WorldWideScience

Sample records for rapid allele-specific pcr

  1. Rapid ABO genotyping by high-speed droplet allele-specific PCR using crude samples.

    Science.gov (United States)

    Taira, Chiaki; Matsuda, Kazuyuki; Takeichi, Naoya; Furukawa, Satomi; Sugano, Mitsutoshi; Uehara, Takeshi; Okumura, Nobuo; Honda, Takayuki

    2018-01-01

    ABO genotyping has common tools for personal identification of forensic and transplantation field. We developed a new method based on a droplet allele-specific PCR (droplet-AS-PCR) that enabled rapid PCR amplification. We attempted rapid ABO genotyping using crude DNA isolated from dried blood and buccal cells. We designed allele-specific primers for three SNPs (at nucleotides 261, 526, and 803) in exons 6 and 7 of the ABO gene. We pretreated dried blood and buccal cells with proteinase K, and obtained crude DNAs without DNA purification. Droplet-AS-PCR allowed specific amplification of the SNPs at the three loci using crude DNA, with results similar to those for DNA extracted from fresh peripheral blood. The sensitivity of the methods was 5%-10%. The genotyping of extracted DNA and crude DNA were completed within 8 and 9 minutes, respectively. The genotypes determined by the droplet-AS-PCR method were always consistent with those obtained by direct sequencing. The droplet-AS-PCR method enabled rapid and specific amplification of three SNPs of the ABO gene from crude DNA treated with proteinase K. ABO genotyping by the droplet-AS-PCR has the potential to be applied to various fields including a forensic medicine and transplantation medical care. © 2017 Wiley Periodicals, Inc.

  2. Kinetic characterisation of primer mismatches in allele-specific PCR: a quantitative assessment.

    Science.gov (United States)

    Waterfall, Christy M; Eisenthal, Robert; Cobb, Benjamin D

    2002-12-20

    A novel method of estimating the kinetic parameters of Taq DNA polymerase during rapid cycle PCR is presented. A model was constructed using a simplified sigmoid function to represent substrate accumulation during PCR in combination with the general equation describing high substrate inhibition for Michaelis-Menten enzymes. The PCR progress curve was viewed as a series of independent reactions where initial rates were accurately measured for each cycle. Kinetic parameters were obtained for allele-specific PCR (AS-PCR) amplification to examine the effect of mismatches on amplification. A high degree of correlation was obtained providing evidence of substrate inhibition as a major cause of the plateau phase that occurs in the later cycles of PCR.

  3. [Molecular authentication of Jinyinhua formula granule by using allele-specific PCR].

    Science.gov (United States)

    Jiang, Chao; Tu, Li-Chan; Yuan, Yuan; Huang, Lu-Qi; Gao, Wei; Jin, Yan

    2017-07-01

    Traditional authentication method is hard to identify herb's authenticity of traditional Chinese medicine(TCM) formula granules because they have lost all their morphological characteristics. In this study, a new allele-specific PCR method was established for identifying the authentication of Jinyinhua formula granule (made from Lonicerae Japonicae Flos) based on an SNP site in trnL-trnF fragment. Genomic DNA was successfully extracted from Lonicerae Japonicae Flos and its formula granules by using an improved spin column method and then PCR was performed with the designed primer. Approximately 110 bp specific bands was obtained only in the authentic Lonicerae Japonicae Flos and its formula granules, while no bands were found in fake mixed products. In addition, the PCR product sequence was proved from Lonicerae Japonicae Flos trnL-trnF sequence by using BLAST method. Therefore, DNA molecular authentication method could make up the limitations of character identification method and microscopic identification, and quickly identify herb's authenticity of TCM formula granules, with enormous potential for market supervision and quality control. Copyright© by the Chinese Pharmaceutical Association.

  4. Detection of MPL mutations by a novel allele-specific PCR-based strategy.

    Science.gov (United States)

    Furtado, Larissa V; Weigelin, Helmut C; Elenitoba-Johnson, Kojo S J; Betz, Bryan L

    2013-11-01

    MPL mutation testing is recommended in patients with suspected primary myelofibrosis or essential thrombocythemia who lack the JAK2 V617F mutation. MPL mutations can occur at allelic levels below 15%, which may escape detection by commonly used mutation screening methods such as Sanger sequencing. We developed a novel multiplexed allele-specific PCR assay capable of detecting most recurrent MPL exon 10 mutations associated with primary myelofibrosis and essential thrombocythemia (W515L, W515K, W515A, and S505N) down to a sensitivity of 2.5% mutant allele. Test results were reviewed from 15 reference cases and 1380 consecutive specimens referred to our laboratory for testing. Assay performance was compared to Sanger sequencing across a series of 58 specimens with MPL mutations. Positive cases consisted of 45 with W515L, 6 with S505N, 5 with W515K, 1 with W515A, and 1 with both W515L and S505N. Seven cases had mutations below 5% that were undetected by Sanger sequencing. Ten additional cases had mutation levels between 5% and 15% that were not consistently detected by sequencing. All results were easily interpreted in the allele-specific test. This assay offers a sensitive and reliable solution for MPL mutation testing. Sanger sequencing appears insufficiently sensitive for robust MPL mutation detection. Our data also suggest the relative frequency of S505N mutations may be underestimated, highlighting the necessity for inclusion of this mutation in MPL test platforms. Copyright © 2013 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  5. Identification and Genetic Diversity of Etambutol Resistant Strains of Mycobacterium Tuberculosis by Allelic-Specific PCR and Spologiotyping

    Directory of Open Access Journals (Sweden)

    Zahra Derakhshani Nezhad

    2012-09-01

    Full Text Available Background & Objectives: Ethambutol is one of the four main drugs in treatment of tuberculosis. The most common mutation associated with this drug resistance usually occurs in codon 306 of embB. The aim of this study was to detect ethambutol resistance using Allele-Specific PCR and Spoligotyping in various subtypes of Mycobacterium tuberculosis.   Methods : 140 sputum specimens were collected from suspected TB patients. They were digested and decontaminated using Pettrof method before culturing them on LJ medium. Drug susceptibility testing was performed on 106 culture positive specimens using proportional method. DNA was extracted from the isolated organisms and subsequently subjected to Allele-Specific PCR to detect any mutationin embB306. Spoligotyping was then used to determine the subtypes.   Results: Out of 106 cultures positive samples, 36 samples (33.9% showed resistance to ethambutol using proportional method. Allele-Specific PCR assay identified 93 as sensitive and 13 (27.6% as resistant strains. The results of PCR were in agreement with result of proportional method. The PCR method revealed that 61.5% of mutation occurred in the first and 38.5% in third nucleotides. Spoligotyping differentiated Mycobacterium tuberculosis strains into Beijing (10 9.4%, Bovis (2 1.8%, CAS (24 22.6%, EAI (1 0.9%, Haarlem (27 25.4%, LAM (5 4.7%, Manu (5 4.7%, T (27 25.4% and U( 2 1,8% families. The high frequency of mutation in embB gene was belonged to Haarlem, CAS and T subfamilies.   Conclusion: Based on results current study, mutations in the genes other than embB might have occurred in the resistant strains that gave negative result in Allele-Specific PCR assay. Therefore other mechanisms of resistance to this antibiotic should be investigated.

  6. Evaluation of efficiency of nested multiplex allele-specific PCR assay for detection of multidrug resistant tuberculosis directly from sputum samples.

    Science.gov (United States)

    Mistri, S K; Sultana, M; Kamal, S M M; Alam, M M; Irin, F; Nessa, J; Ahsan, C R; Yasmin, M

    2016-05-01

    For an effective control of tuberculosis, rapid detection of multidrug resistant tuberculosis (MDR-TB) is necessary. Therefore, we developed a modified nested multiplex allele-specific polymerase chain reaction (MAS-PCR) method that enables rapid MDR-TB detection directly from sputum samples. The efficacy of this method was evaluated using 79 sputum samples collected from suspected tuberculosis patients. The performance of nested MAS-PCR method was compared with other MDR-TB detection methods like drug susceptibility testing (DST) and DNA sequencing. As rifampicin (RIF) resistance conforms to MDR-TB in greater than 90% cases, only the presence of RIF-associated mutations in rpoB gene was determined by DNA sequencing and nested MAS-PCR to detect MDR-TB. The concordance between nested MAS-PCR and DNA sequencing results was found to be 96·3%. When compared with DST, the sensitivity and specificity of nested MAS-PCR for RIF-resistance detection were determined to be 92·9 and 100% respectively. For developing- and high-TB burden countries, molecular-based tests have been recommended by the World Health Organization for rapid detection of MDR-TB. The results of this study indicate that, nested MAS-PCR assay might be a practical and relatively cost effective molecular method for rapid detection of MDR-TB from suspected sputum samples in developing countries with resource poor settings. © 2016 The Society for Applied Microbiology.

  7. Comparison of allele-specific PCR, created restriction-site PCR, and PCR with primer-introduced restriction analysis methods used for screening complex vertebral malformation carriers in Holstein cattle

    Science.gov (United States)

    Altınel, Ahmet

    2017-01-01

    Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256

  8. Development of allele-specific multiplex PCR to determine the length of poly-T in intron 8 of CFTR

    Directory of Open Access Journals (Sweden)

    Neng Chen

    2014-07-01

    Full Text Available Cystic fibrosis transmembrane conductance regulator (CFTR gene mutation analysis has been implemented for Cystic Fibrosis (CF carrier screening, and molecular diagnosis of CF and congenital bilateral absence of the vas deferens (CBAVD. Although poly-T allele analysis in intron 8 of CFTR is required when a patient is positive for R117H, it is not recommended for routine carrier screening. Therefore, commercial kits for CFTR mutation analysis were designed either to mask the poly-T allele results, unless a patient is R117H positive, or to have the poly-T analysis as a standalone reflex test using the same commercial platform. There are other standalone assays developed to detect poly-T alleles, such as heteroduplex analysis, High Resolution Melting (HRM curve analysis, allele-specific PCR (AS-PCR and Sanger sequencing. In this report, we developed a simple and easy-to-implement multiplex AS-PCR assay using unlabeled standard length primers, which can be used as a reflex or standalone test for CFTR poly-T track analysis. Out of 115 human gDNA samples tested, results from our new AS-PCR matched to the previous known poly-T results or results from Sanger sequencing.

  9. Allelic inhibition of displacement activity: a simplified one tube allele-specific PCR for evaluation of ITPA polymorphisms.

    Science.gov (United States)

    Galmozzi, E; Facchetti, F; Degasperi, E; Aghemo, A; Lampertico, P

    2013-02-01

    Recently, genome-wide association studies (GWAS) in patients with chronic hepatitis C virus (HCV) infection have identified two functional single nucleotide polymorphisms (SNPs) in the inosine triphosphatase (ITPA) gene, that are associated strongly and independently with hemolytic anemia in patients exposed to pegylated-interferon (Peg-IFN) plus ribavirin (RBV) combined therapy. Here has been developed a simplified allele discrimination polymerase chain reaction (PCR) assay named allelic inhibition of displacement activity (AIDA) for evaluation of ITPA polymorphisms. AIDA system relies on three unlabeled primers only, two outer common primers and one inner primer with allele-specific 3' terminus mismatch. DNA samples from 192 patients with chronic HCV infection were used to validate the AIDA system and results were compared with the gold standard TaqMan(®) SNP genotyping assay. Concordant data were obtained for all samples, granting for high specificity of the method. In conclusion, AIDA is a practical one-tube method to reproducibly and to assess accurately rs7270101 and rs1127354 ITPA SNPs. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Quantitative threefold allele-specific PCR (QuanTAS-PCR) for highly sensitive JAK2 V617F mutant allele detection

    International Nuclear Information System (INIS)

    Zapparoli, Giada V; Jorissen, Robert N; Hewitt, Chelsee A; McBean, Michelle; Westerman, David A; Dobrovic, Alexander

    2013-01-01

    The JAK2 V617F mutation is the most frequent somatic change in myeloproliferative neoplasms, making it an important tumour-specific marker for diagnostic purposes and for the detection of minimal residual disease. Sensitive quantitative assays are required for both applications, particularly for the monitoring of minimal residual disease, which requires not only high sensitivity but also very high specificity. We developed a highly sensitive probe-free quantitative mutant-allele detection method, Quantitative Threefold Allele-Specific PCR (QuanTAS-PCR), that is performed in a closed-tube system, thus eliminating the manipulation of PCR products. QuantTAS-PCR uses a threefold approach to ensure allele-specific amplification of the mutant sequence: (i) a mutant allele-specific primer, (ii) a 3′dideoxy blocker to suppress false-positive amplification from the wild-type template and (iii) a PCR specificity enhancer, also to suppress false-positive amplification from the wild-type template. Mutant alleles were quantified relative to exon 9 of JAK2. We showed that the addition of the 3′dideoxy blocker suppressed but did not eliminate false-positive amplification from the wild-type template. However, the addition of the PCR specificity enhancer near eliminated false-positive amplification from the wild-type allele. Further discrimination between true and false positives was enabled by using the quantification cycle (Cq) value of a single mutant template as a cut-off point, thus enabling robust distinction between true and false positives. As 10,000 JAK2 templates were used per replicate, the assay had a sensitivity of 1/10 -4 per replicate. Greater sensitivity could be reached by increasing the number of replicates analysed. Variation in replicates when low mutant-allele templates were present necessitated the use of a statistics-based approach to estimate the load of mutant JAK2 copies. QuanTAS-PCR showed comparable quantitative results when validated against a

  11. Development of Allele-Specific Primer PCR for a Swine TLR2 SNP and Comparison of the Frequency among Several Pig Breeds of Japan and the Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Muneta, Y.; Minagawa, Y.; Kusumoto, M.; Shinkai, H.; Uenishi, H.; Šplíchal, Igor

    2012-01-01

    Roč. 74, č. 5 (2012), s. 553-559 ISSN 0916-7250 R&D Projects: GA ČR GA524/09/0365 Institutional support: RVO:61388971 Keywords : allele-specific PCR * Mycoplasma hyopneumoniae * single nucleotide polymorphism Subject RIV: EC - Immunology Impact factor: 0.876, year: 2012

  12. Establishment of real time allele specific locked nucleic acid quantitative PCR for detection of HBV YIDD (ATT mutation and evaluation of its application.

    Directory of Open Access Journals (Sweden)

    Yongbin Zeng

    Full Text Available BACKGROUND: Long-term use of nucleos(tide analogues can increase risk of HBV drug-resistance mutations. The rtM204I (ATT coding for isoleucine is one of the most important resistance mutation sites. Establishing a simple, rapid, reliable and highly sensitive assay to detect the resistant mutants as early as possible is of great clinical significance. METHODS: Recombinant plasmids for HBV YMDD (tyrosine-methionine-aspartate-aspartate and YIDD (tyrosine-isoleucine-aspartate-aspartate were constructed by TA cloning. Real time allele specific locked nucleic acid quantitative PCR (RT-AS-LNA-qPCR with SYBR Green I was established by LNA-modified primers and evaluated with standard recombinant plasmids, clinical templates (the clinical wild type and mutant HBV DNA mixture and 102 serum samples from nucleos(tide analogues-experienced patients. The serum samples from a chronic hepatitis B (CHB patient firstly received LMV mono therapy and then switched to LMV + ADV combined therapy were also dynamically analyzed for 10 times. RESULTS: The linear range of the assay was between 1×10(9 copies/μl and 1 × 10(2 copies/μl. The low detection limit was 1 × 10(1 copies/μl. Sensitivity of the assay were 10(-6, 10(-4 and 10(-2 in the wild-type background of 1 × 10(9 copies/μl, 1 × 10(7 copies/μl and 1 × 10(5 copies/μl, respectively. The sensitivity of the assay in detection of clinical samples was 0.03%. The complete coincidence rate between RT-AS-LNA-qPCR and direct sequencing was 91.2% (93/102, partial coincidence rate was 8.8% (9/102, and no complete discordance was observed. The two assays showed a high concordance (Kappa = 0.676, P = 0.000. Minor variants can be detected 18 weeks earlier than the rebound of HBV DNA load and alanine aminotransferase level. CONCLUSIONS: A rapid, cost-effective, high sensitive, specific and reliable method of RT-AS-LNA-qPCR with SYBR Green I for early and absolute quantification of HBV YIDD (ATT coding for isoleucine

  13. Development of an allele-specific PCR assay for simultaneous sero-typing of avian pathogenic Escherichia coli predominant O1, O2, O18 and O78 strains.

    Science.gov (United States)

    Wang, Shaohui; Meng, Qingmei; Dai, Jianjun; Han, Xiangan; Han, Yue; Ding, Chan; Liu, Haiwen; Yu, Shengqing

    2014-01-01

    Systemic infections by avian pathogenic Escherichia coli (APEC) are economically devastating to poultry industries worldwide. E. coli strains belonging to serotypes O1, O2, O18 and O78 are preferentially associated with avian colibacillosis. The rfb gene cluster controlling O antigen synthesis is usually various among different E. coli serotypes. In present study, the rfb gene clusters of E. coli serotypes O1, O2, O18 and O78 were characterized and compared. Based on the serotype-specific genes in rfb gene cluster, an allele-specific polymerase chain reaction (PCR) assay was developed. This PCR assay was highly specific and reliable for sero-typing of APEC O1, O2, O18 and O78 strains. The sensitivity of the assay was determined as 10 pg DNA or 10 colony forming units (CFUs) bacteria for serotypes O2 and O18 strains, and 500 pg DNA or 1,000 CFUs bacteria for serotypes O1 and O78 strains. Using this PCR system, APEC isolates and the infected tissue samples were categorized successfully. Furthermore, it was able to differentiate the serotypes for the samples with multi-agglutination in the traditional serum agglutination assay. Therefore, the allele-specific PCR is more simple, rapid and accurate assay for APEC diagnosis, epidemiologic study and vaccine development.

  14. Development of an allele-specific PCR assay for simultaneous sero-typing of avian pathogenic Escherichia coli predominant O1, O2, O18 and O78 strains.

    Directory of Open Access Journals (Sweden)

    Shaohui Wang

    Full Text Available Systemic infections by avian pathogenic Escherichia coli (APEC are economically devastating to poultry industries worldwide. E. coli strains belonging to serotypes O1, O2, O18 and O78 are preferentially associated with avian colibacillosis. The rfb gene cluster controlling O antigen synthesis is usually various among different E. coli serotypes. In present study, the rfb gene clusters of E. coli serotypes O1, O2, O18 and O78 were characterized and compared. Based on the serotype-specific genes in rfb gene cluster, an allele-specific polymerase chain reaction (PCR assay was developed. This PCR assay was highly specific and reliable for sero-typing of APEC O1, O2, O18 and O78 strains. The sensitivity of the assay was determined as 10 pg DNA or 10 colony forming units (CFUs bacteria for serotypes O2 and O18 strains, and 500 pg DNA or 1,000 CFUs bacteria for serotypes O1 and O78 strains. Using this PCR system, APEC isolates and the infected tissue samples were categorized successfully. Furthermore, it was able to differentiate the serotypes for the samples with multi-agglutination in the traditional serum agglutination assay. Therefore, the allele-specific PCR is more simple, rapid and accurate assay for APEC diagnosis, epidemiologic study and vaccine development.

  15. WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations

    Directory of Open Access Journals (Sweden)

    Assawamakin Anunchai

    2007-08-01

    Full Text Available Abstract Background Allele-specific (AS Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number

  16. Detection of EGFR mutations in plasma and biopsies from non-small cell lung cancer patients by allele-specific PCR assays

    DEFF Research Database (Denmark)

    Weber, Britta; Meldgaard, Peter; Hager, Henrik

    2014-01-01

    samples with allele-specific PCR assays. METHODS: Pairs of the diagnostic biopsy and plasma obtained just prior to start of erlotinib treatment were collected from 199 patients with adenocarcinoma of non-small-cell lung cancer. DNA from both sample types was isolated and examined for the presence...... of mutations in exons 18-21 of the EGFR gene, employing the cobas(®) EGFR Tissue Test and cobas(®) EGFR Blood Test (in development, Roche Molecular Systems, Inc., CA, USA). RESULTS: Test results were obtained in all 199 (100%) plasma samples and 196/199 (98%) of the biopsies. EGFR-activating mutations were...... identified in 24/199 (12%) plasma samples and 28/196 (14%) biopsy samples, and 17/196 (9%) matched pairs contained the same mutation. Six EGFR mutations were present only in plasma samples but not in the biopsy samples. The overall concordance of the EGFR gene mutations detected in plasma and biopsy tissue...

