WorldWideScience

Sample records for rapid dna mapping

  1. Rapid genotyping with DNA micro-arrays for high-density linkage mapping and QTL mapping in common buckwheat (Fagopyrum esculentum Moench)

    Science.gov (United States)

    Yabe, Shiori; Hara, Takashi; Ueno, Mariko; Enoki, Hiroyuki; Kimura, Tatsuro; Nishimura, Satoru; Yasui, Yasuo; Ohsawa, Ryo; Iwata, Hiroyoshi

    2014-01-01

    For genetic studies and genomics-assisted breeding, particularly of minor crops, a genotyping system that does not require a priori genomic information is preferable. Here, we demonstrated the potential of a novel array-based genotyping system for the rapid construction of high-density linkage map and quantitative trait loci (QTL) mapping. By using the system, we successfully constructed an accurate, high-density linkage map for common buckwheat (Fagopyrum esculentum Moench); the map was composed of 756 loci and included 8,884 markers. The number of linkage groups converged to eight, which is the basic number of chromosomes in common buckwheat. The sizes of the linkage groups of the P1 and P2 maps were 773.8 and 800.4 cM, respectively. The average interval between adjacent loci was 2.13 cM. The linkage map constructed here will be useful for the analysis of other common buckwheat populations. We also performed QTL mapping for main stem length and detected four QTL. It took 37 days to process 178 samples from DNA extraction to genotyping, indicating the system enables genotyping of genome-wide markers for a few hundred buckwheat plants before the plants mature. The novel system will be useful for genomics-assisted breeding in minor crops without a priori genomic information. PMID:25914583

  2. Quantitive DNA Fiber Mapping

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Chun-Mei; Wang, Mei; Greulich-Bode, Karin M.; Weier, Jingly F.; Weier, Heinz-Ulli G.

    2008-01-28

    Several hybridization-based methods used to delineate single copy or repeated DNA sequences in larger genomic intervals take advantage of the increased resolution and sensitivity of free chromatin, i.e., chromatin released from interphase cell nuclei. Quantitative DNA fiber mapping (QDFM) differs from the majority of these methods in that it applies FISH to purified, clonal DNA molecules which have been bound with at least one end to a solid substrate. The DNA molecules are then stretched by the action of a receding meniscus at the water-air interface resulting in DNA molecules stretched homogeneously to about 2.3 kb/{micro}m. When non-isotopically, multicolor-labeled probes are hybridized to these stretched DNA fibers, their respective binding sites are visualized in the fluorescence microscope, their relative distance can be measured and converted into kilobase pairs (kb). The QDFM technique has found useful applications ranging from the detection and delineation of deletions or overlap between linked clones to the construction of high-resolution physical maps to studies of stalled DNA replication and transcription.

  3. High resolution optical DNA mapping

    Science.gov (United States)

    Baday, Murat

    Many types of diseases including cancer and autism are associated with copy-number variations in the genome. Most of these variations could not be identified with existing sequencing and optical DNA mapping methods. We have developed Multi-color Super-resolution technique, with potential for high throughput and low cost, which can allow us to recognize more of these variations. Our technique has made 10--fold improvement in the resolution of optical DNA mapping. Using a 180 kb BAC clone as a model system, we resolved dense patterns from 108 fluorescent labels of two different colors representing two different sequence-motifs. Overall, a detailed DNA map with 100 bp resolution was achieved, which has the potential to reveal detailed information about genetic variance and to facilitate medical diagnosis of genetic disease.

  4. Rapid resistome mapping using nanopore sequencing.

    Science.gov (United States)

    van der Helm, Eric; Imamovic, Lejla; Hashim Ellabaan, Mostafa M; van Schaik, Willem; Koza, Anna; Sommer, Morten O A

    2017-05-05

    The emergence of antibiotic resistance in human pathogens has become a major threat to modern medicine. The outcome of antibiotic treatment can be affected by the composition of the gut. Accordingly, knowledge of the gut resistome composition could enable more effective and individualized treatment of bacterial infections. Yet, rapid workflows for resistome characterization are lacking. To address this challenge we developed the poreFUME workflow that deploys functional metagenomic selections and nanopore sequencing to resistome mapping. We demonstrate the approach by functionally characterizing the gut resistome of an ICU (intensive care unit) patient. The accuracy of the poreFUME pipeline is with >97% sufficient for the annotation of antibiotic resistance genes. The poreFUME pipeline provides a promising approach for efficient resistome profiling that could inform antibiotic treatment decisions in the future. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Rapid consolidation of new knowledge in adulthood via fast mapping.

    Science.gov (United States)

    Coutanche, Marc N; Thompson-Schill, Sharon L

    2015-09-01

    Rapid word learning, where words are 'fast mapped' onto new concepts, may help build vocabulary during childhood. Recent evidence has suggested that fast mapping might help to rapidly integrate information into memory networks of the adult neocortex. The neural basis for this learning by fast mapping determines key properties of the learned information. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Rapid identification of DNA-binding proteins by mass spectrometry

    DEFF Research Database (Denmark)

    Nordhoff, E.; Korgsdam, A.-M.; Jørgensen, H.F.

    1999-01-01

    We report a protocol for the rapid identification of DNA-binding proteins. Immobilized DNA probes harboring a specific sequence motif are incubated with cell or nuclear extract. Proteins are analyzed directly off the solid support by matrix-assisted laser desorption/ionization time-of-flight mass...... was validated by the identification of known prokaryotic and eukaryotic DNA-binding proteins, and its use provided evidence that poly(ADP-ribose) polymerase exhibits DNA sequence-specific binding to DNA....

  7. Validation of DNA probes for molecular cytogenetics by mapping onto immobilized circular DNA

    Energy Technology Data Exchange (ETDEWEB)

    Greulich-Bode, Karin; Wang, Mei; Rhein, Andreas; Weier, Jingly; Weier, Heinz-Ulli

    2008-12-16

    Fluorescence in situ hybridization (FISH) is a sensitive and rapid procedure to detect gene rearrangements in tumor cells using non-isotopically labeled DNA probes. Large insert recombinant DNA clones such as bacterial artificial chromosome (BAC) or P1/PAC clones have established themselves in recent years as preferred starting material for probe preparations due to their low rates of chimerism and ease of use. However, when developing probes for the quantitative analysis of rearrangements involving genomic intervals of less than 100kb, careful probe selection and characterization are of paramount importance. We describe a sensitive approach to quality control probe clones suspected of carrying deletions or for measuring clone overlap with near kilobase resolution. The method takes advantage of the fact that P1/PAC/BAC's can be isolated as circular DNA molecules, stretched out on glass slides and fine-mapped by multicolor hybridization with smaller probe molecules. Two examples demonstrate the application of this technique: mapping of a gene-specific {approx}6kb plasmid onto an unusually small, {approx}55kb circular P1 molecule and the determination of the extent of overlap between P1 molecules homologous to the human NF-?B2 locus. The relatively simple method presented here does not require specialized equipment and may thus find widespread applications in DNA probe preparation and characterization, the assembly of physical maps for model organisms or in studies on gene rearrangements.

  8. Validation of DNA probes for molecular cytogenetics by mapping onto immobilized circular DNA

    Energy Technology Data Exchange (ETDEWEB)

    Greulich-Bode, Karin M.; Wang, Mei; Rhein, Andreas P.; Weier, Jingly F.; Weier, Heinz-Ulli G.

    2008-12-04

    Fluorescence in situ hybridization (FISH) is a sensitive and rapid procedure to detect gene rearrangements in tumor cells using non-isotopically labeled DNA probes. Large insert recombinant DNA clones such as bacterial artificial chromosome (BAC) or P1/PAC clones have established themselves in recent years as preferred starting material for probe preparations due to their low rates of chimerism and ease of use. However, when developing probes for the quantitative analysis of rearrangements involving genomic intervals of less than 100kb, careful probe selection and characterization are of paramount importance. We describe a sensitive approach to quality control probe clones suspected of carrying deletions or for measuring clone overlap with near kilobase resolution. The method takes advantage of the fact that P1/PAC/BAC's can be isolated as circular DNA molecules, stretched out on glass slides and fine-mapped by multicolor hybridization with smaller probe molecules. Two examples demonstrate the application of this technique: mapping of a gene-specific {approx}6kb plasmid onto an unusually small, {approx}55kb circular P1 molecule and the determination of the extent of overlap between P1 molecules homologous to the human NF-{kappa}B2 locus. The relatively simple method presented here does not require specialized equipment and may thus find widespread applications in DNA probe preparation and characterization, the assembly of physical maps for model organisms or in studies on gene rearrangements.

  9. DNA immunoprecipitation semiconductor sequencing (DIP-SC-seq) as a rapid method to generate genome wide epigenetic signatures

    OpenAIRE

    Thomson, John P.; Fawkes, Angie; Ottaviano, Raffaele; Hunter, Jennifer M.; Shukla, Ruchi; Mjoseng, Heidi K.; Clark, Richard; Coutts, Audrey; Murphy, Lee; Meehan, Richard R.

    2015-01-01

    Modification of DNA resulting in 5-methylcytosine (5 mC) or 5-hydroxymethylcytosine (5hmC) has been shown to influence the local chromatin environment and affect transcription. Although recent advances in next generation sequencing technology allow researchers to map epigenetic modifications across the genome, such experiments are often time-consuming and cost prohibitive. Here we present a rapid and cost effective method of generating genome wide DNA modification maps utilising commercially ...

  10. DNA Probe Pooling for Rapid Delineation of Chromosomal Breakpoints

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Chun-Mei; Kwan, Johnson; Baumgartner, Adolf; Weier, Jingly F.; Wang, Mei; Escudero, Tomas; Munne' , Santiago; Zitzelsberger, Horst F.; Weier, Heinz-Ulrich

    2009-01-30

    Structural chromosome aberrations are hallmarks of many human genetic diseases. The precise mapping of translocation breakpoints in tumors is important for identification of genes with altered levels of expression, prediction of tumor progression, therapy response, or length of disease-free survival as well as the preparation of probes for detection of tumor cells in peripheral blood. Similarly, in vitro fertilization (IVF) and preimplantation genetic diagnosis (PGD) for carriers of balanced, reciprocal translocations benefit from accurate breakpoint maps in the preparation of patient-specific DNA probes followed by a selection of normal or balanced oocytes or embryos. We expedited the process of breakpoint mapping and preparation of case-specific probes by utilizing physically mapped bacterial artificial chromosome (BAC) clones. Historically, breakpoint mapping is based on the definition of the smallest interval between proximal and distal probes. Thus, many of the DNA probes prepared for multi-clone and multi-color mapping experiments do not generate additional information. Our pooling protocol described here with examples from thyroid cancer research and PGD accelerates the delineation of translocation breakpoints without sacrificing resolution. The turnaround time from clone selection to mapping results using tumor or IVF patient samples can be as short as three to four days.

  11. Application of GIS Rapid Mapping Technology in Disaster Monitoring

    Science.gov (United States)

    Wang, Z.; Tu, J.; Liu, G.; Zhao, Q.

    2018-04-01

    With the rapid development of GIS and RS technology, especially in recent years, GIS technology and its software functions have been increasingly mature and enhanced. And with the rapid development of mathematical statistical tools for spatial modeling and simulation, has promoted the widespread application and popularization of quantization in the field of geology. Based on the investigation of field disaster and the construction of spatial database, this paper uses remote sensing image, DEM and GIS technology to obtain the data information of disaster vulnerability analysis, and makes use of the information model to carry out disaster risk assessment mapping.Using ArcGIS software and its spatial data modeling method, the basic data information of the disaster risk mapping process was acquired and processed, and the spatial data simulation tool was used to map the disaster rapidly.

  12. Super-resolution optical DNA Mapping via DNA methyltransferase-directed click chemistry

    DEFF Research Database (Denmark)

    Vranken, Charlotte; Deen, Jochem; Dirix, Lieve

    2014-01-01

    We demonstrate an approach to optical DNA mapping, which enables near single-molecule characterization of whole bacteriophage genomes. Our approach uses a DNA methyltransferase enzyme to target labelling to specific sites and copper-catalysed azide-alkyne cycloaddition to couple a fluorophore...... to the DNA. We achieve a labelling efficiency of ∼70% with an average labelling density approaching one site every 500 bp. Such labelling density bridges the gap between the output of a typical DNA sequencing experiment and the long-range information derived from traditional optical DNA mapping. We lay...... the foundations for a wider-scale adoption of DNA mapping by screening 11 methyltransferases for their ability to direct sequence-specific DNA transalkylation; the first step of the DNA labelling process and by optimizing reaction conditions for fluorophore coupling via a click reaction. Three of 11 enzymes...

  13. Recent Advancements in DNA Damage-Transcription Crosstalk and High-Resolution Mapping of DNA Breaks.

    Science.gov (United States)

    Vitelli, Valerio; Galbiati, Alessandro; Iannelli, Fabio; Pessina, Fabio; Sharma, Sheetal; d'Adda di Fagagna, Fabrizio

    2017-08-31

    Until recently, DNA damage arising from physiological DNA metabolism was considered a detrimental by-product for cells. However, an increasing amount of evidence has shown that DNA damage could have a positive role in transcription activation. In particular, DNA damage has been detected in transcriptional elements following different stimuli. These physiological DNA breaks are thought to be instrumental for the correct expression of genomic loci through different mechanisms. In this regard, although a plethora of methods are available to precisely map transcribed regions and transcription start sites, commonly used techniques for mapping DNA breaks lack sufficient resolution and sensitivity to draw a robust correlation between DNA damage generation and transcription. Recently, however, several methods have been developed to map DNA damage at single-nucleotide resolution, thus providing a new set of tools to correlate DNA damage and transcription. Here, we review how DNA damage can positively regulate transcription initiation, the current techniques for mapping DNA breaks at high resolution, and how these techniques can benefit future studies of DNA damage and transcription.

  14. Genome-wide mapping of DNA strand breaks.

    Directory of Open Access Journals (Sweden)

    Frédéric Leduc

    Full Text Available Determination of cellular DNA damage has so far been limited to global assessment of genome integrity whereas nucleotide-level mapping has been restricted to specific loci by the use of specific primers. Therefore, only limited DNA sequences can be studied and novel regions of genomic instability can hardly be discovered. Using a well-characterized yeast model, we describe a straightforward strategy to map genome-wide DNA strand breaks without compromising nucleotide-level resolution. This technique, termed "damaged DNA immunoprecipitation" (dDIP, uses immunoprecipitation and the terminal deoxynucleotidyl transferase-mediated dUTP-biotin end-labeling (TUNEL to capture DNA at break sites. When used in combination with microarray or next-generation sequencing technologies, dDIP will allow researchers to map genome-wide DNA strand breaks as well as other types of DNA damage and to establish a clear profiling of altered genes and/or intergenic sequences in various experimental conditions. This mapping technique could find several applications for instance in the study of aging, genotoxic drug screening, cancer, meiosis, radiation and oxidative DNA damage.

  15. Environmental DNA mapping of Zebra Mussel populations

    Science.gov (United States)

    Amberg, Jon J.; Merkes, Christopher

    2016-01-01

    Environmental DNA (eDNA) has become a popular tool for detecting aquatic invasive species, but advancements have made it possible to potentially answer other questions like reproduction, movement, and abundance of the targeted organism. In this study we developed a Zebra Mussel (Dreissena polymorpha) eDNA protocol. We then determined if this assay could be used to help determine Zebra Mussel biomass in a lake with a well-established population of Zebra Mussels and a lake with an emerging population of mussels. Our eDNA assay detected DNA of Zebra Mussels but not DNA from more than 20 other species of fish and mussels, many commonly found in Minnesota waters. Our assay did not predict biomass. We did find that DNA from Zebra Mussels accumulated in softer substrates in both lakes, even though the mussels were predominately on the harder substrates. Therefore, we concluded that eDNA may be useful to detect the presence of Zebra Mussels in these lakes but our assay/approach could not predict biomass.

  16. Rapid tryptic mapping using enzymatically active mass spectrometer probe tips

    Energy Technology Data Exchange (ETDEWEB)

    Dogruel, D.; Williams, P.; Nelson, R.W. [Arizona State Univ., Tempe, AZ (United States)

    1995-12-01

    A method has been developed for rapid, sensitive, and accurate tryptic mapping of polypeptides using matrix-assisted laser desorption/ionization time-of-flight mass analysis. The technique utilizes mass spectrometer probe tips which have been activated through the covalent immobilization of trypsin. The enzymatically active probe tips were used for the tryptic mapping of chicken egg lysozyme and the results compared with those obtained using either free trypsin or agarose-immobilized trypsin. A significant increase in the overall sensitivity of the process was observed using the active probe tips, as well as the production of more characteristic proteolytic fragments and the elimination of background signals due to the autolysis of the trypsin. Further, probe tip digestions were found to be rapid and convenient. 19 refs., 6 figs., 2 tabs.

  17. A Novel Audio Cryptosystem Using Chaotic Maps and DNA Encoding

    Directory of Open Access Journals (Sweden)

    S. J. Sheela

    2017-01-01

    Full Text Available Chaotic maps have good potential in security applications due to their inherent characteristics relevant to cryptography. This paper introduces a new audio cryptosystem based on chaotic maps, hybrid chaotic shift transform (HCST, and deoxyribonucleic acid (DNA encoding rules. The scheme uses chaotic maps such as two-dimensional modified Henon map (2D-MHM and standard map. The 2D-MHM which has sophisticated chaotic behavior for an extensive range of control parameters is used to perform HCST. DNA encoding technology is used as an auxiliary tool which enhances the security of the cryptosystem. The performance of the algorithm is evaluated for various speech signals using different encryption/decryption quality metrics. The simulation and comparison results show that the algorithm can achieve good encryption results and is able to resist several cryptographic attacks. The various types of analysis revealed that the algorithm is suitable for narrow band radio communication and real-time speech encryption applications.

  18. Global Rapid Flood Mapping System with Spaceborne SAR Data

    Science.gov (United States)

    Yun, S. H.; Owen, S. E.; Hua, H.; Agram, P. S.; Fattahi, H.; Liang, C.; Manipon, G.; Fielding, E. J.; Rosen, P. A.; Webb, F.; Simons, M.

    2017-12-01

    As part of the Advanced Rapid Imaging and Analysis (ARIA) project for Natural Hazards, at NASA's Jet Propulsion Laboratory and California Institute of Technology, we have developed an automated system that produces derived products for flood extent map generation using spaceborne SAR data. The system takes user's input of area of interest polygons and time window for SAR data search (pre- and post-event). Then the system automatically searches and downloads SAR data, processes them to produce coregistered SAR image pairs, and generates log amplitude ratio images from each pair. Currently the system is automated to support SAR data from the European Space Agency's Sentinel-1A/B satellites. We have used the system to produce flood extent maps from Sentinel-1 SAR data for the May 2017 Sri Lanka floods, which killed more than 200 people and displaced about 600,000 people. Our flood extent maps were delivered to the Red Cross to support response efforts. Earlier we also responded to the historic August 2016 Louisiana floods in the United States, which claimed 13 people's lives and caused over $10 billion property damage. For this event, we made synchronized observations from space, air, and ground in close collaboration with USGS and NOAA. The USGS field crews acquired ground observation data, and NOAA acquired high-resolution airborne optical imagery within the time window of +/-2 hours of the SAR data acquisition by JAXA's ALOS-2 satellite. The USGS coordinates of flood water boundaries were used to calibrate our flood extent map derived from the ALOS-2 SAR data, and the map was delivered to FEMA for estimating the number of households affected. Based on the lessons learned from this response effort, we customized the ARIA system automation for rapid flood mapping and developed a mobile friendly web app that can easily be used in the field for data collection. Rapid automatic generation of SAR-based global flood maps calibrated with independent observations from

  19. A software tool for rapid flood inundation mapping

    Science.gov (United States)

    Verdin, James; Verdin, Kristine; Mathis, Melissa L.; Magadzire, Tamuka; Kabuchanga, Eric; Woodbury, Mark; Gadain, Hussein

    2016-06-02

    The GIS Flood Tool (GFT) was developed by the U.S. Geological Survey with support from the U.S. Agency for International Development’s Office of U.S. Foreign Disaster Assistance to provide a means for production of reconnaissance-level flood inundation mapping for data-sparse and resource-limited areas of the world. The GFT has also attracted interest as a tool for rapid assessment flood inundation mapping for the Flood Inundation Mapping Program of the U.S. Geological Survey. The GFT can fill an important gap for communities that lack flood inundation mapping by providing a first-estimate of inundation zones, pending availability of resources to complete an engineering study. The tool can also help identify priority areas for application of scarce flood inundation mapping resources. The technical basis of the GFT is an application of the Manning equation for steady flow in an open channel, operating on specially processed digital elevation data. The GFT is implemented as a software extension in ArcGIS. Output maps from the GFT were validated at 11 sites with inundation maps produced previously by the Flood Inundation Mapping Program using standard one-dimensional hydraulic modeling techniques. In 80 percent of the cases, the GFT inundation patterns matched 75 percent or more of the one-dimensional hydraulic model inundation patterns. Lower rates of pattern agreement were seen at sites with low relief and subtle surface water divides. Although the GFT is simple to use, it should be applied with the oversight or review of a qualified hydraulic engineer who understands the simplifying assumptions of the approach.

  20. Rapid Sequential in Situ Multiplexing with DNA Exchange Imaging in Neuronal Cells and Tissues.

    Science.gov (United States)

    Wang, Yu; Woehrstein, Johannes B; Donoghue, Noah; Dai, Mingjie; Avendaño, Maier S; Schackmann, Ron C J; Zoeller, Jason J; Wang, Shan Shan H; Tillberg, Paul W; Park, Demian; Lapan, Sylvain W; Boyden, Edward S; Brugge, Joan S; Kaeser, Pascal S; Church, George M; Agasti, Sarit S; Jungmann, Ralf; Yin, Peng

    2017-10-11

    To decipher the molecular mechanisms of biological function, it is critical to map the molecular composition of individual cells or even more importantly tissue samples in the context of their biological environment in situ. Immunofluorescence (IF) provides specific labeling for molecular profiling. However, conventional IF methods have finite multiplexing capabilities due to spectral overlap of the fluorophores. Various sequential imaging methods have been developed to circumvent this spectral limit but are not widely adopted due to the common limitation of requiring multirounds of slow (typically over 2 h at room temperature to overnight at 4 °C in practice) immunostaining. We present here a practical and robust method, which we call DNA Exchange Imaging (DEI), for rapid in situ spectrally unlimited multiplexing. This technique overcomes speed restrictions by allowing for single-round immunostaining with DNA-barcoded antibodies, followed by rapid (less than 10 min) buffer exchange of fluorophore-bearing DNA imager strands. The programmability of DEI allows us to apply it to diverse microscopy platforms (with Exchange Confocal, Exchange-SIM, Exchange-STED, and Exchange-PAINT demonstrated here) at multiple desired resolution scales (from ∼300 nm down to sub-20 nm). We optimized and validated the use of DEI in complex biological samples, including primary neuron cultures and tissue sections. These results collectively suggest DNA exchange as a versatile, practical platform for rapid, highly multiplexed in situ imaging, potentially enabling new applications ranging from basic science, to drug discovery, and to clinical pathology.

  1. Rapid DNA analysis for automated processing and interpretation of low DNA content samples.

    Science.gov (United States)

    Turingan, Rosemary S; Vasantgadkar, Sameer; Palombo, Luke; Hogan, Catherine; Jiang, Hua; Tan, Eugene; Selden, Richard F

    2016-01-01

    Short tandem repeat (STR) analysis of casework samples with low DNA content include those resulting from the transfer of epithelial cells from the skin to an object (e.g., cells on a water bottle, or brim of a cap), blood spatter stains, and small bone and tissue fragments. Low DNA content (LDC) samples are important in a wide range of settings, including disaster response teams to assist in victim identification and family reunification, military operations to identify friend or foe, criminal forensics to identify suspects and exonerate the innocent, and medical examiner and coroner offices to identify missing persons. Processing LDC samples requires experienced laboratory personnel, isolated workstations, and sophisticated equipment, requires transport time, and involves complex procedures. We present a rapid DNA analysis system designed specifically to generate STR profiles from LDC samples in field-forward settings by non-technical operators. By performing STR in the field, close to the site of collection, rapid DNA analysis has the potential to increase throughput and to provide actionable information in real time. A Low DNA Content BioChipSet (LDC BCS) was developed and manufactured by injection molding. It was designed to function in the fully integrated Accelerated Nuclear DNA Equipment (ANDE) instrument previously designed for analysis of buccal swab and other high DNA content samples (Investigative Genet. 4(1):1-15, 2013). The LDC BCS performs efficient DNA purification followed by microfluidic ultrafiltration of the purified DNA, maximizing the quantity of DNA available for subsequent amplification and electrophoretic separation and detection of amplified fragments. The system demonstrates accuracy, precision, resolution, signal strength, and peak height ratios appropriate for casework analysis. The LDC rapid DNA analysis system is effective for the generation of STR profiles from a wide range of sample types. The technology broadens the range of sample

  2. Rapid Flood Map Generation from Spaceborne SAR Observations

    Science.gov (United States)

    Yun, S. H.; Liang, C.; Manipon, G.; Jung, J.; Gurrola, E. M.; Owen, S. E.; Hua, H.; Agram, P. S.; Webb, F.; Sacco, G. F.; Rosen, P. A.; Simons, M.

    2016-12-01

    The Advanced Rapid Imaging and Analysis (ARIA) team has responded to the January 2016 US Midwest Floods along the Mississippi River. Daily teleconferences with FEMA, NOAA, NGA, and USGS, provided information on precipitation and flood crest migration, based on which we coordinated with the Japanese Aerospace Exploration Agency (JAXA) through NASA headquarters for JAXA's ALOS-2 timely tasking over two paths. We produced flood extent maps using ALOS-2 SM3 mode Level 1.5 data that were provided through the International Charter and stored at the US Geological Survey's Hazards Data Distribution System (HDDS) archive. On January 6, the first four frames (70 km x 240 km) were acquired, which included the City of Memphis. We registered post-event SAR images to pre-event images, applied radiometric calibration, took a logarithm of the ratio of the two images. Two thresholds were applied to represent flooded areas that became open water (colored in blue) and flooded areas with tall vegetation (colored in red). The second path was acquired on January 11 further down along the Mississippi River. Seven frames (70 km x 420 km) were acquired and flood maps were created in the similar fashion. The maps were delivered to the FEMA as well as posted on ARIA's public website. The FEMA stated that SAR provides inspection priority for optical imagery and ground response. The ALOS-2 data and the products have been a very important source of information during this response as the flood crest has moved down stream. The SAR data continue to be an important resource during times when optical observations are often not useful. In close collaboration with FEMA and USGS, we also work on other flood events including June 2016 China Floods using European Space Agency's (ESA's) Sentienl-1 data, to produce flood extent maps and identify algorithmic needs and ARIA system's requirements to automate and rapidly produce and deliver flood maps for future events. With the addition of Sentinel-1B

  3. In vivo rapid field map measurement and shimming

    International Nuclear Information System (INIS)

    Kanayama, Shoichi; Kassai, Yoshimori; Kondo, Masafumi; Kuhara, Shigehide; Satoh, Kozo; Seo, Yasutsugu.

    1992-01-01

    MR imaging and MR spectroscopy need a homogeneous static magnetic field. The static field characteristics are determined by the magnet's homogeneity, the set-up conditions, and the magnetic suspectibility of the subject itself. The field inhomogeneity is usually minimized only once when the apparatus is installed. However, field distortions arising from the magnetic susceptibility differ with each subject and region. To overcome this problem, in vivo shimming can be carried out to improve the homogeneity. The procedures are too lengthy when applying the conventional shimming techniques in vivo. We have developed a new field map measurement technique using a double gradient-recalled echo phase mapping. The values of the currents for the 13-channel shim coils are derived by least squares fitting to the field map and automatically applied to the shim coils. The proposed technique can rapidly and accurately measure the field map in vivo and correct the field inhomogeneity. The results show that this technique improves the homogeneity, especially in regions having a simple field distribution. However, local sharp field distortions which can not be practically corrected by shimming occur near the eyes, ears, heart, etc. due to abrupt susceptibility changes. (author)

  4. Towards rapid prototyped convective microfluidic DNA amplification platform

    Science.gov (United States)

    Ajit, Smrithi; Praveen, Hemanth Mithun; Puneeth, S. B.; Dave, Abhishek; Sesham, Bharat; Mohan, K. N.; Goel, Sanket

    2017-02-01

    Today, Polymerase Chain Reaction (PCR) based DNA amplification plays an indispensable role in the field of biomedical research. Its inherent ability to exponentially amplify sample DNA has proven useful for the identification of virulent pathogens like those causing Multiple Drug-Resistant Tuberculosis (MDR-TB). The intervention of Microfluidics technology has revolutionized the concept of PCR from being a laborious and time consuming process into one that is faster, easily portable and capable of being multifunctional. The Microfluidics based PCR outweighs its traditional counterpart in terms of flexibility of varying reaction rate, operation simplicity, need of a fraction of volume and capability of being integrated with other functional elements. The scope of the present work involves the development of a real-time continuous flow microfluidic device, fabricated by 3D printing-governed rapid prototyping method, eventually leading to an automated and robust platform to process multiple DNA samples for detection of MDRTB-associated mutations. The thermal gradient characteristic to the PCR process is produced using peltier units appropriate to the microfluidic environment fully monitored and controlled by a low cost controller driven by a Data Acquisition System. The process efficiency achieved in the microfluidic environment in terms of output per cycle is expected to be on par with the traditional PCR and capable of earning the additional advantages of being faster and minimizing the handling.

  5. Linkage map of the fragments of herpesvirus papio DNA.

    Science.gov (United States)

    Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

    1981-01-01

    Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

  6. Fast mapping rapidly integrates information into existing memory networks.

    Science.gov (United States)

    Coutanche, Marc N; Thompson-Schill, Sharon L

    2014-12-01

    Successful learning involves integrating new material into existing memory networks. A learning procedure known as fast mapping (FM), thought to simulate the word-learning environment of children, has recently been linked to distinct neuroanatomical substrates in adults. This idea has suggested the (never-before tested) hypothesis that FM may promote rapid incorporation into cortical memory networks. We test this hypothesis here in 2 experiments. In our 1st experiment, we introduced 50 participants to 16 unfamiliar animals and names through FM or explicit encoding (EE) and tested participants on the training day, and again after sleep. Learning through EE produced strong declarative memories, without immediate lexical competition, as expected from slow-consolidation models. Learning through FM, however, led to almost immediate lexical competition, which continued to the next day. Additionally, the learned words began to prime related concepts on the day following FM (but not EE) training. In a 2nd experiment, we replicated the lexical integration results and determined that presenting an already-known item during learning was crucial for rapid integration through FM. The findings presented here indicate that learned items can be integrated into cortical memory networks at an accelerated rate through fast mapping. The retrieval of a related known concept, in order to infer the target of the FM question, is critical for this effect. PsycINFO Database Record (c) 2014 APA, all rights reserved.

  7. Human cDNA mapping using fluorescence in situ hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Korenberg, J.R.

    1993-03-04

    Genetic mapping is approached using the techniques of high resolution fluorescence in situ hybridization (FISH). This technology and the results of its application are designed to rapidly generate whole genome as tool box of expressed sequence to speed the identification of human disease genes. The results of this study are intended to dovetail with and to link the results of existing technologies for creating backbone YAC and genetic maps. In the first eight months, this approach generated 60--80% of the expressed sequence map, the remainder expected to be derived through more long-term, labor-intensive, regional chromosomal gene searches or sequencing. The laboratory has made significant progress in the set-up phase, in mapping fetal and adult brain and other cDNAs, in testing a model system for directly linking genetic and physical maps using FISH with small fragments, in setting up a database, and in establishing the validity and throughput of the system.

  8. Research on the Application of Rapid Surveying and Mapping for Large Scare Topographic Map by Uav Aerial Photography System

    Science.gov (United States)

    Gao, Z.; Song, Y.; Li, C.; Zeng, F.; Wang, F.

    2017-08-01

    Rapid acquisition and processing method of large scale topographic map data, which relies on the Unmanned Aerial Vehicle (UAV) low-altitude aerial photogrammetry system, is studied in this paper, elaborating the main work flow. Key technologies of UAV photograph mapping is also studied, developing a rapid mapping system based on electronic plate mapping system, thus changing the traditional mapping mode and greatly improving the efficiency of the mapping. Production test and achievement precision evaluation of Digital Orth photo Map (DOM), Digital Line Graphic (DLG) and other digital production were carried out combined with the city basic topographic map update project, which provides a new techniques for large scale rapid surveying and has obvious technical advantage and good application prospect.

  9. Alu polymerase chain reaction: A method for rapid isolation of human-specific sequences from complex DNA sources

    International Nuclear Information System (INIS)

    Nelson, D.L.; Ledbetter, S.A.; Corbo, L.; Victoria, M.F.; Ramirez-Solis, R.; Webster, T.D.; Ledbetter, D.H.; Caskey, C.T.

    1989-01-01

    Current efforts to map the human genome are focused on individual chromosomes or smaller regions and frequently rely on the use of somatic cell hybrids. The authors report the application of the polymerase chain reaction to direct amplification of human DNA from hybrid cells containing regions of the human genome in rodent cell backgrounds using primers directed to the human Alu repeat element. They demonstrate Alu-directed amplification of a fragment of the human HPRT gene from both hybrid cell and cloned DNA and identify through sequence analysis the Alu repeats involved in this amplification. They also demonstrate the application of this technique to identify the chromosomal locations of large fragments of the human X chromosome cloned in a yeast artificial chromosome and the general applicability of the method to the preparation of DNA probes from cloned human sequences. The technique allows rapid gene mapping and provides a simple method for the isolation and analysis of specific chromosomal regions

  10. Mapping soil heterogeneity using RapidEye satellite images

    Science.gov (United States)

    Piccard, Isabelle; Eerens, Herman; Dong, Qinghan; Gobin, Anne; Goffart, Jean-Pierre; Curnel, Yannick; Planchon, Viviane

    2016-04-01

    In the frame of BELCAM, a project funded by the Belgian Science Policy Office (BELSPO), researchers from UCL, ULg, CRA-W and VITO aim to set up a collaborative system to develop and deliver relevant information for agricultural monitoring in Belgium. The main objective is to develop remote sensing methods and processing chains able to ingest crowd sourcing data, provided by farmers or associated partners, and to deliver in return relevant and up-to-date information for crop monitoring at the field and district level based on Sentinel-1 and -2 satellite imagery. One of the developments within BELCAM concerns an automatic procedure to detect soil heterogeneity within a parcel using optical high resolution images. Such heterogeneity maps can be used to adjust farming practices according to the detected heterogeneity. This heterogeneity may for instance be caused by differences in mineral composition of the soil, organic matter content, soil moisture or soil texture. Local differences in plant growth may be indicative for differences in soil characteristics. As such remote sensing derived vegetation indices may be used to reveal soil heterogeneity. VITO started to delineate homogeneous zones within parcels by analyzing a series of RapidEye images acquired in 2015 (as a precursor for Sentinel-2). Both unsupervised classification (ISODATA, K-means) and segmentation techniques were tested. Heterogeneity maps were generated from images acquired at different moments during the season (13 May, 30 June, 17 July, 31 August, 11 September and 1 November 2015). Tests were performed using blue, green, red, red edge and NIR reflectances separately and using derived indices such as NDVI, fAPAR, CIrededge, NDRE2. The results for selected winter wheat, maize and potato fields were evaluated together with experts from the collaborating agricultural research centers. For a few fields UAV images and/or yield measurements were available for comparison.

  11. Global mapping of DNA conformational flexibility on Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Giulia Menconi

    2015-04-01

    Full Text Available In this study we provide the first comprehensive map of DNA conformational flexibility in Saccharomyces cerevisiae complete genome. Flexibility plays a key role in DNA supercoiling and DNA/protein binding, regulating DNA transcription, replication or repair. Specific interest in flexibility analysis concerns its relationship with human genome instability. Enrichment in flexible sequences has been detected in unstable regions of human genome defined fragile sites, where genes map and carry frequent deletions and rearrangements in cancer. Flexible sequences have been suggested to be the determinants of fragile gene proneness to breakage; however, their actual role and properties remain elusive. Our in silico analysis carried out genome-wide via the StabFlex algorithm, shows the conserved presence of highly flexible regions in budding yeast genome as well as in genomes of other Saccharomyces sensu stricto species. Flexibile peaks in S. cerevisiae identify 175 ORFs mapping on their 3'UTR, a region affecting mRNA translation, localization and stability. (TAn repeats of different extension shape the central structure of peaks and co-localize with polyadenylation efficiency element (EE signals. ORFs with flexible peaks share common features. Transcripts are characterized by decreased half-life: this is considered peculiar of genes involved in regulatory systems with high turnover; consistently, their function affects biological processes such as cell cycle regulation or stress response. Our findings support the functional importance of flexibility peaks, suggesting that the flexible sequence may be derived by an expansion of canonical TAYRTA polyadenylation efficiency element. The flexible (TAn repeat amplification could be the outcome of an evolutionary neofunctionalization leading to a differential 3'-end processing and expression regulation in genes with peculiar function. Our study provides a new support to the functional role of flexibility in

  12. Global mapping of DNA conformational flexibility on Saccharomyces cerevisiae.

    Science.gov (United States)

    Menconi, Giulia; Bedini, Andrea; Barale, Roberto; Sbrana, Isabella

    2015-04-01

    In this study we provide the first comprehensive map of DNA conformational flexibility in Saccharomyces cerevisiae complete genome. Flexibility plays a key role in DNA supercoiling and DNA/protein binding, regulating DNA transcription, replication or repair. Specific interest in flexibility analysis concerns its relationship with human genome instability. Enrichment in flexible sequences has been detected in unstable regions of human genome defined fragile sites, where genes map and carry frequent deletions and rearrangements in cancer. Flexible sequences have been suggested to be the determinants of fragile gene proneness to breakage; however, their actual role and properties remain elusive. Our in silico analysis carried out genome-wide via the StabFlex algorithm, shows the conserved presence of highly flexible regions in budding yeast genome as well as in genomes of other Saccharomyces sensu stricto species. Flexibile peaks in S. cerevisiae identify 175 ORFs mapping on their 3'UTR, a region affecting mRNA translation, localization and stability. (TA)n repeats of different extension shape the central structure of peaks and co-localize with polyadenylation efficiency element (EE) signals. ORFs with flexible peaks share common features. Transcripts are characterized by decreased half-life: this is considered peculiar of genes involved in regulatory systems with high turnover; consistently, their function affects biological processes such as cell cycle regulation or stress response. Our findings support the functional importance of flexibility peaks, suggesting that the flexible sequence may be derived by an expansion of canonical TAYRTA polyadenylation efficiency element. The flexible (TA)n repeat amplification could be the outcome of an evolutionary neofunctionalization leading to a differential 3'-end processing and expression regulation in genes with peculiar function. Our study provides a new support to the functional role of flexibility in genomes and a

  13. Genetic maps of polymorphic DNA loci on rat chromosome 1

    Energy Technology Data Exchange (ETDEWEB)

    Ding, Yan-Ping; Remmers, E.F.; Longman, R.E. [National Institutes of Health, Bethesda, MD (United States)] [and others

    1996-09-01

    Genetic linkage maps of loci defined by polymorphic DNA markers on rat chromosome 1 were constructed by genotyping F2 progeny of F344/N x LEW/N, BN/SsN x LEW/N, and DA/Bkl x F344/Hsd inbred rat strains. In total, 43 markers were mapped, of which 3 were restriction fragment length polymorphisms and the others were simple sequence length polymorphisms. Nineteen of these markers were associated with genes. Six markers for five genes, {gamma}-aminobutyric acid receptor {beta}3 (Gabrb3), syntaxin 2 (Stx2), adrenergic receptor {beta}3 (Gabrb3), syntaxin 2 (Stx2), adrenergic receptor {beta}1 (Adrb1), carcinoembryonic antigen gene family member 1 (Cgm1), and lipogenic protein S14 (Lpgp), and 20 anonymous loci were not previously reported. Thirteen gene loci (Myl2, Aldoa, Tnt, Igf2, Prkcg, Cgm4, Calm3, Cgm3, Psbp1, Sa, Hbb, Ins1, and Tcp1) were previously mapped. Comparative mapping analysis indicated that the large portion of rat chromosome 1 is homologous to mouse chromosome 7, although the homologous to mouse chromosome 7, although the homologs of two rat genes are located on mouse chromosomes 17 and 19. Homologs of the rat chromosome 1 genes that we mapped are located on human chromosomes 6, 10, 11, 12, 15, 16, and 19. 38 refs., 1 fig., 3 tabs.

  14. Single-molecule denaturation mapping of DNA in nanofluidic channels

    DEFF Research Database (Denmark)

    Reisner, Walter; Larsen, Niels Bent; Silahtaroglu, Asli

    2010-01-01

    Here we explore the potential power of denaturation mapping as a single-molecule technique. By partially denaturing YOYO (R)-1-labeled DNA in nanofluidic channels with a combination of formamide and local heating, we obtain a sequence-dependent "barcode" corresponding to a series of local dips...... and peaks in the intensity trace along the extended molecule. We demonstrate that this structure arises from the physics of local denaturation: statistical mechanical calculations of sequence-dependent melting probability can predict the barcode to be observed experimentally for a given sequence...

  15. A MapReduce Framework for DNA Sequencing Data Processing

    Directory of Open Access Journals (Sweden)

    Samy Ghoneimy

    2016-12-01

    Full Text Available Genomics and Next Generation Sequencers (NGS like Illumina Hiseq produce data in the order of ‎‎200 billion base pairs in a single one-week run for a 60x human genome coverage, which ‎requires modern high-throughput experimental technologies that can ‎only be tackled with high performance computing (HPC and specialized software algorithms called ‎‎“short read aligners”. This paper focuses on the implementation of the DNA sequencing as a set of MapReduce programs that will accept a DNA data set as a FASTQ file and finally generate a VCF (variant call format file, which has variants for a given DNA data set. In this paper MapReduce/Hadoop along with Burrows-Wheeler Aligner (BWA, Sequence Alignment/Map (SAM ‎tools, are fully utilized to provide various utilities for manipulating alignments, including sorting, merging, indexing, ‎and generating alignments. The Map-Sort-Reduce process is designed to be suited for a Hadoop framework in ‎which each cluster is a traditional N-node Hadoop cluster to utilize all of the Hadoop features like HDFS, program ‎management and fault tolerance. The Map step performs multiple instances of the short read alignment algorithm ‎‎(BoWTie that run in parallel in Hadoop. The ordered list of the sequence reads are used as input tuples and the ‎output tuples are the alignments of the short reads. In the Reduce step many parallel instances of the Short ‎Oligonucleotide Analysis Package for SNP (SOAPsnp algorithm run in the cluster. Input tuples are sorted ‎alignments for a partition and the output tuples are SNP calls. Results are stored via HDFS, and then archived in ‎SOAPsnp format. ‎ The proposed framework enables extremely fast discovering somatic mutations, inferring population genetical ‎parameters, and performing association tests directly based on sequencing data without explicit genotyping or ‎linkage-based imputation. It also demonstrate that this method achieves comparable

  16. Rapid transfer of DNA from agarose gels to nylon membranes.

    OpenAIRE

    Reed, K C; Mann, D A

    1985-01-01

    The unique properties of nylon membranes allow for dramatic improvement in the capillary transfer of DNA restriction fragments from agarose gels (Southern blotting). By using 0.4 M NaOH as the transfer solvent following a short pre-treatment of the gel in acid, DNA is depurinated during transfer. Fragments of all sizes are eluted and retained quantitatively by the membrane; furthermore, the alkaline solvent induces covalent fixation of DNA to the membrane. The saving in time and materials aff...

  17. Rapid and inexpensive method for isolating plasmid DNA

    International Nuclear Information System (INIS)

    Aljanabi, S. M.; Al-Awadi, S. J.; Al-Kazaz, A. A.; Baghdad Univ.

    1997-01-01

    A small-scale and economical method for isolating plasmid DNA from bacteria is described. The method provides DNA of suitable quality for most DNA manipulation techniques. This DNA can be used for restriction endonuclease digestion, southern blot hybridization, nick translation and end labeling of DNA probes, Polymerase Chain Reaction (PCR) -based techniques, transformation, DNA cycle-sequencing, and Chain-termination method for DNA sequencing. The entire procedure is adapted to 1.5 ml microfuge tubes and takes approximately 30 mins. The DNA isolated by this method has the same purity produced by CTAB and cesium chloride precipitation and purification procedures respectively. The two previous methods require many hours to obtain the final product and require the use of very expensive equipment as ultracentrifuge. This method is well suited for the isolation of plasmid DNA from a large number of bacterial samples and in a very short time and low cost in laboratories where chemicals, expensive equipment and finance are limited factors in conducting molecular research. (authors). 11refs. 11refs

  18. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Yomi

    2012-01-03

    Jan 3, 2012 ... Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa ...

  19. A simple, rapid and efficient method of isolating DNA from ...

    African Journals Online (AJOL)

    Total DNA of Chokanan mango (Mangifera indica L.) was extracted from the leaf for the construction of total genomic library. However, the quality of the extracted DNA was often compromised by the presence of secondary metabolites, thus interfering with the analytical applications. Improvement on the quality of the ...

  20. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa was investigated ...

  1. Capillary gel electrophoresis for rapid, high resolution DNA sequencing.

    OpenAIRE

    Swerdlow, H; Gesteland, R

    1990-01-01

    Capillary gel electrophoresis has been demonstrated for the separation and detection of DNA sequencing samples. Enzymatic dideoxy nucleotide chain termination was employed, using fluorescently tagged oligonucleotide primers and laser based on-column detection (limit of detection is 6,000 molecules per peak). Capillary gel separations were shown to be three times faster, with better resolution (2.4 x), and higher separation efficiency (5.4 x) than a conventional automated slab gel DNA sequenci...

  2. Rapid assessment of the effect of ciprofloxacin on chromosomal DNA from Escherichia coli using an in situ DNA fragmentation assay

    Directory of Open Access Journals (Sweden)

    Gosalvez Jaime

    2009-04-01

    Full Text Available Abstract Background Fluoroquinolones are extensively used antibiotics that induce DNA double-strand breaks (DSBs by trapping DNA gyrase and topoisomerase IV on DNA. This effect is usually evaluated using biochemical or molecular procedures, but these are not effective at the single-cell level. We assessed ciprofloxacin (CIP-induced chromosomal DNA breakage in single-cell Escherichia coli by direct visualization of the DNA fragments that diffused from the nucleoid obtained after bacterial lysis in an agarose microgel on a slide. Results Exposing the E. coli strain TG1 to CIP starting at a minimum inhibitory concentration (MIC of 0.012 μg/ml and at increasing doses for 40 min increased the DNA fragmentation progressively. DNA damage started to be detectable at the MIC dose. At a dose of 1 μg/ml of CIP, DNA damage was visualized clearly immediately after processing, and the DNA fragmentation increased progressively with the antibiotic incubation time. The level of DNA damage was much higher when the bacteria were taken from liquid LB broth than from solid LB agar. CIP treatment produced a progressively slower rate of DNA damage in bacteria in the stationary phase than in the exponentially growing phase. Removing the antibiotic after the 40 min incubation resulted in progressive DSB repair activity with time. The magnitude of DNA repair was inversely related to CIP dose and was noticeable after incubation with CIP at 0.1 μg/ml but scarce after 10 μg/ml. The repair activity was not strictly related to viability. Four E. coli strains with identified mechanisms of reduced sensitivity to CIP were assessed using this procedure and produced DNA fragmentation levels that were inversely related to MIC dose, except those with very high MIC dose. Conclusion This procedure for determining DNA fragmentation is a simple and rapid test for studying and evaluating the effect of quinolones.

  3. WHERE MULTIFUNCTIONAL DNA REPAIR PROTEINS MEET: MAPPING THE INTERACTION DOMAINS BETWEEN XPG AND WRN

    Energy Technology Data Exchange (ETDEWEB)

    Rangaraj, K.; Cooper, P.K.; Trego, K.S.

    2009-01-01

    The rapid recognition and repair of DNA damage is essential for the maintenance of genomic integrity and cellular survival. Multiple complex and interconnected DNA damage responses exist within cells to preserve the human genome, and these repair pathways are carried out by a specifi c interplay of protein-protein interactions. Thus a failure in the coordination of these processes, perhaps brought about by a breakdown in any one multifunctional repair protein, can lead to genomic instability, developmental and immunological abnormalities, cancer and premature aging. This study demonstrates a novel interaction between two such repair proteins, Xeroderma pigmentosum group G protein (XPG) and Werner syndrome helicase (WRN), that are both highly pleiotropic and associated with inherited genetic disorders when mutated. XPG is a structure-specifi c endonuclease required for the repair of UV-damaged DNA by nucleotide excision repair (NER), and mutations in XPG result in the diseases Xeroderma pigmentosum (XP) and Cockayne syndrome (CS). A loss of XPG incision activity results in XP, whereas a loss of non-enzymatic function(s) of XPG causes CS. WRN is a multifunctional protein involved in double-strand break repair (DSBR), and consists of 3’–5’ DNA-dependent helicase, 3’–5’ exonuclease, and single-strand DNA annealing activities. Nonfunctional WRN protein leads to Werner syndrome, a premature aging disorder with increased cancer incidence. Far Western analysis was used to map the interacting domains between XPG and WRN by denaturing gel electrophoresis, which separated purifi ed full length and recombinant XPG and WRN deletion constructs, based primarily upon the length of each polypeptide. Specifi c interacting domains were visualized when probed with the secondary protein of interest which was then detected by traditional Western analysis using the antibody of the secondary protein. The interaction between XPG and WRN was mapped to the C-terminal region of

  4. A rapid mini-prep DNA extraction method in rice (Oryza sativa)

    African Journals Online (AJOL)

    STORAGESEVER

    2009-01-19

    Jan 19, 2009 ... homogenizer with a plastic tip is incomplete, since the leaves of these plants .... mortar and pestle with liquid nitrogen and transferred to a tube. ... rapid DNA extraction protocols for gymnosperms for application in population ...

  5. Rapid isolation of high molecular weight DNA from single dried ...

    African Journals Online (AJOL)

    ANAND

    For studying genetic diversity in populations of predatory coccinellid, Cryptolaemus montrouzieri. Mulsant (Coccinellidae: Coleoptera), our attempts to isolate high quality DNA from individual adult beetle using several previously reported protocols and even modifications were quite unsuccessful as the insect size was small ...

  6. A universal, rapid, and inexpensive method for genomic DNA ...

    Indian Academy of Sciences (India)

    MOHAMMED BAQUR SAHIB A. AL-SHUHAIB

    gels, containing 7% glycerol, and 1×TBE buffer. The gels were run under 200 .... Inc. Germany, GeneaidTM DNA Isolation Kit, Geneaid. Biotech., New Taipei City, .... C. L. and Arsenos G. 2015 Comparison of eleven methods for genomic DNA ...

  7. Rapid myelin water content mapping on clinical MR systems

    International Nuclear Information System (INIS)

    Tonkova, Vyara; Arhelger, Volker; Schenk, Jochen; Neeb, Heiko; Koblenz Univ.

    2012-01-01

    We present an algorithm for the fast mapping of myelin water content using standard multiecho gradient echo acquisitions of the human brain. The method extents a previously published approach for the simultaneous measurement of brain T 1 , T * 2 and total water content. Employing the multiexponential T * 2 decay signal of myelinated tissue, myelin water content was measured based on the quantification of two water pools ('myelin water' and 'rest') with different relaxation times. As the existing protocol was focussed on the fast mapping of quantitative MR parameters with whole brain coverage in clinically relevant measurement times, the sampling density of the T * 2 curve was compromised to 10 echo times with a T Emax of approx. 40 ms. Therefore, pool amplitudes were determined using a quadratic optimisation approach. The optimisation was constrained by including a priori knowledge about brain water pools. All constraints were optimised in a simulation study to minimise systematic error sources given the incomplete knowledge about the real pool-specific relaxation properties. Based on the simulation results, whole brain in vivo myelin water content maps were acquired in 10 healthy controls and one subject with multiple sclerosis. The in vivo results obtained were consistent with previous reports which demonstrates that a simultaneous whole brain mapping of T 1 , T * 2 , total and myelin water content is feasible on almost any modern MR scanner in less than 10 minutes. (orig.)

  8. An optimized rapid bisulfite conversion method with high recovery of cell-free DNA.

    Science.gov (United States)

    Yi, Shaohua; Long, Fei; Cheng, Juanbo; Huang, Daixin

    2017-12-19

    Methylation analysis of cell-free DNA is a encouraging tool for tumor diagnosis, monitoring and prognosis. Sensitivity of methylation analysis is a very important matter due to the tiny amounts of cell-free DNA available in plasma. Most current methods of DNA methylation analysis are based on the difference of bisulfite-mediated deamination of cytosine between cytosine and 5-methylcytosine. However, the recovery of bisulfite-converted DNA based on current methods is very poor for the methylation analysis of cell-free DNA. We optimized a rapid method for the crucial steps of bisulfite conversion with high recovery of cell-free DNA. A rapid deamination step and alkaline desulfonation was combined with the purification of DNA on a silica column. The conversion efficiency and recovery of bisulfite-treated DNA was investigated by the droplet digital PCR. The optimization of the reaction results in complete cytosine conversion in 30 min at 70 °C and about 65% of recovery of bisulfite-treated cell-free DNA, which is higher than current methods. The method allows high recovery from low levels of bisulfite-treated cell-free DNA, enhancing the analysis sensitivity of methylation detection from cell-free DNA.

  9. Rapid and reliable extraction of genomic DNA from various wild-type and transgenic plants

    Directory of Open Access Journals (Sweden)

    Yang Moon-Sik

    2004-09-01

    Full Text Available Abstract Background DNA extraction methods for PCR-quality DNA from calluses and plants are not time efficient, since they require that the tissues be ground in liquid nitrogen, followed by precipitation of the DNA pellet in ethanol, washing and drying the pellet, etc. The need for a rapid and simple procedure is urgent, especially when hundreds of samples need to be analyzed. Here, we describe a simple and efficient method of isolating high-quality genomic DNA for PCR amplification and enzyme digestion from calluses, various wild-type and transgenic plants. Results We developed new rapid and reliable genomic DNA extraction method. With our developed method, plant genomic DNA extraction could be performed within 30 min. The method was as follows. Plant tissue was homogenized with salt DNA extraction buffer using hand-operated homogenizer and extracted by phenol:chloroform:isoamyl alcohol (25:24:1. After centrifugation, the supernatant was directly used for DNA template for PCR, resulting in successful amplification for RAPD from various sources of plants and specific foreign genes from transgenic plants. After precipitating the supernatant, the DNA was completely digested by restriction enzymes. Conclusion This DNA extraction procedure promises simplicity, speed, and efficiency, both in terms of time and the amount of plant sample required. In addition, this method does not require expensive facilities for plant genomic DNA extraction.

  10. Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

    Science.gov (United States)

    M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

    1994-01-01

    A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

  11. Rapid mapping of protein functional epitopes by combinatorial alanine scanning

    OpenAIRE

    Weiss, GA; Watanabe, CK; Zhong, A; Goddard, A; Sidhu, SS

    2000-01-01

    A combinatorial alanine-scanning strategy was used to determine simultaneously the functional contributions of 19 side chains buried at the interface between human growth hormone and the extracellular domain of its receptor. A phage-displayed protein library was constructed in which the 19 side chains were preferentially allowed to vary only as the wild type or alanine. The library pool was subjected to binding selections to isolate functional clones, and DNA sequencing was used to determine ...

  12. Rapid outer-surface protein C DNA tattoo vaccination protects against Borrelia afzelii infection.

    Science.gov (United States)

    Wagemakers, A; Mason, L M K; Oei, A; de Wever, B; van der Poll, T; Bins, A D; Hovius, J W R

    2014-12-01

    Borrelia afzelii is the predominant Borrelia species causing Lyme borreliosis in Europe. Currently there is no human vaccine against Lyme borreliosis, and most research focuses on recombinant protein vaccines against Borrelia burgdorferi sensu stricto. DNA tattooing is a novel vaccination method that can be applied in a rapid vaccination schedule. We vaccinated C3H/HeN mice with B. afzelii strain PKo OspC (outer-surface protein C) using a codon-optimized DNA vaccine tattoo and compared this with recombinant protein vaccination in a 0-2-4 week vaccination schedule. We also assessed protection by DNA tattoo in a 0-3-6 day schedule. DNA tattoo and recombinant OspC vaccination induced comparable total IgG responses, with a lower IgG1/IgG2a ratio after DNA tattoo. Two weeks after syringe-challenge with 5 × 10(5) B. afzelii spirochetes most vaccinated mice had negative B. afzelii tissue DNA loads and all were culture negative. Furthermore, DNA tattoo vaccination in a 0-3-6 day regimen also resulted in negative Borrelia loads and cultures after challenge. To conclude, DNA vaccination by tattoo was fully protective against B. afzelii challenge in mice in a rapid vaccination protocol, and induces a favorable humoral immunity compared to recombinant protein vaccination. Rapid DNA tattoo is a promising vaccination strategy against spirochetes.

  13. Sentinel-2 for rapid operational landslide inventory mapping

    Science.gov (United States)

    Stumpf, André; Marc, Odin; Malet, Jean-Philippe; Michea, David

    2017-04-01

    Landslide inventory mapping after major triggering events such as heavy rainfalls or earthquakes is crucial for disaster response, the assessment of hazards, and the quantification of sediment budgets and empirical scaling laws. Numerous studies have already demonstrated the utility of very-high resolution satellite and aerial images for the elaboration of inventories based on semi-automatic methods or visual image interpretation. Nevertheless, such semi-automatic methods are rarely used in an operational context after major triggering events; this is partly due to access limitations on the required input datasets (i.e. VHR satellite images) and to the absence of dedicated services (i.e. processing chain) available for the landslide community. Several on-going initiatives allow to overcome these limitations. First, from a data perspective, the launch of the Sentinel-2 mission offers opportunities for the design of an operational service that can be deployed for landslide inventory mapping at any time and everywhere on the globe. Second, from an implementation perspective, the Geohazards Exploitation Platform (GEP) of the European Space Agency (ESA) allows the integration and diffusion of on-line processing algorithms in a high computing performance environment. Third, from a community perspective, the recently launched Landslide Pilot of the Committee on Earth Observation Satellites (CEOS), has targeted the take-off of such service as a main objective for the landslide community. Within this context, this study targets the development of a largely automatic, supervised image processing chain for landslide inventory mapping from bi-temporal (before and after a given event) Sentinel-2 optical images. The processing chain combines change detection methods, image segmentation, higher-level image features (e.g. texture, shape) and topographic variables. Based on a few representative examples provided by a human operator, a machine learning model is trained and

  14. Rapid DNA sequencing by horizontal ultrathin gel electrophoresis.

    OpenAIRE

    Brumley, R L; Smith, L M

    1991-01-01

    A horizontal polyacrylamide gel electrophoresis apparatus has been developed that decreases the time required to separate the DNA fragments produced in enzymatic sequencing reactions. The configuration of this apparatus and the use of circulating coolant directly under the glass plates result in heat exchange that is approximately nine times more efficient than passive thermal transfer methods commonly used. Bubble-free gels as thin as 25 microns can be routinely cast on this device. The appl...

  15. Rapid Prototyping of a Map-Based Android App

    OpenAIRE

    Flanagan, Nicholas M; Theller, Eric; Theller, Larry

    2013-01-01

    This project tries to provide a mobile phone-based solution app named “DriftWatch Pollinator Mapper” that will allow beekeepers, apiary inspectors, and association staff to easily register and map a hive into the Driftwatch system, where local pesticide applicators will notice it and be aware of the presence of pollinators. The purpose of the mobile application is to speed the process of registering beekeepers within DriftWatch, since many beekeepers have significant trouble using only web-ba...

  16. Rapid myelin water content mapping on clinical MR systems

    Energy Technology Data Exchange (ETDEWEB)

    Tonkova, Vyara; Arhelger, Volker [Fachhochschule Koblenz, RheinAhrCampus Remagen (Germany); Schenk, Jochen [Radiologisches Institut, Koblenz (Germany); Neeb, Heiko [Fachhochschule Koblenz, RheinAhrCampus Remagen (Germany); Koblenz Univ. (Germany). Inst. for Medical Engineering and Information Processing - MTI Mittelrhein

    2012-07-01

    We present an algorithm for the fast mapping of myelin water content using standard multiecho gradient echo acquisitions of the human brain. The method extents a previously published approach for the simultaneous measurement of brain T{sub 1}, T{sup *}{sub 2} and total water content. Employing the multiexponential T{sup *}{sub 2} decay signal of myelinated tissue, myelin water content was measured based on the quantification of two water pools ('myelin water' and 'rest') with different relaxation times. As the existing protocol was focussed on the fast mapping of quantitative MR parameters with whole brain coverage in clinically relevant measurement times, the sampling density of the T{sup *}{sub 2} curve was compromised to 10 echo times with a T {sub Emax} of approx. 40 ms. Therefore, pool amplitudes were determined using a quadratic optimisation approach. The optimisation was constrained by including a priori knowledge about brain water pools. All constraints were optimised in a simulation study to minimise systematic error sources given the incomplete knowledge about the real pool-specific relaxation properties. Based on the simulation results, whole brain in vivo myelin water content maps were acquired in 10 healthy controls and one subject with multiple sclerosis. The in vivo results obtained were consistent with previous reports which demonstrates that a simultaneous whole brain mapping of T{sub 1}, T{sup *}{sub 2}, total and myelin water content is feasible on almost any modern MR scanner in less than 10 minutes. (orig.)

  17. Rapid mapping of landslide disaster using UAV- photogrammetry

    Science.gov (United States)

    Cahyono, A. B.; Zayd, R. A.

    2018-03-01

    Unmanned Aerial Vehicle (UAV) systems offered many advantages in several mapping applications such as slope mapping, geohazard studies, etc. This study utilizes UAV system for landslide disaster occurred in Jombang Regency, East Java. This study concentrates on type of rotor-wing UAV, that is because rotor wing units are stable and able to capture images easily. Aerial photograph were acquired in the form of strips which followed the procedure of acquiring aerial photograph where taken 60 photos. Secondary data of ground control points using GPS Geodetic and check points established using Total Station technique was used. The digital camera was calibrated using close range photogrammetric software and the recovered camera calibration parameters were then used in the processing of digital images. All the aerial photographs were processed using digital photogrammetric software and the output in the form of orthophoto was produced. The final result shows a 1: 1500 scale orthophoto map from the data processing with SfM algorithm with GSD accuracy of 3.45 cm. And the calculated volume of contour line delineation of 10527.03 m3. The result is significantly different from the result of terrestrial methode equal to 964.67 m3 or 8.4% of the difference of both.

  18. Rapid Recombination Mapping for High-Throughput Genetic Screens in Drosophila

    OpenAIRE

    Sapiro, Anne L.; Ihry, Robert J.; Buhr, Derek L.; Konieczko, Kevin M.; Ives, Sarah M.; Engstrom, Anna K.; Wleklinski, Nicholas P.; Kopish, Kristin J.; Bashirullah, Arash

    2013-01-01

    Mutagenesis screens are a staple of classical genetics. Chemical-induced mutations, however, are often difficult and time-consuming to identify. Here, we report that recombination analysis with pairs of dominant visible markers provides a rapid and reliable strategy to map mutations in Drosophila melanogaster. This method requires only two generations and a total of six crosses in vials to estimate the genetic map position of the responsible lesion with high accuracy. This genetic map positio...

  19. Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform

    Directory of Open Access Journals (Sweden)

    Shan Wei

    2018-05-01

    Full Text Available Real-time sequencing of short DNA reads has a wide variety of clinical and research applications including screening for mutations, target sequences and aneuploidy. We recently demonstrated that MinION, a nanopore-based DNA sequencing device the size of a USB drive, could be used for short-read DNA sequencing. In this study, an ultra-rapid multiplex library preparation and sequencing method for the MinION is presented and applied to accurately test normal diploid and aneuploidy samples’ genomic DNA in under three hours, including library preparation and sequencing. This novel method shows great promise as a clinical diagnostic test for applications requiring rapid short-read DNA sequencing.

  20. A rapid method for screening arrayed plasmid cDNA library by PCR

    International Nuclear Information System (INIS)

    Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong

    1999-01-01

    Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency

  1. A pneumatic device for rapid loading of DNA sequencing gels.

    Science.gov (United States)

    Panussis, D A; Cook, M W; Rifkin, L L; Snider, J E; Strong, J T; McGrane, R M; Wilson, R K; Mardis, E R

    1998-05-01

    This work describes the design and construction of a device that facilitates the loading of DNA samples onto polyacrylamide gels for detection in the Perkin Elmer/Applied Biosystems (PE/ABI) 373 and 377 DNA sequencing instruments. The device is mounted onto the existing gel cassettes and makes the process of loading high-density gels less cumbersome while the associated time and errors are reduced. The principle of operation includes the simultaneous transfer of the entire batch of samples, in which a spring-loaded air cylinder generates positive pressure and flexible silica capillaries transfer the samples. A retractable capillary array carrier allows the delivery ends of the capillaries to be held up clear of the gel during loader attachment on the gel plates, while enabling their insertion in the gel wells once the device is securely mounted. Gel-loading devices capable of simultaneously transferring 72 samples onto the PE/ABI 373 and 377 are currently being used in our production sequencing groups while a 96-sample transfer prototype undergoes testing.

  2. Rapid and Accurate Idea Transfer: Presenting Ideas with Concept Maps

    Science.gov (United States)

    2008-07-30

    questions from the Pre-test were included in the Post-test. I. At the end of the day, people in the camps take home about __ taka to feed their families. 2...teachers are not paid regularly. Tuition fees for different classes are 40 to 80 taka (Bangladesh currency) 27 per month which is very high for the...October 26, 2002. 27 In April 2005, exchange rate, one $ = 60 taka . 44 Rapid and Accurate Idea Transfer: CDRL (DI-MIS-807 11 A, 00012 1) Presenting

  3. Facile preparation of a DNA sensor for rapid herpes virus detection

    Energy Technology Data Exchange (ETDEWEB)

    Tam, Phuong Dinh, E-mail: tampd-hast@mail.hut.edu.vn [Hanoi Advanced School of Science and Technology, Hanoi University of Technology (Viet Nam); Tuan, Mai Anh, E-mail: tuanma-itims@mail.hut.edu.vn [International Training Institute for Materials Science, Hanoi University of Technology (Viet Nam); Huy, Tran Quang [National Institute of Hygiene and Epidemiology (NIHE), 01 Yersin, Hai Ba Trung District, Hanoi (Viet Nam); Le, Anh-Tuan [Hanoi Advanced School of Science and Technology, Hanoi University of Technology (Viet Nam); Hieu, Nguyen Van, E-mail: hieu@itims.edu.vn [International Training Institute for Materials Science, Hanoi University of Technology (Viet Nam)

    2010-10-12

    In this paper, a simple DNA sensor platform was developed for rapid herpes virus detection in real samples. The deoxyribonucleic acid (DNA) sequences of the herpes simplex virus (DNA probe) were directly immobilized on the surface of interdigitated electrodes by electrochemical polymerization along with pyrrole monomers. The potential was scanned from - 0.7 to + 0.6 V, and the scanning rate was 100 mV/s. Fourier transform infrared spectroscopy was employed to verify specific DNA sequence binding and the conducting polymer. The morphology of the conducting polymer doped with DNA strands was characterized using a field emission scanning electron microscope. As-obtained DNA sensor was used to detect the herpes virus DNA in the real samples. The results show that the current DNA sensors detected the lowest DNA concentration of 2 nM. This sensitivity appears to be better than that of the DNA sensors prepared by immobilization of the DNA probe on the 3-aminopropyl-triethoxy-silance (APTS) membrane.

  4. Facile preparation of a DNA sensor for rapid herpes virus detection

    International Nuclear Information System (INIS)

    Tam, Phuong Dinh; Tuan, Mai Anh; Huy, Tran Quang; Le, Anh-Tuan; Hieu, Nguyen Van

    2010-01-01

    In this paper, a simple DNA sensor platform was developed for rapid herpes virus detection in real samples. The deoxyribonucleic acid (DNA) sequences of the herpes simplex virus (DNA probe) were directly immobilized on the surface of interdigitated electrodes by electrochemical polymerization along with pyrrole monomers. The potential was scanned from - 0.7 to + 0.6 V, and the scanning rate was 100 mV/s. Fourier transform infrared spectroscopy was employed to verify specific DNA sequence binding and the conducting polymer. The morphology of the conducting polymer doped with DNA strands was characterized using a field emission scanning electron microscope. As-obtained DNA sensor was used to detect the herpes virus DNA in the real samples. The results show that the current DNA sensors detected the lowest DNA concentration of 2 nM. This sensitivity appears to be better than that of the DNA sensors prepared by immobilization of the DNA probe on the 3-aminopropyl-triethoxy-silance (APTS) membrane.

  5. A Rapid and Cost-Effective Method for DNA Extraction from Archival Herbarium Specimens.

    Science.gov (United States)

    Krinitsina, A A; Sizova, T V; Zaika, M A; Speranskaya, A S; Sukhorukov, A P

    2015-11-01

    Here we report a rapid and cost-effective method for the extraction of total DNA from herbarium specimens up to 50-90-year-old. The method takes about 2 h, uses AMPure XP magnetic beads diluted by PEG-8000- containing buffer, and does not require use of traditional volatile components like chloroform, phenol, and liquid nitrogen. It yields up to 4 µg of total nucleic acid with high purity from about 30 mg of dry material. The quality of the extracted DNA was tested by PCR amplification of 5S rRNA and rbcL genes (nuclear and chloroplast DNA markers) and compared against the traditional chloroform/isoamyl alcohol method. Our results demonstrate that the use of the magnetic beads is crucial for extraction of DNA suitable for subsequent PCR from herbarium samples due to the decreasing inhibitor concentrations, reducing short fragments of degraded DNA, and increasing median DNA fragment sizes.

  6. Precise Sequential DNA Ligation on A Solid Substrate: Solid-Based Rapid Sequential Ligation of Multiple DNA Molecules

    Science.gov (United States)

    Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke

    2013-01-01

    Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972

  7. Photoelectrochemical Sensors for the Rapid Detection of DNA Damage Induced by Some Nanoparticles

    Directory of Open Access Journals (Sweden)

    M. Jamaluddin Ahmed

    2010-06-01

    Full Text Available Photoelectrochemcal sensors were developed for the rapid detection of oxidative DNA damage induced by titanium dioxide and polystyrene nanoparticles. Each sensor is a multilayer film prepared on a tin oxide nanoparticle electrode using layer- by-layer self assembly and is composed of separate layer of a photoelectrochemical indicator, DNA. The organic compound and heavy metals represent genotoxic chemicals leading two major damaging mechanisms, DNA adduct formation and DNA oxidation. The DNA damage is detected by monitoring the change of photocurrent of the indicator. In one sensor configuration, a DNA intercalator, Ru(bpy2 (dppz2+ [bpy=2, 2′ -bipyridine, dppz=dipyrido( 3, 2-a: 2′ 3′-c phenazine], was employed as the photoelectrochemical indicator. The damaged DNA on the sensor bound lesser Ru(bpy2 (dppz2+ than the intact DNA, resulting in a drop in photocurrent. In another configuration, ruthenium tris(bipyridine was used as the indicator and was immobilized on the electrode underneath the DNA layer. After oxidative damage, the DNA bases became more accessible to photoelectrochemical oxidation than the intact DNA, producing a rise in photocurrent. Both sensors displayed substantial photocurrent change after incubation in titanium dioxide / polystyrene solution in a time – dependent manner. According to the data, damage of the DNA film was completed in 1h in titanium dioxide / polystyrene solution. In addition, the titanium dioxide induced much more sever damage than polysterene. The results were verified independently by gel electrophoresis and UV-Vis absorbance experiments. The photoelectrochemical reaction can be employed as a new and inexpensive screening tool for the rapid assessment of the genotoxicity of existing and new chemicals.

  8. Photoelectrochemical sensors for the rapid detection of DNA damage Induced by some nanoparticles

    International Nuclear Information System (INIS)

    Ahmed, M.J.; Zhang, B.T.; Guo, L.H.

