WorldWideScience

Sample records for rapid pathogen detection

  1. Rapid Detection of Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    David Perlin

    2005-08-14

    Pathogen identification is a crucial first defense against bioterrorism. A major emphasis of our national biodefense strategy is to establish fast, accurate and sensitive assays for diagnosis of infectious diseases agents. Such assays will ensure early and appropriate treatment of infected patients. Rapid diagnostics can also support infection control measures, which monitor and limit the spread of infectious diseases agents. Many select agents are highly transmissible in the early stages of disease, and it is critical to identify infected patients and limit the risk to the remainder of the population and to stem potential panic in the general population. Nucleic acid-based molecular approaches for identification overcome many of the deficiencies associated with conventional culture methods by exploiting both large- and small-scale genomic differences between organisms. PCR-based amplification of highly conserved ribosomal RNA (rRNA) genes, intergenic sequences, and specific toxin genes is currently the most reliable approach for bacterial, fungal and many viral pathogenic agents. When combined with fluorescence-based oligonucleotide detection systems, this approach provides real-time, quantitative, high fidelity analysis capable of single nucleotide allelic discrimination (4). These probe systems offer rapid turn around time (<2 h) and are suitable for high throughput, automated multiplex operations that are critical for clinical diagnostic laboratories. In this pilot program, we have used molecular beacon technology invented at the Public health Research Institute to develop a new generation of molecular probes to rapidly detect important agents of infectious diseases. We have also developed protocols to rapidly extract nucleic acids from a variety of clinical specimen including and blood and tissue to for detection in the molecular assays. This work represented a cooperative research development program between the Kramer-Tyagi/Perlin labs on probe development

  2. Rapid methods: the detection of foodborne pathogens

    NARCIS (Netherlands)

    Beumer, R.R.; Hazeleger, W.C.

    2009-01-01

    Although bacteria are the first type of microorganisms that come to mind when discussing microbial food safety, they are by no means the only pathogenic foodborne microorganisms. Mycotoxin producing moulds, human enteric viruses, protozoan parasites and marine biotoxins are also of importance.

  3. Rapid Detection, Characterization, and Enumeration of Foodborne Pathogens

    DEFF Research Database (Denmark)

    This book provides a new focus on the rapid detection of food–borne pathogens, employing food production chains as a starting point instead of a specific method or various detection technologies. This reference is organized by production chains or contamination scenarios, and offers a unique...... in implementation. It also provides guidelines for faster, more user–friendly, and cost–effective enumeration of pathogens....

  4. Rapid detection, characterization, and enumeration of foodborne pathogens

    DEFF Research Database (Denmark)

    Hoorfar, Jeffrey

    2011-01-01

    into focus with the 1990s outbreak of bovine spongiform encephalopathy that was linked to the human outbreak of Creutzfeldt Jakob's Disease. Serology is still an important tool in preventing foodborne pathogens to enter the human food supply through meat and milk from animals. One of the primary uses...... broth is tested in PCR, is the most common approach in rapid testing. Recent reports show that it is possible both to enrich a sample and enumerate by pathogen-specific real-time PCR, if the enrichment time is short. This can be especially useful in situations where food producers ask for the level...... following a short log-phase enrichment, (iv) detection of foodborne pathogens in air samples, and finally (v) biotracing of pathogens based on mathematical modeling, even in the absence of isolate. Rapid methods are discussed in a broad global health perspective, international food supply...

  5. Rapid detection, characterization, and enumeration of foodborne pathogens.

    Science.gov (United States)

    Hoorfar, J

    2011-11-01

    As food safety management further develops, microbiological testing will continue to play an important role in assessing whether Food Safety Objectives are achieved. However, traditional microbiological culture-based methods are limited, particularly in their ability to provide timely data. The present review discusses the reasons for the increasing interest in rapid methods, current developments in the field, the research needs, and the future trends. The advent of biotechnology has introduced new technologies that led to the emergence of rapid diagnostic methods and altered food testing practices. Rapid methods are comprised of many different detection technologies, including specialized enzyme substrates, antibodies and DNA, ranging from simple differential plating media to the use of sophisticated instruments. The use of non-invasive sampling techniques for live animals especially came into focus with the 1990s outbreak of bovine spongiform encephalopathy that was linked to the human outbreak of Creutzfeldt Jakob's Disease. Serology is still an important tool in preventing foodborne pathogens to enter the human food supply through meat and milk from animals. One of the primary uses of rapid methods is for fast screening of large number of samples, where most of them are expected to be test-negative, leading to faster product release for sale. This has been the main strength of rapid methods such as real-time Polymerase Chain Reaction (PCR). Enrichment PCR, where a primary culture broth is tested in PCR, is the most common approach in rapid testing. Recent reports show that it is possible both to enrich a sample and enumerate by pathogen-specific real-time PCR, if the enrichment time is short. This can be especially useful in situations where food producers ask for the level of pathogen in a contaminated product. Another key issue is automation, where the key drivers are miniaturization and multiple testing, which mean that not only one instrument is flexible

  6. Rapid Detection and Characterization of Emerging Foreign Animal Disease Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Jaing, C. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2016-11-18

    To best safeguard human and animal health requires early detection and characterization of disease events. This must include effective surveillance for emerging infectious diseases. Both deliberate and natural outbreaks have enormous economic and public health impacts, and can present serious threats to national security. In this project, we developed novel next generation detection technologies to protect the agricultural economy and biosecurity. The first technology is a multiplexed assay to simultaneously detection 10 swine viral and bacterial pathogens. The second one is the Lawrence Livermore Microbial Detection Array (LLMDA) which can detect more than 10,000 microbial species including 4219 viruses, 5367 bacteria, 265 fungi, 117 protozoa and 293 archaea. We analyzed a series of swine clinical samples from past disease events to demonstrate the utility of the assays for faster and cheaper detection of emerging and foreign animal disease pathogens, and their utility as s routine diagnosis and surveillance tool. A second goal of the study is to better understand mechanisms of African swine fever virus (ASFV) infection in pigs to aid the development of countermeasures and diagnostics. There is no vaccine available for ASF. ASF outbreak is on the rise on several European countries. Though ASF is not currently in the U.S., a potential outbreak in the U.S. would be detrimental to the swine industry and the US agricultural economy. We pursued a genome-wide approach to characterize the pig immune responses after ASFV infection. We used RNA sequencing and bioinformatics methods to identify genes and pathways that are affected during ASF infection. We have identified a list of most differentially expressed genes that are in the immune response pathways.

  7. Rapid methods for the detection of foodborne bacterial pathogens: principles, applications, advantages and limitations

    Science.gov (United States)

    Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

    2015-01-01

    The incidence of foodborne diseases has increased over the years and resulted in major public health problem globally. Foodborne pathogens can be found in various foods and it is important to detect foodborne pathogens to provide safe food supply and to prevent foodborne diseases. The conventional methods used to detect foodborne pathogen are time consuming and laborious. Hence, a variety of methods have been developed for rapid detection of foodborne pathogens as it is required in many food analyses. Rapid detection methods can be categorized into nucleic acid-based, biosensor-based and immunological-based methods. This review emphasizes on the principles and application of recent rapid methods for the detection of foodborne bacterial pathogens. Detection methods included are simple polymerase chain reaction (PCR), multiplex PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA), loop-mediated isothermal amplification (LAMP) and oligonucleotide DNA microarray which classified as nucleic acid-based methods; optical, electrochemical and mass-based biosensors which classified as biosensor-based methods; enzyme-linked immunosorbent assay (ELISA) and lateral flow immunoassay which classified as immunological-based methods. In general, rapid detection methods are generally time-efficient, sensitive, specific and labor-saving. The developments of rapid detection methods are vital in prevention and treatment of foodborne diseases. PMID:25628612

  8. Rapid Methods for the Detection of Foodborne Bacterial Pathogens: Principles, Applications, Advantages and Limitations

    Directory of Open Access Journals (Sweden)

    Law eJodi Woan-Fei

    2015-01-01

    Full Text Available The incidence of foodborne diseases has increased over the years and resulted in major public health problem globally. Foodborne pathogens can be found in various foods and it is important to detect foodborne pathogens to provide safe food supply and to prevent foodborne diseases. The conventional methods used to detect foodborne pathogen are time consuming and laborious. Hence, a variety of methods have been developed for rapid detection of foodborne pathogens as it is required in many food analyses. Rapid detection methods can be categorized into nucleic acid-based, biosensor-based and immunological-based methods. This review emphasizes on the principles and application of recent rapid methods for the detection of foodborne bacterial pathogens. Detection methods included are simple polymerase chain reaction (PCR, multiplex PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP and oligonucleotide DNA microarray which classified as nucleic acid-based methods; optical, electrochemical and mass-based biosensors which classified as biosensor-based methods; enzyme-linked immunosorbent assay (ELISA and lateral flow immunoassay which classified as immunological-based methods. In general, rapid detection methods are generally time-efficient, sensitive, specific and labor-saving. The developments of rapid detection methods are vital in prevention and treatment of foodborne diseases.

  9. Biocontrol and Rapid Detection of Food-Borne Pathogens Using Bacteriophages and Endolysins.

    Science.gov (United States)

    Bai, Jaewoo; Kim, You-Tae; Ryu, Sangryeol; Lee, Ju-Hoon

    2016-01-01

    Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield) was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Staphylococcus aureus, Cronobacter sakazakii, and Vibrio spp. revealed that they have great potential to control various food-borne pathogens and may be alternative for conventional food preservatives. In addition, phage-derived endolysins with high host specificity and host lysis activities may be preferred to food applications rather than phages. For rapid detection of food-borne pathogens, cell-wall binding domains (CBDs) from endolysins have been suggested due to their high host-specific binding. Fluorescence-tagged CBDs have been successfully evaluated and suggested to be alternative materials of expensive antibodies for various detection applications. Most recently, reporter phage systems have been developed and tested to confirm their usability and accuracy for specific detection. These systems revealed some advantages like rapid detection of only viable pathogenic cells without interference by food components in a very short reaction time, suggesting that these systems may be suitable for monitoring of pathogens in foods. Consequently, phage is the next-generation biocontrol agent as well as rapid detection tool to confirm and even identify the food-borne pathogens present in various foods.

  10. Biocontrol and Rapid Detection of Food-borne Pathogens Using Bacteriophages and Endolysins

    Directory of Open Access Journals (Sweden)

    Jaewoo eBai

    2016-04-01

    Full Text Available Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Staphylococcus aureus, Cronobacter sakazakii, and Vibrio spp. revealed that they have great potential to control various food-borne pathogens and may be alternative for conventional food preservatives. In addition, phage-derived endolysins with high host specificity and host lysis activities may be preferred to food applications rather than phages. For rapid detection of food-borne pathogens, cell-wall binding domains (CBDs from endolysins have been suggested due to their high host-specific binding. Fluorescence-tagged CBDs have been successfully evaluated and suggested to be alternative materials of expensive antibodies for various detection applications. Most recently, reporter phage systems have been developed and tested to confirm their usability and accuracy for specific detection. These systems revealed some advantages like rapid detection of only viable pathogenic cells without interference by food components in a very short reaction time, suggesting that these systems may be suitable for monitoring of pathogens in foods. Consequently, phage is the next-generation biocontrol agent as well as rapid detection tool to confirm and even identify the food-borne pathogens present in various foods.

  11. Biocontrol and Rapid Detection of Food-Borne Pathogens Using Bacteriophages and Endolysins

    OpenAIRE

    Bai, Jaewoo; Kim, You-Tae; Ryu, Sangryeol; Lee, Ju-Hoon

    2016-01-01

    Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield) was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enter...

  12. Commercially Available Rapid Methods for Detection of Selected Food-borne Pathogens.

    Science.gov (United States)

    Valderrama, Wladir B; Dudley, Edward G; Doores, Stephanie; Cutter, Catherine N

    2016-07-03

    Generally, the enumeration and isolation of food-borne pathogens is performed using culture-dependent methods. These methods are sensitive, inexpensive, and provide both qualitative and quantitative assessment of the microorganisms present in a sample, but these are time-consuming. For this reason, researchers are developing new techniques that allow detection of food pathogens in shorter period of time. This review identifies commercially available methods for rapid detection and quantification of Listeria monocytogenes, Salmonella spp., Staphylococcus aureus, and Shiga toxin-producing Escherichia coli in food samples. Three categories are discussed: immunologically based methods, nucleic acid-based assays, and biosensors. This review describes the basic mechanism and capabilities of each method, discusses the difficulties of choosing the most convenient method, and provides an overview of the future challenges for the technology for rapid detection of microorganisms.

  13. Molecular Detection of Foodborne Pathogens: A Rapid and Accurate Answer to Food Safety.

    Science.gov (United States)

    Mangal, Manisha; Bansal, Sangita; Sharma, Satish K; Gupta, Ram K

    2016-07-03

    Food safety is a global health concern. For the prevention and recognition of problems related to health and safety, detection of foodborne pathogen is of utmost importance at all levels of food production chain. For several decades, a lot of research has been targeted at the development of rapid methodology as reducing the time needed to complete pathogen detection tests has been the primary goal of food microbiologists. With the result, food microbiology laboratories now have a wide array of detection methods and automated technologies such as enzyme immunoassay, polymerase chain reaction, and microarrays, which can cut test times considerably. Nucleic acid amplification strategies and advances in amplicon detection methodologies have been the key factors in the progress of molecular microbiology. A comprehensive literature survey has been carried out to give an overview in the field of foodborne pathogen detection. In this paper, we describe the conventional methods, as well as recent developments in food pathogen detection, identification, and quantification, with a major emphasis on molecular detection methods.

  14. Rapid Detection and Identification of a Pathogen's DNA Using Phi29 DNA Polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Y.; Dunn, J.; Gao, S.; Bruno, J. F.; Luft, B. J.

    2008-10-31

    Zoonotic pathogens including those transmitted by insect vectors are some of the most deadly of all infectious diseases known to mankind. A number of these agents have been further weaponized and are widely recognized as being potentially significant biothreat agents. We describe a novel method based on multiply-primed rolling circle in vitro amplification for profiling genomic DNAs to permit rapid, cultivation-free differential detection and identification of circular plasmids in infectious agents. Using Phi29 DNA polymerase and a two-step priming reaction we could reproducibly detect and characterize by DNA sequencing circular DNA from Borrelia burgdorferi B31 in DNA samples containing as little as 25 pg of Borrelia DNA amongst a vast excess of human DNA. This simple technology can ultimately be adapted as a sensitive method to detect specific DNA from both known and unknown pathogens in a wide variety of complex environments.

  15. Rapid Detection and Identification of Infectious Pathogens Based on High-throughput Sequencing

    Directory of Open Access Journals (Sweden)

    Pei-Xiang Ni

    2015-01-01

    Full Text Available Background: The dilemma of pathogens identification in patients with unidentified clinical symptoms such as fever of unknown origin exists, which not only poses a challenge to both the diagnostic and therapeutic process by itself, but also to expert physicians. Methods: In this report, we have attempted to increase the awareness of unidentified pathogens by developing a method to investigate hitherto unidentified infectious pathogens based on unbiased high-throughput sequencing. Results: Our observations show that this method supplements current diagnostic technology that predominantly relies on information derived five cases from the intensive care unit. This methodological approach detects viruses and corrects the incidence of false positive detection rates of pathogens in a much shorter period. Through our method is followed by polymerase chain reaction validation, we could identify infection with Epstein-Barr virus, and in another case, we could identify infection with Streptococcus viridians based on the culture, which was false positive. Conclusions: This technology is a promising approach to revolutionize rapid diagnosis of infectious pathogens and to guide therapy that might result in the improvement of personalized medicine.

  16. Rapid Detection of Pathogenic Bacteria from Fresh Produce by Filtration and Surface-Enhanced Raman Spectroscopy

    Science.gov (United States)

    Wu, Xiaomeng; Han, Caiqin; Chen, Jing; Huang, Yao-Wen; Zhao, Yiping

    2016-04-01

    The detection of Salmonella Poona from cantaloupe cubes and E. coli O157:H7 from lettuce has been explored by using a filtration method and surface-enhanced Raman spectroscopy (SERS) based on vancomycin-functionalized silver nanorod array substrates. It is found that with a two-step filtration process, the limit of detection (LOD) of Salmonella Poona from cantaloupe cubes can be as low as 100 CFU/mL in less than 4 h, whereas the chlorophyll in the lettuce causes severe SERS spectral interference. To improve the LOD of lettuce, a three-step filtration method with a hydrophobic filter is proposed. The hydrophobic filter can effectively eliminate the interferences from chlorophyll and achieve a LOD of 1000 CFU/mL detection of E. coli O157:H7 from lettuce samples within 5 h. With the low LODs and rapid detection time, the SERS biosensing platform has demonstrated its potential as a rapid, simple, and inexpensive means for pathogenic bacteria detection from fresh produce.

  17. Exploration of Simple Analytical Approaches for Rapid Detection of Pathogenic Bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Rahman, Salma [Iowa State Univ., Ames, IA (United States)

    2005-01-01

    Many of the current methods for pathogenic bacterial detection require long sample-preparation and analysis time, as well as complex instrumentation. This dissertation explores simple analytical approaches (e.g., flow cytometry and diffuse reflectance spectroscopy) that may be applied towards ideal requirements of a microbial detection system, through method and instrumentation development, and by the creation and characterization of immunosensing platforms. This dissertation is organized into six sections. In the general Introduction section a literature review on several of the key aspects of this work is presented. First, different approaches for detection of pathogenic bacteria will be reviewed, with a comparison of the relative strengths and weaknesses of each approach, A general overview regarding diffuse reflectance spectroscopy is then presented. Next, the structure and function of self-assembled monolayers (SAMs) formed from organosulfur molecules at gold and micrometer and sub-micrometer patterning of biomolecules using SAMs will be discussed. This section is followed by four research chapters, presented as separate manuscripts. Chapter 1 describes the efforts and challenges towards the creation of imunosensing platforms that exploit the flexibility and structural stability of SAMs of thiols at gold. 1H, 1H, 2H, 2H-perfluorodecyl-1-thiol SAM (PFDT) and dithio-bis(succinimidyl propionate)-(DSP)-derived SAMs were used to construct the platform. Chapter 2 describes the characterization of the PFDT- and DSP-derived SAMs, and the architectures formed when it is coupled to antibodies as well as target bacteria. These studies used infrared reflection spectroscopy (IRS), X-ray photoelectron spectroscopy (XPS), and electrochemical quartz crystal microbalance (EQCM), Chapter 3 presents a new sensitive, and portable diffuse reflection based technique for the rapid identification and quantification of pathogenic bacteria. Chapter 4 reports research efforts in the

  18. A method for the rapid detection and identification of halo blight pathogen on common bean

    Directory of Open Access Journals (Sweden)

    Popović Tatjana

    2014-01-01

    Full Text Available A diagnostic method based on nested-PCR, followed by ELISA and conventional bacteriology tests, for the rapid and reliable detection of halo blight pathogen Pseudomonas savastanoi pv. phaseolicola (Psp collected from infected bean leaves and seeds is described. Psp formed white, small and flat colonies on nutrient agar medium, creamy white, flat and circular on Milk-Tween agar medium and light yellow, convex and shiny on modified sucrose peptone agar medium. Eighteen Gram-negative, catalase-positive and oxidase-negative strains were subjected to nested PCR with primers P 5.1/P 3.1 and P 5.2/P 3.2, which directed the amplification of the 450 bp target DNA fragment in all tested strains. According to the results of DAS- and PTA-ELISA with respect to reactivity to specific antibodies, all analyzed strains belonged to Psp bacterium. Pathogenicity was tested on bean pods and cotyledon leaves, on which greasy spots were formed. Psp did not cause hypersensitive reaction on the leaves of tobacco and geranium. Strains produced levan, fluorescent pigment, oxidative metabolism of glucose, did not reduce nitrate, did not produce indole and H2S, did not hydrolyze starch, gelatin and esculin; they produced acid from glucose, mannose, sucrose and glycerol, and did not produce acid from maltose, starch, esculin, dulcite, sorbitol, inositol and erythritol.

  19. Surface enhanced Raman scattering (SERS) with biopolymer encapsulated silver nanosubstrates for rapid detection of foodborne pathogens.

    Science.gov (United States)

    Sundaram, Jaya; Park, Bosoon; Kwon, Yongkuk; Lawrence, Kurt C

    2013-10-01

    A biopolymer encapsulated with silver nanoparticles was prepared using silver nitrate, polyvinyl alcohol (PVA) solution, and trisodium citrate. It was deposited on a mica sheet to use as SERS substrate. Fresh cultures of Salmonella Typhimurium, Escherichia coli, Staphylococcus aureus and Listeria innocua were washed from chicken rinse and suspended in 10 ml of sterile deionized water. Approximately 5 μl of the bacterial suspensions was placed on the substrate individually and exposed to 785 nm HeNe laser excitation. SERS spectral data were recorded over the Raman shift between 400 and 1800 cm(-1) from 15 different spots on the substrate for each sample; and three replicates were done on each bacteria type. Principal component analysis (PCA) model was developed to classify foodborne bacteria types. PC1 identified 96% of the variation among the given bacteria specimen, and PC2 identified 3%, resulted in a total of 99% classification accuracy. Soft Independent Modeling of Class Analogies (SIMCA) of validation set gave an overall correct classification of 97%. Comparison of the SERS spectra of different types of gram-negative and gram-positive bacteria indicated that all of them have similar cell walls and cell membrane structures. Conversely, major differences were noted around the nucleic acid and amino acid structure information between 1200 cm(-1) and 1700 cm(-1) and at the finger print region between 400 cm(-1) and 700 cm(-1). Silver biopolymer nanoparticle substrate could be a promising SERS tool for pathogen detection. Also this study indicates that SERS technology could be used for reliable and rapid detection and classification of food borne pathogens. Published by Elsevier B.V.

  20. Rapid sample processing for detection of food-borne pathogens via cross-flow microfiltration.

    Science.gov (United States)

    Li, Xuan; Ximenes, Eduardo; Amalaradjou, Mary Anne Roshni; Vibbert, Hunter B; Foster, Kirk; Jones, Jim; Liu, Xingya; Bhunia, Arun K; Ladisch, Michael R

    2013-11-01

    This paper reports an approach to enable rapid concentration and recovery of bacterial cells from aqueous chicken homogenates as a preanalytical step of detection. This approach includes biochemical pretreatment and prefiltration of food samples and development of an automated cell concentration instrument based on cross-flow microfiltration. A polysulfone hollow-fiber membrane module having a nominal pore size of 0.2 μm constitutes the core of the cell concentration instrument. The aqueous chicken homogenate samples were circulated within the cross-flow system achieving 500- to 1,000-fold concentration of inoculated Salmonella enterica serovar Enteritidis and naturally occurring microbiota with 70% recovery of viable cells as determined by plate counting and quantitative PCR (qPCR) within 35 to 45 min. These steps enabled 10 CFU/ml microorganisms in chicken homogenates or 10(2) CFU/g chicken to be quantified. Cleaning and sterilizing the instrument and membrane module by stepwise hydraulic and chemical cleaning (sodium hydroxide and ethanol) enabled reuse of the membrane 15 times before replacement. This approach begins to address the critical need for the food industry for detecting food pathogens within 6 h or less.

  1. The potential for early and rapid pathogen detection within poultry processing through hyperspectral microscopy

    Science.gov (United States)

    The acquisition of hyperspectral microscopic images containing both spatial and spectral data has shown potential for the early and rapid optical classification of foodborne pathogens. A hyperspectral microscope with a metal halide light source and acousto-optical tunable filter (AOTF) collects 89 ...

  2. A rapid, highly sensitive and culture-free detection of pathogens from blood by positive enrichment.

    Science.gov (United States)

    Vutukuru, Manjula Ramya; Sharma, Divya Khandige; Ragavendar, M S; Schmolke, Susanne; Huang, Yiwei; Gumbrecht, Walter; Mitra, Nivedita

    2016-12-01

    Molecular diagnostics is a promising alternative to culture based methods for the detection of bloodstream infections, notably due to its overall lower turnaround time when starting directly from patient samples. Whole blood is usually the starting diagnostic sample in suspected bloodstream infections. The detection of low concentrations of pathogens in blood using a molecular assay necessitates a fairly high starting volume of blood sample in the range of 5-10mL. This large volume of blood sample has a substantial accompanying human genomic content that interferes with pathogen detection. In this study, we have established a workflow using magnetic beads coated with Apolipoprotein H that makes it possible to concentrate pathogens from a 5.0mL whole blood sample, thereby enriching pathogens from whole blood background and also reducing the sample volume to ~200μL or less. We have also demonstrated that this method of enrichment allows detection of 1CFU/mL of Escherichia coli, Enterococcus gallinarum and Candida tropicalis from 5mL blood using quantitative PCR; a detection limit that is not possible in unenriched samples. The enrichment method demonstrated here took 30min to complete and can be easily integrated with various downstream molecular and microbiological techniques. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. A microdevice for rapid, monoplex and colorimetric detection of foodborne pathogens using a centrifugal microfluidic platform.

    Science.gov (United States)

    Sayad, Abkar; Ibrahim, Fatimah; Mukim Uddin, Shah; Cho, Jongman; Madou, Marc; Thong, Kwai Lin

    2018-02-15

    Outbreaks of foodborne diseases have become a global health concern; hence, many improvements and developments have been made to reduce the risk of food contamination. We developed a centrifugal microfluidic automatic wireless endpoint detection system integrated with loop mediated isothermal amplification (LAMP) for monoplex pathogen detection. Six identical sets were designed on the microfluidic compact disc (CD) to perform 30 genetic analyses of three different species of foodborne pathogens. The consecutive loading, mixing, and aliquoting of the LAMP primers/reagents and DNA sample solutions were accomplished using an optimized square-wave microchannel, metering chambers and revulsion per minute (RPM) control. We tested 24 strains of pathogenic bacteria (Escherichia coli, Salmonella spp and Vibrio cholerae), with 8 strains of each bacterium, and performed DNA amplification on the microfluidic CD for 60min. Then, the amplicons of the LAMP reaction were detected using the calcein colorimetric method and further analysed via the developed electronic system interfaced with Bluetooth wireless technology to transmit the results to a smartphone. The system showed a limit of detection (LOD) of 3 × 10-5ngμL-1 DNA by analysing the colour change when tested with chicken meat spiked with the three pathogenic bacteria. Since the entire process was performed in a fully automated way and was easy to use, our microdevice is suitable for point-of-care (POC) testing with high simplicity, providing affordability and accessibility even to poor, resource-limited settings. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Development and application of a multiplex PCR assay for rapid detection of 4 major bacterial pathogens in ducks.

    Science.gov (United States)

    Wei, B; Cha, S-Y; Kang, M; Park, I-J; Moon, O-K; Park, C-K; Jang, H-K

    2013-05-01

    Infections with Pasteurella multocida, Salmonella enterica, Riemerella anatipestifer, and Escherichia coli result in high morbidity and mortality, which cause significant economic loss in the poultry industry. It can be difficult to distinguish these pathogens based on clinical signs because these pathogens can cause similar clinical signs and coinfections can occur. Thus, rapid and sensitive detection of these 4 major bacterial pathogens are important in ducks. The aim of this study was to develop a multiplex PCR (mPCR) assay for simultaneously detecting and identifying these 4 pathogenic bacteria in a single tube reaction. The target genes used were KMT1 of P. multocida, the invasion protein gene of S. enterica, 16S rDNA of R. anatipestifer, and the alkaline phosphatase gene of E. coli. The detection limit of the assay for all bacterial DNA was 10 pg. The mPCR did not produce any nonspecific amplification products when tested against other related pathogens, including Staphylococcus aureus, Streptococcus pyogenes, Clostridium perfringens, Mycoplasma gallinarum, Mycoplasma synoviae, and Mycoplasma gallisepticum, which can also infect ducks. We applied mPCR to field samples, and the results were the same as the single PCR results. These results suggest that mPCR for the 4 bacteria is a useful and rapid technique to apply to field samples.

  5. Rapid detection and identification of viral and bacterial fish pathogens using a DNA array‐based multiplex assay

    DEFF Research Database (Denmark)

    Lievens, B.; Frans, I.; Heusdens, C.

    2011-01-01

    for the simultaneous detection and identification of all cyprinid herpesviruses (CyHV‐1, CyHV‐2 and CyHV‐3) and some of the most important fish pathogenic Flavobacterium species, including F. branchiophilum, F. columnare and F. psychrophilum. For virus identification, the DNA polymerase and helicase genes were......Fish diseases can be caused by a variety of diverse organisms, including bacteria, fungi, viruses and protozoa, and pose a universal threat to the ornamental fish industry and aquaculture. The lack of rapid, accurate and reliable means by which fish pathogens can be detected and identified has been...... one of the main limitations in fish pathogen diagnosis and fish disease management and has consequently stimulated the search for alternative diagnostic techniques. Here, we describe a method based on multiplex and broad‐range PCR amplification combined with DNA array hybridization...

  6. A novel gold nanoparticle-DNA aptamer-based plasmonic chip for rapid and sensitive detection of bacterial pathogens

    DEFF Research Database (Denmark)

    Sun, Yi; Phuoc Long, Truong; Wolff, Anders

    2016-01-01

    Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers to be detac......Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers...... to be detached from AuNPs when interacting with bacteria. The new strategy greatly increases the sensitivity and specificity of chip-based whole-cell biosensing....

  7. Rapid and high-throughput detection of highly pathogenic bacteria by Ibis PLEX-ID technology.

    Directory of Open Access Journals (Sweden)

    Daniela Jacob

    Full Text Available In this manuscript, we describe the identification of highly pathogenic bacteria using an assay coupling biothreat group-specific PCR with electrospray ionization mass spectrometry (PCR/ESI-MS run on an Ibis PLEX-ID high-throughput platform. The biothreat cluster assay identifies most of the potential bioterrorism-relevant microorganisms including Bacillus anthracis, Francisella tularensis, Yersinia pestis, Burkholderia mallei and pseudomallei, Brucella species, and Coxiella burnetii. DNA from 45 different reference materials with different formulations and different concentrations were chosen and sent to a service screening laboratory that uses the PCR/ESI-MS platform to provide a microbial identification service. The standard reference materials were produced out of a repository built up in the framework of the EU funded project "Establishment of Quality Assurances for Detection of Highly Pathogenic Bacteria of Potential Bioterrorism Risk" (EQADeBa. All samples were correctly identified at least to the genus level.

  8. DNA Sequence Signatures for Rapid Detection of Six Target Bacterial Pathogens Using PCR Assays

    Directory of Open Access Journals (Sweden)

    Kenjiro Nagamine

    2015-01-01

    Full Text Available Using Streptococcus pyogenes as a model, we previously established a stepwise computational workflow to effectively identify species-specific DNA signatures that could be used as PCR primer sets to detect target bacteria with high specificity and sensitivity. In this study, we extended the workflow for the rapid development of PCR assays targeting Enterococcus faecalis, Enterococcus faecium, Clostridium perfringens, Clostridium difficile, Clostridium tetani , and Staphylococcus aureus , which are of safety concern for human tissue intended for transplantation. Twenty-one primer sets that had sensitivity of detecting 5–50 fg DNA from target bacteria with high specificity were selected. These selected primer sets can be used in a PCR array for detecting target bacteria with high sensitivity and specificity. The workflow could be widely applicable for the rapid development of PCR-based assays for a wide range of target bacteria, including those of biothreat agents.

  9. Rapid colorimetric sensing platform for the detection of Listeria monocytogenes foodborne pathogen.

    Science.gov (United States)

    Alhogail, Sahar; Suaifan, Ghadeer A R Y; Zourob, Mohammed

    2016-12-15

    Listeria monocytogenes is a serious cause of human foodborne infections worldwide, which needs spending billions of dollars for inspection of bacterial contamination in food every year. Therefore, there is an urgent need for rapid, in-field and cost effective detection techniques. In this study, rapid, low-cost and simple colorimetric assay was developed using magnetic nanoparticles for the detection of listeria bacteria. The protease from the listeria bacteria was detected using D-amino acid substrate. D-amino acid substrate was linked to the carboxylic acid on the magnetic nanoparticles using EDC/NHS chemistry. The cysteine residue at the C-terminal of the substrate was used for the self-assembled monolayer formation on the gold sensor surface, which in turn the black magnetic nanobeads will mask the golden color. The color will change from black to golden color upon the cleavage of the specific peptide sequence by the Listeria protease. The sensor was tested with serial dilutions of Listeria bacteria. It was found that the appearance of the gold surface area is proportional to the bacterial concentrations in CFU/ml. The lowest detection limit of the developed sensor for Listeria was found to be 2.17×10(2) colony forming unit/ml (CFU/ml). The specificity of the biosensor was tested against four different foodborne associated bacteria (Escherichia coli, Salmonella, Shigella flexnerii and Staphylococcus aureus). Finally, the sensor was tested with artificially spiked whole milk and ground meat spiked with listeria. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. A novel molecular toolkit for rapid detection of the pathogen and primary vector of thousand cankers disease.

    Directory of Open Access Journals (Sweden)

    Emel Oren

    Full Text Available Thousand Cankers Disease (TCD of Juglans and Pterocarya (Juglandaceae involves a fungal pathogen, Geosmithia morbida, and a primary insect vector, Pityophthorus juglandis. TCD was described originally from dying Juglans nigra trees in the western United States (USA, but it was reported subsequently from the eastern USA and northern Italy. The disease is often difficult to diagnose due to the absence of symptoms or signs on the bark surface of the host. Furthermore, disease symptoms can be confused with those caused by other biotic and abiotic agents. Thus, there is a critical need for a method for rapid detection of the pathogen and vector of TCD. Using species-specific microsatellite DNA markers, we developed a molecular protocol for the detection of G. morbida and P. juglandis. To demonstrate the utility of the method for delineating TCD quarantine zones, we tested whether geographical occurrence of symptoms and signs of TCD was correlated with molecular evidence for the presence of the cryptic TCD organisms. A total of 1600 drill cores were taken from branch sections collected from three regions (n = 40 trees for each location: California-J. hindsii (heavy disease incidence; Tennessee-J. nigra (mild disease incidence; and outside the known TCD zone (Missouri-J. nigra, no record of the disease. California samples had the highest incidence of the TCD organisms (85%, 34/40. Tennessee had intermediate incidence (42.5%, 17/40, whereas neither organism was detected in samples from Missouri. The low cost molecular protocol developed here has a high degree of sensitivity and specificity, and it significantly reduces sample-processing time, making the protocol a powerful tool for rapid detection of TCD.

  11. Rapid multiplex detection of 10 foodborne pathogens with an up-converting phosphor technology-based 10-channel lateral flow assay.

    Science.gov (United States)

    Zhao, Yong; Wang, Haoran; Zhang, Pingping; Sun, Chongyun; Wang, Xiaochen; Wang, Xinrui; Yang, Ruifu; Wang, Chengbin; Zhou, Lei

    2016-02-17

    The rapid high-throughput detection of foodborne pathogens is essential in controlling food safety. In this study, a 10-channel up-converting phosphor technology-based lateral flow (TC-UPT-LF) assay was established for the rapid and simultaneous detection of 10 epidemic foodborne pathogens. Ten different single-target UPT-LF strips were developed and integrated into one TC-UPT-LF disc with optimization. Without enrichment the TC-UPT-LF assay had a detection sensitivity of 10(4) CFU mL(-1) or 10(5) CFU mL(-1) for each pathogen, and after sample enrichment it was 10 CFU/0.6 mg. The assay also showed good linearity, allowing quantitative detection, with a linear fitting coefficient of determination (R(2)) of 0.916-0.998. The 10 detection channels did not cross-react, so multiple targets could be specifically detected. When 279 real food samples were tested, the assay was highly consistent (100%) with culture-based methods. The results for 110 food samples artificially contaminated with single or multiple targets showed a high detection rate (≥ 80%) for most target bacteria. Overall, the TC-UPT-LF assay allows the rapid, quantitative, and simultaneous detection of 10 kinds of foodborne pathogens within 20 min, and is especially suitable for the rapid detection and surveillance of foodborne pathogens in food and water.

  12. Reverse transcription-PCR-electrospray ionization mass spectrometry for rapid detection of biothreat and common respiratory pathogens.

    Science.gov (United States)

    Jeng, Kevin; Hardick, Justin; Rothman, Richard; Yang, Samuel; Won, Helen; Peterson, Stephen; Hsieh, Yu-Hsiang; Masek, Billie Jo; Carroll, Karen C; Gaydos, Charlotte A

    2013-10-01

    Electrospray ionization mass spectrometry (ESI-MS) analysis of reverse transcription (RT)-PCR amplicons from human respiratory samples allows for broad pathogen identification approximately 8 h after collection. We investigated the performance characteristics of a high-throughput RT-PCR-coupled ESI-MS assay for distinguishing biothreat (BT) agents from common bacterial, fungal, and viral respiratory pathogens in bronchoalveolar lavage (BAL) fluid specimens from subjects with suspected respiratory infections. In a retrospective case series, 202 BAL fluid specimens were collected at the Johns Hopkins Hospital between August 2010 and February 2011 from patients with suspected acute respiratory infections. Samples were processed using standard bacterial, viral, and fungal testing in the clinical microbiology laboratory as part of routine care and then were blindly spiked with either water or nucleic acids from BT organisms (Bacillus anthracis, Yersinia pestis, Francisella tularensis, Brucella spp., Burkholderia spp., and Rickettsia prowazekii) and tested by RT-PCR-ESI-MS. The sensitivities and specificities of RT-PCR-ESI-MS versus standard clinical methods were as follows: for mock BT DNA, 98.5% sensitivity (95% confidence interval [CI], 94.2 to 99.7%) and 100% specificity (95% CI, 93.1 to 100.0%); for bacterial pathogens, 81.8% sensitivity (95% CI, 74.3 to 87.6%) and 73.6% specificity (95% CI, 64.2 to 81.4%); for viral pathogens, 93.3% sensitivity (95% CI, 66.0 to 99.7%) and 97.3% specificity (95% CI, 89.7 to 99.5%); for fungal pathogens, 42.6% sensitivity (95% CI, 29.5 to 56.7%) and 97.8% specificity (95% CI, 91.8 to 99.6%). Our data suggest that RT-PCR-ESI-MS is a useful adjunct to standard culture protocols for rapid detection of both BT and common respiratory pathogens; further study is required for assay validation, especially for fungal detection, and potential implementation.

  13. Reverse Transcription-PCR–Electrospray Ionization Mass Spectrometry for Rapid Detection of Biothreat and Common Respiratory Pathogens

    Science.gov (United States)

    Jeng, Kevin; Rothman, Richard; Yang, Samuel; Won, Helen; Peterson, Stephen; Hsieh, Yu-Hsiang; Masek, Billie Jo; Carroll, Karen C.; Gaydos, Charlotte A.

    2013-01-01

    Electrospray ionization mass spectrometry (ESI-MS) analysis of reverse transcription (RT)-PCR amplicons from human respiratory samples allows for broad pathogen identification approximately 8 h after collection. We investigated the performance characteristics of a high-throughput RT-PCR-coupled ESI-MS assay for distinguishing biothreat (BT) agents from common bacterial, fungal, and viral respiratory pathogens in bronchoalveolar lavage (BAL) fluid specimens from subjects with suspected respiratory infections. In a retrospective case series, 202 BAL fluid specimens were collected at the Johns Hopkins Hospital between August 2010 and February 2011 from patients with suspected acute respiratory infections. Samples were processed using standard bacterial, viral, and fungal testing in the clinical microbiology laboratory as part of routine care and then were blindly spiked with either water or nucleic acids from BT organisms (Bacillus anthracis, Yersinia pestis, Francisella tularensis, Brucella spp., Burkholderia spp., and Rickettsia prowazekii) and tested by RT-PCR–ESI-MS. The sensitivities and specificities of RT-PCR–ESI-MS versus standard clinical methods were as follows: for mock BT DNA, 98.5% sensitivity (95% confidence interval [CI], 94.2 to 99.7%) and 100% specificity (95% CI, 93.1 to 100.0%); for bacterial pathogens, 81.8% sensitivity (95% CI, 74.3 to 87.6%) and 73.6% specificity (95% CI, 64.2 to 81.4%); for viral pathogens, 93.3% sensitivity (95% CI, 66.0 to 99.7%) and 97.3% specificity (95% CI, 89.7 to 99.5%); for fungal pathogens, 42.6% sensitivity (95% CI, 29.5 to 56.7%) and 97.8% specificity (95% CI, 91.8 to 99.6%). Our data suggest that RT-PCR–ESI-MS is a useful adjunct to standard culture protocols for rapid detection of both BT and common respiratory pathogens; further study is required for assay validation, especially for fungal detection, and potential implementation. PMID:23903543

  14. Isothermal and rapid detection of pathogenic microorganisms using a nano-rolling circle amplification-surface plasmon resonance biosensor.

    Science.gov (United States)

    Shi, Dachuan; Huang, Junfu; Chuai, Zhengran; Chen, Dong; Zhu, Xiaoyan; Wang, Huan; Peng, Jia; Wu, Haiyan; Huang, Qing; Fu, Weiling

    2014-12-15

    Rolling circle amplification (RCA) of DNA is a sensitive and cost effective method for the rapid identification of pathogens without the need for sequencing. In this study, a surface plasmon resonance DNA biosensor based on RCA with a gold (Au) nanoparticle surface was established for isothermal identification of DNA. The probes included a specific padlock probe, a capture probe (CP), which is bound to biotin, and an Au nanoparticle-modified probe, which hybridizes with the RCA products. The CP was assembled on gold nanoparticles to increase its ability to bind and hybridize. The linear padlock probe, which was designed to circularize by ligation upon recognition of the bacterial pathogen-specific sequence in 16S rDNA, hybridizes to fully complementary sequences within the CP. Upon recognition, each target gene DNA is distinguished by localization onto the corresponding channel on the chip surface. Then, the immobilized CPs act as primers to begin the in situ solid-phase RCA reaction, which produces long single-stranded DNA. The RCA products fixed on the chip surface cause significant surface plasmon resonance angle changes. We demonstrated that six different bacterial pathogens can be identified simultaneously and that 0.5 pM of synthetic oligonucleotides and 0.5 pg μl(-1) of genomic DNA from clinical samples can be detected by this method with low background signals. Therefore, the multiplex diagnostic method provides a highly sensitive and specific approach for the rapid identification of positive samples. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Rapidly evolving genes in pathogens: methods for detecting positive selection and examples among fungi, bacteria, viruses and protists.

    Science.gov (United States)

    Aguileta, Gabriela; Refrégier, Guislaine; Yockteng, Roxana; Fournier, Elisabeth; Giraud, Tatiana

    2009-07-01

    The ongoing coevolutionary struggle between hosts and pathogens, with hosts evolving to escape pathogen infection and pathogens evolving to escape host defences, can generate an 'arms race', i.e., the occurrence of recurrent selective sweeps that each favours a novel resistance or virulence allele that goes to fixation. Host-pathogen coevolution can alternatively lead to a 'trench warfare', i.e., balancing selection, maintaining certain alleles at loci involved in host-pathogen recognition over long time scales. Recently, technological and methodological progress has enabled detection of footprints of selection directly on genes, which can provide useful insights into the processes of coevolution. This knowledge can also have practical applications, for instance development of vaccines or drugs. Here we review the methods for detecting genes under positive selection using divergence data (i.e., the ratio of nonsynonymous to synonymous substitution rates, d(N)/d(S)). We also review methods for detecting selection using polymorphisms, such as methods based on F(ST) measures, frequency spectrum, linkage disequilibrium and haplotype structure. In the second part, we review examples where targets of selection have been identified in pathogens using these tests. Genes under positive selection in pathogens have mostly been sought among viruses, bacteria and protists, because of their paramount importance for human health. Another focus is on fungal pathogens owing to their agronomic importance. We finally discuss promising directions in pathogen studies, such as detecting selection in non-coding regions.

  16. Universal Probe Library based real-time PCR for rapid detection of bacterial pathogens from positive blood culture bottles.

    Science.gov (United States)

    Zhu, Lingxiang; Shen, Ding-Xia; Zhou, Qiming; Liu, Chao-Jun; Li, Zexia; Fang, Xiangdong; Li, Quan-Zhen

    2014-03-01

    A set of real-time PCR based assays using the locked nucleic acid probes from Roche Universal ProbeLibrary were developed for rapid detection of eight bacterial species from positive blood culture bottles. Four duplex real-time PCR reactions targeting to one Gram-positive bacterium and one Gram-negative bacterium were optimized for species identification according to Gram stain results. We also included mecA-specific primers and probes in the assays to indicate the presence of methicillin resistance in the bacterial species. The analytical sensitivity was in the range of 1-10 CFU per PCR reaction mixture. The specificity and cross reactivity of the assay was validated by 28 ATCC reference strains and 77 negative blood culture specimens. No cross-reactivity was observed in these samples thus demonstrating 100 % specificity. 72 previously characterized clinical isolates were tested by the real-time PCR assay and validated the accuracy and feasibility of the real-time PCR assay. Furthermore, 55 positive blood culture samples were tested using real-time PCR and 50 (90.9 %) of them were identified as the same species as judged by biochemical analysis. In total, real-time PCR showed 98.2 % consistent to that of traditional methods. Real-time PCR can be used as a supplement for early detection of the frequently-occurred pathogens from the positive blood cultures.

  17. Rapid Detection and Statistical Differentiation of KPC Gene Variants in Gram-Negative Pathogens by Use of High-Resolution Melting and ScreenClust Analyses

    OpenAIRE

    Roth, Amanda L.; Hanson, Nancy D.

    2013-01-01

    In the United States, the production of the Klebsiella pneumoniae carbapenemase (KPC) is an important mechanism of carbapenem resistance in Gram-negative pathogens. Infections with KPC-producing organisms are associated with increased morbidity and mortality; therefore, the rapid detection of KPC-producing pathogens is critical in patient care and infection control. We developed a real-time PCR assay complemented with traditional high-resolution melting (HRM) analysis, as well as statisticall...

  18. Clinical impact of a commercially available multiplex PCR system for rapid detection of pathogens in patients with presumed sepsis

    Directory of Open Access Journals (Sweden)

    Linde Hans-Jörg

    2009-08-01

    Full Text Available Abstract Background Timely identification of pathogens is crucial to minimize mortality in patients with severe infections. Detection of bacterial and fungal pathogens in blood by nucleic acid amplification promises to yield results faster than blood cultures (BC. We analyzed the clinical impact of a commercially available multiplex PCR system in patients with suspected sepsis. Methods Blood samples from patients with presumed sepsis were cultured with the Bactec 9240™ system (Becton Dickinson, Heidelberg, Germany and aliquots subjected to analysis with the LightCycler® SeptiFast® (SF Test (Roche Diagnostics, Mannheim, Germany at a tertiary care centre. For samples with PCR-detected pathogens, the actual impact on clinical management was determined by chart review. Furthermore a comparison between the time to a positive blood culture result and the SF result, based on a fictive assumption that it was done either on a once or twice daily basis, was made. Results Of 101 blood samples from 77 patients, 63 (62% yielded concordant negative results, 14 (13% concordant positive and 9 (9% were BC positive only. In 14 (13% samples pathogens were detected by SF only, resulting in adjustment of antibiotic therapy in 5 patients (7,7% of patients. In 3 samples a treatment adjustment would have been made earlier resulting in a total of 8 adjustments in all 101 samples (8%. Conclusion The addition of multiplex PCR to conventional blood cultures had a relevant impact on clinical management for a subset of patients with presumed sepsis.

  19. Rapid pathogen detection by lateral-flow immunochromatographic assay with gold nanoparticle-assisted enzyme signal amplification.

    Science.gov (United States)

    Cho, Il-Hoon; Bhunia, Arun; Irudayaraj, Joseph

    2015-08-03

    To date most LF-ICA format for pathogen detection is based on generating color signals from gold nanoparticle (AuNP) tracers that are perceivable by naked eye but often these methods exhibit sensitivity lower than those associated with the conventional enzyme-based immunological methods or mandated by the regulatory guidelines. By developing AuNP avidin-biotin constructs in which a number of enzymes can be labeled we report on an enhanced LF-ICA system to detect pathogens at very low levels. With this approach we show that as low as 100 CFU/mL of Escherichia coli O157:H7 can be detected, indicating that the limit of detection can be increased by about 1000-fold due to our signal amplification approach. In addition, extensive cross-reactivity experiments were conducted (19 different organisms were used) to test and successfully validate the specificity of the assay. Semi-quantitative analysis can be performed using signal intensities which were correlated with the target pathogen concentrations for calibration by image processing. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Biosensors for plant pathogen detection.

    Science.gov (United States)

    Khater, Mohga; de la Escosura-Muñiz, Alfredo; Merkoçi, Arben

    2017-07-15

    Infectious plant diseases are caused by pathogenic microorganisms such as fungi, bacteria, viruses, viroids, phytoplasma and nematodes. Worldwide, plant pathogen infections are among main factors limiting crop productivity and increasing economic losses. Plant pathogen detection is important as first step to manage a plant disease in greenhouses, field conditions and at the country boarders. Current immunological techniques used to detect pathogens in plant include enzyme-linked immunosorbent assays (ELISA) and direct tissue blot immunoassays (DTBIA). DNA-based techniques such as polymerase chain reaction (PCR), real time PCR (RT-PCR) and dot blot hybridization have also been proposed for pathogen identification and detection. However these methodologies are time-consuming and require complex instruments, being not suitable for in-situ analysis. Consequently, there is strong interest for developing new biosensing systems for early detection of plant diseases with high sensitivity and specificity at the point-of-care. In this context, we revise here the recent advancement in the development of advantageous biosensing systems for plant pathogen detection based on both antibody and DNA receptors. The use of different nanomaterials such as nanochannels and metallic nanoparticles for the development of innovative and sensitive biosensing systems for the detection of pathogens (i.e. bacteria and viruses) at the point-of-care is also shown. Plastic and paper-based platforms have been used for this purpose, offering cheap and easy-to-use really integrated sensing systems for rapid on-site detection. Beside devices developed at research and development level a brief revision of commercially available kits is also included in this review. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. An alternative chemical redox method for the production of bispecific antibodies: implication in rapid detection of food borne pathogens.

    Directory of Open Access Journals (Sweden)

    Mohammad Owais

    Full Text Available Bi-functional antibodies with the ability to bind two unrelated epitopes have remarkable potential in diagnostic and bio-sensing applications. In the present study, bispecific antibodies that recognize human red blood cell (RBC and the food borne pathogen Listeria monocytogenes (L. monocytogenes were engineered. The procedure involves initial reduction of a mixture of anti-RBC and anti-Listeria antibodies followed by gradual re-oxidation of the reduced disulphides. This facilitates association of the separated antibody chains and formation of hybrid immunoglobulins with affinity for the L. monocytogenes and human RBC. The bispecific antibodies caused the agglutination of the RBCs only in the presence of L. monocytogenes cells. The agglutination process necessitated the specific presence of L. monocytogenes and the red colored clumps formed were readily visible with naked eyes. The RBC agglutination assay described here provides a remarkably simple approach for the rapid and highly specific screening of various pathogens in their biological niches.

  2. Rapid and Sensitive Detection of an Intracellular Pathogen in Human Peripheral Leukocytes with Hybridizing Magnetic Relaxation Nanosensors

    Science.gov (United States)

    Kaittanis, Charalambos; Boukhriss, Hamza; Santra, Santimukul; Naser, Saleh A.; Perez, J. Manuel

    2012-01-01

    Bacterial infections are still a major global healthcare problem. The quick and sensitive detection of pathogens responsible for these infections would facilitate correct diagnosis of the disease and expedite treatment. Of major importance are intracellular slow-growing pathogens that reside within peripheral leukocytes, evading recognition by the immune system and detection by traditional culture methods. Herein, we report the use of hybridizing magnetic nanosensors (hMRS) for the detection of an intracellular pathogen, Mycobacterium avium spp. paratuberculosis (MAP). The hMRS are designed to bind to a unique genomic sequence found in the MAP genome, causing significant changes in the sample’s magnetic resonance signal. Clinically relevant samples, including tissue and blood, were screened with hMRS and results were compared with traditional PCR analysis. Within less than an hour, the hMRS identified MAP-positive samples in a library of laboratory cultures, clinical isolates, blood and homogenized tissues. Comparison of the hMRS with culture methods in terms of prediction of disease state revealed that the hMRS outperformed established culture methods, while being significantly faster (1 hour vs 12 weeks). Additionally, using a single instrument and one nanoparticle preparation we were able to detect the intracellular bacterial target in clinical samples at the genomic and epitope levels. Overall, since the nanoparticles are robust in diverse environmental settings and substantially more affordable than PCR enzymes, the potential clinical and field-based use of hMRS in the multiplexed identification of microbial pathogens and other disease-related biomarkers via a single, deployable instrument in clinical and complex environmental samples is foreseen. PMID:22496916

  3. Rapid and sensitive detection of an intracellular pathogen in human peripheral leukocytes with hybridizing magnetic relaxation nanosensors.

    Directory of Open Access Journals (Sweden)

    Charalambos Kaittanis

    Full Text Available Bacterial infections are still a major global healthcare problem. The quick and sensitive detection of pathogens responsible for these infections would facilitate correct diagnosis of the disease and expedite treatment. Of major importance are intracellular slow-growing pathogens that reside within peripheral leukocytes, evading recognition by the immune system and detection by traditional culture methods. Herein, we report the use of hybridizing magnetic nanosensors (hMRS for the detection of an intracellular pathogen, Mycobacterium avium spp. paratuberculosis (MAP. The hMRS are designed to bind to a unique genomic sequence found in the MAP genome, causing significant changes in the sample's magnetic resonance signal. Clinically relevant samples, including tissue and blood, were screened with hMRS and results were compared with traditional PCR analysis. Within less than an hour, the hMRS identified MAP-positive samples in a library of laboratory cultures, clinical isolates, blood and homogenized tissues. Comparison of the hMRS with culture methods in terms of prediction of disease state revealed that the hMRS outperformed established culture methods, while being significantly faster (1 hour vs 12 weeks. Additionally, using a single instrument and one nanoparticle preparation we were able to detect the intracellular bacterial target in clinical samples at the genomic and epitope levels. Overall, since the nanoparticles are robust in diverse environmental settings and substantially more affordable than PCR enzymes, the potential clinical and field-based use of hMRS in the multiplexed identification of microbial pathogens and other disease-related biomarkers via a single, deployable instrument in clinical and complex environmental samples is foreseen.

  4. Diagnostic accuracy of the ROCHE Septifast PCR system for the rapid detection of blood pathogens in neonatal sepsis-A prospective clinical trial.

    Science.gov (United States)

    Straub, Julia; Paula, Helga; Mayr, Michaela; Kasper, David; Assadian, Ojan; Berger, Angelika; Rittenschober-Böhm, Judith

    2017-01-01

    Diagnosis of neonatal sepsis remains a major challenge in neonatology. Most molecular-based methods are not customized for neonatal requirements. The aim of the present study was to assess the diagnostic accuracy of a modified multiplex PCR protocol for the detection of neonatal sepsis using small blood volumes. 212 episodes of suspected neonatal late onset sepsis were analyzed prospectively using the Roche SeptiFast® MGRADE PCR with a modified DNA extraction protocol and software-handling tool. Results were compared to blood culture, laboratory biomarkers and clinical signs of sepsis. Of 212 episodes, 85 (40.1%) were categorized as "not infected". Among these episodes, 1 was false positive by blood culture (1.2%) and 23 were false positive by PCR (27.1%). Of 51 (24.1%) episodes diagnosed as "culture proven sepsis", the same pathogen was detected by blood culture and PCR in 39 episodes (76.5%). In 8 episodes, more pathogens were detected by PCR compared to blood culture, and in 4 episodes the pathogen detected by blood culture was not found by PCR. One of these episodes was caused by Bacillus cereus, a pathogen not included in the PCR panel. In 76/212 (35.8%) episodes, clinical sepsis was diagnosed. Among these, PCR yielded positive results in 39.5% of episodes (30/76 episodes). For culture-positive sepsis, PCR showed a sensitivity of 90.2% (95%CI 86.2-94.2%) and a specificity of 72.9% (95%CI 67.0-79.0%). The Roche SeptiFast® MGRADE PCR using a modified DNA extraction protocol showed acceptable results for rapid detection of neonatal sepsis in addition to conventional blood culture. The benefit of rapid pathogen detection has to be balanced against the considerable risk of contamination, loss of information on antibiotic sensitivity pattern and increased costs.

  5. Molecular detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann

    of these pathogens in the food chain, in order to improve intervention strategies and make more effective the control of production lines and single food items. To serve this purpose, rapid and reliable detection and quantification methods are imperative. The culture-based standard methods currently applied......Val in comparative and collaborative trials and was approved as an alternative method for detection of Salmonella in chicken neck skin, minced meat and pig carcass swabs. In conclusion, this thesis presents the development and validation of real-time PCR methods for detection of Salmonella and Campylobacter...

  6. Development of Loop-Mediated Isothermal Amplification (LAMP) assay for rapid detection of Fusarium oxysporum f. sp. ciceris - wilt pathogen of chickpea.

    Science.gov (United States)

    Ghosh, Raju; Nagavardhini, Avuthu; Sengupta, Anindita; Sharma, Mamta

    2015-02-11

    Fusarium oxysporum f. sp. ciceris (Foc), the causal agent of Fusarium wilt is a devastating pathogen of chickpea. In chickpea, various soil borne pathogens produce (s) similar symptoms, therefore cannot be distinguished easily at field level. There is real need for a rapid, inexpensive, and easy to operate and maintain genotyping tool to facilitate accurate disease diagnosis and surveillance for better management of Fusarium wilt outbreaks. In this study, we developed a loop-mediated isothermal amplification (LAMP) assay targeting the elongation factor 1 alpha gene sequence for visual detection of Foc. The LAMP reaction was optimal at 63°C for 60 min. When hydroxynaphthol blue (HNB) was added before amplification, samples with Foc DNA developed a characteristic sky blue colour but those without DNA or with the DNA of six other plant pathogenic fungi did not. Results obtained with LAMP and HNB were confirmed when LAMP products were subjected to gel electrophoresis. The detection limit of this LAMP assay for Foc was 10 fg of genomic DNA per reaction, while that of conventional PCR was 100 pg. In conclusion, it was found that a LAMP assay combined with HNB is simple, rapid, sensitive, and specific. The LAMP assay does not require specialized equipment, hence can be used in the field for the rapid detection of Foc. This is the first report of the use of LAMP assay for the detection of Foc. The presented LAMP method provides a specific, sensitive and rapid diagnostic tool for the distinction of Foc, with the potential to be standardized as a detection method for Foc in endemic areas and will be very useful for monitoring the disease complex in the field further suggesting the management strategies.

  7. APDS: Autonomous Pathogen Detection System

    Energy Technology Data Exchange (ETDEWEB)

    Langlois, R G; Brown, S; Burris, L; Colston, B; Jones, L; Makarewicz, T; Mariella, R; Masquelier, D; McBride, M; Milanovich, F; Masarabadi, S; Venkateswaran, K; Marshall, G; Olson, D; Wolcott, D

    2002-02-14

    An early warning system to counter bioterrorism, the Autonomous Pathogen Detection System (APDS) continuously monitors the environment for the presence of biological pathogens (e.g., anthrax) and once detected, it sounds an alarm much like a smoke detector warns of a fire. Long before September 11, 2001, this system was being developed to protect domestic venues and events including performing arts centers, mass transit systems, major sporting and entertainment events, and other high profile situations in which the public is at risk of becoming a target of bioterrorist attacks. Customizing off-the-shelf components and developing new components, a multidisciplinary team developed APDS, a stand-alone system for rapid, continuous monitoring of multiple airborne biological threat agents in the environment. The completely automated APDS samples the air, prepares fluid samples in-line, and performs two orthogonal tests: immunoassay and nucleic acid detection. When compared to competing technologies, APDS is unprecedented in terms of flexibility and system performance.

  8. Surface-Modified Cobalt Ferrite Nanoparticles for Rapid Capture, Detection, and Removal of Pathogens: a Potential Material for Water Purification.

    Science.gov (United States)

    Bohara, Raghvendra A; Throat, Nanasaheb D; Mulla, Nayeem A; Pawar, Shivaji H

    2017-06-01

    Enteric infections resulting from the consumption of contaminated drinking water, inadequate supply of water for personal hygiene, and poor sanitation take a heavy toll worldwide, and developing countries are the major sufferers. Consumption of microbiologically contaminated water leads to diseases such as amoebiasis, cholera, shigellosis, typhoid, and viral infections leading to gastroenteritis and hepatitis B. The present investigation deals with the development of effective method to capture and eliminate microbial contamination of water and improve the quality of water and thus decreasing the contaminated waterborne infections. Over the last decade, numerous biomedical applications have emerged for magnetic nanoparticles (MNPs) specifically iron oxide nanoparticles. For the first time, we have explored functionalized cobalt ferrite nanoparticles (NPs) for capture and detection of pathogens. The captured bacterial were separated by using simple magnet. To begin with, the prepared NPs were confirmed for biocompatibility study and further used for their ability to detect the bacteria in solution. For this, standard bacterial concentrations were prepared and used to confirm the ability of these particles to capture and detect the bacteria. The effect of particle concentration, time, and pH has been studied, and the respective results have been discussed. It is observed that the presence of amine group on the surface of NPs shows nonspecific affinity and capability to capture Escherichia coli and Staphylococcus aureus. The possible underlying mechanism is discussed in the present manuscript. Based upon this, the present material can be considered for large-scale bacteria capture in water purification application.

  9. Rapid detection and typing of pathogenic nonpneumophila Legionella spp. isolates using a multiplex real-time PCR assay.

    Science.gov (United States)

    Benitez, Alvaro J; Winchell, Jonas M

    2016-04-01

    We developed a single tube multiplex real-time PCR assay that allows for the rapid detection and typing of 9 nonpneumophila Legionella spp. isolates that are clinically relevant. The multiplex assay is capable of simultaneously detecting and discriminating L. micdadei, L. bozemanii, L. dumoffii, L. longbeachae, L. feeleii, L. anisa, L. parisiensis, L. tucsonensis serogroup (sg) 1 and 3, and L. sainthelensis sg 1 and 2 isolates. Evaluation of the assay with nucleic acid from each of these species derived from both clinical and environmental isolates and typing strains demonstrated 100% sensitivity and 100% specificity when tested against 43 other Legionella spp. Typing of L. anisa, L. parisiensis, and L. tucsonensis sg 1 and 3 isolates was accomplished by developing a real-time PCR assay followed by high-resolution melt (HRM) analysis targeting the ssrA gene. Further typing of L. bozemanii, L. longbeachae, and L. feeleii isolates to the serogroup level was accomplished by developing a real-time PCR assay followed by HRM analysis targeting the mip gene. When used in conjunction with other currently available diagnostic tests, these assays may aid in rapidly identifying specific etiologies associated with Legionella outbreaks, clusters, sporadic cases, and potential environmental sources. Published by Elsevier Inc.

  10. Rapid detection and statistical differentiation of KPC gene variants in Gram-negative pathogens by use of high-resolution melting and ScreenClust analyses.

    Science.gov (United States)

    Roth, Amanda L; Hanson, Nancy D

    2013-01-01

    In the United States, the production of the Klebsiella pneumoniae carbapenemase (KPC) is an important mechanism of carbapenem resistance in Gram-negative pathogens. Infections with KPC-producing organisms are associated with increased morbidity and mortality; therefore, the rapid detection of KPC-producing pathogens is critical in patient care and infection control. We developed a real-time PCR assay complemented with traditional high-resolution melting (HRM) analysis, as well as statistically based genotyping, using the Rotor-Gene ScreenClust HRM software to both detect the presence of bla(KPC) and differentiate between KPC-2-like and KPC-3-like alleles. A total of 166 clinical isolates of Enterobacteriaceae, Pseudomonas aeruginosa, and Acinetobacter baumannii with various β-lactamase susceptibility patterns were tested in the validation of this assay; 66 of these organisms were known to produce the KPC β-lactamase. The real-time PCR assay was able to detect the presence of bla(KPC) in all 66 of these clinical isolates (100% sensitivity and specificity). HRM analysis demonstrated that 26 had KPC-2-like melting peak temperatures, while 40 had KPC-3-like melting peak temperatures. Sequencing of 21 amplified products confirmed the melting peak results, with 9 isolates carrying bla(KPC-2) and 12 isolates carrying bla(KPC-3). This PCR/HRM assay can identify KPC-producing Gram-negative pathogens in as little as 3 h after isolation of pure colonies and does not require post-PCR sample manipulation for HRM analysis, and ScreenClust analysis easily distinguishes bla(KPC-2-like) and bla(KPC-3-like) alleles. Therefore, this assay is a rapid method to identify the presence of bla(KPC) enzymes in Gram-negative pathogens that can be easily integrated into busy clinical microbiology laboratories.

  11. Multiplex PCR system for rapid detection of pathogens in patients with presumed sepsis - a systemic review and meta-analysis.

    Directory of Open Access Journals (Sweden)

    Shy-Shin Chang

    Full Text Available BACKGROUND: Blood culture is viewed as the golden standard for the diagnosis of sepsis but suffers from low sensitivity and long turnaround time. LightCycler SeptiFast (LC-SF is a real-time multiplex polymerase chain reaction test able to detect 25 common pathogens responsible for bloodstream infections within hours. We aim to assess the accuracy of LC-SF by systematically reviewing the published studies. METHOD: Related literature on Medline, Embase, and Cochrane databases was searched up to October 2012 for studies utilizing LC-SF to diagnose suspected sepsis and that provided sufficient data to construct two-by-two tables. RESULTS: A total of 34 studies enrolling 6012 patients of suspected sepsis were included. The overall sensitivity and specificity for LC-SF to detect bacteremia or fungemia was 0·75 (95% CI: 0·65-0·83 and 0·92 (95%CI:0·90-0·95, respectively. LC-SF had a high positive likelihood ratio (10·10 and a moderate negative likelihood ratio (0·27. Specifically, LC-SF had a sensitivity of 0·80 (95%CI: 0·70-0·88 and a specificity of 0·95(95%CI: 0·93-0·97 for the bacteremia outcome, and a sensitivity of 0·61 (95%CI: 0·48-0·72 and a specificity of 0·99 (95%CI: 0·99-0·99 for the fungemia outcome. High heterogeneity was found in the bacteremia outcome subgroup but not in the fungemia outcome subgroup. CONCLUSION: LC-SF is of high rule-in value for early detection of septic patients. In a population with low pretest probability, LC-SF test can still provide valuable information for ruling out bacteremia or fungemia.

  12. Protecting drinking water: Rapid detection of human fecal contamination, injured and non-culturable pathogenic microbes in water systems

    Energy Technology Data Exchange (ETDEWEB)

    White, D.C.; Nivens, D.E.; Arrage, A.A.; Appelgate, B.M.; Reardon, S.R.; Sayler, G.S.

    1996-05-01

    The rapid, potentially-automatable extraction of filter retentates has allowed quantitative detection of the unique biomarker for human fecal contamination, coprostanol, and the signature lipid biomarkers for total cellular biomass, viable cellular biomass, lipopolysaccharide (endotoxin). This method may be integrated with DNA based gene probe analysis for specific strains and enzyme activities. Not only does the analysis provide for detection of injured and non-culturable microbes but it also provides biomarkers characteristic of microbes exposed to biocides and disinfectants that can be utilized to monitor effectiveness of water mitigation/treatment. The analysis schemes involve filtration of the water or direct extraction of biofilms in sidestream chambers, supercritical fluid and/or liquid extraction, derivatization, and analysis of ``signature`` patterns by gas chromatography/mass spectrometry. Signature lipid biomarkers of interest are diglycerides, steroids including coprostanol and its isomers, poly-{beta}- hydroxyalcanoates (PHA), phospholipid ester-linked fatty acids (PLFA), and the lipopolysaccharide lipid A hydroxy fatty acids. PLFA found in polar lipid fractions estimate total viable cellular biomass, whereas the total cellular biomass can be calculated from diglyceride/phospholipid ester-linked fatty acids ratios. Furthermore, direct evidence of mitigation/treatment effectiveness can be ascertained by detection of diglycerides, respiratory quinones, PHA, and PLFA markers indicative of metabolic stress and toxicity such as trans monoenoic PLFA as well as oxirane and dicarboxylic fatty acids derived from the PLFA.

  13. Evaluation of the line probe assay for the rapid detection of bacterial meningitis pathogens in cerebrospinal fluid samples from children.

    Science.gov (United States)

    Soysal, Ahmet; Toprak, Demet Gedikbasi; Türkoğlu, Salih; Bakir, Mustafa

    2017-01-11

    The aim of this study is to compare the diagnostic performance of the line probe assay (LPA) with conventional multiplex polymerase chain reaction (PCR) for Streptococcus pneumoniae as well as real-time PCR for Neisseria meningitidis and Haemophilus influenzae type b (Hib) in cerebrospinal fluid (CSF) samples from children during the multicenter national surveillance of bacterial meningitis between the years 2006 and 2009 in Turkey. During the study period 1460 subjects were enrolled and among them 841 (57%) met the criteria for probable bacterial meningitis. The mean age of subjects was 51 ± 47 months (range, 1-212 months). We performed the line probe assay in 751 (89%) CSF samples of 841 probable bacterial meningitis cases, of whom 431 (57%) were negative, 127 (17%) were positive for S. pneumoniae, 53 (7%) were positive for H. influenzae type b, and 41 (5%) were positive for N. meningitidis. The LPA was positive in 19 of 23 (82%) S. pneumoniae samples, 4 of 6 (67%) N. meningitidis samples and 2 of 2 (100%) Hib samples in CSF culture-positive cases. The specificity of the LPA for all of S. pneumoniae, H. influenzae type b, and N. meningitidis was 88% (95% CI: 85-91%), when using the standard PCR as a reference. The specificity of LPA for each of S. pneumoniae, H. influenzae type b, and N. meningitidis was 93% (95% CI: 89-95%), 96% (95% CI: 94-98%), and 99% (95% CI: 97-99%), respectively. For all of S. pneumoniae, H. influenzae type b and N. meningitidis the sensitivity of the LPA was 76% (95% CI: 70-82%) and for each of S. pneumoniae, H. influenzae type b and N. meningitidis was 72% (95% CI:63-79%), 88% (95% CI: 73-95%), and 81% (95% CI:67-92%), respectively. The LPA assay can be used to detect common bacterial meningitis pathogens in CSF samples, but the assay requires further improvement.