  17. Rapid identification of capybara (Hydrochaeris hydrochaeris through allele-specific PCR

    Directory of Open Access Journals (Sweden)

    Flávio Henrique-Silva

    2005-07-01

    Full Text Available The capybara is the largest rodent in the world and is widely distributed throughout Central and South America.  It is an animal of economic interest due to the pleasant flavor of its meat and higher protein content in comparison  to beef and pork meat.  The hide, hair and fat also have economic advantages. Thus,  as an animal with such high economic potential, it is the target of hunters, even though  hunting capybara is prohibited by law in Brazil.   Due to their  similarities,  capybara meat  is easily confused with  pork  meat.   This  occurs  upon  the apprehension of the  meat  from hunters, as well as in some restaurants that serve capybara meat that was slaughtered clandestinely. In both cases, when the meat is confiscated, those responsible for the crimes claim it is pork meat,  hindering  the enforcement of the law. A practical  course was ministered  to undergraduate biology students enrolled in the elective course Introduction to Genetic  Engineering  at Federal  University  of Sao Carlos (UFSCar, Sao Paulo  State, Brazil.  The  objective  of the  course was to establish  and  apply  a Polymerase  Chain  Reaction  (PCR assay to identify capybara meat and discriminate it in relation  to other types of meat,  including pork. Primers  were designed based  on 12S rRNA,  transthyretin and  growth  hormone  receptor  genes.  The primers generated  capybara specific fragments  of approximately 220, 290 and 330 bp for transthyretin,12S rRNA  and  growth  hormone  receptor,  respectively.   The  duplexes  developed  in the  present work can be used effectively to discriminate capybara meat  from other  animals,  contributing to combating predatory capybara hunting. The results were extensively discussed and the students have contributed to written a paper  to be submitted to a publication.

  18. Minority drug-resistant HIV-1 variants in treatment naïve East-African and Caucasian patients detected by allele-specific real-time PCR.

    Directory of Open Access Journals (Sweden)

    Halime Ekici

    Full Text Available To assess the presence of two major non-nucleoside reverse transcriptase inhibitors (NNRTI drug resistance mutations (DRMs, Y181C and K103N, in minor viral quasispecies of treatment naïve HIV-1 infected East-African and Swedish patients by allele-specific polymerase chain reaction (AS-PCR.Treatment naïve adults (n=191 with three epidemiological backgrounds were included: 92 Ethiopians living in Ethiopia; 55 East-Africans who had migrated to Sweden; and 44 Caucasians living in Sweden. The pol gene was analysed by standard population sequencing and by AS-PCR for the detection of Y181C and K103N.The Y181C was detected in the minority quasispecies of six Ethiopians (6.5%, in two Caucasians (4.5%, and in one East-African (1.8%. The K103N was detected in one East- African (1.8%, by both methods. The proportion of mutants ranged from 0.25% to 17.5%. Additional DRMs were found in all three treatment naïve patient groups by population sequencing.Major NNRTI mutations can be found by AS-PCR in minor quasispecies of treatment naïve HIV-1 infected Ethiopians living in Ethiopia, in East-African and Caucasian patients living in Sweden in whom population sequencing reveal wild-type virus only. Surveys with standard sequencing are likely to underestimate transmitted drug resistance and the presence of resistant minor quasispecies in treatment naïve patients should be topic for future large scale studies.

  19. Towards a molecular taxonomic key of the Aurantioideae subfamily using chloroplastic SNP diagnostic markers of the main clades genotyped by competitive allele-specific PCR.

    Science.gov (United States)

    Oueslati, Amel; Ollitrault, Frederique; Baraket, Ghada; Salhi-Hannachi, Amel; Navarro, Luis; Ollitrault, Patrick

    2016-08-18

    Chloroplast DNA is a primary source of molecular variations for phylogenetic analysis of photosynthetic eukaryotes. However, the sequencing and analysis of multiple chloroplastic regions is difficult to apply to large collections or large samples of natural populations. The objective of our work was to demonstrate that a molecular taxonomic key based on easy, scalable and low-cost genotyping method should be developed from a set of Single Nucleotide Polymorphisms (SNPs) diagnostic of well-established clades. It was applied to the Aurantioideae subfamily, the largest group of the Rutaceae family that includes the cultivated citrus species. The publicly available nucleotide sequences of eight plastid genomic regions were compared for 79 accessions of the Aurantioideae subfamily to search for SNPs revealing taxonomic differentiation at the inter-tribe, inter-subtribe, inter-genus and interspecific levels. Diagnostic SNPs (DSNPs) were found for 46 of the 54 clade levels analysed. Forty DSNPs were selected to develop KASPar markers and their taxonomic value was tested by genotyping 108 accessions of the Aurantioideae subfamily. Twenty-seven markers diagnostic of 24 clades were validated and they displayed a very high rate of transferability in the Aurantioideae subfamily (only 1.2 % of missing data on average). The UPGMA from the validated markers produced a cladistic organisation that was highly coherent with the previous phylogenetic analysis based on the sequence data of the eight plasmid regions. In particular, the monophyletic origin of the "true citrus" genera plus Oxanthera was validated. However, some clarification remains necessary regarding the organisation of the other wild species of the Citreae tribe. We validated the concept that with well-established clades, DSNPs can be selected and efficiently transformed into competitive allele-specific PCR markers (KASPar method) allowing cost-effective highly efficient cladistic analysis in large collections at

  20. Genotyping of the 19-bp insertion/deletion polymorphism in the 5' flank of beta-hydroxylase gene by dissociation analysis of allele-specific PCR products

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Werge, Thomas

    2005-01-01

    The 19-bp insertion/deletion polymorphism in the 5' flank of the dopamine beta-hydroxylase (DBH) gene has been associated with psychiatric disorders. We have developed a simple, reliable and inexpensive closed-tube assay for genotyping of this polymorphism based upon T(m) determination of amplified...... and a conventional approach based upon agarose gel electrophoresis of amplified fragments revealed complete concordance between the two procedures. The insights obtained in this study may be utilized to develop assays based upon dissociation analysis of PCR products for genotyping of other insertion...

  1. Detection of the V1016G mutation in the voltage-gated sodium channel gene of Aedes aegypti (Diptera: Culicidae) by allele-specific PCR assay, and its distribution and effect on deltamethrin resistance in Thailand.

    Science.gov (United States)

    Stenhouse, Steven A; Plernsub, Suriya; Yanola, Jintana; Lumjuan, Nongkran; Dantrakool, Anchalee; Choochote, Wej; Somboon, Pradya

    2013-08-30

    Resistance to pyrethroid insecticides is widespread among populations of Aedes aegypti, the main vector for the dengue virus. Several different point mutations within the voltage-gated sodium channel (VGSC) gene contribute to such resistance. A mutation at position 1016 in domain II, segment 6 of the VGSC gene in Ae. aegypti leads to a valine to glycine substitution (V1016G) that confers resistance to deltamethrin. This study developed and utilized an allele-specific PCR (AS-PCR) assay that could be used to detect the V1016G mutation. The assay was validated against a number of sequenced DNA samples of known genotype and was determined to be in complete agreement. Larvae and pupae were collected from various localities throughout Thailand. Samples were reared to adulthood and their resistance status against deltamethrin was determined by standard WHO susceptibility bioassays. Deltamethrin-resistant and susceptible insects were then genotyped for the V1016G mutation. Additionally, some samples were genotyped for a second mutation at position 1534 in domain III (F1534C) which is also known to confer pyrethroid resistance. The bioassay results revealed an overall mortality of 77.6%. Homozygous 1016G individuals survived at higher rates than either heterozygous or wild-type (1016 V) mosquitoes. The 1016G mutation was significantly and positively associated with deltamethrin resistance and was widely distributed throughout Thailand. Interestingly, wild-type 1016 V mosquitoes tested were homozygous for the 1534C mutation, and all heterozygous mosquitoes were also heterozygous for 1534C. Mutant homozygous (G/G) mosquitoes expressed the wild-type (F/F) at position 1534. However, the presence of the 1534C mutation was not associated with deltamethrin resistance. Our bioassay results indicate that all populations sampled display some degree of resistance to deltamethrin. Homozygous 1016G mosquitoes were far likelier to survive such exposure. However, resistance in some

  2. Comparison of 454 Ultra-Deep Sequencing and Allele-Specific Real-Time PCR with Regard to the Detection of Emerging Drug-Resistant Minor HIV-1 Variants after Antiretroviral Prophylaxis for Vertical Transmission.

    Directory of Open Access Journals (Sweden)

    Andrea Hauser

    Full Text Available Pregnant HIV-infected women were screened for the development of HIV-1 drug resistance after implementation of a triple-antiretroviral transmission prophylaxis as recommended by the WHO in 2006. The study offered the opportunity to compare amplicon-based 454 ultra-deep sequencing (UDS and allele-specific real-time PCR (ASPCR for the detection of drug-resistant minor variants in the HIV-1 reverse transcriptase (RT.Plasma samples from 34 Tanzanian women were previously analysed by ASPCR for key resistance mutations in the viral RT selected by AZT, 3TC, and NVP (K70R, K103N, Y181C, M184V, T215Y/F. In this study, the RT region of the same samples was investigated by amplicon-based UDS for resistance mutations using the 454 GS FLX System.Drug-resistant HIV-variants were identified in 69% (20/29 of women by UDS and in 45% (13/29 by ASPCR. The absolute number of resistance mutations identified by UDS was twice that identified by ASPCR (45 vs 24. By UDS 14 of 24 ASPCR-detected resistance mutations were identified at the same position. The overall concordance between UDS and ASPCR was 61.0% (25/41. The proportions of variants quantified by UDS were approximately 2-3 times lower than by ASPCR. Amplicon generation from samples with viral loads below 20,000 copies/ml failed more frequently by UDS compared to ASPCR (limit of detection = 650 copies/ml, resulting in missing or insufficient sequence coverage.Both methods can provide useful information about drug-resistant minor HIV-1 variants. ASPCR has a higher sensitivity than UDS, but is restricted to single resistance mutations. In contrast, UDS is limited by its requirement for high viral loads to achieve sufficient sequence coverage, but the sequence information reveals the complete resistance patterns within the genomic region analysed. Improvements to the UDS limit of detection are in progress, and UDS could then facilitate monitoring of drug-resistant minor variants in the HIV-1 quasispecies.

  3. Allele-Specific DNA Methylation Detection by Pyrosequencing®

    DEFF Research Database (Denmark)

    Kristensen, Lasse Sommer; Johansen, Jens Vilstrup; Grønbæk, Kirsten

    2015-01-01

    DNA methylation is an epigenetic modification that plays important roles in healthy as well as diseased cells, by influencing the transcription of genes. In spite the fact that human somatic cells are diploid, most of the currently available methods for the study of DNA methylation do not provide......-effective protocol for allele-specific DNA methylation detection based on Pyrosequencing(®) of methylation-specific PCR (MSP) products including a single nucleotide polymorphism (SNP) within the amplicon....

  4. Allele specific expression and methylation in the bumblebee, Bombus terrestris

    Directory of Open Access Journals (Sweden)

    Zoë Lonsdale

    2017-09-01

    Full Text Available The social hymenoptera are emerging as models for epigenetics. DNA methylation, the addition of a methyl group, is a common epigenetic marker. In mammals and flowering plants methylation affects allele specific expression. There is contradictory evidence for the role of methylation on allele specific expression in social insects. The aim of this paper is to investigate allele specific expression and monoallelic methylation in the bumblebee, Bombus terrestris. We found nineteen genes that were both monoallelically methylated and monoallelically expressed in a single bee. Fourteen of these genes express the hypermethylated allele, while the other five express the hypomethylated allele. We also searched for allele specific expression in twenty-nine published RNA-seq libraries. We found 555 loci with allele-specific expression. We discuss our results with reference to the functional role of methylation in gene expression in insects and in the as yet unquantified role of genetic cis effects in insect allele specific methylation and expression.

  5. Delimiting Allelic Imbalance of TYMS by Allele-Specific Analysis.

    Science.gov (United States)

    Balboa-Beltrán, Emilia; Cruz, Raquel; Carracedo, Angel; Barros, Francisco

    2015-07-01

    Allelic imbalance of thymidylate synthase (TYMS) is attributed to polymorphisms in the 5'- and 3'-untranslated region (UTR). These polymorphisms have been related to the risk of suffering different cancers, for example leukemia, breast or gastric cancer, and response to different drugs, among which are methotrexate glutamates, stavudine, and specifically 5-fluorouracil (5-FU), as TYMS is its direct target. A vast literature has been published in relation to 5-FU, even suggesting the sole use of these polymorphisms to effectively manage 5-FU dosage. Estimates of the extent to which these polymorphisms influence in TYMS expression have in the past been based on functional analysis by luciferase assays and quantification of TYMS mRNA, but both these studies, as the association studies with cancer risk or with toxicity or response to 5-FU, are very contradictory. Regarding functional assays, the artificial genetic environment created in luciferase assay and the problems derived from quantitative polymerase chain reactions (qPCRs), for example the use of a reference gene, may have distorted the results. To avoid these sources of interference, we have analyzed the allelic imbalance of TYMS by allelic-specific analysis in peripheral blood mononuclear cells (PBMCs) from patients.Allelic imbalance in PBMCs, taken from 40 patients with suspected myeloproliferative haematological diseases, was determined by fluorescent fragment analysis (for the 3'-UTR polymorphism), Sanger sequencing and allelic-specific qPCR in multiplex (for the 5'-UTR polymorphisms).For neither the 3'- nor the 5'-UTR polymorphisms did the observed allelic imbalance exceed 1.5 fold. None of the TYMS polymorphisms is statistically associated with allelic imbalance.The results acquired allow us to deny the previously established assertion of an influence of 2 to 4 fold of the rs45445694 and rs2853542 polymorphisms in the expression of TYMS and narrow its allelic imbalance to 1.5 fold, in our population

  6. Template preparation for rapid PCR in Colletotrichum lindemuthianum

    Directory of Open Access Journals (Sweden)

    Roca M. Gabriela

    2003-01-01

    Full Text Available Isolation of DNA for PCR is time-consuming and involves many reagents. The aim of this work was to optimise a rapid and easy PCR methodology without previous DNA isolation. Different strains of the phytopathogenic fungus Colletotrichum lindemuthianum were used. Protoplasts were generated using lytic enzymes under high incubation temperatures using different methodologies to obtain the template. A rapid (10 minute methodology was successful for smaller amplicons (<750 bp.

  7. SASqPCR: robust and rapid analysis of RT-qPCR data in SAS.

    Directory of Open Access Journals (Sweden)

    Daijun Ling

    Full Text Available Reverse transcription quantitative real-time PCR (RT-qPCR is a key method for measurement of relative gene expression. Analysis of RT-qPCR data requires many iterative computations for data normalization and analytical optimization. Currently no computer program for RT-qPCR data analysis is suitable for analytical optimization and user-controllable customization based on data quality, experimental design as well as specific research aims. Here I introduce an all-in-one computer program, SASqPCR, for robust and rapid analysis of RT-qPCR data in SAS. This program has multiple macros for assessment of PCR efficiencies, validation of reference genes, optimization of data normalizers, normalization of confounding variations across samples, and statistical comparison of target gene expression in parallel samples. Users can simply change the macro variables to test various analytical strategies, optimize results and customize the analytical processes. In addition, it is highly automatic and functionally extendable. Thus users are the actual decision-makers controlling RT-qPCR data analyses. SASqPCR and its tutorial are freely available at http://code.google.com/p/sasqpcr/downloads/list.

  8. [Application of rapid PCR to authenticate medicinal snakes].

    Science.gov (United States)

    Chen, Kang; Jiang, Chao; Yuan, Yuan; Huang, Lu-Qi; Li, Man

    2014-10-01

    To obtained an accurate, rapid and efficient method for authenticate medicinal snakes listed in Chinese Pharmacopoeia (Zaocysd humnades, Bungarus multicinctus, Agkistrodon acutus), a rapid PCR method for authenticate snakes and its adulterants was established based on the classic molecular authentication methods. DNA was extracted by alkaline lysis and the specific primers were amplified by two-steps PCR amplification method. The denatured and annealing temperature and cycle numbers were optimized. When 100 x SYBR Green I was added in the PCR product, strong green fluorescence was visualized under 365 nm UV whereas adulterants without. The whole process can complete in 30-45 minutes. The established method provides the technical support for authentication of the snakes on field.

  9. Immunomagnetic nanoparticle based quantitative PCR for rapid detection of Salmonella

    International Nuclear Information System (INIS)

    Bakthavathsalam, Padmavathy; Rajendran, Vinoth Kumar; Saran, Uttara; Chatterjee, Suvro; Ali, Baquir Mohammed Jaffar

    2013-01-01

    We have developed a rapid and sensitive method for immunomagnetic separation (IMS) of Salmonella along with their real time detection via PCR. Silica-coated magnetic nanoparticles were functionalized with carboxy groups to which anti-Salmonella antibody raised against heat-inactivated whole cells of Salmonella were covalently attached. The immuno-captured target cells were detected in beverages like milk and lemon juice by multiplex PCR and real time PCR with a detection limit of 10 4 cfu.mL −1 and 10 3 cfu.mL −1 , respectively. We demonstrate that IMS can be used for selective concentration of target bacteria from beverages for subsequent use in PCR detection. PCR also enables differentiation of Salmonella typhi and Salmonella paratyphi A using a set of four specific primers. In addition, IMS—PCR can be used as a screening tool in the food and beverage industry for the detection of Salmonella within 3–4 h which compares favorably to the time of several days that is needed in case of conventional detection based on culture and biochemical methods. (author)

  10. ALEA: a toolbox for allele-specific epigenomics analysis.

    Science.gov (United States)

    Younesy, Hamid; Möller, Torsten; Heravi-Moussavi, Alireza; Cheng, Jeffrey B; Costello, Joseph F; Lorincz, Matthew C; Karimi, Mohammad M; Jones, Steven J M

    2014-04-15

    The assessment of expression and epigenomic status using sequencing based methods provides an unprecedented opportunity to identify and correlate allelic differences with epigenomic status. We present ALEA, a computational toolbox for allele-specific epigenomics analysis, which incorporates allelic variation data within existing resources, allowing for the identification of significant associations between epigenetic modifications and specific allelic variants in human and mouse cells. ALEA provides a customizable pipeline of command line tools for allele-specific analysis of next-generation sequencing data (ChIP-seq, RNA-seq, etc.) that takes the raw sequencing data and produces separate allelic tracks ready to be viewed on genome browsers. The pipeline has been validated using human and hybrid mouse ChIP-seq and RNA-seq data. The package, test data and usage instructions are available online at http://www.bcgsc.ca/platform/bioinfo/software/alea CONTACT: : mkarimi1@interchange.ubc.ca or sjones@bcgsc.ca Supplementary information: Supplementary data are available at Bioinformatics online. © The Author 2013. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  11. Allele-specific MMP-3 transcription under in vivo conditions

    Energy Technology Data Exchange (ETDEWEB)

    Chaoyong, Zhu [Atherosclerosis Research Unit, King Gustav V Research Institute, Department of Medicine, Karolinska Institute, Stockholm (Sweden); Odeberg, Jacob [Atherosclerosis Research Unit, King Gustav V Research Institute, Department of Medicine, Karolinska Institute, Stockholm (Sweden); Department of Biotechnology, AlbaNova University Center, Royal Institute of Technology, Stockholm (Sweden); Hamsten, Anders [Atherosclerosis Research Unit, King Gustav V Research Institute, Department of Medicine, Karolinska Institute, Stockholm (Sweden); Eriksson, Per [Atherosclerosis Research Unit, King Gustav V Research Institute, Department of Medicine, Karolinska Institute, Stockholm (Sweden)

    2006-09-29

    A common matrix metalloproteinases-3 (MMP-3) -1612 5A/6A promoter polymorphism is associated with risk for cardiovascular disease, rheumatoid arthritis, and other diseases. Here we used the haplotype chromatin immunoprecipitation method to study allele-specific MMP-3 expression under in vivo conditions in heterozygous THP-1 cells. Pyrosequencing was used to analyse the ratio of 5A-allele to 6A-allele after chromatin immunoprecipitation using an antibody against phosphorylated active RNA polymerase II. There was no allele-specific difference in transcriptional activity during basal conditions, i.e., in unstimulated monocytic THP-1 cells. However, after stimulation of MMP-3 expression by monocyte differentiation or incubation with IL-1{beta}, the haplotype containing the 5A-allele was associated with higher transcriptional activity compared with the 6A-containing haplotype. Electromobility shift assay demonstrated increased binding of nuclear proteins to the 5A-allele after monocyte differentiation. In conclusion, the common MMP-3 5A/6A promoter polymorphism appears to be functional only during specific environmental conditions involving inflammation.