    2010-01-01

    Photoelectrochemical sensors were developed for the rapid detection of oxidative DNA damage induced by titanium dioxide and polystyrene nanoparticles. Each sensor is a multilayer film prepared on a tin oxide nanoparticle electrode using layer- by-layer self assembly and is composed of separate layer of a photoelectrochemical indicator, DNA. The organic compound and heavy metals represent genotoxic chemicals leading two major damaging mechanisms, DNA adduct formation and DNA oxidation. The DNA damage is detected by monitoring the change of photocurrent of the indicator. In one sensor configuration, a DNA intercalator, Ru(bpy)2 (dppz)2+ [bpy=2, 2' -bipyridine, dppz=dipyrido (3, 2-a: 2' 3'-c) phenazine], was employed as the photoelectrochemical indicator. The damaged DNA on the sensor bound lesser Ru(bpy)2 (dppz)2+ than the intact DNA, resulting in a drop in photocurrent. In another configuration, ruthenium tris(bipyridine) was used as the indicator and was immobilized on the electrode underneath the DNA layer. After oxidative damage, the DNA bases became more accessible to photoelectrochemical oxidation than the intact DNA, producing a rise in photocurrent. Both sensors displayed substantial photocurrent change after incubation in titanium dioxide / polystyrene solution in a time . dependent manner. According to the data, damage of the DNA film was completed in 1h in titanium dioxide / polystyrene solution. In addition, the titanium dioxide induced much more sever damage than polystyrene. The results were verified independently by gel electrophoresis and UV-Vis absorbance experiments. The photoelectrochemical reaction can be employed as a new and inexpensive screening tool for the rapid assessment of the genotoxicity of existing and new chemicals. (author)

  9. Mapping land cover through time with the Rapid Land Cover Mapper—Documentation and user manual

    Science.gov (United States)

    Cotillon, Suzanne E.; Mathis, Melissa L.

    2017-02-15

    The Rapid Land Cover Mapper is an Esri ArcGIS® Desktop add-in, which was created as an alternative to automated or semiautomated mapping methods. Based on a manual photo interpretation technique, the tool facilitates mapping over large areas and through time, and produces time-series raster maps and associated statistics that characterize the changing landscapes. The Rapid Land Cover Mapper add-in can be used with any imagery source to map various themes (for instance, land cover, soils, or forest) at any chosen mapping resolution. The user manual contains all essential information for the user to make full use of the Rapid Land Cover Mapper add-in. This manual includes a description of the add-in functions and capabilities, and step-by-step procedures for using the add-in. The Rapid Land Cover Mapper add-in was successfully used by the U.S. Geological Survey West Africa Land Use Dynamics team to accurately map land use and land cover in 17 West African countries through time (1975, 2000, and 2013).

  10. LAMP assay for rapid diagnosis of cow DNA in goat milk and meat samples.

    Science.gov (United States)

    Deb, R; Sengar, G S; Singh, U; Kumar, S; Raja, T V; Alex, R; Alyethodi, R R; Prakash, B

    2017-01-01

    Animal species detection is one of the crucial steps for consumer's food analysis. In the present study we developed an in-house built loop-mediated isothermal amplification (LAMP) assay for rapid detection of adulterated cow DNA in goat milk/meat samples. The cow milk/tissue DNA in goat milk/meat samples were identified in the developed LAMP assay by either naked eye visualizing with SYBR Green I dyes or by detecting the typical ladder pattern on gel electrophoresis. This test can detect up to minimum 5% level of cow components admixed in goat milk/meat samples and can be completed within 1 h 40 min starting from DNA extraction from milk/meat samples and can be performed in a water bath. Developed LAMP methodology is simple; rapid and sensitive techniques that can detect adulterant like cow components in goat milk/meat are more accurate than other existing DNA based technologies.

  11. Alignment of Escherichia coli K12 DNA sequences to a genomic restriction map.

    Science.gov (United States)

    Rudd, K E; Miller, W; Ostell, J; Benson, D A

    1990-01-25

    We use the extensive published information describing the genome of Escherichia coli and new restriction map alignment software to align DNA sequence, genetic, and physical maps. Restriction map alignment software is used which considers restriction maps as strings analogous to DNA or protein sequences except that two values, enzyme name and DNA base address, are associated with each position on the string. The resulting alignments reveal a nearly linear relationship between the physical and genetic maps of the E. coli chromosome. Physical map comparisons with the 1976, 1980, and 1983 genetic maps demonstrate a better fit with the more recent maps. The results of these alignments are genomic kilobase coordinates, orientation and rank of the alignment that best fits the genetic data. A statistical measure based on extreme value distribution is applied to the alignments. Additional computer analyses allow us to estimate the accuracy of the published E. coli genomic restriction map, simulate rearrangements of the bacterial chromosome, and search for repetitive DNA. The procedures we used are general enough to be applicable to other genome mapping projects.

  12. Delineating Rearrangements in Single Yeast Artificial Chromosomes by Quantitative DNA Fiber Mapping

    Energy Technology Data Exchange (ETDEWEB)

    Weier, Heinz-Ulrich G.; Greulich-Bode, Karin M.; Wu, Jenny; Duell, Thomas

    2009-09-18

    Cloning of large chunks of human genomic DNA in recombinant systems such as yeast or bacterial artificial chromosomes has greatly facilitated the construction of physical maps, the positional cloning of disease genes or the preparation of patient-specific DNA probes for diagnostic purposes. For this process to work efficiently, the DNA cloning process and subsequent clone propagation need to maintain stable inserts that are neither deleted nor otherwise rearranged. Some regions of the human genome; however, appear to have a higher propensity than others to rearrange in any host system. Thus, techniques to detect and accurately characterize such rearrangements need to be developed. We developed a technique termed 'Quantitative DNA Fiber Mapping (QDFM)' that allows accurate tagging of sequence elements of interest with near kilobase accuracy and optimized it for delineation of rearrangements in recombinant DNA clones. This paper demonstrates the power of this microscopic approach by investigating YAC rearrangements. In our examples, high-resolution physical maps for regions within the immunoglobulin lambda variant gene cluster were constructed for three different YAC clones carrying deletions of 95 kb and more. Rearrangements within YACs could be demonstrated unambiguously by pairwise mapping of cosmids along YAC DNA molecules. When coverage by YAC clones was not available, distances between cosmid clones were estimated by hybridization of cosmids onto DNA fibers prepared from human genomic DNA. In addition, the QDFM technology provides essential information about clone stability facilitating closure of the maps of the human genome as well as those of model organisms.

  13. Rapid methods for the extraction and archiving of molecular grade fungal genomic DNA.

    Science.gov (United States)

    Borman, Andrew M; Palmer, Michael; Johnson, Elizabeth M

    2013-01-01

    The rapid and inexpensive extraction of fungal genomic DNA that is of sufficient quality for molecular approaches is central to the molecular identification, epidemiological analysis, taxonomy, and strain typing of pathogenic fungi. Although many commercially available and in-house extraction procedures do eliminate the majority of contaminants that commonly inhibit molecular approaches, the inherent difficulties in breaking fungal cell walls lead to protocols that are labor intensive and that routinely take several hours to complete. Here we describe several methods that we have developed in our laboratory that allow the extremely rapid and inexpensive preparation of fungal genomic DNA.

  14. Rapid detection and purification of sequence specific DNA binding proteins using magnetic separation

    Directory of Open Access Journals (Sweden)

    TIJANA SAVIC

    2006-02-01

    Full Text Available In this paper, a method for the rapid identification and purification of sequence specific DNA binding proteins based on magnetic separation is presented. This method was applied to confirm the binding of the human recombinant USF1 protein to its putative binding site (E-box within the human SOX3 protomer. It has been shown that biotinylated DNA attached to streptavidin magnetic particles specifically binds the USF1 protein in the presence of competitor DNA. It has also been demonstrated that the protein could be successfully eluted from the beads, in high yield and with restored DNA binding activity. The advantage of these procedures is that they could be applied for the identification and purification of any high-affinity sequence-specific DNA binding protein with only minor modifications.

  15. Rapid detection of cancer related DNA nanoparticulate biomarkers and nanoparticles in whole blood

    Science.gov (United States)

    Heller, Michael J.; Krishnan, Raj; Sonnenberg, Avery

    2010-08-01

    The ability to rapidly detect cell free circulating (cfc) DNA, cfc-RNA, exosomes and other nanoparticulate disease biomarkers as well as drug delivery nanoparticles directly in blood is a major challenge for nanomedicine. We now show that microarray and new high voltage dielectrophoretic (DEP) devices can be used to rapidly isolate and detect cfc-DNA nanoparticulates and nanoparticles directly from whole blood and other high conductance samples (plasma, serum, urine, etc.). At DEP frequencies of 5kHz-10kHz both fluorescent-stained high molecular weight (hmw) DNA, cfc-DNA and fluorescent nanoparticles separate from the blood and become highly concentrated at specific DEP highfield regions over the microelectrodes, while blood cells move to the DEP low field-regions. The blood cells can then be removed by a simple fluidic wash while the DNA and nanoparticles remain highly concentrated. The hmw-DNA could be detected at a level of <260ng/ml and the nanoparticles at <9.5 x 109 particles/ml, detection levels that are well within the range for viable clinical diagnostics and drug nanoparticle monitoring. Disease specific cfc-DNA materials could also be detected directly in blood from patients with Chronic Lymphocytic Leukemia (CLL) and confirmed by PCR genotyping analysis.

  16. Rapid and efficient method to extract metagenomic DNA from estuarine sediments.

    Science.gov (United States)

    Shamim, Kashif; Sharma, Jaya; Dubey, Santosh Kumar

    2017-07-01

    Metagenomic DNA from sediments of selective estuaries of Goa, India was extracted using a simple, fast, efficient and environment friendly method. The recovery of pure metagenomic DNA from our method was significantly high as compared to other well-known methods since the concentration of recovered metagenomic DNA ranged from 1185.1 to 4579.7 µg/g of sediment. The purity of metagenomic DNA was also considerably high as the ratio of absorbance at 260 and 280 nm ranged from 1.88 to 1.94. Therefore, the recovered metagenomic DNA was directly used to perform various molecular biology experiments viz. restriction digestion, PCR amplification, cloning and metagenomic library construction. This clearly proved that our protocol for metagenomic DNA extraction using silica gel efficiently removed the contaminants and prevented shearing of the metagenomic DNA. Thus, this modified method can be used to recover pure metagenomic DNA from various estuarine sediments in a rapid, efficient and eco-friendly manner.

  17. Rapid mapping of chromosomal breakpoints: from blood to BAC in 20 days.

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Chun-Mei; Kwan, Johnson; Weier, Jingly F.; Baumgartner, Aldof; Wang, Mei; Escudero, Tomas; Munne, Santiago; Weier, Heinz-Ulrich

    2009-02-25

    Structural chromosome aberrations and associated segmental or chromosomal aneusomies are major causes of reproductive failure in humans. Despite the fact that carriers of reciprocal balanced translocation often have no other clinical symptoms or disease, impaired chromosome homologue pairing in meiosis and karyokinesis errors lead to over-representation of translocations carriers in the infertile population and in recurrent pregnancy loss patients. At present, clinicians have no means to select healthy germ cells or balanced zygotes in vivo, but in vitro fertilization (IVF) followed by preimplantation genetic diagnosis (PGD) offers translocation carriers a chance to select balanced or normal embryos for transfer. Although a combination of telomeric and centromeric probes can differentiate embryos that are unbalanced from normal or unbalanced ones, a seemingly random position of breakpoints in these IVF-patients poses a serious obstacle to differentiating between normal and balanced embryos, which for most translocation couples, is desirable. Using a carrier with reciprocal translocation t(4;13) as an example, we describe our state-of-the-art approach to the preparation of patient-specific DNA probes that span or 'extent' the breakpoints. With the techniques and resources described here, most breakpoints can be accurately mapped in a matter of days using carrier lymphocytes, and a few extra days are allowed for PGD-probe optimization. The optimized probes will then be suitable for interphase cell analysis, a prerequisite for PGD since blastomeres are biopsied from normally growing day 3 - embryos regardless of their position in the mitotic cell cycle. Furthermore, routine application of these rapid methods should make PGD even more affordable for translocation carriers enrolled in IVF programs.

  18. Rapid DNA multi-analyte immunoassay on a magneto-resistance biosensor

    NARCIS (Netherlands)

    Koets, M.; Wijk, van der T.; Eemeren, van J.T.W.M.; Amerongen, van A.; Prins, M.W.J.

    2009-01-01

    We present the rapid and sensitive detection of amplified DNA on a giant magneto-resistance sensor using superparamagnetic particles as a detection label. The one-step assay is performed on an integrated and miniaturized detection platform suitable for application into point-of-care devices. A

  19. An annotated genetic map of loblolly pine based on microsatellite and cDNA markers

    Science.gov (United States)

    Craig S. Echt; Surya Saha; Konstantin V. Krutovsky; Kokulapalan Wimalanathan; John E. Erpelding; Chun Liang; C Dana Nelson

    2011-01-01

    Previous loblolly pine (Pinus taeda L.) genetic linkage maps have been based on a variety of DNA polymorphisms, such as AFLPs, RAPDs, RFLPs, and ESTPs, but only a few SSRs (simple sequence repeats), also known as simple tandem repeats or microsatellites, have been mapped in P. taeda. The objective of this study was to integrate a large set of SSR markers from a variety...

  20. An annotated genetic map of loblolly pine based on microsatellite and cDNA markers

    Science.gov (United States)

    Previous loblolly pine (Pinus taeda L.) genetic linkage maps have been based on a variety of DNA polymorphisms, such as AFLPs, RAPDs, RFLPs, and ESTPs, but only a few SSRs (simple sequence repeats), also known as simple tandem repeats or microsatellites, have been mapped in P. taeda. The objective o...

  1. Modified DNA extraction for rapid PCR detection of methicillin-resistant staphylococci

    International Nuclear Information System (INIS)

    Japoni, A.; Alborzi, A.; Rasouli, M.; Pourabbas, B.

    2004-01-01

    Nosocomial infection caused by methicillin-resistant staphylococci poses a serious problem in many countries. The aim of this study was to rapidly and reliably detect methicillin-resistant-staphylococci in order to suggest appropriate therapy. The presence or absence of the methicillin-resistance gene in 115 clinical isolates of staphylococcus aureus and 50 isolates of coagulase negative staphylococci was examined by normal PCR. DNA extraction for PCR performance was then modified by omission of achromopeptadiase and proteinase K digestion, phenol/chloroform extraction and ethanol precipitation. All isolates with Mic>8 μ g/ml showed positive PCR. No differences in PCR detection have been observed when normal and modified DNA extractions have been performed. Our modified DNA extraction can quickly detect methicillin-resistant staphylococci by PCR. The advantage of rapid DNA extraction extends to both reduction of time and cost of PCR performance. This modified DNA extraction is suitable for different PCR detection, when staphylococci are the subject of DNA analysis

  2. Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.

    Science.gov (United States)

    Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R

    2001-10-01

    Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.

  3. RBE comparison between rapid electrons of 20 MeV and 45 MeV with survival rate, DNA synthesis, DNA reparation and nucleoid sedimentation

    International Nuclear Information System (INIS)

    Alth, G.; Weniger, P.; Turtzer, K.; Klein, W.; Kocsis, F.; Krankenhaus der Stadt Wien-Lainz; Oesterreichisches Forschungszentrum Seibersdorf G.m.b.H. Inst. fuer Biologie)

    1982-01-01

    In order to find out possible differences of the biologic efficacy of rapid electrons of different energies, the authors examined the influence of rapid electrons of 20 MeV and 45 MeV upon the survival rate of Hela cells S3, their cell growth, DNA synthesis, DNA reparation, and sedimentation of nucleoids. The results show a difference only for the nucleoid sedimentation, i.e. there are more fractured DNA cords after 45 MeV irradiation. No significant differences could be demonstrated for the parameters of the survival curve, DNA synthesis and DNA reparation. Four double tests were carried out corresponding to the indicated types of examination. (orig.) [de

  4. Human cDNA mapping using fluorescence in situ hybridization. Progress report, April 1--December 31, 1992

    Energy Technology Data Exchange (ETDEWEB)

    Korenberg, J.R.

    1993-12-31

    The ultimate goal of this proposal is to create a cDNA map of the human genome. Mapping is approached using the techniques of high resolution fluorescence in situ hybridization (FISH). This technology and the results of its application are designed to rapidly generate whole genome as tool box of expressed sequence to speed the identification of human disease genes. The results of this study are intended to dovetail with and to link the results of existing technologies for creating backbone YAC and genetic maps. In the first eight months, this approach will generate 60--80% of the expressed sequence map, the remainder expected to be derived through more long-term, labor-intensive, regional chromosomal gene searches or sequencing. The laboratory has made significant progress in the set-up phase, in mapping fetal and adult brain and other cDNAs, in testing a model system for directly linking genetic and physical maps using FISH with small fragments, in setting up a database, and in establishing the validity and throughput of the system.

  5. Mapping Base Modifications in DNA by Transverse-Current Sequencing

    Science.gov (United States)

    Alvarez, Jose R.; Skachkov, Dmitry; Massey, Steven E.; Kalitsov, Alan; Velev, Julian P.

    2018-02-01

    Sequencing DNA modifications and lesions, such as methylation of cytosine and oxidation of guanine, is even more important and challenging than sequencing the genome itself. The traditional methods for detecting DNA modifications are either insensitive to these modifications or require additional processing steps to identify a particular type of modification. Transverse-current sequencing in nanopores can potentially identify the canonical bases and base modifications in the same run. In this work, we demonstrate that the most common DNA epigenetic modifications and lesions can be detected with any predefined accuracy based on their tunneling current signature. Our results are based on simulations of the nanopore tunneling current through DNA molecules, calculated using nonequilibrium electron-transport methodology within an effective multiorbital model derived from first-principles calculations, followed by a base-calling algorithm accounting for neighbor current-current correlations. This methodology can be integrated with existing experimental techniques to improve base-calling fidelity.

  6. OPERATIONAL SAR DATA PROCESSING IN GIS ENVIRONMENTS FOR RAPID DISASTER MAPPING

    Directory of Open Access Journals (Sweden)

    A. Meroni

    2013-05-01

    Full Text Available Having access to SAR data can be highly important and critical especially for disaster mapping. Updating a GIS with contemporary information from SAR data allows to deliver a reliable set of geospatial information to advance civilian operations, e.g. search and rescue missions. Therefore, we present in this paper the operational processing of SAR data within a GIS environment for rapid disaster mapping. This is exemplified by the November 2010 flash flood in the Veneto region, Italy. A series of COSMO-SkyMed acquisitions was processed in ArcGIS® using a single-sensor, multi-mode, multi-temporal approach. The relevant processing steps were combined using the ArcGIS ModelBuilder to create a new model for rapid disaster mapping in ArcGIS, which can be accessed both via a desktop and a server environment.

  7. A rapid and efficient DNA extraction protocol from fresh and frozen human blood samples.

    Science.gov (United States)

    Guha, Pokhraj; Das, Avishek; Dutta, Somit; Chaudhuri, Tapas Kumar

    2018-01-01

    Different methods available for extraction of human genomic DNA suffer from one or more drawbacks including low yield, compromised quality, cost, time consumption, use of toxic organic solvents, and many more. Herein, we aimed to develop a method to extract DNA from 500 μL of fresh or frozen human blood. Five hundred microliters of fresh and frozen human blood samples were used for standardization of the extraction procedure. Absorbance at 260 and 280 nm, respectively, (A 260 /A 280 ) were estimated to check the quality and quantity of the extracted DNA sample. Qualitative assessment of the extracted DNA was checked by Polymerase Chain reaction and double digestion of the DNA sample. Our protocol resulted in average yield of 22±2.97 μg and 20.5±3.97 μg from 500 μL of fresh and frozen blood, respectively, which were comparable to many reference protocols and kits. Besides yielding bulk amount of DNA, our protocol is rapid, economical, and avoids toxic organic solvents such as Phenol. Due to unaffected quality, the DNA is suitable for downstream applications. The protocol may also be useful for pursuing basic molecular researches in laboratories having limited funds. © 2017 Wiley Periodicals, Inc.

  8. Coupling amplified DNA from flow-sorted chromosomes to high-density SNP mapping in barley

    Directory of Open Access Journals (Sweden)

    Bartoš Jan

    2008-06-01

    Full Text Available Abstract Background Flow cytometry facilitates sorting of single chromosomes and chromosome arms which can be used for targeted genome analysis. However, the recovery of microgram amounts of DNA needed for some assays requires sorting of millions of chromosomes which is laborious and time consuming. Yet, many genomic applications such as development of genetic maps or physical mapping do not require large DNA fragments. In such cases time-consuming de novo sorting can be minimized by utilizing whole-genome amplification. Results Here we report a protocol optimized in barley including amplification of DNA from only ten thousand chromosomes, which can be isolated in less than one hour. Flow-sorted chromosomes were treated with proteinase K and amplified using Phi29 multiple displacement amplification (MDA. Overnight amplification in a 20-microlitre reaction produced 3.7 – 5.7 micrograms DNA with a majority of products between 5 and 30 kb. To determine the purity of sorted fractions and potential amplification bias we used quantitative PCR for specific genes on each chromosome. To extend the analysis to a whole genome level we performed an oligonucleotide pool assay (OPA for interrogation of 1524 loci, of which 1153 loci had known genetic map positions. Analysis of unamplified genomic DNA of barley cv. Akcent using this OPA resulted in 1426 markers with present calls. Comparison with three replicates of amplified genomic DNA revealed >99% concordance. DNA samples from amplified chromosome 1H and a fraction containing chromosomes 2H – 7H were examined. In addition to loci with known map positions, 349 loci with unknown map positions were included. Based on this analysis 40 new loci were mapped to 1H. Conclusion The results indicate a significant potential of using this approach for physical mapping. Moreover, the study showed that multiple displacement amplification of flow-sorted chromosomes is highly efficient and representative which

  9. Algorithms for mapping high-throughput DNA sequences

    DEFF Research Database (Denmark)

    Frellsen, Jes; Menzel, Peter; Krogh, Anders

    2014-01-01

    of data generation, new bioinformatics approaches have been developed to cope with the large amount of sequencing reads obtained in these experiments. In this chapter, we first introduce HTS technologies and their usage in molecular biology and discuss the problem of mapping sequencing reads...... to their genomic origin. We then in detail describe two approaches that offer very fast heuristics to solve the mapping problem in a feasible runtime. In particular, we describe the BLAT algorithm, and we give an introduction to the Burrows-Wheeler Transform and the mapping algorithms based on this transformation....

  10. The DNA 'comet assay' as a rapid screening technique to control irradiated food

    International Nuclear Information System (INIS)

    Cerda, H.; Delincee, H.; Haine, H.; Rupp, H.

    1997-01-01

    The exposure of food to ionizing radiation is being progressively used in many countries to inactivate food pathogens, to eradicate pests, and to extend shelf-life, thereby contributing to a safer and more plentiful food supply. To ensure free consumer choice, irradiated food will be labelled as such, and to enforce labelling, analytical methods to detect the irradiation treatment in the food product itself are desirable. In particular, there is a need for simple and rapid screening methods for the control of irradiated food. The DNA comet assay offers great potential as a rapid tool to detect whether a wide variety of foodstuffs have been radiation processed. In order to simplify the test, the agarose single-layer set-up has been chosen, using a neutral protocol. Interlaboratory blind trials have been successfully carried out with a number of food products, both of animal and plant origin. This paper presents an overview of the hitherto obtained results and in addition the results of an intercomparison test with seeds, dried fruits and spices are described. In this intercomparison, an identification rate of 95% was achieved. Thus, using this novel technique, an effective screening of radiation-induced DNA fragmentation is obtained. Since other food treatments also may cause DNA fragmentation, samples with fragmented DNA suspected to have been irradiated should be analyzed by other validated methods for irradiated food, if such treatments which damage DNA cannot be excluded

  11. Surficial Geologic Map of the Roanoke Rapids 30' x 60' Quadrangle, North Carolina

    Science.gov (United States)

    Weems, Robert E.; Lewis, William C.; Aleman-Gonzalez, Wilma

    2009-01-01

    The Roanoke Rapids 1:100,000 map sheet is located in northeastern North Carolina. Most of the area is flat to gently rolling, though steep slopes occur occasionally along some of the larger streams. Total relief in the area is slightly less than 400 feet (ft), with elevations ranging from sea level east of Murfreesboro in the far northeastern corner of the map to 384 ft near the northwestern map border near Littleton. The principal streams are the Roanoke River and Fishing Creek, which on average flow from northwest to southeast in the map area. The principal north-south roads are Interstate Route 95, U.S. Route 258, and U.S. Route 301. Two lines of the CSX railroad also cross the area in a north-south and northeast-southwest direction. This part of North Carolina is primarily rural and agricultural. The only large community in the area is Roanoke Rapids. The map lies astride the Tidewater Fall Line, a prominent physiographic feature marked by rapids and waterfalls that separate the rocky streams of the eastern Piedmont physiographic province from the sandy and alluviated streams of the western Atlantic Coastal Plain physiographic province. The energy from the Roanoke River descending the Tidewater Fall Line has been harnessed by dams to produce hydroelectric power, and this source of energy was a major factor in the growth and development of Roanoke Rapids. The Piedmont in the western part of the map area is underlain by Neoproterozoic to Cambrian metavolcanic and metasedimentary rocks that are intruded by granite in some areas. In the central and eastern part of the map area, the folded and faulted igneous and metamorphic rocks of the Piedmont, as well as tilted sedimentary rocks in a buried Triassic basin, are all overlain with profound unconformity by generally unlithified and only slightly eastward-tilted Cretaceous, Paleogene, and Neogene sediments of the Atlantic Coastal Plain. The Coastal Plain sediments lap westward onto the eastern Piedmont along the high

  12. Rapid and label-free electrochemical DNA biosensor for detecting hepatitis A virus.

    Science.gov (United States)

    Manzano, Marisa; Viezzi, Sara; Mazerat, Sandra; Marks, Robert S; Vidic, Jasmina

    2018-02-15

    Diagnostic systems that can deliver highly specific and sensitive detection of hepatitis A virus (HAV) in food and water are of particular interest in many fields including food safety, biosecurity and control of outbreaks. Our aim was the development of an electrochemical method based on DNA hybridization to detect HAV. A ssDNA probe specific for HAV (capture probe) was designed and tested on DNAs from various viral and bacterial samples using Nested-Reverse Transcription Polymerase Chain Reaction (nRT-PCR). To develop the electrochemical device, a disposable gold electrode was functionalized with the specific capture probe and tested on complementary ssDNA and on HAV cDNA. The DNA hybridization on the electrode was measured through the monitoring of the oxidative peak potential of the indicator tripropylamine by cyclic voltammetry. To prevent non-specific binding the gold surface was treated with 3% BSA before detection. High resolution atomic force microscopy (AFM) confirmed the efficiency of electrode functionalization and on-electrode hybridization. The proposed device showed a limit of detection of 0.65pM for the complementary ssDNA and 6.94fg/µL for viral cDNA. For a comparison, nRT-PCR quantified the target HAV cDNA with a limit of detection of 6.4fg/µL. The DNA-sensor developed can be adapted to a portable format to be adopted as an easy-to- use and low cost method for screening HAV in contaminated food and water. In addition, it can be useful for rapid control of HAV infections as it takes only a few minutes to provide the results. Copyright © 2017. Published by Elsevier B.V.

  13. THE USE OF UAS FOR RAPID 3D MAPPING IN GEOMATICS EDUCATION

    Directory of Open Access Journals (Sweden)

    T.-A. Teo

    2016-06-01

    Full Text Available With the development of technology, UAS is an advance technology to support rapid mapping for disaster response. The aim of this study is to develop educational modules for UAS data processing in rapid 3D mapping. The designed modules for this study are focused on UAV data processing from available freeware or trial software for education purpose. The key modules include orientation modelling, 3D point clouds generation, image georeferencing and visualization. The orientation modelling modules adopts VisualSFM to determine the projection matrix for each image station. Besides, the approximate ground control points are measured from OpenStreetMap for absolute orientation. The second module uses SURE and the orientation files from previous module for 3D point clouds generation. Then, the ground point selection and digital terrain model generation can be archived by LAStools. The third module stitches individual rectified images into a mosaic image using Microsoft ICE (Image Composite Editor. The last module visualizes and measures the generated dense point clouds in CloudCompare. These comprehensive UAS processing modules allow the students to gain the skills to process and deliver UAS photogrammetric products in rapid 3D mapping. Moreover, they can also apply the photogrammetric products for analysis in practice.

  14. Rapid recombination mapping for high-throughput genetic screens in Drosophila.

    Science.gov (United States)

    Sapiro, Anne L; Ihry, Robert J; Buhr, Derek L; Konieczko, Kevin M; Ives, Sarah M; Engstrom, Anna K; Wleklinski, Nicholas P; Kopish, Kristin J; Bashirullah, Arash

    2013-12-09

    Mutagenesis screens are a staple of classical genetics. Chemical-induced mutations, however, are often difficult and time-consuming to identify. Here, we report that recombination analysis with pairs of dominant visible markers provides a rapid and reliable strategy to map mutations in Drosophila melanogaster. This method requires only two generations and a total of six crosses in vials to estimate the genetic map position of the responsible lesion with high accuracy. This genetic map position can then be reliably used to identify the mutated gene through complementation testing with an average of nine deficiencies and Sanger sequencing. We have used this approach to successfully map a collection of mutations from an ethyl methanesulfonate-based mutagenesis screen on the third chromosome. We propose that this method also may be used in conjunction with whole-genome sequencing, particularly when multiple independent alleles of the mutated locus are not available. By facilitating the rapid identification of mutated genes, our mapping strategy removes a primary obstacle to the widespread use of powerful chemical mutagenesis screens to understand fundamental biological phenomena.

  15. A rapid and quantitative method to determine the tritium content in DNA from small tissue sampes

    International Nuclear Information System (INIS)

    Kasche, V.; Zoellner, R.

    1979-01-01

    A rapid and quantitative two-step procedure to isolate double-strand DNA from small (10-100 mg) animal tissue samples is presented. The method is developed for investigations to evaluate the relative importance of organically bound tritium for the dose factors used to calculate dose commitments due to this nuclide. In the first step the proteins in the homogenized sample are hydrolysed, at a high pH (9.0) and ionic strength (1.5) to dissociate protein from DNA, using immobilized Proteinase K as a proteolytic enzyme. The DNA is then absorbed to hydroxylapatite and separated from impurities by step-wise elution with buffers of increasing ionic strength. More than 90% of the DNA in the samples could be isolated in double-strand form by this procedure. The method has been applied to determine pool-sizes and biological half-life times of tritium in DNA from various animal (mouse) tissues. It has also been shown to be suitable in other radiobiological studies where effects on DNA are investigated. (author)

  16. Development and production of Lab-on-Chip systems for DNA mapping

    DEFF Research Database (Denmark)

    Østergaard, Peter Friis

    as low as 1:200. The developed polymer systems are tested by conducting two different experiments on DNA. Since such experiments are highly sensitive, efforts have been taken in order to lower the autofluorescence of the devices, resulting in a decrease of the background signal to roughly half...... several nanochannels can be placed parallel to each other, a large number of DNA molecules can be investigated. In the second experiment, mapping is performed on human DNA in nanoslit devices. A fluorescent profile is created by heating the sample up to a temperature, where the DNA is partially denatured....... The fluorescent dye will diffuse away from the denatured regions, and by analysing these black areas, the DNA molecule can be identified and potential mutations can be found. In the nanoslits, the DNA is stretched out via a shear flow, resulting in a stretching of more than 95% of the contour length meaning...

  17. Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

    Science.gov (United States)

    Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

    2014-11-01

    Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates

  18. Rapid turnover of 2-LTR HIV-1 DNA during early stage of highly active antiretroviral therapy.

    Directory of Open Access Journals (Sweden)

    Weijun Zhu

    Full Text Available BACKGROUND: Despite prolonged treatment with highly active antiretroviral therapy (HAART, the infectious HIV-1 continues to replicate and resides latently in the resting memory CD4+ T lymphocytes, which blocks the eradication of HIV-1. The viral persistence of HIV-1 is mainly caused by its proviral DNA being either linear nonintegrated, circular nonintegrated, or integrated. Previous reports have largely focused on the dynamics of HIV-1 DNA from the samples collected with relatively long time intervals during the process of disease and HAART treatment, which may have missed the intricate changes during the intervals in early treatment. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we investigated the dynamics of HIV-1 DNA in patients during the early phase of HARRT treatment. Using optimized real time PCR, we observed significant changes in 2-LTR during the first 12-week of treatment, while total and integrated HIV-1 DNA remained stable. The doubling time and half-life of 2-LTR were not correlated with the baseline and the rate of changes in plasma viral load and various CD4+ T-cell populations. Longitudinal analyses on 2-LTR sequences and plasma lipopolysaccharide (LPS levels did not reveal any significant changes in the same treatment period. CONCLUSIONS/SIGNIFICANCE: Our study revealed the rapid changes in 2-LTR concentration in a relatively large number of patients during the early HAART treatment. The rapid changes indicate the rapid infusion and clearance of cells bearing 2-LTR in the peripheral blood. Those changes are not expected to be caused by the blocking of viral integration, as our study did not include the integrase inhibitor raltegravir. Our study helps better understand the dynamics of HIV-DNA and its potential role as a biomarker for the diseases and for the treatment efficacy of HAART.

  19. An annotated genetic map of loblolly pine based on microsatellite and cDNA markers

    Directory of Open Access Journals (Sweden)

    Wimalanathan Kokulapalan

    2011-01-01

    Full Text Available Abstract Background Previous loblolly pine (Pinus taeda L. genetic linkage maps have been based on a variety of DNA polymorphisms, such as AFLPs, RAPDs, RFLPs, and ESTPs, but only a few SSRs (simple sequence repeats, also known as simple tandem repeats or microsatellites, have been mapped in P. taeda. The objective of this study was to integrate a large set of SSR markers from a variety of sources and published cDNA markers into a composite P. taeda genetic map constructed from two reference mapping pedigrees. A dense genetic map that incorporates SSR loci will benefit complete pine genome sequencing, pine population genetics studies, and pine breeding programs. Careful marker annotation using a variety of references further enhances the utility of the integrated SSR map. Results The updated P. taeda genetic map, with an estimated genome coverage of 1,515 cM(Kosambi across 12 linkage groups, incorporated 170 new SSR markers and 290 previously reported SSR, RFLP, and ESTP markers. The average marker interval was 3.1 cM. Of 233 mapped SSR loci, 84 were from cDNA-derived sequences (EST-SSRs and 149 were from non-transcribed genomic sequences (genomic-SSRs. Of all 311 mapped cDNA-derived markers, 77% were associated with NCBI Pta UniGene clusters, 67% with RefSeq proteins, and 62% with functional Gene Ontology (GO terms. Duplicate (i.e., redundant accessory and paralogous markers were tentatively identified by evaluating marker sequences by their UniGene cluster IDs, clone IDs, and relative map positions. The average gene diversity, He, among polymorphic SSR loci, including those that were not mapped, was 0.43 for 94 EST-SSRs and 0.72 for 83 genomic-SSRs. The genetic map can be viewed and queried at http://www.conifergdb.org/pinemap. Conclusions Many polymorphic and genetically mapped SSR markers are now available for use in P. taeda population genetics, studies of adaptive traits, and various germplasm management applications. Annotating mapped

  20. Force scanning: a rapid, high-resolution approach for spatial mechanical property mapping

    International Nuclear Information System (INIS)

    Darling, E M

    2011-01-01

    Atomic force microscopy (AFM) can be used to co-localize mechanical properties and topographical features through property mapping techniques. The most common approach for testing biological materials at the microscale and nanoscale is force mapping, which involves taking individual force curves at discrete sites across a region of interest. The limitations of force mapping include long testing times and low resolution. While newer AFM methodologies, like modulated scanning and torsional oscillation, circumvent this problem, their adoption for biological materials has been limited. This could be due to their need for specialized software algorithms and/or hardware. The objective of this study is to develop a novel force scanning technique using AFM to rapidly capture high-resolution topographical images of soft biological materials while simultaneously quantifying their mechanical properties. Force scanning is a straightforward methodology applicable to a wide range of materials and testing environments, requiring no special modification to standard AFMs. Essentially, if a contact-mode image can be acquired, then force scanning can be used to produce a spatial modulus map. The current study first validates this technique using agarose gels, comparing results to ones achieved by the standard force mapping approach. Biologically relevant demonstrations are then presented for high-resolution modulus mapping of individual cells, cell-cell interfaces, and articular cartilage tissue.

  1. DNA template strand sequencing of single-cells maps genomic rearrangements at high resolution

    OpenAIRE

    Falconer, Ester; Hills, Mark; Naumann, Ulrike; Poon, Steven S. S.; Chavez, Elizabeth A.; Sanders, Ashley D.; Zhao, Yongjun; Hirst, Martin; Lansdorp, Peter M.

    2012-01-01

    DNA rearrangements such as sister chromatid exchanges (SCEs) are sensitive indicators of genomic stress and instability, but they are typically masked by single-cell sequencing techniques. We developed Strand-seq to independently sequence parental DNA template strands from single cells, making it possible to map SCEs at orders-of-magnitude greater resolution than was previously possible. On average, murine embryonic stem (mES) cells exhibit eight SCEs, which are detected at a resolution of up...

  2. Color Image Encryption Using Three-Dimensional Sine ICMIC Modulation Map and DNA Sequence Operations

    Science.gov (United States)

    Liu, Wenhao; Sun, Kehui; He, Yi; Yu, Mengyao

    Derived from Sine map and iterative chaotic map with infinite collapse (ICMIC), a three-dimensional hyperchaotic Sine ICMIC modulation map (3D-SIMM) is proposed based on a close-loop modulation coupling (CMC) method. Based on this map, a novel color image encryption algorithm is designed by employing a hybrid model of multidirectional circular permutation and deoxyribonucleic acid (DNA) masking. In this scheme, the pixel positions of image are scrambled by multidirectional circular permutation, and the pixel values are substituted by DNA sequence operations. The simulation results and security analysis show that the algorithm has good encryption effect and strong key sensitivity, and can resist brute-force, statistical, differential, known-plaintext and chosen-plaintext attacks.

  3. Essential Function of Dicer in Resolving DNA Damage in the Rapidly Dividing Cells of the Developing and Malignant Cerebellum

    Directory of Open Access Journals (Sweden)

    Vijay Swahari

    2016-01-01

    Full Text Available Maintenance of genomic integrity is critical during neurodevelopment, particularly in rapidly dividing cerebellar granule neuronal precursors that experience constitutive replication-associated DNA damage. As Dicer was recently recognized to have an unexpected function in the DNA damage response, we examined whether Dicer was important for preserving genomic integrity in the developing brain. We report that deletion of Dicer in the developing mouse cerebellum resulted in the accumulation of DNA damage leading to cerebellar progenitor degeneration, which was rescued with p53 deficiency; deletion of DGCR8 also resulted in similar DNA damage and cerebellar degeneration. Dicer deficiency also resulted in DNA damage and death in other rapidly dividing cells including embryonic stem cells and the malignant cerebellar progenitors in a mouse model of medulloblastoma. Together, these results identify an essential function of Dicer in resolving the spontaneous DNA damage that occurs during the rapid proliferation of developmental progenitors and malignant cells.

  4. Mapping metals in Parkinson's and normal brain using rapid-scanning x-ray fluorescence

    International Nuclear Information System (INIS)

    Popescu, Bogdan F Gh; George, Martin J; McCrea, Richard P E; Devon, Richard M; George, Graham N; Hanson, Akela D; Chapman, L Dean; Nichol, Helen; Bergmann, Uwe; Garachtchenko, Alex V; Luening, Katharina; Kelly, Michael E; Harder, Sheri M; Pickering, Ingrid J

    2009-01-01

    Rapid-scanning x-ray fluorescence (RS-XRF) is a synchrotron technology that maps multiple metals in tissues by employing unique hardware and software to increase scanning speed. RS-XRF was validated by mapping and quantifying iron, zinc and copper in brain slices from Parkinson's disease (PD) and unaffected subjects. Regions and structures in the brain were readily identified by their metal complement and each metal had a unique distribution. Many zinc-rich brain regions were low in iron and vice versa. The location and amount of iron in brain regions known to be affected in PD agreed with analyses using other methods. Sample preparation is simple and standard formalin-fixed autopsy slices are suitable. RS-XRF can simultaneously and non-destructively map and quantify multiple metals and holds great promise to reveal metal pathologies associated with PD and other neurodegenerative diseases as well as diseases of metal metabolism.

  5. Rapid Land Cover Map Updates Using Change Detection and Robust Random Forest Classifiers

    Directory of Open Access Journals (Sweden)

    Konrad J. Wessels

    2016-10-01

    Full Text Available The paper evaluated the Landsat Automated Land Cover Update Mapping (LALCUM system designed to rapidly update a land cover map to a desired nominal year using a pre-existing reference land cover map. The system uses the Iteratively Reweighted Multivariate Alteration Detection (IRMAD to identify areas of change and no change. The system then automatically generates large amounts of training samples (n > 1 million in the no-change areas as input to an optimized Random Forest classifier. Experiments were conducted in the KwaZulu-Natal Province of South Africa using a reference land cover map from 2008, a change mask between 2008 and 2011 and Landsat ETM+ data for 2011. The entire system took 9.5 h to process. We expected that the use of the change mask would improve classification accuracy by reducing the number of mislabeled training data caused by land cover change between 2008 and 2011. However, this was not the case due to exceptional robustness of Random Forest classifier to mislabeled training samples. The system achieved an overall accuracy of 65%–67% using 22 detailed classes and 72%–74% using 12 aggregated national classes. “Water”, “Plantations”, “Plantations—clearfelled”, “Orchards—trees”, “Sugarcane”, “Built-up/dense settlement”, “Cultivation—Irrigated” and “Forest (indigenous” had user’s accuracies above 70%. Other detailed classes (e.g., “Low density settlements”, “Mines and Quarries”, and “Cultivation, subsistence, drylands” which are required for operational, provincial-scale land use planning and are usually mapped using manual image interpretation, could not be mapped using Landsat spectral data alone. However, the system was able to map the 12 national classes, at a sufficiently high level of accuracy for national scale land cover monitoring. This update approach and the highly automated, scalable LALCUM system can improve the efficiency and update rate of regional land

  6. Rapid Offline-Online Post-Disaster Landslide Mapping Tool: A case study from Nepal

    Science.gov (United States)

    Olyazadeh, Roya; Jaboyedoff, Michel; Sudmeier-Rieux, Karen; Derron, Marc-Henri; Devkota, Sanjaya

    2016-04-01

    One of the crucial components of post disaster management is the efficient mapping of impacted areas. Here we present a tool designed to map landslides and affected objects after the earthquakes of 2015 in Nepal as well as for intense rainfall impact. Because internet is not available in many rural areas of Nepal, we developed an offline-online prototype based on Open-Source WebGIS technologies to make data on hazard impacts, including damaged infrastructure, landslides or flooding events available to authorities and the general public. This mobile application was designed as a low-cost, rapid and participatory method for recording impacts from hazard events. It is possible to record such events offline and upload them through a server, where internet connection is available. This application allows user authentication, image capturing, and information collation such as geolocation, event description, interactive mapping and finally storing all the data in the server for further analysis and visualisation. This application can be accessed by a mobile phone (Android) or a tablet as a hybrid version for both offline and online versions. The offline version has an interactive-offline map function which allows users to upload satellites image in order to improve ground truthing interpretation. After geolocation, the user can start mapping and then save recorded data into Geojson-TXT files that can be easily uploaded to the server whenever internet is available. This prototype was tested specifically for a rapid assessment of landslides and relevant land use characteristics such as roads, forest area, rivers in the Phewa Lake watershed near Pokhara, Nepal where a large number landslides were activated or reactivated after the 2015 monsoon season. More than 60 landslides were recorded during two days of field trip. Besides, it is possible to use this application for any other kind of hazard event like flood, avalanche, etc. Keywords: Offline, Online, Open source, Web

  7. Rapid screening method for male DNA by using the loop-mediated isothermal amplification assay.

    Science.gov (United States)

    Kitamura, Masashi; Kubo, Seiji; Tanaka, Jin; Adachi, Tatsushi

    2017-08-12

    Screening for male-derived biological material from collected samples plays an important role in criminal investigations, especially those involving sexual assaults. We have developed a loop-mediated isothermal amplification (LAMP) assay targeting multi-repeat sequences of the Y chromosome for detecting male DNA. Successful amplification occurred with 0.5 ng of male DNA under isothermal conditions of 61 to 67 °C, but no amplification occurred with up to 10 ng of female DNA. Under the optimized conditions, the LAMP reaction initiated amplification within 10 min and amplified for 20 min. The LAMP reaction was sensitive at levels as low as 1-pg male DNA, and a quantitative LAMP assay could be developed because of the strong correlation between the reaction time and the amount of template DNA in the range of 10 pg to 10 ng. Furthermore, to apply the LAMP assay to on-site screening for male-derived samples, we evaluated a protocol using a simple DNA extraction method and a colorimetric intercalating dye that allows detection of the LAMP reaction by evaluating the change in color of the solution. Using this protocol, samples of male-derived blood and saliva stains were processed in approximately 30 min from DNA extraction to detection. Because our protocol does not require much hands-on time or special equipment, this LAMP assay promises to become a rapid and simple screening method for male-derived samples in forensic investigations.

  8. Rapid detection of DNA-interstrand and DNA-protein cross-links in mammalian cells by gravity-flow alkaline elution

    International Nuclear Information System (INIS)

    Hincks, J.R.; Coulombe, R.A. Jr.

    1989-01-01

    Alkaline elution is a sensitive and commonly used technique to detect cellular DNA damage in the form of DNA strand breaks and DNA cross-links. Conventional alkaline elution procedures have extensive equipment requirements and are tedious to perform. Our laboratory recently presented a rapid, simplified, and sensitive modification of the alkaline elution technique to detect carcinogen-induced DNA strand breaks. In the present study, we have further modified this technique to enable the rapid characterization of chemically induced DNA-interstrand and DNA-protein associated cross-links in cultured epithelial cells. Cells were exposed to three known DNA cross-linking agents, nitrogen mustard (HN 2 ), mitomycin C (MMC), or ultraviolet irradiation (UV). One hour exposures of HN 2 at 0.25, 1.0, and 4.0 microM or of MMC at 20, 40, and 60 microM produced a dose-dependent induction of total DNA cross-links by these agents. Digestion with proteinase K revealed that HN 2 and MMC induced both DNA-protein cross-links and DNA-interstrand cross-links. Ultraviolet irradiation induced both DNA cross-links and DNA strand breaks, the latter of which were either protein and nonprotein associated. The results demonstrate that gravity-flow alkaline elution is a sensitive and accurate method to characterize the molecular events of DNA cross-linking. Using this procedure, elution of DNA from treated cells is completed in 1 hr, and only three fractions per sample are analyzed. This method may be useful as a rapid screening assay for genotoxicity and/or as an adjunct to other predictive assays for potential mutagenic or carcinogenic agents

  9. Rapid on-site detection of Acidovorax avenae subsp. citrulli by gold-labeled DNA strip sensor.

    Science.gov (United States)

    Zhao, Wenjun; Lu, Jie; Ma, Wenwei; Xu, Chuanlai; Kuang, Hua; Zhu, Shuifang

    2011-06-15

    Acidovorax avenae subsp. citrulli (AAC) is one of the most harmful diseases in cucurbit production. A rapid and sensitive DNA strip sensor was constructed based on gold nanoparticle-labeled oligonucleotide probes for the detection of AAC. Both the qualitative and semi-quantitative detections of target DNA were successfully achieved using the developed DNA strip sensor. The qualitative limit of detection (LOD) of the strip sensor was determined as 4 nM. The LOD for the semi-quantitative detection was calculated to be 0.48 nM in the range of 0-10 nM. The genomic DNA was detected directly using the DNA strip sensor without any further treatment. This DNA strip sensor is a potentially useful tool for rapid on-site DNA screening. Copyright © 2011 Elsevier B.V. All rights reserved.

  10. A DNA 'barcode blitz': rapid digitization and sequencing of a natural history collection.

    Science.gov (United States)

    Hebert, Paul D N; Dewaard, Jeremy R; Zakharov, Evgeny V; Prosser, Sean W J; Sones, Jayme E; McKeown, Jaclyn T A; Mantle, Beth; La Salle, John

    2013-01-01

    DNA barcoding protocols require the linkage of each sequence record to a voucher specimen that has, whenever possible, been authoritatively identified. Natural history collections would seem an ideal resource for barcode library construction, but they have never seen large-scale analysis because of concerns linked to DNA degradation. The present study examines the strength of this barrier, carrying out a comprehensive analysis of moth and butterfly (Lepidoptera) species in the Australian National Insect Collection. Protocols were developed that enabled tissue samples, specimen data, and images to be assembled rapidly. Using these methods, a five-person team processed 41,650 specimens representing 12,699 species in 14 weeks. Subsequent molecular analysis took about six months, reflecting the need for multiple rounds of PCR as sequence recovery was impacted by age, body size, and collection protocols. Despite these variables and the fact that specimens averaged 30.4 years old, barcode records were obtained from 86% of the species. In fact, one or more barcode compliant sequences (>487 bp) were recovered from virtually all species represented by five or more individuals, even when the youngest was 50 years old. By assembling specimen images, distributional data, and DNA barcode sequences on a web-accessible informatics platform, this study has greatly advanced accessibility to information on thousands of species. Moreover, much of the specimen data became publically accessible within days of its acquisition, while most sequence results saw release within three months. As such, this study reveals the speed with which DNA barcode workflows can mobilize biodiversity data, often providing the first web-accessible information for a species. These results further suggest that existing collections can enable the rapid development of a comprehensive DNA barcode library for the most diverse compartment of terrestrial biodiversity - insects.

  11. Cloning and restriction enzyme mapping of ribosomal DNA of Giardia duodenalis, Giardia ardeae and Giardia muris.

    Science.gov (United States)

    van Keulen, H; Campbell, S R; Erlandsen, S L; Jarroll, E L

    1991-06-01

    In an attempt to study Giardia at the DNA sequence level, the rRNA genes of three species, Giardia duodenalis, Giardia ardeae and Giardia muris were cloned and restriction enzyme maps were constructed. The rDNA repeats of these Giardia show completely different restriction enzyme recognition patterns. The size of the rDNA repeat ranges from approximately 5.6 kb in G. duodenalis to 7.6 kb in both G. muris and G. ardeae. These size differences are mainly attributable to the variation in length of the spacer. Minor differences exist among these Giardia in the sizes of their small subunit rRNA and the internal transcribed spacer between small and large subunit rRNA. The genetic maps were constructed by sequence analysis of the DNA around the 5' and 3' ends of the mature rRNA genes and between the rRNA covering the 5.8S rRNA gene and internal transcribed spacer. Comparison of the 5.8S rDNA and 3' end of large subunit rDNA from these three Giardia species showed considerable sequence variation, but the rDNA sequences of G. duodenalis and G. ardeae appear more closely related to each other than to G. muris.

  12. RAPID-N: Assessing and mapping the risk of natural-hazard impact at industrial installations

    Science.gov (United States)

    Girgin, Serkan; Krausmann, Elisabeth

    2015-04-01

    Natural hazard-triggered technological accidents (so-called Natech accidents) at hazardous installations can have major consequences due to the potential for release of hazardous materials, fires and explosions. Effective Natech risk reduction requires the identification of areas where this risk is high. However, recent studies have shown that there are hardly any methodologies and tools that would allow authorities to identify these areas. To work towards closing this gap, the European Commission's Joint Research Centre has developed the rapid Natech risk assessment and mapping framework RAPID-N. The tool, which is implemented in an online web-based environment, is unique in that it contains all functionalities required for running a full Natech risk analysis simulation (natural hazards severity estimation, equipment damage probability and severity calculation, modeling of the consequences of loss of containment scenarios) and for visualizing its results. The output of RAPID-N are risk summary reports and interactive risk maps which can be used for decision making. Currently, the tool focuses on Natech risk due to earthquakes at industrial installations. However, it will be extended to also analyse and map Natech risk due to floods in the near future. RAPID-N is available at http://rapidn.jrc.ec.europa.eu. This presentation will discuss the results of case-study calculations performed for selected flammable and toxic substances to test the capabilities of RAPID-N both for single- and multi-site earthquake Natech risk assessment. For this purpose, an Istanbul earthquake scenario provided by the Turkish government was used. The results of the exercise show that RAPID-N is a valuable decision-support tool that assesses the Natech risk and maps the consequence end-point distances. These end-point distances are currently defined by 7 kPa overpressure for Vapour Cloud Explosions, 2nd degree burns for pool fire (which is equivalent to a heat radiation of 5 kW/m2 for 40s

  13. Presence of intestinal Mycobacterium avium subspecies paratuberculosis (MAP DNA is not associated with altered MMP expression in ulcerative colitis

    Directory of Open Access Journals (Sweden)

    Halwe Jörg M

    2011-04-01

    Full Text Available Abstract Background Mycobacterium avium subspecies paratuberculosis (MAP is suspected to be a causative agent in human Crohn's disease (CD. Recent evidence suggests that pathogenic mycobacteria and MAP can induce the expression of Matrix Metalloproteinases (MMP, which are the main proteases in the pathogenesis of mucosal ulcerations in inflammatory bowel disease (IBD. Within this study we assessed the prevalence of intestinal MAP specific DNA in patients with Crohn's disease, ulcerative colitis (UC, and healthy controls. We further analysed regulation patterns of MMPs in mucosal tissues of UC patients with and without intestinal MAP DNA detection. Methods Colonic biopsy samples were obtained from 63 Norwegian and German IBD patients and 21 healthy controls. RNA was quantified by quantitative real-time polymerase chain reaction (PCR to study MMP gene expression in both pathological and healthy mucosal specimens. The presence of MAP DNA in colonic mucosa was examined using MAP specific PCR. Results MAP DNA was detected in 20% of UC patients and 33% of healthy controls but only in 7% of patients with CD. UC patients treated with corticosteroids exhibited a significantly increased frequency of intestinal MAP DNA compared to those not receiving corticosteroids. Expression of MMP-1, -2, -7, -9, -13, -19, -28 and TNF-α did not differ between UC patients with presence of intestinal MAP DNA compared to those without. MMP-2, MMP-9 and MMP-13 were significantly decreased in UC patients receiving corticosteroids. Conclusions The presence of intestinal MAP specific DNA is not associated with altered MMP expression in UC in vivo. Corticosteroids are associated with increased detection of intestinal MAP DNA and decreased expression of certain MMPs. Frequent detection of MAP DNA in healthy controls might be attributable to the wide environmental distribution of MAP and its presence in the food-chain.

  14. Extensive mapping of PPAR binding to genomic DNA

    DEFF Research Database (Denmark)

    Nielsen, Ronni; Pedersen, Thomas Åskov; Trindade, Luisa

    processes such as adaptation to fasting and cold, muscle isotype switching and adipogenesis, underscoring the metabolic importance of these transcription factors. Although the PPARs have been subject to intensive studies for almost two decades, far from all PPAR target genes are known. In addition, only few...... analysis of the regulatory networks controlled by PPAR transcription factors, thereby allowing for a better understanding of PPAR biology. - Adenoviral expression PPARg2 and RXR induce transcription from a wide range of hepatocyte as well as non-hepatocyte PPAR target genes in the murine AML-12 hepatoma...... cell line. Only very few PPAR target genes are not induced by PPARg2/RXR. - ChIP-on-chip analysis shows ~1200 peaks on chr. 7 & 8 by peak detection software. 80% of selected peaks were positive in single ChIP experiments.   - PPARg2/RXR are recruited to DNA elements near several genes on chr. 7 & 8...

  15. Rapid and sensitive PCR-dipstick DNA chromatography for multiplex analysis of the oral microbiota.

    Science.gov (United States)

    Tian, Lingyang; Sato, Takuichi; Niwa, Kousuke; Kawase, Mitsuo; Tanner, Anne C R; Takahashi, Nobuhiro

    2014-01-01

    A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

  16. Rapid and Sensitive PCR-Dipstick DNA Chromatography for Multiplex Analysis of the Oral Microbiota

    Directory of Open Access Journals (Sweden)

    Lingyang Tian

    2014-01-01

    Full Text Available A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

  17. Rapid Detection of Cell-Free Mycobacterium tuberculosis DNA in Tuberculous Pleural Effusion.

    Science.gov (United States)

    Che, Nanying; Yang, Xinting; Liu, Zichen; Li, Kun; Chen, Xiaoyou

    2017-05-01

    Tuberculous pleurisy is one of the most common types of extrapulmonary tuberculosis, but its diagnosis remains difficult. In this study, we report for the first time on the detection of cell-free Mycobacterium tuberculosis DNA in pleural effusion and an evaluation of a newly developed molecular assay for the detection of cell-free Mycobacterium tuberculosis DNA. A total of 78 patients with pleural effusion, 60 patients with tuberculous pleurisy, and 18 patients with alternative diseases were included in this study. Mycobacterial culture, the Xpert MTB/RIF assay, the adenosine deaminase assay, the T-SPOT.TB assay, and the cell-free Mycobacterium tuberculosis DNA assay were performed on all the pleural effusion samples. The cell-free Mycobacterium tuberculosis DNA assay and adenosine deaminase assay showed significantly higher sensitivities of 75.0% and 68.3%, respectively, than mycobacterial culture and the Xpert MTB/RIF assay, which had sensitivities of 26.7% and 20.0%, respectively ( P pleural effusion showed the highest sensitivity of 95.0% but the lowest specificity of 38.9%. The cell-free Mycobacterium tuberculosis DNA assay detected as few as 1.25 copies of IS 6110 per ml of pleural effusion and showed good accordance of the results between repeated tests ( r = 0.978, P = 2.84 × 10 -10 ). These data suggest that the cell-free Mycobacterium tuberculosis DNA assay is a rapid and accurate molecular test which provides direct evidence of Mycobacterium tuberculosis etiology. Copyright © 2017 American Society for Microbiology.

  18. Updating rDNA restriction enzyme maps of Tetrahymena reveals four new intron-containing species

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Simon, E M; Engberg, J

    1985-01-01

    an intron in the 26s rRNA coding region. The evolutionary relationship among the species of the T. pyriformis complex was examined on the basis of the rDNA maps with emphasis on similarities between two of the new species and the widely studied T. thermophila and T. pigmentosa. Examination of a large number...

  19. Integrating a comprehensive DNA barcode reference library with a global map of yews (Taxus L.) for forensic identification.

    Science.gov (United States)

    Liu, Jie; Milne, Richard I; Möller, Michael; Zhu, Guang-Fu; Ye, Lin-Jiang; Luo, Ya-Huang; Yang, Jun-Bo; Wambulwa, Moses Cheloti; Wang, Chun-Neng; Li, De-Zhu; Gao, Lian-Ming

    2018-05-22

    Rapid and accurate identification of endangered species is a critical component of bio-surveillance and conservation management, and potentially policing illegal trades. However, this is often not possible using traditional taxonomy, especially where only small or pre-processed parts of plants are available. Reliable identification can be achieved via a comprehensive DNA barcode reference library, accompanied by precise distribution data. However, these require extensive sampling at spatial and taxonomic scales, which has rarely been achieved for cosmopolitan taxa. Here we construct a comprehensive DNA barcode reference library, and generate distribution maps using species distribution modeling (SDM), for all 15 Taxus species worldwide. We find that trnL-trnF is the ideal barcode for Taxus: it can distinguish all Taxus species, and in combination with ITS identify hybrids. Among five analysis methods tested, NJ was the most effective. Among 4151 individuals screened for trnL-trnF, 73 haplotypes were detected, all species-specific and some population private. Taxonomical, geographical and genetic dimensions of sampling strategy were all found to affect the comprehensiveness of the resulting DNA barcode library. Maps from SDM showed that most species had allopatric distributions, except three in the Sino-Himalayan region. Using the barcode library and distribution map data, two unknown forensic samples were identified to species (and in one case, population) level, and another was determined as a putative interspecific hybrid. This integrated species identification system for Taxus can be used for bio-surveillance, conservation management and to monitor and prosecute illegal trade. Similar identification systems are recommended for other IUCN- and -CITES listed taxa. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  20. A rapid and economic in-house DNA purification method using glass syringe filters.

    Directory of Open Access Journals (Sweden)

    Yun-Cheol Kim

    Full Text Available BACKGROUND: Purity, yield, speed and cost are important considerations in plasmid purification, but it is difficult to achieve all of these at the same time. Currently, there are many protocols and kits for DNA purification, however none maximize all four considerations. METHODOLOGY/PRINCIPAL FINDINGS: We now describe a fast, efficient and economic in-house protocol for plasmid preparation using glass syringe filters. Plasmid yield and quality as determined by enzyme digestion and transfection efficiency were equivalent to the expensive commercial kits. Importantly, the time required for purification was much less than that required using a commercial kit. CONCLUSIONS/SIGNIFICANCE: This method provides DNA yield and quality similar to that obtained with commercial kits, but is more rapid and less costly.

  1. Mapping yeast origins of replication via single-stranded DNA detection.

    Science.gov (United States)

    Feng, Wenyi; Raghuraman, M K; Brewer, Bonita J

    2007-02-01

    Studies in th Saccharomyces cerevisiae have provided a framework for understanding how eukaryotic cells replicate their chromosomal DNA to ensure faithful transmission of genetic information to their daughter cells. In particular, S. cerevisiae is the first eukaryote to have its origins of replication mapped on a genomic scale, by three independent groups using three different microarray-based approaches. Here we describe a new technique of origin mapping via detection of single-stranded DNA in yeast. This method not only identified the majority of previously discovered origins, but also detected new ones. We have also shown that this technique can identify origins in Schizosaccharomyces pombe, illustrating the utility of this method for origin mapping in other eukaryotes.

  2. Rapid DNA vaccination against Burkholderia pseudomallei flagellin by tattoo or intranasal application.

    Science.gov (United States)

    Lankelma, Jacqueline M; Wagemakers, Alex; Birnie, Emma; Haak, Bastiaan W; Trentelman, Jos J A; Weehuizen, Tassili A F; Ersöz, Jasmin; Roelofs, Joris J T H; Hovius, Joppe W; Wiersinga, W Joost; Bins, Adriaan D

    2017-11-17

    Melioidosis is a severe infectious disease with a high mortality that is endemic in South-East Asia and Northern Australia. The causative pathogen, Burkholderia pseudomallei, is listed as potential bioterror weapon due to its high virulence and potential for easy dissemination. Currently, there is no licensed vaccine for prevention of melioidosis. Here, we explore the use of rapid plasmid DNA vaccination against B. pseudomallei flagellin for protection against respiratory challenge. We tested three flagellin DNA vaccines with different subcellular targeting designs. C57BL/6 mice were vaccinated via skin tattoo on day 0, 3 and 6 before intranasal challenge with B. pseudomallei on day 21. Next, the most effective construct was used as single vaccination on day 0 by tattoo or intranasal formulation. Mice were sacrificed 72 hours post-challenge to assess bacterial loads, cytokine responses, inflammation and microscopic lesions. A construct encoding a cellular secretion signal resulted in the most effective protection against melioidosis via tattooing, with a 10-fold reduction in bacterial loads in lungs and distant organs compared to the empty vector. Strikingly, a single intranasal administration of the same vaccine resulted in >1000-fold lower bacterial loads and increased survival. Pro-inflammatory cytokine responses were significantly diminished and strong reductions in markers for distant organ damage were observed. A rapid vaccination scheme using flagellin DNA tattoo provides significant protection against intranasal challenge with B. pseudomallei, markedly improved by a single administration via airway mucosa. Hence intranasal vaccination with flagellin-encoding DNA may be applicable when acute mass vaccination is indicated and warrants further testing.

  3. Rapid detection of fungal keratitis with DNA-stabilizing FTA filter paper.

    Science.gov (United States)

    Menassa, Nardine; Bosshard, Philipp P; Kaufmann, Claude; Grimm, Christian; Auffarth, Gerd U; Thiel, Michael A

    2010-04-01

    Purpose. Polymerase chain reaction (PCR) is increasingly important for the rapid detection of fungal keratitis. However, techniques of specimen collection and DNA extraction before PCR may interfere with test sensitivity. The purpose of this study was to investigate the use of DNA-stabilizing FTA filter paper (Indicating FTA filter paper; Whatman International, Ltd., Maidstone, UK) for specimen collection without DNA extraction in a single-step, nonnested PCR for fungal keratitis. Methods. Specimens were collected from ocular surfaces with FTA filter discs, which automatically lyse collected cells and stabilize nucleic acids. Filter discs were directly used in single-step PCR reactions to detect fungal DNA. Test sensitivity was evaluated with serial dilutions of Candida albicans, Fusarium oxysporum, and Aspergillus fumigatus cultures. Test specificity was analyzed by comparing 196 and 155 healthy individuals from Switzerland and Egypt, respectively, with 15 patients with a diagnosis of microbial keratitis. Results. PCR with filter discs detected 3 C. albicans, 25 F. oxysporum, and 125 A. fumigatus organisms. In healthy volunteers, fungal PCR was positive in 1.0% and 8.4% of eyes from Switzerland and Egypt, respectively. Fungal PCR remained negative in 10 cases of culture-proven bacterial keratitis, became positive in 4 cases of fungal keratitis, but missed 1 case of culture-proven A. fumigatus keratitis. Conclusions. FTA filter paper for specimen collection together with direct PCR is a promising method of detecting fungal keratitis. The analytical sensitivity is high without the need for a semi-nested or nested second PCR, the clinical specificity is 91.7% to 99.0%, and the method is rapid and inexpensive.

  4. Nonlinear microrheology and molecular imaging to map microscale deformations of entangled DNA networks

    Science.gov (United States)

    Wu, Tsai-Chin; Anderson, Rae

    We use active microrheology coupled to single-molecule fluorescence imaging to elucidate the microscale dynamics of entangled DNA. DNA naturally exists in a wide range of lengths and topologies, and is often confined in cell nucleui, forming highly concentrated and entangled biopolymer networks. Thus, DNA is the model polymer for understanding entangled polymer dynamics as well as the crowded environment of cells. These networks display complex viscoelastic properties that are not well understood, especially at the molecular-level and in response to nonlinear perturbations. Specifically, how microscopic stresses and strains propagate through entangled networks, and what molecular deformations lead to the network stress responses are unknown. To answer these important questions, we optically drive a microsphere through entangled DNA, perturbing the system far from equilibrium, while measuring the resistive force the DNA exerts on the bead during and after bead motion. We simultaneously image single fluorescent-labeled DNA molecules throughout the network to directly link the microscale stress response to molecular deformations. We characterize the deformation of the network from the molecular-level to the mesoscale, and map the stress propagation throughout the network. We further study the impact of DNA length (11 - 115 kbp) and topology (linear vs ring DNA) on deformation and propagation dynamics, exploring key nonlinear features such as tube dilation and power-law relaxation.

  5. Genomic mapping of single-stranded DNA in hydroxyurea-challenged yeasts identifies origins of replication.

    Science.gov (United States)

    Feng, Wenyi; Collingwood, David; Boeck, Max E; Fox, Lindsay A; Alvino, Gina M; Fangman, Walton L; Raghuraman, Mosur K; Brewer, Bonita J

    2006-02-01

    During DNA replication one or both strands transiently become single stranded: first at the sites where initiation of DNA synthesis occurs (known as origins of replication) and subsequently on the lagging strands of replication forks as discontinuous Okazaki fragments are generated. We report a genome-wide analysis of single-stranded DNA (ssDNA) formation in the presence of hydroxyurea during DNA replication in wild-type and checkpoint-deficient rad53 Saccharomyces cerevisiae cells. In wild-type cells, ssDNA was first observed at a subset of replication origins and later 'migrated' bi-directionally, suggesting that ssDNA formation is associated with continuously moving replication forks. In rad53 cells, ssDNA was observed at virtually every known origin, but remained there over time, suggesting that replication forks stall. Telomeric regions seemed to be particularly sensitive to the loss of Rad53 checkpoint function. Replication origins in Schizosaccharomyces pombe were also mapped using our method.

  6. Rapid disinhibition by adjustment of PV intrinsic excitability during whisker map plasticity in mouse S1.

    Science.gov (United States)

    Gainey, Melanie A; Aman, Joseph W; Feldman, Daniel E

    2018-04-20

    Rapid plasticity of layer (L) 2/3 inhibitory circuits is an early step in sensory cortical map plasticity, but its cellular basis is unclear. We show that, in mice of either sex, 1 day whisker deprivation drives rapid loss of L4-evoked feedforward inhibition and more modest loss of feedforward excitation in L2/3 pyramidal (PYR) cells, increasing E-I conductance ratio. Rapid disinhibition was due to reduced L4-evoked spiking by L2/3 parvalbumin (PV) interneurons, caused by reduced PV intrinsic excitability. This included elevated PV spike threshold, associated with an increase in low-threshold, voltage activated delayed rectifier (presumed Kv1) and A-type potassium currents. Excitatory synaptic input and unitary inhibitory output of PV cells were unaffected. Functionally, the loss of feedforward inhibition and excitation were precisely coordinated in L2/3 PYR cells, so that peak feedforward synaptic depolarization remained stable. Thus, rapid plasticity of PV intrinsic excitability offsets early weakening of excitatory circuits to homeostatically stabilize synaptic potentials in PYR cells of sensory cortex. SIGNIFICANCE STATEMENT Inhibitory circuits in cerebral cortex are highly plastic, but the cellular mechanisms and functional importance of this plasticity are incompletely understood. We show that brief (1-day) sensory deprivation rapidly weakens parvalbumin (PV) inhibitory circuits by reducing the intrinsic excitability of PV neurons. This involved a rapid increase in voltage-gated potassium conductances that control near-threshold spiking excitability. Functionally, the loss of PV-mediated feedforward inhibition in L2/3 pyramidal cells was precisely balanced with the separate loss of feedforward excitation, resulting in a net homeostatic stabilization of synaptic potentials. Thus, rapid plasticity of PV intrinsic excitability implements network-level homeostasis to stabilize synaptic potentials in sensory cortex. Copyright © 2018 the authors.

  7. A novel gold nanoparticle-DNA aptamer-based plasmonic chip for rapid and sensitive detection of bacterial pathogens

    DEFF Research Database (Denmark)

    Sun, Yi; Phuoc Long, Truong; Wolff, Anders

    2016-01-01

    Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers...

  8. Rapid Extraction of Genomic DNA from Medically Important Yeasts and Filamentous Fungi by High-Speed Cell Disruption

    OpenAIRE

    Müller, Frank-Michael C.; Werner, Katherine E.; Kasai, Miki; Francesconi, Andrea; Chanock, Stephen J.; Walsh, Thomas J.

    1998-01-01

    Current methods of DNA extraction from different fungal pathogens are often time-consuming and require the use of toxic chemicals. DNA isolation from some fungal organisms is difficult due to cell walls or capsules that are not readily susceptible to lysis. We therefore investigated a new and rapid DNA isolation method using high-speed cell disruption (HSCD) incorporating chaotropic reagents and lysing matrices in comparison to standard phenol-chloroform (PC) extraction protocols for isolatio...

  9. Phase mapping of iron-based rapidly quenched alloys using precession electron diffraction

    International Nuclear Information System (INIS)

    Svec, P.; Janotova, I.; Hosko, J.; Matko, I.; Janickovic, D.; Svec, P. Sr.; Kepaptsoglou, D. M.

    2013-01-01

    The present contribution is focused on application of PED and phase/orientation mapping of nanocrystals of bcc-Fe formed during the first crystallization stage of amorphous Fe-Co-Si-B ribbon. Using precession electron diffraction and phase/orientation mapping the formation of primary crystalline phase, bcc-Fe, from amorphous Fe-Co-Si-B has been analyzed. Important information about mutual orientation of the phase in individual submicron grains as well as against the sample surface has been obtained. This information contributes to the understanding of micromechanisms controlling crystallization from amorphous rapidly quenched structure and of the structure of the original amorphous state. The presented technique due to its high spatial resolution, speed and information content provided complements well classical techniques, especially in nanocrystalline materials. (authors)

  10. Mapping Submerged Aquatic Vegetation Using RapidEye Satellite Data: The Example of Lake Kummerow (Germany

    Directory of Open Access Journals (Sweden)

    Christine Fritz

    2017-07-01

    Full Text Available Submersed aquatic vegetation (SAV is sensitive to changes in environmental conditions and plays an important role as a long-term indictor for the trophic state of freshwater lakes. Variations in water level height, nutrient condition, light availability and water temperature affect the growth and species composition of SAV. Detailed information about seasonal variations in littoral bottom coverage are still unknown, although these effects are expected to mask climate change-related long-term changes, as derived by snapshots of standard monitoring methods included in the European Water Framework Directive. Remote sensing offers concepts to map SAV quickly, within large areas, and at short intervals. This study analyses the potential of a semi-empirical method to map littoral bottom coverage by a multi-seasonal approach. Depth-invariant indices were calculated for four Atmospheric & Topographic Correction (ATCOR2 atmospheric corrected RapidEye data sets acquired at Lake Kummerow, Germany, between June and August 2015. RapidEye data evaluation was supported by in situ measurements of the diffuse attenuation coefficient of the water column and bottom reflectance. The processing chain was able to differentiate between SAV and sandy sediment. The successive increase of SAV coverage from June to August was correctly monitored. Comparisons with in situ and Google Earth imagery revealed medium accuracies (kappa coefficient = 0.61, overall accuracy = 72.2%. The analysed time series further revealed how water constituents and temporary surface phenomena such as sun glint or algal blooms influence the identification success of lake bottom substrates. An abundant algal bloom biased the interpretability of shallow water substrate such that a differentiation of sediments and SAV patches failed completely. Despite the documented limitations, mapping of SAV using RapidEye seems possible, even in eutrophic lakes.