  14. Molecular detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann

    Salmonella and Campylobacter are recognised as some of the most important foodborne pathogens worldwide. Human infections have wide health and socioeconomic consequences. Lots of effort has been devoted to increase the knowledge on the prevalence, transmission routes and persistence of these path......Salmonella and Campylobacter are recognised as some of the most important foodborne pathogens worldwide. Human infections have wide health and socioeconomic consequences. Lots of effort has been devoted to increase the knowledge on the prevalence, transmission routes and persistence...... of these pathogens in the food chain, in order to improve intervention strategies and make more effective the control of production lines and single food items. To serve this purpose, rapid and reliable detection and quantification methods are imperative. The culture-based standard methods currently applied...... in an optimization strategy. Finally, the real-time PCR method was evaluated for direct quantification of Campylobacter in chicken carcass rinse samples. A propidium monoazide (PMA) sample treatment was incorporated into the method, enabling PCR detection of viable Campylobacter only. A strong correlation (R2 = 0...

  15. A rapid method for the detection of foodborne pathogens by extraction of a trace amount of DNA from raw milk based on label-free amino-modified silica-coated magnetic nanoparticles and polymerase chain reaction

    Science.gov (United States)

    A method based on amino-modified silica-coated magnetic nanoparticles (ASMNPs) and polymerase chain reaction (PCR) was developed to rapidly and sensitively detect foodborne pathogens in raw milk. After optimizing parameters such as pH, temperature, and time, a trace amount of genomic DNA of pathogen...

  16. A novel and simple cell-based detection system with a collagen-encapsulated B-lymphocyte cell line as a biosensor for rapid detection of pathogens and toxins.

    Science.gov (United States)

    Banerjee, Pratik; Lenz, Dominik; Robinson, Joseph Paul; Rickus, Jenna L; Bhunia, Arun K

    2008-02-01

    Cell-based biosensors (CBBs) are becoming important tools for biosecurity applications and rapid diagnostics in food microbiology for their unique capability of detecting physiologically hazardous materials. A multi-well plate-based biosensor containing B-cell hybridoma, Ped-2E9, encapsulated in type I collagen matrix, was developed for rapid detection of viable cells of pathogenic Listeria, the toxin listeriolysin O, and the enterotoxin from Bacillus species. This sensor measures the alkaline phosphatase release from infected Ped-2E9 cells colorimetrically. Pathogenic L. monocytogenes cells and toxin preparations from L. monocytogenes or B. cereus showed cytotoxicity ranging from 24 to 98% at 3-6 h postinfection. In contrast, nonpathogenic L. innocua (F4247) and B. subtilis induced minimal cytotoxicity, ranging only 0.4-7.6%. Laser scanning cytometry and cryo-nano scanning electron microscopy confirmed the live or dead status of the infected Ped-2E9 cells in gel matrix. This paper presents the first example of a cell-based sensing system using collagen-encapsulated mammalian cells for rapid detection of pathogenic bacteria or toxin, and demonstrates a potential for onsite use as a portable detection system.

  17. Light Scattering based detection of food pathogens

    Science.gov (United States)

    The current methods for detecting foodborne pathogens are mostly destructive (i.e., samples need to be pretreated), and require time, personnel, and laboratories for analyses. Optical methods including light scattering based techniques have gained a lot of attention recently due to its their rapid a...

  18. Multiplex detection of respiratory pathogens

    Energy Technology Data Exchange (ETDEWEB)

    McBride, Mary [Brentwood, CA; Slezak, Thomas [Livermore, CA; Birch, James M [Albany, CA

    2012-07-31

    Described are kits and methods useful for detection of respiratory pathogens (influenza A (including subtyping capability for H1, H3, H5 and H7 subtypes) influenza B, parainfluenza (type 2), respiratory syncytial virus, and adenovirus) in a sample. Genomic sequence information from the respiratory pathogens was analyzed to identify signature sequences, e.g., polynucleotide sequences useful for confirming the presence or absence of a pathogen in a sample. Primer and probe sets were designed and optimized for use in a PCR based, multiplexed Luminex assay to successfully identify the presence or absence of pathogens in a sample.

  19. A rapid, highly sensitive and culture-free detection of pathogens from whole blood by removal of white blood cells using immuno-magnetic beads.

    Science.gov (United States)

    Vutukuru, Manjula Ramya; Sharma, Divya Khandige; Ms, Ragavendar; Mitra, Nivedita

    2016-08-01

    Using anti-human CD45 antibody coated beads, we show a 98% reduction of WBCs from spiked blood samples in 1h, thereby enriching it for pathogens. This enrichment allowed the detection of blood using quantitative PCR; something not observed in unenriched samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Rapid Detection of Bloodstream Pathogens in Liver Transplantation Patients With FilmArray Multiplex Polymerase Chain Reaction Assays: Comparison With Conventional Methods.

    Science.gov (United States)

    Otlu, B; Bayindir, Y; Ozdemir, F; Ince, V; Cuglan, S; Hopoglu, M; Yakupogullari, Y; Kizilkaya, C; Kuzucu, C; Isık, B; Yilmaz, S

    2015-01-01

    Bloodstream infection (BSI) is an important concern in transplant patients. Early intervention with appropriate antimicrobial therapy is critical to better clinical outcome; however, there is significant delay when conventional identification methods are used. We aimed to determine the diagnostic performance of the FilmArray Blood Culture Identification Panel, a recently approved multiplex polymerase chain reaction assay detecting 24 BSI pathogens and 3 resistance genes, in comparison with the performances of conventional identification methods in liver transplant (LT) patients. A total of 52 defined sepsis episodes (signal-positive by blood culture systems) from 45 LT patients were prospectively studied. The FilmArray successfully identified 37 of 39 (94.8%) bacterial and 3 of 3 (100%) yeast pathogens in a total of 42 samples with microbial growth, failing to detect only 2 of 39 (5.1%) bacterial pathogens that were not covered by the test panel. The FilmArray could also detect additional pathogens in 3 samples that had been reported as having monomicrobial growth, and it could detect Acinetobacter baumannii in 2 samples suspected of skin flora contamination. The remaining 8 blood cultures showing a positive signal but yielding no growth were also negative by this assay. Results of MecA, KPC, and VanA/B gene detection were in high accordance. The FilmArray produced results with significantly shorter turnaround times (1.33 versus 36.2, 23.6, and 19.5 h; P FilmArray appeared as a reliable alternative diagnostic method with the potential to mitigate problems with protracted diagnosis of the BSI pathogens in LT patients. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Molecular detection of human bacterial pathogens

    National Research Council Canada - National Science Library

    Liu, Dongyou

    2011-01-01

    .... Molecular Detection of Human Bacterial Pathogens addresses this issue, with international scientists in respective bacterial pathogen research and diagnosis providing expert summaries on current...

  2. Continuous-Flow Detector for Rapid Pathogen Identification

    Energy Technology Data Exchange (ETDEWEB)

    Barrett, Louise M. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics; Skulan, Andrew J. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics; Singh, Anup K. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics; Cummings, Eric B. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics; Fiechtner, Gregory J. [Sandia National Lab. (SNL-CA), Livermore, CA (United States). Microfluidics

    2006-09-01

    This report describes the continued development of a low-power, portable detector for the rapid identification of pathogens such as B. anthracis and smallpox. Based on our successful demonstration of the continuous filter/concentrator inlet, we believe strongly that the inlet section will enable differentiation between viable and non-viable populations, between types of cells, and between pathogens and background contamination. Selective, continuous focusing of particles in a microstream enables highly selective and sensitive identification using fluorescently labeled antibodies and other receptors such as peptides, aptamers, or small ligands to minimize false positives. Processes such as mixing and lysing will also benefit from the highly localized particle streams. The concentrator is based on faceted prisms to contract microfluidic flows while maintaining uniform flowfields. The resulting interfaces, capable of high throughput, serve as high-, low-, and band-pass filters to direct selected bioparticles to a rapid, affinity-based detection system. The proposed device is superior to existing array-based detectors as antibody-pathogen binding can be accomplished in seconds rather than tens of minutes or even hours. The system is being designed to interface with aerosol collectors under development by the National Laboratories or commercial systems. The focused stream is designed to be interrogated using diode lasers to differentiate pathogens by light scattering. Identification of particles is done using fluorescently labeled antibodies to tag the particles, followed by multiplexed laser-induced fluorescence (LIF) detection (achieved by labeling each antibody with a different dye).

  3. The Autonomous Pathogen Detection System

    Energy Technology Data Exchange (ETDEWEB)

    Dzenitis, J M; Makarewicz, A J

    2009-01-13

    We developed, tested, and now operate a civilian biological defense capability that continuously monitors the air for biological threat agents. The Autonomous Pathogen Detection System (APDS) collects, prepares, reads, analyzes, and reports results of multiplexed immunoassays and multiplexed PCR assays using Luminex{copyright} xMAP technology and flow cytometer. The mission we conduct is particularly demanding: continuous monitoring, multiple threat agents, high sensitivity, challenging environments, and ultimately extremely low false positive rates. Here, we introduce the mission requirements and metrics, show the system engineering and analysis framework, and describe the progress to date including early development and current status.

  4. Molecular detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann

    Salmonella and Campylobacter are recognised as some of the most important foodborne pathogens worldwide. Human infections have wide health and socioeconomic consequences. Lots of effort has been devoted to increase the knowledge on the prevalence, transmission routes and persistence of these path......Salmonella and Campylobacter are recognised as some of the most important foodborne pathogens worldwide. Human infections have wide health and socioeconomic consequences. Lots of effort has been devoted to increase the knowledge on the prevalence, transmission routes and persistence......), Scorpion and TaqMan probes. The LNA probe was shown to be the most sensitive probe chemistry in the real-time PCR assay for detection of Campylobacter, producing the highest amplification efficiency. Choice of probe chemistry was found to impact the sensitivity of PCR assays, and should be considered...... of the VBNC state, and would thus be able to assess the outcome and impact of increasingly applied post-slaughter reduction strategies. A real-time PCR-based method for detection of Salmonella was optimized following a diversified approach to enable the shortest time of analysis possible. Positive effects...

  5. The FilmArray® respiratory panel: an automated, broadly multiplexed molecular test for the rapid and accurate detection of respiratory pathogens.

    Science.gov (United States)

    Babady, N Esther

    2013-11-01

    The FilmArray Respiratory Panel (RP) (BioFire(™) Diagnostics, Inc., Salt Lake City, UT, USA) is the first multiplex molecular panel cleared by the US FDA for the detection of both bacterial and viral respiratory pathogens in nasopharygeal swabs. The FilmArray RP targets 20 pathogens including 17 viruses and subtypes and three bacteria, and is performed with minimal sample manipulation. The FilmArray RP has a fully automated sample-to-answer workflow with a turn-around-time of approximately 1 h. The reported sensitivity and specificity of the assay ranges from 80 to 100 and 100%, respectively, with the sensitivity for the adenovirus as low as 46%. A new version of the FilmArray RP assay (version 1.7) with improved sensitivity for the adenovirus was released in 2013. The performance characteristics and simplified workflow have allowed its implementation in a wide range of laboratories. The FilmArray RP has changed the diagnostic landscape and will have a significant impact on the care of patients with respiratory tract infection.

  6. Aptamer-Based Technologies in Foodborne Pathogen Detection.

    Science.gov (United States)

    Teng, Jun; Yuan, Fang; Ye, Yingwang; Zheng, Lei; Yao, Li; Xue, Feng; Chen, Wei; Li, Baoguang

    2016-01-01

    Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX); and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make the accurate assessments on the risks of infections (humans and animals) or contaminations (foods and other commodities) caused by various pathogens. This article reviews the development in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development in aptamer-based biosensors including optical biosensors for multiple pathogen detection by multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors and lateral chromatography test strips, and their applications in pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening remain to be overcome.

  7. Aptamer-Based Technologies in Foodborne Pathogen Detection

    Directory of Open Access Journals (Sweden)

    Jun Teng

    2016-09-01

    Full Text Available Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX; and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the first and critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make to accurate assessments on the risk of infections (humans and animals or contaminations (foods and other commodities caused by various pathogens. This article reviews the developments in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development of aptamer-based biosensors including optical biosensors for multiple pathogen detection in multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors, and lateral chromatography test strips, and their applications in the pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening, remain to be overcome.

  8. Multiplex detection of plant pathogens using a microsphere immunoassay technology.

    Directory of Open Access Journals (Sweden)

    Ratthaphol Charlermroj

    Full Text Available Plant pathogens are a serious problem for seed export, plant disease control and plant quarantine. Rapid and accurate screening tests are urgently required to protect and prevent plant diseases spreading worldwide. A novel multiplex detection method was developed based on microsphere immunoassays to simultaneously detect four important plant pathogens: a fruit blotch bacterium Acidovorax avenae subsp. citrulli (Aac, chilli vein-banding mottle virus (CVbMV, potyvirus, watermelon silver mottle virus (WSMoV, tospovirus serogroup IV and melon yellow spot virus (MYSV, tospovirus. An antibody for each plant pathogen was linked on a fluorescence-coded magnetic microsphere set which was used to capture corresponding pathogen. The presence of pathogens was detected by R-phycoerythrin (RPE-labeled antibodies specific to the pathogens. The assay conditions were optimized by identifying appropriate antibody pairs, blocking buffer, concentration of RPE-labeled antibodies and assay time. Once conditions were optimized, the assay was able to detect all four plant pathogens precisely and accurately with substantially higher sensitivity than enzyme-linked immunosorbent assay (ELISA when spiked in buffer and in healthy watermelon leaf extract. The assay time of the microsphere immunoassay (1 hour was much shorter than that of ELISA (4 hours. This system was also shown to be capable of detecting the pathogens in naturally infected plant samples and is a major advancement in plant pathogen detection.

  9. Biosensors for the Detection of Food Pathogens.

    Science.gov (United States)

    Poltronieri, Palmiro; Mezzolla, Valeria; Primiceri, Elisabetta; Maruccio, Giuseppe

    2014-09-02

    Food pathogens frequently cause foodborne diseases. There is a need to rapidly identify the source of the bacteria in order to contain their spread and epidemics. A pre-enrichment culture or a direct culture on agar plate are standard microbiological methods. In this review, we present an update on alternative molecular methods to nucleic acid-based detection for species identification. Biosensor-based methods rely on the recognition of antigen targets or receptors by antibodies, aptamers or high-affinity ligands. The captured antigens may be then directly or indirectly detected through an antibody or high-affinity and high-specificity recognition molecule. Various different detection methods are discussed, from label-free sensors and immunosensors to fluorescence-based ones. Each method shows advantages and disadvantages in terms of equipment, sensitivity, simplicity and cost-effectiveness. Finally, lab-on-a-chip (LOC) devices are introduced briefly, with the potential to be fast, sensitive and useful for on-site bacteria detection in food processing laboratories to check potential contamination by sample monitoring combined with a rapid pre-enrichment step.

  10. Biosensors for the Detection of Food Pathogens

    Directory of Open Access Journals (Sweden)

    Palmiro Poltronieri

    2014-09-01

    Full Text Available Food pathogens frequently cause foodborne diseases. There is a need to rapidly identify the source of the bacteria in order to contain their spread and epidemics. A pre-enrichment culture or a direct culture on agar plate are standard microbiological methods. In this review, we present an update on alternative molecular methods to nucleic acid-based detection for species identification. Biosensor-based methods rely on the recognition of antigen targets or receptors by antibodies, aptamers or high-affinity ligands. The captured antigens may be then directly or indirectly detected through an antibody or high-affinity and high-specificity recognition molecule. Various different detection methods are discussed, from label-free sensors and immunosensors to fluorescence-based ones. Each method shows advantages and disadvantages in terms of equipment, sensitivity, simplicity and cost-effectiveness. Finally, lab-on-a-chip (LOC devices are introduced briefly, with the potential to be fast, sensitive and useful for on-site bacteria detection in food processing laboratories to check potential contamination by sample monitoring combined with a rapid pre-enrichment step.

  11. Field application of pathogen detection technologies

    Energy Technology Data Exchange (ETDEWEB)

    Straub, Tim M.; Call, Douglas R.; Bruckner-Lea, Cindy J.; Colburn, Heather A.; Baird, Cheryl L.; Bartholomew, Rachel A.; Ozanich, Richard M.; Jarman, Kristin H.

    2016-06-29

    Over the last 10 years there has been a significant increase in commercial products designed for field-based detection of microbial pathogens. This is due, in part, to the anthrax attacks in the United States in 2001, and the need for first responders to quickly identify the composition of suspected white powders and other potential biothreats. Demand for rapid detection is also driven by the need to ensure safe food, water, and environmental systems. From a technology perspective, rapid identification methods have largely capitalized on PCR and other molecular recognition techniques that can be deployed as robust field instrumentation. Examples of the relevant needs include the ability to: 1) declare a water distribution system free of microbial pathogens after a pipe/main break repair; 2) assess risks of contamination such as when produce production and processing plants are located near concentrated animal feeing operations; 3) evaluate the safety of ready-to-eat products; 4) determine the extent of potential serious disease outbreaks in remote and/or disaster stricken areas where access to clinical laboratories is not an immediate option; and 5) quickly assess credible biological terrorism events. Many of the principles underlying rapid detection methods are derived from methods for environmental microbiology, but there is a dearth of literature describing and evaluating field-based detection systems. Thus, the aims of this chapter are to: 1) summarize the different kinds of commercially available sampling kits and field-based biological detectors; 2) highlight some of the continued challenges of sample preparation to stimulate new research towards minimizing the impact of inhibitors on PCR-based detection systems; 3) describe our general rationale and statistically-based approach for instrument evaluation; 4) provide statistical and spatial guidelines for developing valid sampling plans; and 5) summarize some current needs and emerging technologies. This

  12. Emerging technologies for rapid identification of bloodstream pathogens.

    Science.gov (United States)

    Kothari, Atul; Morgan, Margie; Haake, David A

    2014-07-15

    Technologies for rapid microbial identification are poised to revolutionize clinical microbiology and enable informed decision making for patients with life-threatening bloodstream infections. Species identification of microorganisms in positive blood cultures can be performed in minutes using commercial fluorescence in situ hybridization tests or mass spectroscopy. Microorganisms in positive blood cultures can also be identified within 1-2.5 hours using automated polymerase chain reaction-based systems that can also detect selected antibiotic resistance markers, such as methicillin resistance. When combined with antibiotic stewardship programs, these approaches improve clinical outcomes and reduce healthcare expenditures. Tests for direct detection in whole blood samples are highly desirable because of their potential to identify bloodstream pathogens without waiting 1-2 days for blood cultures to become positive. However, results for pathogen detection in whole blood do not overlap with those of conventional blood culture techniques and we are still learning how best to use these approaches. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  13. Multiplex Detection of Food-Borne Pathogens.

    Science.gov (United States)

    Villamizar-Rodríguez, Germán; Lombó, Felipe

    2017-01-01

    Detection of food-borne pathogens is traditionally carried out by plating out techniques in selective or differential media using Petri agar dishes or other culture-dependent methods, usually designed for each pathogen to be detected. These classical methods are time and personnel consuming and also may last for up to 5 days in the case of final confirmation of some specific pathogens.Here we describe a method for fast multiplex detection of nine food-borne pathogens (all species usually required under most countrylegislations) by means of a single multiplex PCR reaction coupled to a capillary electrophoresis detection, in just 2-2.5 h and with a minimum cost of around 2 € per sample and nine pathogens. This method saves consumables and personnel time and allows a faster detection of any possible contaminated food batches at industrial level, therefore helping to prevent future food-borne outbreaks at clinical level.

  14. Detection and characterization of foodborne pathogenic bacteria with hyperspectral microscope imaging

    Science.gov (United States)

    Rapid detection and identification of pathogenic microorganisms naturally occurring during food processing are important in developing intervention and verification strategies. In the poultry industry, contamination of poultry meat with foodborne pathogens (especially, Salmonella and Campylobacter) ...

  15. Digital PCR for detection of citrus pathogens

    Science.gov (United States)

    Citrus trees are often infected with multiple pathogens of economic importance, especially those with insect or mite vectors. Real-time/quantitative PCR (qPCR) has been used for high-throughput detection and relative quantification of pathogens; however, target reference or standards are required. I...

  16. Waterborne Pathogens: Detection Methods and Challenges

    Science.gov (United States)

    Ramírez-Castillo, Flor Yazmín; Loera-Muro, Abraham; Jacques, Mario; Garneau, Philippe; Avelar-González, Francisco Javier; Harel, Josée; Guerrero-Barrera, Alma Lilián

    2015-01-01

    Waterborne pathogens and related diseases are a major public health concern worldwide, not only by the morbidity and mortality that they cause, but by the high cost that represents their prevention and treatment. These diseases are directly related to environmental deterioration and pollution. Despite the continued efforts to maintain water safety, waterborne outbreaks are still reported globally. Proper assessment of pathogens on water and water quality monitoring are key factors for decision-making regarding water distribution systems’ infrastructure, the choice of best water treatment and prevention waterborne outbreaks. Powerful, sensitive and reproducible diagnostic tools are developed to monitor pathogen contamination in water and be able to detect not only cultivable pathogens but also to detect the occurrence of viable but non-culturable microorganisms as well as the presence of pathogens on biofilms. Quantitative microbial risk assessment (QMRA) is a helpful tool to evaluate the scenarios for pathogen contamination that involve surveillance, detection methods, analysis and decision-making. This review aims to present a research outlook on waterborne outbreaks that have occurred in recent years. This review also focuses in the main molecular techniques for detection of waterborne pathogens and the use of QMRA approach to protect public health. PMID:26011827

  17. Molecular detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann

    and Campylobacter. A conventional PCR-based method for detection of Campylobacter in chicken carcass rinse following 20 h of enrichment in Bolton broth was successfully compared to the ISO standard culture-based method (10272) on 68 naturally infected chickens. The method was subsequently validated on artificially...... artificially inoculated and 66 naturally infected chicken carcass rinse samples. The robustness, detection probability, precision, amplification efficiency and linear range of the method were evaluated on two different thermal cyclers, and the method was proven suitable for quantification. Furthermore...... in an optimization strategy. Finally, the real-time PCR method was evaluated for direct quantification of Campylobacter in chicken carcass rinse samples. A propidium monoazide (PMA) sample treatment was incorporated into the method, enabling PCR detection of viable Campylobacter only. A strong correlation (R2 = 0...

  18. Multilocus DNA Sequence Comparisons Rapidly Identify Pathogenic Molds

    Science.gov (United States)

    Rakeman, Jennifer L.; Bui, Uyen; LaFe, Karen; Chen, Yi-Ching; Honeycutt, Rhonda J.; Cookson, Brad T.

    2005-01-01

    The increasing incidence of opportunistic fungal infections necessitates rapid and accurate identification of the associated fungi to facilitate optimal patient treatment. Traditional phenotype-based identification methods utilized in clinical laboratories rely on the production and recognition of reproductive structures, making identification difficult or impossible when these structures are not observed. We hypothesized that DNA sequence analysis of multiple loci is useful for rapidly identifying medically important molds. Our study included the analysis of the D1/D2 hypervariable region of the 28S ribosomal gene and the internal transcribed spacer (ITS) regions 1 and 2 of the rRNA operon. Two hundred one strains, including 143 clinical isolates and 58 reference and type strains, representing 43 recognized species and one possible new species, were examined. We generated a phenotypically validated database of 118 diagnostic alleles. DNA length polymorphisms detected among ITS1 and ITS2 PCR products can differentiate 20 of 33 species of molds tested, and ITS DNA sequence analysis permits identification of all species tested. For 42 of 44 species tested, conspecific strains displayed >99% sequence identity at ITS1 and ITS2; sequevars were detected in two species. For all 44 species, identifications by genotypic and traditional phenotypic methods were 100% concordant. Because dendrograms based on ITS sequence analysis are similar in topology to 28S-based trees, we conclude that ITS sequences provide phylogenetically valid information and can be utilized to identify clinically important molds. Additionally, this phenotypically validated database of ITS sequences will be useful for identifying new species of pathogenic molds. PMID:16000456

  19. Automated Methods for Multiplexed Pathogen Detection

    Energy Technology Data Exchange (ETDEWEB)

    Straub, Tim M.; Dockendorff, Brian P.; Quinonez-Diaz, Maria D.; Valdez, Catherine O.; Shutthanandan, Janani I.; Tarasevich, Barbara J.; Grate, Jay W.; Bruckner-Lea, Cindy J.

    2005-09-01

    Detection of pathogenic microorganisms in environmental samples is a difficult process. Concentration of the organisms of interest also co-concentrates inhibitors of many end-point detection methods, notably, nucleic acid methods. In addition, sensitive, highly multiplexed pathogen detection continues to be problematic. The primary function of the BEADS (Biodetection Enabling Analyte Delivery System) platform is the automated concentration and purification of target analytes from interfering substances, often present in these samples, via a renewable surface column. In one version of BEADS, automated immunomagnetic separation (IMS) is used to separate cells from their samples. Captured cells are transferred to a flow-through thermal cycler where PCR, using labeled primers, is performed. PCR products are then detected by hybridization to a DNA suspension array. In another version of BEADS, cell lysis is performed, and community RNA is purified and directly labeled. Multiplexed detection is accomplished by direct hybridization of the RNA to a planar microarray. The integrated IMS/PCR version of BEADS can successfully purify and amplify 10 E. coli O157:H7 cells from river water samples. Multiplexed PCR assays for the simultaneous detection of E. coli O157:H7, Salmonella, and Shigella on bead suspension arrays was demonstrated for the detection of as few as 100 cells for each organism. Results for the RNA version of BEADS are also showing promising results. Automation yields highly purified RNA, suitable for multiplexed detection on microarrays, with microarray detection specificity equivalent to PCR. Both versions of the BEADS platform show great promise for automated pathogen detection from environmental samples. Highly multiplexed pathogen detection using PCR continues to be problematic, but may be required for trace detection in large volume samples. The RNA approach solves the issues of highly multiplexed PCR and provides ''live vs. dead

  20. SERS Detection of Multiple Antimicrobial-Resistant Pathogens Using Nanosensors.

    Science.gov (United States)

    Kearns, Hayleigh; Goodacre, Royston; Jamieson, Lauren E; Graham, Duncan; Faulds, Karen

    2017-12-05

    Successful pathogen detection is crucial for public health as the threat of infectious disease is dramatically increasing globally due to bacteria developing resistance to many antimicrobial drugs. The increase in bacterial infections has led to urgent demands for simpler, faster, and more reliable detection methods to be developed allowing the most appropriate therapy to be provided. Surface enhanced Raman scattering (SERS) is an analytical technique which has gained a great deal of interest for biosensing due to its sensitivity, selectivity, and multiplexing capabilities. A new bionanosensor has been developed for the isolation and detection of multiple bacterial pathogens via magnetic separation and SERS. This novel assay format involves using lectin functionalized magnetic nanoparticles for capture and isolation of bacteria from the sample matrix followed by specifically detecting bacterial pathogens using SERS active nanoparticles functionalized with antibodies which are strain specific. Therefore, the sample is captured using a "magnetic plug" and interrogated with a laser allowing simple and fast optical detection. Three bacterial pathogens (Escherichia coli, Salmonella typhimurium, and methicillin-resistant Staphylococcus aureus) were successfully isolated and detected, with the lowest concentration for each of the strains detected at just 101 colony forming units per mL (CFU/mL). In addition to single pathogen detection, a mixture of all three bacterial strains was isolated and identified within the same sample matrix using SERS with the triplex detection also being confirmed using principal component analysis. Herein, we demonstrate that this multiplexed bionanosensor is capable of providing rapid and sensitive discrimination of bacterial pathogens both individually, and within a multiplex system, offering opportunities for future point of care devices and advancements in biomedical applications.

  1. Human mobility networks and persistence of rapidly mutating pathogens

    CERN Document Server

    Aleta, Alberto; Meloni, Sandro; Poletto, Chiara; Colizza, Vittoria; Moreno, Yamir

    2016-01-01

    Rapidly mutating pathogens may be able to persist in the population and reach an endemic equilibrium by escaping hosts' acquired immunity. For such diseases, multiple biological, environmental and population-level mechanisms determine the dynamics of the outbreak, including pathogen's epidemiological traits (e.g. transmissibility, infectious period and duration of immunity), seasonality, interaction with other circulating strains and hosts' mixing and spatial fragmentation. Here, we study a susceptible-infected-recovered-susceptible model on a metapopulation where individuals are distributed in subpopulations connected via a network of mobility flows. Through extensive numerical simulations, we explore the phase space of pathogen's persistence and map the dynamical regimes of the pathogen following emergence. Our results show that spatial fragmentation and mobility play a key role in the persistence of the disease whose maximum is reached at intermediate mobility values. We describe the occurrence of differen...

  2. Advances and Challenges in Viability Detection of Foodborne Pathogens

    Directory of Open Access Journals (Sweden)

    Dexin Zeng

    2016-11-01

    Full Text Available Foodborne outbreaks are a serious public health and food safety concern worldwide. There is a great demand for rapid, sensitive, specific, and accurate methods to detect microbial pathogens in foods. Conventional methods based on cultivation of pathogens have been the gold standard protocols; however, they take up to a week to complete. Molecular assays such as polymerase chain reaction (PCR, sequencing, microarray technologies have been widely used in detection of foodborne pathogens. Among molecular assays, PCR technology conventional and real-time PCR (qPCR is most commonly used in the foodborne pathogen detection because of its high sensitivity and specificity. However, a major drawback of PCR is its inability to differentiate the DNA from dead and viable cells, and this is a critical factor for the food industry, regulatory agencies and the consumer. To remedy this shortcoming, researchers have used biological dyes such as ethidium monoazide (EMA and propidium monoazide (PMA to pretreat samples before DNA extraction to intercalate the DNA of dead cells in food samples, and then proceed with regular DNA preparation and qPCR. By combining PMA treatment with qPCR (PMA-qPCR, scientists have applied this technology to detect viable cells of various bacterial pathogens in foods. The incorporation of PMA into PCR-based assays for viability detection of pathogens in foods has increased significantly in the last decade. On the other hand, some downsides with this approach have been noted, particularly to achieve complete suppression of signal of DNA from the dead cells present in some particular food matrix. Nowadays, there is a tendency of more and more researchers adapting this approach for viability detection; and a few commercial kits based on PMA are available in the market. As time goes on, more scientists apply this approach to a broader range of pathogen detections, this viability approach (PMA or other chemicals such as platinum compound

  3. Quantitative multiplex detection of pathogen biomarkers

    Science.gov (United States)

    Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I; Martinez, Jennifer; Grace, Wynne K

    2014-10-14

    The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.

  4. Metagenomics for pathogen detection in public health

    Science.gov (United States)

    2013-01-01

    Traditional pathogen detection methods in public health infectious disease surveillance rely upon the identification of agents that are already known to be associated with a particular clinical syndrome. The emerging field of metagenomics has the potential to revolutionize pathogen detection in public health laboratories by allowing the simultaneous detection of all microorganisms in a clinical sample, without a priori knowledge of their identities, through the use of next-generation DNA sequencing. A single metagenomics analysis has the potential to detect rare and novel pathogens, and to uncover the role of dysbiotic microbiomes in infectious and chronic human disease. Making use of advances in sequencing platforms and bioinformatics tools, recent studies have shown that metagenomics can even determine the whole-genome sequences of pathogens, allowing inferences about antibiotic resistance, virulence, evolution and transmission to be made. We are entering an era in which more novel infectious diseases will be identified through metagenomics-based methods than through traditional laboratory methods. The impetus is now on public health laboratories to integrate metagenomics techniques into their diagnostic arsenals. PMID:24050114

  5. Quantitative multiplex detection of pathogen biomarkers

    Energy Technology Data Exchange (ETDEWEB)

    Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I.; Martinez, Jennifer; Grace, Wynne K.

    2016-02-09

    The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.

  6. Human mobility networks and persistence of rapidly mutating pathogens.

    Science.gov (United States)

    Aleta, Alberto; Hisi, Andreia N S; Meloni, Sandro; Poletto, Chiara; Colizza, Vittoria; Moreno, Yamir

    2017-03-01

    Rapidly mutating pathogens may be able to persist in the population and reach an endemic equilibrium by escaping hosts' acquired immunity. For such diseases, multiple biological, environmental and population-level mechanisms determine the dynamics of the outbreak, including pathogen's epidemiological traits (e.g. transmissibility, infectious period and duration of immunity), seasonality, interaction with other circulating strains and hosts' mixing and spatial fragmentation. Here, we study a susceptible-infected-recovered-susceptible model on a metapopulation where individuals are distributed in sub-populations connected via a network of mobility flows. Through extensive numerical simulations, we explore the phase space of pathogen's persistence and map the dynamical regimes of the pathogen following emergence. Our results show that spatial fragmentation and mobility play a key role in the persistence of the disease whose maximum is reached at intermediate mobility values. We describe the occurrence of different phenomena including local extinction and emergence of epidemic waves, and assess the conditions for large-scale spreading. Findings are highlighted in reference to previous studies and to real scenarios. Our work uncovers the crucial role of hosts' mobility on the ecological dynamics of rapidly mutating pathogens, opening the path for further studies on disease ecology in the presence of a complex and heterogeneous environment.

  7. RAPID DETECTION OF MICROBIAL CONTAMINATION IN GHANA ...

    African Journals Online (AJOL)

    2014-06-01

    Jun 1, 2014 ... pathogens in herbal medicines from Ghana. Methods: We employed different DNA extraction ... kits yielded significant amounts of DNA. PCR was able to detect pathogens present in the samples directly. ..... safety of dried spices and herbs from production and retail premises in the United Kingdom. Food.

  8. A new oligonucleotide microarray for detection of pathogenic and non-pathogenic Legionella spp.

    Science.gov (United States)

    Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei

    2014-01-01

    Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp.

  9. Detection of pathogens from periodontal lesions

    Directory of Open Access Journals (Sweden)

    Malheiros Veruska de João

    2004-01-01

    Full Text Available OBJECTIVE: To comparatively detect A. actinomycetemcomitans and F. nucleatum from periodontal and healthy sites. METHODS: Subgingival clinical samples from 50 periodontitis adult patients and 50 healthy subjects were analyzed. Both organisms were isolated using a trypticase soy agar-bacitracin-vancomycin (TSBV medium and detected by PCR. Conventional biochemical tests were used for bacteria identification. RESULTS: A. actinomycetemcomitans and F. nucleatum were isolated in 18% and 20% of the patients, respectively, and in 2% and 24% of healthy subjects. Among A. actinomycetemcomitans isolates, biotype II was the most prevalent. Primer pair AA was 100% sensitive in the detection of A. actinomycetemcomitans from both subject groups. Primers ASH and FU were also 100% sensitive to detect this organism in healthy subject samples. Primer pair FN5047 was more sensitive to detect F. nucleatum in patients or in healthy samples than primer 5059S. Primers ASH and 5059S were more specific in the detection of A. actinomycetemcomitans and F. nucleatum, respectively, in patients and in healthy subject samples. CONCLUSIONS: PCR is an effective tool for detecting periodontal pathogens in subgingival samples, providing a faster and safer diagnostic tool of periodontal diseases. The method's sensitivity and specificity is conditioned by the choice of the set of primers used.

  10. Rapid methods for detection of bacteria

    DEFF Research Database (Denmark)

    Corfitzen, Charlotte B.; Andersen, B.Ø.; Miller, M.

    2006-01-01

    Traditional methods for detection of bacteria in drinking water e.g. Heterotrophic Plate Counts (HPC) or Most Probable Number (MNP) take 48-72 hours to give the result. New rapid methods for detection of bacteria are needed to protect the consumers against contaminations. Two rapid methods...

  11. An integrated lab-on-chip for rapid identification and simultaneous differentiation of tropical pathogens.

    Science.gov (United States)

    Tan, Jeslin J L; Capozzoli, Monica; Sato, Mitsuharu; Watthanaworawit, Wanitda; Ling, Clare L; Mauduit, Marjorie; Malleret, Benoît; Grüner, Anne-Charlotte; Tan, Rosemary; Nosten, François H; Snounou, Georges; Rénia, Laurent; Ng, Lisa F P

    2014-01-01

    Tropical pathogens often cause febrile illnesses in humans and are responsible for considerable morbidity and mortality. The similarities in clinical symptoms provoked by these pathogens make diagnosis difficult. Thus, early, rapid and accurate diagnosis will be crucial in patient management and in the control of these diseases. In this study, a microfluidic lab-on-chip integrating multiplex molecular amplification and DNA microarray hybridization was developed for simultaneous detection and species differentiation of 26 globally important tropical pathogens. The analytical performance of the lab-on-chip for each pathogen ranged from 102 to 103 DNA or RNA copies. Assay performance was further verified with human whole blood spiked with Plasmodium falciparum and Chikungunya virus that yielded a range of detection from 200 to 4×105 parasites, and from 250 to 4×107 PFU respectively. This lab-on-chip was subsequently assessed and evaluated using 170 retrospective patient specimens in Singapore and Thailand. The lab-on-chip had a detection sensitivity of 83.1% and a specificity of 100% for P. falciparum; a sensitivity of 91.3% and a specificity of 99.3% for P. vivax; a positive 90.0% agreement and a specificity of 100% for Chikungunya virus; and a positive 85.0% agreement and a specificity of 100% for Dengue virus serotype 3 with reference methods conducted on the samples. Results suggested the practicality of an amplification microarray-based approach in a field setting for high-throughput detection and identification of tropical pathogens.

  12. Novel strategies to enhance lateral flow immunoassay sensitivity for detecting foodborne pathogens.

    Science.gov (United States)

    Shan, Shan; Lai, Weihua; Xiong, Yonghua; Wei, Hua; Xu, Hengyi

    2015-01-28

    Food contaminated by foodborne pathogens causes diseases, affects individuals, and even kills those affected individuals. As such, rapid and sensitive detection methods should be developed to screen pathogens in food. One current detection method is lateral flow immunoassay, an efficient technique because of several advantages, including rapidity, simplicity, stability, portability, and sensitivity. This review presents the format and principle of lateral flow immunoassay strip and the development of conventional lateral flow immunoassay for detecting foodborne pathogens. Furthermore, novel strategies that can be applied to enhance the sensitivity of lateral flow immunoassay to detect foodborne pathogens are presented; these strategies include innovating new label application, designing new formats of lateral flow immunoassay, combining with other methods, and developing signal amplification systems. With these advancements, detection sensitivity and detection time can be greatly improved.

  13. Antibody conjugated graphene nanocomposites for pathogen detection

    Science.gov (United States)

    Sign, Chandan; Sumana, Gajjala

    2016-04-01

    Graphene oxide (GO), due to its excellent electrochemical properties and large surface area, known to be highly suitable material for biosensing application. Here, we report in situ synthesis of silver nanopaticles (AgNPs) onto the GO sheets for the electrochemical detection of Salmonella typhimurium (S.typhimurium). The GO-AgNPs composites have been deposited onto the indium tin oxide (ITO) coated glass substrate by the electrophoretic deposition technique. Carbodiimide coupling (EDC-NHS) has been used for the immobilization of antibodies of Salmonella typhimurium (anti-S.typhimurium) for detection of S.typhimurium. The electron microscopy and UV-visible studies reveal successful synthesis GO-AgNPs composites while FT-IR studies suggest the proper immobilization of anti-S.typhi. The cyclic voltammetry (CV) has been utilized for detection using anti-S.typhi/GOAgNPs/ITO based immunoelectrode as a function of S.typhimurium concentration. The fabricated immunosensor shows improved sensitivity of 33.04 μACFU-1mLcm-2 in a wide detection range of 101 to 106 CFUmL-1. This immunosensor may be utilized for the detection of other food borne pathogens like aflatoxin and E.coli also.

  14. Pathogen detection in produce using applications of immunomagnetic beads and biosensors

    Science.gov (United States)

    The presence of pathogenic bacteria is of increasing public health concerns. Rapid and sensitive tests to detect pathogens are required to keep the safety of food supply. In this chapter we summarized our previous investigations where we applied immunomagnetic-bead (IMB) capture and various biosen...

  15. Rapid detection of threshold VEPs.

    Science.gov (United States)

    Mackay, Alison M; Bradnam, Michael S; Hamilton, Ruth

    2003-06-01

    To determine whether a one-dimensional (1D) Laplacian analysis detects steady-state visual evoked potentials (ssVEPs) faster than the standard O(z)-F(z) montage and to establish the optimum position of Laplacian reference electrodes. Twenty-two normal adults were shown reversing checks ranging from 1.5' to 60'. Three electrode montages were investigated: O(z)-F(z), LO-F(z) and a 1D Laplacian analysis of 3 occipital electrodes (2O(z)-(RO+LO)). RO and LO were placed symmetrically and horizontally about O(z). Five different locations for RO and LO were investigated. Recordings were analysed in the frequency domain and the presence (and detection time, DT) or absence of a ssVEP defined statistically. Effects of individual, reference electrode site and check size on DT and phase differences between recording montages were investigated. Laplacian analysis detected ssVEPs to small (3') checks faster than O(z)-F(z), by 12.3 and 4.1s on average with Laplacian reference electrodes at 15 and 20% of half-head circumference, respectively. The optimum position of reference electrodes was governed by the instantaneous spatial spread of the response and the noise coherence between midline and lateral electrodes. A 1D Laplacian analysis can reduce the time to statistical detection of ssVEPs compared to the traditional O(z)-F(z) recording for stimuli near the normal acuity threshold of adults. This in turn could be used to minimise the length of a VEP acuity assessment.

  16. APDS: The Autonomous Pathogen Detection System

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B; Makarewicz, A; Setlur, U; Henderer, B; McBride, M; Dzenitis, J

    2004-10-04

    We have developed and tested a fully autonomous pathogen detection system (APDS) capable of continuously monitoring the environment for airborne biological threat agents. The system was developed to provide early warning to civilians in the event of a bioterrorism incident and can be used at high profile events for short-term, intensive monitoring or in major public buildings or transportation nodes for long-term monitoring. The APDS is completely automated, offering continuous aerosol sampling, in-line sample preparation fluidics, multiplexed detection and identification immunoassays, and nucleic-acid based polymerase chain reaction (PCR) amplification and detection. Highly multiplexed antibody-based and duplex nucleic acid-based assays are combined to reduce false positives to a very low level, lower reagent costs, and significantly expand the detection capabilities of this biosensor. This article provides an overview of the current design and operation of the APDS. Certain sub-components of the ADPS are described in detail, including the aerosol collector, the automated sample preparation module that performs multiplexed immunoassays with confirmatory PCR, and the data monitoring and communications system. Data obtained from an APDS that operated continuously for seven days in a major U.S. transportation hub is reported.

  17. Incorporating indel information into phylogeny estimation for rapidly emerging pathogens

    Directory of Open Access Journals (Sweden)

    Suchard Marc A

    2007-03-01

    Full Text Available Abstract Background Phylogenies of rapidly evolving pathogens can be difficult to resolve because of the small number of substitutions that accumulate in the short times since divergence. To improve resolution of such phylogenies we propose using insertion and deletion (indel information in addition to substitution information. We accomplish this through joint estimation of alignment and phylogeny in a Bayesian framework, drawing inference using Markov chain Monte Carlo. Joint estimation of alignment and phylogeny sidesteps biases that stem from conditioning on a single alignment by taking into account the ensemble of near-optimal alignments. Results We introduce a novel Markov chain transition kernel that improves computational efficiency by proposing non-local topology rearrangements and by block sampling alignment and topology parameters. In addition, we extend our previous indel model to increase biological realism by placing indels preferentially on longer branches. We demonstrate the ability of indel information to increase phylogenetic resolution in examples drawn from within-host viral sequence samples. We also demonstrate the importance of taking alignment uncertainty into account when using such information. Finally, we show that codon-based substitution models can significantly affect alignment quality and phylogenetic inference by unrealistically forcing indels to begin and end between codons. Conclusion These results indicate that indel information can improve phylogenetic resolution of recently diverged pathogens and that alignment uncertainty should be considered in such analyses.

  18. Surface plasmon resonance imaging for label-free detection of foodborne pathogens and toxins

    Science.gov (United States)

    More rapid and efficient detection methods for foodborne pathogenic bacteria and toxins are needed to address the long assay time and limitations in multiplex capacity. Surface plasmon resonance imaging (SPRi) is an emerging optical technique, which allows for rapid and label-free screening of multi...

  19. Rapid Identification of Pathogens from Positive Blood Cultures by Multiplex PCR using the FilmArray System

    Science.gov (United States)

    Blaschke, Anne J.; Heyrend, Caroline; Byington, Carrie L.; Fisher, Mark A.; Barker, Elizabeth; Garrone, Nicholas F.; Thatcher, Stephanie A.; Pavia, Andrew T.; Barney, Trenda; Alger, Garrison D.; Daly, Judy A.; Ririe, Kirk M.; Ota, Irene; Poritz, Mark A.

    2012-01-01

    Sepsis is a leading cause of death. Rapid and accurate identification of pathogens and antimicrobial resistance directly from blood culture could improve patient outcomes. The FilmArray® (FA; Idaho Technology, Inc., Salt Lake City, UT) Blood Culture (BC) panel can identify > 25 pathogens and 4 antibiotic resistance genes from positive blood cultures in 1 hour. We compared a development version of the panel to conventional culture and susceptibility testing on 102 archived blood cultures from adults and children with bacteremia. Of 109 pathogens identified by culture, 95% were identified by FA. Among 111 prospectively collected blood cultures, the FA identified 84 of 92 pathogens (91%) covered by the panel. Among 25 Staphylococcus aureus and 21 Enterococcus species detected, FA identified all culture-proven MRSA and VRE. The FA BC panel is an accurate method for the rapid identification of pathogens and resistance genes from blood culture. PMID:22999332

  20. Microchip-based one step DNA extraction and real-time PCR in one chamber for rapid pathogen identification.

    Science.gov (United States)

    Lee, Jeong-Gun; Cheong, Kwang Ho; Huh, Nam; Kim, Suhyeon; Choi, Jeong-Woo; Ko, Christopher

    2006-07-01

    Optimal detection of a pathogen present in biological samples depends on the ability to extract DNA molecules rapidly and efficiently. In this paper, we report a novel method for efficient DNA extraction and subsequent real-time detection in a single microchip by combining laser irradiation and magnetic beads. By using a 808 nm laser and carboxyl-terminated magnetic beads, we demonstrate that a single pulse of 40 seconds lysed pathogens including E. coli and Gram-positive bacterial cells as well as the hepatitis B virus mixed with human serum. We further demonstrate that the real-time pathogen detection was performed with pre-mixed PCR reagents in a real-time PCR machine using the same microchip, after laser irradiation in a hand-held device equipped with a small laser diode. These results suggest that the new sample preparation method is well suited to be integrated into lab-on-a-chip application of the pathogen detection system.

  1. Current molecular techniques for the detection of microbial pathogens.

    Science.gov (United States)

    Galluzzi, Luca; Magnani, Mauro; Saunders, Nick; Harms, Carsten; Bruce, Ian James

    2007-01-01

    Traditionally the detection of microbial pathogens in clinical, environmental or food samples has commonly needed the prelevation of cells by culture before the application ofthe detection strategy. This is done to increase cell number thereby overcoming problems associated with the sensitivity of classical detection strategies. However, culture-based methods have the disadvantages of taking longer, usually are more complex and require skilled personnel as well as not being able to detect viable but non cultivable microbial species. A number of molecular methods have been developed in the last 10 to 15 years to overcome these issues and to facilitate the rapid, accurate, sensitive and cost effective identification and enumeration of microorganisms which are designed to replace and/or support classical approaches to microbial detection. Amongst these new methods, ones based on the polymerase chain reaction and nucleic acid hybridization have been shown to be particularly suitable for this purpose. This review generally summarizes some of the current and emerging nucleic acid based molecular approaches for the detection, discrimination andquantification ofmicrobes in environmental, food and clinical samples and includes reference to the recently developing areas of microfluidics and nanotechnology "Lab-on-a-chip".

  2. An Integrated Lab-on-Chip for Rapid Identification and Simultaneous Differentiation of Tropical Pathogens

    Science.gov (United States)

    Sato, Mitsuharu; Watthanaworawit, Wanitda; Ling, Clare L.; Mauduit, Marjorie; Malleret, Benoît; Grüner, Anne-Charlotte; Tan, Rosemary; Nosten, François H.; Snounou, Georges; Rénia, Laurent; Ng, Lisa F. P.

    2014-01-01

    Tropical pathogens often cause febrile illnesses in humans and are responsible for considerable morbidity and mortality. The similarities in clinical symptoms provoked by these pathogens make diagnosis difficult. Thus, early, rapid and accurate diagnosis will be crucial in patient management and in the control of these diseases. In this study, a microfluidic lab-on-chip integrating multiplex molecular amplification and DNA microarray hybridization was developed for simultaneous detection and species differentiation of 26 globally important tropical pathogens. The analytical performance of the lab-on-chip for each pathogen ranged from 102 to 103 DNA or RNA copies. Assay performance was further verified with human whole blood spiked with Plasmodium falciparum and Chikungunya virus that yielded a range of detection from 200 to 4×105 parasites, and from 250 to 4×107 PFU respectively. This lab-on-chip was subsequently assessed and evaluated using 170 retrospective patient specimens in Singapore and Thailand. The lab-on-chip had a detection sensitivity of 83.1% and a specificity of 100% for P. falciparum; a sensitivity of 91.3% and a specificity of 99.3% for P. vivax; a positive 90.0% agreement and a specificity of 100% for Chikungunya virus; and a positive 85.0% agreement and a specificity of 100% for Dengue virus serotype 3 with reference methods conducted on the samples. Results suggested the practicality of an amplification microarray-based approach in a field setting for high-throughput detection and identification of tropical pathogens. PMID:25078474

  3. An integrated lab-on-chip for rapid identification and simultaneous differentiation of tropical pathogens.

    Directory of Open Access Journals (Sweden)

    Jeslin J L Tan

    Full Text Available Tropical pathogens often cause febrile illnesses in humans and are responsible for considerable morbidity and mortality. The similarities in clinical symptoms provoked by these pathogens make diagnosis difficult. Thus, early, rapid and accurate diagnosis will be crucial in patient management and in the control of these diseases. In this study, a microfluidic lab-on-chip integrating multiplex molecular amplification and DNA microarray hybridization was developed for simultaneous detection and species differentiation of 26 globally important tropical pathogens. The analytical performance of the lab-on-chip for each pathogen ranged from 102 to 103 DNA or RNA copies. Assay performance was further verified with human whole blood spiked with Plasmodium falciparum and Chikungunya virus that yielded a range of detection from 200 to 4×105 parasites, and from 250 to 4×107 PFU respectively. This lab-on-chip was subsequently assessed and evaluated using 170 retrospective patient specimens in Singapore and Thailand. The lab-on-chip had a detection sensitivity of 83.1% and a specificity of 100% for P. falciparum; a sensitivity of 91.3% and a specificity of 99.3% for P. vivax; a positive 90.0% agreement and a specificity of 100% for Chikungunya virus; and a positive 85.0% agreement and a specificity of 100% for Dengue virus serotype 3 with reference methods conducted on the samples. Results suggested the practicality of an amplification microarray-based approach in a field setting for high-throughput detection and identification of tropical pathogens.

  4. An AC electrokinetics facilitated biosensor cassette for rapid pathogen identification.

    Science.gov (United States)

    Ouyang, Mengxing; Mohan, Ruchika; Lu, Yi; Liu, Tingting; Mach, Kathleen E; Sin, Mandy L Y; McComb, Mason; Joshi, Janhvi; Gau, Vincent; Wong, Pak Kin; Liao, Joseph C

    2013-07-07

    To develop a portable point-of-care system based on biosensors for common infectious diseases such as urinary tract infection, the sensing process needs to be implemented within an enclosed fluidic system. On chip sample preparation of clinical samples remains a significant obstacle to achieving robust sensor performance. Herein AC electrokinetics is applied in an electrochemical biosensor cassette to enhance molecular convection and hybridization efficiency through electrokinetics induced fluid motion and Joule heating induced temperature elevation. Using E. coli as an exemplary pathogen, we determined the optimal electrokinetic parameters for detecting bacterial 16S rRNA in the biosensor cassette based on the current output, signal-to-noise ratio, and limit of detection. In addition, a panel of six probe sets targeting common uropathogenic bacteria was demonstrated. The optimized parameters were also validated using patient-derived clinical urine samples. The effectiveness of electrokinetics for on chip sample preparation will facilitate the implementation of point-of-care diagnosis of urinary tract infection in the future.

  5. AC Electrokinetics Facilitated Biosensor Cassette for Rapid Pathogen Identification

    Science.gov (United States)

    Ouyang, Mengxing; Mohan, Ruchika; Lu, Yi; Liu, Tingting; Mach, Kathleen E.; Sin, Mandy L. Y.; McComb, Mason; Joshi, Janhvi; Gau, Vincent

    2013-01-01

    To develop a portable point-of-care system based on biosensors for common infectious diseases such as urinary tract infection, the sensing process needs to be implemented within an enclosed fluidic system. On chip sample preparation of clinical samples remains a significant obstacle to achieve robust sensor performance. Herein AC electrokinetics is applied in an electrochemical biosensor cassette to enhance molecular convection and hybridization efficiency though electrokinetic induced fluid motion and Joule heating induced temperature elevation. Using E. coli as an exemplary pathogen, we determined the optimal electrokinetic parameters for detecting bacterial 16S rRNA in the biosensor cassette based on the current output, signal-to-noise ratio, and limit of detection. In addition, a panel of six probe sets targeting common uropathogenic bacteria was demonstrated. The optimized parameters were also validated using patient-derived clinical urine samples. The effectiveness of electrokinetic for on chip sample preparation will facilitate the implementation of point-of-care diagnosis of urinary tract infection in the future. PMID:23626988

  6. Human pathogens in plant biofilms: Formation, physiology, and detection.

    Science.gov (United States)

    Ximenes, Eduardo; Hoagland, Lori; Ku, Seockmo; Li, Xuan; Ladisch, Michael

    2017-07-01

    Fresh produce, viewed as an essential part of a healthy life style is usually consumed in the form of raw or minimally processed fruits and vegetables, and is a potentially important source of food-borne human pathogenic bacteria and viruses. These are passed on to the consumer since the bacteria can form biofilms or otherwise populate plant tissues, thereby using plants as vectors to infect animal hosts. The life cycle of the bacteria in plants differs from those in animals or humans and results in altered physiochemical and biological properties (e.g., physiology, immunity, native microflora, physical barriers, mobility, and temperature). Mechanisms by which healthy plants may become contaminated by microorganisms, develop biofilms, and then pass on their pathogenic burden to people are explored in the context of hollow fiber microfiltration by which plant-derived microorganisms may be recovered and rapidly concentrated to facilitate study of their properties. Enzymes, when added to macerated plant tissues, hydrolyze or alter macromolecules that would otherwise foul hollow-fiber microfiltration membranes. Hence, microfiltration may be used to quickly increase the concentration of microorganisms to detectable levels. This review discusses microbial colonization of vegetables, formation and properties of biofilms, and how hollow fiber microfiltration may be used to concentrate microbial targets to detectable levels. The use of added enzymes helps to disintegrate biofilms and minimize hollow fiber membrane fouling, thereby providing a new tool for more time effectively elucidating mechanisms by which biofilms develop and plant tissue becomes contaminated with human pathogens. Biotechnol. Bioeng. 2017;114: 1403-1418. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  7. Isolation, amplification and characterization of foodborne pathogen disease bacteria gene for rapid kit test development

    Science.gov (United States)

    Nurjayadi, M.; Santoso, I.; Kartika, I. R.; Kurniadewi, F.; Saamia, V.; Sofihan, W.; Nurkhasanah, D.

    2017-07-01

    There is a lot of public concern over food safety. Food-safety cases recently, including many food poisoning cases in both the developed and developing countries, considered to be the national security threats which involved police investigation. Quick and accurate detection methods are needed to handle the food poisoning cases with a big number of sufferers at the same time. Therefore, the research is aimed to develop a specific, sensitive, and rapid result molecular detection tool for foodborne pathogen bacteria. We, thus, propose genomic level approach with Polymerase Chain Reaction. The research has successfully produced a specific primer to perform amplification to fim-C S. typhi, E. coli, and pef Salmonella typhimurium genes. The electrophoresis result shows that amplification products are 95 base pairs, 121 base pairs, and 139 base pairs; and all three genes are in accordance with the size of the in silico to third genes bacteria. In conclusion, the research has been successfully designed a specific detection tool to three foodborne pathogen bacteria genes. Further stages test and the uses of Real-time PCR in the detection are still in the trial process for better detection method.

  8. Rapidly expanding range of highly pathogenic avian influenza viruses

    Science.gov (United States)

    Hall, Jeffrey S.; Dusek, Robert J.; Spackman, Erica

    2015-01-01

    The movement of highly pathogenic avian influenza (H5N8) virus across Eurasia and into North America and the virus’ propensity to reassort with co-circulating low pathogenicity viruses raise concerns among poultry producers, wildlife biologists, aviculturists, and public health personnel worldwide. Surveillance, modeling, and experimental research will provide the knowledge required for intelligent policy and management decisions.

  9. Rapid in vivo analysis of synthetic promoters for plant pathogen phytosensing

    Directory of Open Access Journals (Sweden)

    Liu Wusheng

    2011-11-01

    Full Text Available Abstract Background We aimed to engineer transgenic plants for the purpose of early detection of plant pathogen infection, which was accomplished by employing synthetic pathogen inducible promoters fused to reporter genes for altered phenotypes in response to the pathogen infection. Toward this end, a number of synthetic promoters consisting of inducible regulatory elements fused to a red fluorescent protein (RFP reporter were constructed for use in phytosensing. Results For rapid analysis, an Agrobacterium-mediated transient expression assay was evaluated, then utilized to assess the inducibility of each synthetic promoter construct in vivo. Tobacco (Nicotiana tabacum cv. Xanthi leaves were infiltrated with Agrobacterium harboring the individual synthetic promoter-reporter constructs. The infiltrated tobacco leaves were re-infiltrated with biotic (bacterial pathogens or abiotic (plant defense signal molecules salicylic acid, ethylene and methyl jasmonate agents 24 and 48 hours after initial agroinfiltration, followed by RFP measurements at relevant time points after treatment. These analyses indicated that the synthetic promoter constructs were capable of conferring the inducibility of the RFP reporter in response to appropriate phytohormones and bacterial pathogens, accordingly. Conclusions These observations demonstrate that the Agrobacterium-mediated transient expression is an efficient method for in vivo assays of promoter constructs in less than one week. Our results provide the opportunity to gain further insights into the versatility of the expression system as a potential tool for high-throughput in planta expression screening prior to generating stably transgenic plants for pathogen phytosensing. This system could also be utilized for temporary phytosensing; e.g., not requiring stably transgenic plants.

  10. Molecular techniques for detection and identification of pathogens in food: advantages and limitations

    OpenAIRE

    Palomino-Camargo, Carolina; Instituto de Ciencia y Tecnología de Alimentos, Facultad de Ciencias, Universidad Central de Venezuela. Caracas, Venezuela. Magíster en Ciencia y Tecnología de los Alimentos licenciada en Biología; González-Muñoz, Yuniesky; Instituto de Ciencia y Tecnología de Alimentos, Facultad de Ciencias, Universidad Central de Venezuela. Caracas, Venezuela. Ministerio del Poder Popular para la Alimentación. Caracas, Venezuela. licenciado en Ciencias de los Alimentos.

    2014-01-01

    Foodborne diseases, caused by pathogenic microorganisms, are a major public health problem worldwide. Microbiological methods commonly used in the detection of these foodborne pathogens are laborious and time consuming. This situation, coupled with the demand for immediate results and with technological advances, has led to the development of a wide range of rapid methods in recent decades. On this basis, this review describes the advantages and limitations of the main molecular methods used ...

  11. Separation and detection of multiple pathogens in a food matrix by magnetic SERS nanoprobes.

    Science.gov (United States)

    Wang, Yuling; Ravindranath, Sandeep; Irudayaraj, Joseph

    2011-01-01

    A rapid and sensitive method was developed here for separation and detection of multiple pathogens in food matrix by magnetic surface-enhanced Raman scattering (SERS) nanoprobes. Silica-coated magnetic probes (MNPs@SiO(2)) of ~100 nm in diameter were first prepared via the reverse microemulsion method using cetyltrimethylammonium bromide as a surfactant and tetraethyl orthosilicate as the silica precursor. The as-prepared MNPs@SiO(2) were functionalized with specific pathogen antibodies to first capture threat agents directly from a food matrix followed by detection using an optical approach enabled by SERS. In this scheme, pathogens were first immuno-magnetically captured with MNPs@SiO(2), and pathogen-specific SERS probes (gold nanoparticles integrated with a Raman reporter) were functionalized with corresponding antibodies to allow the formation of a sandwich assay to complete the sensor module for the detection of multiple pathogens in selected food matrices, just changing the kinds of Raman reporters on SERS probes. Here, up to two key pathogens, Salmonella enterica serovar Typhimurium and Staphylococcus aureus, were selected as a model to illustrate the probability of this scheme for multiple pathogens detection. The lowest cell concentration detected in spinach solution was 10(3) CFU/mL. A blind test conducted in peanut butter validated the limit of detection as 10(3) CFU/mL with high specificity, demonstrating the potential of this approach in complex matrices.

  12. Immunomagnetic separation for MEMS-based biosensor of waterborne pathogens detection

    Science.gov (United States)

    Guo, Jianjiang; Zhang, Rongbiao

    2017-07-01

    Rapid isolation and detection of special pathogens present in environmental drinking water is critical for water quality monitoring. Numerical analysis and experimental investigations on immunomagnetic capture and isolation of waterborne pathogens with magnetic nanoparticles (MNPs) in microfluidic channel are performed. A finite-element COMSOL-based model is established to demonstrate the novel method of on-chip capturing pathogens using MNPs together with periodic pulse magnetic field. Simulation results determine the optimum magnetic pole current and switching frequency for magnetic separation. With the magnetic isolation experiment platform built up, as a pathogen example of Escherichia coli O157:H7, the performance of the method is experimentally verified. Both numerical and experimental results are found to agree reasonably well. Results of these investigations show that the capture efficiency of the immunomagnetic separation method is more than 92%, which could be encouraging for the design and optimization of MEMS-based biosensor of waterborne pathogen detection.

  13. Detection of Biological Pathogens Using Multiple Wireless Magnetoelastic Biosensors

    Science.gov (United States)

    Shen, Wen

    A number of recent, high-profile incidences of food-borne illness spreading through the food supply and the use of anthrax by terrorists after the September 11, 2001 attacks have demonstrated the need for new technologies that can rapidly detect the presence of biological pathogens. A bevy of biosensors show excellent detection sensitivity and specificity. However, false positive and false negative signals remain one of the primary reasons that many of these newly developed biosensors have not found application in the marketplace. The research described in this dissertation focuses on developing a free-standing magnetoelastic based bio-sensing system using a pulse method. This method allows fast detection, eliminates the bias magnetic field that is necessary in current methods, makes the system more simply and suitable for in-field detection. This system has two pairs of transformer coils, where a measurement sensor and a control sensor can be put in each pair of coils. The control sensor is used to compensate for environmental variables. The effect of pulse power on the performance of the magnetoelastic sensors in the pulse system is studied. The system is found to have excellent stability, good detection repeatability when used with multiple sensors. This research has investigated and demonstrated a multiple sensors approach. Because it will involve the simultaneous measurement of many sensors, it will significantly reduce problems encountered with false positive indications. The positioning and interference of sensors are investigated. By adding a multi-channel structure to the pulse detection system, the effect of sensor interference is minimized. The result of the repeatability test shows that the standard deviation when measuring three 1 mm magnetoelastic sensors is around 500 Hz, which is smaller than the minimum requirement for actual spores/bacteria detection. Magnetoelastic sensors immobilized with JRB7 phages and E2 phages have been used to specifically

  14. Detection and identification of Phoma pathogens of potato.

    Science.gov (United States)

    A'Hara, Denise

    2015-01-01

    Phoma foveata, Phoma exigua var. exigua, and Phoma eupyrena are fungal pathogens of potato, causing gangrene or pit rot symptoms in tubers, and they are responsible for significant crop losses. Various techniques are available to identify these pathogens in the laboratory. A multiplex Plexor(®) real-time PCR method which can detect and identify these pathogens in a single reaction will be presented.

  15. Development of nanoparticle-based optical sensors for pathogenic bacterial detection.

    Science.gov (United States)

    Mocan, Teodora; Matea, Cristian T; Pop, Teodora; Mosteanu, Ofelia; Buzoianu, Anca Dana; Puia, Cosmin; Iancu, Cornel; Mocan, Lucian

    2017-03-31

    Pathogenic bacteria contribute to various globally important diseases, killing millions of people each year. Various fields of medicine currently benefit from or may potentially benefit from the use of nanotechnology applications, in which there is growing interest. Disease-related biomarkers can be rapidly and directly detected by nanostructures, such as nanowires, nanotubes, nanoparticles, cantilevers, microarrays, and nanoarrays, as part of an accurate process characterized by lower sample consumption and considerably higher sensitivity. There is a need for accurate techniques for pathogenic bacteria identification and detection to allow the prevention and management of pathogenic diseases and to assure food safety. The focus of this review is on the current nanoparticle-based techniques for pathogenic bacterial identification and detection using these applications.

  16. Indigenous people's detection of rapid ecological change.

    Science.gov (United States)

    Aswani, Shankar; Lauer, Matthew

    2014-06-01

    When sudden catastrophic events occur, it becomes critical for coastal communities to detect and respond to environmental transformations because failure to do so may undermine overall ecosystem resilience and threaten people's livelihoods. We therefore asked how capable of detecting rapid ecological change following massive environmental disruptions local, indigenous people are. We assessed the direction and periodicity of experimental learning of people in the Western Solomon Islands after a tsunami in 2007. We compared the results of marine science surveys with local ecological knowledge of the benthos across 3 affected villages and 3 periods before and after the tsunami. We sought to determine how people recognize biophysical changes in the environment before and after catastrophic events such as earthquakes and tsunamis and whether people have the ability to detect ecological changes over short time scales or need longer time scales to recognize changes. Indigenous people were able to detect changes in the benthos over time. Detection levels differed between marine science surveys and local ecological knowledge sources over time, but overall patterns of statistically significant detection of change were evident for various habitats. Our findings have implications for marine conservation, coastal management policies, and disaster-relief efforts because when people are able to detect ecological changes, this, in turn, affects how they exploit and manage their marine resources. © 2014 Society for Conservation Biology.

  17. [Rapid detection of Shigella dysenteriae by PCR assay].

    Science.gov (United States)

    Chen, Hongyuan; Zhong, Qingping; Wang, Li; Sun, Yuanming

    2010-09-01

    Based on the invasive plasmid antigen H gene (ipaH) of S. dysenteriae, one pair of specific primers was designed for PCR assays in this study. The concentrations of dNTP, Mg2+ and primer, dosage of Taq DNA polymerase, annealing temperature and circulating parameter in the PCR amplification system were optimized. In this way, a rapid and stable method of PCR assay for the detection of S. dysenteriae was established. The specificity and sensitivity of PCR were also analyzed. The detection limits of pure culture and genomic DNA in the PCR assay were 1.06 x 10(2) cfu/ml and 106.34 pg/PCR system, respectively. The detection limit for S. dysenteriae in artificially contaminated food samples was 3.21 x 10(4) cfu/ml. These results indicated that the PCR method for S. dysenteriae detection was simple, rapid, high in specificity and sensitivity and suitable for the detection of pathogens in foods caused by Shigella dysenteriae.

  18. Detection of mastitis pathogens by analysis of volatile bacterial metabolites

    NARCIS (Netherlands)

    Hettinga, K.A.; Valenberg, van H.J.F.; Lam, T.J.G.M.; Hooijdonk, van A.C.M.

    2008-01-01

    The ability to detect mastitis pathogens based on their volatile metabolites was studied. Milk samples from cows with clinical mastitis, caused by Staphylococcus aureus, coagulase-negative staphylococci, Streptococcus uberis, Streptococcus dysgalactiae, and Escherichia coli were collected. In

  19. Evaluation of pathogen detection from clinical samples by real-time polymerase chain reaction using a sepsis pathogen DNA detection kit.

    Science.gov (United States)

    Yanagihara, Katsunori; Kitagawa, Yuko; Tomonaga, Masao; Tsukasaki, Kunihiro; Kohno, Shigeru; Seki, Masafumi; Sugimoto, Hisashi; Shimazu, Takeshi; Tasaki, Osamu; Matsushima, Asako; Ikeda, Yasuo; Okamoto, Shinichiro; Aikawa, Naoki; Hori, Shingo; Obara, Hideaki; Ishizaka, Akitoshi; Hasegawa, Naoki; Takeda, Junzo; Kamihira, Shimeru; Sugahara, Kazuyuki; Asari, Seishi; Murata, Mitsuru; Kobayashi, Yoshio; Ginba, Hiroyuki; Sumiyama, Yoshinobu; Kitajima, Masaki

    2010-01-01

    Sepsis is a serious medical condition that requires rapidly administered, appropriate antibiotic treatment. Conventional methods take three or more days for final pathogen identification and antimicrobial susceptibility testing. We organized a prospective observational multicenter study in three study sites to evaluate the diagnostic accuracy and potential clinical utility of the SeptiFast system, a multiplex pathogen detection system used in the clinical setting to support early diagnosis of bloodstream infections. A total of 212 patients, suspected of having systemic inflammatory response syndrome (SIRS) caused by bacterial or fungal infection, were enrolled in the study. From these patients, 407 blood samples were taken and blood culture analysis was performed to identify pathogens. Whole blood was also collected for DNA Detection Kit analysis immediately after its collection for blood culture. The results of the DNA Detection Kit, blood culture and other culture tests were compared. The chosen antimicrobial treatment in patients whose samples tested positive in the DNA Detection Kit and/or blood culture analysis was examined to evaluate the effect of concomitant antibiotic exposure on the results of these analyses. SeptiFast analysis gave a positive result for 55 samples, while 43 samples were positive in blood culture analysis. The DNA Detection Kit identified a pathogen in 11.3% (45/400) of the samples, compared to 8.0% (32/400) by blood culture analysis. Twenty-three pathogens were detected by SeptiFast only; conversely, this system missed five episodes of clinically significant bacteremia (Methicillin-resistant Staphylococcus aureus (MRSA), 2; Pseudomonas aeruginosa, 1; Klebsiella spp, 1; Enterococcus faecium, 1). The number of samples that tested positive was significantly increased by combining the result of the blood culture analysis with those of the DNA Detection Kit analysis (P = 0.01). Among antibiotic pre-treated patients (prevalence, 72%), Septi

  20. Development of omics methodologies for the detection and indetification of pathogenic and spoilage bacteria in seafood

    OpenAIRE

    Böhme, Karola

    2012-01-01

    The project bases on the development of analytical methods for the rapid detection and identification of the main pathogenic and food-borne spoilage microorganisms, present in fish products and products of the aquaculture. Traditionally the methods to identify bacteria were time consuming and tediously. However the application of molecular methods by genomic and proteomic analysis offer an attractive alternative for the rapid and simple identification and characterization of bacteria. The mai...