  12. Rapid diagnosis of aneuploidy using segmental duplication quantitative fluorescent PCR.

    Directory of Open Access Journals (Sweden)

    Xiangdong Kong

    Full Text Available The aim of this study was use a simple and rapid procedure, called segmental duplication quantitative fluorescent polymerase chain reaction (SD-QF-PCR, for the prenatal diagnosis of fetal chromosomal aneuploidies. This method is based on the co-amplification of segmental duplications located on two different chromosomes using a single pair of fluorescent primers. The PCR products of different sizes were subsequently analyzed through capillary electrophoresis, and the aneuploidies were determined based on the relative dosage between the two chromosomes. Each primer set, containing five pairs of primers, was designed to simultaneously detect aneuploidies located on chromosomes 21, 18, 13, X and Y in a single reaction. We applied these two primer sets to DNA samples isolated from individuals with trisomy 21 (n = 36; trisomy 18 (n = 6; trisomy 13 (n = 4; 45, X (n = 5; 47, XXX (n = 3; 48, XXYY (n = 2; and unaffected controls (n = 40. We evaluated the performance of this method using the karyotyping results. A correct and unambiguous diagnosis with 100% sensitivity and 100% specificity, was achieved for clinical samples examined. Thus, the present study demonstrates that SD-QF-PCR is a robust, rapid and sensitive method for the diagnosis of common aneuploidies, and these analyses can be performed in less than 4 hours for a single sample, providing a competitive alternative for routine use.

  13. Comparative anatomy of chromosomal domains with imprinted and non-imprinted allele-specific DNA methylation.

    Science.gov (United States)

    Paliwal, Anupam; Temkin, Alexis M; Kerkel, Kristi; Yale, Alexander; Yotova, Iveta; Drost, Natalia; Lax, Simon; Nhan-Chang, Chia-Ling; Powell, Charles; Borczuk, Alain; Aviv, Abraham; Wapner, Ronald; Chen, Xiaowei; Nagy, Peter L; Schork, Nicholas; Do, Catherine; Torkamani, Ali; Tycko, Benjamin

    2013-08-01

    Allele-specific DNA methylation (ASM) is well studied in imprinted domains, but this type of epigenetic asymmetry is actually found more commonly at non-imprinted loci, where the ASM is dictated not by parent-of-origin but instead by the local haplotype. We identified loci with strong ASM in human tissues from methylation-sensitive SNP array data. Two index regions (bisulfite PCR amplicons), one between the C3orf27 and RPN1 genes in chromosome band 3q21 and the other near the VTRNA2-1 vault RNA in band 5q31, proved to be new examples of imprinted DMRs (maternal alleles methylated) while a third, between STEAP3 and C2orf76 in chromosome band 2q14, showed non-imprinted haplotype-dependent ASM. Using long-read bisulfite sequencing (bis-seq) in 8 human tissues we found that in all 3 domains the ASM is restricted to single differentially methylated regions (DMRs), each less than 2kb. The ASM in the C3orf27-RPN1 intergenic region was placenta-specific and associated with allele-specific expression of a long non-coding RNA. Strikingly, the discrete DMRs in all 3 regions overlap with binding sites for the insulator protein CTCF, which we found selectively bound to the unmethylated allele of the STEAP3-C2orf76 DMR. Methylation mapping in two additional genes with non-imprinted haplotype-dependent ASM, ELK3 and CYP2A7, showed that the CYP2A7 DMR also overlaps a CTCF site. Thus, two features of imprinted domains, highly localized DMRs and allele-specific insulator occupancy by CTCF, can also be found in chromosomal domains with non-imprinted ASM. Arguing for biological importance, our analysis of published whole genome bis-seq data from hES cells revealed multiple genome-wide association study (GWAS) peaks near CTCF binding sites with ASM.

  14. QuASAR: quantitative allele-specific analysis of reads.

    Science.gov (United States)

    Harvey, Chris T; Moyerbrailean, Gregory A; Davis, Gordon O; Wen, Xiaoquan; Luca, Francesca; Pique-Regi, Roger

    2015-04-15

    Expression quantitative trait loci (eQTL) studies have discovered thousands of genetic variants that regulate gene expression, enabling a better understanding of the functional role of non-coding sequences. However, eQTL studies are costly, requiring large sample sizes and genome-wide genotyping of each sample. In contrast, analysis of allele-specific expression (ASE) is becoming a popular approach to detect the effect of genetic variation on gene expression, even within a single individual. This is typically achieved by counting the number of RNA-seq reads matching each allele at heterozygous sites and testing the null hypothesis of a 1:1 allelic ratio. In principle, when genotype information is not readily available, it could be inferred from the RNA-seq reads directly. However, there are currently no existing methods that jointly infer genotypes and conduct ASE inference, while considering uncertainty in the genotype calls. We present QuASAR, quantitative allele-specific analysis of reads, a novel statistical learning method for jointly detecting heterozygous genotypes and inferring ASE. The proposed ASE inference step takes into consideration the uncertainty in the genotype calls, while including parameters that model base-call errors in sequencing and allelic over-dispersion. We validated our method with experimental data for which high-quality genotypes are available. Results for an additional dataset with multiple replicates at different sequencing depths demonstrate that QuASAR is a powerful tool for ASE analysis when genotypes are not available. http://github.com/piquelab/QuASAR. fluca@wayne.edu or rpique@wayne.edu Supplementary Material is available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  15. Comparative anatomy of chromosomal domains with imprinted and non-imprinted allele-specific DNA methylation.

    Directory of Open Access Journals (Sweden)

    Anupam Paliwal

    2013-08-01

    Full Text Available Allele-specific DNA methylation (ASM is well studied in imprinted domains, but this type of epigenetic asymmetry is actually found more commonly at non-imprinted loci, where the ASM is dictated not by parent-of-origin but instead by the local haplotype. We identified loci with strong ASM in human tissues from methylation-sensitive SNP array data. Two index regions (bisulfite PCR amplicons, one between the C3orf27 and RPN1 genes in chromosome band 3q21 and the other near the VTRNA2-1 vault RNA in band 5q31, proved to be new examples of imprinted DMRs (maternal alleles methylated while a third, between STEAP3 and C2orf76 in chromosome band 2q14, showed non-imprinted haplotype-dependent ASM. Using long-read bisulfite sequencing (bis-seq in 8 human tissues we found that in all 3 domains the ASM is restricted to single differentially methylated regions (DMRs, each less than 2kb. The ASM in the C3orf27-RPN1 intergenic region was placenta-specific and associated with allele-specific expression of a long non-coding RNA. Strikingly, the discrete DMRs in all 3 regions overlap with binding sites for the insulator protein CTCF, which we found selectively bound to the unmethylated allele of the STEAP3-C2orf76 DMR. Methylation mapping in two additional genes with non-imprinted haplotype-dependent ASM, ELK3 and CYP2A7, showed that the CYP2A7 DMR also overlaps a CTCF site. Thus, two features of imprinted domains, highly localized DMRs and allele-specific insulator occupancy by CTCF, can also be found in chromosomal domains with non-imprinted ASM. Arguing for biological importance, our analysis of published whole genome bis-seq data from hES cells revealed multiple genome-wide association study (GWAS peaks near CTCF binding sites with ASM.

  16. Allele specific expression in worker reproduction genes in the bumblebee Bombus terrestris

    Directory of Open Access Journals (Sweden)

    Harindra E. Amarasinghe

    2015-07-01

    Full Text Available Methylation has previously been associated with allele specific expression in ants. Recently, we found methylation is important in worker reproduction in the bumblebee Bombus terrestris. Here we searched for allele specific expression in twelve genes associated with worker reproduction in bees. We found allele specific expression in Ecdysone 20 monooxygenase and IMP-L2-like. Although we were unable to confirm a genetic or epigenetic cause for this allele specific expression, the expression patterns of the two genes match those predicted for imprinted genes.

  17. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  18. Allele specific LAMP- gold nanoparticle for characterization of single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Fábio Ferreira Carlos

    2017-12-01

    Full Text Available Due to their relevance as disease biomarkers and for diagnostics, screening of single nucleotide polymorphism (SNPs requires simple and straightforward strategies capable to provide results in medium throughput settings. Suitable approaches relying on isothermal amplification techniques have been evolving to substitute the cumbersome and highly specialized PCR amplification detection schemes. Nonetheless, identification of an individual’s genotype still requires sophisticated equipment and laborious methods.Here, we present a low-cost and reliable approach based on the allele specific loop-mediated isothermal amplification (AS-LAMP coupled to ssDNA functionalized gold nanoparticle (Au-nanoprobe colorimetric sequence discrimination. The Au-nanoprobe integration allows for the colorimetric detection of AS-LAMP amplification product that can be easily interpreted in less than 15 min. We targeted a clinical relevant SNP responsible for lactose intolerance (-13910C/T dbSNP rs#: 4988235 to demonstrate its proof of concept and full potential of this novel approach. Keywords: SNP, Isothermal amplification, Gold nanoparticles, Gold nanoprobes, Lactose intolerance

  19. Enhanced specificity of TPMT*2 genotyping using unidirectional wild-type and mutant allele-specific scorpion primers in a single tube.

    Directory of Open Access Journals (Sweden)

    Dong Chen

    Full Text Available Genotyping of thiopurine S-methyltransferase (TPMT is recommended for predicting the adverse drug response of thiopurines. In the current study, a novel version of allele-specific PCR (AS-PCR, termed competitive real-time fluorescent AS-PCR (CRAS-PCR was developed to analyze the TPMT*2 genotype in ethnic Chinese. This technique simultaneously uses wild-type and mutant allele-specific scorpion primers in a single reaction. To determine the optimal conditions for both traditional AS-PCR and CRAS-PCR, we used the Taguchi method, an engineering optimization process that balances the concentrations of all components using an orthogonal array rather than a factorial array. Instead of running up to 264 experiments with the conventional factorial method, the Taguchi method achieved the same optimization using only 16 experiments. The optimized CRAS-PCR system completely avoided non-specific amplification occurring in traditional AS-PCR and could be performed at much more relaxed reaction conditions at 1% sensitivity, similar to traditional AS-PCR. TPMT*2 genotyping of 240 clinical samples was consistent with published data. In conclusion, CRAS-PCR is a novel and robust genotyping method, and the Taguchi method is an effective tool for the optimization of molecular analysis techniques.

  20. Allele-Specific Alternative mRNA processing (ASARP) | Informatics Technology for Cancer Research (ITCR)

    Science.gov (United States)

    A software pipeline for prediction of allele-specific alternative RNA processing events using single RNA-seq data. The current version focuses on prediction of alternative splicing and alternative polyadenylation modulated by genetic variants.

  1. A multiplex PCR method for rapid identification of Brachionus rotifers.

    Science.gov (United States)

    Vasileiadou, Kalliopi; Papakostas, Spiros; Triantafyllidis, Alexander; Kappas, Ilias; Abatzopoulos, Theodore J

    2009-01-01

    Cryptic species are increasingly being recognized in many organisms. In Brachionus rotifers, many morphologically similar yet genetically distinct species/biotypes have been described. A number of Brachionus cryptic species have been recognized among hatchery strains. In this study, we present a simple, one-step genetic method to detect the presence of those Brachionus sp. rotifers that have been found in hatcheries. With the proposed technique, each of the B. plicatilis sensu stricto, B. ibericus, Brachionus sp. Nevada, Brachionus sp. Austria, Brachionus sp. Manjavacas, and Brachionus sp. Cayman species and/or biotypes can be identified with polymerase chain reaction (PCR) analysis. Based on 233 cytochrome c oxidase subunit I sequences, we reviewed all the available cryptic Brachionus sp. genetic polymorphisms, and we designed six nested primers. With these primers, a specific amplicon of distinct size is produced for every one of the involved species/biotypes. Two highly sensitive protocols were developed for using the primers. Many of the primers can be combined in the same PCR. The proposed method has been found to be an effective and practical tool to investigate the presence of the above six cryptic species/biotypes in both individual and communal (bulk) rotifer deoxyribonucleic acid extractions from hatcheries. With this technique, hatchery managers could easily determine their rotifer composition at the level of cryptic species and monitor their cultures more efficiently.

  2. A rapid and direct real time PCR-based method for identification of Salmonella spp

    DEFF Research Database (Denmark)

    Rodriguez-Lazaro, D.; Hernández, Marta; Esteve, T.

    2003-01-01

    The aim of this work was the validation of a rapid, real-time PCR assay based on TaqMan((R)) technology for the unequivocal identification of Salmonella spp. to be used directly on an agar-grown colony. A real-time PCR system targeting at the Salmonella spp. invA gene was optimized and validated ...

  3. Original Article. Evaluation of Rapid Detection of Nasopharyngeal Colonization with MRSA by Real-Time PCR

    Directory of Open Access Journals (Sweden)

    Kang Feng-feng

    2012-03-01

    Full Text Available Objective To investigate the clinical application of Real-Time PCR for rapid detection of methicillin-resistant Staphylococcus aureus (MRSA directly from nasopharyngeal swab specimens.

  4. Soil Baiting, Rapid PCR Assay and Quantitative Real Time PCR to Diagnose Late Blight of Potato in Quarantine Programs

    Directory of Open Access Journals (Sweden)

    Touseef Hussain

    2018-05-01

    Full Text Available Phytophthora infestans (mont de Bary is a pathogen of great concern across the globe, and accurate detection is an important component in responding to the outbreaks of potential disease. Although the molecular diagnostic protocol used in regulatory programs has been evaluated but till date methods implying direct comparison has rarely used. In this study, a known area soil samples from potato fields where light blight appear every year (both A1 and A2 mating type was assayed by soil bait method, PCR assay detection and quantification of the inoculums. Suspected disease symptoms appeared on bait tubers were further confirmed by rapid PCR, inoculums were quantified through Real Time PCR, which confirms presence of P. infestans. These diagnostic methods can be highly correlated with one another. Potato tuber baiting increased the sensitivity of the assay compared with direct extraction of DNA from tuber and soil samples. Our study determines diagnostic sensitivity and specificity of the assays to determine the performance of each method. Overall, molecular techniques based on different types of PCR amplification and Real-time PCR can lead to high throughput, faster and more accurate detection method which can be used in quarantine programmes in potato industry and diagnostic laboratory.

  5. Integration of nanoparticle cell lysis and microchip PCR for one-step rapid detection of bacteria.

    Science.gov (United States)

    Wan, Weijie; Yeow, John T W

    2012-04-01

    This paper describes an integrated microchip system as an efficient and cost-effective solution involving Nanotechnology and Lab-on-a-Chip technology for the rapid detection of bacteria. The system is based on using surface-modified gold nanoparticles for efficient cell lysis followed by microchip PCR without having to remove the nanoparticles from the PCR solution. Poly(quaternary ammonium) modified gold nanoparticles are used to provide a novel and efficient cell lysis method without the need to go through time-consuming, expensive and complicated microfabrication processes as most of current cell lysis methods for Lab-on-a-Chip applications do. It also facilitates the integration of cell lysis and PCR by sharing the same reaction chamber as PCR uses. It is integrated with a prototype microchip PCR system consisting of a physical microchip PCR device and an automated temperature control mechanism. The research work explores solutions for the problem of PCR inhibition caused by gold nanoparticles as well as for the problem of non-specific PCR amplification in the integrated microchip system. It also explores the possibility of greatly reducing PCR cycling time to achieve the same result compared to the protocol for a regular PCR machine. The simplicity of the setup makes it easy to be integrated with other Lab-on-a-Chip functional modules to create customized solutions for target applications.

  6. PCR

    African Journals Online (AJOL)

    Elham

    2013-07-03

    Jul 3, 2013 ... was constructed with competitive strategy by PCR-cloning technique and the limitation range was determined. The PCR products of MTB and IAC were 245 and 660 bp, respectively on .... products' differentiation was easy.

  7. Rapid identification of HPV 16 and 18 by multiplex nested PCR-immunochromatographic test.

    Science.gov (United States)

    Kuo, Yung-Bin; Li, Yi-Shuan; Chan, Err-Cheng

    2015-02-01

    Human papillomavirus (HPV) types 16 and 18 are known to be high-risk viruses that cause cervical cancer. An HPV rapid testing kit that could help physicians to make early and more informed decisions regarding patient care is needed urgently but not yet available. This study aimed to develop a multiplex nested polymerase chain reaction-immunochromatographic test (PCR-ICT) for the rapid identification of HPV 16 and 18. A multiplex nested PCR was constructed to amplify the HPV 16 and 18 genotype-specific L1 gene fragments and followed by ICT which coated with antibodies to identify rapidly the different PCR products. The type-specific gene regions of high-risk HPV 16 and 18 could be amplified successfully by multiplex nested PCR at molecular sizes of approximately 99 and 101bp, respectively. The capture antibodies raised specifically against the moleculars labeled on the PCR products could be detected simultaneously both HPV 16 and 18 in one strip. Under optimal conditions, this PCR-ICT assay had the capability to detect HPV in a sample with as low as 100 copies of HPV viral DNA. The PCR-ICT system has the advantage of direct and simultaneous detection of two high-risk HPV 16 and 18 DNA targets in one sample, which suggested a significant potential of this assay for clinical application. Copyright © 2014. Published by Elsevier B.V.

  8. Allele Workbench: transcriptome pipeline and interactive graphics for allele-specific expression.

    Directory of Open Access Journals (Sweden)

    Carol A Soderlund

    Full Text Available Sequencing the transcriptome can answer various questions such as determining the transcripts expressed in a given species for a specific tissue or condition, evaluating differential expression, discovering variants, and evaluating allele-specific expression. Differential expression evaluates the expression differences between different strains, tissues, and conditions. Allele-specific expression evaluates expression differences between parental alleles. Both differential expression and allele-specific expression have been studied for heterosis (hybrid vigor, where the hybrid has improved performance over the parents for one or more traits. The Allele Workbench software was developed for a heterosis study that evaluated allele-specific expression for a mouse F1 hybrid using libraries from multiple tissues with biological replicates. This software has been made into a distributable package, which includes a pipeline, a Java interface to build the database, and a Java interface for query and display of the results. The required input is a reference genome, annotation file, and one or more RNA-Seq libraries with optional replicates. It evaluates allelic imbalance at the SNP and transcript level and flags transcripts with significant opposite directional allele-specific expression. The Java interface allows the user to view data from libraries, replicates, genes, transcripts, exons, and variants, including queries on allele imbalance for selected libraries. To determine the impact of allele-specific SNPs on protein folding, variants are annotated with their effect (e.g., missense, and the parental protein sequences may be exported for protein folding analysis. The Allele Workbench processing results in transcript files and read counts that can be used as input to the previously published Transcriptome Computational Workbench, which has a new algorithm for determining a trimmed set of gene ontology terms. The software with demo files is available

  9. Validation of a Multiplex Allele-Specific Polymerase Chain Reaction Assay for Detection of KRAS Gene Mutations in Formalin-Fixed, Paraffin-Embedded Tissues from Colorectal Cancer Patients.

    Directory of Open Access Journals (Sweden)

    Sirirat Seekhuntod

    Full Text Available Patients with KRAS mutations do not respond to epidermal growth factor receptor (EGFR inhibitors and fail to benefit from adjuvant chemotherapy. Mutation analysis of KRAS is needed before starting treatment with monoclonal anti-EGFR antibodies in patients with metastatic colorectal cancer (mCRC. The objective of this study is to develop a multiplex allele-specific PCR (MAS-PCR assay to detect KRAS mutations.We developed a single-tube MAS-PCR assay for the detection of seven KRAS mutations (G12D, G12A, G12R, G12C, G12S, G12V, and G13D. We performed MAS-PCR assay analysis for KRAS on DNA isolated from 270 formalin-fixed paraffin-embedded (FFPE colorectal cancer tissues. Sequences of all 270 samples were determined by pyrosequencing. Seven known point-mutation DNA samples diluted with wild-type DNA were assayed to determine the limitation of detection and reproducibility of the MAS-PCR assay.Overall, the results of MAS-PCR assay were in good concordance with pyrosequencing, and only seven discordant samples were found. The MAS-PCR assay reproducibly detected 1 to 2% mutant alleles. The most common mutations were G13D in codon 13 (49.17%, G12D (25.83% and G12V (12.50% in codon 12.The MAS-PCR assay provides a rapid, cost-effective, and reliable diagnostic tool for accurate detection of KRAS mutations in routine FFPE colorectal cancer tissues.

  10. Polymerase chain reaction (PCR) for rapid diagnosis and differentiation of parapoxvirus and orthopoxvirus infections in camels

    International Nuclear Information System (INIS)

    Khalafalla, A.I.; Buettner, M.; Rziha, H.-J.

    2005-01-01

    Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)

  11. Modified DNA extraction for rapid PCR detection of methicillin-resistant staphylococci

    International Nuclear Information System (INIS)

    Japoni, A.; Alborzi, A.; Rasouli, M.; Pourabbas, B.