  11. Maize Cropping Systems Mapping Using RapidEye Observations in Agro-Ecological Landscapes in Kenya.

    Science.gov (United States)

    Richard, Kyalo; Abdel-Rahman, Elfatih M; Subramanian, Sevgan; Nyasani, Johnson O; Thiel, Michael; Jozani, Hosein; Borgemeister, Christian; Landmann, Tobias

    2017-11-03

    Cropping systems information on explicit scales is an important but rarely available variable in many crops modeling routines and of utmost importance for understanding pests and disease propagation mechanisms in agro-ecological landscapes. In this study, high spatial and temporal resolution RapidEye bio-temporal data were utilized within a novel 2-step hierarchical random forest (RF) classification approach to map areas of mono- and mixed maize cropping systems. A small-scale maize farming site in Machakos County, Kenya was used as a study site. Within the study site, field data was collected during the satellite acquisition period on general land use/land cover (LULC) and the two cropping systems. Firstly, non-cropland areas were masked out from other land use/land cover using the LULC mapping result. Subsequently an optimized RF model was applied to the cropland layer to map the two cropping systems (2nd classification step). An overall accuracy of 93% was attained for the LULC classification, while the class accuracies (PA: producer's accuracy and UA: user's accuracy) for the two cropping systems were consistently above 85%. We concluded that explicit mapping of different cropping systems is feasible in complex and highly fragmented agro-ecological landscapes if high resolution and multi-temporal satellite data such as 5 m RapidEye data is employed. Further research is needed on the feasibility of using freely available 10-20 m Sentinel-2 data for wide-area assessment of cropping systems as an important variable in numerous crop productivity models.

  12. Maize Cropping Systems Mapping Using RapidEye Observations in Agro-Ecological Landscapes in Kenya

    Directory of Open Access Journals (Sweden)

    Kyalo Richard

    2017-11-01

    Full Text Available Cropping systems information on explicit scales is an important but rarely available variable in many crops modeling routines and of utmost importance for understanding pests and disease propagation mechanisms in agro-ecological landscapes. In this study, high spatial and temporal resolution RapidEye bio-temporal data were utilized within a novel 2-step hierarchical random forest (RF classification approach to map areas of mono- and mixed maize cropping systems. A small-scale maize farming site in Machakos County, Kenya was used as a study site. Within the study site, field data was collected during the satellite acquisition period on general land use/land cover (LULC and the two cropping systems. Firstly, non-cropland areas were masked out from other land use/land cover using the LULC mapping result. Subsequently an optimized RF model was applied to the cropland layer to map the two cropping systems (2nd classification step. An overall accuracy of 93% was attained for the LULC classification, while the class accuracies (PA: producer’s accuracy and UA: user’s accuracy for the two cropping systems were consistently above 85%. We concluded that explicit mapping of different cropping systems is feasible in complex and highly fragmented agro-ecological landscapes if high resolution and multi-temporal satellite data such as 5 m RapidEye data is employed. Further research is needed on the feasibility of using freely available 10–20 m Sentinel-2 data for wide-area assessment of cropping systems as an important variable in numerous crop productivity models.

  13. DNA adduct profiling of in vitro colonic meat digests to map red vs. white meat genotoxicity.

    Science.gov (United States)

    Hemeryck, Lieselot Y; Rombouts, Caroline; De Paepe, Ellen; Vanhaecke, Lynn

    2018-05-01

    The consumption of red meat has been linked to an increased colorectal cancer (CRC) risk. One of the major hypotheses states that heme iron (present in red meat) stimulates the formation of genotoxic N-nitroso compounds (NOCs) and lipid peroxidation products (LPOs). By means of DNA adductomics, chemically induced DNA adduct formation can be mapped in relation to e.g. dietary exposures. In this study, this state-of-the-art methodology was used to investigate alkylation and (lipid per)oxidation induced DNA adduct formation in in vitro red vs. white meat digests. In doing so, 90 alkylation and (lipid per)oxidation induced DNA adduct types could be (tentatively) identified. Overall, 12 NOC- and/or LPO-related DNA adduct types, i.e. dimethyl-T (or ethyl-T), hydroxymethyl-T, tetramethyl-T, methylguanine (MeG), guanidinohydantoin, hydroxybutyl-C, hydroxymethylhydantoin, malondialdehyde-x3-C, O 6 -carboxymethylguanine, hydroxyethyl-T, carboxyethyl-T and 3,N 4 -etheno-C were singled out as potential heme-rich meat digestion markers. The retrieval of these DNA adduct markers is in support of the heme, NOC and LPO hypotheses, suggesting that DNA adduct formation may indeed contribute to red meat related CRC risk. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. Target-Specific Assay for Rapid and Quantitative Detection of Mycobacterium chimaera DNA.

    Science.gov (United States)

    Zozaya-Valdés, Enrique; Porter, Jessica L; Coventry, John; Fyfe, Janet A M; Carter, Glen P; Gonçalves da Silva, Anders; Schultz, Mark B; Seemann, Torsten; Johnson, Paul D R; Stewardson, Andrew J; Bastian, Ivan; Roberts, Sally A; Howden, Benjamin P; Williamson, Deborah A; Stinear, Timothy P

    2017-06-01

    Mycobacterium chimaera is an opportunistic environmental mycobacterium belonging to the Mycobacterium avium - M. intracellulare complex. Although most commonly associated with pulmonary disease, there has been growing awareness of invasive M. chimaera infections following cardiac surgery. Investigations suggest worldwide spread of a specific M. chimaera clone, associated with contaminated hospital heater-cooler units used during the surgery. Given the global dissemination of this clone, its potential to cause invasive disease, and the laboriousness of current culture-based diagnostic methods, there is a pressing need to develop rapid and accurate diagnostic assays specific for M. chimaera Here, we assessed 354 mycobacterial genome sequences and confirmed that M. chimaera is a phylogenetically coherent group. In silico comparisons indicated six DNA regions present only in M. chimaera We targeted one of these regions and developed a TaqMan quantitative PCR (qPCR) assay for M. chimaera with a detection limit of 100 CFU/ml in whole blood spiked with bacteria. In vitro screening against DNA extracted from 40 other mycobacterial species and 22 bacterial species from 21 diverse genera confirmed the in silico -predicted specificity for M. chimaera Screening 33 water samples from heater-cooler units with this assay highlighted the increased sensitivity of PCR compared to culture, with 15 of 23 culture-negative samples positive by M. chimaera qPCR. We have thus developed a robust molecular assay that can be readily and rapidly deployed to screen clinical and environmental specimens for M. chimaera . Copyright © 2017 American Society for Microbiology.

  15. Rapid detection of microbial DNA by a novel isothermal genome exponential amplification reaction (GEAR) assay.

    Science.gov (United States)

    Prithiviraj, Jothikumar; Hill, Vincent; Jothikumar, Narayanan

    2012-04-20

    In this study we report the development of a simple target-specific isothermal nucleic acid amplification technique, termed genome exponential amplification reaction (GEAR). Escherichia coli was selected as the microbial target to demonstrate the GEAR technique as a proof of concept. The GEAR technique uses a set of four primers; in the present study these primers targeted 5 regions on the 16S rRNA gene of E. coli. The outer forward and reverse Tab primer sequences are complementary to each other at their 5' end, whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The GEAR assay was performed at a constant temperature 60 °C and monitored continuously in a real-time PCR instrument in the presence of an intercalating dye (SYTO 9). The GEAR assay enabled amplification of as few as one colony forming units of E. coli per reaction within 30 min. We also evaluated the GEAR assay for rapid identification of bacterial colonies cultured on agar media directly in the reaction without DNA extraction. Cells from E. coli colonies were picked and added directly to GEAR assay mastermix without prior DNA extraction. DNA in the cells could be amplified, yielding positive results within 15 min. Published by Elsevier Inc.

  16. Mapping of 34 minisatellite loci resolved by two-dimensional DNA typing

    DEFF Research Database (Denmark)

    Børglum, Anders; Nyegaard, Mette; Kvistgaard, AB

    1997-01-01

    Two-dimensional (2-D) DNA typing is based on electrophoretic separation of genomic DNA fragments in two dimensions according to independent criteria (size and base-pair sequence), followed by hybridization analysis using multilocus probes. The technique allows simultaneous visualization of several...... could be deduced, showing no evidence of clustering. In the analysis of spot patterns, use was made of a computerized image analysis system specifically designed for 2-D DNA typing. Since experimental variations between different separation patterns were automatically corrected for with this program......, rapid and reliable scorings could be obtained. The results presented demonstrate the availability of reliable genetic information throughout the 2-D separation pattern. Adding the use of semiautomated computerized pattern analysis, this study further substantiates the applicability of 2-D DNA typing...

  17. A Spectral Mapping Signature for the Rapid Ohia Death (ROD Pathogen in Hawaiian Forests

    Directory of Open Access Journals (Sweden)

    Gregory P. Asner

    2018-03-01

    Full Text Available Pathogenic invasions are a major source of change in both agricultural and natural ecosystems. In forests, fungal pathogens can kill habitat-generating plant species such as canopy trees, but methods for remote detection, mapping and monitoring of such outbreaks are poorly developed. Two novel species of the fungal genus Ceratocystis have spread rapidly across humid and mesic forests of Hawaiʻi Island, causing widespread mortality of the keystone endemic canopy tree species, Metrosideros polymorpha (common name: ʻōhiʻa. The process, known as Rapid Ohia Death (ROD, causes browning of canopy leaves in weeks to months following infection by the pathogen. An operational mapping approach is needed to track the spread of the disease. We combined field studies of leaf spectroscopy with laboratory chemical studies and airborne remote sensing to develop a spectral signature for ROD. We found that close to 80% of ROD-infected plants undergo marked decreases in foliar concentrations of chlorophyll, water and non-structural carbohydrates, which collectively result in strong consistent changes in leaf spectral reflectance in the visible (400–700 nm and shortwave-infrared (1300–2500 nm wavelength regions. Leaf-level results were replicated at the canopy level using airborne laser-guided imaging spectroscopy, with quantitative spectral separability of normal green-leaf canopies from suspected ROD-infected brown-leaf canopies in the visible and shortwave-infrared spectrum. Our results provide the spectral–chemical basis for detection, mapping and monitoring of the spread of ROD in native Hawaiian forests.

  18. Mapping of rDNA on the chromosomes of Eleusine species by fluorescence in situ hybridization.

    Science.gov (United States)

    Bisht, M S; Mukai, Y

    2000-12-01

    Mapping of rDNA sites on the chromosomes of four diploid and two tetraploid species of Eleusine has provided valuable information on genome relationship between the species. Presence of 18S-5.8S-26S rDNA on the largest pair of the chromosomes, location of 5S rDNA at four sites on two pairs of chromosomes and presence of 18S-5.8S-26S and 5S rDNA at same location on one pair of chromosomes have clearly differentiated E. multiflora from rest of the species of Eleusine. The two tetraploid species, E. coracana and E. africana have the same number of 18S-5.8S-26S and 5S rDNA sites and located at similar position on the chromosomes. Diploid species, E. indica, E. floccifolia and E. tristachya have the same 18S-5.8S-26S sites and location on the chromosomes which also resembled with the two pairs of 18S-5.8S-26S rDNA locations in tetraploid species, E. coracana and E. africana. The 5S rDNA sites on chromosomes of E. indica and E. floccifolia were also comparable to the 5S rDNA sites of E. africana and E. coracana. The similarity of the rDNA sites and their location on chromosomes in the three diploid and two polyploid species also supports the view that genome donors to tetraploid species may be from these diploid species.

  19. Mapping of gene transcripts by nuclease protection assays and cDNA primer extension

    International Nuclear Information System (INIS)

    Calzone, F.J.; Britten, R.J.; Davidson, E.J.

    1987-01-01

    An important problem often faced in the molecular characterization of genes is the precise mapping of those genomic sequences transcribed into RNA. This requires identification of the genomic site initiating gene transcription, the location of genomic sequences removed from the primary gene transcript during RNA processing, and knowledge of sequences terminating the processed gene transcript. The objective of the protocols described here is the generation of transcription maps utilizing relatively uncharacterized gene fragments. The basic approach is hybridization of a single-stranded DNA probe with cellular RNA, followed by treatment with a single-strand-specific nuclease that does not attack DNA-RNA hybrids, in order to destroy any unreacted probe sequences. Thus the probe sequences included in the hybrid duplexes are protected from nuclease digestion. The sizes of the protected probe fragments determined by gel electrophoresis correspond to the lengths of the hybridized sequence elements

  20. Rapid Mapping Of Floods Using SAR Data: Opportunities And Critical Aspects

    Science.gov (United States)

    Pulvirenti, Luca; Pierdicca, Nazzareno; Chini, Marco

    2013-04-01

    The potentiality of spaceborne Synthetic Aperture Radar (SAR) for flood mapping was demonstrated by several past investigations. The synoptic view, the capability to operate in almost all-weather conditions and during both day time and night time and the sensitivity of the microwave band to water are the key features that make SAR data useful for monitoring inundation events. In addition, their high spatial resolution, which can reach 1m with the new generation of X-band instruments such as TerraSAR-X and COSMO-SkyMed (CSK), allows emergency managers to use flood maps at very high spatial resolution. CSK gives also the possibility of performing frequent observations of regions hit by floods, thanks to the four-satellite constellation. Current research on flood mapping using SAR is focused on the development of automatic algorithms to be used in near real time applications. The approaches are generally based on the low radar return from smooth open water bodies that behave as specular reflectors and appear dark in SAR images. The major advantage of automatic algorithms is the computational efficiency that makes them suitable for rapid mapping purposes. The choice of the threshold value that, in this kind of algorithms, separates flooded from non-flooded areas is a critical aspect because it depends on the characteristics of the observed scenario and on system parameters. To deal with this aspect an algorithm for automatic detection of the regions of low backscatter has been developed. It basically accomplishes three steps: 1) division of the SAR image in a set of non-overlapping sub-images or splits; 2) selection of inhomogeneous sub-images that contain (at least) two populations of pixels, one of which is formed by dark pixels; 3) the application in sequence of an automatic thresholding algorithm and a region growing algorithm in order to produce a homogeneous map of flooded areas. Besides the aforementioned choice of the threshold, rapid mapping of floods may

  1. BAC-end sequence-based SNPs and Bin mapping for rapid integration of physical and genetic maps in apple.

    Science.gov (United States)

    Han, Yuepeng; Chagné, David; Gasic, Ksenija; Rikkerink, Erik H A; Beever, Jonathan E; Gardiner, Susan E; Korban, Schuyler S

    2009-03-01

    A genome-wide BAC physical map of the apple, Malus x domestica Borkh., has been recently developed. Here, we report on integrating the physical and genetic maps of the apple using a SNP-based approach in conjunction with bin mapping. Briefly, BAC clones located at ends of BAC contigs were selected, and sequenced at both ends. The BAC end sequences (BESs) were used to identify candidate SNPs. Subsequently, these candidate SNPs were genetically mapped using a bin mapping strategy for the purpose of mapping the physical onto the genetic map. Using this approach, 52 (23%) out of 228 BESs tested were successfully exploited to develop SNPs. These SNPs anchored 51 contigs, spanning approximately 37 Mb in cumulative physical length, onto 14 linkage groups. The reliability of the integration of the physical and genetic maps using this SNP-based strategy is described, and the results confirm the feasibility of this approach to construct an integrated physical and genetic maps for apple.

  2. Fine resolution mapping of double-strand break sites for human ribosomal DNA units

    Directory of Open Access Journals (Sweden)

    Bernard J. Pope

    2016-12-01

    Full Text Available DNA breakage arises during a variety of biological processes, including transcription, replication and genome rearrangements. In the context of disease, extensive fragmentation of DNA has been described in cancer cells and during early stages of neurodegeneration (Stephens et al., 2011 Stephens et al. (2011 [5]; Blondet et al., 2001 Blondet et al. (2001 [1]. Stults et al. (2009 Stults et al. (2009 [6] reported that human rDNA gene clusters are hotspots for recombination and that rDNA restructuring is among the most common chromosomal alterations in adult solid tumours. As such, analysis of rDNA regions is likely to have significant prognostic and predictive value, clinically. Tchurikov et al. (2015a, 2016 Tchurikov et al. (2015a, 2016 [7,9] have made major advances in this direction, reporting that sites of human genome double-strand breaks (DSBs occur frequently at sites in rDNA that are tightly linked with active transcription - the authors used a RAFT (rapid amplification of forum termini protocol that selects for blunt-ended sites. They reported the relative frequency of these rDNA DSBs within defined co-ordinate ‘windows’ of varying size and made these data (as well as the relevant ‘raw’ sequencing information available to the public (Tchurikov et al., 2015b. Assay designs targeting rDNA DSB hotspots will benefit greatly from the publication of break sites at greater resolution. Here, we re-analyse public RAFT data and make available rDNA DSB co-ordinates to the single-nucleotide level.

  3. DNA comet assay as a rapid detection method of irradiated bovine meat by electron beam

    International Nuclear Information System (INIS)

    Marin-Huachaca, Nelida Simona; Villavicencio, Anna Lucia C.H.

    2001-01-01

    Full text: Introduction: The presence in food of pathogenic microorganisms, such as Salmonella species, Escherichia coli 0157:H7, Listeria Monocytogenes or Yersinia enterolitica, is a problem of growing concern to public health authorities all over the world. Thus, irradiation of certain prepackaged meat products such as ground beef, minced meat, and hamburgers may help in controlling meatborne pathogens and parasites. Pathogenic microorganisms and parasites in meat products, which are commonly consumed raw, are of particular importance, Up to now, only electron-beam accelerators and gamma-ray cells have been used for commercial applications. At the international conference on 'The Acceptance, Control of, and Trade in Irradiated Food', it was recommended that governments should encourage research into detection methods (Anon, 1989), Already five international standards are available to food control agencies. A number of physical, chemical, and biological techniques of detection of irradiated foods have been discussed in the literature. A rapid and inexpensive screening test employing DNA Comet Assay to identify radiation treatment of food has been described by Cerda et al. (1997). This method is restricted to foods that have not been subjected to heat or other treatments, which also induce DNA fragmentation. Advantages are its simplicity, low cost and speed of measurement. This method was proposed to the European Committee for Standardization (CEN) as a screening protocol (presumptive) and not as a proof (definitive). The DNA comet assay have been yielded good results with chicken, pork, fish meat, exotic meat, hamburgers, fruits and cereals. In this work we studied a DNA fragmentation of bovine meat irradiated by electron beam. Experimental: Bovine meat was purchased in local shops in Sao Paulo. Irradiation was performed with electron beam of accelerator facility of Radiation Dynamics Inc., USA (E=1,5 MeV, l=25 mA). The irradiation doses were 3,5; 4,5, 5,5, and 7

  4. A rapid and efficient branched DNA hybridization assay to titer lentiviral vectors.

    Science.gov (United States)

    Nair, Ayyappan; Xie, Jinger; Joshi, Sarasijam; Harden, Paul; Davies, Joan; Hermiston, Terry

    2008-11-01

    A robust assay to titer lentiviral vectors is imperative to qualifying their use in drug discovery, target validation and clinical applications. In this study, a novel branched DNA based hybridization assay was developed to titer lentiviral vectors by quantifying viral RNA genome copy numbers from viral lysates without having to purify viral RNA, and this approach was compared with other non-functional (p24 protein ELISA and viral RT-qPCR) and a functional method (reporter gene expression) used commonly. The RT-qPCR method requires purification of viral RNA and the accuracy of titration therefore depends on the efficiency of purification; this requirement is ameliorated in the hybridization assay as RNA is measured directly in viral lysates. The present study indicates that the hybridization based titration assay performed on viral lysates was more accurate and has additional advantages of being rapid, robust and not dependent on transduction efficiency in different cell types.

  5. Rapid and low-invasive functional brain mapping by realtime visualization of high gamma activity for awake craniotomy.

    Science.gov (United States)

    Kamada, K; Ogawa, H; Kapeller, C; Prueckl, R; Guger, C

    2014-01-01

    For neurosurgery with an awake craniotomy, the critical issue is to set aside enough time to identify eloquent cortices by electrocortical stimulation (ECS). High gamma activity (HGA) ranging between 80 and 120 Hz on electrocorticogram (ECoG) is assumed to reflect localized cortical processing. In this report, we used realtime HGA mapping and functional magnetic resonance imaging (fMRI) for rapid and reliable identification of motor and language functions. Three patients with intra-axial tumors in their dominant hemisphere underwent preoperative fMRI and lesion resection with an awake craniotomy. All patients showed significant fMRI activation evoked by motor and language tasks. After the craniotomy, we recorded ECoG activity by placing subdural grids directly on the exposed brain surface. Each patient performed motor and language tasks and demonstrated realtime HGA dynamics in hand motor areas and parts of the inferior frontal gyrus. Sensitivity and specificity of HGA mapping were 100% compared to ECS mapping in the frontal lobe, which suggested HGA mapping precisely indicated eloquent cortices. The investigation times of HGA mapping was significantly shorter than that of ECS mapping. Specificities of the motor and language-fMRI, however, did not reach 85%. The results of HGA mapping was mostly consistent with those of ECS mapping, although fMRI tended to overestimate functional areas. This novel technique enables rapid and accurate functional mapping.

  6. Rapid mapping using low-cost structure-from-motion photogrammetry expedites the lahar modeling process

    Science.gov (United States)

    Ratner, Jacqueline; Pyle, David; Mather, Tamsin

    2014-05-01

    Structure-from-motion (SfM) is a branch of photogrammetry that triangulates points in digital photos to produce a 3D model. When applied to topographical modeling, SfM presents a powerful tool for rapid terrain mapping. At little to no cost and on a timescale of hours, a metric-resolution digital terrain model (DTM) can be produced; the resultant DTM can be used for many types of hazard scenario modeling and is here applied to lahars and floods. This study demonstrates the robustness of the SfM method through two case studies. First, an SfM DTM of Boscastle, UK, is compared against LiDAR and SRTM DTMs in a flood simulation model. Resolution is found to be more robust than for satellite based DTMs, and though less precise than the most detailed LiDAR survey, still perfectly adequate for the purposes of modeling flows. Next, the same method is applied to a region of Ecuador lacking the regionally comprehensive LiDAR survey available in the UK. Compared against the only other topographical data available, (SRTM, ASTER, 1956 topographical map), the SfM DTM is shown to have a higher resolution and is a preferable alternative for modeling lahars. The advantages of this study for emergency management are to provide a cheap and rapid metric-resolution alternative to low resolution or costly topography data sets. In regions such as Ecuador where scientific resources are scarce, SfM assists in providing a thorough, but otherwise unattainable, understanding of potential disaster scenarios that is accessible to local authorities to be used in the disaster prevention and mitigation processes.

  7. Operational SAR Data Processing in GIS Environments for Rapid Disaster Mapping

    Science.gov (United States)

    Bahr, Thomas

    2014-05-01

    The use of SAR data has become increasingly popular in recent years and in a wide array of industries. Having access to SAR can be highly important and critical especially for public safety. Updating a GIS with contemporary information from SAR data allows to deliver a reliable set of geospatial information to advance civilian operations, e.g. search and rescue missions. SAR imaging offers the great advantage, over its optical counterparts, of not being affected by darkness, meteorological conditions such as clouds, fog, etc., or smoke and dust, frequently associated with disaster zones. In this paper we present the operational processing of SAR data within a GIS environment for rapid disaster mapping. For this technique we integrated the SARscape modules for ENVI with ArcGIS®, eliminating the need to switch between software packages. Thereby the premier algorithms for SAR image analysis can be directly accessed from ArcGIS desktop and server environments. They allow processing and analyzing SAR data in almost real time and with minimum user interaction. This is exemplified by the November 2010 flash flood in the Veneto region, Italy. The Bacchiglione River burst its banks on Nov. 2nd after two days of heavy rainfall throughout the northern Italian region. The community of Bovolenta, 22 km SSE of Padova, was covered by several meters of water. People were requested to stay in their homes; several roads, highways sections and railroads had to be closed. The extent of this flooding is documented by a series of Cosmo-SkyMed acquisitions with a GSD of 2.5 m (StripMap mode). Cosmo-SkyMed is a constellation of four Earth observation satellites, allowing a very frequent coverage, which enables monitoring using a very high temporal resolution. This data is processed in ArcGIS using a single-sensor, multi-mode, multi-temporal approach consisting of 3 steps: (1) The single images are filtered with a Gamma DE-MAP filter. (2) The filtered images are geocoded using a reference

  8. Rapid Mapping and Deformation Analysis over Cultural Heritage and Rural Sites Based on Persistent Scatterer Interferometry

    Directory of Open Access Journals (Sweden)

    D. Tapete

    2012-01-01

    Full Text Available We propose an easy-to-use procedure of “PSI-based rapid mapping and deformation analysis,” to effectively exploit Persistent Scatterer Interferometry (PSI for multispatial/temporal hazard assessment of cultural heritage and rural sites, update the condition report at the scale of entire site and single building, and address the conservation strategies. Advantages and drawbacks of the methodology are critically discussed based on feasibility tests performed over Pitigliano and Bivigliano, respectively, located in Southern and Northern Tuscany, Italy, and representative of hilltop historic towns and countryside settlements chronically affected by natural hazards. We radar-interpreted ERS-1/2 (1992–2000 and ENVISAT (2003–2010 datasets, already processed, respectively with the Permanent Scatterers (PSs and Persistent Scatterers Pairs (PSPs techniques, and assigned the levels of conservation criticality for both the sites. The PSI analysis allowed the zoning of the most unstable sectors of Pitigliano and showed a good agreement with the most updated hazard assessment of the cliff. The reconstruction of past/recent deformation patterns over Bivigliano confirmed the criticality for the Church of San Romolo, supporting the hypothesis of a correlation with local landslide phenomena, as also perceived from the annual motions observed over the entire site, where several landslide bodies are mapped.

  9. Rapid model building of beta-sheets in electron-density maps.

    Science.gov (United States)

    Terwilliger, Thomas C

    2010-03-01

    A method for rapidly building beta-sheets into electron-density maps is presented. beta-Strands are identified as tubes of high density adjacent to and nearly parallel to other tubes of density. The alignment and direction of each strand are identified from the pattern of high density corresponding to carbonyl and C(beta) atoms along the strand averaged over all repeats present in the strand. The beta-strands obtained are then assembled into a single atomic model of the beta-sheet regions. The method was tested on a set of 42 experimental electron-density maps at resolutions ranging from 1.5 to 3.8 A. The beta-sheet regions were nearly completely built in all but two cases, the exceptions being one structure at 2.5 A resolution in which a third of the residues in beta-sheets were built and a structure at 3.8 A in which under 10% were built. The overall average r.m.s.d. of main-chain atoms in the residues built using this method compared with refined models of the structures was 1.5 A.

  10. THE SLOAN DIGITAL SKY SURVEY REVERBERATION MAPPING PROJECT: RAPID C iv BROAD ABSORPTION LINE VARIABILITY

    International Nuclear Information System (INIS)

    Grier, C. J.; Brandt, W. N.; Trump, J. R.; Schneider, D. P.; Hall, P. B.; Shen, Yue; Vivek, M.; Dawson, K. S.; Ak, N. Filiz; Chen, Yuguang; Denney, K. D.; Kochanek, C. S.; Peterson, B. M.; Green, Paul J.; Jiang, Linhua; McGreer, Ian D.; Pâris, I.; Tao, Charling; Wood-Vasey, W. M.; Bizyaev, Dmitry

    2015-01-01

    We report the discovery of rapid variations of a high-velocity C iv broad absorption line trough in the quasar SDSS J141007.74+541203.3. This object was intensively observed in 2014 as a part of the Sloan Digital Sky Survey Reverberation Mapping Project, during which 32 epochs of spectroscopy were obtained with the Baryon Oscillation Spectroscopic Survey spectrograph. We observe significant (>4σ) variability in the equivalent width (EW) of the broad (∼4000 km s −1 wide) C iv trough on rest-frame timescales as short as 1.20 days (∼29 hr), the shortest broad absorption line variability timescale yet reported. The EW varied by ∼10% on these short timescales, and by about a factor of two over the duration of the campaign. We evaluate several potential causes of the variability, concluding that the most likely cause is a rapid response to changes in the incident ionizing continuum. If the outflow is at a radius where the recombination rate is higher than the ionization rate, the timescale of variability places a lower limit on the density of the absorbing gas of n e ≳ 3.9 × 10 5 cm −3 . The broad absorption line variability characteristics of this quasar are consistent with those observed in previous studies of quasars, indicating that such short-term variability may in fact be common and thus can be used to learn about outflow characteristics and contributions to quasar/host-galaxy feedback scenarios

  11. Rapid identification of the Asian gypsy moth and its related species based on mitochondrial DNA.

    Science.gov (United States)

    Wu, Ying; Du, Qiuyang; Qin, Haiwen; Shi, Juan; Wu, Zhiyi; Shao, Weidong

    2018-02-01

    The gypsy moth- Lymantria dispar (Linnaeus)-is a worldwide forest defoliator and is of two types: the European gypsy moth and the Asian gypsy moth. Because of multiple invasions of the Asian gypsy moth, the North American Plant Protection Organization officially approved Regional Standards for Phytosanitary Measures No. 33. Accordingly, special quarantine measures have been implemented for 30 special focused ports in the epidemic areas of the Asian gypsy moth, including China, which has imposed great inconvenience on export trade. The Asian gypsy moth and its related species (i.e., Lymantria monocha and Lymantria xylina ) intercepted at ports are usually at different life stages, making their identification difficult. Furthermore, Port quarantine requires speedy clearance. As such, it is difficult to identify the Asian gypsy moth and its related species only by their morphological characteristics in a speedy measure. Therefore, this study aimed to use molecular biology technology to rapidly identify the Asian gypsy moth and its related species based on the consistency of mitochondrial DNA in different life stages. We designed 10 pairs of specific primers from different fragments of the Asian gypsy moth and its related species, and their detection sensitivity met the need for rapid identification. In addition, we determined the optimal polymerase chain reaction amplification temperature of the 10 pairs of specific primers, including three pairs of specific primers for the Asian gypsy moth ( L. dispar asiatic ), four pairs of specific primers for the nun moth ( L. monocha ), and three pairs of specific primers for the casuarina moth ( L. xylina ). In conclusion, using our designed primers, direct rapid identification of the Asian gypsy moth and its related species is possible, and this advancement can help improve export trade in China.

  12. Doppler-Zeeman Mapping of the Rapidly Rotating Magnetic CP Star HD37776

    Science.gov (United States)

    Khokhlova, V. L.; Vasilchenko, D. V.; Stepanov, V. V.; Romanyuk, I. I.

    2000-03-01

    We present the results of our analysis of magnetic-field configuration and abundance anomalies on the surface of the rapidly rotating, chemically peculiar helium-strong variable B2 V star HD37776 with unresolved Zeeman components of spectral lines. Simultaneous inversion of the observed Stokes I and V profiles, which realizes the method of Doppler-Zeeman mapping (Vasilchenko et al. 1996), has been applied for the first time. Spectroscopic observations were carried out with the Main stellar spectrograph of the 6-m Special Astrophysical Observatory telescope equipped with a Zeeman analyzer and a CCD array, which allowed spectra in right- and left-hand circularly polarized light to be taken simultaneously at a signal-to-noise ratio S/N > 200 (Romanyuk et al. 1999). The profile width of winged spectral lines (reaching 5 A) is determined by Zeeman line splitting; however, the observed Zeeman components are blurred and unresolved because of the rapid stellar rotation. When solving the inverse problem, we sought for the magnetic-field configuration in the form of a combination of arbitrarily oriented dipole, quadrupole, and octupole placed at the stellar center. The observed Stokes I and V profiles for eight spectral lines of He, OII, AlIII, SiIII, and FeIII averaged over the visible stellar surface were used as input data. We constructed a model of the magnetic field from the condition of coincidence of magnetic maps obtained from different lines of different chemical elements and from the condition of a minimum profile residual. This model is a combination of centered coaxial dipole and quadrupole with the dominant quadrupole component at 30 deg < i < 50 deg, beta = 40 deg, and a maximum surface field strength H_s = 60 kG. A comparison of our abundance maps with the field configuration shows that the He concentration is at a maximum in the regions of maximum radial field, while the maximum concentrations of O, Al, Si, and Fe coincide with the regions of maximum

  13. Back to basics: an evaluation of NaOH and alternative rapid DNA extraction protocols for DNA barcoding, genotyping, and disease diagnostics from fungal and oomycete samples.

    Science.gov (United States)

    Osmundson, Todd W; Eyre, Catherine A; Hayden, Katherine M; Dhillon, Jaskirn; Garbelotto, Matteo M

    2013-01-01

    The ubiquity, high diversity and often-cryptic manifestations of fungi and oomycetes frequently necessitate molecular tools for detecting and identifying them in the environment. In applications including DNA barcoding, pathogen detection from plant samples, and genotyping for population genetics and epidemiology, rapid and dependable DNA extraction methods scalable from one to hundreds of samples are desirable. We evaluated several rapid extraction methods (NaOH, Rapid one-step extraction (ROSE), Chelex 100, proteinase K) for their ability to obtain DNA of quantity and quality suitable for the following applications: PCR amplification of the multicopy barcoding locus ITS1/5.8S/ITS2 from various fungal cultures and sporocarps; single-copy microsatellite amplification from cultures of the phytopathogenic oomycete Phytophthora ramorum; probe-based P. ramorum detection from leaves. Several methods were effective for most of the applications, with NaOH extraction favored in terms of success rate, cost, speed and simplicity. Frozen dilutions of ROSE and NaOH extracts maintained PCR viability for over 32 months. DNA from rapid extractions performed poorly compared to CTAB/phenol-chloroform extracts for TaqMan diagnostics from tanoak leaves, suggesting that incomplete removal of PCR inhibitors is an issue for sensitive diagnostic procedures, especially from plants with recalcitrant leaf chemistry. NaOH extracts exhibited lower yield and size than CTAB/phenol-chloroform extracts; however, NaOH extraction facilitated obtaining clean sequence data from sporocarps contaminated by other fungi, perhaps due to dilution resulting from low DNA yield. We conclude that conventional extractions are often unnecessary for routine DNA sequencing or genotyping of fungi and oomycetes, and recommend simpler strategies where source materials and intended applications warrant such use. © 2012 Blackwell Publishing Ltd.

  14. Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

    DEFF Research Database (Denmark)

    Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads

    2017-01-01

    Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so...

  15. Mapping DNA damage-dependent genetic interactions in yeast via party mating and barcode fusion genetics.

    Science.gov (United States)

    Díaz-Mejía, J Javier; Celaj, Albi; Mellor, Joseph C; Coté, Atina; Balint, Attila; Ho, Brandon; Bansal, Pritpal; Shaeri, Fatemeh; Gebbia, Marinella; Weile, Jochen; Verby, Marta; Karkhanina, Anna; Zhang, YiFan; Wong, Cassandra; Rich, Justin; Prendergast, D'Arcy; Gupta, Gaurav; Öztürk, Sedide; Durocher, Daniel; Brown, Grant W; Roth, Frederick P

    2018-05-28

    Condition-dependent genetic interactions can reveal functional relationships between genes that are not evident under standard culture conditions. State-of-the-art yeast genetic interaction mapping, which relies on robotic manipulation of arrays of double-mutant strains, does not scale readily to multi-condition studies. Here, we describe barcode fusion genetics to map genetic interactions (BFG-GI), by which double-mutant strains generated via en masse "party" mating can also be monitored en masse for growth to detect genetic interactions. By using site-specific recombination to fuse two DNA barcodes, each representing a specific gene deletion, BFG-GI enables multiplexed quantitative tracking of double mutants via next-generation sequencing. We applied BFG-GI to a matrix of DNA repair genes under nine different conditions, including methyl methanesulfonate (MMS), 4-nitroquinoline 1-oxide (4NQO), bleomycin, zeocin, and three other DNA-damaging environments. BFG-GI recapitulated known genetic interactions and yielded new condition-dependent genetic interactions. We validated and further explored a subnetwork of condition-dependent genetic interactions involving MAG1 , SLX4, and genes encoding the Shu complex, and inferred that loss of the Shu complex leads to an increase in the activation of the checkpoint protein kinase Rad53. © 2018 The Authors. Published under the terms of the CC BY 4.0 license.

  16. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations.

    Science.gov (United States)

    You, David J; Yoon, Jeong-Yeol

    2012-09-04

    A computer numerical control (CNC) apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using "wire-guided" method (a pipette tip was used in this study). This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate). Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction). The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability), in rapid succession (using droplets), and with a high level of

  17. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations

    Directory of Open Access Journals (Sweden)

    You David J

    2012-09-01

    Full Text Available Abstract A computer numerical control (CNC apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using “wire-guided” method (a pipette tip was used in this study. This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate. Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction. The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability, in rapid succession (using droplets

  18. Rapid extraction of genomic DNA from medically important yeasts and filamentous fungi by high-speed cell disruption.

    Science.gov (United States)

    Müller, F M; Werner, K E; Kasai, M; Francesconi, A; Chanock, S J; Walsh, T J

    1998-06-01

    Current methods of DNA extraction from different fungal pathogens are often time-consuming and require the use of toxic chemicals. DNA isolation from some fungal organisms is difficult due to cell walls or capsules that are not readily susceptible to lysis. We therefore investigated a new and rapid DNA isolation method using high-speed cell disruption (HSCD) incorporating chaotropic reagents and lysing matrices in comparison to standard phenol-chloroform (PC) extraction protocols for isolation of DNA from three medically important yeasts (Candida albicans, Cryptococcus neoformans, and Trichosporon beigelii) and two filamentous fungi (Aspergillus fumigatus and Fusarium solani). Additional extractions by HSCD were performed on Saccharomyces cerevisiae, Pseudallescheria boydii, and Rhizopus arrhizus. Two different inocula (10(8) and 10(7) CFU) were compared for optimization of obtained yields. The entire extraction procedure was performed on as many as 12 samples within 1 h compared to 6 h for PC extraction. In comparison to the PC procedure, HSCD DNA extraction demonstrated significantly greater yields for 10(8) CFU of C. albicans, T. beigelii, A. fumigatus, and F. solani (P extraction and PC extraction. For 10(7) CFU of T. beigelii, PC extraction resulted in a greater yield than did HSCD (P fungi than for yeasts by the HSCD extraction procedure (P extraction procedure, differences were not significant. For all eight organisms, the rapid extraction procedure resulted in good yield, integrity, and quality of DNA as demonstrated by restriction fragment length polymorphism, PCR, and random amplified polymorphic DNA. We conclude that mechanical disruption of fungal cells by HSCD is a safe, rapid, and efficient procedure for extracting genomic DNA from medically important yeasts and especially from filamentous fungi.

  19. DNA microarray unravels rapid changes in transcriptome of MK-801 treated rat brain

    Science.gov (United States)

    Kobayashi, Yuka; Kulikova, Sofya P; Shibato, Junko; Rakwal, Randeep; Satoh, Hiroyuki; Pinault, Didier; Masuo, Yoshinori

    2015-01-01

    AIM: To investigate the impact of MK-801 on gene expression patterns genome wide in rat brain regions. METHODS: Rats were treated with an intraperitoneal injection of MK-801 [0.08 (low-dose) and 0.16 (high-dose) mg/kg] or NaCl (vehicle control). In a first series of experiment, the frontoparietal electrocorticogram was recorded 15 min before and 60 min after injection. In a second series of experiments, the whole brain of each animal was rapidly removed at 40 min post-injection, and different regions were separated: amygdala, cerebral cortex, hippocampus, hypothalamus, midbrain and ventral striatum on ice followed by DNA microarray (4 × 44 K whole rat genome chip) analysis. RESULTS: Spectral analysis revealed that a single systemic injection of MK-801 significantly and selectively augmented the power of baseline gamma frequency (30-80 Hz) oscillations in the frontoparietal electroencephalogram. DNA microarray analysis showed the largest number (up- and down- regulations) of gene expressions in the cerebral cortex (378), midbrain (376), hippocampus (375), ventral striatum (353), amygdala (301), and hypothalamus (201) under low-dose (0.08 mg/kg) of MK-801. Under high-dose (0.16 mg/kg), ventral striatum (811) showed the largest number of gene expression changes. Gene expression changes were functionally categorized to reveal expression of genes and function varies with each brain region. CONCLUSION: Acute MK-801 treatment increases synchrony of baseline gamma oscillations, and causes very early changes in gene expressions in six individual rat brain regions, a first report. PMID:26629322

  20. Mapping vaccinia virus DNA replication origins at nucleotide level by deep sequencing.

    Science.gov (United States)

    Senkevich, Tatiana G; Bruno, Daniel; Martens, Craig; Porcella, Stephen F; Wolf, Yuri I; Moss, Bernard

    2015-09-01

    Poxviruses reproduce in the host cytoplasm and encode most or all of the enzymes and factors needed for expression and synthesis of their double-stranded DNA genomes. Nevertheless, the mode of poxvirus DNA replication and the nature and location of the replication origins remain unknown. A current but unsubstantiated model posits only leading strand synthesis starting at a nick near one covalently closed end of the genome and continuing around the other end to generate a concatemer that is subsequently resolved into unit genomes. The existence of specific origins has been questioned because any plasmid can replicate in cells infected by vaccinia virus (VACV), the prototype poxvirus. We applied directional deep sequencing of short single-stranded DNA fragments enriched for RNA-primed nascent strands isolated from the cytoplasm of VACV-infected cells to pinpoint replication origins. The origins were identified as the switching points of the fragment directions, which correspond to the transition from continuous to discontinuous DNA synthesis. Origins containing a prominent initiation point mapped to a sequence within the hairpin loop at one end of the VACV genome and to the same sequence within the concatemeric junction of replication intermediates. These findings support a model for poxvirus genome replication that involves leading and lagging strand synthesis and is consistent with the requirements for primase and ligase activities as well as earlier electron microscopic and biochemical studies implicating a replication origin at the end of the VACV genome.

  1. Rapid colorimetric assay for detection of Listeria monocytogenes in food samples using LAMP formation of DNA concatemers and gold nanoparticle-DNA probe complex

    Science.gov (United States)

    Wachiralurpan, Sirirat; Sriyapai, Thayat; Areekit, Supatra; Sriyapai, Pichapak; Augkarawaritsawong, Suphitcha; Santiwatanakul, Somchai; Chansiri, Kosum

    2018-04-01

    ABSTRACT Listeria monocytogenes is a major foodborne pathogen of global health concern. Herein, the rapid diagnosis of L. monocytogenes has been achieved using loop-mediated isothermal amplification (LAMP) based on the phosphatidylcholine-phospholipase C gene (plcB). Colorimetric detection was then performed through the formation of DNA concatemers and a gold nanoparticle/DNA probe complex (GNP/DNA probe). The overall detection process was accomplished within approximately 1 h with no need for complicated equipment. The limits of detection for L. monocytogenes in the forms of purified genomic DNA and pure culture were 800 fg and 2.82 CFU mL-1, respectively. No cross reactions were observed from closely related bacteria species. The LAMP-GNP/DNA probe assay was applied to the detection of 200 raw chicken meat samples and compared to routine standard methods. The data revealed that the specificity, sensitivity and accuracy were 100%, 90.20% and 97.50%, respectively. The present assay was 100% in conformity with LAMP-agarose gel electrophoresis assay. Five samples that were negative by both assays appeared to have the pathogen at below the level of detection. The assay can be applied as a rapid direct screening method for L. monocytogenes.

  2. COMPARATIVE EVALUATION OF CONVENTIONAL VERSUS RAPID METHODS FOR AMPLIFIABLE GENOMIC DNA ISOLATION OF CULTURED Azospirillum sp. JG3

    Directory of Open Access Journals (Sweden)

    Stalis Norma Ethica

    2013-12-01

    Full Text Available As an initial attempt to reveal genetic information of Azospirillum sp. JG3 strain, which is still absence despite of the strains' ability in producing valued enzymes, two groups of conventional methods: lysis-enzyme and column-kit; and two rapid methods: thermal disruption and intact colony were evaluated. The aim is to determine the most practical method for obtaining high-grade PCR product using degenerate primers as part of routine-basis protocols for studying the molecular genetics of the Azospirillal bacteria. The evaluation includes the assessment of electrophoresis gel visualization, pellet appearance, preparation time, and PCR result of extracted genomic DNA from each method. Our results confirmed that the conventional methods were more superior to the rapid methods in generating genomic DNA isolates visible on electrophoresis gel. However, modification made in the previously developed DNA isolation protocol giving the simplest and most rapid method of all methods used in this study for extracting PCR-amplifiable DNA of Azospirillum sp. JG3. Intact bacterial cells (intact colony loaded on electrophoresis gel could present genomic DNA band, but could not be completely amplified by PCR without thermal treatment. It can also be inferred from our result that the 3 to 5-min heating in dH2O step is critical for the pre-treatment of colony PCR of Azospirillal cells.

  3. Rapid mapping of ultrafine fault zone topography with structure from motion

    Science.gov (United States)

    Johnson, Kendra; Nissen, Edwin; Saripalli, Srikanth; Arrowsmith, J. Ramón; McGarey, Patrick; Scharer, Katherine M.; Williams, Patrick; Blisniuk, Kimberly

    2014-01-01

    Structure from Motion (SfM) generates high-resolution topography and coregistered texture (color) from an unstructured set of overlapping photographs taken from varying viewpoints, overcoming many of the cost, time, and logistical limitations of Light Detection and Ranging (LiDAR) and other topographic surveying methods. This paper provides the first investigation of SfM as a tool for mapping fault zone topography in areas of sparse or low-lying vegetation. First, we present a simple, affordable SfM workflow, based on an unmanned helium balloon or motorized glider, an inexpensive camera, and semiautomated software. Second, we illustrate the system at two sites on southern California faults covered by existing airborne or terrestrial LiDAR, enabling a comparative assessment of SfM topography resolution and precision. At the first site, an ∼0.1 km2 alluvial fan on the San Andreas fault, a colored point cloud of density mostly >700 points/m2 and a 3 cm digital elevation model (DEM) and orthophoto were produced from 233 photos collected ∼50 m above ground level. When a few global positioning system ground control points are incorporated, closest point vertical distances to the much sparser (∼4 points/m2) airborne LiDAR point cloud are mostly 530 points/m2 and a 2 cm DEM and orthophoto were produced from 450 photos taken from ∼60 m above ground level. Closest point vertical distances to existing terrestrial LiDAR data of comparable density are mostly geomorphic offsets related to past earthquakes as well as rapid response mapping or long-term monitoring of faulted landscapes.

  4. Facile and rapid DNA extraction and purification from food matrices using IFAST (immiscible filtration assisted by surface tension).

    Science.gov (United States)

    Strotman, Lindsay N; Lin, Guangyun; Berry, Scott M; Johnson, Eric A; Beebe, David J

    2012-09-07

    Extraction and purification of DNA is a prerequisite to detection and analytical techniques. While DNA sample preparation methods have improved over the last few decades, current methods are still time consuming and labor intensive. Here we demonstrate a technology termed IFAST (Immiscible Filtration Assisted by Surface Tension), that relies on immiscible phase filtration to reduce the time and effort required to purify DNA. IFAST replaces the multiple wash and centrifugation steps required by traditional DNA sample preparation methods with a single step. To operate, DNA from lysed cells is bound to paramagnetic particles (PMPs) and drawn through an immiscible fluid phase barrier (i.e. oil) by an external handheld magnet. Purified DNA is then eluted from the PMPs. Here, detection of Clostridium botulinum type A (BoNT/A) in food matrices (milk, orange juice), a bioterrorism concern, was used as a model system to establish IFAST's utility in detection assays. Data validated that the DNA purified by IFAST was functional as a qPCR template to amplify the bont/A gene. The sensitivity limit of IFAST was comparable to the commercially available Invitrogen ChargeSwitch® method. Notably, pathogen detection via IFAST required only 8.5 μL of sample and was accomplished in five-fold less time. The simplicity, rapidity and portability of IFAST offer significant advantages when compared to existing DNA sample preparation methods.

  5. Development of rapid methods for relaxation time mapping and motion estimation using magnetic resonance imaging

    Energy Technology Data Exchange (ETDEWEB)

    Gilani, Syed Irtiza Ali

    2008-09-15

    Recent technological developments in the field of magnetic resonance imaging have resulted in advanced techniques that can reduce the total time to acquire images. For applications such as relaxation time mapping, which enables improved visualisation of in vivo structures, rapid imaging techniques are highly desirable. TAPIR is a Look- Locker-based sequence for high-resolution, multislice T{sub 1} relaxation time mapping. Despite the high accuracy and precision of TAPIR, an improvement in the k-space sampling trajectory is desired to acquire data in clinically acceptable times. In this thesis, a new trajectory, termed line-sharing, is introduced for TAPIR that can potentially reduce the acquisition time by 40 %. Additionally, the line-sharing method was compared with the GRAPPA parallel imaging method. These methods were employed to reconstruct time-point images from the data acquired on a 4T high-field MR research scanner. Multislice, multipoint in vivo results obtained using these methods are presented. Despite improvement in acquisition speed, through line-sharing, for example, motion remains a problem and artefact-free data cannot always be obtained. Therefore, in this thesis, a rapid technique is introduced to estimate in-plane motion. The presented technique is based on calculating the in-plane motion parameters, i.e., translation and rotation, by registering the low-resolution MR images. The rotation estimation method is based on the pseudo-polar FFT, where the Fourier domain is composed of frequencies that reside in an oversampled set of non-angularly, equispaced points. The essence of the method is that unlike other Fourier-based registration schemes, the employed approach does not require any interpolation to calculate the pseudo-polar FFT grid coordinates. Translation parameters are estimated by the phase correlation method. However, instead of two-dimensional analysis of the phase correlation matrix, a low complexity subspace identification of the phase

  6. Development of rapid methods for relaxation time mapping and motion estimation using magnetic resonance imaging

    International Nuclear Information System (INIS)

    Gilani, Syed Irtiza Ali

    2008-09-01

    Recent technological developments in the field of magnetic resonance imaging have resulted in advanced techniques that can reduce the total time to acquire images. For applications such as relaxation time mapping, which enables improved visualisation of in vivo structures, rapid imaging techniques are highly desirable. TAPIR is a Look- Locker-based sequence for high-resolution, multislice T 1 relaxation time mapping. Despite the high accuracy and precision of TAPIR, an improvement in the k-space sampling trajectory is desired to acquire data in clinically acceptable times. In this thesis, a new trajectory, termed line-sharing, is introduced for TAPIR that can potentially reduce the acquisition time by 40 %. Additionally, the line-sharing method was compared with the GRAPPA parallel imaging method. These methods were employed to reconstruct time-point images from the data acquired on a 4T high-field MR research scanner. Multislice, multipoint in vivo results obtained using these methods are presented. Despite improvement in acquisition speed, through line-sharing, for example, motion remains a problem and artefact-free data cannot always be obtained. Therefore, in this thesis, a rapid technique is introduced to estimate in-plane motion. The presented technique is based on calculating the in-plane motion parameters, i.e., translation and rotation, by registering the low-resolution MR images. The rotation estimation method is based on the pseudo-polar FFT, where the Fourier domain is composed of frequencies that reside in an oversampled set of non-angularly, equispaced points. The essence of the method is that unlike other Fourier-based registration schemes, the employed approach does not require any interpolation to calculate the pseudo-polar FFT grid coordinates. Translation parameters are estimated by the phase correlation method. However, instead of two-dimensional analysis of the phase correlation matrix, a low complexity subspace identification of the phase

  7. THE SLOAN DIGITAL SKY SURVEY REVERBERATION MAPPING PROJECT: RAPID C iv BROAD ABSORPTION LINE VARIABILITY

    Energy Technology Data Exchange (ETDEWEB)

    Grier, C. J.; Brandt, W. N.; Trump, J. R.; Schneider, D. P. [Department of Astronomy and Astrophysics and Institute for Gravitation and the Cosmos, The Pennsylvania State University, 525 Davey Laboratory, University Park, PA 16802 (United States); Hall, P. B. [Department of Physics and Astronomy, York University, Toronto, ON M3J 1P3 (Canada); Shen, Yue [Carnegie Observatories, 813 Santa Barbara Street, Pasadena, CA 91101 (United States); Vivek, M.; Dawson, K. S. [Department of Physics and Astronomy, University of Utah, Salt Lake City, UT 84112 (United States); Ak, N. Filiz [Faculty of Sciences, Department of Astronomy and Space Sciences, Erciyes University, 38039 Kayseri (Turkey); Chen, Yuguang [Department of Astronomy, School of Physics, Peking University, Beijing 100871 (China); Denney, K. D.; Kochanek, C. S.; Peterson, B. M. [Department of Astronomy, The Ohio State University, 140 West 18th Avenue, Columbus, OH 43210 (United States); Green, Paul J. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Jiang, Linhua [Kavli Institute for Astronomy and Astrophysics, Peking University, Beijing 100871 (China); McGreer, Ian D. [Steward Observatory, The University of Arizona, 933 North Cherry Avenue, Tucson, AZ 85721-0065 (United States); Pâris, I. [INAF-Osservatorio Astronomico di Trieste, Via G. B. Tiepolo 11, I-34131 Trieste (Italy); Tao, Charling [Centre de Physique des Particules de Marseille, Aix-Marseille Universite, CNRS /IN2P3, 163, avenue de Luminy, Case 902, F-13288 Marseille Cedex 09 (France); Wood-Vasey, W. M. [PITT PACC, Department of Physics and Astronomy, University of Pittsburgh, 3941 O’Hara Street, Pittsburgh, PA 15260 (United States); Bizyaev, Dmitry, E-mail: grier@psu.edu [Apache Point Observatory and New Mexico State University, P.O. Box 59, Sunspot, NM, 88349-0059 (United States); and others

    2015-06-10

    We report the discovery of rapid variations of a high-velocity C iv broad absorption line trough in the quasar SDSS J141007.74+541203.3. This object was intensively observed in 2014 as a part of the Sloan Digital Sky Survey Reverberation Mapping Project, during which 32 epochs of spectroscopy were obtained with the Baryon Oscillation Spectroscopic Survey spectrograph. We observe significant (>4σ) variability in the equivalent width (EW) of the broad (∼4000 km s{sup −1} wide) C iv trough on rest-frame timescales as short as 1.20 days (∼29 hr), the shortest broad absorption line variability timescale yet reported. The EW varied by ∼10% on these short timescales, and by about a factor of two over the duration of the campaign. We evaluate several potential causes of the variability, concluding that the most likely cause is a rapid response to changes in the incident ionizing continuum. If the outflow is at a radius where the recombination rate is higher than the ionization rate, the timescale of variability places a lower limit on the density of the absorbing gas of n{sub e} ≳ 3.9 × 10{sup 5} cm{sup −3}. The broad absorption line variability characteristics of this quasar are consistent with those observed in previous studies of quasars, indicating that such short-term variability may in fact be common and thus can be used to learn about outflow characteristics and contributions to quasar/host-galaxy feedback scenarios.

  8. All-in-one nanowire-decorated multifunctional membrane for rapid cell lysis and direct DNA isolation.

    KAUST Repository

    So, Hongyun

    2014-11-24

    This paper describes a handheld device that uses an all-in-one membrane for continuous mechanical cell lysis and rapid DNA isolation without the assistance of power sources, lysis reagents, and routine centrifugation. This nanowire-decorated multifunctional membrane was fabricated to isolate DNA by selective adsorption to silica surface immediately after disruption of nucleus membranes by ultrasharp tips of nanowires for a rapid cell lysis, and it can be directly assembled with commercial syringe filter holders. The membrane was fabricated by photoelectrochemical etching to create microchannel arrays followed by hydrothermal synthesis of nanowires and deposition of silica. The proposed membrane successfully purifies high-quality DNA within 5 min, whereas a commercial purification kit needs more than an hour.

  9. All-in-one nanowire-decorated multifunctional membrane for rapid cell lysis and direct DNA isolation.

    KAUST Repository

    So, Hongyun; Lee, Kunwoo; Murthy, Niren; Pisano, Albert P

    2014-01-01

    This paper describes a handheld device that uses an all-in-one membrane for continuous mechanical cell lysis and rapid DNA isolation without the assistance of power sources, lysis reagents, and routine centrifugation. This nanowire-decorated multifunctional membrane was fabricated to isolate DNA by selective adsorption to silica surface immediately after disruption of nucleus membranes by ultrasharp tips of nanowires for a rapid cell lysis, and it can be directly assembled with commercial syringe filter holders. The membrane was fabricated by photoelectrochemical etching to create microchannel arrays followed by hydrothermal synthesis of nanowires and deposition of silica. The proposed membrane successfully purifies high-quality DNA within 5 min, whereas a commercial purification kit needs more than an hour.

  10. Collaborative, Rapid Mapping of Water Extents During Hurricane Harvey Using Optical and Radar Satellite Sensors

    Science.gov (United States)

    Muench, R.; Jones, M.; Herndon, K. E.; Bell, J. R.; Anderson, E. R.; Markert, K. N.; Molthan, A.; Adams, E. C.; Shultz, L.; Cherrington, E. A.; Flores, A.; Lucey, R.; Munroe, T.; Layne, G.; Pulla, S. T.; Weigel, A. M.; Tondapu, G.

    2017-12-01

    On August 25, 2017, Hurricane Harvey made landfall between Port Aransas and Port O'Connor, Texas, bringing with it unprecedented amounts of rainfall and flooding. In times of natural disasters of this nature, emergency responders require timely and accurate information about the hazard in order to assess and plan for disaster response. Due to the extreme flooding impacts associated with Hurricane Harvey, delineations of water extent were crucial to inform resource deployment. Through the USGS's Hazards Data Distribution System, government and commercial vendors were able to acquire and distribute various satellite imagery to analysts to create value-added products that can be used by these emergency responders. Rapid-response water extent maps were created through a collaborative multi-organization and multi-sensor approach. One team of researchers created Synthetic Aperture Radar (SAR) water extent maps using modified Copernicus Sentinel data (2017), processed by ESA. This group used backscatter images, pre-processed by the Alaska Satellite Facility's Hybrid Pluggable Processing Pipeline (HyP3), to identify and apply a threshold to identify water in the image. Quality control was conducted by manually examining the image and correcting for potential errors. Another group of researchers and graduate student volunteers derived water masks from high resolution DigitalGlobe and SPOT images. Through a system of standardized image processing, quality control measures, and communication channels the team provided timely and fairly accurate water extent maps to support a larger NASA Disasters Program response. The optical imagery was processed through a combination of various band thresholds by using Normalized Difference Water Index (NDWI), Modified Normalized Water Index (MNDWI), Normalized Difference Vegetation Index (NDVI), and cloud masking. Several aspects of the pre-processing and image access were run on internal servers to expedite the provision of images to

  11. Collaborative, Rapid Mapping of Water Extents During Hurricane Harvey Using Optical and Radar Satellite Sensors

    Science.gov (United States)

    Muench, Rebekke; Jones, Madeline; Herndon, Kelsey; Schultz, Lori; Bell, Jordan; Anderson, Eric; Markert, Kel; Molthan, Andrew; Adams, Emily; Cherrington, Emil; hide

    2017-01-01

    On August 25, 2017, Hurricane Harvey made landfall between Port Aransas and Port O'Connor, Texas, bringing with it unprecedented amounts of rainfall and record flooding. In times of natural disasters of this nature, emergency responders require timely and accurate information about the hazard in order to assess and plan for disaster response. Due to the extreme flooding impacts associated with Hurricane Harvey, delineations of water extent were crucial to inform resource deployment. Through the USGS's Hazards Data Distribution System, government and commercial vendors were able to acquire and distribute various satellite imagery to analysts to create value-added products that can be used by these emergency responders. Rapid-response water extent maps were created through a collaborative multi-organization and multi-sensor approach. One team of researchers created Synthetic Aperture Radar (SAR) water extent maps using modified Copernicus Sentinel data (2017), processed by ESA. This group used backscatter images, pre-processed by the Alaska Satellite Facility's Hybrid Pluggable Processing Pipeline (HyP3), to identify and apply a threshold to identify water in the image. Quality control was conducted by manually examining the image and correcting for potential errors. Another group of researchers and graduate student volunteers derived water masks from high resolution DigitalGlobe and SPOT images. Through a system of standardized image processing, quality control measures, and communication channels the team provided timely and fairly accurate water extent maps to support a larger NASA Disasters Program response. The optical imagery was processed through a combination of various band thresholds and by using Normalized Difference Water Index (NDWI), Modified Normalized Water Index (MNDWI), Normalized Difference Vegetation Index (NDVI), and cloud masking. Several aspects of the pre-processing and image access were run on internal servers to expedite the provision of

  12. Rapid micro-scale proteolysis of proteins for MALDI-MS peptide mapping using immobilized trypsin

    Science.gov (United States)

    Gobom, Johan; Nordhoff, Eckhard; Ekman, Rolf; Roepstorff, Peter

    1997-12-01

    In this study we present a rapid method for tryptic digestion of proteins using micro-columns with enzyme immobilized on perfusion chromatography media. The performance of the method is exemplified with acyl-CoA-binding protein and reduced carbamidomethylated bovine serum albumin. The method proved to be significantly faster and yielded a better sequence coverage and an improved signal-to-noise ratio for the MALDI-MS peptide maps, compared to in-solution- and on-target digestion. Only a single sample transfer step is required, and therefore sample loss due to adsorption to surfaces is reduced, which is a critical issue when handling low picomole to femtomole amounts of proteins. An example is shown with on-column proteolytic digestion and subsequent elution of the digest into a reversed-phase micro-column. This is useful if the sample contains large amounts of salt or is too diluted for MALDI-MS analysis. Furthermore, by step-wise elution from the reversedphase column, a complex digest can be fractionated, which reduces signal suppression and facilitates data interpretation in the subsequent MS-analysis. The method also proved useful for consecutive digestions with enzymes of different cleavage specificity. This is exemplified with on-column tryptic digestion, followed by reversed-phase step-wise elution, and subsequent on-target V8 protease digestion.

  13. Mapping and quantifying sediment transfer between the front of rapidly moving rock glaciers and torrential gullies

    Science.gov (United States)

    Kummert, Mario; Delaloye, Reynald

    2018-05-01

    The sedimentary connection which may occur between the front of active rock glaciers and torrential channels is not well understood, despite its potential impact on the torrential activity characterizing the concerned catchments. In this study, DEMs of difference (DoDs) covering various time intervals between 2013 and 2016 were obtained from LiDAR-derived multitemporal DEMs for three rapidly moving rock glaciers located in the western Swiss Alps. The DoDs were used to map and quantify sediment transfer activity between the front of these rock glaciers and the corresponding underlying torrential gullies. Sediment transfer rates ranging between 1500 m3/y and 7800 m3/y have been calculated, depending on the sites. Sediment eroded from the fronts generally accumulated in the upper sectors of the torrential gullies where they were occasionally mobilized within small to medium sized debris flow events. A clear relation between the motion rates of the rock glaciers and the sediment transfer rates calculated at their fronts could be highlighted. Along with the size of the frontal areas, rock glacier creep rates influence thus directly sediment availability in the headwaters of the studied torrents. The frequency-magnitude of debris flow events varied between sites and was mainly related to the concordance of local factors such as topography, water availability, sediment availability or sediment type.

  14. Imaging metals in proteins by combining electrophoresis with rapid x-ray fluorescence mapping

    International Nuclear Information System (INIS)

    Finney, L.; Chishti, Y.; Khare, T.; Giometti, C.; Levina, A.; Lay, P.A.; Vogt, S.

    2010-01-01

    Growing evidence points toward a very dynamic role for metals in biology. This suggests that physiological circumstance may mandate metal ion redistribution among ligands. This work addresses a critical need for technology that detects, identifies, and measures the metal-containing components of complex biological matrixes. We describe a direct, user-friendly approach for identifying and quantifying metal?protein adducts in complex samples using native- or SDS-PAGE, blotting, and rapid synchrotron X-ray fluorescence mapping with micro-XANES (X-ray absorption near-edge structure) of entire blots. The identification and quantification of each metal bound to a protein spot has been demonstrated, and the technique has been applied in two exemplary cases. In the first, the speciation of the in vitro binding of exogenous chromium to blood serum proteins was influenced markedly by both the oxidation state of chromium exposed to the serum proteins and the treatment conditions, which is of relevance to the biochemistry of Cr dietary supplements. In the second case, in vivo changes in endogenous metal speciation were examined to probe the influence of oxygen depletion on iron speciation in Shewanella oneidensis.

  15. Environmental science applications with Rapid Integrated Mapping and analysis System (RIMS)

    Science.gov (United States)

    Shiklomanov, A.; Prusevich, A.; Gordov, E.; Okladnikov, I.; Titov, A.

    2016-11-01

    The Rapid Integrated Mapping and analysis System (RIMS) has been developed at the University of New Hampshire as an online instrument for multidisciplinary data visualization, analysis and manipulation with a focus on hydrological applications. Recently it was enriched with data and tools to allow more sophisticated analysis of interdisciplinary data. Three different examples of specific scientific applications with RIMS are demonstrated and discussed. Analysis of historical changes in major components of the Eurasian pan-Arctic water budget is based on historical discharge data, gridded observational meteorological fields, and remote sensing data for sea ice area. Express analysis of the extremely hot and dry summer of 2010 across European Russia is performed using a combination of near-real time and historical data to evaluate the intensity and spatial distribution of this event and its socioeconomic impacts. Integrative analysis of hydrological, water management, and population data for Central Asia over the last 30 years provides an assessment of regional water security due to changes in climate, water use and demography. The presented case studies demonstrate the capabilities of RIMS as a powerful instrument for hydrological and coupled human-natural systems research.

  16. Minimal methylation classifier (MIMIC): A novel method for derivation and rapid diagnostic detection of disease-associated DNA methylation signatures.

    Science.gov (United States)

    Schwalbe, E C; Hicks, D; Rafiee, G; Bashton, M; Gohlke, H; Enshaei, A; Potluri, S; Matthiesen, J; Mather, M; Taleongpong, P; Chaston, R; Silmon, A; Curtis, A; Lindsey, J C; Crosier, S; Smith, A J; Goschzik, T; Doz, F; Rutkowski, S; Lannering, B; Pietsch, T; Bailey, S; Williamson, D; Clifford, S C

    2017-10-18

    Rapid and reliable detection of disease-associated DNA methylation patterns has major potential to advance molecular diagnostics and underpin research investigations. We describe the development and validation of minimal methylation classifier (MIMIC), combining CpG signature design from genome-wide datasets, multiplex-PCR and detection by single-base extension and MALDI-TOF mass spectrometry, in a novel method to assess multi-locus DNA methylation profiles within routine clinically-applicable assays. We illustrate the application of MIMIC to successfully identify the methylation-dependent diagnostic molecular subgroups of medulloblastoma (the most common malignant childhood brain tumour), using scant/low-quality samples remaining from the most recently completed pan-European medulloblastoma clinical trial, refractory to analysis by conventional genome-wide DNA methylation analysis. Using this approach, we identify critical DNA methylation patterns from previously inaccessible cohorts, and reveal novel survival differences between the medulloblastoma disease subgroups with significant potential for clinical exploitation.

  17. 3' RNA ligase mediated rapid amplification of cDNA ends for validating viroid induced cleavage at the 3' extremity of the host mRNA.

    Science.gov (United States)

    Adkar-Purushothama, Charith Raj; Bru, Pierrick; Perreault, Jean-Pierre

    2017-12-01

    5' RNA ligase-mediated rapid amplification of cDNA ends (5' RLM-RACE) is a widely-accepted method for the validation of direct cleavage of a target gene by a microRNA (miRNA) and viroid-derived small RNA (vd-sRNA). However, this method cannot be used if cleavage takes place in the 3' extremity of the target RNA, as this gives insufficient sequence length to design nested PCR primers for 5' RLM RACE. To overcome this hurdle, we have developed 3' RNA ligase-mediated rapid amplification of cDNA ends (3' RLM RACE). In this method, an oligonucleotide adapter having 5' adenylated and 3' blocked is ligated to the 3' end of the cleaved RNA followed by PCR amplification using gene specific primers. In other words, in 3' RLM RACE, 3' end is mapped using 5' fragment instead of small 3' fragment. The method developed here was verified by examining the bioinformatics predicted and parallel analysis of RNA ends (PARE) proved cleavage sites of chloride channel protein CLC-b-like mRNA in Potato spindle tuber viroid infected tomato plants. The 3' RLM RACE developed in this study has the potential to validate the miRNA and vd-sRNA mediated cleavage of mRNAs at its 3' untranslated region (3' UTR). Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Rapid Topographic Mapping Using TLS and UAV in a Beach-dune-wetland Environment: Case Study in Freeport, Texas, USA

    Science.gov (United States)

    Ding, J.; Wang, G.; Xiong, L.; Zhou, X.; England, E.

    2017-12-01

    Coastal regions are naturally vulnerable to impact from long-term coastal erosion and episodic coastal hazards caused by extreme weather events. Major geomorphic changes can occur within a few hours during storms. Prediction of storm impact, costal planning and resilience observation after natural events all require accurate and up-to-date topographic maps of coastal morphology. Thus, the ability to conduct rapid and high-resolution-high-accuracy topographic mapping is of critical importance for long-term coastal management and rapid response after natural hazard events. Terrestrial laser scanning (TLS) techniques have been frequently applied to beach and dune erosion studies and post hazard responses. However, TLS surveying is relatively slow and costly for rapid surveying. Furthermore, TLS surveying unavoidably retains gray areas that cannot be reached by laser pulses, particularly in wetland areas where lack of direct access in most cases. Aerial mapping using photogrammetry from images taken by unmanned aerial vehicles (UAV) has become a new technique for rapid topographic mapping. UAV photogrammetry mapping techniques provide the ability to map coastal features quickly, safely, inexpensively, on short notice and with minimal impact. The primary products from photogrammetry are point clouds similar to the LiDAR point clouds. However, a large number of ground control points (ground truth) are essential for obtaining high-accuracy UAV maps. The ground control points are often obtained by GPS survey simultaneously with the TLS survey in the field. The GPS survey could be a slow and arduous process in the field. This study aims to develop methods for acquiring a huge number of ground control points from TLS survey and validating point clouds obtained from photogrammetry with the TLS point clouds. A Rigel VZ-2000 TLS scanner was used for developing laser point clouds and a DJI Phantom 4 Pro UAV was used for acquiring images. The aerial images were processed with the

  19. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    user

    2011-02-21

    Feb 21, 2011 ... Available online at http://www.academicjournals.org/AJB ... α-casein, produces PCR ready DNA at a fraction of the cost of commercial DNA extraction kits. Key words: DNA .... This experiment was performed to evaluate the efficiency of the ..... Zoetendal EG, Ben-Amor K, Akkermans AD, Abee T, De Vos WM.

  20. Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction

    Science.gov (United States)

    Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka

    2005-01-01

    AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152

  1. Cloning and comparative mapping of a human chromosome 4-specific alpha satellite DNA sequence

    Energy Technology Data Exchange (ETDEWEB)

    D' Aiuto, L.; Marzella, R.; Archidiacono, N.; Rocchi, M. (Universita di Bari (Italy)); Antonacci, R. (Instituto Anatomia Umana Normale, Modena (Italy))

    1993-11-01

    The authors have isolated and characterized two human alphoid DNA clones: p4n1/4 and pZ4.1. Clone p4n1/4 identifies specifically the centromeric region of chromosome 4; pZ4.1 recognizes a subset of alphoid DNA shared by chromosomes 4 and 9. The specificity was determined using fluorescence in situ hybridization experiments on metaphase spreads and Southern blotting analysis of human-hamster somatic cell hybrids. The genomic organization of both subsets was also investigated. Comparative mapping on chimpanzee and gorilla chromosomes was performed. p4n1/4 hybridizes to chimpanzee chromosomes 11 and 13, homologs of human chromosomes 9 and 2q, respectively. On gorilla metaphase spreads, p4n1/4 hybridizes exclusively to the centromeric region of chromosome 19, partially homologous to human chromosome 17. No hybridization signal was detected on chromosome 3 of both chimpanzee and gorilla, in both species homolog of human chromosome 4. Identical comparative mapping results were obtained using pZ4.1 probe, although the latter recognizes an alphoid subset distinct from the one recognized by p4n1/4. The implications of these results in the evolution of centromeric regions of primate chromosomes are discussed. 33 refs., 4 figs.