  1. A Review of Membrane-Based Biosensors for Pathogen Detection.

    Science.gov (United States)

    van den Hurk, Remko; Evoy, Stephane

    2015-06-15

    Biosensors are of increasing interest for the detection of bacterial pathogens in many applications such as human, animal and plant health, as well as food and water safety. Membranes and membrane-like structures have been integral part of several pathogen detection platforms. Such structures may serve as simple mechanical support, function as a part of the transduction mechanism, may be used to filter out or concentrate pathogens, and may be engineered to specifically house active proteins. This review focuses on membrane materials, their associated biosensing applications, chemical linking procedures, and transduction mechanisms. The sensitivity of membrane biosensors is discussed, and the state of the field is evaluated and summarized.

  2. Large scale multiplex PCR improves pathogen detection by DNA microarrays

    Directory of Open Access Journals (Sweden)

    Krönke Martin

    2009-01-01

    Full Text Available Abstract Background Medium density DNA microchips that carry a collection of probes for a broad spectrum of pathogens, have the potential to be powerful tools for simultaneous species identification, detection of virulence factors and antimicrobial resistance determinants. However, their widespread use in microbiological diagnostics is limited by the problem of low pathogen numbers in clinical specimens revealing relatively low amounts of pathogen DNA. Results To increase the detection power of a fluorescence-based prototype-microarray designed to identify pathogenic microorganisms involved in sepsis, we propose a large scale multiplex PCR (LSplex PCR for amplification of several dozens of gene-segments of 9 pathogenic species. This protocol employs a large set of primer pairs, potentially able to amplify 800 different gene segments that correspond to the capture probes spotted on the microarray. The LSplex protocol is shown to selectively amplify only the gene segments corresponding to the specific pathogen present in the analyte. Application of LSplex increases the microarray detection of target templates by a factor of 100 to 1000. Conclusion Our data provide a proof of principle for the improvement of detection of pathogen DNA by microarray hybridization by using LSplex PCR.

  3. Rapid Detection of the Varicella Zoster Virus

    Science.gov (United States)

    Lewis, Michelle P.; Harding, Robert

    2011-01-01

    1.Technology Description-Researchers discovered that when the Varicella Zoster Virus (VZV) reactivates from latency in the body, the virus is consistently present in saliva before the appearance of skin lesions. A small saliva sample is mixed with a specialized reagent in a test kit. If the virus is present in the saliva sample, the mixture turns a red color. The sensitivity and specificity emanates from an antibody-antigen reaction. This technology is a rapid, non-invasive, point of-of-care testing kit for detecting the virus from a saliva sample. The device is easy to use and can be used in clinics and in remote locations to quickly detect VZV and begin treatment with antiviral drugs. 2.Market Opportunity- RST Bioscience will be the first and only company to market a rapid, same day test kit for the detection of VZV in saliva. The RST detection test kit will have several advantages over existing, competitive technology. The test kit is self contained and laboratory equipment is not required for analysis of the sample. Only a single saliva sample is required to be taken instead of blood or cerebral spinal fluid. The test kit is portable, sterile and disposable after use. RST detection test kits require no electrical power or expensive storage equipment and can be used in remote locations. 3.Market Analysis- According to the CDC, it is estimated that 1 million cases of shingles occur each year in the U.S. with more than half over the age of sixty. There is a high demand for rapid diagnostics by the public. The point-of-care testing (POCT) market is growing faster than other segments of in vitro diagnostics. According to a July 2007 InteLab Corporation industry report the overall market for POCT was forecast to increase from $10.3 billion in 2005 to $18.7 billion by 2011. The market value of this test kit has not been determined. 4.Competition- The VZV vaccine prevents 50% of cases and reduces neuralgia by 66%. The most popular test detects VZV-specific IgM antibody

  4. Genome-Wide Analysis in Three Fusarium Pathogens Identifies Rapidly Evolving Chromosomes and Genes Associated with Pathogenicity

    Science.gov (United States)

    Sperschneider, Jana; Gardiner, Donald M.; Thatcher, Louise F.; Lyons, Rebecca; Singh, Karam B.; Manners, John M.; Taylor, Jennifer M.

    2015-01-01

    Pathogens and hosts are in an ongoing arms race and genes involved in host–pathogen interactions are likely to undergo diversifying selection. Fusarium plant pathogens have evolved diverse infection strategies, but how they interact with their hosts in the biotrophic infection stage remains puzzling. To address this, we analyzed the genomes of three Fusarium plant pathogens for genes that are under diversifying selection. We found a two-speed genome structure both on the chromosome and gene group level. Diversifying selection acts strongly on the dispensable chromosomes in Fusarium oxysporum f. sp. lycopersici and on distinct core chromosome regions in Fusarium graminearum, all of which have associations with virulence. Members of two gene groups evolve rapidly, namely those that encode proteins with an N-terminal [SG]-P-C-[KR]-P sequence motif and proteins that are conserved predominantly in pathogens. Specifically, 29 F. graminearum genes are rapidly evolving, in planta induced and encode secreted proteins, strongly pointing toward effector function. In summary, diversifying selection in Fusarium is strongly reflected as genomic footprints and can be used to predict a small gene set likely to be involved in host–pathogen interactions for experimental verification. PMID:25994930

  5. Multiplexed lateral flow microarray assay for detection of citrus pathogens Xylella fastidiosa and Xanthomonas axonopodis pv citri

    Science.gov (United States)

    Cary,; Bruce, R [Santa Fe, NM; Stubben, Christopher J [Los Alamos, NM

    2011-03-22

    The invention provides highly sensitive and specific assays for the major citrus pathogens Xylella fastidiosa and Xanthomonas axonopodis, including a field deployable multiplexed assay capable of rapidly assaying for both pathogens simultaneously. The assays are directed at particular gene targets derived from pathogenic strains that specifically cause the major citrus diseases of citrus variegated chlorosis (Xylella fastidiosa 9a5c) and citrus canker (Xanthomonas axonopodis pv citri). The citrus pathogen assays of the invention offer femtomole sensitivity, excellent linear dynamic range, and rapid and specific detection.

  6. PathogenMIPer: a tool for the design of molecular inversion probes to detect multiple pathogens

    Directory of Open Access Journals (Sweden)

    Akhras Michael

    2006-11-01

    Full Text Available Abstract Background Here we describe PathogenMIPer, a software program for designing molecular inversion probe (MIP oligonucleotides for use in pathogen identification and detection. The software designs unique and specific oligonucleotide probes targeting microbial or other genomes. The tool tailors all probe sequence components (including target-specific sequences, barcode sequences, universal primers and restriction sites and combines these components into ready-to-order probes for use in a MIP assay. The system can harness the genetic variability available in an entire genome in designing specific probes for the detection of multiple co-infections in a single tube using a MIP assay. Results PathogenMIPer can accept sequence data in FASTA file format, and other parameter inputs from the user through a graphical user interface. It can design MIPs not only for pathogens, but for any genome for use in parallel genomic analyses. The software was validated experimentally by applying it to the detection of human papilloma virus (HPV as a model system, which is associated with various human malignancies including cervical and skin cancers. Initial tests of laboratory samples using the MIPs developed by the PathogenMIPer to recognize 24 different types of HPVs gave very promising results, detecting even a small viral load of single as well as multiple infections (Akhras et al, personal communication. Conclusion PathogenMIPer is a software for designing molecular inversion probes for detection of multiple target DNAs in a sample using MIP assays. It enables broader use of MIP technology in the detection through genotyping of pathogens that are complex, difficult-to-amplify, or present in multiple subtypes in a sample.

  7. Identification of pathogenic microbial cells and spores by electrochemical detection on a biochip

    OpenAIRE

    Gabig-Ciminska, M.; Andresen, H; Albers, J; Hintsche, R.; Enfors, S.-O.

    2004-01-01

    Background Bacillus cereus constitutes a significant cause of acute food poisoning in humans. Despite the recent development of different detection methods, new effective control measures and better diagnostic tools are required for quick and reliable detection of pathogenic micro-organisms. Thus, the objective of this study was to determine a simple method for rapid identification of enterotoxic Bacillus strains. Here, a special attention is given to an electrochemical biosensor since it mee...

  8. Nano/Micro and Spectroscopic Approaches to Food Pathogen Detection

    Science.gov (United States)

    Cho, Il-Hoon; Radadia, Adarsh D.; Farrokhzad, Khashayar; Ximenes, Eduardo; Bae, Euiwon; Singh, Atul K.; Oliver, Haley; Ladisch, Michael; Bhunia, Arun; Applegate, Bruce; Mauer, Lisa; Bashir, Rashid; Irudayaraj, Joseph

    2014-06-01

    Despite continuing research efforts, timely and simple pathogen detection with a high degree of sensitivity and specificity remains an elusive goal. Given the recent explosion of sensor technologies, significant strides have been made in addressing the various nuances of this important global challenge that affects not only the food industry but also human health. In this review, we provide a summary of the various ongoing efforts in pathogen detection and sample preparation in areas related to Fourier transform infrared and Raman spectroscopy, light scattering, phage display, micro/nanodevices, and nanoparticle biosensors. We also discuss the advantages and potential limitations of the detection methods and suggest next steps for further consideration.

  9. Rapid genetic detection of ingested Amanita phalloides.

    Science.gov (United States)

    Gausterer, Christian; Penker, Martina; Krisai-Greilhuber, Irmgard; Stein, Christina; Stimpfl, Thomas

    2014-03-01

    Mushrooms are often poorly digested by humans. Thus, their remains (tissues, spores) may persist in the gastrointestinal tract and can be detected in feces several days after mushroom consumption. In this report, we present protocols for the rapid PCR-based detection of fungal traces in a variety of complex samples. Novel primers were designed to amplify portions of ribosomal DNA from deadly poisonous European members of the genus Amanita, namely the death cap (A. phalloides), the destroying angel (A. virosa) and the fool's mushroom (A. verna), respectively. Assay sensitivity was sufficient to discover diluted DNA traces in amounts below the genomic content of a single target mushroom cell. Specificity testing was performed with DNA extracts from a variety of mushroom species. Template amplification was exclusively observed with intended targets and it was not compromised by a vast excess of non-target DNA (i.e. DNA from human and human fecal origin, respectively). A series of experiments was conducted with prepared specimens in order to follow the course of mushroom food processing and digestion. Amplification by direct PCR was successful with raw, fried and digested mixed mushrooms. To improve assay performance with fecal samples, a rapid protocol for sample pre-processing (including water-ether sedimentation and bead beating) and a modified PCR reaction mix were applied. Thereby, it was possible to detect the presence of A. phalloides DNA in spiked feces as well as in clinical samples (vomit, stool) from two independent cases of suspected mushroom poisoning. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  10. Electrochemical biosensors for rapid detection of Escherichia coli O157:H7.

    Science.gov (United States)

    Xu, Meng; Wang, Ronghui; Li, Yanbin

    2017-01-01

    Electrochemical biosensors have shown great promise in the development of rapid methods for the detection of foodborne pathogens and have been intensively studied over the past two decades. The scope of this review is to summarize the advancements made in the development of electrochemical biosensors for the rapid detection of one of the most common foodborne pathogens, Escherichia coli O157:H7. The article is intended to include different configurations of electrochemical biosensors based on the sensing principles and measured electrical parameters, as well as the latest improvements of technology in the progress of electrochemical biosensor development to detect E. coli O157:H7. By discussing the current and future trend based on some of excellent published literatures and reviews, this survey is hoped to illustrate a broad and comprehensive understanding of electrochemical biosensors for the detection of foodborne pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Universal primers for rapid detection of hytrosaviruses.

    Science.gov (United States)

    Abd-Alla, Adly M M; Salem, Tamer Z; Parker, Andrew G; Wang, Yongjie; Jehle, Johannes A; Vreysen, Marc J B; Boucias, Drion

    2011-01-01

    Hytrosaviridae is a proposed virus family encompassing viruses that cause salivary gland hypertrophy (SGH) syndrome in infected insects and reduce the fertility in their dipteran insect hosts. They contain a large, double stranded DNA genome of 120-190 kbp. To date, these viruses have been detected only in adult Diptera. These include hytrosaviruses detected in various tsetse fly species (Glossina spp.), the narcissus bulb fly Merodon equestris and the house fly Musca domestica. The limited number of hytrosaviruses reported to date may be a reflection of the frequent absence of external symptoms in infected adult flies and the fact that the virus does not cause rapid mortality. Based on the complete genome sequence of Glossinia pallidipes (GpSGHV) and Musca domestica (MdSGHV) salivary gland hypertrophy viruses, a PCR based methodology was developed to detect the viruses in these species. To be able to detect hytrosaviruses in other Diptera, five degenerate primer pairs were designed and tested on GpSGHV and MdSGHV DNA using gradient PCR with annealing temperatures from 37 to 61°C. Two pairs of primers were selected from p74, two pairs from PIF-1 and one pair from ODV-e66 homologous proteins. Four primer pairs generated a virus specific PCR product on both MdSGHV and GpSGHV at all tested annealing temperatures, while the ODV-e66 based primers did not generate a virus specific product with annealing temperatures higher that 47°C. No non-specific PCR product was found when using genomic DNA of infected flies as template DNA. These results offer new sets of primers that could be used to detect hytrosaviruses in other insects. Copyright © 2010 Elsevier B.V. All rights reserved.

  12. Detection of 23 Gastrointestinal Pathogens Among Children Who Present With Diarrhea.

    Science.gov (United States)

    Stockmann, Chris; Pavia, Andrew T; Graham, Brad; Vaughn, Mike; Crisp, Rob; Poritz, Mark A; Thatcher, Stephanie; Korgenski, E Kent; Barney, Trenda; Daly, Judy; Rogatcheva, Margarita

    2017-09-01

    Diarrheal diseases are a major cause of ambulatory care visits and hospitalizations among children. Because of overlapping signs and symptoms and expensive and inefficient testing methods, the etiology of pediatric diarrhea is rarely established. We identified children diarrhea at Primary Children's Hospital in Salt Lake City, Utah, between October 2010 and September 2012. Stool specimens submitted for testing were evaluated by using the FilmArray gastrointestinal diagnostic system, which is a rapid multiplex polymerase chain reaction platform that can simultaneously detect 23 bacterial, viral, and protozoal agents. A pathogen was detected in 561 (52%) of 1089 diarrheal episodes. The most commonly detected pathogens included toxigenic Clostridium difficile (16%), diarrheagenic Escherichia coli (15%), norovirus GI/GII (11%), and adenovirus F 40/41 (7%). Shiga toxin-producing E coli were detected in 43 (4%) specimens. Multiple pathogens were identified in 160 (15%) specimens. Viral pathogens (norovirus, adenovirus, rotavirus, and sapovirus) were more common among children chronic medical conditions were less likely to have a pathogen identified than those without a chronic medical condition (45% vs 60%, respectively; P diarrhea. Viral pathogens are identified frequently among young children with acute gastroenteritis.

  13. Advanced molecular diagnostic techniques for detection of food-borne pathogens: Current applications and future challenges.

    Science.gov (United States)

    Umesha, S; Manukumar, H M

    2018-01-02

    The elimination of disease-causing microbes from the food supply is a primary goal and this review deals with the overall techniques available for detection of food-borne pathogens. Now-a-days conventional methods are replaced by advanced methods like Biosensors, Nucleic Acid-based Tests (NAT), and different PCR-based techniques used in molecular biology to identify specific pathogens. Bacillus cereus, Staphylococcus aureus, Proteus vulgaris, Escherichia coli, Campylobacter, Listeria monocytogenes, Salmonella spp., Aspergillus spp., Fusarium spp., Penicillium spp., and pathogens are detected in contaminated food items that cause always diseases in human in any one or the other way. Identification of food-borne pathogens in a short period of time is still a challenge to the scientific field in general and food technology in particular. The low level of food contamination by major pathogens requires specific sensitive detection platforms and the present area of hot research looking forward to new nanomolecular techniques for nanomaterials, make them suitable for the development of assays with high sensitivity, response time, and portability. With the sound of these, we attempt to highlight a comprehensive overview about food-borne pathogen detection by rapid, sensitive, accurate, and cost affordable in situ analytical methods from conventional methods to recent molecular approaches for advanced food and microbiology research.

  14. Nanostructured bioluminescent sensor for rapidly detecting thrombin.

    Science.gov (United States)

    Chen, Longyan; Bao, Yige; Denstedt, John; Zhang, Jin

    2016-03-15

    Thrombin plays a key role in thrombosis and hemostasis. The abnormal level of thrombin in body fluids may lead to different diseases, such as rheumatoid arthritis, glomerulonephritis, etc. Detection of thrombin level in blood and/or urine is one of important methods for medical diagnosis. Here, a bioluminescent sensor is developed for non-invasively and rapidly detecting thrombin in urine. The sensor is assembled through conjugating gold nanoparticles (Au NPs) and a recombinant protein containing Renilla luciferase (pRluc) by a peptide, which is thrombin specific substrate. The luciferase-catalyzed bioluminescence can be quenched by peptide-conjugating Au NPs. In the presence of thrombin, the short peptide conjugating luciferase and Au NPs is digested and cut off, which results in the recovery of bioluminescence due to the release of luciferase from Au NPs. The bioluminescence intensity at 470 nm is observed, and increases with increasing concentration of thrombin. The bioluminescence intensity of this designed sensor is significantly recovered when the thrombin digestion time lasts for 10 min. In addition, a similar linear relationship between luminescence intensity and the concentration of thrombin is found in the range of 8 nM to 8 μM in both buffer and human urine spiked samples. The limit of detection is as low as 80 pM. It is anticipated that our nanosensor could be a promising tool for clinical diagnosis of thrombin in human urine. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Waveguide-Based Biosensors for Pathogen Detection

    Directory of Open Access Journals (Sweden)

    Nile Hartman

    2009-07-01

    Full Text Available Optical phenomena such as fluorescence, phosphorescence, polarization, interference and non-linearity have been extensively used for biosensing applications. Optical waveguides (both planar and fiber-optic are comprised of a material with high permittivity/high refractive index surrounded on all sides by materials with lower refractive indices, such as a substrate and the media to be sensed. This arrangement allows coupled light to propagate through the high refractive index waveguide by total internal reflection and generates an electromagnetic wave—the evanescent field—whose amplitude decreases exponentially as the distance from the surface increases. Excitation of fluorophores within the evanescent wave allows for sensitive detection while minimizing background fluorescence from complex, “dirty” biological samples. In this review, we will describe the basic principles, advantages and disadvantages of planar optical waveguide-based biodetection technologies. This discussion will include already commercialized technologies (e.g., Corning’s EPIC® Ô, SRU Biosystems’ BIND™, Zeptosense®, etc. and new technologies that are under research and development. We will also review differing assay approaches for the detection of various biomolecules, as well as the thin-film coatings that are often required for waveguide functionalization and effective detection. Finally, we will discuss reverse-symmetry waveguides, resonant waveguide grating sensors and metal-clad leaky waveguides as alternative signal transducers in optical biosensing.

  16. Methods for detecting pathogens in the beef food chain: detecting particular pathogens

    Science.gov (United States)

    The main food-borne pathogens of concern in the beef food chain are Shiga toxin-producing Escherichia coli (STEC) and Salmonella spp.; however, the presence of other pathogens, including Listeria monocytogenes, Campylobacter spp., Clostridium spp., Bacillus cereus, and Mycobacterium avium subsp. par...

  17. Detection of pathogens in food using a SERS-based assay in just a few hours

    Science.gov (United States)

    Shende, Chetan; Sengupta, Atanu; Huang, Hermes; Farquharson, Stuart

    2014-05-01

    In 2011 Escherichia, Listeria, and Salmonella species infected over 1.2 million people in the United States, resulting in over 23,000 hospitalizations and 650 deaths. In January 2013 President Obama signed into law the Food and Drug Administration (FDA) Food Safety Modernization Act (FSMA), which requires constant microbial testing of food processing equipment and food to minimize contamination and distribution of food tainted with pathogens. The challenge to preventing distribution and consumption of contaminated foods lies in the fact that just a few bacterial cells can rapidly multiply to millions, reaching infectious doses within a few days. Unfortunately, current methods used to detect these few cells rely on similar growth steps to multiply the cells to the point of detection, which also takes a few days. Consequently, there is a critical need for an analyzer that can rapidly extract and detect foodborne pathogens at 1000 colony forming units per gram of food in 1-2 hours (not days), and with a specificity that differentiates from indigenous microflora, so that false alarms are eliminated. In an effort to meet this need, we have been developing an assay that extracts such pathogens from food, selectively binds these pathogens, and produces surface-enhanced Raman spectra (SERS) when read by a Raman analyzer. Here we present SERS measurements of these pathogens in actual food samples using this assay.

  18. Rapid multiplex PCR assay to identify respiratory viral pathogens: moving forward diagnosing the common cold.

    Science.gov (United States)

    Layman, Clifton P; Gordon, Sarah M; Elegino-Steffens, Diane U; Agee, Willie; Barnhill, Jason; Hsue, Gunther

    2013-09-01

    Upper respiratory tract infections (URIs) can be a serious burden to the healthcare system. The majority of URIs are viral in etiology, but definitive diagnosis can prove difficult due to frequently overlapping clinical presentations of viral and bacterial infections, and the variable sensitivity, and lengthy turn-around time of viral culture. We tested new automated nested multiplex PCR technology, the FilmArray(®) system, in the TAMC department of clinical investigations, to determine the feasibility of replacing the standard viral culture with a rapid turn-around system. We conducted a feasibility study using a single-blinded comparison study, comparing PCR results with archived viral culture results from a convenience sample of cryopreserved archived nasopharyngeal swabs from acutely ill ED patients who presented with complaints of URI symptoms. A total of 61 archived samples were processed. Viral culture had previously identified 31 positive specimens from these samples. The automated nested multiplex PCR detected 38 positive samples. In total, PCR was 94.5% concordant with the previously positive viral culture results. However, PCR was only 63.4% concordant with the negative viral culture results, owing to PCR detection of 11 additional viral pathogens not recovered on viral culture. The average time to process a sample was 75 minutes. We determined that an automated nested multiplex PCR is a feasible alternative to viral culture in an acute clinical setting. We were able to detect at least 94.5% as many viral pathogens as viral culture is able to identify, with a faster turn-around time.

  19. Detection of Streptococcus pyogenes using rapid visual molecular assay.

    Science.gov (United States)

    Zhao, Xiangna; He, Xiaoming; Li, Huan; Zhao, Jiangtao; Huang, Simo; Liu, Wei; Wei, Xiao; Ding, Yiwei; Wang, Zhaoyan; Zou, Dayang; Wang, Xuesong; Dong, Derong; Yang, Zhan; Yan, Xiabei; Huang, Liuyu; Du, Shuangkui; Yuan, Jing

    2015-09-01

    Streptococcus pyogenes is an increasingly important pathogen in many parts of the world. Rapid and accurate detection of S. pyogenes aids in the control of the infection. In this study, a loop-mediated isothermal amplification (LAMP) assay was developed and validated for the specific detection of S. pyogenes. The assay incorporates two methods: a chromogenic analysis using a calcein/Mn(2+) complex and real-time turbidity monitoring to assess the reaction. Both methods detected the target DNA within 60 min under 64°C isothermal conditions. The assay used specifically designed primers to target spy1258, and correctly identified 111 strains of S. pyogenes and 32 non-S. pyogenes strains, including other species of the genus Streptococcus. Tests using reference strains showed that the LAMP assay was highly specific. The sensitivity of the assay, with a detection limit of 1.49 pg DNA, was 10-fold greater than that of PCR. The LAMP assay established in this study is simple, fast and sensitive, and does not rely upon any special equipment; thus, it could be employed in clinical diagnosis. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  20. Rapid identification of pathogens from positive blood cultures by multiplex polymerase chain reaction using the FilmArray system.

    Science.gov (United States)

    Blaschke, Anne J; Heyrend, Caroline; Byington, Carrie L; Fisher, Mark A; Barker, Elizabeth; Garrone, Nicholas F; Thatcher, Stephanie A; Pavia, Andrew T; Barney, Trenda; Alger, Garrison D; Daly, Judy A; Ririe, Kirk M; Ota, Irene; Poritz, Mark A

    2012-12-01

    Sepsis is a leading cause of death. Rapid and accurate identification of pathogens and antimicrobial resistance directly from blood culture could improve patient outcomes. The FilmArray® (FA; Idaho Technology, Salt Lake City, UT, USA) Blood Culture (BC) panel can identify >25 pathogens and 4 antibiotic resistance genes from positive blood cultures in 1 h. We compared a development version of the panel to conventional culture and susceptibility testing on 102 archived blood cultures from adults and children with bacteremia. Of 109 pathogens identified by culture, 95% were identified by FA. Among 111 prospectively collected blood cultures, the FA identified 84 (91%) of 92 pathogens covered by the panel. Among 25 Staphylococcus aureus and 21 Enterococcus species detected, FA identified all culture-proven methicillin-resistant S. aureus and vancomycin-resistant enterococci. The FA BC panel is an accurate method for the rapid identification of pathogens and resistance genes from blood culture. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. Development of a rapid immunoassay for human pathogenic markers

    OpenAIRE

    Lawton, Nicola Jane

    2006-01-01

    A demand exists for a fast, sensitive, reliable and economical test for pyogenic sepsis that provides a “real time” bed-side assessment. Detection of significant intra-abdominal sepsis can be particularly problematic in the ICU setting and in patients with multi-system organ failure. Lysozyme, first reported by Fleming (1922), is a bacteriolytic enzyme released during phagocytosis. Previous studies have shown significant correlation between lysozyme levels and the presence of intra-a...

  2. Rapid Detection of Salmonella enterica in Food Using a Compact Disc-Shaped Device

    Directory of Open Access Journals (Sweden)

    Shunsuke Furutani

    2016-01-01

    Full Text Available Rapid detection of food-borne pathogens is essential to public health and the food industry. Although the conventional culture method is highly sensitive, it takes at least a few days to detect food-borne pathogens. Even though polymerase chain reaction (PCR can detect food-borne pathogens in a few hours, it is more expensive and unsatisfactorily sensitive relative to the culture method. We have developed a method to rapidly detect Salmonella enterica by using a compact disc (CD-shaped device that can reduce reagent consumption in conventional PCR. The detection method, which combines culture and PCR, is more rapid than the conventional culture method and is more sensitive and cheaper than PCR. In this study, we also examined a sample preparation method that involved collecting bacterial cells from food. The bacteria collected from chicken meat spiked with S. enterica were mixed with PCR reagents, and PCR was performed on the device. At a low concentration of S. enterica, the collected S. enterica was cultured before PCR for sensitive detection. After cultivation for 4 h, S. enterica at 1.7 × 104 colony-forming units (CFUs·g−1 was detected within 8 h, which included the time needed for sample preparation and detection. Furthermore, the detection of 30 CFUs·g−1 of S. enterica was possible within 12 h including 8 h for cultivation.

  3. A microfluidic nano-biosensor for the detection of pathogenic Salmonella.

    Science.gov (United States)

    Kim, Giyoung; Moon, Ji-Hea; Moh, Chang-Yeon; Lim, Jong-guk

    2015-05-15

    Rapid detection of pathogenic Salmonella in food products is extremely important for protecting the public from salmonellosis. The objective of the present study was to explore the feasibility of using a microfluidic nano-biosensor to rapidly detect pathogenic Salmonella. Quantum dot nanoparticles were used to detect Salmonella cells. For selective detection of Salmonella, anti-Salmonella polyclonal antibodies were covalently immobilized onto the quantum dot surface. To separate and concentrate the cells from the sample, superparamagnetic particles and a microfluidic chip were used. A portable fluorometer was developed to measure the fluorescence signal from the quantum dot nanoparticles attached to Salmonella in the samples. The sensitivity for detection of pathogenic Salmonella was evaluated using serially diluted Salmonella Typhimurium in borate buffer and chicken extract. The fluorescence response of the nano-biosensor increased with increasing cell concentration. The detection limit of the sensor was 10(3) CFU/mL Salmonella in both borate buffer and food extract. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Development of a real-time PCR for the detection of pathogenic Leptospira spp. in California sea lions.

    Science.gov (United States)

    Wu, Qingzhong; Prager, Katherine C; Goldstein, Tracey; Alt, David P; Galloway, Renee L; Zuerner, Richard L; Lloyd-Smith, James O; Schwacke, Lori

    2014-08-11

    Several real-time PCR assays are currently used for detection of pathogenic Leptospira spp.; however, few methods have been described for the successful evaluation of clinical urine samples. This study reports a rapid assay for the detection of pathogenic Leptospira spp. in California sea lions Zalophus californianus using real-time PCR with primers and a probe targeting the lipL32 gene. The PCR assay had high analytic sensitivity-the limit of detection was 3 genome copies per PCR volume using L. interrogans serovar Pomona DNA and 100% analytic specificity; it detected all pathogenic leptospiral serovars tested and none of the non-pathogenic Leptospira species (L. biflexa and L. meyeri serovar Semaranga), the intermediate species L. inadai, or the non-Leptospira pathogens tested. Our assay had an amplification efficiency of 1.00. Comparisons between the real-time PCR assay and culture isolation for detection of pathogenic Leptospira spp. in urine and kidney tissue samples from California sea lions showed that samples were more often positive by real-time PCR than by culture methods. Inclusion of an internal amplification control in the real-time PCR assay showed no inhibitory effects in PCR negative samples. These studies indicated that our real-time PCR assay has high analytic sensitivity and specificity for the rapid detection of pathogenic Leptospira species in urine and kidney tissue samples.

  5. Genome scale evolution of myxoma virus reveals host-pathogen adaptation and rapid geographic spread.

    Science.gov (United States)

    Kerr, Peter J; Rogers, Matthew B; Fitch, Adam; Depasse, Jay V; Cattadori, Isabella M; Twaddle, Alan C; Hudson, Peter J; Tscharke, David C; Read, Andrew F; Holmes, Edward C; Ghedin, Elodie

    2013-12-01

    The evolutionary interplay between myxoma virus (MYXV) and the European rabbit (Oryctolagus cuniculus) following release of the virus in Australia in 1950 as a biological control is a classic example of host-pathogen coevolution. We present a detailed genomic and phylogeographic analysis of 30 strains of MYXV, including the Australian progenitor strain Standard Laboratory Strain (SLS), 24 Australian viruses isolated from 1951 to 1999, and three isolates from the early radiation in Britain from 1954 and 1955. We show that in Australia MYXV has spread rapidly on a spatial scale, with multiple lineages cocirculating within individual localities, and that both highly virulent and attenuated viruses were still present in the field through the 1990s. In addition, the detection of closely related virus lineages at sites 1,000 km apart suggests that MYXV moves freely in geographic space, with mosquitoes, fleas, and rabbit migration all providing means of transport. Strikingly, despite multiple introductions, all modern viruses appear to be ultimately derived from the original introductions of SLS. The rapidity of MYXV evolution was also apparent at the genomic scale, with gene duplications documented in a number of viruses. Duplication of potential virulence genes may be important in increasing the expression of virulence proteins and provides the basis for the evolution of novel functions. Mutations leading to loss of open reading frames were surprisingly frequent and in some cases may explain attenuation, but no common mutations that correlated with virulence or attenuation were identified.

  6. Electroanalytical Sensors and Devices for Multiplexed Detection of Foodborne Pathogen Microorganisms

    Directory of Open Access Journals (Sweden)

    Susana Campuzano

    2009-07-01

    Full Text Available The detection and identification of pathogen microorganisms still rely on conventional culturing techniques, which are not suitable for on-site monitoring. Therefore, a great research challenge in this field is focused on the need to develop rapid, reliable, specific, and sensitive methods to detect these bacteria at low cost. Moreover, the growing interest in biochip development for large scale screening analysis implies improved miniaturization, reduction of analysis time and cost, and multi-analyte detection, which has nowadays become a crucial challenge. This paper reviews multiplexed foodborne pathogen microorganisms detection methods based on electrochemical sensors incorporating microarrays and other platforms. These devices usually involve antibody-antigen and DNA hybridization specific interactions, although other approaches such as the monitoring of oxygen consumption are also considered.

  7. A novel capillary electrophoresis-based multiplex PCR assay for detection of respiratory pathogens.

    Science.gov (United States)

    Stevenson, Jeffery B; Hymas, Weston C; Hillyard, David R

    2011-01-01

    The field of infectious disease testing has recently experienced rapid expansion in the number of multiplexed PCR-based assays available for detecting respiratory pathogens. This study provides a preliminary evaluation of a multiplex assay from Seegene that uses capillary electrophoresis as the detection platform for viral and bacterial respiratory pathogens. We compared this technology to a real-time PCR assay for 3 viral targets. Thirty respiratory samples were collected that had previously tested positive for either Flu A, Flu B, or RSV (ten of each). The Seegene assay detected 9/10 Flu A samples, 9/10 Flu B, and 10/10 RSV, for a total detection rate of 93%. The two samples that were undetected by the Seegene assay both generated late-crossing thresholds on the real-time platform, consistent with low viral loads. The Seeplex assay provides a promising alternative for multiplex respiratory testing.

  8. Rapid evolutionary adaptation to elevated salt concentrations in pathogenic freshwater bacteria Serratia marcescens

    OpenAIRE

    Ketola, Tarmo; Hiltunen, Teppo

    2014-01-01

    Rapid evolutionary adaptions to new and previously detrimental environmental conditions can increase the risk of invasion by novel pathogens. We tested this hypothesis with a 133-day-long evolutionary experiment studying the evolution of the pathogenic Serratia marcescens bacterium at salinity niche boundary and in fluctuating conditions. We found that S. marcescens evolved at harsh (80 g/L) and extreme (100 g/L) salt conditions had clearly improved salt tolerance than those evolved in the ot...

  9. Rapid detection of predation of Escherichia coli O157:H7 and sorting of bacterivorous tetrahymena by flow cytometry

    Science.gov (United States)

    Protozoa are known to harbor bacterial pathogens, enhance their survival in the environment and make them hypervirulent. Rapid non-culture based detection methods are required to determine the environmental transport of enteric pathogens from point sources such as dairies and feedlots to food crops ...

  10. Specific and Rapid Detection of Camellia oleifera Anthracnose ...

    African Journals Online (AJOL)

    The internal transcribed spacer (ITS) regions and the 5.8S rRNA gene of strain C1 of the pathogenic fungus Colletetrichum gloeosporioides were sequenced in order to design specific PCR primers for pathogen detection. Alignment of the sequence data of strain C1 and the other Colletetrichum species obtained from the ...

  11. Bioelectronic DNA detection of human papillomaviruses using eSensor™: a model system for detection of multiple pathogens

    Directory of Open Access Journals (Sweden)

    Miller Donna L

    2003-06-01

    Full Text Available Abstract Background We used human papillomaviruses (HPV as a model system to evaluate the utility of a nucleic acid, hybridization-based bioelectronic DNA detection platform (eSensor™ in identifying multiple pathogens. Methods Two chips were spotted with capture probes consisting of DNA oligonucleotide sequences specific for HPV types. Electrically conductive signal probes were synthesized to be complementary to a distinct region of the amplified HPV target DNA. A portion of the HPV L1 region that was amplified by using consensus primers served as target DNA. The amplified target was mixed with a cocktail of signal probes and added to a cartridge containing a DNA chip to allow for hybridization with complementary capture probes. Results Two bioelectric chips were designed and successfully detected 86% of the HPV types contained in clinical samples. Conclusions This model system demonstrates the potential of the eSensor platform for rapid and integrated detection of multiple pathogens.

  12. A duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains.

    Science.gov (United States)

    Benacer, Douadi; Zain, Siti Nursheena Mohd; Lewis, John W; Khalid, Mohd Khairul Nizam Mohd; Thong, Kwai Lin

    2017-01-01

    This study aimed to develop a duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains. Primers were designed to target the rrs (LG1/LG2) and ligB (LP1/LP2) genes to confirm the presence of the Leptospira genus and the pathogenic species, respectively. The assay showed 100% specificity against 17 Leptospira strains with a limit of detection of 23.1pg/µl of leptospiral DNA and sensitivity of 103 leptospires/ml in both spiked urine and water. Our duplex endpoint PCR assay is suitable for rapid early detection of Leptospira with high sensitivity and specificity.

  13. DNA microarray technique for detecting food-borne pathogens

    Directory of Open Access Journals (Sweden)

    Xing GAO

    2012-08-01

    Full Text Available Objective To study the application of DNA microarray technique for screening and identifying multiple food-borne pathogens. Methods The oligonucleotide probes were designed by Clustal X and Oligo 6.0 at the conserved regions of specific genes of multiple food-borne pathogens, and then were validated by bioinformatic analyses. The 5' end of each probe was modified by amino-group and 10 Poly-T, and the optimized probes were synthesized and spotted on aldehyde-coated slides. The bacteria DNA template incubated with Klenow enzyme was amplified by arbitrarily primed PCR, and PCR products incorporated into Aminoallyl-dUTP were coupled with fluorescent dye. After hybridization of the purified PCR products with DNA microarray, the hybridization image and fluorescence intensity analysis was acquired by ScanArray and GenePix Pro 5.1 software. A series of detection conditions such as arbitrarily primed PCR and microarray hybridization were optimized. The specificity of this approach was evaluated by 16 different bacteria DNA, and the sensitivity and reproducibility were verified by 4 food-borne pathogens DNA. The samples of multiple bacteria DNA and simulated water samples of Shigella dysenteriae were detected. Results Nine different food-borne bacteria were successfully discriminated under the same condition. The sensitivity of genomic DNA was 102 -103pg/ μl, and the coefficient of variation (CV of the reproducibility of assay was less than 15%. The corresponding specific hybridization maps of the multiple bacteria DNA samples were obtained, and the detection limit of simulated water sample of Shigella dysenteriae was 3.54×105cfu/ml. Conclusions The DNA microarray detection system based on arbitrarily primed PCR can be employed for effective detection of multiple food-borne pathogens, and this assay may offer a new method for high-throughput platform for detecting bacteria.

  14. Retraction: Popović T, Balaž J, Stanković S.: A method for the rapid detection and identification of halo blight pathogen on common bean. Arch biol sci. 2014; 66(4:1393-1400. DOI: 10.2298/ABS1404393P

    Directory of Open Access Journals (Sweden)

    Editorial

    2015-01-01

    Full Text Available This is a notice of retraction of the article: A method for the rapid detection and identification of halo blight pathogen on common bean, published in the Archives of Biological Sciences in 2014, Vol. 66, Issue 4. The Editor-in-Chief has been informed that the results presented in Fig 1. in this article have already been presented in Fig 3. in the article: Balaž J, Popović T, Vasić M, Nikolić Z. Elaboration of methods for detection of Pseudomonas savastanoi pv. phaseolicola on bean seeds. Pesticidi i fitomedicina. 2008; 23(2:81-8. DOI: 10.2298/PIF0802081B; and the results presented in Fig 2. have already been presented in Fig 4. in the article: Popović T, Milovanović P, Aleksić G, Gavrilović V, Starović M, Vasić M, Balaž J. Application of semi-selective mediums in routine diagnostic testing of Pseudomonas savastanoi pv. phaseolicola on common bean seeds. Sci Agric. 2012;69(4:265-70. After confirmation of this fact, the Editor-in-Chief of the Archives of Biological Sciences has decided to retract the paper immediately. Link to the retracted article 10.2298/ABS1404393P

  15. Rapid PCR-Based Diagnosis of Septic Arthritis by Early Gram-Type Classification and Pathogen Identification▿

    Science.gov (United States)

    Yang, Samuel; Ramachandran, Padmini; Hardick, Andrew; Hsieh, Yu-Hsiang; Quianzon, Celeste; Kuroki, Marcos; Hardick, Justin; Kecojevic, Aleksandar; Abeygunawardena, Avanthi; Zenilman, Jonathan; Melendez, Johan; Doshi, Vishal; Gaydos, Charlotte; Rothman, Richard E.

    2008-01-01

    Septic arthritis (SA) is a rheumatologic emergency associated with significant morbidity and mortality. Delayed or inadequate treatment of SA can lead to irreversible joint destruction and disability. Current methods of diagnosing SA rely on synovial fluid analysis and culture which are known to be imprecise and time-consuming. We report a novel adaptation of a probe-based real-time PCR assay targeting the 16S rRNA gene for early and accurate diagnosis of bacterial SA. The assay algorithm consists of initial broad-range eubacterial detection, followed by Gram typing and species characterization of the pathogen. The platform demonstrated a high analytical sensitivity with a limit of detection of 101 CFU/ml with a panel of SA-related organisms. Gram typing and pathogen-specific probes correctly identified their respective targets in a mock test panel of 36 common clinically relevant pathogens. One hundred twenty-one clinical synovial fluid samples from patients presenting with suspected acute SA were tested. The sensitivity and specificity of the assay were 95% and 97%, respectively, versus synovial fluid culture results. Gram-typing probes correctly identified 100% of eubacterial positive samples as to gram-positive or gram-negative status, and pathogen-specific probes correctly identified the etiologic agent in 16/20 eubacterial positive samples. The total assay time from sample collection to result is 3 h. We have demonstrated that a real-time broad-based PCR assay has high analytical and clinical performance with an improved time to detection versus culture for SA. This assay may be a useful diagnostic adjunct for clinicians, particularly those practicing in the acute care setting where rapid pathogen detection and identification would assist in disposition and treatment decisions. PMID:18305128

  16. Simultaneous Detection of 13 Key Bacterial Respiratory Pathogens by Combination of Multiplex PCR and Capillary Electrophoresis.

    Science.gov (United States)

    Jiang, Lu Xi; Ren, Hong Yu; Zhou, Hai Jian; Zhao, Si Hong; Hou, Bo Yan; Yan, Jian Ping; Qin, Tian; Chen, Yu

    2017-08-01

    Lower respiratory tract infections continue to pose a significant threat to human health. It is important to accurately and rapidly detect respiratory bacteria. To compensate for the limits of current respiratory bacteria detection methods, we developed a combination of multiplex polymerase chain reaction (PCR) and capillary electrophoresis (MPCE) assay to detect thirteen bacterial pathogens responsible for lower respiratory tract infections, including Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Mycoplasma pneumoniae, Legionella spp., Bordetella pertussis, Mycobacterium tuberculosis complex, Corynebacterium diphtheriae, and Streptococcus pyogenes. Three multiplex PCR reactions were built, and the products were analyzed by capillary electrophoresis using the high-throughput DNA analyzer. The specificity of the MPCE assay was examined and the detection limit was evaluated using DNA samples from each bacterial strain and the simulative samples of each strain. This assay was further evaluated using 152 clinical specimens and compared with real-time PCR reactions. For this assay, three nested-multiplex-PCRs were used to detect these clinical specimens. The detection limits of the MPCE assay for the 13 pathogens were very low and ranged from 10-7 to 10-2 ng/μL. Furthermore, analysis of the 152 clinical specimens yielded a specificity ranging from 96.5%-100.0%, and a sensitivity of 100.0% for the 13 pathogens. This study revealed that the MPCE assay is a rapid, reliable, and high-throughput method with high specificity and sensitivity. This assay has great potential in the molecular epidemiological survey of respiratory pathogens. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  17. Novel aptamer-linked nanoconjugate approach for detection of waterborne bacterial pathogens: an update

    Science.gov (United States)

    Singh, Gulshan; Manohar, Murli; Adegoke, Anthony Ayodeji; Stenström, Thor Axel; Shanker, Rishi

    2017-01-01

    The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1-100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.

  18. Novel aptamer-linked nanoconjugate approach for detection of waterborne bacterial pathogens: an update

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Gulshan, E-mail: gsingh.gulshan@gmail.com [Durban University of Technology, Institute for Water and Wastewater Technology (IWWT) (South Africa); Manohar, Murli [Jamia Hamdard (Hamdard University), Department of Biochemistry (India); Adegoke, Anthony Ayodeji; Stenström, Thor Axel [Durban University of Technology, Institute for Water and Wastewater Technology (IWWT) (South Africa); Shanker, Rishi [Ahmedabad University, Division of Biological & Life Sciences, School of Arts & Sciences (India)

    2017-01-15

    The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1–100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.

  19. Detection of 3-hydroxykynurenine in a plant pathogenic fungus.

    OpenAIRE

    Wilson, T J Greer; Thomsen, Karl Kristian; Petersen, Bent O.; Duus, Jens Ø.; Oliver, Richard P.

    2003-01-01

    A redox-active compound has been purified from the barley powdery mildew fungus Blumeria ( Erysiphe ) graminis f. sp. hordei. A combination of spectrophotometry, MS and NMR has identified it as 3-hydroxykynurenine (3OHKyn). This compound, never previously detected in any fungus or pathogen, is best known for its role in vertebrate cataracts. It is found abundantly in developing and germinating spores and also in runner hyphae. Two roles for 3OHKyn are discussed: first, the presence of active ...

  20. A rapid Salmonella detection method involving thermophilic helicase-dependent amplification and a lateral flow assay.

    Science.gov (United States)

    Du, Xin-Jun; Zhou, Tian-Jiao; Li, Ping; Wang, Shuo

    2017-08-01

    Salmonella is a major foodborne pathogen that is widespread in the environment and can cause serious human and animal disease. Since conventional culture methods to detect Salmonella are time-consuming and laborious, rapid and accurate techniques to detect this pathogen are critically important for food safety and diagnosing foodborne illness. In this study, we developed a rapid, simple and portable Salmonella detection strategy that combines thermophilic helicase-dependent amplification (tHDA) with a lateral flow assay to provide a detection result based on visual signals within 90 min. Performance analyses indicated that the method had detection limits for DNA and pure cultured bacteria of 73.4-80.7 fg and 35-40 CFU, respectively. Specificity analyses showed no cross reactions with Escherichia coli, Staphylococcus aureus, Listeria monocytogenes, Enterobacter aerogenes, Shigella and Campylobacter jejuni. The results for detection in real food samples showed that 1.3-1.9 CFU/g or 1.3-1.9 CFU/mL of Salmonella in contaminated chicken products and infant nutritional cereal could be detected after 2 h of enrichment. The same amount of Salmonella in contaminated milk could be detected after 4 h of enrichment. This tHDA-strip can be used for the rapid detection of Salmonella in food samples and is particularly suitable for use in areas with limited equipment. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Detection of respiratory bacterial pathogens causing atypical pneumonia by multiplex Lightmix®RT-PCR.

    Science.gov (United States)

    Wagner, Karoline; Springer, Burkard; Imkamp, Frank; Opota, Onya; Greub, Gilbert; Keller, Peter M

    2018-01-31

    Pneumonia is a severe infectious disease. In addition to common viruses and bacterial pathogens (e.g. Streptococcus pneumoniae), fastidious respiratory pathogens like Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella spp. can cause severe atypical pneumonia. They do not respond to penicillin derivatives, which may cause failure of antibiotic empirical therapy. The same applies for infections with B. pertussis and B. parapertussis, the cause of pertussis disease, that may present atypically and need to be treated with macrolides. Moreover, these fastidious bacteria are difficult to identify by culture or serology, and therefore often remain undetected. Thus, rapid and accurate identification of bacterial pathogens causing atypical pneumonia is crucial. We performed a retrospective method evaluation study to evaluate the diagnostic performance of the new, commercially available Lightmix ® multiplex RT-PCR assay that detects these fastidious bacterial pathogens causing atypical pneumonia. In this retrospective study, 368 clinical respiratory specimens, obtained from patients suffering from atypical pneumonia that have been tested negative for the presence of common agents of pneumonia by culture and viral PCR, were investigated. These clinical specimens have been previously characterized by singleplex RT-PCR assays in our diagnostic laboratory and were used to evaluate the diagnostic performance of the respiratory multiplex Lightmix ® RT-PCR. The multiplex RT-PCR displayed a limit of detection between 5 and 10 DNA copies for different in-panel organisms and showed identical performance characteristics with respect to specificity and sensitivity as in-house singleplex RT-PCRs for pathogen detection. The Lightmix ® multiplex RT-PCR assay represents a low-cost, time-saving and accurate diagnostic tool with high throughput potential. The time-to-result using an automated DNA extraction device for respiratory specimens followed by multiplex RT-PCR detection was

  2. Specific and Sensitive Isothermal Electrochemical Biosensor for Plant Pathogen DNA Detection with Colloidal Gold Nanoparticles as Probes

    Science.gov (United States)

    Lau, Han Yih; Wu, Haoqi; Wee, Eugene J. H.; Trau, Matt; Wang, Yuling; Botella, Jose R.

    2017-01-01

    Developing quick and sensitive molecular diagnostics for plant pathogen detection is challenging. Herein, a nanoparticle based electrochemical biosensor was developed for rapid and sensitive detection of plant pathogen DNA on disposable screen-printed carbon electrodes. This 60 min assay relied on the rapid isothermal amplification of target pathogen DNA sequences by recombinase polymerase amplification (RPA) followed by gold nanoparticle-based electrochemical assessment with differential pulse voltammetry (DPV). Our method was 10,000 times more sensitive than conventional polymerase chain reaction (PCR)/gel electrophoresis and could readily identify P. syringae infected plant samples even before the disease symptoms were visible. On the basis of the speed, sensitivity, simplicity and portability of the approach, we believe the method has potential as a rapid disease management solution for applications in agriculture diagnostics.

  3. Development and validation of an arthropod maceration protocol for zoonotic pathogen detection in mosquitoes and fleas.

    Science.gov (United States)

    Harrison, Genelle F; Scheirer, Jessica L; Melanson, Vanessa R

    2015-06-01

    Arthropod-borne diseases remain a pressing international public health concern. While progress has been made in the rapid detection of arthropod-borne pathogens via quantitative real-time (qPCR), or even hand-held detection devices, a simple and robust maceration and nucleic acid extraction method is necessary to implement biosurveillance capabilities. In this study, a comparison of maceration techniques using five types of beads followed by nucleic acid extraction and detection were tested using two morphologically disparate arthropods, the Aedes aegypti mosquito and Xenopsylla spp. flea, to detect the zoonotic diseases dengue virus serotype-1 and Yersinia pestis. Post-maceration nucleic acid extraction was carried out using the 1-2-3 Platinum-Path-Sample-Purification (PPSP) kit followed by qPCR detection using the Joint Biological Agent Identification and Diagnostic System (JBAIDS). We found that the 5mm stainless steel beads added to the beads provided in the PPSP kit were successful in macerating the exoskeleton for both Ae. aegypti and Xenopsylla spp. Replicates in the maceration/extraction/detection protocol were increased in a stepwise fashion until a final 128 replicates were obtained. For dengue virus detection there was a 99% positivity rate and for Y. pestis detection there was a 95% positive detection rate. In the examination of both pathogens, there were no significant differences between qPCR instruments, days ran, time of day ran, or operators. © 2015 The Society for Vector Ecology.

  4. Portable microfluidic raman system for rapid, label-free early disease signature detection

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Meiye [Sandia National Laboratories (SNL-CA), Livermore, CA (United States); Davis, Ryan Wesley [Sandia National Laboratories (SNL-CA), Livermore, CA (United States); Hatch, Anson [Sandia National Laboratories (SNL-CA), Livermore, CA (United States)

    2015-09-01

    In the early stages of infection, patients develop non-specific or no symptoms at all. While waiting for identification of the infectious agent, precious window of opportunity for early intervention is lost. The standard diagnostics require affinity reagents and sufficient pathogen titers to reach the limit of detection. In the event of a disease outbreak, triaging the at-risk population rapidly and reliably for quarantine and countermeasure is more important than the identification of the pathogen by name. To expand Sandia's portfolio of Biological threat management capabilities, we will utilize Raman spectrometry to analyze immune subsets in whole blood to rapidly distinguish infected from non-infected, and bacterial from viral infection, for the purpose of triage during an emergency outbreak. The goal of this one year LDRD is to determine whether Raman spectroscopy can provide label-free detection of early disease signatures, and define a miniaturized Raman detection system meeting requirements for low- resource settings.

  5. Label and label-free based surface-enhanced Raman scattering for pathogen bacteria detection: A review.

    Science.gov (United States)

    Liu, Yu; Zhou, Haibo; Hu, Ziwei; Yu, Guangxia; Yang, Danting; Zhao, Jinshun

    2017-08-15

    Rapid, accurate detection of pathogen bacteria is a highly topical research area for the sake of food safety and public health. Surface-enhanced Raman scattering (SERS) is being considered as a powerful and attractive technique for pathogen bacteria detection, due to its sensitivity, high speed, comparatively low cost, multiplexing ability and portability. This contribution aims to give a comprehensive overview of SERS as a technique for rapid detection of pathogen bacteria based on label and label-free strategies. A brief tutorial on SERS is given first of all. Then we summarize the recent trends and developments of label and label-free based SERS applied to detection of pathogen bacteria, including the relatively complete interpretation of SERS spectra. In addition, multifunctional SERS platforms for pathogen bacteria in matrix are discussed as well. Furthermore, an outlook of the work done and a perspective on the future directions of SERS as a reliable tool for real-time pathogen bacteria detection are given. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Evaluating the use of dedicated swab for rapid antigen detection ...

    African Journals Online (AJOL)

    Background: Group A streptococcus (GAS) is the most common and fearful bacterial cause in pediatric acute pharyngitis due to its serious complications. Several generations of rapid antigen detection tests (RADTs) have been developed to facilitate rapid detection of GAS pharyngitis. We assessed the value of using a ...

  7. Rapid assessment of assignments using plagiarism detection software.

    Science.gov (United States)

    Bischoff, Whitney R; Abrego, Patricia C

    2011-01-01

    Faculty members most often use plagiarism detection software to detect portions of students' written work that have been copied and/or not attributed to their authors. The rise in plagiarism has led to a parallel rise in software products designed to detect plagiarism. Some of these products are configurable for rapid assessment and teaching, as well as for plagiarism detection.

  8. [Detection of enteric pathogenic bacteria from surface waters by quantitative polymerase chain reaction (QPCR)].

    Science.gov (United States)

    Liu, Yong-Jun; Zhang, Chong-Miao; Wang, Xiao-Chang; Lü, Ying-Jun; Zuo, Li-Li

    2008-05-01

    A rapid quantitative polymerase chain reaction (QPCR) analysis method with universal primers was developed to detect cell densities of the enteric pathogenic bacteria from 5 surface water of Xi'an City for 4 months continuously. And the detection results by QPCR method were compared with counts of coliforms colony-forming units (CFU) determined by membrane filter (MF) analysis. The results showed that QPCR method had an estimated 94% confidence, and detection limit was 2.7 Escherichia coli cells per sample in undiluted DNA extracts. For five surface waters (N = 60), the geometric mean of pathogenic bacteria concentration determined by QPCR was 2.2-5 times of corresponding coliform CFU determined by MF analysis. Using QPCR analysis, these geometric means of pathogenic bacteria concentration ranged from 25 CCE/100 mL to 67 000 CCE/100 mL. Using MF culture analysis, coliforms ranged from 3 CFU/100 mL to 45 000 CFU/100 mL. Regression analysis showed that there was a significant positive correlation between pathogenic bacteria determined by QPCR method and coliforms determined by MF method, the correlation coefficient (r) was 0.983.

  9. [Molecular techniques for detection and identification of pathogens in food: advantages and limitations].

    Science.gov (United States)

    Palomino-Camargo, Carolina; González-Muñoz, Yuniesky

    2014-01-01

    Foodborne diseases, caused by pathogenic microorganisms, are a major public health problem worldwide. Microbiological methods commonly used in the detection of these foodborne pathogens are laborious and time consuming. This situation, coupled with the demand for immediate results and with technological advances, has led to the development of a wide range of rapid methods in recent decades. On this basis, this review describes the advantages and limitations of the main molecular methods used in detection and identification of foodborne pathogens. To this end, we considered how recent the information was published, the objective analysis of the topic and its scope. Recent literature reports a significant number of alternative, sensitive and selective molecular techniques for detection, enumeration and identification of pathogenic microorganisms in food. Polymerase chain reaction (PCR) is the most popular platform, while high performance sequencing is emerging as a technique of wide applicability for the future. However, even with all the advantages of these new methodologies, their limitations should not be overlooked. For example, molecular methods are not standardized protocols, which hinders its use in some cases. For this reason, hard work should be done to overcome these limitations and improve the application of these techniques in complex matrices such as food systems.

  10. Culture-Free Detection of Crop Pathogens at the Single-Cell Level by Micro-Raman Spectroscopy.

    Science.gov (United States)

    Gan, Qinhua; Wang, Xuetao; Wang, Yun; Xie, Zhenyu; Tian, Yang; Lu, Yandu

    2017-11-01

    The rapid and sensitive identification of invasive plant pathogens has important applications in biotechnology, plant quarantine, and food security. Current methods are far too time-consuming and need a pre-enrichment period ranging from hours to days. Here, a micro-Raman spectroscopy-based bioassay for culture-free pathogen quarantine inspection at the single cell level within 40 min is presented. The application of this approach can readily and specifically detect plant pathogens Burkholderia gladioli pv. alliicola and Erwinia chrysanthemi that are closely related pathogenically. Furthermore, the single-bacterium detection was able to discriminate them from a reference Raman spectral library including multiple quarantine-relevant pathogens with broad host ranges and an array of pathogenic variants. To show the usefulness of this assay, Burkholderia gladioli pv. alliicola and Erwinia chrysanthemi are detected at single-bacterium level in plant tissue lesions without pre-enrichment. The results are confirmed by the plate-counting method and a genetic molecular approach, which display comparable recognition ratios to the Raman spectroscopy-based bioassay. The results represent a critical step toward the use of micro-Raman spectroscopy in rapid and culture-free discrimination of quarantine relevant plant pathogens.

  11. Rapid Detection of Arthropod-Borne Pathogens in Mosquitoes

    Science.gov (United States)

    1997-06-01

    in ELISA testing. A cone-shaped plastic pestle is attached to a Dremel drill and the mosquito is homogenized. At a laboratory, each Eppendorf tube is...understanding of the current practice for obtaining mosquitoes for testing. We recieved a plastic eppendorf tube and a plastic pestle used to homogenize...maculatus in peninsular Malaysia . Maheswary, N.P., M.A., Habib, M. Elias. Southeast Asian J. Trop; Med Public Health (1992) 23:798-801. Incrimination of

  12. Actual Pathogen Detection: Sensors and Algorithms - a Review

    Directory of Open Access Journals (Sweden)

    Federico Hahn

    2009-03-01

    Full Text Available Pathogens feed on fruits and vegetables causing great food losses or at least reduction of their shelf life. These pathogens can cause losses of the final product or in the farms were the products are grown, attacking leaves, stems and trees. This review analyses disease detection sensors and algorithms for both the farm and postharvest management of fruit and vegetable quality. Mango, avocado, apple, tomato, potato, citrus and grapes were selected as the fruits and vegetables for study due to their world-wide consumption. Disease warning systems for predicting pathogens and insects on farms during fruit and vegetable production are commonly used for all the crops and are available where meteorological stations are present. It can be seen that these disease risk systems are being slowly replaced by remote sensing monitoring in developed countries. Satellite images have reduced their temporal resolution, but are expensive and must become cheaper for their use world-wide. In the last 30 years, a lot of research has been carried out in non-destructive sensors for food quality. Actually, non-destructive technology has been applied for sorting high quality fruit which is desired by the consumer. The sensors require algorithms to work properly; the most used being discriminant analysis and training neural networks. New algorithms will be required due to the high quantity of data acquired and its processing, and for disease warning strategies for disease detection.

  13. Detection of Blastocystis hominis: a controversial human pathogen.

    Science.gov (United States)

    Basak, Silpi; Rajurkar, Monali N; Mallick, Sanjay Kumar

    2014-01-01

    Blastocystis hominis has been reclassified as a protozoan parasite. Its role as a human pathogen is somewhat controversial. There has been a dramatic increase in the frequency of B. hominis infection in association with diarrhea especially in immunocompromised hosts like AIDS patients, travelers, homosexuals, day care children, animal handlers especially zoo keepers, etc. Recent reports suggest that B. hominis is an emerging pathogen; hence, we have undertaken this study to detect B. hominis from stool samples of patients attending our hospital. About 200 stool samples were tested by light microscopic examination, for observing wet mounts with saline and Lugol's iodine. Permanent staining of fecal smear by Gram's staining and modified acid fast staining was done. The stool sample which was microscopically positive for B. hominis was cultured on Lowenstein-Jensen's (LJ) medium. In one patient, the vacuolated form of B. hominis was observed in wet mount with saline preparation of stool sample. This was very clearly seen in wet mount with Lugol's iodine. In Gram's stained preparation, also the vacuolated form was observed. Detection of B. hominis was not possible by modified acid fast staining. B. hominis was also grown on LJ medium which is an egg-containing medium. Clinical microbiology laboratories should start screening of stool samples for B. hominis as it is an emerging pathogen.

  14. Multiplex PCR to detect four different tomato-infecting pathogens.

    Science.gov (United States)

    Quintero-Vásquez, Gabriela Alejandra; Bazán-Tejeda, María Luisa; Martínez-Peñafiel, Eva; Kameyama-Kawabe, Luis; Bermúdez-Cruz, Rosa María

    2013-07-01

    This work was aimed to develop a multiplex PCR assay to detect infectious agents such as Clavibacter michiganensis subsp. michiganensis, Fusarium sp, Leveillula taurica, and begomoviruses in tomato (Solanum lycopersicum) plants. Specific primer sets of each pathogen were designed based on intergenic ribosomal RNA sequences for the first three, whereas for begomoviruses, primers were designed based on conserved regions. The design also considered that the length (200-800 bp) of the PCR products was resolvable by electrophoresis; thus 296, 380, 457, and 731 bp fragments for Clavibacter, Fusarium, Leveillula, and begomoviruses, respectively, were considered. PCR conditions were optimized to amplify all the products in a single tube from genomic DNA and circumvent PCR inhibitors from infected plants. Finally, when the multiplex PCR assay was tested with tomato plants infected with any of the four pathogens, specific PCR products confirmed the presence of the pathogens. Optimized PCR multiplex allowed for the accurate and simultaneous detection of Clavibacter, Fusarium, Leveillula, and begomoviruses in infected plants or seeds from tomato.

  15. Nano-particle enhanced impedimetric biosensor for detection of foodborne pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Kim, G [National Institute of Agricultural Engineering, 249 Seodun-dong, Suwon, Republic of Korea, 441-100 (Korea, Republic of); Om, A S [Department of Food and Nutrient, Hanyang University, 17 Haengdang-dong, Seoul, Republic of Korea, 133-791 (Korea, Republic of); Mun, J H [Department of Food and Nutrient, Hanyang University, 17 Haengdang-dong, Seoul, Republic of Korea, 133-791 (Korea, Republic of)

    2007-03-15

    Recent outbreaks of foodborne illness have been increased the need for rapid and sensitive methods for detection of these pathogens. Conventional methods for pathogens detection and identification involve prolonged multiple enrichment steps. Even though some immunological rapid assays are available, these assays still need enrichment steps result in delayed detection. Biosensors have shown great potential for rapid detection of foodborne pathogens. They are capable of direct monitoring the antigen-antibody reactions in real time. Among the biosensors, impedimetric biosensors have been widely adapted as an analysis tool for the study of various biological binding reactions because of their high sensitivity and reagentless operation. In this study a nanoparticle-enhanced impedimetric biosensor for Salmonella enteritidis detection was developed which detected impedance changes caused by the attachment of the cells to the anti-Salmonella antibodies immobilized on interdigitated gold electrodes. Successive immobilization of neutravidin followed by anti-Salmonella antibodies was performed to the sensing area to create a biological detection surface. To enhance the impedance responses generated by antigen-antibody reactions, anti-Salmonella antibody conjugated nanoparticles were introduced on the sensing area. Using a portable impedance analyzer, the impedance across the interdigital electrodes was measured after the series of antigen-antibody bindings. Bacteria cells present in solution attached to capture antibodies and became tethered to the sensor surface. Attached bacteria cells changed the dielectric constant of the media between the electrodes thereby causing a change in measured impedance. Optimum input frequency was determined by analyzing frequency characteristics of the biosensor over ranges of applied frequencies from 10 Hz to 400 Hz. At 100 Hz of input frequency, the biosensor was most sensitive to the changes of the bacteria concentration and this frequency

  16. Molecular detection of pathogens in water--the pros and cons of molecular techniques.

    Science.gov (United States)

    Girones, Rosina; Ferrús, Maria Antonia; Alonso, José Luis; Rodriguez-Manzano, Jesus; Calgua, Byron; Corrêa, Adriana de Abreu; Hundesa, Ayalkibet; Carratala, Anna; Bofill-Mas, Sílvia

    2010-08-01

    Pollution of water by sewage and run-off from farms produces a serious public health problem in many countries. Viruses, along with bacteria and protozoa in the intestine or in urine are shed and transported through the sewer system. Even in highly industrialized countries, pathogens, including viruses, are prevalent throughout the environment. Molecular methods are used to monitor viral, bacterial, and protozoan pathogens, and to track pathogen- and source-specific markers in the environment. Molecular techniques, specifically polymerase chain reaction-based methods, provide sensitive, rapid, and quantitative analytical tools with which to study such pathogens, including new or emerging strains. These techniques are used to evaluate the microbiological quality of food and water, and to assess the efficiency of virus removal in drinking and wastewater treatment plants. The range of methods available for the application of molecular techniques has increased, and the costs involved have fallen. These developments have allowed the potential standardization and automation of certain techniques. In some cases they facilitate the identification, genotyping, enumeration, viability assessment, and source-tracking of human and animal contamination. Additionally, recent improvements in detection technologies have allowed the simultaneous detection of multiple targets in a single assay. However, the molecular techniques available today and those under development require further refinement in order to be standardized and applicable to a diversity of matrices. Water disinfection treatments may have an effect on the viability of pathogens and the numbers obtained by molecular techniques may overestimate the quantification of infectious microorganisms. The pros and cons of molecular techniques for the detection and quantification of pathogens in water are discussed. (c) 2010 Elsevier Ltd. All rights reserved.

  17. Rapid Identification of Emerging Human-Pathogenic Sporothrix Species with Rolling Circle Amplification

    Science.gov (United States)

    Rodrigues, Anderson M.; Najafzadeh, Mohammad J.; de Hoog, G. Sybren; de Camargo, Zoilo P.

    2015-01-01

    Sporothrix infections are emerging as an important human and animal threat among otherwise healthy patients, especially in Brazil and China. Correct identification of sporotrichosis agents is beneficial for epidemiological surveillance, enabling implementation of adequate public-health policies and guiding antifungal therapy. In areas of limited resources where sporotrichosis is endemic, high-throughput detection methods that are specific and sensitive are preferred over phenotypic methods that usually result in misidentification of closely related Sporothrix species. We sought to establish rolling circle amplification (RCA) as a low-cost screening tool for species-specific identification of human-pathogenic Sporothrix. We developed six species-specific padlock probes targeting polymorphisms in the gene encoding calmodulin. BLAST-searches revealed candidate probes that were conserved intraspecifically; no significant homology with sequences from humans, mice, plants or microorganisms outside members of Sporothrix were found. The accuracy of our RCA-based assay was demonstrated through the specificity of probe-template binding to 25 S. brasiliensis, 58 S. schenckii, 5 S. globosa, 1 S. luriei, 4 S. mexicana, and 3 S. pallida samples. No cross reactivity between closely related species was evident in vitro, and padlock probes yielded 100% specificity and sensitivity down to 3 × 106 copies of the target sequence. RCA-based speciation matched identifications via phylogenetic analysis of the gene encoding calmodulin and the rDNA operon (kappa 1.0; 95% confidence interval 1.0-1.0), supporting its use as a reliable alternative to DNA sequencing. This method is a powerful tool for rapid identification and specific detection of medically relevant Sporothrix, and due to its robustness has potential for ecological studies. PMID:26696992

  18. Integrated Detection of Pathogens and Host Biomarkers for Wounds

    Energy Technology Data Exchange (ETDEWEB)

    Jaing, C

    2012-03-19

    The increasing incidence and complications arising from combat wounds has necessitated a reassessment of methods for effective treatment. Infection, excessive inflammation, and incidence of drug-resistant organisms all contribute toward negative outcomes for afflicted individuals. The organisms and host processes involved in wound progression, however, are incompletely understood. We therefore set out, using our unique technical resources, to construct a profile of combat wounds which did or did not successfully resolve. We employed the Lawrence Livermore Microbial Detection Array and identified a number of nosocomial pathogens present in wound samples. Some of these identities corresponded with bacterial isolates previously cultured, while others were not obtained via standard microbiology. Further, we optimized proteomics protocols for the identification of host biomarkers indicative of various stages in wound progression. In combination with our pathogen data, our biomarker discovery efforts will provide a profile corresponding to wound complications, and will assist significantly in treatment of these complex cases.

  19. Recent Trends in Rapid Environmental Monitoring of Pathogens and Toxicants: Potential of Nanoparticle-Based Biosensor and Applications

    Science.gov (United States)

    Koedrith, Preeyaporn; Thasiphu, Thalisa; Weon, Jong-Il; Boonprasert, Rattana; Tuitemwong, Kooranee; Tuitemwong, Pravate

    2015-01-01

    Of global concern, environmental pollution adversely affects human health and socioeconomic development. The presence of environmental contaminants, especially bacterial, viral, and parasitic pathogens and their toxins as well as chemical substances, poses serious public health concerns. Nanoparticle-based biosensors are considered as potential tools for rapid, specific, and highly sensitive detection of the analyte of interest (both biotic and abiotic contaminants). In particular, there are several limitations of conventional detection methods for water-borne pathogens due to low concentrations and interference with various enzymatic inhibitors in the environmental samples. The increase of cells to detection levels requires long incubation time. This review describes current state of biosensor nanotechnology, the advantage over conventional detection methods, and the challenges due to testing of environmental samples. The major approach is to use nanoparticles as signal reporter to increase output rather than spending time to increase cell concentrations. Trends in future development of novel detection devices and their advantages over other environmental monitoring methodologies are also discussed. PMID:25884032

  20. Recent Trends in Rapid Environmental Monitoring of Pathogens and Toxicants: Potential of Nanoparticle-Based Biosensor and Applications

    Directory of Open Access Journals (Sweden)

    Preeyaporn Koedrith

    2015-01-01

    Full Text Available Of global concern, environmental pollution adversely affects human health and socioeconomic development. The presence of environmental contaminants, especially bacterial, viral, and parasitic pathogens and their toxins as well as chemical substances, poses serious public health concerns. Nanoparticle-based biosensors are considered as potential tools for rapid, specific, and highly sensitive detection of the analyte of interest (both biotic and abiotic contaminants. In particular, there are several limitations of conventional detection methods for water-borne pathogens due to low concentrations and interference with various enzymatic inhibitors in the environmental samples. The increase of cells to detection levels requires long incubation time. This review describes current state of biosensor nanotechnology, the advantage over conventional detection methods, and the challenges due to testing of environmental samples. The major approach is to use nanoparticles as signal reporter to increase output rather than spending time to increase cell concentrations. Trends in future development of novel detection devices and their advantages over other environmental monitoring methodologies are also discussed.

