistance calls for an explanation. © 2015 The Author(s). Evolution © 2015 The Society for the Study of Evolution.
Tran, Thi-Nguyen-Ny; Signoli, Michel; Fozzati, Luigi; Aboudharam, Gérard; Raoult, Didier; Drancourt, Michel
2011-03-10
Historical records suggest that multiple burial sites from the 14th-16th centuries in Venice, Italy, were used during the Black Death and subsequent plague epidemics. High throughput, multiplexed real-time PCR detected DNA of seven highly transmissible pathogens in 173 dental pulp specimens collected from 46 graves. Bartonella quintana DNA was identified in five (2.9%) samples, including three from the 16th century and two from the 15th century, and Yersinia pestis DNA was detected in three (1.7%) samples, including two from the 14th century and one from the 16th century. Partial glpD gene sequencing indicated that the detected Y. pestis was the Orientalis biotype. These data document for the first time successive plague epidemics in the medieval European city where quarantine was first instituted in the 14th century.
Kim, Jinwoo; Kim, Minsik; Kim, Seongmi; Ryu, Sangryeol
2017-08-02
Escherichia coli O157:H7, a major foodborne pathogen, is a major public health concern associated with life-threatening diseases such as hemolytic uremic syndrome. To alleviate this burden, a sensitive and rapid system is required to detect this pathogen in various kinds of foods. Herein, we propose a phage-based pathogen detection method to replace laborious and time-consuming conventional methods. We engineered an E. coli O157:H7-specific phage phiV10 to rapidly and sensitively detect this notorious pathogen. The luxCDABE operon was introduced into the phiV10 genome and allowed the engineered phage phiV10lux to generate bioluminescence proportional to the number of viable E. coli O157:H7 cells without any substrate addition. The phage phiV10lux was able to detect at least 1CFU/ml of E. coli O157:H7 in a pure culture within 40min after 5h of pre-incubation. In artificially contaminated romaine lettuce, apple juice (pH3.51), and ground beef, the reporter phage could detect approximately 10CFU/cm 2 , 13CFU/ml, and 17CFU/g of E. coli O157:H7, respectively. Taken together, the constructed reporter phage phiV10lux could be applied as a powerful tool for rapid and sensitive detection of live E. coli O157:H7 in foods. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Rajeswaran Radhakrishnan
2017-12-01
Full Text Available Food pathogens contaminate food products that allow their growth on the shelf and also under refrigerated conditions. Therefore, it is of utmost importance to lower the limit of detection (LOD of the method used and to obtain the results within hours to few days. Biosensor methods exploit the available technologies to individuate and provide an approximate quantification of the bacteria present in a sample. The main bottleneck of these methods depends on the aspecific binding to the surfaces and on a change in sensitivity when bacteria are in a complex food matrix with respect to bacteria in a liquid food sample. In this review, we introduce surface plasmon resonance (SPR, new advancements in SPR techniques, and electrochemical impedance spectroscopy (EIS, as fluorescence-free biosensing technologies for detection of L. monocytogenes in foods. The application of the two methods has facilitated L. monocytogenes detection with LOD of 1 log CFU/mL. Further advancements are envisaged through the combination of biosensor methods with immunoseparation of bacteria from larger volumes, application of lab-on-chip technologies, and EIS sensing methods for multiplex pathogen detection. Validation efforts are being conducted to demonstrate the robustness of detection, reproducibility and variability in multi-site installations.
Directory of Open Access Journals (Sweden)
Erik Corona
Full Text Available Infectious disease has shaped the natural genetic diversity of humans throughout the world. A new approach to capture positive selection driven by pathogens would provide information regarding pathogen exposure in distinct human populations and the constantly evolving arms race between host and disease-causing agents. We created a human pathogen interaction database and used the integrated haplotype score (iHS to detect recent positive selection in genes that interact with proteins from 26 different pathogens. We used the Human Genome Diversity Panel to identify specific populations harboring pathogen-interacting genes that have undergone positive selection. We found that human genes that interact with 9 pathogen species show evidence of recent positive selection. These pathogens are Yersenia pestis, human immunodeficiency virus (HIV 1, Zaire ebolavirus, Francisella tularensis, dengue virus, human respiratory syncytial virus, measles virus, Rubella virus, and Bacillus anthracis. For HIV-1, GWAS demonstrate that some naturally selected variants in the host-pathogen protein interaction networks continue to have functional consequences for susceptibility to these pathogens. We show that selected human genes were enriched for HIV susceptibility variants (identified through GWAS, providing further support for the hypothesis that ancient humans were exposed to lentivirus pandemics. Human genes in the Italian, Miao, and Biaka Pygmy populations that interact with Y. pestis show significant signs of selection. These results reveal some of the genetic footprints created by pathogens in the human genome that may have left lasting marks on susceptibility to infectious disease.
Application of rapid microbiological screening methods for detection of irradiated frozen foods
International Nuclear Information System (INIS)
Hussain, A.A.; Rady, A.H.; ElBary, N.A.A.
2003-01-01
The exposure of food to ionizing radiation is being progressively used in many countries to, inactivate food pathogens, eradicate pests and extend shelf-life. To ensure free consumer choice, irradiated food. The direct epi fluorescent filter technique (DEFT) was applied as recent and rapid technique for determination of total bacterial count in irradiated minced chicken (2,4,6, and 8 kGy) as well as non-irradiated samples. Also aerobic plate count (APC) was used to determine the viable bacterial cells. A large significant differences between the profiteered DEFT and APC counts were obtained with the irradiated samples of each chicken and fish where the conventional plating gives a much lower values than the (DEFT) technique compared with non-irradiated samples. A highly correlation (r=0.99 and 1.00) were detected at 8 and 6 kGy with irradiated minced chicken and fish respectively. The Gram-negative bacteria belonging to (Enterobacteriaceae and fluorescence pseudomonas) showed very low count in the irradiated selected fish samples compared with control while the endotoxin selected fish samples compared with control while the endotoxin levels did not affect under the same conditions. Micro-gel electrophoresis indicated that gamma irradiation at 8 kGy can induce DNA damage in the cells of both minced chicken and fish where, some bands disappeared compared with the non-irradiated samples
Stokdyk, Joel P.; Firnstahl, Aaron; Spencer, Susan K.; Burch, Tucker R; Borchardt, Mark A.
2016-01-01
The limit of detection (LOD) for qPCR-based analyses is not consistently defined or determined in studies on waterborne pathogens. Moreover, the LODs reported often reflect the qPCR assay alone rather than the entire sample process. Our objective was to develop an approach to determine the 95% LOD (lowest concentration at which 95% of positive samples are detected) for the entire process of waterborne pathogen detection. We began by spiking the lowest concentration that was consistently positive at the qPCR step (based on its standard curve) into each procedural step working backwards (i.e., extraction, secondary concentration, primary concentration), which established a concentration that was detectable following losses of the pathogen from processing. Using the fraction of positive replicates (n = 10) at this concentration, we selected and analyzed a second, and then third, concentration. If the fraction of positive replicates equaled 1 or 0 for two concentrations, we selected another. We calculated the LOD using probit analysis. To demonstrate our approach we determined the 95% LOD for Salmonella enterica serovar Typhimurium, adenovirus 41, and vaccine-derived poliovirus Sabin 3, which were 11, 12, and 6 genomic copies (gc) per reaction (rxn), respectively (equivalent to 1.3, 1.5, and 4.0 gc L−1 assuming the 1500 L tap-water sample volume prescribed in EPA Method 1615). This approach limited the number of analyses required and was amenable to testing multiple genetic targets simultaneously (i.e., spiking a single sample with multiple microorganisms). An LOD determined this way can facilitate study design, guide the number of required technical replicates, aid method evaluation, and inform data interpretation.
Rapid Detection Technology for Pesticides Residues Based on Microelectrodes Impedance Immunosensor
Directory of Open Access Journals (Sweden)
Wen Ping Zhao
2014-09-01
Full Text Available Compared with conventional methods, electrochemical immunosensors have many advantages, such as low cost, high sensitivity, and rapid detection, and has certain prospects for realizing real-time-monitoring. In this paper, a design of portable pesticide residues detection instrument was presented based on an electrochemical impedance immunosensor. Firstly, we studied on an impedance immunosensor based on interdigitated array microelectrode (IDAM coupled with magnetic nanobeads-antibody conjugates (MNAC for the pesticide detection. Magnetic nanobeads (diameter 150 nm coated with anti-carbofuran antibodies were used for further amplification of the binding reaction between antibody and hapten (carbofuran. Secondly, in order to develop a portable pesticide residue apparatus, we designed the impedance detection electric circuit. Main work included designing and constructing of the system circuit, designing and debugging of the system software and so on. Thirdly, the apparatus was used for the standard pesticides solutions testing combined with immunosensor to test the reliability and stability. The pesticide added standard recovery was more than 70 % and the impedance test error was less than 5 %. The results showed that the proposed instrument had a good consistence compared with the traditional analytical methods. Thus, it would be a promising rapid detection instrument for pesticide residues in agricultural products.
RNA aptasensor for rapid detection of natively folded type A botulinum neurotoxin.
Janardhanan, Pavithra; Mello, Charlene M; Singh, Bal Ram; Lou, Jianlong; Marks, James D; Cai, Shuowei
2013-12-15
A surface plasmon resonance based RNA aptasensor for rapid detection of natively folded type A botulinum neurotoxin is reported. Using detoxified recombinant type A botulinum neurotoxin as the surrogate, the aptasensor detects active toxin within 90 min. The detection limit of the aptasensor in phosphate buffered saline, carrot juice, and fat free milk is 5.8 ng/ml, 20.3 ng/ml and 23.4 ng/ml, respectively, while that in 5-fold diluted human serum is 22.5 ng/ml. Recovery of toxin from disparate sample matrices are within 91-116%. Most significant is the ability of this aptasensor to effectively differentiate the natively folded toxin from denatured, inactive toxin, which is important for homeland security surveillance and threat assessment. The aptasensor is stable for more than 30 days and over 400 injections/regeneration cycles. Such an aptasensor holds great promise for rapid detection of active botulinum neurotoxin for field surveillance due to its robustness, stability and reusability. © 2013 Elsevier B.V. All rights reserved.
Miller, Melissa A.; Byrne, Barbara A.; Jang, Spencer S.; Dodd, Erin M.; Dorfmeier, Elene; Harris, Michael D.; Ames, Jack; Paradies, David; Worcester, Karen; Jessup, David A.; Miller, Woutrina A.
2009-01-01
Although protected for nearly a century, California’s sea otters have been slow to recover, in part due to exposure to fecally-associated protozoal pathogens like Toxoplasma gondii and Sarcocystis neurona. However, potential impacts from exposure to fecal bacteria have not been systematically explored. Using selective media, we examined feces from live and dead sea otters from California for specific enteric bacterial pathogens (Campylobacter, Salmonella, Clostridium perfringens, C. difficile and Escherichia coli O157:H7), and pathogens endemic to the marine environment (Vibrio cholerae, V. parahaemolyticus and Plesiomonas shigelloides). We evaluated statistical associations between detection of these pathogens in otter feces and demographic or environmental risk factors for otter exposure, and found that dead otters were more likely to test positive for C. perfringens, Campylobacter and V. parahaemolyticus than were live otters. Otters from more urbanized coastlines and areas with high freshwater runoff (near outflows of rivers or streams) were more likely to test positive for one or more of these bacterial pathogens. Other risk factors for bacterial detection in otters included male gender and fecal samples collected during the rainy season when surface runoff is maximal. Similar risk factors were reported in prior studies of pathogen exposure for California otters and their invertebrate prey, suggesting that land-sea transfer and/or facilitation of pathogen survival in degraded coastal marine habitat may be impacting sea otter recovery. Because otters and humans share many of the same foods, our findings may also have implications for human health. PMID:19720009
Wu, Shijia; Duan, Nuo; Shi, Zhao; Fang, Congcong; Wang, Zhouping
2014-03-18
A highly sensitive and specific multiplex method for the simultaneous detection of three pathogenic bacteria was fabricated using multicolor upconversion nanoparticles (UCNPs) as luminescence labels coupled with aptamers as the molecular recognition elements. Multicolor UCNPs were synthesized via doping with various rare-earth ions to obtain well-separated emission peaks. The aptamer sequences were selected using the systematic evolution of ligands by exponential enrichment (SELEX) strategy for Staphylococcus aureus, Vibrio parahemolyticus, and Salmonella typhimurium. When applied in this method, aptamers can be used for the specific recognition of the bacteria from complex mixtures, including those found in real food matrixes. Aptamers and multicolor UCNPs were employed to selectively capture and simultaneously quantify the three target bacteria on the basis of the independent peaks. Under optimal conditions, the correlation between the concentration of three bacteria and the luminescence signal was found to be linear from 50-10(6) cfu mL(-1). Improved by the magnetic separation and concentration effect of Fe3O4 magnetic nanoparticles, the limits of detection of the developed method were found to be 25, 10, and 15 cfu mL(-1) for S. aureus, V. parahemolyticus, and S. typhimurium, respectively. The capability of the bioassay in real food samples was also investigated, and the results were consistent with experimental results obtained from plate-counting methods. This proposed method for the detection of various pathogenic bacteria based on multicolor UCNPs has great potential in the application of food safety and multiplex nanosensors.
Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.
Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing
2018-02-01
The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.