  2. Rectangular coordination polymer nanoplates: large-scale, rapid synthesis and their application as a fluorescent sensing platform for DNA detection.

    Directory of Open Access Journals (Sweden)

    Yingwei Zhang

    Full Text Available In this paper, we report on the large-scale, rapid synthesis of uniform rectangular coordination polymer nanoplates (RCPNs assembled from Cu(II and 4,4'-bipyridine for the first time. We further demonstrate that such RCPNs can be used as a very effective fluorescent sensing platform for multiple DNA detection with a detection limit as low as 30 pM and a high selectivity down to single-base mismatch. The DNA detection is accomplished by the following two steps: (1 RCPN binds dye-labeled single-stranded DNA (ssDNA probe, which brings dye and RCPN into close proximity, leading to fluorescence quenching; (2 Specific hybridization of the probe with its target generates a double-stranded DNA (dsDNA which detaches from RCPN, leading to fluorescence recovery. It suggests that this sensing system can well discriminate complementary and mismatched DNA sequences. The exact mechanism of fluorescence quenching involved is elucidated experimentally and its use in a human blood serum system is also demonstrated successfully.

  3. Rapid purification of circular DNA by triplex-mediated affinity capture

    Science.gov (United States)

    Ji, H.; Smith, L.M.

    1997-01-07

    A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.

  4. Combination of methylated-DNA precipitation and methylation-sensitive restriction enzymes (COMPARE-MS) for the rapid, sensitive and quantitative detection of DNA methylation.

    Science.gov (United States)

    Yegnasubramanian, Srinivasan; Lin, Xiaohui; Haffner, Michael C; DeMarzo, Angelo M; Nelson, William G

    2006-02-09

    Hypermethylation of CpG island (CGI) sequences is a nearly universal somatic genome alteration in cancer. Rapid and sensitive detection of DNA hypermethylation would aid in cancer diagnosis and risk stratification. We present a novel technique, called COMPARE-MS, that can rapidly and quantitatively detect CGI hypermethylation with high sensitivity and specificity in hundreds of samples simultaneously. To quantitate CGI hypermethylation, COMPARE-MS uses real-time PCR of DNA that was first digested by methylation-sensitive restriction enzymes and then precipitated by methyl-binding domain polypeptides immobilized on a magnetic solid matrix. We show that COMPARE-MS could detect five genome equivalents of methylated CGIs in a 1000- to 10,000-fold excess of unmethylated DNA. COMPARE-MS was used to rapidly quantitate hypermethylation at multiple CGIs in >155 prostate tissues, including benign and malignant prostate specimens, and prostate cell lines. This analysis showed that GSTP1, MDR1 and PTGS2 CGI hypermethylation as determined by COMPARE-MS could differentiate between malignant and benign prostate with sensitivities >95% and specificities approaching 100%. This novel technology could significantly improve our ability to detect CGI hypermethylation.

  5. Mapping DNA methylation by transverse current sequencing: Reduction of noise from neighboring nucleotides

    Science.gov (United States)

    Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian

    Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.

  6. Using rapid diagnostic tests as source of malaria parasite DNA for molecular analyses in the era of declining malaria prevalence

    DEFF Research Database (Denmark)

    Ishengoma, Deus S; Lwitiho, Sudi; Madebe, Rashid A

    2011-01-01

    was conducted to examine if sufficient DNA could be successfully extracted from malaria rapid diagnostic tests (RDTs), used and collected as part of routine case management services in health facilities, and thus forming the basis for molecular analyses, surveillance and quality control (QC) testing of RDTs....... continued molecular surveillance of malaria parasites is important to early identify emerging anti-malarial drug resistance, it is becoming increasingly difficult to obtain parasite samples from ongoing studies, such as routine drug efficacy trials. To explore other sources of parasite DNA, this study...

  7. Rapid and minimum invasive functional brain mapping by real-time visualization of high gamma activity during awake craniotomy.

    Science.gov (United States)

    Ogawa, Hiroshi; Kamada, Kyousuke; Kapeller, Christoph; Hiroshima, Satoru; Prueckl, Robert; Guger, Christoph

    2014-11-01

    Electrocortical stimulation (ECS) is the gold standard for functional brain mapping during an awake craniotomy. The critical issue is to set aside enough time to identify eloquent cortices by ECS. High gamma activity (HGA) ranging between 80 and 120 Hz on electrocorticogram is assumed to reflect localized cortical processing. In this report, we used real-time HGA mapping and functional neuronavigation integrated with functional magnetic resonance imaging (fMRI) for rapid and reliable identification of motor and language functions. Four patients with intra-axial tumors in their dominant hemisphere underwent preoperative fMRI and lesion resection with an awake craniotomy. All patients showed significant fMRI activation evoked by motor and language tasks. During the craniotomy, we recorded electrocorticogram activity by placing subdural grids directly on the exposed brain surface. Each patient performed motor and language tasks and demonstrated real-time HGA dynamics in hand motor areas and parts of the inferior frontal gyrus. Sensitivity and specificity of HGA mapping were 100% compared with ECS mapping in the frontal lobe, which suggested HGA mapping precisely indicated eloquent cortices. We found different HGA dynamics of language tasks in frontal and temporal regions. Specificities of the motor and language-fMRI did not reach 85%. The results of HGA mapping was mostly consistent with those of ECS mapping, although fMRI tended to overestimate functional areas. This novel technique enables rapid and accurate identification of motor and frontal language areas. Furthermore, real-time HGA mapping sheds light on underlying physiological mechanisms related to human brain functions. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. SeqAnt: A web service to rapidly identify and annotate DNA sequence variations

    Directory of Open Access Journals (Sweden)

    Patel Viren

    2010-09-01

    Full Text Available Abstract Background The enormous throughput and low cost of second-generation sequencing platforms now allow research and clinical geneticists to routinely perform single experiments that identify tens of thousands to millions of variant sites. Existing methods to annotate variant sites using information from publicly available databases via web browsers are too slow to be useful for the large sequencing datasets being routinely generated by geneticists. Because sequence annotation of variant sites is required before functional characterization can proceed, the lack of a high-throughput pipeline to efficiently annotate variant sites can act as a significant bottleneck in genetics research. Results SeqAnt (Sequence Annotator is an open source web service and software package that rapidly annotates DNA sequence variants and identifies recessive or compound heterozygous loci in human, mouse, fly, and worm genome sequencing experiments. Variants are characterized with respect to their functional type, frequency, and evolutionary conservation. Annotated variants can be viewed on a web browser, downloaded in a tab-delimited text file, or directly uploaded in a BED format to the UCSC genome browser. To demonstrate the speed of SeqAnt, we annotated a series of publicly available datasets that ranged in size from 37 to 3,439,107 variant sites. The total time to completely annotate these data completely ranged from 0.17 seconds to 28 minutes 49.8 seconds. Conclusion SeqAnt is an open source web service and software package that overcomes a critical bottleneck facing research and clinical geneticists using second-generation sequencing platforms. SeqAnt will prove especially useful for those investigators who lack dedicated bioinformatics personnel or infrastructure in their laboratories.

  9. Spatiotemporal reconstruction of the Aquilegia rapid radiation through next-generation sequencing of rapidly evolving cpDNA regions.

    Science.gov (United States)

    Fior, Simone; Li, Mingai; Oxelman, Bengt; Viola, Roberto; Hodges, Scott A; Ometto, Lino; Varotto, Claudio

    2013-04-01

    Aquilegia is a well-known model system in the field of evolutionary biology, but obtaining a resolved and well-supported phylogenetic reconstruction for the genus has been hindered by its recent and rapid diversification. Here, we applied 454 next-generation sequencing to PCR amplicons of 21 of the most rapidly evolving regions of the plastome to generate c. 24 kb of sequences from each of 84 individuals from throughout the genus. The resulting phylogeny has well-supported resolution of the main lineages of the genus, although recent diversification such as in the European taxa remains unresolved. By producing a chronogram of the whole Ranunculaceae family based on published data, we inferred calibration points for dating the Aquilegia radiation. The genus originated in the upper Miocene c. 6.9 million yr ago (Ma) in Eastern Asia, and diversification occurred c. 4.8 Ma with the split of two main clades, one colonizing North America, and the other Western Eurasia through the mountains of Central Asia. This was followed by a back-to-Asia migration, originating from the European stock using a North Asian route. These results provide the first backbone phylogeny and spatiotemporal reconstruction of the Aquilegia radiation, and constitute a robust framework to address the adaptative nature of speciation within the group. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

  10. Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

    DEFF Research Database (Denmark)

    Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads

    2017-01-01

    Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so......-megabase- to megabase-sized DNA molecules were recovered from the gel and analysed by denaturation-renaturation optical mapping. Size-selected molecules from the same gel were sequenced by NGS. The optically mapped molecules and the NGS reads showed enrichment from regions defined by NotI restriction sites. We...... demonstrate that the unannotated genome can be characterized in a locus-specific manner via molecules partially overlapping with the annotated genome. The method is a promising tool for investigation of structural variants in enriched human genomic regions for both research and diagnostic purposes. Our...

  11. Oxidants and not alkylating agents induce rapid mtDNA loss and mitochondrial dysfunction

    Science.gov (United States)

    Furda, Amy M.; Marrangoni, Adele M.; Lokshin, Anna; Van Houten, Bennett

    2013-01-01

    Mitochondrial DNA (mtDNA) is essential for proper mitochondrial function and encodes 22 tRNAs, 2 rRNAs and 13 polypeptides that make up subunits of complex I, III, IV, in the electron transport chain and complex V, the ATP synthase. Although mitochondrial dysfunction has been implicated in processes such as premature aging, neurodegeneration, and cancer, it has not been shown whether persistent mtDNA damage causes a loss of oxidative phosphorylation. We addressed this question by treating mouse embryonic fibroblasts with either hydrogen peroxide (H2O2) or the alkylating agent methyl methanesulfonate (MMS) and measuring several endpoints, including mtDNA damage and repair rates using QPCR, levels of mitochondrial- and nuclear-encoded proteins using antibody analysis, and a pharmacologic profile of mitochondria using the Seahorse Extracellular Flux Analyzer. We show that a 60 min treatment with H2O2 causes persistent mtDNA lesions, mtDNA loss, decreased levels of a nuclear-encoded mitochondrial subunit, a loss of ATP-linked oxidative phosphorylation and a loss of total reserve capacity. Conversely, a 60 min treatment with 2 mM MMS causes persistent mtDNA lesions but no mtDNA loss, no decrease in levels of a nuclear-encoded mitochondrial subunit, and no mitochondrial dysfunction. These results suggest that persistent mtDNA damage is not sufficient to cause mitochondrial dysfunction. PMID:22766155

  12. A Fluorescent Tile DNA Diagnocode System for In Situ Rapid and Selective Diagnosis of Cytosolic RNA Cancer Markers

    Science.gov (United States)

    Park, Kyung Soo; Shin, Seung Won; Jang, Min Su; Shin, Woojung; Yang, Kisuk; Min, Junhong; Cho, Seung-Woo; Oh, Byung-Keun; Bae, Jong Wook; Jung, Sunghwan; Choi, Jeong-Woo; Um, Soong Ho

    2015-01-01

    Accurate cancer diagnosis often requires extraction and purification of genetic materials from cells, and sophisticated instrumentations that follow. Otherwise in order to directly treat the diagnostic materials to cells, multiple steps to optimize dose concentration and treatment time are necessary due to diversity in cellular behaviors. These processes may offer high precision but hinder fast analysis of cancer, especially in clinical situations that need rapid detection and characterization of cancer. Here we present a novel fluorescent tile DNA nanostructure delivered to cancer cytosol by employing nanoparticle technology. Its structural anisotropicity offers easy manipulation for multifunctionalities, enabling the novel DNA nanostructure to detect intracellular cancer RNA markers with high specificity within 30 minutes post treatment, while the nanoparticle property bypasses the requirement of treatment optimization, effectively reducing the complexity of applying the system for cancer diagnosis. Altogether, the system offers a precise and rapid detection of cancer, suggesting the future use in the clinical fields. PMID:26678430

  13. A RAPID DNA EXTRACTION METHOD FOR PCR IDENTIFICATION OF FUNGAL INDOOR AIR CONTAMINANTS

    Science.gov (United States)

    Following air sampling, fungal DNA needs to be extracted and purified to a state suitable for laboratory use. Our laboratory has developed a simple method of extraction and purification of fungal DNA appropriate for enzymatic manipulation and polymerase chain reaction (PCR) appli...

  14. Single-step rapid assembly of DNA origami nanostructures for addressable nanoscale bioreactors

    DEFF Research Database (Denmark)

    Fu, Yanming; Zeng, Dongdong; Chao, Jie

    2013-01-01

    nm resolution and at the single-molecule level. We attach a pair of enzymes (horseradish peroxidase and glucose oxidase) at the inner side of DNA nanotubes and observe high coupling efficiency of enzyme cascade within this confined nanospace. Hence, DNA nanostructures with such unprecedented...

  15. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    The price of commercial DNA extraction methods makes the routine use of polymerase chain reaction amplification (PCR) based methods rather costly for scientists in developing countries. A guanidium thiocayante-based DNA extraction method was investigated in this study for the isolation of Escherichia coli (E. coli) DNA ...

  16. Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami

    Science.gov (United States)

    Chikkaraddy, Rohit; Turek, V. A.; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F.; Baumberg, Jeremy J.

    2018-01-01

    Fabricating nanocavities in which optically-active single quantum emitters are precisely positioned, is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore, and obtain enhancements of $\\geq4\\times10^3$ with high quantum yield ($\\geq50$%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of $\\pm1.5$ nm. Our approach introduces a straightforward non-invasive way to measure and quantify confined optical modes on the nanoscale.

  17. Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami.

    Science.gov (United States)

    Chikkaraddy, Rohit; Turek, V A; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F; Baumberg, Jeremy J

    2018-01-10

    Fabricating nanocavities in which optically active single quantum emitters are precisely positioned is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5 nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore and obtain enhancements of ≥4 × 10 3 with high quantum yield (≥50%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of ±1.5 nm. Our approach introduces a straightforward noninvasive way to measure and quantify confined optical modes on the nanoscale.

  18. Preservation and rapid purification of DNA from decomposing human tissue samples.

    Science.gov (United States)

    Sorensen, Amy; Rahman, Elizabeth; Canela, Cassandra; Gangitano, David; Hughes-Stamm, Sheree

    2016-11-01

    One of the key features to be considered in a mass disaster is victim identification. However, the recovery and identification of human remains are sometimes complicated by harsh environmental conditions, limited facilities, loss of electricity and lack of refrigeration. If human remains cannot be collected, stored, or identified immediately, bodies decompose and DNA degrades making genotyping more difficult and ultimately decreasing DNA profiling success. In order to prevent further DNA damage and degradation after collection, tissue preservatives may be used. The goal of this study was to evaluate three customized (modified TENT, DESS, LST) and two commercial DNA preservatives (RNAlater and DNAgard ® ) on fresh and decomposed human skin and muscle samples stored in hot (35°C) and humid (60-70% relative humidity) conditions for up to three months. Skin and muscle samples were harvested from the thigh of three human cadavers placed outdoors for up to two weeks. In addition, the possibility of purifying DNA directly from the preservative solutions ("free DNA") was investigated in order to eliminate lengthy tissue digestion processes and increase throughput. The efficiency of each preservative was evaluated based on the quantity of DNA recovered from both the "free DNA" in solution and the tissue sample itself in conjunction with the quality and completeness of downstream STR profiles. As expected, DNA quantity and STR success decreased with time of decomposition. However, a marked decrease in DNA quantity and STR quality was observed in all samples after the bodies entered the bloat stage (approximately six days of decomposition in this study). Similar amounts of DNA were retrieved from skin and muscle samples over time, but slightly more complete STR profiles were obtained from muscle tissue. Although higher amounts of DNA were recovered from tissue samples than from the surrounding preservative, the average number of reportable alleles from the "free DNA" was

  19. Rapid and efficient extraction of genomic DNA from different phytopathogenic fungi using DNAzol reagent.

    Science.gov (United States)

    Guo, Jian-Rong; Schnieder, F; Abd-Elsalam, K A; Verreet, J A

    2005-01-01

    A modified procedure using the commercial DNAzol reagent was successfully applied to extract genomic DNA from 25 fungal species. The DNA yield varied from 306 to 1,927 microg g(-1) dry mycelia and the A(260)/A(280) ratio from 1.59 to 1.93. Compared with the method of J.L. Cenis (Nucleic Acids Res. 1992, 20: 2380) this procedure generated a higher DNA yield from 17 species and a higher A(260)/A(280) ratio from 23 species. But for four species, Cenis (1992) method was more suitable. No inhibitor of polymerase chain reaction was evident for the DNA extracted by the modified procedure, whereas some inhibitors remained in DNA of eight species extracted by the previous method.

  20. Rapid and efficient protocol for DNA extraction and molecular identification of the basidiomycete Crinipellis perniciosa.

    Science.gov (United States)

    Melo, S C O; Pungartnik, C; Cascardo, J C M; Brendel, M

    2006-12-14

    DNA isolation from some fungal organisms is difficult because they have cell walls or capsules that are relatively unsusceptible to lysis. Beginning with a yeast Saccharomyces cerevisiae genomic DNA isolation method, we developed a 30-min DNA isolation protocol for filamentous fungi by combining cell wall digestion with cell disruption by glass beads. High-quality DNA was isolated with good yield from the hyphae of Crinipellis perniciosa, which causes witches' broom disease in cacao, from three other filamentous fungi, Lentinus edodes, Agaricus blazei, Trichoderma stromaticum, and from the yeast S. cerevisiae. Genomic DNA was suitable for PCR of specific actin primers of C. perniciosa, allowing it to be differentiated from fungal contaminants, including its natural competitor, T. stromaticum.

  1. Empirical evaluation of selective DNA pooling to map QTL in dairy cattle using a half-sib design by comparison to individual genotyping and interval mapping

    Directory of Open Access Journals (Sweden)

    Robinson Nicholas

    2007-04-01

    Full Text Available Abstract This study represents the first attempt at an empirical evaluation of the DNA pooling methodology by comparing it to individual genotyping and interval mapping to detect QTL in a dairy half-sib design. The findings indicated that the use of peak heights from the pool electropherograms without correction for stutter (shadow product and preferential amplification performed as well as corrected estimates of frequencies. However, errors were found to decrease the power of the experiment at every stage of the pooling and analysis. The main sources of errors include technical errors from DNA quantification, pool construction, inconsistent differential amplification, and from the prevalence of sire alleles in the dams. Additionally, interval mapping using individual genotyping gains information from phenotypic differences between individuals in the same pool and from neighbouring markers, which is lost in a DNA pooling design. These errors cause some differences between the markers detected as significant by pooling and those found significant by interval mapping based on individual selective genotyping. Therefore, it is recommended that pooled genotyping only be used as part of an initial screen with significant results to be confirmed by individual genotyping. Strategies for improving the efficiency of the DNA pooling design are also presented.

  2. Rapid whole brain myelin water content mapping without an external water standard at 1.5T.

    Science.gov (United States)

    Nguyen, Thanh D; Spincemaille, Pascal; Gauthier, Susan A; Wang, Yi

    2017-06-01

    The objective of this study is to develop rapid whole brain mapping of myelin water content (MWC) at 1.5T. The Fast Acquisition with Spiral Trajectory and T2prep (FAST-T2) pulse sequence originally developed for myelin water fraction (MWF) mapping was modified to obtain fast mapping of T1 and receiver coil sensitivity needed for MWC computation. The accuracy of the proposed T1 mapping was evaluated by comparing with the standard IR-FSE method. Numerical simulations were performed to assess the accuracy and reliability of the proposed MWC mapping. We also compared MWC values obtained with either cerebrospinal fluid (CSF) or an external water tube attached to the subject's head as the water reference. Our results from healthy volunteers show that whole brain MWC mapping is feasible in 7min and provides accurate brain T1 values. Regional brain WC and MWC measurements obtained with the internal CSF-based water standard showed excellent correlation (R>0.99) and negligible bias within narrow limits of agreement compared to those obtained with an external water standard. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Rapid diagnostic tests as a source of DNA for Plasmodium species-specific real-time PCR

    Directory of Open Access Journals (Sweden)

    Van Esbroeck Marjan

    2011-03-01

    Full Text Available Abstract Background This study describes the use of malaria rapid diagnostic tests (RDTs as a source of DNA for Plasmodium species-specific real-time PCR. Methods First, the best method to recover DNA from RDTs was investigated and then the applicability of this DNA extraction method was assessed on 12 different RDT brands. Finally, two RDT brands (OptiMAL Rapid Malaria Test and SDFK60 malaria Ag Plasmodium falciparum/Pan test were comprehensively evaluated on a panel of clinical samples submitted for routine malaria diagnosis at ITM. DNA amplification was done with the 18S rRNA real-time PCR targeting the four Plasmodium species. Results of PCR on RDT were compared to those obtained by PCR on whole blood samples. Results Best results were obtained by isolating DNA from the proximal part of the nitrocellulose component of the RDT strip with a simple DNA elution method. The PCR on RDT showed a detection limit of 0.02 asexual parasites/μl, which was identical to the same PCR on whole blood. For all 12 RDT brands tested, DNA was detected except for one brand when a low parasite density sample was applied. In RDTs with a plastic seal covering the nitrocellulose strip, DNA extraction was hampered. PCR analysis on clinical RDT samples demonstrated correct identification for single species infections for all RDT samples with asexual parasites of P. falciparum (n = 60, Plasmodium vivax (n = 10, Plasmodium ovale (n = 10 and Plasmodium malariae (n = 10. Samples with only gametocytes were detected in all OptiMAL and in 10 of the 11 SDFK60 tests. None of the negative samples (n = 20 gave a signal by PCR on RDT. With PCR on RDT, higher Ct-values were observed than with PCR on whole blood, with a mean difference of 2.68 for OptiMAL and 3.53 for SDFK60. Mixed infections were correctly identified with PCR on RDT in 4/5 OptiMAL tests and 2/5 SDFK60 tests. Conclusions RDTs are a reliable source of DNA for Plasmodium real-time PCR. This study demonstrates the

  4. ‘‘Blind'' mapping of genic DNA sequence polymorphisms in Lolium perenne L. by high resolution melting curve analysis

    DEFF Research Database (Denmark)

    Studer, Bruno; Jensen, Louise Bach; Fiil, Alice

    2009-01-01

    High resolution melting curve analysis (HRM) measures dissociation of double stranded DNA of a PCR product amplified in the presence of a saturating fluorescence dye. Recently, HRM proved successful to genotype DNA sequence polymorphisms such as SSRs and SNPs based on the shape of the melting...... curves. In this study, HRM was used for simultaneous screening and genotyping of genic DNA sequence polymorphisms identified in the Lolium perenne F2 mapping population VrnA. Melting profiles of PCR products amplified from previously published gene loci and from a novel gene putatively involved...

  5. SalanderMaps: A rapid overview about felt earthquakes through data mining of web-accesses

    Science.gov (United States)

    Kradolfer, Urs

    2013-04-01

    While seismological observatories detect and locate earthquakes based on measurements of the ground motion, they neither know a priori whether an earthquake has been felt by the public nor is it known, where it has been felt. Such information is usually gathered by evaluating feedback reported by the public through on-line forms on the web. However, after a felt earthquake in Switzerland, many people visit the webpages of the Swiss Seismological Service (SED) at the ETH Zurich and each such visit leaves traces in the logfiles on our web-servers. Data mining techniques, applied to these logfiles and mining publicly available data bases on the internet open possibilities to obtain previously unknown information about our virtual visitors. In order to provide precise information to authorities and the media, it would be desirable to rapidly know from which locations these web-accesses origin. The method 'Salander' (Seismic Activitiy Linked to Area codes - Nimble Detection of Earthquake Rumbles) will be introduced and it will be explained, how the IP-addresses (each computer or router directly connected to the internet has a unique IP-address; an example would be 129.132.53.5) of a sufficient amount of our virtual visitors were linked to their geographical area. This allows us to unprecedentedly quickly know whether and where an earthquake was felt in Switzerland. It will also be explained, why the method Salander is superior to commercial so-called geolocation products. The corresponding products of the Salander method, animated SalanderMaps, which are routinely generated after each earthquake with a magnitude of M>2 in Switzerland (http://www.seismo.ethz.ch/prod/salandermaps/, available after March 2013), demonstrate how the wavefield of earthquakes propagates through Switzerland and where it was felt. Often, such information is available within less than 60 seconds after origin time, and we always get a clear picture within already five minutes after origin time

  6. Optical Whole-Genome Restriction Mapping as a Tool for Rapidly Distinguishing and Identifying Bacterial Contaminants in Clinical Samples

    Science.gov (United States)

    2015-08-01

    Article 3. DATES COVERED (From – To) Oct 2011 – Aug 2012 4. TITLE AND SUBTITLE Optical Whole-Genome Restriction Mapping as a Tool for Rapidly...multiple bacteria could be uniquely identified within mixtures. In the first set of experiments, three unique organisms ( Bacillus subtilis subsp. globigii...be useful in monitoring nosocomial outbreaks in neonatal and intensive care wards, or even as an initial screen for antibiotic resistant strains

  7. An inexpensive and rapid method for extracting papilionoid genomic DNA from herbarium specimens.

    Science.gov (United States)

    Riahi, M; Zarre, S; Maassoumi, A A; Attar, F; Kazempour Osaloo, S

    2010-07-13

    Three DNA extraction protocols were compared for their ability to yield DNA from the leaves of herbarium specimens of nine species from nine genera of the Papilionoideae. We tested two protocols that use classic procedures for lysis and purification with cetyl trimethylammonium bromide (CTAB); a third protocol used a Nucleospin Plant kit. DNA obtained from all three procedures was quantified and tested by PCR. Test results indicated the superiority of one of the CTAB protocols. We made some modifications, developing a protocol that produced high-quality DNA from all nine species. The modification involved the use of a lower EDTA concentration (20 mM instead of 50 mM) and a higher beta-mercaptoethanol concentration (1% instead of 0.4%) in the extraction buffer. The modified protocol avoids the necessity for a second DNA precipitation step. This new CTAB protocol includes the use of 1.4 M NaCl, 20 mM EDTA and 1% beta-mercaptoethanol in the extraction; DNA precipitation time is reduced. A reduction in contaminating metabolites (such as PCR inhibitors) in the sample mixtures and lower costs for reagents are characteristics of this modified protocol; the cost of analysis per sample was lowered, compared to previous options. The quality of DNA was suitable for PCR amplification. This is a practical alternative to more difficult, time-consuming and expensive protocols.

  8. Rapid extraction of genomic DNA from saliva for HLA typing on microarray based on magnetic nanobeads

    Energy Technology Data Exchange (ETDEWEB)

    Xie Xin; Zhang Xu E-mail: shinezhang@hotmail.com; Yu Bingbin; Gao Huafang; Zhang Huan; Fei Weiyang

    2004-09-01

    A series of simplified protocols are developed for extracting genomic DNA from saliva by using the magnetic nanobeads as absorbents. In these protocols, both the enrichment of the target cells and the adsorption of DNA can be achieved simultaneously by our functionally modified magnetic beads in one step, and the DNA-nanobeads complex can be used as PCR templates. HLA typing based on an oligonucleotide array was conducted by hybridization with the PCR products. The result shows that the protocols are robust and sensitive.

  9. The Use of Surveillance Cameras for the Rapid Mapping of Lava Flows: An Application to Mount Etna Volcano

    Directory of Open Access Journals (Sweden)

    Mauro Coltelli

    2017-02-01

    Full Text Available In order to improve the observation capability in one of the most active volcanic areas in the world, Mt. Etna, we developed a processing method to use the surveillance cameras for a quasi real-time mapping of syn-eruptive processes. Following an evaluation of the current performance of the Etna permanent ground NEtwork of Thermal and Visible Sensors (Etna_NETVIS, its possible implementation and optimization was investigated to determine the locations of additional observation sites to be rapidly set up during emergencies. A tool was then devised to process time series of ground-acquired images and extract a coherent multi-temporal dataset of georeferenced map. The processed datasets can be used to extract 2D features such as evolution maps of active lava flows. The tool was validated on ad-hoc test fields and then adopted to map the evolution of two recent lava flows. The achievable accuracy (about three times the original pixel size and the short processing time makes the tool suitable for rapidly assessing lava flow evolutions, especially in the case of recurrent eruptions, such as those of the 2011–2015 Etna activity. The tool can be used both in standard monitoring activities and during emergency phases (eventually improving the present network with additional mobile stations when it is mandatory to carry out a quasi-real-time mapping to support civil protection actions. The developed tool could be integrated in the control room of the Osservatorio Etneo, thus enabling the Etna_NETVIS for mapping purposes and not only for video surveillance.

  10. Analysis of correlations between the occurrence of anti-MAP antibodies in blood serum and the presence of DNA-MAP in milk.

    Science.gov (United States)

    Wiszniewska-Łaszczych, A; Szteyn, J; Smolińska, A

    2009-01-01

    Paratuberculosis (Johne's disease) is a chronic, infectious enteritis of both domestic and wild ruminants. Unfortunately, the problem of MAP infections is not linked only with the health status of animals and potential direct and indirect economic losses in bovine herds (of dairy cattle in particular). MAP bacilli present in food of animal origin (milk in particular) are likely to lead to the development of the disease in humans. Fast and effective diagnosis of the disease in animals, especially of its subclinical form, may prevent the transmission of the germ to humans. The study was aimed at analyzing the correlations between the occurance of seropositive and serodoubtful reaction in the ELISA test and the presence of DNA-MAP in udder milk. The results suggest that half of the population of animals with positive and doubtful serological responces against John's disease are likely to be a potential source of germ transmission into humans. The fact of detecting DNA-MAP in 1/3 of all milk samples points to the likelihood of occurrence of MAP bacilli in milk of animals not displaying seropositive or serodoubtful responses.

  11. A rapid and simple method for DNA extraction from yeasts and fungi isolated from Agave fourcroydes.

    Science.gov (United States)

    Tapia-Tussell, Raul; Lappe, Patricia; Ulloa, Miguel; Quijano-Ramayo, Andrés; Cáceres-Farfán, Mirbella; Larqué-Saavedra, Alfonso; Perez-Brito, Daisy

    2006-05-01

    A simple and easy protocol for extracting high-quality DNA from different yeast and filamentous fungal species is described. This method involves two important steps: first, the disruption of cell walls by mechanical means and freezing; and second, the extraction, isolation, and precipitation of genomic DNA. The absorbance ratios (A(260)/A(280)) obtained ranged from 1.6 to 2.0. The main objective of this procedure is to extract pure DNA from yeast and filamentous fungi, including those with high contents of proteins, polysaccharides, and other complex compounds in their cell walls. The yield and quality of the DNAs obtained were suitable for micro/minisatellite primer-polymerase chain reaction (MSP-PCR) fingerprinting as well as for the sequence of the D1/D2 domain of the 26S rDNA.

  12. Rapid Construction of Fe-Co-Ni Composition-Phase Map by Combinatorial Materials Chip Approach.

    Science.gov (United States)

    Xing, Hui; Zhao, Bingbing; Wang, Yujie; Zhang, Xiaoyi; Ren, Yang; Yan, Ningning; Gao, Tieren; Li, Jindong; Zhang, Lanting; Wang, Hong

    2018-03-12

    One hundred nanometer thick Fe-Co-Ni material chips were prepared and isothermally annealed at 500, 600, and 700 °C, respectively. Pixel-by-pixel composition and structural mapping was performed by microbeam X-ray at synchrotron light source. Diffraction images were recorded at a rate of 1 pattern/s. The XRD patterns were automatically processed, phase-identified, and categorized by hierarchical clustering algorithm to construct the composition-phase map. The resulting maps are consistent with corresponding isothermal sections reported in the ASM Alloy Phase Diagram Database, verifying the effectiveness of the present approach in phase diagram construction.

  13. Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques.

    OpenAIRE

    Aljanabi, S M; Martinez, I

    1997-01-01

    A very simple, fast, universally applicable and reproducible method to extract high quality megabase genomic DNA from different organisms is described. We applied the same method to extract high quality complex genomic DNA from different tissues (wheat, barley, potato, beans, pear and almond leaves as well as fungi, insects and shrimps' fresh tissue) without any modification. The method does not require expensive and environmentally hazardous reagents and equipment. It can be performed even i...

  14. Sixty-five radiation hybrids for the short arm of human chromosome 6: their value as a mapping panel and as a source for rapid isolation of new probes using repeat element-mediated PCR

    International Nuclear Information System (INIS)

    Zoghbi, H.Y.; McCall, A.E.; LeBorgne-Demarquoy, F.

    1991-01-01

    We have used an irradiation and fusion procedure to generate somatic cell hybrids that retain fragments of the short arm of human chromosome 6 (6p). To identify hybrids retaining human material, we performed repeat element-mediated PCR on crude lysates of cells from individual clones. Sixty-five hybrids were shown to contain human material and fifty of those contained one or more 6p-specific probes. Detailed characterization of these hybrids identified a subset that divides 6p into ten mapping intervals. Using repeat element-mediated PCR, we were able to isolate and map 61 new DNA fragments from specific regions of 6p. Fifteen of these fragments were used to screen for restriction fragment length polymorphisms (RFLPs), and nine identified RFLPs with one or more enzymes. The radiation hybrids described in this study provide a valuable resource for high-resolution mapping of 6p and for the rapid isolation of region-specific markers

  15. Rapid molecular detection of invasive species in ballast and harbor water by integrating environmental DNA and light transmission spectroscopy.

    Science.gov (United States)

    Egan, Scott P; Grey, Erin; Olds, Brett; Feder, Jeffery L; Ruggiero, Steven T; Tanner, Carol E; Lodge, David M

    2015-04-07

    Invasive species introduced via the ballast water of commercial ships cause enormous environmental and economic damage worldwide. Accurate monitoring for these often microscopic and morphologically indistinguishable species is challenging but critical for mitigating damages. We apply eDNA sampling, which involves the filtering and subsequent DNA extraction of microscopic bits of tissue suspended in water, to ballast and harbor water sampled during a commercial ship's 1400 km voyage through the North American Great Lakes. Using a lab-based gel electrophoresis assay and a rapid, field-ready light transmission spectroscopy (LTS) assay, we test for the presence of two invasive species: quagga (Dreissena bugensis) and zebra (D. polymorpha) mussels. Furthermore, we spiked a set of uninfested ballast and harbor samples with zebra mussel tissue to further test each assay's detection capabilities. In unmanipulated samples, zebra mussel was not detected, while quagga mussel was detected in all samples at a rate of 85% for the gel assay and 100% for the LTS assay. In the spiked experimental samples, both assays detected zebra mussel in 94% of spiked samples and 0% of negative controls. Overall, these results demonstrate that eDNA sampling is effective for monitoring ballast-mediated invasions and that LTS has the potential for rapid, field-based detection.

  16. Rapid Diminution in the Level and Activity of DNA-Dependent Protein Kinase in Cancer Cells by a Reactive Nitro-Benzoxadiazole Compound

    Directory of Open Access Journals (Sweden)

    Viviane A. O. Silva

    2016-05-01

    Full Text Available The expression and activity of DNA-dependent protein kinase (DNA-PK is related to DNA repair status in the response of cells to exogenous and endogenous factors. Recent studies indicate that Epidermal Growth Factor Receptor (EGFR is involved in modulating DNA-PK. It has been shown that a compound 4-nitro-7-[(1-oxidopyridin-2-ylsulfanyl]-2,1,3-benzoxadiazole (NSC, bearing a nitro-benzoxadiazole (NBD scaffold, enhances tyrosine phosphorylation of EGFR and triggers downstream signaling pathways. Here, we studied the behavior of DNA-PK and other DNA repair proteins in prostate cancer cells exposed to compound NSC. We showed that both the expression and activity of DNA-PKcs (catalytic subunit of DNA-PK rapidly decreased upon exposure of cells to the compound. The decline in DNA-PKcs was associated with enhanced protein ubiquitination, indicating the activation of cellular proteasome. However, pretreatment of cells with thioglycerol abolished the action of compound NSC and restored the level of DNA-PKcs. Moreover, the decreased level of DNA-PKcs was associated with the production of intracellular hydrogen peroxide by stable dimeric forms of Cu/Zn SOD1 induced by NSC. Our findings indicate that reactive oxygen species and electrophilic intermediates, generated and accumulated during the redox transformation of NBD compounds, are primarily responsible for the rapid modulation of DNA-PKcs functions in cancer cells.

  17. Filtration Isolation of Nucleic Acids: A Simple and Rapid DNA Extraction Method.

    Science.gov (United States)

    McFall, Sally M; Neto, Mário F; Reed, Jennifer L; Wagner, Robin L

    2016-08-06

    FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 µl whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

  18. A rapid and inexpensive method for isolation of total DNA from Trichoderma spp (Hypocreaceae).

    Science.gov (United States)

    Vazquez-Angulo, J C; Mendez-Trujillo, V; González-Mendoza, D; Morales-Trejo, A; Grimaldo-Juarez, O; Cervantes-Díaz, L

    2012-05-15

    Extraction of high-quality genomic DNA for PCR amplification from filamentous fungi is difficult because of the complex cell wall and the high concentrations of polysaccharides and other secondary metabolites that bind to or co-precipitate with nucleic acids. We developed a modified sodium dodecyl sulfate/phenol protocol, without maceration in liquid nitrogen and without a final ethanol precipitation step. The A(260/280) absorbance ratios of isolated DNA were approximately 1.7-1.9, demonstrating that the DNA fraction is pure and can be used for analysis. Additionally, the A(260/230) values were higher than 1.6, demonstrating negligible contamination by polysaccharides. The DNA isolated by this protocol is of sufficient quality for molecular applications; this technique could be applied to other organisms that have similar substances that hinder DNA extraction. The main advantages of the method are that the mycelium is directly recovered from culture medium and it does not require the use of expensive and specialized equipment.

  19. Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes

    Directory of Open Access Journals (Sweden)

    Georg Walch

    2016-04-01

    Full Text Available Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success.

  20. Measurement of cell proliferation in microculture using Hoechst 33342 for the rapid semiautomated microfluorimetric determination of chromatin DNA.

    Science.gov (United States)

    Richards, W L; Song, M K; Krutzsch, H; Evarts, R P; Marsden, E; Thorgeirsson, S S

    1985-07-01

    We report the development and characterization of a semiautomated method for measurement of cell proliferation in microculture using Hoechst 33342, a non-toxic specific vital stain for DNA. In this assay, fluorescence resulting from interaction of cell chromatin DNA with Hoechst 33342 dye was measured by an instrument that automatically reads the fluorescence of each well of a 96-well microtiter plate within 1 min. Each cell line examined was shown to require different Hoechst 33342 concentrations and time of incubation with the dye to attain optimum fluorescence in the assay. In all cell lines, cell chromatin-enhanced Hoechst 33342 fluorescence was shown to be a linear function of the number of cells or cell nuclei per well when optimum assay conditions were employed. Because of this linear relation, equivalent cell doubling times were calculated from growth curves based on changes in cell counts or changes in Hoechst/DNA fluorescence and the fluorimetric assay was shown to be useful for the direct assay of the influence of growth factors on cell proliferation. The fluorimetric assay also provided a means for normalizing the incorporation of tritiated thymidine ( [3H] TdR) into DNA; normalized values of DPM per fluorescence unit closely paralleled values of percent 3H-labelled nuclei when DNA synthesis was studied as a function of the concentration of rat serum in the medium. In summary, the chromatin-enhanced Hoechst 33342 fluorimetric assay provides a rapid, simple, and reproducible means for estimating cell proliferation by direct measurement of changes in cell fluorescence or by measurement of changes in the normalized incorporation of thymidine into DNA.

  1. Web Based Rapid Mapping of Disaster Areas using Satellite Images, Web Processing Service, Web Mapping Service, Frequency Based Change Detection Algorithm and J-iView

    Science.gov (United States)

    Bandibas, J. C.; Takarada, S.

    2013-12-01

    Timely identification of areas affected by natural disasters is very important for a successful rescue and effective emergency relief efforts. This research focuses on the development of a cost effective and efficient system of identifying areas affected by natural disasters, and the efficient distribution of the information. The developed system is composed of 3 modules which are the Web Processing Service (WPS), Web Map Service (WMS) and the user interface provided by J-iView (fig. 1). WPS is an online system that provides computation, storage and data access services. In this study, the WPS module provides online access of the software implementing the developed frequency based change detection algorithm for the identification of areas affected by natural disasters. It also sends requests to WMS servers to get the remotely sensed data to be used in the computation. WMS is a standard protocol that provides a simple HTTP interface for requesting geo-registered map images from one or more geospatial databases. In this research, the WMS component provides remote access of the satellite images which are used as inputs for land cover change detection. The user interface in this system is provided by J-iView, which is an online mapping system developed at the Geological Survey of Japan (GSJ). The 3 modules are seamlessly integrated into a single package using J-iView, which could rapidly generate a map of disaster areas that is instantaneously viewable online. The developed system was tested using ASTER images covering the areas damaged by the March 11, 2011 tsunami in northeastern Japan. The developed system efficiently generated a map showing areas devastated by the tsunami. Based on the initial results of the study, the developed system proved to be a useful tool for emergency workers to quickly identify areas affected by natural disasters.

  2. Rapid DNA Synthesis During Early Drosophila Embryogenesis Is Sensitive to Maternal Humpty Dumpty Protein Function.

    Science.gov (United States)

    Lesly, Shera; Bandura, Jennifer L; Calvi, Brian R

    2017-11-01

    Problems with DNA replication cause cancer and developmental malformations. It is not fully understood how DNA replication is coordinated with development and perturbed in disease. We had previously identified the Drosophila gene humpty dumpty ( hd ), and showed that null alleles cause incomplete DNA replication, tissue undergrowth, and lethality. Animals homozygous for the missense allele, hd 272-9 , were viable, but adult females had impaired amplification of eggshell protein genes in the ovary, resulting in the maternal effects of thin eggshells and embryonic lethality. Here, we show that expression of an hd transgene in somatic cells of the ovary rescues amplification and eggshell synthesis but not embryo viability. The germline of these mothers remain mutant for the hd 272-9 allele, resulting in reduced maternal Hd protein and embryonic arrest during mitosis of the first few S/M nuclear cleavage cycles with chromosome instability and chromosome bridges. Epistasis analysis of hd with the rereplication mutation plutonium indicates that the chromosome bridges of hd embryos are the result of a failed attempt to segregate incompletely replicated sister chromatids. This study reveals that maternally encoded Humpty dumpty protein is essential for DNA replication and genome integrity during the little-understood embryonic S/M cycles. Moreover, the two hd 272-9 maternal-effect phenotypes suggest that ovarian gene amplification and embryonic cleavage are two time periods in development that are particularly sensitive to mild deficits in DNA replication function. This last observation has broader relevance for interpreting why mild mutations in the human ortholog of humpty dumpty and other DNA replication genes cause tissue-specific malformations of microcephalic dwarfisms. Copyright © 2017 by the Genetics Society of America.

  3. Direct identification of antibiotic resistance genes on single plasmid molecules using CRISPR/Cas9 in combination with optical DNA mapping

    Science.gov (United States)

    Müller, Vilhelm; Rajer, Fredrika; Frykholm, Karolin; Nyberg, Lena K.; Quaderi, Saair; Fritzsche, Joachim; Kristiansson, Erik; Ambjörnsson, Tobias; Sandegren, Linus; Westerlund, Fredrik

    2016-12-01

    Bacterial plasmids are extensively involved in the rapid global spread of antibiotic resistance. We here present an assay, based on optical DNA mapping of single plasmids in nanofluidic channels, which provides detailed information about the plasmids present in a bacterial isolate. In a single experiment, we obtain the number of different plasmids in the sample, the size of each plasmid, an optical barcode that can be used to identify and trace the plasmid of interest and information about which plasmid that carries a specific resistance gene. Gene identification is done using CRISPR/Cas9 loaded with a guide-RNA (gRNA) complementary to the gene of interest that linearizes the circular plasmids at a specific location that is identified using the optical DNA maps. We demonstrate the principle on clinically relevant extended spectrum beta-lactamase (ESBL) producing isolates. We discuss how the gRNA sequence can be varied to obtain the desired information. The gRNA can either be very specific to identify a homogeneous group of genes or general to detect several groups of genes at the same time. Finally, we demonstrate an example where we use a combination of two gRNA sequences to identify carbapenemase-encoding genes in two previously not characterized clinical bacterial samples.

  4. Mapping DNA cleavage by the Type ISP restriction-modification enzymes following long-range communication between DNA sites in different orientations

    Science.gov (United States)

    van Aelst, Kara; Saikrishnan, Kayarat; Szczelkun, Mark D.

    2015-01-01

    The prokaryotic Type ISP restriction-modification enzymes are single-chain proteins comprising an Mrr-family nuclease, a superfamily 2 helicase-like ATPase, a coupler domain, a methyltransferase, and a DNA-recognition domain. Upon recognising an unmodified DNA target site, the helicase-like domain hydrolyzes ATP to cause site release (remodeling activity) and to then drive downstream translocation consuming 1–2 ATP per base pair (motor activity). On an invading foreign DNA, double-strand breaks are introduced at random wherever two translocating enzymes form a so-called collision complex following long-range communication between a pair of target sites in inverted (head-to-head) repeat. Paradoxically, structural models for collision suggest that the nuclease domains are too far apart (>30 bp) to dimerise and produce a double-strand DNA break using just two strand-cleavage events. Here, we examined the organisation of different collision complexes and how these lead to nuclease activation. We mapped DNA cleavage when a translocating enzyme collides with a static enzyme bound to its site. By following communication between sites in both head-to-head and head-to-tail orientations, we could show that motor activity leads to activation of the nuclease domains via distant interactions of the helicase or MTase-TRD. Direct nuclease dimerization is not required. To help explain the observed cleavage patterns, we also used exonuclease footprinting to demonstrate that individual Type ISP domains can swing off the DNA. This study lends further support to a model where DNA breaks are generated by multiple random nicks due to mobility of a collision complex with an overall DNA-binding footprint of ∼30 bp. PMID:26507855

  5. Rapid detection of structural variation in a human genome using nanochannel-based genome mapping technology

    DEFF Research Database (Denmark)

    Cao, Hongzhi; Hastie, Alex R.; Cao, Dandan

    2014-01-01

    mutations; however, none of the current detection methods are comprehensive, and currently available methodologies are incapable of providing sufficient resolution and unambiguous information across complex regions in the human genome. To address these challenges, we applied a high-throughput, cost......-effective genome mapping technology to comprehensively discover genome-wide SVs and characterize complex regions of the YH genome using long single molecules (>150 kb) in a global fashion. RESULTS: Utilizing nanochannel-based genome mapping technology, we obtained 708 insertions/deletions and 17 inversions larger...... fosmid data. Of the remaining 270 SVs, 260 are insertions and 213 overlap known SVs in the Database of Genomic Variants. Overall, 609 out of 666 (90%) variants were supported by experimental orthogonal methods or historical evidence in public databases. At the same time, genome mapping also provides...

  6. Rapid assessment of non-indigenous species in the era of the eDNA barcoding: A Mediterranean case study

    Science.gov (United States)

    Ardura, Alba; Planes, Serge

    2017-03-01

    With only a narrow opening through the Gibraltar and Suez Canals, the Mediterranean Sea is one of the largest semi-enclosed seas. The marine flora and fauna are some of the richest in the world, relative to its size, particularly in the coastal habitats, which are also characterized by numerous endemic species although the introduction of non-indigenous species threatens its rich and unique biodiversity. Following the opening of the Suez Canal, and in combination with shipping and aquaculture activities, non-indigenous species (NIS) introduction has had measurable impacts on the Mediterranean. Lagoon ecosystems along the French coastline, with approx. 100 NIS identified, are considered hot-spot areas for these species. Rapid assessment sampling for sessile benthic species together with DNA barcoding is a rapid, easy and cheap method to detect non-indigenous species. Two nearby and different ecosystems were sampled for invertebrate species: Saint-Nazaire lagoon, a Special Protection Area within the Natura 2000 Network and Canet port, a marina in a small village. The DNA barcoding tool for species identification was used for confirming the taxonomy. This showed that, despite the Saint-Nazaire Lagoon classification within the Natura 2000 network, it is already contaminated with a single NIS that was found in high densities and is clearly beginning to dominate the system. It is proposed that a rapid assessment of the sampled environment and the DNA barcode approach are efficient and can provide sufficient information on the new target species to be used in conservation planning and ongoing management efforts.

  7. Rapid outer-surface protein C DNA tattoo vaccination protects against Borrelia afzelii infection

    NARCIS (Netherlands)

    Wagemakers, A.; Mason, L. M. K.; Oei, A.; de Wever, B.; van der Poll, T.; Bins, A. D.; Hovius, J. W. R.

    2014-01-01

    Borrelia afzelii is the predominant Borrelia species causing Lyme borreliosis in Europe. Currently there is no human vaccine against Lyme borreliosis, and most research focuses on recombinant protein vaccines against Borrelia burgdorferi sensu stricto. DNA tattooing is a novel vaccination method

  8. Rapid DNA extraction from dried blood spots on filter paper: potential applications in biobanking.

    Science.gov (United States)

    Choi, Eun-Hye; Lee, Sang Kwang; Ihm, Chunhwa; Sohn, Young-Hak

    2014-12-01

    Dried blood spot (DBS) technology is a microsampling alternative to traditional plasma or serum sampling for pharmaco- or toxicokinetic evaluation. DBS technology has been applied to diagnostic screening in drug discovery, nonclinical, and clinical settings. We have developed an improved elution protocol involving boiling of blood spots dried on Whatman filter paper. The purpose of this study was to compare the quality, purity, and quantity of DNA isolated from frozen blood samples and DBSs. We optimized a method for extraction and estimation of DNA from blood spots dried on filter paper (3-mm FTA card). A single DBS containing 40 μL blood was used. DNA was efficiently extracted in phosphate-buffered saline (PBS) or Tris-EDTA (TE) buffer by incubation at 37°C overnight. DNA was stable in DBSs that were stored at room temperature or frozen. The housekeeping genes GAPDH and beta-actin were used as positive standards for polymerase chain reaction (PCR) validation of general diagnostic screening. Our simple and convenient DBS storage and extraction methods are suitable for diagnostic screening by using very small volumes of blood collected on filter paper, and can be used in biobanks for blood sample storage.

  9. The use of DNA markers for rapid improvement of crops in Africa ...

    African Journals Online (AJOL)

    Genetic engineering and biotechnology are providing new tools for genetic improvement of food crops. Molecular DNA markers are some of these tools which can be used in various fields of plant breeding and germplasm management. For example, molecular markers have been used to confirm the identity of hybrids in ...

  10. Human cDNA mapping using fluorescence in situ hybridization. Progress report, April 1, 1992--December 31, 1992

    Energy Technology Data Exchange (ETDEWEB)

    Korenberg, J.R.

    1993-03-04

    Genetic mapping is approached using the techniques of high resolution fluorescence in situ hybridization (FISH). This technology and the results of its application are designed to rapidly generate whole genome as tool box of expressed sequence to speed the identification of human disease genes. The results of this study are intended to dovetail with and to link the results of existing technologies for creating backbone YAC and genetic maps. In the first eight months, this approach generated 60--80% of the expressed sequence map, the remainder expected to be derived through more long-term, labor-intensive, regional chromosomal gene searches or sequencing. The laboratory has made significant progress in the set-up phase, in mapping fetal and adult brain and other cDNAs, in testing a model system for directly linking genetic and physical maps using FISH with small fragments, in setting up a database, and in establishing the validity and throughput of the system.

  11. Human cDNA mapping using fluorescence in situ hybridization. Final progress report, April 1, 1994--July 31, 1997

    Energy Technology Data Exchange (ETDEWEB)

    Korenberg, J.R.

    1997-12-31

    The ultimate goal of this research is to generate and apply novel technologies to speed completion and integration of the human genome map and sequence with biomedical problems. To do this, techniques were developed and genome-wide resources generated. This includes a genome-wide Mapped and Integrated BAC/PAC Resource that has been used for gene finding, map completion and anchoring, breakpoint definition and sequencing. In the last period of the grant, the Human Mapped BAC/PAC Resource was also applied to determine regions of human variation and to develop a novel paradigm of primate evolution through to humans. Further, in order to more rapidly evaluate animal models of human disease, a BAC Map of the mouse was generated in collaboration with the MTI Genome Center, Dr. Bruce Birren.

  12. A Spectral Mapping Signature for the Rapid Ohia Death (ROD) Pathogen in Hawaiian Forests

    Science.gov (United States)

    Pathogenic invasions are a major disruptive source of change in both agricultural and natural ecosystems. In forests, fungal pathogens can kill habitat-generating plant species such as canopy trees, but methods for remote detection, mapping and monitoring of such outbreaks are poorly developed. Cera...

  13. Mapping of histone modifications in episomal HBV cccDNA uncovers an unusual chromatin organization amenable to epigenetic manipulation

    Science.gov (United States)

    Tropberger, Philipp; Mercier, Alexandre; Robinson, Margaret; Zhong, Weidong; Ganem, Don E.; Holdorf, Meghan

    2015-01-01

    Chronic hepatitis B virus (HBV) infection affects 240 million people worldwide and is a major risk factor for liver failure and hepatocellular carcinoma. Current antiviral therapy inhibits cytoplasmic HBV genomic replication, but is not curative because it does not directly affect nuclear HBV closed circular DNA (cccDNA), the genomic form that templates viral transcription and sustains viral persistence. Novel approaches that directly target cccDNA regulation would therefore be highly desirable. cccDNA is assembled with cellular histone proteins into chromatin, but little is known about the regulation of HBV chromatin by histone posttranslational modifications (PTMs). Here, using a new cccDNA ChIP-Seq approach, we report, to our knowledge, the first genome-wide maps of PTMs in cccDNA-containing chromatin from de novo infected HepG2 cells, primary human hepatocytes, and from HBV-infected liver tissue. We find high levels of PTMs associated with active transcription enriched at specific sites within the HBV genome and, surprisingly, very low levels of PTMs linked to transcriptional repression even at silent HBV promoters. We show that transcription and active PTMs in HBV chromatin are reduced by the activation of an innate immunity pathway, and that this effect can be recapitulated with a small molecule epigenetic modifying agent, opening the possibility that chromatin-based regulation of cccDNA transcription could be a new therapeutic approach to chronic HBV infection. PMID:26438841

  14. Mitochondrial DNA mapping of social-biological interactions in Brazilian Amazonian African-descendant populations

    Directory of Open Access Journals (Sweden)

    Bruno Maia Carvalho

    2008-01-01

    Full Text Available The formation of the Brazilian Amazonian population has historically involved three main ethnic groups, Amerindian, African and European. This has resulted in genetic investigations having been carried out using classical polymorphisms and molecular markers. To better understand the genetic variability and the micro-evolutionary processes acting in human groups in the Brazilian Amazon region we used mitochondrial DNA to investigate 159 maternally unrelated individuals from five Amazonian African-descendant communities. The mitochondrial lineage distribution indicated a contribution of 50.2% from Africans (L0, L1, L2, and L3, 46.6% from Amerindians (haplogroups A, B, C and D and a small European contribution of 1.3%. These results indicated high genetic diversity in the Amerindian and African lineage groups, suggesting that the Brazilian Amazonian African-descendant populations reflect a possible population amalgamation of Amerindian women from different Amazonian indigenous tribes and African women from different geographic regions of Africa who had been brought to Brazil as slaves. The present study partially mapped the historical biological and social interactions that had occurred during the formation and expansion of Amazonian African-descendant communities.

  15. A Novel Method for Rapid Hybridization of DNA to a Solid Support

    Science.gov (United States)

    Pettersson, Erik; Ahmadian, Afshin; Ståhl, Patrik L.

    2013-01-01

    Here we present a novel approach entitled Magnetic Forced Hybridization (MFH) that provides the means for efficient and direct hybridization of target nucleic acids to complementary probes immobilized on a glass surface in less than 15 seconds at ambient temperature. In addition, detection is carried out instantly since the beads become visible on the surface. The concept of MFH was tested for quality control of array manufacturing, and was combined with a multiplex competitive hybridization (MUCH) approach for typing of Human Papilloma Virus (HPV). Magnetic Forced Hybridization of bead-DNA constructs to a surface achieves a significant reduction in diagnostic testing time. In addition, readout of results by visual inspection of the unassisted eye eliminates the need for additional expensive instrumentation. The method uses the same set of beads throughout the whole process of manipulating and washing DNA constructs prior to detection, as in the actual detection step itself. PMID:23950946

  16. Rapid Identification of Seven Waterborne Exophiala Species by RCA DNA Padlock Probes.

    Science.gov (United States)

    Najafzadeh, M J; Vicente, V A; Feng, Peiying; Naseri, A; Sun, Jiufeng; Rezaei-Matehkolaei, A; de Hoog, G S

    2018-03-05

    The black yeast genus Exophiala includes numerous potential opportunistic species that potentially cause systematic and disseminated infections in immunocompetent individuals. Species causing systemic disease have ability to grow at 37-40 °C, while others consistently lack thermotolerance and are involved in diseases of cold-blooded, waterborne vertebrates and occasionally invertebrates. We explain a fast and sensitive assay for recognition and identification of waterborne Exophiala species without sequencing. The ITS rDNA region of seven Exophiala species (E. equina, E. salmonis, E. opportunistica, E. pisciphila, E. aquamarina, E. angulospora and E. castellanii) along with the close relative Veronaea botryosa was sequenced and aligned for the design of specific padlock probes for the detection of characteristic single-nucleotide polymorphisms. The assay demonstrated to successfully amplify DNA of target fungi, allowing detection at the species level. Amplification products were visualized on 1% agarose gels to confirm specificity of probe-template binding. Amounts of reagents were reduced to prevent the generation of false positive results. The simplicity, tenderness, robustness and low expenses provide padlock probe assay (RCA) a definite place as a very practical method among isothermal approaches for DNA diagnostics.

  17. DNA Sequence-Mediated, Evolutionarily Rapid Redistribution of Meiotic Recombination Hotspots

    Science.gov (United States)

    Wahls, Wayne P.; Davidson, Mari K.

    2011-01-01

    Hotspots regulate the position and frequency of Spo11 (Rec12)-initiated meiotic recombination, but paradoxically they are suicidal and are somehow resurrected elsewhere in the genome. After the DNA sequence-dependent activation of hotspots was discovered in fission yeast, nearly two decades elapsed before the key realizations that (A) DNA site-dependent regulation is broadly conserved and (B) individual eukaryotes have multiple different DNA sequence motifs that activate hotspots. From our perspective, such findings provide a conceptually straightforward solution to the hotspot paradox and can explain other, seemingly complex features of meiotic recombination. We describe how a small number of single-base-pair substitutions can generate hotspots de novo and dramatically alter their distribution in the genome. This model also shows how equilibrium rate kinetics could maintain the presence of hotspots over evolutionary timescales, without strong selective pressures invoked previously, and explains why hotspots localize preferentially to intergenic regions and introns. The model is robust enough to account for all hotspots of humans and chimpanzees repositioned since their divergence from the latest common ancestor. PMID:22084420

  18. Rapid corn and soybean mapping in US Corn Belt and neighboring areas

    Science.gov (United States)

    Zhong, Liheng; Yu, Le; Li, Xuecao; Hu, Lina; Gong, Peng

    2016-11-01

    The goal of this study was to promptly map the extent of corn and soybeans early in the growing season. A classification experiment was conducted for the US Corn Belt and neighboring states, which is the most important production area of corn and soybeans in the world. To improve the timeliness of the classification algorithm, training was completely based on reference data and images from other years, circumventing the need to finish reference data collection in the current season. To account for interannual variability in crop development in the cross-year classification scenario, several innovative strategies were used. A random forest classifier was used in all tests, and MODIS surface reflectance products from the years 2008-2014 were used for training and cross-year validation. It is concluded that the fuzzy classification approach is necessary to achieve satisfactory results with R-squared ~0.9 (compared with the USDA Cropland Data Layer). The year of training data is an important factor, and it is recommended to select a year with similar crop phenology as the mapping year. With this phenology-based and cross-year-training method, in 2015 we mapped the cropping proportion of corn and soybeans around mid-August, when the two crops just reached peak growth.

  19. Development of Rapid and Low Cost Archaeological Site Mapping Using Photogrammetric Technique

    International Nuclear Information System (INIS)

    Azhar, N A Mohd; Ahmad, Anuar

    2014-01-01

    In digital photogrammetry, unmanned aerial vehicle (UAV) platform is a new technology that can be used to capture digital images for large scale mapping with accuracy down to centimeter level from various waypoints for archaeological site documentation. UAV is one of the great alternatives to replace piloted aircraft and with combination of non -metric camera, thus it can be applied for small area such as cultural heritage building/ archeological site area. With the recent technology of non-metric cameras, this camera is capable of producing high resolution digital images. This study investigates the application of UAV images for documentation and mapping of a simulated archaeological sites. An archaeological site simulation modelwith dimension of 2.4 m × 3.5 m is used in this study. The accuracy for mapping the archeological sites based on the UAV system is evaluated and analyzed by performing the Root Mean Square Error (RMSE) derived from the differences of coordinates between reference value and the coordinates observed from photogrammetric output such as digital terrain model and orthophoto. In this application, a simulation model was used to simulate the archaeological site excavation. The results clearly demonstrate the potential and the capability of UAV and non-metric camera in providing the accuracy of centimetre level for this application. From this study, it can be concluded that the UAV and the photogrammetric technique procedure satisfied the needs of archaeological sites survey and documentation

  20. Rapid identification and classification of bacteria by 16S rDNA restriction fragment melting curve analyses (RFMCA).

    Science.gov (United States)

    Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T

    2007-08-01

    The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control.

  1. A novel GMO biosensor for rapid ultrasensitive and simultaneous detection of multiple DNA components in GMO products.

    Science.gov (United States)

    Huang, Lin; Zheng, Lei; Chen, Yinji; Xue, Feng; Cheng, Lin; Adeloju, Samuel B; Chen, Wei

    2015-04-15

    Since the introduction of genetically modified organisms (GMOs), there has been on-going and continuous concern and debates on the commercialization of products derived from GMOs. There is an urgent need for development of highly efficient analytical methods for rapid and high throughput screening of GMOs components, as required for appropriate labeling of GMO-derived foods, as well as for on-site inspection and import/export quarantine. In this study, we describe, for the first time, a multi-labeling based electrochemical biosensor for simultaneous detection of multiple DNA components of GMO products on the same sensing interface. Two-round signal amplification was applied by using both an exonuclease enzyme catalytic reaction and gold nanoparticle-based bio-barcode related strategies, respectively. Simultaneous multiple detections of different DNA components of GMOs were successfully achieved with satisfied sensitivity using this electrochemical biosensor. Furthermore, the robustness and effectiveness of the proposed approach was successfully demonstrated by application to various GMO products, including locally obtained and confirmed commercial GMO seeds and transgenetic plants. The proposed electrochemical biosensor demonstrated unique merits that promise to gain more interest in its use for rapid and on-site simultaneous multiple screening of different components of GMO products. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Rapid and sensitive method to identify Mycobacterium avium subsp. paratuberculosis in cow's milk by DNA methylase genotyping.

    Science.gov (United States)

    Mundo, Silvia Leonor; Gilardoni, Liliana Rosa; Hoffman, Federico José; Lopez, Osvaldo Jorge

    2013-03-01

    Paratuberculosis is an infectious, chronic, and incurable disease that affects ruminants, caused by Mycobacterium avium subsp. paratuberculosis. This bacterium is shed primarily through feces of infected cows but can be also excreted in colostrum and milk and might survive pasteurization. Since an association of genomic sequences of M. avium subsp. paratuberculosis in patients with Crohn's disease has been described; it is of interest to rapidly detect M. avium subsp. paratuberculosis in milk for human consumption. IS900 insertion is used as a target for PCR amplification to identify the presence of M. avium subsp. paratuberculosis in biological samples. Two target sequences were selected: IS1 (155 bp) and IS2 (94 bp). These fragments have a 100% identity among all M. avium subsp. paratuberculosis strains sequenced. M. avium subsp. paratuberculosis was specifically concentrated from milk samples by immunomagnetic separation prior to performing PCR. The amplicons were characterized using DNA methylase Genotyping, i.e., the amplicons were methylated with 6-methyl-adenine and digested with restriction enzymes to confirm their identity. The methylated amplicons from 100 CFU of M. avium subsp. paratuberculosis can be visualized in a Western blot format using an anti-6-methyl-adenine monoclonal antibody. The use of DNA methyltransferase genotyping coupled to a scintillation proximity assay allows for the detection of up to 10 CFU of M. avium subsp. paratuberculosis per ml of milk. This test is rapid and sensitive and allows for automation and thus multiple samples can be tested at the same time.

  3. Rapid and annealing-free self-assembly of DNA building blocks for 3D hydrogel chaperoned by cationic comb-type copolymers.

    Science.gov (United States)

    Zhang, Zheng; Wu, Yuyang; Yu, Feng; Niu, Chaoqun; Du, Zhi; Chen, Yong; Du, Jie

    2017-10-01

    The construction and self-assembly of DNA building blocks are the foundation of bottom-up development of three-dimensional DNA nanostructures or hydrogels. However, most self-assembly from DNA components is impeded by the mishybridized intermediates or the thermodynamic instability. To enable rapid production of complicated DNA objects with high yields no need for annealing process, herein different DNA building blocks (Y-shaped, L- and L'-shaped units) were assembled in presence of a cationic comb-type copolymer, poly (L-lysine)-graft-dextran (PLL-g-Dex), under physiological conditions. The results demonstrated that PLL-g-Dex not only significantly promoted the self-assembly of DNA blocks with high efficiency, but also stabilized the assembled multi-level structures especially for promoting the complicated 3D DNA hydrogel formation. This study develops a novel strategy for rapid and high-yield production of DNA hydrogel even derived from instable building blocks at relatively low DNA concentrations, which would endow DNA nanotechnology for more practical applications.

  4. DNA-based genetic markers for Rapid Cycling Brassica rapa (Fast Plants type designed for the teaching laboratory.

    Directory of Open Access Journals (Sweden)

    Eryn E. Slankster

    2012-06-01

    Full Text Available We have developed DNA-based genetic markers for rapid-cycling Brassica rapa (RCBr, also known as Fast Plants. Although markers for Brassica rapa already exist, ours were intentionally designed for use in a teaching laboratory environment. The qualities we selected for were robust amplification in PCR, polymorphism in RCBr strains, and alleles that can be easily resolved in simple agarose slab gels. We have developed two single nucleotide polymorphism (SNP based markers and 14 variable number tandem repeat (VNTR-type markers spread over four chromosomes. The DNA sequences of these markers represent variation in a wide range of genomic features. Among the VNTR-type markers, there are examples of variation in a nongenic region, variation within an intron, and variation in the coding sequence of a gene. Among the SNP-based markers there are examples of polymorphism in intronic DNA and synonymous substitution in a coding sequence. Thus these markers can serve laboratory exercises in both transmission genetics and molecular biology.

  5. Restriction map of the single-stranded DNA genome of Kilham rat virus strain 171, a nondefective parvovirus

    International Nuclear Information System (INIS)

    Banerjee, P.T.; Rathrock, R.; Mitra, S.

    1981-01-01

    A physical map of Kilham rat virus strain 171 DNA was constructed by analyzing the sizes and locations of restriction endonuclease-generated fragments of the replicative-form viral DNA synthesized in vitro. BglI, KpnI, BamHI, SmaI, XhoI, and XorII did not appear to have any cleavage sites, whereas 11 other enzymes cleaved the genome at one to eight sites, and AluI generated more than 12 distinct fragments. The 30 restriction sites that were mapped were distributed randomly in the viral genome. A comparison of the restriction fragments of in vivo- and in vitro-replicated replicative-form DNAs showed that these DNAs were identical except in the size or configuration of the terminal fragments

  6. Single-shot T1 mapping of the corpus callosum: A rapid characterization of fiber bundle anatomy

    Directory of Open Access Journals (Sweden)

    Sabine eHofer

    2015-05-01

    Full Text Available Using diffusion-tensor MRI and fiber tractography the topographic organization of the corpus callosum (CC has been described to comprise 5 segments with fibers projecting into prefrontal (I, premotor and supplementary motor (II, primary motor (III, and primary sensory areas (IV, as well as into parietal, temporal, and occipital cortical areas (V. In order to more rapidly characterize the underlying anatomy of these segments, this study used a novel single-shot T1 mapping method to quantitatively determine T1 relaxation times in the human CC. A region-of-interest analysis revealed a tendency for the lowest T1 relaxation times in the genu and the highest T1 relaxation times in the somatomotor region of the CC. This observation separates regions dominated by myelinated fibers with large diameters (somatomotor area from densely packed smaller axonal bundles (genu with less myelin. The results indicate that characteristic T1 relaxation times in callosal profiles provide an additional means to monitor differences in fiber anatomy, fiber density, and gray matter in respective neocortical areas. In conclusion, rapid T1 mapping allows for a characterization of the axonal architecture in an individual CC in less than 10 s. The approach emerges as a valuable means for studying neocortical brain anatomy with possible implications for the diagnosis of neurodegenerative processes.

  7. Molecular couplings and energy exchange between DNA and water mapped by femtosecond infrared spectroscopy of backbone vibrations

    Directory of Open Access Journals (Sweden)

    Yingliang Liu

    2017-07-01

    Full Text Available Molecular couplings between DNA and water together with the accompanying processes of energy exchange are mapped via the ultrafast response of DNA backbone vibrations after OH stretch excitation of the water shell. Native salmon testes DNA is studied in femtosecond pump-probe experiments under conditions of full hydration and at a reduced hydration level with two water layers around the double helix. Independent of their local hydration patterns, all backbone vibrations in the frequency range from 940 to 1120 cm–1 display a quasi-instantaneous reshaping of the spectral envelopes of their fundamental absorption bands upon excitation of the water shell. The subsequent reshaping kinetics encompass a one-picosecond component, reflecting the formation of a hot ground state of the water shell, and a slower contribution on a time scale of tens of picoseconds. Such results are benchmarked by measurements with resonant excitation of the backbone modes, resulting in distinctly different absorption changes. We assign the fast changes of DNA absorption after OH stretch excitation to structural changes in the water shell which couple to DNA through the local electric fields. The second slower process is attributed to a flow of excess energy from the water shell into DNA, establishing a common heated ground state in the molecular ensemble. This interpretation is supported by theoretical calculations of the electric fields exerted by the water shell at different temperatures.

  8. Real-time DNA barcoding in a rainforest using nanopore sequencing: opportunities for rapid biodiversity assessments and local capacity building.

    Science.gov (United States)

    Pomerantz, Aaron; Peñafiel, Nicolás; Arteaga, Alejandro; Bustamante, Lucas; Pichardo, Frank; Coloma, Luis A; Barrio-Amorós, César L; Salazar-Valenzuela, David; Prost, Stefan

    2018-04-01

    Advancements in portable scientific instruments provide promising avenues to expedite field work in order to understand the diverse array of organisms that inhabit our planet. Here, we tested the feasibility for in situ molecular analyses of endemic fauna using a portable laboratory fitting within a single backpack in one of the world's most imperiled biodiversity hotspots, the Ecuadorian Chocó rainforest. We used portable equipment, including the MinION nanopore sequencer (Oxford Nanopore Technologies) and the miniPCR (miniPCR), to perform DNA extraction, polymerase chain reaction amplification, and real-time DNA barcoding of reptile specimens in the field. We demonstrate that nanopore sequencing can be implemented in a remote tropical forest to quickly and accurately identify species using DNA barcoding, as we generated consensus sequences for species resolution with an accuracy of >99% in less than 24 hours after collecting specimens. The flexibility of our mobile laboratory further allowed us to generate sequence information at the Universidad Tecnológica Indoamérica in Quito for rare, endangered, and undescribed species. This includes the recently rediscovered Jambato toad, which was thought to be extinct for 28 years. Sequences generated on the MinION required as few as 30 reads to achieve high accuracy relative to Sanger sequencing, and with further multiplexing of samples, nanopore sequencing can become a cost-effective approach for rapid and portable DNA barcoding. Overall, we establish how mobile laboratories and nanopore sequencing can help to accelerate species identification in remote areas to aid in conservation efforts and be applied to research facilities in developing countries. This opens up possibilities for biodiversity studies by promoting local research capacity building, teaching nonspecialists and students about the environment, tackling wildlife crime, and promoting conservation via research-focused ecotourism.