  1. Rapid detection of Naegleria fowleri in water distribution pipeline biofilms and drinking water samples.

    Science.gov (United States)

    Puzon, Geoffrey J; Lancaster, James A; Wylie, Jason T; Plumb, Iason J

    2009-09-01

    Rapid detection of pathogenic Naegleria fowler in water distribution networks is critical for water utilities. Current detection methods rely on sampling drinking water followed by culturing and molecular identification of purified strains. This culture-based method takes an extended amount of time (days), detects both nonpathogenic and pathogenic species, and does not account for N. fowleri cells associated with pipe wall biofilms. In this study, a total DNA extraction technique coupled with a real-time PCR method using primers specific for N. fowleri was developed and validated. The method readily detected N. fowleri without preculturing with the lowest detection limit for N. fowleri cells spiked in biofilm being one cell (66% detection rate) and five cells (100% detection rate). For drinking water, the detection limit was five cells (66% detection rate) and 10 cells (100% detection rate). By comparison, culture-based methods were less sensitive for detection of cells spiked into both biofilm (66% detection for pipe wall biofilm samples obtained from a distribution network enabled the detection of N. fowleri in under 6 h, versus 3+ daysforthe culture based method. Further, comparison of the real-time PCR data from the field samples and the standard curves enabled an approximation of N. fowleri cells in the biofilm and drinking water. The use of such a method will further aid water utilities in detecting and managing the persistence of N. fowleri in water distribution networks.

  2. Current Technical Approaches for the Early Detection of Foodborne Pathogens: Challenges and Opportunities

    Directory of Open Access Journals (Sweden)

    Il-Hoon Cho

    2017-09-01

    Full Text Available The development of novel and high-tech solutions for rapid, accurate, and non-laborious microbial detection methods is imperative to improve the global food supply. Such solutions have begun to address the need for microbial detection that is faster and more sensitive than existing methodologies (e.g., classic culture enrichment methods. Multiple reviews report the technical functions and structures of conventional microbial detection tools. These tools, used to detect pathogens in food and food homogenates, were designed via qualitative analysis methods. The inherent disadvantage of these analytical methods is the necessity for specimen preparation, which is a time-consuming process. While some literature describes the challenges and opportunities to overcome the technical issues related to food industry legal guidelines, there is a lack of reviews of the current trials to overcome technological limitations related to sample preparation and microbial detection via nano and micro technologies. In this review, we primarily explore current analytical technologies, including metallic and magnetic nanomaterials, optics, electrochemistry, and spectroscopy. These techniques rely on the early detection of pathogens via enhanced analytical sensitivity and specificity. In order to introduce the potential combination and comparative analysis of various advanced methods, we also reference a novel sample preparation protocol that uses microbial concentration and recovery technologies. This technology has the potential to expedite the pre-enrichment step that precedes the detection process.

  3. Current Technical Approaches for the Early Detection of Foodborne Pathogens: Challenges and Opportunities.

    Science.gov (United States)

    Cho, Il-Hoon; Ku, Seockmo

    2017-09-30

    The development of novel and high-tech solutions for rapid, accurate, and non-laborious microbial detection methods is imperative to improve the global food supply. Such solutions have begun to address the need for microbial detection that is faster and more sensitive than existing methodologies (e.g., classic culture enrichment methods). Multiple reviews report the technical functions and structures of conventional microbial detection tools. These tools, used to detect pathogens in food and food homogenates, were designed via qualitative analysis methods. The inherent disadvantage of these analytical methods is the necessity for specimen preparation, which is a time-consuming process. While some literature describes the challenges and opportunities to overcome the technical issues related to food industry legal guidelines, there is a lack of reviews of the current trials to overcome technological limitations related to sample preparation and microbial detection via nano and micro technologies. In this review, we primarily explore current analytical technologies, including metallic and magnetic nanomaterials, optics, electrochemistry, and spectroscopy. These techniques rely on the early detection of pathogens via enhanced analytical sensitivity and specificity. In order to introduce the potential combination and comparative analysis of various advanced methods, we also reference a novel sample preparation protocol that uses microbial concentration and recovery technologies. This technology has the potential to expedite the pre-enrichment step that precedes the detection process.

  4. Rapid Molecular detection of citrus brown spot disease using ACT gene in Alternaria alternata

    Directory of Open Access Journals (Sweden)

    Hamid Moghimi

    2017-06-01

    Full Text Available Introduction:Using rapid detection methods is important for detection of plant pathogens and also prevention through spreading pests in agriculture. Citrus brown spot disease caused by pathogenic isolates of Alternaria alternata is a common disease in Iran. Materials and methods: In this study, for the first time a PCR based molecular method was used for rapid diagnosis of brown spot disease. Nine isolates of A. Alternata were isolated in PDA medium from different citrus gardens. The plant pathogenic activity was examined in tangerine leaves for isolates. Results showed that these isolates are the agents of brown spot disease. PCR amplification of specific ACT-toxin gene was performed for DNA extracted from A. alternata isolates, with 11 different fungal isolates as negative controls and 5 DNA samples extracted from soil. Results: Results showed that A. alternata, the causal agent of brown spot disease, can be carefully distinguished from other pathogenic agents by performing PCR amplification with specific primers for ACT toxin gene. Also, the results from Nested-PCR method confirmed the primary reaction and the specificity of A. alternata for brown spot disease. PCR results to control samples of the other standard fungal isolates, showed no amplification band. In addition, PCR with the DNA extracted from contaminated soils confirmed the presence of ACT toxin gene. Discussion and conclusion: Molecular procedure presented here can be used in rapid identification and prevention of brown spot infection in citrus gardens all over the country.

  5. Rapid identification of bio-molecules applied for detection of biosecurity agents using rolling circle amplification.

    Directory of Open Access Journals (Sweden)

    Jenny Göransson

    Full Text Available Detection and identification of pathogens in environmental samples for biosecurity applications are challenging due to the strict requirements on specificity, sensitivity and time. We have developed a concept for quick, specific and sensitive pathogen identification in environmental samples. Target identification is realized by padlock- and proximity probing, and reacted probes are amplified by RCA (rolling-circle amplification. The individual RCA products are labeled by fluorescence and enumerated by an instrument, developed for sensitive and rapid digital analysis. The concept is demonstrated by identification of simili biowarfare agents for bacteria (Escherichia coli and Pantoea agglomerans and spores (Bacillus atrophaeus released in field.

  6. Rapid detection of Mycobacterium avium subsp. paratuberculosis ...

    African Journals Online (AJOL)

    Paratuberculosis, caused by Mycobacterium avium subsp. paratuberculosis, a suspect causative agent of Crohns disease in man, is an emerging disease of international proportions affecting all ruminants. Early stage detection of Mycobacterium avium subsp. paratuberculosis infection would accelerate progress in control ...

  7. Detection of Pathogen Exposure in African Buffalo Using Non-Specific Markers of Inflammation

    Directory of Open Access Journals (Sweden)

    Caroline K. Glidden

    2018-01-01

    Full Text Available Detecting exposure to new or emerging pathogens is a critical challenge to protecting human, domestic animal, and wildlife health. Yet, current techniques to detect infections typically target known pathogens of humans or economically important animals. In the face of the current surge in infectious disease emergence, non-specific disease surveillance tools are urgently needed. Tracking common host immune responses indicative of recent infection may have potential as a non-specific diagnostic approach for disease surveillance. The challenge to immunologists is to identify the most promising markers, which ideally should be highly conserved across pathogens and host species, become upregulated rapidly and consistently in response to pathogen invasion, and remain elevated beyond clearance of infection. This study combined an infection experiment and a longitudinal observational study to evaluate the utility of non-specific markers of inflammation [NSMI; two acute phase proteins (haptoglobin and serum amyloid A, two pro-inflammatory cytokines (IFNγ and TNF-α] as indicators of pathogen exposure in a wild mammalian species, African buffalo (Syncerus caffer. Specifically, in the experimental study, we asked (1 How quickly do buffalo mount NSMI responses upon challenge with an endemic pathogen, foot-and-mouth disease virus; (2 for how long do NSMI remain elevated after viral clearance and; (3 how pronounced is the difference between peak NSMI concentration and baseline NSMI concentration? In the longitudinal study, we asked (4 Are elevated NSMI associated with recent exposure to a suite of bacterial and viral respiratory pathogens in a wild population? Among the four NSMI that we tested, haptoglobin showed the strongest potential as a surveillance marker in African buffalo: concentrations quickly and consistently reached high levels in response to experimental infection, remaining elevated for almost a month. Moreover, elevated haptoglobin was

  8. Detection of 3-hydroxykynurenine in a plant pathogenic fungus.

    Science.gov (United States)

    Wilson, T J Greer; Thomsen, Karl Kristian; Petersen, Bent O; Duus, Jens Ø; Oliver, Richard P

    2003-05-01

    A redox-active compound has been purified from the barley powdery mildew fungus Blumeria ( Erysiphe ) graminis f. sp. hordei. A combination of spectrophotometry, MS and NMR has identified it as 3-hydroxykynurenine (3OHKyn). This compound, never previously detected in any fungus or pathogen, is best known for its role in vertebrate cataracts. It is found abundantly in developing and germinating spores and also in runner hyphae. Two roles for 3OHKyn are discussed: first, the presence of active oxygen species would enable 3OHKyn to cross-link the spore chemically with the plant. Secondly, it may be acting as an UV protectant and an antioxidant.

  9. Identification of upper respiratory tract pathogens using electrochemical detection on an oligonucleotide microarray.

    Directory of Open Access Journals (Sweden)

    Michael J Lodes

    Full Text Available Bacterial and viral upper respiratory infections (URI produce highly variable clinical symptoms that cannot be used to identify the etiologic agent. Proper treatment, however, depends on correct identification of the pathogen involved as antibiotics provide little or no benefit with viral infections. Here we describe a rapid and sensitive genotyping assay and microarray for URI identification using standard amplification and hybridization techniques, with electrochemical detection (ECD on a semiconductor-based oligonucleotide microarray. The assay was developed to detect four bacterial pathogens (Bordetella pertussis, Streptococcus pyogenes, Chlamydia pneumoniae and Mycoplasma pneumoniae and 9 viral pathogens (adenovirus 4, coronavirus OC43, 229E and HK, influenza A and B, parainfluenza types 1, 2, and 3 and respiratory syncytial virus. This new platform forms the basis for a fully automated diagnostics system that is very flexible and can be customized to suit different or additional pathogens. Multiple probes on a flexible platform allow one to test probes empirically and then select highly reactive probes for further iterative evaluation. Because ECD uses an enzymatic reaction to create electrical signals that can be read directly from the array, there is no need for image analysis or for expensive and delicate optical scanning equipment. We show assay sensitivity and specificity that are excellent for a multiplexed format.

  10. Etiological Analysis of Fungal Keratitis and Rapid Identification of Predominant Fungal Pathogens.

    Science.gov (United States)

    He, Dan; Hao, Jilong; Gao, Song; Wan, Xue; Wang, Wanting; Shan, Qiushi; Wang, Li

    2016-02-01

    Fungal keratitis is a worldwide-distributed refractory and potentially blinding ocular infection caused by various fungi. It is necessary to investigate the etiological and epidemiological characteristics of this disease and establish a rapid and specific pathogenic identification method. Here, we isolated and identified fungal pathogens of 275 patients with presumed fungal keratitis from Jilin Province, China, and conducted statistical analyses of epidemiological information. The positive rate of fungal culture was 72.0 %. Fusarium sp. was the most common genus among 210 fungal isolates. The predominant species were Fusarium solani, Aspergillus fumigatus, and Candida glabrata, which accounted for over 50 % of the isolated organisms. Corneal trauma and previous use of drugs were the most important predisposing factors. In addition, a multiplex polymerase chain reaction (PCR) was designed with species-specific primers of the three species that could identify them with amplicons of approximately 330 bp from F. solani, 275 bp from A. fumigatus, and 230 bp from C. glabrata. Additionally, PCR with fungal universal primers and multiplex PCR were performed using DNA prepared by an improved DNA extraction method from corneal scrapings. With this method, fungal pathogens from corneal scrapings could be specifically and rapidly identified within 8 h. The culture-independent rapid identification of corneal scrapings may have great significance for the early diagnosis and treatment of fungal keratitis.

  11. Next generation sequencing-based multigene panel for high throughput detection of food-borne pathogens.

    Science.gov (United States)

    Ferrario, Chiara; Lugli, Gabriele Andrea; Ossiprandi, Maria Cristina; Turroni, Francesca; Milani, Christian; Duranti, Sabrina; Mancabelli, Leonardo; Mangifesta, Marta; Alessandri, Giulia; van Sinderen, Douwe; Ventura, Marco

    2017-09-01

    Contamination of food by chemicals or pathogenic bacteria may cause particular illnesses that are linked to food consumption, commonly referred to as foodborne diseases. Bacteria are present in/on various foods products, such as fruits, vegetables and ready-to-eat products. Bacteria that cause foodborne diseases are known as foodborne pathogens (FBPs). Accurate detection methods that are able to reveal the presence of FBPs in food matrices are in constant demand, in order to ensure safe foods with a minimal risk of causing foodborne diseases. Here, a multiplex PCR-based Illumina sequencing method for FBP detection in food matrices was developed. Starting from 25 bacterial targets and 49 selected PCR primer pairs, a primer collection called foodborne pathogen - panel (FPP) consisting of 12 oligonucleotide pairs was developed. The FPP allows a more rapid and reliable identification of FBPs compared to classical cultivation methods. Furthermore, FPP permits sensitive and specific FBP detection in about two days from food sample acquisition to bioinformatics-based identification. The FPP is able to simultaneously identify eight different bacterial pathogens, i.e. Listeria monocytogenes, Campylobacter jejuni, Campylobacter coli, Salmonella enterica subsp. enterica serovar enteritidis, Escherichia coli, Shigella sonnei, Staphylococcus aureus and Yersinia enterocolitica, in a given food matrix at a threshold contamination level of 10 1 cell/g. Moreover, this novel detection method may represent an alternative and/or a complementary approach to PCR-based techniques, which are routinely used for FBP detection, and could be implemented in (parts of) the food chain as a quality check. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. New quantitative detection of pathogens in heterogeneous environmental samples

    Science.gov (United States)

    Lee, Eun-Hee; Wang, Xiaofang; Mitchell, Kristi; Chae, Seon-Ha; Son, Ahjeong

    2015-04-01

    Quantum dots and magnetic beads based genomic assay (NanoGene assay) has been developed for sensitive and inhibition resistant gene quantification to achieve in-situ bacteria monitoring in environmental samples. In this study, eaeA gene of pathogenic E. coli O157:H7 was quantified. The result demonstrated the excellent sensitivity (i.e., limit of detection: 87 gene copies for dsDNA and 890 zeptomolar for ssDNA) in the presence of nonspecific microbial populations (Kim et al., 2010; 2011a). The feasibility of the developed gene quantification for non-laboratory environment usage (in-situ use) was investigated. Therefore, DNA hybridization was achieved at ambient temperature and minimum agitation, and the analysis was completed within hours. Most importantly, the NanoGene assay demonstrated the resistance to the presence of naturally occurring inhibitors (humic acids, cations) and residual reagents (surfactants, alcohols) from DNA extraction (Kim et al., 2011b). The assay was also applied to humic acids laden soils (7 types of soils with various amount of organic matters) and successfully quantified 105 to 108 CFU of E. coli O157:H7 per gram soil (R2 = 0.99). The results indicate that the presented NanoGene assay is suitable for further development as an in-situ bacteria monitoring method for working with heterogeneous environmental samples (Wang et al., 2013). Another aspect of the method is to transform the NanoGene assay into a portable device that can be used as a pathogenic bacteria detector in environment. The project consisted of the first inline fluidic components development and characterization as well as the first integration effort on a briefcase platform for the in-situ pathogen detection system (IPDS) (Mitchell et al., 2014). Our long term vision is to further miniaturize the briefcase platform implementation of the IPDS and to commercialize the handheld version of the IPDS.

  13. Humic substances interfere with detection of pathogenic prion protein

    Science.gov (United States)

    Smith, Christen B.; Booth, Clarissa J.; Wadzinski, Tyler J.; Legname, Giuseppe; Chappell, Rick; Johnson, Christopher J.; Pedersen, Joel A.

    2014-01-01

    Studies examining the persistence of prions (the etiological agent of transmissible spongiform encephalopathies) in soil require accurate quantification of pathogenic prion protein (PrPTSE) extracted from or in the presence of soil particles. Here, we demonstrate that natural organic matter (NOM) in soil impacts PrPTSE detection by immunoblotting. Methods commonly used to extract PrPTSE from soils release substantial amounts of NOM, and NOM inhibited PrPTSE immunoblot signal. The degree of immunoblot interference increased with increasing NOM concentration and decreasing NOM polarity. Humic substances affected immunoblot detection of prion protein from both deer and hamsters. We also establish that after interaction with humic acid, PrPTSE remains infectious to hamsters inoculated intracerebrally, and humic acid appeared to slow disease progression. These results provide evidence for interactions between PrPTSE and humic substances that influence both accurate measurement of PrPTSE in soil and disease transmission.

  14. Advanced biosensors for detection of pathogens related to livestock and poultry.

    Science.gov (United States)

    Vidic, Jasmina; Manzano, Marisa; Chang, Chung-Ming; Jaffrezic-Renault, Nicole

    2017-02-21

    Infectious animal diseases caused by pathogenic microorganisms such as bacteria and viruses threaten the health and well-being of wildlife, livestock, and human populations, limit productivity and increase significantly economic losses to each sector. The pathogen detection is an important step for the diagnostics, successful treatment of animal infection diseases and control management in farms and field conditions. Current techniques employed to diagnose pathogens in livestock and poultry include classical plate-based methods and conventional biochemical methods as enzyme-linked immunosorbent assays (ELISA). These methods are time-consuming and frequently incapable to distinguish between low and highly pathogenic strains. Molecular techniques such as polymerase chain reaction (PCR) and real time PCR (RT-PCR) have also been proposed to be used to diagnose and identify relevant infectious disease in animals. However these DNA-based methodologies need isolated genetic materials and sophisticated instruments, being not suitable for in field analysis. Consequently, there is strong interest for developing new swift point-of-care biosensing systems for early detection of animal diseases with high sensitivity and specificity. In this review, we provide an overview of the innovative biosensing systems that can be applied for livestock pathogen detection. Different sensing strategies based on DNA receptors, glycan, aptamers and antibodies are presented. Besides devices still at development level some are validated according to standards of the World Organization for Animal Health and are commercially available. Especially, paper-based platforms proposed as an affordable, rapid and easy to perform sensing systems for implementation in field condition are included in this review.

  15. Rapid Detection of Cellular Response to Biological Agents

    National Research Council Canada - National Science Library

    Williams, Bryan R

    2005-01-01

    Our program objective is to develop simple and rapid methods for detecting at a cellular level, individual responses to environmental stresses elaborated by exposure to infectious agents such as bacteria and viruses...

  16. Rapid Detection of Cellular Responses to Biological Agents

    National Research Council Canada - National Science Library

    Williams, Bryan

    2004-01-01

    Our program objective is to develop simple and rapid methods for detecting, at a cellular level, individual responses to environmental stresses elaborated by exposure to infectious agents such as bacteria and viruses...

  17. Rapid Detection of Cellular Responses to Biological Agents

    National Research Council Canada - National Science Library

    Williams, Bryan

    2003-01-01

    Our program objective is to develop simple and rapid methods for detecting, at a cellular level, individual responses to environmental stresses elaborated by exposure to infectious agents such as bacteria and viruses...

  18. ETV Tech Brief: Rapid Fungi and Bacteria Detection Technologies

    Science.gov (United States)

    Technical brief that summarizes the results for Mycometer, Inc. Mycometer®-test and Bactiquant®-test, which are rapid detection technologies for fungi and bacteria. The brief summarizes the results of the verification report and statement.

  19. Reliable, rapid and simple voltammetric detection of urea nitrate explosive.

    Science.gov (United States)

    Cagan, Avi; Lu, Donglai; Cizek, Karel; La Belle, Jeff; Wang, Joseph

    2008-05-01

    A highly selective and rapid electrochemical assay of the improvised explosive urea nitrate (UN) is reported. The method involves a short ( approximately 10 s) acid-catalyzed reaction of UN with 4-nitrotoluene (NT) followed by a rapid ( approximately 2 s) square-wave voltammetric (SWV) detection of the 2,4-dinitrotoluene (DNT) product. The new protocol offers great promise for a reliable field detection of UN, with significant advantages of speed, sensitivity, portability, simplicity, and cost.

  20. Rapid method for detection of salmonella in meat

    DEFF Research Database (Denmark)

    2016-01-01

    The present invention relates to a rapid method for the detection of Salmonella in meat as well as to a kit for performing said method. The method provides a time-to-result of less than 8 hours.......The present invention relates to a rapid method for the detection of Salmonella in meat as well as to a kit for performing said method. The method provides a time-to-result of less than 8 hours....

  1. Molecular Detection of 10 of the Most Unwanted Alien Forest Pathogens in Canada Using Real-Time PCR.

    Directory of Open Access Journals (Sweden)

    Josyanne Lamarche

    Full Text Available Invasive alien tree pathogens can cause significant economic losses as well as large-scale damage to natural ecosystems. Early detection to prevent their establishment and spread is an important approach used by several national plant protection organizations (NPPOs. Molecular detection tools targeting 10 of the most unwanted alien forest pathogens in Canada were developed as part of the TAIGA project (http://taigaforesthealth.com/. Forest pathogens were selected following an independent prioritization. Specific TaqMan real-time PCR detection assays were designed to function under homogeneous conditions so that they may be used in 96- or 384-well plate format arrays for high-throughput testing of large numbers of samples against multiple targets. Assays were validated for 1 specificity, 2 sensitivity, 3 precision, and 4 robustness on environmental samples. All assays were highly specific when evaluated against a panel of pure cultures of target and phylogenetically closely-related species. Sensitivity, evaluated by assessing the limit of detection (with a threshold of 95% of positive samples, was found to be between one and ten target gene region copies. Precision or repeatability of each assay revealed a mean coefficient of variation of 3.4%. All assays successfully allowed detection of target pathogen on positive environmental samples, without any non-specific amplification. These molecular detection tools will allow for rapid and reliable detection of 10 of the most unwanted alien forest pathogens in Canada.

  2. Rapid detection of Ganoderma lucidum and assessment of inhibition ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-05-18

    May 18, 2009 ... revolutionized the field of plant pathology in diagnosing various plant pathogens (Henson and French, 1993). The internal transcribed spacer (ITS) regions of ribosomal. RNA gene (rDNA) have been selected as specific targets for PCR detection of Ganoderma (Utomo and Niepold,. 2000). Secondly, the ...

  3. Evaluation of a rapid, quantitative real-time PCR method for enumeration of pathogenic Candida cells in water

    Science.gov (United States)

    Brinkman, Nichole E.; Haugland, Richard A.; Wymer, Larry J.; Byappanahalli, Muruleedhara N.; Whitman, Richard L.; Vesper, Stephen J.

    2003-01-01

    Quantitative PCR (QPCR) technology, incorporating fluorigenic 5′ nuclease (TaqMan) chemistry, was utilized for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C. lusitaniae) in water. Known numbers of target cells were added to distilled and tap water samples, filtered, and disrupted directly on the membranes for recovery of DNA for QPCR analysis. The assay's sensitivities were between one and three cells per filter. The accuracy of the cell estimates was between 50 and 200% of their true value (95% confidence level). In similar tests with surface water samples, the presence of PCR inhibitory compounds necessitated further purification and/or dilution of the DNA extracts, with resultant reductions in sensitivity but generally not in quantitative accuracy. Analyses of a series of freshwater samples collected from a recreational beach showed positive correlations between the QPCR results and colony counts of the corresponding target species. Positive correlations were also seen between the cell quantities of the target Candida species detected in these analyses and colony counts of Enterococcus organisms. With a combined sample processing and analysis time of less than 4 h, this method shows great promise as a tool for rapidly assessing potential exposures to waterborne pathogenic Candida species from drinking and recreational waters and may have applications in the detection of fecal pollution.

  4. Rapid screening for entry inhibitors of highly pathogenic viruses under low-level biocontainment.

    Directory of Open Access Journals (Sweden)

    Aparna Talekar

    Full Text Available Emerging viruses including Nipah, Hendra, Lujo, and Junin viruses have enormous potential to spread rapidly. Nipah virus, after emerging as a zoonosis, has also evolved the capacity for human-to-human transmission. Most of the diseases caused by these pathogens are untreatable and require high biocontainment conditions. Universal methods for rapidly identifying and screening candidate antivirals are urgently needed. We have developed a modular antiviral platform strategy that relies on simple bioinformatic and genetic information about each pathogen. Central to this platform is the use of envelope glycoprotein cDNAs to establish multi-cycle replication systems under BSL2 conditions for viral pathogens that normally require BSL3 and BSL4 facilities. We generated monoclonal antibodies against Nipah G by cDNA immunization in rats, and we showed that these antibodies neutralize both Nipah and Hendra live viruses. We then used these effective Henipavirus inhibitors to validate our screening strategy. Our proposed strategy should contribute to the response capability for emerging infectious diseases, providing a way to initiate antiviral development immediately upon identifying novel viruses.

  5. Rapid Screening for Entry Inhibitors of Highly Pathogenic Viruses under Low-Level Biocontainment

    Science.gov (United States)

    Talekar, Aparna; Pessi, Antonello; Glickman, Fraser; Sengupta, Uttara; Briese, Thomas; Whitt, Michael A.; Mathieu, Cyrille; Horvat, Branka; Moscona, Anne; Porotto, Matteo

    2012-01-01

    Emerging viruses including Nipah, Hendra, Lujo, and Junin viruses have enormous potential to spread rapidly. Nipah virus, after emerging as a zoonosis, has also evolved the capacity for human-to-human transmission. Most of the diseases caused by these pathogens are untreatable and require high biocontainment conditions. Universal methods for rapidly identifying and screening candidate antivirals are urgently needed. We have developed a modular antiviral platform strategy that relies on simple bioinformatic and genetic information about each pathogen. Central to this platform is the use of envelope glycoprotein cDNAs to establish multi-cycle replication systems under BSL2 conditions for viral pathogens that normally require BSL3 and BSL4 facilities. We generated monoclonal antibodies against Nipah G by cDNA immunization in rats, and we showed that these antibodies neutralize both Nipah and Hendra live viruses. We then used these effective Henipavirus inhibitors to validate our screening strategy. Our proposed strategy should contribute to the response capability for emerging infectious diseases, providing a way to initiate antiviral development immediately upon identifying novel viruses. PMID:22396728

  6. Genome Sequencing and Mapping Reveal Loss of Heterozygosity as a Mechanism for Rapid Adaptation in the Vegetable Pathogen Phytophthora capsici

    Energy Technology Data Exchange (ETDEWEB)

    Lamour, Kurt H.; Mudge, Joann; Gobena, Daniel; Hurtado-Gonzales, Oscar P.; Schmutz, Jeremy; Kuo, Alan; Miller, Neil A.; Rice, Brandon J.; Raffaele, Sylvain; Cano, Liliana M.; Bharti, Arvind K.; Donahoo, Ryan S.; Finely, Sabra; Huitema, Edgar; Hulvey, Jon; Platt, Darren; Salamov, Asaf; Savidor, Alon; Sharma, Rahul; Stam, Remco; Sotrey, Dylan; Thines, Marco; Win, Joe; Haas, Brian J.; Dinwiddie, Darrell L.; Jenkins, Jerry; Knight, James R.; Affourtit, Jason P.; Han, Cliff S.; Chertkov, Olga; Lindquist, Erika A.; Detter, Chris; Grigoriev, Igor V.; Kamoun, Sophien; Kingsmore, Stephen F.

    2012-02-07

    The oomycete vegetable pathogen Phytophthora capsici has shown remarkable adaptation to fungicides and new hosts. Like other members of this destructive genus, P. capsici has an explosive epidemiology, rapidly producing massive numbers of asexual spores on infected hosts. In addition, P. capsici can remain dormant for years as sexually recombined oospores, making it difficult to produce crops at infested sites, and allowing outcrossing populations to maintain significant genetic variation. Genome sequencing, development of a high-density genetic map, and integrative genomic or genetic characterization of P. capsici field isolates and intercross progeny revealed significant mitotic loss of heterozygosity (LOH) in diverse isolates. LOH was detected in clonally propagated field isolates and sexual progeny, cumulatively affecting >30percent of the genome. LOH altered genotypes for more than 11,000 single-nucleotide variant sites and showed a strong association with changes in mating type and pathogenicity. Overall, it appears that LOH may provide a rapid mechanism for fixing alleles and may be an important component of adaptability for P. capsici.

  7. Rapid Staining Method to Detect and Identify Downy Mildew (Peronospora belbahrii in Basil

    Directory of Open Access Journals (Sweden)

    Adolfina R. Koroch

    2013-07-01

    Full Text Available Premise of the study: Demand for fresh-market sweet basil continues to increase, but in 2009 a new pathogen emerged, threatening commercial field/greenhouse production and leading to high crop losses. This study describes a simple and effective staining method for rapid microscopic detection of basil downy mildew (Peronospora belbahrii from leaves of basil (Ocimum basilicum. Methods and Results: Fresh leaf sections infected with P. belbahrii were placed on a microscope slide, cleared with Visikol™, and stained with iodine solution followed by one drop of 70% sulfuric acid. Cell walls of the pathogen were stained with a distinct coloration, providing a high-contrast image between the pathogen and plant. Conclusions: This new staining method can be used successfully to identify downy mildew in basil, which then can significantly reduce its spread if identified early, coupled with mitigation strategies. This technique can facilitate the control of the disease, without expensive and specialized equipment.

  8. Development and evaluation of rapid novel isothermal amplification assays for important veterinary pathogens: Chlamydia psittaci and Chlamydia pecorum

    Directory of Open Access Journals (Sweden)

    Martina Jelocnik

    2017-09-01

    Full Text Available Background Chlamydia psittaci and Chlamydia pecorum are important veterinary pathogens, with the former also being responsible for zoonoses, and the latter adversely affecting koala populations in Australia and livestock globally. The rapid detection of these organisms is still challenging, particularly at the point-of-care (POC. In the present study, we developed and evaluated rapid, sensitive and robust C. psittaci-specific and C. pecorum-specific Loop Mediated Isothermal Amplification (LAMP assays for detection of these pathogens. Methods and Materials The LAMP assays, performed in a Genie III real-time fluorometer, targeted a 263 bp region of the C. psittaci-specific Cps_0607 gene or a 209 bp region of a C. pecorum-specific conserved gene CpecG_0573, and were evaluated using a range of samples previously screened using species-specific quantitative PCRs (qPCRs. Species-specificity for C. psittaci and C. pecorum LAMP targets was tested against DNA samples from related chlamydial species and a range of other bacteria. In order to evaluate pathogen detection in clinical samples, C. psittaci LAMP was evaluated using a total of 26 DNA extracts from clinical samples from equine and avian hosts, while for C. pecorum LAMP, we tested a total of 63 DNA extracts from clinical samples from koala, sheep and cattle hosts. A subset of 36 C. pecorum samples was also tested in a thermal cycler (instead of a real-time fluorometer using newly developed LAMP and results were determined as an end point detection. We also evaluated rapid swab processing (without DNA extraction to assess the robustness of these assays. Results Both LAMP assays were demonstrated to species-specific, highly reproducible and to be able to detect as little as 10 genome copy number/reaction, with a mean amplification time of 14 and 24 min for C. psittaci and C. pecorum, respectively. When testing clinical samples, the overall congruence between the newly developed LAMP assays and q

  9. Development and evaluation of rapid novel isothermal amplification assays for important veterinary pathogens: Chlamydia psittaci and Chlamydia pecorum.

    Science.gov (United States)

    Jelocnik, Martina; Islam, Md Mominul; Madden, Danielle; Jenkins, Cheryl; Branley, James; Carver, Scott; Polkinghorne, Adam

    2017-01-01

    Chlamydia psittaci and Chlamydia pecorum are important veterinary pathogens, with the former also being responsible for zoonoses, and the latter adversely affecting koala populations in Australia and livestock globally. The rapid detection of these organisms is still challenging, particularly at the point-of-care (POC). In the present study, we developed and evaluated rapid, sensitive and robust C. psittaci-specific and C. pecorum-specific Loop Mediated Isothermal Amplification (LAMP) assays for detection of these pathogens. The LAMP assays, performed in a Genie III real-time fluorometer, targeted a 263 bp region of the C. psittaci-specific Cps_0607 gene or a 209 bp region of a C. pecorum-specific conserved gene CpecG_0573, and were evaluated using a range of samples previously screened using species-specific quantitative PCRs (qPCRs). Species-specificity for C. psittaci and C. pecorum LAMP targets was tested against DNA samples from related chlamydial species and a range of other bacteria. In order to evaluate pathogen detection in clinical samples, C. psittaci LAMP was evaluated using a total of 26 DNA extracts from clinical samples from equine and avian hosts, while for C. pecorum LAMP, we tested a total of 63 DNA extracts from clinical samples from koala, sheep and cattle hosts. A subset of 36 C. pecorum samples was also tested in a thermal cycler (instead of a real-time fluorometer) using newly developed LAMP and results were determined as an end point detection. We also evaluated rapid swab processing (without DNA extraction) to assess the robustness of these assays. Both LAMP assays were demonstrated to species-specific, highly reproducible and to be able to detect as little as 10 genome copy number/reaction, with a mean amplification time of 14 and 24 min for C. psittaci and C. pecorum, respectively. When testing clinical samples, the overall congruence between the newly developed LAMP assays and qPCR was 92.3% for C. psittaci (91.7% sensitivity and 92

  10. Nested PCR Assay for Eight Pathogens: A Rapid Tool for Diagnosis of Bacterial Meningitis.

    Science.gov (United States)

    Bhagchandani, Sharda P; Kubade, Sushant; Nikhare, Priyanka P; Manke, Sonali; Chandak, Nitin H; Kabra, Dinesh; Baheti, Neeraj N; Agrawal, Vijay S; Sarda, Pankaj; Mahajan, Parikshit; Ganjre, Ashish; Purohit, Hemant J; Singh, Lokendra; Taori, Girdhar M; Daginawala, Hatim F; Kashyap, Rajpal S

    2016-02-01

    Bacterial meningitis is a dreadful infectious disease with a high mortality and morbidity if remained undiagnosed. Traditional diagnostic methods for bacterial meningitis pose a challenge in accurate identification of pathogen, making prognosis difficult. The present study is therefore aimed to design and evaluate a specific and sensitive nested 16S rDNA genus-based polymerase chain reaction (PCR) assay using clinical cerebrospinal fluid (CSF) for rapid diagnosis of eight pathogens causing the disease. The present work was dedicated to development of an in-house genus specific 16S rDNA nested PCR covering pathogens of eight genera responsible for causing bacterial meningitis using newly designed as well as literature based primers for respective genus. A total 150 suspected meningitis CSF obtained from the patients admitted to Central India Institute of Medical Sciences (CIIMS), India during the period from August 2011 to May 2014, were used to evaluate clinical sensitivity and clinical specificity of optimized PCR assays. The analytical sensitivity and specificity of our newly designed genus-specific 16S rDNA PCR were found to be ≥92%. With such a high sensitivity and specificity, our in-house nested PCR was able to give 100% sensitivity in clinically confirmed positive cases and 100% specificity in clinically confirmed negative cases indicating its applicability in clinical diagnosis. Our in-house nested PCR system therefore can diagnose the accurate pathogen causing bacterial meningitis and therefore be useful in selecting a specific treatment line to minimize morbidity. Results are obtained within 24 h and high sensitivity makes this nested PCR assay a rapid and accurate diagnostic tool compared to traditional culture-based methods.

  11. [Detection of biofilm formation by selected pathogens relevant to the food industry].

    Science.gov (United States)

    Šilhová-Hrušková, L; Moťková, P; Šilha, D; Vytřasová, J

    2015-09-01

    Detection of biofilm formation by microbial pathogens relevant to the food industry and comparison of biofilm formation under different conditions of culture. The following microorganisms were selected for the study: Staphylococcus aureus, Listeria innocua, Listeria ivanovii, Cronobacter sakazakii, Cronobacter muytjensii, Arcobacter butzleri, Arcobacter cryaerophilus, Campylobacter jejuni, and Campylobacter coli. To detect biofilm formation the microtiter plate assay, as described by Christensen and culture on stainless steel coupons were used. The biofilm forming capacity was confirmed in all microorganisms tested, both on the microtiter plates and stainless steel coupons. Biofilm formation was influenced by the culture medium, material used, and culture duration as well as by the test microorganism. It was found that different species and strains of the same genus differ in biofilm formation. Differences were also found between the collection strains and isolates from the environment. Some bacteria tended to form biofilm more readily on the surface of the polyethylene microtiter plates and less readily on stainless steel coupons while others appeared to have an opposite tendency. Some pathogens were able to increase the planktonic cell density in the initial suspension even by three orders of magnitude within 72 hours while producing plenty of biofilm. The study of biofilm formation by high risk pathogens is of utmost importance, not only to the food industry. From the obtained results, it is evident that bacterial biofilms form rapidly (within 24 hours in the present study). Due to their architecture, these biofilms are difficult to eradicate, and therefore, it is crucial to prevent biofilm formation.

  12. Comparing nucleic acid lateral flow and electrochemical genosensing for the simultaneous detection of foodborne pathogens.

    Science.gov (United States)

    Ben Aissa, A; Jara, J J; Sebastián, R M; Vallribera, A; Campoy, S; Pividori, M I

    2017-02-15

    Due to the increasing need of rapid tests for application in low resource settings, WHO summarized their ideal features under the acronym ASSURED (Affordable, Sensitive, Specific, User-friendly, Rapid and Robust, Equipment-free, Delivered to those who need it). In this work, two different platforms for the rapid and simultaneous testing of the foodborne pathogens E. coli O157:H7 and Salmonella enterica, in detail a nucleic acid lateral flow and an electrochemical magneto-genosensor are presented and compared in terms of their analytical performance. The DNA of the bacteria was amplified by polymerase chain reaction using a quadruple-tagging set of primers specific for E. coli eaeA (151bp) and Salmonella enterica yfiR (375bp) genes. During the amplification, the amplicons were labelled at the same time with biotin/digoxigenin or biotin/fluorescein tags, respectively. The nucleic acid lateral flow assay was based on the use of streptavidin gold nanoparticles for the labelling of the tagged amplicon from E. coli and Salmonella. The visual readout was achieved when the gold-modified amplicons were captured by the specific antibodies. The features of this approach are discussed and compared with an electrochemical magneto-genosensor. Although nucleic acid lateral flow showed higher limit of detection, this strategy was able to clearly distinguish positive and negative samples of both bacteria being considered as a rapid and promising detection tool for bacteria screening. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Loop-mediated isothermal amplification: an emerging technology for detection of fish and shellfish pathogens.

    Science.gov (United States)

    Savan, R; Kono, T; Itami, T; Sakai, M

    2005-10-01

    Fish and shellfish diseases are a constant threat to the sustainability and economic viability of aquaculture. Early diagnosis plays a vital role in management of fish and shellfish diseases. Traditionally, various biochemical and serological tests have been used for fish disease diagnosis. However, the time and expertise required for such diagnoses makes it difficult for aquaculturists to easily adopt them under production conditions. Polymerase chain reaction and probe-based nucleic acid detection have become increasingly popular in fish and shellfish diagnostics. Recently, a novel technique called loop-mediated isothermal amplification (LAMP) has been developed, which is highly sensitive and rapid. LAMP has been used for the detection of bacterial, viral, fungal and parasitic diseases in both animal and plants. In aquaculture, LAMP-based detection of pathogens like Edwardsiella tarda, E. ictaluri, Nocardia seriolae, Tetracapsuloides bryosalmonae, white spot syndrome virus and infectious haematopoietic necrosis virus have been reported. In this review, the application of LAMP for the detection of aquaculture-associated pathogens is discussed.

  14. A rapid and efficient method for assessing pathogenicity of ustilago maydis on maize and teosinte lines.

    Science.gov (United States)

    Chavan, Suchitra; Smith, Shavannor M

    2014-01-03

    Maize is a major cereal crop worldwide. However, susceptibility to biotrophic pathogens is the primary constraint to increasing productivity. U. maydis is a biotrophic fungal pathogen and the causal agent of corn smut on maize. This disease is responsible for significant yield losses of approximately $1.0 billion annually in the U.S.(1) Several methods including crop rotation, fungicide application and seed treatments are currently used to control corn smut(2). However, host resistance is the only practical method for managing corn smut. Identification of crop plants including maize, wheat, and rice that are resistant to various biotrophic pathogens has significantly decreased yield losses annually(3-5). Therefore, the use of a pathogen inoculation method that efficiently and reproducibly delivers the pathogen in between the plant leaves, would facilitate the rapid identification of maize lines that are resistant to U. maydis. As, a first step toward indentifying maize lines that are resistant to U. maydis, a needle injection inoculation method and a resistance reaction screening method was utilized to inoculate maize, teosinte, and maize x teosinte introgression lines with a U. maydis strain and to select resistant plants. Maize, teosinte and maize x teosinte introgression lines, consisting of about 700 plants, were planted, inoculated with a strain of U. maydis, and screened for resistance. The inoculation and screening methods successfully identified three teosinte lines resistant to U. maydis. Here a detailed needle injection inoculation and resistance reaction screening protocol for maize, teosinte, and maize x teosinte introgression lines is presented. This study demonstrates that needle injection inoculation is an invaluable tool in agriculture that can efficiently deliver U. maydis in between the plant leaves and has provided plant lines that are resistant to U. maydis that can now be combined and tested in breeding programs for improved disease resistance.

  15. Prospective study of the performance of vibrational spectroscopies for rapid identification of bacterial and fungal pathogens recovered from blood cultures

    NARCIS (Netherlands)

    K. Maquelin (Kees); C. Kirschner; L.P. Choo-Smith; N.A. Ngo-Thi; T. van Vreeswijk; M. Stammler; H.P. Endtz (Hubert); H.A. Bruining (Hajo); D. Naumann; G.J. Puppels (Gerwin)

    2003-01-01

    textabstractRapid identification of microbial pathogens reduces infection-related morbidity and mortality of hospitalized patients. Raman spectra and Fourier transform infrared (IR) spectra constitute highly specific spectroscopic fingerprints of microorganisms by which they can

  16. Rapid detection of Actinobacillus actinomycetemcomitans, Prevotella intermedia and Porphyromona gingivalis by multiplex PCR.

    Science.gov (United States)

    García, L; Tercero, J C; Legido, B; Ramos, J A; Alemany, J; Sanz, M

    1998-01-01

    The identification of specific periodontal pathogens by conventional methods, mainly anaerobic cultivation, is difficult, time consuming and even sometimes unreliable. Therefore, a multiplex PCR method for simultaneous detection of Actinobacillus actinomycetemcomitans (A.a.), Porphyromona gingivalis (P.g.) and Prevotella intermedia (P.i.) was developed for rapid and easy identification of these specific bacterial pathogens in subgingival plaque samples. In this paper, there is a detailed description of the oligonucleotide primer selection, DNA extraction and PCR conditions and the sequencing of the amplified products. The locus chosen to be amplified is a highly variable region in the 16S ribosomal DNA. For the development of this technique ATCC cultures and pure cultures from subgingival plaque samples taken from periodontitis patients were used. As an internal positive control a recombinant plasmid was developed. This simple DNA extraction procedure and the DNA amplification and visualization of the amplified product permits the detection of the bacteria in a working day. Thus, this multiplex PCR method is a rapid and effective detection method for specific periodontal pathogens.

  17. Simultaneous detection of pathogenic bacteria using agglutination test based on colored silica nanoparticles.

    Science.gov (United States)

    Yu, Hui; Zhao, Guangying; Dou, Wenchao

    2015-01-01

    Aimed to explore an agglutination test which can simultaneously detect two pathogenic bacteria, an agglutination test based on colored silica nanoparticles (colored-SiNps) was established in this work. Monodisperse colored-SiNps were used as agglutination test carriers; red-SiNps and blue-SiNps were prepared by reverse microemulsion with C.I. Reactive red 136 and C.I. Reactive Blue 14. Then the red-SiNps were sensitized with antibodies against E. sakazaki and denoted as IgG-red-SiNps; The blue-SiNps were coated with antibodies against S. pullorum and S. Gallinarum and denoted as IgGblue- SiNps. The mixture solution of IgG-red-SiNps and IgG-blue-SiNps could simultaneously agglutinate with E. sakazakii and S. pullorum and S. gallinarum on glass slide. The E. sakazakii and S. pullorum and S. gallinarum could be simultaneously detected by agglutination test with obvious agglutination phenomena. The E. sakazakii and S. pullorum and S. gallinarum could both be detected in a range from 4×10(3) to 4×10(9) CFU/mL. The pullorum and S. gallinarum and E. sakazakii in the infected food sample were detected by mixture solution of IgG-red-SiNps and IgG-blue-SiNps too. This agglutination test was easy and rapid, it might be useful for in situ rapid detection method for simultaneously screening different pathogenic microorganisms of foods and feeds in the field.

  18. Pathogen detection and gut bacteria identification in Apis cerana ...

    African Journals Online (AJOL)

    Pathogen infection of honeybees can lead to economic losses in apiculture. The earlier the pathogen contamination can be found the better it will likely be for the treatment of the infected colony and prevention of the spread of the pathogen within and between colonies. A total of 50 colonies of Apis cerana were sampled in ...

  19. Nanomaterial-enabled Rapid Detection of Water Contaminants.

    Science.gov (United States)

    Mao, Shun; Chang, Jingbo; Zhou, Guihua; Chen, Junhong

    2015-10-28

    Water contaminants, e.g., inorganic chemicals and microorganisms, are critical metrics for water quality monitoring and have significant impacts on human health and plants/organisms living in water. The scope and focus of this review is nanomaterial-based optical, electronic, and electrochemical sensors for rapid detection of water contaminants, e.g., heavy metals, anions, and bacteria. These contaminants are commonly found in different water systems. The importance of water quality monitoring and control demands significant advancement in the detection of contaminants in water because current sensing technologies for water contaminants have limitations. The advantages of nanomaterial-based sensing technologies are highlighted and recent progress on nanomaterial-based sensors for rapid water contaminant detection is discussed. An outlook for future research into this rapidly growing field is also provided. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Rapid detection of EBOLA VP40 in microchip immunofiltration assay

    Science.gov (United States)

    Miethe, Peter; Gary, Dominik; Hlawatsch, Nadine; Gad, Anne-Marie

    2015-05-01

    In the spring of 2014, the Ebola virus (EBOV) strain Zaire caused a dramatic outbreak in several regions of West Africa. The RT-PCR and antigen capture diagnostic proved to be effective for detecting EBOV in blood and serum. In this paper, we present data of a rapid antigen capture test for the detection of VP40. The test was performed in a microfluidic chip for immunofiltration analysis. The chip integrates all necessary assay components. The analytical sensitivity of the rapid test was 8 ng/ml for recombinant VP40. In serum and whole blood samples spiked with virus culture material, the detection limit was 2.2 x 102 PFU/ml. The performance data of the rapid test (15 min) are comparable to that of the VP40 laboratory ELISA.

  1. Current and emerging technologies for rapid detection and characterization of Salmonella in poultry and poultry products.

    Science.gov (United States)

    Park, Si Hong; Aydin, Muhsin; Khatiwara, Anita; Dolan, Maureen C; Gilmore, David F; Bouldin, Jennifer L; Ahn, Soohyoun; Ricke, Steven C

    2014-04-01

    Salmonella is the leading cause of foodborne illnesses in the United States, and one of the main contributors to salmonellosis is the consumption of contaminated poultry and poultry products. Since deleterious effects of Salmonella on public health and the economy continue to occur, there is an ongoing need to develop more advanced detection methods that can identify Salmonella accurately and rapidly in foods before they reach consumers. Rapid detection and identification methods for Salmonella are considered to be an important component of strategies designed to prevent poultry and poultry product-associated illnesses. In the past three decades, there have been increasing efforts towards developing and improving rapid pathogen detection and characterization methodologies for application to poultry and poultry products. In this review, we discuss molecular methods for detection, identification and genetic characterization of Salmonella associated with poultry and poultry products. In addition, the advantages and disadvantages of the established and emerging rapid detection and characterization methods are addressed for Salmonella in poultry and poultry products. The methods with potential application to the industry are highlighted in this review. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Simple and rapid detection of Tilletia horrida causing rice kernel smut in rice seeds.

    Science.gov (United States)

    Chen, Yu; Yang, Xue; Yao, Jian; Kyaw, Ei Phyu; Zhang, Ai-Fang; Li, Yun-Fei; Gu, Chun-Yan; Zang, Hao-Yu; Gao, Tong-Chun

    2016-09-14

    A simple and rapid method for the detection of Tilletia horrida, the causal agent of rice kernel smut, in rice seeds is developed based on specific polymerase chain reaction (PCR). To design the specific primers for the detection of T. horrida, partial sequences of internal transcribed spacer (ITS) DNA region of T. horrida, T. controversa, T. walkeri, T. ehrhartae, T. indica and T. caries were analyzed and compared. A 503-bp fragment was amplified with the designed primers from the T. horrida genomic DNA. However, no PCR product was obtained from the DNA of other five Tilletia species and 22 fungal plant pathogens tested in the present work indicating the specificity of the primers for the detection of T. horrida. The PCR was performed by directly using the spores, isolated from the 21 different rice seed samples, as template DNA. The T. horrida was detected in 6 of the samples, indicating that 28.6% of the rice samples were contaminated with the kernel smut pathogen. This simple PCR based diagnostic assay can be applied for the direct and rapid detection and identification of T. horrida to screen large numbers of rice seed samples.

  3. Evaluation of the Seeplex® Meningitis ACE Detection kit for the detection of 12 common bacterial and viral pathogens of acute meningitis.

    Science.gov (United States)

    Shin, So Youn; Kwon, Kye Chul; Park, Jong Woo; Kim, Ji Myung; Shin, So Young; Koo, Sun Hoe

    2012-01-01

    Bacterial meningitis is an infectious disease with high rates of mortality and high frequency of severe sequelae. Early identification of causative bacterial and viral pathogens is important for prompt and proper treatment of meningitis and for prevention of life-threatening clinical outcomes. In the present study, we evaluated the value of the Seeplex Meningitis ACE Detection kit (Seegene Inc., Korea), a newly developed multiplex PCR kit employing dual priming oligonucleotide methods, for diagnosing acute meningitis. Analytical sensitivity of the kit was studied using reference strains for each pathogen targeted by the kit, while it's analytical specificity was studied using the human genome DNA and 58 clinically well-identified reference strains. For clinical validation experiment, we used 27 control cerebrospinal fluid (CSF) samples and 78 clinical CSF samples collected from patients at the time of diagnosis of acute meningitis. The lower detection limits ranged from 10(1) copies/µL to 5×10(1) copies/µL for the 12 viral and bacterial pathogens targeted. No cross-reaction was observed. In the validation study, high detection rate of 56.4% was obtained. None of the control samples tested positive, i.e., false-positive results were absent. The Seeplex Meningitis ACE Detection kit showed high sensitivity, specificity, and detection rate for the identification of pathogens in clinical CSF samples. This kit may be useful for rapid identification of important acute meningitis-causing pathogens.

  4. Development and evaluation of a panel of filovirus sequence capture probes for pathogen detection by next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Jeffrey W Koehler

    Full Text Available A detailed understanding of the circulating pathogens in a particular geographic location aids in effectively utilizing targeted, rapid diagnostic assays, thus allowing for appropriate therapeutic and containment procedures. This is especially important in regions prevalent for highly pathogenic viruses co-circulating with other endemic pathogens such as the malaria parasite. The importance of biosurveillance is highlighted by the ongoing Ebola virus disease outbreak in West Africa. For example, a more comprehensive assessment of the regional pathogens could have identified the risk of a filovirus disease outbreak earlier and led to an improved diagnostic and response capacity in the region. In this context, being able to rapidly screen a single sample for multiple pathogens in a single tube reaction could improve both diagnostics as well as pathogen surveillance. Here, probes were designed to capture identifying filovirus sequence for the ebolaviruses Sudan, Ebola, Reston, Taï Forest, and Bundibugyo and the Marburg virus variants Musoke, Ci67, and Angola. These probes were combined into a single probe panel, and the captured filovirus sequence was successfully identified using the MiSeq next-generation sequencing platform. This panel was then used to identify the specific filovirus from nonhuman primates experimentally infected with Ebola virus as well as Bundibugyo virus in human sera samples from the Democratic Republic of the Congo, thus demonstrating the utility for pathogen detection using clinical samples. While not as sensitive and rapid as real-time PCR, this panel, along with incorporating additional sequence capture probe panels, could be used for broad pathogen screening and biosurveillance.

  5. Pathogen specific carbohydrate antigen microarrays: a chip for detection of Salmonella O-antigen specific antibodies.

    Science.gov (United States)

    Blixt, Ola; Hoffmann, Julia; Svenson, Stefan; Norberg, Thomas

    2008-01-01

    A Salmonella O-antigen microarray was developed by covalent coupling of oligosaccharide antigens specific for serogroups Salmonella enterica sv. Paratyphi (group A), Typhimurium (group B) and Enteritidis (group D). Antibodies were correctly detected in sera from patients with culture verified salmonellosis. High serogroup-specificity was seen with the disaccharide antigens. With the larger antigens, containing the backbone sequence Manalpha1-2Rhaalpha1-2Gal (MRG), common backbone-specific antibodies (O-antigen 12) were also detected. This is "proof of principle" that pathogen-specific carbohydrate antigen microarrays constitute a novel technology for rapid and specific serological diagnosis in either individual patients or larger sero-epidemiological and vaccine studies.

  6. Noninvasive prenatal detection for pathogenic CNVs: the application in α-thalassemia.

    Directory of Open Access Journals (Sweden)

    Huijuan Ge

    Full Text Available BACKGROUND: The discovery of cell free fetal DNA (cff-DNA in maternal plasma has brought new insight for noninvasive prenatal diagnosis. Combining with the rapidly developed massively parallel sequencing technology, noninvasive prenatal detection of chromosome aneuploidy and single base variation has been successfully validated. However, few studies discussed the possibility of noninvasive pathogenic CNVs detection. METHODOLOGY/PRINCIPAL FINDINGS: A novel algorithm for noninvasive prenatal detection of fetal pathogenic CNVs was firstly tested in 5 pairs of parents with heterozygote α-thalassemia of Southeast Asian (SEA deletion using target region capture sequencing for maternal plasma. Capture probes were designed for α-globin (HBA and β-globin (HBB gene, as well as 4,525 SNPs selected from 22 automatic chromosomes. Mixed adaptors with 384 different barcodes were employed to construct maternal plasma DNA library for massively parallel sequencing. The signal of fetal CNVs was calculated using the relative copy ratio (RCR of maternal plasma combined with the analysis of R-score and L-score by comparing with normal control. With mean of 101.93× maternal plasma sequencing depth for the target region, the RCR value combined with further R-score and L-score analysis showed a possible homozygous deletion in the HBA gene region for one fetus, heterozygous deletion for two fetus and normal for the other two fetus, which was consistent with that of invasive prenatal diagnosis. CONCLUSIONS/SIGNIFICANCE: Our study showed the feasibility to detect pathogenic CNVs using target region capture sequencing, which might greatly extend the scope of noninvasive prenatal diagnosis.

  7. Identification of pathogenic microbial cells and spores by electrochemical detection on a biochip.

    Science.gov (United States)

    Gabig-Ciminska, Magdalena; Andresen, Heiko; Albers, Joerg; Hintsche, Rainer; Enfors, Sven-Olof

    2004-04-16

    BACKGROUND: Bacillus cereus constitutes a significant cause of acute food poisoning in humans. Despite the recent development of different detection methods, new effective control measures and better diagnostic tools are required for quick and reliable detection of pathogenic micro-organisms. Thus, the objective of this study was to determine a simple method for rapid identification of enterotoxic Bacillus strains. Here, a special attention is given to an electrochemical biosensor since it meets the requirements of minimal size, lower costs and decreased power consumption. RESULTS: A bead-based sandwich hybridization system was employed in conjugation with electric chips for detection of vegetative cells and spores of Bacillus strains based on their toxin-encoding genes. The system consists of a silicon chip based potentiometric cell, and utilizes paramagnetic beads as solid carriers of the DNA probes. The specific signals from 20 amol of bacterial cell or spore DNA were achieved in less than 4 h. The method was also successful when applied directly to unpurified spore and cell extract samples. The assay for the haemolytic enterotoxin genes resulted in reproducible signals from B. cereus and B. thuringiensis while haemolysin-negative B. subtilis strain did not yield any signal. CONCLUSIONS: The sensitivity, convenience and specificity of the system have shown its potential. In this respect an electrochemical detection on a chip enabling a fast characterization and monitoring of pathogens in food is of interest. This system can offer a contribution in the rapid identification of bacteria based on the presence of specific genes without preceding nucleic acid amplification.

  8. Identification of pathogenic microbial cells and spores by electrochemical detection on a biochip

    Directory of Open Access Journals (Sweden)

    Andresen Heiko

    2004-04-01

    Full Text Available Abstract Background Bacillus cereus constitutes a significant cause of acute food poisoning in humans. Despite the recent development of different detection methods, new effective control measures and better diagnostic tools are required for quick and reliable detection of pathogenic micro-organisms. Thus, the objective of this study was to determine a simple method for rapid identification of enterotoxic Bacillus strains. Here, a special attention is given to an electrochemical biosensor since it meets the requirements of minimal size, lower costs and decreased power consumption. Results A bead-based sandwich hybridization system was employed in conjugation with electric chips for detection of vegetative cells and spores of Bacillus strains based on their toxin-encoding genes. The system consists of a silicon chip based potentiometric cell, and utilizes paramagnetic beads as solid carriers of the DNA probes. The specific signals from 20 amol of bacterial cell or spore DNA were achieved in less than 4 h. The method was also successful when applied directly to unpurified spore and cell extract samples. The assay for the haemolytic enterotoxin genes resulted in reproducible signals from B. cereus and B. thuringiensis while haemolysin-negative B. subtilis strain did not yield any signal. Conclusions The sensitivity, convenience and specificity of the system have shown its potential. In this respect an electrochemical detection on a chip enabling a fast characterization and monitoring of pathogens in food is of interest. This system can offer a contribution in the rapid identification of bacteria based on the presence of specific genes without preceding nucleic acid amplification.

  9. Survey and Rapid detection of Bordetella pertussis in clinical samples targeting the BP485 in China

    Directory of Open Access Journals (Sweden)

    Wei eLiu

    2015-03-01

    Full Text Available Bordetella pertussis is an important human respiratory pathogen. Here, we describe a loop-mediated isothermal amplification (LAMP method for the rapid detection of B. pertussis in clinical samples based on a visual test. The LAMP assay detected the BP485 target sequence within 60 min with a detection limit of 1.3 pg/µl, a 10-fold increase in sensitivity compared with conventional PCR. All 31 non-pertussis respiratory pathogens tested were negative for LAMP detection, indicating the high specificity of the primers for B. pertussis. To evaluate the application of the LAMP assay to clinical diagnosis, of 105 sputum and nasopharyngeal samples collected from the patients with suspected respiratory infections in China, a total of 12 Bordetella pertussis isolates were identified from 33 positive samples detected by LAMP-based surveillance targeting BP485. Strikingly, a 4.5 months old baby and her mother were found to be infected with B. pertussis at the same time. All isolates belonged to different B. pertussis multilocus sequence typing (MLST groups with different alleles of the virulence-related genes including 4 alleles of ptxA, 6 of prn, 4 of tcfA, 2 of fim2 and 3 of fim3. The diversity of B. pertussis carrying toxin genes in clinical strains indicates a rapid and continuing evolution of B. pertussis. This combined with its high prevalence will make it difficult to control. In conclusion, we have developed a visual detection LAMP assay, which could be a useful tool for rapid B. pertussis detection, especially in situations where resources are poor and in point-of-care tests.

  10. Flow cytometry for rapid detection of Salmonella spp. in seed sprouts

    Directory of Open Access Journals (Sweden)

    Bledar Bisha

    2014-12-01

    Full Text Available Seed sprouts (alfalfa, mung bean, radish, etc. have been implicated in several recent national and international outbreaks of salmonellosis. Conditions used for sprouting are also conducive to the growth of Salmonella. As a result, this pathogen can quickly grow to very high cell densities during sprouting without any detectable organoleptic impact. Seed sprouts typically also support heavy growth (~108 CFU g−1 of a heterogeneous microbiota consisting of various bacterial, yeast, and mold species, often dominated by non-pathogenic members of the family Enterobacteriaceae. This heavy background may present challenges to the detection of Salmonella, especially if this pathogen is present in relatively low numbers. We combined DNA-based fluorescence in situ hybridization (FISH with flow cytometry (FCM for the rapid molecular detection of Salmonella enterica ser. Typhimurium in artificially contaminated alfalfa and other seed sprouts. Components of the assay included a set of cooperatively binding probes, a chemical blocking treatment intended to reduce non-specific background, and sample concentration via tangential flow filtration (TFF. We were able to detect S. Typhimurium in sprout wash at levels as low as 103 CFU ml−1 sprout wash (104 CFU g−1 sprouts against high microbial backgrounds (~108 CFU g−1 sprouts. Hybridization times were typically 30 min, with additional washing, but we ultimately found that S. Typhimurium could be readily detected using hybridization times as short as 2 min, without a wash step. These results clearly demonstrate the potential of combined DNA-FISH and FCM for rapid detection of Salmonella in this challenging food matrix and provide industry with a useful tool for compliance with sprout production standards proposed in the Food Safety Modernization Act (FSMA.

  11. Rapid detection of Ceratocystis platani inoculum by quantitative real-time PCR assay.

    Science.gov (United States)

    Luchi, Nicola; Ghelardini, Luisa; Belbahri, Lassaâd; Quartier, Marion; Santini, Alberto

    2013-09-01

    Ceratocystis platani is the causal agent of canker stain of plane trees, a lethal disease able to kill mature trees in one or two successive growing seasons. The pathogen is a quarantine organism and has a negative impact on anthropogenic and natural populations of plane trees. Contaminated sawdust produced during pruning and sanitation fellings can contribute to disease spread. The goal of this study was to design a rapid, real-time quantitative PCR assay to detect a C. platani airborne inoculum. Airborne inoculum traps (AITs) were placed in an urban setting in the city of Florence, Italy, where the disease was present. Primers and TaqMan minor groove binder (MGB) probes were designed to target cerato-platanin (CP) and internal transcribed spacer 2 (ITS2) genes. The detection limits of the assay were 0.05 pg/μl and 2 fg/μl of fungal DNA for CP and ITS, respectively. Pathogen detection directly from AITs demonstrated specificity and high sensitivity for C. platani, detecting DNA concentrations as low as 1.2 × 10(-2) to 1.4 × 10(-2) pg/μl, corresponding to ∼10 conidia per ml. Airborne inoculum traps were able to detect the C. platani inoculum within 200 m of the closest symptomatic infected plane tree. The combination of airborne trapping and real-time quantitative PCR assay provides a rapid and sensitive method for the specific detection of a C. platani inoculum. This technique may be used to identify the period of highest risk of pathogen spread in a site, thus helping disease management.

  12. Rapid Detection of Escherichia coli O157 and Shiga Toxins by Lateral Flow Immunoassays

    Directory of Open Access Journals (Sweden)

    Jinliang Wang

    2016-03-01

    Full Text Available Shiga toxin-producing Escherichia coli O157:H7 (STEC cause food-borne illness that may be fatal. STEC strains enumerate two types of potent Shiga toxins (Stx1 and Stx2 that are responsible for causing diseases. It is important to detect the E. coli O157 and Shiga toxins in food to prevent outbreak of diseases. We describe the development of two multi-analyte antibody-based lateral flow immunoassays (LFIA; one for the detection of Stx1 and Stx2 and one for the detection of E. coli O157 that may be used simultaneously to detect pathogenic E. coli O157:H7. The LFIA strips were developed by conjugating nano colloidal gold particles with monoclonal antibodies against Stx1 and Stx2 and anti-lipid A antibodies to capture Shiga toxins and O157 antigen, respectively. Our results indicate that the LFIA for Stx is highly specific and detected Stx1 and Stx2 within three hours of induction of STEC with ciprofloxacin at 37 °C. The limit of detection for E. coli O157 LFIA was found to be 105 CFU/mL in ground beef spiked with the pathogen. The LFIAs are rapid, accurate and easy to use and do not require sophisticated equipment or trained personnel. Following the assay, colored bands on the membrane develop for end-point detection. The LFIAs may be used for screening STEC in food and the environment.

  13. Rapid Detection of Escherichia coli O157 and Shiga Toxins by Lateral Flow Immunoassays.

    Science.gov (United States)

    Wang, Jinliang; Katani, Robab; Li, Lingling; Hegde, Narasimha; Roberts, Elisabeth L; Kapur, Vivek; DebRoy, Chitrita

    2016-03-25

    Shiga toxin-producing Escherichia coli O157:H7 (STEC) cause food-borne illness that may be fatal. STEC strains enumerate two types of potent Shiga toxins (Stx1 and Stx2) that are responsible for causing diseases. It is important to detect the E. coli O157 and Shiga toxins in food to prevent outbreak of diseases. We describe the development of two multi-analyte antibody-based lateral flow immunoassays (LFIA); one for the detection of Stx1 and Stx2 and one for the detection of E. coli O157 that may be used simultaneously to detect pathogenic E. coli O157:H7. The LFIA strips were developed by conjugating nano colloidal gold particles with monoclonal antibodies against Stx1 and Stx2 and anti-lipid A antibodies to capture Shiga toxins and O157 antigen, respectively. Our results indicate that the LFIA for Stx is highly specific and detected Stx1 and Stx2 within three hours of induction of STEC with ciprofloxacin at 37 °C. The limit of detection for E. coli O157 LFIA was found to be 10⁵ CFU/mL in ground beef spiked with the pathogen. The LFIAs are rapid, accurate and easy to use and do not require sophisticated equipment or trained personnel. Following the assay, colored bands on the membrane develop for end-point detection. The LFIAs may be used for screening STEC in food and the environment.

  14. A rapid ultrasound particle agglutination method for HIV antibody detection: Comparison with conventional rapid HIV tests.

    Science.gov (United States)

    Bystryak, Simon; Ossina, Natalya

    2017-11-01

    We present the results of the feasibility and preliminary studies on analytical performance of a rapid test for detection of human immunodeficiency virus (HIV) antibodies in human serum or plasma that is an important advance in detecting HIV infection. Current methods for rapid testing of antibodies against HIV are qualitative and exhibit poor sensitivity (limit of detection). In this paper, we describe an ultrasound particle agglutination (UPA) method that leads to a significant increase of the sensitivity of conventional latex agglutination tests for HIV antibody detection in human serum or plasma. The UPA method is based on the use of: 1) a dual mode ultrasound, wherein a first single-frequency mode is used to accelerate the latex agglutination process, and then a second swept-frequency mode of sonication is used to disintegrate non-specifically bound aggregates; and 2) a numerical assessment of results of the agglutination process. The numerical assessment is carried out by optical detection and analysis of moving patterns in the resonator cell during the swept-frequency mode. The single-step UPA method is rapid and more sensitive than the three commercial rapid HIV test kits analyzed in the study: analytical sensitivity of the new UPA method was found to be 510-, 115-, and 80-fold higher than that for Capillus™, Multispot™ and Uni-Gold™ Recombigen HIV antibody rapid test kits, respectively. The newly developed UPA method opens up additional possibilities for detection of a number of clinically significant markers in point-of-care settings. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Development of a loop-mediated isothermal amplification method for rapid detection of pigeon circovirus.

    Science.gov (United States)

    Tsai, Shinn Shyong; Chang, Yeng Ling; Huang, Yen Li; Liu, Hung Jen; Ke, Guan Ming; Chiou, Chwei Jang; Hsieh, Yao Ching; Chang, Tsung Chou; Cheng, Li Ting; Chuang, Kuo Pin

    2014-05-01

    There are no effective antiviral treatments for pigeon circovirus (PiCV); thus, rapid diagnosis is critical for effective control of the disease caused by this virus. The recent development of a novel LAMP technique that amplifies nucleic acids rapidly with high specificity and sensitivity under isothermal conditions has overcome some of the deficiencies of nucleic-acid-based diagnostic tests. We established a LAMP method for rapid detection of PiCV using two pairs of primers that were designed from PiCV and compared its sensitivity and specificity with that of PCR. Amplification by LAMP was optimal at 63 °C for 60 min. The detection limit was nearly 0.5 pg of PiCV DNA, making it ten times more sensitive than PCR. There was no cross-reaction with porcine circovirus type 2 (PCV2), pigeon Trichomonas gallinae, or pigeon herpesvirus (PHV) under the same conditions. The assay also successfully detected the pathogen DNA in the tissues of infected pigeons. This is the first report indicating that LAMP is a valuable, rapid method of detecting PiCV with high sensitivity and specificity.

  16. Trichomonas spp. in pigeons: detection by OSOM Trichomonas Rapid Test.

    Science.gov (United States)

    Valek, Petr; Kunca, Tomas; Langrova, Iva; Hartlova, Helena; Brozova, Adela; Jankovska, Ivana; Kudrnacova, Marie; Sloup, Vladislav

    2013-12-01

    The efficacy of the OSOM Trichomonas Rapid Test (developed for rapid diagnosis of human Trichomonas vaginalis) in detection of Trichomonas spp. in pigeons (Columba livia) was investigated. Two oral cavity swabs were taken from 50 farm pigeons. Cultivation in Diamond Trichomonas medium was used as a reference method. According to a morphological determination, Trichomonas gallinae was the only protozoan found; however, no further molecular analysis was conducted. The OSOM Trichomonas test was positive in 39 oral swabs. In comparison with the cultivation method three samples were identified as false negative and one as false positive. Test specificity and sensitivity were established as 93% and 90%, respectively. Using Cohen's Kappa, the concordance between the two testing methods was found to be strong (kappa = 0.7506, 95% CI = 0.5162-0.9850). The OSOM Trichomonas test is not able to distinguish between Trichomonas species; however, results suggest that the test is suitable for the rapid detection of Trichomonas spp. infection in pigeons.