High Throughput, Multiplexed Pathogen Detection Authenticates Plague Waves in Medieval Venice, Italy
Tran, Thi-Nguyen-Ny; Signoli, Michel; Fozzati, Luigi; Aboudharam, Gérard; Raoult, Didier; Drancourt, Michel
2011-01-01
Background Historical records suggest that multiple burial sites from the 14th–16th centuries in Venice, Italy, were used during the Black Death and subsequent plague epidemics. Methodology/Principal Findings High throughput, multiplexed real-time PCR detected DNA of seven highly transmissible pathogens in 173 dental pulp specimens collected from 46 graves. Bartonella quintana DNA was identified in five (2.9%) samples, including three from the 16th century and two from the 15th century, and Yersinia pestis DNA was detected in three (1.7%) samples, including two from the 14th century and one from the 16th century. Partial glpD gene sequencing indicated that the detected Y. pestis was the Orientalis biotype. Conclusions These data document for the first time successive plague epidemics in the medieval European city where quarantine was first instituted in the 14th century. PMID:21423736
Rapid Detection of Food Allergens by Microfluidics ELISA-Based Optical Sensor
Directory of Open Access Journals (Sweden)
Xuan Weng
2016-06-01
Full Text Available The risks associated with the presence of hidden allergens in food have increased the need for rapid, sensitive, and reliable methods for tracing food allergens in commodities. Conventional enzyme immunosorbent assay (ELISA has usually been performed in a centralized lab, requiring considerable time and sample/reagent consumption and expensive detection instruments. In this study, a microfluidic ELISA platform combined with a custom-designed optical sensor was developed for the quantitative analysis of the proteins wheat gluten and Ara h 1. The developed microfluidic ELISA biosensor reduced the total assay time from hours (up to 3.5 h to 15–20 min and decreased sample/reagent consumption to 5–10 μL, compared to a few hundred microliters in commercial ELISA kits, with superior sensitivity. The quantitative capability of the presented biosensor is a distinctive advantage over the commercially available rapid methods such as lateral flow devices (LFD and dipstick tests. The developed microfluidic biosensor demonstrates the potential for sensitive and less-expensive on-site determination for rapidly detecting food allergens in a complex sample system.
Detection of Antibodies to Seven Priority Pathogens in Backyard Poultry in Trinidad, West Indies
Directory of Open Access Journals (Sweden)
Arianne Brown Jordan
2018-01-01
Full Text Available Backyard poultry farms in Trinidad and Tobago (T&T play a vital role in providing food and income for rural communities. There is currently no information on the presence and circulation of pathogens in backyard poultry farms in T&T, and little is known in relation to the potential risks of spread of these pathogens to the commercial poultry sector. In order to address this, serum samples were collected from 41 chickens on five backyard farms taken from selected locations in Trinidad. Samples were tested for antibodies to seven priority pathogens of poultry by enzyme-linked immunosorbent assay (ELISA. Antibodies were detected in 65% (CI 95%: 50–78% of the sampled birds for Infectious bronchitis virus (IBV, 67.5% (CI 95%: 52–80% for Infectious bursal disease virus (IBDV, 10% (CI 95%: 4–23% for Newcastle disease virus (NDV, 0% (CI 95%: 0–0% for Avian influenza virus (AIV, 0% (CI 95%: 0–0% for West Nile virus (WNV, 31.7% (CI 95%: 20–47% for Mycoplasm gallisepticum/synoviae and 0% (CI 95%: 0–0% for Salmonella enterica serotype Enteritidis. These results reveal the presence and circulation of important pathogens of poultry in selected backyard farms in Trinidad. The results provide important information which should be taken into consideration when assessing the risks of pathogen transmission between commercial and backyard poultry farms, as well as between poultry and wild birds.
Rapid and real-time detection technologies for emerging viruses of ...
Indian Academy of Sciences (India)
2008-10-17
Oct 17, 2008 ... The development of technologies with rapid and sensitive detection capabilities and increased throughput have become crucial for responding to greater number threats posed by emerging and re-emerging viruses in the recent past. The conventional identification methods require time-consuming culturing ...
Schötta, Anna-Margarita; Wijnveld, Michiel; Stockinger, Hannes; Stanek, Gerold
2017-07-01
Ticks transmit a large number of pathogens capable of causing human disease. In this study, the PCR-reverse line blot (RLB) method was used to screen for pathogens in a total of 554 Ixodes ricinus ticks collected from all provinces of Austria. These pathogens belong to the genera Borrelia , Rickettsiae , Anaplasma / Ehrlichia (including " Candidatus Neoehrlichia"), Babesia , and Coxiella The pathogens with the highest detected prevalence were spirochetes of the Borrelia burgdorferi sensu lato complex, in 142 ticks (25.6%). Borrelia afzelii (80/142) was the most frequently detected species, followed by Borrelia burgdorferi sensu stricto (38/142) and Borrelia valaisiana (36/142). Borrelia garinii/Borrelia bavariensis , Borrelia lusitaniae , and Borrelia spielmanii were found in 28 ticks, 5 ticks, and 1 tick, respectively. Rickettsia spp. were detected in 93 ticks (16.8%): R. helvetica (39/93), R. raoultii (38/93), R. monacensis (2/93), and R. slovaca (1/93). Thirteen Rickettsia samples remain uncharacterized. " Candidatus Neoehrlichia mikurensis," Babesia spp. ( B. venatorum , B. divergens , B. microti ), and Anaplasma phagocytophilum were found in 4.5%, 2.7%, and 0.7%, respectively. Coxiella burnetii was not detected. Multiple microorganisms were detected in 40 ticks (7.2%), and the cooccurrence of Babesia spp. and " Candidatus Neoehrlichia mikurensis" showed a significant positive correlation. We also compared different PCR-RLBs for detection of Borrelia burgdorferi sensu lato and Rickettsia spp. and showed that different detection approaches provide highly diverse results, indicating that analysis of environmental samples remains challenging. IMPORTANCE This study determined the wide spectrum of tick-borne bacterial and protozoal pathogens that can be encountered in Austria. Surveillance of (putative) pathogenic microorganisms occurring in the environment is of medical importance, especially when those agents can be transmitted by ticks and cause disease. The
Villamizar-Rodríguez, Germán; Fernández, Javier; Marín, Laura; Muñiz, Juan; González, Isabel; Lombó, Felipe
2015-01-01
Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to ensure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for the simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (38 species, 27 genera), Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, 13 strains). Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for each pathogen type. The detection limits have been 1 Genome Equivalent (GE), with the exception of the Fam. Enterobacteriaceae (5 GEs). We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type), showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h), followed by a mPCR (2 h) and a capillary electrophoresis (30 min); avoiding the tedious and long lasting growing on solid media required in traditional analysis (1-4 days, depending on the specific pathogen and verification procedure). An external testing of this method was conducted in order to compare classical and mPCR methods. This evaluation was
Villamizar-Rodríguez, Germán; Fernández, Javier; Marín, Laura; Muñiz, Juan; González, Isabel; Lombó, Felipe
2015-01-01
Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to ensure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for the simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (38 species, 27 genera), Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, 13 strains). Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for each pathogen type. The detection limits have been 1 Genome Equivalent (GE), with the exception of the Fam. Enterobacteriaceae (5 GEs). We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type), showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h), followed by a mPCR (2 h) and a capillary electrophoresis (30 min); avoiding the tedious and long lasting growing on solid media required in traditional analysis (1–4 days, depending on the specific pathogen and verification procedure). An external testing of this method was conducted in order to compare classical and mPCR methods. This evaluation was
Rapid Change Detection Algorithm for Disaster Management
Michel, U.; Thunig, H.; Ehlers, M.; Reinartz, P.
2012-07-01
This paper focuses on change detection applications in areas where catastrophic events took place which resulted in rapid destruction especially of manmade objects. Standard methods for automated change detection prove not to be sufficient; therefore a new method was developed and tested. The presented method allows a fast detection and visualization of change in areas of crisis or catastrophes. While often new methods of remote sensing are developed without user oriented aspects, organizations and authorities are not able to use these methods because of absence of remote sensing know how. Therefore a semi-automated procedure was developed. Within a transferable framework, the developed algorithm can be implemented for a set of remote sensing data among different investigation areas. Several case studies are the base for the retrieved results. Within a coarse dividing into statistical parts and the segmentation in meaningful objects, the framework is able to deal with different types of change. By means of an elaborated Temporal Change Index (TCI) only panchromatic datasets are used to extract areas which are destroyed, areas which were not affected and in addition areas where rebuilding has already started.
Rapid and Sensitive Detection of BLAD in Cattle Population
Directory of Open Access Journals (Sweden)
Daniela Elena Ilie
2014-05-01
Full Text Available Bovine leukocyte adhesion deficiency (BLAD is an autosomal recessive disorder with negative impact on dairy cattle breeding. The molecular basis of BLAD is a single point mutation (A→G, resulting in a single amino acid substitution (aspartic acid → glycine at amino acid 128 in the adhesion molecule CD18. The object of this study was to establish a fast and sensitive molecular genotyping assay to detect BLAD carriers using high-resolution melting (HRM curve analysis. We tested animals with known genotypes for BLAD that were previously confirmed by PCR-RFLP method, and then examined the sensitivity of mutation detection using PCR followed by HRM curve analysis. BLAD carriers were readily detectable using HRM assay. Thus, the PCR-HRM genotyping method is a rapid, easily interpretable, reliable and cost-effective assay for BLAD mutant allele detection. This assay can be useful in cattle genotyping and genetic selection.
Fungal disease detection in plants: Traditional assays, novel diagnostic techniques and biosensors.
Ray, Monalisa; Ray, Asit; Dash, Swagatika; Mishra, Abtar; Achary, K Gopinath; Nayak, Sanghamitra; Singh, Shikha
2017-01-15
Fungal diseases in commercially important plants results in a significant reduction in both quality and yield, often leading to the loss of an entire plant. In order to minimize the losses, it is essential to detect and identify the pathogens at an early stage. Early detection and accurate identification of pathogens can control the spread of infection. The present article provides a comprehensive overview of conventional methods, current trends and advances in fungal pathogen detection with an emphasis on biosensors. Traditional techniques are the "gold standard" in fungal detection which relies on symptoms, culture-based, morphological observation and biochemical identifications. In recent times, with the advancement of biotechnology, molecular and immunological approaches have revolutionized fungal disease detection. But the drawback lies in the fact that these methods require specific and expensive equipments. Thus, there is an urgent need for rapid, reliable, sensitive, cost effective and easy to use diagnostic methods for fungal pathogen detection. Biosensors would become a promising and attractive alternative, but they still have to be subjected to some modifications, improvements and proper validation for on-field use. Copyright © 2016 Elsevier B.V. All rights reserved.
Detection of Pathogenic Biofilms with Bacterial Amyloid Targeting Fluorescent Probe, CDy11
DEFF Research Database (Denmark)
Kim, Jun Young; Sahu, Srikanta; Yau, Yin Hoe
2016-01-01
Bacterial biofilms are responsible for a wide range of persistent infections. In the clinic, diagnosis of biofilm-associated infections relies heavily on culturing methods, which fail to detect nonculturable bacteria. Identification of novel fluorescent probes for biofilm imaging will greatly...... facilitate diagnosis of pathogenic bacterial infection. Herein, we report a novel fluorescent probe, CDy11 (compound of designation yellow 11), which targets amyloid in the Pseudomonas aeruginosa biofilm matrix through a diversity oriented fluorescent library approach (DOFLA). CDy11 was further demonstrated...
Ye, Y W; Ling, N; Han, Y J; Wu, Q P
2014-11-01
Pathogenic Yersinia enterocolitica is involved in yersiniosis through expression of chromosome-borne or plasmid-borne virulence factors. Yersinia enterocolitica is a cold-tolerant pathogen frequently isolated from refrigerated or frozen foods. However, little attention has been focused on the prevalence of pathogenic Y. enterocolitica in refrigerated or frozen dairy samples in China. In this study, we developed a new duplex PCR targeting the plasmid-borne virF gene and chromosome-borne ail gene for detection of pathogenic Y. enterocolitica isolates. We established a detection limit for the duplex PCR of 6.5 × 10(2)cfu/mL in artificially contaminated dairy samples. In addition, the duplex PCR could detect directly 4.5 to 5.7 cfu of Y. enterocolitica in 5 mL of brain heart infusion broth after 6 h of enrichment at 28 °C. A newly developed dot hybridization assay further confirmed specificity of the duplex PCR for detection of virulent Y. enterocolitica. Furthermore, 13 Y. enterocolitica and 5 pathogenic strains, from 88 commercial frozen or refrigerated dairy products, were detected successfully by the China National Standard method (GB/T4789.8-2008) and the duplex PCR, respectively. Finally, biotypes and serotypes of pathogenic Y. enterocolitica strains were further characterized. The duplex PCR developed here is reliable for large-scale screening, routine monitoring, and risk assessment of pathogenic Y. enterocolitica in refrigerated or frozen dairy products. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Wang, Jianchang; Wang, Jinfeng; Li, Ruiwen; Liu, Libing; Yuan, Wanzhe
2017-08-15
Canine distemper, caused by Canine distemper virus (CDV), is a highly contagious and fatal systemic disease in free-living and captive carnivores worldwide. Recombinase polymerase amplification (RPA), as an isothermal gene amplification technique, has been explored for the molecular detection of diverse pathogens. A real-time reverse transcription RPA (RT-RPA) assay for the detection of canine distemper virus (CDV) using primers and exo probe targeting the CDV nucleocapsid protein gene was developed. A series of other viruses were tested by the RT-RPA.Thirty-two field samples were further tested by RT-RPA, and the resuts were compared with those obtained by the real-time RT-PCR. The RT-RPA assay was performed successfully at 40 °C, and the results were obtained within 3 min-12 min. The assay could detect CDV, but did not show cross-detection of canine parvovirus-2 (CPV-2), canine coronavirus (CCoV), canine parainfluenza virus (CPIV), pseudorabies virus (PRV) or Newcastle disease virus (NDV), demonstrating high specificity. The analytical sensitivity of RT-RPA was 31.8 copies in vitro transcribed CDV RNA, which is 10 times lower than the real-time RT-PCR. The assay performance was validated by testing 32 field samples and compared to real-time RT-PCR. The results indicated an excellent correlation between RT-RPA and a reference real-time RT-PCR method. Both assays provided the same results, and R 2 value of the positive results was 0.947. The results demonstrated that the RT-RPA assay offers an alternative tool for simple, rapid, and reliable detection of CDV both in the laboratory and point-of-care facility, especially in the resource-limited settings.
Bacterial food-borne pathogens in Indian food
International Nuclear Information System (INIS)
Bandekar, J.R.
2015-01-01
. 50 species, their prevalence in export quality sea-foods as well as in food sold in retail markets such as poultry, fish, sprouts and salads. The isolates from Indian foods were characterized for the presence of virulence genes, antibiotic resistance pattern as well as pulse field gel electrophoresis (PFGE) patterns. A rapid method for the detection of Salmonella species from foods was also developed. The radiation doses for the elimination of these pathogens from various foods were optimized. Details of detection method, characteristics of the pathogens isolated form Indian foods and radiation processing for the elimination of these pathogens will be discussed. (author)
As the incidence of human fungal infection increases, the ability to detect and identify pathogenic fungi in potential environmental reservoirs becomes increasingly important for disease control. PCR based assays are widely used for diagnostic purposes, but may be inadequate for...