  9. Construction of a high-density genetic map for grape using next generation restriction-site associated DNA sequencing

    Directory of Open Access Journals (Sweden)

    Wang Nian

    2012-08-01

    Full Text Available Abstract Background Genetic mapping and QTL detection are powerful methodologies in plant improvement and breeding. Construction of a high-density and high-quality genetic map would be of great benefit in the production of superior grapes to meet human demand. High throughput and low cost of the recently developed next generation sequencing (NGS technology have resulted in its wide application in genome research. Sequencing restriction-site associated DNA (RAD might be an efficient strategy to simplify genotyping. Combining NGS with RAD has proven to be powerful for single nucleotide polymorphism (SNP marker development. Results An F1 population of 100 individual plants was developed. In-silico digestion-site prediction was used to select an appropriate restriction enzyme for construction of a RAD sequencing library. Next generation RAD sequencing was applied to genotype the F1 population and its parents. Applying a cluster strategy for SNP modulation, a total of 1,814 high-quality SNP markers were developed: 1,121 of these were mapped to the female genetic map, 759 to the male map, and 1,646 to the integrated map. A comparison of the genetic maps to the published Vitis vinifera genome revealed both conservation and variations. Conclusions The applicability of next generation RAD sequencing for genotyping a grape F1 population was demonstrated, leading to the successful development of a genetic map with high density and quality using our designed SNP markers. Detailed analysis revealed that this newly developed genetic map can be used for a variety of genome investigations, such as QTL detection, sequence assembly and genome comparison.

  10. Gene organization in rice revealed by full-length cDNA mapping and gene expression analysis through microarray.

    Directory of Open Access Journals (Sweden)

    Kouji Satoh

    Full Text Available Rice (Oryza sativa L. is a model organism for the functional genomics of monocotyledonous plants since the genome size is considerably smaller than those of other monocotyledonous plants. Although highly accurate genome sequences of indica and japonica rice are available, additional resources such as full-length complementary DNA (FL-cDNA sequences are also indispensable for comprehensive analyses of gene structure and function. We cross-referenced 28.5K individual loci in the rice genome defined by mapping of 578K FL-cDNA clones with the 56K loci predicted in the TIGR genome assembly. Based on the annotation status and the presence of corresponding cDNA clones, genes were classified into 23K annotated expressed (AE genes, 33K annotated non-expressed (ANE genes, and 5.5K non-annotated expressed (NAE genes. We developed a 60mer oligo-array for analysis of gene expression from each locus. Analysis of gene structures and expression levels revealed that the general features of gene structure and expression of NAE and ANE genes were considerably different from those of AE genes. The results also suggested that the cloning efficiency of rice FL-cDNA is associated with the transcription activity of the corresponding genetic locus, although other factors may also have an effect. Comparison of the coverage of FL-cDNA among gene families suggested that FL-cDNA from genes encoding rice- or eukaryote-specific domains, and those involved in regulatory functions were difficult to produce in bacterial cells. Collectively, these results indicate that rice genes can be divided into distinct groups based on transcription activity and gene structure, and that the coverage bias of FL-cDNA clones exists due to the incompatibility of certain eukaryotic genes in bacteria.

  11. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    Science.gov (United States)

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus.

  12. Rapid, sensitive and cost effective method for isolation of viral DNA from feacal samples of dogs

    Directory of Open Access Journals (Sweden)

    Savi.

    2010-06-01

    Full Text Available A simple method for viral DNA extraction using chelex resin was developed. The method used was eco-friendly and cost effective compared to other methods such as phenol chloroform method which use health hazardous organic reagents. Further, a polymerase chain reaction (PCR based detection of canine parvovirus (CPV using primers from conserved region of VP2 gene was developed. To increase the sensitivity and specificity of reaction, nested PCR was designed. PCR reaction was optimized to amplify 747bp product of VP2 gene. The assay can be completed in few hours and doesn’t need hazardous chemicals. Thus, the sample preparation using chelating resin along with nested PCR seems to be a sensitive, specific and practical method for the detection of CPV in diarrhoeal feacal samples. [Vet. World 2010; 3(3.000: 105-106

  13. Development of bufferless gel electrophoresis chip for easy preparation and rapid DNA separation.

    Science.gov (United States)

    Oleksandrov, Sergiy; Aman, Abdurazak; Lim, Wanyoung; Kim, Younghee; Bae, Nam Ho; Lee, Kyoung G; Lee, Seok Jae; Park, Sungsu

    2018-02-01

    This work presents a handy, fast, and compact bufferless gel electrophoresis chip (BGEC), which consists of precast agarose gel confined in a disposable plastic body with electrodes. It does not require large volumes of buffer to fill reservoirs, or the process of immersing the gel in the buffer. It withstands voltages up to 28.4 V/cm, thereby allowing DNA separation within 10 min with a similar separation capability to the standard gel electrophoresis. The results suggest that our BGEC is highly suitable for in situ gel electrophoresis in forensic, epidemiological settings and crime scenes where standard gel electrophoresis equipment cannot be brought in while quick results are needed. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Evaluation of powdery mildew-resistance of grape germplasm and rapid amplified polymorphic DNA markers associated with the resistant trait in Chinese wild Vitis.

    Science.gov (United States)

    Zhang, J; Zhang, Y; Yu, H; Wang, Y

    2014-05-09

    The resistance of wild Vitis germplasm, including Chinese and American wild Vitis and Vitis vinifera cultivars, to powdery mildew (Uncinula necator Burr.) was evaluated for two consecutive years under natural conditions. Most of the Chinese and North American species displayed a resistant phenotype, whereas all of the European species were highly susceptible. The Alachua and Conquistador accessions of Vitis rotundifolia species, which originated in North America, were immune to the disease, while Baihe-35-1, one of the accessions of Vitis pseudoreticulata, showed the strongest resistance among all Chinese accessions evaluated. Three rapid amplified polymorphic DNA (RAPD) markers, OPW02-1756, OPO11-964, and OPY13-661, were obtained after screening 520 random primers among various germplasm, and these markers were found to be associated with powdery mildew resistance in Baihe-35-1 and in some Chinese species, but not in any European species. Analysis of F₁ and F₂ progenies of a cross between resistant Baihe-35-1 and susceptible Carignane (V. vinifera) revealed that the three RAPD markers were linked to the powdery resistant trait in Baihe-35-1 plants. Potential applications of the identified RAPD markers for gene mapping, marker-assisted selection, and breeding were investigated in 168 F₂ progenies of the same cross. Characterization of the resistant phenotype of the selected F₂ seedlings for breeding a new disease-resistant grape cultivar is in progress.

  15. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  16. Managing the wastewater microbiome: Rapid microbial surveillance using Nanopore DNA sequencing

    DEFF Research Database (Denmark)

    Andersen, Martin Hjorth; Kirkegaard, Rasmus Hansen; Albertsen, Mads

    and lead to process breakdown, leading to increased operational costs and potential environmental hazards[1,2]. With current methods, it is often impossible to predict a system crash before it is too late. Monitoring the microbial community for critical changes is tedious, as the process from sample...... to results generally take several days and requires expert knowledge as well as expensive lab facilities. A faster workflow is therefore necessary to ensure a more efficient wastewater management in the future. Experimental design Protocols were developed with focus on portability, ease-of-use and equipment...... (Oxford Nanopore Technologies, UK). The amplicon libraries were sequenced on a MinION (Oxford Nanopore Technologies, UK) and data for the first 10 minutes of sequencing was base-called on a local laptop, mapped to the MiDAS database using minimap2 and analysed in the R environment using the R package...

  17. Rapid DNA haplotyping using a multiplex heteroduplex approach: Application to Duchenne muscula dystrophy carrier detection

    Energy Technology Data Exchange (ETDEWEB)

    Prior, T.W.; Wenger, G.D.; Moore, J. [Ohio State Univ., Columbus, OH (United States)] [and others

    1994-09-01

    A new strategy has been developed for rapid haplotype analysis. It is based on an initial multiplex amplification of several polymorphic sites, followed by heteroduplex detection. Heteroduplexes formed between two different alleles are detected because they migrate differently than the corresponding homoduplexes in Hydrolink-MDE gel. The method is simple, rapid, does not depend on specific sequences such as restriction enzyme sites or CA boxes and does not require the use of isotope. This approach has been tested using 12 commonly occurring polymorphisms spanning the dystrophin gene as a model. We describe the use of the method to assign the carrier status of females in Duchenne muscular dystrophy (DMD) pedigrees. As a result of expanding the number of detectable polymorphisms throughout the dystrophin gene, we show how the method can easily be combined with dinucleotide analysis to improve the accuracy of carrier detection in the nondeletion cases. The technique is also shown to be used as an effective screen for improving carrier detection in several families with deletions. The finding of heterozygosity within the deletion identifies the at-risk female as a noncarrier. Using this method, we have identified and incorporated 3 new dystrophin polymorphisms (one of which in exon 16 is unique to African Americans). The method may be used other genetic diseases when mutations are unknown, or there are few dinucleotide markers in the gene proximity, or for the identification of haplotype backgrounds of mutant alleles.

  18. A first linkage map and downy mildew resistance QTL discovery for sweet basil (Ocimum basilicum) facilitated by double digestion restriction site associated DNA sequencing (ddRADseq).

    Science.gov (United States)

    Pyne, Robert; Honig, Josh; Vaiciunas, Jennifer; Koroch, Adolfina; Wyenandt, Christian; Bonos, Stacy; Simon, James

    2017-01-01

    Limited understanding of sweet basil (Ocimum basilicum L.) genetics and genome structure has reduced efficiency of breeding strategies. This is evidenced by the rapid, worldwide dissemination of basil downy mildew (Peronospora belbahrii) in the absence of resistant cultivars. In an effort to improve available genetic resources, expressed sequence tag simple sequence repeat (EST-SSR) and single nucleotide polymorphism (SNP) markers were developed and used to genotype the MRI x SB22 F2 mapping population, which segregates for response to downy mildew. SNP markers were generated from genomic sequences derived from double digestion restriction site associated DNA sequencing (ddRADseq). Disomic segregation was observed in both SNP and EST-SSR markers providing evidence of an O. basilicum allotetraploid genome structure and allowing for subsequent analysis of the mapping population as a diploid intercross. A dense linkage map was constructed using 42 EST-SSR and 1,847 SNP markers spanning 3,030.9 cM. Multiple quantitative trait loci (QTL) model (MQM) analysis identified three QTL that explained 37-55% of phenotypic variance associated with downy mildew response across three environments. A single major QTL, dm11.1 explained 21-28% of phenotypic variance and demonstrated dominant gene action. Two minor QTL dm9.1 and dm14.1 explained 5-16% and 4-18% of phenotypic variance, respectively. Evidence is provided for an additive effect between the two minor QTL and the major QTL dm11.1 increasing downy mildew susceptibility. Results indicate that ddRADseq-facilitated SNP and SSR marker genotyping is an effective approach for mapping the sweet basil genome.

  19. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae

    Directory of Open Access Journals (Sweden)

    Victor Manuel Gomez-Rodriguez

    2013-08-01

    Full Text Available Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in A. tequilana Weber, 1902 ‘Azul’, A. cupreata Trelease et Berger, 1915 and A. angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH was used for physical mapping of 5S and 18S ribosomal DNA (rDNA. All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.

  20. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae).

    Science.gov (United States)

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country's economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 'Azul', Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.

  1. Mapping the structural and dynamical features of multiple p53 DNA binding domains: insights into loop 1 intrinsic dynamics.

    Directory of Open Access Journals (Sweden)

    Suryani Lukman

    Full Text Available The transcription factor p53 regulates cellular integrity in response to stress. p53 is mutated in more than half of cancerous cells, with a majority of the mutations localized to the DNA binding domain (DBD. In order to map the structural and dynamical features of the DBD, we carried out multiple copy molecular dynamics simulations (totaling 0.8 μs. Simulations show the loop 1 to be the most dynamic element among the DNA-contacting loops (loops 1-3. Loop 1 occupies two major conformational states: extended and recessed; the former but not the latter displays correlations in atomic fluctuations with those of loop 2 (~24 Å apart. Since loop 1 binds to the major groove whereas loop 2 binds to the minor groove of DNA, our results begin to provide some insight into the possible mechanism underpinning the cooperative nature of DBD binding to DNA. We propose (1 a novel mechanism underlying the dynamics of loop 1 and the possible tread-milling of p53 on DNA and (2 possible mutations on loop 1 residues to restore the transcriptional activity of an oncogenic mutation at a distant site.

  2. MAP kinase-signaling controls nuclear translocation of tripeptidyl-peptidase II in response to DNA damage and oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Preta, Giulio; Klark, Rainier de; Chakraborti, Shankhamala [Center for Molecular Medicine (CMM), Department of Medicine, Karolinska Institutet, Karolinska University Hospital, 171 76 Stockholm (Sweden); Glas, Rickard, E-mail: rickard.glas@ki.se [Center for Molecular Medicine (CMM), Department of Medicine, Karolinska Institutet, Karolinska University Hospital, 171 76 Stockholm (Sweden)

    2010-08-27

    Research highlights: {yields} Nuclear translocation of TPPII occurs in response to different DNA damage inducers. {yields} Nuclear accumulation of TPPII is linked to ROS and anti-oxidant enzyme levels. {yields} MAPKs control nuclear accumulation of TPPII. {yields} Inhibited nuclear accumulation of TPPII decreases DNA damage-induced {gamma}-H2AX expression. -- Abstract: Reactive oxygen species (ROS) are a continuous hazard in eukaroytic cells by their ability to cause damage to biomolecules, in particular to DNA. Previous data indicated that the cytosolic serine peptidase tripeptidyl-peptidase II (TPPII) translocates into the nucleus of most tumor cell lines in response to {gamma}-irradiation and ROS production; an event that promoted p53 expression as well as caspase-activation. We here observed that nuclear translocation of TPPII was dependent on signaling by MAP kinases, including p38MAPK. Further, this was caused by several types of DNA-damaging drugs, a DNA cross-linker (cisplatinum), an inhibitor of topoisomerase II (etoposide), and to some extent also by nucleoside-analogues (5-fluorouracil, hydroxyurea). In the minority of tumor cell lines where TPPII was not translocated into the nucleus in response to DNA damage we observed reduced intracellular ROS levels, and the expression levels of redox defense systems were increased. Further, treatment with the ROS-inducer {gamma}-hexa-chloro-cyclohexane ({gamma}-HCH, lindane), an inhibitor of GAP junctions, restored nuclear translocation of TPPII in these cell lines upon {gamma}-irradiation. Moreover, blocking nuclear translocation of TPPII in etoposide-treated cells, by using a peptide-derived inhibitor (Z-Gly-Leu-Ala-OH), attenuated expression of {gamma}-H2AX in {gamma}-irradiated melanoma cells. Our results indicated a role for TPPII in MAPK-dependent DNA damage signaling.

  3. Laser electro-optic system for rapid three-dimensional /3-D/ topographic mapping of surfaces

    Science.gov (United States)

    Altschuler, M. D.; Altschuler, B. R.; Taboada, J.

    1981-01-01

    It is pointed out that the generic utility of a robot in a factory/assembly environment could be substantially enhanced by providing a vision capability to the robot. A standard videocamera for robot vision provides a two-dimensional image which contains insufficient information for a detailed three-dimensional reconstruction of an object. Approaches which supply the additional information needed for the three-dimensional mapping of objects with complex surface shapes are briefly considered and a description is presented of a laser-based system which can provide three-dimensional vision to a robot. The system consists of a laser beam array generator, an optical image recorder, and software for controlling the required operations. The projection of a laser beam array onto a surface produces a dot pattern image which is viewed from one or more suitable perspectives. Attention is given to the mathematical method employed, the space coding technique, the approaches used for obtaining the transformation parameters, the optics for laser beam array generation, the hardware for beam array coding, and aspects of image acquisition.

  4. Combination of UAV and terrestrial photogrammetry to assess rapid glacier evolution and map glacier hazards

    Science.gov (United States)

    Fugazza, Davide; Scaioni, Marco; Corti, Manuel; D'Agata, Carlo; Azzoni, Roberto Sergio; Cernuschi, Massimo; Smiraglia, Claudio; Diolaiuti, Guglielmina Adele

    2018-04-01

    Tourists and hikers visiting glaciers all year round face hazards such as sudden terminus collapses, typical of such a dynamically evolving environment. In this study, we analyzed the potential of different survey techniques to analyze hazards of the Forni Glacier, an important geosite located in Stelvio Park (Italian Alps). We carried out surveys in the 2016 ablation season and compared point clouds generated from an unmanned aerial vehicle (UAV) survey, close-range photogrammetry and terrestrial laser scanning (TLS). To investigate the evolution of glacier hazards and evaluate the glacier thinning rate, we also used UAV data collected in 2014 and a digital elevation model (DEM) created from an aerial photogrammetric survey of 2007. We found that the integration between terrestrial and UAV photogrammetry is ideal for mapping hazards related to the glacier collapse, while TLS is affected by occlusions and is logistically complex in glacial terrain. Photogrammetric techniques can therefore replace TLS for glacier studies and UAV-based DEMs hold potential for becoming a standard tool in the investigation of glacier thickness changes. Based on our data sets, an increase in the size of collapses was found over the study period, and the glacier thinning rates went from 4.55 ± 0.24 m a-1 between 2007 and 2014 to 5.20 ± 1.11 m a-1 between 2014 and 2016.

  5. The development of a loop-mediated isothermal amplification assay for rapid and sensitive detection of abalone herpesvirus DNA.

    Science.gov (United States)

    Chen, M H; Kuo, S T; Renault, T; Chang, P H

    2014-02-01

    A loop-mediated isothermal amplification (LAMP) assay was developed for the detection of abalone herpesvirus DNA. Two pairs of primers were designed, based on the sequence of the DNA polymerase gene of abalone herpesvirus. The reaction temperature and time were optimized to 63°C and 60min, respectively. LAMP amplicons were analyzed by 2% agarose gel electrophoresis or by visual inspection of a colour change emitted by fluorescent dye. The method developed was specific for the detection of abalone herpesvirus, without cross-reactions with other tested herpesviruses including ostreid herpesvirus 1 (OsHV-1), European eel herpesvirus, koi herpesvirus (KHV) and an avian herpesvirus. The LAMP assay was 100 folds more sensitive than a conventional PCR and 10 folds less sensitive than a SYBR Green PCR. These results indicate that the developed LAMP assay is a simple, rapid, sensitive, specific and reliable technique for the detection of abalone herpesvirus. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Mass spectrometric-based stable isotopic 2-aminobenzoic acid glycan mapping for rapid glycan screening of biotherapeutics.

    Science.gov (United States)

    Prien, Justin M; Prater, Bradley D; Qin, Qiang; Cockrill, Steven L

    2010-02-15

    Fast, sensitive, robust methods for "high-level" glycan screening are necessary during various stages of a biotherapeutic product's lifecycle, including clone selection, process changes, and quality control for lot release testing. Traditional glycan screening involves chromatographic or electrophoretic separation-based methods, and, although reproducible, these methods can be time-consuming. Even ultrahigh-performance chromatographic and microfluidic integrated LC/MS systems, which work on the tens of minute time scale, become lengthy when hundreds of samples are to be analyzed. Comparatively, a direct infusion mass spectrometry (MS)-based glycan screening method acquires data on a millisecond time scale, exhibits exquisite sensitivity and reproducibility, and is amenable to automated peak annotation. In addition, characterization of glycan species via sequential mass spectrometry can be performed simultaneously. Here, we demonstrate a quantitative high-throughput MS-based mapping approach using stable isotope 2-aminobenzoic acid (2-AA) for rapid "high-level" glycan screening.

  7. Rapid, semi-automatic fracture and contact mapping for point clouds, images and geophysical data

    Science.gov (United States)

    Thiele, Samuel T.; Grose, Lachlan; Samsu, Anindita; Micklethwaite, Steven; Vollgger, Stefan A.; Cruden, Alexander R.

    2017-12-01

    The advent of large digital datasets from unmanned aerial vehicle (UAV) and satellite platforms now challenges our ability to extract information across multiple scales in a timely manner, often meaning that the full value of the data is not realised. Here we adapt a least-cost-path solver and specially tailored cost functions to rapidly interpolate structural features between manually defined control points in point cloud and raster datasets. We implement the method in the geographic information system QGIS and the point cloud and mesh processing software CloudCompare. Using these implementations, the method can be applied to a variety of three-dimensional (3-D) and two-dimensional (2-D) datasets, including high-resolution aerial imagery, digital outcrop models, digital elevation models (DEMs) and geophysical grids. We demonstrate the algorithm with four diverse applications in which we extract (1) joint and contact patterns in high-resolution orthophotographs, (2) fracture patterns in a dense 3-D point cloud, (3) earthquake surface ruptures of the Greendale Fault associated with the Mw7.1 Darfield earthquake (New Zealand) from high-resolution light detection and ranging (lidar) data, and (4) oceanic fracture zones from bathymetric data of the North Atlantic. The approach improves the consistency of the interpretation process while retaining expert guidance and achieves significant improvements (35-65 %) in digitisation time compared to traditional methods. Furthermore, it opens up new possibilities for data synthesis and can quantify the agreement between datasets and an interpretation.

  8. Single-base resolution maps of cultivated and wild rice methylomes and regulatory roles of DNA methylation in plant gene expression

    DEFF Research Database (Denmark)

    Li, Xin; Zhu, Jingde; Hu, Fengyi

    2012-01-01

    DNA methylation plays important biological roles in plants and animals. To examine the rice genomic methylation landscape and assess its functional significance, we generated single-base resolution DNA methylome maps for Asian cultivated rice Oryza sativa ssp. japonica, indica and their wild rela...

  9. A DNA minor groove electronegative potential genome map based on photo-chemical probing

    DEFF Research Database (Denmark)

    Lindemose, Søren; Nielsen, Peter Eigil; Hansen, Morten

    2011-01-01

    The double-stranded DNA of the genome contains both sequence information directly relating to the protein and RNA coding as well as functional and structural information relating to protein recognition. Only recently is the importance of DNA shape in this recognition process being fully appreciat...

  10. DNA template strand sequencing of single-cells maps genomic rearrangements at high resolution

    NARCIS (Netherlands)

    Falconer, Ester; Hills, Mark; Naumann, Ulrike; Poon, Steven S. S.; Chavez, Elizabeth A.; Sanders, Ashley D.; Zhao, Yongjun; Hirst, Martin; Lansdorp, Peter M.

    DNA rearrangements such as sister chromatid exchanges (SCEs) are sensitive indicators of genomic stress and instability, but they are typically masked by single-cell sequencing techniques. We developed Strand-seq to independently sequence parental DNA template strands from single cells, making it

  11. DNA Mapping Made Simple: An Intellectual Activity about the Genetic Modification of Organisms

    Science.gov (United States)

    Marques, Miguel; Arrabaca, Joao; Chagas, Isabel

    2004-01-01

    Since the discovery of the DNA double helix (in 1953 by Watson and Crick), technologies have been developed that allow scientists to manipulate the genome of bacteria to produce human hormones, as well as the genome of crop plants to achieve high yield and enhanced flavor. The universality of the genetic code has allowed DNA isolated from a…

  12. Unique mitochondrial DNA lineages in Irish stickleback populations: cryptic refugium or rapid recolonization?

    Science.gov (United States)

    Ravinet, Mark; Harrod, Chris; Eizaguirre, Christophe; Prodöhl, Paulo A

    2014-06-01

    Repeated recolonization of freshwater environments following Pleistocene glaciations has played a major role in the evolution and adaptation of anadromous taxa. Located at the western fringe of Europe, Ireland and Britain were likely recolonized rapidly by anadromous fishes from the North Atlantic following the last glacial maximum (LGM). While the presence of unique mitochondrial haplotypes in Ireland suggests that a cryptic northern refugium may have played a role in recolonization, no explicit test of this hypothesis has been conducted. The three-spined stickleback is native and ubiquitous to aquatic ecosystems throughout Ireland, making it an excellent model species with which to examine the biogeographical history of anadromous fishes in the region. We used mitochondrial and microsatellite markers to examine the presence of divergent evolutionary lineages and to assess broad-scale patterns of geographical clustering among postglacially isolated populations. Our results confirm that Ireland is a region of secondary contact for divergent mitochondrial lineages and that endemic haplotypes occur in populations in Central and Southern Ireland. To test whether a putative Irish lineage arose from a cryptic Irish refugium, we used approximate Bayesian computation (ABC). However, we found no support for this hypothesis. Instead, the Irish lineage likely diverged from the European lineage as a result of postglacial isolation of freshwater populations by rising sea levels. These findings emphasize the need to rigorously test biogeographical hypothesis and contribute further evidence that postglacial processes may have shaped genetic diversity in temperate fauna.

  13. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    OpenAIRE

    Farkhondeh Saba; Moslem Papizadeh; Javad Khansha; Mahshid Sedghi; Mehrnoosh Rasooli; Mohammad Ali Amoozegar; Mohammad Reza Soudi; Seyed Abolhassan Shahzadeh Fazeli

    2016-01-01

    Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR). Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Me...

  14. Genome Sequencing and Mapping Reveal Loss of Heterozygosity as a Mechanism for Rapid Adaptation in the Vegetable Pathogen Phytophthora capsici

    Energy Technology Data Exchange (ETDEWEB)

    Lamour, Kurt H.; Mudge, Joann; Gobena, Daniel; Hurtado-Gonzales, Oscar P.; Schmutz, Jeremy; Kuo, Alan; Miller, Neil A.; Rice, Brandon J.; Raffaele, Sylvain; Cano, Liliana M.; Bharti, Arvind K.; Donahoo, Ryan S.; Finely, Sabra; Huitema, Edgar; Hulvey, Jon; Platt, Darren; Salamov, Asaf; Savidor, Alon; Sharma, Rahul; Stam, Remco; Sotrey, Dylan; Thines, Marco; Win, Joe; Haas, Brian J.; Dinwiddie, Darrell L.; Jenkins, Jerry; Knight, James R.; Affourtit, Jason P.; Han, Cliff S.; Chertkov, Olga; Lindquist, Erika A.; Detter, Chris; Grigoriev, Igor V.; Kamoun, Sophien; Kingsmore, Stephen F.

    2012-02-07

    The oomycete vegetable pathogen Phytophthora capsici has shown remarkable adaptation to fungicides and new hosts. Like other members of this destructive genus, P. capsici has an explosive epidemiology, rapidly producing massive numbers of asexual spores on infected hosts. In addition, P. capsici can remain dormant for years as sexually recombined oospores, making it difficult to produce crops at infested sites, and allowing outcrossing populations to maintain significant genetic variation. Genome sequencing, development of a high-density genetic map, and integrative genomic or genetic characterization of P. capsici field isolates and intercross progeny revealed significant mitotic loss of heterozygosity (LOH) in diverse isolates. LOH was detected in clonally propagated field isolates and sexual progeny, cumulatively affecting >30percent of the genome. LOH altered genotypes for more than 11,000 single-nucleotide variant sites and showed a strong association with changes in mating type and pathogenicity. Overall, it appears that LOH may provide a rapid mechanism for fixing alleles and may be an important component of adaptability for P. capsici.

  15. Full-length cDNA sequences from Rhesus monkey placenta tissue: analysis and utility for comparative mapping

    Directory of Open Access Journals (Sweden)

    Lee Sang-Rae

    2010-07-01

    Full Text Available Abstract Background Rhesus monkeys (Macaca mulatta are widely-used as experimental animals in biomedical research and are closely related to other laboratory macaques, such as cynomolgus monkeys (Macaca fascicularis, and to humans, sharing a last common ancestor from about 25 million years ago. Although rhesus monkeys have been studied extensively under field and laboratory conditions, research has been limited by the lack of genetic resources. The present study generated placenta full-length cDNA libraries, characterized the resulting expressed sequence tags, and described their utility for comparative mapping with human RefSeq mRNA transcripts. Results From rhesus monkey placenta full-length cDNA libraries, 2000 full-length cDNA sequences were determined and 1835 rhesus placenta cDNA sequences longer than 100 bp were collected. These sequences were annotated based on homology to human genes. Homology search against human RefSeq mRNAs revealed that our collection included the sequences of 1462 putative rhesus monkey genes. Moreover, we identified 207 genes containing exon alterations in the coding region and the untranslated region of rhesus monkey transcripts, despite the highly conserved structure of the coding regions. Approximately 10% (187 of all full-length cDNA sequences did not represent any public human RefSeq mRNAs. Intriguingly, two rhesus monkey specific exons derived from the transposable elements of AluYRa2 (SINE family and MER11B (LTR family were also identified. Conclusion The 1835 rhesus monkey placenta full-length cDNA sequences described here could expand genomic resources and information of rhesus monkeys. This increased genomic information will greatly contribute to the development of evolutionary biology and biomedical research.

  16. DNA Physical Mapping via the Controlled Translocation of Single Molecules through a 5-10nm Silicon Nitride Nanopore

    Science.gov (United States)

    Stein, Derek; Reisner, Walter; Jiang, Zhijun; Hagerty, Nick; Wood, Charles; Chan, Jason

    2009-03-01

    The ability to map the binding position of sequence-specific markers, including transcription-factors, protein-nucleic acids (PNAs) or deactivated restriction enzymes, along a single DNA molecule in a nanofluidic device would be of key importance for the life-sciences. Such markers could give an indication of the active genes at particular stage in a cell's transcriptional cycle, pinpoint the location of mutations or even provide a DNA barcode that could aid in genomics applications. We have developed a setup consisting of a 5-10 nm nanopore in a 20nm thick silicon nitride film coupled to an optical tweezer setup. The translocation of DNA across the nanopore can be detected via blockades in the electrical current through the pore. By anchoring one end of the translocating DNA to an optically trapped microsphere, we hope to stretch out the molecule in the nanopore and control the translocation speed, enabling us to slowly scan across the genome and detect changes in the baseline current due to the presence of bound markers.

  17. Clustering self-organizing maps (SOM) method for human papillomavirus (HPV) DNA as the main cause of cervical cancer disease

    Science.gov (United States)

    Bustamam, A.; Aldila, D.; Fatimah, Arimbi, M. D.

    2017-07-01

    One of the most widely used clustering method, since it has advantage on its robustness, is Self-Organizing Maps (SOM) method. This paper discusses the application of SOM method on Human Papillomavirus (HPV) DNA which is the main cause of cervical cancer disease, the most dangerous cancer in developing countries. We use 18 types of HPV DNA-based on the newest complete genome. By using open-source-based program R, clustering process can separate 18 types of HPV into two different clusters. There are two types of HPV in the first cluster while 16 others in the second cluster. The analyzing result of 18 types HPV based on the malignancy of the virus (the difficultness to cure). Two of HPV types the first cluster can be classified as tame HPV, while 16 others in the second cluster are classified as vicious HPV.

  18. Mouse tetranectin: cDNA sequence, tissue-specific expression, and chromosomal mapping

    DEFF Research Database (Denmark)

    Ibaraki, K; Kozak, C A; Wewer, U M

    1995-01-01

    regulation, mouse tetranectin cDNA was cloned from a 16-day-old mouse embryo library. Sequence analysis revealed a 992-bp cDNA with an open reading frame of 606 bp, which is identical in length to the human tetranectin cDNA. The deduced amino acid sequence showed high homology to the human cDNA with 76......(s) of tetranectin. The sequence analysis revealed a difference in both sequence and size of the noncoding regions between mouse and human cDNAs. Northern analysis of the various tissues from mouse, rat, and cow showed the major transcript(s) to be approximately 1 kb, which is similar in size to that observed...

  19. Molecular Cytogenetic Mapping of Satellite DNA Sequences in Aegilops geniculata and Wheat

    Czech Academy of Sciences Publication Activity Database

    Koo, D.H.; Tiwari, V.K.; Hřibová, Eva; Doležel, Jaroslav; Friebe, B.; Gill, B.S.

    2016-01-01

    Roč. 148, č. 4 (2016), s. 314-321 ISSN 1424-8581 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : in-situ hybridization * chromosome addition lines * resistance genes lr57 * repetitive dna * triticum-ovatum * powdery mildew * plant genome * bread wheat * leaf rust * identification * Aegilops geniculata * Chromosome identification * Fluorescence in situ hybridization * Satellite DNA * Wheat Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.354, year: 2016

  20. Rapid one-step selection method for generating nucleic acid aptamers: development of a DNA aptamer against α-bungarotoxin.

    Directory of Open Access Journals (Sweden)

    Lasse H Lauridsen

    Full Text Available BACKGROUND: Nucleic acids based therapeutic approaches have gained significant interest in recent years towards the development of therapeutics against many diseases. Recently, research on aptamers led to the marketing of Macugen®, an inhibitor of vascular endothelial growth factor (VEGF for the treatment of age related macular degeneration (AMD. Aptamer technology may prove useful as a therapeutic alternative against an array of human maladies. Considering the increased interest in aptamer technology globally that rival antibody mediated therapeutic approaches, a simplified selection, possibly in one-step, technique is required for developing aptamers in limited time period. PRINCIPAL FINDINGS: Herein, we present a simple one-step selection of DNA aptamers against α-bungarotoxin. A toxin immobilized glass coverslip was subjected to nucleic acid pool binding and extensive washing followed by PCR enrichment of the selected aptamers. One round of selection successfully identified a DNA aptamer sequence with a binding affinity of 7.58 µM. CONCLUSION: We have demonstrated a one-step method for rapid production of nucleic acid aptamers. Although the reported binding affinity is in the low micromolar range, we believe that this could be further improved by using larger targets, increasing the stringency of selection and also by combining a capillary electrophoresis separation prior to the one-step selection. Furthermore, the method presented here is a user-friendly, cheap and an easy way of deriving an aptamer unlike the time consuming conventional SELEX-based approach. The most important application of this method is that chemically-modified nucleic acid libraries can also be used for aptamer selection as it requires only one enzymatic step. This method could equally be suitable for developing RNA aptamers.

  1. Feedback-regulated poly(ADP-ribosyl)ation by PARP-1 is required for rapid response to DNA damage in living cells

    Science.gov (United States)

    Mortusewicz, Oliver; Amé, Jean-Christophe; Leonhardt, Heinrich

    2007-01-01

    Genome integrity is constantly threatened by DNA lesions arising from numerous exogenous and endogenous sources. Survival depends on immediate recognition of these lesions and rapid recruitment of repair factors. Using laser microirradiation and live cell microscopy we found that the DNA-damage dependent poly(ADP-ribose) polymerases (PARP) PARP-1 and PARP-2 are recruited to DNA damage sites, however, with different kinetics and roles. With specific PARP inhibitors and mutations, we could show that the initial recruitment of PARP-1 is mediated by the DNA-binding domain. PARP-1 activation and localized poly(ADP-ribose) synthesis then generates binding sites for a second wave of PARP-1 recruitment and for the rapid accumulation of the loading platform XRCC1 at repair sites. Further PARP-1 poly(ADP-ribosyl)ation eventually initiates the release of PARP-1. We conclude that feedback regulated recruitment of PARP-1 and concomitant local poly(ADP-ribosyl)ation at DNA lesions amplifies a signal for rapid recruitment of repair factors enabling efficient restoration of genome integrity. PMID:17982172

  2. Non-invasive transdermal two-dimensional mapping of cutaneous oxygenation with a rapid-drying liquid bandage.

    Science.gov (United States)

    Li, Zongxi; Roussakis, Emmanuel; Koolen, Pieter G L; Ibrahim, Ahmed M S; Kim, Kuylhee; Rose, Lloyd F; Wu, Jesse; Nichols, Alexander J; Baek, Yunjung; Birngruber, Reginald; Apiou-Sbirlea, Gabriela; Matyal, Robina; Huang, Thomas; Chan, Rodney; Lin, Samuel J; Evans, Conor L

    2014-11-01

    Oxygen plays an important role in wound healing, as it is essential to biological functions such as cell proliferation, immune responses and collagen synthesis. Poor oxygenation is directly associated with the development of chronic ischemic wounds, which affect more than 6 million people each year in the United States alone at an estimated cost of $25 billion. Knowledge of oxygenation status is also important in the management of burns and skin grafts, as well as in a wide range of skin conditions. Despite the importance of the clinical determination of tissue oxygenation, there is a lack of rapid, user-friendly and quantitative diagnostic tools that allow for non-disruptive, continuous monitoring of oxygen content across large areas of skin and wounds to guide care and therapeutic decisions. In this work, we describe a sensitive, colorimetric, oxygen-sensing paint-on bandage for two-dimensional mapping of tissue oxygenation in skin, burns, and skin grafts. By embedding both an oxygen-sensing porphyrin-dendrimer phosphor and a reference dye in a liquid bandage matrix, we have created a liquid bandage that can be painted onto the skin surface and dries into a thin film that adheres tightly to the skin or wound topology. When captured by a camera-based imaging device, the oxygen-dependent phosphorescence emission of the bandage can be used to quantify and map both the pO2 and oxygen consumption of the underlying tissue. In this proof-of-principle study, we first demonstrate our system on a rat ischemic limb model to show its capabilities in sensing tissue ischemia. It is then tested on both ex vivo and in vivo porcine burn models to monitor the progression of burn injuries. Lastly, the bandage is applied to an in vivo porcine graft model for monitoring the integration of full- and partial-thickness skin grafts.

  3. The rapid moving Capriglio earth flow (Parma Province, North Italy): multi-temporal mapping and GB-InSAR monitoring

    Science.gov (United States)

    Bardi, Federica; Raspini, Federico; Frodella, William; Lombardi, Luca; Nocentini, Massimiliano; Gigli, Giovanni; Morelli, Stefano; Corsini, Alessandro; Casagli, Nicola

    2017-04-01

    This research presents the main findings of the multi-temporal mapping and of the long-term, real-time monitoring of the Capriglio landslide in the Emilian Apennines (Northern Italy). The landslide, triggered by prolonged rainfall and rapid snowmelt, activated of April 6th 2013. It is constituted by two main adjacent enlarging bodies with a roto-translational kinematics. They activated in sequence and subsequently joined into a large fast moving earth flow, channelizing downstream the Bardea Creek, for a total length of about 3600 meters. The landslide completely destroyed a 450 m sector of the provincial roadway S.P. 101, and its retrogression tendency put at high risk the Capriglio and Pianestolla villages, located in the upper watershed area of the Bardea River. Furthermore, the advancing toe seriously threatened the Antria bridge, representing the "Massese" provincial roadway S.P. 665R transect over the Bardea Creek, the only strategic roadway left able to connect the above-mentioned villages. With the final aim of supporting local authorities in the hazard assessment and risk management during the emergency phase, on May 5th 2013 aerial optical surveys were conducted to accurately map the landslide extension and evolution. Moreover, a GB-InSAR monitoring campaign was started in order to assess displacements of the whole landslide area. The versatility and flexibility of the GB-InSAR sensors allowed acquiring data with two different configurations, designed and set up to continuously retrieve information on the landslide movements rates (both in its upper slow-moving sectors and in its fast-moving toe). The first acquisition mode revealed that the Capriglio and Pianestolla villages were affected by minor displacements (order of magnitude of few millimetres per month). The second acquisition mode allowed to acquire data every 28'', reaching very high temporal resolution values by applying GB-InSAR technique (Monserrat et al., 2014; Caduff et al., 2015).

  4. Enzymic colorimetry-based DNA chip: a rapid and accurate assay for detecting mutations for clarithromycin resistance in the 23S rRNA gene of Helicobacter pylori.

    Science.gov (United States)

    Xuan, Shi-Hai; Zhou, Yu-Gui; Shao, Bo; Cui, Ya-Lin; Li, Jian; Yin, Hong-Bo; Song, Xiao-Ping; Cong, Hui; Jing, Feng-Xiang; Jin, Qing-Hui; Wang, Hui-Min; Zhou, Jie

    2009-11-01

    Macrolide drugs, such as clarithromycin (CAM), are a key component of many combination therapies used to eradicate Helicobacter pylori. However, resistance to CAM is increasing in H. pylori and is becoming a serious problem in H. pylori eradication therapy. CAM resistance in H. pylori is mostly due to point mutations (A2142G/C, A2143G) in the peptidyltransferase-encoding region of the 23S rRNA gene. In this study an enzymic colorimetry-based DNA chip was developed to analyse single-nucleotide polymorphisms of the 23S rRNA gene to determine the prevalence of mutations in CAM-related resistance in H. pylori-positive patients. The results of the colorimetric DNA chip were confirmed by direct DNA sequencing. In 63 samples, the incidence of the A2143G mutation was 17.46 % (11/63). The results of the colorimetric DNA chip were concordant with DNA sequencing in 96.83 % of results (61/63). The colorimetric DNA chip could detect wild-type and mutant signals at every site, even at a DNA concentration of 1.53 x 10(2) copies microl(-1). Thus, the colorimetric DNA chip is a reliable assay for rapid and accurate detection of mutations in the 23S rRNA gene of H. pylori that lead to CAM-related resistance, directly from gastric tissues.

  5. A Rapid, Accurate, and Efficient Method to Map Heavy Metal-Contaminated Soils of Abandoned Mine Sites Using Converted Portable XRF Data and GIS

    Directory of Open Access Journals (Sweden)

    Jangwon Suh

    2016-12-01

    Full Text Available The use of portable X-ray fluorescence (PXRF and inductively coupled plasma atomic emission spectrometry (ICP-AES increases the rapidity and accuracy of soil contamination mapping, respectively. In practice, it is often necessary to repeat the soil contamination assessment and mapping procedure several times during soil management within a limited budget. In this study, we have developed a rapid, inexpensive, and accurate soil contamination mapping method using a PXRF data and geostatistical spatial interpolation. To obtain a large quantity of high quality data for interpolation, in situ PXRF data analyzed at 40 points were transformed to converted PXRF data using the correlation between PXRF and ICP-AES data. The method was applied to an abandoned mine site in Korea to generate a soil contamination map for copper and was validated for investigation speed and prediction accuracy. As a result, regions that required soil remediation were identified. Our method significantly shortened the time required for mapping compared to the conventional mapping method and provided copper concentration estimates with high accuracy similar to those measured by ICP-AES. Therefore, our method is an effective way of mapping soil contamination if we consistently construct a database based on the correlation between PXRF and ICP-AES data.

  6. Microfluidic method for rapid turbidimetric detection of the DNA of Mycobacterium tuberculosis using loop-mediated isothermal amplification in capillary tubes

    International Nuclear Information System (INIS)

    Rafati, Adele; Gill, Pooria

    2015-01-01

    We describe a microfluidic method for rapid isothermal turbidimetric detection of the DNA of Mycobacterium tuberculosis. Loop-mediated isothermal amplification is accomplished in capillary tubes for amplifying DNA in less than 15 min, and sensitivity and specificity were compared to conventional loop-mediated isothermal amplification (LAMP). The method can detect as little as 1 pg mL −1 DNA in a sample. Results obtained with clinical specimens indicated 90 % sensitivity and 95 % specificity for microfluidic LAMP in comparison to culture methods. No interference occurred due to the presence of nonspecific DNAs. The findings demonstrate the power of the new microfluidic LAMP test for rapid molecular detection of microorganisms even when using bare eyes. (author)

  7. OligoHeatMap (OHM): an online tool to estimate and display hybridizations of oligonucleotides onto DNA sequences.

    Science.gov (United States)

    Croce, Olivier; Chevenet, François; Christen, Richard

    2008-07-01

    The efficiency of molecular methods involving DNA/DNA hybridizations depends on the accurate prediction of the melting temperature (T(m)) of the duplex. Many softwares are available for T(m) calculations, but difficulties arise when one wishes to check if a given oligomer (PCR primer or probe) hybridizes well or not on more than a single sequence. Moreover, the presence of mismatches within the duplex is not sufficient to estimate specificity as it does not always significantly decrease the T(m). OHM (OligoHeatMap) is an online tool able to provide estimates of T(m) for a set of oligomers and a set of aligned sequences, not only as text files of complete results but also in a graphical way: T(m) values are translated into colors and displayed as a heat map image, either stand alone or to be used by softwares such as TreeDyn to be included in a phylogenetic tree. OHM is freely available at http://bioinfo.unice.fr/ohm/, with links to the full source code and online help.

  8. Distribution of Plasmodium species on the island of Grande Comore on the basis of DNA extracted from rapid diagnostic tests

    Directory of Open Access Journals (Sweden)

    Papa Mze Nasserdine

    2016-01-01

    Full Text Available In the Union of Comoros, interventions for combating malaria have contributed to a spectacular decrease in the prevalence of the disease. We studied the current distribution of Plasmodium species on the island of Grande Comore using nested PCR. The rapid diagnostic tests (RDTs currently used in the Comoros are able to identify Plasmodium falciparum but no other Plasmodium species. In this study, we tested 211 RDTs (158 positive and 53 negative. Among the 158 positive RDTs, 22 were positive for HRP2, 3 were positive only for pLDH, and 133 were positive for HRP2 and pLDH. DNA was extracted from a proximal part of the nitrocellulose membrane of RDTs. A total of 159 samples were positive by nested PCR. Of those, 156 (98.11% were positive for P. falciparum, 2 (1.25% were positive for P. vivaxI, and 1 (0.62% was positive for P. malariae. None of the samples were positive for P. ovale. Our results show that P. falciparum is still the most dominant species on the island of Grande Comore, but P. vivax and P. malariae are present at a low prevalence.

  9. Nanobodies: site-specific labeling for super-resolution imaging, rapid epitope-mapping and native protein complex isolation

    Science.gov (United States)

    Pleiner, Tino; Bates, Mark; Trakhanov, Sergei; Lee, Chung-Tien; Schliep, Jan Erik; Chug, Hema; Böhning, Marc; Stark, Holger; Urlaub, Henning; Görlich, Dirk

    2015-01-01

    Nanobodies are single-domain antibodies of camelid origin. We generated nanobodies against the vertebrate nuclear pore complex (NPC) and used them in STORM imaging to locate individual NPC proteins with nanobody sequence and labeled the resulting proteins with fluorophore-maleimides. As nanobodies are normally stabilized by disulfide-bonded cysteines, this appears counterintuitive. Yet, our analysis showed that this caused no folding problems. Compared to traditional NHS ester-labeling of lysines, the cysteine-maleimide strategy resulted in far less background in fluorescence imaging, it better preserved epitope recognition and it is site-specific. We also devised a rapid epitope-mapping strategy, which relies on crosslinking mass spectrometry and the introduced ectopic cysteines. Finally, we used different anti-nucleoporin nanobodies to purify the major NPC building blocks – each in a single step, with native elution and, as demonstrated, in excellent quality for structural analysis by electron microscopy. The presented strategies are applicable to any nanobody and nanobody-target. DOI: http://dx.doi.org/10.7554/eLife.11349.001 PMID:26633879

  10. Rapid method for detecting base damage in DNA of mammalian cells: assay of U. V. -induced pyrimidine dimers in human cells

    Energy Technology Data Exchange (ETDEWEB)

    Bryant, P E [Hammersmith Hospital, London (UK). M.R.C. Cyclotron Unit; Jansson, G; Ahnstroem, G

    1978-11-01

    Simple and rapid techniques are described for the detection of pyrimidine dimers in DNA. Human cells derived from embryonic lung tissue were UV-irradiated and subjected to either an osmotic shock procedure or detergent lysis, then treated with UV-endonuclease from Micrococcus luteus and the DNA partially denatured by treatment with weak alkali. Brief sonication reduced the molecular weight of the DNA, and the single- and double-stranded DNA could then be separated by hydroxylapatite chromatography. Approximately 40% of the expected number of pyrimidine dimers were detected by the enzyme treatment technique. The mean value of numbers of strand breaks per 10/sup 9/ dalton per J/m/sup 2/ was approximately 50% of the expected value. The method has advantages of speed and reproducibility and a large reduction in the quantities of materials used, particularly at the scintillation-counting stage.

  11. Loop-mediated isothermal amplification (LAMP) assay-A rapid detection tool for identifying red fox (Vulpes vulpes) DNA in the carcasses of harbour porpoises (Phocoena phocoena).

    Science.gov (United States)

    Heers, Teresa; van Neer, Abbo; Becker, André; Grilo, Miguel Luca; Siebert, Ursula; Abdulmawjood, Amir

    2017-01-01

    Carcasses of wild animals are often visited by different scavengers. However, determining which scavenger caused certain types of bite marks is particularly difficult and knowledge thereof is lacking. Therefore, a loop-mediated isothermal amplification (LAMP) assay (target sequence cytochrome b) was developed to detect red fox DNA in carcasses of harbour porpoises. The MSwab™ method for direct testing without prior DNA isolation was validated. As a detection device, the portable real-time fluorometer Genie® II was used, which yields rapid results and can be used in field studies without huge laboratory equipment. In addition to in vitro evaluation and validation, a stranded and scavenged harbour porpoise carcass was successfully examined for red fox DNA residues. The developed LAMP method is a valuable diagnostic tool for confirming presumable red fox bite wounds in harbour porpoises without further DNA isolation steps.

  12. Potassium hydroxide-ethylene diamine tetraacetic acid method for the rapid preparation of small-scale PCR template DNA from actinobacteria.

    Science.gov (United States)

    Sun, Zhibin; Huang, Yan; Wang, Yanzhuo; Zhao, Yuguo; Cui, Zhongli

    2014-01-01

    Genomic DNA extraction from Gram-positive bacteria is a laborious and time-consuming process. A rapid and convenient method was established to extract genomic DNA from a single colony as a PCR template. KOH-EDTA is used as a lysis buffer to disrupt the cell envelope, releasing genomic DNA, and Tris-HCl (pH = 4) is then added to neutralize the lysate. The lysate can be used directly as a template for PCR amplification. 16S rDNA was successfully amplified from Gram-positive bacteria from the genera of Bacillus, Streptomyces, Micromonospora, Nonomuraea, Microbispora, and Staphylococcus. Amplification of the trpB gene indicated that this method could also be applied to the amplification of functional genes. Compared to colony PCR methods without KOH-EDTA, this method is extremely fast and efficient, and it is applicable to high-throughput PCR amplifications.

  13. Simple design for DNA nanotubes from a minimal set of unmodified strands: rapid, room-temperature assembly and readily tunable structure.

    Science.gov (United States)

    Hamblin, Graham D; Hariri, Amani A; Carneiro, Karina M M; Lau, Kai L; Cosa, Gonzalo; Sleiman, Hanadi F

    2013-04-23

    DNA nanotubes have great potential as nanoscale scaffolds for the organization of materials and the templation of nanowires and as drug delivery vehicles. Current methods for making DNA nanotubes either rely on a tile-based step-growth polymerization mechanism or use a large number of component strands and long annealing times. Step-growth polymerization gives little control over length, is sensitive to stoichiometry, and is slow to generate long products. Here, we present a design strategy for DNA nanotubes that uses an alternative, more controlled growth mechanism, while using just five unmodified component strands and a long enzymatically produced backbone. These tubes form rapidly at room temperature and have numerous, orthogonal sites available for the programmable incorporation of arrays of cargo along their length. As a proof-of-concept, cyanine dyes were organized into two distinct patterns by inclusion into these DNA nanotubes.

  14. Quantification and genome-wide mapping of DNA double-strand breaks.

    Science.gov (United States)

    Grégoire, Marie-Chantal; Massonneau, Julien; Leduc, Frédéric; Arguin, Mélina; Brazeau, Marc-André; Boissonneault, Guylain

    2016-12-01

    DNA double-strand breaks (DSBs) represent a major threat to the genetic integrity of the cell. Knowing both their genome-wide distribution and number is important for a better assessment of genotoxicity at a molecular level. Available methods may have underestimated the extent of DSBs as they are based on markers specific to those undergoing active repair or may not be adapted for the large diversity of naturally occurring DNA ends. We have established conditions for an efficient first step of DNA nick and gap repair (NGR) allowing specific determination of DSBs by end labeling with terminal transferase. We used DNA extracted from HeLa cells harboring an I-SceI cassette to induce a targeted nick or DSB and demonstrated by immunocapture of 3'-OH that a prior step of NGR allows specific determination of loci-specific or genome wide DSBs. This method can be applied to the global determination of DSBs using radioactive end labeling and can find several applications aimed at understanding the distribution and kinetics of DSBs formation and repair. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Identification of two new repetitive elements and chromosomal mapping of repetitive DNA sequences in the fish Gymnothorax unicolor (Anguilliformes: Muraenidae

    Directory of Open Access Journals (Sweden)

    E. Coluccia

    2011-05-01

    Full Text Available Muraenidae is a species-rich family, with relationships among genera and species and taxonomy that have not been completely clarified. Few cytogenetic studies have been conducted on this family, and all of them showed the same diploid chromosome number (2n=42 but with conspicuous karyotypic variation among species. The Mediterranean moray eel Gymnothorax unicolor was previously cytogenetically studied using classical techniques that allowed the characterization of its karyotype structure and the constitutive heterochromatin and argyrophilic nucleolar organizer regions (Ag-NORs distribution pattern. In the present study, we describe two new repetitive elements (called GuMboI and GuDdeI obtained from restricted genomic DNA of G. unicolor that were characterized by Southern blot and physically localized by in situ hybridization on metaphase chromosomes. As they are highly repetitive DNA sequences, they map in heterochromatic regions. However, while GuDdeI was localized in the centromeric regions, the GuMboI fraction was distributed on some centromeres and was co-localized with the nucleolus organizer region (NOR. Comparative analysis with other Mediterranean species such as Muraena helena pointed out that these DNA fractions are species-specific and could potentially be used for species discrimination. As a new contribution to the karyotype of this species, we found that the major ribosomal genes are localized on acrocentric chromosome 9 and that the telomeres of each chromosome are composed of a tandem repeat derived from a poly-TTAGGG DNA sequence, as it occurs in most vertebrate species. The results obtained add new information useful in comparative genomics at the chromosomal level and contribute to the cytogenetic knowledge regarding this fish family, which has not been extensively studied.

  16. DNA-based identification of invasive alien species in relation to Canadian federal policy and law, and the basis of rapid-response management.

    Science.gov (United States)

    Thomas, Vernon G; Hanner, Robert H; Borisenko, Alex V

    2016-11-01

    Managing invasive alien species in Canada requires reliable taxonomic identification as the basis of rapid-response management. This can be challenging, especially when organisms are small and lack morphological diagnostic features. DNA-based techniques, such as DNA barcoding, offer a reliable, rapid, and inexpensive toolkit for taxonomic identification of individual or bulk samples, forensic remains, and even environmental DNA. Well suited for this requirement, they could be more broadly deployed and incorporated into the operating policy and practices of Canadian federal departments and should be authorized under these agencies' articles of law. These include Fisheries and Oceans Canada, Canadian Food Inspection Agency, Transport Canada, Environment Canada, Parks Canada, and Health Canada. These efforts should be harmonized with the appropriate provisions of provincial jurisdictions, for example, the Ontario Invasive Species Act. This approach necessitates that a network of accredited, certified laboratories exists, and that updated DNA reference libraries are readily accessible. Harmonizing this approach is vital among Canadian federal agencies, and between the federal and provincial levels of government. Canadian policy and law must also be harmonized with that of the USA when detecting, and responding to, invasive species in contiguous lands and waters. Creating capacity in legislation for use of DNA-based identifications brings the authority to fund, train, deploy, and certify staff, and to refine further developments in this molecular technology.

  17. Molecular-based rapid inventories of sympatric diversity: a comparison of DNA barcode clustering methods applied to geography-based vs clade-based sampling of amphibians.

    Science.gov (United States)

    Paz, Andrea; Crawford, Andrew J

    2012-11-01

    Molecular markers offer a universal source of data for quantifying biodiversity. DNA barcoding uses a standardized genetic marker and a curated reference database to identify known species and to reveal cryptic diversity within wellsampled clades. Rapid biological inventories, e.g. rapid assessment programs (RAPs), unlike most barcoding campaigns, are focused on particular geographic localities rather than on clades. Because of the potentially sparse phylogenetic sampling, the addition of DNA barcoding to RAPs may present a greater challenge for the identification of named species or for revealing cryptic diversity. In this article we evaluate the use of DNA barcoding for quantifying lineage diversity within a single sampling site as compared to clade-based sampling, and present examples from amphibians. We compared algorithms for identifying DNA barcode clusters (e.g. species, cryptic species or Evolutionary Significant Units) using previously published DNA barcode data obtained from geography-based sampling at a site in Central Panama, and from clade-based sampling in Madagascar. We found that clustering algorithms based on genetic distance performed similarly on sympatric as well as clade-based barcode data, while a promising coalescent-based method performed poorly on sympatric data. The various clustering algorithms were also compared in terms of speed and software implementation. Although each method has its shortcomings in certain contexts, we recommend the use of the ABGD method, which not only performs fairly well under either sampling method, but does so in a few seconds and with a user-friendly Web interface.

  18. Clinical Application of Picodroplet Digital PCR Technology for Rapid Detection of EGFR T790M in Next-Generation Sequencing Libraries and DNA from Limited Tumor Samples.

    Science.gov (United States)

    Borsu, Laetitia; Intrieri, Julie; Thampi, Linta; Yu, Helena; Riely, Gregory; Nafa, Khedoudja; Chandramohan, Raghu; Ladanyi, Marc; Arcila, Maria E

    2016-11-01

    Although next-generation sequencing (NGS) is a robust technology for comprehensive assessment of EGFR-mutant lung adenocarcinomas with acquired resistance to tyrosine kinase inhibitors, it may not provide sufficiently rapid and sensitive detection of the EGFR T790M mutation, the most clinically relevant resistance biomarker. Here, we describe a digital PCR (dPCR) assay for rapid T790M detection on aliquots of NGS libraries prepared for comprehensive profiling, fully maximizing broad genomic analysis on limited samples. Tumor DNAs from patients with EGFR-mutant lung adenocarcinomas and acquired resistance to epidermal growth factor receptor inhibitors were prepared for Memorial Sloan-Kettering-Integrated Mutation Profiling of Actionable Cancer Targets sequencing, a hybrid capture-based assay interrogating 410 cancer-related genes. Precapture library aliquots were used for rapid EGFR T790M testing by dPCR, and results were compared with NGS and locked nucleic acid-PCR Sanger sequencing (reference high sensitivity method). Seventy resistance samples showed 99% concordance with the reference high sensitivity method in accuracy studies. Input as low as 2.5 ng provided a sensitivity of 1% and improved further with increasing DNA input. dPCR on libraries required less DNA and showed better performance than direct genomic DNA. dPCR on NGS libraries is a robust and rapid approach to EGFR T790M testing, allowing most economical utilization of limited material for comprehensive assessment. The same assay can also be performed directly on any limited DNA source and cell-free DNA. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  19. Coupling amplified DNA from flow-sorted chromosomes to high-density SNP mapping in barley

    Czech Academy of Sciences Publication Activity Database

    Šimková, Hana; Svensson, J.T.; Condamine, P.; Hřibová, Eva; Suchánková, Pavla; Bhat, P.R.; Bartoš, Jan; Šafář, Jan; Close, T.J.; Doležel, Jaroslav

    2008-01-01

    Roč. 9, č. 294 (2008), s. 1-9 ISSN 1471-2164 R&D Projects: GA ČR GD521/05/H013; GA MŠk ME 884; GA MŠk(CZ) LC06004 Institutional research plan: CEZ:AV0Z50380511 Keywords : Flow cytometry * DNA amplification * Hordeum vulgare L. Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.926, year: 2008

  20. DNA microarray-based solid-phase RT-PCR for rapid detection and identification of influenza virus type A and subtypes H5 and H7

    DEFF Research Database (Denmark)

    Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

    2011-01-01

    of RNA extract in the liquid phase with sequence-specific nested PCR on the solid phase. A simple ultraviolet cross-linking method was used to immobilize the DNA probes over an unmodified glass surface, which makes solid-phase PCR a convenient possibility for AIV screening. The testing of 33 avian fecal....... In this article, a DNA microarray-based solid-phase polymerase chain reaction (PCR) approach has been developed for rapid detection of influenza virus type A and for simultaneous identification of pathogenic virus subtypes H5 and H7. This solid-phase RT-PCR method combined reverse-transcription amplification...

  1. Rapid discrimination and classification of the Lactobacillus plantarum group based on a partial dnaK sequence and DNA fingerprinting techniques.

    Science.gov (United States)

    Huang, Chien-Hsun; Lee, Fwu-Ling; Liou, Jong-Shian

    2010-03-01

    The Lactobacillus plantarum group comprises five very closely related species. Some species of this group are considered to be probiotic and widely applied in the food industry. In this study, we compared the use of two different molecular markers, the 16S rRNA and dnaK gene, for discriminating phylogenetic relationships amongst L. plantarum strains using sequencing and DNA fingerprinting. The average sequence similarity for the dnaK gene (89.2%) among five type strains was significantly less than that for the 16S rRNA (99.4%). This result demonstrates that the dnaK gene sequence provided higher resolution than the 16S rRNA and suggests that the dnaK could be used as an additional phylogenetic marker for L. plantarum. Species-specific profiles of the Lactobacillus strains were obtained with RAPD and RFLP methods. Our data indicate that phylogenetic relationships between these strains are easily resolved using sequencing of the dnaK gene or DNA fingerprinting assays.

  2. Toward allotetraploid cotton genome assembly: integration of a high-density molecular genetic linkage map with DNA sequence information

    Science.gov (United States)

    2012-01-01

    Background Cotton is the world’s most important natural textile fiber and a significant oilseed crop. Decoding cotton genomes will provide the ultimate reference and resource for research and utilization of the species. Integration of high-density genetic maps with genomic sequence information will largely accelerate the process of whole-genome assembly in cotton. Results In this paper, we update a high-density interspecific genetic linkage map of allotetraploid cultivated cotton. An additional 1,167 marker loci have been added to our previously published map of 2,247 loci. Three new marker types, InDel (insertion-deletion) and SNP (single nucleotide polymorphism) developed from gene information, and REMAP (retrotransposon-microsatellite amplified polymorphism), were used to increase map density. The updated map consists of 3,414 loci in 26 linkage groups covering 3,667.62 cM with an average inter-locus distance of 1.08 cM. Furthermore, genome-wide sequence analysis was finished using 3,324 informative sequence-based markers and publicly-available Gossypium DNA sequence information. A total of 413,113 EST and 195 BAC sequences were physically anchored and clustered by 3,324 sequence-based markers. Of these, 14,243 ESTs and 188 BACs from different species of Gossypium were clustered and specifically anchored to the high-density genetic map. A total of 2,748 candidate unigenes from 2,111 ESTs clusters and 63 BACs were mined for functional annotation and classification. The 337 ESTs/genes related to fiber quality traits were integrated with 132 previously reported cotton fiber quality quantitative trait loci, which demonstrated the important roles in fiber quality of these genes. Higher-level sequence conservation between different cotton species and between the A- and D-subgenomes in tetraploid cotton was found, indicating a common evolutionary origin for orthologous and paralogous loci in Gossypium. Conclusion This study will serve as a valuable genomic resource

  3. GRIM-Filter: Fast seed location filtering in DNA read mapping using processing-in-memory technologies.

    Science.gov (United States)

    Kim, Jeremie S; Senol Cali, Damla; Xin, Hongyi; Lee, Donghyuk; Ghose, Saugata; Alser, Mohammed; Hassan, Hasan; Ergin, Oguz; Alkan, Can; Mutlu, Onur

    2018-05-09

    Seed location filtering is critical in DNA read mapping, a process where billions of DNA fragments (reads) sampled from a donor are mapped onto a reference genome to identify genomic variants of the donor. State-of-the-art read mappers 1) quickly generate possible mapping locations for seeds (i.e., smaller segments) within each read, 2) extract reference sequences at each of the mapping locations, and 3) check similarity between each read and its associated reference sequences with a computationally-expensive algorithm (i.e., sequence alignment) to determine the origin of the read. A seed location filter comes into play before alignment, discarding seed locations that alignment would deem a poor match. The ideal seed location filter would discard all poor match locations prior to alignment such that there is no wasted computation on unnecessary alignments. We propose a novel seed location filtering algorithm, GRIM-Filter, optimized to exploit 3D-stacked memory systems that integrate computation within a logic layer stacked under memory layers, to perform processing-in-memory (PIM). GRIM-Filter quickly filters seed locations by 1) introducing a new representation of coarse-grained segments of the reference genome, and 2) using massively-parallel in-memory operations to identify read presence within each coarse-grained segment. Our evaluations show that for a sequence alignment error tolerance of 0.05, GRIM-Filter 1) reduces the false negative rate of filtering by 5.59x-6.41x, and 2) provides an end-to-end read mapper speedup of 1.81x-3.65x, compared to a state-of-the-art read mapper employing the best previous seed location filtering algorithm. GRIM-Filter exploits 3D-stacked memory, which enables the efficient use of processing-in-memory, to overcome the memory bandwidth bottleneck in seed location filtering. We show that GRIM-Filter significantly improves the performance of a state-of-the-art read mapper. GRIM-Filter is a universal seed location filter that can be

  4. Analysis of changes in water cycle across Northern Eurasia with Rapid Integrated Mapping and Analysis System (RIMS)

    Science.gov (United States)

    Shiklomanov, A.; Prusevich, A.

    2012-04-01

    Historical and contemporary changes in various components of the hydrological cycle across the Northern Eurasia have been investigated using multiple observational and modeled data compiled in Rapid Integrated Mapping and Analysis System (RIMS) for North Eurasian Earth Science Partnership Initiative (NEESPI). To evaluate potential future patterns of change in the Northern Eurasian water cycle we have used climate change projections simulated by several coupled Atmosphere-Ocean General Circulation Models (AO GCMs). Future changes in hydrological regime were assessed using the UNH Water Balance and Water Transport Models (WBM/WTM) which take into account water management including irrigation and reservoir regulation. We found significant shifts in the regional hydrology and quantified potential natural and anthropogenic causes of these changes. The results of our historical and future analysis have demonstrated an intensification of hydrological cycle in many regions of the Northern Eurasia observed over 50-60 year period with accelerated rate during the last decade. Based on climate projections we can expect that the current rate of changes to continue over the course of XXI century. A significant part of the analysis and quantitative estimates of water cycle trends in Northern Eurasia has been done using RIMS online and offline data analysis tools. RIMS has been developed by the Water Systems Analysis Group at the University of New Hampshire, USA for the NEESPI program. Presently, the RIMS data pool is composed of a variety of themes including climate, hydrology, land cover, human dimension, and others. It comprises over five thousand single layer (e.g. soil type) and time series (e.g. daily runoff) raster GIS coverages, and a number of climate and hydrology station/point network datasets. The system streamlines data mining, management and model feeds in the computational environment of large and diverse data holdings. In this presentation we want to demonstrate

  5. Admixture analysis of stocked brown trout populations using mapped microsatellite DNA markers: indigenous trout persist in introgressed populations

    DEFF Research Database (Denmark)

    Hansen, Michael Møller; Mensberg, Karen-Lise Dons

    2009-01-01

    , but resolution is low if genetic differentiation is weak. Here, we analyse stocked brown trout populations represented by historical (1943-1956) and contemporary (2000s) samples, where genetic differentiation between wild populations and stocked trout is weak (pair-wise F-ST of 0.047 and 0.053). By analysing...... a high number of microsatellite DNA markers (50) and making use of linkage map information, we achieve clear identification of admixed and non-admixed trout. Moreover, despite strong population-level admixture by hatchery strain trout in one of the populations (70.8%), non-admixed individuals...... nevertheless persist (7 out of 53 individuals). These remnants of the indigenous population are characterized by later spawning time than the majority of the admixed individuals. We hypothesize that isolation by time mediated by spawning time differences between wild and hatchery strain trout is a major factor...

  6. Development of rapid and simple method for DNA extraction from cannabis resin based on the evaluation of relative PCR amplification ability.

    Science.gov (United States)

    Yamamuro, Tadashi; Iwata, Yuko T; Segawa, Hiroki; Kuwayama, Kenji; Tsujikawa, Kenji; Kanamori, Tatsuyuki; Inoue, Hiroyuki

    2018-04-04

    In recent years, analysis of cannabis DNA has been increasingly used in forensic drug tests. However, in the case of cannabis resin, a processed marijuana product, complicated procedures are required for the extraction of clean DNA, as the presence of various impurities inhibits PCR amplification. Therefore, in this study, we attempted to identify the factors that would allow quick and simple DNA extraction from cannabis resin with a commercially available kit. We also constructed a simple assay system for comparing relative amplification efficiencies by end-point PCR and used it to evaluate the purity of the obtained DNA solutions. For extraction with a kit that contains a silica column, reducing the starting amount of resin, using the residue remaining after methanol extraction, dilution of the final solution, extraction with an equal amount of powdered activated carbon or an excess amount of polyvinylpolypyrrolidone, and the addition of an appropriate amount of polyvinylpyrrolidone to the solution after extraction were effective measures that improved amplification efficiency. Furthermore, the use of the most rapid alkaline extraction kit combined with the addition of powdered activated carbon allowed obtaining DNA solutions with sufficient amplification efficiency in about 10min. These findings should be useful for routine DNA analysis of cannabis resin during forensic examination. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Rapid, highly sensitive and highly specific gene detection by combining enzymatic amplification and DNA chip detection simultaneously

    Directory of Open Access Journals (Sweden)

    Koji Hashimoto

    2016-05-01

    Full Text Available We have developed a novel gene detection method based on the loop-mediated isothermal amplification (LAMP reaction and the DNA dissociation reaction on the same DNA chip surface to achieve a lower detection limit, broader dynamic range and faster detection time than are attainable with a conventional DNA chip. Both FAM- and thiol-labeled DNA probe bound to the complementary sequence accompanying Dabcyl was immobilized on the gold surface via Au/thiol bond. The LAMP reaction was carried out on the DNA probe fixed gold surface. At first, Dabcyl molecules quenched the FAM fluorescence. According to the LAMP reaction, the complementary sequence with Dabcyl was competitively reacted with the amplified targeted sequence. As a result, the FAM fluorescence increased owing to dissociation of the complementary sequence from the DNA probe. The simultaneous reaction of LAMP and DNA chip detection was achieved, and 103 copies of the targeted gene were detected within an hour by measuring fluorescence intensity of the DNA probe. Keywords: Biosensor, DNA chip, Loop-mediated isothermal amplification (LAMP, Fluorescence detection, Gold substrate, Au/thiol bond

  8. A simple and rapid micromethod for genomic DNA extraction from jugal epithelial cells. Application to human lymphocyte antigen typing in one large family of atopic/asthmatic probands.

    Science.gov (United States)

    Aron, Y; Swierczewski, E; Lockhart, A

    1994-10-01

    We describe a rapid and reliable micromethod for DNA isolation from buccal epithelial cells from the interior mouth mucosa. This convenient, noninvasive method could be applied to genetic typing in a small number of cells (about 2000 cells per cheek). We have shown that DNA released by this method is suitable for further amplification by polymerase chain reaction (PCR). Using this protocol, coupled with the PCR-RFLP (restriction fragment length polymorphism) method, we analyzed the allelic sequence diversity of the human lymphocyte antigen (HLA) class II genes in an extended family of 33 persons containing 14 asthmatic or atopic members. Six of eight DQA1 alleles, and 11 DQB1, 20 DPB1, and 10 DR haplotypes could be identified in a single DNA sample. Our results suggest that the DR53 group haplotype is frequently associated with allergic asthma and atopy. The micromethod described here may be useful in genetic epidemiology, especially in family studies involving small children.

  9. New LightCycler PCR for Rapid and Sensitive Quantification of Parvovirus B19 DNA Guides Therapeutic Decision-Making in Relapsing Infections

    Science.gov (United States)

    Harder, Timm C.; Hufnagel, Markus; Zahn, Katrin; Beutel, Karin; Schmitt, Heinz-Josef; Ullmann, Uwe; Rautenberg, Peter

    2001-01-01

    Detection of parvovirus B19 DNA offers diagnostic advantages over serology, particularly in persistent infections of immunocompromised patients. A rapid, novel method of B19 DNA detection and quantification is introduced. This method, a quantitative PCR assay, is based on real-time glass capillary thermocycling (LightCycler [LC]) and fluorescence resonance energy transfer (FRET). The PCR assay allowed quantification over a dynamic range of over 7 logs and could quantify as little as 250 B19 genome equivalents (geq) per ml as calculated for plasmid DNA (i.e., theoretically ≥5 geq per assay). Interrater agreement analysis demonstrated equivalence of LC-FRET PCR and conventional nested PCR in the diagnosis of an active B19 infection (kappa coefficient = 0.83). The benefit of the new method was demonstrated in an immunocompromised child with a relapsing infection, who required an attenuation of the immunosuppressive therapy in addition to repeated doses of immunoglobulin to eliminate the virus. PMID:11724854

  10. Rapid detection of ERG11 gene mutations in clinical Candida albicans isolates with reduced susceptibility to fluconazole by rolling circle amplification and DNA sequencing

    OpenAIRE

    Wang, Huiping; Kong, Fanrong; Sorrell, Tania C; Wang, Bin; McNicholas, Paul; Pantarat, Namfon; Ellis, David; Xiao, Meng; Widmer, Fred; Chen, Sharon CA

    2009-01-01

    Abstract Background Amino acid substitutions in the target enzyme Erg11p of azole antifungals contribute to clinically-relevant azole resistance in Candida albicans. A simple molecular method for rapid detection of ERG11 gene mutations would be an advantage as a screening tool to identify potentially-resistant strains and to track their movement. To complement DNA sequencing, we developed a padlock probe and rolling circle amplification (RCA)-based method to detect a series of mutations in th...