  17. Palm kernel agar: An alternative culture medium for rapid detection ...

    African Journals Online (AJOL)

    Palm kernel agar: An alternative culture medium for rapid detection of aflatoxins in agricultural commodities. ... a pink background and blue or blue green fluorescence of palm kernel agar Under long wave UV light (366nm) as against the white background of DCA, which often interferes with fluorescence with corresponding ...

  18. Rapid detection of methicillin-resistant staphylococci by multiplex PCR

    African Journals Online (AJOL)

    A rapid and sensitive method for excluding the presence of methicillin-resistant Staphylococcus aureus (MRSA) in clinical samples was developed. The combination of MRSA detection by mecA coaA PCR with prior enrichment in selective broth was tested for 300 swabs. PCR identified 26 MRSApositive samples, ...

  19. Evaluation of a direct colorimetric assay for rapid detection of ...

    African Journals Online (AJOL)

    Yemane Berhane

    bromide (MTT) for a rapid detection of rifampicin resistance. Methods: Sputum was inoculated directly into 7H9 .... a loopful of the corresponding broth on nutrient agar and incubating it at 370C for 24 hours before performing the .... and Training in Tropical Diseases (TDR). This study was part of the MSc thesis of DW at Addis ...

  20. Evaluation of BacLite Rapid MRSA, a rapid culture based screening test for the detection of ciprofloxacin and methicillin resistant S. aureus (MRSA from screening swabs

    Directory of Open Access Journals (Sweden)

    Skyrme Margaret

    2006-09-01

    Full Text Available Abstract Background Methicillin-resistant Staphylococcus aureus (MRSA is a major nosocomial pathogen worldwide. The need for accurate and rapid screening methods to detect MRSA carriers has been clearly established. The performance of a novel assay, BacLite Rapid MRSA (Acolyte Biomedica, UK for the rapid detection (5 h and identification of hospital associated ciprofloxacin resistant strains of MRSA directly from nasal swab specimens was compared to that obtained by culture on Mannitol salt agar containing Oxacillin (MSAO after 48 h incubation. Results A total of 1382 nasal screening swabs were tested by multiple operators. The BacLite Rapid MRSA test detected 142 out of the 157 confirmed MRSA that were detected on MSAO giving a diagnostic sensitivity of 90.4, diagnostic specificity of 95.7% and a negative predictive value of 98.7%. Of the 15 false negatives obtained by the BacLite Rapid MRSA test, seven grew small amounts ( Conclusion The Baclite MRSA test is easy to use and provides a similar level of sensitivity to conventional culture for the detection of nasal carriage of MRSA with the advantage that the results are obtained much more rapidly.

  1. Rapid detection of Salmonella in pet food: design and evaluation of integrated methods based on real-time PCR detection.

    Science.gov (United States)

    Balachandran, Priya; Friberg, Maria; Vanlandingham, V; Kozak, K; Manolis, Amanda; Brevnov, Maxim; Crowley, Erin; Bird, Patrick; Goins, David; Furtado, Manohar R; Petrauskene, Olga V; Tebbs, Robert S; Charbonneau, Duane

    2012-02-01

    Reducing the risk of Salmonella contamination in pet food is critical for both companion animals and humans, and its importance is reflected by the substantial increase in the demand for pathogen testing. Accurate and rapid detection of foodborne pathogens improves food safety, protects the public health, and benefits food producers by assuring product quality while facilitating product release in a timely manner. Traditional culture-based methods for Salmonella screening are laborious and can take 5 to 7 days to obtain definitive results. In this study, we developed two methods for the detection of low levels of Salmonella in pet food using real-time PCR: (i) detection of Salmonella in 25 g of dried pet food in less than 14 h with an automated magnetic bead-based nucleic acid extraction method and (ii) detection of Salmonella in 375 g of composite dry pet food matrix in less than 24 h with a manual centrifugation-based nucleic acid preparation method. Both methods included a preclarification step using a novel protocol that removes food matrix-associated debris and PCR inhibitors and improves the sensitivity of detection. Validation studies revealed no significant differences between the two real-time PCR methods and the standard U.S. Food and Drug Administration Bacteriological Analytical Manual (chapter 5) culture confirmation method.

  2. Radiometric method for the rapid detection of Leptospira organisms

    Energy Technology Data Exchange (ETDEWEB)

    Manca, N.; Verardi, R.; Colombrita, D.; Ravizzola, G.; Savoldi, E.; Turano, A.

    1986-02-01

    A rapid and sensitive radiometric method for detection of Leptospira interrogans serovar pomona and Leptospira interrogans serovar copenhageni is described. Stuart's medium and Middlebrook TB (12A) medium supplemented with bovine serum albumin, catalase, and casein hydrolysate and labeled with /sup 14/C-fatty acids were used. The radioactivity was measured in a BACTEC 460. With this system, Leptospira organisms were detected in human blood in 2 to 5 days, a notably shorter time period than that required for the majority of detection techniques.

  3. A Multiplexed Diagnostic Platform for Point-of-Care Pathogen Detection

    Energy Technology Data Exchange (ETDEWEB)

    Regan, J F; Letant, S E; Adams, K L; Mahnke, R C; Nguyen, N T; Dzenitis, J M; Hindson, B J; Hadley, D R; Makarewicz, T J; Henderer, B D; Breneman, J W; Tammero, L F; Ortiz, J I; Derlet, R W; Cohen, S; Colston, W W; McBride, M T; Birch, J M

    2008-02-04

    We developed an automated point-of-care diagnostic instrument that is capable of analyzing nasal swab samples for the presence of respiratory diseases. This robust instrument, called FluIDx, performs autonomous multiplexed RT-PCR reactions that are analyzed by microsphere xMAP technology. We evaluated the performance of FluIDx, in comparison rapid tests specific for influenza and respiratory syncytial virus, in a clinical study performed at the UC Davis Medical Center. The clinical study included samples positive for RSV (n = 71), influenza A (n = 16), influenza B (n = 4), adenovirus (n = 5), parainfluenza virus (n = 2), and 44 negative samples, according to a composite reference method. FluIDx and the rapid tests detected 85.9% and 62.0% of the RSV positive samples, respectively. Similar sensitivities were recorded for the influenza B samples; whereas the influenza A samples were poorly detected, likely due to the utilization of an influenza A signature that did not accurately match currently circulating influenza A strains. Data for all pathogens were compiled and indicate that FluIDx is more sensitive than the rapid tests, detecting 74.2% (95% C.I. of 64.7-81.9%) of the positive samples in comparison to 53.6% (95% C.I. of 43.7-63.2%) for the rapid tests. The higher sensitivity of FluIDx was partially offset by a lower specificity, 77.3% versus 100.0%. Overall, these data suggest automated flow-through PCR-based instruments that perform multiplexed assays can successfully screen clinical samples for infectious diseases.

  4. Microfluidic designs and techniques using lab-on-a-chip devices for pathogen detection for point-of-care diagnostics.

    Science.gov (United States)

    Foudeh, Amir M; Fatanat Didar, Tohid; Veres, Teodor; Tabrizian, Maryam

    2012-09-21

    Effective pathogen detection is an essential prerequisite for the prevention and treatment of infectious diseases. Despite recent advances in biosensors, infectious diseases remain a major cause of illnesses and mortality throughout the world. For instance in developing countries, infectious diseases account for over half of the mortality rate. Pathogen detection platforms provide a fundamental tool in different fields including clinical diagnostics, pathology, drug discovery, clinical research, disease outbreaks, and food safety. Microfluidic lab-on-a-chip (LOC) devices offer many advantages for pathogen detection such as miniaturization, small sample volume, portability, rapid detection time and point-of-care diagnosis. This review paper outlines recent microfluidic based devices and LOC design strategies for pathogen detection with the main focus on the integration of different techniques that led to the development of sample-to-result devices. Several examples of recently developed devices are presented along with respective advantages and limitations of each design. Progresses made in biomarkers, sample preparation, amplification and fluid handling techniques using microfluidic platforms are also covered and strategies for multiplexing and high-throughput analysis, as well as point-of-care diagnosis, are discussed.

  5. An FPGA-based rapid wheezing detection system.

    Science.gov (United States)

    Lin, Bor-Shing; Yen, Tian-Shiue

    2014-01-29

    Wheezing is often treated as a crucial indicator in the diagnosis of obstructive pulmonary diseases. A rapid wheezing detection system may help physicians to monitor patients over the long-term. In this study, a portable wheezing detection system based on a field-programmable gate array (FPGA) is proposed. This system accelerates wheezing detection, and can be used as either a single-process system, or as an integrated part of another biomedical signal detection system. The system segments sound signals into 2-second units. A short-time Fourier transform was used to determine the relationship between the time and frequency components of wheezing sound data. A spectrogram was processed using 2D bilateral filtering, edge detection, multithreshold image segmentation, morphological image processing, and image labeling, to extract wheezing features according to computerized respiratory sound analysis (CORSA) standards. These features were then used to train the support vector machine (SVM) and build the classification models. The trained model was used to analyze sound data to detect wheezing. The system runs on a Xilinx Virtex-6 FPGA ML605 platform. The experimental results revealed that the system offered excellent wheezing recognition performance (0.912). The detection process can be used with a clock frequency of 51.97 MHz, and is able to perform rapid wheezing classification.

  6. A portable cell-based optical detection device for rapid detection of Listeria and Bacillus toxins

    Science.gov (United States)

    Banerjee, Pratik; Banada, Padmapriya P.; Rickus, Jenna L.; Morgan, Mark T.; Bhunia, Arun K.

    2005-11-01

    A mammalian cell-based optical biosensor was built to detect pathogenic Listeria and Bacillus species. This sensor measures the ability of the pathogens to infect and induce cytotoxicity on hybrid lymphocyte cell line (Ped-2E9) resulting in the release of alkaline phosphatase (ALP) that can be detected optically using a portable spectrophotometer. The Ped-2E9 cells were encapsulated in collagen gel matrices and grown in 48-well plates or in specially designed filtration tube units. Toxin preparations or bacterial cells were introduced and ALP release was assayed after 3-5 h. Pathogenic L. monocytogenes strains or the listeriolysin toxins preparation showed cytotoxicity ranging from 55% - 92%. Toxin preparations (~20 μg/ml) from B. cereus strains showed 24 - 98% cytotoxicity. In contrast, a non-pathogenic L. innocua (F4247) and a B. substilis induced only 2% and 8% cytotoxicity, respectively. This cell-based detection device demonstrates its ability to detect the presence of pathogenic Listeria and Bacillus species and can potentially be used onsite for food safety or in biosecurity application.

  7. Rapid, sensitive, and specific detection of Clostridium tetani by loop-mediated isothermal amplification assay.

    Science.gov (United States)

    Jiang, Dongneng; Pu, Xiaoyun; Wu, Jiehong; Li, Meng; Liu, Ping

    2013-01-01

    Tetanus is a specific infectious disease, which is often associated with catastrophic events such as earthquakes, traumas, and war wounds. The obligate anaerobe Clostridium tetani is the pathogen that causes tetanus. Once the infection of tetanus progresses to an advanced stage within the wounds of limbs, the rates of amputation and mortality increase manifold. Therefore, it is necessary to devise a rapid and sensitive point-of-care detection method for C. tetani so as to ensure an early diagnosis and clinical treatment of tetanus. In this study, we developed a detection method for C. tetani using loop-mediated isothermal amplification (LAMP) assay, wherein the C. tetani tetanus toxin gene was used as the target gene. The method was highly specific and sensitive, with a detection limit of 10 colony forming units (CFU)/ml, and allowed quantitative analysis. While detecting C. tetani in clinical samples, it was found that the LAMP results completely agreed with those of the traditional API 20A anaerobic bacteria identification test. As compared with the traditional API test and PCR assay, LAMP detection of C. tetani is simple and rapid, and the results can be identified through naked-eye observation. Therefore, it is an ideal and rapid point-of-care testing method for tetanus.

  8. Development of a double-antibody sandwich ELISA for rapid detection of Bacillus Cereus in food

    Science.gov (United States)

    Zhu, Longjiao; He, Jing; Cao, Xiaohan; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

    2016-01-01

    Bacillus cereus is increasingly recognized as one of the major causes of food poisoning in the industrialized world. In this paper, we describe a sensitive double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) that was developed for rapid detection of B. cereus in food to minimize the risk of contamination. The polyclonal antibody (pAb) and monoclonal antibodies (mAbs) specific to B. cereus were generated from rabbit antiserum and mouse ascites, respectively, using the octanoic acid/saturated ammonium sulfate precipitation method and protein A-sepharose columns. IgG-isotype mAbs were specially developed to undergo a novel peripheral multiple sites immunization for rapid gain of hybridomas and a subtractive screen was used to eliminate cross reactivity with closely related species such as Bacillus thuringiensis, B. subtilis, B. licheniformis and B. perfringens. The linear detection range of the method was approximately 1 × 104–2.8 × 106 cells/mL with a detection limit (LOD) of 0.9 × 103 cells/mL. The assay was able to detect B. cereus when the samples were prepared in meat with various pathogens. The newly developed analytical method provides a rapid method to sensitively detect B. cereus in food specimens. PMID:26976753

  9. Simultaneous detection of viral and bacterial enteric pathogens using the Seeplex® Diarrhea ACE detection system.

    Science.gov (United States)

    Coupland, L J; McElarney, I; Meader, E; Cowley, K; Alcock, L; Naunton, J; Gray, J

    2013-10-01

    A panel of 223 faecal samples was analysed to determine the clinical utility of the Seeplex® Diarrhea ACE Detection multiplex PCR system (Seeplex system; Seegene, Korea), a qualitative multiplexing PCR technology that enables simultaneous multi-pathogen detection of four viruses and/or ten bacteria associated with acute gastroenteritis. Conventional diagnostic methods and a norovirus-specific multiplex real-time RT–PCR detected 98 pathogens in 96 samples. The Seeplex system detected 81 pathogens in 75 samples. All samples positive for adenovirus, norovirus, Campylobacter spp., Escherichia coli O157, Shigella spp. or Vibrio spp. were detected by the Seeplex system. Rotavirus, Clostridium difficile toxin B, and Salmonella spp. were not detected in 12.5%, 50% and 15.8% of samples, respectively. Additional multiple infections were detected in 19 samples by the Seeplex system. The Seeplex system provides significant additional diagnostic capability for the syndromic diagnosis of acute gastroenteritis with increased sensitivity for the majority of pathogens.

  10. Use of Triplex PCR for Rapid Detection of PVL and Differentiation of MRSA from Methicillin Resistant Coagulase Negative Staphylococci

    OpenAIRE

    Abimanyu, Nagarajan; Krishnan, Arunkumar; Murugesan, Saravanan; Subramanian G, Kaushik; Gurumurthy, Sivakumar; Krishnan, Padma

    2013-01-01

    Introduction: Methicillin-Resistant Staphylococcus aureus (MRSA) has become a major public health problem in both hospitals and communities. Panton – Valentine Leucocidin (PVL) has been reported to be an important marker for the highly pathogenic community acquired S. aureus infections. A rapid detection of these MRSA is very important for its treatment. The specific detection of MRSA is always a problem due to the prevalence of methicillin resistance among the coagulase negative Staphylococc...

  11. Multiplex polymerase chain reaction of genetic markers for detection of potentially pathogenic environmental Legionella pneumophila isolates

    Directory of Open Access Journals (Sweden)

    Arvind Valavane

    2017-01-01

    Interpretation & conclusions: The findings of this study showed the presence of gene markers of pathogenic potential of the bacterium L. pneumophila. However, the genomic constitution of the environmental isolates should be correlated with clinical isolates to prove their pathogenic potential. Rapid diagnostic methods such as multiplex PCR reported here, for elucidating gene markers, could help in future epidemiological studies of bacterium L. pneumophila.

  12. Validation of Metagenomic Next-Generation Sequencing Tests for Universal Pathogen Detection.

    Science.gov (United States)

    Schlaberg, Robert; Chiu, Charles Y; Miller, Steve; Procop, Gary W; Weinstock, George

    2017-06-01

    - Metagenomic sequencing can be used for detection of any pathogens using unbiased, shotgun next-generation sequencing (NGS), without the need for sequence-specific amplification. Proof-of-concept has been demonstrated in infectious disease outbreaks of unknown causes and in patients with suspected infections but negative results for conventional tests. Metagenomic NGS tests hold great promise to improve infectious disease diagnostics, especially in immunocompromised and critically ill patients. - To discuss challenges and provide example solutions for validating metagenomic pathogen detection tests in clinical laboratories. A summary of current regulatory requirements, largely based on prior guidance for NGS testing in constitutional genetics and oncology, is provided. - Examples from 2 separate validation studies are provided for steps from assay design, and validation of wet bench and bioinformatics protocols, to quality control and assurance. - Although laboratory and data analysis workflows are still complex, metagenomic NGS tests for infectious diseases are increasingly being validated in clinical laboratories. Many parallels exist to NGS tests in other fields. Nevertheless, specimen preparation, rapidly evolving data analysis algorithms, and incomplete reference sequence databases are idiosyncratic to the field of microbiology and often overlooked.

  13. Inflammatory stimuli reprogram macrophage phagocytosis to macropinocytosis for the rapid elimination of pathogens.

    Directory of Open Access Journals (Sweden)

    Somdeb Bosedasgupta

    2014-01-01

    Full Text Available Following an infectious challenge, macrophages have to be activated in order to allow efficient clearance of infectious pathogens, but how macrophage activation is coupled to increased clearance remains largely unknown. We here describe that inflammatory stimuli induced the reprogramming of the macrophage endocytic machinery from receptor-mediated phagocytosis to macropinocytosis, allowing the rapid transfer of internalized cargo to lysosomes in a receptor-independent manner. Reprogramming occurred through protein kinase C-mediated phosphorylation of the macrophage protein coronin 1, thereby activating phosphoinositol (PI-3-kinase activity necessary for macropinocytic uptake. Expression of a phosphomimetic form of coronin 1 was sufficient to induce PI3-kinase activation and macropinocytosis even in the absence of inflammatory stimuli. Together these results suggest a hitherto unknown mechanism to regulate the internalization and degradation of infectious material during inflammation.

  14. Inflammatory Stimuli Reprogram Macrophage Phagocytosis to Macropinocytosis for the Rapid Elimination of Pathogens

    Science.gov (United States)

    BoseDasgupta, Somdeb; Pieters, Jean

    2014-01-01

    Following an infectious challenge, macrophages have to be activated in order to allow efficient clearance of infectious pathogens, but how macrophage activation is coupled to increased clearance remains largely unknown. We here describe that inflammatory stimuli induced the reprogramming of the macrophage endocytic machinery from receptor-mediated phagocytosis to macropinocytosis, allowing the rapid transfer of internalized cargo to lysosomes in a receptor-independent manner. Reprogramming occurred through protein kinase C-mediated phosphorylation of the macrophage protein coronin 1, thereby activating phosphoinositol (PI)-3-kinase activity necessary for macropinocytic uptake. Expression of a phosphomimetic form of coronin 1 was sufficient to induce PI3-kinase activation and macropinocytosis even in the absence of inflammatory stimuli. Together these results suggest a hitherto unknown mechanism to regulate the internalization and degradation of infectious material during inflammation. PMID:24497827

  15. Detection and treatment of chemical weapons and/or biological pathogens

    Science.gov (United States)

    Mariella Jr., Raymond P.

    2004-09-07

    A system for detection and treatment of chemical weapons and/or biological pathogens uses a detector system, an electrostatic precipitator or scrubber, a circulation system, and a control. The precipitator or scrubber is activated in response to a signal from the detector upon the detection of chemical weapons and/or biological pathogens.

  16. gmos: Rapid Detection of Genome Mosaicism over Short Evolutionary Distances.

    Science.gov (United States)

    Domazet-Lošo, Mirjana; Domazet-Lošo, Tomislav

    2016-01-01

    Prokaryotic and viral genomes are often altered by recombination and horizontal gene transfer. The existing methods for detecting recombination are primarily aimed at viral genomes or sets of loci, since the expensive computation of underlying statistical models often hinders the comparison of complete prokaryotic genomes. As an alternative, alignment-free solutions are more efficient, but cannot map (align) a query to subject genomes. To address this problem, we have developed gmos (Genome MOsaic Structure), a new program that determines the mosaic structure of query genomes when compared to a set of closely related subject genomes. The program first computes local alignments between query and subject genomes and then reconstructs the query mosaic structure by choosing the best local alignment for each query region. To accomplish the analysis quickly, the program mostly relies on pairwise alignments and constructs multiple sequence alignments over short overlapping subject regions only when necessary. This fine-tuned implementation achieves an efficiency comparable to an alignment-free tool. The program performs well for simulated and real data sets of closely related genomes and can be used for fast recombination detection; for instance, when a new prokaryotic pathogen is discovered. As an example, gmos was used to detect genome mosaicism in a pathogenic Enterococcus faecium strain compared to seven closely related genomes. The analysis took less than two minutes on a single 2.1 GHz processor. The output is available in fasta format and can be visualized using an accessory program, gmosDraw (freely available with gmos).

  17. Hyperspectral imaging using a color camera and its application for pathogen detection

    Science.gov (United States)

    Yoon, Seung-Chul; Shin, Tae-Sung; Heitschmidt, Gerald W.; Lawrence, Kurt C.; Park, Bosoon; Gamble, Gary

    2015-02-01

    This paper reports the results of a feasibility study for the development of a hyperspectral image recovery (reconstruction) technique using a RGB color camera and regression analysis in order to detect and classify colonies of foodborne pathogens. The target bacterial pathogens were the six representative non-O157 Shiga-toxin producing Escherichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) grown in Petri dishes of Rainbow agar. The purpose of the feasibility study was to evaluate whether a DSLR camera (Nikon D700) could be used to predict hyperspectral images in the wavelength range from 400 to 1,000 nm and even to predict the types of pathogens using a hyperspectral STEC classification algorithm that was previously developed. Unlike many other studies using color charts with known and noise-free spectra for training reconstruction models, this work used hyperspectral and color images, separately measured by a hyperspectral imaging spectrometer and the DSLR color camera. The color images were calibrated (i.e. normalized) to relative reflectance, subsampled and spatially registered to match with counterpart pixels in hyperspectral images that were also calibrated to relative reflectance. Polynomial multivariate least-squares regression (PMLR) was previously developed with simulated color images. In this study, partial least squares regression (PLSR) was also evaluated as a spectral recovery technique to minimize multicollinearity and overfitting. The two spectral recovery models (PMLR and PLSR) and their parameters were evaluated by cross-validation. The QR decomposition was used to find a numerically more stable solution of the regression equation. The preliminary results showed that PLSR was more effective especially with higher order polynomial regressions than PMLR. The best classification accuracy measured with an independent test set was about 90%. The results suggest the potential of cost-effective color imaging using hyperspectral image

  18. Recent Advances in Molecular Technologies and Their Application in Pathogen Detection in Foods with Particular Reference to Yersinia

    Science.gov (United States)

    Gui, Jin; Patel, Isha R.

    2011-01-01

    Yersinia enterocolitica is an important zoonotic pathogen that can cause yersiniosis in humans and animals. Food has been suggested to be the main source of yersiniosis. It is critical for the researchers to be able to detect Yersinia or any other foodborne pathogen with increased sensitivity and specificity, as well as in real-time, in the case of a foodborne disease outbreak. Conventional detection methods are known to be labor intensive, time consuming, or expensive. On the other hand, more sensitive molecular-based detection methods like next generation sequencing, microarray, and many others are capable of providing faster results. DNA testing is now possible on a single molecule, and high-throughput analysis allows multiple detection reactions to be performed at once, thus allowing a range of characteristics to be rapidly and simultaneously determined. Despite better detection efficiencies, results derived using molecular biology methods can be affected by the various food matrixes. With the improvements in sample preparation, data analysis, and testing procedures, molecular detection techniques will likely continue to simplify and increase the speed of detection while simultaneously improving the sensitivity and specificity for tracking pathogens in food matrices. PMID:22567329

  19. Recent Advances in Molecular Technologies and Their Application in Pathogen Detection in Foods with Particular Reference to Yersinia

    Directory of Open Access Journals (Sweden)

    Jin Gui

    2011-01-01

    Full Text Available Yersinia enterocolitica is an important zoonotic pathogen that can cause yersiniosis in humans and animals. Food has been suggested to be the main source of yersiniosis. It is critical for the researchers to be able to detect Yersinia or any other foodborne pathogen with increased sensitivity and specificity, as well as in real-time, in the case of a foodborne disease outbreak. Conventional detection methods are known to be labor intensive, time consuming, or expensive. On the other hand, more sensitive molecular-based detection methods like next generation sequencing, microarray, and many others are capable of providing faster results. DNA testing is now possible on a single molecule, and high-throughput analysis allows multiple detection reactions to be performed at once, thus allowing a range of characteristics to be rapidly and simultaneously determined. Despite better detection efficiencies, results derived using molecular biology methods can be affected by the various food matrixes. With the improvements in sample preparation, data analysis, and testing procedures, molecular detection techniques will likely continue to simplify and increase the speed of detection while simultaneously improving the sensitivity and specificity for tracking pathogens in food matrices.

  20. Development of a Loop-Mediated Isothermal Amplification Assay for Rapid Detection of Trichosporon asahii in Experimental and Clinical Samples

    Science.gov (United States)

    Zhou, Jianfeng; Liao, Yong; Li, Haitao; Lu, Xuelian; Han, Xiufeng; Tian, Yanli; Chen, Shanshan; Yang, Rongya

    2015-01-01

    Invasive trichosporonosis is a deep mycosis found mainly in immunocompromised hosts, and the major pathogen is Trichosporon asahii. We detected the species-specific intergenic spacers (IGS) of rRNA gene of T. asahii using a loop-mediated isothermal amplification (LAMP) assay in 15 isolates with 3 different visualization methods, including SYBR green detection, gel electrophoresis, and turbidimetric methods. The LAMP assay displayed superior rapidity to other traditional methods in the detection time; that is, only 1 h was needed for detection and identification of the pathogen DNA. Furthermore, the detection limit of the LAMP assay was more sensitive than the PCR assay. We also successfully detect the presence of T. asahii in samples from experimentally infected mice and samples from patients with invasive trichosporonosis caused by T. asahii, suggesting that this method may become useful in clinical applications in the near future. PMID:25692144

  1. Acanthamoeba keratitis: improving the Scottish diagnostic service for the rapid molecular detection of Acanthamoeba species.

    Science.gov (United States)

    Alexander, Claire Low; Coyne, Michael; Jones, Brian; Anijeet, Deepa

    2015-07-01

    Acanthamoeba species are responsible for causing the potentially sight-threatening condition, Acanthamoeba keratitis, which is commonly associated with contact lens use. In this report, we highlight the challenges faced using conventional laboratory identification methods to identify this often under-reported pathogen, and discuss the reasons for introducing the first national service in Scotland for the rapid and sensitive molecular identification of Acanthamoeba species. By comparing culture and molecular testing data from a total of 63 patients (n = 80 samples) throughout Scotland presenting with ocular eye disease, we describe the improvement in detection rates where an additional four positive cases were identified using a molecular assay versus culture. The testing of a further ten patients by confocal imaging is also presented. This report emphasizes the importance of continuing to improve clinical laboratory services to ensure a prompt, correct diagnosis and better prognosis, in addition to raising awareness of this potentially debilitating opportunistic pathogen.

  2. Evaluation of the multiplex PCR Allplex-GI assay in the detection of bacterial pathogens in diarrheic stool samples.

    Science.gov (United States)

    Martín, Ariadna; Pérez-Ayala, Ana; Chaves, Fernando; Lora, David; Orellana, M Ángeles

    2017-10-31

    Rapid and accurate detection of the pathogens that cause gastrointestinal infection is important for appropriate therapy and proper infection control. This study assesses the performance of a new molecular assay for simultaneous detection of 13 different gastrointestinal bacteria in stool specimens. Using the Allplex GI-Bacteria (AGI-BI/AGI-BII) assay, a total of 394 stool samples were tested and the results were compared with culturing on selective differential followed by identification by mass spectroscopy. Discordant results were analyzed by a different multiplex PCR method, the Fast-Track Diagnostics Bacterial gastroenteritis (FTD-BG). The routine method (RM) detected 109 (27.7%) positive samples and the Allplex-GI assay, 261 (66.2%). Analysis of discordant results revealed that the molecular assay detected 44 pathogens that were not detected by the RM, including 23 Campylobacter spp., 11 Salmonella spp, 3 Y. enterocolitica, 2 EIEC/Shigella spp, 2 E. coli 0157, 2 C. difficile and 1 Aeromonas spp. Five cases not detected by the molecular method were detected by the RM (3 Aeromonas spp, 1 Salmonella spp and 1 Y. enterocolitica). For all targets, the percentages of sensitivity and specificity were >95%, except for Aeromonas spp., which were 81% and 99% respectively. This study suggests that Allplex-GI multiplex PCR is a sensitive and specific assay that enables a rapid and accurate diagnosis of bacterial gastrointestinal infections. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. A nanoporous membrane-based impedimetric immunosensor for label-free detection of pathogenic bacteria in whole milk.

    Science.gov (United States)

    Joung, Cho-Kyung; Kim, Han-Nah; Lim, Min-Cheol; Jeon, Tae-Joon; Kim, Hae-Yeong; Kim, Young-Rok

    2013-06-15

    We introduce a nanoporous membrane based impedimetric immunosensor for the label-free detection of bacterial pathogens in whole milk. A simple and rapid method to modify a commercially available alumina nanoporous membrane with hyaluronic acid (HA) effectively reduced the non-specific binding of biomolecules and other cells, and permitted successful immobilization of antibodies. Escherichia coli O157:H7, one of the most harmful food-borne pathogenic bacteria, was tested as a model pathogen in this study. The ionic impedance of electrolytes through nanopores, due to antibody-pathogen interactions, was monitored by impedance spectra and analyzed by normalized impedance change (NIC). The regression equation for the NIC at 1 kHz versus concentration of E. coli O157:H7 (10-10(5)cfu/ml) was obtained, and the detection limit found to be as low as 10 cfu/ml. In addition, the proposed immunosensor was successfully used for the detection of E. coli O157:H7 in whole milk samples with the detection limit as low as 83.7 cfu/ml with 95% probability. The specificity of the immunosensor was also demonstrated using non-target bacteria, including Staphylococcus aureus, Bacillus cereus, and non pathogenic E. coli DH5α. This study shows that a HA-functionalized nanoporous membrane-based impedimetric sensor is capable of detecting pathogenic bacteria in whole milk without any pretreatment. This is a significant step for evaluating the safety of food and environmental samples and other medical diagnostics. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Melting Temperature Mapping Method: A Novel Method for Rapid Identification of Unknown Pathogenic Microorganisms within Three Hours of Sample Collection.

    Science.gov (United States)

    Niimi, Hideki; Ueno, Tomohiro; Hayashi, Shirou; Abe, Akihito; Tsurue, Takahiro; Mori, Masashi; Tabata, Homare; Minami, Hiroshi; Goto, Michihiko; Akiyama, Makoto; Yamamoto, Yoshihiro; Saito, Shigeru; Kitajima, Isao

    2015-07-28

    Acquiring the earliest possible identification of pathogenic microorganisms is critical for selecting the appropriate antimicrobial therapy in infected patients. We herein report the novel "melting temperature (Tm) mapping method" for rapidly identifying the dominant bacteria in a clinical sample from sterile sites. Employing only seven primer sets, more than 100 bacterial species can be identified. In particular, using the Difference Value, it is possible to identify samples suitable for Tm mapping identification. Moreover, this method can be used to rapidly diagnose the absence of bacteria in clinical samples. We tested the Tm mapping method using 200 whole blood samples obtained from patients with suspected sepsis, 85% (171/200) of which matched the culture results based on the detection level. A total of 130 samples were negative according to the Tm mapping method, 98% (128/130) of which were also negative based on the culture method. Meanwhile, 70 samples were positive according to the Tm mapping method, and of the 59 suitable for identification, 100% (59/59) exhibited a "match" or "broad match" with the culture or sequencing results. These findings were obtained within three hours of whole blood collection. The Tm mapping method is therefore useful for identifying infectious diseases requiring prompt treatment.

  5. Direct Detection and Differentiation of Pathogenic Leptospira Species Using a Multi-Gene Targeted Real Time PCR Approach

    Science.gov (United States)

    Ferreira, Ana Sofia; Costa, Pedro; Rocha, Teresa; Amaro, Ana; Vieira, Maria Luísa; Ahmed, Ahmed; Thompson, Gertrude; Hartskeerl, Rudy A.; Inácio, João

    2014-01-01

    Leptospirosis is a growing public and veterinary health concern caused by pathogenic species of Leptospira. Rapid and reliable laboratory tests for the direct detection of leptospiral infections in animals are in high demand not only to improve diagnosis but also for understanding the epidemiology of the disease. In this work we describe a novel and simple TaqMan-based multi-gene targeted real-time PCR approach able to detect and differentiate Leptospira interrogans, L. kirschneri, L. borgpeteresenii and L. noguchii, which constitute the veterinary most relevant pathogenic species of Leptospira. The method uses sets of species-specific probes, and respective flanking primers, designed from ompL1 and secY gene sequences. To monitor the presence of inhibitors, a duplex amplification assay targeting both the mammal β-actin and the leptospiral lipL32 genes was implemented. The analytical sensitivity of all primer and probe sets was estimated to be Leptospira strains and other non-related bacteria revealed a 100% analytical specificity. Additionally, pathogenic leptospires were successfully detected in five out of 29 tissue samples from animals (Mus spp., Rattus spp., Dolichotis patagonum and Sus domesticus). Two samples were infected with L. borgpetersenii, two with L. interrogans and one with L. kirschneri. The possibility to detect and identify these pathogenic agents to the species level in domestic and wildlife animals reinforces the diagnostic information and will enhance our understanding of the epidemiology of leptopirosis. PMID:25398140

  6. Rapid and sensitive detection of rotavirus molecular signatures using surface enhanced Raman spectroscopy.

    Directory of Open Access Journals (Sweden)

    Jeremy D Driskell

    Full Text Available Human enteric virus infections range from gastroenteritis to life threatening diseases such as myocarditis and aseptic meningitis. Rotavirus is one of the most common enteric agents and mortality associated with infection can be very significant in developing countries. Most enteric viruses produce diseases that are not distinct from other pathogens, and current diagnostics is limited in breadth and sensitivity required to advance virus detection schemes for disease intervention strategies. A spectroscopic assay based on surface enhanced Raman scattering (SERS has been developed for rapid and sensitive detection of rotavirus. The SERS method relies on the fabrication of silver nanorod array substrates that are extremely SERS-active allowing for direct structural characterization of viruses. SERS spectra for eight rotavirus strains were analyzed to qualitatively identify rotaviruses and to classify each according to G and P genotype and strain with >96% accuracy, and a quantitative model based on partial least squares regression analysis was evaluated. This novel SERS-based virus detection method shows that SERS can be used to identify spectral fingerprints of human rotaviruses, and suggests that this detection method can be used for pathogen detection central to human health care.

  7. Individual differences in detecting rapidly presented fearful faces.

    Directory of Open Access Journals (Sweden)

    Dandan Zhang

    Full Text Available Rapid detection of evolutionarily relevant threats (e.g., fearful faces is important for human survival. The ability to rapidly detect fearful faces exhibits high variability across individuals. The present study aimed to investigate the relationship between behavioral detection ability and brain activity, using both event-related potential (ERP and event-related oscillation (ERO measurements. Faces with fearful or neutral facial expressions were presented for 17 ms or 200 ms in a backward masking paradigm. Forty-two participants were required to discriminate facial expressions of the masked faces. The behavioral sensitivity index d' showed that the detection ability to rapidly presented and masked fearful faces varied across participants. The ANOVA analyses showed that the facial expression, hemisphere, and presentation duration affected the grand-mean ERP (N1, P1, and N170 and ERO (below 20 Hz and lasted from 100 ms to 250 ms post-stimulus, mainly in theta band brain activity. More importantly, the overall detection ability of 42 subjects was significantly correlated with the emotion effect (i.e., fearful vs. neutral on ERP (r = 0.403 and ERO (r = 0.552 measurements. A higher d' value was corresponding to a larger size of the emotional effect (i.e., fearful--neutral of N170 amplitude and a larger size of the emotional effect of the specific ERO spectral power at the right hemisphere. The present results suggested a close link between behavioral detection ability and the N170 amplitude as well as the ERO spectral power below 20 Hz in individuals. The emotional effect size between fearful and neutral faces in brain activity may reflect the level of conscious awareness of fearful faces.

  8. A recombinase polymerase amplification assay for rapid detection of Crimean-Congo Haemorrhagic fever Virus infection.

    Directory of Open Access Journals (Sweden)

    Laura C Bonney

    2017-10-01

    Full Text Available Crimean-Congo Haemorrhagic fever Virus (CCHFV is a rapidly emerging vector-borne pathogen and the cause of a virulent haemorrhagic fever affecting large parts of Europe, Africa, the Middle East and Asia.An isothermal recombinase polymerase amplification (RPA assay was successfully developed for molecular detection of CCHFV. The assay showed rapid (under 10 minutes detection of viral extracts/synthetic virus RNA of all 7 S-segment clades of CCHFV, with high target specificity. The assay was shown to tolerate the presence of inhibitors in crude preparations of mock field samples, indicating that this assay may be suitable for use in the field with minimal sample preparation. The CCHFV RPA was successfully used to screen and detect CCHFV positives from a panel of clinical samples from Tajikistan.The assay is a rapid, isothermal, simple-to-perform molecular diagnostic, which can be performed on a light, portable real-time detection device. It is ideally placed therefore for use as a field-diagnostic or in-low resource laboratories, for monitoring of CCHF outbreaks at the point-of-need, such as in remote rural regions in affected countries.

  9. A recombinase polymerase amplification assay for rapid detection of Crimean-Congo Haemorrhagic fever Virus infection.

    Science.gov (United States)

    Bonney, Laura C; Watson, Robert J; Afrough, Babak; Mullojonova, Manija; Dzhuraeva, Viktoriya; Tishkova, Farida; Hewson, Roger

    2017-10-01

    Crimean-Congo Haemorrhagic fever Virus (CCHFV) is a rapidly emerging vector-borne pathogen and the cause of a virulent haemorrhagic fever affecting large parts of Europe, Africa, the Middle East and Asia. An isothermal recombinase polymerase amplification (RPA) assay was successfully developed for molecular detection of CCHFV. The assay showed rapid (under 10 minutes) detection of viral extracts/synthetic virus RNA of all 7 S-segment clades of CCHFV, with high target specificity. The assay was shown to tolerate the presence of inhibitors in crude preparations of mock field samples, indicating that this assay may be suitable for use in the field with minimal sample preparation. The CCHFV RPA was successfully used to screen and detect CCHFV positives from a panel of clinical samples from Tajikistan. The assay is a rapid, isothermal, simple-to-perform molecular diagnostic, which can be performed on a light, portable real-time detection device. It is ideally placed therefore for use as a field-diagnostic or in-low resource laboratories, for monitoring of CCHF outbreaks at the point-of-need, such as in remote rural regions in affected countries.

  10. High-Throughput Detection of Pathogenic Yeasts of the Genus Trichosporon

    Science.gov (United States)

    Diaz, Mara R.; Fell, Jack W.

    2004-01-01

    The need for a rapid and accurate method for the detection of fungal pathogens has become imperative as the incidence of fungal infections has increased dramatically. Herein, we tested the Luminex 100, a novel flow cytometer, for the detection of the medically important genus Trichosporon. This genus was selected as our proof-of-concept model due to the close phylogenetic relationship between the species. The method, which is based on a nucleotide hybridization assay, consists of a combination of different sets of fluorescent beads covalently bound to species-specific capture probes. Upon hybridization, the beads bearing the target amplicons are classified by their spectral addresses with a 635-nm laser. Quantitation of the hybridized biotinylated amplicon is based on fluorescence detection with a 532-nm laser. We tested in various multiplex formats 48 species-specific and group-specific capture probes designed in the D1/D2 region of ribosomal DNA, internal transcribed spacer regions, and intergenic spacer region. Species-specific biotinylated amplicons were generated with three sets of primers to yield fragments from the three regions. The assay was specific and fast, as it discriminated species differing by 1 nucleotide and required less than 50 min following amplification to process a 96-well plate. The sensitivity of the assay allowed the detection of 102 genome molecules in PCRs and 107 to 108 molecules of biotinylated amplification product. This technology provided a rapid means of detection of Trichosporon species with the flexibility to identify species in a multiplex format by combining different sets of beads. PMID:15297519

  11. Rapid Visual Tests: Fast and Reliable Detection of Ochratoxin A

    Directory of Open Access Journals (Sweden)

    Miguel Lopez-Ferber

    2010-08-01

    Full Text Available This paper reviews the early detection strategies that have been employed for the rapid monitoring of ochratoxin A (OTA contamination of food. OTA, a mycotoxin mainly produced by some Aspergillus and Penicillium species, is found in cereals, coffee, wine, pork and grapes. To minimize the entry of this mycotoxin into the food chain, rapid diagnostic tools are required. To this end, the potential use of lateral flow devices has also been developed. In this study, we analyze the robustness of test strips using published methods for colorimetric detection. Different test formats are discussed, and challenges in the development of lateral flow devices for on-site determination of OTA, with requirements such as robustness, speed, and cost-effectiveness, are discussed.

  12. Rapid and Sensitive Detection of BLAD in Cattle Population

    Directory of Open Access Journals (Sweden)

    Daniela Elena Ilie

    2014-05-01

    Full Text Available Bovine leukocyte adhesion deficiency (BLAD is an autosomal recessive disorder with negative impact on dairy cattle breeding. The molecular basis of BLAD is a single point mutation (A→G, resulting in a single amino acid substitution (aspartic acid → glycine at amino acid 128 in the adhesion molecule CD18. The object of this study was to establish a fast and sensitive molecular genotyping assay to detect BLAD carriers using high-resolution melting (HRM curve analysis. We tested animals with known genotypes for BLAD that were previously confirmed by PCR-RFLP method, and then examined the sensitivity of mutation detection using PCR followed by HRM curve analysis. BLAD carriers were readily detectable using HRM assay. Thus, the PCR-HRM genotyping method is a rapid, easily interpretable, reliable and cost-effective assay for BLAD mutant allele detection. This assay can be useful in cattle genotyping and genetic selection.

  13. Rapid detection of methanol in artisanal alcoholic beverages

    Science.gov (United States)

    de Goes, R. E.; Muller, M.; Fabris, J. L.

    2015-09-01

    In the industry of artisanal beverages, uncontrolled production processes may result in contaminated products with methanol, leading to risks for consumers. Owing to the similar odor of methanol and ethanol, as well as their common transparency, the distinction between them is a difficult task. Contamination may also occur deliberately due to the lower price of methanol when compared to ethanol. This paper describes a spectroscopic method for methanol detection in beverages based on Raman scattering and Principal Component Analysis. Associated with a refractometric assessment of the alcohol content, the method may be applied in field for a rapid detection of methanol presence.

  14. Amperometric immunosensor for rapid detection of Mycobacterium tuberculosis

    Science.gov (United States)

    Hiraiwa, Morgan; Kim, Jong-Hoon; Lee, Hyun-Boo; Inoue, Shinnosuke; Becker, Annie L.; Weigel, Kris M.; Cangelosi, Gerard A.; Lee, Kyong-Hoon; Chung, Jae-Hyun

    2015-05-01

    Tuberculosis (TB) has been a major public health problem, which can be better controlled by using accurate and rapid diagnosis in low-resource settings. A simple, portable, and sensitive detection method is required for point-of-care (POC) settings. This paper studies an amperometric biosensor using a microtip immunoassay for a rapid and low-cost detection of Mycobacterium tuberculosis (MTB) in sputum. MTB in sputum is specifically captured on the functionalized microtip surface and detected by electric current. According to the numerical study, the current signal on the microtip surface is linearly changed with increasing immersion depth. Using a reference microtip, the immersion depth is compensated for a sensing microtip. On the microtip surface, target bacteria are concentrated and organized by a coffee-ring effect, which amplifies the electric current. To enhance the signal-to-noise ratio, both the sample processing and rinsing steps are presented with the use of deionized water as a medium for the amperometric measurement. When applied to cultured MTB cells spiked into human sputum, the detection limit was 100 CFU mL-1, comparable to a more labor-intensive fluorescence detection method reported previously.

  15. Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR

    Directory of Open Access Journals (Sweden)

    Hansson Per

    2005-11-01

    Full Text Available Abstract Background Gremmeniella abietina (Lagerb. Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities.

  16. Rapid Screening of Natural Plant Extracts with Calcium Diacetate for Differential Effects Against Foodborne Pathogens and a Probiotic Bacterium.

    Science.gov (United States)

    Colonna, William; Brehm-Stecher, Byron; Shetty, Kalidas; Pometto, Anthony

    2017-12-01

    This study focused on advancing a rapid turbidimetric bioassay to screen antimicrobials using specific cocktails of targeted foodborne bacterial pathogens. Specifically, to show the relevance of this rapid screening tool, the antimicrobial potential of generally recognized as safe calcium diacetate (DAX) and blends with cranberry (NC) and oregano (OX) natural extracts was evaluated. Furthermore, the same extracts were evaluated against beneficial lactic acid bacteria. The targeted foodborne pathogens evaluated were Escherichia coli O157:H7, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus using optimized initial cocktails (∼108 colony-forming unit/mL) containing strains isolated from human food outbreaks. Of all extracts evaluated, 0.51% (w/v) DAX in ethanol was the most effective against all four pathogens. However, DAX when reduced to 0.26% and with added blends from ethanol extractions consisting of DAX:OX (3:1), slightly outperformed or was equal to same levels of DAX alone. Subculture of wells in which no growth occurred after 1 week indicated that all water and ethanol extracts were bacteriostatic against the pathogens tested. All the targeted antimicrobials had no effect on the probiotic organism Lactobacillus plantarum. The use of such rapid screening methods combined with the use of multistrain cocktails of targeted foodborne pathogens from outbreaks will allow rapid large-scale screening of antimicrobials and enable further detailed studies in targeted model food systems.

  17. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    , in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...... of newly designed primers targeting Salmonella spp. at subtype level were incorporated in the multiplex Direct PCR. To maximize the efficiency of the Direct PCR, the ratio between sample and dilution buffer was optimized. The sensitivity and specificity of the multiplex Direct PCR were tested using...... and integration into a point-of-need Lab-on-a-chip system for rapid online pathogen detection....

  18. Nanomaterial-based sensors for detection of foodborne bacterial pathogens and toxins as well as pork adulteration in meat products

    OpenAIRE

    Stephen Inbaraj, B.; Chen, B. H.

    2016-01-01

    Food safety draws considerable attention in the modern pace of the world owing to rapid-changing food recipes and food habits. Foodborne illnesses associated with pathogens, toxins, and other contaminants pose serious threat to human health. Besides, a large amount of money is spent on both analyses and control measures, which causes significant loss to the food industry. Conventional detection methods for bacterial pathogens and toxins are time consuming and laborious, requiring certain soph...

  19. Molecular inversion probe: a new tool for highly specific detection of plant pathogens.

    Directory of Open Access Journals (Sweden)

    Han Yih Lau

    Full Text Available Highly specific detection methods, capable of reliably identifying plant pathogens are crucial in plant disease management strategies to reduce losses in agriculture by preventing the spread of diseases. We describe a novel molecular inversion probe (MIP assay that can be potentially developed into a robust multiplex platform to detect and identify plant pathogens. A MIP has been designed for the plant pathogenic fungus Fusarium oxysporum f.sp. conglutinans and the proof of concept for the efficiency of this technology is provided. We demonstrate that this methodology can detect as little as 2.5 ng of pathogen DNA and is highly specific, being able to accurately differentiate Fusarium oxysporum f.sp. conglutinans from other fungal pathogens such as Botrytis cinerea and even pathogens of the same species such as Fusarium oxysporum f.sp. lycopersici. The MIP assay was able to detect the presence of the pathogen in infected Arabidopsis thaliana plants as soon as the tissues contained minimal amounts of pathogen. MIP methods are intrinsically highly multiplexable and future development of specific MIPs could lead to the establishment of a diagnostic method that could potentially screen infected plants for hundreds of pathogens in a single assay.

  20. Molecular inversion probe: a new tool for highly specific detection of plant pathogens.

    Science.gov (United States)

    Lau, Han Yih; Palanisamy, Ramkumar; Trau, Matt; Botella, Jose R

    2014-01-01

    Highly specific detection methods, capable of reliably identifying plant pathogens are crucial in plant disease management strategies to reduce losses in agriculture by preventing the spread of diseases. We describe a novel molecular inversion probe (MIP) assay that can be potentially developed into a robust multiplex platform to detect and identify plant pathogens. A MIP has been designed for the plant pathogenic fungus Fusarium oxysporum f.sp. conglutinans and the proof of concept for the efficiency of this technology is provided. We demonstrate that this methodology can detect as little as 2.5 ng of pathogen DNA and is highly specific, being able to accurately differentiate Fusarium oxysporum f.sp. conglutinans from other fungal pathogens such as Botrytis cinerea and even pathogens of the same species such as Fusarium oxysporum f.sp. lycopersici. The MIP assay was able to detect the presence of the pathogen in infected Arabidopsis thaliana plants as soon as the tissues contained minimal amounts of pathogen. MIP methods are intrinsically highly multiplexable and future development of specific MIPs could lead to the establishment of a diagnostic method that could potentially screen infected plants for hundreds of pathogens in a single assay.

  1. [Evaluation of Seeplex Pneumobacter multiplex PCR kit for the detection of respiratory bacterial pathogens in pediatric patients].

    Science.gov (United States)

    Park, Joowon; Kim, Jae Kyoung; Rheem, Insoo; Kim, Jongwan

    2009-08-01

    Rapid identification of the causative agent among potential bacterial and viral pathogens is important for the management of acute respiratory disease. In this study, we evaluated the analytical performance and clinical usefulness of a recently-introduced multiplex PCR assay, Seeplex Pneumobacter detection kit (Seegene Inc., Korea) for the identification of respiratory bacterial pathogens. One hundred and eighty one nasopharyngeal aspirates were collected from pediatric patients with respiratory symptoms and analysed by multiplex PCR for the detection of Streptococcus pneumoniae (S.P), Haemophilus influenzae (H.I), Mycoplasma pneumoniae (M.P), Chlamydophila pneumoniae (C.P), Bordetella pertussis (B.P) and Legionella pneumophila (L.P). A comparison of multiplex PCR with conventional culture for the isolation of S.P and H.I was performed on 112 specimens. The cross reactivity of multiplex PCR was also evaluated. Of 181 cases, 81 cases were positive by multiplex PCR (44.8%): 52 cases for S.P (28.7%), 47 cases for H.I (26.0%), 9 cases for M.P (5.0%), 3 cases for B.P (1.7%) and 1 case for C.P (0.6%) including multiple infection cases. The agreement rates between multiplex PCR and culture for S.P and H.I were 92.9% (kappa index=0.84, P<0.001) and 91.1% (kappa index=0.75, P<0.001), respectively. There was no cross reactivity with common bacterial and viral pathogens. Seeplex Pneumobacter detection kit could be a useful screening tool for the rapid detection of respiratory bacterial pathogens. Further studies with lower respiratory tract specimens would be needed for the clinical evaluation of S. pneumoniae and H. influenzae detected by multiplex PCR.

  2. Self-Assembled Biosensors on a Solid Interface for Rapid Detection and Growth Monitoring of Bacteria

    CERN Document Server

    Kinnunen, Paivo; Craig, Elizabeth; Brahmasandra, Sundu; McNaughton, Brandon H

    2012-01-01

    Developing rapid methods for pathogen detection and growth monitoring at low cell and analyte concentrations is an important goal, which numerous technologies are working towards solving. Rapid biosensors have already made a dramatic impact on improving patient outcomes and with continued development, these technologies may also help limit the emergence of antimicrobial resistance and reduce the ever expanding risk of foodborne illnesses. One technology that is being developed with these goals in mind is asynchronous magnetic bead rotation (AMBR) biosensors. Self-assembled AMBR biosensors have been demonstrated at water/air and water/oil interfaces, and here, for the first time, we report on self-assembled AMBR biosensors used at a solid interface. The solid interface configuration was used to measure the growth of Escherichia coli with two distinct phenomena at low cell concentrations: firstly, the AMBR rotational period decreased and secondly, the rotational period increased after several division times. Ta...

  3. gmos: Rapid Detection of Genome Mosaicism over Short Evolutionary Distances.

    Directory of Open Access Journals (Sweden)

    Mirjana Domazet-Lošo

    Full Text Available Prokaryotic and viral genomes are often altered by recombination and horizontal gene transfer. The existing methods for detecting recombination are primarily aimed at viral genomes or sets of loci, since the expensive computation of underlying statistical models often hinders the comparison of complete prokaryotic genomes. As an alternative, alignment-free solutions are more efficient, but cannot map (align a query to subject genomes. To address this problem, we have developed gmos (Genome MOsaic Structure, a new program that determines the mosaic structure of query genomes when compared to a set of closely related subject genomes. The program first computes local alignments between query and subject genomes and then reconstructs the query mosaic structure by choosing the best local alignment for each query region. To accomplish the analysis quickly, the program mostly relies on pairwise alignments and constructs multiple sequence alignments over short overlapping subject regions only when necessary. This fine-tuned implementation achieves an efficiency comparable to an alignment-free tool. The program performs well for simulated and real data sets of closely related genomes and can be used for fast recombination detection; for instance, when a new prokaryotic pathogen is discovered. As an example, gmos was used to detect genome mosaicism in a pathogenic Enterococcus faecium strain compared to seven closely related genomes. The analysis took less than two minutes on a single 2.1 GHz processor. The output is available in fasta format and can be visualized using an accessory program, gmosDraw (freely available with gmos.

  4. Upconversion nanoparticles based FRET aptasensor for rapid and ultrasenstive bacteria detection.

    Science.gov (United States)

    Jin, Birui; Wang, Shurui; Lin, Min; Jin, Ying; Zhang, Shujing; Cui, Xingye; Gong, Yan; Li, Ang; Xu, Feng; Lu, Tian Jian

    2017-04-15

    Pathogenic bacteria cause serious harm to human health, which calls for the development of advanced detection methods. Herein, we developed a novel detection platform based on fluorescence resonance energy transfer (FRET) for rapid, ultrasensitive and specific bacteria detection, where gold nanoparticles (AuNPs, acceptor) were conjugated with aptamers while upconversion nanoparticles (UCNPs, donor) were functionalized with corresponding complementary DNA (cDNA). The spectral overlap between UCNPs fluorescence emission and AuNPs absorption enables the occurrence of FRET when hybridizing the targeted aptamer and cDNA, causing upconversion fluorescence quenching. In the presence of target bacteria, the aptamers preferentially bind to bacteria forming a three-dimensional structure and thereby dissociate UCNPs-cDNA from AuNPs-aptamers, resulting in the recovery of upconversion fluorescence. Using the UCNPs based FRET aptasensor, we successfully detected Escherichia coli ATCC 8739 (as a model analyte) with a detection range of 5-106cfu/mL and detection limit of 3cfu/mL. The aptasensor was further used to detect E. coli in real food and water samples (e.g., tap/pond water, milk) within 20min. The novel UCNPs based FRET aptasensor could be used to detect a broad range of targets from whole cells to metal ions by using different aptamer sequences, holding great potential in environmental monitoring, medical diagnostics and food safety analysis. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Detection of Intestinal Pathogens in River, Shore, and Drinking Water in Lima, Peru.

    Science.gov (United States)

    Grothen, David C; Zach, Sydney J; Davis, Paul H

    2017-01-01

    Water quality management is an ongoing struggle for many locations worldwide. Current testing of water supplies can be time-consuming, expensive, and lack sensitivity. This study describes an alternative, easy-to-use, and inexpensive method to water sampling and testing at remote locations. This method was employed to detect a number of intestinal pathogens in various locations of Lima, Peru. A total of 34 PCR primer pairs were tested for specificity and high-yield amplification for 12 different pathogens using known DNA templates. Select primers for each pathogen were then tested for minimum detection limits of DNA. Water samples were collected from 22 locations. PCR was used to detect the presence of a pathogen, virulence factors, or differentiate between pathogenic species. In 22 water samples, cholera toxin gene was detected in 4.5% of samples, C. perfringens DNA was detected in 50% of samples, E. histolytica DNA was detected in 54.5% of samples, Giardia intestinalis DNA was detected in 4.5% of samples, Leptospira spp. DNA was detected in 29% of samples, and T. gondii DNA was detected in 31.8% of samples. DNA from three pathogens, C. perfringens, E. histolytica, and T. gondii, were found in residential samples, which accounted for 10 out of 22 samples.

  6. Development of a highly sensitive lateral immunochromatographic assay for rapid detection of Vibrio parahaemolyticus.

    Science.gov (United States)

    Liu, Xinfeng; Guan, Yuyao; Cheng, Shiliang; Huang, Yidan; Yan, Qin; Zhang, Jun; Huang, Guanjun; Zheng, Jian; Liu, Tianqiang

    2016-12-01

    Vibrio parahaemolyticus is widely present in brackish water all over the world, causing infections in certain aquatic animals. It is also a foodborne pathogen that causes diarrhea in humans. The aim of this study is to develop an immunochromatographic lateral flow assay (LFA) for rapid detection of V. parahaemolyticus in both aquatic products and human feces of diarrheal patients. Two monoclonal antibody (MAb) pairs, GA1a-IC9 and IC9-KB4c, were developed and proven to be highly specific and sensitive to V. parahaemolyticus. Based on the two MAb pairs, two types of LFA strips were prepared. Their testing limits for V. parahaemolyticus culture were both 1.2×103CFU/ml. The diagnostic sensitivities and specificities were both 100% for the 32 tested microbial species, including 6 Vibrio species. Subsequently, the LFA strips were used to test Whiteleg shrimps and human feces. The type II strip showed a higher diagnostic sensitivity. Its sensitivity and specificity for hepatopancreas and fecal samples from 13 Whiteleg shrimps and fecal samples from 146 human diarrheal patients were all 100%. In conclusion, our homemade type II LFA is a very promising testing device for rapid and convenient detection of V. parahaemolyticus infection not only in aquatic animals, but also in human diarrheal patients. This sensitive immunochromtographic LFA allows rapid detection of V. parahaemolyticus without requirement of culture enrichment. Copyright © 2016. Published by Elsevier B.V.

  7. Rapid Electrochemical Detection and Identification of Microbiological and Chemical Contaminants for Manned Spaceflight Project

    Science.gov (United States)

    Pierson, Duane; Botkin, Douglas; Gazda, Daniel

    2014-01-01

    Microbial control in the spacecraft environment is a daunting task, especially in the presence of human crew members. Currently, assessing the potential crew health risk associated with a microbial contamination event requires return of representative environmental samples that are analyzed in a ground-based laboratory. It is therefore not currently possible to quickly identify microbes during spaceflight. This project addresses the unmet need for spaceflight-compatible microbial identification technology. The electrochemical detection and identification platform is expected to provide a sensitive, specific, and rapid sample-to-answer capability for in-flight microbial monitoring that can distinguish between related microorganisms (pathogens and non-pathogens) as well as chemical contaminants. This will dramatically enhance our ability to monitor the spacecraft environment and the health risk to the crew. Further, the project is expected to eliminate the need for sample return while significantly reducing crew time required for detection of multiple targets. Initial work will focus on the optimization of bacterial detection and identification. The platform is designed to release nucleic acids (DNA and RNA) from microorganisms without the use of harmful chemicals. Bacterial DNA or RNA is captured by bacteria-specific probe molecules that are bound to a microelectrode, and that capture event can generate a small change in the electrical current (Lam, et al. 2012. Anal. Chem. 84(1): 21-5.). This current is measured, and a determination is made whether a given microbe is present in the sample analyzed. Chemical detection can be accomplished by directly applying a sample to the microelectrode and measuring the resulting current change. This rapid microbial and chemical detection device is designed to be a low-cost, low-power platform anticipated to be operated independently of an external power source, characteristics optimal for manned spaceflight and areas where power

  8. Optical Imaging of Paramagnetic Bead-DNA Aggregation Inhibition Allows for Low Copy Number Detection of Infectious Pathogens.

    Science.gov (United States)

    DuVall, Jacquelyn A; Borba, Juliane C; Shafagati, Nazly; Luzader, Deborah; Shukla, Nishant; Li, Jingyi; Kehn-Hall, Kylene; Kendall, Melissa M; Feldman, Sanford H; Landers, James P

    2015-01-01

    DNA-paramagnetic silica bead aggregation in a rotating magnetic field facilitates the quantification of DNA with femtogram sensitivity, but yields no sequence-specific information. Here we provide an original description of aggregation inhibition for the detection of DNA and RNA in a sequence-specific manner following loop-mediated isothermal amplification (LAMP). The fragments generated via LAMP fail to induce chaotrope-mediated bead aggregation; however, due to their ability to passivate the bead surface, they effectively inhibit bead aggregation by longer 'trigger' DNA. We demonstrate the utility of aggregation inhibition as a method for the detection of bacterial and viral pathogens with sensitivity that approaches single copies of the target. We successfully use this methodology for the detection of notable food-borne pathogens Escherichia coli O157:H7 and Salmonella enterica, as well as Rift Valley fever virus, a weaponizable virus of national security concern. We also show the concentration dependence of aggregation inhibition, suggesting the potential for quantification of target nucleic acid in clinical and environmental samples. Lastly, we demonstrate the ability to rapidly detect infectious pathogens by utilizing a cell phone and custom-written application (App), making this novel detection modality fully portable for point-of-care use.

  9. Optical Imaging of Paramagnetic Bead-DNA Aggregation Inhibition Allows for Low Copy Number Detection of Infectious Pathogens.

    Directory of Open Access Journals (Sweden)

    Jacquelyn A DuVall

    Full Text Available DNA-paramagnetic silica bead aggregation in a rotating magnetic field facilitates the quantification of DNA with femtogram sensitivity, but yields no sequence-specific information. Here we provide an original description of aggregation inhibition for the detection of DNA and RNA in a sequence-specific manner following loop-mediated isothermal amplification (LAMP. The fragments generated via LAMP fail to induce chaotrope-mediated bead aggregation; however, due to their ability to passivate the bead surface, they effectively inhibit bead aggregation by longer 'trigger' DNA. We demonstrate the utility of aggregation inhibition as a method for the detection of bacterial and viral pathogens with sensitivity that approaches single copies of the target. We successfully use this methodology for the detection of notable food-borne pathogens Escherichia coli O157:H7 and Salmonella enterica, as well as Rift Valley fever virus, a weaponizable virus of national security concern. We also show the concentration dependence of aggregation inhibition, suggesting the potential for quantification of target nucleic acid in clinical and environmental samples. Lastly, we demonstrate the ability to rapidly detect infectious pathogens by utilizing a cell phone and custom-written application (App, making this novel detection modality fully portable for point-of-care use.

  10. Towards On-site Pathogen Detection Using Antibody-based Sensors

    DEFF Research Database (Denmark)

    Skottrup, Peter Durand; Nicolaisen, Mogens; Justesen, Annemarie Fejer

    2008-01-01

    -immobilisation strategies as well as the use of antibodies in the widely used sensors, quartz crystal microbalance, surface plasmon resonance and cantilevers. We will describe the available data on antibody-based plant pathogen detection and furthermore use examples from detection of the pathogens Salmonella, Listeria......In this paper the recent progress within biosensors for plant pathogen detection will be reviewed. Bio-recognition layers on sensors can be designed in various ways, however the most popular approach is to immobilise antibodies for specific capture of analytes. Focus will be put on antibody surface...

  11. Human pathogens in plant biofilms: Formation, physiology, and detection

    Science.gov (United States)

    Fresh produce, viewed as an essential part of a healthy life style is usually consumed in the form of raw or minimally processed fruits and vegetables, and is a potentially important source of food-borne human pathogenic bacteria and viruses. These are passed on to the consumer since the bacteria ca...

  12. Detection of Pathogenic Organisms in Food, Water and Body (Postprint)

    Science.gov (United States)

    2002-06-27

    originally cloned from the marine bacterium Vibrio fischeri . The bioluminescent (lux) genes from bacteria have been genetically and biochemically...bacteriophage specific for pathogenic bacteria. The bioreporter design will incorporate a lux gene from Vibrio fischeri into the genome of the

  13. Development of Rapid Isothermal Amplification Assays for Detection of Phytophthora spp. in Plant Tissue.

    Science.gov (United States)

    Miles, Timothy D; Martin, Frank N; Coffey, Michael D

    2015-02-01

    Several isothermal amplification techniques recently have been developed that are tolerant of inhibitors present in many plant extracts, which can reduce the need for obtaining purified DNA for running diagnostic assays. One such commercially available technique that has similarities with real-time polymerase chain reaction (PCR) for designing primers and a labeled probe is recombinase polymerase amplification (RPA). This technology was used to develop two simple and rapid approaches for detection of Phytophthora spp.: one genus-specific assay multiplexed with a plant internal control and the other species-specific assays for Phytophthora ramorum and P. kernoviae. All assays were tested for sensitivity (ranging from 3 ng to 1 fg of DNA) and specificity using DNA extracted from more than 136 Phytophthora taxa, 21 Pythium spp., 1 Phytopythium sp., and a wide range of plant species. The lower limit of linear detection using purified DNA was 200 to 300 fg of DNA in all pathogen RPA assays. Six different extraction buffers were tested for use during plant tissue maceration and the assays were validated in the field by collecting 222 symptomatic plant samples from over 50 different hosts. Only 56 samples were culture positive for Phytophthora spp. whereas 91 were positive using the Phytophthora genus-specific RPA test and a TaqMan real-time PCR assay. A technique for the generation of sequencing templates from positive RPA amplifications to confirm species identification was also developed. These RPA assays have added benefits over traditional technologies because they are rapid (results can be obtained in as little as 15 min), do not require DNA extraction or extensive training to complete, use less expensive portable equipment than PCR-based assays, and are significantly more specific than current immunologically based methods. This should provide a rapid, field-deployable capability for pathogen detection that will facilitate point-of-sample collection processing

  14. Rapid diagnosis of tuberculosis. Detection of drug resistance mechanisms.

    Science.gov (United States)

    Viñuelas-Bayón, Jesús; Vitoria, María Asunción; Samper, Sofía

    2017-10-01

    Tuberculosis is still a serious public health problem, with 10.8 million new cases and 1.8 million deaths worldwide in 2015. The diversity among members of the Mycobacterium tuberculosis complex, the causal agent of tuberculosis, is conducive to the design of different methods for rapid diagnosis. Mutations in the genes involved in resistance mechanisms enable the bacteria to elude the treatment. We have reviewed the methods for the rapid diagnosis of M. tuberculosis complex and the detection of susceptibility to drugs, both of which are necessary to prevent the onset of new resistance and to establish early, appropriate treatment. Copyright © 2017 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  15. Rapid in situ detection of chromosome 21 by PRINS technique

    Energy Technology Data Exchange (ETDEWEB)

    Pellestor, F.; Girardet, A.; Andreo, B. [CNRS UPR 9008, Montpellier (France)] [and others

    1995-05-08

    The {open_quotes}PRimed IN Situ labeling{close_quotes} (PRINS) method is an interesting alternative to in situ hybridization for chromosomal detection. In this procedure, chromosome labeling is performed by in situ annealing of specific oligonucleotide primers, followed by primer elongation by a Taq polymerase in the presence of labeled nucleotides. Using this process, we have developed a simple and semi-automatic method for rapid in situ detection of human chromosome 21. The reaction was performed on a programmable temperature cycler, with a chromosome 21 specific oligonucleotide primer. Different samples of normal and trisomic lymphocytes and amniotic fluid cells were used for testing the method. Specific labeling of chromosome 21 was obtained in both metaphases and interphase nuclei in a 1 hour reaction. The use of oligonucleotide primer for in situ labeling overcomes the need for complex preparations of specific DNA probes. The present results demonstrate that PRINS may be a simple and reliable technique for rapidly detecting aneuploidies. 18 refs., 1 fig.

  16. Rapid shape detection signals in area V4.

    Science.gov (United States)

    Weiner, Katherine F; Ghose, Geoffrey M

    2014-01-01

    Vision in foveate animals is an active process that requires rapid and constant decision-making. For example, when a new object appears in the visual field, we can quickly decide to inspect it by directing our eyes to the object's location. We studied the contribution of primate area V4 to these types of rapid foveation decisions. Animals performed a reaction time task that required them to report when any shape appeared within a peripherally-located noisy stimulus by making a saccade to the stimulus location. We found that about half of the randomly sampled V4 neurons not only rapidly and precisely represented the appearance of this shape, but they were also predictive of the animal's saccades. A neuron's ability to predict the animal's saccades was not related to the specificity with which the cell represented a single type of shape but rather to its ability to signal whether any shape was present. This relationship between sensory sensitivity and behavioral predictiveness was not due to global effects such as alertness, as it was equally likely to be observed for cells with increases and decreases in firing rate. Careful analysis of the timescales of reliability in these neurons implies that they reflect both feedforward and feedback shape detecting processes. In approximately 7% of our recorded sample, individual neurons were able to predict both the delay and precision of the animal's shape detection performance. This suggests that a subset of V4 neurons may have been directly and causally contributing to task performance and that area V4 likely plays a critical role in guiding rapid, form-based foveation decisions.

  17. Development of a rapid and simple Agrobacterium tumefaciens mediated transformation system for the fungal pathogen Heterobasidion annosum

    Science.gov (United States)

    Nicklas Samils; Malin Elfstrand; Daniel L. Lindner Czederpiltz; Jan Fahleson; Ake Olson; Christina Dixelius; Jan Stenlid

    2006-01-01

    Heterobasidion annosum causes root and butt-rot in trees and is the most serious forest pathogen in the northern hemisphere. We developed a rapid and simple Agrobacterium-mediated method of gene delivery into H. annosum to be used in functional studies of candidate genes and for visualization of mycelial interactions. Heterobasidion annosum TC 32-1 was cocultivated at...