Peng, Huan; Long, Haibo; Huang, Wenkun; Liu, Jing; Cui, Jiangkuan; Kong, Lingan; Hu, Xianqi; Gu, Jianfeng; Peng, Deliang
2017-04-03
The northern root-knot nematode (Meloidogyne hapla) is a damaging nematode that has caused serious economic losses worldwide. In the present study, a sensitive, simple and rapid method was developed for detection of M. hapla in infested plant roots by combining a Flinders Technology Associates (FTA) card with loop-mediated isothermal amplification (LAMP). The specific primers of LAMP were designed based on the distinction of internal transcribed spacer (ITS) sequences between M. hapla and other Meloidogyne spp. The LAMP assay can detect nematode genomic DNA at concentrations low to 1/200 000, which is 100 times more sensitive than conventional PCR. The LAMP was able to highly specifically distinguish M. hapla from other closely related nematode species. Furthermore, the advantages of the FTA-LAMP assay to detect M. hapla were demonstrated by assaying infected root galls that were artificially inoculated. In addition, M. hapla was successfully detected from six of forty-two field samples using FTA-LAMP technology. This study was the first to provide a simple diagnostic assay for M. hapla using the LAMP assay combined with FTA technology. In conclusion, the new FTA-LAMP assay has the potential for diagnosing infestation in the field and managing the pathogen M. hapla.
An integrated micro-chip for rapid detection of magnetic particles
Gooneratne, Chinthaka P.
2012-03-09
This paper proposes an integrated micro-chip for the manipulation and detection of magnetic particles (MPs). A conducting ring structure is used to manipulate MPs toward giant magnetoresistance(GMR) sensing elements for rapid detection. The GMRsensor is fabricated in a horseshoe shape in order to detect the majority of MPs that are trapped around the conducting structure. The GMR sensing elements are connected in a Wheatstone bridge circuit topology for optimum noise suppression. Full fabrication details of the micro-chip, characterization of the GMRsensors, and experimental results with MPs are presented in this paper. Experimental results showed that the micro-chip can detect MPs from low concentration samples after they were guided toward the GMRsensors by applying current to the conducting ring structure.
Novel Eurasian highly pathogenic avian influenza A H5 viruses in wild birds, Washington, USA, 2014.
Ip, Hon S; Torchetti, Mia Kim; Crespo, Rocio; Kohrs, Paul; DeBruyn, Paul; Mansfield, Kristin G; Baszler, Timothy; Badcoe, Lyndon; Bodenstein, Barbara; Shearn-Bochsler, Valerie; Killian, Mary Lea; Pedersen, Janice C; Hines, Nichole; Gidlewski, Thomas; DeLiberto, Thomas; Sleeman, Jonathan M
2015-05-01
Novel Eurasian lineage avian influenza A(H5N8) virus has spread rapidly and globally since January 2014. In December 2014, H5N8 and reassortant H5N2 viruses were detected in wild birds in Washington, USA, and subsequently in backyard birds. When they infect commercial poultry, these highly pathogenic viruses pose substantial trade issues.
Pankhurst, Louise; Macfarlane-Smith, Louissa; Buchanan, James; Anson, Luke; Davies, Kerrie; O'Connor, Lily; Ashwin, Helen; Pike, Graham; Dingle, Kate E; Peto, Timothy Ea; Wordsworth, Sarah; Walker, A Sarah; Wilcox, Mark H; Crook, Derrick W
2014-08-01
Every year approximately 5000-9000 patients are admitted to a hospital with diarrhoea, which in up to 90% of cases has a non-infectious cause. As a result, single rooms are 'blocked' by patients with non-infectious diarrhoea, while patients with infectious diarrhoea are still in open bays because of a lack of free side rooms. A rapid test for differentiating infectious from non-infectious diarrhoea could be very beneficial for patients. To evaluate MassCode multiplex polymerase chain reaction (PCR) for the simultaneous diagnosis of multiple enteropathogens directly from stool, in terms of sensitivity/specificity to detect four common important enteropathogens: Clostridium difficile, Campylobacter spp., Salmonella spp. and norovirus. A retrospective study of fixed numbers of samples positive for C. difficile (n = 200), Campylobacter spp. (n = 200), Salmonella spp. (n = 100) and norovirus (n = 200) plus samples negative for all these pathogens (n = 300). Samples were sourced from NHS microbiology laboratories in Oxford and Leeds where initial diagnostic testing was performed according to Public Health England methodology. Researchers carrying out MassCode assays were blind to this information. A questionnaire survey, examining current practice for infection control teams and microbiology laboratories managing infectious diarrhoea, was also carried out. MassCode assays were carried out at Oxford University Hospitals NHS Trust. Further multiplex assays, carried out using Luminex, were run on the same set of samples at Leeds Teaching Hospitals NHS Trust. The questionnaire was completed by various NHS trusts. Sensitivity and specificity to detect C. difficile, Campylobacter spp., Salmonella spp., and norovirus. Nucleic acids were extracted from 948 clinical samples using an optimised protocol (200 Campylobacter spp., 199 C. difficile, 60 S. enterica, 199 norovirus and 295 negative samples; some samples contained more than one pathogen). Using the Mass
The Genome Biology of Effector Gene Evolution in Filamentous Plant Pathogens.
Sánchez-Vallet, Andrea; Fouché, Simone; Fudal, Isabelle; Hartmann, Fanny E; Soyer, Jessica L; Tellier, Aurélien; Croll, Daniel
2018-05-16
Filamentous pathogens, including fungi and oomycetes, pose major threats to global food security. Crop pathogens cause damage by secreting effectors that manipulate the host to the pathogen's advantage. Genes encoding such effectors are among the most rapidly evolving genes in pathogen genomes. Here, we review how the major characteristics of the emergence, function, and regulation of effector genes are tightly linked to the genomic compartments where these genes are located in pathogen genomes. The presence of repetitive elements in these compartments is associated with elevated rates of point mutations and sequence rearrangements with a major impact on effector diversification. The expression of many effectors converges on an epigenetic control mediated by the presence of repetitive elements. Population genomics analyses showed that rapidly evolving pathogens show high rates of turnover at effector loci and display a mosaic in effector presence-absence polymorphism among strains. We conclude that effective pathogen containment strategies require a thorough understanding of the effector genome biology and the pathogen's potential for rapid adaptation. Expected final online publication date for the Annual Review of Phytopathology Volume 56 is August 25, 2018. Please see http://www.annualreviews.org/page/journal/pubdates for revised estimates.
[Rapid test for detection of susceptibility to cefotaxime in Enterobacteriaceae].
Jiménez-Guerra, Gemma; Hoyos-Mallecot, Yannik; Rodríguez-Granger, Javier; Navarro-Marí, José María; Gutiérrez-Fernández, José
In this work an "in house" rapid test based on the change in pH that is due to hydrolysis for detecting Enterobacteriaceae susceptible to cefotaxime is evaluated. The strains of Enterobacteriaceae from 1947 urine cultures were assessed using MicroScan panels and the "in house" test. This rapid test includes red phenol solution and cefotaxime. Using MicroScan panels, 499 Enterobacteriaceae isolates were evaluated, which included 27 isolates of Escherichia coli producing extended-spectrum beta-lactamases (ESBL), 16 isolates of Klebsiella pneumoniae ESBL and 1 isolate of Klebsiella oxytoca ESBL. The "in house" test offers the following values: sensitivity 98% and specificity 97%, with negative predictive value 100% and positive predictive value 78%. The "in house" test based on the change of pH is useful in our area for detecting presumptively cefotaxime-resistant Enterobacteriaceae strains. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
International Nuclear Information System (INIS)
Biagi, C.M.R. de
1992-01-01
Detection of bacteriocin production was studied under distinct conditions using strains of plant pathogenic bacteria from the genera Erwinia, Pseudomonas and Xanthomonas. 58.06%, 79.31% and 40.00% of producing strains were found respectively in the three groups of bacteria using the 523 medium which was the best for the detection of bacteriocin production. Increasing agar concentrations added to the medium up to 1,5% improved the detection. The amount of medium added to the Petri dishes did not affect bacteriocin production. The longest incubation time (72 h.) improved the detection of haloes production. Ultra-violet irradiation in low dosages seems to improve the visualization of haloes production but this is dependent on the tested strains. (author)
Detection of pathogenic micro-organisms on children's hands and toys during play.
Martínez-Bastidas, T; Castro-del Campo, N; Mena, K D; Castro-del Campo, N; León-Félix, J; Gerba, C P; Chaidez, C
2014-06-01
This study aimed to determine if the children's leisure activities impact the presence of pathogens on their hands and toys. To assess the microbiological hazard in playground areas, a pilot study that included 12 children was conducted. We then conducted an intervention study; children's hands and toys were washed before playing. Faecal coliforms, pathogenic bacteria and Giardia lamblia were quantified by membrane filtration, selective media and flotation techniques, respectively; rotavirus, hepatitis A and rhinovirus by RT-PCR. Pilot study results revealed faecal contamination on children's hands and toys after playing on sidewalks and in public parks. Pathogenic bacteria, hepatitis A and G. lamblia on children's hands were also found. In the intervention study, Staphylococcus aureus and Klebsiella pneumoniae were found on children's hands at concentrations up to 2·5 × 10(4) and 1 × 10(4) CFU hands(-1), respectively. E. coli and Kl. pneumoniae were detected on toys (2·4 × 10(3) and 2·7 × 10(4) CFU toy(-1), respectively). Salmonella spp, Serratia spp and G. lamblia cysts were also present on toys. Children's play activities influence microbial presence on hands and toys; the transfer seems to occur in both ways. Control strategy needs to be implemented to protect children from infectious diseases. © 2014 The Society for Applied Microbiology.
Hellmér, Maria; Paxéus, Nicklas; Magnius, Lars; Enache, Lucica; Arnholm, Birgitta; Johansson, Annette; Bergström, Tomas
2014-01-01
Most persons infected with enterically transmitted viruses shed large amounts of virus in feces for days or weeks, both before and after onset of symptoms. Therefore, viruses causing gastroenteritis may be detected in wastewater, even if only a few persons are infected. In this study, the presence of eight pathogenic viruses (norovirus, astrovirus, rotavirus, adenovirus, Aichi virus, parechovirus, hepatitis A virus [HAV], and hepatitis E virus) was investigated in sewage to explore whether their identification could be used as an early warning of outbreaks. Samples of the untreated sewage were collected in proportion to flow at Ryaverket, Gothenburg, Sweden. Daily samples collected during every second week between January and May 2013 were pooled and analyzed for detection of viruses by concentration through adsorption to milk proteins and PCR. The largest amount of noroviruses was detected in sewage 2 to 3 weeks before most patients were diagnosed with this infection in Gothenburg. The other viruses were detected at lower levels. HAV was detected between weeks 5 and 13, and partial sequencing of the structural VP1protein identified three different strains. Two strains were involved in an ongoing outbreak in Scandinavia and were also identified in samples from patients with acute hepatitis A in Gothenburg during spring of 2013. The third strain was unique and was not detected in any patient sample. The method used may thus be a tool to detect incipient outbreaks of these viruses and provide early warning before the causative pathogens have been recognized in health care. PMID:25172863
Chiu, Charles Y
2015-01-01
Viral pathogen discovery is of critical importance to clinical microbiology, infectious diseases, and public health. Genomic approaches for pathogen discovery, including consensus polymerase chain reaction (PCR), microarrays, and unbiased next-generation sequencing (NGS), have the capacity to comprehensively identify novel microbes present in clinical samples. Although numerous challenges remain to be addressed, including the bioinformatics analysis and interpretation of large datasets, these technologies have been successful in rapidly identifying emerging outbreak threats, screening vaccines and other biological products for microbial contamination, and discovering novel viruses associated with both acute and chronic illnesses. Downstream studies such as genome assembly, epidemiologic screening, and a culture system or animal model of infection are necessary to establish an association of a candidate pathogen with disease. PMID:23725672
Detection of HPV and co-infecting pathogens in healthy Italian women by multiplex real-time PCR.
Camporiondo, Maria Pia; Farchi, Francesca; Ciccozzi, Massimo; Denaro, Aurelia; Gallone, Domenica; Maracchioni, Fabio; Favalli, Cartesio; Ciotti, Marco
2016-01-01
Several pathogens can be transmitted sexually and are an important cause of morbidity among sexually active women. The aim of the study was to detect the presence of human papillomavirus (HPV), Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), Trichomonas vaginalis (TV), Mycoplasma hominis (MH), Mycoplasma genitalium (MG), Ureaplasma urealyticum (UU), and Ureaplasma parvum (UP) in a group of 309 healthy women enrolled at the San Camillo - Forlanini hospital of Rome by using two multiplex real-time PCR assays based on TOCE® technology. The women's ages ranged from 34 to 60 years, median 49 [IQR 45-54]. Of the 309 women tested, HPV DNA was detected in 77/309 (24.9%) patients. Of these, 44 (14.2%) harboured a single infection while 33 (10.7%) were infected by multiple genotypes. Prevalence of HPV infection was highest among females aged 40-50 years (15.2%). Of the other pathogens sought, CT, MG and NG were not detected while positive results were found for MH (12/309, 3.9%), TV (4/309, 1.3%), UP (89/309, 28.8%) and UU (14/309, 4.5%). Co-infections were as follows: 5 MH/HPV, 4 TV/HPV, 34 UP/HPV and 9 UU/HPV. In HPV-positive women, the probability of being infected by UP and UU was 2.5 (p=0.00045) and 6 fold higher (p=0.0016) than in HPV-negative women. The study supports the use of multiplex real-time PCR assays in a routine diagnostic setting. The high sensitivity and specificity of these assays along with the simultaneous detection of the most common sexually transmitted pathogens confers an advantage with respect to more obsolete methods reducing costs and time to diagnosis.
Application of a rapid screening method to detect irradiated meat in Brazil
International Nuclear Information System (INIS)
Villavicencio, A.L.C.H.; Delincee, H.