  11. Determination of alkylation of bacterial DNA as a rapid test for toxicological evaluation of alkylating xenobiotic agents

    Energy Technology Data Exchange (ETDEWEB)

    Botzenhart, K.; Waldner-Sander, S.; Schweinsberg, F.

    1986-05-01

    Alkylated purine bases from hydrolized DNA can be separated by HPLC and quantified with a fluorescence detector. We applied this method to bacterial DNA. 7-methylguanine was detected after treatment of Serratia marcescens with iodoacetamide, dimethyl sulfate and with polluted air.

  12. A DNA Barcode-Based RPA Assay (BAR-RPA) for Rapid Identification of the Dry Root of Ficus hirta (Wuzhimaotao).

    Science.gov (United States)

    Tian, Enwei; Liu, Qianqian; Ye, Haoting; Li, Fang; Chao, Zhi

    2017-12-18

    Background: Wuzhimaotao (the dry root of Ficus hirta ) is used as both medicine and food ingredient by the locals in areas around Nanling Mountains of China. Due to its very similar external morphologies with Duanchangcao (the root of Gelsemium elegans , which contains gelsemine that is extremely neurotoxic) and the associated growth of these two plants, incidents of food poisoning and even death frequently occur, resulting from the misuse of Duanchangcao as Wuzhimaotao. The aim of this study is to develop a fast, even, on-spot approach to identification of Wuzhimaotao. Methods: We used DNA barcode-based recombinase polymerase amplification (BAR-RPA) with species-specific primers targeting the internal transcribed spacer (ITS) region of the rDNA of F. hirta. BAR-RPA reaction time and temperature were optimized and the specificity and sensitivity of BAR-RPA species-specific primers were assessed. Results: This technique showed a high specificity and sensitivity to amplify the genomic DNA of F. hirta and allowed for rapid amplification (within 15 min) of the ITS region under a constant and mild temperature range of 37-42 °C without using thermocyclers. Conclusions: The BAR-RPA assay with a fast DNA extraction protocol provides a simple, energy-saving, and rapid method for identification of Wuzhimaotao in both laboratory and field settings.

  13. A DNA Barcode-Based RPA Assay (BAR-RPA for Rapid Identification of the Dry Root of Ficus hirta (Wuzhimaotao

    Directory of Open Access Journals (Sweden)

    Enwei Tian

    2017-12-01

    Full Text Available Background: Wuzhimaotao (the dry root of Ficus hirta is used as both medicine and food ingredient by the locals in areas around Nanling Mountains of China. Due to its very similar external morphologies with Duanchangcao (the root of Gelsemium elegans, which contains gelsemine that is extremely neurotoxic and the associated growth of these two plants, incidents of food poisoning and even death frequently occur, resulting from the misuse of Duanchangcao as Wuzhimaotao. The aim of this study is to develop a fast, even, on-spot approach to identification of Wuzhimaotao. Methods: We used DNA barcode-based recombinase polymerase amplification (BAR-RPA with species–specific primers targeting the internal transcribed spacer (ITS region of the rDNA of F. hirta. BAR-RPA reaction time and temperature were optimized and the specificity and sensitivity of BAR-RPA species–specific primers were assessed. Results: This technique showed a high specificity and sensitivity to amplify the genomic DNA of F. hirta and allowed for rapid amplification (within 15 min of the ITS region under a constant and mild temperature range of 37–42 °C without using thermocyclers. Conclusions: The BAR-RPA assay with a fast DNA extraction protocol provides a simple, energy-saving, and rapid method for identification of Wuzhimaotao in both laboratory and field settings.

  14. Methylation-sensitive linking libraries enhance gene-enriched sequencing of complex genomes and map DNA methylation domains

    Directory of Open Access Journals (Sweden)

    Bharti Arvind K

    2008-12-01

    Full Text Available Abstract Background Many plant genomes are resistant to whole-genome assembly due to an abundance of repetitive sequence, leading to the development of gene-rich sequencing techniques. Two such techniques are hypomethylated partial restriction (HMPR and methylation spanning linker libraries (MSLL. These libraries differ from other gene-rich datasets in having larger insert sizes, and the MSLL clones are designed to provide reads localized to "epigenetic boundaries" where methylation begins or ends. Results A large-scale study in maize generated 40,299 HMPR sequences and 80,723 MSLL sequences, including MSLL clones exceeding 100 kb. The paired end reads of MSLL and HMPR clones were shown to be effective in linking existing gene-rich sequences into scaffolds. In addition, it was shown that the MSLL clones can be used for anchoring these scaffolds to a BAC-based physical map. The MSLL end reads effectively identified epigenetic boundaries, as indicated by their preferential alignment to regions upstream and downstream from annotated genes. The ability to precisely map long stretches of fully methylated DNA sequence is a unique outcome of MSLL analysis, and was also shown to provide evidence for errors in gene identification. MSLL clones were observed to be significantly more repeat-rich in their interiors than in their end reads, confirming the correlation between methylation and retroelement content. Both MSLL and HMPR reads were found to be substantially gene-enriched, with the SalI MSLL libraries being the most highly enriched (31% align to an EST contig, while the HMPR clones exhibited exceptional depletion of repetitive DNA (to ~11%. These two techniques were compared with other gene-enrichment methods, and shown to be complementary. Conclusion MSLL technology provides an unparalleled approach for mapping the epigenetic status of repetitive blocks and for identifying sequences mis-identified as genes. Although the types and natures of

  15. DNA sequencing conference, 2

    Energy Technology Data Exchange (ETDEWEB)

    Cook-Deegan, R.M. [Georgetown Univ., Kennedy Inst. of Ethics, Washington, DC (United States); Venter, J.C. [National Inst. of Neurological Disorders and Strokes, Bethesda, MD (United States); Gilbert, W. [Harvard Univ., Cambridge, MA (United States); Mulligan, J. [Stanford Univ., CA (United States); Mansfield, B.K. [Oak Ridge National Lab., TN (United States)

    1991-06-19

    This conference focused on DNA sequencing, genetic linkage mapping, physical mapping, informatics and bioethics. Several were used to study this sequencing and mapping. This article also discusses computer hardware and software aiding in the mapping of genes.

  16. Census Cities experiment in urban change detection. [mapping of land use changes in San Francisco, Washington D.C., Phoenix, Tucson, Boston, New Haven, Cedar Rapids, and Pontiac

    Science.gov (United States)

    Wray, J. R. (Principal Investigator); Milazzo, V. A.

    1974-01-01

    The author has identified the following significant results. Mapping of 1970 and 1972 land use from high-flight photography has been completed for all test sites: San Francisco, Washington, Phoenix, Tucson, Boston, New Haven, Cedar Rapids, and Pontiac. Area analysis of 1970 and 1972 land use has been completed for each of the mandatory urban areas. All 44 sections of the 1970 land use maps of the San Francisco test site have been officially released through USGS Open File at 1:62,500. Five thousand copies of the Washington one-sheet color 1970 land use map, census tract map, and point line identification map are being printed by USGS Publication Division. ERTS-1 imagery for each of the eight test sites is being received and analyzed. Color infrared photo enlargements at 1:100,000 of ERTS-1 MSS images of Phoenix taken on October 16, 1972 and May 2, 1973 are being analyzed to determine to what level land use and land use changes can be identified and to what extent the ERTS-1 imagery can be used in updating the 1970 aircraft photo-derived land use data base. Work is proceeding on the analysis of ERTS-1 imagery by computer manipulation of ERTS-1 MSS data in digital format. ERTS-1 CCT maps at 1:24,000 are being analyzed for two dates over Washington and Phoenix. Anniversary tape sets have been received at Purdue LARS for some additional urban test sites.

  17. Mapping biodiversity and setting conservation priorities for SE Queensland's rainforests using DNA barcoding.

    Science.gov (United States)

    Shapcott, Alison; Forster, Paul I; Guymer, Gordon P; McDonald, William J F; Faith, Daniel P; Erickson, David; Kress, W John

    2015-01-01

    Australian rainforests have been fragmented due to past climatic changes and more recently landscape change as a result of clearing for agriculture and urban spread. The subtropical rainforests of South Eastern Queensland are significantly more fragmented than the tropical World Heritage listed northern rainforests and are subject to much greater human population pressures. The Australian rainforest flora is relatively taxonomically rich at the family level, but less so at the species level. Current methods to assess biodiversity based on species numbers fail to adequately capture this richness at higher taxonomic levels. We developed a DNA barcode library for the SE Queensland rainforest flora to support a methodology for biodiversity assessment that incorporates both taxonomic diversity and phylogenetic relationships. We placed our SE Queensland phylogeny based on a three marker DNA barcode within a larger international rainforest barcode library and used this to calculate phylogenetic diversity (PD). We compared phylo- diversity measures, species composition and richness and ecosystem diversity of the SE Queensland rainforest estate to identify which bio subregions contain the greatest rainforest biodiversity, subregion relationships and their level of protection. We identified areas of highest conservation priority. Diversity was not correlated with rainforest area in SE Queensland subregions but PD was correlated with both the percent of the subregion occupied by rainforest and the diversity of regional ecosystems (RE) present. The patterns of species diversity and phylogenetic diversity suggest a strong influence of historical biogeography. Some subregions contain significantly more PD than expected by chance, consistent with the concept of refugia, while others were significantly phylogenetically clustered, consistent with recent range expansions.

  18. Mapping Biodiversity and Setting Conservation Priorities for SE Queensland’s Rainforests Using DNA Barcoding

    Science.gov (United States)

    Shapcott, Alison; Forster, Paul I.; Guymer, Gordon P.; McDonald, William J. F.; Faith, Daniel P.; Erickson, David; Kress, W. John

    2015-01-01

    Australian rainforests have been fragmented due to past climatic changes and more recently landscape change as a result of clearing for agriculture and urban spread. The subtropical rainforests of South Eastern Queensland are significantly more fragmented than the tropical World Heritage listed northern rainforests and are subject to much greater human population pressures. The Australian rainforest flora is relatively taxonomically rich at the family level, but less so at the species level. Current methods to assess biodiversity based on species numbers fail to adequately capture this richness at higher taxonomic levels. We developed a DNA barcode library for the SE Queensland rainforest flora to support a methodology for biodiversity assessment that incorporates both taxonomic diversity and phylogenetic relationships. We placed our SE Queensland phylogeny based on a three marker DNA barcode within a larger international rainforest barcode library and used this to calculate phylogenetic diversity (PD). We compared phylo- diversity measures, species composition and richness and ecosystem diversity of the SE Queensland rainforest estate to identify which bio subregions contain the greatest rainforest biodiversity, subregion relationships and their level of protection. We identified areas of highest conservation priority. Diversity was not correlated with rainforest area in SE Queensland subregions but PD was correlated with both the percent of the subregion occupied by rainforest and the diversity of regional ecosystems (RE) present. The patterns of species diversity and phylogenetic diversity suggest a strong influence of historical biogeography. Some subregions contain significantly more PD than expected by chance, consistent with the concept of refugia, while others were significantly phylogenetically clustered, consistent with recent range expansions. PMID:25803607

  19. Lung Basal Stem Cells Rapidly Repair DNA Damage Using the Error-Prone Nonhomologous End-Joining Pathway

    Science.gov (United States)

    Weeden, Clare E.; Chen, Yunshun; Ma, Stephen B.; Hu, Yifang; Ramm, Georg; Sutherland, Kate D.; Smyth, Gordon K.

    2017-01-01

    Lung squamous cell carcinoma (SqCC), the second most common subtype of lung cancer, is strongly associated with tobacco smoking and exhibits genomic instability. The cellular origins and molecular processes that contribute to SqCC formation are largely unexplored. Here we show that human basal stem cells (BSCs) isolated from heavy smokers proliferate extensively, whereas their alveolar progenitor cell counterparts have limited colony-forming capacity. We demonstrate that this difference arises in part because of the ability of BSCs to repair their DNA more efficiently than alveolar cells following ionizing radiation or chemical-induced DNA damage. Analysis of mice harbouring a mutation in the DNA-dependent protein kinase catalytic subunit (DNA-PKcs), a key enzyme in DNA damage repair by nonhomologous end joining (NHEJ), indicated that BSCs preferentially repair their DNA by this error-prone process. Interestingly, polyploidy, a phenomenon associated with genetically unstable cells, was only observed in the human BSC subset. Expression signature analysis indicated that BSCs are the likely cells of origin of human SqCC and that high levels of NHEJ genes in SqCC are correlated with increasing genomic instability. Hence, our results favour a model in which heavy smoking promotes proliferation of BSCs, and their predilection for error-prone NHEJ could lead to the high mutagenic burden that culminates in SqCC. Targeting DNA repair processes may therefore have a role in the prevention and therapy of SqCC. PMID:28125611

  20. Rapid point-of-care testing for epidermal growth factor receptor gene mutations in patients with lung cancer using cell-free DNA from cytology specimen supernatants.

    Science.gov (United States)

    Asaka, Shiho; Yoshizawa, Akihiko; Saito, Kazusa; Kobayashi, Yukihiro; Yamamoto, Hiroshi; Negishi, Tatsuya; Nakata, Rie; Matsuda, Kazuyuki; Yamaguchi, Akemi; Honda, Takayuki

    2018-06-01

    Epidermal growth factor receptor (EGFR) mutations are associated with responses to EGFR tyrosine kinase inhibitors (EGFR-TKIs) in non-small-cell lung cancer (NSCLC). Our previous study revealed a rapid point-of-care system for detecting EGFR mutations. This system analyzes cell pellets from cytology specimens using droplet-polymerase chain reaction (d-PCR), and has a reaction time of 10 min. The present study aimed to validate the performance of the EGFR d-PCR assay using cell-free DNA (cfDNA) from supernatants obtained from cytology specimens. Assay results from cfDNA supernatant analyses were compared with those from cell pellets for 90 patients who were clinically diagnosed with, or suspected of having, lung cancer (80 bronchial lavage fluid samples, nine pleural effusion samples and one spinal fluid sample). EGFR mutations were identified in 12 and 15 cases using cfDNA supernatants and cell pellets, respectively. The concordance rates between cfDNA-supernatant and cell‑pellet assay results were 96.7% [kappa coefficient (K)=0.87], 98.9% (K=0.94), 98.9% (K=0.79) and 98.9% (K=0.79) for total EGFR mutations, L858R, E746_A750del and T790M, respectively. All 15 patients with EGFR mutation-positive results, as determined by EGFR d-PCR assay using cfDNA supernatants or cell pellets, also displayed positive results by conventional EGFR assays using tumor tissue or cytology specimens. Notably, EGFR mutations were even detected in five cfDNA supernatants for which the cytological diagnoses of the corresponding cell pellets were 'suspicious for malignancy', 'atypical' or 'negative for malignancy.' In conclusion, this rapid point-of-care system may be considered a promising novel screening method that may enable patients with NSCLC to receive EGFR-TKI therapy more rapidly, whilst also reserving cell pellets for additional morphological and molecular analyses.

  1. Boom-Bust Turnovers of Megabase-Sized Centromeric DNA in Solanum Species: Rapid Evolution of DNA Sequences Associated with Centromeres

    Czech Academy of Sciences Publication Activity Database

    Zhang, H.Q.; Koblížková, Andrea; Wang, K.; Gong, Z.Y.; Oliveira, L.; Torres, G.A.; Wu, Y.; Zhang, W.; Novák, Petr; Buell, C.R.; Macas, Jiří; Jiang, J.

    2014-01-01

    Roč. 26, č. 4 (2014), s. 1436-1447 ISSN 1040-4651 Institutional support: RVO:60077344 Keywords : Alpha-satellite DNA * repetitive sequences * rice centromeres Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.338, year: 2014

  2. Karyotypes, heterochromatin, and physical mapping of 18S-26S rDNA in Cactaceae.

    Science.gov (United States)

    Las Peñas, M L; Urdampilleta, J D; Bernardello, G; Forni-Martins, E R

    2009-01-01

    Karyotype analyses in members of the four Cactaceae subfamilies were performed. Numbers and karyotype formula obtained were: Pereskioideae = Pereskiaaculeata(2n = 22; 10 m + 1 sm), Maihuenioideae = Maihuenia patagonica (2n = 22, 9 m + 2 sm; 2n = 44, 18 m + 4 sm), Opuntioideae = Cumulopuntia recurvata(2n = 44; 20 m + 2 sm), Cactoideae = Acanthocalycium spiniflorum (2n = 22; 10 m + 1 sm),Echinopsis tubiflora (2n = 22; 10 m + 1 sm), Trichocereus candicans (2n = 22, 22 m). Chromosomes were small, the average chromosome length was 2.3 mum. Diploid species and the tetraploid C. recurvata had one terminal satellite, whereas the remaining tetraploid species showed four satellited chromosomes. Karyotypes were symmetrical. No CMA(-)/DAPI(+) bands were detected, but CMA(+)/DAPI(-) bands associated with NOR were always found. Pericentromeric heterochromatin was found in C. recurvata, A. spiniflorum, and the tetraploid cytotype of M. patagonica. The locations of the 18S-26S rDNA sites in all species coincided with CMA(+)/DAPI(-) bands; the same occurred with the sizes and numbers of signals for each species. This technique was applied for the first time in metaphase chromosomes in cacti. NOR-bearing pair no.1 may be homeologous in all species examined. In Cactaceae, the 18S-26S loci seem to be highly conserved. Copyright 2009 S. Karger AG, Basel.

  3. Rapid and reliable high-throughput methods of DNA extraction for use in barcoding and molecular systematics of mushrooms.

    Science.gov (United States)

    Dentinger, Bryn T M; Margaritescu, Simona; Moncalvo, Jean-Marc

    2010-07-01

    We present two methods for DNA extraction from fresh and dried mushrooms that are adaptable to high-throughput sequencing initiatives, such as DNA barcoding. Our results show that these protocols yield ∼85% sequencing success from recently collected materials. Tests with both recent (100 years) specimens reveal that older collections have low success rates and may be an inefficient resource for populating a barcode database. However, our method of extracting DNA from herbarium samples using small amount of tissue is reliable and could be used for important historical specimens. The application of these protocols greatly reduces time, and therefore cost, of generating DNA sequences from mushrooms and other fungi vs. traditional extraction methods. The efficiency of these methods illustrates that standardization and streamlining of sample processing should be shifted from the laboratory to the field. © 2009 Blackwell Publishing Ltd.

  4. Inhibition of exportin-1 function results in rapid cell cycle-associated DNA damage in cancer cells.

    Science.gov (United States)

    Burke, Russell T; Marcus, Joshua M; Orth, James D

    2017-06-13

    Selective inhibitors of nuclear export (SINE) are small molecules in development as anti-cancer agents. The first-in-class SINE, selinexor, is in clinical trials for blood and solid cancers. Selinexor forms a covalent bond with exportin-1 at cysteine-528, and blocks its ability to export cargos. Previous work has shown strong cell cycle effects and drug-induced cell death across many different cancer-derived cell lines. Here, we report strong cell cycle-associated DNA double-stranded break formation upon the treatment of cancer cells with SINE. In multiple cell models, selinexor treatment results in the formation of clustered DNA damage foci in 30-40% of cells within 8 hours that is dependent upon cysteine-528. DNA damage strongly correlates with G1/S-phase and decreased DNA replication. Live cell microscopy reveals an association between DNA damage and cell fate. Cells that form damage in G1-phase more often die or arrest, while those damaged in S/G2-phase frequently progress to cell division. Up to half of all treated cells form damage foci, and most cells that die after being damaged, were damaged in G1-phase. By comparison, non-transformed cell lines show strong cell cycle effects but little DNA damage and less death than cancer cells. Significant drug combination effects occur when selinexor is paired with different classes of agents that either cause DNA damage or that diminish DNA damage repair. These data present a novel effect of exportin-1 inhibition and provide a strong rationale for multiple combination treatments of selinexor with agents that are currently in use for the treatment of different solid cancers.

  5. Cloning and characterization of transferrin cDNA and rapid detection of transferrin gene polymorphism in rainbow trout (Oncorhynchus mykiss).

    Science.gov (United States)

    Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T

    1997-12-01

    A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.

  6. Novel Polymerase Spiral Reaction (PSR) for rapid visual detection of Bovine Herpesvirus 1 genomic DNA from aborted bovine fetus and semen.

    Science.gov (United States)

    Malla, Javed Ahmed; Chakravarti, Soumendu; Gupta, Vikas; Chander, Vishal; Sharma, Gaurav Kumar; Qureshi, Salauddin; Mishra, Adhiraj; Gupta, Vivek Kumar; Nandi, Sukdeb

    2018-02-20

    Bovine herpesvirus-1 (BHV-1) is a major viral pathogen affecting bovines leading to various clinical manifestations and causes significant economic impediment in modern livestock production system. Rapid, accurate and sensitive detection of BHV-1 infection at frozen semen stations or at dairy herds remains a priority for control of BHV-1 spread to susceptible population. Polymerase Spiral Reaction (PSR), a novel addition in the gamut of isothermal techniques, has been successfully implemented in initial optimization for detection of BHV-1 genomic DNA and further validated in clinical samples. The developed PSR assay has been validated for detection of BHV-1 from bovine semen (n=99), a major source of transmission of BHV-1 from breeding bulls to susceptible dams in artificial insemination programs. The technique has also been used for screening of BHV-1 DNA from suspected aborted fetal tissues (n=25). The developed PSR technique is 100 fold more sensitive than conventional PCR and comparable to real-time PCR. The PSR technique has been successful in detecting 13 samples positive for BHV-1 DNA in bovine semen, 4 samples more than conventional PCR. The aborted fetal tissues were negative for presence of BHV-1 DNA. The presence of BHV-1 in bovine semen samples raises a pertinent concern for extensively screening of semen from breeding bulls before been used for artificial insemination process. PSR has all the attributes for becoming a method of choice for rapid, accurate and sensitive detection of BHV-1 DNA at frozen semen stations or at dairy herds in resource constrained settings. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Discovery of possible gene relationships through the application of self-organizing maps to DNA microarray databases.

    Science.gov (United States)

    Chavez-Alvarez, Rocio; Chavoya, Arturo; Mendez-Vazquez, Andres

    2014-01-01

    DNA microarrays and cell cycle synchronization experiments have made possible the study of the mechanisms of cell cycle regulation of Saccharomyces cerevisiae by simultaneously monitoring the expression levels of thousands of genes at specific time points. On the other hand, pattern recognition techniques can contribute to the analysis of such massive measurements, providing a model of gene expression level evolution through the cell cycle process. In this paper, we propose the use of one of such techniques--an unsupervised artificial neural network called a Self-Organizing Map (SOM)-which has been successfully applied to processes involving very noisy signals, classifying and organizing them, and assisting in the discovery of behavior patterns without requiring prior knowledge about the process under analysis. As a test bed for the use of SOMs in finding possible relationships among genes and their possible contribution in some biological processes, we selected 282 S. cerevisiae genes that have been shown through biological experiments to have an activity during the cell cycle. The expression level of these genes was analyzed in five of the most cited time series DNA microarray databases used in the study of the cell cycle of this organism. With the use of SOM, it was possible to find clusters of genes with similar behavior in the five databases along two cell cycles. This result suggested that some of these genes might be biologically related or might have a regulatory relationship, as was corroborated by comparing some of the clusters obtained with SOMs against a previously reported regulatory network that was generated using biological knowledge, such as protein-protein interactions, gene expression levels, metabolism dynamics, promoter binding, and modification, regulation and transport of proteins. The methodology described in this paper could be applied to the study of gene relationships of other biological processes in different organisms.

  8. GateKeeper: a new hardware architecture for accelerating pre-alignment in DNA short read mapping.

    Science.gov (United States)

    Alser, Mohammed; Hassan, Hasan; Xin, Hongyi; Ergin, Oguz; Mutlu, Onur; Alkan, Can

    2017-11-01

    High throughput DNA sequencing (HTS) technologies generate an excessive number of small DNA segments -called short reads- that cause significant computational burden. To analyze the entire genome, each of the billions of short reads must be mapped to a reference genome based on the similarity between a read and 'candidate' locations in that reference genome. The similarity measurement, called alignment, formulated as an approximate string matching problem, is the computational bottleneck because: (i) it is implemented using quadratic-time dynamic programming algorithms and (ii) the majority of candidate locations in the reference genome do not align with a given read due to high dissimilarity. Calculating the alignment of such incorrect candidate locations consumes an overwhelming majority of a modern read mapper's execution time. Therefore, it is crucial to develop a fast and effective filter that can detect incorrect candidate locations and eliminate them before invoking computationally costly alignment algorithms. We propose GateKeeper, a new hardware accelerator that functions as a pre-alignment step that quickly filters out most incorrect candidate locations. GateKeeper is the first design to accelerate pre-alignment using Field-Programmable Gate Arrays (FPGAs), which can perform pre-alignment much faster than software. When implemented on a single FPGA chip, GateKeeper maintains high accuracy (on average >96%) while providing, on average, 90-fold and 130-fold speedup over the state-of-the-art software pre-alignment techniques, Adjacency Filter and Shifted Hamming Distance (SHD), respectively. The addition of GateKeeper as a pre-alignment step can reduce the verification time of the mrFAST mapper by a factor of 10. https://github.com/BilkentCompGen/GateKeeper. mohammedalser@bilkent.edu.tr or onur.mutlu@inf.ethz.ch or calkan@cs.bilkent.edu.tr. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press

  9. XenDB: Full length cDNA prediction and cross species mapping in Xenopus laevis

    Directory of Open Access Journals (Sweden)

    Giegerich Robert

    2005-09-01

    Full Text Available Abstract Background Research using the model system Xenopus laevis has provided critical insights into the mechanisms of early vertebrate development and cell biology. Large scale sequencing efforts have provided an increasingly important resource for researchers. To provide full advantage of the available sequence, we have analyzed 350,468 Xenopus laevis Expressed Sequence Tags (ESTs both to identify full length protein encoding sequences and to develop a unique database system to support comparative approaches between X. laevis and other model systems. Description Using a suffix array based clustering approach, we have identified 25,971 clusters and 40,877 singleton sequences. Generation of a consensus sequence for each cluster resulted in 31,353 tentative contig and 4,801 singleton sequences. Using both BLASTX and FASTY comparison to five model organisms and the NR protein database, more than 15,000 sequences are predicted to encode full length proteins and these have been matched to publicly available IMAGE clones when available. Each sequence has been compared to the KOG database and ~67% of the sequences have been assigned a putative functional category. Based on sequence homology to mouse and human, putative GO annotations have been determined. Conclusion The results of the analysis have been stored in a publicly available database XenDB http://bibiserv.techfak.uni-bielefeld.de/xendb/. A unique capability of the database is the ability to batch upload cross species queries to identify potential Xenopus homologues and their associated full length clones. Examples are provided including mapping of microarray results and application of 'in silico' analysis. The ability to quickly translate the results of various species into 'Xenopus-centric' information should greatly enhance comparative embryological approaches. Supplementary material can be found at http://bibiserv.techfak.uni-bielefeld.de/xendb/.

  10. Intra-genomic GC heterogeneity in sauropsids: evolutionary insights from cDNA mapping and GC3 profiling in snake

    Science.gov (United States)

    2012-01-01

    Background Extant sauropsids (reptiles and birds) are divided into two major lineages, the lineage of Testudines (turtles) and Archosauria (crocodilians and birds) and the lineage of Lepidosauria (tuatara, lizards, worm lizards and snakes). Karyotypes of these sauropsidan groups generally consist of macrochromosomes and microchromosomes. In chicken, microchromosomes exhibit a higher GC-content than macrochromosomes. To examine the pattern of intra-genomic GC heterogeneity in lepidosaurian genomes, we constructed a cytogenetic map of the Japanese four-striped rat snake (Elaphe quadrivirgata) with 183 cDNA clones by fluorescence in situ hybridization, and examined the correlation between the GC-content of exonic third codon positions (GC3) of the genes and the size of chromosomes on which the genes were localized. Results Although GC3 distribution of snake genes was relatively homogeneous compared with those of the other amniotes, microchromosomal genes showed significantly higher GC3 than macrochromosomal genes as in chicken. Our snake cytogenetic map also identified several conserved segments between the snake macrochromosomes and the chicken microchromosomes. Cross-species comparisons revealed that GC3 of most snake orthologs in such macrochromosomal segments were GC-poor (GC3 < 50%) whereas those of chicken orthologs in microchromosomes were relatively GC-rich (GC3 ≥ 50%). Conclusion Our results suggest that the chromosome size-dependent GC heterogeneity had already occurred before the lepidosaur-archosaur split, 275 million years ago. This character was probably present in the common ancestor of lepidosaurs and but lost in the lineage leading to Anolis during the diversification of lepidosaurs. We also identified several genes whose GC-content might have been influenced by the size of the chromosomes on which they were harbored over the course of sauropsid evolution. PMID:23140509

  11. Rapid colorimetric detection of p53 protein function using DNA-gold nanoconjugates with applications for drug discovery and cancer diagnostics.

    Science.gov (United States)

    Assah, Enock; Goh, Walter; Zheng, Xin Ting; Lim, Ting Xiang; Li, Jun; Lane, David; Ghadessy, Farid; Tan, Yen Nee

    2018-05-05

    The tumor suppressor protein p53 plays a central role in preventing cancer through interaction with DNA response elements (REs) to regulate target gene expression in cells. Due to its significance in cancer biology, relentless efforts have been directed toward understanding p53-DNA interactions for the development of cancer therapeutics and diagnostics. In this paper, we report a rapid, label-free and versatile colorimetric assay to detect wildtype p53 DNA-binding function in complex solutions. The assay design is based on a concept that alters interparticle-distances between RE-AuNPs from a crosslinking effect induced through tetramerization of wildtype p53 protein (p53-WT) upon binding to canonical DNA motifs modified on gold nanoparticles (RE-AuNPs). This leads to a visible solution color change from red to blue, which is quantifiable by the UV- visible absorption spectra with a detection limit of 5 nM. Contrastingly, no color change was observed for the binding-deficient p53 mutants and non-specific proteins due to their inability to crosslink RE-AuNPs. Based on this sensing principle, we further demonstrate its utility for fast detection of drug-induced DNA binding function to cancer-associated Y220C mutant p53 protein using well-established reactivating compounds. By exploiting the dominant-negative property of mutant p53 over p53-WT and interactions with RE-AuNPs, this assay is configurable to detect low numbers of mutant p53 expressing cells in miniscule sample fractions obtained from typical core needle biopsy-sized tissues without signal attrition, alluding to the potential for biopsy sampling in cancer diagnostics or for defining cancer margins. This nanogold enabled colorimetric assay provides a facile yet robust method for studying important parameters influencing p53-DNA interactions with great promises for clinically pertinent applications. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. A simple and rapid method for isolation of high quality genomic DNA from fruit trees and conifers using PVP.

    Science.gov (United States)

    Kim, C S; Lee, C H; Shin, J S; Chung, Y S; Hyung, N I

    1997-03-01

    Because DNA degradation is mediated by secondary plant products such as phenolic terpenoids, the isolation of high quality DNA from plants containing a high content of polyphenolics has been a difficult problem. We demonstrate an easy extraction process by modifying several existing ones. Using this process we have found it possible to isolate DNAs from four fruit trees, grape (Vitis spp.), apple (Malus spp.), pear (Pyrus spp.) and persimmon (Diospyros spp.) and four species of conifer, Pinus densiflora, Pinus koraiensis,Taxus cuspidata and Juniperus chinensis within a few hours. Compared with the existing method, we have isolated high quality intact DNAs (260/280 = 1.8-2.0) routinely yielding 250-500 ng/microl (total 7.5-15 microg DNA from four to five tissue discs).

  13. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    Directory of Open Access Journals (Sweden)

    Farkhondeh Saba

    2017-01-01

    Full Text Available Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR. Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Methods:  According to our results, amplification of various genomic regions including SSU, LSU, ITS, β-tubulin, actin, RPB2, and EF-1 resulted in a reproducible and efficient DNA extraction from a wide range of microorganisms yielding adequate pure genomic material for reproducible PCR-amplifications. Results:   This method relies on a temporary shock of increased concentrations of detergent which can be applied concomitant with multiple freeze-thaws to yield sufficient amount of DNA for PCR amplification of multiple or single fragments(s of the genome. As an advantage, the recipe seems very flexible, thus, various optional steps can be included depending on the samples used.Conclusion:   Having the needed flexibility in each step, this protocol is applicable on a very wide range of samples. Hence, various steps can be included depending on the desired quantity and quality.

  14. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    Directory of Open Access Journals (Sweden)

    Farkhondeh Saba

    2016-09-01

    Full Text Available Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR. Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Methods:  According to our results, amplification of various genomic regions including SSU, LSU, ITS, β-tubulin, actin, RPB2, and EF-1 resulted in a reproducible and efficient DNA extraction from a wide range of microorganisms yielding adequate pure genomic material for reproducible PCR-amplifications. Results:   This method relies on a temporary shock of increased concentrations of detergent which can be applied concomitant with multiple freeze-thaws to yield sufficient amount of DNA for PCR amplification of multiple or single fragments(s of the genome. As an advantage, the recipe seems very flexible, thus, various optional steps can be included depending on the samples used.Conclusion:   Having the needed flexibility in each step, this protocol is applicable on a very wide range of samples. Hence, various steps can be included depending on the desired quantity and quality.

  15. A differential mobility spectrometry/mass spectrometry platform for the rapid detection and quantitation of DNA adduct dG-ABP.

    Science.gov (United States)

    Kafle, Amol; Klaene, Joshua; Hall, Adam B; Glick, James; Coy, Stephen L; Vouros, Paul

    2013-07-15

    There is continued interest in exploring new analytical technologies for the detection and quantitation of DNA adducts, biomarkers which provide direct evidence of exposure and genetic damage in cells. With the goal of reducing clean-up steps and improving sample throughput, a Differential Mobility Spectrometry/Mass Spectrometry (DMS/MS) platform has been introduced for adduct analysis. A DMS/MS platform has been utilized for the analysis of dG-ABP, the deoxyguanosine adduct of the bladder carcinogen 4-aminobiphenyl (4-ABP). After optimization of the DMS parameters, each sample was analyzed in just 30 s following a simple protein precipitation step of the digested DNA. A detection limit of one modification in 10^6 nucleosides has been achieved using only 2 µg of DNA. A brief comparison (quantitative and qualitative) with liquid chromatography/mass spectrometry is also presented highlighting the advantages of using the DMS/MS method as a high-throughput platform. The data presented demonstrate the successful application of a DMS/MS/MS platform for the rapid quantitation of DNA adducts using, as a model analyte, the deoxyguanosine adduct of the bladder carcinogen 4-aminobiphenyl. Copyright © 2013 John Wiley & Sons, Ltd.

  16. Internal validation of the DNAscan/ANDE™ Rapid DNA Analysis™ platform and its associated PowerPlex® 16 high content DNA biochip cassette for use as an expert system with reference buccal swabs.

    Science.gov (United States)

    Moreno, Lilliana I; Brown, Alice L; Callaghan, Thomas F

    2017-07-01

    Rapid DNA platforms are fully integrated systems capable of producing and analyzing short tandem repeat (STR) profiles from reference sample buccal swabs in less than two hours. The technology requires minimal user interaction and experience making it possible for high quality profiles to be generated outside an accredited laboratory. The automated production of point of collection reference STR profiles could eliminate the time delay for shipment and analysis of arrestee samples at centralized laboratories. Furthermore, point of collection analysis would allow searching against profiles from unsolved crimes during the normal booking process once the infrastructure to immediately search the Combined DNA Index System (CODIS) database from the booking station is established. The DNAscan/ANDE™ Rapid DNA Analysis™ System developed by Network Biosystems was evaluated for robustness and reliability in the production of high quality reference STR profiles for database enrollment and searching applications. A total of 193 reference samples were assessed for concordance of the CODIS 13 loci. Studies to evaluate contamination, reproducibility, precision, stutter, peak height ratio, noise and sensitivity were also performed. The system proved to be robust, consistent and dependable. Results indicated an overall success rate of 75% for the 13 CODIS core loci and more importantly no incorrect calls were identified. The DNAscan/ANDE™ could be confidently used without human interaction in both laboratory and non-laboratory settings to generate reference profiles. Published by Elsevier B.V.

  17. Brickworx builds recurrent RNA and DNA structural motifs into medium- and low-resolution electron-density maps

    Energy Technology Data Exchange (ETDEWEB)

    Chojnowski, Grzegorz, E-mail: gchojnowski@genesilico.pl [International Institute of Molecular and Cell Biology, Trojdena 4, 02-109 Warsaw (Poland); Waleń, Tomasz [International Institute of Molecular and Cell Biology, Trojdena 4, 02-109 Warsaw (Poland); University of Warsaw, Banacha 2, 02-097 Warsaw (Poland); Piątkowski, Paweł; Potrzebowski, Wojciech [International Institute of Molecular and Cell Biology, Trojdena 4, 02-109 Warsaw (Poland); Bujnicki, Janusz M. [International Institute of Molecular and Cell Biology, Trojdena 4, 02-109 Warsaw (Poland); Adam Mickiewicz University, Umultowska 89, 61-614 Poznan (Poland)

    2015-03-01

    A computer program that builds crystal structure models of nucleic acid molecules is presented. Brickworx is a computer program that builds crystal structure models of nucleic acid molecules using recurrent motifs including double-stranded helices. In a first step, the program searches for electron-density peaks that may correspond to phosphate groups; it may also take into account phosphate-group positions provided by the user. Subsequently, comparing the three-dimensional patterns of the P atoms with a database of nucleic acid fragments, it finds the matching positions of the double-stranded helical motifs (A-RNA or B-DNA) in the unit cell. If the target structure is RNA, the helical fragments are further extended with recurrent RNA motifs from a fragment library that contains single-stranded segments. Finally, the matched motifs are merged and refined in real space to find the most likely conformations, including a fit of the sequence to the electron-density map. The Brickworx program is available for download and as a web server at http://iimcb.genesilico.pl/brickworx.

  18. Brickworx builds recurrent RNA and DNA structural motifs into medium- and low-resolution electron-density maps

    International Nuclear Information System (INIS)

    Chojnowski, Grzegorz; Waleń, Tomasz; Piątkowski, Paweł; Potrzebowski, Wojciech; Bujnicki, Janusz M.

    2015-01-01

    A computer program that builds crystal structure models of nucleic acid molecules is presented. Brickworx is a computer program that builds crystal structure models of nucleic acid molecules using recurrent motifs including double-stranded helices. In a first step, the program searches for electron-density peaks that may correspond to phosphate groups; it may also take into account phosphate-group positions provided by the user. Subsequently, comparing the three-dimensional patterns of the P atoms with a database of nucleic acid fragments, it finds the matching positions of the double-stranded helical motifs (A-RNA or B-DNA) in the unit cell. If the target structure is RNA, the helical fragments are further extended with recurrent RNA motifs from a fragment library that contains single-stranded segments. Finally, the matched motifs are merged and refined in real space to find the most likely conformations, including a fit of the sequence to the electron-density map. The Brickworx program is available for download and as a web server at http://iimcb.genesilico.pl/brickworx

  19. Use of ENVISAT ASAR Global Monitoring Mode to complement optical data in the mapping of rapid broad-scale flooding in Pakistan

    Directory of Open Access Journals (Sweden)

    D. O'Grady

    2011-11-01

    Full Text Available Envisat ASAR Global Monitoring Mode (GM data are used to produce maps of the extent of the flooding in Pakistan which are made available to the rapid response effort within 24 h of acquisition. The high temporal frequency and independence of the data from cloud-free skies makes GM data a viable tool for mapping flood waters during those periods where optical satellite data are unavailable, which may be crucial to rapid response disaster planning, where thousands of lives are affected. Image differencing techniques are used, with pre-flood baseline image backscatter values being deducted from target values to eliminate regions with a permanent flood-like radar response due to volume scattering and attenuation, and to highlight the low response caused by specular reflection by open flood water. The effect of local incidence angle on the received signal is mitigated by ensuring that the deducted image is acquired from the same orbit track as the target image. Poor separability of the water class with land in areas beyond the river channels is tackled using a region-growing algorithm which seeks threshold-conformance from seed pixels at the center of the river channels. The resultant mapped extents are tested against MODIS SWIR data where available, with encouraging results.

  20. Mapping DNA cleavage by the Type ISP restriction-modification enzymes following long-range communication between DNA sites in different orientations

    OpenAIRE

    van Aelst, Kara; Saikrishnan, Kayarat; Szczelkun, Mark D

    2015-01-01

    The prokaryotic Type ISP restriction-modification enzymes are single-chain proteins comprising an Mrr-family nuclease, a superfamily 2 helicase-like ATPase, a coupler domain, a methyltransferase, and a DNA-recognition domain. Upon recognising an unmodified DNA target site, the helicase-like domain hydrolyzes ATP to cause site release (remodeling activity) and to then drive downstream translocation consuming 1-2 ATP per base pair (motor activity). On an invading foreign DNA, double-strand brea...

  1. Cloning of the cDNA for a human homologue of the Drosophila white gene and mapping to chromosome 21q22.3.

    OpenAIRE

    Chen, H.; Rossier, C.; Lalioti, M. D.; Lynn, A.; Chakravarti, A.; Perrin, G.; Antonarakis, S. E.

    1996-01-01

    In an effort to contribute to the transcript map of human chromosome 21 and the understanding of the pathophysiology of trisomy 21, we have used exon trapping to identify fragments of chromosome 21 genes. Two trapped exons, from pools of chromosome 21-specific cosmids, showed homology to the Drosophila white (w) gene. We subsequently cloned the corresponding cDNA for a human homologue of the Drosophila w gene (hW) from human retina and fetal brain cDNA libraries. The gene belongs to the ATP-b...

  2. Rapid discrimination of Isaria javanica and Isaria poprawskii from Isaria spp. using high resolution DNA melting assays

    Science.gov (United States)

    The current study evaluates the potential of using high resolution DNA melting assays to discriminate species in the genus, Isaria. The study utilizes a previously identified 103 base pair PCR amplicon, which was reported to be selective for Isaria fumosorosea. Our study finds the amplicon selective...

  3. Rapid detection and identification of viral and bacterial fish pathogens using a DNA array‐based multiplex assay

    DEFF Research Database (Denmark)

    Lievens, B.; Frans, I.; Heusdens, C.

    2011-01-01

    for the simultaneous detection and identification of all cyprinid herpesviruses (CyHV‐1, CyHV‐2 and CyHV‐3) and some of the most important fish pathogenic Flavobacterium species, including F. branchiophilum, F. columnare and F. psychrophilum. For virus identification, the DNA polymerase and helicase genes were...

  4. Evaluation of a transposase protocol for rapid generation of shotgun high-throughput sequencing libraries from nanogram quantities of DNA.

    Science.gov (United States)

    Marine, Rachel; Polson, Shawn W; Ravel, Jacques; Hatfull, Graham; Russell, Daniel; Sullivan, Matthew; Syed, Fraz; Dumas, Michael; Wommack, K Eric

    2011-11-01

    Construction of DNA fragment libraries for next-generation sequencing can prove challenging, especially for samples with low DNA yield. Protocols devised to circumvent the problems associated with low starting quantities of DNA can result in amplification biases that skew the distribution of genomes in metagenomic data. Moreover, sample throughput can be slow, as current library construction techniques are time-consuming. This study evaluated Nextera, a new transposon-based method that is designed for quick production of DNA fragment libraries from a small quantity of DNA. The sequence read distribution across nine phage genomes in a mock viral assemblage met predictions for six of the least-abundant phages; however, the rank order of the most abundant phages differed slightly from predictions. De novo genome assemblies from Nextera libraries provided long contigs spanning over half of the phage genome; in four cases where full-length genome sequences were available for comparison, consensus sequences were found to match over 99% of the genome with near-perfect identity. Analysis of areas of low and high sequence coverage within phage genomes indicated that GC content may influence coverage of sequences from Nextera libraries. Comparisons of phage genomes prepared using both Nextera and a standard 454 FLX Titanium library preparation protocol suggested that the coverage biases according to GC content observed within the Nextera libraries were largely attributable to bias in the Nextera protocol rather than to the 454 sequencing technology. Nevertheless, given suitable sequence coverage, the Nextera protocol produced high-quality data for genomic studies. For metagenomics analyses, effects of GC amplification bias would need to be considered; however, the library preparation standardization that Nextera provides should benefit comparative metagenomic analyses.

  5. An accurate and rapid continuous wavelet dynamic time warping algorithm for unbalanced global mapping in nanopore sequencing

    KAUST Repository

    Han, Renmin; Li, Yu; Wang, Sheng; Gao, Xin

    2017-01-01

    Long-reads, point-of-care, and PCR-free are the promises brought by nanopore sequencing. Among various steps in nanopore data analysis, the global mapping between the raw electrical current signal sequence and the expected signal sequence from

  6. National Insect and Disease Risk Map (NIDRM)--cutting edge software for rapid insect and disease risk model development

    Science.gov (United States)

    Frank J. Krist

    2010-01-01

    The Forest Health Technology Enterprise Team (FHTET) of the U.S. Forest Service is leading an effort to produce the next version of the National Insect and Disease Risk Map (NIDRM) for targeted release in 2011. The goal of this effort is to update spatial depictions of risk of tree mortality based on: (1) newly derived 240-m geospatial information depicting the...

  7. Feasibility study of using the RoboEarth cloud engine for rapid mapping and tracking with small unmanned aerial systems

    Science.gov (United States)

    Li-Chee-Ming, J.; Armenakis, C.

    2014-11-01

    This paper presents the ongoing development of a small unmanned aerial mapping system (sUAMS) that in the future will track its trajectory and perform 3D mapping in near-real time. As both mapping and tracking algorithms require powerful computational capabilities and large data storage facilities, we propose to use the RoboEarth Cloud Engine (RCE) to offload heavy computation and store data to secure computing environments in the cloud. While the RCE's capabilities have been demonstrated with terrestrial robots in indoor environments, this paper explores the feasibility of using the RCE in mapping and tracking applications in outdoor environments by small UAMS. The experiments presented in this work assess the data processing strategies and evaluate the attainable tracking and mapping accuracies using the data obtained by the sUAMS. Testing was performed with an Aeryon Scout quadcopter. It flew over York University, up to approximately 40 metres above the ground. The quadcopter was equipped with a single-frequency GPS receiver providing positioning to about 3 meter accuracies, an AHRS (Attitude and Heading Reference System) estimating the attitude to about 3 degrees, and an FPV (First Person Viewing) camera. Video images captured from the onboard camera were processed using VisualSFM and SURE, which are being reformed as an Application-as-a-Service via the RCE. The 3D virtual building model of York University was used as a known environment to georeference the point cloud generated from the sUAMS' sensor data. The estimated position and orientation parameters of the video camera show increases in accuracy when compared to the sUAMS' autopilot solution, derived from the onboard GPS and AHRS. The paper presents the proposed approach and the results, along with their accuracies.

  8. Evaluating rapid ground sampling and scaling estimated plant cover using UAV imagery up to Landsat for mapping arctic vegetation

    Science.gov (United States)

    Nelson, P.; Paradis, D. P.

    2017-12-01

    The small stature and spectral diversity of arctic plant taxa presents challenges in mapping arctic vegetation. Mapping vegetation at the appropriate scale is needed to visualize effects of disturbance, directional vegetation change or mapping of specific plant groups for other applications (eg. habitat mapping). Fine spatial grain of remotely sensed data (ca. 10 cm pixels) is often necessary to resolve patches of many arctic plant groups, such as bryophytes and lichens. These groups are also spectrally different from mineral, litter and vascular plants. We sought to explore method to generate high-resolution spatial and spectral data to explore better mapping methods for arctic vegetation. We sampled ground vegetation at seven sites north or west of tree-line in Alaska, four north of Fairbanks and three northwest of Bethel, respectively. At each site, we estimated cover of plant functional types in 1m2 quadrats spaced approximately every 10 m along a 100 m long transect. Each quadrat was also scanned using a field spectroradiometer (PSR+ Spectral Evolution, 400-2500 nm range) and photographed from multiple perspectives. We then flew our small UAV with a RGB camera over the transect and at least 50 m on either side collecting on imagery of the plot, which were used to generate a image mosaic and digital surface model of the plot. We compare plant functional group cover ocular estimated in situ to post-hoc estimation, either automated or using a human observer, using the quadrat photos. We also compare interpolated lichen cover from UAV scenes to estimated lichen cover using a statistical models using Landsat data, with focus on lichens. Light and yellow lichens are discernable in the UAV imagery but certain lichens, especially dark colored lichens or those with spectral signatures similar to graminoid litter, present challenges. Future efforts will focus on integrating UAV-upscaled ground cover estimates to hyperspectral sensors (eg. AVIRIS ng) for better combined

  9. Rapid Response to a Typhoon-Induced Flood with an SAR-Derived Map of Inundated Areas: Case Study and Validation

    Directory of Open Access Journals (Sweden)

    Hsiao-Wei Chung

    2015-09-01

    Full Text Available We report the successful case of a rapid response to a flash flood in I-Lan County of Taiwan with a map of inundated areas derived from COSMO-SkyMed 1 radar satellite imagery within 24 hours. The flood was caused by the intensive precipitation brought by Typhoon Soulik in July 2013. Based on the ensemble forecasts of trajectory, an urgent request of spaceborne SAR imagery was made 24 hours before Typhoon Soulik made landfall. Two COSMO-SkyMed images were successfully acquired when the center of Typhoon Soulik had just crossed the northern part of Taiwan. The standard level-1b product (radiometric-corrected, geometric-calibrated and orthorectified image was generated by using the off-the-shelf SARscape software. Following the same approach used with the Expert Landslide and Shadow Area Delineating System, the regional threshold of each tile image was determined to delineate still water surface and quasi-inundated areas in a fully-automatic manner. The results were overlaid on a digital elevation model, and the same tile was visually compared to an optical image taken by Formosat-2 before this event. With this ancillary information, the inundated areas were accurately and quickly identified. The SAR-derived map of inundated areas was published on a web-based platform powered by Google Earth within 24 hours, with the aim of supporting the decision-making process of disaster prevention and mitigation. A detailed validation was made afterwards by comparing the map with in situ data of the water levels at 17 stations. The results demonstrate the feasibility of rapidly responding to a typhoon-induced flood with a spaceborne SAR-derived map of inundated areas. A standard operating procedure was derived from this work and followed by the Water Hazard Mitigation Center of the Water Resources Agency, Taiwan, in subsequent typhoon seasons, such as Typhoon Trami (August, 2013 and Typhoon Soudelor (August, 2015.

  10. Rapid isolation of microsatellite DNAs and identification of polymorphic mitochondrial DNA regions in the fish rotan (Perccottus glenii) invading European Russia

    Science.gov (United States)

    King, Timothy L.; Eackles, Michael S.; Reshetnikov, Andrey N.

    2015-01-01

    Human-mediated translocations and subsequent large-scale colonization by the invasive fish rotan (Perccottus glenii Dybowski, 1877; Perciformes, Odontobutidae), also known as Amur or Chinese sleeper, has resulted in dramatic transformations of small lentic ecosystems. However, no detailed genetic information exists on population structure, levels of effective movement, or relatedness among geographic populations of P. glenii within the European part of the range. We used massively parallel genomic DNA shotgun sequencing on the semiconductor-based Ion Torrent Personal Genome Machine (PGM) sequencing platform to identify nuclear microsatellite and mitochondrial DNA sequences in P. glenii from European Russia. Here we describe the characterization of nine nuclear microsatellite loci, ascertain levels of allelic diversity, heterozygosity, and demographic status of P. glenii collected from Ilev, Russia, one of several initial introduction points in European Russia. In addition, we mapped sequence reads to the complete P. glenii mitochondrial DNA sequence to identify polymorphic regions. Nuclear microsatellite markers developed for P. glenii yielded sufficient genetic diversity to: (1) produce unique multilocus genotypes; (2) elucidate structure among geographic populations; and (3) provide unique perspectives for analysis of population sizes and historical demographics. Among 4.9 million filtered P. glenii Ion Torrent PGM sequence reads, 11,304 mapped to the mitochondrial genome (NC_020350). This resulted in 100 % coverage of this genome to a mean coverage depth of 102X. A total of 130 variable sites were observed between the publicly available genome from China and the studied composite mitochondrial genome. Among these, 82 were diagnostic and monomorphic between the mitochondrial genomes and distributed among 15 genome regions. The polymorphic sites (N = 48) were distributed among 11 mitochondrial genome regions. Our results also indicate that sequence reads generated

  11. Potential of cross-priming amplification and DNA-based lateral-flow strip biosensor for rapid on-site GMO screening.

    Science.gov (United States)

    Huang, Xin; Zhai, Congcong; You, Qimin; Chen, Hongjun

    2014-07-01

    The requirement to monitor the presence of genetically modified organisms (GMO) in a variety of marked products has generated an increasing demand for reliable, rapid, and time and cost-effective analytical methods. Here we report an on-site method for rapid detection of cauliflower mosaic virus promoter (CaMV 35S), a common element present in most GMO, using cross-priming amplification (CPA) technology. Detection was achieved using a DNA-based contamination-proof strip biosensor. The limit of detection was 30 copies for the pBI121 plasmid containing the CaMV 35S gene. The certified reference sample of GM maize line MON810 was detectable even at the low relative mass concentration of 0.05%. The developed CPA method had high specificity for the CaMV 35S gene, as compared with other GM lines not containing this gene and non-GM products. The method was further validated using nine real-world samples, and the results were confirmed by real-time PCR analysis. Because of its simplicity, rapidity, and high sensitivity, this method of detecting the CaMV 35S gene has great commercial prospects for rapid GMO screening of high-consumption food and agriculture products.

  12. Whole-bacterium SELEX of DNA aptamers for rapid detection of E.coli O157:H7 using a QCM sensor.

    Science.gov (United States)

    Yu, Xiaofan; Chen, Fang; Wang, Ronghui; Li, Yanbin

    2018-01-20

    The rapid detection of foodborne pathogens is critical to ensure food safety. The objective of this study is to select aptamers specifically bound to Escherichia coli O157:H7 using the whole-bacterium SELEX (Systematic Evolution of Ligands by Exponential Enrichment) and apply the selected aptamer to a QCM (quartz crystal microbalance) sensor for rapid and sensitive detection of target bacteria. A total of 19 rounds of selection against live E. coli O157:H7 and 6 rounds of counter selection against a mixture of Staphylococcus aureus, Listeria monocytogenes, and Salmonella Typhimurium, were performed. The aptamer pool from the last round was cloned and sequenced. One sequence S1 that appeared 16 times was characterized and a dissociation constant (K d ) of 10.30nM was obtained. Subsequently, a QCM aptasensor was developed for the rapid detection of E. coli O157:H7. The limit of detection (LOD) and the detection time of the aptasensor was determined to be 1.46×10 3 CFU/ml and 50min, respectively. This study demonstrated that the ssDNA aptamer selected by the whole-bacterium SELEX possessed higher sensitivity than previous work and the potential use of the constructed QCM aptasensor in rapid screening of foodborne pathogens. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Single-base resolution maps of cultivated and wild rice methylomes and regulatory roles of DNA methylation in plant gene expression

    Directory of Open Access Journals (Sweden)

    Li Xin

    2012-07-01

    Full Text Available Abstract Background DNA methylation plays important biological roles in plants and animals. To examine the rice genomic methylation landscape and assess its functional significance, we generated single-base resolution DNA methylome maps for Asian cultivated rice Oryza sativa ssp. japonica, indica and their wild relatives, Oryza rufipogon and Oryza nivara. Results The overall methylation level of rice genomes is four times higher than that of Arabidopsis. Consistent with the results reported for Arabidopsis, methylation in promoters represses gene expression while gene-body methylation generally appears to be positively associated with gene expression. Interestingly, we discovered that methylation in gene transcriptional termination regions (TTRs can significantly repress gene expression, and the effect is even stronger than that of promoter methylation. Through integrated analysis of genomic, DNA methylomic and transcriptomic differences between cultivated and wild rice, we found that primary DNA sequence divergence is the major determinant of methylational differences at the whole genome level, but DNA methylational difference alone can only account for limited gene expression variation between the cultivated and wild rice. Furthermore, we identified a number of genes with significant difference in methylation level between the wild and cultivated rice. Conclusions The single-base resolution methylomes of rice obtained in this study have not only broadened our understanding of the mechanism and function of DNA methylation in plant genomes, but also provided valuable data for future studies of rice epigenetics and the epigenetic differentiation between wild and cultivated rice.

  14. Independent, rapid and targeted loss of highly repetitive DNA in natural and synthetic allopolyploids of Nicotiana tabacum

    Czech Academy of Sciences Publication Activity Database

    Renny-Byfield, S.; Kovařík, Aleš; Chester, M.; Nichols, R.A.; Macas, Jiří; Novák, Petr; Leitch, A.R.

    2012-01-01

    Roč. 7, č. 5 (2012), e36963 E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GAP501/10/0208; GA MŠk OC10037 Institutional research plan: CEZ:AV0Z50040702; CEZ:AV0Z50510513 Keywords : chromosome evolution * repetitive DNA * allopolyploid Subject RIV: BO - Biophysics; EB - Genetics ; Molecular Biology (BC-A) Impact factor: 3.730, year: 2012

  15. Rapid, large-scale purification and characterization of Ada protein (O sup 6 methylguanine-DNA methyltransferase) of E. coli

    Energy Technology Data Exchange (ETDEWEB)

    Bhattacharyya, D.; Tano, K.; Bunick, G.J.; Uberbacher, E.C.; Mitra, S. (Oak Ridge National Laboratory, TN (USA)); Behnke, W.D. (Univ. of Cincinnati College of Medicine, OH (USA))

    1988-07-25

    The E. coli Ada protein (O{sup 6}-methylguanine-DNA methyltransferase) has been purified using a high-level expression vector with a yield of about 3 mg per liter of E. coli culture. The 39-kDa protein has an extinction coefficient (E{sup 280nm}{sub 1%}) of 5.3. Its isoelectric point of 7.1 is lower than that predicted from the amino acid content. The homogeneous Ada protein is fully active as a methyl acceptor from O{sup 6}-methylguanine in DNA. Its reaction with O{sup 6}-methylguanine in a synthetic DNA has a second-order rate constant of 1.1 {times} 10{sup 9} M{sup {minus}1} min{sup {minus}1} at 0{degree}C. Both the native form and the protein methylated at Cys-69 are monomeric. The CD spectrum suggests a low {alpha}-helical content and the radius of gyration of 23 {angstrom} indicates a compact, globular shape. The middle region of the protein is sensitive to a variety of proteases, including an endogenous activity in E. coli, suggesting that the protein is composed of N-terminal and C-terminal domains connected by a hinge region. E. coli B has a higher level of this protease than does K12.

  16. Mitochondrial DNA signature for range-wide populations of Bicyclus anynana suggests a rapid expansion from recent refugia.

    Directory of Open Access Journals (Sweden)

    Maaike A de Jong

    Full Text Available This study investigates the genetic diversity, population structure and demographic history of the afrotropical butterfly Bicyclus anynana using mitochondrial DNA (mtDNA. Samples from six wild populations covering most of the species range from Uganda to South Africa were compared for the cytochrome c oxidase subunit gene (COI. Molecular diversity indices show overall high mtDNA diversity for the populations, but low nucleotide divergence between haplotypes. Our results indicate relatively little geographic population structure among the southern populations, especially given the extensive distributional range and an expectation of limited gene flow between populations. We implemented neutrality tests to assess signatures of recent historical demographic events. Tajima's D test and Fu's F(S test both suggested recent population growth for the populations. The results were only significant for the southernmost populations when applying Tajima's D, but Fu's F(S indicated significant deviations from neutrality for all populations except the one closest to the equator. Based on our own findings and those from pollen and vegetation studies, we hypothesize that the species range of B. anynana was reduced to equatorial refugia during the last glacial period, and that the species expanded southwards during the past 10.000 years. These results provide crucial background information for studies of phenotypic and molecular adaptation in wild populations of B. anynana.

  17. Application of a mapping function technique to the design of damped detuned structures and rapid calculation of their wakefields

    International Nuclear Information System (INIS)

    Jones, R.M.; Miller, R.H.

    1998-08-01

    In order to reduce the dipole wake encountered by the first few bunches accelerated in a multi-bunch NLC scenario the DDS (damped detuned structure) was redesigned such that a much improved Gaussian fall-off occurs in the initial wake-function. From the 9 parameterized model of DDS1 the authors use a mapping function to allow DDS 3 and 4 to be modeled and hence avoid additional and prohibitively time consuming MAFIA runs. The equivalent circuit parameters and geometrical parameters are treated as functions of the synchronous frequency and are readily mapped onto the new synchronous frequencies. The new geometrical parameters form a family where each is associated with the iris diameter

  18. DPS - a rapid method for genome sequencing of DNA-containing bacteriophages directly from a single plaque

    DEFF Research Database (Denmark)

    Kot, Witold Piotr; Vogensen, Finn Kvist; Sørensen, Søren Johannes

    2014-01-01

    Bacteriophages (phages) coexist with bacteria in all environments and influence microbial diversity, evolution and industrial production processes. As a result of this major impact of phages on microbes, tools that allow rapid characterization of phages are needed. Today, one of the most powerful...

  19. Mapping of Schistosomiasis and Soil-Transmitted Helminths in Namibia: The First Large-Scale Protocol to Formally Include Rapid Diagnostic Tests.

    Directory of Open Access Journals (Sweden)

    José Carlos Sousa-Figueiredo

    Full Text Available Namibia is now ready to begin mass drug administration of praziquantel and albendazole against schistosomiasis and soil-transmitted helminths, respectively. Although historical data identifies areas of transmission of these neglected tropical diseases (NTDs, there is a need to update epidemiological data. For this reason, Namibia adopted a new protocol for mapping of schistosomiasis and geohelminths, formally integrating rapid diagnostic tests (RDTs for infections and morbidity. In this article, we explain the protocol in detail, and introduce the concept of 'mapping resolution', as well as present results and treatment recommendations for northern Namibia.This new protocol allowed a large sample to be surveyed (N = 17,896 children from 299 schools at relatively low cost (7 USD per person mapped and very quickly (28 working days. All children were analysed by RDTs, but only a sub-sample was also diagnosed by light microscopy. Overall prevalence of schistosomiasis in the surveyed areas was 9.0%, highly associated with poorer access to potable water (OR = 1.5, P<0.001 and defective (OR = 1.2, P<0.001 or absent sanitation infrastructure (OR = 2.0, P<0.001. Overall prevalence of geohelminths, more particularly hookworm infection, was 12.2%, highly associated with presence of faecal occult blood (OR = 1.9, P<0.001. Prevalence maps were produced and hot spots identified to better guide the national programme in drug administration, as well as targeted improvements in water, sanitation and hygiene. The RDTs employed (circulating cathodic antigen and microhaematuria for Schistosoma mansoni and S. haematobium, respectively performed well, with sensitivities above 80% and specificities above 95%.This protocol is cost-effective and sensitive to budget limitations and the potential economic and logistical strains placed on the national Ministries of Health. Here we present a high resolution map of disease prevalence levels, and treatment regimens are

  20. An easy, rapid, and cost-effective method for DNA extraction from various lichen taxa and specimens suitable for analysis of fungal and algal strains.

    Science.gov (United States)

    Park, Sook-Young; Jang, Seol-Hwa; Oh, Soon-Ok; Kim, Jung A; Hur, Jae-Seoun

    2014-12-01

    Lichen studies, including biodiversity, phylogenetic relationships, and conservation concerns require definitive species identification, however many lichens can be challenging to identify at the species level. Molecular techniques have shown efficacy in discriminating among lichen taxa, however, obtaining genomic DNA from herbarium and fresh lichen thalli by conventional methods has been difficult, because lichens contain high proteins, polysaccharides, and other complex compounds in their cell walls. Here we report a rapid, easy, and inexpensive protocol for extracting PCR-quality DNA from various lichen species. This method involves the following two steps: first, cell breakage using a beadbeater; and second, extraction, isolation, and precipitation of genomic DNA. The procedure requires approximately 10 mg of lichen thalli and can be completed within 20 min. The obtained DNAs were of sufficient quality and quantity to amplify the internal transcribed spacer region from the fungal and algal lichen components, as well as to sequence the amplified products. In addition, 26 different lichen taxa were tested, resulting in successful PCR products. The results of this study validated the experimental protocols, and clearly demonstrated the efficacy and value of our KCl extraction method applied in the fungal and algal samples.

  1. Rapid detection of ERG11 gene mutations in clinical Candida albicans isolates with reduced susceptibility to fluconazole by rolling circle amplification and DNA sequencing

    Directory of Open Access Journals (Sweden)

    Ellis David

    2009-08-01

    Full Text Available Abstract Background Amino acid substitutions in the target enzyme Erg11p of azole antifungals contribute to clinically-relevant azole resistance in Candida albicans. A simple molecular method for rapid detection of ERG11 gene mutations would be an advantage as a screening tool to identify potentially-resistant strains and to track their movement. To complement DNA sequencing, we developed a padlock probe and rolling circle amplification (RCA-based method to detect a series of mutations in the C. albicans ERG11 gene using "reference" azole-resistant isolates with known mutations. The method was then used to estimate the frequency of ERG11 mutations and their type in 25 Australian clinical C. albicans isolates with reduced susceptibility to fluconazole and in 23 fluconazole-susceptible isolates. RCA results were compared DNA sequencing. Results The RCA assay correctly identified all ERG11 mutations in eight "reference" C. albicans isolates. When applied to 48 test strains, the RCA method showed 100% agreement with DNA sequencing where an ERG11 mutation-specific probe was used. Of 20 different missense mutations detected by sequencing in 24 of 25 (96% isolates with reduced fluconazole susceptibility, 16 were detected by RCA. Five missense mutations were detected by both methods in 18 of 23 (78% fluconazole-susceptible strains. DNA sequencing revealed that mutations in non-susceptible isolates were all due to homozygous nucleotide changes. With the exception of the mutations leading to amino acid substitution E266D, those in fluconazole-susceptible strains were heterozygous. Amino acid substitutions common to both sets of isolates were D116E, E266D, K128T, V437I and V488I. Substitutions unique to isolates with reduced fluconazole susceptibility were G464 S (n = 4 isolates, G448E (n = 3, G307S (n = 3, K143R (n = 3 and Y123H, S405F and R467K (each n = 1. DNA sequencing revealed a novel substitution, G450V, in one isolate. Conclusion The sensitive RCA

  2. Open microfluidic gel electrophoresis: Rapid and low cost separation and analysis of DNA at the nanoliter scale.

    Science.gov (United States)

    Gutzweiler, Ludwig; Gleichmann, Tobias; Tanguy, Laurent; Koltay, Peter; Zengerle, Roland; Riegger, Lutz

    2017-07-01

    Gel electrophoresis is one of the most applied and standardized tools for separation and analysis of macromolecules and their fragments in academic research and in industry. In this work we present a novel approach for conducting on-demand electrophoretic separations of DNA molecules in open microfluidic (OM) systems on planar polymer substrates. The approach combines advantages of slab gel, capillary- and chip-based methods offering low consumable costs (<0.1$) circumventing cost-intensive microfluidic chip fabrication, short process times (5 min per analysis) and high sensitivity (4 ng/μL dsDNA) combined with reasonable resolution (17 bases). The open microfluidic separation system comprises two opposing reservoirs of 2-4 μL in volume, a semi-contact written gel line acting as separation channel interconnecting the reservoirs and sample injected into the line via non-contact droplet dispensing and thus enabling the precise control of the injection plug and sample concentration. Evaporation is prevented by covering aqueous structures with PCR-grade mineral oil while maintaining surface temperature at 15°C. The liquid gel line exhibits a semi-circular cross section of adaptable width (∼200-600 μm) and height (∼30-80 μm) as well as a typical length of 15-55 mm. Layout of such liquid structures is adaptable on-demand not requiring time consuming and repetitive fabrication steps. The approach was successfully demonstrated by the separation of a standard label-free DNA ladder (100-1000 bp) at 100 V/cm via in-line staining and laser induced fluorescent end-point detection using an automated prototype. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. RAPID MAPPING FOR BUILT HERITAGE AT RISK USING LOW-COST AND COTS SENSORS. A TEST IN THE DUOMO VECCHIO OF SAN SEVERINO MARCHE

    Directory of Open Access Journals (Sweden)

    A. Calantropio

    2017-11-01

    Full Text Available In the last years, the researchers in the field of Geomatics have focused their attention in the experimentation and validation of new methodologies and techniques, stressing especially the potential of low-cost and COTS (Commercial Off The Shelf solutions and sensors. In particular, these tools have been used with purposes of rapid mapping in different contexts (ranging from the construction industry, environmental monitoring, mining activities, etc.. The Built Heritage, due to its intrinsic nature of endangered artefact, can largely benefit from the technological and methodological innovations in this research field. The contribute presented in this paper will highlight these main topics: the rapid mapping of the Built Heritage (in particular the one subjected to different types of risk using low-cost and COTS solutions. Different sensors and techniques were chosen to be evaluated on a specific test site: the Duomo Vecchio of San Severino Marche (MC - Italy, that was partially affected by the earthquake swarm that hit the area of Central Italy starting from the 24th of August 2016. One of the main aims of this work is to demonstrate how low-cost and COTS sensors can contribute to the documentation of the Built Heritage for its safeguard, for damage assessment in case of disastrous events and operations of restoration and preservation.

  4. Rapid Mapping for Built Heritage at Risk Using Low-Cost and Cots Sensors. a Test in the Duomo Vecchio of San Severino Marche

    Science.gov (United States)

    Calantropio, A.; Colucci, E.; Teppati Losè, L.

    2017-11-01

    In the last years, the researchers in the field of Geomatics have focused their attention in the experimentation and validation of new methodologies and techniques, stressing especially the potential of low-cost and COTS (Commercial Off The Shelf) solutions and sensors. In particular, these tools have been used with purposes of rapid mapping in different contexts (ranging from the construction industry, environmental monitoring, mining activities, etc.). The Built Heritage, due to its intrinsic nature of endangered artefact, can largely benefit from the technological and methodological innovations in this research field. The contribute presented in this paper will highlight these main topics: the rapid mapping of the Built Heritage (in particular the one subjected to different types of risk) using low-cost and COTS solutions. Different sensors and techniques were chosen to be evaluated on a specific test site: the Duomo Vecchio of San Severino Marche (MC - Italy), that was partially affected by the earthquake swarm that hit the area of Central Italy starting from the 24th of August 2016. One of the main aims of this work is to demonstrate how low-cost and COTS sensors can contribute to the documentation of the Built Heritage for its safeguard, for damage assessment in case of disastrous events and operations of restoration and preservation.

  5. An accurate and rapid continuous wavelet dynamic time warping algorithm for unbalanced global mapping in nanopore sequencing

    KAUST Repository

    Han, Renmin

    2017-12-24

    Long-reads, point-of-care, and PCR-free are the promises brought by nanopore sequencing. Among various steps in nanopore data analysis, the global mapping between the raw electrical current signal sequence and the expected signal sequence from the pore model serves as the key building block to base calling, reads mapping, variant identification, and methylation detection. However, the ultra-long reads of nanopore sequencing and an order of magnitude difference in the sampling speeds of the two sequences make the classical dynamic time warping (DTW) and its variants infeasible to solve the problem. Here, we propose a novel multi-level DTW algorithm, cwDTW, based on continuous wavelet transforms with different scales of the two signal sequences. Our algorithm starts from low-resolution wavelet transforms of the two sequences, such that the transformed sequences are short and have similar sampling rates. Then the peaks and nadirs of the transformed sequences are extracted to form feature sequences with similar lengths, which can be easily mapped by the original DTW. Our algorithm then recursively projects the warping path from a lower-resolution level to a higher-resolution one by building a context-dependent boundary and enabling a constrained search for the warping path in the latter. Comprehensive experiments on two real nanopore datasets on human and on Pandoraea pnomenusa, as well as two benchmark datasets from previous studies, demonstrate the efficiency and effectiveness of the proposed algorithm. In particular, cwDTW can almost always generate warping paths that are very close to the original DTW, which are remarkably more accurate than the state-of-the-art methods including FastDTW and PrunedDTW. Meanwhile, on the real nanopore datasets, cwDTW is about 440 times faster than FastDTW and 3000 times faster than the original DTW. Our program is available at https://github.com/realbigws/cwDTW.