  18. Fluorescence techniques to detect and to assess viability of plant pathogenic bacteria

    NARCIS (Netherlands)

    Chitarra, L.G.

    2001-01-01

    Plant pathogenic bacteria cause major economic losses in commercial crop production worldwide every year. The current methods used to detect and to assess the viability of bacterial pathogens and to test seed lots or plants for contamination are usually based on plate assays or on

  19. Rapid Antemortem Detection of CWD Prions in Deer Saliva

    Science.gov (United States)

    Haley, Nicholas J.; Denkers, Nathaniel D.; Nalls, Amy V.; Mathiason, Candace K.; Caughey, Byron; Hoover, Edward A.

    2013-01-01

    Chronic wasting disease (CWD) is an efficiently transmitted prion disease of cervids, now identified in 22 United States, 2 Canadian provinces and Korea. One hallmark of CWD is the shedding of infectious prions in saliva, as demonstrated by bioassay in deer. It is also clear that the concentration of prions in saliva, blood, urine and feces is much lower than in the nervous system or lymphoid tissues. Rapid in vitro detection of CWD (and other) prions in body fluids and excreta has been problematic due to the sensitivity limits of direct assays (western blotting, ELISA) and the presence of inhibitors in these complex biological materials that hamper detection. Here we use real-time quaking induced conversion (RT-QuIC) to demonstrate CWD prions in both diluted and prion-enriched saliva samples from asymptomatic and symptomatic white-tailed deer. CWD prions were detected in 14 of 24 (58.3%) diluted saliva samples from CWD-exposed white-tailed deer, including 9 of 14 asymptomatic animals (64.2%). In addition, a phosphotungstic acid enrichment enhanced the RT-QuIC assay sensitivity, enabling detection in 19 of 24 (79.1%) of the above saliva samples. Bioassay in Tg[CerPrP] mice confirmed the presence of infectious prions in 2 of 2 RT-QuIC-positive saliva samples so examined. The modified RT-QuIC analysis described represents a non-invasive, rapid ante-mortem detection of prions in complex biologic fluids, excreta, or environmental samples as well as a tool for exploring prion trafficking, peripheralization, and dissemination. PMID:24040235

  20. Rapid antemortem detection of CWD prions in deer saliva.

    Directory of Open Access Journals (Sweden)

    Davin M Henderson

    Full Text Available Chronic wasting disease (CWD is an efficiently transmitted prion disease of cervids, now identified in 22 United States, 2 Canadian provinces and Korea. One hallmark of CWD is the shedding of infectious prions in saliva, as demonstrated by bioassay in deer. It is also clear that the concentration of prions in saliva, blood, urine and feces is much lower than in the nervous system or lymphoid tissues. Rapid in vitro detection of CWD (and other prions in body fluids and excreta has been problematic due to the sensitivity limits of direct assays (western blotting, ELISA and the presence of inhibitors in these complex biological materials that hamper detection. Here we use real-time quaking induced conversion (RT-QuIC to demonstrate CWD prions in both diluted and prion-enriched saliva samples from asymptomatic and symptomatic white-tailed deer. CWD prions were detected in 14 of 24 (58.3% diluted saliva samples from CWD-exposed white-tailed deer, including 9 of 14 asymptomatic animals (64.2%. In addition, a phosphotungstic acid enrichment enhanced the RT-QuIC assay sensitivity, enabling detection in 19 of 24 (79.1% of the above saliva samples. Bioassay in Tg[CerPrP] mice confirmed the presence of infectious prions in 2 of 2 RT-QuIC-positive saliva samples so examined. The modified RT-QuIC analysis described represents a non-invasive, rapid ante-mortem detection of prions in complex biologic fluids, excreta, or environmental samples as well as a tool for exploring prion trafficking, peripheralization, and dissemination.

  1. Label-Free 3D Ag Nanoflower-Based Electrochemical Immunosensor for the Detection of Escherichia coli O157:H7 Pathogens

    Science.gov (United States)

    Huang, He; Liu, Minghuan; Wang, Xiangsheng; Zhang, Wenjie; Yang, Da-Peng; Cui, Lianhua; Wang, Xiansong

    2016-11-01

    It is highly desirable to develop a rapid and simple method to detect pathogens. Combining nanomaterials with electrochemical techniques is an efficient way for pathogen detection. Herein, a novel 3D Ag nanoflower was prepared via a biomineralization method by using bovine serum albumin (BSA) as a template. It was adopted as a sensing interface to construct an electrochemical bacteria immunosensor for the rapid detection of foodborne pathogens Escherichia coli ( E. coli) O157:H7. Bacterial antibody was immobilized onto the surface of Ag nanoflowers through covalent conjugation. Electrochemical impedance spectroscopy (EIS) was used to detect and validate the resistance changes, where [Fe(CN)6]3-/4- acted as the redox probe. A linear relation between R et and E. coli concentration was obtained in the E. coli concentration range of 3.0 × 102-3.0 × 108 cfu mL-1. The as-prepared biosensor gave rise to an obvious response to E. coli but had no distinct response to Cronobacter sakazakii, methicillin-resistant Staphylococcus aureus (MRSA), Staphylococcus albus, Lactobacillus easei, and Shigella flexneri, revealing a high selectivity for the detection of the pathogens down to 100 cfu mL-1 in a short time. We believe that this BSA-conjugated 3D Ag nanoflowers could be used as a powerful interface material with good conductivity and biocompatibility for improving pathogen detection and treatment in the field of medicine, environment, and food safety.

  2. Rapid detection of Clostridium difficile via magnetic bead aggregation in cost-effective polyester microdevices with cell phone image analysis.

    Science.gov (United States)

    DuVall, Jacquelyn A; Cabaniss, Scott T; Angotti, Morgan L; Moore, John H; Abhyankar, Mayuresh; Shukla, Nishant; Mills, Daniel L; Kessel, Bryan G; Garner, Gavin T; Swami, Nathan S; Landers, James P

    2016-10-07

    Pathogen detection has traditionally been accomplished by utilizing methods such as cell culture, immunoassays, and nucleic acid amplification tests; however, these methods are not easily implemented in resource-limited settings because special equipment for detection and thermal cycling is often required. In this study, we present a magnetic bead aggregation assay coupled to an inexpensive microfluidic fabrication technique that allows for cell phone detection and analysis of a notable pathogen in less than one hour. Detection is achieved through the use of a custom-built system that allows for fluid flow control via centrifugal force, as well as manipulation of magnetic beads with an adjustable rotating magnetic field. Cell phone image capture and analysis is housed in a 3D-printed case with LED backlighting and a lid-mounted Android phone. A custom-written application (app.) is employed to interrogate images for the extent of aggregation present following loop-mediated isothermal amplification (LAMP) coupled to product-inhibited bead aggregation (PiBA) for detection of target sequences. Clostridium difficile is a pathogen of increasing interest due to its causative role in intestinal infections following antibiotic treatment, and was therefore chosen as the pathogen of interest in the present study to demonstrate the rapid, cost-effective, and sequence-specific detection capabilities of the microfluidic platform described herein.

  3. A duplex PCR for rapid and simultaneous detection of Brucella spp. in human blood samples.

    Science.gov (United States)

    Mirnejad, Reza; Mohamadi, Mozafar; Piranfar, Vahbeh; Mortazavi, Seied Mojtaba; Kachuei, Reza

    2013-06-01

    To design a duplex PCR for rapid and simultaneous detection of Brucella species. in human blood samples. Fifty-two peripheral bloods samples were collected from suspicious patients with brucellosis. Following DNA extraction, PCR assay were performed, using three primers that could simultaneously identify and differentiate three major species of pathogenic Brucella in humans and animals. Of the 52 peripheral bloods samples tested, 25 sample (48%) showed positive reactions in PCR. Twelve samples were positive for Brucella abortus 39 (B. abortus 39) (23%), 13 for Brucella melitensis 39 (B. melitensis 39) (25%) and 0 for Brucella ovis 39 (B. ovis 39) (0%). This work demonstrates that in case where specific primers were utilized, duplex PCR has proved to be a simple, fast, and relatively inexpensive method for simultaneous detection of important species of Brucella in clinical samples. Copyright © 2013 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  4. Rapid detection of anti-Vaccinia virus neutralizing antibodies

    Directory of Open Access Journals (Sweden)

    Lichtfuss Gregor F

    2011-03-01

    Full Text Available Abstract Increasing infections with Monkeypox and Cowpox viruses pose a continuous and growing threat to human health. The standard method for detecting poxvirus neutralizing antibodies is the plaque-reduction neutralization test that is specific but also time-consuming and laborious. Therefore, a rapid and reliable method was developed to determine neutralizing antibody titers within twelve hours. The new assay measures viral mRNA transcription as a marker for actively replicating virus after incomplete neutralization using real-time PCR.

  5. Rapid and Reliable Diagnostic Algorithm for Detection of Clostridium difficile▿

    Science.gov (United States)

    Fenner, Lukas; Widmer, Andreas F.; Goy, Gisela; Rudin, Sonja; Frei, Reno

    2008-01-01

    We evaluated a two-step algorithm for detection of Clostridium difficile in 1,468 stool specimens. First, specimens were screened by an immunoassay for C. difficile glutamate dehydrogenase antigen (C.DIFF CHEK-60). Second, screen-positive specimens underwent toxin testing by a rapid toxin A/B assay (TOX A/B QUIK CHEK); toxin-negative specimens were subjected to stool culture. This algorithm allowed final results for 92% of specimens with a turnaround time of 4 h. PMID:18032627

  6. Comparison of supervised machine learning algorithms for waterborne pathogen detection using mobile phone fluorescence microscopy

    KAUST Repository

    Ceylan Koydemir, Hatice

    2017-06-14

    a limit of detection of 12 cysts per 10 ml, an average cyst capture efficiency of ~79%, and an accuracy of ~95%. Providing rapid detection and quantification of waterborne pathogens without the need for a microbiology expert, this field-portable imaging and sensing platform running on a smartphone could be very useful for water quality monitoring in resource-limited settings.

  7. Comparison of supervised machine learning algorithms for waterborne pathogen detection using mobile phone fluorescence microscopy

    Science.gov (United States)

    Ceylan Koydemir, Hatice; Feng, Steve; Liang, Kyle; Nadkarni, Rohan; Benien, Parul; Ozcan, Aydogan

    2017-06-01

    limit of detection of 12 cysts per 10 ml, an average cyst capture efficiency of 79%, and an accuracy of 95%. Providing rapid detection and quantification of waterborne pathogens without the need for a microbiology expert, this field-portable imaging and sensing platform running on a smartphone could be very useful for water quality monitoring in resource-limited settings.

  8. Comparison of supervised machine learning algorithms for waterborne pathogen detection using mobile phone fluorescence microscopy

    Directory of Open Access Journals (Sweden)

    Ceylan Koydemir Hatice

    2017-06-01

    water and achieved a limit of detection of 12 cysts per 10 ml, an average cyst capture efficiency of ~79%, and an accuracy of ~95%. Providing rapid detection and quantification of waterborne pathogens without the need for a microbiology expert, this field-portable imaging and sensing platform running on a smartphone could be very useful for water quality monitoring in resource-limited settings.

  9. Multiplex PCR Tests for Detection of Pathogens Associated with Gastroenteritis

    OpenAIRE

    Zhang, Hongwei; Morrison, Scott; Tang, Yi-Wei

    2015-01-01

    A wide range of enteric pathogens can cause infectious gastroenteritis. Conventional diagnostic algorithms including culture, biochemical identification, immunoassay and microscopic examination are time consuming and often lack sensitivity and specificity. Advances in molecular technology have as allowed its use as clinical diagnostic tools. Multiplex PCR based testing has made its way to gastroenterology diagnostic arena in recent years. In this article we present a review of recent laborato...

  10. Detection of H5 and H7 highly pathogenic avian influenza virus with lateral flow devices: performance with healthy, sick and dead chickens

    Science.gov (United States)

    Rapid detection of highly pathogenic avian influenza virus (HPAIV) in the field is critical for effective disease control and to differentiate it from other diseases, such as Newcastle disease. Lateral flow devices (LFD) are commercially available and provide a fast, highly specific, on-site test fo...

  11. DETECTION AND IDENTIFICATION OF PATHOGENIC CANDIDA SPECIES IN WATER USING FLOW CYTOMETRY COUPLED WITH TAQMAN PCR

    Science.gov (United States)

    As the incidence of human fungal infection increases, the ability to detect and identify pathogenic fungi in potential environmental reservoirs becomes increasingly important for disease control. PCR based assays are widely used for diagnostic purposes, but may be inadequate for...

  12. Rapid detection of equine coronavirus by reverse transcription loop-mediated isothermal amplification.

    Science.gov (United States)

    Nemoto, Manabu; Morita, Yoshinori; Niwa, Hidekazu; Bannai, Hiroshi; Tsujimura, Koji; Yamanaka, Takashi; Kondo, Takashi

    2015-04-01

    A reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed for the rapid detection of equine coronavirus (ECoV). This assay was conducted at 60 °C for 40 min. Specificity of the RT-LAMP assay was confirmed using several equine intestinal and respiratory pathogens in addition to ECoV. The novel assay failed to cross-react with the other pathogens tested, suggesting it is highly specific for ECoV. Using artificially synthesized ECoV RNA, the 50% detection limit of the RT-LAMP assay was 10(1.8)copies/reaction. This is a 50-fold greater sensitivity than conventional reverse transcription polymerase chain reaction (RT-PCR) assays, but a 4-fold lower sensitivity than quantitative RT-PCR (qRT-PCR) assays. Eighty-two fecal samples collected during ECoV outbreaks were analyzed. ECoV was detected in 59 samples using the RT-LAMP assay, and in 30 and 65 samples using RT-PCR or qRT-PCR assays, respectively. Although the RT-LAMP assay is less sensitive than qRT-PCR techniques, it can be performed without the need for expensive equipment. Thus, the RT-LAMP assay might be suitable for large-scale surveillance and diagnosis of ECoV infection in laboratories with limited resources. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Rapid detection of autosomal aneuploidy using microsatellite markers

    Energy Technology Data Exchange (ETDEWEB)

    Ray, P.N.; Teshima, I.E. [Hospital for Sick Children, Ontario (Canada); Winsor, E.J.T. [Toronto Hospital, Ontario (Canada)] [and others

    1994-09-01

    Trisomy occurs in at least 4% of all clinically recognized pregnancies, making it the most common type of chromosome abnormality in humans. The most commonly occurring trisomies are those of chromosomes 13, 18, 21 and aneuploidy of X and Y, accounting for about 0.3% of all newborns and a much higher percentage of conceptuses. In Canada, prenatal chromosome analysis by amniocentesis is offered to those women {ge} 35 years of age at the time of delivery or equivalent risk by maternal serum screen. We are developing a rapid molecular diagnostic test to detect the most common autosomal aneuploidies in prenatal and neonatal samples. The tests makes use of highly polymorphic short tandem repeat markers labeled with fluorescent tags which allow analysis on a GENESCANNER automated fragment analyzer (ABI). Multiple polymorphic markers have been selected on each of chromosomes 13, 18 and 21. At a given locus, trisomic fetuses/neonates will have either three alleles or two alleles with one allele having twice the intensity of the other. Unaffected individuals have two equal intensity alleles. We are conducting a blind study that will compare the detection efficiencies of FISH analysis on uncultured cells and the molecular method on confirmation amniotic fluid samples collected at the time of termination of affected fetuses. Results on cultured amniocytes from one such patient confirmed that trisomy 21 can be detected. FISH was not done on this sample. In addition, detection efficiency of the molecular method in whole blood samples from affected neonates is also being studied. To date, two such samples have been tested, one with trisomy 13 and one with trisomy 18, and both samples were diagnosed correctly. Preliminary results suggest that this method may provide a valuable tool for the rapid diagnosis of aneuploidy.

  14. Quartz crystal microbalance biosensor for rapid detection of aerosolized microorganisms

    Science.gov (United States)

    Farka, Zdenĕk.; Kovár, David; Skládal, Petr

    2015-05-01

    Biological warfare agents (BWAs) represent the current menace of the asymmetric war. The early detection of BWAs, especially in the form of bioaerosol, is a challenging task for governments all around the world. Label-free quartz crystal microbalance (QCM) immunosensor and electrochemical immunosensor were developed and tested for rapid detection of BWA surrogate (E. coli) in the form of bioaerosol. Two immobilization strategies for the attachment of antibody were tested; the gold sensor surface was activated by cysteamine and then antibody was covalently linked either using glutaraldehyde, or the reduced antibodies were attached via Sulfo-SMCC. A portable bioaerosol chamber was constructed and used for safe manipulation with aerosolized microorganisms. The dissemination was done using a piezoelectric humidifier, distribution of bioaerosol inside the chamber was ensured using three 12-cm fans. The whole system was controlled remotely using LAN network. The disseminated microbial cells were collected and preconcentrated using the wetted-wall cyclone SASS 2300, the analysis was done using the on-line linked immunosensors. The QCM immunosensor had limit of detection 1×104 CFU·L-1 of air with analysis time 16 min, the whole experiment including dissemination and sensor surface regeneration took 40 min. In case of blank (disseminated sterile buffer), no signal change was observed. The electrochemical immunosensor was able to detect 150 CFU·L-1 of air in 20 min; also in this case, no interferences were observed. Reference measurements were done using particle counter Met One 3400 and by cultivation method on agar plates. The sensors have proved to be applicable for rapid screening of microorganisms in air.

  15. Vaginal microbicides: detecting toxicities in vivo that paradoxically increase pathogen transmission

    Directory of Open Access Journals (Sweden)

    Abusuwwa Raed

    2006-06-01

    Full Text Available Abstract Background Microbicides must protect against STD pathogens without causing unacceptable toxic effects. Microbicides based on nonoxynol-9 (N9 and other detergents disrupt sperm, HSV and HIV membranes, and these agents are effective contraceptives. But paradoxically N9 fails to protect women against HIV and other STD pathogens, most likely because it causes toxic effects that increase susceptibility. The mouse HSV-2 vaginal transmission model reported here: (a Directly tests for toxic effects that increase susceptibility to HSV-2, (b Determines in vivo whether a microbicide can protect against HSV-2 transmission without causing toxicities that increase susceptibility, and (c Identifies those toxic effects that best correlate with the increased HSV susceptibility. Methods Susceptibility was evaluated in progestin-treated mice by delivering a low-dose viral inoculum (0.1 ID50 at various times after delivering the candidate microbicide to detect whether the candidate increased the fraction of mice infected. Ten agents were tested – five detergents: nonionic (N9, cationic (benzalkonium chloride, BZK, anionic (sodium dodecylsulfate, SDS, the pair of detergents in C31G (C14AO and C16B; one surface active agent (chlorhexidine; two non-detergents (BufferGel®, and sulfonated polystyrene, SPS; and HEC placebo gel (hydroxyethylcellulose. Toxic effects were evaluated by histology, uptake of a 'dead cell' dye, colposcopy, enumeration of vaginal macrophages, and measurement of inflammatory cytokines. Results A single dose of N9 protected against HSV-2 for a few minutes but then rapidly increased susceptibility, which reached maximum at 12 hours. When applied at the minimal concentration needed for brief partial protection, all five detergents caused a subsequent increase in susceptibility at 12 hours of ~20–30-fold. Surprisingly, colposcopy failed to detect visible signs of the N9 toxic effect that increased susceptibility at 12 hours. Toxic

  16. [Rapid test for detection of susceptibility to cefotaxime in Enterobacteriaceae].

    Science.gov (United States)

    Jiménez-Guerra, Gemma; Hoyos-Mallecot, Yannik; Rodríguez-Granger, Javier; Navarro-Marí, José María; Gutiérrez-Fernández, José

    In this work an "in house" rapid test based on the change in pH that is due to hydrolysis for detecting Enterobacteriaceae susceptible to cefotaxime is evaluated. The strains of Enterobacteriaceae from 1947 urine cultures were assessed using MicroScan panels and the "in house" test. This rapid test includes red phenol solution and cefotaxime. Using MicroScan panels, 499 Enterobacteriaceae isolates were evaluated, which included 27 isolates of Escherichia coli producing extended-spectrum beta-lactamases (ESBL), 16 isolates of Klebsiella pneumoniae ESBL and 1 isolate of Klebsiella oxytoca ESBL. The "in house" test offers the following values: sensitivity 98% and specificity 97%, with negative predictive value 100% and positive predictive value 78%. The "in house" test based on the change of pH is useful in our area for detecting presumptively cefotaxime-resistant Enterobacteriaceae strains. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  17. Rapid and robust traffic accident detection based on orientation map

    Science.gov (United States)

    Zhou, Jinglei; Ye, Mao; Ding, Jian; Mao, Songan; Zhang, Huixiong John

    2012-11-01

    Video-based rapid traffic accident detection is very important for intelligent transport systems. Traditional methods are either not fast enough or not stable with working environments. A rapid and environment-adaptive method is proposed. The inspiration of the method is originated from the key observation that the traffic accident brings abundant information on motion directions. This method includes three steps. First, the orientation map for each video frame is constructed based on the optical flows. Then, for each orientation map, the connected regions are formed. An entropy-like energy function is used to measure the orientation information of the connected region. The higher the energy value, the more moving directions exist. The highest measure of these connected regions in each orientation map is considered as its energy measure. Finally, based on the energy sequence of orientation maps, a Gaussian model is established to learn the normal energy fluctuation range for some environment. In the detection process, if the energy of one orientation map burst out of the normal range, it means there exists a traffic accident. The advantages of our method include the fast processing speed, a compact parameter set, and the robustness to the different environments and illuminations. Experimental results confirm the above advantages of the proposed approach.

  18. Rapid focused sequencing: a multiplexed assay for simultaneous detection and strain typing of Bacillus anthracis, Francisella tularensis, and Yersinia pestis.

    Directory of Open Access Journals (Sweden)

    Rosemary S Turingan

    Full Text Available BACKGROUND: The intentional release of Bacillus anthracis in the United States in 2001 has heightened concern about the use of pathogenic microorganisms in bioterrorism attacks. Many of the deadliest bacteria, including the Class A Select Agents Bacillus anthracis, Francisella tularensis, and Yersinia pestis, are highly infectious via the pulmonary route when released in aerosolized form. Hence, rapid, sensitive, and reliable methods for detection of these biothreats and characterization of their potential impact on the exposed population are of critical importance to initiate and support rapid military, public health, and clinical responses. METHODOLOGY/PRINCIPAL FINDINGS: We have developed microfluidic multiplexed PCR and sequencing assays based on the simultaneous interrogation of three pathogens per assay and ten loci per pathogen. Microfluidic separation of amplified fluorescently labeled fragments generated characteristic electrophoretic signatures for identification of each agent. The three sets of primers allowed significant strain typing and discrimination from non-pathogenic closely-related species and environmental background strains based on amplicon sizes alone. Furthermore, sequencing of the 10 amplicons per pathogen, termed "Rapid Focused Sequencing," allowed an even greater degree of strain discrimination and, in some cases, can be used to determine virulence. Both amplification and sequencing assays were performed in microfluidic biochips developed for fast thermal cycling and requiring 7 µL per reaction. The 30-plex sequencing assay resulted in genotypic resolution of 84 representative strains belonging to each of the three biothreat species. CONCLUSIONS/SIGNIFICANCE: The microfluidic multiplexed assays allowed identification and strain differentiation of the biothreat agents Bacillus anthracis, Francisella tularensis, and Yersinia pestis and clear discrimination from closely-related species and several environmental

  19. Rapid Detection Strategies for the Global Threat of Zika Virus: Current State, New Hypotheses and Limitations

    Directory of Open Access Journals (Sweden)

    Shruti Shukla

    2016-10-01

    Full Text Available The current scenario regarding the widespread Zika virus (ZIKV has resulted in numerous diagnostic studies, specifically in South America and in locations where there is frequent entry of travelers returning from ZIKV-affected areas, including pregnant women with or without clinical symptoms of ZIKV infection. The World Health Organization, WHO, announced that millions of cases of ZIKV are likely to occur in the United States of America in the near future. This situation has created an alarming public health emergency of international concern requiring the detection of this life-threatening viral candidate due to increased cases of newborn microcephaly associated with ZIKV infection. Hence, this review reports possible methods and strategies for the fast and reliable detection of ZIKV with particular emphasis on current updates, knowledge and new hypotheses that might be helpful for medical professionals in poor and developing countries that urgently need to address this problem. In particular, we emphasize liposome-based biosensors. Although these biosensors are currently among the less popular tools for human disease detection, they have become useful tools for the screening and detection of pathogenic bacteria, fungi and viruses because of their versatile advantageous features compared to other sensing devices. This review summarizes the currently available methods employed for the rapid detection of ZIKV and suggests an innovative approach involving the application of a liposome-based hypothesis for the development of new strategies for ZIKV detection and their use as effective biomedicinal tools.

  20. Enhanced Microbial Detection Capabilities by a Rapid Portable Instrument

    Science.gov (United States)

    Morris, Heather; Monaco, Lisa; Wainwright, Norm; Steele, Andrew; Damon, Michael; Schenk, Alison; Stimpson, Eric; Maule, Jake; Effinger, Michael

    2010-01-01

    We present data describing a progression of continuing technology development - from expanding the detection capabilities of the current PTS unit to re-outfitting the instrument with a protein microarray increasing the number of detectable compounds. To illustrate the adaptability of the cartridge format, on-orbit operations data from the ISS demonstrate the detection of the fungal cell wall compound beta-glucan using applicable LOCAD-PTS cartridges. LOCAD-PTS is a handheld device consisting of a spectrophotometer, an onboard pumping mechanism, and data storage capabilities. A suite of interchangeable cartridges lined with four distinct capillaries allow a hydrated sample to mix with necessary reagents in the channels before being pumped to the optical well for spectrophotometric analysis. The reagents housed in one type of cartridge trigger a reaction based on the Limulus Amebocyte Lysate (LAL) assay, which results in the release of paranitroaniline dye. The dye is measured using a 395 nm filter. The LAL assay detects the Gram-negative bacterial cell wall molecule, endotoxin or lipopolysaccharide (LPS). The more dye released, the greater the concentration of endotoxin in the sample. Sampling, quantitative analysis, and data retrieval require less than 20 minutes. This is significantly faster than standard culture-based methods, which require at least a 24 hour incubation period.Using modified cartridges, we demonstrate the detection of Gram negative bacteria with protein microarray technology. Additionally, we provide data from multiple field tests where both standard and advanced PTS technologies were used. These tests investigate the transfer of target microbial molecules from one surface to another. Collectively, these data demonstrate that the new cartridges expand the number of compounds detected by LOCAD-PTS, while maintaining the rapid, in situ analysis characteristic of the instrument. The unit provides relevant data for verifying sterile sample collection

  1. An improved specimens handling procedure for pathogen detection of the cerebrospinal fluid by microscope

    Directory of Open Access Journals (Sweden)

    WANG Hua-cheng

    2013-02-01

    Full Text Available Background The diagnosis of encephalitis depends on the finding of pathogens in the brain parenchyma or cerebrospinal fluid (CSF. But the success rates of finding pathogens by microscope are low by the traditional specimens handling procedure in which pathogens are detected by direct centrifugation of CSF getting from lumbar puncture. The process of pathogen collection from the CSF such as centrifugation and washing would cause the destruction and loss of pathogens, resulting in a lower rate of pathogen discovery. Therefore, in order to increase the detection rate of pathogenic microorganisms in CSF, these traditional steps need to be improved. Methods CSF samples of 23 patients with suspected viral encephalitis and 10 control patients with fracture were prepared by two methods: traditional specimens handling procedure (TSHP and improved specimens handling procedure (ISHP. In the ISHP, a final concentration of 2.5% glutaraldehyde was added to CSF in a glass tube, mixed and kept not moving in 4 ℃ for 2 to 4 h or in 37 ℃for 1 h. Then a smear was made from the sediment formed in the tube to check pathogens by microscope. As for the TSHP, pathogens were collected by direct centrifugation of CSF which had not been treated after lumbar puncture, and checked through Gimenze staining. Results There was no statistically significant difference between the two dealing procedures in the control group ( P = 1.000. As for the case group, there were 10 cases showing positive in Pandy test after TSHP, and visible sediments were seen in all the 23 cases after ISHP. There was statistically significant difference between two kinds of CSF treatment for the finding of pathogens (P = 0.000. Seven cases presented pathogen growth in CSF and were diagosed as rickettsial infections by Gimenze staining, immunofluorescence assay (IFA and polymerase chain reaction (PCR. Conclusion Improved specimens handling procedures of CSF contribute to the seperation of cells

  2. Functionalized Nanopipettes: A Sensitive Tool for Pathogen Detection

    Science.gov (United States)

    Actis, P.; Jejelowo, O.; Pourmand, N.

    2010-04-01

    Nanopipette technology is capable of detecting and functional analyzing biomolecules. Preliminary experiments are demonstrating the sensitivity and selectivity of the technique with specific proteins targeting environmental toxins.

  3. Rapid emergence of pathogens in agro-ecosystems: global threats to agricultural sustainability and food security.

    Science.gov (United States)

    McDonald, Bruce A; Stukenbrock, Eva H

    2016-12-05

    Agricultural ecosystems are composed of genetically depauperate populations of crop plants grown at a high density and over large spatial scales, with the regional composition of crop species changing little from year to year. These environments are highly conducive for the emergence and dissemination of pathogens. The uniform host populations facilitate the specialization of pathogens to particular crop cultivars and allow the build-up of large population sizes. Population genetic and genomic studies have shed light on the evolutionary mechanisms underlying speciation processes, adaptive evolution and long-distance dispersal of highly damaging pathogens in agro-ecosystems. These studies document the speed with which pathogens evolve to overcome crop resistance genes and pesticides. They also show that crop pathogens can be disseminated very quickly across and among continents through human activities. In this review, we discuss how the peculiar architecture of agro-ecosystems facilitates pathogen emergence, evolution and dispersal. We present four example pathosystems that illustrate both pathogen specialization and pathogen speciation, including different time frames for emergence and different mechanisms underlying the emergence process. Lastly, we argue for a re-design of agro-ecosystems that embraces the concept of dynamic diversity to improve their resilience to pathogens. This article is part of the themed issue 'Tackling emerging fungal threats to animal health, food security and ecosystem resilience'. © 2016 The Author(s).

  4. High-throughput biosensors for multiplexed foodborne pathogen detection

    Science.gov (United States)

    Incidental contamination of foods by harmful bacteria (such as E. coli and Salmonella) and the toxins that they produce is a serious threat to public health and the economy in the United States. The presence of such bacteri and toxins in foods must be rapidly determined at various stages of food pr...

  5. A rapid DNA extraction method suitable for human papillomavirus detection.

    Science.gov (United States)

    Brestovac, Brian; Wong, Michelle E; Costantino, Paul S; Groth, David

    2014-04-01

    Infection with oncogenic human papillomavirus (HPV) genotypes is necessary for the development of cervical cancer. Testing for HPV DNA from liquid based cervical samples can be used as an adjunct to traditional cytological screening. In addition there are ongoing viral load, genotyping, and prevalence studies. Therefore, a sensitive DNA extraction method is needed to maximize the efficiency of HPV DNA detection. The XytXtract Tissue kit is a DNA extraction kit that is rapid and so could be useful for HPV testing, particularly in screening protocols. This study was undertaken to determine the suitability of this method for HPV detection. DNA extraction from HeLa and Caski cell lines containing HPV 18 and 16 respectively together with DNA from five liquid based cervical samples were used in a HPV PCR assay. DNA was also extracted using the QIAamp DNA mini kit (Qiagen, Hilden, Germany) as a comparison. DNA extracts were serially diluted and assayed. HPV DNA was successfully detected in cell lines and cervical samples using the XytXtract Tissue kit. In addition, the XytXtract method was found to be more sensitive than the QIAmp method as determined by a dilution series of the extracted DNA. While the XytXtract method is a closed, the QIAamp method uses a spin column with possible loss of DNA through DNA binding competition of the matrix, which could impact on the final extraction efficiency. The XytXtract is a cheap, rapid and efficient method for extracting HPV DNA from both cell lines and liquid based cervical samples. © 2014 Wiley Periodicals, Inc.

  6. [Filmarray GI TM panel for detection of enteric pathogens in stool samples: preliminary experience].

    Science.gov (United States)

    Farfán, Mauricio; Piemonte, Paula; Labra, Yohanna; Henríquez, Juan; Candía, Enzo; Torres, J Pablo

    2016-02-01

    Gastrointestinal infections remain a major public health problem worldwide and its etiologic diagnosis is one of the main challenges. In molecular diagnostic techniques recently developed, the Filmarray GI® panel allows detection of 23 pathogens (14 bacteria, virus 5 and 4 parasites) within an hour. To describe the experience of Filmarray GI® panel in the Molecular Biology Laboratory of Clinica Las Condes. A cross-sectional observational study that includes the results of 305 stool samples tested by Filmarray GI® panel was performed. Of the 305 tests requested 99 (32.5%) were negative and 206 were positive (67.5%). Of the positive samples, in 107 samples (51.9%) one pathogen was detected and in 99 samples (48.1%) more than one pathogen was found. Describe the experience of using FilmArray GI® panel in stool specimens, which highlights the large number of positive samples for a microorganism and co-detection of enteric pathogens.

  7. Detection of foodborne pathogens by qPCR: A practical approach for food industry applications

    Directory of Open Access Journals (Sweden)

    María-José Chapela

    2015-12-01

    Full Text Available Microbiological analysis of food is an integrated part of microbial safety management in the food chain. Monitoring and controlling foodborne pathogens are traditionally carried out by conventional microbiological methods based on culture-dependent approaches in control laboratories and private companies. However, polymerase chain reaction (PCR has revolutionized microbiological analysis allowing detection of pathogenic microorganisms in food, without the necessity of classical isolation and identification. However, at present, PCR and quantitative polymerase chain reaction (qPCR are essential analytical tools for researchers working in the field of foodborne pathogens. This manuscript reviews recently described qPCR methods applied for foodborne bacteria detection, serving as economical, safe, and reliable alternatives for application in the food industry and control laboratories. Multiplex qPCR, which allows the simultaneous detection of more than one pathogen in one single reaction, saving considerable effort, time, and money, is emphasized in the article.

  8. A Portable Impedance Immunosensing System for Rapid Detection of Salmonella Typhimurium.

    Science.gov (United States)

    Wen, Tao; Wang, Ronghui; Sotero, America; Li, Yanbin

    2017-08-28

    SalmonellaTyphimurium is one of the most dangerous foodborne pathogens and poses a significant threat to human health. The objective of this study was to develop a portable impedance immunosensing system for rapid and sensitive detection of S. Typhimurium in poultry. The developed portable impedance immunosensing system consisted of a gold interdigitated array microelectrode (IDAM), a signal acquisitive interface and a laptop computer with LabVIEW software. The IDAM was first functionalized with 16-Mercaptohexadecanoic acid, and streptavidin was immobilized onto the electrode surface through covalent bonding. Then, biotin-labelled S. Typhimurium-antibody was immobilized onto the IDAM surface. Samples were dropped on the surface of the IDAM and the S. Typhimurium cells in the samples were captured by the antibody on the IDAM. This resulted in impedance changes that were measured and displayed with the LabVIEW software. An equivalent circuit of the immunosensor demonstrated that the largest change in impedance was due to the electron-transfer resistance. The equivalent circuit showed an increase of 35% for the electron-transfer resistance value compared to the negative control. The calibration result indicated that the portable impedance immunosensing system could be used to measure the standard impedance elements, and it had a maximum error of measurement of approximately 13%. For pure culture detection, the system had a linear relationship between the impedance change and the logarithmic value of S. Typhimurium cells ranging from 76 to 7.6 × 10⁶ CFU (colony-forming unit) (50 μL)(-1). The immunosensor also had a correlation coefficient of 0.98, and a high specificity for detection of S. Typhimurium cells with a limit of detection (LOD) of 10² CFU (50 μL)(-1). The detection time from the moment a sample was introduced to the display of the results was 1 h. To conclude, the portable impedance immunosensing system for detection of S. Typhimurium achieved an LOD

  9. A Portable Impedance Immunosensing System for Rapid Detection of Salmonella Typhimurium

    Directory of Open Access Journals (Sweden)

    Tao Wen

    2017-08-01

    Full Text Available Salmonella Typhimurium is one of the most dangerous foodborne pathogens and poses a significant threat to human health. The objective of this study was to develop a portable impedance immunosensing system for rapid and sensitive detection of S. Typhimurium in poultry. The developed portable impedance immunosensing system consisted of a gold interdigitated array microelectrode (IDAM, a signal acquisitive interface and a laptop computer with LabVIEW software. The IDAM was first functionalized with 16-Mercaptohexadecanoic acid, and streptavidin was immobilized onto the electrode surface through covalent bonding. Then, biotin-labelled S. Typhimurium-antibody was immobilized onto the IDAM surface. Samples were dropped on the surface of the IDAM and the S. Typhimurium cells in the samples were captured by the antibody on the IDAM. This resulted in impedance changes that were measured and displayed with the LabVIEW software. An equivalent circuit of the immunosensor demonstrated that the largest change in impedance was due to the electron-transfer resistance. The equivalent circuit showed an increase of 35% for the electron-transfer resistance value compared to the negative control. The calibration result indicated that the portable impedance immunosensing system could be used to measure the standard impedance elements, and it had a maximum error of measurement of approximately 13%. For pure culture detection, the system had a linear relationship between the impedance change and the logarithmic value of S. Typhimurium cells ranging from 76 to 7.6 × 106 CFU (colony-forming unit (50 μL−1. The immunosensor also had a correlation coefficient of 0.98, and a high specificity for detection of S. Typhimurium cells with a limit of detection (LOD of 102 CFU (50 μL−1. The detection time from the moment a sample was introduced to the display of the results was 1 h. To conclude, the portable impedance immunosensing system for detection of S. Typhimurium

  10. A real-time loop-mediated isothermal amplification assay for rapid detection of Shigella species.

    Science.gov (United States)

    Liew, P S; Teh, C S J; Lau, Y L; Thong, K L

    2014-12-01

    Shigellosis is a foodborne illness caused by the genus Shigella and is an important global health issue. The development of effective techniques for rapid detection of this pathogen is essential for breaking the chain of transmission. Therefore, we have developed a novel loop-mediated isothermal amplification (LAMP) assay targeting the invasion plasmid antigen H (ipaH) gene to rapidly detect Shigella species. This assay could be performed in 90 min at an optimal temperature of 64ºC, with endpoint results visualized directly. Notably, the method was found to be more sensitive than conventional PCR. Indeed, the detection limit for the LAMP assay on pure bacterial cultures was 5.9 x 10(5) CFU/ml, while PCR displayed a limit of 5.9 x 10(7) CFU/ml. In spiked lettuce samples, the sensitivity of the LAMP assay was 3.6 x 10(4) CFU/g, whereas PCR was 3.6 x 10(5) CFU/g. Overall, the assay accurately identified 32 Shigella spp. with one enteroinvasive Escherichia coli displaying positive reaction while the remaining 32 non-Shigella strains tested were negative.

  11. Use of Triplex PCR for Rapid Detection of PVL and Differentiation of MRSA from Methicillin Resistant Coagulase Negative Staphylococci

    Science.gov (United States)

    Abimanyu, Nagarajan; Krishnan, Arunkumar; Murugesan, Saravanan; Subramanian G, Kaushik; Gurumurthy, Sivakumar; Krishnan, Padma

    2013-01-01

    Introduction: Methicillin-Resistant Staphylococcus aureus (MRSA) has become a major public health problem in both hospitals and communities. Panton – Valentine Leucocidin (PVL) has been reported to be an important marker for the highly pathogenic community acquired S. aureus infections. A rapid detection of these MRSA is very important for its treatment. The specific detection of MRSA is always a problem due to the prevalence of methicillin resistance among the coagulase negative Staphylococci. Hence, this study was done to develop a rapid triplex PCR for the detection of PVL positive MRSA and for the simultaneous differentiation of MRSA from Coagulase Negative Staphylococci (CoNS). Materials and Methods: We developed a triplex PCR for the specific detection of PVL positive Community Acquired (CA) – MRSA and for its simultaneous differentiation from the coagulase negative Staphylococci. We used PCR for targeting the fem A gene which is specific for S. aureus, mecA which is specific for methicillin-resistance and luk - PV which is specific for the PVL toxin. The method was evaluated with a total of 100 clinical isolates of Staphylococcus spp. Results: The triplex PCR was successfully standardized by using the reference strains and it was evaluated by using clinical strains. The method was found to be rapid, highly sensitive (100%), specific (99%) and cost effective. Conclusion: Triplex PCR can be used as a diagnostic tool for the detection of the highly pathogenic strains of CA-MRSA. PMID:23542876

  12. Detection of Foodborne Pathogenic Bacteria using Bacteriophage Tail Spike Proteins

    Science.gov (United States)

    Poshtiban, Somayyeh

    Foodborne infections are worldwide health problem with tremendous social and financial impacts. Efforts are focused on developing accurate and reliable technologies for detection of food contaminations in early stages preferably on-site. This thesis focuses on interfacing engineering and biology by combining phage receptor binding proteins (RBPs) with engineered platforms including microresonator-based biosensors, magnetic particles and polymerase chain reaction (PCR) to develop bacterial detection sensors. We used phage RBPs as target specific bioreceptors to develop an enhanced microresonator array for bacterial detection. These resonator beams are optimized to feature a high natural frequency while offer large surface area for capture of bacteria. Theoretical analysis indicates a high mass sensitivity with a threshold for the detection of a single bacterial cell. We used phage RBPs as target specific bioreceptors, and successfully demonstrated the application of these phage RBB-immobilized arrays for specific detection of C. jejuni cells. We also developed a RBP-derivatized magnetic pre-enrichment method as an upstream sample preparation method to improve sensitivity and specificity of PCR for detection of bacterial cells in various food samples. The combination of RBP-based magnetic separation and real-time PCR allowed the detection of small number of bacteria in artificially contaminated food samples without any need for time consuming pre-enrichment step through culturing. We also looked into integration of the RBP-based magnetic separation with PCR onto a single microfluidic lab-on-a-chip to reduce the overall turnaround time.

  13. Bioluminescence-based system for rapid detection of natural transformation.

    Science.gov (United States)

    Santala, Ville; Karp, Matti; Santala, Suvi

    2016-07-01

    Horizontal gene transfer plays a significant role in bacterial evolution and has major clinical importance. Thus, it is vital to understand the mechanisms and kinetics of genetic transformations. Natural transformation is the driving mechanism for horizontal gene transfer in diverse genera of bacteria. Our study introduces a simple and rapid method for the investigation of natural transformation. This highly sensitive system allows the detection of a transformation event directly from a bacterial population without any separation step or selection of cells. The system is based on the bacterial luciferase operon from Photorhabdus luminescens The studied molecular tools consist of the functional modules luxCDE and luxAB, which involve a replicative plasmid and an integrative gene cassette. A well-established host for bacterial genetic investigations, Acinetobacter baylyi ADP1, is used as the model bacterium. We show that natural transformation followed by homologous recombination or plasmid recircularization can be readily detected in both actively growing and static biofilm-like cultures, including very rare transformation events. The system allows the detection of natural transformation within 1 h of introducing sample DNA into the culture. The introduced method provides a convenient means to study the kinetics of natural transformation under variable conditions and perturbations. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. A rapid Raman detection of deoxynivalenol in agricultural products.

    Science.gov (United States)

    Yuan, Jing; Sun, Chuanwen; Guo, Xiaoyu; Yang, Tianxi; Wang, Hui; Fu, Shuyue; Li, Chuanchuan; Yang, Haifeng

    2017-04-15

    Mycotoxin results in financial damage and considerable safety risks. In this paper, the possibility of portable Raman system-based surface-enhanced Raman scattering (SERS) for a rapid detection of deoxynivalenol (DON) a mycotoxin in cereals was investigated. Under an optimized condition, SERS analysis for pure DON solution has a wide dynamic concentration range from 10-7M to 10-2M with the limit of detection (LOD) down to 100nM. Density functional theory (DFT) analysis at the level of B3LYP/6-311++G(d, p) was also preformed for vibrational assignment. For practical application, the LOD of the proposed Raman method for both DON-contaminated corns and kidney beans were validated as 10-6M and the LOD for DON-contaminated oats was 10-4M. As a perspective, the SERS-based technology could be developed into an alternatively promising assay for on-field detection of DON residues at various cereals due to it high sensitivity and selectivity. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Rapid detection of radiation-induced hydrocarbons in cooked ham.

    Science.gov (United States)

    Barba, C; Santa-María, G; Herraiz, M; Calvo, M M

    2012-03-01

    Solid phase microextraction (SPME) coupled with either gas chromatography-ionization flame detector (CG-FID) or multidimensional gas chromatography-mass spectrometry (MDGC-MS) was evaluated for its ability to detect volatile hydrocarbons produced during the irradiation of cooked ham. The chromatogram of an irradiated sample obtained using GC-FID showed a complex pattern of peaks, with several co-eluting peaks superimposed, indicating that the method was unlikely to resolve adequately the volatile hydrocarbons formed during irradiation. Using SPME-MDGC-MS 1-tetradecene (C(1-14:1)), n-pentadecane (C(15:0)), 1-hexadecene (C(1-16:1)), n-heptadecane (C(17:0)) and 8-heptadecene (C(8-17:1)) were detected in cooked ham irradiated at 0.5, 2, 4 and 8kGy. This method allows the detection of most n-alkanes and n-alkenes produced during the irradiation of the majority of fatty acids in cooked ham, namely oleic acid, stearic acid and palmitic acid. SPME is rapid and inexpensive and does not require organic solvents. The proposed SPME-MDGC-MS method allows the determination of radiolytic markers in cooked ham in less than 115min. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. Detection of rapid-eye movements in sleep studies.

    Science.gov (United States)

    Agarwal, Rajeev; Takeuchi, Tomoka; Laroche, Suzie; Gotman, Jean

    2005-08-01

    One of the key features of rapid-eye movement (REM) sleep is the presence of bursts of REMs. Sleep studies routinely use REMs to classify sleep stages. Moreover, REM count or density has been used in studies involving learning and various psychiatric disorders. Most of these studies have been based on the visual identification of REMs, which is generally a very time-consuming task. This and the varying definitions of REMs across scorers have warranted the development of automatic REM detection methodologies. In this paper, we present a new detection scheme that combines many of the intrinsic properties of REMs and requires minimal parameter adjustments. In the proposed method, a single parameter can be used to control the REM detection sensitivity and specificity tradeoff. Manually scored training data are used to develop the method. We assess the performance of the method against manual scoring of individual REM events and present validation results using a separate data set. The ability of the method to discriminate fast horizontal ocular movement in REM sleep from other types of events is highlighted. A key advantage of the presented method is the minimal a priori information requirement. The results of training data (recordings from five subjects) show an overall sensitivity of 78.8% and specificity of 81.6%. The performance on the testing data (recording from five subjects different from the training data) showed overall sensitivity of 67.2% and specificity of 77.5%.

  17. Detection of Multiple Waterborne Pathogens Using Microsequencing Arrays

    Science.gov (United States)

    Aims: A microarray was developed to simultaneously detect Cryptosporidium parvum, Cryptosporidium hominis, Enterococcus faecium, Bacillus anthracis and Francisella tularensis in water. Methods and Results: A DNA microarray was designed to contain probes that specifically dete...

  18. PCR-based specific techniques used for detecting the most important pathogens on strawberry: a systematic review.

    Science.gov (United States)

    Mirmajlessi, Seyed Mahyar; Destefanis, Marialaura; Gottsberger, Richard Alexander; Mänd, Marika; Loit, Evelin

    2015-01-15

    Strawberry diseases are a major limiting factor that severely impact plant agronomic performance. Regarding limitations of traditional techniques for detection of pathogens, researchers have developed specific DNA-based tests as sensitive and specific techniques. The aim of this review is to provide an overview of polymerase chain reaction (PCR)-based methods used for detection or quantification of the most widespread strawberry pathogens, such as Fusarium oxysporum f.sp. fragariae, Phytophthora fragariae, Colletotrichum acutatum, Verticillium dahliae, Botrytis cinerea, Macrophomina phaseolina, and Xanthomonas fragariae. An updated and detailed list of published PCR protocols is presented and discussed, aimed at facilitating access to information that could be particularly useful for diagnostic laboratories in order to develop a rapid, cost-effective, and reliable monitoring technique. The study design was a systematic review of PCR-based techniques used for detection and quantification of strawberry pathogens. Using appropriate subject headings, AGRICOLA, AGRIS, BASE, Biological Abstracts, CAB Abstracts, Google Scholar, Scopus, Web of Knowledge, and SpringerLink databases were searched from their inception up to April 2014. Two assessors independently reviewed the titles, abstracts, and full articles of all identified citations. Selected articles were included if one of the mentioned strawberry pathogens was investigated based on PCR methods, and a summary of pre-analytical requirements for PCR was provided. A total of 259 titles and abstracts were reviewed, of which 22 full texts met all the inclusion criteria. Our systematic review identified ten different protocols for X. fragariae, eight for P. fragariae, four for B. cinerea, six for C. acutatum, three for V. dahlia, and only one for F. oxysporum. The accuracy and sensitivity of PCR diagnostic methods is the focus of most studies included in this review. However, a large proportion of errors in laboratories

  19. Rapid immunochromatographic malarial antigen detection unreliable for detecting Plasmodium malariae and Plasmodium ovale

    NARCIS (Netherlands)

    Grobusch, M. P.; Hänscheid, T.; Zoller, T.; Jelinek, T.; Burchard, G. D.

    2002-01-01

    In order to determine the reliability of two commercial tests for the rapid detection of plasmodial antigen in cases of infection with Plasmodium ovale and Plasmodium malariae, the products were evaluated in four centers and a search of the relevant literature was performed. The results of the

  20. Rapid detection of cryptococcal antigen by a flow assay

    Directory of Open Access Journals (Sweden)

    Graziano Bargiggia

    2017-10-01

    Full Text Available Cryptococcosis is a life-threatening infection caused by Cryptococcus neoformans and C. gattii. Tests for quick detection of the cryptococcal antigen are needed. This study compares the performance of a lateral flow assay (LFA to the latex agglutination method. Thirty-five cryopreserved positive samples (sera and cerebrospinal fluids plus three negative sera for control have been examined. LFA does not need high-temperature incubation or enzyme pre-treatment. All the results, except for one serum, agree with previous obtained with latex agglutination method. LFA has an important clinical utility for its rapidity and sensitivity, and it also can be used as a point-of-care test.

  1. Rapid methods for detection of bacterial resistance to antibiotics.

    Science.gov (United States)

    March-Rosselló, Gabriel Alberto

    2017-03-01

    The most widely used antibiotic susceptibility testing methods in Clinical Microbiology are based on the phenotypic detection of antibiotic resistance by measuring bacterial growth in the presence of the antibiotic being tested. These conventional methods take typically 24hours to obtain results. Here we review the main techniques for rapid determination of antibiotic susceptibility. Data obtained with different methods such as molecular techniques, microarrays, commercial methods used in work routine, immunochromatographic methods, colorimetric methods, image methods, nephelometry, MALDI-TOF mass spectrometry, flow cytometry, chemiluminescence and bioluminescence, microfluids and methods based on cell disruption are analysed in detail. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  2. Dual color fluorescence in situ hybridization (FISH) assays for detecting Mycobacterium tuberculosis and Mycobacterium avium complexes and related pathogens in cultures

    OpenAIRE

    Shah, Jyotsna; Weltman, Helena; Narciso, Patricia; Murphy, Christina; Poruri, Akhila; Baliga, Shrikala; Sharon, Leesha; York, Mary; Cunningham, Gail; Miller, Steve; Caviedes, Luz; Gilman, Robert; Desmond, Edward; Ramasamy, Ranjan

    2017-01-01

    Two rapid dual color fluorescence in situ hybridization (FISH) assays were evaluated for detecting M. tuberculosis and related pathogens in cultures. The MN Genus-MTBC FISH assay uses an orange fluorescent probe specific for the Mycobacterium tuberculosis complex (MTBC) and a green fluorescent probe specific for the Mycobacterium and Nocardia genera (MN Genus) to detect and distinguish MTBC from other Mycobacteria and Nocardia. A complementary MTBC-MAC FISH assay uses green and orange fluores...

  3. Rapid detection of Mycobacterium tuberculosis by recombinase polymerase amplification.

    Directory of Open Access Journals (Sweden)

    David S Boyle

    Full Text Available Improved access to effective tests for diagnosing tuberculosis (TB has been designated a public health priority by the World Health Organisation. In high burden TB countries nucleic acid based TB tests have been restricted to centralised laboratories and specialised research settings. Requirements such as a constant electrical supply, air conditioning and skilled, computer literate operators prevent implementation of such tests in many settings. Isothermal DNA amplification technologies permit the use of simpler, less energy intensive detection platforms more suited to low resource settings that allow the accurate diagnosis of a disease within a short timeframe. Recombinase Polymerase Amplification (RPA is a rapid, low temperature isothermal DNA amplification reaction. We report here RPA-based detection of Mycobacterium tuberculosis complex (MTC DNA in <20 minutes at 39 °C. Assays for two MTC specific targets were investigated, IS6110 and IS1081. When testing purified MTC genomic DNA, limits of detection of 6.25 fg (IS6110 and 20 fg (IS1081were consistently achieved. When testing a convenience sample of pulmonary specimens from suspected TB patients, RPA demonstrated superior accuracy to indirect fluorescence microscopy. Compared to culture, sensitivities for the IS1081 RPA and microscopy were 91.4% (95%CI: 85, 97.9 and 86.1% (95%CI: 78.1, 94.1 respectively (n = 71. Specificities were 100% and 88.6% (95% CI: 80.8, 96.1 respectively. For the IS6110 RPA and microscopy sensitivities of 87.5% (95%CI: 81.7, 93.2 and 70.8% (95%CI: 62.9, 78.7 were obtained (n = 90. Specificities were 95.4 (95% CI: 92.3,98.1 and 88% (95% CI: 83.6, 92.4 respectively. The superior specificity of RPA for detecting tuberculosis was due to the reduced ability of fluorescence microscopy to distinguish Mtb complex from other acid fast bacteria. The rapid nature of the RPA assay and its low energy requirement compared to other amplification technologies suggest RPA-based TB

  4. Detection of the emerging amphibian pathogens Batrachochytrium dendrobatidis and ranavirus in Russia

    Science.gov (United States)

    Reshetnikov, Andrey N.; Chestnut, Tara E.; Brunner, Jesse L.; Charles, Kaylene M.; Nebergall, Emily E.; Olson, Deanna H.

    2014-01-01

    In a population of the European common toad Bufo bufo from a rural pond in the region of Lake Glubokoe Regional Reserve in Moscow province, Russia, unexplained mass mortality events involving larvae and metamorphs have been observed over a monitoring period of >20 yr. We tested toads from this and a nearby site for the emerging amphibian pathogens Batrachochytrium dendrobatidis (Bd) and ranavirus (Rv). Both pathogens were detected, and at the rural pond site, with the above-noted losses and decline in toad breeding success, 40% of B. bufo metamorphs were Bd positive, 46% were Rv positive and 20% were co-infected with both pathogens. Toad metamorphs from a neighbouring water body were also Bd and Rv positive (25 and 55%, respectively). This is the first confirmation of these pathogens in Russia. Questions remain as to the origins of these pathogens in Russia and their roles in documented mass mortality events.

  5. Rapid detection of flooded areas after Tohoku March 2011 tsunami

    Science.gov (United States)

    Faruolo, M.; Coviello, I.; Falconieri, A.; Lacava, T.; Pergola, N.; Tramutoli, V.

    2012-04-01

    In the recent years there has been a continuous increase of natural disasters affecting the world. Their catastrophic consequences generally have extreme impacts both from an economic and social point of view. The effects are the more severe the higher are the population density and concentration of industrial facilities and infrastructures in disaster-affected areas. Systems able to provide timely information about the affected areas may help in supporting decision makers to manage the crisis. In this context, satellite data may give a useful and effectively support. The devastating earthquake occurred on March 11, 2011 off the Japan coasts produced a huge tsunami which strongly affected the municipality of Miyagi, where more than two millions of inhabitants were used to live. In this paper, the Robust Satellite Techniques (RST) approach was used to detect areas affected by the flood due to such a tsunami. RST have been already applied with satisfactory results for the detection and monitoring of flooded area by using data acquired both from polar (NOAA-AVHRR and EOS-MODIS) and geostationary (MSG-SEVIRI) system. The potential of such data acquired in the visible and infrared regions of the electromagnetic spectrum has already been verified, allowing the development of an all-day detection and monitoring system of flooded areas. In particular, the potential of RST when implemented on optical data acquired by the Japan geostationary MT-SAT series satellites for rapid detection of flooded areas within Sendai district will be investigated in this study. MT-SAT, guaranteeing a temporal resolution of 30 minutes and a spatial resolution of up to 1km in the visible channel, together with the high sensitivity to detecting changes, offered by RST approach, should assure the capability for a prompt and effective detection, allowing for a near real time identification of the dynamics and the evolution of the disaster. Results and main achievements of this study will be

  6. Technique for rapid detection of phthalates in water and beverages

    KAUST Repository

    Zia, Asif I.

    2013-05-01

    ), USA. Results showed that the new sensor was able to detect different concentrations of phthalates in energy drinks. The experimental outcomes provided sufficient indication to favour the development of a low cost detection system for rapid quantification of phthalates in beverages for industrial use. © 2012 Elsevier Ltd. All rights reserved.

  7. Detection of Pathogens with Impedance Analysis in a Lab on a Chip

    NARCIS (Netherlands)

    van der Wouden, E.J.; Super, M.; Ingber, D.E.; van den Berg, Albert

    2011-01-01

    In this work, we demonstrate an impedance approach to detect pathogens bound to magnetic beads. The approach was demonstrated with C-Albicans. We show that when an appropriate frequency is applied to two electrodes present in a microfluidic channel the impedance change in the detection volume can be

  8. Rapid detection of Shigella and enteroinvasive Escherichia coli in produce enrichments by a conventional multiplex PCR assay.

    Science.gov (United States)

    Binet, Rachel; Deer, Deanne M; Uhlfelder, Samantha J

    2014-06-01

    Faster detection of contaminated foods can prevent adulterated foods from being consumed and minimize the risk of an outbreak of foodborne illness. A sensitive molecular detection method is especially important for Shigella because ingestion of as few as 10 of these bacterial pathogens can cause disease. The objectives of this study were to compare the ability of four DNA extraction methods to detect Shigella in six types of produce, post-enrichment, and to evaluate a new and rapid conventional multiplex assay that targets the Shigella ipaH, virB and mxiC virulence genes. This assay can detect less than two Shigella cells in pure culture, even when the pathogen is mixed with background microflora, and it can also differentiate natural Shigella strains from a control strain and eliminate false positive results due to accidental laboratory contamination. The four DNA extraction methods (boiling, PrepMan Ultra [Applied Biosystems], InstaGene Matrix [Bio-Rad], DNeasy Tissue kit [Qiagen]) detected 1.6 × 10(3)Shigella CFU/ml post-enrichment, requiring ∼18 doublings to one cell in 25 g of produce pre-enrichment. Lower sensitivity was obtained, depending on produce type and extraction method. The InstaGene Matrix was the most consistent and sensitive and the multiplex assay accurately detected Shigella in less than 90 min, outperforming, to the best of our knowledge, molecular assays currently in place for this pathogen. Published by Elsevier Ltd.

  9. Rapid identification of pathogens from pediatric blood cultures by use of the FilmArray blood culture identification panel.

    Science.gov (United States)

    Zheng, Xiaotian; Polanco, Wanda; Carter, Donna; Shulman, Stanford

    2014-12-01

    The performance of the FilmArray blood culture identification (BCID) panel has been studied in adult patients. We describe here an evaluation of this assay for the rapid identification of pathogens in Bactec Peds Plus/F and Bactec standard anaerobic/F bottles that contained blood samples from pediatric patients at a tertiary care children's hospital. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  10. EVALUATION OF A RAPID, QUANTITATIVE REAL-TIME PCR METHOD FOR ENUMERATION OF PATHOGENIC CANDIDA CELLS IN WATER

    Science.gov (United States)

    Quantitative Real-Time PCR (QRT-PCR) technology, incorporating fluorigenic 5' nuclease (TaqMan?) chemistry, was developed for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C....

  11. Strategies for the detection of food pathogens and contaminants

    DEFF Research Database (Denmark)

    molecules and once suitably high affinity antibodies have been isolated, it is relatively straightforward to design and optimise concentration-based assays using SPR. Recently we have investigated the potential of applying Biacore technology to routine food analysis. Our experiences have shown...... to date with using Biacore for analysis of food contaminants and in particular the challenges associated with large analyte detection...

  12. Molecular detection and characterization of tick-borne pathogens in dogs and ticks from Nigeria.

    Directory of Open Access Journals (Sweden)

    Joshua Kamani

    Full Text Available BACKGROUND: Only limited information is currently available on the prevalence of vector borne and zoonotic pathogens in dogs and ticks in Nigeria. The aim of this study was to use molecular techniques to detect and characterize vector borne pathogens in dogs and ticks from Nigeria. METHODOLOGY/PRINCIPAL FINDINGS: Blood samples and ticks (Rhipicephalus sanguineus, Rhipicephalus turanicus and Heamaphysalis leachi collected from 181 dogs from Nigeria were molecularly screened for human and animal vector-borne pathogens by PCR and sequencing. DNA of Hepatozoon canis (41.4%, Ehrlichia canis (12.7%, Rickettsia spp. (8.8%, Babesia rossi (6.6%, Anaplasma platys (6.6%, Babesia vogeli (0.6% and Theileria sp. (0.6% was detected in the blood samples. DNA of E. canis (23.7%, H. canis (21.1%, Rickettsia spp. (10.5%, Candidatus Neoehrlichia mikurensis (5.3% and A. platys (1.9% was detected in 258 ticks collected from 42 of the 181 dogs. Co- infections with two pathogens were present in 37% of the dogs examined and one dog was co-infected with 3 pathogens. DNA of Rickettsia conorii israelensis was detected in one dog and Rhipicephalus sanguineus tick. DNA of another human pathogen, Candidatus N. mikurensis was detected in Rhipicephalus sanguineus and Heamaphysalis leachi ticks, and is the first description of Candidatus N. mikurensis in Africa. The Theileria sp. DNA detected in a local dog in this study had 98% sequence identity to Theileria ovis from sheep. CONCLUSIONS/SIGNIFICANCE: The results of this study indicate that human and animal pathogens are abundant in dogs and their ticks in Nigeria and portray the potential high risk of human exposure to infection with these agents.

  13. The use of carbohydrate microarrays to study carbohydrate-cell interactions and to detect pathogens.

    Science.gov (United States)

    Disney, Matthew D; Seeberger, Peter H

    2004-12-01

    The use of carbohydrate microarrays to investigate the carbohydrate binding specificities of bacteria, to detect pathogens, and to screen antiadhesion therapeutics is reported. This system is ideal for whole-cell applications because microarrays present carbohydrate ligands in a manner that mimics interactions at cell-cell interfaces. Other advantages include assay miniaturization, since minimal amounts (approximately picomoles) of a ligand are required to observe binding, and high throughput, since thousands of compounds can be placed on an array and analyzed in parallel. Pathogen detection experiments can be completed in complex mixtures of cells or protein using the known carbohydrate binding epitopes of the pathogens in question. The nondestructive nature of the arrays allows the pathogen to be harvested and tested for antibacterial susceptibility. These investigations allow microarray-based screening of biological samples for contaminants and combinatorial libraries for antiadhesion therapeutics.

  14. Rapid detection of listeria spp. using an internalin A aptasensor based on carbon-metal nanohybrid structures

    Science.gov (United States)

    Vanegas, D. C.; Rong, Yue; Schwalb, N.; Hills, K. D.; Gomes, C.; McLamore, E. S.

    2015-05-01

    Foodborne outbreaks caused by Listeria monocytogenes continue to raise major public health concerns worldwide. In the United States alone, the centers for disease control and prevention have confirmed the occurrence of 183 cases of listeriosis with 39 fatalities within the last 3 years. Standard methods for the detection of pathogenic strains require up to 7 days to yield results, thus faster techniques with the same level of reliability for bacteria detection are desirable. This study reports on the development of a rapid, accurate, and sensitive electrochemical biosensor for rapid testing of Listeria spp. based on the selective binding of InlA aptamers to internalins in the cell membrane of the target bacteria. Hybrid nanomaterial platforms based on reduced graphene oxide and nanoplatinum were deposited onto Pt/Ir electrodes for enhancing electrochemical transduction during the recognition events. InlA aptamers were immobilized onto the nanomaterial platforms via metal-thiol adsorption. Aptamer loading onto different platform nanostructures was investigated through cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The detection mechanism was evaluated by recording the electrochemical response to several bacterial dilutions in PBS buffer using the non-pathogenic species Listeria innocua. These preliminary results show that the aptasensor can be tuned for detection of Listeria concentrations as low as 100 CFU/ml in less than 3 hours (including incubation time and data analysis). The developed aptasensor opens a promising direction for rapid testing of Listeria monocytogenes in food products.

  15. Rapid and sensitive detection of bisphenol a from serum matrix.

    Science.gov (United States)

    Lin, Xiaogang; Cheng, Cheng; Terry, Paul; Chen, Jiangang; Cui, Haochen; Wu, Jayne

    2017-05-15

    Bisphenol A (BPA) is an endocrine disrupting compound that may have adverse developmental, reproductive, neurological, and immune system effects. Low-level exposure to BPA is ubiquitous in human populations due to its widespread use in consumer products. Therefore, highly sensitive methods are needed to quantify BPA in various matrices including water, serum, and food products. In this study, we developed a simple, rapid, highly sensitive and specific sensor based on an aptamer probe and AC electrokinetics capacitive sensing method that successfully detected BPA at femto molar (fM) levels, which is an improvement over prior work by a factor of 10. We were able to detect BPA spiked in human serum as well as in maternal and cord blood within 30s. The sensor is responsive to BPA down to femto molar levels, but not to structurally similar compounds including bisphenol F (BPF) or bisphenol S (BPS) even at much higher concentration. Further development of this platform may prove useful in monitoring exposure to BPA and other small molecules in various matrices. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Rapid detection of intracellular nanoparticles by electron microscopy

    Directory of Open Access Journals (Sweden)

    Kyoung Hwan Lee

    2010-03-01

    Full Text Available Recently, a number of nanoparticle carriers have provided new platforms for research in biotechnology and biomedicine. A particularly interest in these fields is the monitoring of nanoparticle delivery to target cells. Since the structures involved are on a nanometer scale, high resolution imaging, such as electron microscopy, is required. Aside from assessing the structural characteristics of the target sites localized with the nanoparticles, an electron microscope can also be used to observe the biological effects of the nanoparticles on the cells. It can also be used to test and detect a wide range of fluorescent nanoparticles and nanoassemblies. Although this approach has many advantages, most researchers are unwilling to try electron microscopy due to the complicated specimen preparation procedures and time-consuming process. Here, we developed a method to simplify the sample preparation and shorten the total processing time. In particular, double staining was removed, and cryo-preparation was included. Using this simple and rapid sample preparation, we were able to observe nanoparticles with high-contrast images of the cellular organelles. This efficient detection method can be applied to studies on nanoparticle drug delivery systems and nanoparticle-cell interactions.

  17. Designing Multicomponent Nanosystems for Rapid Detection of Circulating Tumor Cells.

    Science.gov (United States)

    Banerjee, Shashwat S; Khobragade, Vrushali; Khandare, Jayant

    2017-01-01

    Detection of circulating tumor cells (CTCs) in the blood circulation holds immense promise as it predicts the overall probability of patient survival. Therefore, CTC-based technologies are gaining prominence as a "liquid biopsy" for cancer diagnostics and prognostics. Here, we describe the design and synthesis of two distinct multicomponent magnetic nanosystems for rapid capture and detection of CTCs. The multifunctional Magneto-Dendrimeric Nano System (MDNS) composed of an anchoring dendrimer that is conjugated to multiple agents such as near infrared (NIR) fluorescent cyanine 5 NHS (Cy5), glutathione (GSH), transferrin (Tf), and iron oxide (Fe3O4) magnetic nanoparticle (MNP) for simultaneous tumor cell-specific affinity, multimodal high resolution confocal imaging, and cell isolation. The second nanosystem is a self-propelled microrocket that is composed of carbon nanotube (CNT), chemically conjugated with targeting ligand such as transferrin on the outer surface and Fe3O4 nanoparticles in the inner surface. The multicomponent nanosystems described here are highly efficient in targeting and isolating cancer cells thus benefiting early diagnosis and therapy of cancer.

  18. Rapid Detection and Classification of Salmonella enterica Shedding in Feedlot Cattle Utilizing the Roka Bioscience Atlas Salmonella Detection Assay for the Analysis of Rectoanal Mucosal Swabs.

    Science.gov (United States)

    Chaney, W Evan; Agga, Getahun E; Nguyen, Scott V; Arthur, Terrance M; Bosilevac, Joseph M; Dreyling, Erin; Rishi, Anantharama; Brichta-Harhay, Dayna

    2017-10-01

    With an increasing focus on preharvest food safety, rapid methods are required for the detection and quantification of foodborne pathogens such as Salmonella enterica in beef cattle. We validated the Atlas Salmonella Detection Assay (SEN), a nucleic acid amplification technology that targets Salmonella rRNA, for the qualitative detection of S. enterica with sample enrichment using immunomagnetic separation as a reference test, and we further evaluated its accuracy to predict pathogen load using SEN signal-to-cutoff (SCO) values from unenriched samples to classify animals as high or nonhigh shedders. Rectoanal mucosal swabs (RAMS) were collected from 238 beef cattle from five cohorts located in the Midwest or southern High Plains of the United States between July 2015 and April 2016. Unenriched RAMS samples were used for the enumeration and SEN SCO analyses. Enriched samples were tested using SEN and immunomagnetic separation methods for the detection of Salmonella. The SEN method was 100% sensitive and specific for the detection of Salmonella from the enriched RAMS samples. A SEN SCO value of 8, with a sensitivity of 93.5% and specificity of 94.3%, was found to be an optimum cutoff value for classifying animals as high or nonhigh shedders from the unenriched RAMS samples. The SEN assay is a rapid and reliable method for the qualitative detection and categorization of the shedding load of Salmonella from RAMS in feedlot cattle.