    2004-01-01

    Nosocomial infection caused by methicillin-resistant staphylococci poses a serious problem in many countries. The aim of this study was to rapidly and reliably detect methicillin-resistant-staphylococci in order to suggest appropriate therapy. The presence or absence of the methicillin-resistance gene in 115 clinical isolates of staphylococcus aureus and 50 isolates of coagulase negative staphylococci was examined by normal PCR. DNA extraction for PCR performance was then modified by omission of achromopeptadiase and proteinase K digestion, phenol/chloroform extraction and ethanol precipitation. All isolates with Mic>8 μ g/ml showed positive PCR. No differences in PCR detection have been observed when normal and modified DNA extractions have been performed. Our modified DNA extraction can quickly detect methicillin-resistant staphylococci by PCR. The advantage of rapid DNA extraction extends to both reduction of time and cost of PCR performance. This modified DNA extraction is suitable for different PCR detection, when staphylococci are the subject of DNA analysis

  12. Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.

    Science.gov (United States)

    Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R

    2001-10-01

    Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.

  13. A duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains.

    Science.gov (United States)

    Benacer, Douadi; Zain, Siti Nursheena Mohd; Lewis, John W; Khalid, Mohd Khairul Nizam Mohd; Thong, Kwai Lin

    2017-01-01

    This study aimed to develop a duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains. Primers were designed to target the rrs (LG1/LG2) and ligB (LP1/LP2) genes to confirm the presence of the Leptospira genus and the pathogenic species, respectively. The assay showed 100% specificity against 17 Leptospira strains with a limit of detection of 23.1pg/µl of leptospiral DNA and sensitivity of 103 leptospires/ml in both spiked urine and water. Our duplex endpoint PCR assay is suitable for rapid early detection of Leptospira with high sensitivity and specificity.

  14. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  15. Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.

    Science.gov (United States)

    Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing

    2018-02-01

    The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.

  16. Simultaneous SNP identification and assessment of allele-specific bias from ChIP-seq data

    Directory of Open Access Journals (Sweden)

    Ni Yunyun

    2012-09-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs have been associated with many aspects of human development and disease, and many non-coding SNPs associated with disease risk are presumed to affect gene regulation. We have previously shown that SNPs within transcription factor binding sites can affect transcription factor binding in an allele-specific and heritable manner. However, such analysis has relied on prior whole-genome genotypes provided by large external projects such as HapMap and the 1000 Genomes Project. This requirement limits the study of allele-specific effects of SNPs in primary patient samples from diseases of interest, where complete genotypes are not readily available. Results In this study, we show that we are able to identify SNPs de novo and accurately from ChIP-seq data generated in the ENCODE Project. Our de novo identified SNPs from ChIP-seq data are highly concordant with published genotypes. Independent experimental verification of more than 100 sites estimates our false discovery rate at less than 5%. Analysis of transcription factor binding at de novo identified SNPs revealed widespread heritable allele-specific binding, confirming previous observations. SNPs identified from ChIP-seq datasets were significantly enriched for disease-associated variants, and we identified dozens of allele-specific binding events in non-coding regions that could distinguish between disease and normal haplotypes. Conclusions Our approach combines SNP discovery, genotyping and allele-specific analysis, but is selectively focused on functional regulatory elements occupied by transcription factors or epigenetic marks, and will therefore be valuable for identifying the functional regulatory consequences of non-coding SNPs in primary disease samples.

  17. QuASAR-MPRA: accurate allele-specific analysis for massively parallel reporter assays.

    Science.gov (United States)

    Kalita, Cynthia A; Moyerbrailean, Gregory A; Brown, Christopher; Wen, Xiaoquan; Luca, Francesca; Pique-Regi, Roger

    2018-03-01

    The majority of the human genome is composed of non-coding regions containing regulatory elements such as enhancers, which are crucial for controlling gene expression. Many variants associated with complex traits are in these regions, and may disrupt gene regulatory sequences. Consequently, it is important to not only identify true enhancers but also to test if a variant within an enhancer affects gene regulation. Recently, allele-specific analysis in high-throughput reporter assays, such as massively parallel reporter assays (MPRAs), have been used to functionally validate non-coding variants. However, we are still missing high-quality and robust data analysis tools for these datasets. We have further developed our method for allele-specific analysis QuASAR (quantitative allele-specific analysis of reads) to analyze allele-specific signals in barcoded read counts data from MPRA. Using this approach, we can take into account the uncertainty on the original plasmid proportions, over-dispersion, and sequencing errors. The provided allelic skew estimate and its standard error also simplifies meta-analysis of replicate experiments. Additionally, we show that a beta-binomial distribution better models the variability present in the allelic imbalance of these synthetic reporters and results in a test that is statistically well calibrated under the null. Applying this approach to the MPRA data, we found 602 SNPs with significant (false discovery rate 10%) allele-specific regulatory function in LCLs. We also show that we can combine MPRA with QuASAR estimates to validate existing experimental and computational annotations of regulatory variants. Our study shows that with appropriate data analysis tools, we can improve the power to detect allelic effects in high-throughput reporter assays. http://github.com/piquelab/QuASAR/tree/master/mpra. fluca@wayne.edu or rpique@wayne.edu. Supplementary data are available online at Bioinformatics. © The Author (2017). Published by

  18. Use of PCR-Based Methods for Rapid Differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis

    OpenAIRE

    Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco

    1999-01-01

    Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy pr...

  19. A new methodology for rapid detection of Lactobacillus delbrueckii subsp. bulgaricus based on multiplex PCR.

    Science.gov (United States)

    Nikolaou, Anastasios; Saxami, Georgia; Kourkoutas, Yiannis; Galanis, Alex

    2011-02-01

    In this study we present a novel multiplex PCR assay for rapid and efficient detection of Lactobacillus delbrueckii subsp. bulgaricus. The accuracy of our method was confirmed by the successful identification of L. delbrueckii subsp. bulgaricus in commercial yoghurts and food supplements and it may be readily applied to the food industry. Copyright © 2010 Elsevier B.V. All rights reserved.

  20. Allele-specific primer polymerase chain reaction for a single nucleotide polymorphism (C1205T) of swine Toll-like receptor 5 and comparison of the allelic frequency among several pig breeds in Japan and the Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Muneta, Y.; Minagawa, Y.; Kusumoto, M.; Shinkai, H.; Uenishi, H.; Šplíchal, Igor

    2012-01-01

    Roč. 56, č. 6 (2012), s. 385-391 ISSN 0385-5600 R&D Projects: GA ČR GA524/09/0365 Institutional support: RVO:61388971 Keywords : allele-specific PCR * Salmonella enterica serovar Choleraesuis * single nucleotide polymorphism Subject RIV: EC - Immunology Impact factor: 1.545, year: 2012

  1. Rapid detection of Pseudomonas aeruginosa from positive blood cultures by quantitative PCR

    Directory of Open Access Journals (Sweden)

    Cattoir Vincent

    2010-08-01

    Full Text Available Abstract Background Pseudomonas aeruginosa is responsible for numerous bloodstream infections associated with severe adverse outcomes in case of inappropriate initial antimicrobial therapy. The present study was aimed to develop a novel quantitative PCR (qPCR assay, using ecfX as the specific target gene, for the rapid and accurate identification of P. aeruginosa from positive blood cultures (BCs. Methods Over the period August 2008 to June 2009, 100 BC bottles positive for gram-negative bacilli were tested in order to evaluate performances of the qPCR technique with conventional methods as gold standard (i.e. culture and phenotypic identification. Results Thirty-three strains of P. aeruginosa, 53 strains of Enterobactericaeae, nine strains of Stenotrophomonas maltophilia and two other gram-negative species were isolated while 3 BCs were polymicrobial including one mixture containing P. aeruginosa. All P. aeruginosa clinical isolates were detected by qPCR except a single strain in mixed culture. Performances of the qPCR technique were: specificity, 100%; positive predictive value, 100%; negative predictive value, 98.5%; and sensitivity, 97%. Conclusions This reliable technique may offer a rapid (

  2. Allele-Specific Chromatin Recruitment and Therapeutic Vulnerabilities of ESR1 Activating Mutations.

    Science.gov (United States)

    Jeselsohn, Rinath; Bergholz, Johann S; Pun, Matthew; Cornwell, MacIntosh; Liu, Weihan; Nardone, Agostina; Xiao, Tengfei; Li, Wei; Qiu, Xintao; Buchwalter, Gilles; Feiglin, Ariel; Abell-Hart, Kayley; Fei, Teng; Rao, Prakash; Long, Henry; Kwiatkowski, Nicholas; Zhang, Tinghu; Gray, Nathanael; Melchers, Diane; Houtman, Rene; Liu, X Shirley; Cohen, Ofir; Wagle, Nikhil; Winer, Eric P; Zhao, Jean; Brown, Myles

    2018-02-12

    Estrogen receptor α (ER) ligand-binding domain (LBD) mutations are found in a substantial number of endocrine treatment-resistant metastatic ER-positive (ER + ) breast cancers. We investigated the chromatin recruitment, transcriptional network, and genetic vulnerabilities in breast cancer models harboring the clinically relevant ER mutations. These mutants exhibit both ligand-independent functions that mimic estradiol-bound wild-type ER as well as allele-specific neomorphic properties that promote a pro-metastatic phenotype. Analysis of the genome-wide ER binding sites identified mutant ER unique recruitment mediating the allele-specific transcriptional program. Genetic screens identified genes that are essential for the ligand-independent growth driven by the mutants. These studies provide insights into the mechanism of endocrine therapy resistance engendered by ER mutations and potential therapeutic targets. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. Nested PCR Assay for Eight Pathogens: A Rapid Tool for Diagnosis of Bacterial Meningitis.

    Science.gov (United States)

    Bhagchandani, Sharda P; Kubade, Sushant; Nikhare, Priyanka P; Manke, Sonali; Chandak, Nitin H; Kabra, Dinesh; Baheti, Neeraj N; Agrawal, Vijay S; Sarda, Pankaj; Mahajan, Parikshit; Ganjre, Ashish; Purohit, Hemant J; Singh, Lokendra; Taori, Girdhar M; Daginawala, Hatim F; Kashyap, Rajpal S

    2016-02-01

    Bacterial meningitis is a dreadful infectious disease with a high mortality and morbidity if remained undiagnosed. Traditional diagnostic methods for bacterial meningitis pose a challenge in accurate identification of pathogen, making prognosis difficult. The present study is therefore aimed to design and evaluate a specific and sensitive nested 16S rDNA genus-based polymerase chain reaction (PCR) assay using clinical cerebrospinal fluid (CSF) for rapid diagnosis of eight pathogens causing the disease. The present work was dedicated to development of an in-house genus specific 16S rDNA nested PCR covering pathogens of eight genera responsible for causing bacterial meningitis using newly designed as well as literature based primers for respective genus. A total 150 suspected meningitis CSF obtained from the patients admitted to Central India Institute of Medical Sciences (CIIMS), India during the period from August 2011 to May 2014, were used to evaluate clinical sensitivity and clinical specificity of optimized PCR assays. The analytical sensitivity and specificity of our newly designed genus-specific 16S rDNA PCR were found to be ≥92%. With such a high sensitivity and specificity, our in-house nested PCR was able to give 100% sensitivity in clinically confirmed positive cases and 100% specificity in clinically confirmed negative cases indicating its applicability in clinical diagnosis. Our in-house nested PCR system therefore can diagnose the accurate pathogen causing bacterial meningitis and therefore be useful in selecting a specific treatment line to minimize morbidity. Results are obtained within 24 h and high sensitivity makes this nested PCR assay a rapid and accurate diagnostic tool compared to traditional culture-based methods.

  4. Rapid direct identification of Cryptococcus neoformans from pigeon droppings by nested PCR using CNLAC1 gene.

    Science.gov (United States)

    Chae, H S; Park, G N; Kim, S H; Jo, H J; Kim, J T; Jeoung, H Y; An, D J; Kim, N H; Shin, B W; Kang, Y I; Chang, K S

    2012-08-01

    Isolation and identification of Cryptococcus neoformans and pathogenic yeast-like fungi from pigeon droppings has been taken for a long time and requires various nutrients for its growth. In this study, we attempted to establish a rapid direct identification method of Cr. neoformans from pigeon dropping samples by nested-PCR using internal transcribed spacer (ITS) CAP64 and CNLAC1 genes, polysaccharide capsule gene and laccase-associated gene to produce melanin pigment, respectively, which are common genes of yeasts. The ITS and CAP64 genes were amplified in all pathogenic yeasts, but CNLAC1 was amplified only in Cr. neoformans. The ITS gene was useful for yeast genotyping depending on nucleotide sequence. Homology of CAP64 genes among the yeasts were very high. The specificity of PCR using CNLAC1 was demonstrated in Cr. neoformans environmental strains but not in other yeast-like fungi. The CNLAC1 gene was detected in 5 serotypes of Cr. neoformans. The nested-PCR amplified up to 10(-11) μg of the genomic DNA and showed high sensitivity. All pigeon droppings among 31 Cr. neoformans-positive samples were positive and all pigeon droppings among 348 Cr. neoformans-negative samples were negative by the direct nested-PCR. In addition, after primary enrichment of pigeon droppings in Sabouraud dextrose broth, all Cr. neoformans-negative samples were negative by the nested-PCR, which showed high specificity. The nested-PCR showed high sensitivity without culture of pigeon droppings. Nested-PCR using CNLAC1 provides a rapid and reliable molecular diagnostic method to overcome weak points such as long culture time of many conventional methods.

  5. Screening for SNPs with Allele-Specific Methylation based on Next-Generation Sequencing Data

    OpenAIRE

    Hu, Bo; Ji, Yuan; Xu, Yaomin; Ting, Angela H

    2013-01-01

    Allele-specific methylation (ASM) has long been studied but mainly documented in the context of genomic imprinting and X chromosome inactivation. Taking advantage of the next-generation sequencing technology, we conduct a high-throughput sequencing experiment with four prostate cell lines to survey the whole genome and identify single nucleotide polymorphisms (SNPs) with ASM. A Bayesian approach is proposed to model the counts of short reads for each SNP conditional on its genotypes of multip...

  6. Allele-specific deletions in mouse tumors identify Fbxw7 as germline modifier of tumor susceptibility.

    Directory of Open Access Journals (Sweden)

    Jesus Perez-Losada

    Full Text Available Genome-wide association studies (GWAS have been successful in finding associations between specific genetic variants and cancer susceptibility in human populations. These studies have identified a range of highly statistically significant associations between single nucleotide polymorphisms (SNPs and susceptibility to development of a range of human tumors. However, the effect of each SNP in isolation is very small, and all of the SNPs combined only account for a relatively minor proportion of the total genetic risk (5-10%. There is therefore a major requirement for alternative routes to the discovery of genetic risk factors for cancer. We have previously shown using mouse models that chromosomal regions harboring susceptibility genes identified by linkage analysis frequently exhibit allele-specific genetic alterations in tumors. We demonstrate here that the Fbxw7 gene, a commonly mutated gene in a wide range of mouse and human cancers, shows allele-specific deletions in mouse lymphomas and skin tumors. Lymphomas from three different F1 hybrids show 100% allele-specificity in the patterns of allelic loss. Parental alleles from 129/Sv or Spretus/Gla mice are lost in tumors from F1 hybrids with C57BL/6 animals, due to the presence of a specific non-synonymous coding sequence polymorphism at the N-terminal portion of the gene. A specific genetic test of association between this SNP and lymphoma susceptibility in interspecific backcross mice showed a significant linkage (p = 0.001, but only in animals with a functional p53 gene. These data therefore identify Fbxw7 as a p53-dependent tumor susceptibility gene. Increased p53-dependent tumor susceptibility and allele-specific losses were also seen in a mouse skin model of skin tumor development. We propose that analysis of preferential allelic imbalances in tumors may provide an efficient means of uncovering genetic variants that affect mouse and human tumor susceptibility.

  7. A small asparagine-rich protein required for S-allele-specific pollen rejection in Nicotiana.

    Science.gov (United States)

    McClure, B; Mou, B; Canevascini, S; Bernatzky, R

    1999-11-09

    Although S-locus RNases (S-RNases) determine the specificity of pollen rejection in self-incompatible (SI) solanaceous plants, they alone are not sufficient to cause S-allele-specific pollen rejection. To identify non-S-RNase sequences that are required for pollen rejection, a Nicotiana alata cDNA library was screened by differential hybridization. One clone, designated HT, hybridized strongly to RNA from N. alata styles but not to RNA from Nicotiana plumbaginifolia, a species known to lack one or more factors necessary for S-allele-specific pollen rejection. Sequence analysis revealed a 101-residue ORF including a putative secretion signal and an asparagine-rich domain near the C terminus. RNA blot analysis showed that the HT-transcript accumulates in the stigma and style before anthesis. The timing of HT-expression lags slightly behind S(C10)-RNase in SI N. alata S(C10)S(C10) and is well correlated with the onset of S-allele-specific pollen rejection in the style. An antisense-HT construct was prepared to test for a role in pollen rejection. Transformed (N. plumbaginifolia x SI N. alata S(C10)S(C10)) hybrids with reduced levels of HT-protein continued to express S(C10)-RNase but failed to reject S(C10)-pollen. Control hybrids expressing both S(C10)-RNase and HT-protein showed a normal S-allele-specific pollen rejection response. We conclude that HT-protein is directly implicated in pollen rejection.

  8. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    Directory of Open Access Journals (Sweden)

    Nelly eDatukishvili

    2015-07-01

    Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  9. New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

    Science.gov (United States)

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  10. Arbitrarily primed PCR- A rapid and simple method for typing of leptospiral serovars

    Directory of Open Access Journals (Sweden)

    Ramadass P

    2002-01-01

    Full Text Available PURPOSE: To investigate the use of arbitrarily primed polymerase chain reaction (AP-PCR for typing of leptospiral serovars. METHODS: AP-PCR was adopted for identification of laboratory strains of leptospires and leptospiral cultures at serovar level. A primer of 12 bp was used for amplifying DNA of 13 laboratory strains of leptospires as well as culture pellets of leptospires. RESULTS: Each serovar produced distinct DNA fingerprint which was characteristic for each serovar. These patterns were used for typing of 81 serum culture samples obtained from human leptospiral cases. Of these samples, 39 could be typed based on AP-PCR fingerprints belonging to serovars autumnalis, pomona, canicola, javanica, icterohaemorrhagiae, patoc and pyrogenes. These results were confirmed by RAPD fingerprinting of the DNA samples of the respective leptospiral serovars after culturing -FNx01them in EMJH media. One of the important findings of this work was that straight culture sample could be used for AP-PCR assay, without purification of DNA. By having more number of AP-PCR reference fingerprints, more serovars could be typed. CONCLUSIONS: AP-PCR technique provides great potential for simple and rapid identification of leptospires at serovar level, which could be useful in molecular epidemiological studies of leptospirosis.

  11. A rapid method for screening arrayed plasmid cDNA library by PCR

    International Nuclear Information System (INIS)

    Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong

    1999-01-01

    Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency

  12. Rapid PCR amplification using a microfluidic device with integrated microwave heating and air impingement cooling.

    Science.gov (United States)

    Shaw, Kirsty J; Docker, Peter T; Yelland, John V; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

    2010-07-07

    A microwave heating system is described for performing polymerase chain reaction (PCR) in a microfluidic device. The heating system, in combination with air impingement cooling, provided rapid thermal cycling with heating and cooling rates of up to 65 degrees C s(-1) and minimal over- or under-shoot (+/-0.1 degrees C) when reaching target temperatures. In addition, once the required temperature was reached it could be maintained with an accuracy of +/-0.1 degrees C. To demonstrate the functionality of the system, PCR was successfully performed for the amplification of the Amelogenin locus using heating rates and quantities an order of magnitude faster and smaller than current commercial instruments.

  13. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Directory of Open Access Journals (Sweden)

    Tian-Min Qiao

    2016-10-01

    Full Text Available Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP were developed for detection of C. scoparium based on factor 1-alpha (tef1 and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  14. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Science.gov (United States)

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-01-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products. PMID:27721691

  15. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus.

    Science.gov (United States)

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-10-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium , has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium . The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  16. Allele-specific physical interactions regulate the heterotic traits in hybrids of Arabidopsis thaliana ecotypes

    Directory of Open Access Journals (Sweden)

    Babita Singh

    2017-10-01

    Full Text Available Heterosis is an important phenomenon for the breeding in agricultural crops as it influences yield related traits such as biomass yield, seed number and weight, adaptive and reproductive traits. However, the level of heterosis greatly varies for different traits and different genotypes. The present study focuses on identification of physical interactions between alleles and their role in transcriptional regulation in heterotic plants. Here, we used two Arabidopsis ecotypes; Col-0 and C24 as parent for crosses. We performed crossing between these ecotypes and screened the F1 hybrids on the basis of different SSR markers. Further, we used Hi-C to capture intra- and inter-chromosomal physical interactions between alleles on genome-wide level. Then, we identified allele-specific chromatin interactions and constructed genome-wide allele-specific contact maps at different resolutions for the entire chromosome. We also performed RNA-seq of hybrids and their parents. RNA-seq analysis identified several differentially expressed genes and non-additively expressed genes in hybrids with respect to their parents. Further, to understand the biological significance of these chromatin interactions, we annotated these interactions and correlated with the transcriptome data. Thus, our study provides alleles-specific chromatin interactions in genome-wide fashion which play a crucial role in regulation of different genes that may be important for heterosis.