1998-01-01
Complete text of publication follows. Based on the enormous potential for food irradiation in Brazil, and to ensure free consumer choice, there is a need to find a convenient and rapid method for detection of irradiated food. Since treatment with ionizing radiation causes DNA fragmentation, the analysis of DNA damage might be promising. In fact, DNA fragmentation measured in single cells by agarose gel electrophoresis - DNA Comet Assay - has shown to offer great potential as a rapid tool to detect whether a wide variety of foodstuffs has been radiation processed. However, more work is needed to exploit the full potential of this promising technique. In this paper, the DNA Comet Assay was used to identify exotic meat (boar, jacare and capybara), irradiated with 60 Co gamma-rays. The applied radiation doses were 0, 1.5, 3.0 and 4.5 kGy. Analysis of the DNA migration enable a rapid identification of the radiation treatment
Directory of Open Access Journals (Sweden)
Ke Feng
Full Text Available Fresh-cut cantaloupe is particularly susceptible to contamination with pathogenic bacteria, such as Escherichia coli O157:H7, Listeria monocytogenes, and Staphylococcus aureus. Therefore, development of rapid, yet accurate detection techniques is necessary to ensure food safety. In this study, a multiplex PCR system and propidium monoazide (PMA concentration were optimized to detect all viable pathogens in a single tube. A dual filtration system utilized a filtration membrane with different pore sizes to enrich pathogens found on fresh-cut cantaloupe. The results revealed that an optimized multiplex PCR system has the ability to effectively detect three pathogens in the same tube. The viable pathogens were simultaneously detected for PMA concentrations above 10 μg/ml. The combination of a nylon membrane (15 μm and a micro pore filtration membrane (0.22 μm formed the dual filtration system used to enrich pathogens. The achieved sensitivity of PMA-mPCR based on this dual filtration system was 2.6 × 103 cfu/g for L. monocytogenes, 4.3 × 10 cfu/g for E. coli O157:H7, and 3.1 × 102 cfu/g for S. aureus. Fresh-cut cantaloupe was inoculated with the three target pathogens using concentrations of 103, 102, 10, and 1 cfu/g. After 6-h of enrichment culture, assay sensitivity increased to 1 cfu/g for each of these pathogens. Thus, this technique represents an efficient and rapid detection tool for implementation on fresh-cut cantaloupe.
Directory of Open Access Journals (Sweden)
Koziel Monika
2012-11-01
Full Text Available Abstract Campylobacter jejuni and coli are collectively regarded as the most prevalent cause of bacterial foodborne illness worldwide. An emerging species, Campylobacter ureolyticus has recently been detected in patients with gastroenteritis, however, the source of this organism has, until now, remained unclear. Herein, we describe the molecular-based detection of this pathogen in bovine faeces (1/20 and unpasteurized milk (6/47 but not in poultry (chicken wings and caeca. This is, to the best of our knowledge, the first report of the presence of this potential gastrointestinal pathogen in an animal source, possibly suggesting a route for its transmission to humans.
Lipid profiling of the soybean pathogen Phytophthora sojae using Fatty Acid Methyl Esters (FAMEs).
Yousef, Lina Fayez; Wojno, Michal; Dick, Warren A; Dick, Richard P
2012-05-01
Phytophthora sojae is a destructive soilborne pathogen of soybean, but currently there is no rapid or commercially available testing for its infestation level in soil. For growers, such information would greatly improve their ability to make management decisions to minimize disease damage to soybean crops. Fatty acid profiling of P. sojae holds potential for determining the prevalence of this pathogen in soil. In this study, the Fatty Acid Methyl Ester (FAME) profile of P. sojae was determined in pure culture, and the profile was subsequently evaluated for its potential use in detecting the pathogen in soil. The predominant fatty acids in the FAME profile of P. sojae are the unsaturated 18C fatty acids (18:1ω9 and 18:2ω6) followed by the saturated and unsaturated 16C fatty acids (16:0 and 16:1ω7). FAME analysis of P. sojae zoospores showed two additional long-chain saturated fatty acids (20:0 and 22:0) that were not detected in the mycelium of this organism. Addition of a known number of zoospores of P. sojae to soil demonstrated that fatty acids such as 18:1ω9, 18:2ω6, 20:1ω9, 20:4ω6, and 22:1ω9 could be detected and quantified against the background levels of fatty acids present in soil. These results show the potential for using selected FAMEs of P. sojae as a marker for detecting this pathogen in soybean fields. Copyright © 2012 British Mycological Society. Published by Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Pal, Monalisa; Lee, Sanghee; Kwon, Donghoon; Hwang, Jeongin; Lee, Hyeonjeong; Hwang, Seokyung; Jeon, Sangmin
2017-01-01
Zinc-doped magnetic nanoclusters (Zn-MNCs) were synthesized and used to detect pathogenic bacteria in milk. Hydrothermally synthesized Zn-MNCs exhibited stronger magnetic properties than pure MNCs, which facilitated the magnetic separation from the sample using a permanent magnet. The presence of accessible Zn sites allows the direct immobilization of half-fragmented antibodies over Zn-MNCs through strong Zn−S bonds and prevents the tedious multiple steps of molecular functionalization or coating with costly noble metals prior to conjugation with an antibody. After the capture and magnetic separation of Salmonella in milk using the antibody-functionalized Zn-MNCs, the concentration of bacteria was determined with a portable ATP luminometer and the detection limit was found to be 10 CFU/mL. - Highlights: • Zn-doped Fe_3O_4 nanoclusters (Zn-MNCs) were synthesized by hydrothermal method. • Antibodies were directly immobilized over Zn-MNCs through strong Zn–S_t_h_i_o_l bonds. • Higher magnetization of Zn-MNCs than pure MNCs facilitates the magnetic separation. • Detection limit of pathogenic bacteria in milk was found to be 10 cfu/mL. • Cost effective, sensitive and selective detection of bacteria.
Establishment and Application of a Visual DNA Microarray for the Detection of Food-borne Pathogens.
Li, Yongjin
2016-01-01
The accurate detection and identification of food-borne pathogenic microorganisms is critical for food safety nowadays. In the present work, a visual DNA microarray was established and applied to detect pathogens commonly found in food, including Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in food samples. Multiplex PCR (mPCR) was employed to simultaneously amplify specific gene fragments, fimY for Salmonella, ipaH for Shigella, iap for L. monocytogenes and ECs2841 for E. coli O157:H7, respectively. Biotinylated PCR amplicons annealed to the microarray probes were then reacted with a streptavidin-alkaline phosphatase conjugate and nitro blue tetrazolium/5-bromo-4-chloro-3'-indolylphosphate, p-toluidine salt (NBT/BCIP); the positive results were easily visualized as blue dots formatted on the microarray surface. The performance of a DNA microarray was tested against 14 representative collection strains and mock-contamination food samples. The combination of mPCR and a visual micro-plate chip specifically and sensitively detected Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in standard strains and food matrices with a sensitivity of ∼10(2) CFU/mL of bacterial culture. Thus, the developed method is advantageous because of its high throughput, cost-effectiveness and ease of use.
Hahn, Jungwoo; Kim, Eunghee; You, Young Sang; Gunasekaran, Sundaram; Lim, Seokwon; Choi, Young Jin
2017-10-01
On-site detection for sensitive identification of foodborne pathogens on fresh produce with minimal use of specialized instrumentation is crucial to the food industry. A switchable linker (SL)-based immunoassay was designed for ultrasensitive on-site detection of Salmonella in tomato samples. The assay is based on large-scale aggregation of gold nanoparticles (GNPs), induced by a quantitative relationship among the biotinylated Salmonella polyclonal antibody (b-Ab) used as the SL, the functionalized GNPs, and Salmonella. Important factors such as the concentration of SLs, time required for large-scale aggregation, and selectivity of b-Ab were optimized to minimize the detection time (within 45 min with gentle agitation) and achieve the lowest limit of detection (LOD; 10 CFU/g in tomato samples) possible. This SL-based immunoassay with its relatively low LOD and short detection time may meet the need for rapid, simple, on-site analysis of pathogens in fresh produce. The novel switchable linker-based immunoassay is a rapid, specific, and sensitive method that has potential applications for routine diagnostics of Salmonella in tomato products. These advantages make it a practical approach for general use in the processing industry to detect Salmonella rapidly and to implement appropriate regulatory procedures. Furthermore, it could be applied to other fresh products including cantaloupe, strawberry, and cucumbers. © 2017 Institute of Food Technologists®.
DEFF Research Database (Denmark)
Rosenstierne, Maiken W; McLoughlin, Kevin S; Olesen, Majken Lindholm
2014-01-01
Emerging viruses are usually endemic to tropical and sub-tropical regions of the world, but increased global travel, climate change and changes in lifestyle are believed to contribute to the spread of these viruses into new regions. Many of these viruses cause similar disease symptoms as other...... emerging viruses or common infections, making these unexpected pathogens difficult to diagnose. Broad-spectrum pathogen detection microarrays containing probes for all sequenced viruses and bacteria can provide rapid identification of viruses, guiding decisions about treatment and appropriate case...... of emerging viruses present in both non-clinical and clinical samples using two different microarray data analysis methods....
Molecular detection of tick-borne pathogens in cattle from Southwestern Ethiopia.
Directory of Open Access Journals (Sweden)
Zerihun Hailemariam
Full Text Available Tick-borne diseases (TBDs cause significant losses among livestock and impact the livelihoods of resource-poor farming communities worldwide. In Ethiopia, detailed studies on the epidemiology of tick-borne pathogens (TBPs in cattle using sensitive molecular detection methods are scarce. The objective of this study was to determine the prevalence and species composition of bovine TBPs of veterinary significance in local cattle populations. A comprehensive cross-sectional epidemiological study was conducted in cattle populations of Illubabor zone in Southwestern Ethiopia from June to August 2013. For this purpose, blood samples were collected from 392 cattle. A combination of polymerase chain reaction (PCR and a Reverse Line Blot (RLB hybridization assay was employed for the detection of TBPs in these samples. The PCR/RLB results of the 392 blood samples indicated a high overall prevalence of 96.9% for TBPs, including Theileria mutans (66.1%, Theileria orientalis (51.8%, Anaplasma sp. Omatjenne (25.5%, Anaplasma marginale (14.5%, Babesia bigemina (14.0% and Theileria velifera (13.0% and minor occurrences of Ehrlichia ruminantium (0.5% and Ehrlichia minasensis (0.26%. Moreover, three novel Anaplasma genotypes were detected in bovine blood samples. A phylogenetic analysis revealed that they most likely represent three, but at least two, new species. The prevalence of the three novel Anaplasma species, preliminary designated as Anaplasma sp. Hadesa, Anaplasma sp. Saso and Anaplasma sp. Dedessa, was 12.5%, 14.3% and 5.6%, respectively. Overall, a total of 227 cattle (57.9% were found to be co-infected with two or more TBPs simultaneously and 86 different species combinations were observed. The findings show a very high burden of infection of cattle with TBPs in Ethiopia. The high frequency of co-infections suggests that clinical manifestations might be complex. Further research is required to determine the pathogenicity, host cell types and vector of
Rapid antigen detection test for respiratory syncytial virus diagnosis as a diagnostic tool.
Mesquita, Flávio da Silva; Oliveira, Danielle Bruna Leal de; Crema, Daniela; Pinez, Célia Miranda Nunes; Colmanetti, Thaís Cristina; Thomazelli, Luciano Matsumia; Gilio, Alfredo Elias; Vieira, Sandra Elisabeth; Martinez, Marina Baquerizo; Botosso, Viviane Fongaro; Durigon, Edison Luiz
The aim of this study was to evaluate the QuickVue ® RSV Test Kit (QUIDEL Corp, CA, USA) as a screening tool for respiratory syncytial virus in children with acute respiratory disease in comparison with the indirect immunofluorescence assay as gold standard. In Brazil, rapid antigen detection tests for respiratory syncytial virus are not routinely utilized as a diagnostic tool, except for the diagnosis of dengue and influenza. The authors retrospectively analyzed 486 nasopharyngeal aspirate samples from children under age 5 with acute respiratory infection, between December 2013 and August 2014, the samples were analyzed by indirect immunofluorescence assay and QuickVue ® RSV Test kit. Samples with discordant results were analyzed by real time PCR and nucleotide sequencing. From 313 positive samples by immunofluorescence assays, 282 (90%) were also positive by the rapid antigen detection test, two were positive only by rapid antigen detection test, 33 were positive only by immunofluorescence assays, and 171 were positive by both methods. The 35 samples with discordant results were analyzed by real time PCR; the two samples positive only by rapid antigen detection test and the five positive only by immunofluorescence assays were also positive by real time PCR. There was no relation between the negativity by QuickVue ® RSV Test and viral load or specific strain. The QuickVue ® RSV Test showed sensitivity of 90%, specificity of 98.8%, predictive positive value of 99.3%, and negative predictive value of 94.6%, with accuracy of 93.2% and agreement κ index of 0.85 in comparison to immunofluorescence assay. This study demonstrated that the QuickVue ® RSV Test Kit can be effective in early detection of Respiratory syncytial virus in nasopharyngeal aspirate and is reliable for use as a diagnostic tool in pediatrics. Copyright © 2016 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.
Rapid antigen detection test for respiratory syncytial virus diagnosis as a diagnostic tool,
Directory of Open Access Journals (Sweden)
Flávio da Silva Mesquita
Full Text Available Abstract Objective: The aim of this study was to evaluate the QuickVue® RSV Test Kit (QUIDEL Corp, CA, USA as a screening tool for respiratory syncytial virus in children with acute respiratory disease in comparison with the indirect immunofluorescence assay as gold standard. In Brazil, rapid antigen detection tests for respiratory syncytial virus are not routinely utilized as a diagnostic tool, except for the diagnosis of dengue and influenza. Methods: The authors retrospectively analyzed 486 nasopharyngeal aspirate samples from children under age 5 with acute respiratory infection, between December 2013 and August 2014, the samples were analyzed by indirect immunofluorescence assay and QuickVue® RSV Test kit. Samples with discordant results were analyzed by real time PCR and nucleotide sequencing. Results: From 313 positive samples by immunofluorescence assays, 282 (90% were also positive by the rapid antigen detection test, two were positive only by rapid antigen detection test, 33 were positive only by immunofluorescence assays, and 171 were positive by both methods. The 35 samples with discordant results were analyzed by real time PCR; the two samples positive only by rapid antigen detection test and the five positive only by immunofluorescence assays were also positive by real time PCR. There was no relation between the negativity by QuickVue® RSV Test and viral load or specific strain. The QuickVue® RSV Test showed sensitivity of 90%, specificity of 98.8%, predictive positive value of 99.3%, and negative predictive value of 94.6%, with accuracy of 93.2% and agreement κ index of 0.85 in comparison to immunofluorescence assay. Conclusions: This study demonstrated that the QuickVue® RSV Test Kit can be effective in early detection of Respiratory syncytial virus in nasopharyngeal aspirate and is reliable for use as a diagnostic tool in pediatrics.