  6. Optofluidics-based DNA structure-competitive aptasensor for rapid on-site detection of lead(II) in an aquatic environment.

    Science.gov (United States)

    Long, Feng; Zhu, Anna; Wang, Hongchen

    2014-11-07

    Lead ions (Pb(2+)), ubiquitous and one of the most toxic metallic pollutants, have attracted increasing attentions because of their various neurotoxic effects. Pb(2+) has been proven to induce a conformational change in G-quadruplex (G4) aptamers to form a stabilizing G4/Pb(2+) complex. Based on this principle, an innovative optofluidics-based DNA structure-competitive aptasensor was developed for Pb(2+) detection in an actual aquatic environment. The proposed sensing system has good characteristics, such as high sensitivity and selectivity, reusability, easy operation, rapidity, robustness, portability, use of a small sample volume, and cost effectiveness. A fluorescence-labeled G4 aptamer was utilized as a molecular probe. A DNA probe, a complementary strand of G4 aptamer, was immobilized onto the sensor surface. When the mixture of Pb(2+) solution and G4 aptamer was introduced into the optofluidic cell, Pb(2+) and the DNA probe bound competitively with the G4 aptamer. A high Pb(2+) concentration reduced the binding of the aptamer and the DNA probe; thus, a low-fluorescence signal was detected. A sensitive sensing response to Pb(2+) in the range of 1.0-300.0 nM with a low detection limit of 0.22 nM was exhibited under optimal conditions. The potential interference of the environmental sample matrix was assessed with spiked samples, and the recovery of Pb(2+) ranged from 80 to 105% with a relative standard deviation value of monitoring of other trace analytes. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library

    DEFF Research Database (Denmark)

    Petersen, L. K.; Blakskjær, P.; Chaikuad, A.

    2016-01-01

    A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous...... interactions. Moreover, the crystal structure showed, that although buried in the p38α active site, the original DNA attachment point of the compound was accessible through a channel created by the distorted P-loop conformation. This study demonstrates the usability of DNA-encoded library technologies...

  8. Rapid One-Step Selection Method for Generating Nucleic Acid Aptamers: Development of a DNA Aptamer against alpha-Bungarotoxin

    DEFF Research Database (Denmark)

    Lauridsen, Lasse Holm; Shamaileh, Hadi A.; Edwards, Stacey L.

    2012-01-01

    Background: Nucleic acids based therapeutic approaches have gained significant interest in recent years towards the development of therapeutics against many diseases. Recently, research on aptamers led to the marketing of Macugen (R), an inhibitor of vascular endothelial growth factor (VEGF......) for the treatment of age related macular degeneration (AMD). Aptamer technology may prove useful as a therapeutic alternative against an array of human maladies. Considering the increased interest in aptamer technology globally that rival antibody mediated therapeutic approaches, a simplified selection, possibly...... in one-step, technique is required for developing aptamers in limited time period. Principal Findings: Herein, we present a simple one-step selection of DNA aptamers against alpha-bungarotoxin. A toxin immobilized glass coverslip was subjected to nucleic acid pool binding and extensive washing followed...

  9. A GIS-based statistical model for rapid landslide susceptibility mapping in the Beichuan-Pingwu area, Sichuan, China

    International Nuclear Information System (INIS)

    Chen, Y; Wang, Q J

    2014-01-01

    The 2008 Wenchuan earthquake, with a magnitude of Mw 8.0, induced numerous landslides. Remote sensing planes were sent out to take high resolution aerial photographs, from which the geologic hazards could be instantly interpreted. However, aerial images covering all of the study area could not be obtained in a short time because of the limitations of the planes and the influence of weather conditions. This studyestablishes a statistical model based on the landslide interpretation results of one photographic strip inside the Beichuan-Pingwu area. It has strong applicability and can be applied to other places without such data. Finally, we produced a landslide susceptibility map, which providesscientific support for the instant evaluation of disaster information and post-disaster reconstruction

  10. Improved approach for electric vehicle rapid charging station placement and sizing using Google maps and binary lightning search algorithm

    Science.gov (United States)

    Shareef, Hussain; Mohamed, Azah

    2017-01-01

    The electric vehicle (EV) is considered a premium solution to global warming and various types of pollution. Nonetheless, a key concern is the recharging of EV batteries. Therefore, this study proposes a novel approach that considers the costs of transportation loss, buildup, and substation energy loss and that incorporates harmonic power loss into optimal rapid charging station (RCS) planning. A novel optimization technique, called binary lightning search algorithm (BLSA), is proposed to solve the optimization problem. BLSA is also applied to a conventional RCS planning method. A comprehensive analysis is conducted to assess the performance of the two RCS planning methods by using the IEEE 34-bus test system as the power grid. The comparative studies show that the proposed BLSA is better than other optimization techniques. The daily total cost in RCS planning of the proposed method, including harmonic power loss, decreases by 10% compared with that of the conventional method. PMID:29220396

  11. Improved approach for electric vehicle rapid charging station placement and sizing using Google maps and binary lightning search algorithm.

    Directory of Open Access Journals (Sweden)

    Md Mainul Islam

    Full Text Available The electric vehicle (EV is considered a premium solution to global warming and various types of pollution. Nonetheless, a key concern is the recharging of EV batteries. Therefore, this study proposes a novel approach that considers the costs of transportation loss, buildup, and substation energy loss and that incorporates harmonic power loss into optimal rapid charging station (RCS planning. A novel optimization technique, called binary lightning search algorithm (BLSA, is proposed to solve the optimization problem. BLSA is also applied to a conventional RCS planning method. A comprehensive analysis is conducted to assess the performance of the two RCS planning methods by using the IEEE 34-bus test system as the power grid. The comparative studies show that the proposed BLSA is better than other optimization techniques. The daily total cost in RCS planning of the proposed method, including harmonic power loss, decreases by 10% compared with that of the conventional method.

  12. Quantum Mechanics/Molecular Mechanics Free Energy Maps and Nonadiabatic Simulations for a Photochemical Reaction in DNA: Cyclobutane Thymine Dimer.

    Science.gov (United States)

    Mendieta-Moreno, Jesús I; Trabada, Daniel G; Mendieta, Jesús; Lewis, James P; Gómez-Puertas, Paulino; Ortega, José

    2016-11-03

    The absorption of ultraviolet radiation by DNA may result in harmful genetic lesions that affect DNA replication and transcription, ultimately causing mutations, cancer, and/or cell death. We analyze the most abundant photochemical reaction in DNA, the cyclobutane thymine dimer, using hybrid quantum mechanics/molecular mechanics (QM/MM) techniques and QM/MM nonadiabatic molecular dynamics. We find that, due to its double helix structure, DNA presents a free energy barrier between nonreactive and reactive conformations leading to the photolesion. Moreover, our nonadiabatic simulations show that most of the photoexcited reactive conformations return to standard B-DNA conformations after an ultrafast nonradiative decay to the ground state. This work highlights the importance of dynamical effects (free energy, excited-state dynamics) for the study of photochemical reactions in biological systems.

  13. Some AFLP amplicons are highly conserved DNA sequences mapping to the same linkage groups in two F2 populations of carrot

    Directory of Open Access Journals (Sweden)

    Santos Carlos A.F.

    2002-01-01

    Full Text Available Amplified fragment length polymorphism (AFLP is a fast and reliable tool to generate a large number of DNA markers. In two unrelated F2 populations of carrot (Daucus carota L., Brasilia x HCM and B493 x QAL (wild carrot, it was hypothesized that DNA 1 digested with the same restriction endonuclease enzymes and amplified with the same primer combination and 2 sharing the same position in polyacrylamide gels should be conserved sequences. To test this hypothesis AFLP fragments from polyacrylamide gels were eluted, reamplified, separated in agarose gels, purified, cloned and sequenced. Among thirty-one paired fragments from each F2 population, twenty-six had identity greater than 91% and five presented identity of 24% to 44%. Among the twenty-six conserved AFLPs only one mapped to different linkage groups in the two populations while four of the five less-conserved bands mapped to different linkage groups. Of eight SCAR (sequence characterized amplified regions primers tested, one conserved AFLP resulted in co-dominant markers in both populations. Screening among 14 carrot inbreds or cultivars with three AFLP-SCAR primers revealed clear and polymorphic PCR products, with similar molecular sizes on agarose gels. The development of co-dominant markers based on conserved AFLP fragments will be useful to detect seed mixtures among hybrids, to improve and to merge linkage maps and to study diversity and phylogenetic relationships.

  14. Rapid-response flood mapping during Hurricanes Harvey, Irma and Maria by the Global Flood Partnership (GFP)

    Science.gov (United States)

    Cohen, S.; Alfieri, L.; Brakenridge, G. R.; Coughlan, E.; Galantowicz, J. F.; Hong, Y.; Kettner, A.; Nghiem, S. V.; Prados, A. I.; Rudari, R.; Salamon, P.; Trigg, M.; Weerts, A.

    2017-12-01

    The Global Flood Partnership (GFP; https://gfp.jrc.ec.europa.eu) is a multi-disciplinary group of scientists, operational agencies and flood risk managers focused on developing efficient and effective global flood management tools. Launched in 2014, its aim is to establish a partnership for global flood forecasting, monitoring and impact assessment to strengthen preparedness and response and to reduce global disaster losses. International organizations, the private sector, national authorities, universities and research agencies contribute to the GFP on a voluntary basis and benefit from a global network focused on flood risk reduction. At the onset of Hurricane Harvey, GFP was `activated' using email requests via its mailing service. Soon after, flood inundation maps, based on remote sensing analysis and modeling, were shared by different agencies, institutions, and individuals. These products were disseminated, to varying degrees of effectiveness, to federal, state and local agencies via emails and data-sharing services. This generated a broad data-sharing network which was utilized at the early stages of Hurricane Irma's impact, just two weeks after Harvey. In this presentation, we will describe the extent and chronology of the GFP response to both Hurricanes Harvey, Irma and Maria. We will assess the potential usefulness of this effort for event managers in various types of organizations and discuss future improvements to be implemented.

  15. Forest loss maps from regional satellite monitoring systematically underestimate deforestation in two rapidly changing parts of the Amazon

    Science.gov (United States)

    Milodowski, D. T.; Mitchard, E. T. A.; Williams, M.

    2017-09-01

    Accurate, consistent reporting of changing forest area, stratified by forest type, is required for all countries under their commitments to the Paris Agreement (UNFCCC 2015 Adoption of the Paris Agreement (Paris: UNFCCC)). Such change reporting may directly impact on payments through comparisons to national Reference (Emissions) Levels under the Reducing Emissions from Deforestation and forest Degradation (REDD+) framework. The emergence of global, satellite-based forest monitoring systems, including Global Forest Watch (GFW) and FORMA, have great potential in aiding this endeavour. However, the accuracy of these systems has been questioned and their uncertainties are poorly constrained, both in terms of the spatial extent of forest loss and timing of change. Here, using annual time series of 5 m optical imagery at two sites in the Brazilian Amazon, we demonstrate that GFW more accurately detects forest loss than the coarser-resolution FORMA or Brazil’s national-level PRODES product, though all underestimate the rate of loss. We conclude GFW provides robust indicators of forest loss, at least for larger-scale forest change, but under-predicts losses driven by small-scale disturbances (< 2 ha), even though these are much larger than its minimum mapping unit (0.09 ha).

  16. Eukaryote-Made Thermostable DNA Polymerase Enables Rapid PCR-Based Detection of Mycoplasma, Ureaplasma and Other Bacteria in the Amniotic Fluid of Preterm Labor Cases.

    Science.gov (United States)

    Ueno, Tomohiro; Niimi, Hideki; Yoneda, Noriko; Yoneda, Satoshi; Mori, Masashi; Tabata, Homare; Minami, Hiroshi; Saito, Shigeru; Kitajima, Isao

    2015-01-01

    Intra-amniotic infection has long been recognized as the leading cause of preterm delivery. Microbial culture is the gold standard for the detection of intra-amniotic infection, but several days are required, and many bacterial species in the amniotic fluid are difficult to cultivate. We developed a novel nested-PCR-based assay for detecting Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples within three hours of sample collection. To detect prokaryotes, eukaryote-made thermostable DNA polymerase, which is free from bacterial DNA contamination, is used in combination with bacterial universal primers. In contrast, to detect eukaryotes, conventional bacterially-made thermostable DNA polymerase is used in combination with fungal universal primers. To assess the validity of the PCR assay, we compared the PCR and conventional culture results using 300 amniotic fluid samples. Based on the detection level (positive and negative), 93.3% (280/300) of Mycoplasma, 94.3% (283/300) of Ureaplasma, 89.3% (268/300) of other bacteria and 99.7% (299/300) of fungi matched the culture results. Meanwhile, concerning the detection of bacteria other than Mycoplasma and Ureaplasma, 228 samples were negative according to the PCR method, 98.2% (224/228) of which were also negative based on the culture method. Employing the devised primer sets, mixed amniotic fluid infections of Mycoplasma, Ureaplasma and/or other bacteria could be clearly distinguished. In addition, we also attempted to compare the relative abundance in 28 amniotic fluid samples with mixed infection, and judged dominance by comparing the Ct values of quantitative real-time PCR. We developed a novel PCR assay for the rapid detection of Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples. This assay can also be applied to accurately diagnose the absence of bacteria in samples. We believe that this assay will positively contribute to the treatment of intra-amniotic infection and

  17. Improving the extraction of crisis information in the context of flood, fire, and landslide rapid mapping using SAR and optical remote sensing data

    Science.gov (United States)

    Martinis, Sandro; Clandillon, Stephen; Twele, André; Huber, Claire; Plank, Simon; Maxant, Jérôme; Cao, Wenxi; Caspard, Mathilde; May, Stéphane

    2016-04-01

    Optical and radar satellite remote sensing have proven to provide essential crisis information in case of natural disasters, humanitarian relief activities and civil security issues in a growing number of cases through mechanisms such as the Copernicus Emergency Management Service (EMS) of the European Commission or the International Charter 'Space and Major Disasters'. The aforementioned programs and initiatives make use of satellite-based rapid mapping services aimed at delivering reliable and accurate crisis information after natural hazards. Although these services are increasingly operational, they need to be continuously updated and improved through research and development (R&D) activities. The principal objective of ASAPTERRA (Advancing SAR and Optical Methods for Rapid Mapping), the ESA-funded R&D project being described here, is to improve, automate and, hence, speed-up geo-information extraction procedures in the context of natural hazards response. This is performed through the development, implementation, testing and validation of novel image processing methods using optical and Synthetic Aperture Radar (SAR) data. The methods are mainly developed based on data of the German radar satellites TerraSAR-X and TanDEM-X, the French satellite missions Pléiades-1A/1B as well as the ESA missions Sentinel-1/2 with the aim to better characterize the potential and limitations of these sensors and their synergy. The resulting algorithms and techniques are evaluated in real case applications during rapid mapping activities. The project is focussed on three types of natural hazards: floods, landslides and fires. Within this presentation an overview of the main methodological developments in each topic is given and demonstrated in selected test areas. The following developments are presented in the context of flood mapping: a fully automated Sentinel-1 based processing chain for detecting open flood surfaces, a method for the improved detection of flooded vegetation

  18. Rapid Mapping of Lithiation Dynamics in Transition Metal Oxide Particles with Operando X-ray Absorption Spectroscopy

    Science.gov (United States)

    Nowack, Lea; Grolimund, Daniel; Samson, Vallerie; Marone, Federica; Wood, Vanessa

    2016-02-01

    Since the commercialization of lithium ion batteries (LIBs), layered transition metal oxides (LiMO2, where M = Co, Mn, Ni, or mixtures thereof) have been materials of choice for LIB cathodes. During cycling, the transition metals change their oxidation states, an effect that can be tracked by detecting energy shifts in the X-ray absorption near edge structure (XANES) spectrum. X-ray absorption spectroscopy (XAS) can therefore be used to visualize and quantify lithiation kinetics in transition metal oxide cathodes; however, in-situ measurements are often constrained by temporal resolution and X-ray dose, necessitating compromises in the electrochemistry cycling conditions used or the materials examined. We report a combined approach to reduce measurement time and X-ray exposure for operando XAS studies of lithium ion batteries. A highly discretized energy resolution coupled with advanced post-processing enables rapid yet reliable identification of the oxidation state. A full-field microscopy setup provides sub-particle resolution over a large area of battery electrode, enabling the oxidation state within many transition metal oxide particles to be tracked simultaneously. Here, we apply this approach to gain insights into the lithiation kinetics of a commercial, mixed-metal oxide cathode material, nickel cobalt aluminium oxide (NCA), during (dis)charge and its degradation during overcharge.

  19. [Application of DNA-based electrochemical biosensor in rapid detection of Escherichia coli exist in licorice decoction].

    Science.gov (United States)

    Zhao, Yu-Wen; Wang, Hai-Xia; Bie, Song-Tao; Shao, Qian; Wang, Chun-Hua; Wang, Dong-Heng; Li, Zheng

    2018-03-01

    A new method for detection of Escherichia coli exist in licorice decoction was developed by using DNA-based electrochemical biosensor. The thiolated capture probe was immobilized on a gold electrode at first. Then the aptamer for Escherichia coli was combined with the capture probe by hybridization. Due to the stronger interaction between the aptamer and the E. coli, the aptamer can dissociate from the capture probe in the presence of E. coli in licorice decoction. The biotinylated detection probe was hybridized with the single-strand capture probe. As a result, the electrochemical response to Escherichia coli can be measured by using differential pulse voltammetric in the presence of α-naphthyl phosphate. The plot of peak current vs. the logarithm of concentration in the range from 2.7×10² to 2.7×10⁸ CFU·mL⁻¹ displayed a linear relationship with a detection limit of 50 CFU·mL⁻¹. The relative standard deviation of 3 successive scans was 2.5%,2.1%,4.6% for 2×10²,2×10⁴,2×106:⁶ CFU·mL⁻¹ E. coli, respectively. The proposed procedure showed better specificity to E. coli in comparison to Pseudomonas aeruginosa, Staphylococcus aureus and Bacillus subtilis. In the detection of the real extractum glycyrrhizae, the results between the proposed strategy and the GB assay showed high degree of agreement, demonstrating the designed biosensor could be utilized as a powerful tool for microbial examination for traditional Chinese medicine. Copyright© by the Chinese Pharmaceutical Association.

  20. Rapid changes in phospho-MAP/tau epitopes during neuronal stress: cofilin-actin rods primarily recruit microtubule binding domain epitopes.

    Science.gov (United States)

    Whiteman, Ineka T; Minamide, Laurie S; Goh, De Lian; Bamburg, James R; Goldsbury, Claire

    2011-01-01

    Abnormal mitochondrial function is a widely reported contributor to neurodegenerative disease including Alzheimer's disease (AD), however, a mechanistic link between mitochondrial dysfunction and the initiation of neuropathology remains elusive. In AD, one of the earliest hallmark pathologies is neuropil threads comprising accumulated hyperphosphorylated microtubule-associated protein (MAP) tau in neurites. Rod-like aggregates of actin and its associated protein cofilin (AC rods) also occur in AD. Using a series of antibodies--AT270, AT8, AT100, S214, AT180, 12E8, S396, S404 and S422--raised against different phosphoepitopes on tau, we characterize the pattern of expression and re-distribution in neurites of these phosphoepitope labels during mitochondrial inhibition. Employing chick primary neuron cultures, we demonstrate that epitopes recognized by the monoclonal antibody 12E8, are the only species rapidly recruited into AC rods. These results were recapitulated with the actin depolymerizing drug Latrunculin B, which induces AC rods and a concomitant increase in the 12E8 signal measured on Western blot. This suggests that AC rods may be one way in which MAP redistribution and phosphorylation is influenced in neurons during mitochondrial stress and potentially in the early pathogenesis of AD.

  1. Rapid changes in phospho-MAP/tau epitopes during neuronal stress: cofilin-actin rods primarily recruit microtubule binding domain epitopes.

    Directory of Open Access Journals (Sweden)

    Ineka T Whiteman

    Full Text Available Abnormal mitochondrial function is a widely reported contributor to neurodegenerative disease including Alzheimer's disease (AD, however, a mechanistic link between mitochondrial dysfunction and the initiation of neuropathology remains elusive. In AD, one of the earliest hallmark pathologies is neuropil threads comprising accumulated hyperphosphorylated microtubule-associated protein (MAP tau in neurites. Rod-like aggregates of actin and its associated protein cofilin (AC rods also occur in AD. Using a series of antibodies--AT270, AT8, AT100, S214, AT180, 12E8, S396, S404 and S422--raised against different phosphoepitopes on tau, we characterize the pattern of expression and re-distribution in neurites of these phosphoepitope labels during mitochondrial inhibition. Employing chick primary neuron cultures, we demonstrate that epitopes recognized by the monoclonal antibody 12E8, are the only species rapidly recruited into AC rods. These results were recapitulated with the actin depolymerizing drug Latrunculin B, which induces AC rods and a concomitant increase in the 12E8 signal measured on Western blot. This suggests that AC rods may be one way in which MAP redistribution and phosphorylation is influenced in neurons during mitochondrial stress and potentially in the early pathogenesis of AD.

  2. Rapid Recruitment of BRCA1 to DNA Double-Strand Breaks Is Dependent on Its Association with Ku80▿ †

    Science.gov (United States)

    Wei, Leizhen; Lan, Li; Hong, Zehui; Yasui, Akira; Ishioka, Chikashi; Chiba, Natsuko

    2008-01-01

    BRCA1 is the first susceptibility gene to be linked to breast and ovarian cancers. Although mounting evidence has indicated that BRCA1 participates in DNA double-strand break (DSB) repair pathways, its precise mechanism is still unclear. Here, we analyzed the in situ response of BRCA1 at DSBs produced by laser microirradiation. The amino (N)- and carboxyl (C)-terminal fragments of BRCA1 accumulated independently at DSBs with distinct kinetics. The N-terminal BRCA1 fragment accumulated immediately after laser irradiation at DSBs and dissociated rapidly. In contrast, the C-terminal fragment of BRCA1 accumulated more slowly at DSBs but remained at the sites. Interestingly, rapid accumulation of the BRCA1 N terminus, but not the C terminus, at DSBs depended on Ku80, which functions in the nonhomologous end-joining (NHEJ) pathway, independently of BARD1, which binds to the N terminus of BRCA1. Two small regions in the N terminus of BRCA1 independently accumulated at DSBs and interacted with Ku80. Missense mutations found within the N terminus of BRCA1 in cancers significantly changed the kinetics of its accumulation at DSBs. A P142H mutant failed to associate with Ku80 and restore resistance to irradiation in BRCA1-deficient cells. These might provide a molecular basis of the involvement of BRCA1 in the NHEJ pathway of the DSB repair process. PMID:18936166

  3. A Rapid Protocol of Crude RNA/DNA Extraction for RT-qPCR Detection and Quantification of 'Candidatus Phytoplasma prunorum'.

    Science.gov (United States)

    Minguzzi, Stefano; Terlizzi, Federica; Lanzoni, Chiara; Poggi Pollini, Carlo; Ratti, Claudio

    2016-01-01

    Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum ('Ca. P. prunorum') detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor 'Ca. P. prunorum' infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect 'Ca. P. prunorum' and Plum pox virus (PPV) in Prunus.

  4. Qu'Appelle River Dam, dam break analysis using advanced GIS tools for rapid modelling and inundation mapping

    Energy Technology Data Exchange (ETDEWEB)

    Bonin, D. [Hatch Energy, Winnipeg, MB (Canada); Campbell, C. [Saskatchewan Watershed Authority, Moose Jaw, SK (Canada); Groeneveld, J. [Hatch Energy, Calgary, AB (Canada)

    2008-07-01

    The South Saskatchewan River Project (SSRP) comprises a multi-purpose reservoir that provides water for conservation and irrigation, flood control, power generation, recreation, and municipal and industrial water supply. In addition to the 64 m high Gardiner Dam, the 27 m high Qu'Appelle River Dam and the 22 km long Lake Diefenbaker Reservoir, the SSRP also includes ancillary works. The Qu'Appelle River valley extends for 458 km before connecting to the Assiniboine River. The valley is incised up to 90 m in depth and is a popular cottaging and recreational area with several major communities located in the flood plain. In the event of a breach of the Qu'Appelle Dam, the discharge will increase from a normal maximum discharge of under 60 m{sup 3} per second to over 50,000 m{sup 3} per second. The Saskatchewan Watershed Authority (SWA) is responsible for ensuring safe development of the Province's water resources, without affecting reservoir or lake operations, and preventing damage from flooding, erosion or land slides. It is in the process of developing Hazard Assessments and emergency preparedness plans for each of their dams in accordance with the Canadian Dam Safety Guidelines. Studies using GIS technology and the hydrodynamic routing model HEC-RAS have been completed to evaluate the potential inundation that may result in the event of failure of the Qu'Appelle River Dam. These studies involved the development of a breach parameter model using a breach data set revised to better reflect the Qu'Appelle River Dam; the development of a dam break model for the Qu'Appelle River Dam and downstream river and flood plain; and, the use of this model to simulate two potential dam failure scenarios for the Qu'Appelle River Dam, notably failure during passage of the PMF and failure during fair weather conditions. Inundation maps have been prepared for the downstream Qu'Appelle River valley for each of the above events. 3 refs., 4

  5. Rapid MCNP simulation of DNA double strand break (DSB) relative biological effectiveness (RBE) for photons, neutrons, and light ions.

    Science.gov (United States)

    Stewart, Robert D; Streitmatter, Seth W; Argento, David C; Kirkby, Charles; Goorley, John T; Moffitt, Greg; Jevremovic, Tatjana; Sandison, George A

    2015-11-07

    To account for particle interactions in the extracellular (physical) environment, information from the cell-level Monte Carlo damage simulation (MCDS) for DNA double strand break (DSB) induction has been integrated into the general purpose Monte Carlo N-particle (MCNP) radiation transport code system. The effort to integrate these models is motivated by the need for a computationally efficient model to accurately predict particle relative biological effectiveness (RBE) in cell cultures and in vivo. To illustrate the approach and highlight the impact of the larger scale physical environment (e.g. establishing charged particle equilibrium), we examined the RBE for DSB induction (RBEDSB) of x-rays, (137)Cs γ-rays, neutrons and light ions relative to γ-rays from (60)Co in monolayer cell cultures at various depths in water. Under normoxic conditions, we found that (137)Cs γ-rays are about 1.7% more effective at creating DSB than γ-rays from (60)Co (RBEDSB  =  1.017) whereas 60-250 kV x-rays are 1.1 to 1.25 times more efficient at creating DSB than (60)Co. Under anoxic conditions, kV x-rays may have an RBEDSB up to 1.51 times as large as (60)Co γ-rays. Fission neutrons passing through monolayer cell cultures have an RBEDSB that ranges from 2.6 to 3.0 in normoxic cells, but may be as large as 9.93 for anoxic cells. For proton pencil beams, Monte Carlo simulations suggest an RBEDSB of about 1.2 at the tip of the Bragg peak and up to 1.6 a few mm beyond the Bragg peak. Bragg peak RBEDSB increases with decreasing oxygen concentration, which may create opportunities to apply proton dose painting to help address tumor hypoxia. Modeling of the particle RBE for DSB induction across multiple physical and biological scales has the potential to aid in the interpretation of laboratory experiments and provide useful information to advance the safety and effectiveness of hadron therapy in the treatment of cancer.

  6. Comparative mapping of DNA markers from the familial Alzheimer disease and Down syndrome regions of human chromosome 21 to mouse chromosomes 16 and 17

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, S.V.; Nadeau, J.H.; Tanzi, R.E.; Watkins, P.C.; Jagadesh, J.; Taylor, B.A.; Haines, J.L.; Sacchi, N.; Gusella, J.F. (Harvard Medical School, Boston, MA (USA))

    1988-08-01

    Mouse trisomy 16 has been proposed as an animal model of Down syndrome (DS), since this chromosome contains homologues of several loci from the q22 band of human chromosome 21. The recent mapping of the defect causing familial Alzheimer disease (FAD) and the locus encoding the Alzheimer amyloid {beta} precursor protein (APP) to human chromosome 21 has prompted a more detailed examination of the extent of conservation of this linkage group between the two species. Using anonymous DNA probes and cloned genes from human chromosome 21 in a combination of recombinant inbred and interspecific mouse backcross analyses, the authors have established that the linkage group shared by mouse chromosome 16 includes not only the critical DS region of human chromosome 21 but also the APP gene and FAD-linked markers. Extending from the anonymous DNA locus D21S52 to ETS2, the linkage map of six loci spans 39% recombination in man but only 6.4% recombination in the mouse. A break in synteny occurs distal to ETS2, with the homologue of the human marker D21S56 mapping to mouse chromosome 17. Conservation of the linkage relationships of markers in the FAD region suggests that the murine homologue of the FAD locus probably maps to chromosome 16 and that detailed comparison of the corresponding region in both species could facilitate identification of the primary defect in this disorder. The break in synteny between the terminal portion of human chromosome 21 and mouse chromosome 16 indicates, however, that mouse trisomy 16 may not represent a complete model of DS.

  7. Comparative mapping of DNA markers from the familial Alzheimer disease and Down syndrome regions of human chromosome 21 to mouse chromosomes 16 and 17

    International Nuclear Information System (INIS)

    Cheng, S.V.; Nadeau, J.H.; Tanzi, R.E.; Watkins, P.C.; Jagadesh, J.; Taylor, B.A.; Haines, J.L.; Sacchi, N.; Gusella, J.F.

    1988-01-01

    Mouse trisomy 16 has been proposed as an animal model of Down syndrome (DS), since this chromosome contains homologues of several loci from the q22 band of human chromosome 21. The recent mapping of the defect causing familial Alzheimer disease (FAD) and the locus encoding the Alzheimer amyloid β precursor protein (APP) to human chromosome 21 has prompted a more detailed examination of the extent of conservation of this linkage group between the two species. Using anonymous DNA probes and cloned genes from human chromosome 21 in a combination of recombinant inbred and interspecific mouse backcross analyses, the authors have established that the linkage group shared by mouse chromosome 16 includes not only the critical DS region of human chromosome 21 but also the APP gene and FAD-linked markers. Extending from the anonymous DNA locus D21S52 to ETS2, the linkage map of six loci spans 39% recombination in man but only 6.4% recombination in the mouse. A break in synteny occurs distal to ETS2, with the homologue of the human marker D21S56 mapping to mouse chromosome 17. Conservation of the linkage relationships of markers in the FAD region suggests that the murine homologue of the FAD locus probably maps to chromosome 16 and that detailed comparison of the corresponding region in both species could facilitate identification of the primary defect in this disorder. The break in synteny between the terminal portion of human chromosome 21 and mouse chromosome 16 indicates, however, that mouse trisomy 16 may not represent a complete model of DS

  8. Identification and reproducibility of diagnostic DNA markers for tuber starch and yield optimization in a novel association mapping population of potato (Solanum tuberosum L.).

    Science.gov (United States)

    Schönhals, E M; Ortega, F; Barandalla, L; Aragones, A; Ruiz de Galarreta, J I; Liao, J-C; Sanetomo, R; Walkemeier, B; Tacke, E; Ritter, E; Gebhardt, C

    2016-04-01

    SNPs in candidate genes Pain - 1, InvCD141 (invertases), SSIV (starch synthase), StCDF1 (transcription factor), LapN (leucine aminopeptidase), and cytoplasm type are associated with potato tuber yield, starch content and/or starch yield. Tuber yield (TY), starch content (TSC), and starch yield (TSY) are complex characters of high importance for the potato crop in general and for industrial starch production in particular. DNA markers associated with superior alleles of genes that control the natural variation of TY, TSC, and TSY could increase precision and speed of breeding new cultivars optimized for potato starch production. Diagnostic DNA markers are identified by association mapping in populations of tetraploid potato varieties and advanced breeding clones. A novel association mapping population of 282 genotypes including varieties, breeding clones and Andean landraces was assembled and field evaluated in Northern Spain for TY, TSC, TSY, tuber number (TN) and tuber weight (TW). The landraces had lower mean values of TY, TW, TN, and TSY. The population was genotyped for 183 microsatellite alleles, 221 single nucleotide polymorphisms (SNPs) in fourteen candidate genes and eight known diagnostic markers for TSC and TSY. Association test statistics including kinship and population structure reproduced five known marker-trait associations of candidate genes and discovered new ones, particularly for tuber yield and starch yield. The inclusion of landraces increased the number of detected marker-trait associations. Integration of the present association mapping results with previous QTL linkage mapping studies for TY, TSC, TSY, TW, TN, and tuberization revealed some hot spots of QTL for these traits in the potato genome. The genomic positions of markers linked or associated with QTL for complex tuber traits suggest high multiplicity and genome wide distribution of the underlying genes.

  9. Rapid divergence of histones in Hydrozoa (Cnidaria) and evolution of a novel histone involved in DNA damage response in hydra.

    Science.gov (United States)

    Reddy, Puli Chandramouli; Ubhe, Suyog; Sirwani, Neha; Lohokare, Rasika; Galande, Sanjeev

    2017-08-01

    Histones are fundamental components of chromatin in all eukaryotes. Hydra, an emerging model system belonging to the basal metazoan phylum Cnidaria, provides an ideal platform to understand the evolution of core histone components at the base of eumetazoan phyla. Hydra exhibits peculiar properties such as tremendous regenerative capacity, lack of organismal senescence and rarity of malignancy. In light of the role of histone modifications and histone variants in these processes it is important to understand the nature of histones themselves and their variants in hydra. Here, we report identification of the complete repertoire of histone-coding genes in the Hydra magnipapillata genome. Hydra histones were classified based on their copy numbers, gene structure and other characteristic features. Genomic organization of canonical histone genes revealed the presence of H2A-H2B and H3-H4 paired clusters in high frequency and also a cluster with all core histones along with H1. Phylogenetic analysis of identified members of H2A and H2B histones suggested rapid expansion of these groups in Hydrozoa resulting in the appearance of unique subtypes. Amino acid sequence level comparisons of H2A and H2B forms with bilaterian counterparts suggest the possibility of a highly mobile nature of nucleosomes in hydra. Absolute quantitation of transcripts confirmed the high copy number of histones and supported the canonical nature of H2A. Furthermore, functional characterization of H2A.X.1 and a unique variant H2A.X.2 in the gastric region suggest their role in the maintenance of genome integrity and differentiation processes. These findings provide insights into the evolution of histones and their variants in hydra. Copyright © 2017 Elsevier GmbH. All rights reserved.

  10. Rapid response to an emerging infectious disease - Lessons learned from development of a synthetic DNA vaccine targeting Zika virus.

    Science.gov (United States)

    Kudchodkar, Sagar B; Choi, Hyeree; Reuschel, Emma L; Esquivel, Rianne; Jin-Ah Kwon, Jackie; Jeong, Moonsup; Maslow, Joel N; Reed, Charles C; White, Scott; Kim, J Joseph; Kobinger, Gary P; Tebas, Pablo; Weiner, David B; Muthumani, Kar

    2018-03-17

    Vaccines are considered one of the greatest advances in modern medicine. The global burden of numerous infectious diseases has been significantly reduced, and in some cases, effectively eradicated through the deployment of specific vaccines. However, efforts to develop effective new vaccines against infectious pathogens such as influenza, Human immunodeficiency virus (HIV), dengue virus (DENV), chikungunya virus (CHIKV), Ebola virus, and Zika virus (ZIKV) have proven challenging. Zika virus is a mosquito-vectored flavivirus responsible for periodic outbreaks of disease in Africa, Southeast Asia, and the Pacific Islands dating back over 50 years. Over this period, ZIKV infections were subclinical in most infected individuals and resulted in mild cases of fever, arthralgia, and rash in others. Concerns about ZIKV changed over the past two years, however, as outbreaks in Brazil, Central American countries, and Caribbean islands revealed novel aspects of infection including vertical and sexual transmission modes. Cases have been reported showing dramatic neurological pathologies including microcephaly and other neurodevelopmental problems in babies born to ZIKV infected mothers, as well as an increased risk of Guillain-Barre syndrome in adults. These findings prompted the World Health Organization to declare ZIKV a public health emergency in 2016, which resulted in expanded efforts to develop ZIKV vaccines and immunotherapeutics. Several ZIKV vaccine candidates that are immunogenic and effective at blocking ZIKV infection in animal models have since been developed, with some of these now being evaluated in the clinic. Additional therapeutics under investigation include anti-ZIKV monoclonal antibodies (mAbs) that have been shown to neutralize infection in vitro as well as protect against morbidity in mouse models of ZIKV infection. In this review, we summarize the current understanding of ZIKV biology and describe our efforts to rapidly develop a vaccine against ZIKV

  11. Comparative physical mapping of 18S rDNA in the karyotypes of six leafcutter ant species of the genera Atta and Acromyrmex (Formicidae: Myrmicinae).

    Science.gov (United States)

    Teixeira, Gisele Amaro; Barros, Luísa Antônia Campos; de Aguiar, Hilton Jeferson Alves Cardoso; das Graças Pompolo, Silvia

    2017-10-01

    Leafcutter ants of the Atta and Acromyrmex genera are important plagues in different cultures. Cytogenetic data on chromosome number, morphology, and chromosomal banding pattern are only available for 17 species of leafcutter ants. Molecular cytogenetic data for the detection of ribosomal genes by the FISH technique are scarce, and only 15 Neotropical ant species have been studied. This study aimed to physically map the 18S ribosomal RNA genes (rDNA) of six leafcutter ants belonging to the genera Atta and Acromyrmex using FISH. The results were compared with data on the fluorochrome CMA 3 currently available for these species. All analyzed species presented the 18S rDNA on one pair of chromosomes. In Acromyrmex subterraneus molestans and Ac. aspersus, FISH signals were observed in the terminal region of the short arm of the largest subtelocentric pair, while in Atta bisphaerica, A. laevigata, and A. sexdens, FISH signals were observed in the interstitial region of the long arm of the fourth metacentric pair. In Acromyrmex striatus, 18S rDNA was located in the interstitial region of the second metacentric pair. The karyotypic formula for Ac. aspersus was 2n = 38 (8m + 10sm + 16st + 4a), representing the first report in this species. The observed 18S rDNA regions in A. laevigata, A. sexdens, A. bisphaerica, Ac. aspersus, and Ac. subterraneus molestans corresponded to the CMA 3 + bands, while in Ac. striatus, several GC-rich bands and one pair of 18S rDNA bands were observed. No differential bands were visible using the DAPI fluorochrome. Karyotype uniformity with previously studied Atta spp. was also observed at the level of molecular cytogenetics using 18S rDNA FISH. A difference in the size of the chromosomal pair carrying the 18S rDNA gene was observed in Ac. striatus (2n = 22) and Atta spp. (2n = 22) highlighting the dissimilarity between these species. The results from the present study contribute to the description of 18S rDNA clusters

  12. CISN Display - Reliable Delivery of Real-time Earthquake Information, Including Rapid Notification and ShakeMap to Critical End Users

    Science.gov (United States)

    Rico, H.; Hauksson, E.; Thomas, E.; Friberg, P.; Given, D.

    2002-12-01

    The California Integrated Seismic Network (CISN) Display is part of a Web-enabled earthquake notification system alerting users in near real-time of seismicity, and also valuable geophysical information following a large earthquake. It will replace the Caltech/USGS Broadcast of Earthquakes (CUBE) and Rapid Earthquake Data Integration (REDI) Display as the principal means of delivering graphical earthquake information to users at emergency operations centers, and other organizations. Features distinguishing the CISN Display from other GUI tools are a state-full client/server relationship, a scalable message format supporting automated hyperlink creation, and a configurable platform-independent client with a GIS mapping tool; supporting the decision-making activities of critical users. The CISN Display is the front-end of a client/server architecture known as the QuakeWatch system. It is comprised of the CISN Display (and other potential clients), message queues, server, server "feeder" modules, and messaging middleware, schema and generators. It is written in Java, making it platform-independent, and offering the latest in Internet technologies. QuakeWatch's object-oriented design allows components to be easily upgraded through a well-defined set of application programming interfaces (APIs). Central to the CISN Display's role as a gateway to other earthquake products is its comprehensive XML-schema. The message model starts with the CUBE message format, but extends it by provisioning additional attributes for currently available products, and those yet to be considered. The supporting metadata in the XML-message provides the data necessary for the client to create a hyperlink and associate it with a unique event ID. Earthquake products deliverable to the CISN Display are ShakeMap, Ground Displacement, Focal Mechanisms, Rapid Notifications, OES Reports, and Earthquake Commentaries. Leveraging the power of the XML-format, the CISN Display provides prompt access to

  13. The Mapping of Predicted Triplex DNA:RNA in the Drosophila Genome Reveals a Prominent Location in Development- and Morphogenesis-Related Genes

    Directory of Open Access Journals (Sweden)

    Claude Pasquier

    2017-07-01

    Full Text Available Double-stranded DNA is able to form triple-helical structures by accommodating a third nucleotide strand. A nucleic acid triplex occurs according to Hoogsteen rules that predict the stability and affinity of the third strand bound to the Watson–Crick duplex. The “triplex-forming oligonucleotide” (TFO can be a short sequence of RNA that binds to the major groove of the targeted duplex only when this duplex presents a sequence of purine or pyrimidine bases in one of the DNA strands. Many nuclear proteins are known to bind triplex DNA or DNA:RNA, but their biological functions are unexplored. We identified sequences that are capable of engaging as the “triplex-forming oligonucleotide” in both the pre-lncRNA and pre-mRNA collections of Drosophila melanogaster. These motifs were matched against the Drosophila genome in order to identify putative sequences of triplex formation in intergenic regions, promoters, and introns/exons. Most of the identified TFOs appear to be located in the intronic region of the analyzed genes. Computational prediction of the most targeted genes by TFOs originating from pre-lncRNAs and pre-mRNAs revealed that they are restrictively associated with development- and morphogenesis-related gene networks. The refined analysis by Gene Ontology enrichment demonstrates that some individual TFOs present genome-wide scale matches that are located in numerous genes and regulatory sequences. The triplex DNA:RNA computational mapping at the genome-wide scale suggests broad interference in the regulatory process of the gene networks orchestrated by TFO RNAs acting in association simultaneously at multiple sites.

  14. A hybrid genetic linkage map of two ecologically and morphologically divergent Midas cichlid fishes (Amphilophus spp.) obtained by massively parallel DNA sequencing (ddRADSeq).

    Science.gov (United States)

    Recknagel, Hans; Elmer, Kathryn R; Meyer, Axel

    2013-01-01

    Cichlid fishes are an excellent model system for studying speciation and the formation of adaptive radiations because of their tremendous species richness and astonishing phenotypic diversity. Most research has focused on African rift lake fishes, although Neotropical cichlid species display much variability as well. Almost one dozen species of the Midas cichlid species complex (Amphilophus spp.) have been described so far and have formed repeated adaptive radiations in several Nicaraguan crater lakes. Here we apply double-digest restriction-site associated DNA sequencing to obtain a high-density linkage map of an interspecific cross between the benthic Amphilophus astorquii and the limnetic Amphilophus zaliosus, which are sympatric species endemic to Crater Lake Apoyo, Nicaragua. A total of 755 RAD markers were genotyped in 343 F(2) hybrids. The map resolved 25 linkage groups and spans a total distance of 1427 cM with an average marker spacing distance of 1.95 cM, almost matching the total number of chromosomes (n = 24) in these species. Regions of segregation distortion were identified in five linkage groups. Based on the pedigree of parents to F(2) offspring, we calculated a genome-wide mutation rate of 6.6 × 10(-8) mutations per nucleotide per generation. This genetic map will facilitate the mapping of ecomorphologically relevant adaptive traits in the repeated phenotypes that evolved within the Midas cichlid lineage and, as the first linkage map of a Neotropical cichlid, facilitate comparative genomic analyses between African cichlids, Neotropical cichlids and other teleost fishes.

  15. Chromosome-wide mapping of DNA methylation patterns in normal and malignant prostate cells reveals pervasive methylation of gene-associated and conserved intergenic sequences

    Directory of Open Access Journals (Sweden)

    De Marzo Angelo M

    2011-06-01

    Full Text Available Abstract Background DNA methylation has been linked to genome regulation and dysregulation in health and disease respectively, and methods for characterizing genomic DNA methylation patterns are rapidly emerging. We have developed/refined methods for enrichment of methylated genomic fragments using the methyl-binding domain of the human MBD2 protein (MBD2-MBD followed by analysis with high-density tiling microarrays. This MBD-chip approach was used to characterize DNA methylation patterns across all non-repetitive sequences of human chromosomes 21 and 22 at high-resolution in normal and malignant prostate cells. Results Examining this data using computational methods that were designed specifically for DNA methylation tiling array data revealed widespread methylation of both gene promoter and non-promoter regions in cancer and normal cells. In addition to identifying several novel cancer hypermethylated 5' gene upstream regions that mediated epigenetic gene silencing, we also found several hypermethylated 3' gene downstream, intragenic and intergenic regions. The hypermethylated intragenic regions were highly enriched for overlap with intron-exon boundaries, suggesting a possible role in regulation of alternative transcriptional start sites, exon usage and/or splicing. The hypermethylated intergenic regions showed significant enrichment for conservation across vertebrate species. A sampling of these newly identified promoter (ADAMTS1 and SCARF2 genes and non-promoter (downstream or within DSCR9, C21orf57 and HLCS genes hypermethylated regions were effective in distinguishing malignant from normal prostate tissues and/or cell lines. Conclusions Comparison of chromosome-wide DNA methylation patterns in normal and malignant prostate cells revealed significant methylation of gene-proximal and conserved intergenic sequences. Such analyses can be easily extended for genome-wide methylation analysis in health and disease.

  16. Delimiting the origin of a B chromosome by FISH mapping, chromosome painting and DNA sequence analysis in Astyanax paranae (Teleostei, Characiformes.

    Directory of Open Access Journals (Sweden)

    Duílio M Z de A Silva

    Full Text Available Supernumerary (B chromosomes have been shown to contain a wide variety of repetitive sequences. For this reason, fluorescent in situ hybridisation (FISH is a useful tool for ascertaining the origin of these genomic elements, especially when combined with painting from microdissected B chromosomes. In order to investigate the origin of B chromosomes in the fish species Astyanax paranae, these two approaches were used along with PCR amplification of specific DNA sequences obtained from the B chromosomes and its comparison with those residing in the A chromosomes. Remarkably, chromosome painting with the one-arm metacentric B chromosome probe showed hybridization signals on entire B chromosome, while FISH mapping revealed the presence of H1 histone and 18S rDNA genes symmetrically placed in both arms of the B chromosome. These results support the hypothesis that the B chromosome of A. paranae is an isochromosome. Additionally, the chromosome pairs Nos. 2 or 23 are considered the possible B chromosome ancestors since both contain syntenic H1 and 18S rRNA sequences. The analysis of DNA sequence fragments of the histone and rRNA genes obtained from the microdissected B chromosomes showed high similarity with those obtained from 0B individuals, which supports the intraspecific origin of B chromosomes in A. paranae. Finally, the population hereby analysed showed a female-biased B chromosome presence suggesting that B chromosomes in this species could influence sex determinism.

  17. MALDI-TOF MS performance compared to direct examination, culture, and 16S rDNA PCR for the rapid diagnosis of bone and joint infections.

    Science.gov (United States)

    Lallemand, E; Coiffier, G; Arvieux, C; Brillet, E; Guggenbuhl, P; Jolivet-Gougeon, A

    2016-05-01

    The rapid identification of bacterial species involved in bone and joint infections (BJI) is an important element to optimize the diagnosis and care of patients. The aim of this study was to evaluate the usefulness of matrix-assisted laser desorption ionization mass spectrometry (MALDI-TOF MS) for the rapid diagnosis of bone infections, directly on synovial fluid (SF) or on crushed osteoarticular samples (CS). From January to October 2013, we prospectively analyzed 111 osteoarticular samples (bone and joint samples, BJS) from 78 patients in care at the University Hospital of Rennes, France. The diagnosis procedure leading to the sample collection was linked to a suspicion of infection, inflammatory disease, arthritis, or for any bone or joint abnormalities. Standard bacteriological diagnosis and molecular biology analysis [16S rRNA polymerase chain reaction (PCR) and sequencing] were conducted. In addition, analysis by MALDI-TOF MS was performed directly on the osteoarticular samples, as soon as the amount allowed. Culture, which remains the gold standard for the diagnosis of BJI, has the highest sensitivity (85.9 %) and remains necessary to test antimicrobial susceptibility. The 16S rDNA PCR results were positive in the group with positive BJI (28.6 %) and negative in the group without infection. Direct examination remains insensitive (31.7 %) but more effective than MALDI-TOF MS directly on the sample (6.3 %). The specificity was 100 % in all cases, except for culture (74.5 %). Bacterial culture remains the gold standard, especially enrichment in blood bottles. Direct analysis of bone samples with MALDI-TOF MS is not useful, possibly due to the low inoculum of BJS.

  18. Surface-enhanced Raman spectroscopic study of DNA and 6-mercapto-1-hexanol interactions using large area mapping

    DEFF Research Database (Denmark)

    Frøhling, Kasper Bayer; Alstrøm, Tommy Sonne; Bache, Michael

    2016-01-01

    intensities and peak positions it is possible to directly inspect the interplay between DNA and 6-mercapto-1-hexanol on gold covered nanopillars. It is demonstrated that optimised functionalization parameters can be extracted from the Raman spectra directly. Using the peak-fitting approach it is possible...

  19. rDNA mapping, heterochromatin characterization and AT/GC content of Agapanthus africanus (L. Hoffmanns (Agapanthaceae

    Directory of Open Access Journals (Sweden)

    ARYANE C. REIS

    2016-01-01

    Full Text Available ABSTRACT Agapanthus (Agapanthaceae has 10 species described. However, most taxonomists differ respect to this number because the great phenotypic plasticity of the species. The cytogenetic has been an important tool to aid the plant taxon identification, and to date, all taxa of Agapanthus L'Héritier studied cytologically, presented 2n = 30. Although the species possess large chromosomes, the group is karyologically little explored. This work aimed to increase the cytogenetic knowledge of Agapanthus africanus (L. Hoffmanns by utilization of chromosome banding techniques with DAPI / CMA3 and Fluorescent in situ Hybridization (FISH. In addition, flow cytometry was used for determination of DNA content and the percentage of AT / GC nitrogenous bases. Plants studied showed 2n = 30 chromosomes, ranging from 4.34 - 8.55 µm, with the karyotype formulae (KF = 10m + 5sm. Through FISH, one 45S rDNA signal was observed proximally to centromere of the chromosome 7, while for 5S rDNA sites we observed one signal proximally to centromere of chromosome 9. The 2C DNA content estimated for the species was 2C = 24.4 with 59% of AT and 41% of GC. Our data allowed important upgrade for biology and cytotaxonomy of Agapanthus africanus (L. Hoffmanns.

  20. Chromosome mapping by FISH to metaphase and interphase nuclei. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Trask, B.

    1997-08-01

    The overall specific aims of this project were: (1) to determine the large-scale structure of interphase and metaphase chromosomes, in order to establish new capabilities for genome mapping by fluorescence in situ hybridization (FISH); (2) to detect chromosome abnormalities associated with genetic disease and map DNA sequences relative to them in order to facilitate the identification of new genes with disease-causing mutations; (3) to establish medium resolution physical maps of selected chromosomal regions using a combined metaphase and interphase mapping strategy and to corroborate physical and genetic maps and integrate these maps with the cytogenetic map; (4) to analyze the polymorphism and sequence evolution of subtelomeric regions of human chromosomes; (5) to establish a state-of-the-art FISH and image processing facility in the Department of Molecular Biotechnology, University of Washington, in order to map DNA sequences rapidly and accurately to benefit the Human Genome Project.

  1. Evaluation of a Rapid One-step Real-time PCR Method as a High-throughput Screening for Quantification of Hepatitis B Virus DNA in a Resource-limited Setting.

    Science.gov (United States)

    Rashed-Ul Islam, S M; Jahan, Munira; Tabassum, Shahina

    2015-01-01

    Virological monitoring is the best predictor for the management of chronic hepatitis B virus (HBV) infections. Consequently, it is important to use the most efficient, rapid and cost-effective testing systems for HBV DNA quantification. The present study compared the performance characteristics of a one-step HBV polymerase chain reaction (PCR) vs the two-step HBV PCR method for quantification of HBV DNA from clinical samples. A total of 100 samples consisting of 85 randomly selected samples from patients with chronic hepatitis B (CHB) and 15 samples from apparently healthy individuals were enrolled in this study. Of the 85 CHB clinical samples tested, HBV DNA was detected from 81% samples by one-step PCR method with median HBV DNA viral load (VL) of 7.50 × 10 3 lU/ml. In contrast, 72% samples were detected by the two-step PCR system with median HBV DNA of 3.71 × 10 3 lU/ml. The one-step method showed strong linear correlation with two-step PCR method (r = 0.89; p Tabassum S. Evaluation of a Rapid One-step Real-time PCR Method as a High-throughput Screening for Quantification of Hepatitis B Virus DNA in a Resource-limited Setting. Euroasian J Hepato-Gastroenterol 2015;5(1):11-15.

  2. Genome-wide DNA methylation alterations of Alternanthera philoxeroides in natural and manipulated habitats: implications for epigenetic regulation of rapid responses to environmental fluctuation and phenotypic variation.

    Science.gov (United States)

    Gao, Lexuan; Geng, Yupeng; Li, Bo; Chen, Jiakuan; Yang, Ji

    2010-11-01

    Alternanthera philoxeroides (alligator weed) is an invasive weed that can colonize both aquatic and terrestrial habitats. Individuals growing in different habitats exhibit extensive phenotypic variation but little genetic differentiation in its introduced range. The mechanisms underpinning the wide range of phenotypic variation and rapid adaptation to novel and changing environments remain uncharacterized. In this study, we examined the epigenetic variation and its correlation with phenotypic variation in plants exposed to natural and manipulated environmental variability. Genome-wide methylation profiling using methylation-sensitive amplified fragment length polymorphism (MSAP) revealed considerable DNA methylation polymorphisms within and between natural populations. Plants of different source populations not only underwent significant morphological changes in common garden environments, but also underwent a genome-wide epigenetic reprogramming in response to different treatments. Methylation alterations associated with response to different water availability were detected in 78.2% (169/216) of common garden induced polymorphic sites, demonstrating the environmental sensitivity and flexibility of the epigenetic regulatory system. These data provide evidence of the correlation between epigenetic reprogramming and the reversible phenotypic response of alligator weed to particular environmental factors. © 2010 Blackwell Publishing Ltd.

  3. Rapid Convergence of Energy and Free Energy Profiles with Quantum Mechanical Size in Quantum Mechanical-Molecular Mechanical Simulations of Proton Transfer in DNA.

    Science.gov (United States)

    Das, Susanta; Nam, Kwangho; Major, Dan Thomas

    2018-03-13

    In recent years, a number of quantum mechanical-molecular mechanical (QM/MM) enzyme studies have investigated the dependence of reaction energetics on the size of the QM region using energy and free energy calculations. In this study, we revisit the question of QM region size dependence in QM/MM simulations within the context of energy and free energy calculations using a proton transfer in a DNA base pair as a test case. In the simulations, the QM region was treated with a dispersion-corrected AM1/d-PhoT Hamiltonian, which was developed to accurately describe phosphoryl and proton transfer reactions, in conjunction with an electrostatic embedding scheme using the particle-mesh Ewald summation method. With this rigorous QM/MM potential, we performed rather extensive QM/MM sampling, and found that the free energy reaction profiles converge rapidly with respect to the QM region size within ca. ±1 kcal/mol. This finding suggests that the strategy of QM/MM simulations with reasonably sized and selected QM regions, which has been employed for over four decades, is a valid approach for modeling complex biomolecular systems. We point to possible causes for the sensitivity of the energy and free energy calculations to the size of the QM region, and potential implications.

  4. Accurate and rapid modeling of iron-bleomycin-induced DNA damage using tethered duplex oligonucleotides and electrospray ionization ion trap mass spectrometric analysis.

    Science.gov (United States)

    Harsch, A; Marzilli, L A; Bunt, R C; Stubbe, J; Vouros, P

    2000-05-01

    Bleomycin B(2)(BLM) in the presence of iron [Fe(II)] and O(2)catalyzes single-stranded (ss) and double-stranded (ds) cleavage of DNA. Electrospray ionization ion trap mass spectrometry was used to monitor these cleavage processes. Two duplex oligonucleotides containing an ethylene oxide tether between both strands were used in this investigation, allowing facile monitoring of all ss and ds cleavage events. A sequence for site-specific binding and cleavage by Fe-BLM was incorporated into each analyte. One of these core sequences, GTAC, is a known hot-spot for ds cleavage, while the other sequence, GGCC, is a hot-spot for ss cleavage. Incubation of each oligo-nucleotide under anaerobic conditions with Fe(II)-BLM allowed detection of the non-covalent ternary Fe-BLM/oligonucleotide complex in the gas phase. Cleavage studies were then performed utilizing O(2)-activated Fe(II)-BLM. No work-up or separation steps were required and direct MS and MS/MS analyses of the crude reaction mixtures confirmed sequence-specific Fe-BLM-induced cleavage. Comparison of the cleavage patterns for both oligonucleotides revealed sequence-dependent preferences for ss and ds cleavages in accordance with previously established gel electrophoresis analysis of hairpin oligonucleotides. This novel methodology allowed direct, rapid and accurate determination of cleavage profiles of model duplex oligonucleotides after exposure to activated Fe-BLM.

  5. Rapid classification of turmeric based on DNA fingerprint by near-infrared spectroscopy combined with moving window partial least squares-discrimination analysis

    International Nuclear Information System (INIS)

    Kasemsumran, Sumaporn; Suttiwijitpukdee, Nattaporn; Keeratinijakal, Vichein

    2017-01-01

    In this research, near-infrared (NIR) spectroscopy in combination with moving window partial least squares-discrimination analysis (MWPLS-DA) was utilized to discriminate the variety of turmeric based on DNA markers, which correlated to the quantity of curcuminoid. Curcuminoid was used as a marker compound in variety identification due to the most pharmacological properties of turmeric possessed from it. MWPLS-DA optimized informative NIR spectral regions for the fitting and prediction to {-1/1}-coded turmeric varieties, indicating variables in the development of latent variables in discrimination analysis. Consequently, MWPLS-DA benefited in the selection of combined informative NIR spectral regions of 1100 – 1260, 1300 – 1500 and 1880 – 2500 nm for classification modeling of turmeric variety with 148 calibration samples, and yielded the results better than that obtained from a partial least squares-discrimination analysis (PLS-DA) model built by using the whole NIR spectral region. An effective and rapid strategy of using NIR in combination with MWPLS-DA provided the best variety identification results of 100% in both specificity and total accuracy for 48 test samples. (author)

  6. Human thyroid peroxidase: complete cDNA and protein sequence, chromosome mapping, and identification of two alternately spliced mRNAs

    International Nuclear Information System (INIS)

    Kimura, S.; Kotani, T.; McBride, O.W.; Umeki, K.; Hirai, K.; Nakayama, T.; Ohtaki, S.

    1987-01-01

    Two forms of human thyroid peroxidase cDNAs were isolated from a λgt11 cDNA library, prepared from Graves disease thyroid tissue mRNA, by use of oligonucleotides. The longest complete cDNA, designated phTPO-1, has 3048 nucleotides and an open reading frame consisting of 933 amino acids, which would encode a protein with a molecular weight of 103,026. Five potential asparagine-linked glycosylation sites are found in the deduced amino acid sequence. The second peroxidase cDNA, designated phTPO-2, is almost identical to phTPO-1 beginning 605 base pairs downstream except that it contains 1-base-pair difference and lacks 171 base pairs in the middle of the sequence. This results in a loss of 57 amino acids corresponding to a molecular weight of 6282. Interestingly, this 171-nucleotide sequence has GT and AG at its 5' and 3' boundaries, respectively, that are in good agreement with donor and acceptor splice site consensus sequences. Using specific oligonucleotide probes for the mRNAs derived from the cDNA sequences hTOP-1 and hTOP-2, the authors show that both are expressed in all thyroid tissues examined and the relative level of two mRNAs is different in each sample. The results suggest that two thyroid peroxidase proteins might be generated through alternate splicing of the same gene. By using somatic cell hybrid lines, the thyroid peroxidase gene was mapped to the short arm of human chromosome 2

  7. Mapping the contribution of Allied Health Professions to the wider public health workforce: a rapid review of evidence-based interventions.

    Science.gov (United States)

    Davis, S Fowler; Enderby, P; Harrop, D; Hindle, L

    2017-03-01

    The objective was to identify a selection of the best examples of the public health contributions by Allied Health Professionals (AHPs) in order to encourage a wider awareness and participation from that workforce to public health practice. A mapping exercise was used to identify evidence-based interventions that could lead to health improvements across a population. A rapid review was undertaken to identify evidence, followed by a survey of Allied Health Profession (AHP) practitioners and an expert panel consensus method to select the examples of AHP public health interventions. Nine evidence-based interventions are identified and selected as examples of current AHP good practice. These examples represent a contribution to public health and include screening interventions, secondary prevention and risk management. This study contributes to a strategy for AHPs in public health by appraising the effectiveness and impact of some exemplar AHP practices that contribute to health improvement. There is a need for AHPs to measure the impact of their interventions and to demonstrate evidence of outcomes at population level. © The Author 2016. Published by Oxford University Press on behalf of Faculty of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. DMS-Seq for In Vivo Genome-wide Mapping of Protein-DNA Interactions and Nucleosome Centers.

    Science.gov (United States)

    Umeyama, Taichi; Ito, Takashi

    2017-10-03

    Protein-DNA interactions provide the basis for chromatin structure and gene regulation. Comprehensive identification of protein-occupied sites is thus vital to an in-depth understanding of genome function. Dimethyl sulfate (DMS) is a chemical probe that has long been used to detect footprints of DNA-bound proteins in vitro and in vivo. Here, we describe a genomic footprinting method, dimethyl sulfate sequencing (DMS-seq), which exploits the cell-permeable nature of DMS to obviate the need for nuclear isolation. This feature makes DMS-seq simple in practice and removes the potential risk of protein re-localization during nuclear isolation. DMS-seq successfully detects transcription factors bound to cis-regulatory elements and non-canonical chromatin particles in nucleosome-free regions. Furthermore, an unexpected preference of DMS confers on DMS-seq a unique potential to directly detect nucleosome centers without using genetic manipulation. We expect that DMS-seq will serve as a characteristic method for genome-wide interrogation of in vivo protein-DNA interactions. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  9. Genomic Mapping of Human DNA provides Evidence of Difference in Stretch between AT and GC rich regions

    Science.gov (United States)

    Reifenberger, Jeffrey; Dorfman, Kevin; Cao, Han

    Human DNA is a not a polymer consisting of a uniform distribution of all 4 nucleic acids, but rather contains regions of high AT and high GC content. When confined, these regions could have different stretch due to the extra hydrogen bond present in the GC basepair. To measure this potential difference, human genomic DNA was nicked with NtBspQI, labeled with a cy3 like fluorophore at the nick site, stained with YOYO, loaded into a device containing an array of nanochannels, and imaged. Over 473,000 individual molecules of DNA, corresponding to roughly 30x coverage of a human genome, were collected and aligned to the human reference. Based on the known AT/GC content between aligned pairs of labels, the stretch was measured for regions of similar size but different AT/GC content. We found that regions of high GC content were consistently more stretched than regions of high AT content between pairs of labels varying in size between 2.5 kbp and 500 kbp. We measured that for every 1% increase in GC content there was roughly a 0.06% increase in stretch. While this effect is small, it is important to take into account differences in stretch between AT and GC rich regions to improve the sensitivity of detection of structural variations from genomic variations. NIH Grant: R01-HG006851.

  10. Rapid radiation in spiny lobsters (Palinurus spp) as revealed by classic and ABC methods using mtDNA and microsatellite data.

    Science.gov (United States)

    Palero, Ferran; Lopes, Joao; Abelló, Pere; Macpherson, Enrique; Pascual, Marta; Beaumont, Mark A

    2009-11-09

    Molecular tools may help to uncover closely related and still diverging species from a wide variety of taxa and provide insight into the mechanisms, pace and geography of marine speciation. There is a certain controversy on the phylogeography and speciation modes of species-groups with an Eastern Atlantic-Western Indian Ocean distribution, with previous studies suggesting that older events (Miocene) and/or more recent (Pleistocene) oceanographic processes could have influenced the phylogeny of marine taxa. The spiny lobster genus Palinurus allows for testing among speciation hypotheses, since it has a particular distribution with two groups of three species each in the Northeastern Atlantic (P. elephas, P. mauritanicus and P. charlestoni) and Southeastern Atlantic and Southwestern Indian Oceans (P. gilchristi, P. delagoae and P. barbarae). In the present study, we obtain a more complete understanding of the phylogenetic relationships among these species through a combined dataset with both nuclear and mitochondrial markers, by testing alternative hypotheses on both the mutation rate and tree topology under the recently developed approximate Bayesian computation (ABC) methods. Our analyses support a North-to-South speciation pattern in Palinurus with all the South-African species forming a monophyletic clade nested within the Northern Hemisphere species. Coalescent-based ABC methods allowed us to reject the previously proposed hypothesis of a Middle Miocene speciation event related with the closure of the Tethyan Seaway. Instead, divergence times obtained for Palinurus species using the combined mtDNA-microsatellite dataset and standard mutation rates for mtDNA agree with known glaciation-related processes occurring during the last 2 my. The Palinurus speciation pattern is a typical example of a series of rapid speciation events occurring within a group, with very short branches separating different species. Our results support the hypothesis that recent climate

  11. DNA methylation map in circulating leukocytes mirrors subcutaneous adipose tissue methylation pattern: a genome-wide analysis from non-obese and obese patients

    Science.gov (United States)

    Crujeiras, A. B.; Diaz-Lagares, A.; Sandoval, J.; Milagro, F. I.; Navas-Carretero, S.; Carreira, M. C.; Gomez, A.; Hervas, D.; Monteiro, M. P.; Casanueva, F. F.; Esteller, M.; Martinez, J. A.

    2017-01-01

    The characterization of the epigenetic changes within the obesity-related adipose tissue will provide new insights to understand this metabolic disorder, but adipose tissue is not easy to sample in population-based studies. We aimed to evaluate the capacity of circulating leukocytes to reflect the adipose tissue-specific DNA methylation status of obesity susceptibility. DNA samples isolated from subcutaneous adipose tissue and circulating leukocytes were hybridized in the Infinium HumanMethylation 450 BeadChip. Data were compared between samples from obese (n = 45) and non-obese (n = 8–10) patients by Wilcoxon-rank test, unadjusted for cell type distributions. A global hypomethylation of the differentially methylated CpG sites (DMCpGs) was observed in the obese subcutaneous adipose tissue and leukocytes. The overlap analysis yielded a number of genes mapped by the common DMCpGs that were identified to reflect the obesity state in the leukocytes. Specifically, the methylation levels of FGFRL1, NCAPH2, PNKD and SMAD3 exhibited excellent and statistically significant efficiencies in the discrimination of obesity from non-obesity status (AUC > 0.80; p obesity-related adipose tissue pathogenesis through peripheral blood analysis, an easily accessible and minimally invasive biological material instead of adipose tissue. PMID:28211912

  12. Comprehensive mapping of the human papillomavirus (HPV) DNA integration sites in cervical carcinomas by HPV capture technology.

    Science.gov (United States)

    Liu, Ying; Lu, Zheming; Xu, Ruiping; Ke, Yang

    2016-02-02

    Integration of human papillomavirus (HPV) DNA into the host genome can be a driver mutation in cervical carcinoma. Identification of HPV integration at base resolution has been a longstanding technical challenge, largely due to sensitivity masking by HPV in episomes or concatenated forms. The aim was to enhance the understanding of the precise localization of HPV integration sites using an innovative strategy. Using HPV capture technology combined with next generation sequencing, HPV prevalence and the exact integration sites of the HPV DNA in 47 primary cervical cancer samples and 2 cell lines were investigated. A total of 117 unique HPV integration sites were identified, including HPV16 (n = 101), HPV18 (n = 7), and HPV58 (n = 9). We observed that the HPV16 integration sites were broadly located across the whole viral genome. In addition, either single or multiple integration events could occur frequently for HPV16, ranging from 1 to 19 per sample. The viral integration sites were distributed across almost all the chromosomes, except chromosome 22. All the cervical cancer cases harboring more than four HPV16 integration sites showed clinical diagnosis of stage III carcinoma. A significant enrichment of overlapping nucleotides shared between the human genome and HPV genome at integration breakpoints was observed, indicating that it may play an important role in the HPV integration process. The results expand on knowledge from previous findings on HPV16 and HPV18 integration sites and allow a better understanding of the molecular basis of the pathogenesis of cervical carcinoma.

  13. Differential equilibration and intergranular diffusion of trace elements during rapid regional metamorphism: constraints from LA-ICP-MS mapping of a garnet population

    Science.gov (United States)

    George, F. R.; Gaidies, F.

    2017-12-01

    Trace element zoning contained within a metapelitic garnet population yields information pertaining to a more complex prograde reaction history than is evident in major element zoning patterns and other conventional analyses. In particular, while trace elements may not act as a rate-limiting component for garnet crystallization, their incorporation into garnet growth surfaces provides a nuanced insight into the crystallization history of the population, and the extent of equilibration of trace elements in the matrix. In this study, we present LA-ICP-MS raster maps of trace element concentrations from several population-representative, centrally sectioned garnets from a garnet-grade metapelite of the Sikkim Himalaya, India. Equilibrium forward modeling of garnet crystallization and simulation of diffusional modification indicates that the garnet population crystallized rapidly over <1 Myr between 515 °C/4.5 kbar and 565 °C/5.5 kbar, as a consequence of high heating rates during regional amphibolite-facies metamorphism. While the rate of diffusional homogenization of major divalent cations is interpreted to have exceeded the rate of interfacial advance (yielding simple prograde growth zoning), trace element distributions record a more complex transport history. In particular, yttrium and the heavy rare earth elements (HREE) document a transition from an overprinted sigmoidal core to concentric repeated HREE and yttrium annuli in all crystals. This suggests that there was a discrete increase in the length scale of equilibration along the advancing garnet interface at some point in the growth history. However, there is no evidence for a coeval change in HREE transport thorough the intergranular network. Conversely, spiral core-to-rim zoning of chromium indicates the element remains almost completely immobile in the matrix over the duration of garnet growth.

  14. Genome-wide DNA methylation maps in follicular lymphoma cells determined by methylation-enriched bisulfite sequencing.

    Directory of Open Access Journals (Sweden)

    Jeong-Hyeon Choi

    Full Text Available BACKGROUND: Follicular lymphoma (FL is a form of non-Hodgkin's lymphoma (NHL that arises from germinal center (GC B-cells. Despite the significant advances in immunotherapy, FL is still not curable. Beyond transcriptional profiling and genomics datasets, there currently is no epigenome-scale dataset or integrative biology approach that can adequately model this disease and therefore identify novel mechanisms and targets for successful prevention and treatment of FL. METHODOLOGY/PRINCIPAL FINDINGS: We performed methylation-enriched genome-wide bisulfite sequencing of FL cells and normal CD19(+ B-cells using 454 sequencing technology. The methylated DNA fragments were enriched with methyl-binding proteins, treated with bisulfite, and sequenced using the Roche-454 GS FLX sequencer. The total number of bases covered in the human genome was 18.2 and 49.3 million including 726,003 and 1.3 million CpGs in FL and CD19(+ B-cells, respectively. 11,971 and 7,882 methylated regions of interest (MRIs were identified respectively. The genome-wide distribution of these MRIs displayed significant differences between FL and normal B-cells. A reverse trend in the distribution of MRIs between the promoter and the gene body was observed in FL and CD19(+ B-cells. The MRIs identified in FL cells also correlated well with transcriptomic data and ChIP-on-Chip analyses of genome-wide histone modifications such as tri-methyl-H3K27, and tri-methyl-H3K4, indicating a concerted epigenetic alteration in FL cells. CONCLUSIONS/SIGNIFICANCE: This study is the first to provide a large scale and comprehensive analysis of the DNA methylation sequence composition and distribution in the FL epigenome. These integrated approaches have led to the discovery of novel and frequent targets of aberrant epigenetic alterations. The genome-wide bisulfite sequencing approach developed here can be a useful tool for profiling DNA methylation in clinical samples.