  17. A PCR detection method for rapid identification of Melissococcus pluton in honeybee larvae.

    Science.gov (United States)

    Govan, V A; Brözel, V; Allsopp, M H; Davison, S

    1998-05-01

    Melissococcus pluton is the causative agent of European foulbrood, a disease of honeybee larvae. This bacterium is particularly difficult to isolate because of its stringent growth requirements and competition from other bacteria. PCR was used selectively to amplify specific rRNA gene sequences of M. pluton from pure culture, from crude cell lysates, and directly from infected bee larvae. The PCR primers were designed from M. pluton 16S rRNA sequence data. The PCR products were visualized by agarose gel electrophoresis and confirmed as originating from M. pluton by sequencing in both directions. Detection was highly specific, and the probes did not hybridize with DNA from other bacterial species tested. This method enabled the rapid and specific detection and identification of M. pluton from pure cultures and infected bee larvae.

  18. Comprehensive and Rapid Real-Time PCR Analysis of 21 Foodborne Outbreaks

    Directory of Open Access Journals (Sweden)

    Hiroshi Fukushima

    2009-01-01

    Full Text Available A set of four duplex SYBR Green I PCR (SG-PCR assay combined with DNA extraction using QIAamp DNA Stool Mini kit was evaluated for the detection of foodborne bacteria from 21 foodborne outbreaks. The causative pathogens were detected in almost all cases in 2 hours or less. The first run was for the detection of 8 main foodborne pathogens in 5 stool specimens within 2 hours and the second run was for the detection of other unusual suspect pathogens within a further 45 minutes. After 2 to 4 days, the causative agents were isolated and identified. The results proved that for comprehensive and rapid molecular diagnosis in foodborne outbreaks, Duplex SG-PCR assay is not only very useful, but is also economically viable for one-step differentiation of causative pathogens in fecal specimens obtained from symptomatic patients. This then allows for effective diagnosis and management of foodborne outbreaks.

  19. Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.

    Science.gov (United States)

    Kageyama, A; Benno, Y

    2001-01-01

    PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.

  20. A Rapid and Low-Cost PCR Thermal Cycler for Low Resource Settings.

    Directory of Open Access Journals (Sweden)

    Grace Wong

    Full Text Available Many modern molecular diagnostic assays targeting nucleic acids are typically confined to developed countries or to the national reference laboratories of developing-world countries. The ability to make technologies for the rapid diagnosis of infectious diseases broadly available in a portable, low-cost format would mark a revolutionary step forward in global health. Many molecular assays are also developed based on polymerase chain reactions (PCR, which require thermal cyclers that are relatively heavy (>20 pounds and need continuous electrical power. The temperature ramping speed of most economical thermal cyclers are relatively slow (2 to 3 °C/s so a polymerase chain reaction can take 1 to 2 hours. Most of all, these thermal cyclers are still too expensive ($2k to $4k for low-resource setting uses.In this article, we demonstrate the development of a low-cost and rapid water bath based thermal cycler that does not require active temperature control or continuous power supply during PCR. This unit costs $130 to build using commercial off-the-shelf items. The use of two or three vacuum-insulated stainless-steel Thermos food jars containing heated water (for denaturation and annealing/extension steps and a layer of oil on top of the water allow for significantly stabilized temperatures for PCR to take place. Using an Arduino-based microcontroller, we automate the "archaic" method of hand-transferring PCR tubes between water baths.We demonstrate that this innovative unit can deliver high speed PCR (17 s per PCR cycle with the potential to go beyond the 1,522 bp long amplicons tested in this study and can amplify from templates down to at least 20 copies per reaction. The unit also accepts regular PCR tubes and glass capillary tubes. The PCR efficiency of our thermal cycler is not different from other commercial thermal cyclers. When combined with a rapid nucleic acid detection approach, the thermos thermal cycler (TTC can enable on-site molecular

  1. Rapid-viability PCR method for detection of live, virulent Bacillus anthracis in environmental samples.

    Science.gov (United States)

    Létant, Sonia E; Murphy, Gloria A; Alfaro, Teneile M; Avila, Julie R; Kane, Staci R; Raber, Ellen; Bunt, Thomas M; Shah, Sanjiv R

    2011-09-01

    In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real-time PCR analysis is conducted on samples before and after incubation. The method, referred to as rapid-viability (RV)-PCR, uses the change in cycle threshold after incubation to detect the presence of live organisms. In this article, we report a novel RV-PCR method for detection of live, virulent Bacillus anthracis, in which the incubation time was reduced from 14 h to 9 h, bringing the total turnaround time for results below 15 h. The method incorporates a magnetic bead-based DNA extraction and purification step prior to PCR analysis, as well as specific real-time PCR assays for the B. anthracis chromosome and pXO1 and pXO2 plasmids. A single laboratory verification of the optimized method applied to the detection of virulent B. anthracis in environmental samples was conducted and showed a detection level of 10 to 99 CFU/sample with both manual and automated RV-PCR methods in the presence of various challenges. Experiments exploring the relationship between the incubation time and the limit of detection suggest that the method could be further shortened by an additional 2 to 3 h for relatively clean samples.

  2. Evaluation of PCR electrospray-ionization mass spectrometry for rapid molecular diagnosis of bovine mastitis.

    Science.gov (United States)

    Perreten, Vincent; Endimiani, Andrea; Thomann, Andreas; Wipf, Juliette R K; Rossano, Alexandra; Bodmer, Michèle; Raemy, Andreas; Sannes-Lowery, Kristin A; Ecker, David J; Sampath, Rangarajan; Bonomo, Robert A; Washington, Cicely

    2013-06-01

    Bovine mastitis, an inflammatory disease of the mammary gland, is one of the most costly diseases affecting the dairy industry. The treatment and prevention of this disease is linked heavily to the use of antibiotics in agriculture and early detection of the primary pathogen is essential to control the disease. Milk samples (n=67) from cows suffering from mastitis were analyzed for the presence of pathogens using PCR electrospray-ionization mass spectrometry (PCR/ESI-MS) and were compared with standard culture diagnostic methods. Concurrent identification of the primary mastitis pathogens was obtained for 64% of the tested milk samples, whereas divergent results were obtained for 27% of the samples. The PCR/ESI-MS failed to identify some of the primary pathogens in 18% of the samples, but identified other pathogens as well as microorganisms in samples that were negative by culture. The PCR/ESI-MS identified bacteria to the species level as well as yeasts and molds in samples that contained a mixed bacterial culture (9%). The sensitivity of the PCR/ESI-MS for the most common pathogens ranged from 57.1 to 100% and the specificity ranged from 69.8 to 100% using culture as gold standard. The PCR/ESI-MS also revealed the presence of the methicillin-resistant gene mecA in 16.2% of the milk samples, which correlated with the simultaneous detection of staphylococci including Staphylococcus aureus. We demonstrated that PCR/ESI-MS, a more rapid diagnostic platform compared with bacterial culture, has the significant potential to serve as an important screening method in the diagnosis of bovine clinical mastitis and has the capacity to be used in infection control programs for both subclinical and clinical disease. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  3. A rapid PCR-based approach for molecular identification of filamentous fungi.

    Science.gov (United States)

    Chen, Yuanyuan; Prior, Bernard A; Shi, Guiyang; Wang, Zhengxiang

    2011-08-01

    In this study, a novel rapid and efficient DNA extraction method based on alkaline lysis, which can deal with a large number of filamentous fungal isolates in the same batch, was established. The filamentous fungal genomic DNA required only 20 min to prepare and can be directly used as a template for PCR amplification. The amplified internal transcribed spacer regions were easy to identify by analysis. The extracted DNA also can be used to amplify other protein-coding genes for fungal identification. This method can be used for rapid systematic identification of filamentous fungal isolates.

  4. Development of an allele-specific, loop-mediated, isothermal amplification method (AS-LAMP to detect the L1014F kdr-w mutation in Anopheles gambiae s. l.

    Directory of Open Access Journals (Sweden)

    Badolo Athanase

    2012-07-01

    Full Text Available Abstract Background Malaria control relies heavily on treated bed nets and indoor residual spraying with pyrethroid insecticides. Unfortunately, the resistance to pyrethroid insecticides, mainly due to the kdr mutation, is spreading in the main malaria vector Anopheles gambiae s.l., decreasing the insecticides’ efficacy. To manage the insecticide resistance rapidly and flexibly, simple and effective tools for the early detection of resistant mosquitoes are needed. This study aimed to develop an allele-specific, loop-mediated, isothermal amplification (AS-LAMP method to detect the West African-type kdr mutation (kdr-w; L1014F in field-collected mosquitoes. Methods DNA fragments of the wild-type and the mutated kdr gene were used to select the primers and develop the method. The primers were designed with the mutation at the 5’ end of the backward inner primer (BIP. The AS-LAMP method was compared to the AS-PCR method using the genomic DNA of 120 field-collected mosquitoes. Results The AS-LAMP method could discriminate between the wild-type homozygote, the heterozygote, and the kdr-w homozygote within 75 min. The AS-LAMP method has the advantage of being faster and at least as sensitive and specific as the AS-PCR method. Conclusions The AS-LAMP method can be used to detect the kdr mutation for quick decision-making, even in less well-equipped laboratories.

  5. Genome-wide survey of allele-specific splicing in humans

    Directory of Open Access Journals (Sweden)

    Scheffler Konrad

    2008-06-01

    Full Text Available Abstract Background Accurate mRNA splicing depends on multiple regulatory signals encoded in the transcribed RNA sequence. Many examples of mutations within human splice regulatory regions that alter splicing qualitatively or quantitatively have been reported and allelic differences in mRNA splicing are likely to be a common and important source of phenotypic diversity at the molecular level, in addition to their contribution to genetic disease susceptibility. However, because the effect of a mutation on the efficiency of mRNA splicing is often difficult to predict, many mutations that cause disease through an effect on splicing are likely to remain undiscovered. Results We have combined a genome-wide scan for sequence polymorphisms likely to affect mRNA splicing with analysis of publicly available Expressed Sequence Tag (EST and exon array data. The genome-wide scan uses published tools and identified 30,977 SNPs located within donor and acceptor splice sites, branch points and exonic splicing enhancer elements. For 1,185 candidate splicing polymorphisms the difference in splicing between alternative alleles was corroborated by publicly available exon array data from 166 lymphoblastoid cell lines. We developed a novel probabilistic method to infer allele-specific splicing from EST data. The method uses SNPs and alternative mRNA isoforms mapped to EST sequences and models both regulated alternative splicing as well as allele-specific splicing. We have also estimated heritability of splicing and report that a greater proportion of genes show evidence of splicing heritability than show heritability of overall gene expression level. Our results provide an extensive resource that can be used to assess the possible effect on splicing of human polymorphisms in putative splice-regulatory sites. Conclusion We report a set of genes showing evidence of allele-specific splicing from an integrated analysis of genomic polymorphisms, EST data and exon array

  6. Impact of a Rapid Herpes Simplex Virus PCR Assay on Duration of Acyclovir Therapy.

    Science.gov (United States)

    Van, Tam T; Mongkolrattanothai, Kanokporn; Arevalo, Melissa; Lustestica, Maryann; Dien Bard, Jennifer

    2017-05-01

    Herpes simplex virus (HSV) infections of the central nervous system (CNS) are associated with significant morbidity and mortality rates in children. This study assessed the impact of a direct HSV (dHSV) PCR assay on the time to result reporting and the duration of acyclovir therapy for children with signs and symptoms of meningitis and encephalitis. A total of 363 patients with HSV PCR results from cerebrospinal fluid (CSF) samples were included in this retrospective analysis, divided into preimplementation and postimplementation groups. For the preimplementation group, CSF testing was performed using a laboratory-developed real-time PCR assay; for the postimplementation group, CSF samples were tested using a direct sample-to-answer assay. All CSF samples were negative for HSV. Over 60% of patients from both groups were prescribed acyclovir. The average HSV PCR test turnaround time for the postimplementation group was reduced by 14.5 h (23.6 h versus 9.1 h; P < 0.001). Furthermore, 79 patients (43.6%) in the postimplementation group had dHSV PCR results reported <4 h after specimen collection. The mean time from specimen collection to acyclovir discontinuation was 17.1 h shorter in the postimplementation group (31.1 h versus 14 h; P < 0.001). The median duration of acyclovir therapy was also significantly reduced in the postimplementation group (29.2 h versus 14.3 h; P = 0.01). Our investigation suggests that implementation of rapid HSV PCR testing can decrease turnaround times and the duration of unnecessary acyclovir therapy. Copyright © 2017 American Society for Microbiology.

  7. A Simple PCR Method for Rapid Genotype Analysis of Mycobacterium ulcerans

    Science.gov (United States)

    Stinear, Timothy; Davies, John K.; Jenkin, Grant A.; Portaels, Françoise; Ross, Bruce C.; OppEdIsano, Frances; Purcell, Maria; Hayman, John A.; Johnson, Paul D. R.

    2000-01-01

    Two high-copy-number insertion sequences, IS2404 and IS2606, were recently identified in Mycobacterium ulcerans and were shown by Southern hybridization to possess restriction fragment length polymorphism between strains from different geographic origins. We have designed a simple genotyping method that captures these differences by PCR amplification of the region between adjacent copies of IS2404 and IS2606. We have called this system 2426 PCR. The method is rapid, reproducible, sensitive, and specific for M. ulcerans, and it has confirmed previous studies suggesting a clonal population structure of M. ulcerans within a geographic region. M. ulcerans isolates from Australia, Papua New Guinea, Malaysia, Surinam, Mexico, Japan, China, and several countries in Africa were easily differentiated based on an array of 4 to 14 PCR products ranging in size from 200 to 900 bp. Numerical analysis of the banding patterns suggested a close evolutionary link between M. ulcerans isolates from Africa and southeast Asia. The application of 2426 PCR to total DNA, extracted directly from M. ulcerans-infected tissue specimens without culture, demonstrated the sensitivity and specificity of this method and confirmed for the first time that both animal and human isolates from areas of endemicity in southeast Australia have the same genotype. PMID:10747130

  8. [Real-time PCR in rapid diagnosis of Aeromonas hydrophila necrotizing soft tissue infections].

    Science.gov (United States)

    Kohayagawa, Yoshitaka; Izumi, Yoko; Ushita, Misuzu; Niinou, Norio; Koshizaki, Masayuki; Yamamori, Yuji; Kaneko, Sakae; Fukushima, Hiroshi

    2009-11-01

    We report a case of rapidly progressive necrotizing soft tissue infection and sepsis followed by a patient's death. We suspected Vibrio vulnificus infection because the patient's underlying disease was cirrhosis and the course extremely rapid. No microbe had been detected at death. We extracted DNA from a blood culture bottle. SYBR green I real-time PCR was conducted but could not detect V. vulnificus vvh in the DNA sample. Aeromonas hydrophila was cultured and identified in blood and necrotized tissue samples. Real-time PCR was conducted to detect A. hydrophila ahh1, AHCYTOEN and aerA in the DNA sample extracted from the blood culture bottle and an isolated necrotized tissue strain, but only ahh1 was positive. High-mortality in necrotizing soft tissue infections makes it is crucial to quickly detect V. vulnificus and A. hydrophila. We found real-time PCR for vvh, ahh1, AHCYTOEN, and aerA useful in detecting V. vulnificus and A. hydrophila in necrotizing soft tissue infections.

  9. Rapid and reliable detection and identification of GM events using multiplex PCR coupled with oligonucleotide microarray.

    Science.gov (United States)

    Xu, Xiaodan; Li, Yingcong; Zhao, Heng; Wen, Si-yuan; Wang, Sheng-qi; Huang, Jian; Huang, Kun-lun; Luo, Yun-bo

    2005-05-18

    To devise a rapid and reliable method for the detection and identification of genetically modified (GM) events, we developed a multiplex polymerase chain reaction (PCR) coupled with a DNA microarray system simultaneously aiming at many targets in a single reaction. The system included probes for screening gene, species reference gene, specific gene, construct-specific gene, event-specific gene, and internal and negative control genes. 18S rRNA was combined with species reference genes as internal controls to assess the efficiency of all reactions and to eliminate false negatives. Two sets of the multiplex PCR system were used to amplify four and five targets, respectively. Eight different structure genes could be detected and identified simultaneously for Roundup Ready soybean in a single microarray. The microarray specificity was validated by its ability to discriminate two GM maizes Bt176 and Bt11. The advantages of this method are its high specificity and greatly reduced false-positives and -negatives. The multiplex PCR coupled with microarray technology presented here is a rapid and reliable tool for the simultaneous detection of GM organism ingredients.

  10. Rapid quantification of plant-powdery mildew interactions by qPCR and conidiospore counts.

    Science.gov (United States)

    Weßling, Ralf; Panstruga, Ralph

    2012-08-31

    The powdery mildew disease represents a valuable patho-system to study the interaction between plant hosts and obligate biotrophic fungal pathogens. Numerous discoveries have been made on the basis of the quantitative evaluation of plant-powdery mildew interactions, especially in the context of hyper-susceptible and/or resistant plant mutants. However, the presently available methods to score the pathogenic success of powdery mildew fungi are laborious and thus not well suited for medium- to high-throughput analysis. Here we present two new protocols that allow the rapid quantitative assessment of powdery mildew disease development. One procedure depends on quantitative polymerase chain reaction (qPCR)-based evaluation of fungal biomass, while the other relies on the quantification of fungal conidiospores. We validated both techniques using the powdery mildew pathogen Golovinomyces orontii on a set of hyper-susceptible and resistant Arabidopsis thaliana mutants and found that both cover a wide dynamic range of one to two (qPCR) and four to five (quantification of conidia) orders of magnitude, respectively. The two approaches yield reproducible results and are easy to perform without specialized equipment. The qPCR and spore count assays rapidly and reproducibly quantify powdery mildew pathogenesis. Our methods are performed at later stages of infection and discern mutant phenotypes accurately. The assays therefore complement currently used procedures of powdery mildew quantification and can overcome some of their limitations. In addition, they can easily be adapted to other plant-powdery mildew patho-systems.

  11. Use of PCR-Based Methods for Rapid Differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis

    Science.gov (United States)

    Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco

    1999-01-01

    Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059

  12. Use of PCR-based methods for rapid differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis.

    Science.gov (United States)

    Torriani, S; Zapparoli, G; Dellaglio, F

    1999-10-01

    Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.

  13. Allele-specific cytokine responses at the HLA-C locus, implications for psoriasis

    Science.gov (United States)

    Hundhausen, Christian; Bertoni, Anna; Mak, Rose K; Botti, Elisabetta; Di Meglio, Paola; Clop, Alex; Laggner, Ute; Chimenti, Sergio; Hayday, Adrian C; Barker, Jonathan N; Trembath, Richard C; Capon, Francesca; Nestle, Frank O

    2011-01-01

    Psoriasis is an inflammatory skin disorder that is inherited as a complex trait. Genetic studies have repeatedly highlighted HLA-C as the major determinant for psoriasis susceptibility, with the Cw*0602 allele conferring significant disease risk in a wide-range of populations. Despite the potential importance of HLA-C variation in psoriasis, either via an effect on peptide presentation or immuno-inhibitory activity, allele-specific expression patterns have not been investigated. Here, we used reporter assays to characterize two regulatory variants, which virtually abolished the response to TNF-α (rs2524094) and IFN-γ (rs10657191) in HLA-Cw*0602 and a cluster of related alleles. We validated these findings through the analysis of HLA-Cw*0602 expression in primary keratinocytes treated with TNF-α and IFN-γ. Finally, we showed that HLA-Cw*0602 transcripts are not increased in psoriatic skin lesions, despite highly elevated TNF-α levels. Thus, our findings demonstrate the presence of allele-specific differences in HLA-C expression and indicate that HLA-Cw*0602 is unresponsive to up-regulation by key pro-inflammatory cytokines in psoriasis. These data pave the way for functional studies into the pathogenic role of the major psoriasis susceptibility allele. PMID:22113476

  14. Allele-specific cytokine responses at the HLA-C locus: implications for psoriasis.

    Science.gov (United States)

    Hundhausen, Christian; Bertoni, Anna; Mak, Rose K; Botti, Elisabetta; Di Meglio, Paola; Clop, Alex; Laggner, Ute; Chimenti, Sergio; Hayday, Adrian C; Barker, Jonathan N; Trembath, Richard C; Capon, Francesca; Nestle, Frank O

    2012-03-01

    Psoriasis is an inflammatory skin disorder that is inherited as a complex trait. Genetic studies have repeatedly highlighted HLA-C as the major determinant for psoriasis susceptibility, with the Cw*0602 allele conferring significant disease risk in a wide range of populations. Despite the potential importance of HLA-C variation in psoriasis, either via an effect on peptide presentation or immuno-inhibitory activity, allele-specific expression patterns have not been investigated. Here, we used reporter assays to characterize two regulatory variants, which virtually abolished the response to tumor necrosis factor (TNF)-α (rs2524094) and IFN-γ (rs10657191) in HLA-Cw*0602 and a cluster of related alleles. We validated these findings through the analysis of HLA-Cw*0602 expression in primary keratinocytes treated with TNF-α and IFN-γ. Finally, we showed that HLA-Cw*0602 transcripts are not increased in psoriatic skin lesions, despite highly elevated TNF-α levels. Thus, our findings demonstrate the presence of allele-specific differences in HLA-C expression and indicate that HLA-Cw*0602 is unresponsive to upregulation by key proinflammatory cytokines in psoriasis. These data pave the way for functional studies into the pathogenic role of the major psoriasis susceptibility allele.