Directory of Open Access Journals (Sweden)
Maity Susmita
2012-11-01
Full Text Available Abstract Background HIV, HBV and HCV pose a major public health problem throughout the world. Detection of infection markers for these agents is a major challenge for testing laboratories in a resource poor setting. As blood transfusion is an important activity saving millions of live every year, it also carries a risk of transfusion transmissible infections caused by these fatal blood borne pathogens if the quality of testing is compromised. Conventional ELISA is regarded as the mostly used screening technique but due to limitations like high cost, unavailability in many blood banks and testing sites, involvement of costly instruments, time taking nature and requirement of highly skilled personnel for interpretation, rapid tests are gaining more importance and warrants comparison of performance. Results A comparative study between these two techniques has been performed using commercially available diagnostic kits to assess their efficacy for detection of HIV, HBV and HCV infections. Rapid kits were more efficient in specificity with synthetic antigens along with high PPV than ELISA in most cases. Comparison between different ELISA kits revealed that Microlisa HIV and Hepalisa (J. Mitra & Co. Pvt. Ltd.; ERBA LISA HIV1 + 2, ERBA LISA Hepatitis B and ERBA LISA HCV (Transasia Bio-medicals Ltd. gives uniform result with good performance in terms of sensitivity, specificity, PPV, NPV and efficiency, whereas, Microlisa HCV (J. Mitra & Co. Pvt. Ltd., Microscreen HBsAg ELISA and INNOVA HCV (Span Diagnostics Ltd. did not perform well. Rapid kits were also having high degree of sensitivity and specificity (100% except in HIV Comb and HCV Comb (J. Mitra & Co. Pvt. Ltd.. The kit efficiency didn’t vary significantly among different companies and lots in all the cases except for HCV ELISA showing statistically significant variation (p Conclusions ELISA is a good screening assay for markers of HIV, HBV and HCV infections. Rapid tests are useful for
DEFF Research Database (Denmark)
Fapyane, Deby
2018-01-01
to those conventional methods, are intensively studied. Biosensor technology is one of the strategies for rapid monitoring of pathogens such as bacteria, virus, and parasites in the environment. Among them, the electrochemical biosensor offers simple, rapid, cost-effective and possibility...... for ultrasensitive detection of bacterial cells, DNA and rRNA. Several key operational parameters were assessed such as the optimization of probe design and labeling molecules. Here, more specifically we used two novel labels for the development of the electrochemical biosensor for bacteria detection; cellulase...
Huver, J R; Koprivnikar, J; Johnson, P T J; Whyard, S
2015-06-01
Approaches based on organismal DNA found in the environment (eDNA) have become increasingly utilized for ecological studies and biodiversity inventories as an alternative to traditional field survey methods. Such DNA-based techniques have largely been used to establish the presence of free-living organisms, but have much potential for detecting and quantifying infectious agents in the environment, which is necessary to evaluate disease risk. We developed an eDNA method to examine the distribution and abundance of the trematode Ribeiroia ondatrae, a pathogenic parasite known to cause malformations in North American amphibians. In addition to comparing this eDNA approach to classical host necropsy, we examined the detectability of R. ondatrae in water samples subject to different degradation conditions (time and temperature). Our test exhibited high specificity and sensitivity to R. ondatrae, capable of detecting as little as 14 fg (femtograms) of this parasite's DNA (1/2500th of a single infectious stage) from field water samples. Compared to our results from amphibian host necropsy, quantitative PCR was -90% concordant with respect to R. ondatrae detection from 15 field sites and was also a significant predictor of host infection abundance. DNA was still detectable in lab samples after 21 days at 25°C, indicating that our method is robust to field conditions. By comparing the advantages and disadvantages of eDNA vs. traditional survey methods for determining pathogen presence and abundance in the field, we found that the lower cost and effort associated with eDNA approaches provide many advantages. The development of alternative tools is critical for disease ecology, as wildlife management and conservation efforts require reliable establishment and monitoring of pathogens.
Załuga, Joanna; Stragier, Pieter; Baeyen, Steve; Haegeman, Annelies; Van Vaerenbergh, Johan; Maes, Martine; De Vos, Paul
2014-01-01
Background The genus Clavibacter harbors economically important plant pathogens infecting agricultural crops such as potato and tomato. Although the vast majority of Clavibacter strains are pathogenic, there is an increasing number of non-pathogenic isolates reported. Non-pathogenic Clavibacter strains isolated from tomato seeds are particularly problematic because they affect the current detection and identification tests for Clavibacter michiganensis subsp. michiganensis (Cmm), which is reg...
Melanson, Vanessa R; Jochim, Ryan; Yarnell, Michael; Ferlez, Karen Bingham; Shashikumar, Soumya; Richardson, Jason H
2017-01-01
Vector-borne pathogen surveillance programmes typically rely on the collection of large numbers of potential vectors followed by screening protocols focused on detecting pathogens in the arthropods. These processes are laborious, time consuming, expensive, and require screening of large numbers of samples. To streamline the surveillance process, increase sample throughput, and improve cost-effectiveness, a method to detect dengue virus and malaria parasites (Plasmodium falciparum) by leveraging the sugar-feeding behaviour of mosquitoes and their habit of expectorating infectious agents in their saliva during feeding was investigated in this study. Dengue virus 2 (DENV-2) infected female Aedes aegypti mosquitoes and P. falciparum infected female Anopheles stephensi mosquitoes were allowed to feed on honey coated Flinders Technical Associates -FTA® cards dyed with blue food colouring. The feeding resulted in deposition of saliva containing either DENV-2 particles or P. falciparum sporozoites onto the FTA card. Nucleic acid was extracted from each card and the appropriate real-time PCR (qPCR) assay was run to detect the pathogen of interest. As little as one plaque forming unit (PFU) of DENV-2 and as few as 60 P. falciparum parasites deposited on FTA cards from infected mosquitoes were detected via qPCR. Hence, their use to collect mosquito saliva for pathogen detection is a relevant technique for vector surveillance. This study provides laboratory confirmation that FTA cards can be used to capture and stabilize expectorated DENV-2 particles and P. falciparum sporozoites from infectious, sugar-feeding mosquitoes in very low numbers. Thus, the FTA card-based mosquito saliva capture method offers promise to overcome current limitations and revolutionize traditional mosquito-based pathogen surveillance programmes. Field testing and further method development are required to optimize this strategy.
Advanced DNA-Based Point-of-Care Diagnostic Methods for Plant Diseases Detection
Directory of Open Access Journals (Sweden)
Han Yih Lau
2017-12-01
Full Text Available Diagnostic technologies for the detection of plant pathogens with point-of-care capability and high multiplexing ability are an essential tool in the fight to reduce the large agricultural production losses caused by plant diseases. The main desirable characteristics for such diagnostic assays are high specificity, sensitivity, reproducibility, quickness, cost efficiency and high-throughput multiplex detection capability. This article describes and discusses various DNA-based point-of care diagnostic methods for applications in plant disease detection. Polymerase chain reaction (PCR is the most common DNA amplification technology used for detecting various plant and animal pathogens. However, subsequent to PCR based assays, several types of nucleic acid amplification technologies have been developed to achieve higher sensitivity, rapid detection as well as suitable for field applications such as loop-mediated isothermal amplification, helicase-dependent amplification, rolling circle amplification, recombinase polymerase amplification, and molecular inversion probe. The principle behind these technologies has been thoroughly discussed in several review papers; herein we emphasize the application of these technologies to detect plant pathogens by outlining the advantages and disadvantages of each technology in detail.
Rapid single cell detection of Staphylococcus aureus by aptamer-conjugated gold nanoparticles
Chang, Yi-Chung; Yang, Chia-Ying; Sun, Ruei-Lin; Cheng, Yi-Feng; Kao, Wei-Chen; Yang, Pan-Chyr
2013-01-01
Staphylococcus aureus is one of the most important human pathogens, causing more than 500,000 infections in the United States each year. Traditional methods for bacterial culture and identification take several days, wasting precious time for patients who are suffering severe bacterial infections. Numerous nucleic acid-based detection methods have been introduced to address this deficiency; however, the costs and requirement for expensive equipment may limit the widespread use of such technol...
Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.
Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis
2018-03-01
Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.
The human enteric pathogens, hepatitis A virus and human norovirus, have been shown to contaminate molluscan shellfish and cause foodborne disease in consumers. Rapid viral extraction methods are needed to replace current time consuming methods, which use whole oysters or dissected tissues. In our ...
Pathogen identification using peptide nanotube biosensors and impedance AFM
Maccuspie, Robert I.
Pathogen identification at highly sensitive levels is crucial to meet urgent needs in fighting the spread of disease or detecting bioterrorism events. Toward that end, a new method for biosensing utilizing fluorescent antibody nanotubes is proposed. Fundamental studies on the self-assembly of these peptide nanotubes are performed, as are applications of aligning these nanotubes on surfaces. As biosensors, these nanotubes incorporate recognition units with antibodies at their ends and fluorescent signaling units at their sidewalls. When viral pathogens were mixed with these antibody nanotubes in solution, the nanotubes rapidly aggregated around the viruses. The size of the aggregates increased as the concentration of viruses increased, as detected by flow cytometry on the order of attomolar concentrations by changes in fluorescence and light scattering intensities. This enabled determination of the concentrations of viruses at trace levels (102 to 106 pfu/mL) within 30 minutes from the receipt of samples to the final quantitative data analysis, as demonstrated on Adenovirus, Herpes Simplex Virus, Influenza, and Vaccinia virus. As another separate approach, impedance AFM is used to study the electrical properties of individual viruses and nanoparticles used as model systems. The design, development, and implementation of the impedance AFM for an Asylum Research platform is described, as well as its application towards studying the impedance of individual nanoparticles as a model system for understanding the fundamental science of how the life cycle of a virus affects its electrical properties. In combination, these approaches fill a pressing need to quantify viruses both rapidly and sensitively.
Detection of gonococcal infection : pros and cons of a rapid test.
Vickerman, Peter; Peeling, Rosanna W; Watts, Charlotte; Mabey, David
2005-01-01
WHO estimates that 62 million cases of gonorrhea occur annually worldwide. Untreated infection can cause serious long-term complications, especially in women. In addition, Neisseria gonorrheae infection can facilitate HIV transmission, and babies born to infected mothers are at risk of ocular infection, which can lead to blindness. Where diagnostic facilities are lacking, gonorrhea can be treated syndromically. However, this inevitably leads to over-treatment, especially in women in whom the syndrome of vaginal discharge may be due not to N. gonorrheae infection but to several other more prevalent conditions. Over-treatment is a major concern because of widespread N. gonorrheae antibiotic resistance. Moreover, a high proportion of gonorrhea cases are asymptomatic and so do not present for syndromic management. Such cases will only be detected by screening tests. The gold standard test for the detection of N. gonorrheae is culture, which has high sensitivity and specificity. However, it requires well trained staff and its performance is affected by specimen transport conditions. Other options include microscopy and tests that detect gonococcal antigen or nucleic acid. Nucleic acid amplification tests (NAATs) have higher sensitivity and can be used on non-invasive samples (urine). However, they can cross-react with other Neisseria species and are expensive, requiring highly trained staff and sophisticated equipment. In settings where patients are asked to return for laboratory results, some infected patients never receive treatment as they fail to return for their test results. This reduction in treatment, and the possible onward transmission of N. gonorrheae during any delay in treatment, means that a rapid test of lower sensitivity may be more effective if it results in patients being treated at the initial visit. Indeed, even with the low sensitivity of currently available rapid tests (50-70%), modeling shows that they can outperform gold standard tests in
Kodani, Maja; Mixson-Hayden, Tonya; Drobeniuc, Jan; Kamili, Saleem
2014-10-01
Five viruses have been etiologically associated with viral hepatitis. Nucleic acid testing (NAT) remains the gold standard for diagnosis of viremic stages of infection. NAT methodologies have been developed for all hepatitis viruses; however, a NAT-based assay that can simultaneously detect all five viruses is not available. We designed TaqMan card-based assays for detection of HAV RNA, HBV DNA, HCV RNA, HDV RNA and HEV RNA. The performances of individual assays were evaluated on TaqMan Array Cards (TAC) for detecting five viral genomes simultaneously. Sensitivity and specificity were determined by testing 329 NAT-tested clinical specimens. All NAT-positive samples for HCV (n = 32), HDV (n = 28) and HEV (n = 14) were also found positive in TAC (sensitivity, 100%). Forty-three of 46 HAV-NAT positive samples were also positive in TAC (sensitivity, 94%), while 36 of 39 HBV-NAT positive samples were positive (sensitivity, 92%). No false-positives were detected for HBV (n = 32), HCV (n = 36), HDV (n = 30), and HEV (n = 31) NAT-negative samples (specificity 100%), while 38 of 41 HAV-NAT negative samples were negative by TAC (specificity 93%). TAC assay was concordant with corresponding individual NATs for hepatitis A-E viral genomes and can be used for their detection simultaneously. The TAC assay has potential for use in hepatitis surveillance, for screening of donor specimens and in outbreak situations. Wider availability of TAC-ready assays may allow for customized assays, for improving acute jaundice surveillance and for other purposes for which there is need to identify multiple pathogens rapidly. Published by Elsevier B.V.
Rapid visual and spectrophotometric nitrite detection by cyclometalated ruthenium complex.
Lo, Hoi-Shing; Lo, Ka-Wai; Yeung, Chi-Fung; Wong, Chun-Yuen
2017-10-16
Quantitative determination of nitrite ion (NO 2 - ) is of great importance in environmental and clinical investigations. A rapid visual and spectrophotometric assay for NO 2 - detection was developed based on a newly designed ruthenium complex, [Ru(npy)([9]aneS3)(CO)](ClO 4 ) (denoted as RuNPY; npy = 2-(1-naphthyl)pyridine, [9]aneS3 = 1,4,7-trithiacyclononane). This complex traps NO + produced in acidified NO 2 - solution, and yields observable color change within 1 min at room temperature. The assay features excellent dynamic range (1-840 μmol L -1 ) and high selectivity, and its limit of detection (0.39 μmol L -1 ) is also well below the guideline values for drinking water recommended by WHO and U.S. EPA. Practical use of this assay in tap water and human urine was successfully demonstrated. Overall, the rapidity and selectivity of this assay overcome the problems suffered by the commonly used modified Griess assays for nitrite determination. Copyright © 2017 Elsevier B.V. All rights reserved.