  15. HapMap-based study of the DNA repair gene ERCC2 and lung cancer susceptibility in a Chinese population

    DEFF Research Database (Denmark)

    Yin, Jiaoyang; Vogel, Ulla Birgitte; Ma, Yegang

    2009-01-01

    -nucleotide polymorphisms (htSNPs) (rs238403, rs50871, rs3916840, rs238415, rs3916874 and rs1799787) from HapMap database were analyzed, which provide an almost complete coverage of the genetic variations in the ERCC2 gene. Although none of the six htSNPs was individually associated with lung cancer risk, we found that two...... ratio, OR (95% confidence interval, CI) = 2.62 (1.53–4.50), P = 0.0003 for hap4; OR (95% CI) = 3.01 (1.36–6.63), P = 0.004 for hap7]. Furthermore, diplotype analyses also strengthened the significant associations of risk haplotype 4 [OR (95% CI) = 3.56 (2.12–5.87), P

  16. Proliferating Cell Nuclear Antigen-dependent Rapid Recruitment of Cdt1 and CRL4Cdt2 at DNA-damaged Sites after UV Irradiation in HeLa Cells*

    Science.gov (United States)

    Ishii, Takashi; Shiomi, Yasushi; Takami, Toshihiro; Murakami, Yusuke; Ohnishi, Naho; Nishitani, Hideo

    2010-01-01

    The licensing factor Cdt1 is degraded by CRL4Cdt2 ubiquitin ligase dependent on proliferating cell nuclear antigen (PCNA) during S phase and when DNA damage is induced in G1 phase. Association of both Cdt2 and PCNA with chromatin was observed in S phase and after UV irradiation. Here we used a micropore UV irradiation assay to examine Cdt2 accumulation at cyclobutane pyrimidine dimer-containing DNA-damaged sites in the process of Cdt1 degradation in HeLa cells. Cdt2, present in the nucleus throughout the cell cycle, accumulated rapidly at damaged DNA sites during G1 phase. The recruitment of Cdt2 is dependent on prior PCNA chromatin binding because Cdt2 association was prevented when PCNA was silenced. Cdt1 was also recruited to damaged sites soon after UV irradiation through its PIP-box. As Cdt1 was degraded, the Cdt2 signal at damaged sites was reduced, but PCNA, cyclobutane pyrimidine dimer, and XPA (xeroderma pigmentosum, complementation group A) signals remained at the same levels. These findings suggest that Cdt1 degradation following UV irradiation occurs rapidly at damaged sites due to PCNA chromatin loading and the recruitment of Cdt1 and CRL4Cdt2, before DNA damage repair is completed. PMID:20929861

  17. Magnetic bead/capture DNA/glucose-loaded nanoliposomes for amplifying the glucometer signal in the rapid screening of hepatitis C virus RNA.

    Science.gov (United States)

    Tu, Haijian; Lin, Kun; Lun, Yongzhi; Yu, Liuming

    2018-06-01

    A digital detection strategy based on a portable personal glucometer (PGM) was developed for the simple, rapid, and sensitive detection of hepatitis C virus (HCV) RNA, involving the release of glucose-loaded nanoliposomes due to coupling-site-specific cleavage by the endonuclease BamHI. The glucose-loaded nanoliposomes were synthesized using a reversed-phase evaporation method and provided an amplified signal at the PGM in the presence of HCV RNA. Initially, a 21-mer oligonucleotide complementary to HCV RNA was covalently conjugated to a magnetic bead through the amino group at the 5' end of the oligonucleotide, and then bound to a glucose-loaded liposome by typical carbodiimide coupling at its 3' end. In the presence of the target HCV RNA, the target hybridized with the oligonucleotide to form double-stranded DNA. The symmetrical duplex sequence 5'-GGATCC-3' between guanines was then catalytically cleaved by BamHI, which detached the glucose-loaded liposome from the magnetic bead. Following magnetic separation of the bead, the detached glucose-loaded liposome was lysed using Triton X-100 to release the glucose molecules within it, which were then detected as an amplified signal at the digital PGM. Under optimal conditions, the PGM signal increased with increasing HCV RNA, and displayed a strongly linear dependence on the level of HCV RNA for concentrations ranging from 10 pM to 1.0 μM. The detection limit (LOD) of the system was 1.9 pM. Good reproducibility and favorable specificity were achieved in the analysis of the target HCV RNA. Human serum samples containing HCV RNA were analyzed using this strategy, and the developed sensing platform was observed to yield satisfactory results based on a comparison with the corresponding results from a Cobas ® Amplicor HCV Test Analyzer. Graphical abstract A digital detection strategy utilizing a personal glucometer was developed for the detection of hepatitis C virus RNA. The strategy involved the use of the

  18. Functional mapping of the fission yeast DNA polymerase δ B-subunit Cdc1 by site-directed and random pentapeptide insertion mutagenesis

    Directory of Open Access Journals (Sweden)

    Gray Fiona C

    2009-08-01

    Full Text Available Abstract Background DNA polymerase δ plays an essential role in chromosomal DNA replication in eukaryotic cells, being responsible for synthesising the bulk of the lagging strand. In fission yeast, Pol δ is a heterotetrameric enzyme comprising four evolutionarily well-conserved proteins: the catalytic subunit Pol3 and three smaller subunits Cdc1, Cdc27 and Cdm1. Pol3 binds directly to the B-subunit, Cdc1, which in turn binds the C-subunit, Cdc27. Human Pol δ comprises the same four subunits, and the crystal structure was recently reported of a complex of human p50 and the N-terminal domain of p66, the human orthologues of Cdc1 and Cdc27, respectively. Results To gain insights into the structure and function of Cdc1, random and directed mutagenesis techniques were used to create a collection of thirty alleles encoding mutant Cdc1 proteins. Each allele was tested for function in fission yeast and for binding of the altered protein to Pol3 and Cdc27 using the two-hybrid system. Additionally, the locations of the amino acid changes in each protein were mapped onto the three-dimensional structure of human p50. The results obtained from these studies identify amino acid residues and regions within the Cdc1 protein that are essential for interaction with Pol3 and Cdc27 and for in vivo function. Mutations specifically defective in Pol3-Cdc1 interactions allow the identification of a possible Pol3 binding surface on Cdc1. Conclusion In the absence of a three-dimensional structure of the entire Pol δ complex, the results of this study highlight regions in Cdc1 that are vital for protein function in vivo and provide valuable clues to possible protein-protein interaction surfaces on the Cdc1 protein that will be important targets for further study.

  19. Direct Quantification of Campylobacter jejuni in Chicken Fecal Samples Using Real-Time PCR: Evaluation of Six Rapid DNA Extraction Methods

    DEFF Research Database (Denmark)

    Garcia Clavero, Ana Belén; Kamara, Judy N.; Vigre, Håkan

    2013-01-01

    of this study, the Easy-DNA (Invitrogen) method generated lower Ct values, the best amplification efficiency (AE = 93.2 %) and good precision (R squared = 0.996). The method NucleoSpin® Tissue was able to detect samples spiked with the lowest Campylobacter concentration level (10 CFU/ml) but the amplification...... efficiency was not optimal (AE = 139.5 %). DNA extraction methods Easy-DNA Invitrogen, MiniMAG® and NucleoSpin® Tissue produced good real-time PCR reproducibility generating standard deviations from 0.3 to 0.8 between replicates....

  20. Mapping recessive ophthalmic diseases: linkage of the locus for Usher syndrome type II to a DNA marker on chromosome 1q.

    Science.gov (United States)

    Lewis, R A; Otterud, B; Stauffer, D; Lalouel, J M; Leppert, M

    1990-06-01

    Usher syndrome is a heterogeneous group of autosomal recessive disorders that combines variably severe congenital neurosensory hearing impairment with progressive night-blindness and visual loss similar to that in retinitis pigmentosa. Usher syndrome type I is distinguished by profound congenital (preverbal) deafness and retinal disease with onset in the first decade of life. Usher syndrome type II is characterized by partial hearing impairment and retinal dystrophy that occurs in late adolescence or early adulthood. The chromosomal assignment and the regional localization of the genetic mutation(s) causing the Usher syndromes are unknown. We analyzed a panel of polymorphic genomic markers for linkage to the disease gene among six families with Usher syndrome type I and 22 families with Usher syndrome type II. Significant linkage was established between Usher syndrome type II and the DNA marker locus THH33 (D1S81), which maps to chromosome 1q. The most likely location of the disease gene is at a map distance of 9 cM from THH33 (lod score 6.5). The same marker failed to show linkage in families segregating an allele for Usher syndrome type I. These data confirm the provisional assignment of the locus for Usher syndrome type II to the distal end of chromosome 1q and demonstrate that the clinical heterogeneity between Usher types I and II is caused by mutational events at different genetic loci. Regional localization has the potential to improve carrier detection and to provide antenatal diagnosis in families at risk for the disease.

  1. One simple DNA extraction device and its combination with modified visual loop-mediated isothermal amplification for rapid on-field detection of genetically modified organisms.

    Science.gov (United States)

    Zhang, Miao; Liu, Yinan; Chen, Lili; Quan, Sheng; Jiang, Shimeng; Zhang, Dabing; Yang, Litao

    2013-01-02

    Quickness, simplicity, and effectiveness are the three major criteria for establishing a good molecular diagnosis method in many fields. Herein we report a novel detection system for genetically modified organisms (GMOs), which can be utilized to perform both on-field quick screening and routine laboratory diagnosis. In this system, a newly designed inexpensive DNA extraction device was used in combination with a modified visual loop-mediated isothermal amplification (vLAMP) assay. The main parts of the DNA extraction device included a silica gel membrane filtration column and a modified syringe. The DNA extraction device could be easily operated without using other laboratory instruments, making it applicable to an on-field GMO test. High-quality genomic DNA (gDNA) suitable for polymerase chain reaction (PCR) and isothermal amplification could be quickly isolated from plant tissues using this device within 15 min. In the modified vLAMP assay, a microcrystalline wax encapsulated detection bead containing SYBR green fluorescent dye was introduced to avoid dye inhibition and cross-contaminations from post-LAMP operation. The system was successfully applied and validated in screening and identification of GM rice, soybean, and maize samples collected from both field testing and the Grain Inspection, Packers, and Stockyards Administration (GIPSA) proficiency test program, which demonstrated that it was well-adapted to both on-field testing and/or routine laboratory analysis of GMOs.

  2. Rapid decrease of circulating tumor DNA predicted the treatment effect of nivolumab in a lung cancer patient within only 5 days

    Directory of Open Access Journals (Sweden)

    Yuki Iijima

    2017-01-01

    Full Text Available A 77-year-old Japanese man presented to our hospital with a 1-month history of low back pain and was diagnosed as having stage IV EGFR mutation-positive lung adenocarcinoma. After treatment with EGFR tyrosine kinase inhibitor and cytotoxic chemotherapy, nivolumab was started as fourth-line therapy. Remarkable regression of the primary tumor was observed, suggesting high anti-tumor activity of nivolumab. We retrospectively investigated the change in circulating tumor DNA (ctDNA variant allele fractions in serial plasma samples before and after the nivolumab therapy. Targeted sequencing analysis showed tumor-derived TP53R249S and EGFRL858R mutations detectable in plasma, and the timing of decrease was only 5 days, much earlier than the appearance of radiological changes. Overall, these results suggest that ctDNA might reflect tumor burden and might be a surrogate marker of the therapeutic efficacy of immune checkpoint therapy.

  3. A rapid assessment method to estimate the distribution of juvenile Chinook Salmon in tributary habitats using eDNA and occupancy estimation

    Science.gov (United States)

    Matter, A.; Falke, Jeffrey A.; López, J. Andres; Savereide, James W.

    2018-01-01

    Identification and protection of water bodies used by anadromous species are critical in light of increasing threats to fish populations, yet often challenging given budgetary and logistical limitations. Noninvasive, rapid‐assessment, sampling techniques may reduce costs and effort while increasing species detection efficiencies. We used an intrinsic potential (IP) habitat model to identify high‐quality rearing habitats for Chinook Salmon Oncorhynchus tshawytscha and select sites to sample throughout the Chena River basin, Alaska, for juvenile occupancy using an environmental DNA (eDNA) approach. Water samples were collected from 75 tributary sites in 2014 and 2015. The presence of Chinook Salmon DNA in water samples was assessed using a species‐specific quantitative PCR (qPCR) assay. The IP model predicted over 900 stream kilometers in the basin to support high‐quality (IP ≥ 0.75) rearing habitat. Occupancy estimation based on eDNA samples indicated that 80% and 56% of previously unsampled sites classified as high or low IP (IP Salmon DNA from three replicate water samples was high (p = 0.76) but varied with drainage area (km2). A power analysis indicated high power to detect proportional changes in occupancy based on parameter values estimated from eDNA occupancy models, although power curves were not symmetrical around zero, indicating greater power to detect positive than negative proportional changes in occupancy. Overall, the combination of IP habitat modeling and occupancy estimation provided a useful, rapid‐assessment method to predict and subsequently quantify the distribution of juvenile salmon in previously unsampled tributary habitats. Additionally, these methods are flexible and can be modified for application to other species and in other locations, which may contribute towards improved population monitoring and management.

  4. Utility of DNA barcoding for rapid and accurate assessment of bat diversity in Malaysia in the absence of formally described species.

    Science.gov (United States)

    Wilson, J-J; Sing, K-W; Halim, M R A; Ramli, R; Hashim, R; Sofian-Azirun, M

    2014-02-19

    Bats are important flagship species for biodiversity research; however, diversity in Southeast Asia is considerably underestimated in the current checklists and field guides. Incorporation of DNA barcoding into surveys has revealed numerous species-level taxa overlooked by conventional methods. Inclusion of these taxa in inventories provides a more informative record of diversity, but is problematic as these species lack formal description. We investigated how frequently documented, but undescribed, bat taxa are encountered in Peninsular Malaysia. We discuss whether a barcode library provides a means of recognizing and recording these taxa across biodiversity inventories. Tissue was sampled from bats trapped at Pasir Raja, Dungun Terengganu, Peninsular Malaysia. The DNA was extracted and the COI barcode region amplified and sequenced. We identified 9 species-level taxa within our samples, based on analysis of the DNA barcodes. Six specimens matched to four previously documented taxa considered candidate species but currently lacking formal taxonomic status. This study confirms the high diversity of bats within Peninsular Malaysia (9 species in 13 samples) and demonstrates how DNA barcoding allows for inventory and documentation of known taxa lacking formal taxonomic status.

  5. Rapid diagnosis of virulent Pasteurella multocida isolated from farm animals with clinical manifestation of pneumonia respiratory infection using 16S rDNA and KMT1 gene

    Directory of Open Access Journals (Sweden)

    Gamal Mohamedin Hassan

    2016-01-01

    Full Text Available Objective: To characterize intra-isolates variation between clinical isolates of Pasteurella multocida (P. multocida isolated from sheep, cattle and buffalo at molecular level to check the distribution of pneumonia and hemorrhagic septicemia in some regions of Fayoum, Egypt. Methods: These isolates were obtained from various locations in the Fayoum Governorate, Egypt and they were identified by amplifying 16S rDNA and KMT1 genes using their DNA as a template in PCR reaction. Results: The results demonstrated that the five selective isolates of P. multocida had similar size of PCR products that generated one band of 16S rDNA having 1 471 bp and KMT1 gene having 460 bp. The phylogenetic tree and similarity of the five selective isolates of P. multocida which were collected from GenBank database were calculated and analyzed for the nucleotide sequence of 16S rDNA and KMT1 genes. The sequencing result of 16S rRNA gene product (1 471 bp for the five selective isolates of P. multocida showed that the isolates of sheep (FUP2 shared 94.08%, 88.10% homology with the buffalo isolate (FUP8 and cattle isolate (FUP9 respectively, whereas, the buffalo isolate (FUP5 shared 98.18% and 94.40% homology with the cattle isolates (FUP12 and FUP9. Conclusions: The results indicated the relationships of P. multocida isolated from buffalo and cattle rather than the close relationships between P. multocida isolated from cattle and sheep. Diagnosis of P. multocida by 16S rDNA and KMT1 gene sequences was important to determine the antigen that is responsible for protective cover within the same group of animals and to help for the production of new vaccines for the control of microbial infection for domestic animals.

  6. Towards High-throughput Immunomics for Infectious Diseases: Use of Next-generation Peptide Microarrays for Rapid Discovery and Mapping of Antigenic Determinants

    DEFF Research Database (Denmark)

    J. Carmona, Santiago; Nielsen, Morten; Schafer-Nielsen, Claus

    2015-01-01

    , we developed a highly-multiplexed platform based on next-generation high-density peptide microarrays to map these specificities in Chagas Disease, an exemplar of a human infectious disease caused by the protozoan Trypanosoma cruzi. We designed a high-density peptide microarray containing more than...

  7. PG-2 photogrammetric plotter: a rapid and accurate means of mapping surface effects produced by subsurface nuclear testing at the Nevada Test Site, Nevada

    International Nuclear Information System (INIS)

    Van de Werken, M.G.

    1983-01-01

    Since October 1981, the US Geological Survey has been using the Kern PG-2 photogrammetric plotter to map surface effects using post-test aerial photographs. The main goal of this pilot program was to compare the two mapping methods and to determine if field observations are necessary. Preliminary results indicate that only questionable small-scale features need to be field checked. Mapping on the plotter is highly reliable if aerial photographs obtained immediately after detonation are used. If photography is delayed, surface effects may be obliterated by natural processes and construction activities. Disadvantages to the plotter method relate to the quality and coverage of aerial photographs. The main problem concerns the scale of aerial photographs. Because of the large scale, the photographs lack adequate control points to properly orient the photographs to a map base. In addition, the paper print photographs used were often distorted. Once the problems were recognized and corrected, the method was greatly improved. Generally, the PG-2 offers a precise method for determining the distribution of surface effects

  8. 大豆种子DNA快速提取方法的改良及应用%Improvement and application of the rapid DNA extraction method from Soybean Seeds

    Institute of Scientific and Technical Information of China (English)

    朱振雷; 束永俊; 李勇; 柏锡; 才华; 纪巍; 朱延明

    2009-01-01

    High-quality DNA is an important base of molecular biology manipulation, such as gene cloning. There are lots of protein and fat in the soybean seeds, so the DNA extracted from them by using traditional methods is very difficult to achieve quality requirements of experiments. This study improved the SDS extraction buffer by adding NP-40 and Tween-20, and established a rapid DNA extraction method that is suitable for soybean seeds. The DNA extraction by the optimized SDS extraction method has high-quality, and the values of OD_(260)/OD_(280) ranged from 1.809 to 1.916, that means non-protein and RNA pollution. The DNA extraction method was validated by gene cloning and genotyping, and the results showed that it could be used for soybean gene cloning and molecular markers.%高质量的DNA是进行基因克隆等分子生物学试验的前提条件.因大豆种子中蛋白质和油脂含量丰富,利用传统方法提取DNA质量很难达到试验要求.研究在SDS提取液的基础上.通过添加表面活性剂NP-40和Tween-20,优化出一种适合于大豆种子DNA快速提取的方法.优化后的SDS方法提取的DNA质量较高.OD_(260)/OD_(280)在1.809~1.916之间,无蛋白质和RNA污染.对该方法提取的DNA进行了基因克隆和分子标记的试验验证,结果表明,它们能够用于大豆基因克隆、分子标记.

  9. Rapid assessment of repair of ultraviolet DNA damage with a modified host-cell reactivation assay using a luciferase reporter gene and correlation with polymorphisms of DNA repair genes in normal human lymphocytes

    Energy Technology Data Exchange (ETDEWEB)

    Qiao Yawei; Spitz, Margaret R.; Guo Zhaozheng; Hadeyati, Mohammad; Grossman, Lawrence; Kraemer, Kenneth H.; Wei Qingyi

    2002-11-30

    As DNA repair plays an important role in genetic susceptibility to cancer, assessment of the DNA repair phenotype is critical for molecular epidemiological studies of cancer. In this report, we compared use of the luciferase (luc) reporter gene in a host-cell reactivation (HCR) (LUC) assay of repair of ultraviolet (UV) damage to DNA to use of the chloramphenicol (cat) gene-based HCR (CAT) assay we used previously for case-control studies. We performed both the assays on cryopreserved lymphocytes from 102 healthy non-Hispanic white subjects. There was a close correlation between DNA repair capacity (DRC) as measured by the LUC and CAT assays. Although these two assays had similar variation, the LUC assay was faster and more sensitive. We also analyzed the relationship between DRC and the subjects' previously determined genotypes for four polymorphisms of two nucleotide-excision repair (NER) genes (in intron 9 of xeroderma pigmentosum (XP) C and exons 6, 10 and 23 of XPD) and one polymorphism of a base-excision repair gene in exon 10 of X-ray complementing group 1 (XRCC1). The DRC was significantly lower in subjects homozygous for one or more polymorphisms of the two NER genes than in subjects with other genotypes (P=0.010). In contrast, the polymorphic XRCC1 allele had no significant effect on DRC. These results suggest that the post-UV LUC assay measures NER phenotype and that polymorphisms of XPC and XPD genes modulate DRC. For population studies of the DNA repair phenotype, many samples need to be evaluated, and so the LUC assay has several advantages over the CAT assay: the LUC assay was more sensitive, had less variation, was not radioactive, was easier to perform, and required fewer cryopreserved cells. These features make the LUC-based HCR assay suitable for molecular epidemiological studies.

  10. Rapid parametric mapping of the longitudinal relaxation time T1 using two-dimensional variable flip angle magnetic resonance imaging at 1.5 Tesla, 3 Tesla, and 7 Tesla.

    Science.gov (United States)

    Dieringer, Matthias A; Deimling, Michael; Santoro, Davide; Wuerfel, Jens; Madai, Vince I; Sobesky, Jan; von Knobelsdorff-Brenkenhoff, Florian; Schulz-Menger, Jeanette; Niendorf, Thoralf

    2014-01-01

    Visual but subjective reading of longitudinal relaxation time (T1) weighted magnetic resonance images is commonly used for the detection of brain pathologies. For this non-quantitative measure, diagnostic quality depends on hardware configuration, imaging parameters, radio frequency transmission field (B1+) uniformity, as well as observer experience. Parametric quantification of the tissue T1 relaxation parameter offsets the propensity for these effects, but is typically time consuming. For this reason, this study examines the feasibility of rapid 2D T1 quantification using a variable flip angles (VFA) approach at magnetic field strengths of 1.5 Tesla, 3 Tesla, and 7 Tesla. These efforts include validation in phantom experiments and application for brain T1 mapping. T1 quantification included simulations of the Bloch equations to correct for slice profile imperfections, and a correction for B1+. Fast gradient echo acquisitions were conducted using three adjusted flip angles for the proposed T1 quantification approach that was benchmarked against slice profile uncorrected 2D VFA and an inversion-recovery spin-echo based reference method. Brain T1 mapping was performed in six healthy subjects, one multiple sclerosis patient, and one stroke patient. Phantom experiments showed a mean T1 estimation error of (-63±1.5)% for slice profile uncorrected 2D VFA and (0.2±1.4)% for the proposed approach compared to the reference method. Scan time for single slice T1 mapping including B1+ mapping could be reduced to 5 seconds using an in-plane resolution of (2×2) mm2, which equals a scan time reduction of more than 99% compared to the reference method. Our results demonstrate that rapid 2D T1 quantification using a variable flip angle approach is feasible at 1.5T/3T/7T. It represents a valuable alternative for rapid T1 mapping due to the gain in speed versus conventional approaches. This progress may serve to enhance the capabilities of parametric MR based lesion detection and

  11. Rapid, sensitive, and selective fluorescent DNA detection using iron-based metal-organic framework nanorods: Synergies of the metal center and organic linker.

    Science.gov (United States)

    Tian, Jingqi; Liu, Qian; Shi, Jinle; Hu, Jianming; Asiri, Abdullah M; Sun, Xuping; He, Yuquan

    2015-09-15

    Considerable recent attention has been paid to homogeneous fluorescent DNA detection with the use of nanostructures as a universal "quencher", but it still remains a great challenge to develop such nanosensor with the benefits of low cost, high speed, sensitivity, and selectivity. In this work, we report the use of iron-based metal-organic framework nanorods as a high-efficient sensing platform for fluorescent DNA detection. It only takes about 4 min to complete the whole "mix-and-detect" process with a low detection limit of 10 pM and a strong discrimination of single point mutation. Control experiments reveal the remarkable sensing behavior is a consequence of the synergies of the metal center and organic linker. This work elucidates how composition control of nanostructures can significantly impact their sensing properties, enabling new opportunities for the rational design of functional materials for analytical applications. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Direct immobilization of DNA probes on non-modified plastics by UV irradiation and integration in microfluidic devices for rapid bioassay

    DEFF Research Database (Denmark)

    Yi, Sun; Perch-Nielsen, Ivan R.; Dufva, Martin

    2012-01-01

    that simple UV irradiation can be used to directly immobilize poly(T)poly(C)-tagged DNA oligonucleotide probes on many different types of plastics without any surface modification. On average, five- and fourfold improvement in immobilization and hybridization efficiency have been achieved compared to surface......DNA microarrays have become one of the most powerful tools in the field of genomics and medical diagnosis. Recently, there has been increased interest in combining microfluidics with microarrays since this approach offers advantages in terms of portability, reduced analysis time, low consumption...... of reagents, and increased system integration. Polymers are widely used for microfluidic systems, but fabrication of microarrays on such materials often requires complicated chemical surface modifications, which hinders the integration of microarrays into microfluidic systems. In this paper, we demonstrate...

  13. A rapid genotyping method for an obligate fungal pathogen, Puccinia striiformis f.sp. tritici, based on DNA extraction from infected leaf and Multiplex PCR genotyping

    Directory of Open Access Journals (Sweden)

    Enjalbert Jérôme

    2011-07-01

    Full Text Available Abstract Background Puccinia striiformis f.sp. tritici (PST, an obligate fungal pathogen causing wheat yellow/stripe rust, a serious disease, has been used to understand the evolution of crop pathogen using molecular markers. However, numerous questions regarding its evolutionary history and recent migration routes still remains to be addressed, which need the genotyping of a large number of isolates, a process that is limited by both DNA extraction and genotyping methods. To address the two issues, we developed here a method for direct DNA extraction from infected leaves combined with optimized SSR multiplexing. Findings We report here an efficient protocol for direct fungal DNA extraction from infected leaves, avoiding the costly and time consuming step of spore multiplication. The genotyping strategy we propose, amplified a total of 20 SSRs in three Multiplex PCR reactions, which were highly polymorphic and were able to differentiate different PST populations with high efficiency and accuracy. Conclusion These two developments enabled a genotyping strategy that could contribute to the development of molecular epidemiology of yellow rust disease, both at a regional or worldwide scale.

  14. Rapid turn-around mapping of wildfires and disasters with airborne infrared imagery fro the new FireMapper® 2.0 and Oilmapper systems

    Science.gov (United States)

    James W. Hoffman; Lloyd L. Coulter; Philip J Riggan

    2005-01-01

    The new FireMapper® 2.0 and OilMapper airborne, infrared imaging systems operate in a "snapshot" mode. Both systems feature the real time display of single image frames, in any selected spectral band, on a daylight readable tablet PC. These single frames are displayed to the operator with full temperature calibration in color or grayscale renditions. A rapid...

  15. Rapid assessment and mapping of tree cover in southern African savanna woodlands using a new iPhone App and Landsat 8 imagery

    Science.gov (United States)

    Fuller, D. O.

    2016-12-01

    Tree cover is a key parameter in climate modeling. It strongly influences CO2 exchanges between the land surface and atmosphere and surface energy balance. We measured percent woody canopy cover (PWCC) in the savanna woodlands of eastern Zambia over a 10-day period in May 2016 using a new iPhone App (CanopyApp) and related these field measurements to Landsat 8 (L8) Band 4 (red) imagery acquired approximately the same time. We then used parameters from the band 4 digital numbers (DNs)-PWCC linear regression to derive a new map of PWCC for the entire L8 scene. Consistent with theory and previous empirical studies, we found that the relationship between L8 band 4 DNs- PWCC was negative and linear (r2 = 0.61, p reflectance was weaker (r2 = 0.46, p shadowing effects and other spatial inhomogeneities from variable soil and background reflectance. Our PWCC map agreed qualitatively with similar percent tree-cover maps based on Landsat level 1 products and past field studies in the area conducted using a hemispherical lens. Our results also compared favorably with other remote sensing studies that have used complex multivariate approaches to estimate tree cover, which suggests that use of a single L8 band 4 is sufficient to estimate PWCC when spectral contrast exists between the grass, soil and tree layers during the austral fall period in southern African savannas.

  16. Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

    Science.gov (United States)

    Kim, S A; Park, S H; Lee, S I; Ricke, S C

    2017-12-01

    The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

  17. Accurate and rapid modeling of iron–bleomycin-induced DNA damage using tethered duplex oligonucleotides and electrospray ionization ion trap mass spectrometric analysis

    OpenAIRE

    Harsch, Andreas; Marzilli, Lisa A.; Bunt, Richard C.; Stubbe, Joanne; Vouros, Paul

    2000-01-01

    Bleomycin B2 (BLM) in the presence of iron [Fe(II)] and O2 catalyzes single-stranded (ss) and double-stranded (ds) cleavage of DNA. Electrospray ionization ion trap mass spectrometry was used to monitor these cleavage processes. Two duplex oligonucleotides containing an ethylene oxide tether between both strands were used in this investigation, allowing facile monitoring of all ss and ds cleavage events. A sequence for site-specific binding and cleavage by Fe–BLM was incorporated into each an...

  18. Rapid world modeling

    International Nuclear Information System (INIS)

    Little, Charles; Jensen, Ken

    2002-01-01

    Sandia National Laboratories has designed and developed systems capable of large-scale, three-dimensional mapping of unstructured environments in near real time. This mapping technique is called rapid world modeling and has proven invaluable when used by prototype systems consisting of sensory detection devices mounted on mobile platforms. These systems can be deployed into previously unmapped environments and transmit real-time 3-D visual images to operators located remotely. This paper covers a brief history of the rapid world modeling system, its implementation on mobile platforms, and the current state of the technology. Applications to the nuclear power industry are discussed. (author)

  19. Rapid simultaneous high-resolution mapping of myelin water fraction and relaxation times in human brain using BMC-mcDESPOT.

    Science.gov (United States)

    Bouhrara, Mustapha; Spencer, Richard G

    2017-02-15

    A number of central nervous system (CNS) diseases exhibit changes in myelin content and magnetic resonance longitudinal, T 1 , and transverse, T 2 , relaxation times, which therefore represent important biomarkers of CNS pathology. Among the methods applied for measurement of myelin water fraction (MWF) and relaxation times, the multicomponent driven equilibrium single pulse observation of T 1 and T 2 (mcDESPOT) approach is of particular interest. mcDESPOT permits whole brain mapping of multicomponent T 1 and T 2 , with data acquisition accomplished within a clinically realistic acquisition time. Unfortunately, previous studies have indicated the limited performance of mcDESPOT in the setting of the modest signal-to-noise range of high-resolution mapping, required for the depiction of small structures and to reduce partial volume effects. Recently, we showed that a new Bayesian Monte Carlo (BMC) analysis substantially improved determination of MWF from mcDESPOT imaging data. However, our previous study was limited in that it did not discuss determination of relaxation times. Here, we extend the BMC analysis to the simultaneous determination of whole-brain MWF and relaxation times using the two-component mcDESPOT signal model. Simulation analyses and in-vivo human brain studies indicate the overall greater performance of this approach compared to the stochastic region contraction (SRC) algorithm, conventionally used to derive parameter estimates from mcDESPOT data. SRC estimates of the transverse relaxation time of the long T 2 fraction, T 2,l , and the longitudinal relaxation time of the short T 1 fraction, T 1,s , clustered towards the lower and upper parameter search space limits, respectively, indicating failure of the fitting procedure. We demonstrate that this effect is absent in the BMC analysis. Our results also showed improved parameter estimation for BMC as compared to SRC for high-resolution mapping. Overall we find that the combination of BMC analysis

  20. Layer-by-Layer-Assembled AuNPs-Decorated First-Generation Poly(amidoamine) Dendrimer with Reduced Graphene Oxide Core as Highly Sensitive Biosensing Platform with Controllable 3D Nanoarchitecture for Rapid Voltammetric Analysis of Ultratrace DNA Hybridization.

    Science.gov (United States)

    Jayakumar, Kumarasamy; Camarada, María Belén; Dharuman, Venkataraman; Rajesh, Rajendiran; Venkatesan, Rengarajan; Ju, Huangxian; Maniraj, Mahalingam; Rai, Abhishek; Barman, Sudipta Roy; Wen, Yangping

    2018-06-12

    The structure and electrochemical properties of layer-by-layer-assembled gold nanoparticles (AuNPs)-decorated first-generation (G1) poly(amidoamine) dendrimer (PD) with reduced graphene oxide (rGO) core as a highly sensitive and label-free biosensing platform with a controllable three-dimensional (3D) nanoarchitecture for the rapid voltammetric analysis of DNA hybridization at ultratrace levels were characterized. Mercaptopropinoic acid (MPA) was self-assembled onto Au substrate, then GG1PD formed by the covalent functionalization between the amino terminals of G1PD and carboxyl terminals of rGO was covalently linked onto MPA, and finally AuNPs were decorated onto GG1PD by strong physicochemical interaction between AuNPs and -OH of rGO in GG1PD, which was characterized through different techniques and confirmed by computational calculation. This 3D controllable thin-film electrode was optimized and evaluated using [Fe(CN) 6 ] 3-/4- as the redox probe and employed to covalently immobilize thiol-functionalized single-stranded DNA as biorecognition element to form the DNA nanobiosensor, which achieved fast, ultrasensitive, and high-selective differential pulse voltammetric analysis of DNA hybridization in a linear range from 1 × 10 -6 to 1 × 10 -13 g m -1 with a low detection limit of 9.07 × 10 -14 g m -1 . This work will open a new pathway for the controllable 3D nanoarchitecture of the layer-by-layer-assembled metal nanoparticles-functionalized lower-generation PD with two-dimensional layered nanomaterials as cores that can be employed as ultrasensitive and label-free nanobiodevices for the fast diagnosis of specific genome diseases in the field of biomedicine.

  1. Rapid analysis of heterogeneously methylated DNA using digital methylation-sensitive high resolution melting: application to the CDKN2B (p15) gene

    DEFF Research Database (Denmark)

    Candiloro, Ida Lm; Mikeska, Thomas; Hokland, Peter

    2008-01-01

    ABSTRACT: BACKGROUND: Methylation-sensitive high resolution melting (MS-HRM) methodology is able to recognise heterogeneously methylated sequences by their characteristic melting profiles. To further analyse heterogeneously methylated sequences, we adopted a digital approach to MS-HRM (dMS-HRM) t......ABSTRACT: BACKGROUND: Methylation-sensitive high resolution melting (MS-HRM) methodology is able to recognise heterogeneously methylated sequences by their characteristic melting profiles. To further analyse heterogeneously methylated sequences, we adopted a digital approach to MS-HRM (d......MS-HRM) that involves the amplification of single templates after limiting dilution to quantify and to determine the degree of methylation. We used this approach to study methylation of the CDKN2B (p15) cell cycle progression inhibitor gene which is inactivated by DNA methylation in haematological malignancies...... the methylated alleles and assess the degree of methylation. Direct sequencing of selected dMS-HRM products was used to determine the exact DNA methylation pattern and confirmed the degree of methylation estimated by dMS-HRM. CONCLUSION: dMS-HRM is a powerful technique for the analysis of methylation in CDKN2B...

  2. Genome-Wide Mapping of Growth-Related Quantitative Trait Loci in Orange-Spotted Grouper (Epinephelus coioides) Using Double Digest Restriction-Site Associated DNA Sequencing (ddRADseq).

    Science.gov (United States)

    Yu, Hui; You, Xinxin; Li, Jia; Liu, Hankui; Meng, Zining; Xiao, Ling; Zhang, Haifa; Lin, Hao-Ran; Zhang, Yong; Shi, Qiong

    2016-04-06

    Mapping of quantitative trait loci (QTL) is essential for the discovery of genetic structures that related to complex quantitative traits. In this study, we identified 264,072 raw SNPs (single-nucleotide polymorphisms) by double digest restriction site associated DNA sequencing (ddRADseq), and utilized 3029 of these SNPs to construct a genetic linkage map in orange-spotted grouper (Epinephelus coioides) using a regression mapping algorithm. The genetic map contained 24 linkage groups (LGs) spanning a total genetic distance of 1231.98 cM. Twenty-seven significant growth-related QTLs were identified. Furthermore, we identified 17 genes (fez2, alg3, ece2, arvcf, sla27a4, sgk223, camk2, prrc2b, mchr1, sardh, pappa, syk, tert, wdrcp91, ftz-f1, mate1 and notch1) including three (tert, ftz-f1 and notch1) that have been reported to be involved in fish growth. To summarize, we mapped growth-related QTLs in the orange-spotted grouper. These QTLs will be useful in marker-assisted selection (MAS) efforts to improve growth-related traits in this economically important fish.

  3. Projective mapping

    DEFF Research Database (Denmark)

    Dehlholm, Christian; Brockhoff, Per B.; Bredie, Wender Laurentius Petrus

    2012-01-01

    by the practical testing environment. As a result of the changes, a reasonable assumption would be to question the consequences caused by the variations in method procedures. Here, the aim is to highlight the proven or hypothetic consequences of variations of Projective Mapping. Presented variations will include...... instructions and influence heavily the product placements and the descriptive vocabulary (Dehlholm et.al., 2012b). The type of assessors performing the method influences results with an extra aspect in Projective Mapping compared to more analytical tests, as the given spontaneous perceptions are much dependent......Projective Mapping (Risvik et.al., 1994) and its Napping (Pagès, 2003) variations have become increasingly popular in the sensory field for rapid collection of spontaneous product perceptions. It has been applied in variations which sometimes are caused by the purpose of the analysis and sometimes...

  4. Dna fingerprinting - review paper

    OpenAIRE

    Blundell, Renald

    2006-01-01

    Before the Polymerase Chain Reaction (PCR) was established, DNA fingerprinting technology has relied for years on Restriction Fragment Length Polymorphism (RFLP) and Variable Number of Tandom Repeats (VNTR) analysis, a very efficient technique but quite laborious and not suitable for high throughput mapping. Since its, development, PCR has provided a new and powerful tool for DNA fingerprinting.

  5. Knock-in/Knock-out (KIKO) vectors for rapid integration of large DNA sequences, including whole metabolic pathways, onto the Escherichia coli chromosome at well-characterised loci.

    Science.gov (United States)

    Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E

    2013-06-24

    Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable

  6. Rapid Amplification of the 5'cDNA End of Reindeer Ghrelin by Inverse Nested PCR%反向嵌套PCR技术扩增驯鹿Ghrelin cDNA 5'末端序列

    Institute of Scientific and Technical Information of China (English)

    朱雪敏; 张义; 张剑平; 杨银凤

    2008-01-01

    为了研究Ghrelin在驯鹿生长发育过程中的作用和功能,以驯鹿为研究对象,采用反向嵌套PCR RACE技术原理,根据已知的序列设计1条5'末端磷酸化的特异性反转录引物和2对特异性反向嵌套PCR引物,首先进行反转录(RT),然后将反转录成的cDNA进行环化,最后进行反向嵌套巢式PCR,成功地扩增了驯鹿Ghrelin cDNA 5'末端序列.与锚定PCR相比,反向嵌套PCR法具有特异性强、扩增效率高等优点,是一种非常有效的扩增cDNA 5'末端序列的方法.

  7. Application of a Novel and Automated Branched DNA in Situ Hybridization Method for the Rapid and Sensitive Localization of mRNA Molecules in Plant Tissues

    Directory of Open Access Journals (Sweden)

    Andrew J. Bowling

    2014-04-01

    Full Text Available Premise of the study: A novel branched DNA detection technology, RNAscope in situ hybridization (ISH, originally developed for use on human clinical and animal tissues, was adapted for use in plant tissue in an attempt to overcome some of the limitations associated with traditional ISH assays. Methods and Results: Zea mays leaf tissue was formaldehyde fixed and paraffin embedded (FFPE and then probed with the RNAscope ISH assay for two endogenous genes, phosphoenolpyruvate carboxylase (PEPC and phosphoenolpyruvate carboxykinase (PEPCK. Results from both manual and automated methods showed tissue- and cell-specific mRNA localization patterns expected from these well-studied genes. Conclusions: RNAscope ISH is a sensitive method that generates high-quality, easily interpretable results from FFPE plant tissues. Automation of the RNAscope method on the Ventana Discovery Ultra platform allows significant advantages for repeatability, reduction in variability, and flexibility of workflow processes.

  8. Dietary restriction but not angiotensin II type 1 receptor blockade improves DNA damage-related vasodilator dysfunction in rapidly aging Ercc1Δ/- mice.

    Science.gov (United States)

    Wu, Haiyan; van Thiel, Bibi S; Bautista-Niño, Paula K; Reiling, Erwin; Durik, Matej; Leijten, Frank P J; Ridwan, Yanto; Brandt, Renata M C; van Steeg, Harry; Dollé, Martijn E T; Vermeij, Wilbert P; Hoeijmakers, Jan H J; Essers, Jeroen; van der Pluijm, Ingrid; Danser, A H Jan; Roks, Anton J M

    2017-08-01

    DNA damage is an important contributor to endothelial dysfunction and age-related vascular disease. Recently, we demonstrated in a DNA repair-deficient, prematurely aging mouse model ( Ercc1 Δ/- mice) that dietary restriction (DR) strongly increases life- and health span, including ameliorating endothelial dysfunction, by preserving genomic integrity. In this mouse mutant displaying prominent accelerated, age-dependent endothelial dysfunction we investigated the signaling pathways involved in improved endothelium-mediated vasodilation by DR, and explore the potential role of the renin-angiotensin system (RAS). Ercc1 Δ/- mice showed increased blood pressure and decreased aortic relaxations to acetylcholine (ACh) in organ bath experiments. Nitric oxide (NO) signaling and phospho-Ser 1177 -eNOS were compromised in Ercc1 Δ / - DR improved relaxations by increasing prostaglandin-mediated responses. Increase of cyclo-oxygenase 2 and decrease of phosphodiesterase 4B were identified as potential mechanisms. DR also prevented loss of NO signaling in vascular smooth muscle cells and normalized angiotensin II (Ang II) vasoconstrictions, which were increased in Ercc1 Δ/- mice. Ercc1 Δ/ - mutants showed a loss of Ang II type 2 receptor-mediated counter-regulation of Ang II type 1 receptor-induced vasoconstrictions. Chronic losartan treatment effectively decreased blood pressure, but did not improve endothelium-dependent relaxations. This result might relate to the aging-associated loss of treatment efficacy of RAS blockade with respect to endothelial function improvement. In summary, DR effectively prevents endothelium-dependent vasodilator dysfunction by augmenting prostaglandin-mediated responses, whereas chronic Ang II type 1 receptor blockade is ineffective. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  9. Ancient DNA

    DEFF Research Database (Denmark)

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...

  10. EzMap: a simple pipeline for reproducible analysis of the human virome.

    Science.gov (United States)

    Czeczko, Patrick; Greenway, Steven C; de Koning, A P Jason

    2017-08-15

    In solid-organ transplant recipients, a delicate balance between immunosuppression and immunocompetence must be achieved, which can be difficult to monitor in real-time. Shotgun sequencing of cell-free DNA (cfDNA) has been recently proposed as a new way to indirectly assess immune function in transplant recipients through analysis of the status of the human virome. To facilitate exploration of the utility of the human virome as an indicator of immune status, and to enable rapid, straightforward analyses by clinicians, we developed a fully automated computational pipeline, EzMap, for performing metagenomic analysis of the human virome. EzMap combines a number of tools to clean, filter, and subtract WGS reads by mapping to a reference human assembly. The relative abundance of each virus present is estimated using a maximum likelihood approach that accounts for genome size, and results are presented with interactive visualizations and taxonomy-based summaries that enable rapid insights. The pipeline is automated to run on both workstations and computing clusters for all steps. EzMap automates an otherwise tedious and time-consuming protocol and aims to facilitate rapid and reproducible insights from cfDNA. EzMap is freely available at https://github.com/dekoning-lab/ezmap. jason.dekoning@ucalgary.ca. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  11. Mapping and polymorphism of bovine ghreline gene

    OpenAIRE

    Colinet, Frédéric; Eggen, André; Halleux, Caroline; Arnould, Valérie; Portetelle, Daniel; Renaville, Robert

    2006-01-01

    Bovine ghrelin, a 27-amino-acid peptide has been identified in bovine oxyntic glands of the abomasum. It is an endogenous growth hormone secretagogue. Total mRNA was extracted from abomasum and complete ghrelin mRNA was sequenced by rapid amplification of cDNA ends. The gene contains five exons and four introns with a short noncoding first exon of 17 bp similar to mouse and human ghrelin gene. Using a radiation hybrid panel, the gene was mapped to chromosome 22 near microsat...

  12. Evaluation of genetic diversity in Chinese kale (Brassica oleracea L. var. alboglabra Bailey) by using rapid amplified polymorphic DNA and sequence-related amplified polymorphism markers.

    Science.gov (United States)

    Zhang, J; Zhang, L G

    2014-02-14

    Chinese kale is an original Chinese vegetable of the Cruciferae family. To select suitable parents for hybrid breeding, we thoroughly analyzed the genetic diversity of Chinese kale. Random amplified polymorphic DNA (RAPD) and sequence-related amplified polymorphism (SRAP) molecular markers were used to evaluate the genetic diversity across 21 Chinese kale accessions from AVRDC and Guangzhou in China. A total of 104 bands were detected by 11 RAPD primers, of which 66 (63.5%) were polymorphic, and 229 polymorphic bands (68.4%) were observed in 335 bands amplified by 17 SRAP primer combinations. The dendrogram showed the grouping of the 21 accessions into 4 main clusters based on RAPD data, and into 6 clusters based on SRAP and combined data (RAPD + SRAP). The clustering of accessions based on SRAP data was consistent with petal colors. The Mantel test indicated a poor fit for the RAPD and SRAP data (r = 0.16). These results have an important implication for Chinese kale germplasm characterization and improvement.

  13. Human Genome Research: Decoding DNA

    Science.gov (United States)

    dropdown arrow Site Map A-Z Index Menu Synopsis Human Genome Research: Decoding DNA Resources with of the DNA double helix during April 2003. James D. Watson, Francis Crick, and Maurice Wilkins were company Celera announced the completion of a "working draft" reference DNA sequence of the human

  14. Use and results of the aerial gamma mapping system during the international exercise R.E.S.U.M.E. 95 (Rapid Environmental Surveying Using Mobile Equipment) in Finland

    International Nuclear Information System (INIS)

    Bourgeois, C.; Bresson, J.; Chastel, R.; Chiffot, T.; Guillot, L.; Kruajitch, J.C.; Bergey, C.

    1997-01-01

    The French Atomic Energy Commission (C.E.A.) has developed an aerial gamma mapping system called HELINUC. The acquisition of a gamma spectrum and at the same time the corresponding coordinates of the aircraft is performed by the equipment aboard a light helicopter or an airplane. The data acquired in flight are processed on the ground by a specialized computer data processing system. Within a few minutes the system can produce a map with artificial colours showing the levels of natural or man-made activity and then superimpose it on a topographic map. HELINUC can, within a few hours, elaborate a map of radioactivity of areas spread over several square kilometres up to several tens of square kilometers and identify the radioelements in the range from natural radioactivity to a serious accidental situation. HELINUC has been operational for about 12 years and is part of the French nuclear emergency preparedness in the event of a civil or military nuclear accident. In August 1995, the exercise RESUME 95 was arranged in Vesivehmaa, 150 kilometres north of Helsinki by the Nordic Nuclear Safety Project, EKO-3. The main objective of the exercise was to compare results from survey measurements from airborne, car-borne and in situ measurements on the ground. Different areas and routes had been defined for survey purposes, and artificial point sources had been hidden. The main results of this exercise, particularly those concerning the gamma mapping of the area called II, contaminated by the Chernobyl's fallouts and the hidden sources are presented here. The cartography of area II shows that the levels of 137 Cs reaches 100 kBq/m 2 in small spots and the average value more than 60 kBq/m 2 . In the research of hidden sources, we discovered a point-source of cobalt 60 the activity of which was only 25 MBq (0.7 mCi). The results obtained with the HELINUC system during this exercise prove that the methods using uranium exploration data and techniques are rapid, powerful and

  15. A rapid method to map the crustal and lithospheric thickness using elevation, geoid anomaly and thermal analysis. Application to the Gibraltar Arc System, Atlas Mountains and adjacent zones

    Science.gov (United States)

    Fullea, J.; Fernàndez, M.; Zeyen, H.; Vergés, J.

    2007-02-01

    We present a method based on the combination of elevation and geoid anomaly data together with thermal field to map crustal and lithospheric thickness. The main assumptions are local isostasy and a four-layered model composed of crust, lithospheric mantle, sea water and the asthenosphere. We consider a linear density gradient for the crust and a temperature dependent density for the lithospheric mantle. We perform sensitivity tests to evaluate the effect of the variation of the model parameters and the influence of RMS error of elevation and geoid anomaly databases. The application of this method to the Gibraltar Arc System, Atlas Mountains and adjacent zones reveals the presence of a lithospheric thinning zone, SW-NE oriented. This zone affects the High and Middle Atlas and extends from the Canary Islands to the eastern Alboran Basin and is probably linked with a similarly trending zone of thick lithosphere constituting the western Betics, eastern Rif, Rharb Basin, and Gulf of Cadiz. A number of different, even mutually opposite, geodynamic models have been proposed to explain the origin and evolution of the study area. Our results suggest that a plausible slab-retreating model should incorporate tear and asymmetric roll-back of the subducting slab to fit the present-day observed lithosphere geometry. In this context, the lithospheric thinning would be caused by lateral asthenospheric flow. An alternative mechanism responsible for lithospheric thinning is the presence of a hot magmatic reservoir derived from a deep ancient plume centred in the Canary Island, and extending as far as Central Europe.

  16. Mapping out Map Libraries

    Directory of Open Access Journals (Sweden)

    Ferjan Ormeling

    2008-09-01

    Full Text Available Discussing the requirements for map data quality, map users and their library/archives environment, the paper focuses on the metadata the user would need for a correct and efficient interpretation of the map data. For such a correct interpretation, knowledge of the rules and guidelines according to which the topographers/cartographers work (such as the kind of data categories to be collected, and the degree to which these rules and guidelines were indeed followed are essential. This is not only valid for the old maps stored in our libraries and archives, but perhaps even more so for the new digital files as the format in which we now have to access our geospatial data. As this would be too much to ask from map librarians/curators, some sort of web 2.0 environment is sought where comments about data quality, completeness and up-to-dateness from knowledgeable map users regarding the specific maps or map series studied can be collected and tagged to scanned versions of these maps on the web. In order not to be subject to the same disadvantages as Wikipedia, where the ‘communis opinio’ rather than scholarship, seems to be decisive, some checking by map curators of this tagged map use information would still be needed. Cooperation between map curators and the International Cartographic Association ( ICA map and spatial data use commission to this end is suggested.

  17. DNA preservation in silk.

    Science.gov (United States)

    Liu, Yawen; Zheng, Zhaozhu; Gong, He; Liu, Meng; Guo, Shaozhe; Li, Gang; Wang, Xiaoqin; Kaplan, David L

    2017-06-27

    The structure of DNA is susceptible to alterations at high temperature and on changing pH, irradiation and exposure to DNase. Options to protect and preserve DNA during storage are important for applications in genetic diagnosis, identity authentication, drug development and bioresearch. In the present study, the stability of total DNA purified from human dermal fibroblast cells, as well as that of plasmid DNA, was studied in silk protein materials. The DNA/silk mixtures were stabilized on filter paper (silk/DNA + filter) or filter paper pre-coated with silk and treated with methanol (silk/DNA + PT-filter) as a route to practical utility. After air-drying and water extraction, 50-70% of the DNA and silk could be retrieved and showed a single band on electrophoretic gels. 6% silk/DNA + PT-filter samples provided improved stability in comparison with 3% silk/DNA + filter samples and DNA + filter samples for DNA preservation, with ∼40% of the band intensity remaining at 37 °C after 40 days and ∼10% after exposure to UV light for 10 hours. Quantitative analysis using the PicoGreen assay confirmed the results. The use of Tris/borate/EDTA (TBE) buffer enhanced the preservation and/or extraction of the DNA. The DNA extracted after storage maintained integrity and function based on serving as a functional template for PCR amplification of the gene for zinc finger protein 750 (ZNF750) and for transgene expression of red fluorescence protein (dsRed) in HEK293 cells. The high molecular weight and high content of a crystalline beta-sheet structure formed on the coated surfaces likely accounted for the preservation effects observed for the silk/DNA + PT-filter samples. Although similar preservation effects were also obtained for lyophilized silk/DNA samples, the rapid and simple processing available with the silk-DNA-filter membrane system makes it appealing for future applications.

  18. Use of reiterative primer extension methodology to map UV-induced photoproducts at the nucleotide level in the laci gene from genomic DNA

    International Nuclear Information System (INIS)

    Chandrasekhar, D.; Houten, B. Van

    1994-01-01

    A newly developed reiterative primer extension assay has been employed to examine photoproduct formation and repair at the nucleotide level. Analysis of UV-induced DNA photoproduct hotspots in the first 184 base pairs of the laci genes of genomic E. coli DNA has revealed that photoproducts are formed linearly with dose and display a sequence-dependent increase. Generally, pyrimdine dimers were twice as frequent as all other UV-induced photoproducts. However, specific sites showed differing distributions. A post-irradiation recovery period revealed differences in the repair efficiency at individual nucleotides. Repair of photoproducts on the transcribed strand was generally twice as efficient as repair of photoproducts on the nontranscribed strand, indicating that strand-specific DNA repair occurs in the constitutively transcribed laci gene of E. coli. The UV-induced DNA photoproduct distribution following repair was well correlated with an established UV-induced mutation spectrum for wild-type E. coli cells. This analysis revealed that photoproduct hotspots on the efficiently repaired transcribed strand did not correlate with mutagenic hotspots. These data strongly support the hypothesis that mutations arise at inefficiently repaired sites on the nontranscribed strand

  19. Gene mapping of 28S and 5S rDNA sites in chromosomes of two Barbus species and their F1 hybrids (Teleostei, Cyprinidae

    Directory of Open Access Journals (Sweden)

    Aneta Spoz

    2015-11-01

    Chromosomal location of ribosomal DNA sequences is useful for comparative cytogenetic fish studies due to their relatively fast rate of evolution. The results of species from the family Barbinae comparatively presented here for the first time, and they may support further taxonomical studies of the Barbus species.

  20. In silico analysis, mapping of regulatory elements and corresponding dna-protein interaction in polyphenol oxidase gene promoter from different rice varieties

    International Nuclear Information System (INIS)

    Mahmood, T.; Rehman, M.; Aziz, E.

    2015-01-01

    Polyphenol oxidase (PPO) is an important enzyme that has positive impact regarding plant resistance against different biotic and abiotic stresses. In the present study PPO promoter from six different rice varieties was amplified and then analyzed for cis- and trans-acting elements. The study revealed a total of 79 different cis-acting regulatory elements including 11 elements restricted to only one or other variety. Among six varieties Pakhal-Basmati had highest number (5) of these elements, whereas C-622 and Rachna-Basmati have no such sequences. Rachna-Basmati, IR-36-Basmati and Kashmir- Basmati had 1, 2 and 3 unique elements, respectively. Different elementsrelated to pathogen, salt and water stresses were found, which may be helpful in controlling PPO activity according to changing environment. Moreover, HADDOCK was used to understand molecular mechanism of PPO regulation and it was found that DNA-protein interactions are stabilized by many potential hydrogen bonds. Adenine and arginine were the most reactive residues in DNA and proteins respectively.Structural comparison of different protein-DNA complexes show that even a highly conserved transcriptional factor can adopt different conformations when they contact a different DNA binding sequence, however their stable interactions depend on the number of hydrogen bonds formed and distance. (author)

  1. Integrating laser-range finding, electronic compass measurements and GPS to rapidly map vertical changes in volcanic stratigraphy and constrain unit thicknesses and volumes: two examples from the northern Cordilleran volcanic province

    Science.gov (United States)

    Nogier, M.; Edwards, B. R.; Wetherell, K.

    2005-12-01

    We present preliminary results of laser-range finding-GPS surveys from two separate locations in northern British Columbia, in the south-central northern Cordilleran volcanic province: Hoodoo Mountain volcano and Craven Lake cone. This technique, described in detail below, is appropriate for rapidly measuring changes in vertical thicknesses of units that either would be difficult or impossible to measure by most other techniques. The ability to accurately measure thicknesses of geologic units in otherwise difficult-to-access locations will aide in generating better quantitative estimates of deposit geometries and eruption volumes. Such data is particularly important for constraining quantitative models of magma production and eruption dynamics. The deposits of interest in this study comprised at least partly inaccessible, largely pyroclastic units, although the technique could be used to map any vertical surfaces. The first field location was the northern side of Hoodoo Mountain volcano (56deg47'23.72'N/131deg17'36.97'W/1208m-asl), where a sequence of welded to unwelded, trachytic-phonolitic tephra was deposited in a paleovalley. This deposit is informally referred to as the Pointer Ridge deposit, and it comprises at least 7 distinct subunits. The horizontal limit of the exposures is approximately 1.5km, and the vertical limit is approximately 250m. Three different GPS base stations were used to map the lateral and vertical variations in the deposit. The second field location is north of Craven Lake (56deg54'44.55'N/129deg21'42.17'W/1453m-asl), along Craven Creek, where a sequence of basaltic tephra is overlain by pillow lava and glacial diamicton. This exposure is 200m long and approximately 30m high, much smaller than the area mapped at Hoodoo Mountain. The basaltic tephra appears to comprise 4 distinct sequences (measured thicknesses vary from 3-4m) not including the overlying pillow lava (measured thickness varies from 2 to 10m), and measurements of the

  2. A Real-Time PCR Assay Based on 5.8S rRNA Gene (5.8S rDNA) for Rapid Detection of Candida from Whole Blood Samples.

    Science.gov (United States)

    Guo, Yi; Yang, Jing-Xian; Liang, Guo-Wei

    2016-06-01

    The prevalence of Candida in bloodstream infections (BSIs) has increased. To date, the identification of Candida in BSIs still mainly relies on blood culture and serological tests, but they have various limitations. Therefore, a real-time PCR assay for the detection of Candida from whole blood is presented. The unique primers/probe system was designed on 5.8S rRNA gene (5.8S rDNA) of Candida genus. The analytical sensitivity was determined by numbers of positive PCRs in 12 repetitions. At the concentration of 10(1) CFU/ml blood, positive PCR rates of 100 % were obtained for C. albicans, C. parapsilosis, C. tropicalis, and C. krusei. The detection rate for C. glabrata was 75 % at 10(1) CFU/ml blood. The reaction specificity was 100 % when evaluating the assay using DNA samples from clinical isolates and human blood. The maximum CVs of intra-assay and inter-assay for the detection limit were 1.22 and 2.22 %, respectively. To assess the clinical applicability, 328 blood samples from 82 patients were prospectively tested and real-time PCR results were compared with results from blood culture. Diagnostic sensitivity of the PCR was 100 % using as gold standard blood culture, and specificity was 98.4 %. Our data suggest that the developed assay can be used in clinical laboratories as an accurate and rapid screening test for the Candida from whole blood. Although further evaluation is warranted, our assay holds promise for earlier diagnosis of candidemia.

  3. ReMap 2018: an updated atlas of regulatory regions from an integrative analysis of DNA-binding ChIP-seq experiments.

    Science.gov (United States)

    Chèneby, Jeanne; Gheorghe, Marius; Artufel, Marie; Mathelier, Anthony; Ballester, Benoit

    2018-01-04

    With this latest release of ReMap (http://remap.cisreg.eu), we present a unique collection of regulatory regions in human, as a result of a large-scale integrative analysis of ChIP-seq experiments for hundreds of transcriptional regulators (TRs) such as transcription factors, transcriptional co-activators and chromatin regulators. In 2015, we introduced the ReMap database to capture the genome regulatory space by integrating public ChIP-seq datasets, covering 237 TRs across 13 million (M) peaks. In this release, we have extended this catalog to constitute a unique collection of regulatory regions. Specifically, we have collected, analyzed and retained after quality control a total of 2829 ChIP-seq datasets available from public sources, covering a total of 485 TRs with a catalog of 80M peaks. Additionally, the updated database includes new search features for TR names as well as aliases, including cell line names and the ability to navigate the data directly within genome browsers via public track hubs. Finally, full access to this catalog is available online together with a TR binding enrichment analysis tool. ReMap 2018 provides a significant update of the ReMap database, providing an in depth view of the complexity of the regulatory landscape in human. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Karyotypes, male meiosis and comparative FISH mapping of 18S ribosomal DNA and telomeric (TTAGGn repeat in eight species of true bugs (Hemiptera, Heteroptera

    Directory of Open Access Journals (Sweden)

    Snejana Grozeva

    2011-11-01

    Full Text Available Eight species belonging to five true bug families were analyzed using DAPI/CMA3-staining and fluorescence in situ hybridization (FISH with telomeric (TTAGGn and 18S rDNA probes. Standard chromosomal complements are reported for the first time for Deraeocoris rutilus (Herrich-Schäffer, 1838 (2n=30+2m+XY and D. ruber (Linnaeus, 1758 (2n=30+2m+XY from the family Miridae. Using FISH, the location of a 18S rDNA cluster was detected in these species and in five more species: Megaloceroea recticornis (Geoffroy, 1785 (2n=30+XY from the Miridae; Oxycarenus lavaterae (Fabricius, 1787 (2n=14+2m+XY from the Lygaeidae s.l.; Pyrrhocoris apterus (Linnaeus, 1758 (2n=22+X from the Pyrrhocoridae; Eurydema oleracea (Linnaeus, 1758 (2n=12+XY and Graphosoma lineatum (Linnaeus, 1758 (2n=12+XY from the Pentatomidae. The species were found to differ with respect to location of a 18S rRNA gene cluster which resides on autosomes in O. lavaterae and P. apterus, whereas it locates on sex chromosomes in other five species. The 18S rDNA location provides the first physical landmark of the genomes of the species studied. The insect consensus telomeric pentanucleotide (TTAGGn was demonstrated to be absent in all the species studied in this respect, D. rutilus, M. recticornis, Cimex lectularius Linnaeus, 1758 (Cimicidae, E. oleracea, and G. lineatum, supporting the hypothesis that this motif was lost in early evolution of the Heteroptera and secondarily replaced with another motif (yet unknown or the alternative telomerase-independent mechanisms of telomere maintenance. Dot-blot hybridization analysis of the genomic DNA from C. lectularius, Nabis sp. and O. lavaterae with (TTAGGn and six other telomeric probes likewise provided a negative result.

  5. Spatially Resolved Hα Maps and Sizes of 57 Strongly Star-forming Galaxies at z ~ 1 from 3D-HST: Evidence for Rapid Inside-out Assembly of Disk Galaxies

    Science.gov (United States)

    Nelson, Erica June; van Dokkum, Pieter G.; Brammer, Gabriel; Förster Schreiber, Natascha; Franx, Marijn; Fumagalli, Mattia; Patel, Shannon; Rix, Hans-Walter; Skelton, Rosalind E.; Bezanson, Rachel; Da Cunha, Elisabete; Kriek, Mariska; Labbe, Ivo; Lundgren, Britt; Quadri, Ryan; Schmidt, Kasper B.

    2012-03-01

    We investigate the buildup of galaxies at z ~ 1 using maps of Hα and stellar continuum emission for a sample of 57 galaxies with rest-frame Hα equivalent widths >100 Å in the 3D-HST grism survey. We find that the Hα emission broadly follows the rest-frame R-band light but that it is typically somewhat more extended and clumpy. We quantify the spatial distribution with the half-light radius. The median Hα effective radius re (Hα) is 4.2 ± 0.1 kpc but the sizes span a large range, from compact objects with re (Hα) ~ 1.0 kpc to extended disks with re (Hα) ~ 15 kpc. Comparing Hα sizes to continuum sizes, we find =1.3 ± 0.1 for the full sample. That is, star formation, as traced by Hα, typically occurs out to larger radii than the rest-frame R-band stellar continuum; galaxies are growing their radii and building up from the inside out. This effect appears to be somewhat more pronounced for the largest galaxies. Using the measured Hα sizes, we derive star formation rate surface densities, ΣSFR. We find that ΣSFR ranges from ~0.05 M ⊙ yr-1 kpc-2 for the largest galaxies to ~5 M ⊙ yr-1 kpc-2 for the smallest galaxies, implying a large range in physical conditions in rapidly star-forming z ~ 1 galaxies. Finally, we infer that all galaxies in the sample have very high gas mass fractions and stellar mass doubling times <500 Myr. Although other explanations are also possible, a straightforward interpretation is that we are simultaneously witnessing the rapid formation of compact bulges and large disks at z ~ 1.

  6. SPATIALLY RESOLVED Hα MAPS AND SIZES OF 57 STRONGLY STAR-FORMING GALAXIES AT z ∼ 1 FROM 3D-HST: EVIDENCE FOR RAPID INSIDE-OUT ASSEMBLY OF DISK GALAXIES

    International Nuclear Information System (INIS)

    Nelson, Erica June; Van Dokkum, Pieter G.; Skelton, Rosalind E.; Bezanson, Rachel; Lundgren, Britt; Brammer, Gabriel; Förster Schreiber, Natascha; Franx, Marijn; Fumagalli, Mattia; Patel, Shannon; Labbe, Ivo; Rix, Hans-Walter; Da Cunha, Elisabete; Schmidt, Kasper B.; Kriek, Mariska; Quadri, Ryan

    2012-01-01

    We investigate the buildup of galaxies at z ∼ 1 using maps of Hα and stellar continuum emission for a sample of 57 galaxies with rest-frame Hα equivalent widths >100 Å in the 3D-HST grism survey. We find that the Hα emission broadly follows the rest-frame R-band light but that it is typically somewhat more extended and clumpy. We quantify the spatial distribution with the half-light radius. The median Hα effective radius r e (Hα) is 4.2 ± 0.1 kpc but the sizes span a large range, from compact objects with r e (Hα) ∼ 1.0 kpc to extended disks with r e (Hα) ∼ 15 kpc. Comparing Hα sizes to continuum sizes, we find e (Hα)/r e (R) > =1.3 ± 0.1 for the full sample. That is, star formation, as traced by Hα, typically occurs out to larger radii than the rest-frame R-band stellar continuum; galaxies are growing their radii and building up from the inside out. This effect appears to be somewhat more pronounced for the largest galaxies. Using the measured Hα sizes, we derive star formation rate surface densities, Σ SFR . We find that Σ SFR ranges from ∼0.05 M ☉ yr –1 kpc –2 for the largest galaxies to ∼5 M ☉ yr –1 kpc –2 for the smallest galaxies, implying a large range in physical conditions in rapidly star-forming z ∼ 1 galaxies. Finally, we infer that all galaxies in the sample have very high gas mass fractions and stellar mass doubling times <500 Myr. Although other explanations are also possible, a straightforward interpretation is that we are simultaneously witnessing the rapid formation of compact bulges and large disks at z ∼ 1.

  7. BioBarcode: a general DNA barcoding database and server platform for Asian biodiversity resources

    Science.gov (United States)

    2009-01-01

    Background DNA barcoding provides a rapid, accurate, and standardized method for species-level identification using short DNA sequences. Such a standardized identification method is useful for mapping all the species on Earth, particularly when DNA sequencing technology is cheaply available. There are many nations in Asia with many biodiversity resources that need to be mapped and registered in databases. Results We have built a general DNA barcode data processing system, BioBarcode, with open source software - which is a general purpose database and server. It uses mySQL RDBMS 5.0, BLAST2, and Apache httpd server. An exemplary database of BioBarcode has around 11,300 specimen entries (including GenBank data) and registers the biological species to map their genetic relationships. The BioBarcode database contains a chromatogram viewer which improves the performance in DNA sequence analyses. Conclusion Asia has a very high degree of biodiversity and the BioBarcode database server system aims to provide an efficient bioinformatics protocol that can be freely used by Asian researchers and research organizations interested in DNA barcoding. The BioBarcode promotes the rapid acquisition of biological species DNA sequence data that meet global standards by providing specialized services, and provides useful tools that will make barcoding cheaper and faster in the biodiversity community such as standardization, depository, management, and analysis of DNA barcode data. The system can be downloaded upon request, and an exemplary server has been constructed with which to build an Asian biodiversity system http://www.asianbarcode.org. PMID:19958506

  8. 5′ Rapid Amplification of cDNA Ends and Illumina MiSeq Reveals B Cell Receptor Features in Healthy Adults, Adults With Chronic HIV-1 Infection, Cord Blood, and Humanized Mice

    Directory of Open Access Journals (Sweden)

    Eric Waltari

    2018-03-01

    Full Text Available Using 5′ rapid amplification of cDNA ends, Illumina MiSeq, and basic flow cytometry, we systematically analyzed the expressed B cell receptor (BCR repertoire in 14 healthy adult PBMCs, 5 HIV-1+ adult PBMCs, 5 cord blood samples, and 3 HIS-CD4/B mice, examining the full-length variable region of μ, γ, α, κ, and λ chains for V-gene usage, somatic hypermutation (SHM, and CDR3 length. Adding to the known repertoire of healthy adults, Illumina MiSeq consistently detected small fractions of reads with high mutation frequencies including hypermutated μ reads, and reads with long CDR3s. Additionally, the less studied IgA repertoire displayed similar characteristics to that of IgG. Compared to healthy adults, the five HIV-1 chronically infected adults displayed elevated mutation frequencies for all μ, γ, α, κ, and λ chains examined and slightly longer CDR3 lengths for γ, α, and λ. To evaluate the reconstituted human BCR sequences in a humanized mouse model, we analyzed cord blood and HIS-CD4/B mice, which all lacked the typical SHM seen in the adult reference. Furthermore, MiSeq revealed identical unmutated IgM sequences derived from separate cell aliquots, thus for the first time demonstrating rare clonal members of unmutated IgM B cells by sequencing.

  9. 5' Rapid Amplification of cDNA Ends and Illumina MiSeq Reveals B Cell Receptor Features in Healthy Adults, Adults With Chronic HIV-1 Infection, Cord Blood, and Humanized Mice.

    Science.gov (United States)

    Waltari, Eric; Jia, Manxue; Jiang, Caroline S; Lu, Hong; Huang, Jing; Fernandez, Cristina; Finzi, Andrés; Kaufmann, Daniel E; Markowitz, Martin; Tsuji, Moriya; Wu, Xueling

    2018-01-01

    Using 5' rapid amplification of cDNA ends, Illumina MiSeq, and basic flow cytometry, we systematically analyzed the expressed B cell receptor (BCR) repertoire in 14 healthy adult PBMCs, 5 HIV-1+ adult PBMCs, 5 cord blood samples, and 3 HIS-CD4/B mice, examining the full-length variable region of μ, γ, α, κ, and λ chains for V-gene usage, somatic hypermutation (SHM), and CDR3 length. Adding to the known repertoire of healthy adults, Illumina MiSeq consistently detected small fractions of reads with high mutation frequencies including hypermutated μ reads, and reads with long CDR3s. Additionally, the less studied IgA repertoire displayed similar characteristics to that of IgG. Compared to healthy adults, the five HIV-1 chronically infected adults displayed elevated mutation frequencies for all μ, γ, α, κ, and λ chains examined and slightly longer CDR3 lengths for γ, α, and λ. To evaluate the reconstituted human BCR sequences in a humanized mouse model, we analyzed cord blood and HIS-CD4/B mice, which all lacked the typical SHM seen in the adult reference. Furthermore, MiSeq revealed identical unmutated IgM sequences derived from separate cell aliquots, thus for the first time demonstrating rare clonal members of unmutated IgM B cells by sequencing.

  10. Rapid resistome mapping using nanopore sequencing

    DEFF Research Database (Denmark)

    van der Helm, Eric; Imamovic, Lejla; Ellabaan, Mostafa M Hashim

    2017-01-01

    The emergence of antibiotic resistance in human pathogens has become a major threat to modern medicine. The outcome of antibiotic tre