  15. Development of a high-speed real-time PCR system for rapid and precise nucleotide recognition

    Science.gov (United States)

    Terazono, Hideyuki; Takei, Hiroyuki; Hattori, Akihiro; Yasuda, Kenji

    2010-04-01

    Polymerase chain reaction (PCR) is a common method used to create copies of a specific target region of a DNA sequence and to produce large quantities of DNA. A few DNA molecules, which act as templates, are rapidly amplified by PCR into many billions of copies. PCR is a key technology in genome-based biological analysis, revolutionizing many life science fields such as medical diagnostics, food safety monitoring, and countermeasures against bioterrorism. Thus, many applications have been developed with the thermal cycling. For these PCR applications, one of the most important key factors is reduction in the data acquisition time. To reduce the acquisition time, it is necessary to decrease the temperature transition time between the high and low ends as much as possible. We have developed a novel rapid real-time PCR system based on rapid exchange of media maintained at different temperatures. This system consists of two thermal reservoirs and a reaction chamber for PCR observation. The temperature transition was achieved within 0.3 sec, and good thermal stability was achieved during thermal cycling with rapid exchange of circulating media. This system allows rigorous optimization of the temperatures required for each stage of the PCR processes. Resulting amplicons were confirmed by electrophoresis. Using the system, rapid DNA amplification was accomplished within 3.5 min, including initial heating and complete 50 PCR cycles. It clearly shows that the device could allow us faster temperature switching than the conventional conduction-based heating systems based on Peltier heating/cooling.

  16. Rapid identification of Yersinia pestis and Brucella melitensis by chip-based continuous flow PCR

    Science.gov (United States)

    Dietzsch, Michael; Hlawatsch, Nadine; Melzer, Falk; Tomaso, Herbert; Gärtner, Claudia; Neubauer, Heinrich

    2012-06-01

    To combat the threat of biological agents like Yersinia pestis and Brucella melitensis in bioterroristic scenarios requires fast, easy-to-use and safe identification systems. In this study we describe a system for rapid amplification of specific genetic markers for the identification of Yersinia pestis and Brucella melitensis. Using chip based PCR and continuous flow technology we were able to amplify the targets simultaneously with a 2-step reaction profile within 20 minutes. The subsequent analysis of amplified fragments by standard gel electrophoresis requires another 45 minutes. We were able to detect both pathogens within 75 minutes being much faster than most other nucleic acid amplification technologies.

  17. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    , in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...

  18. The Rotary Zone Thermal Cycler: A Low-Power System Enabling Automated Rapid PCR

    Science.gov (United States)

    Bartsch, Michael S.; Renzi, Ronald F.; Van de Vreugde, James L.; Kim, Hanyoup; Knight, Daniel L.; Sinha, Anupama; Branda, Steven S.; Patel, Kamlesh D.

    2015-01-01

    Advances in molecular biology, microfluidics, and laboratory automation continue to expand the accessibility and applicability of these methods beyond the confines of conventional, centralized laboratory facilities and into point of use roles in clinical, military, forensic, and field-deployed applications. As a result, there is a growing need to adapt the unit operations of molecular biology (e.g., aliquoting, centrifuging, mixing, and thermal cycling) to compact, portable, low-power, and automation-ready formats. Here we present one such adaptation, the rotary zone thermal cycler (RZTC), a novel wheel-based device capable of cycling up to four different fixed-temperature blocks into contact with a stationary 4-microliter capillary-bound sample to realize 1-3 second transitions with steady state heater power of less than 10 W. We demonstrate the utility of the RZTC for DNA amplification as part of a highly integrated rotary zone PCR (rzPCR) system that uses low-volume valves and syringe-based fluid handling to automate sample loading and unloading, thermal cycling, and between-run cleaning functionalities in a compact, modular form factor. In addition to characterizing the performance of the RZTC and the efficacy of different online cleaning protocols, we present preliminary results for rapid single-plex PCR, multiplex short tandem repeat (STR) amplification, and second strand cDNA synthesis. PMID:25826708

  19. The rotary zone thermal cycler: a low-power system enabling automated rapid PCR.

    Directory of Open Access Journals (Sweden)

    Michael S Bartsch

    Full Text Available Advances in molecular biology, microfluidics, and laboratory automation continue to expand the accessibility and applicability of these methods beyond the confines of conventional, centralized laboratory facilities and into point of use roles in clinical, military, forensic, and field-deployed applications. As a result, there is a growing need to adapt the unit operations of molecular biology (e.g., aliquoting, centrifuging, mixing, and thermal cycling to compact, portable, low-power, and automation-ready formats. Here we present one such adaptation, the rotary zone thermal cycler (RZTC, a novel wheel-based device capable of cycling up to four different fixed-temperature blocks into contact with a stationary 4-microliter capillary-bound sample to realize 1-3 second transitions with steady state heater power of less than 10 W. We demonstrate the utility of the RZTC for DNA amplification as part of a highly integrated rotary zone PCR (rzPCR system that uses low-volume valves and syringe-based fluid handling to automate sample loading and unloading, thermal cycling, and between-run cleaning functionalities in a compact, modular form factor. In addition to characterizing the performance of the RZTC and the efficacy of different online cleaning protocols, we present preliminary results for rapid single-plex PCR, multiplex short tandem repeat (STR amplification, and second strand cDNA synthesis.

  20. Rapid quantitative detection of Lactobacillus sakei in meat and fermented sausages by real-time PCR.

    Science.gov (United States)

    Martín, Belén; Jofré, Anna; Garriga, Margarita; Pla, Maria; Aymerich, Teresa

    2006-09-01

    A quick and simple method for quantitative detection of Lactobacillus sakei in fermented sausages was successfully developed. It is based on Chelex-100-based DNA purification and real-time PCR enumeration using a TaqMan fluorescence probe. Primers and probes were designed in the L. sakei 16S-23S rRNA intergenic transcribed spacer region, and the assay was evaluated using L. sakei genomic DNA and an artificially inoculated sausage model. The detection limit of this technique was approximately 3 cells per reaction mixture using both purified DNA and the inoculated sausage model. The quantification limit was established at 30 cells per reaction mixture in both models. The assay was then applied to enumerate L. sakei in real samples, and the results were compared to the MRS agar count method followed by confirmation of the percentage of L. sakei colonies. The results obtained by real-time PCR were not statistically significantly different than those obtained by plate count on MRS agar (P > 0.05), showing a satisfactory agreement between both methods. Therefore, the real-time PCR assay developed can be considered a promising rapid alternative method for the quantification of L. sakei and evaluation of the implantation of starter strains of L. sakei in fermented sausages.

  1. A rapid minor groove binder PCR method for distinguishing the vaccine strain Brucella abortus 104M.

    Science.gov (United States)

    Nan, Wenlong; Qin, Lide; Wang, Yong; Zhang, Yueyong; Tan, Pengfei; Chen, Yuqi; Mao, Kairong; Chen, Yiping

    2018-01-24

    Brucellosis is a widespread zoonotic disease caused by Gram-negative Brucella bacteria. Immunisation with attenuated vaccine is an effective method of prevention, but it can interfere with diagnosis. Live, attenuated Brucella abortus strain 104M has been used for the prevention of human brucellosis in China since 1965. However, at present, no fast and reliable method exists that can distinguish this strain from field strains. Single nucleotide polymorphism (SNP)-based assays offer a new approach for such discrimination. SNP-based minor groove binder (MGB) and Cycleave assays have been used for rapid identification of four Brucella vaccine strains (B. abortus strains S19, A19 and RB51, and B. melitensis Rev1). The main objective of this study was to develop a PCR assay for rapid and specific detection of strain 104M. We developed a SNP-based MGB PCR assay that could successfully distinguish strain 104M from 18 representative strains of Brucella (B. abortus biovars 1, 2, 3, 4, 5, 6, 7 and 9, B. melitensis biovars 1, 2 and 3, B. suis biovars 1, 2, 3 and 4, B. canis, B. neotomae, and B. ovis), four Brucella vaccine strains (A19, S19, S2, M5), and 55 Brucella clinical field strains. The assay gave a negative reaction with four non-Brucella species (Escherichia coli, Pasteurella multocida, Streptococcus suis and Pseudomonas aeruginosa). The minimum sensitivity of the assay, evaluated using 10-fold dilutions of chromosomal DNA, was 220 fg for the 104M strain and 76 fg for the single non-104M Brucella strain tested (B. abortus A19). The assay was also reproducible (intra- and inter-assay coefficients of variation = 0.006-0.022 and 0.012-0.044, respectively). A SNP-based MGB PCR assay was developed that could straightforwardly and unambiguously distinguish B. abortus vaccine strain 104M from non-104M Brucella strains. Compared to the classical isolation and identification approaches of bacteriology, this real-time PCR assay has substantial advantages in terms of

  2. Rapid and sensitive detection of Feline immunodeficiency virus using an insulated isothermal PCR-based assay with a point-of-need PCR detection platform.

    Science.gov (United States)

    Wilkes, Rebecca Penrose; Kania, Stephen A; Tsai, Yun-Long; Lee, Pei-Yu Alison; Chang, Hsiu-Hui; Ma, Li-Juan; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

    2015-07-01

    Feline immunodeficiency virus (FIV) is an important infectious agent of cats. Clinical syndromes resulting from FIV infection include immunodeficiency, opportunistic infections, and neoplasia. In our study, a 5' long terminal repeat/gag region-based reverse transcription insulated isothermal polymerase chain reaction (RT-iiPCR) was developed to amplify all known FIV strains to facilitate point-of-need FIV diagnosis. The RT-iiPCR method was applied in a point-of-need PCR detection platform--a field-deployable device capable of generating automatically interpreted RT-iiPCR results from nucleic acids within 1 hr. Limit of detection 95% of FIV RT-iiPCR was calculated to be 95 copies standard in vitro transcription RNA per reaction. Endpoint dilution studies with serial dilutions of an ATCC FIV type strain showed that the sensitivity of lyophilized FIV RT-iiPCR reagent was comparable to that of a reference nested PCR. The established reaction did not amplify any nontargeted feline pathogens, including Felid herpesvirus 1, feline coronavirus, Feline calicivirus, Feline leukemia virus, Mycoplasma haemofelis, and Chlamydophila felis. Based on analysis of 76 clinical samples (including blood and bone marrow) with the FIV RT-iiPCR, test sensitivity was 97.78% (44/45), specificity was 100.00% (31/31), and agreement was 98.65% (75/76), determined against a reference nested-PCR assay. A kappa value of 0.97 indicated excellent correlation between these 2 methods. The lyophilized FIV RT-iiPCR reagent, deployed on a user-friendly portable device, has potential utility for rapid and easy point-of-need detection of FIV in cats. © 2015 The Author(s).

  3. Screening for SNPs with Allele-Specific Methylation based on Next-Generation Sequencing Data.

    Science.gov (United States)

    Hu, Bo; Ji, Yuan; Xu, Yaomin; Ting, Angela H

    2013-05-01

    Allele-specific methylation (ASM) has long been studied but mainly documented in the context of genomic imprinting and X chromosome inactivation. Taking advantage of the next-generation sequencing technology, we conduct a high-throughput sequencing experiment with four prostate cell lines to survey the whole genome and identify single nucleotide polymorphisms (SNPs) with ASM. A Bayesian approach is proposed to model the counts of short reads for each SNP conditional on its genotypes of multiple subjects, leading to a posterior probability of ASM. We flag SNPs with high posterior probabilities of ASM by accounting for multiple comparisons based on posterior false discovery rates. Applying the Bayesian approach to the in-house prostate cell line data, we identify 269 SNPs as candidates of ASM. A simulation study is carried out to demonstrate the quantitative performance of the proposed approach.

  4. Development of a qPCR method to rapidly assess the function of NKT cells.

    Science.gov (United States)

    Sohn, Silke; Tiper, Irina; Japp, Emily; Sun, Wenji; Tkaczuk, Katherine; Webb, Tonya J

    2014-05-01

    NKT cells comprise a rare, but important subset of T cells which account for ~0.2% of the total circulating T cell population. NKT cells are known to have anti-tumor functions and rapidly produce high levels of cytokines following activation. Several clinical trials have sought to exploit the effector functions of NKT cells. While some studies have shown promise, NKT cells are approximately 50% lower in cancer patients compared to healthy donors of the same age and gender, thus limiting their therapeutic efficacy. These studies indicate that baseline levels of activation should be assessed before initiating an NKT cell based immunotherapeutic strategy. The goal of this study was to develop a sensitive method to rapidly assess NKT cell function. We utilized artificial antigen presenting cells in combination with qPCR in order to determine NKT cell function in peripheral blood mononuclear cells from healthy donors and breast cancer patients. We found that NKT cell activation can be detected by qPCR, but not by ELISA, in healthy donors as well as in breast cancer patients following four hour stimulation. This method utilizing CD1d-expressing aAPCs will enhance our knowledge of NKT cell biology and could potentially be used as a novel tool in adoptive immunotherapeutic strategies. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Rapid and sensitive PCR-dipstick DNA chromatography for multiplex analysis of the oral microbiota.

    Science.gov (United States)

    Tian, Lingyang; Sato, Takuichi; Niwa, Kousuke; Kawase, Mitsuo; Tanner, Anne C R; Takahashi, Nobuhiro

    2014-01-01

    A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

  6. Rapid and Sensitive PCR-Dipstick DNA Chromatography for Multiplex Analysis of the Oral Microbiota

    Directory of Open Access Journals (Sweden)

    Lingyang Tian

    2014-01-01

    Full Text Available A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.

  7. A Rapid and Low-Cost PCR Thermal Cycler for Infectious Disease Diagnostics.

    Directory of Open Access Journals (Sweden)

    Kamfai Chan

    Full Text Available The ability to make rapid diagnosis of infectious diseases broadly available in a portable, low-cost format would mark a great step forward in global health. Many molecular diagnostic assays are developed based on using thermal cyclers to carry out polymerase chain reaction (PCR and reverse-transcription PCR for DNA and RNA amplification and detection, respectively. Unfortunately, most commercial thermal cyclers are expensive and need continuous electrical power supply, so they are not suitable for uses in low-resource settings. We have previously reported a low-cost and simple approach to amplify DNA using vacuum insulated stainless steel thermoses food cans, which we have named it thermos thermal cycler or TTC. Here, we describe the use of an improved set up to enable the detection of viral RNA targets by reverse-transcription PCR (RT-PCR, thus expanding the TTC's ability to identify highly infectious, RNA virus-based diseases in low resource settings. The TTC was successful in demonstrating high-speed and sensitive detection of DNA or RNA targets of sexually transmitted diseases, HIV/AIDS, Ebola hemorrhagic fever, and dengue fever. Our innovative TTC costs less than $200 to build and has a capacity of at least eight tubes. In terms of speed, the TTC's performance exceeded that of commercial thermal cyclers tested. When coupled with low-cost endpoint detection technologies such as nucleic acid lateral-flow assay or a cell-phone-based fluorescence detector, the TTC will increase the availability of on-site molecular diagnostics in low-resource settings.

  8. siRNA-mediated Allele-specific Silencing of a COL6A3 Mutation in a Cellular Model of Dominant Ullrich Muscular Dystrophy

    Directory of Open Access Journals (Sweden)

    Véronique Bolduc

    2014-01-01

    Full Text Available Congenital muscular dystrophy type Ullrich (UCMD is a severe disorder of early childhood onset for which currently there is no effective treatment. UCMD commonly is caused by dominant-negative mutations in the genes coding for collagen type VI, a major microfibrillar component of the extracellular matrix surrounding the muscle fibers. To explore RNA interference (RNAi as a potential therapy for UCMD, we designed a series of small interfering RNA (siRNA oligos that specifically target the most common mutations resulting in skipping of exon 16 in the COL6A3 gene and tested them in UCMD-derived dermal fibroblasts. Transcript analysis by semiquantitative and quantitative reverse transcriptase PCR showed that two of these siRNAs were the most allele-specific, i.e., they efficiently knocked down the expression from the mutant allele, without affecting the normal allele. In HEK293T cells, these siRNAs selectively suppressed protein expression from a reporter construct carrying the mutation, with no or minimal suppression of the wild-type (WT construct, suggesting that collagen VI protein levels are as also reduced in an allele-specific manner. Furthermore, we found that treating UCMD fibroblasts with these siRNAs considerably improved the quantity and quality of the collagen VI matrix, as assessed by confocal microscopy. Our current study establishes RNAi as a promising molecular approach for treating dominant COL6-related dystrophies.

  9. Allele-specific expression at the androgen receptor alpha gene in a hybrid unisexual fish, the Amazon molly (Poecilia formosa.

    Directory of Open Access Journals (Sweden)

    Fangjun Zhu

    Full Text Available The all-female Amazon molly (Poecilia formosa is the result of a hybridization of the Atlantic molly (P. mexicana and the sailfin molly (P. latipinna approximately 120,000 years ago. As a gynogenetic species, P. formosa needs to copulate with heterospecific males including males from one of its bisexual ancestral species. However, the sperm only triggers embryogenesis of the diploid eggs. The genetic information of the sperm donor typically will not contribute to the next generation of P. formosa. Hence, P. formosa possesses generally one allele from each of its ancestral species at any genetic locus. This raises the question whether both ancestral alleles are equally expressed in P. formosa. Allele-specific expression (ASE has been previously assessed in various organisms, e.g., human and fish, and ASE was found to be important in the context of phenotypic variability and disease. In this study, we utilized Real-Time PCR techniques to estimate ASE of the androgen receptor alpha (arα gene in several distinct tissues of Amazon mollies. We found an allelic bias favoring the maternal ancestor (P. mexicana allele in ovarian tissue. This allelic bias was not observed in the gill or the brain tissue. Sequencing of the promoter regions of both alleles revealed an association between an Indel in a known CpG island and differential expression. Future studies may reveal whether our observed cis-regulatory divergence is caused by an ovary-specific trans-regulatory element, preferentially activating the allele of the maternal ancestor.

  10. Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    Directory of Open Access Journals (Sweden)

    Wang Zhen

    2011-11-01

    Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

  11. Rapid Methods to Distinguish Heterodera schachtii from Heterodera glycines Using PCR Technique

    Directory of Open Access Journals (Sweden)

    Hyoung Rai Ko

    2017-09-01

    Full Text Available The purpose of this study was to develop rapid methods for distinguishing between Heterodera schachtii and H. glycines detected from chinese cabbage fields of highland in Gangwon, Korea. To do this, we performed PCR-RFLP and PCR with the primers set developed in this study for GC147, GC408 and PM001 population, H. schachtii, and YS224, DA142 and BC115 population, H. glycines. Eight restriction enzymes generated RFLP profiles of mtDNA COI region for populations of H. schachtii and H. glycines, repectively. As a result, treatment of two restriction enzymes, RsaI and HinfI, were allowed to distinguish H. schachtii from H. glycines based on the differences of DNA band patterns. The primer set, #JBS1, #JBG1 and #JB3R, amplified specific fragments with 277 and 339 bp of H. schachtii, 339 bp of H. glycines, respectively, while it did not amplify fragments from three root-knot nematodes and two root-lesion nematodes. Thus, the primer set developed in this study could be a good method, which is used to distinguish between H. schachtii and H. glycines.

  12. A novel polymerase chain reaction (PCR) for rapid isolation of a new ...

    African Journals Online (AJOL)

    mediated self-formed panhandle PCR, for gene or chromosome walking. It combined the advantages of ligation-mediated PCR in its specificity and of panhandle PCR in its efficiency. Self-formed panhandle PCR was used for a new rbcS gene ...