Detection of pathogenic Leptospira from selected environment in Kelantan and Terengganu, Malaysia.
Ridzlan, F R; Bahaman, A R; Khairani-Bejo, S; Mutalib, A R
2010-12-01
Leptospirosis is recognized as one of the important zoonotic diseases in the world including Malaysia. A total of 145 soil and water samples were collected from selected National Service Training Centres (NSTC) in Kelantan and Terengganu. The samples were inoculated into modified semisolid Ellinghausen McCullough Johnson Harris (EMJH) medium, incubated at room temperature for 1 month and examined under the dark-field microscope. Positive growth of the leptospiral isolates were then confirmed with 8-Azaguanine Test, Polymerase Chain Reaction (PCR) assay and Microscopic Agglutination Test (MAT). Fifteen cultures (10.34%) exhibited positive growths which were seen under dark field microscope whilst only 20% (3/15) were confirmed as pathogenic species. based on 8-Azaguanine Test and PCR. Serological identification of the isolates with MAT showed that hebdomadis was the dominant serovar in Terengganu. Pathogenic leptospires can be detected in Malaysian environment and this has the potential to cause an outbreak. Therefore, precautionary steps against leptospirosis should be taken by camp authorities to ensure the safety of trainees.
Molecular and serological detection of tick-borne pathogens in donkeys (Equus asinus) in Italy.
Veronesi, Fabrizia; Morganti, Giulia; Ravagnan, Silvia; Laus, Fulvio; Spaterna, Andrea; Diaferia, Manuela; Moretti, Annabella; Fioretti, Daniela Piergili; Capelli, Gioia
2014-10-10
Donkeys, owing to the frequent outdoor activity, are exposed to a high risk of infection with tick-borne pathogens. This work aimed to detect exposure to Theileria equi, Babesia caballi, Anaplasma phagocytophilum and Borrelia burgdorferi s.l. of donkeys reared in Central Italy. For this purpose 122 adult donkeys were selected within 11 herds and submitted to blood collection. IgG antibodies to T. equi, B. caballi, A. phagocytophilum and B. burgdorferi s.l. were detected by IFAT. Conventional PCRs targeting the genes MSP2 and the flagellin were used for the detection of A. phagocytophilum and B. burgdorferi s.l. respectively and a Real Time PCR Sybr Green was used to detect Babesia/Theileria spp…. The species identity was determined by amplicons sequencing. Forty eight (39.3%) and 58 (47.5%) animals tested positive for T. equi and B. caballi antibodies, respectively; nine animals (7.4%) were found positive for antibodies against A. phagocytophilum whereas negative results were obtained for B. burgdorferi s.l. Twenty-six (21.3%) animals showed antibodies for both T. equi and B. caballi. Twenty-three (18.8%) donkeys were positive to Babesia/Theileria spp. PCR assay. Out of 21 sequenced amplicons, 20 were identified as T. equi, belonging to three main groups designated A, B and D and one as B. caballi group A. Neither A. phagocytophilum nor B. burgdorferi PCR results were positive. The study showed a high exposure of donkeys to tick-borne pathogens and provides information on the genetic identity of the T. equi strains circulating in Central Italy. Copyright © 2014 Elsevier B.V. All rights reserved.
Wilkes, Rebecca Penrose; Kania, Stephen A; Tsai, Yun-Long; Lee, Pei-Yu Alison; Chang, Hsiu-Hui; Ma, Li-Juan; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas
2015-07-01
Feline immunodeficiency virus (FIV) is an important infectious agent of cats. Clinical syndromes resulting from FIV infection include immunodeficiency, opportunistic infections, and neoplasia. In our study, a 5' long terminal repeat/gag region-based reverse transcription insulated isothermal polymerase chain reaction (RT-iiPCR) was developed to amplify all known FIV strains to facilitate point-of-need FIV diagnosis. The RT-iiPCR method was applied in a point-of-need PCR detection platform--a field-deployable device capable of generating automatically interpreted RT-iiPCR results from nucleic acids within 1 hr. Limit of detection 95% of FIV RT-iiPCR was calculated to be 95 copies standard in vitro transcription RNA per reaction. Endpoint dilution studies with serial dilutions of an ATCC FIV type strain showed that the sensitivity of lyophilized FIV RT-iiPCR reagent was comparable to that of a reference nested PCR. The established reaction did not amplify any nontargeted feline pathogens, including Felid herpesvirus 1, feline coronavirus, Feline calicivirus, Feline leukemia virus, Mycoplasma haemofelis, and Chlamydophila felis. Based on analysis of 76 clinical samples (including blood and bone marrow) with the FIV RT-iiPCR, test sensitivity was 97.78% (44/45), specificity was 100.00% (31/31), and agreement was 98.65% (75/76), determined against a reference nested-PCR assay. A kappa value of 0.97 indicated excellent correlation between these 2 methods. The lyophilized FIV RT-iiPCR reagent, deployed on a user-friendly portable device, has potential utility for rapid and easy point-of-need detection of FIV in cats. © 2015 The Author(s).
A novel kit for rapid detection of Vibrio cholerae O1.
Hasan, J A; Huq, A; Tamplin, M L; Siebeling, R J; Colwell, R R
1994-01-01
We report on the development and testing of a novel, rapid, colorimetric immunodiagnostic kit, Cholera SMART, for direct detection of the presence of Vibrio cholerae O1 in clinical specimens. Unlike conventional culture methods requiring several days to complete, the Cholera SMART kit can be used directly in the field by untrained or minimally skilled personnel to detect V. cholerae O1 in less than 15 min, without cumbersome laboratory equipment. A total of 120 clinical and environmental bact...
Small acid soluble proteins for rapid spore identification.
Energy Technology Data Exchange (ETDEWEB)
Branda, Steven S.; Lane, Todd W.; VanderNoot, Victoria A.; Jokerst, Amanda S.
2006-12-01
This one year LDRD addressed the problem of rapid characterization of bacterial spores such as those from the genus Bacillus, the group that contains pathogenic spores such as B. anthracis. In this effort we addressed the feasibility of using a proteomics based approach to spore characterization using a subset of conserved spore proteins known as the small acid soluble proteins or SASPs. We proposed developing techniques that built on our previous expertise in microseparations to rapidly characterize or identify spores. An alternative SASP extraction method was developed that was amenable to both the subsequent fluorescent labeling required for laser-induced fluorescence detection and the low ionic strength requirements for isoelectric focusing. For the microseparations, both capillary isoelectric focusing and chip gel electrophoresis were employed. A variety of methods were evaluated to improve the molecular weight resolution for the SASPs, which are in a molecular weight range that is not well resolved by the current methods. Isoelectric focusing was optimized and employed to resolve the SASPs using UV absorbance detection. Proteomic signatures of native wild type Bacillus spores and clones genetically engineered to produce altered SASP patterns were assessed by slab gel electrophoresis, capillary isoelectric focusing with absorbance detection as well as microchip based gel electrophoresis employing sensitive laser-induced fluorescence detection.
Directory of Open Access Journals (Sweden)
Klein Cátia S
2009-12-01
Full Text Available Abstract Background Mycoplasma hyopneumoniae is a highly infectious swine pathogen and is the causative agent of enzootic pneumonia (EP. Following the previous report of a proteomic survey of the pathogenic 7448 strain of swine pathogen, Mycoplasma hyopneumoniae, we performed comparative protein profiling of three M. hyopneumoniae strains, namely the non-pathogenic J strain and the two pathogenic strains 7448 and 7422. Results In 2DE comparisons, we were able to identify differences in expression levels for 67 proteins, including the overexpression of some cytoadherence-related proteins only in the pathogenic strains. 2DE immunoblot analyses allowed the identification of differential proteolytic cleavage patterns of the P97 adhesin in the three strains. For more comprehensive protein profiling, an LC-MS/MS strategy was used. Overall, 35% of the M. hyopneumoniae genome coding capacity was covered. Partially overlapping profiles of identified proteins were observed in the strains with 81 proteins identified only in one strain and 54 proteins identified in two strains. Abundance analysis of proteins detected in more than one strain demonstrates the relative overexpression of 64 proteins, including the P97 adhesin in the pathogenic strains. Conclusions Our results indicate the physiological differences between the non-pathogenic strain, with its non-infective proliferate lifestyle, and the pathogenic strains, with its constitutive expression of adhesins, which would render the bacterium competent for adhesion and infection prior to host contact.
16S rRNA-based detection of oral pathogens in coronary atherosclerotic plaque
Directory of Open Access Journals (Sweden)
Mahendra Jaideep
2010-01-01
Full Text Available Background: Atherosclerosis develops as a response of the vessel wall to injury. Chronic bacterial infections have been associated with an increased risk for atherosclerosis and coronary artery disease. The ability of oral pathogens to colonize in coronary atheromatous plaque is well known. Aim: The aim of this study was to detect the presence of Treponema denticola, Porphyromonas gingivalis and Campylobacter rectus in the subgingival and atherosclerotic plaques of patients with coronary artery disease. Materials and Methods: Fifty-one patients in the age group of 40-80 years with coronary artery disease were selected for the study. DNA was extracted from the plaque samples. The specific primers for T. denticola, C. rectus and P. gingivalis were used to amplify a part of the 16S rRNA gene by polymerase chain reaction. Statistical Analysis Used: Chi-square analysis, correlation coefficient and prevalence percentage of the microorganisms were carried out for the analysis. Results: Of the 51 patients, T. denticola, C. rectus and P. gingivalis were detected in 49.01%, 21.51% and 45.10% of the atherosclerotic plaque samples. Conclusions: Our study revealed the presence of bacterial DNA of the oral pathogenic microorganisms in coronary atherosclerotic plaques. The presence of the bacterial DNA in the coronary atherosclerotic plaques in significant proportion may suggest the possible relationship between periodontal bacterial infection and genesis of coronary atherosclerosis.
Directory of Open Access Journals (Sweden)
Germán eVillamizar-Rodríguez
2015-11-01
Full Text Available Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to assure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (thirty eight species, twenty seven genera, Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, thirteen strains. Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for them. The detection limits have been 1 Genome Equivalent, with the exception of Fam. Enterobacteriaceae (5 GEs. We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type, showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h, followed by a mPCR (2 h and a capillary electrophoresis (30 min; avoiding the tedious and long lasting growing on solid media required in traditional analysis (1 to 4 days, depending on the specific pathogen and verification procedure. An external testing of this method was conducted in order to compare classical and mPCR methods. This
Molecular Diagnosis of Pathogenic Sporothrix Species.
Directory of Open Access Journals (Sweden)
Anderson Messias Rodrigues
2015-12-01
Full Text Available Sporotrichosis is a chronic (subcutaneous infection caused by thermodimorphic fungi in the order, Ophiostomatales. These fungi are characterized by major differences in routes of transmission, host predilections, species virulence, and susceptibilities to antifungals. Sporothrix species emerge in the form of outbreaks. Large zoonoses and sapronoses are ongoing in Brazil and China, respectively. Current diagnostic methods based on morphology and physiology are inaccurate due to closely related phenotypes with overlapping components between pathogenic and non-pathogenic Sporothrix. There is a critical need for new diagnostic tools that are specific, sensitive, and cost-effective.We developed a panel of novel markers, based on calmodulin (CAL gene sequences, for the large-scale diagnosis and epidemiology of clinically relevant members of the Sporothrix genus, and its relative, Ophiostoma. We identified specific PCR-based markers for S. brasiliensis, S. schenckii, S. globosa, S. mexicana, S. pallida, and O. stenoceras. We employed a murine model of disseminated sporotrichosis to optimize a PCR assay for detecting Sporothrix in clinical specimens.Primer-BLAST searches revealed candidate sequences that were conserved within a single species. Species-specific primers showed no significant homology with human, mouse, or microorganisms outside the Sporothrix genus. The detection limit was 10-100 fg of DNA in a single round of PCR for identifying S. brasiliensis, S. schenckii, S. globosa, S. mexicana, and S. pallida. A simple, direct PCR assay, with conidia as a source of DNA, was effective for rapid, low-cost genotyping. Samples from a murine model of disseminated sporotrichosis confirmed the feasibility of detecting S. brasiliensis and S. schenckii DNA in spleen, liver, lungs, heart, brain, kidney, tail, and feces of infected animals.This PCR-based method could successfully detect and identify a single species in samples from cultures and from clinical
Immunomagnetic nanoparticle based quantitative PCR for rapid detection of Salmonella
International Nuclear Information System (INIS)
Bakthavathsalam, Padmavathy; Rajendran, Vinoth Kumar; Saran, Uttara; Chatterjee, Suvro; Ali, Baquir Mohammed Jaffar
2013-01-01
We have developed a rapid and sensitive method for immunomagnetic separation (IMS) of Salmonella along with their real time detection via PCR. Silica-coated magnetic nanoparticles were functionalized with carboxy groups to which anti-Salmonella antibody raised against heat-inactivated whole cells of Salmonella were covalently attached. The immuno-captured target cells were detected in beverages like milk and lemon juice by multiplex PCR and real time PCR with a detection limit of 10 4 cfu.mL −1 and 10 3 cfu.mL −1 , respectively. We demonstrate that IMS can be used for selective concentration of target bacteria from beverages for subsequent use in PCR detection. PCR also enables differentiation of Salmonella typhi and Salmonella paratyphi A using a set of four specific primers. In addition, IMS—PCR can be used as a screening tool in the food and beverage industry for the detection of Salmonella within 3–4 h which compares favorably to the time of several days that is needed in case of conventional detection based on culture and biochemical methods. (author)
Rapid on-site detection of Acidovorax avenae subsp. citrulli by gold-labeled DNA strip sensor.