  19. Development of cross-priming amplification assays for rapid and sensitive detection of Aeromonas hydrophila.

    Science.gov (United States)

    Meng, S; Wang, Y; Wang, Y; Liu, D; Ye, C

    2015-08-01

    Aeromonas hydrophila has been increasingly implicated as the aetiologic agent of various human diseases. Therefore, reliable laboratory detection and identification of this bacterium has become clinically and epidemiologically desirable. We developed a nearly instrument-free, simple molecular method for rapid detection of Aer. hydrophila using a cross-priming amplification (CPA) assay with the desA gene as the target. The desA gene is crucial for the survival and growth of Aer. hydrophila under iron starvation. The results can be visualized as colour changes without opening the reaction tubes. No false-positive results were observed for the 33 non-Aer. hydrophila strains tested to evaluate assay specificity. The limit of detection for Aer. hydrophila was approximately 200 copies of desA per reaction (on reference plasmids) and 5 × 10(3)  CFU g(-1) Aer. hydrophila in simulated human stool, which is the same sensitivity as a qPCR assay. The performance of the CPA assay was also evaluated with 100 stool specimens from diarrhoea patients and 40 environmental water samples. In conclusion, the simplicity, cost-effectiveness and nearly instrument-free platform of the CPA assay make it practical for use in primary care facilities and smaller clinical laboratories. Aeromonas hydrophila is a human pathogen that infects via exposed wounds or ingestion of contaminated water and food. In this study, a CPA-based PCR method was developed for specific, rapid, cost-effective detection of Aer. hydrophila, and the test results could be visualized without opening the reaction tubes. This is the first report on the application of the CPA method for the detection of Aer. hydrophila. This novel method could be practical for use in primary care facilities and smaller clinical laboratories. © 2015 The Society for Applied Microbiology.

  20. Rapid evolutionary adaptation to elevated salt concentrations in pathogenic freshwater bacteria Serratia marcescens

    National Research Council Canada - National Science Library

    Ketola, Tarmo; Hiltunen, Teppo

    2014-01-01

    .... We tested this hypothesis with a 133‐day‐long evolutionary experiment studying the evolution of the pathogenic Serratia marcescens bacterium at salinity niche boundary and in fluctuating conditions. We found...

  1. Fluorescence techniques to detect and to assess viability of plant pathogenic bacteria

    OpenAIRE

    Chitarra, L.G.

    2001-01-01

    Plant pathogenic bacteria cause major economic losses in commercial crop production worldwide every year. The current methods used to detect and to assess the viability of bacterial pathogens and to test seed lots or plants for contamination are usually based on plate assays or on serological techniques. Plating methods provide information about cell viability, but are generally laborious and time-consuming. Serological techniques, such as immunofluorescence microscopy (IF) and enzym...

  2. Pathogen detection, testing, and control in fresh broccoli sprouts

    Directory of Open Access Journals (Sweden)

    Fahey Jed W

    2006-04-01

    Full Text Available Abstract Background The recent increased interest in consuming green vegetable sprouts has been tempered by the fact that fresh sprouts can in some cases be vehicles for food-borne illnesses. They must be grown according to proper conditions of sanitation and handled as a food product rather than as an agricultural commodity. When sprouts are grown in accordance with the criteria proposed from within the sprout industry, developed by regulatory agencies, and adhered to by many sprouters, green sprouts can be produced with very low risk. Contamination may occur when these guidelines are not followed. Methods A one year program of microbial hold-and-release testing, conducted in concert with strict seed and facility cleaning procedures by 13 U.S. broccoli sprout growers was evaluated. Microbial contamination tests were performed on 6839 drums of sprouts, equivalent to about 5 million consumer packages of fresh green sprouts. Results Only 24 (0.75% of the 3191 sprout samples gave an initial positive test for Escherichia coli O157:H7 or Salmonella spp., and when re-tested, 3 drums again tested positive. Composite testing (e.g., pooling up to 7 drums for pathogen testing was equally sensitive to single drum testing. Conclusion By using a "test-and-re-test" protocol, growers were able to minimize crop destruction. By pooling drums for testing, they were also able to reduce testing costs which now represent a substantial portion of the costs associated with sprout growing. The test-and-hold scheme described herein allowed those few batches of contaminated sprouts to be found prior to packaging and shipping. These events were isolated, and only safe sprouts entered the food supply.

  3. In-gel technology for PCR genotyping and pathogen detection.

    Science.gov (United States)

    Atrazhev, Alexey; Manage, Dammika P; Stickel, Alexander J; Crabtree, H John; Pilarski, Linda M; Acker, Jason P

    2010-10-01

    This work describes the use of polyacrylamide gel and PCR reagents photopolymerized in a mold to create an array of semisolid posts that serve as reaction vessels for parallel PCR amplification of an externally added template. DNA amplification occurred in a cylindrical, self-standing 9 × 9 array of gel posts each less than 1 μL in volume. Photopolymerization of the gel with an intercalating dye added prior to polymerization permitted acquisition of real-time PCR data and melting curve analysis data without the need for any type of post-PCR staining procedures. PCR was equally efficient and reproducible when template DNA was polymerized within the gel or when exogenous template was added atop precast gel posts. PCR amplification occurred with template from purified DNA or from raw urine of patients with BK viruria. Multiple primer sets can be utilized per gel post array with no detectable cross contamination. As few as 34 BK virus templates were consistently detected by PCR in an individual gel post. Amplification of HPA1 and FGFR2 genes in human genomic DNA (gDNA) required as little as 2-5 ng of gDNA template/gel post. The device prototype includes a Peltier element for PCR thermal cycling and a CCD camera to capture fluorescence for product detection. Our technology is amenable to integration in point of care microdevices.

  4. The development and application of the two real-time RT-PCR assays to detect the pathogen of HFMD.

    Directory of Open Access Journals (Sweden)

    Aili Cui

    Full Text Available Large-scale Hand, Foot, and Mouth Disease (HFMD outbreaks have frequently occurred in China since 2008, affecting more than one million children and causing several hundred children deaths every year. The pathogens of HFMD are mainly human enteroviruses (HEVs. Among them, human enterovirus 71 (HEV71 and coxsackievirus A16 (CVA16 are the most common pathogens of HFMD. However, other HEVs could also cause HFMD. To rapidly detect HEV71 and CVA16, and ensure detection of all HEVs causing HFMD, two real-time hybridization probe-based RT-PCR assays were developed in this study. One is a multiplex real-time RT-PCR assay, which was developed to detect and differentiate HEV71 specifically from CVA16 directly from clinical specimens within 1-2 h, and the other is a broad-spectrum real-time RT-PCR assay, which targeted almost all HEVs. The experiments confirmed that the two assays have high sensitivity and specificity, and the sensitivity was up to 0.1 TCID50/ml for detection of HEVs, HEV71, and CVA16, respectively. A total of 213 clinical specimens were simultaneously detected by three kinds of assays, including the two real-time RT-PCR assays, direct conventional RT-PCR assay, and virus isolation assay on human rhabdomyosarcoma cells (RD cells. The total positive rate of both HEV71 and CVA16 was 69.48% with real-time RT-PCR assay, 47.42% with RT-PCR assay, and 34.58% with virus isolation assay. One HFMD clinical specimen was positive for HEV, but negative for HEV71 or CVA16, which was identified as Echovirus 11 (Echo11 by virus isolation, RT-PCR, and sequencing for the VP1 gene. The two real-time RT-PCR assays had been applied in 31 provincial HFMD labs to detect the pathogens of HFMD, which has contributed to the rapid identification of the pathogens in the early stages of HFMD outbreaks, and helped to clarify the etiologic agents of HFMD in China.

  5. Rapid Detection of the Varicella Zoster Virus in Saliva

    Science.gov (United States)

    Pierson, Duane L.; Mehta, Satish K.; Cohrs, Randall J.; Gilden, Don H.; Harding, Robert E.

    2011-01-01

    Varicella zoster virus (VZV) causes chicken pox on first exposure (usually in children), and reactivates from latency causing shingles (usually in adults). Shingles can be extremely painful, causing nerve damage, organ damage, and blindness in some cases. The virus can be life-threatening in immune-compromised individuals. The virus is very difficult to culture for diagnosis, requiring a week or longer. This invention is a rapid test for VZV from a saliva sample and can be performed in a doctor s office. The kit is small, compact, and lightweight. Detec tion is sensitive, specific, and noninvasive (no needles); only a saliva sample is required. The test provides results in minutes. The entire test is performed in a closed system, with no exposure to infectious materials. The components are made mostly of inexpensive plastic injection molded parts, many of which can be purchased off the shelf and merely assembled. All biological waste is contained for fast, efficient disposal. This innovation was made possible because of discovery of a NASA scientists flight experiment showing the presence of VZV in saliva during high stress periods and disease. This finding enables clinicians to quickly screen patients for VZV and treat the ones that show positive results with antiviral medicines. This promotes a rapid recovery, easing of pain and symptoms, and reduces chances of complications from zoster. Screening of high-risk patients could be incorporated as part of a regular physical exam. These patients include the elderly, pregnant women, and immune-compromised individuals. In these patients, VZV can be a life-threatening disease. In both high- and low-risk patients, early detection and treatment with antiviral drugs can dramatically decrease or even eliminate the clinical manifestation of disease.

  6. Development of rapid, sensitive and non-radioactive tissue-blot diagnostic method for the detection of citrus greening.

    Science.gov (United States)

    Nageswara-Rao, Madhugiri; Miyata, Shin-Ichi; Ghosh, Dilip; Irey, Mike; Garnsey, Stephen M; Gowda, Siddarame

    2013-01-01

    Citrus huanglongbing (HLB or citrus greening) is one of the most devastating diseases of citrus worldwide. The disease is caused by Gram-negative, phloem-limited α-proteobacterium, 'Candidatus Liberibacter asiaticus', vectored by the psyllid, Diaphorina citri Kuwayama. Citrus plants infected by the HLB bacterium may not show visible symptoms sometimes for years following infection and non-uniform distribution within the tree makes the detection of the pathogen very difficult. Efficient management of HLB disease requires rapid and sensitive detection early in the infection followed by eradication of the source of pathogen and the vector. The polymerase chain reaction (PCR) based method is most commonly employed for screening the infected/suspected HLB plants and psyllids. This is time consuming, cumbersome and not practical for screening large number of samples in the field. To overcome this, we developed a simple, sensitive, non-radioactive, tissue-blot diagnostic method for early detection and screening of HLB disease. Digoxigenin labeled molecular probes specific to 'Ca. L. asiaticus' nucleotide sequences have been developed and used for the detection of the pathogen of the HLB disease. The copy number of the target genes was also assessed using real-time PCR experiments and the optimized real-time PCR protocol allowed positive 'Ca. L. asiaticus' detection in citrus samples infected with 'Ca. L. asiaticus' bacterium. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. Development of a Multiplex PCR Method to Detect Fungal Pathogens for Quarantine on Exported Cacti

    Directory of Open Access Journals (Sweden)

    Hyun ji Cho

    2016-02-01

    Full Text Available Major diseases in grafted cacti have been reported and Fusarium oxysporum, Bipolaris cactivora, Phytophthora spp. and Collectotrichum spp. are known as causal pathogens. These pathogens can lead to plant death after infection. Therefore, some European countries have quarantined imported cacti that are infected with specific fungal pathogens. Consequently, we developed PCR detection methods to identify four quarantined fungal pathogens and reduce export rejection rates of Korean grafted cacti. The pathogen specific primer sets F.oF-F.oR, B.CF-B.CR, P.nF-P.nR, and P.cF-P.CR were tested for F. oxysporum, B. cactivora, P. nicotinae, and P. cactorum, respectively. The F.oF-F.oR primer set was designed from the Fusarium ITS region; the B.CF-B.CR and P.nF-P.nR primers respectively from Bipolaris and Phytophthora ITS1; and the P.cF-P.CR primer set from the Ypt1protein gene region. The quarantine fungal pathogen primer pairs were amplified to the specific number of base pairs in each of the following fungal pathogens: 210-bp (F. oxysporum, 510-bp (B. cactivora, 313-bp (P. nicotinae, and 447-bp (P. cactorum. The detection limit for the mono- and multiplex PCR primer sets was 0.1 ng of template DNA under in vitro conditions. Therefore, each primer set successfully diagnosed contamination of quarantine pathogens in export grafted cacti. Consequently, our methodology is a viable tool to screen contamination of the fungal pathogen in exported grafted cacti.

  8. Using a resequencing microarray as a multiple respiratory pathogen detection assay.

    Science.gov (United States)

    Lin, Baochuan; Blaney, Kate M; Malanoski, Anthony P; Ligler, Adam G; Schnur, Joel M; Metzgar, David; Russell, Kevin L; Stenger, David A

    2007-02-01

    Simultaneous testing for detection of infectious pathogens that cause similar symptoms (e.g., acute respiratory infections) is invaluable for patient treatment, outbreak prevention, and efficient use of antibiotic and antiviral agents. In addition, such testing may provide information regarding possible coinfections or induced secondary infections, such as virally induced bacterial infections. Furthermore, in many cases, detection of a pathogen requires more than genus/species-level resolution, since harmful agents (e.g., avian influenza virus) are grouped with other, relatively benign common agents, and for every pathogen, finer resolution is useful to allow tracking of the location and nature of mutations leading to strain variations. In this study, a previously developed resequencing microarray that has been demonstrated to have these capabilities was further developed to provide individual detection sensitivity ranging from 10(1) to 10(3) genomic copies for more than 26 respiratory pathogens while still retaining the ability to detect and differentiate between close genetic neighbors. In addition, the study demonstrated that this system allows unambiguous and reproducible sequence-based strain identification of the mixed pathogens. Successful proof-of-concept experiments using clinical specimens show that this approach is potentially very useful for both diagnostics and epidemic surveillance.

  9. Development of an isothermal amplification-based assay for the rapid visual detection of Salmonella bacteria.

    Science.gov (United States)

    Liu, Hai-Bin; Zang, Yu-Xuan; Du, Xin-Jun; Li, Ping; Wang, Shuo

    2017-09-01

    The efficient and timely detection of pathogens is a major concern worldwide. The aim of this study was to establish a rapid detection method for Salmonella bacteria in food samples to facilitate timely treatment. Widely used detection methods currently include culture-based methods and PCR-based methods. The former are time consuming, requiring 2 to 3 d, whereas the latter have higher accuracy but are typically complicated, requiring expertise and expensive instruments. In this study, a sensitive and rapid approach for the visual and point-of-use detection of Salmonella bacteria based on recombinase polymerase amplification (RPA) and a lateral-flow (LF) nucleic acid strip was established. We designed a pair of primers according to the invA gene of Salmonella bacteria: one was modified with digoxin, and the other was modified with biotin. In the presence of the biotin- and digoxin-modified primers and target DNA, the RPA produced a substantial amount of duplex DNA attached to biotin and digoxin. The products were detected using LF strips through immunoreaction: anti-digoxin antibodies on the gold nanoparticles, digoxin on the duplex, streptavidin on the LF test line, and biotin on the duplex. The developed RPA-LF assay allowed detection of Salmonella genomic DNA in less than 20 min with simple water bath equipment or portable thermal equipment. In addition, the RPA-LF assay was highly sensitive, with a detection limit as low as 20 fg of target DNA or 1.05 × 101 cfu of bacteria in pure culture, and highly specific, exhibiting no cross-reaction with Staphylococcus aureus, Escherichia coli, Listeria monocytogenes, Shigella, Enterobacter aerogenes, or Campylobacter jejuni. Importantly, Salmonella could be detected in milk and chicken breast at concentrations as low as 1.05 × 100 cfu/mL or 1.05 × 100 cfu/g after enrichment for 2 h and in eggs at 1.05 × 100 cfu/g after enrichment for 4 h. Furthermore, RPA was more sensitive than PCR, which requires a thermal cycling

  10. Rapid Detection of Small Movements with GNSS Doppler Observables

    Science.gov (United States)

    Hohensinn, Roland; Geiger, Alain

    2017-04-01

    High-alpine terrain reacts very sensitively to varying environmental conditions. As an example, increasing temperatures cause thawing of permafrost areas. This, in turn causes an increasing threat by natural hazards like debris flow (e.g. rock glaciers) or rockfalls. The Institute of Geodesy and Photogrammetry is contributing to alpine mass-movement monitoring systems in different project areas in the Swiss Alps. A main focus lies on providing geodetic mass-movement information derived from GNSS static solutions on a daily and a sub-daily basis, obtained with low-cost and autonomous GNSS stations. Another focus is set on rapidly providing reliable geodetic information in real-time i.e. for an integration in early warning systems. One way to achieve this is the estimation of accurate station velocities from observations of range rates, which can be obtained as Doppler observables from time derivatives of carrier phase measurements. The key for this method lies in a precise modeling of prominent effects contributing to the observed range rates, which are satellite velocity, atmospheric delay rates and relativistic effects. A suitable observation model is then devised, which accounts for these predictions. The observation model, combined with a simple kinematic movement model forms the basis for the parameter estimation. Based on the estimated station velocities, movements are then detected using a statistical test. To improve the reliablity of the estimated parameters, another spotlight is set on an on-line quality control procedure. We will present the basic algorithms as well as results from first tests which were carried out with a low-cost GPS L1 phase receiver. With a u-blox module and a sampling rate of 5 Hz, accuracies on the mm/s level can be obtained and velocities down to 1 cm/s can be detected. Reliable and accurate station velocities and movement information can be provided within seconds.

  11. Clinical Evaluation of the New High-Throughput Luminex NxTAG Respiratory Pathogen Panel Assay for Multiplex Respiratory Pathogen Detection.

    Science.gov (United States)

    Chen, Jonathan H K; Lam, Ho-Yin; Yip, Cyril C Y; Wong, Sally C Y; Chan, Jasper F W; Ma, Edmond S K; Cheng, Vincent C C; Tang, Bone S F; Yuen, Kwok-Yung

    2016-07-01

    A broad range of viral and bacterial pathogens can cause acute respiratory tract infection. For rapid detection of a broad respiratory pathogen spectrum, multiplex real-time PCR is ideal. This study evaluated the performance of the new Luminex NxTAG Respiratory Pathogen Panel (NxTAG-RPP) in comparison with the BioFire FilmArray Respiratory Panel (FA-RP) or singleplex real-time PCR as reference. A total of 284 clinical respiratory specimens and 3 influenza A/H7N9 viral culture samples were tested. All clinical specimens were processed and analyzed in parallel using NxTAG-RPP and the reference standard method. The H7N9 viral culture samples were tested using NxTAG-RPP only. Overall, the NxTAG-RPP demonstrated ≥93% sensitivity and specificity for all respiratory targets except human coronavirus OC43 (HCoV-OC43) and HCoV-HKU1. The H7N9 virus was detected by the influenza A virus matrix gene target, while other influenza A virus subtyping gene targets in the panel remained negative. Complete concordance between NxTAG-RPP and FA-RP was observed in 98.8% (318/322) of positive results (kappa = 0.92). Substantial agreement was found for most respiratory targets, but significant differences were observed in human metapneumovirus (P = 0.001) and parainfluenza virus type 3 (P = 0.031). NxTAG-RPP has a higher sample throughput than FA-RP (96 samples versus 1 sample per run) while the turnaround times for NxTAG-RPP and FA-RP were 5 h (up to 96 samples) and 1 h (for one sample), respectively. Overall, NxTAG-RPP demonstrated good diagnostic performance for most respiratory pathogens. The high sample throughput with reasonable turnaround time of this new assay makes it a suitable multiplex platform for routine screening of respiratory specimens in hospital-based laboratories. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  12. A lab-on-a-chip system with integrated sample preparation and loop-mediated isothermal amplification for rapid and quantitative detection of Salmonella spp. in food samples

    DEFF Research Database (Denmark)

    Sun, Yi; Than Linh, Quyen; Hung, Tran Quang

    2015-01-01

    and usually take a few hours to days to complete. In response to the demand for rapid on line or at site detection of pathogens, in this study, we describe for the first time an eight-chamber lab-on-a-chip (LOC) system with integrated magnetic beads-based sample preparation and loop-mediated isothermal...

  13. Phage-based surface plasmon resonance strategies for the detection of pathogens

    Science.gov (United States)

    Tawil, Nancy

    MRSA bacteriophages to gold, using several immobilization methods[2]. We found that mixed self-assembled monolayers (SAMs) of L-cysteine and MUA permitted oriented positioning of the phages, thus preserving their biofunctionality and their bacterial lysing efficiency. This was due to the formation of uniform cavity islands on the gold surfaces, permitting an oriented positioning of the phages, thus better exposing their recognition proteins towards the medium containing the bacterial hosts. T4 bacteriophages were then used to detect E. coli, while a novel, highly specific phage was isolated, characterized and used to detect MRSA[3]. We found that our technique, combined with the use of SPR permits label-free, real-time, specific, rapid and cost-effective detection of pathogens, for concentrations of 103 colony forming units/milliliter (CFU/mL), in less than 20 minutes. We then turned our attention towards the differential detection of community-acquired MRSA (CA-MRSA), hospital-acquired MRSA (HA-MRSA), methicillin susceptible S. aureus (MSSA), and borderline resistant oxacillin-resistant S. aureus (BORSA), using SPR[4]. We studied two hundred fifty Staphylococcus aureus clinical isolates to determine their susceptibilities to â- lactam antibiotics. A surface plasmon resonance (SPR) biosensor was used to differentiate among CA-MRSA, HA-MRSA, BORSA and MSSA strains by specifically detecting PBP2a, an altered penicilling binding proteins that confers resistance to S. aureus strains, on whole bacterial cells, without labeling, without recourse to PCR or enrichment steps. We found that the system permits, specific detection of pathogens for concentrations as low as 10 CFU/mL. This approach has the advantages of being simple and rapid, allowing for identification of resistant strains of Staphylococcus aureus up to 48 hours earlier than conventional microbiological techniques. This method could have a significant impact on hospital costs, effective infection control, and

  14. Rapid Detection of Human Norovirus in Frozen Raspberries.

    Science.gov (United States)

    Summa, Maija; Maunula, Leena

    2017-10-10

    Raspberries have lately caused several human norovirus (HuNoV) outbreaks in Europe. In this study, we developed and evaluated for HuNoV reverse transcription (RT)-PCR detection in frozen raspberries extraction methods that have equal sensitivity but are less time-consuming than widely used methods based on polyethylene glycol (PEG) precipitation and chloroform-butanol purification. One method was applied to stored frozen raspberries linked to previous HuNoV outbreaks and berries on sale. In the virus elution-based Method 1, sparkling water eluted viruses most efficiently from the berries. Method 2, based on direct nucleic acid extraction with minor PEG supplement, yielded the highest number of positive findings (4 out of 9) at low virus concentration level of 100 genome copies HuNoV genogroup II per 25 g raspberries. Both methods showed approximately equal sensitivity to a method including PEG precipitation and chloroform-butanol purification. Two naturally contaminated berry samples linked to HuNoV outbreaks in 2006 and 2009 were still positive for HuNoV genogroup I, but all berry products purchased from a local store remained negative for HuNoV. In conclusion, this study presents two efficient and rapid methods which can be used in urgent HuNoV outbreak investigations, since the results of the virus analysis are available in a few hours.

  15. Rapid detection of biothreat agents based on cellular machinery.

    Energy Technology Data Exchange (ETDEWEB)

    Lane, Todd W.; Gantt, Richard W.

    2004-12-01

    This research addresses rapid and sensitive identification of biological agents in a complex background. We attempted to devise a method by which the specificity of the cellular transcriptional machinery could be used to detect and identify bacterial bio-terror agents in a background of other organisms. Bacterial cells contain RNA polymerases and transcription factors that transcribe genes into mRNA for translation into proteins. RNA polymerases in conjunction with transcription factors recognize regulatory elements (promoters) upstream of the gene. These promoters are, in many cases, recognized by the polymerase and transcription factor combinations of one species only. We have engineered a plasmid, for Escherichia coli, containing the virA promoter from the target species Shigella flexneri. This promoter was fused to a reporter gene Green Fluorescent Protein (GFP). In theory the indicator strain (carrying the plasmid) is mixed with the target strain and the two are lysed. The cellular machinery from both cells mixes and the GFP is produced. This report details the results of testing this system.

  16. Detection of bacterial pathogens including potential new species in human head lice from Mali.

    Science.gov (United States)

    Amanzougaghene, Nadia; Fenollar, Florence; Sangaré, Abdoul Karim; Sissoko, Mahamadou S; Doumbo, Ogobara K; Raoult, Didier; Mediannikov, Oleg

    2017-01-01

    In poor African countries, where no medical and biological facilities are available, the identification of potential emerging pathogens of concern at an early stage is challenging. Head lice, Pediculus humanus capitis, have a short life, feed only on human blood and do not transmit pathogens to their progeny. They are, therefore, a perfect tool for the xenodiagnosis of current or recent human infection. This study assessed the occurrence of bacterial pathogens from head lice collected in two rural villages from Mali, where a high frequency of head lice infestation had previously been reported, using molecular methods. Results show that all 600 head lice, collected from 117 individuals, belonged to clade E, specific to West Africa. Bartonella quintana, the causative agent of trench fever, was identified in three of the 600 (0.5%) head lice studied. Our study also shows, for the first time, the presence of the DNA of two pathogenic bacteria, namely Coxiella burnetii (5.1%) and Rickettsia aeschlimannii (0.6%), detected in human head lice, as well as the DNA of potential new species from the Anaplasma and Ehrlichia genera of unknown pathogenicity. The finding of several Malian head lice infected with B. quintana, C. burnetii, R. aeschlimannii, Anaplasma and Ehrlichia is alarming and highlights the need for active survey programs to define the public health consequences of the detection of these emerging bacterial pathogens in human head lice.

  17. Scientists Detect Radio Emission from Rapidly Rotating Cosmic Dust Grains

    Science.gov (United States)

    2001-11-01

    Astronomers have made the first tentative observations of a long-speculated, but never before detected, source of natural radio waves in interstellar space. Data from the National Science Foundation's 140 Foot Radio Telescope at the National Radio Astronomy Observatory in Green Bank, W.Va., show the faint, tell-tale signals of what appear to be dust grains spinning billions of times each second. This discovery eventually could yield a powerful new tool for understanding the interstellar medium - the immense clouds of gas and dust that populate interstellar space. The NRAO 140 Foot Radio Telescope The NRAO 140-Foot Radio Telescope "What we believe we have found," said Douglas P. Finkbeiner of Princeton University's Department of Astrophysics, "is the first hard evidence for electric dipole emission from rapidly rotating dust grains. If our studies are confirmed, it will be the first new source of continuum emission to be conclusively identified in the interstellar medium in nearly the past 20 years." Finkbeiner believes that these emissions have the potential in the future of revealing new and exciting information about the interstellar medium; they also may help to refine future studies of the Cosmic Microwave Background Radiation. The results from this study, which took place in spring 1999, were accepted for publication in Astrophysical Journal. Other contributors to this paper include David J. Schlegel, department of astrophysics, Princeton University; Curtis Frank, department of astronomy, University of Maryland; and Carl Heiles, department of astronomy, University of California at Berkeley. "The idea of dust grains emitting radiation by rotating is not new," comments Finkbeiner, "but to date it has been somewhat speculative." Scientists first proposed in 1957 that dust grains could emit radio signals, if they were caused to rotate rapidly enough. It was believed, however, that these radio emissions would be negligibly small - too weak to be of any impact to

  18. Rapid Detection of Microorganisms Based on Active and Passive Modes of QCM

    Directory of Open Access Journals (Sweden)

    Zdeněk Farka

    2014-12-01

    Full Text Available Label-free immunosensors are well suited for detection of microorganisms because of their fast response and reasonable sensitivity comparable to infection doses of common pathogens. Active (lever oscillator and frequency counter and passive (impedance analyzer modes of quartz crystal microbalance (QCM were used and compared for rapid detection of three strains of E. coli. Different approaches for antibody immobilization were compared, the immobilization of reduced antibody using Sulfo‑SMCC was most effective achieving the limit of detection (LOD 8 × 104 CFU·mL−1 in 10 min. For the passive mode, software evaluating impedance characteristics in real-time was developed and used. Almost the same results were achieved using both active and passive modes confirming that the sensor properties are not limited by the frequency evaluation method but mainly by affinity of the antibody. Furthermore, reference measurements were done using surface plasmon resonance. Effect of condition of cells on signal was observed showing that cells ruptured by ultrasonication provided slightly higher signal changes than intact microbes.

  19. Development of loop-mediated isothermal amplification for rapid detection of Entamoeba histolytica.

    Science.gov (United States)

    Rivera, Windell L; Ong, Vanissa A

    2013-06-01

    To develop a loop-mediated isothermal amplification (LAMP) assay for the detection of Entamoeba histolytica E. histolytica, the causative agent of amebiasis. The LAMP primer set was designed from E. histolytica hemolysin gene HLY6. Genomic DNA of E. histolytica trophozoites strain HK9 was used to optimize the LAMP mixture and conditions. Amplification of DNA in the LAMP mixture was monitored through visual inspection for turbidity of the LAMP mix as well as addition of fluorescent dye. Positive LAMP reactions turned turbid while negative ones remained clear. Upon addition of a fluorescent dye, all positive reactions turned green while the negative control remained orange under ambient light. After electrophoresis in 1.5% agarose gels, a ladder of multiple bands of different sizes can be observed in positive samples while no bands were detected in the negative control. The sensitivity of the assay was found to be 5 parasites per reaction which corresponds to approximately 15.8 ng/μ L DNA. The specificity of the assay was verified by the absence of amplified products when DNA from other gastrointestinal parasites such as the morphologically similar but non-pathogenic species, Entamoeba dispar 39, and other diarrhea-causing organisms such as Blastocystis hominis and Escherichia coli were used. The LAMP assay we have developed enables the detection of E. histolytica with rapidity and ease, therefore rendering it is suitable for laboratory and field diagnosis of amebiasis. Copyright © 2013 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  20. Rapid detection of Listeria monocytogenes in milk using confocal micro-Raman spectroscopy and chemometric analysis.

    Science.gov (United States)

    Wang, Junping; Xie, Xinfang; Feng, Jinsong; Chen, Jessica C; Du, Xin-jun; Luo, Jiangzhao; Lu, Xiaonan; Wang, Shuo

    2015-07-02

    Listeria monocytogenes is a facultatively anaerobic, Gram-positive, rod-shape foodborne bacterium causing invasive infection, listeriosis, in susceptible populations. Rapid and high-throughput detection of this pathogen in dairy products is critical as milk and other dairy products have been implicated as food vehicles in several outbreaks. Here we evaluated confocal micro-Raman spectroscopy (785 nm laser) coupled with chemometric analysis to distinguish six closely related Listeria species, including L. monocytogenes, in both liquid media and milk. Raman spectra of different Listeria species and other bacteria (i.e., Staphylococcus aureus, Salmonella enterica and Escherichia coli) were collected to create two independent databases for detection in media and milk, respectively. Unsupervised chemometric models including principal component analysis and hierarchical cluster analysis were applied to differentiate L. monocytogenes from Listeria and other bacteria. To further evaluate the performance and reliability of unsupervised chemometric analyses, supervised chemometrics were performed, including two discriminant analyses (DA) and soft independent modeling of class analogies (SIMCA). By analyzing Raman spectra via two DA-based chemometric models, average identification accuracies of 97.78% and 98.33% for L. monocytogenes in media, and 95.28% and 96.11% in milk were obtained, respectively. SIMCA analysis also resulted in satisfied average classification accuracies (over 93% in both media and milk). This Raman spectroscopic-based detection of L. monocytogenes in media and milk can be finished within a few hours and requires no extensive sample preparation. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Rapid PCR-based assay for Sclerotinia sclerotiorum detection on soybean seeds

    Directory of Open Access Journals (Sweden)

    Edilaine Mauricia Gelinski Grabicoski

    2015-02-01

    Full Text Available Caused by Sclerotinia sclerotiorum, white mold is an important seed-transmitted disease of soybean (Glycine max. Incubation-based methods available for the detection and quantification of seed-borne inoculum such as the blotter test, paper roll and Neon-S assay are time-consuming, laborious, and not always sensitive. In this study, we developed and evaluated a molecular assay for the detection of S. sclerotiorum in soybean seeds using a species-specific PCR (polymerase chain reaction primer set and seed soaking (without DNA extraction for up to 72 h. The PCR products were amplified in all the samples infected with the pathogen, but not in the other samples of plant material or the other seed-borne fungi DNA. The minimum amount of DNA detected was 10 pg, or one artificially infested seed in a 400-seed sample (0.25 % fungal incidence and one naturally infected seed in a 300-seed sample (0.33 % incidence. The PCR-based assay was rapid (< 9 h, did not require DNA extraction and was very sensitive.

  2. Improved Multiplex Polymerase Chain Reaction for Rapid Staphylococcus Aureus Detection in Meat and Milk Matrices

    Directory of Open Access Journals (Sweden)

    Šramková Zuzana

    2016-06-01

    Full Text Available Staphylococcal food poisoning represents one of the most frequently occurring intoxications, caused by staphylococcal enterotoxins (SE-s and staphylococcal enterotoxin-like proteins (SEl-s. Therefore, there is a need for rapid, sensitive and specific detection method for this human pathogen and its toxin genes in food matrices. The present work is focused on Staphylococcus aureus detection by a nonaplex polymerase chain reaction, which targets the 23S rRNA gene for identification of S. aureus at the species level, genes for classical SE-s (SEA, SEC, SED, new SE-s (SEH, SEI, SEl-s (SEK, SEL and tsst-1 gene (toxic shock syndrome toxin. Primers were properly designed to avoid undesirable interactions and to create a reliably identifiable profile of amplicons when visualized in agarose gel. According to obtained results, this approach is able to reach the detection sensitivity of 12 colony forming units from milk and meat matrices without prior culturing and DNA extraction.

  3. Rapid detection of Pseudomonas aeruginosa biomarkers in biological fluids using surface-enhanced Raman scattering

    Science.gov (United States)

    Wu, Xiaomeng; Chen, Jing; Zhao, Yiping; Zughaier, Susu M.

    2014-05-01

    Pseudomonas aeruginosa (PA) is an opportunistic pathogen that causes major infection not only in Cystic Fibrosis patients but also in chronic obstructive pulmonary disease and in critically ill patients in intensive care units. Successful antibiotic treatment of the infection relies on accurate and rapid identification of the infectious agents. Conventional microbiological detection methods usually take more than 3 days to obtain accurate results. We have developed a rapid diagnostic technique based on surface-enhanced Raman scattering to directly identify PA from biological fluids. P. aeruginosa strains, PAO1 and PA14, are cultured in lysogeny broth, and the SERS spectra of the broth show the signature Raman peaks from pyocyanin and pyoverdine, two major biomarkers that P. aeruginosa secretes during its growth, as well as lipopolysaccharides. This provides the evidence that the presence of these biomarkers can be used to indicate P. aeruginosa infection. A total of 22 clinical exhaled breath condensates (EBC) samples were obtained from subjects with CF disease and from non-CF healthy donors. SERS spectra of these EBC samples were obtained and further analyzed by both principle component analysis and partial least square-discriminant analysis (PLS-DA). PLS-DA can discriminate the samples with P. aeruginosa infection and the ones without P. aeruginosa infection at 99.3% sensitivity and 99.6% specificity. In addition, this technique can also discriminate samples from subject with CF disease and healthy donor with 97.5% sensitivity and 100% specificity. These results demonstrate the potential of using SERS of EBC samples as a rapid diagnostic tool to detect PA infection.

  4. Rapid identification of pathogens in blood cultures with a modified fluorescence in situ hybridization assay

    NARCIS (Netherlands)

    Peters, Remco P. H.; van Agtmael, Michiel A.; Simoons-Smit, Alberdina M.; Danner, Sven A.; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.

    2006-01-01

    We evaluated a modified fluorescence in situ hybridization (FISH) assay for rapid ( <1 h) identification of microorganisms in growth-positive blood cultures. The results were compared to those of the standard FISH technique and conventional culturing. The rapid identification of microorganisms with

  5. Spatial sampling to detect an invasive pathogen outside of an eradication zone.

    Science.gov (United States)

    Demon, I; Cunniffe, N J; Marchant, B P; Gilligan, C A; van den Bosch, F

    2011-06-01

    Invasive pathogens are known to cause major damage to the environments they invade. Effective control of such invasive pathogens depends on early detection. In this paper we focus on sampling with the aim of detecting an invasive pathogen. To that end, we introduce the concept of optimized spatial sampling, using spatial simulated annealing, to plant pathology. It has been mathematically proven (15) that this optimization method converges to the optimum allocation of sampling points that give the largest detection probability. We show the benefits of the method to plant pathology by (i) first illustrating that optimized spatial sampling can easily be applied for disease detection, and then we show that (ii) combining it with a spatially explicit epidemic model, we can develop optimum sample schemes, i.e., optimum locations to sample that maximize the probability of detecting an invasive pathogen. This method is then used as baseline against which other sampling methods can be tested for their accuracy. For the specific example case of this paper, we test (i) random sampling, (ii) stratified sampling as well as (iii) sampling based on the output of the simulation model (using the most frequently infected hosts as sample points), and (iv) sampling the hosts closest to the outbreak point.

  6. Rapid Evolution of Virulence and Drug Resistance in the Emerging Zoonotic Pathogen Streptococcus suis

    NARCIS (Netherlands)

    Holden, M.T.G.; Hauser, H.; Sanders, M.; Hoa Ngo, Thi; Cherevach, I.; Cronin, A.; Goodhead, I.; Mungall, K.; Quail, M.A.; Price, C.; Rabbinowitsch, E.; Sharp, S.; Croucher, N.; Chieu, Tran Bich; Nguyen, Thi Hoang Mai; To, Song Diep; Nguyen, Tran Chinh; Kehoe, M.; Leigh, J.A.; Ward, P.N.; Dowson, C.G.; Whatmore, A.M.; Chanter, N.; Iversen, P.; Gottschalk, M.; Slater, J.D.; Smith, H.E.; Spratt, B.G.; Jianguo, Xu; Changyun, Ye; Bentley, S.; Barrell, B.G.; Schultsz, C.; Maskell, D.J.; Parkhill, J.

    2009-01-01

    Background - Streptococcus suis is a zoonotic pathogen that infects pigs and can occasionally cause serious infections in humans. S. suis infections occur sporadically in human Europe and North America, but a recent major outbreak has been described in China with high levels of mortality. The

  7. Time is of essence; rapid identification of veterinary pathogens using MALDI TOF

    DEFF Research Database (Denmark)

    Nonnemann, Bettina; Dalsgaard, Inger; Pedersen, Karl

    species in the database. Since commercial MALDI-TOF spectral database providers mainly focus on human pathogens there is a need for improving the datasets in order to extend the applicability of the technique to the veterinary field. Here we report upgrading of a commercial MALDI-TOF database...

  8. Simultaneous Detection of Multiple Fish Pathogens Using a Naked-Eye Readable DNA Microarray

    Directory of Open Access Journals (Sweden)

    King-Jung Lin

    2012-02-01

    Full Text Available We coupled 16S rDNA PCR and DNA hybridization technology to construct a microarray for simultaneous detection and discrimination of eight fish pathogens (Aeromonas hydrophila, Edwardsiella tarda, Flavobacterium columnare, Lactococcus garvieae, Photobacterium damselae, Pseudomonas anguilliseptica, Streptococcus iniae and Vibrio anguillarum commonly encountered in aquaculture. The array comprised short oligonucleotide probes (30 mer complementary to the polymorphic regions of 16S rRNA genes for the target pathogens. Targets annealed to the microarray probes were reacted with streptavidin-conjugated alkaline phosphatase and nitro blue tetrazolium/5-bromo-4-chloro-3′-indolylphosphate, p-toluidine salt (NBT/BCIP, resulting in blue spots that are easily visualized by the naked eye. Testing was performed against a total of 168 bacterial strains, i.e., 26 representative collection strains, 81 isolates of target fish pathogens, and 61 ecologically or phylogenetically related strains. The results showed that each probe consistently identified its corresponding target strain with 100% specificity. The detection limit of the microarray was estimated to be in the range of 1 pg for genomic DNA and 103 CFU/mL for pure pathogen cultures. These high specificity and sensitivity results demonstrate the feasibility of using DNA microarrays in the diagnostic detection of fish pathogens.

  9. [Performance of Cholera-SMART and Pathogen-Detection-Kit in the quick diagnosis of cholera].

    Science.gov (United States)

    Bolaños, Hilda María; Acuña, María Teresa; Serrano, Ana María; Obando, Xinia; Mairena, Hazel; Cháves, Lorena; Sandí, Flor; Rodríguez, Gina; Tamplin, Mark L; Pérez, Enrique; Campos, Elena

    2004-10-01

    To compare the performance of two rapid systems for the diagnosis of cholera with the culture method, and to propose a strategy for improving the specificity and sensitivity of these systems and reducing the costs involved in making a diagnosis. The following institutions participated in the study: the National Bacteriology Referral Center (Centro Nacional de Referencia en Bacteriologia, CNRB) of the Costa Rican Institute for Research and Teaching in Nutrition and Health (Instituto Costarricense de Investigacion y Ensenanza en Nutricion y Salud, INCIENSA) and various hospitals in the provinces of Alajuela, Guanacaste and San Jose, in Costa Rica. A total of 237 feces samples were used to asses the performance of two tests for the rapid detection of Vibrio cholerae 01: the Pathogen Detection Kit (PDK, Intelligent Monitoring Systems, Gainesville, Florida, USA) and Cholera-SMART (New Horizons Diagnostics Corp., Columbia, Maryland, USA), both when applied directly (direct SMART and direct PDK) and when applied to specimens cultured in broth-enriched medium for 6 hours (SMART-6 and CPK-6) and for 18 hours (SMART-18 and PDK-18) at 37 degrees C in alkaline peptone water. Liquid and partially formed stools were cultured and examined by means of the rapid direct test; when the initial result was negative, the tests were repeated after culture for periods of 6 and 18 hours. Rectal and fecal swabs were obtained from feces cultured in enriched-broth medium for 6 and 18 hours. In addition, we studied the sensitivity of the rapid testing systems by using pure cultures of V. cholerae 01 (strain SOS-833, CNRB, Costa Rica) that were incubated for 18 to 24 hours, and we assessed the usefulness of observing motility under the microscope in order to rationalize the use of rapid methods. The sensitivity of the direct SMART test and of the direct PDK test was 100% when samples obtained from liquid and partially formed stools and from the intestinal contents of dead bodies were used. With

  10. Taxonomer: an interactive metagenomics analysis portal for universal pathogen detection and host mRNA expression profiling.

    Science.gov (United States)

    Flygare, Steven; Simmon, Keith; Miller, Chase; Qiao, Yi; Kennedy, Brett; Di Sera, Tonya; Graf, Erin H; Tardif, Keith D; Kapusta, Aurélie; Rynearson, Shawn; Stockmann, Chris; Queen, Krista; Tong, Suxiang; Voelkerding, Karl V; Blaschke, Anne; Byington, Carrie L; Jain, Seema; Pavia, Andrew; Ampofo, Krow; Eilbeck, Karen; Marth, Gabor; Yandell, Mark; Schlaberg, Robert

    2016-05-26

    High-throughput sequencing enables unbiased profiling of microbial communities, universal pathogen detection, and host response to infectious diseases. However, computation times and algorithmic inaccuracies have hindered adoption. We present Taxonomer, an ultrafast, web-tool for comprehensive metagenomics data analysis and interactive results visualization. Taxonomer is unique in providing integrated nucleotide and protein-based classification and simultaneous host messenger RNA (mRNA) transcript profiling. Using real-world case-studies, we show that Taxonomer detects previously unrecognized infections and reveals antiviral host mRNA expression profiles. To facilitate data-sharing across geographic distances in outbreak settings, Taxonomer is publicly available through a web-based user interface. Taxonomer enables rapid, accurate, and interactive analyses of metagenomics data on personal computers and mobile devices.

  11. Molecular approaches for biosurveillance of the cucurbit downy mildew pathogen, Pseudoperonospora cubensis

    Science.gov (United States)

    Globalization has allowed for rapid movement of plant pathogens that threaten food security. Successful disease management largely depends in timely and accurate detection of plant pathogens causing epidemics. Thus, biosurveillance of epidemic plant pathogens such as Pseudoperonospora cubensis, the ...

  12. Evaluation of Rapid Molecular Detection Assays for Salmonella in Challenging Food Matrices at Low Inoculation Levels and Using Difficult-to-Detect Strains.

    Science.gov (United States)

    Ryan, Gina; Roof, Sherry; Post, Laurie; Wiedmann, Martin

    2015-09-01

    Assays for detection of foodborne pathogens are generally initially evaluated for performance in validation studies carried out according to guidelines provided by validation schemes (e.g., AOAC International or the International Organization for Standardization). End users often perform additional validation studies to evaluate the performance of assays in specific matrices (e.g., specific foods or raw material streams of interest) and with specific pathogen strains. However, these types of end-user validations are typically not well defined. This study was conducted to evaluate a secondary end user validation of four AOAC-validated commercial rapid detection assays (an isothermal nucleic acid amplification, an immunoassay, and two PCR-based assays) for their ability to detect Salmonella in two challenging matrices (dry pet food and dark chocolate). Inclusivity was evaluated with 68 diverse Salmonella strains at low population levels representing the limit of detection (LOD) for each assay. One assay detected all strains at the LOD, two assays detected multiple strains only at 10 times the LOD, and the fourth assay failed to detect two strains (Salmonella bongori and S. enterica subsp. houtenae) even at 1,000 times the LOD; this assay was not further evaluated. The three remaining assays were subsequently evaluated for their ability to detect five selected Salmonella strains in food samples contaminated at fractional levels. Unpaired comparisons revealed no significant difference between the results for each given assay and the results obtained with the reference assay. However, analysis of paired culture-confirmed results revealed assay false-negative rates of 4 to 26% for dry pet food and 12 to 16% for dark chocolate. Overall, our data indicate that rapid assays may have high false-negative rates when performance is evaluated under challenging conditions, including low-moisture matrices, strains that are difficult to detect, injured cells, and low inoculum

  13. Development of an Automated Microfluidic System for DNA Collection, Amplification, and Detection of Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Hagan, Bethany S.; Bruckner-Lea, Cynthia J.

    2002-12-01

    This project was focused on developing and testing automated routines for a microfluidic Pathogen Detection System. The basic pathogen detection routine has three primary components; cell concentration, DNA amplification, and detection. In cell concentration, magnetic beads are held in a flow cell by an electromagnet. Sample liquid is passed through the flow cell and bacterial cells attach to the beads. These beads are then released into a small volume of fluid and delivered to the peltier device for cell lysis and DNA amplification. The cells are lysed during initial heating in the peltier device, and the released DNA is amplified using polymerase chain reaction (PCR) or strand displacement amplification (SDA). Once amplified, the DNA is then delivered to a laser induced fluorescence detection unit in which the sample is detected. These three components create a flexible platform that can be used for pathogen detection in liquid and sediment samples. Future developments of the system will include on-line DNA detection during DNA amplification and improved capture and release methods for the magnetic beads during cell concentration.

  14. Bacteriophages for detection and control of bacterial pathogens in food and food-processing environment.

    Science.gov (United States)

    Brovko, Lubov Y; Anany, Hany; Griffiths, Mansel W

    2012-01-01

    This chapter presents recent advances in bacteriophage research and their application in the area of food safety. Section 1 describes general facts on phage biology that are relevant to their application for control and detection of bacterial pathogens in food and environmental samples. Section 2 summarizes the recently acquired data on application of bacteriophages to control growth of bacterial pathogens and spoilage organisms in food and food-processing environment. Section 3 deals with application of bacteriophages for detection and identification of bacterial pathogens. Advantages of bacteriophage-based methods are presented and their shortcomings are discussed. The chapter is intended for food scientist and food product developers, and people in food inspection and health agencies with the ultimate goal to attract their attention to the new developing technology that has a tremendous potential in providing means for producing wholesome and safe food. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Detection of multiple potentially pathogenic bacteria in Matang mangrove estuaries, Malaysia.

    Science.gov (United States)

    Ghaderpour, Aziz; Mohd Nasori, Khairul Nazrin; Chew, Li Lee; Chong, Ving Ching; Thong, Kwai Lin; Chai, Lay Ching

    2014-06-15

    The deltaic estuarine system of the Matang Mangrove Forest Reserve of Malaysia is a site where several human settlements and brackish water aquaculture have been established. Here, we evaluated the level of fecal indicator bacteria (FIB) and the presence of potentially pathogenic bacteria in the surface water and sediments. Higher levels of FIB were detected at downstream sampling sites from the fishing village, indicating it as a possible source of anthropogenic pollution to the estuary. Enterococci levels in the estuarine sediments were higher than in the surface water, while total coliforms and E. coli in the estuarine sediments were not detected in all samples. Also, various types of potentially pathogenic bacteria, including Klebsiella pneumoniae, Serratia marcescens and Enterobacter cloacae were isolated. The results indicate that the Matang estuarine system is contaminated with various types of potential human bacterial pathogens which might pose a health risk to the public. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Breakage-fusion-bridge cycles and large insertions contribute to the rapid evolution of accessory chromosomes in a fungal pathogen.

    Science.gov (United States)

    Croll, Daniel; Zala, Marcello; McDonald, Bruce A

    2013-06-01

    Chromosomal rearrangements are a major driver of eukaryotic genome evolution, affecting speciation, pathogenicity and cancer progression. Changes in chromosome structure are often initiated by mis-repair of double-strand breaks in the DNA. Mis-repair is particularly likely when telomeres are lost or when dispersed repeats misalign during crossing-over. Fungi carry highly polymorphic chromosomal complements showing substantial variation in chromosome length and number. The mechanisms driving chromosome polymorphism in fungi are poorly understood. We aimed to identify mechanisms of chromosomal rearrangements in the fungal wheat pathogen Zymoseptoria tritici. We combined population genomic resequencing and chromosomal segment PCR assays with electrophoretic karyotyping and resequencing of parents and offspring from experimental crosses to show that this pathogen harbors a highly diverse complement of accessory chromosomes that exhibits strong global geographic differentiation in numbers and lengths of chromosomes. Homologous chromosomes carried highly differentiated gene contents due to numerous insertions and deletions. The largest accessory chromosome recently doubled in length through insertions totaling 380 kb. Based on comparative genomics, we identified the precise breakpoint locations of these insertions. Nondisjunction during meiosis led to chromosome losses in progeny of three different crosses. We showed that a new accessory chromosome emerged in two viable offspring through a fusion between sister chromatids. Such chromosome fusion is likely to initiate a breakage-fusion-bridge (BFB) cycle that can rapidly degenerate chromosomal structure. We suggest that the accessory chromosomes of Z. tritici originated mainly from ancient core chromosomes through a degeneration process that included BFB cycles, nondisjunction and mutational decay of duplicated sequences. The rapidly evolving accessory chromosome complement may serve as a cradle for adaptive evolution in

  17. Rapid, in situ detection of Agrobacterium tumefaciens attachment to leaf tissue.

    Science.gov (United States)

    Simmons, Christopher W; Nitin, N; Vandergheynst, Jean S

    2012-01-01

    Attachment of the plant pathogen Agrobacterium tumefaciens to host plant cells is an early and necessary step in plant transformation and agroinfiltration processes. However, bacterial attachment behavior is not well understood in complex plant tissues. Here we developed an imaging-based method to observe and quantify A. tumefaciens attached to leaf tissue in situ. Fluorescent labeling of bacteria with nucleic acid, protein, and vital dyes was investigated as a rapid alternative to generating recombinant strains expressing fluorescent proteins. Syto 16 green fluorescent nucleic acid stain was found to yield the greatest signal intensity in stained bacteria without affecting viability or infectivity. Stained bacteria retained the stain and were detectable over 72 h. To demonstrate in situ detection of attached bacteria, confocal fluorescent microscopy was used to image A. tumefaciens in sections of lettuce leaf tissue following vacuum-infiltration with labeled bacteria. Bacterial signals were associated with plant cell surfaces, suggesting detection of bacteria attached to plant cells. Bacterial attachment to specific leaf tissues was in agreement with known leaf tissue competencies for transformation with Agrobacterium. Levels of bacteria attached to leaf cells were quantified over time post-infiltration. Signals from stained bacteria were stable over the first 24 h following infiltration but decreased in intensity as bacteria multiplied in planta. Nucleic acid staining of A. tumefaciens followed by confocal microscopy of infected leaf tissue offers a rapid, in situ method for evaluating attachment of A. tumefaciens' to plant expression hosts and a tool to facilitate management of transient expression processes via agroinfiltration. Copyright © 2012 American Institute of Chemical Engineers (AIChE).

  18. Rapid Methods for detection of Veterinary Drug residues in Meat

    Directory of Open Access Journals (Sweden)

    Chandan

    2010-10-01

    Full Text Available The use of substances having hormonal or thyreostatic action as well as b-agonists is banned in many countries. However, sometimes forbidden drugs may be added to feeds for illegal administration to farm animals for promoting increased muscle development or increased water retention and thus obtain an economical benefit. The result is a fraudulent overweight of meat but, what is worse, residues of these substances may remain in meat and may pose a real threat to the consumer either through exposure to the residues, transfer of antibiotic resistance or allergy risk. This has exerted a great concern among the meat consumers. The control of the absence of these forbidden substances in animal foods and feeds is regulated in the European Union by Directive 96/23/EC on measures to monitor certain substances and residues in live animals and animal products. Analytical methodology, including criteria for identification and confirmation, for the monitoring of compliance was also given in Decisions 93/256/EEC and 93/257/EEC. More recently, Decision 2002/657/EC provided rules for the analytical methods to be used in testing of official samples. New substances with anabolic properties are being detected year by year increasing the list of forbidden compounds to be tested. Furthermore, the extended practice consisting in the use of “cocktails” (mixtures of low amounts of several substances that exert a synergistic effect to have a similar growth promotion, reduces the margin for an effective analytical detection. Thus, the evolution of the “black market” is making really difficult to have an effective analytical control of the residues of these substances in foods of animal origin. Control laboratories must face an increasing demand of analysis like the growing number of residues to be analysed in different types of samples, the strict guidelines for analytical methodologies according to the latest Directives, the increased costs of such new

  19. Multiplex surface plasmon resonance imaging platform for label-free detection of foodborne pathogens

    Science.gov (United States)

    Salmonellae are among the leading causes of foodborne outbreaks in the United States, and more rapid and efficient detection methods are needed. Surface plasmon resonance imaging (SPRi) is an emerging optical technique, which allows for rapid and label-free screening of multiple targets simultaneous...

  20. A tissue-scale gradient of hydrogen peroxide mediates rapid wound detection in zebrafish.

    Science.gov (United States)

    Niethammer, Philipp; Grabher, Clemens; Look, A Thomas; Mitchison, Timothy J

    2009-06-18

    Barrier structures (for example, epithelia around tissues and plasma membranes around cells) are required for internal homeostasis and protection from pathogens. Wound detection and healing represent a dormant morphogenetic program that can be rapidly executed to restore barrier integrity and tissue homeostasis. In animals, initial steps include recruitment of leukocytes to the site of injury across distances of hundreds of micrometres within minutes of wounding. The spatial signals that direct this immediate tissue response are unknown. Owing to their fast diffusion and versatile biological activities, reactive oxygen species, including hydrogen peroxide (H(2)O(2)), are interesting candidates for wound-to-leukocyte signalling. Here we probe the role of H(2)O(2) during the early events of wound responses in zebrafish larvae expressing a genetically encoded H(2)O(2) sensor. This reporter revealed a sustained rise in H(2)O(2) concentration at the wound margin, starting approximately 3 min after wounding and peaking at approximately 20 min, which extended approximately 100-200 microm into the tail-fin epithelium as a decreasing concentration gradient. Using pharmacological and genetic inhibition, we show that this gradient is created by dual oxidase (Duox), and that it is required for rapid recruitment of leukocytes to the wound. This is the first observation, to our knowledge, of a tissue-scale H(2)O(2) pattern, and the first evidence that H(2)O(2) signals to leukocytes in tissues, in addition to its known antiseptic role.

  1. Low-fouling surface plasmon resonance biosensor for multi-step detection of foodborne bacterial pathogens in complex food samples.

    Science.gov (United States)

    Vaisocherová-Lísalová, Hana; Víšová, Ivana; Ermini, Maria Laura; Špringer, Tomáš; Song, Xue Chadtová; Mrázek, Jan; Lamačová, Josefína; Scott Lynn, N; Šedivák, Petr; Homola, Jiří

    2016-06-15

    Recent outbreaks of foodborne illnesses have shown that foodborne bacterial pathogens present a significant threat to public health, resulting in an increased need for technologies capable of fast and reliable screening of food commodities. The optimal method of pathogen detection in foods should: (i) be rapid, specific, and sensitive; (ii) require minimum sample preparation; and (iii) be robust and cost-effective, thus enabling use in the field. Here we report the use of a SPR biosensor based on ultra-low fouling and functionalizable poly(carboxybetaine acrylamide) (pCBAA) brushes for the rapid and sensitive detection of bacterial pathogens in crude food samples utilizing a three-step detection assay. We studied both the surface resistance to fouling and the functional capabilities of these brushes with respect to each step of the assay, namely: (I) incubation of the sensor with crude food samples, resulting in the capture of bacteria by antibodies immobilized to the pCBAA coating, (II) binding of secondary biotinylated antibody (Ab2) to previously captured bacteria, and (III) binding of streptavidin-coated gold nanoparticles to the biotinylated Ab2 in order to enhance the sensor response. We also investigated the effects of the brush thickness on the biorecognition capabilities of the gold-grafted functionalized pCBAA coatings. We demonstrate that pCBAA-compared to standard low-fouling OEG-based alkanethiolate self-assemabled monolayers-exhibits superior surface resistance regarding both fouling from complex food samples as well as the non-specific binding of S-AuNPs. We further demonstrate that a SPR biosensor based on a pCBAA brush with a thickness as low as 20 nm was capable of detecting E. coli O157:H7 and Salmonella sp. in complex hamburger and cucumber samples with extraordinary sensitivity and specificity. The limits of detection for the two bacteria in cucumber and hamburger extracts were determined to be 57 CFU/mL and 17 CFU/mL for E. coli and 7.4 × 10

  2. Rapid detection of CWD PrP: comparison of tests designed for the detection of BSE or scrapie.

    Science.gov (United States)

    Blasche, T; Schenck, E V; Balachandran, A; Miller, M W; Langenberg, J; Frölich, K; Steinbach, F

    2012-10-01

    Chronic wasting disease (CWD) is a transmissible spongiform encephalopathy (TSE) mainly affecting cervids in North America. The accumulation of an abnormal form of host-encoded prion protein (PrP(CWD) ) in the CNS and lymphoid tissues is characteristic of the disease and known to be caused by pathogenic prion proteins (PrP(res) ), which are thought to be transmitted mainly by contact with body fluids, such like saliva. Species known to be naturally infected by CWD include Rocky Mountain elk (Cervus elaphus nelsoni), white-tailed deer (Odocoileus virginianus) and mule deer (Odocoileus hemionus). Recently, large-scale disease eradication or control programs have been attempted to curtail the spread of disease. But reports of diseased free-ranging and farmed cervids in many locations in the USA and Canada are still continuing. The goal of this study was to find sensitive rapid test systems that are reliably able to detect CWD-associated PrP(CWD) in cervids, thereby reviewing an important control tool in case the disease spreads further and reaches Europe. Seven tests, originally developed for the detection of other TSE diseases such as Scrapie and bovine spongiform encephalopathy, including two Western blots, four enzyme-linked immunosorbent assays (ELISAs), and one lateral flow device, were included in this study. All seven tests evaluated were able to detect pathogenic prion proteins (PrP(CWD) ) in Northern American infected animals and distinguish physiologic prion protein (PrP(c) ) in brainstem (obex region) and lymph node samples from North American and European cervids, respectively. However, the specificity and sensitivity of the tests differed significantly. Highly sensitive tests for the detection of prion proteins are an important tool both for the design of effective disease surveillance and control strategies and the safety of the food chain. Thus, this study contributes to the emergency preparedness against CWD. © 2011 Crown Copyright. Reproduced with

  3. Improvement of methods for the detection of Gram-negative foodborne pathogens

    NARCIS (Netherlands)

    Margot, H.F.T.

    2016-01-01

    Foodborne diseases are a major source of morbidity and mortality worldwide. In most cases, these diseases are caused by contaminated food products, but transmission can also subsequently occur via person to person contact. The ability to detect the pathogens is an important aspect in the

  4. Indirect immunofluorescence colony staining method for detecting bacterial pathogens of tomato

    NARCIS (Netherlands)

    Veena, M.S.; Vuurde, van J.W.L.

    2002-01-01

    An indirect immunoflouorescence colony staining method was developed for the detection of important seed-borne bacterial pathogens of tomato. The method involves the use of specific antiserum for initial binding of target bacteria and visualization of positive colonies with a commercially available

  5. A rapid inoculation technique for assessing pathogenicity of Fusarium oxysporum f. sp. niveum and F. o. melonis on Cucurbits

    Science.gov (United States)

    Freeman, S.; Rodriguez, R.J.

    1993-01-01

    A continuous-dip inoculation technique for rapid assessment of pathogenicity of Fusarium oxysporum f. sp. niveum and F. o. melonis was developed. The method, adapted from a similar procedure for determining pathogenicity of Colletotrichum magna (causal agent of anthracnose of cucurbits), involves constant exposure of seedlings and cuttings (seedlings with root systems excised) of watermelon and muskmelon to conidial suspensions contained in small scintillation vials. Disease development in intact seedlings corresponded well to disease responses observed with the standard root-dip inoculation/pot assay. The continuous-dip inoculation technique resulted in rapid disease development, with 50% of watermelon cuttings dying after 4–6 days of exposure to F. o. niveum. A mortality of 30% also was observed in watermelon cuttings exposed to conidia of F. o. melonis, as opposed to only a 0–2.5% mortality in seedlings with intact roots. Disease response was similar with muskmelon seedlings and cuttings continuously dip-inoculated with F. o. melonis isolates. However, no disease symptoms were observed in muskmelon seedlings or cuttings inoculated with F. o. niveum. Four nonpathogenic isolates of F. oxysporum did not cause disease symptoms in either watermelon or muskmelon cuttings and seedlings when assayed by this technique. The proposed method enables a rapid screening of pathogenicity and requires less time, labor, and greenhouse space than the standard root-dip inoculation/pot assay. The reliability of the continuous-dip inoculation technique is limited, however, to exposure of intact seedlings at a concentration of 1 × 106conidia per milliliter; the method is not accurate at this range for excised seedlings.

  6. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples.

    Science.gov (United States)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas; Quyen, Than Linh; Engelsmann, Pia; Wolff, Anders; Bang, Dang Duong

    2017-04-01

    Salmonellosis, an infectious disease caused by Salmonella spp., is one of the most common foodborne diseases. Isolation and identification of Salmonella by conventional bacterial culture method is time consuming. In response to the demand for rapid on line or at site detection of pathogens, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair of newly designed primers targeting Salmonella spp. at subtype level were incorporated in the multiplex Direct PCR. To maximize the efficiency of the Direct PCR, the ratio between sample and dilution buffer was optimized. The sensitivity and specificity of the multiplex Direct PCR were tested using naturally contaminated pork meat samples for detecting and subtyping of Salmonella spp. Conventional bacterial culture methods were used as reference to evaluate the performance of the multiplex Direct PCR. Relative accuracy, sensitivity and specificity of 98.8%; 97.6% and 100%, respectively, were achieved by the method. Application of the multiplex Direct PCR to detect Salmonella in pork meat at slaughter reduces the time of detection from 5 to 6 days by conventional bacterial culture and serotyping methods to 14 h (including 12 h enrichment time). Furthermore, the method poses a possibility of miniaturization and integration into a point-of-need Lab-on-a-chip system for rapid online pathogen detection. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Rapid Synthesis of Gold Nanoparticles from Quercus incana and Their Antimicrobial Potential against Human Pathogens

    Directory of Open Access Journals (Sweden)

    Rizwana Sarwar

    2017-01-01

    Full Text Available In current study, bioreduction of tetrachloroauric acid (HAuCl4·3H2O was carried out using leaves extract of Quercus incana for nanoparticle synthesis. The nanoparticles were characterized by ultraviolet visible spectrum (UV, Fourier-transform infrared (FT-IR, and transmission electron microscopy (TEM analysis. The gold nanoparticles (GNPs were generally clumpy agglomerates of polydispersed particles, with an average size in the range 5.5–10 nm. The Gas chromatography–mass spectrometry (GC–MS qualitative analysis and FT-IR data supported the presence of bioactive compounds, which are responsible for the metal reduction and nanoparticles stabilization. The biocompatibility of synthesized GNPs was evaluated via antibacterial activity by using human bacterial pathogens. The results showed that synthesized GNPs showed enhanced antibacterial activity against all bacterial pathogens.

  8. Host-jump drives rapid and recent ecological speciation of the emergent fungal pathogen Colletotrichum kahawae.

    Science.gov (United States)

    Silva, Diogo N; Talhinhas, Pedro; Cai, Lei; Manuel, Luzolo; Gichuru, Elijah K; Loureiro, Andreia; Várzea, Vítor; Paulo, Octávio S; Batista, Dora

    2012-06-01

    Ecological speciation through host-shift has been proposed as a major route for the appearance of novel fungal pathogens. The growing awareness of their negative impact on global economies and public health created an enormous interest in identifying the factors that are most likely to promote their emergence in nature. In this work, a combination of pathological, molecular and geographical data was used to investigate the recent emergence of the fungus Colletotrichum kahawae. C. kahawae emerged as a specialist pathogen causing coffee berry disease in Coffea arabica, owing to its unparalleled adaptation of infecting green coffee berries. Contrary to current hypotheses, our results suggest that a recent host-jump underlay the speciation of C. kahawae from a generalist group of fungi seemingly harmless to coffee berries. We posit that immigrant inviability and a predominantly asexual behaviour could have been instrumental in driving speciation by creating pleiotropic interactions between local adaptation and reproductive patterns. Moreover, we estimate that C. kahawae began its diversification at pathogens through ecological speciation. © 2012 Blackwell Publishing Ltd.

  9. Development of multiplex loop mediated isothermal amplification (m-LAMP) label-based gold nanoparticles lateral flow dipstick biosensor for detection of pathogenic Leptospira.

    Science.gov (United States)

    Nurul Najian, A B; Engku Nur Syafirah, E A R; Ismail, Nabilah; Mohamed, Maizan; Yean, Chan Yean

    2016-01-15

    In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10(-1) genomic equivalent ml(-1). An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Development of a DNA Macroarray for the Detection and Identification of Fungal Pathogens Causing Decline of Young Grapevines.

    Science.gov (United States)

    Úrbez-Torres, J R; Haag, P; Bowen, P; Lowery, T; O'Gorman, D T

    2015-10-01

    Young vine decline (YVD) is a complex disease caused by at least 51 different fungi and responsible for important economic losses to the grapevine industry worldwide. YVD fungi are known to occur in planting material. Hence, detection prior to planting is critical to assure longevity of newly established vineyards. A DNA macroarray based on reverse dot-blot hybridization containing 102 oligonucleotides complementary to portions of the β-tubulin region was developed for detection of YVD fungi. Specificity of the array was first evaluated against 138 pure fungal cultures representing 72 different taxa from nine genera, including 37 YVD species. In total, 61 species, including 34 YVD pathogens, were detected and identified by the array. The detection limit of the array was below 0.1 pg of genomic DNA. The array was validated against artificially inoculated canes and soil and commercial planting material, with the latter showing a high incidence of YVD fungi in nursery plants otherwise not detected by traditional plating and culturing. This DNA array proved to be a rapid and specific tool to simultaneously detect and identify most YVD fungi in a single test, which has the potential to be used in commercial diagnostics or by the grapevine nursery industry to determine the health status of the planting material.

  11. Detection and enumeration of four foodborne pathogens in raw commingled silo milk in the United States.

    Science.gov (United States)

    Jackson, Emily E; Erten, Edibe S; Maddi, Neeraj; Graham, Thomas E; Larkin, John W; Blodgett, Robert J; Schlesser, Joseph E; Reddy, Ravinder M

    2012-08-01

    A nationwide survey was conducted to obtain qualitative and quantitative data on bacterial contamination of raw commingled silo milk intended for pasteurization. The levels of total aerobic bacteria, total coliforms, Enterobacteriaceae, Escherichia coli, and Staphylococcus aureus were determined using the TEMPO system. The prevalence rates and levels of presumptive Bacillus cereus, E. coli O157:H7, Listeria monocytogenes, and Salmonella spp. were determined in 214 samples. B. cereus was detected in 8.91% of samples, at 3.0 to 93 CFU/ml. E. coli O157:H7 was detected in 3.79 to 9.05% of samples, at detected in 50.00% of samples, at detected with the TEMPO system and the presence or levels of any pathogen except E. coli O157:H7. A higher average log-transformed count of total viable bacteria was observed in samples positive for this organism. The high prevalence rates of target pathogens may be attributed to a variety of factors, including detection methods, sample size, and commingling of the milk in the silo. The effects of commingling likely contributed to the high prevalence rates and low levels of target pathogens because of the inclusion of milk from multiple bulk tanks. The high prevalence rates also may be the result of analysis of larger sample volumes using more sensitive detection methods. These quantitative data could be utilized to perform more accurate risk assessments and to better estimate the appropriate level of protection for dairy products and processing technologies.

  12. Evolution of Drosophila resistance against different pathogens and infection routes entails no detectable maintenance costs.

    Science.gov (United States)

    Faria, Vítor G; Martins, Nelson E; Paulo, Tânia; Teixeira, Luís; Sucena, Élio; Magalhães, Sara

    2015-11-01

    Pathogens exert a strong selective pressure on hosts, entailing host adaptation to infection. This adaptation often affects negatively other fitness-related traits. Such trade-offs may underlie the maintenance of genetic diversity for pathogen resistance. Trade-offs can be tested with experimental evolution of host populations adapting to parasites, using two approaches: (1) measuring changes in immunocompetence in relaxed-selection lines and (2) comparing life-history traits of evolved and control lines in pathogen-free environments. Here, we used both approaches to examine trade-offs in Drosophila melanogaster populations evolving for over 30 generations under infection with Drosophila C Virus or the bacterium Pseudomonas entomophila, the latter through different routes. We find that resistance is maintained after up to 30 generations of relaxed selection. Moreover, no differences in several classical life-history traits between control and evolved populations were found in pathogen-free environments, even under stresses such as desiccation, nutrient limitation, and high densities. Hence, we did not detect any maintenance costs associated with resistance to pathogens. We hypothesize that extremely high selection pressures commonly used lead to the disproportionate expression of costs relative to their actual occurrence in natural systems. Still, the maintenance of genetic variation for pathogen resistance calls for an explanation. © 2015 The Author(s). Evolution © 2015 The Society for the Study of Evolution.