  13. Allele-specific marker generation and linkage mapping on the Xiphophorus sex chromosomes.

    Science.gov (United States)

    Woolcock, B; Kazianis, S; Lucito, R; Walter, R B; Kallman, K D; Morizot, D C; Vielkind, J R

    2006-01-01

    There is great interest in the sex chromosomes of Xiphophorus fishes because both WY/YY and XX/XY sex-determining mechanisms function in these species, with at least one taxon possessing all three types of sex chromosomes, and because in certain interspecific hybrids melanoma arises as a consequence of inheritance of the sex-linked macromelanophore determining locus (MDL). Representational difference analysis (RDA) has been used to clone two sequences from the sex-determining region of X. maculatus, including a cholinergic receptor, nicotinic, delta polypeptide (CHRND) orthologue. Allele-specific assays for these sequences, as well as for the sex-linked XMRK1 and XMRK2 genes, were developed to distinguish W, X, and Y chromosomes derived from a X. maculatus (XX/XY) strain and a X. helleri (WY/YY) strain. Linkage mapping localized these markers to linkage group (LG) 24. No recombinants were observed between XMRK2 and MDL, confirming a role for XMRK2 in macromelanophore development. Although the master sex-determining (SD) locus certainly resides on Xiphophorus LG 24, autosomal loci are probably involved in sex determination as well, as indicated by the abnormal sex ratios in the backcross hybrids that contrast theoretical predictions based on LG 24 genotyping. Marker development and allelic discrimination on the Xiphophorus sex chromosomes should prove highly useful for studies that utilize this genus as an animal model.

  14. [Development and evaluation of a rapid PCR detection kit for Ophiocordyceps sinensis].

    Science.gov (United States)

    Hou, Fei-Xia; Cao, Jing; Wang, Sha-Sha; Wang, Xi; Yuan, Yuan; Peng, Cheng; Wan, De-Guang; Guo, Jin-Lin

    2017-03-01

    Ophiocordyceps sinensis is a valuable traditional Chinese medicine. Due to resource shortage, expensive price and huge market demand, there are many adulterants of O. sinensis in markets. Therefore, it is necessary to establish a rapid and effective method for distinguishing O. sinensis. Based on the species-specific PCR of O. sinensis, this study developed a detection kit by optimizing the components and evaluated the specificity, detection limit, repeatability and shelf life of the kit. The results showed that when the quality of O. sinensis accounted for more than 1/200 of that mixture, it could be detected successfully. Moreover, only O. sinensis could be amplified and glowed bright green fluorescence under ultraviolet light. The kit was still in effect when it was placed at 37 ℃ for three days, which indicated that it was stable and effective for one year stored in 4 ℃. The kit in the same batch under different operation conditions, and in different batch under the same operation conditions gave the same result and accuracy, which showed good repeatability of the kit. It is simple, rapid and accurate to distinguish O. sinensis from its adulterants using the kit, and lays the foundation for commercialization of traditional Chinese medicine fast detection kit. Copyright© by the Chinese Pharmaceutical Association.

  15. Hybrid sterility and evolution in Hawaiian Drosophila: differential gene and allele-specific expression analysis of backcross males.

    Science.gov (United States)

    Brill, E; Kang, L; Michalak, K; Michalak, P; Price, D K

    2016-08-01

    The Hawaiian Drosophila are an iconic example of sequential colonization, adaptive radiation and speciation on islands. Genetic and phenotypic analysis of closely related species pairs that exhibit incomplete reproductive isolation can provide insights into the mechanisms of speciation. Drosophila silvestris from Hawai'i Island and Drosophila planitibia from Maui are two closely related allopatric Hawaiian picture-winged Drosophila that produce sterile F1 males but fertile F1 females, a pattern consistent with Haldane's rule. Backcrossing F1 hybrid females between these two species to parental species gives rise to recombinant males with three distinct sperm phenotypes despite a similar genomic background: motile sperm, no sperm (sterile), and immotile sperm. We found that these three reproductive morphologies of backcross hybrid males produce divergent gene expression profiles in testes, as measured with RNA sequencing. There were a total of 71 genes significantly differentially expressed between backcross males with no sperm compared with those backcross males with motile sperm and immotile sperm, but no significant differential gene expression between backcross males with motile sperm and backcross males with immotile sperm. All of these genes were underexpressed in males with no sperm, including a number of genes with previously known activities in adult testis. An allele-specific expression analysis showed overwhelmingly more cis-divergent than trans-divergent genes, with no significant difference in the ratio of cis- and trans-divergent genes among the sperm phenotypes. Overall, the results indicate that the regulation of gene expression involved in sperm production likely diverged relatively rapidly between these two closely related species.

  16. Development and Validation of a Real-Time PCR Assay for Rapid Detection of Candida auris from Surveillance Samples.

    Science.gov (United States)

    Leach, L; Zhu, Y; Chaturvedi, S

    2018-02-01

    Candida auris is an emerging multidrug-resistant yeast causing invasive health care-associated infection with high mortality worldwide. Rapid identification of C. auris is of primary importance for the implementation of public health measures to control the spread of infection. To achieve these goals, we developed and validated a TaqMan-based real-time PCR assay targeting the internal transcribed spacer 2 ( ITS 2) region of the ribosomal gene. The assay was highly specific, reproducible, and sensitive, with the detection limit of 1 C. auris CFU/PCR. The performance of the C. auris real-time PCR assay was evaluated by using 623 surveillance samples, including 365 patient swabs and 258 environmental sponges. Real-time PCR yielded positive results from 49 swab and 58 sponge samples, with 89% and 100% clinical sensitivity with regard to their respective culture-positive results. The real-time PCR also detected C. auris DNA from 1% and 12% of swab and sponge samples with culture-negative results, indicating the presence of dead or culture-impaired C. auris The real-time PCR yielded results within 4 h of sample processing, compared to 4 to 14 days for culture, reducing turnaround time significantly. The new real-time PCR assay allows for accurate and rapid screening of C. auris and can increase effective control and prevention of this emerging multidrug-resistant fungal pathogen in health care facilities. Copyright © 2018 Leach et al.

  17. Development of a multiplex PCR assay for rapid and simultaneous detection of four genera of fish pathogenic bacteria.

    Science.gov (United States)

    Zhang, D F; Zhang, Q Q; Li, A H

    2014-11-01

    Species of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus are the most common fish pathogenic bacteria that cause economically devastating losses in aquaculture. A multiplex polymerase chain reaction (mPCR) was developed for the simultaneous detection and differentiation of the four genera of fish pathogenic bacteria. Through the use of genus-specific primers instead of species-specific ones, the current mPCR covered much more target bacterial species compared with previously reported species-specific mPCR methods. The specificity of the four putative genus-specific primers was validated experimentally while used exclusively (uniplex PCR) or combined (mPCR) against bacterial genomic DNA templates of the target bacteria and nontarget bacteria. The PCR amplicons for the following genera were obtained as expected: Aeromonas (875 bp), Vibrio (524 bp), Edwardsiella (302 bp) and Streptococcus (197 bp), and the fragments could be separated clearly on the agarose gel electrophoresis. The mPCR did not produce nonspecific amplification products when used to amplify 21 nontarget species of bacteria. The mPCR detection limits for each target bacterial genera were 50 colony-forming units (CFU) in pure culture and 100 CFU in fish tissue samples. In conclusion, the mPCR assay was proven to be a powerful alternative to the conventional culture-based method, given its rapid, specific, sensitive and reliable detection of target pathogens. The fish pathogenic bacteria of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus frequently cause severe outbreaks of diseases in cultured fish, and the genus-specific multiplex PCR assay developed in this study can detect the bacteria of the four genera when present in the samples either alone or mixed. The mPCR assay is expected to identify the causative agents more efficiently than uniplex PCR or species-specific multiplex PCR for clinical diagnosis, resulting in the earlier implementation of control measures. This mPCR

  18. Allele-specific gene expression in a wild nonhuman primate population

    Science.gov (United States)

    Tung, J.; Akinyi, M. Y.; Mutura, S.; Altmann, J.; Wray, G. A.; Alberts, S. C.

    2015-01-01

    Natural populations hold enormous potential for evolutionary genetic studies, especially when phenotypic, genetic and environmental data are all available on the same individuals. However, untangling the genotype-phenotype relationship in natural populations remains a major challenge. Here, we describe results of an investigation of one class of phenotype, allele-specific gene expression (ASGE), in the well-studied natural population of baboons of the Amboseli basin, Kenya. ASGE measurements identify cases in which one allele of a gene is overexpressed relative to the alternative allele of the same gene, within individuals, thus providing a control for background genetic and environmental effects. Here, we characterize the incidence of ASGE in the Amboseli baboon population, focusing on the genetic and environmental contributions to ASGE in a set of eleven genes involved in immunity and defence. Within this set, we identify evidence for common ASGE in four genes. We also present examples of two relationships between cis-regulatory genetic variants and the ASGE phenotype. Finally, we identify one case in which this relationship is influenced by a novel gene-environment interaction. Specifically, the dominance rank of an individual’s mother during its early life (an aspect of that individual’s social environment) influences the expression of the gene CCL5 via an interaction with cis-regulatory genetic variation. These results illustrate how environmental and ecological data can be integrated into evolutionary genetic studies of functional variation in natural populations. They also highlight the potential importance of early life environmental variation in shaping the genetic architecture of complex traits in wild mammals. PMID:21226779

  19. An informational view of accession rarity and allele specificity in germplasm banks for management and conservation.

    Science.gov (United States)

    Reyes-Valdés, M Humberto; Burgueño, Juan; Singh, Sukhwinder; Martínez, Octavio; Sansaloni, Carolina Paola

    2018-01-01

    Germplasm banks are growing in their importance, number of accessions and amount of characterization data, with a large emphasis on molecular genetic markers. In this work, we offer an integrated view of accessions and marker data in an information theory framework. The basis of this development is the mutual information between accessions and allele frequencies for molecular marker loci, which can be decomposed in allele specificities, as well as in rarity and divergence of accessions. In this way, formulas are provided to calculate the specificity of the different marker alleles with reference to their distribution across accessions, accession rarity, defined as the weighted average of the specificity of its alleles, and divergence, defined by the Kullback-Leibler formula. Albeit being different measures, it is demonstrated that average rarity and divergence are equal for any collection. These parameters can contribute to the knowledge of the structure of a germplasm collection and to make decisions about the preservation of rare variants. The concepts herein developed served as the basis for a strategy for core subset selection called HCore, implemented in a publicly available R script. As a proof of concept, the mathematical view and tools developed in this research were applied to a large collection of Mexican wheat accessions, widely characterized by SNP markers. The most specific alleles were found to be private of a single accession, and the distribution of this parameter had its highest frequencies at low levels of specificity. Accession rarity and divergence had largely symmetrical distributions, and had a positive, albeit non-strictly linear relationship. Comparison of the HCore approach for core subset selection, with three state-of-the-art methods, showed it to be superior for average divergence and rarity, mean genetic distance and diversity. The proposed approach can be used for knowledge extraction and decision making in germplasm collections of

  20. Rapid screening of β-Globin gene mutations by Real-Time PCR in ...

    African Journals Online (AJOL)

    Introduction of the real time PCR has made a revolution in the time taken for the PCR reactions. We present a method for the diagnosis of the common mutations of the B-thalassemia in Egyptian children & families. The procedure depends on the real-time PCR using specific fluorescently labeled hybridization probes.

  1. Field-Deployable Reverse Transcription-Insulated Isothermal PCR (RT-iiPCR) Assay for Rapid and Sensitive Detection of Foot-and-Mouth Disease Virus.

    Science.gov (United States)

    Ambagala, A; Fisher, M; Goolia, M; Nfon, C; Furukawa-Stoffer, T; Ortega Polo, R; Lung, O

    2017-10-01

    Foot-and-mouth disease (FMD) is a highly contagious viral disease of cloven-hoofed animals, which can decimate the livestock industry and economy of countries previously free of this disease. Rapid detection of foot-and-mouth disease virus (FMDV) is critical to containing an FMD outbreak. Availability of a rapid, highly sensitive and specific, yet simple and field-deployable assay would support local decision-making during an FMDV outbreak. Here we report validation of a novel reverse transcription-insulated isothermal PCR (RT-iiPCR) assay that can be performed on a commercially available, compact and portable POCKIT ™ analyser that automatically analyses data and displays '+' or '-' results. The FMDV RT-iiPCR assay targets the 3D region of the FMDV genome and was capable of detecting 9 copies of in vitro-transcribed RNA standard with 95% confidence. It accurately identified 63 FMDV strains belonging to all seven serotypes and showed no cross-reactivity with viruses causing similar clinical diseases in cloven-hoofed animals. The assay was able to identify FMDV RNA in multiple sample types including oral, nasal and lesion swabs, epithelial tissue suspensions, vesicular and oral fluid samples, even before the appearance of clinical signs. Clinical sensitivity of the assay was comparable or slightly higher than the laboratory-based real-time RT-PCR assay in use. The assay was able to detect FMDV RNA in vesicular fluid samples without nucleic acid extraction. For RNA extraction from more complex sample types, a commercially available taco ™ mini transportable magnetic bead-based, automated extraction system was used. This assay provides a potentially useful field-deployable diagnostic tool for rapid detection of FMDV in an outbreak in FMD-free countries or for routine diagnostics in endemic countries with less structured laboratory systems. © 2016 Her Majesty the Queen in Right of Canada.

  2. Rapid and sensitive detection of Yersinia pestis using amplification of plague diagnostic bacteriophages monitored by real-time PCR.

    Directory of Open Access Journals (Sweden)

    Kirill V Sergueev

    Full Text Available BACKGROUND: Yersinia pestis, the agent of plague, has caused many millions of human deaths and still poses a serious threat to global public health. Timely and reliable detection of such a dangerous pathogen is of critical importance. Lysis by specific bacteriophages remains an essential method of Y. pestis detection and plague diagnostics. METHODOLOGY/PRINCIPAL FINDINGS: The objective of this work was to develop an alternative to conventional phage lysis tests--a rapid and highly sensitive method of indirect detection of live Y. pestis cells based on quantitative real-time PCR (qPCR monitoring of amplification of reporter Y. pestis-specific bacteriophages. Plague diagnostic phages phiA1122 and L-413C were shown to be highly effective diagnostic tools for the detection and identification of Y. pestis by using qPCR with primers specific for phage DNA. The template DNA extraction step that usually precedes qPCR was omitted. phiA1122-specific qPCR enabled the detection of an initial bacterial concentration of 10(3 CFU/ml (equivalent to as few as one Y. pestis cell per 1-microl sample in four hours. L-413C-mediated detection of Y. pestis was less sensitive (up to 100 bacteria per sample but more specific, and thus we propose parallel qPCR for the two phages as a rapid and reliable method of Y. pestis identification. Importantly, phiA1122 propagated in simulated clinical blood specimens containing EDTA and its titer rise was detected by both a standard plating test and qPCR. CONCLUSIONS/SIGNIFICANCE: Thus, we developed a novel assay for detection and identification of Y. pestis using amplification of specific phages monitored by qPCR. The method is simple, rapid, highly sensitive, and specific and allows the detection of only live bacteria.

  3. Rapid detection and strain typing of Chlamydia trachomatis using a highly multiplexed microfluidic PCR assay.

    Directory of Open Access Journals (Sweden)

    Rosemary S Turingan

    Full Text Available Nucleic acid amplification tests (NAATs are recommended by the CDC for detection of Chlamydia trachomatis (Ct urogenital infections. Current commercial NAATs require technical expertise and sophisticated laboratory infrastructure, are time-consuming and expensive, and do not differentiate the lymphogranuloma venereum (LGV strains that require a longer duration of treatment than non-LGV strains. The multiplexed microfluidic PCR-based assay presented in this work simultaneously interrogates 13 loci to detect Ct and identify LGV and non-LGV strain-types. Based on amplified fragment length polymorphisms, the assay differentiates LGV, ocular, urogenital, and proctocolitis clades, and also serovars L1, L2, and L3 within the LGV group. The assay was evaluated in a blinded fashion using 95 clinical swabs, with 76 previously reported as urogenital Ct-positive samples and typed by ompA genotyping and/or Multi-Locus Sequence Typing. Results of the 13-plex assay showed that 51 samples fell within urogenital clade 2 or 4, 24 samples showed both clade 2 and 4 signatures, indicating possible mixed infection, gene rearrangement, or inter-clade recombination, and one sample was a noninvasive trachoma biovar (either a clade 3 or 4. The remaining 19 blinded samples were correctly identified as LGV clade 1 (3, ocular clade 3 (4, or as negatives (12. To date, no NAAT assay can provide a point-of-care applicable turnaround time for Ct detection while identifying clinically significant Ct strain types to inform appropriate treatment. Coupled with rapid DNA processing of clinical swabs (approximately 60 minutes from swab-in to result-out, the assay has significant potential as a rapid POC diagnostic for Ct infections.

  4. Rapid Detection of the Chlamydiaceae and Other Families in the Order Chlamydiales: Three PCR Tests

    Science.gov (United States)

    Everett, Karin D. E.; Hornung, Linda J.; Andersen, Arthur A.

    1999-01-01

    Few identification methods will rapidly or specifically detect all bacteria in the order Chlamydiales, family Chlamydiaceae. In this study, three PCR tests based on sequence data from over 48 chlamydial strains were developed for identification of these bacteria. Two tests exclusively recognized the Chlamydiaceae: a multiplex test targeting the ompA gene and the rRNA intergenic spacer and a TaqMan test targeting the 23S ribosomal DNA. The multiplex test was able to detect as few as 200 inclusion-forming units (IFU), while the TaqMan test could detect 2 IFU. The amplicons produced in these tests ranged from 132 to 320 bp in length. The third test, targeting the 23S rRNA gene, produced a 600-bp amplicon from strains belonging to several families in the order Chlamydiales. Direct sequence analysis of this amplicon has facilitated the identification of new chlamydial strains. These three tests permit ready identification of chlamydiae for diagnostic and epidemiologic study. The specificity of these tests indicates that they might also be used to identify chlamydiae without culture or isolation. PMID:9986815

  5. PCR-Restriction Fragment Length Polymorphism for Rapid, Low-Cost Identification of Isoniazid-Resistant Mycobacterium tuberculosis▿

    Science.gov (United States)

    Caws, Maxine; Tho, Dau Quang; Duy, Phan Minh; Lan, Nguyen Thi Ngoc; Hoa, Dai Viet; Torok, Mili Estee; Chau, Tran Thi Hong; Van Vinh Chau, Nguyen; Chinh, Nguyen Tran; Farrar, Jeremy

    2007-01-01

    PCR-restriction fragment length poymorphism (PCR-RFLP) is a simple, robust technique for the rapid identification of isoniazid-resistant Mycobacterium tuberculosis. One hundred consecutive isolates from a Vietnamese tuberculosis hospital were tested by MspA1I PCR-RFLP for the detection of isoniazid-resistant katG_315 mutants. The test had a sensitivity of 80% and a specificity of 100% against conventional phenotypic drug susceptibility testing. The positive and negative predictive values were 1 and 0.86, respectively. None of the discrepant isolates had mutant katG_315 codons by sequencing. The test is cheap (less than $1.50 per test), specific, and suitable for the rapid identification of isoniazid resistance in regions with a high prevalence of katG_315 mutants among isoniazid-resistant M. tuberculosis isolates. PMID:17428939

  6. Allele-specific DNA methylation of disease susceptibility genes in Japanese patients with inflammatory bowel disease.

    Science.gov (United States)

    Chiba, Hirofumi; Kakuta, Yoichi; Kinouchi, Yoshitaka; Kawai, Yosuke; Watanabe, Kazuhiro; Nagao, Munenori; Naito, Takeo; Onodera, Motoyuki; Moroi, Rintaro; Kuroha, Masatake; Kanazawa, Yoshitake; Kimura, Tomoya; Shiga, Hisashi; Endo, Katsuya; Negoro, Kenichi; Nagasaki, Masao; Unno, Michiaki; Shimosegawa, Tooru

    2018-01-01

    Inflammatory bowel disease (IBD) has an unknown etiology; however, accumulating evidence suggests that IBD is a multifactorial disease influenced by a combination of genetic and environmental factors. The influence of genetic variants on DNA methylation in cis and cis effects on expression have been demonstrated. We hypothesized that IBD susceptibility single-nucleotide polymorphisms (SNPs) regulate susceptibility gene expressions in cis by regulating DNA methylation around SNPs. For this, we determined cis-regulated allele-specific DNA methylation (ASM) around IBD susceptibility genes in CD4+ effector/memory T cells (Tem) in lamina propria mononuclear cells (LPMCs) in patients with IBD and examined the association between the ASM SNP genotype and neighboring susceptibility gene expressions. CD4+ effector/memory T cells (Tem) were isolated from LPMCs in 15 Japanese IBD patients (ten Crohn's disease [CD] and five ulcerative colitis [UC] patients). ASM analysis was performed by methylation-sensitive SNP array analysis. We defined ASM as a changing average relative allele score ([Formula: see text]) >0.1 after digestion by methylation-sensitive restriction enzymes. Among SNPs showing [Formula: see text] >0.1, we extracted the probes located on tag-SNPs of 200 IBD susceptibility loci and around IBD susceptibility genes as candidate ASM SNPs. To validate ASM, bisulfite-pyrosequencing was performed. Transcriptome analysis was examined in 11 IBD patients (seven CD and four UC patients). The relation between rs36221701 genotype and neighboring gene expressions were analyzed. We extracted six candidate ASM SNPs around IBD susceptibility genes. The top of [Formula: see text] (0.23) was rs1130368 located on HLA-DQB1. ASM around rs36221701 ([Formula: see text] = 0.14) located near SMAD3 was validated using bisulfite pyrosequencing. The SMAD3 expression was significantly associated with the rs36221701 genotype (p = 0.016). We confirmed the existence of cis-regulated ASM around