Zhao, Wenjun; Lu, Jie; Ma, Wenwei; Xu, Chuanlai; Kuang, Hua; Zhu, Shuifang
2011-06-15
Acidovorax avenae subsp. citrulli (AAC) is one of the most harmful diseases in cucurbit production. A rapid and sensitive DNA strip sensor was constructed based on gold nanoparticle-labeled oligonucleotide probes for the detection of AAC. Both the qualitative and semi-quantitative detections of target DNA were successfully achieved using the developed DNA strip sensor. The qualitative limit of detection (LOD) of the strip sensor was determined as 4 nM. The LOD for the semi-quantitative detection was calculated to be 0.48 nM in the range of 0-10 nM. The genomic DNA was detected directly using the DNA strip sensor without any further treatment. This DNA strip sensor is a potentially useful tool for rapid on-site DNA screening. Copyright © 2011 Elsevier B.V. All rights reserved.
Dileep, V; Kumar, H S; Kumar, Y; Nishibuchi, M; Karunasagar, Indrani; Karunasagar, Iddya
2003-01-01
To study the incidence of Vibrio parahaemolyticus in seafoods, water and sediment by molecular techniques vs conventional microbiological methods. Of 86 samples analysed, 28 recorded positive for V. parahaemolyticus by conventional microbiological method, while 53 were positive by the toxR-targeted PCR, performed directly on enrichment broth lysates. While one sample of molluscan shellfish was positive for tdh gene, trh gene was detected in three enrichment broths of molluscan shellfish. Direct application of PCR to enrichment broths will be useful for the rapid and sensitive detection of potentially pathogenic strains of V. parahemolyticus in seafoods. Vibrio parahaemolyticus is an important human pathogen responsible for food-borne gastroenteritis world-wide. As, both pathogenic and non-pathogenic strains of V. parahaemolyticus exist in the seafood, application of PCR specific for the virulence genes (tdh & trh) will help in detection of pathogenic strains of V. parahaemolyticus and consequently reduce the risk of food-borne illness.
Aptasensors for rapid detection of Escherichia coli O157:H7 and Salmonella typhimurium
Wu, Wen-he; Li, Min; Wang, Yue; Ouyang, Hou-xian; Wang, Lin; Li, Ci-xiu; Cao, Yu-chen; Meng, Qing-he; Lu, Jian-xin
2012-11-01
Herein we reported the development of aptamer-based biosensors (aptasensors) based on label-free aptamers and gold nanoparticles (AuNPs) for detection of Escherichia coli ( E. coli) O157:H7 and Salmonella typhimurium. Target bacteria binding aptamers are adsorbed on the surface of unmodified AuNPs to capture target bacteria, and the detection was accomplished by target bacteria-induced aggregation of the aptasensor which is associated as red-to-purple color change upon high-salt conditions. By employing anti- E. coli O157:H7 aptamer and anti- S. typhimurium aptamer, we developed a convenient and rapid approach that could selectively detect bacteria without specialized instrumentation and pretreatment steps such as cell lysis. The aptasensor could detect as low as 105colony-forming units (CFU)/ml target bacteria within 20 min or less and its specificity was 100%. This novel method has a great potential application in rapid detection of bacteria in the near future.
Bevins, S N; Dusek, R J; White, C L; Gidlewski, T; Bodenstein, B; Mansfield, K G; DeBruyn, P; Kraege, D; Rowan, E; Gillin, C; Thomas, B; Chandler, S; Baroch, J; Schmit, B; Grady, M J; Miller, R S; Drew, M L; Stopak, S; Zscheile, B; Bennett, J; Sengl, J; Brady, Caroline; Ip, H S; Spackman, E; Killian, M L; Torchetti, M K; Sleeman, J M; Deliberto, T J
2016-07-06
A novel highly pathogenic avian influenza virus belonging to the H5 clade 2.3.4.4 variant viruses was detected in North America in late 2014. Motivated by the identification of these viruses in domestic poultry in Canada, an intensive study was initiated to conduct highly pathogenic avian influenza surveillance in wild birds in the Pacific Flyway of the United States. A total of 4,729 hunter-harvested wild birds were sampled and highly pathogenic avian influenza virus was detected in 1.3% (n = 63). Three H5 clade 2.3.4.4 subtypes were isolated from wild birds, H5N2, H5N8, and H5N1, representing the wholly Eurasian lineage H5N8 and two novel reassortant viruses. Testing of 150 additional wild birds during avian morbidity and mortality investigations in Washington yielded 10 (6.7%) additional highly pathogenic avian influenza isolates (H5N8 = 3 and H5N2 = 7). The geographically widespread detection of these viruses in apparently healthy wild waterfowl suggest that the H5 clade 2.3.4.4 variant viruses may behave similarly in this taxonomic group whereby many waterfowl species are susceptible to infection but do not demonstrate obvious clinical disease. Despite these findings in wild waterfowl, mortality has been documented for some wild bird species and losses in US domestic poultry during the first half of 2015 were unprecedented.
Liu, Ye; Kannegulla, Akash; Wu, Bo; Cheng, Li-Jing
2018-05-15
Spherical fullerene (C 60 ) can quench the fluorescence of a quantum dot (QD) through energy transfer and charge transfer processes, with the quenching efficiency regulated by the number of proximate C 60 on each QD. With the quenching property and its small size compared with other nanoparticle-based quenchers, it is advantageous to group a QD reporter and multiple C 60 -labeled oligonucleotide probes to construct a molecular beacon (MB) probe for sensitive, robust nucleic acid detection. We demonstrated a rapid, high-sensitivity DNA detection method using the nanosensors composed of QD-C 60 based MBs carried by magnetic nanoparticles (MNPs). The assay was accelerated by first dispersing the nanosensors in analytes for highly efficient DNA capture resulting from short-distance 3-dimensional diffusion of targets to the sensor surface and then concentrating the nanosensors to a substrate by magnetic force to amplify the fluorescence signal for target quantification. The enhanced mass transport enabled a rapid detection (< 10 min) with a small sample volume (1-10 µl). The high signal-to-noise ratio produced by the QD-C 60 pairs and magnetic concentration yielded a detection limit of 100 fM (~106 target DNA copies for a 10 µl analyte). The rapid, sensitive, label-free detection method will benefit the applications in point-of-care molecular diagnostic technologies.
Zhang, Xiaoguang; Tsuji, Sachiko; Kitaoka, Hayato; Kobayashi, Hiroshi; Tamai, Mitsuru; Honjoh, Ken-Ichi; Miyamoto, Takahisa
2017-10-01
Detection of foodborne pathogens at very low levels is still a challenge. A custom-built multichannel surface plasmon resonance (SPR) biosensor and simultaneous enrichment broth (SEB) were used to develop a simultaneous detection method for 3 important foodborne pathogens, Escherichia coli O157:H7 (O157:H7), Salmonella enteritidis, and Listeria monocytogenes, at a very low level. These 3 foodborne pathogens at a very low level (14, 6, and 28 CFU/25 g (mL) for O157:H7, S. enteritidis, and L. monocytogenes, respectively) were inoculated in SEB and incubated at 37 ˚C for 24 h. Sample prepared from the simultaneous enrichment culture was analyzed using the multichannel SPR biosensor and sensor chip immobilized with polyclonal antibodies specific to each of the target pathogens. O157:H7, S. enteritidis, and L. monocytogenes in chicken were detected simultaneously at an inoculum dose of 14, 6, and 28 CFU/25 g, respectively. Our method using a custom-built multichannel SPR biosensor and enrichment in SEB is expected as a rapid and simultaneous detection method for low levels of O157:H7, S. enteritidis, and L. monocytogenes in food. Our method is expected as a rapid and simultaneous detection method for pathogens at very low levels. It has great potential for safety control of food and microbiological detection applications. © 2017 Institute of Food Technologists®.
Rundell, Mark S; Pingle, Maneesh; Das, Sanchita; Hussain, Aashiq; Ocheretina, Oksana; Charles, Macarthur; Larone, Davise H; Spitzer, Eric D; Golightly, Linnie; Barany, Francis
2014-06-01
Enteric pathogens that cause gastroenteritis remain a major global health concern. The goal of this study was to develop a multiplex PCR/ligation detection reaction (LDR) assay for the detection of all NIAID category B bacterial food and water-borne pathogens directly from stool specimens. To validate the PCR/LDR assay, clinical isolates of Campylobacter spp., Vibrio spp., Shigella spp., Salmonella spp., Listeria monocytogenes, Yersinia enterocolitica, and diarrheagenic Escherichia coli were tested. The sensitivity and specificity of the assay were assessed using a large number of seeded culture-negative stool specimens and a smaller set of clinical specimens from Haiti. The overall sensitivity ranged from 91% to 100% (median 100%) depending on the species. For the majority of organisms, the sensitivity was 100%. The overall specificity based on initial testing ranged from 98% to 100% depending on the species. After additional testing of discordant samples, the lowest specificity was 99.4%. PCR/LDR detected additional category B agents (particularly diarrheagenic E. coli) in 11/40 specimens from Haiti that were culture-positive for V. cholerae and in approximately 1% of routine culture-negative stool specimens from a hospital in New York. This study demonstrated the ability of the PCR/LDR assay to detect a large comprehensive panel of category B enteric bacterial pathogens as well as mixed infections. This type of assay has the potential to provide earlier warnings of possible public health threats and more accurate surveillance of food and water-borne pathogens. Copyright © 2014 Elsevier Inc. All rights reserved.
Trang, Vu Thi; Dinh, Ngo Xuan; Lan, Hoang; Tam, Le Thi; Huy, Tran Quang; Tuan, Pham Anh; Phan, Vu Ngoc; Le, Anh-Tuan
2018-02-01
Magnetic nanomaterials, as a promising platform for the fast and sensitive detection of bacterial pathogens, have attracted increasing interest from researchers in recent years. In this work, by utilizing a two-step synthetic technique consisting of co-precipitation and subsequent hydrothermal reaction, followed by functionalization steps with (3-aminopropyl)triethoxysilane (APTES) and the antibody against Salmonella enteritidis, antibody-conjugated Fe3O4-Ag@APTES hetero-nanocomposites were successfully prepared. Due to the specific antibody, the developed Fe3O4-Ag@APTES@SE-Ab conjugates are capable of selectively capturing S. enteritidis at a low concentration of about 101 CFU/mL. Moreover, the prepared magnetic conjugates also revealed that the S. enteritidis could be rapidly removed from water solution in 20 min by using an external magnetic field with a removal efficiency obtained of ˜ 91.36%. These results indicated that the Fe3O4-Ag@APTES@SE-Ab conjugates are promising for the rapid selective capture and removal of bacterial pathogens from aqueous environments, and can be used for improving the detection quality of pathogens in water samples using immunosensor-based diagnostic tests.
Early Detection Rapid Response Program Targets New Noxious Weed Species in Washington State
Andreas, Jennifer E.; Halpern, Alison D.; DesCamp, Wendy C.; Miller, Timothy W.
2015-01-01
Early detection, rapid response is a critical component of invasive plant management. It can be challenging, however, to detect new invaders before they become established if landowners cannot identify species of concern. In order to increase awareness, eye-catching postcards were developed in Washington State as part of a noxious weed educational…
Screen-printed fluorescent sensors for rapid and sensitive anthrax biomarker detection
International Nuclear Information System (INIS)
Lee, Inkyu; Oh, Wan-Kyu; Jang, Jyongsik
2013-01-01
Highlights: •We fabricated flexible anthrax sensors with a simple screen-printing method. •The sensors selectively detected B. anthracis biomarker. •The sensors provide the visible alarm against anthrax attack. -- Abstract: Since the 2001 anthrax attacks, efforts have focused on the development of an anthrax detector with rapid response and high selectivity and sensitivity. Here, we demonstrate a fluorescence sensor for detecting anthrax biomarker with high sensitivity and selectivity using a screen-printing method. A lanthanide–ethylenediamine tetraacetic acid complex was printed on a flexible polyethersulfone film. Screen-printing deposition of fluorescent detecting moieties produced fluorescent patterns that acted as a visual alarm against anthrax
Future research needs involving pathogens in groundwater
Bradford, Scott A.; Harvey, Ronald W.
2017-01-01
Contamination of groundwater by enteric pathogens has commonly been associated with disease outbreaks. Proper management and treatment of pathogen sources are important prerequisites for preventing groundwater contamination. However, non-point sources of pathogen contamination are frequently difficult to identify, and existing approaches for pathogen detection are costly and only provide semi-quantitative information. Microbial indicators that are readily quantified often do not correlate with the presence of pathogens. Pathogens of emerging concern and increasing detections of antibiotic resistance among bacterial pathogens in groundwater are topics of growing concern. Adequate removal of pathogens during soil passage is therefore critical for safe groundwater extraction. Processes that enhance pathogen transport (e.g., high velocity zones and preferential flow) and diminish pathogen removal (e.g., reversible retention and enhanced survival) are of special concern because they increase the risk of groundwater contamination, but are still incompletely understood. Improved theory and modeling tools are needed to analyze experimental data, test hypotheses, understand coupled processes and controlling mechanisms, predict spatial and/or temporal variability in model parameters and uncertainty in pathogen concentrations, assess risk, and develop mitigation and best management approaches to protect groundwater.
Future research needs involving pathogens in groundwater
Bradford, Scott A.; Harvey, Ronald W.
2017-06-01
Contamination of groundwater by enteric pathogens has commonly been associated with disease outbreaks. Proper management and treatment of pathogen sources are important prerequisites for preventing groundwater contamination. However, non-point sources of pathogen contamination are frequently difficult to identify, and existing approaches for pathogen detection are costly and only provide semi-quantitative information. Microbial indicators that are readily quantified often do not correlate with the presence of pathogens. Pathogens of emerging concern and increasing detections of antibiotic resistance among bacterial pathogens in groundwater are topics of growing concern. Adequate removal of pathogens during soil passage is therefore critical for safe groundwater extraction. Processes that enhance pathogen transport (e.g., high velocity zones and preferential flow) and diminish pathogen removal (e.g., reversible retention and enhanced survival) are of special concern because they increase the risk of groundwater contamination, but are still incompletely understood. Improved theory and modeling tools are needed to analyze experimental data, test hypotheses, understand coupled processes and controlling mechanisms, predict spatial and/or temporal variability in model parameters and uncertainty in pathogen concentrations, assess risk, and develop mitigation and best management approaches to protect groundwater.