  13. Detection of Emerging and Re-Emerging Pathogens in Surface Waters Close to an Urban Area

    Directory of Open Access Journals (Sweden)

    Stefania Marcheggiani

    2015-05-01

    Full Text Available Current knowledge about the spread of pathogens in aquatic environments is scarce probably because bacteria, viruses, algae and their toxins tend to occur at low concentrations in water, making them very difficult to measure directly. The purpose of this study was the development and validation of tools to detect pathogens in freshwater systems close to an urban area. In order to evaluate anthropogenic impacts on water microbiological quality, a phylogenetic microarray was developed in the context of the EU project µAQUA to detect simultaneously numerous pathogens and applied to samples from two different locations close to an urban area located upstream and downstream of Rome in the Tiber River. Furthermore, human enteric viruses were also detected. Fifty liters of water were collected and concentrated using a hollow-fiber ultrafiltration approach. The resultant concentrate was further size-fractionated through a series of decreasing pore size filters. RNA was extracted from pooled filters and hybridized to the newly designed microarray to detect pathogenic bacteria, protozoa and toxic cyanobacteria. Diatoms as indicators of the water quality status, were also included in the microarray to evaluate water quality. The microarray results gave positive signals for bacteria, diatoms, cyanobacteria and protozoa. Cross validation of the microarray was performed using standard microbiological methods for the bacteria. The presence of oral-fecal transmitted human enteric-viruses were detected using q-PCR. Significant concentrations of Salmonella, Clostridium, Campylobacter and Staphylococcus as well as Hepatitis E Virus (HEV, noroviruses GI (NoGGI and GII (NoGII and human adenovirus 41 (ADV 41 were found in the Mezzocammino site, whereas lower concentrations of other bacteria and only the ADV41 virus was recovered at the Castel Giubileo site. This study revealed that the pollution level in the Tiber River was considerably higher downstream rather than

  14. Detection of hepatitis E virus and other livestock-related pathogens in Iowa streams

    Science.gov (United States)

    Givens, Carrie E.; Kolpin, Dana W.; Borchardt, Mark A.; Duris, Joseph W.; Moorman, Thomas B.; Spencer, Susan K.

    2016-01-01

    Manure application is a source of pathogens to the environment. Through overland runoff and tile drainage, zoonotic pathogens can contaminate surface water and streambed sediment and could affect both wildlife and human health. This study examined the environmental occurrence of gene markers for livestock-related bacterial, protozoan, and viral pathogens and antibiotic resistance in surface waters within the South Fork Iowa River basin before and after periods of swine manure application on agricultural land. Increased concentrations of indicator bacteria after manure application exceeding Iowa's state bacteria water quality standards suggest that swine manure contributes to diminished water quality and may pose a risk to human health. Additionally, the occurrence of HEV and numerous bacterial pathogen genes for Escherichia coli, Enterococcus spp., Salmonella sp., and Staphylococcus aureus in both manure samples and in corresponding surface water following periods of manure application suggests a potential role for swine in the spreading of zoonotic pathogens to the surrounding environment. During this study, several zoonotic pathogens were detected including Shiga-toxin producing E. coli, Campylobacter jejuni, pathogenic enterococci, and S. aureus; all of which can pose mild to serious health risks to swine, humans, and other wildlife. This research provides the foundational understanding required for future assessment of the risk to environmental health from livestock-related zoonotic pathogen exposures in this region. This information could also be important for maintaining swine herd biosecurity and protecting the health of wildlife near swine facilities.

  15. Rapid detection of Salmonella in food and feed by coupling loop-mediated isothermal amplification with bioluminescent assay in real-time

    OpenAIRE

    Yang, Qianru; Domesle, Kelly J; Wang, Fei; Ge, Beilei

    2016-01-01

    Background Salmonella is among the most significant pathogens causing food and feed safety concerns. This study examined the rapid detection of Salmonella in various types of food and feed samples by coupling loop-mediated isothermal amplification (LAMP) with a novel reporter, bioluminescent assay in real-time (BART). Performance of the LAMP-BART assay was compared to a conventional LAMP and the commercially available 3M Molecular Detection Assay (MDA) Salmonella. Results The LAMP-BART assay ...

  16. Mobile suitcase laboratory for rapid detection of Leishmania donovani using recombinase polymerase amplification assay.

    Science.gov (United States)

    Mondal, Dinesh; Ghosh, Prakash; Khan, Md Anik Ashfaq; Hossain, Faria; Böhlken-Fascher, Susanne; Matlashewski, Greg; Kroeger, Axel; Olliaro, Piero; Abd El Wahed, Ahmed

    2016-05-13

    Leishmania donovani (LD) is a protozoan parasite transmitted to humans from sand flies, which causes Visceral Leishmaniasis (VL). Currently, the diagnosis is based on presence of the anti-LD antibodies and clinical symptoms. Molecular diagnosis would require real-time PCR, which is not easy to implement at field settings. In this study, we report on the development and testing of a recombinase polymerase amplification (RPA) assay for the detection of LD. A genomic DNA sample was applied to determine the assay analytical sensitivity. The cross-reactivity of the assay was tested by DNA of Leishmania spp. and of pathogens considered for differential diagnosis. The clinical performance of the assay was evaluated on LD positive and negative samples. All results were compared with real-time PCR. To allow the use of the assay at field settings, a mobile suitcase laboratory (56 × 45.5 × 26.5 cm) was developed and operated at the local hospital in Mymensingh, Bangladesh. The LD RPA assay detected equivalent to one LD genomic DNA. The assay was performed at constant temperature (42 °C) in 15 min. The RPA assay also detected other Leishmania species (L. major, L. aethiopica and L. infantum), but did not identify nucleic acid of other pathogens. Forty-eight samples from VL, asymptomatic and post-kala-azar dermal leishmaniasis subjects were detected positive and 48 LD-negative samples were negative by both LD RPA and real-time PCR assays, which indicates 100 % agreement. The suitcase laboratory was successfully operated at the local hospital by using a solar-powered battery. DNA extraction was performed by a novel magnetic bead based method (SpeedXtract), in which a simple fast lysis protocol was applied. Moreover, All reagents were cold-chain independent. The mobile suitcase laboratory using RPA is ideal for rapid sensitive and specific detection of LD especially at low resource settings and could contribute to VL control and elimination programmes.

  17. Development of a droplet digital polymerase chain reaction for rapid and simultaneous identification of common foodborne pathogens in soft cheese

    Directory of Open Access Journals (Sweden)

    Paola Cremonesi

    2016-10-01

    Full Text Available Dairy products can harbor various microorganisms (e.g., Campylobacter spp., Salmonella spp., Listeria monocytogenes, verocytotoxin-producing Escherichia coli arising from animal reservoirs, and which can become important sources of foodborne illness. Therefore, early detection of food pathogens is crucial to prevent diseases. We wished to develop an accurate quantitative protocol based on a droplet digital polymerase chain reaction (ddPCR involving eight individual TaqMan™ reactions to detect simultaneously, without selective enrichment, Listeria spp., L. monocytogenes, Salmonella spp., verocytotoxin-producing E. coli and Campylobacter spp. in cheese. ddPCR (a third-generation PCR provides absolute quantification of target DNAs without requirement of a standard curve, which simplifies experimentation and data comparability. The accuracy, specificity and sensitivity of the developed ddPCR system were assessed using purified DNA from 50 reference pathogenic and non-pathogenic strains from international or Italian collections and analyzing soft cheese samples artificially contaminated with serial dilutions (from 4×106 to 4×101 CFU/g of pure cultures from the American Type Culture Collection.Finally, the performance of our ddPCR system was compared by parallel testing with quantitative PCR: it gave higher sensitivity (102 CFU/g for the Listeria spp. assay without the necessity of a standard curve.In conclusion, this is the first ddPCR system developed for simultaneous detection of common foodborne pathogens in cheese using a single set of amplification conditions. As such, it could become a useful strategy for high-throughput screening of microorganisms to evaluate the quality and safety of food products.

  18. Development of a Droplet Digital Polymerase Chain Reaction for Rapid and Simultaneous Identification of Common Foodborne Pathogens in Soft Cheese.

    Science.gov (United States)

    Cremonesi, Paola; Cortimiglia, Claudia; Picozzi, Claudia; Minozzi, Giulietta; Malvisi, Michela; Luini, Mario; Castiglioni, Bianca

    2016-01-01

    Dairy products can harbor various microorganisms (e.g., Campylobacter spp., Salmonella spp., Listeria monocytogenes, verocytotoxin-producing Escherichia coli) arising from animal reservoirs, and which can become important sources of foodborne illness. Therefore, early detection of food pathogens is crucial to prevent diseases. We wished to develop an accurate quantitative protocol based on a droplet digital polymerase chain reaction (ddPCR) involving eight individual TaqMan™ reactions to detect simultaneously, without selective enrichment, Listeria spp., L. monocytogenes, Salmonella spp., verocytotoxin-producing E. coli and Campylobacter spp. in cheese. ddPCR (a "third-generation PCR") provides absolute quantification of target DNAs without requirement of a standard curve, which simplifies experimentation and data comparability. The accuracy, specificity and sensitivity of the developed ddPCR system were assessed using purified DNA from 50 reference pathogenic and non-pathogenic strains from international or Italian collections and analyzing soft cheese samples artificially contaminated with serial dilutions (from 4 × 106 to 4 × 101 CFU/g) of pure cultures from the American Type Culture Collection. Finally, the performance of our ddPCR system was compared by parallel testing with quantitative PCR: it gave higher sensitivity (102 CFU/g for the Listeria spp. assay) without the necessity of a standard curve. In conclusion, this is the first ddPCR system developed for simultaneous detection of common foodborne pathogens in cheese using a single set of amplification conditions. As such, it could become a useful strategy for high-throughput screening of microorganisms to evaluate the quality and safety of food products.

  19. Imperfect pathogen detection from non-invasive skin swabs biases disease inference

    Science.gov (United States)

    DiRenzo, Graziella V.; Grant, Evan H. Campbell; Longo, Ana; Che-Castaldo, Christian; Zamudio, Kelly R.; Lips, Karen

    2018-01-01

    1. Conservation managers rely on accurate estimates of disease parameters, such as pathogen prevalence and infection intensity, to assess disease status of a host population. However, these disease metrics may be biased if low-level infection intensities are missed by sampling methods or laboratory diagnostic tests. These false negatives underestimate pathogen prevalence and overestimate mean infection intensity of infected individuals. 2. Our objectives were two-fold. First, we quantified false negative error rates of Batrachochytrium dendrobatidis on non-invasive skin swabs collected from an amphibian community in El Copé, Panama. We swabbed amphibians twice in sequence, and we used a recently developed hierarchical Bayesian estimator to assess disease status of the population. Second, we developed a novel hierarchical Bayesian model to simultaneously account for imperfect pathogen detection from field sampling and laboratory diagnostic testing. We evaluated the performance of the model using simulations and varying sampling design to quantify the magnitude of bias in estimates of pathogen prevalence and infection intensity. 3. We show that Bd detection probability from skin swabs was related to host infection intensity, where Bd infections caused by skin swabs in persisting host communities with low-level infections. More generally, our results have implications for study designs in other disease systems, particularly those with similar objectives, biology, and sampling decisions. 4. Uncertainty in pathogen detection is an inherent property of most sampling protocols and diagnostic tests, where the magnitude of bias depends on the study system, type of infection, and false negative error rates. Given that it may be difficult to know this information in advance, we advocate that the most cautious approach is to assume all errors are possible and to accommodate them by adjusting sampling designs. The modeling framework presented here improves the accuracy in

  20. Semi-automated, occupationally safe immunofluorescence microtip sensor for rapid detection of Mycobacterium cells in sputum.

    Directory of Open Access Journals (Sweden)

    Shinnosuke Inoue

    Full Text Available An occupationally safe (biosafe sputum liquefaction protocol was developed for use with a semi-automated antibody-based microtip immunofluorescence sensor. The protocol effectively liquefied sputum and inactivated microorganisms including Mycobacterium tuberculosis, while preserving the antibody-binding activity of Mycobacterium cell surface antigens. Sputum was treated with a synergistic chemical-thermal protocol that included moderate concentrations of NaOH and detergent at 60°C for 5 to 10 min. Samples spiked with M. tuberculosis complex cells showed approximately 10(6-fold inactivation of the pathogen after treatment. Antibody binding was retained post-treatment, as determined by analysis with a microtip immunosensor. The sensor correctly distinguished between Mycobacterium species and other cell types naturally present in biosafe-treated sputum, with a detection limit of 100 CFU/mL for M. tuberculosis, in a 30-minute sample-to-result process. The microtip device was also semi-automated and shown to be compatible with low-cost, LED-powered fluorescence microscopy. The device and biosafe sputum liquefaction method opens the door to rapid detection of tuberculosis in settings with limited laboratory infrastructure.

  1. Loop-Mediated Isothermal Amplification Assay for the Rapid Detection of Staphylococcus aureus

    Directory of Open Access Journals (Sweden)

    King Ting Lim

    2013-01-01

    Full Text Available Staphylococcus aureus, including methicillin-resistant S. aureus (MRSA, is an important human pathogen that produces a variety of toxins and causes a wide range of infections, including soft-tissue infections, bacteremia, and staphylococcal food poisoning. A loop-mediated isothermal amplification (LAMP assay targeting the arcC gene of S. aureus was developed and evaluated with 119 S. aureus and 25 non-S. aureus strains. The usefulness of the assay was compared with the PCR method that targets spa and arcC genes. The optimal temperature for the LAMP assay was 58.5°C with a detection limit of 2.5 ng/μL and 102 CFU/mL when compared to 12.5 ng/μL and 103 CFU/mL for PCR (spa and arcC. Both LAMP and PCR assays were 100% specific, 100% sensitive, 100% positive predictive value (PPV, and 100% negative predictive value (NPV. When tested on 30 spiked blood specimens (21 MRSA, eight non-S. aureus and one negative control, the performance of LAMP and PCR was comparable: 100% specific, 100% sensitive, 100% PPV, and 100% NPV. In conclusion, the LAMP assay was equally specific with a shorter detection time when compared to PCR in the identification of S. aureus. The LAMP assay is a promising alternative method for the rapid identification of S. aureus and could be used in resource-limited laboratories and fields.

  2. Detection of chikungunya virus antigen by a novel rapid immunochromatographic test.

    Science.gov (United States)

    Okabayashi, Tamaki; Sasaki, Tadahiro; Masrinoul, Promsin; Chantawat, Nantarat; Yoksan, Sutee; Nitatpattana, Narong; Chusri, Sarunyou; Morales Vargas, Ronald E; Grandadam, Marc; Brey, Paul T; Soegijanto, Soegeng; Mulyantno, Kris Cahyo; Churrotin, Siti; Kotaki, Tomohiro; Faye, Oumar; Faye, Ousmane; Sow, Abdourahmane; Sall, Amadou Alpha; Puiprom, Orapim; Chaichana, Panjaporn; Kurosu, Takeshi; Kato, Seiji; Kosaka, Mieko; Ramasoota, Pongrama; Ikuta, Kazuyoshi

    2015-02-01

    Chikungunya fever is a mosquito-borne disease of key public health importance in tropical and subtropical countries. Although severe joint pain is the most distinguishing feature of chikungunya fever, diagnosis remains difficult because the symptoms of chikungunya fever are shared by many pathogens, including dengue fever. The present study aimed to develop a new immunochromatographic diagnosis test for the detection of chikungunya virus antigen in serum. Mice were immunized with isolates from patients with Thai chikungunya fever, East/Central/South African genotype, to produce mouse monoclonal antibodies against chikungunya virus. Using these monoclonal antibodies, a new diagnostic test was developed and evaluated for the detection of chikungunya virus. The newly developed diagnostic test reacted with not only the East/Central/South African genotype but also with the Asian and West African genotypes of chikungunya virus. Testing of sera from patients suspected to have chikungunya fever in Thailand (n = 50), Laos (n = 54), Indonesia (n = 2), and Senegal (n = 6) revealed sensitivity, specificity, and real-time PCR (RT-PCR) agreement values of 89.4%, 94.4%, and 91.1%, respectively. In our study using serial samples, a new diagnostic test showed high agreement with the RT-PCR within the first 5 days after onset. A rapid diagnostic test was developed using mouse monoclonal antibodies that react with chikungunya virus envelope proteins. The diagnostic accuracy of our test is clinically acceptable for chikungunya fever in the acute phase. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  3. Huanglongbing: Pathogen detection system for integrated disease management – A review

    Directory of Open Access Journals (Sweden)

    Yasir Iftikhar

    2016-01-01

    Full Text Available Huanglongbing (HLB is a major threat to citrus sustainable yield and production. Therefore, various strategies are discussed in this review to provide solutions for the control of the disease. These include phyto-sanitory techniques to reduce pathogen inoculum in the field which are based on several approaches such as the presence of a reliable pathogen detection system, control over vector populations, cultural practices, chemotherapy and finally the production of disease-free propagating material. In addition to phytosanitory techniques, efforts to introduce resistant genes into cultivatable germplasm are also needed and are thus also discussed in this review.

  4. Turnbull - Early Detection and Rapid Response Team 2007

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Biocontrol agents and chemicals to facilitate the rapid response phase of the project will be purchased and applied and a Washington Service Corps AmeriCorps member...

  5. Turnbull - Early Detection and Rapid Response Team 2010

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Funding from this grant will allow for the purchase of biocontrol agents and chemicals to facilitate the rapid response phase of the project and to provide funds to...

  6. Turnbull - Early Detection and Rapid Response Team 2008

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Funding from this grant will allow for the purchase of biocontrol agents and chemicals to facilitate the rapid response phase of the project and to provide match for...

  7. Monoclonal antibody-based Surface Plasmon Resonance sensors for pathogen detection

    DEFF Research Database (Denmark)

    Skottrup, Peter Durand

    2007-01-01

    , that can detect and quantify specific plant pathogens and map these to defined positions within the field, would enable the farm manager to perform a precise and targeted application of pesticides and thereby reduce and optimise the use of agrochemicals. The ideal scenario for precision agriculture...... essentially transforms molecular interactions into a digital signal, thereby making detection of analytes label-free. Biosensors are used for detection of analytes ranging from small drug molecules to food- and waterborne microorganisms as well as biowarfare pathogens. In future farming, plant production...... will be concentrated at few and very large farms. In order to reduce the pesticide use, it is necessary for the farm manager to have detailed knowledge of the distribution of weeds, diseases and pests within the fields. However, field-monitoring by manual inspection is time consuming and expensive. Biosensors...

  8. A high-sensitivity optical device for the early monitoring of plant pathogen attack via the in vivo detection of ROS bursts

    Directory of Open Access Journals (Sweden)

    Lizhang eZeng

    2015-02-01

    Full Text Available Biotic stressors, especially pathogenic microorganisms, are rather difficult to detect. In plants, one of the earliest cellular responses following pathogen infection is the production of reactive oxygen species (ROS. In this study, a novel optical device for the early monitoring of Pseudomonas attack was developed; this device measures the ROS level via oxidation-sensitive 2’, 7’-dichlorodihydrofluorescein diacetate (H2DCFDA-mediated fluorescence, which could provide early monitoring of attacks by a range of plant pathogen; ROS bursts were detected in vivo in Arabidopsis thaliana with higher sensitivity and accuracy than those of a commercial luminescence spectrophotometer. Additionally, the DCF fluorescence truly reflected early changes in the ROS level, as indicated by an evaluation of the H2O2 content and the tight association between the ROS and Pseudomonas concentration. Moreover, compared with traditional methods for detecting plant pathogen attacks based on physiological and biochemical measurements, our proposed technique also offers significant advantages, such as low cost, simplicity, convenient operation and quick turnaround. These results therefore suggest that the proposed optical device could be useful for the rapid monitoring of attacks by plant pathogen and yield results considerably earlier than the appearance of visual changes in plant morphology or growth.

  9. Direct simultaneous detection of 6 sexually transmitted pathogens from clinical specimens by multiplex polymerase chain reaction and auto-capillary electrophoresis.

    Science.gov (United States)

    Samra, Zmira; Rosenberg, Shoshana; Madar-Shapiro, Liora

    2011-05-01

    The availability of a reliable and user-friendly method to identify pathogens causing sexually transmitted diseases (STDs) is essential to reduce the complications and spread of infection. In this study, genital/urinary specimens from 113 patients with STDs were simultaneously tested for 6 pathogens using the automated Seeplex® (Seegene, Seoul, Korea) multiplex polymerase chain reaction (PCR)-based STD6B auto-capillary electrophoresis (ACE) system. The results were compared with conventional reference methods, including culture and PCR tests. The sensitivity of STD6B ACE was found to be 100% for Chlamydia trachomatis, Mycoplasma hominis, Mycoplasma genitalium, Neisseria gonorrhoeae, and Trichomonas vaginalis, and 98% for genital Ureoplasma (U. urealyticum and U. parvum). Specificity ranged from 97% to 100%. One pathogen was detected in 51 specimens, and 2 or more pathogens were detected in 24. In conclusion, the multiplex PCR and ACE system is highly sensitive and specific for the rapid, simultaneous detection of STD pathogens directly from a single specimen. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. Multiplex real-time PCR assays for detection of four seedborne spinach pathogens.

    Science.gov (United States)

    Feng, C; Mansouri, S; Bluhm, B H; du Toit, L J; Correll, J C

    2014-08-01

    To develop multiplex TaqMan real-time PCR assays for detection of spinach seedborne pathogens that cause economically important diseases on spinach. Primers and probes were designed from conserved sequences of the internal transcribed spacer (for Peronospora farinosa f. sp. spinaciae and Stemphylium botryosum), the intergenic spacer (for Verticillium dahliae) and the elongation factor 1 alpha (for Cladosporium variabile) regions of DNA. The TaqMan assays were tested on DNA extracted from numerous isolates of the four target pathogens, as well as a wide range of nontarget, related fungi or oomycetes and numerous saprophytes commonly found on spinach seed. Multiplex real-time PCR assays were evaluated by detecting two or three target pathogens simultaneously. Singular and multiplex real-time PCR assays were also applied to DNA extracted from bulked seed and single spinach seed. The real-time PCR assays were species-specific and sensitive. Singular or multiplex real-time PCR assays could detect target pathogens from both bulked seed samples as well as single spinach seed. The freeze-blotter assay that is currently routinely used in the spinach seed industry to detect and quantify three fungal seedborne pathogens of spinach (C. variabile, S. botryosum and V. dahliae) is quite laborious and takes several weeks to process. The real-time PCR assays developed in this study are more sensitive and can be completed in a single day. As the assays can be applied easily for routine seed inspections, these tools could be very useful to the spinach seed industry. © 2014 The Society for Applied Microbiology.

  11. Reagent deposition for rapid multiplex pathogen identification in human blood culture samples

    DEFF Research Database (Denmark)

    Mogensen, Klaus Bo; Machado, Ana Manuel; Dufva, Martin

    2014-01-01

    viewed in a dual-color microscope configuration. The test takes 20-30 min to perform. In order to lower the cost of the test, rapid automated reagent deposition is needed. Here, ultrasonic spray coating of polyvinyl alcohol/PNA-probes on microscope glass slides is presented. Different wetting regimes...

  12. Equivalence of self- and staff-collected nasal swabs for the detection of viral respiratory pathogens.

    Directory of Open Access Journals (Sweden)

    Manas K Akmatov

    Full Text Available BACKGROUND: The need for the timely collection of diagnostic biosamples during symptomatic episodes represents a major obstacle to large-scale studies on acute respiratory infection (ARI epidemiology. This may be circumvented by having the participants collect their own nasal swabs. We compared self- and staff-collected swabs in terms of swabbing quality and detection of viral respiratory pathogens. METHODOLOGY/PRINCIPAL FINDINGS: We conducted a prospective study among employees of our institution during the ARI season 2010/2011 (December-March. Weekly emails were sent to the participants (n = 84, reminding them to come to the study center in case of new symptoms. The participants self-collected an anterior nasal swab from one nostril, and trained study personnel collected one from the other nostril. The participants self-collected another two swabs (one from each nostril on a subsequent day. Human β-actin DNA concentration was determined in the swabs as a quality control. Viral respiratory pathogens were detected by multiplex RT-PCR (Seeplex RV15 kit, Seegene, Eschborn, Germany. Of 84 participants, 56 (67% reported at least one ARI episode, 18 participants two, and one participant three. Self-swabbing was highly accepted by the participants. The amount of β-actin DNA per swab was higher in the self- than in the staff-collected swabs (p = 0.008. β-actin concentration was lower in the self-swabs collected on day 1 than in those collected on a subsequent day (p<0.0001. A respiratory viral pathogen was detected in 31% (23/75 of staff- and in 35% (26/75 of self-collected swabs (p = 0.36. With both approaches, the most frequently identified pathogens were human rhinoviruses A/B/C (12/75 swabs, 16% and human coronavirus OC43 (4/75 swabs, 5%. There was almost perfect agreement between self- and staff-collected swabs in terms of pathogen detection (agreement = 93%, kappa = 0.85, p<0.0001. CONCLUSIONS/SIGNIFICANCE: Nasal self

  13. Equivalence of self- and staff-collected nasal swabs for the detection of viral respiratory pathogens.

    Science.gov (United States)

    Akmatov, Manas K; Gatzemeier, Anja; Schughart, Klaus; Pessler, Frank

    2012-01-01

    The need for the timely collection of diagnostic biosamples during symptomatic episodes represents a major obstacle to large-scale studies on acute respiratory infection (ARI) epidemiology. This may be circumvented by having the participants collect their own nasal swabs. We compared self- and staff-collected swabs in terms of swabbing quality and detection of viral respiratory pathogens. We conducted a prospective study among employees of our institution during the ARI season 2010/2011 (December-March). Weekly emails were sent to the participants (n = 84), reminding them to come to the study center in case of new symptoms. The participants self-collected an anterior nasal swab from one nostril, and trained study personnel collected one from the other nostril. The participants self-collected another two swabs (one from each nostril) on a subsequent day. Human β-actin DNA concentration was determined in the swabs as a quality control. Viral respiratory pathogens were detected by multiplex RT-PCR (Seeplex RV15 kit, Seegene, Eschborn, Germany). Of 84 participants, 56 (67%) reported at least one ARI episode, 18 participants two, and one participant three. Self-swabbing was highly accepted by the participants. The amount of β-actin DNA per swab was higher in the self- than in the staff-collected swabs (p = 0.008). β-actin concentration was lower in the self-swabs collected on day 1 than in those collected on a subsequent day (p<0.0001). A respiratory viral pathogen was detected in 31% (23/75) of staff- and in 35% (26/75) of self-collected swabs (p = 0.36). With both approaches, the most frequently identified pathogens were human rhinoviruses A/B/C (12/75 swabs, 16%) and human coronavirus OC43 (4/75 swabs, 5%). There was almost perfect agreement between self- and staff-collected swabs in terms of pathogen detection (agreement = 93%, kappa = 0.85, p<0.0001). Nasal self-swabbing for identification of viral ARI pathogens proved to be equivalent to

  14. Rapid and sensitive detection of Yersinia pestis using amplification of plague diagnostic bacteriophages monitored by real-time PCR.

    Directory of Open Access Journals (Sweden)

    Kirill V Sergueev

    Full Text Available BACKGROUND: Yersinia pestis, the agent of plague, has caused many millions of human deaths and still poses a serious threat to global public health. Timely and reliable detection of such a dangerous pathogen is of critical importance. Lysis by specific bacteriophages remains an essential method of Y. pestis detection and plague diagnostics. METHODOLOGY/PRINCIPAL FINDINGS: The objective of this work was to develop an alternative to conventional phage lysis tests--a rapid and highly sensitive method of indirect detection of live Y. pestis cells based on quantitative real-time PCR (qPCR monitoring of amplification of reporter Y. pestis-specific bacteriophages. Plague diagnostic phages phiA1122 and L-413C were shown to be highly effective diagnostic tools for the detection and identification of Y. pestis by using qPCR with primers specific for phage DNA. The template DNA extraction step that usually precedes qPCR was omitted. phiA1122-specific qPCR enabled the detection of an initial bacterial concentration of 10(3 CFU/ml (equivalent to as few as one Y. pestis cell per 1-microl sample in four hours. L-413C-mediated detection of Y. pestis was less sensitive (up to 100 bacteria per sample but more specific, and thus we propose parallel qPCR for the two phages as a rapid and reliable method of Y. pestis identification. Importantly, phiA1122 propagated in simulated clinical blood specimens containing EDTA and its titer rise was detected by both a standard plating test and qPCR. CONCLUSIONS/SIGNIFICANCE: Thus, we developed a novel assay for detection and identification of Y. pestis using amplification of specific phages monitored by qPCR. The method is simple, rapid, highly sensitive, and specific and allows the detection of only live bacteria.

  15. Detection of food-borne pathogens by nanoparticle technology coupled to a low-cost cell reader

    Science.gov (United States)

    Noiseux, Isabelle; Bouchard, Jean-Pierre; Gallant, Pascal; Bourqui, Pascal; Cao, Honghe; Vernon, Marci; Johnson, Roger; Chen, Shu; Mermut, Ozzy

    2010-02-01

    The detection, identification and quantification of pathogenic microorganisms at low cost are of great interest to the agro-food industry. We have developed a simple, rapid, sensitive, and specific method for detection of food-borne pathogens based on use of nanoparticles alongside a low cost fluorescence cell reader for the bioassay. The nanoparticles are coupled with antibodies that allow specific recognition of the targeted Listeria in either a liquid or food matrix. The bioconjugated nanoparticles (FNP) contain thousands of dye molecules enabling significant amplification of the fluorescent signal emitted from each bacterium. The developed fluorescence Cell Reader is an LED-based reader coupled with suitable optics and a camera that acquires high resolution images. The dedicated algorithm allowed the counting of each individual nanoparticles-fluorescent bacterial cells thus enabling highly sensitive reading. The system allows, within 1 hour, the recovery and counting of 104 to 108 cfu/mL of Listeria in pure culture. However, neither the Cell Reader nor the algorithm can differentiate between the FNPs specifically-bound to the target and the residual unbound FNPs limiting sensitivity of the system. Since FNPs are too small to be washed in the bioassay, a dual tagging approach was implemented to allow online optical separation of the fluorescent background caused by free FNPs.

  16. Characterization, validation and application of a DNA microarray for the detection of mandatory and other waterborne pathogens.

    Science.gov (United States)

    Gomes, Maria; Vieira, Helena; Vale, Filipa F

    2015-11-01

    Culture methods for the detection of indicator bacteria are currently used for detection of waterborne bacteria. The need for an increased range of analyzed bacteria coupled with the obtainment of rapid and early results justify the development of a DNA microarray for the identification of waterborne pathogens. This DNA microarray has 16 implanted probes with a median size of 147 bases, targeting 12 different parameters, including all mandatory indicator microorganisms, such as Escherichia coli, Clostridium perfringens, Pseudomonas aeruginosa, Staphylococcus aureus, total and fecal coliforms and enterococci. The validation performed with DNA extracted from pure microbial cultures showed the suitability of the probes for detection of the target microorganism. To overcome the high dilution of water samples it was included either a prior culture step of bacterial contaminants retained after filtering 100 ml of water, or a 10-fold increase in the volume of filtered water, that resulted in the increase of the detected bacteria. The analysis of complex environmental water samples using culture methods and the DNA microarray revealed that the latter detected the same parameters plus other bacteria tested only in the DNA microarray. The results show that this DNA microarray may be a useful tool for water microbiological surveillance. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  17. Development of a novel multiplex PCR assay for rapid detection of virulence associated genes of Pasteurella multocida from pigs.

    Science.gov (United States)

    Rajkhowa, S

    2015-09-01

    As the pathogenicity of Pasteurella multocida is associated with various virulence factors (VFs), the aim of the study was to develop a novel multiplex PCR (m-PCR) assay for the rapid detection of important virulence associated genes (VAGs) of P. multocida isolates from pigs. The target recognized VFs used in the study were diverse adhesins (ptfA and pfhA), toxins (toxA), siderophores (tonB and hgbA), sialidases (nanB, nanH) and outer membrane proteins (ompA, ompH, oma87 and plpB). The primers for the genes encoding these VFs were designed by primer3 software (http://bioinfo.ut.ee/primer3-0.4.0/) using gene sequences available in Genbank. The detection limit of the developed assay was 10(2)  CFU ml(-1) . The m-PCR did not produce any nonspecific amplification products when tested against Bordetella bronchiseptica which also commonly infects pigs. We applied m-PCR to the field samples, and the results obtained were the same as the single PCR results. The developed assay would be very useful for veterinary diagnostic laboratories and for others interested in the rapid virulence profiling of porcine P. multocida isolates circulating in the piggeries. The study reports the development and evaluation of a novel multiplex PCR assay for the rapid detection of 11 important VAGs of Pasteurella multocida isolates from pigs. Rapid and simultaneous detection of recognized VFs of the organism are essential to know the virulo-types of P. multocida isolates circulating in the piggeries. The developed novel assay will be very useful for the rapid detection of VAGs of P. multocida isolates from pigs. © 2015 The Society for Applied Microbiology.

  18. Evaluation of different enrichment methods for pathogenic Yersinia species detection by real time PCR

    Science.gov (United States)

    2014-01-01

    Background Yersiniosis is a zoonotic disease reported worldwide. Culture and PCR based protocols are the most common used methods for detection of pathogenic Yersinia species in animal samples. PCR sensitivity could be increased by an initial enrichment step. This step is particularly useful in surveillance programs, where PCR is applied to samples from asymptomatic animals. The aim of this study was to evaluate the improvement in pathogenic Yersinia species detection using a suitable enrichment method prior to the real time PCR (rtPCR). Nine different enrichment protocols were evaluated including six different broth mediums (CASO, ITC, PSB, PBS, PBSMSB and PBSSSB). Results The analysis of variance showed significant differences in Yersinia detection by rtPCR according to the enrichment protocol used. These differences were higher for Y. pseudotuberculosis than for Y. enterocolitica. In general, samples incubated at lower temperatures yielded the highest detection rates. The best results were obtained with PBSMSB and PBS2. Application of PBSMSB protocol to free-ranging wild board samples improved the detection of Y. enterocolitica by 21.2% when compared with direct rtPCR. Y. pseudotuberculosis detection was improved by 10.6% when results obtained by direct rtPCR and by PBSMSB enrichment before rtPCR were analyzed in combination. Conclusions The data obtained in the present study indicate a difference in Yersinia detection by rtPCR related to the enrichment protocol used, being PBSMSB enrichment during 15 days at 4°C and PBS during 7 days at 4°C the most efficient. The use of direct rtPCR in combination with PBSMSB enrichment prior to rtPCR resulted in an improvement in the detection rates of pathogenic Yersinia in wild boar and could be useful for application in other animal samples. PMID:25168886

  19. Development of multiplex loop mediated isothermal amplification (m-LAMP) label-based gold nanoparticles lateral flow dipstick biosensor for detection of pathogenic Leptospira

    Energy Technology Data Exchange (ETDEWEB)

    Nurul Najian, A.B.; Engku Nur Syafirah, E.A.R.; Ismail, Nabilah [Department of Medical Microbiology & Parasitology, School of Medical Sciences, Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia); Mohamed, Maizan [Faculty of Veterinary Medicine, Universiti Malaysia Kelantan, City Campus, Pengkalan Chepa, Locked Bag 36, 16100 Kota Bharu, Kelantan (Malaysia); Yean, Chan Yean, E-mail: yeancyn@yahoo.com [Department of Medical Microbiology & Parasitology, School of Medical Sciences, Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia); Institute for Research in Molecular Medicine (INFORMM), Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia)

    2016-01-15

    In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10{sup −1} genomic equivalent ml{sup −1}. An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. - Highlights: • We develop multiplex LAMP label-based lateral flow dipstick biosensor for detection of pathogenic Leptospira. • We design primers for multiplex LAMP targeting the conserved LipL32 gene of pathogenic Leptospira and LAMP

  20. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  1. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method.

    Science.gov (United States)

    Khan, J A; Rathore, R S; Khan, S; Ahmad, I

    2013-01-01

    Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 μL and 50 μL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong

  2. Rapid detection of genetic modification for GMO monitoring in agriculture

    Directory of Open Access Journals (Sweden)

    Petrović Sofija

    2015-01-01

    Full Text Available Transgenic technology has expanded the ways of new genetic variability creation. Genetically modified organisms (GMOs are organisms which total genome is altered in a way that could not happen in nature. GM crops recorded a steady increase in its share in agricultural production. However, for the most part, GMO in agriculture has been limited to two cultivars - soy and corn, and the two genetic modifications, the total herbicide resistance and pest of the Lepidoptera genus. In order to monitor cultivation and trade of GMOs, tests of different precision are used, qualitatively and/or quantitatively determining the presence of genetic modification. Tests for the rapid determination of the presence of GM are suitable, since they can be implemented quickly and accurately, in terms of declared sensitivity, outside or in the laboratory. The example of the use of rapid tests demonstrates their value in use for rapid and efficient monitoring.

  3. Electrochemical Genosensor To Detect Pathogenic Bacteria (Escherichia coli O157:H7) As Applied in Real Food Samples (Fresh Beef) To Improve Food Safety and Quality Control.

    Science.gov (United States)

    Abdalhai, Mandour H; Fernandes, António Maximiano; Xia, Xiaofeng; Musa, Abubakr; Ji, Jian; Sun, Xiulan

    2015-05-27

    The electrochemical genosensor is one of the most promising methods for the rapid and reliable detection of pathogenic bacteria. In a previous work, we performed an efficient electrochemical genosensor detection of Staphylococcus aureus by using lead sulfide nanoparticles (PbSNPs). As a continuation of this study, in the present work, the electrochemical genosensor was used to detect Escherichia coli O157:H7. The primer and probes were designed using NCBI database and Sigma-Aldrich primer and probe software. The capture and signalizing probes were modified by thiol (SH) and amine (NH2), respectively. Then, the signalizing probe was connected using cadmium sulfide nanoparticles (CdSNPs), which showed well-defined peaks after electrochemical detection. The genosensor was prepared by immobilization of complementary DNA on the gold electrode surface, which hybridizes with a specific fragment gene from pathogenic to make a sandwich structure. The conductivity and sensitivity of the sensor were increased by using multiwalled carbon nanotubes (MWCNT) that had been modified using chitosan deposited as a thin layer on the glass carbon electrode (GCE) surface, followed by a deposit of bismuth. The peak currents of E. coli O157:H7 correlated in a linear fashion with the concentration of tDNA. The detection limit was 1.97 × 10(-14) M, and the correlation coefficient was 0.989. A poorly defined current response was observed as the negative control and baseline. Our results showed high sensitivity and selectivity of the electrochemical DNA biosensor to the pathogenic bacteria E. coli O157:H7. The biosensor was also used to evaluate the detection of pathogen in real beef samples contaminated artificially. Compared with other electrochemical DNA biosensors, we conclude that this genosensor provides for very efficient detection of pathogenic bacteria. Therefore, this method may have potential application in food safety and related fields.

  4. Detection of Gastrointestinal Pathogens from Stool Samples on Hemoccult Cards by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    Martin Alberer

    2017-01-01

    Full Text Available Purpose. Up to 30% of international travelers are affected by travelers’ diarrhea (TD. Reliable data on the etiology of TD is lacking. Sufficient laboratory capacity at travel destinations is often unavailable and transporting conventional stool samples to the home country is inconvenient. We evaluated the use of Hemoccult cards for stool sampling combined with a multiplex PCR for the detection of model viral, bacterial, and protozoal TD pathogens. Methods. Following the creation of serial dilutions for each model pathogen, last positive dilution steps (LPDs and thereof calculated last positive sample concentrations (LPCs were compared between conventional stool samples and card samples. Furthermore, card samples were tested after a prolonged time interval simulating storage during a travel duration of up to 6 weeks. Results. The LPDs/LPCs were comparable to testing of conventional stool samples. After storage on Hemoccult cards, the recovery rate was 97.6% for C. jejuni, 100% for E. histolytica, 97.6% for norovirus GI, and 100% for GII. Detection of expected pathogens was possible at weekly intervals up to 42 days. Conclusion. Stool samples on Hemoccult cards stored at room temperature can be used in combination with a multiplex PCR as a reliable tool for testing of TD pathogens.

  5. Rapid and Sensitive Detection of Phytophthora sojae in Soil and Infected Soybeans by Species-Specific Polymerase Chain Reaction Assays.

    Science.gov (United States)

    Wang, Yuanchao; Zhang, Wenli; Wang, Ying; Zheng, Xiaobo

    2006-12-01

    ABSTRACT Root and stem rot caused by Phytophthora sojae is one of the most destructive diseases of soybean (Glycine max) worldwide. P. sojae can survive as oospores in soil for many years. In order to develop a rapid and accurate method for the specific detection of P. sojae in soil, the internal transcribed spacer (ITS) regions of eight P. sojae isolates were amplified using polymerase chain reaction (PCR) with the universal primers DC6 and ITS4. The sequences of PCR products were aligned with published sequences of 50 other Phytophthora species, and a region specific to P. sojae was used to design the specific PCR primers, PS1 and PS2. More than 245 isolates representing 25 species of Phytophthora and at least 35 other species of pathogens were used to test the specificity of the primers. PCR amplification with PS primers resulted in the amplification of a product of approximately 330 bp, exclusively from isolates of P. sojae. Tests with P. sojae genomic DNA determined that the sensitivity of the PS primer set is approximately 1 fg. This PCR assay, combined with a simple soil screening method developed in this work, allowed the detection of P. sojae from soil within 6 h, with a detection sensitivity of two oospores in 20 g of soil. PCR with the PS primers could also be used to detect P. sojae from diseased soybean tissue and residues. Real-time fluorescent quantitative PCR assays were also developed to detect the pathogen directly in soil samples. The PS primer-based PCR assay provides a rapid and sensitive tool for the detection of P. sojae in soil and infected soybean tissue.

  6. Lab-on-a-chip for rapid electrochemical detection of nerve agent Sarin

    DEFF Research Database (Denmark)

    Tan, Hsih-Yin; Loke, Weng Keong; Nguyen, Nam-Trung

    2014-01-01

    This paper reports a lab-on-a-chip for the detection of Sarin nerve agent based on rapid electrochemical detection. The chemical warfare agent Sarin (C4H10FO2P, O-isopropyl methylphosphonofluoridate) is a highly toxic organophosphate that induces rapid respiratory depression, seizures and death w...

  7. Detection of malaria parasites by microscopy and rapid diagnostic ...

    African Journals Online (AJOL)

    The effectiveness of Rapid Diagnostic Test Kit (RDT) was compared with microscopy for the evaluation of malaria infection in children and pregnant women attending two selected health facilities in Lagos State, south-western, Nigeria. A total of 482 patients comprising 252 pregnant women (mean age: 26.86±4.46 years) ...

  8. An ultrasensitive young interferometer handheld sensor for rapid virus detection

    NARCIS (Netherlands)

    Ymeti, Aurel; Subramaniam, Vinod; Beumer, Tom A M; Kanger, Johannes S

    Future viral outbreaks are a major threat to societal and economic development throughout the world. A rapid, sensitive and easy-to-use test for viral infections is essential to prevent and control such viral pandemics. Furthermore, a compact, portable device is potentially very useful in remote or

  9. Rapid detection of methicillin-resistant staphylococci by multiplex PCR

    African Journals Online (AJOL)

    Administrator

    2010-11-08

    Nov 8, 2010 ... Deletion screening of the Duchenne muscular dystrophy locus via multiplex DNA amplification. Nucleic Acids Res. 16: 11141-11156. Fang H, Hedin G (2003). Rapid screening and identification of methicillin-resistant Staphylococcus aureus from clinical samples by selective-broth and real-time PCR assay.

  10. Development of Conductive Polymer Analysis for the Rapid Detection and Identification of Phytopathogenic Microbes

    Science.gov (United States)

    A. Dan Wilson; D.G. Lester; C.S. Oberle

    2004-01-01

    Conductive polymer analysis, a type of electronic aroma detection technology, was evaluated for its efficacy in the detection, identification, and discrimination of plant-pathogenic microorganisms on standardized media and in diseased plant tissues. The method is based on the acquisition of a diagnostic electronic fingerprint derived from multisensor responses to...

  11. DNA microarray-based solid-phase RT-PCR for rapid detection and identification of influenza virus type A and subtypes H5 and H7

    DEFF Research Database (Denmark)

    Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

    2011-01-01

    Endemic of avian influenza virus (AIV) in Asia and epizootics in some European regions have caused considerable public concern on a possible pandemic of AIV. A rapid method for virus detection and effective surveillance in wild avian, poultry production as well as in humans is required....... In this article, a DNA microarray-based solid-phase polymerase chain reaction (PCR) approach has been developed for rapid detection of influenza virus type A and for simultaneous identification of pathogenic virus subtypes H5 and H7. This solid-phase RT-PCR method combined reverse-transcription amplification...

  12. Development of rapid, specific and sensitive detection of Cucumber ...

    African Journals Online (AJOL)

    detection of the CMV in infected plants using a monoclonal and polyclonal antibodies. Dotimmunobinding assays (DIBA) are useful alternatives to microtitre plate enzyme-linked immunosorbent assay (ELISA). Nine monoclonal antibodies were readily used for detected CMV by TAS-ELISA and DIBA of infected plants.

  13. Rapid detection of Ganoderma lucidum and assessment of inhibition ...

    African Journals Online (AJOL)

    Molecular and immunological methods have been applied for detecting the Ganoderma disease of coconut. Polyclonal antibodies (PAbs) raised against basidiocarp protein of Ganoderma were used for detection. For polymerase chain reaction (PCR) test, the primer generated from the internal transcribed spacer region one ...

  14. Microbial Diagnostic Microarrays for the Detection and Typing of Food- and Water-Borne (Bacterial) Pathogens

    Science.gov (United States)

    Kostić, Tanja; Sessitsch, Angela

    2011-01-01

    Reliable and sensitive pathogen detection in clinical and environmental (including food and water) samples is of greatest importance for public health. Standard microbiological methods have several limitations and improved alternatives are needed. Most important requirements for reliable analysis include: (i) specificity; (ii) sensitivity; (iii) multiplexing potential; (iv) robustness; (v) speed; (vi) automation potential; and (vii) low cost. Microarray technology can, through its very nature, fulfill many of these requirements directly and the remaining challenges have been tackled. In this review, we attempt to compare performance characteristics of the microbial diagnostic microarrays developed for the detection and typing of food and water pathogens, and discuss limitations, points still to be addressed and issues specific for the analysis of food, water and environmental samples. PMID:27605332

  15. Rapid detection of single bacteria in unprocessed blood using Integrated Comprehensive Droplet Digital Detection

    Science.gov (United States)

    Kang, Dong-Ku; Ali, M. Monsur; Zhang, Kaixiang; Huang, Susan S.; Peterson, Ellena; Digman, Michelle A.; Gratton, Enrico; Zhao, Weian

    2014-01-01

    Blood stream infection or sepsis is a major health problem worldwide, with extremely high mortality, which is partly due to the inability to rapidly detect and identify bacteria in the early stages of infection. Here we present a new technology termed ‘Integrated Comprehensive Droplet Digital Detection’ (IC 3D) that can selectively detect bacteria directly from milliliters of diluted blood at single-cell sensitivity in a one-step, culture- and amplification-free process within 1.5–4 h. The IC 3D integrates real-time, DNAzyme-based sensors, droplet microencapsulation and a high-throughput 3D particle counter system. Using Escherichia coli as a target, we demonstrate that the IC 3D can provide absolute quantification of both stock and clinical isolates of E. coli in spiked blood within a broad range of extremely low concentration from 1 to 10,000 bacteria per ml with exceptional robustness and limit of detection in the single digit regime. PMID:25391809

  16. Multiplexed Detection of Foodborne Pathogens from Contaminated Lettuces Using a Handheld Multistep Lateral Flow Assay Device.

    Science.gov (United States)

    Shin, Joong Ho; Hong, Jisoo; Go, Hyeyun; Park, Juhwan; Kong, Minsuk; Ryu, Sangryeol; Kim, Kwang-Pyo; Roh, Eunjung; Park, Je-Kyun

    2018-01-10

    This paper presents a handheld device that is capable of simplifying multistep assays to perform sensitive detection of foodborne pathogens. The device is capable of multiplexed detection of Escherichia coli (E. coli) O157:H7, Salmonella Typhimurium (S. Typhimurium), Staphylococcus aureus, and Bacillus cereus. The limit of detection for each bacterium was characterized, and then, the detection of bacteria from contaminated fresh lettuces was demonstrated for two representative foodborne pathogens. We employed a sample pretreatment protocol to recover and concentrate target bacteria from contaminated lettuces, which can detect 1.87 × 10 4 CFU of E. coli O157:H7 and 1.47 × 10 4 CFU of S. Typhimurium/1 g of lettuce without an enrichment process. Lastly, we demonstrated that the limit of detection can be reduced to 1 CFU of E. coli O157:H7 and 1 CFU of S. Typhimurium/1 g of lettuce by including a 6 h enrichment of contaminated lettuces in growth media before pretreatment.

  17. Extraction and sensitive detection of toxins A and B from the human pathogen Clostridium difficile in 40 seconds using microwave-accelerated metal-enhanced fluorescence.

    Directory of Open Access Journals (Sweden)

    Lovleen Tina Joshi

    Full Text Available Clostridium difficile is the primary cause of antibiotic associated diarrhea in humans and is a significant cause of morbidity and mortality. Thus the rapid and accurate identification of this pathogen in clinical samples, such as feces, is a key step in reducing the devastating impact of this disease. The bacterium produces two toxins, A and B, which are thought to be responsible for the majority of the pathology associated with the disease, although the relative contribution of each is currently a subject of debate. For this reason we have developed a rapid detection assay based on microwave-accelerated metal-enhanced fluorescence which is capable of detecting the presence of 10 bacteria in unprocessed human feces within 40 seconds. These promising results suggest that this prototype biosensor has the potential to be developed into a rapid, point of care, real time diagnostic assay for C. difficile.

  18. Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time rt-PCR.

    Directory of Open Access Journals (Sweden)

    Kerstin Wernike

    Full Text Available Porcine reproductive and respiratory syndrome (PRRS causes economic losses in the pig industry worldwide, and PRRS viruses (PRRSV are classified into the two distinct genotypes "North American (NA, type 2" and "European (EU, type 1". In 2006, a highly pathogenic NA strain of PRRSV (HP-PRRSV, characterized by high fever as well as high morbidity and mortality, emerged in swine farms in China. Therefore, a real-time reverse transcription polymerase chain reaction (RT-qPCR assay specific for HP-PRRSV was developed and combined with type 1- and type 2-specific RT-qPCR systems. Furthermore, an internal control, based on a heterologous RNA, was successfully introduced. This final multiplex PRRSV RT-qPCR, detecting and typing PRRSV, had an analytical sensitivity of less than 200 copies per µl for the type 1-assay and 20 copies per µl for the type 2- and HP assays and a high diagnostic sensitivity. A panel of reference strains and field isolates was reliably detected and samples from an animal trial with a Chinese HP-PRRS strain were used for test validation. The new multiplex PRRSV RT-qPCR system allows for the first time the highly sensitive detection and rapid differentiation of PRRSV of both genotypes as well as the direct detection of HP-PRRSV.

  19. Use of sensitive, broad-spectrum molecular assays and human airway epithelium cultures for detection of respiratory pathogens.

    Directory of Open Access Journals (Sweden)

    Krzysztof Pyrc

    Full Text Available Rapid and accurate detection and identification of viruses causing respiratory tract infections is important for patient care and disease control. Despite the fact that several assays are available, identification of an etiological agent is not possible in ~30% of patients suffering from respiratory tract diseases. Therefore, the aim of the current study was to develop a diagnostic set for the detection of respiratory viruses with sensitivity as low as 1-10 copies per reaction. Evaluation of the assay using a training clinical sample set showed that viral nucleic acids were identified in ~76% of cases. To improve assay performance and facilitate the identification of novel species or emerging strains, cultures of fully differentiated human airway epithelium were used to pre-amplify infectious viruses. This additional step resulted in the detection of pathogens in all samples tested. Based on these results it can be hypothesized that the lack of an etiological agent in some clinical samples, both reported previously and observed in the present study, may result not only from the presence of unknown viral species, but also from imperfections in the detection methods used.

  20. Multiplex-PCR for simultaneous detection of 3 bacterial fish pathogens, Flavobacterium columnare, Edwardsiella ictaluri, and Aeromonas hydrophila.

    Science.gov (United States)

    Panangala, Victor S; Shoemaker, Craig A; Van Santen, Vicky L; Dybvig, Kevin; Klesius, Phillip H

    2007-03-13

    A multiplex PCR (m-PCR) method was developed for simultaneous detection of 3 important fish pathogens in warm water aquaculture. The m-PCR to amplify target DNA fragments from Flavobacterium columnare (504 bp), Edwardsiella ictaluri (407 bp) and Aeromonas hydrophila (209 bp) was optimized by adjustment of reaction buffers and a touchdown protocol. The lower detection limit for each of the 3 bacteria was 20 pg of nucleic acid template from each bacteria per m-PCR reaction mixture. The sensitivity threshold for detection of the 3 bacteria in tissues ranged between 3.4 x 10(2) and 2.5 x 10(5) cells g(-1) of tissue (channel catfish Ictalurus punctatus Rafinesque). The diagnostic sensitivity and specificity of the m-PCR was evaluated with 10 representative isolates of each of the 3 bacteria and 11 other Gram-negative and 2 Gram-positive bacteria that are taxonomically related or ubiquitous in the aquatic environment. Except for a single species (A. salmonicida subsp. salmonicida), each set of primers specifically amplified the target DNA of the cognate species of bacteria. m-PCR was compared with bacteriological culture for identification of bacteria in experimentally infected fish. The m-PCR appears promising for the rapid, sensitive and simultaneous detection of Flavobacterium columnare, E. ictaluri and A. hydrophila in infected fish compared to the time-consuming traditional bacteriological culture techniques.

  1. Microbial Biosensor for the Detection of Protease-Virulent Factors from Pathogens

    Science.gov (United States)

    2017-04-28

    pathogen signalling molecules. With that goal in mind , researchers have developed various types of biosensors that detect infectious determinants...acidic water, we developed a riboswitch- based genetic platform for self-directed evolution acid-tolerant phenotype (RIDE) that is based on the...riboswitch-based genetic platform for self-directed evolution acid-tolerant phenotype (RIDE) construct. A. Genetic circuit for RIDE (PREmR34: the pH

  2. Rapid intrinsic fluorescence method for direct identification of pathogens in blood cultures.

    Science.gov (United States)

    Walsh, John D; Hyman, Jay M; Borzhemskaya, Larisa; Bowen, Ann; McKellar, Caroline; Ullery, Michael; Mathias, Erin; Ronsick, Christopher; Link, John; Wilson, Mark; Clay, Bradford; Robinson, Ron; Thorpe, Thurman; van Belkum, Alex; Dunne, W Michael

    2013-11-19

    A positive blood culture is a critical result that requires prompt identification of the causative agent. This article describes a simple method to identify microorganisms from positive blood culture broth within the time taken to perform a Gram stain (identification of the etiologic agent may benefit the clinical management of sepsis. Further evaluation is now warranted to determine the performance of the method using clinical blood culture specimens. Physicians often require the identity of the infective agent in order to make life-saving adjustments to empirical therapy or to switch to less expensive and/or more targeted antimicrobials. However, standard identification procedures take up to 2 days after a blood culture is signaled positive, and even most rapid molecular techniques take several hours to provide a result. Other techniques are faster (e.g., matrix-assisted laser desorption ionization-time of flight [MALDI-TOF] mass spectrometry) but require time-consuming manual processing steps and expensive equipment. There remains a clear need for a simple, inexpensive method to rapidly identify microorganisms directly from positive blood cultures. The promising new method described in this research article can identify microorganisms in minutes by optical spectroscopy, thus permitting the lab to simultaneously report the presence of a positive blood culture and the organism's identity.

  3. Use of flow cytometry for rapid and accurate enumeration of live pathogenic Leptospira strains.

    Science.gov (United States)

    Fontana, Célia; Crussard, Steve; Simon-Dufay, Nathalie; Pialot, Daniel; Bomchil, Natalia; Reyes, Jean

    2017-01-01

    Enumeration of Leptospira, the causative agent of leptospirosis, is arduous mainly because of its slow growth rate. Rapid and reliable tools for numbering leptospires are still lacking. The current standard for Leptospira cultures is the count on Petroff-Hausser chamber under dark-field microscopy, but this method remains time-consuming, requires well-trained operators and lacks reproducibility. Here we present the development of a flow-cytometry technique for counting leptospires. We showed that upon addition of fluorescent dyes, necessary to discriminate the bacterial population from debris, several live Leptospira strains could be enumerated at different physiologic states. Flow cytometry titers were highly correlated to counts with Petroff-Hausser chambers (R(2)>0.99). Advantages of flow cytometry lie in its rapidity, its reproducibility significantly higher than Petroff-Hausser method and its wide linearity range, from 10(4) to 10(8)leptospires/ml. Therefore, flow cytometry is a fast, reproducible and sensitive tool representing a promising technology to replace current enumeration techniques of Leptospira in culture. We were also able to enumerate Leptospira in artificially infected urine and blood with a sensitivity limit of 10(5)leptospires/ml and 10(6)leptospires/ml, respectively, demonstrating the feasibility to use flow cytometry as first-line tool for diagnosis or bacterial dissemination studies. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Development and evaluation of a novel and rapid detection assay for Botrytis cinerea based on loop-mediated isothermal amplification.

    Directory of Open Access Journals (Sweden)

    Ya-Bing Duan

    Full Text Available Botrytis cinerea is a devastating plant pathogen that causes grey mould disease. In this study, we developed a visual detection method of B. cinerea based on the Bcos5 sequence using loop-mediated isothermal amplification (LAMP with hydroxynaphthol blue dye (HNB. The LAMP reaction was optimal at 63 °C for 45 min. When HNB was added prior to amplification, samples with B. cinerea DNA developed a characteristic sky blue color after the reaction but those without DNA or with DNA of other plant pathogenic fungi did not. Results of HNB staining method were reconfirmed when LAMP products were subjected to gel electrophoresis. The detection limit of this LAMP assay for B. cinerea was 10(-3 ng µL(-1 of genomic DNA per reaction, which was 10-fold more sensitive than conventional PCR (10(-2 ng µL(-1. Detection of the LAMP assay for inoculum of B. cinerea was possible in the inoculated tomato and strawberry petals. In the 191 diseased samples, 180 (94.2% were confirmed as positive by LAMP, 172 (90.1% positive by the tissue separation, while 147 (77.0% positive by PCR. Because the LAMP assay performed well in aspects of sensitivity, specificity, repeatability, reliability, and visibility, it is suitable for rapid detection of B. cinerea in infected plant materials prior to storage and during transportation, such as cut flowers, fruits and vegetables.

  5. Development and evaluation of a novel and rapid detection assay for Botrytis cinerea based on loop-mediated isothermal amplification.

    Science.gov (United States)

    Duan, Ya-Bing; Ge, Chang-Yan; Zhang, Xiao-Ke; Wang, Jian-Xin; Zhou, Ming-Guo

    2014-01-01

    Botrytis cinerea is a devastating plant pathogen that causes grey mould disease. In this study, we developed a visual detection method of B. cinerea based on the Bcos5 sequence using loop-mediated isothermal amplification (LAMP) with hydroxynaphthol blue dye (HNB). The LAMP reaction was optimal at 63 °C for 45 min. When HNB was added prior to amplification, samples with B. cinerea DNA developed a characteristic sky blue color after the reaction but those without DNA or with DNA of other plant pathogenic fungi did not. Results of HNB staining method were reconfirmed when LAMP products were subjected to gel electrophoresis. The detection limit of this LAMP assay for B. cinerea was 10(-3) ng µL(-1) of genomic DNA per reaction, which was 10-fold more sensitive than conventional PCR (10(-2) ng µL(-1)). Detection of the LAMP assay for inoculum of B. cinerea was possible in the inoculated tomato and strawberry petals. In the 191 diseased samples, 180 (94.2%) were confirmed as positive by LAMP, 172 (90.1%) positive by the tissue separation, while 147 (77.0%) positive by PCR. Because the LAMP assay performed well in aspects of sensitivity, specificity, repeatability, reliability, and visibility, it is suitable for rapid detection of B. cinerea in infected plant materials prior to storage and during transportation, such as cut flowers, fruits and vegetables.

  6. Development of a loop-mediated Isothermal amplification assay for sensitive and rapid detection of Vibrio parahaemolyticus

    Directory of Open Access Journals (Sweden)

    Kawahara Ryuji

    2008-09-01

    Full Text Available Abstract Background Vibrio parahaemolyticus is a marine seafood-borne pathogen causing gastrointestinal disorders in humans. Thermostable direct hemolysin (TDH and TDH-related hemolysin (TRH are known as major virulence determinants of V. parahaemolyticus. Most V. parahaemolyticus isolates from the environment do not produce TDH or TRH. Total V. parahaemolyticus has been used as an indicator for control of seafood contamination toward prevention of infection. Detection of total V. parahaemolyticus using conventional culture- and biochemical-based assays is time-consuming and laborious, requiring more than three days. Thus, we developed a novel and highly specific loop-mediated isothermal amplification (LAMP assay for the sensitive and rapid detection of Vibrio parahaemolyticus. Results The assay provided markedly more sensitive and rapid detection of V. parahaemolyticus strains than conventional biochemical and PCR assays. The assay correctly identified 143 V. parahaemolyticus strains, but did not detect 33 non-parahaemolyticus Vibrio and 56 non-Vibrio strains. Sensitivity of the LAMP assay for direct detection of V. parahaemolyticus in pure cultures and in spiked shrimp samples was 5.3 × 102 CFU per ml/g (2.0 CFU per reaction. The sensitivity of the LAMP assay was 10-fold more sensitive than that of the conventional PCR assay. The LAMP assay was markedly faster, requiring for amplification 13–22 min in a single colony on TCBS agar from each of 143 V. parahaemolyticus strains and less than 35 min in spiked shrimp samples. The LAMP assay for detection of V. parahaemolyticus required less than 40 min in a single colony on thiosulfate citrate bile salt sucrose (TCBS agar and 60 min in spiked shrimp samples from the beginning of DNA extraction to final determination. Conclusion The LAMP assay is a sensitive, rapid and simple tool for the detection of V. parahaemolyticus and will facilitate the surveillance for control of contamination of V

  7. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-02-07

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. Multiplexed plasmon sensor for rapid label-free analyte detection.

    Science.gov (United States)

    Rosman, Christina; Prasad, Janak; Neiser, Andreas; Henkel, Andreas; Edgar, Jonathan; Sönnichsen, Carsten

    2013-07-10

    Efficient and cost-effective multiplexed detection schemes for proteins in small liquid samples would bring drastic advances to fields like disease detection or water quality monitoring. We present a novel multiplexed sensor with randomly deposited aptamer functionalized gold nanorods. The spectral position of plasmon resonances of individual nanorods, monitored by dark-field spectroscopy, respond specifically to different proteins. We demonstrate nanomolar sensitivity, sensor recycling, and the potential to upscale to hundreds or thousands of targets.

  9. Rapid Detection of Pediatric Bacteriuria Using Narrow Angle Forward Laser Scattering Technology (NAFLST) with Bacterioscan

    Science.gov (United States)

    Cline, Adriana; Jhaveri, Ravi; Levinson, Kara; Miller, Melissa

    2017-01-01

    Abstract Background Pediatric urinary tract infections (UTI) are common, but culture-based diagnosis can take up to 48 hours. This time delay means patients are exposed to potentially unnecessary antibiotics. The sensitivity of screening urinalysis can vary, so rapid detection of UTI by another means would be beneficial. Narrow Angle Forward Laser Scattering Technology (NAFLST) with Bacterioscan can rapidly detect bacteriuria by shining a laser continuously through a liquid sample containing replicating bacteria, and graphing the degree of light refraction over time. Higher degrees of light refraction represent higher initial bacterial load and continued bacterial growth. After 3 hours, the optical scatter classifies a sample as either Likely Positive or Likely Negative. We compared Bacterioscan results to culture data in pediatric patients to assess the ability to diagnose UTI and avoid unnecessary urine culture. Methods This protocol was approved by the UNC Biomedical Institutional Review Board. Over one month, 169 pediatric (<18 yo) urine cultures were collected as part of routine patient care. An individual urine sample and 2.5mL of Sterile Tryptic Soy Broth were pipetted into a Bacterioscan micro-curette. Bacterioscan labeled the specimen as Likely Positive or Likely Negative after a 3 hour period. Results were then compared with urine culture results obtained by routine microbiologic methods. Results Of the 169 urine cultures, 96 were positive, but only 27 were positive for uropathogens. Bacterioscan was 100% sensitive and 58.4% specific in predicting clinically relevant/pathogenic bacterial growth in culture (PPV 31.3%, NPV 100%), and 70.8% sensitive and 75.3% specific in predicting any bacterial growth (PPV 79.0%, NPV 66.2%). If a “Likely Positive” Bacterioscan result had been used in our study population to screen urine samples for culture, then 58% (83/142) of negative urine cultures would have been eliminated with no UTIs missed. Conclusion By

  10. A rapid, low-cost, and microfluidic chip-based system for parallel identification of multiple pathogens related to clinical pneumonia.

    Science.gov (United States)

    Huang, Guoliang; Huang, Qin; Xie, Lan; Xiang, Guangxin; Wang, Lei; Xu, Hui; Ma, Li; Luo, Xianbo; Xin, Juan; Zhou, Xinying; Jin, Xiangyu; Zhang, Lei

    2017-07-25

    An air-insulated microfluidic chip was designed for the automatic centrifugal distribution of samples to 24-test cells, enabling the parallel identification of multiple clinical pneumonia-related pathogens in 1.45-μL reactions without cross-contamination in 45 min. A portable nucleic acid analyzer that integrates mechanical, confocal optical, electronic, and software functions was also developed to collect fluorescence data in a Ø3 mm imaging field near the optical diffraction limit for highly sensitive fluorescence detection of nucleic acid amplification in real time. This microfluidic chip-based portable nucleic acid analyzer could detect low abundance nucleic acids present at as few as 10 copies. In a blinded experiment, specific identification of Mycoplasma pneumoniae, Staphylococcus aureus, and methicillin-resistant S. aureus was achieved with 229 clinical patient sputum samples. The total coincidence rate of our system and traditional RT-PCR with an ABI 7500 was 99.56%. Four samples accounting for the 0.44% inconformity were retested by gene sequencing, revealing that our system reported the correct results. This novel microfluidic chip-based detection system is cost-effective, rapid, sensitive, specific, and has a relatively high throughput for parallel identification, which is especially suitable for resource-limited facilities/areas and point-of-care testing.

  11. Monoclonal antibody-based Surface Plasmon Resonance sensors for pathogen detection

    DEFF Research Database (Denmark)

    Skottrup, Peter Durand

    2007-01-01

    essentially transforms molecular interactions into a digital signal, thereby making detection of analytes label-free. Biosensors are used for detection of analytes ranging from small drug molecules to food- and waterborne microorganisms as well as biowarfare pathogens. In future farming, plant production...... to the initial cell concentration. Assay performance was investigated by cross-reactivity studies against other rust fungi. Cross-reactivity was found with Puccinia recondita and Puccinia hordei, suggesting that the ~ 39 kDa mAb8-antigen might be a conserved structural component in the surface of Puccinia...

  12. The emergence of pan-resistant Gram-negative pathogens merits a rapid global political response.

    Science.gov (United States)

    Walsh, Timothy R; Toleman, Mark A

    2012-01-01

    Recent media coverage of New Delhi metallo-β-lactamase (NDM-1) put antibiotic resistance back on the political map if only for the wrong reasons, mainly the reaction to the naming of NDM-1 and the incorrect assumption that medical tourism was being deliberately targeted. However, work on NDM-1 has most certainly highlighted the rapid dissemination of new antibiotic resistance mechanisms via economic globalization. The example of NDM-1 has also magnified the desperate need for a publicly funded global antibiotic surveillance system rather than just national or regional systems. Furthermore, there is a pressing need to establish a global task force to enforce international transparency and accountability on antibiotic stewardship and the implementation of measures to curb antibiotic resistance. An international antibiotic stewardship index should be established that is related to each country's gross domestic product (GDP) and assesses how much of their GDP is committed to publically funded health initiatives aimed at controlling antibiotic resistance.

  13. Evaluating surveillance strategies for the early detection of low pathogenicity avian influenza infections.

    Directory of Open Access Journals (Sweden)

    Arianna Comin

    Full Text Available In recent years, the early detection of low pathogenicity avian influenza (LPAI viruses in poultry has become increasingly important, given their potential to mutate into highly pathogenic viruses. However, evaluations of LPAI surveillance have mainly focused on prevalence and not on the ability to act as an early warning system. We used a simulation model based on data from Italian LPAI epidemics in turkeys to evaluate different surveillance strategies in terms of their performance as early warning systems. The strategies differed in terms of sample size, sampling frequency, diagnostic tests, and whether or not active surveillance (i.e., routine laboratory testing of farms was performed, and were also tested under different epidemiological scenarios. We compared surveillance strategies by simulating within-farm outbreaks. The output measures were the proportion of infected farms that are detected and the farm reproduction number (R(h. The first one provides an indication of the sensitivity of the surveillance system to detect within-farm infections, whereas R(h reflects the effectiveness of outbreak detection (i.e., if detection occurs soon enough to bring an epidemic under control. Increasing the sampling frequency was the most effective means of improving the timeliness of detection (i.e., it occurs earlier, whereas increasing the sample size increased the likelihood of detection. Surveillance was only effective in preventing an epidemic if actions were taken within two days of sampling. The strategies were not affected by the quality of the diagnostic test, although performing both serological and virological assays increased the sensitivity of active surveillance. Early detection of LPAI outbreaks in turkeys can be achieved by increasing the sampling frequency for active surveillance, though very frequent sampling may not be sustainable in the long term. We suggest that, when no LPAI virus is circulating yet and there is a low risk of virus

  14. Rapid Identification of Bacterial Pathogens of Military Interest Using Surface-Enhanced Raman Spectroscopy

    Science.gov (United States)

    2014-06-11

    Hendra , & McQuillan, 197 4; Jeanmaire & Van Duyne, 1977), SERS has matured into a widely used technique, especially in biosensing and medical...detection of viruses (Driskell et al., 2008; Shanmukh et al., 2006) and bacteria (Chu, Huang, & Zhao, 2008; Jarvis, Clarke, & Goodacre, 20