Załuga, Joanna; Stragier, Pieter; Baeyen, Steve; Haegeman, Annelies; Van Vaerenbergh, Johan; Maes, Martine; De Vos, Paul
2014-05-22
The genus Clavibacter harbors economically important plant pathogens infecting agricultural crops such as potato and tomato. Although the vast majority of Clavibacter strains are pathogenic, there is an increasing number of non-pathogenic isolates reported. Non-pathogenic Clavibacter strains isolated from tomato seeds are particularly problematic because they affect the current detection and identification tests for Clavibacter michiganensis subsp. michiganensis (Cmm), which is regulated with a zero tolerance in tomato seed. Their misidentification as pathogenic Cmm hampers a clear judgment on the seed quality and health. To get more insight in the genetic features linked to the lifestyle of these bacteria, a whole-genome sequence of the tomato seed-borne non-pathogenic Clavibacter LMG 26808 was determined. To gain a better understanding of the molecular determinants of pathogenicity, the genome sequence of LMG 26808 was compared with that of the pathogenic Cmm strain (NCPPB 382). The comparative analysis revealed that LMG 26808 does not contain plasmids pCM1 and pCM2 and also lacks the majority of important virulence factors described so far for pathogenic Cmm. This explains its apparent non-pathogenic nature in tomato plants. Moreover, the genome analysis of LMG 26808 detected sequences from a plasmid originating from a member of Enterobacteriaceae/Klebsiella relative. Genes received that way and coding for antibiotic resistance may provide a competitive advantage for survival of LMG 26808 in its ecological niche. Genetically, LMG 26808 was the most similar to the pathogenic Cmm NCPPB 382 but contained more mobile genetic elements. The genome of this non-pathogenic Clavibacter strain contained also a high number of transporters and regulatory genes. The genome sequence of the non-pathogenic Clavibacter strain LMG 26808 and the comparative analyses with other pathogenic Clavibacter strains provided a better understanding of the genetic bases of virulence and
Kosakovsky Pond, Sergei L; Weaver, Steven; Leigh Brown, Andrew J; Wertheim, Joel O
2018-01-31
In modern applications of molecular epidemiology, genetic sequence data are routinely used to identify clusters of transmission in rapidly evolving pathogens, most notably HIV-1. Traditional 'shoeleather' epidemiology infers transmission clusters by tracing chains of partners sharing epidemiological connections (e.g., sexual contact). Here, we present a computational tool for identifying a molecular transmission analog of such clusters: HIV-TRACE (TRAnsmission Cluster Engine). HIV-TRACE implements an approach inspired by traditional epidemiology, by identifying chains of partners whose viral genetic relatedness imply direct or indirect epidemiological connections. Molecular transmission clusters are constructed using codon-aware pairwise alignment to a reference sequence followed by pairwise genetic distance estimation among all sequences. This approach is computationally tractable and is capable of identifying HIV-1 transmission clusters in large surveillance databases comprising tens or hundreds of thousands of sequences in near real time, i.e., on the order of minutes to hours. HIV-TRACE is available at www.hivtrace.org and from github.com/veg/hivtrace, along with the accompanying result visualization module from github.com/veg/hivtrace-viz. Importantly, the approach underlying HIV-TRACE is not limited to the study of HIV-1 and can be applied to study outbreaks and epidemics of other rapidly evolving pathogens. © The Author 2018. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Wootton, Susan H; Aguilera, Elizabeth; Salazar, Lucrecia; Hemmert, Andrew C; Hasbun, Rodrigo
2016-04-21
Meningitis with a negative cerebrospinal (CSF) Gram stain represents a diagnostic and therapeutic challenge. The purpose of our study was to evaluate the performance of the BioFire FilmArray(®) Meningitis/Encephalitis (FA ME) panel in patients presenting with community-acquired meningitis with a negative Gram stain. CSF from 48 patients with community-acquired meningitis with a negative Gram stain admitted to four hospitals in Houston, TX underwent additional testing by the FA ME. FA ME results were compared to results obtained as part of routine evaluation. The panel detected pathogens not previously identified in 11 (22.9 %) of 48, but did not detect pathogens identified by standard technique (West Nile virus, Histoplasma) in 5 (15.2 %) patients. Rapid testing for the most common pathogens causing meningitis will aid in the diagnosis and treatment of patients with meningitis.
BOERSMA, WG; LOWENBERG, A; HOLLOWAY, Y; KUTTSCHRUTTER, H; SNIJDER, JAM; KOETER, GH
Background Detection of pneumococcal antigen may help to increase the rate of diagnosis of pneumococcal pneumonia. This study was designed to determine the value of rapid detection of pneumococcal antigen in pleural fluid from patients with community acquired pneumonia. Methods Thoracentesis was
Hasan, Mohammad R.; Rawat, Arun; Tang, Patrick; Jithesh, Puthen V.; Thomas, Eva; Tan, Rusung; Tilley, Peter
2016-01-01
Next-generation sequencing (NGS) technology has shown promise for the detection of human pathogens from clinical samples. However, one of the major obstacles to the use of NGS in diagnostic microbiology is the low ratio of pathogen DNA to human DNA in most clinical specimens. In this study, we aimed to develop a specimen-processing protocol to remove human DNA and enrich specimens for bacterial and viral DNA for shotgun metagenomic sequencing. Cerebrospinal fluid (CSF) and nasopharyngeal aspi...
Directory of Open Access Journals (Sweden)
Agnes Marie Sá Figueiredo
2014-06-01
Full Text Available Methicillin-resistant Staphylococcus aureus (MRSA is one of the most important bacterial pathogens based on its incidence and the severity of its associated infections. In addition, severe MRSA infections can occur in hospitalised patients or healthy individuals from the community. Studies have shown the infiltration of MRSA isolates of community origin into hospitals and variants of hospital-associated MRSA have caused infections in the community. These rapid epidemiological changes represent a challenge for the molecular characterisation of such bacteria as a hospital or community-acquired pathogen. To efficiently control the spread of MRSA, it is important to promptly detect the mecA gene, which is the determinant of methicillin resistance, using a polymerase chain reaction-based test or other rapidly and accurate methods that detect the mecA product penicillin-binding protein (PBP2a or PBP2’. The recent emergence of MRSA isolates that harbour a mecA allotype, i.e., the mecC gene, infecting animals and humans has raised an additional and significant issue regarding MRSA laboratory detection. Antimicrobial drugs for MRSA therapy are becoming depleted and vancomycin is still the main choice in many cases. In this review, we present an overview of MRSA infections in community and healthcare settings with focus on recent changes in the global epidemiology, with special reference to the MRSA picture in Brazil.
Figueiredo, Agnes Marie Sá; Ferreira, Fabienne Antunes
2014-01-01
Methicillin-resistant Staphylococcus aureus (MRSA) is one of the most important bacterial pathogens based on its incidence and the severity of its associated infections. In addition, severe MRSA infections can occur in hospitalised patients or healthy individuals from the community. Studies have shown the infiltration of MRSA isolates of community origin into hospitals and variants of hospital-associated MRSA have caused infections in the community. These rapid epidemiological changes represent a challenge for the molecular characterisation of such bacteria as a hospital or community-acquired pathogen. To efficiently control the spread of MRSA, it is important to promptly detect the mecA gene, which is the determinant of methicillin resistance, using a polymerase chain reaction-based test or other rapidly and accurate methods that detect the mecA product penicillin-binding protein (PBP)2a or PBP2’. The recent emergence of MRSA isolates that harbour a mecA allotype, i.e., the mecC gene, infecting animals and humans has raised an additional and significant issue regarding MRSA laboratory detection. Antimicrobial drugs for MRSA therapy are becoming depleted and vancomycin is still the main choice in many cases. In this review, we present an overview of MRSA infections in community and healthcare settings with focus on recent changes in the global epidemiology, with special reference to the MRSA picture in Brazil. PMID:24789555
Energy Technology Data Exchange (ETDEWEB)
Kingsley, Mark T.
2001-03-13
The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, and analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: 1) to assess the potential terrorist threat to U.S. agricultural crops, 2) to determine whether suitable assays exist to monitor that threat, and 3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.
Morgenstern, Christian; Cabric, Sabrina; Perka, Carsten; Trampuz, Andrej; Renz, Nora
2018-02-01
Analysis of joint aspirate is the standard preoperative investigation for diagnosis of periprosthetic joint infection (PJI). We compared the diagnostic performance of culture and multiplex polymerase chain reaction (PCR) of synovial fluid for diagnosis of PJI. Patients in whom aspiration of the prosthetic hip or knee joint was performed before revision arthroplasty were prospectively included. The performance of synovial fluid culture and multiplex PCR was compared by McNemar's chi-squared test. A total of 142 patients were included, 82 with knee and 60 with hip prosthesis. PJI was diagnosed in 77 patients (54%) and aseptic failure in 65 patients (46%). The sensitivity of synovial fluid culture and PCR was 52% and 60%, respectively, showing concordant results in 116 patients (82%). In patients with PJI, PCR missed 6 high-virulent pathogens (S. aureus, streptococci, E. faecalis, E. coli) which grew in synovial fluid culture, whereas synovial fluid culture missed 12 pathogens detected by multiplex PCR, predominantly low-virulent pathogens (Cutibacterium acnes and coagulase-negative staphylococci). In patients with aseptic failure, PCR detected 6 low-virulent organisms (predominantly C. acnes). While the overall performance of synovial fluid PCR was comparable to culture, PCR was superior for detection of low-virulent bacteria such as Cutibacterium spp. and coagulase-negative staphylococci. In addition, synovial fluid culture required several days for growth, whereas multiplex PCR provided results within 5hours in an automated manner. Copyright © 2017 Elsevier Inc. All rights reserved.
Matta, Leann Lerie; Karuppuswami, Saranraj; Chahal, Premjeet; Alocilja, Evangelyn C
2018-07-15
Rapid detection techniques of pathogenic bacteria in the liquid food supply chain are of significant research interest due to their pivotal role in preventing foodborne outbreaks, and in maintaining high standards of public health and safety. Milk and dairy products are of particular interest due to their widespread consumption across the globe. In this paper, a biosensor for detecting pathogenic bacteria in milk using dextrin-capped gold nanoparticles (d-AuNP) as labels decoded at microwave frequencies is presented. The SPEL (sensing pathogens electrically in liquids) biosensor consists of a 3D printed vial and uses an RF reader and an RFID (radio-frequency identification) compatible Split Ring Resonator (SRR) based tag. The SPEL biosensor is capable of detecting bacteria at 5 log CFU/mL within 75 min, with the possibility of testing multiple concurrent samples. Detection is based on impedance loading of SRR by d-AuNP bound to pathogenic bacteria. Spectrophotometry, along with carbohydrate-functionalized magnetic nanoparticle (MNP) cell capture, is used to verify the sensitivity of the SPEL biosensor with respect to d-AuNP presence. The proof-of-concept device, along with challenges and opportunities for commercialization, are also outlined. Copyright © 2018. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Reiko Sawada
2017-06-01
Full Text Available Rapid detection of food is crucial for the survival of organisms. However, previous visual search studies have reported discrepant results regarding the detection speeds for food vs. non-food items; some experiments showed faster detection of food than non-food, whereas others reported null findings concerning any speed advantage for the detection of food vs. non-food. Moreover, although some previous studies showed that fat content can affect visual attention for food, the effect of fat content on the detection of food remains unclear. To investigate these issues, we measured reaction times (RTs during a visual search task in which participants with normal weight detected high-fat food (i.e., fast food, low-fat food (i.e., Japanese diet, and non-food (i.e., kitchen utensils targets within crowds of non-food distractors (i.e., cars. Results showed that RTs for food targets were shorter than those for non-food targets. Moreover, the RTs for high-fat food were shorter than those for low-fat food. These results suggest that food is more rapidly detected than non-food within the environment and that a higher fat content in food facilitates rapid detection.
Sawada, Reiko; Sato, Wataru; Toichi, Motomi; Fushiki, Tohru
2017-01-01
Rapid detection of food is crucial for the survival of organisms. However, previous visual search studies have reported discrepant results regarding the detection speeds for food vs. non-food items; some experiments showed faster detection of food than non-food, whereas others reported null findings concerning any speed advantage for the detection of food vs. non-food. Moreover, although some previous studies showed that fat content can affect visual attention for food, the effect of fat content on the detection of food remains unclear. To investigate these issues, we measured reaction times (RTs) during a visual search task in which participants with normal weight detected high-fat food (i.e., fast food), low-fat food (i.e., Japanese diet), and non-food (i.e., kitchen utensils) targets within crowds of non-food distractors (i.e., cars). Results showed that RTs for food targets were shorter than those for non-food targets. Moreover, the RTs for high-fat food were shorter than those for low-fat food. These results suggest that food is more rapidly detected than non-food within the environment and that a higher fat content in food facilitates rapid detection.
Sawada, Reiko; Sato, Wataru; Toichi, Motomi; Fushiki, Tohru
2017-01-01
Rapid detection of food is crucial for the survival of organisms. However, previous visual search studies have reported discrepant results regarding the detection speeds for food vs. non-food items; some experiments showed faster detection of food than non-food, whereas others reported null findings concerning any speed advantage for the detection of food vs. non-food. Moreover, although some previous studies showed that fat content can affect visual attention for food, the effect of fat content on the detection of food remains unclear. To investigate these issues, we measured reaction times (RTs) during a visual search task in which participants with normal weight detected high-fat food (i.e., fast food), low-fat food (i.e., Japanese diet), and non-food (i.e., kitchen utensils) targets within crowds of non-food distractors (i.e., cars). Results showed that RTs for food targets were shorter than those for non-food targets. Moreover, the RTs for high-fat food were shorter than those for low-fat food. These results suggest that food is more rapidly detected than non-food within the environment and that a higher fat content in food facilitates rapid detection. PMID:28690568
Nucleic acid probes in the diagnosis of human microbial pathogens
International Nuclear Information System (INIS)
Hyypia, T.; Huovinen, P.; Holmberg, M.; Pettersson, U.
1989-01-01
The development of effective vaccines and antimicrobial drugs against infectious diseases has been among the most successful achievements in modern medicine. The control of these diseases requires efficient diagnostic methods for the evaluation of the prevalence of diseases and for initiation of specific treatment. Virtually all known microbes can be specifically identified today but in many cases further development is needed for more accurate, rapid, easy-to-use, and inexpensive diagnostic assays. Cell culture facilities are needed for the isolation of viruses in clinical specimens. Any gene of any known microorganism can be cloned in a vector and produced in large amounts economically and then used in diagnostic assays for the identification of the pathogen. The application of the nucleic acid hybridization methods in detection of human pathogens has received considerable attention during the past few years. This paper presents examples of this application of gene technology