  7. Allele-specific DNA methylation of disease susceptibility genes in Japanese patients with inflammatory bowel disease

    Science.gov (United States)

    Chiba, Hirofumi; Kakuta, Yoichi; Kinouchi, Yoshitaka; Kawai, Yosuke; Watanabe, Kazuhiro; Nagao, Munenori; Naito, Takeo; Onodera, Motoyuki; Moroi, Rintaro; Kuroha, Masatake; Kanazawa, Yoshitake; Kimura, Tomoya; Shiga, Hisashi; Endo, Katsuya; Negoro, Kenichi; Nagasaki, Masao; Unno, Michiaki; Shimosegawa, Tooru

    2018-01-01

    Background Inflammatory bowel disease (IBD) has an unknown etiology; however, accumulating evidence suggests that IBD is a multifactorial disease influenced by a combination of genetic and environmental factors. The influence of genetic variants on DNA methylation in cis and cis effects on expression have been demonstrated. We hypothesized that IBD susceptibility single-nucleotide polymorphisms (SNPs) regulate susceptibility gene expressions in cis by regulating DNA methylation around SNPs. For this, we determined cis-regulated allele-specific DNA methylation (ASM) around IBD susceptibility genes in CD4+ effector/memory T cells (Tem) in lamina propria mononuclear cells (LPMCs) in patients with IBD and examined the association between the ASM SNP genotype and neighboring susceptibility gene expressions. Methods CD4+ effector/memory T cells (Tem) were isolated from LPMCs in 15 Japanese IBD patients (ten Crohn's disease [CD] and five ulcerative colitis [UC] patients). ASM analysis was performed by methylation-sensitive SNP array analysis. We defined ASM as a changing average relative allele score (ΔRAS¯) >0.1 after digestion by methylation-sensitive restriction enzymes. Among SNPs showing ΔRAS¯ >0.1, we extracted the probes located on tag-SNPs of 200 IBD susceptibility loci and around IBD susceptibility genes as candidate ASM SNPs. To validate ASM, bisulfite-pyrosequencing was performed. Transcriptome analysis was examined in 11 IBD patients (seven CD and four UC patients). The relation between rs36221701 genotype and neighboring gene expressions were analyzed. Results We extracted six candidate ASM SNPs around IBD susceptibility genes. The top of ΔRAS¯ (0.23) was rs1130368 located on HLA-DQB1. ASM around rs36221701 (ΔRAS¯ = 0.14) located near SMAD3 was validated using bisulfite pyrosequencing. The SMAD3 expression was significantly associated with the rs36221701 genotype (p = 0.016). Conclusions We confirmed the existence of cis-regulated ASM around IBD

  8. Rapid diagnostic tests as a source of DNA for Plasmodium species-specific real-time PCR

    Directory of Open Access Journals (Sweden)

    Van Esbroeck Marjan

    2011-03-01

    Full Text Available Abstract Background This study describes the use of malaria rapid diagnostic tests (RDTs as a source of DNA for Plasmodium species-specific real-time PCR. Methods First, the best method to recover DNA from RDTs was investigated and then the applicability of this DNA extraction method was assessed on 12 different RDT brands. Finally, two RDT brands (OptiMAL Rapid Malaria Test and SDFK60 malaria Ag Plasmodium falciparum/Pan test were comprehensively evaluated on a panel of clinical samples submitted for routine malaria diagnosis at ITM. DNA amplification was done with the 18S rRNA real-time PCR targeting the four Plasmodium species. Results of PCR on RDT were compared to those obtained by PCR on whole blood samples. Results Best results were obtained by isolating DNA from the proximal part of the nitrocellulose component of the RDT strip with a simple DNA elution method. The PCR on RDT showed a detection limit of 0.02 asexual parasites/μl, which was identical to the same PCR on whole blood. For all 12 RDT brands tested, DNA was detected except for one brand when a low parasite density sample was applied. In RDTs with a plastic seal covering the nitrocellulose strip, DNA extraction was hampered. PCR analysis on clinical RDT samples demonstrated correct identification for single species infections for all RDT samples with asexual parasites of P. falciparum (n = 60, Plasmodium vivax (n = 10, Plasmodium ovale (n = 10 and Plasmodium malariae (n = 10. Samples with only gametocytes were detected in all OptiMAL and in 10 of the 11 SDFK60 tests. None of the negative samples (n = 20 gave a signal by PCR on RDT. With PCR on RDT, higher Ct-values were observed than with PCR on whole blood, with a mean difference of 2.68 for OptiMAL and 3.53 for SDFK60. Mixed infections were correctly identified with PCR on RDT in 4/5 OptiMAL tests and 2/5 SDFK60 tests. Conclusions RDTs are a reliable source of DNA for Plasmodium real-time PCR. This study demonstrates the

  9. A rapid cycleave PCR method for distinguishing the vaccine strain Brucella abortus A19 in China.

    Science.gov (United States)

    Nan, Wenlong; Zhang, Yueyong; Tan, Pengfei; Xu, Zouliang; Chen, Yuqi; Mao, Kairong; Chen, Yiping

    2016-05-01

    Brucellosis is a widespread zoonotic disease caused by Brucella spp. Immunization with attenuated vaccines has proved to be an effective method of prevention; however, it may also interfere with diagnosis. Brucella abortus strain A19, which is homologous to B. abortus strain S19, is widely used for the prevention of bovine brucellosis in China. For effective monitoring of the control of brucellosis, it is essential to distinguish A19 from field strains. Single-nucleotide polymorphism-based assays offer a new approach to such discrimination studies. In the current study, we developed a cycleave PCR assay that successfully distinguished attenuated vaccine strains A19 and S19 from 22 strains of B. abortus and 57 strains of 5 other Brucella species. The assay gave a negative reaction with 4 non-Brucella species. The minimum sensitivity of the assay, evaluated using 10-fold dilutions of chromosomal DNA, was 7.6 fg for the A19 strain and 220 fg for the single non-A19/non-S19 Brucella strain tested (B. abortus 104M). The assay was also reproducible (intra- and interassay coefficients of variation: 0.003-0.01 and 0.004-0.025, respectively). The cycleave assay gave an A19/S19-specific reaction in 3 out of 125 field serum samples, with the same 3 samples being positive in an alternative A19/S19-specific molecular assay. The cycleave assay gave a total of 102 Brucella-specific reactions (3 being the A19/S19-specific reactions), whereas an alternative Brucella-specific assay gave 92 positive reactions (all also positive in the cycleave assay). Therefore, this assay represents a simple, rapid, sensitive, and specific tool for use in brucellosis control. © 2016 The Author(s).

  10. A one-step, real-time PCR assay for rapid detection of rhinovirus.

    Science.gov (United States)

    Do, Duc H; Laus, Stella; Leber, Amy; Marcon, Mario J; Jordan, Jeanne A; Martin, Judith M; Wadowsky, Robert M

    2010-01-01

    One-step, real-time PCR assays for rhinovirus have been developed for a limited number of PCR amplification platforms and chemistries, and some exhibit cross-reactivity with genetically similar enteroviruses. We developed a one-step, real-time PCR assay for rhinovirus by using a sequence detection system (Applied Biosystems; Foster City, CA). The primers were designed to amplify a 120-base target in the noncoding region of picornavirus RNA, and a TaqMan (Applied Biosystems) degenerate probe was designed for the specific detection of rhinovirus amplicons. The PCR assay had no cross-reactivity with a panel of 76 nontarget nucleic acids, which included RNAs from 43 enterovirus strains. Excellent lower limits of detection relative to viral culture were observed for the PCR assay by using 38 of 40 rhinovirus reference strains representing different serotypes, which could reproducibly detect rhinovirus serotype 2 in viral transport medium containing 10 to 10,000 TCID(50) (50% tissue culture infectious dose endpoint) units/ml of the virus. However, for rhinovirus serotypes 59 and 69, the PCR assay was less sensitive than culture. Testing of 48 clinical specimens from children with cold-like illnesses for rhinovirus by the PCR and culture assays yielded detection rates of 16.7% and 6.3%, respectively. For a batch of 10 specimens, the entire assay was completed in 4.5 hours. This real-time PCR assay enables detection of many rhinovirus serotypes with the Applied Biosystems reagent-instrument platform.

  11. Application of rapid onsite PCR (TaqMan) for Phytophthora ramorum under U.S. conditions

    Science.gov (United States)

    Kelvin Hughes; Jenny Tomlinson; Neil Boonham; Kelly Ivors; Matteo Garbelotto; Ian Barker

    2006-01-01

    Currently, diagnosis of Phytophthora ramorum involves sending samples to a laboratory for traditional isolation and morphological characterisation, and/or PCR analysis. This can take as long as 2 weeks from sampling to final diagnosis. However, the Plant Health Group, Central Science Laboratory, has produced on-site DNA extraction and real-time PCR (...

  12. A PCR-based strategy for simple and rapid identification of rough presumptive Salmonella isolates

    DEFF Research Database (Denmark)

    Hoorfar, Jeffrey; Baggesen, Dorte Lau; Porting, P.H.

    1999-01-01

    The purpose of the present study was to investigate the application of ready-to-go Salmonella PCR tests, based on dry chemistry, for final identification of rough presumptive Salmonella isolates. The results were compared with two different biotyping methods performed at two different laboratories......, which did not result in any DNA band. A total of 32 out of the 36 rough presumptive isolates were positive in the PCR. All but one isolate were also identified as Salmonella by the two biochemical methods. All 80 Salmonella strains were also tested in the two multiplex serogroup tests based on PCR beads....... The sensitivity of the BAX Salmonella PCR test was assessed by testing a total of 80 Salmonella isolates, covering most serogroups, which correctly identified all the Salmonella strains by resulting in one 800-bp band in the sample tubes. The specificity of the PCR was assessed using 20 non-Salmonella strains...

  13. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    Directory of Open Access Journals (Sweden)

    Parida Manmohan

    2008-01-01

    Full Text Available Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Japanese encephalitis, West Nile, Yellow fever and alphavirus (Chikungunya. The feasibility of M-RT-PCR assay for clinical diagnosis was validated with 620 acute phase dengue patient sera samples of recent epidemics in India. The comparative evaluation vis a vis conventional virus isolation revealed higher sensitivity. None of the forty healthy serum samples screened in the present study revealed any amplification, thereby establishing specificity of the reported assay for dengue virus only. Conclusion These findings clearly suggested that M-RT-PCR assay reported in the present study is the rapid and cost-effective method for simultaneous detection as well as typing of the dengue virus in acute phase patient serum samples. Thus, the M-RT-PCR assay developed in this study will serve as a very useful tool for rapid diagnosis and typing of dengue infections in endemic areas.

  14. Allele-specific expression in the germline of patients with familial pancreatic cancer: An unbiased approach to cancer gene discovery

    OpenAIRE

    Tan, Aik Choon; Fan, Jian-Bing; Karikari, Collins; Bibikova, Marina; Garcia, Eliza Wickham; Zhou, Lixin; Barker, David; Serre, David; Feldmann, Georg; Hruban, Ralph H.; Klein, Alison P.; Goggins, Michael; Couch, Fergus J.; Hudson, Thomas J.; Winslow, Raimond L.

    2007-01-01

    Physiologic allele-specific expression (ASE) in germline tissues occurs during random X-chromosome inactivation1 and in genomic imprinting,2 wherein the two alleles of a gene in a heterozygous individual are not expressed equally. Recent studies have confirmed the existence of ASE in apparently non-imprinted autosomal genes;3–14 however, the extent of ASE in the human genome is unknown. We explored ASE in lymphoblastoid cell lines of 145 individuals using an oligonucleotide array based assay....

  15. Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil

    Directory of Open Access Journals (Sweden)

    Vlademir Cantarelli

    2011-10-01

    Full Text Available INTRODUCTION: Laboratory-based surveillance is an important component in the control of vancomycin resistant enterococci (VRE. METHODS: The study aimed to evaluate real-time polymerase chain reaction (RT-PCR (genes vanA-vanB for VRE detection on 115 swabs from patients included in a surveillance program. RESULTS: Sensitivity of RT-PCR was similar to primary culture (75% and 79.5%, respectively when compared to broth enriched culture, whereas specificity was 83.1%. CONCLUSIONS: RT-PCR provides same day results, however it showed low sensitivity for VRE detection.

  16. Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods.

    Science.gov (United States)

    Chahorm, Kanchana; Prakitchaiwattana, Cheunjit

    2018-01-02

    The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004

  17. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    International Nuclear Information System (INIS)

    Jothikumar, N.; Hill, Vincent R.

    2013-01-01

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  18. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    Energy Technology Data Exchange (ETDEWEB)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  19. Multiplex PCR for rapid diagnosis and differentiation of pox and pox-like diseases in dromedary Camels.

    Science.gov (United States)

    Khalafalla, Abdelmalik I; Al-Busada, Khalid A; El-Sabagh, Ibrahim M

    2015-07-07

    Pox and pox-like diseases of camels are a group of exanthematous skin conditions that have become increasingly important economically. Three distinct viruses may cause them: camelpox virus (CMLV), camel parapox virus (CPPV) and camelus dromedary papilloma virus (CdPV). These diseases are often difficult to differentiate based on clinical presentation in disease outbreaks. Molecular methods such as PCR targeting species-specific genes have been developed and used to identify these diseases, but not simultaneously in a single tube. Recently, multiplex PCR has gained reputation as a convenient diagnostic method with cost-and timesaving benefits. In the present communication, we describe the development, optimization and validation of a multiplex PCR assay able to detect simultaneously the genome of the three viruses in one single test allowing for rapid and efficient molecular diagnosis. The assay was developed based on the evaluation and combination of published and new primer sets and was validated with viral genomic DNA extracted from known virus strains (n = 14) and DNA extracted from homogenized clinical skin specimens (n = 86). The assay detects correctly the target pathogens by amplification of targeted genes, even in case of co-infection. The method showed high sensitivity, and the specificity was confirmed by PCR-product sequencing. This assay provide rapid, sensitive and specific method for identifying three important viruses in specimens collected from dromedary camels with varying clinical presentations.

  20. Establishment of a 10-Plex Quantitative Fluorescent-PCR Assay for rapid diagnosis of sex chromosome aneuploidies.

    Directory of Open Access Journals (Sweden)

    Xingmei Xie

    Full Text Available Sex chromosome aneuploidies occur commonly in the general population, with an incidence of 1 in 400 newborns. However, no tests specifically targeting sex chromosomes have been carried out in prenatal diagnosis or newborn screening, resulting in late recognition of these diseases. In this study, a rapid diagnostic method for sex chromosome aneuploidies was established using Quantitative Fluorescent-PCR (QF-PCR. Ten markers were included in one multiplex QF-PCR assay, including two sex determination genes (AMXY and SRY, five X-linked short tandem repeats (STRs; DXS1053, DXS981, DXS6809, DXS1187, and DXS8377, one X/Y-common STR (X22, and two autosomal STRs (D13S305 and D21S11. Retrospective tests of 70 cases with known cytogenetic results indicated that the 10-plex QF-PCR assay could well determine sex chromosome copy numbers by both allelic peak numbers and a sex chromosome dosage calculation with the autosomal STRs as internal controls. Prospective comparison with cytogenetic karyotyping on 534 cases confirmed that the 10-plex QF-PCR assay could be well employed for sex chromosome aneuploidy diagnosis in at least the Chinese Han population. This is the first QF-PCR test for the diagnosis of sex chromosome aneuploidies in the Chinese population. This test is superior to previous designs by including up to 8 sex-linked markers covering different parts of sex chromosomes as well as employing internal controls for copy number dosage calculation in a single PCR reaction. Due to simple technique and data analysis, as well as easy implementation within routine clinical services, this method is of great clinical application value and could be widely applied.

  1. Rapid Detection and Differentiation of Clonorchis sinensis and Opisthorchis viverrini Using Real-Time PCR and High Resolution Melting Analysis

    OpenAIRE

    Cai, Xian-Quan; Yu, Hai-Qiong; Li, Rong; Yue, Qiao-Yun; Liu, Guo-Hua; Bai, Jian-Shan; Deng, Yan; Qiu, De-Yi; Zhu, Xing-Quan

    2014-01-01

    Clonorchis sinensis and Opisthorchis viverrini are both important fish-borne pathogens, causing serious public health problem in Asia. The present study developed an assay integrating real-time PCR and high resolution melting (HRM) analysis for the specific detection and rapid identification of C. sinensis and O. viverrini. Primers targeting COX1 gene were highly specific for these liver flukes, as evidenced by the negative amplification of closely related trematodes. Assays using genomic DNA...

  2. The use of newly developed real-time PCR for the rapid identification of bacteria in culture-negative osteomyelitis.

    Science.gov (United States)

    Kobayashi, Naomi; Bauer, Thomas W; Sakai, Hiroshige; Togawa, Daisuke; Lieberman, Isador H; Fujishiro, Takaaki; Procop, Gary W

    2006-12-01

    We report a case of a culture-negative osteomyelitis in which our newly developed real-time polymerase chain reaction (PCR) could differentiate Staphylococcus aureus from Staphylococcus epidermidis. This is the first report that described the application of this novel assay to an orthopedics clinical sample. This assay may be useful for other clinical culture-negative cases in a combination with a broad-spectrum assay as a rapid microorganism identification method.

  3. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    OpenAIRE

    Parida Manmohan; Shrivastava Ambuj; Santhosh SR; Dash Paban; Saxena Parag; Rao PV

    2008-01-01

    Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR) for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Jap...

  4. Rapid identification of dairy lactic acid bacteria by M13-generated, RAPD-PCR fingerprint databases.

    Science.gov (United States)

    Rossetti, Lia; Giraffa, Giorgio

    2005-11-01

    About a thousand lactic acid bacteria (LAB) isolated from dairy products, especially cheeses, were identified and typed by species-specific PCR and RAPD-PCR, respectively. RAPD-PCR profiles, which were obtained by using the M13 sequence as a primer, allowed us to implement a large database of different fingerprints, which were analysed by BioNumerics software. Cluster analysis of the combined RAPD-PCR fingerprinting profiles enabled us to implement a library, which is a collection of library units, which in turn is a selection of representative database entries. A library unit, in this case, can be considered to be a definable taxon. The strains belonged to 11 main RAPD-PCR fingerprinting library units identified as Lactobacillus casei/paracasei, Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacillus helveticus, Lactobacillus delbrueckii, Lactobacillus fermentum, Lactobacillus brevis, Enterococcus faecium, Enterococcus faecalis, Streptococcus thermophilus and Lactococcus lactis. The possibility to routinely identify newly typed, bacterial isolates by consulting the library of the software was valued. The proposed method could be suggested to refine previous strain identifications, eliminate redundancy and dispose of a technologically useful LAB strain collection. The same approach could also be applied to identify LAB strains isolated from other food ecosystems.

  5. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  6. An SSP-PCR method for the rapid detection of disease-associated alleles HLA-A*29 and HLA-B*51.

    Science.gov (United States)

    Amstutz, U; Schaerer, D; Andrey, G; Wirthmueller, U; Largiadèr, C R

    2018-05-15

    HLA-A*29 and HLA-B*51 are associated with birdshot uveitis and Behçet's disease, respectively, and are used as a diagnostic criterion in patients with suspected disease, requiring their detection in diagnostic laboratories. While commercial tests for individual HLA alleles are available for other disease-associated HLA variants, no similar allele-specific assays are available for HLA-A*29 and -B*51. Here, we report SSP-PCR methods for the detection of HLA-A*29 and -B*51 using a single PCR reaction per allele. The assays were tested in 30 and 32 previously HLA-typed samples, respectively, representing >97% of HLA-A alleles and >93% of HLA-B alleles in a European population. A concordance of 100% was observed with previous typing results, validating these methods for use in a diagnostic or research context. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  7. A RAPID DNA EXTRACTION METHOD FOR PCR IDENTIFICATION OF FUNGAL INDOOR AIR CONTAMINANTS

    Science.gov (United States)

    Following air sampling, fungal DNA needs to be extracted and purified to a state suitable for laboratory use. Our laboratory has developed a simple method of extraction and purification of fungal DNA appropriate for enzymatic manipulation and polymerase chain reaction (PCR) appli...

  8. Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes

    Directory of Open Access Journals (Sweden)

    Georg Walch

    2016-04-01

    Full Text Available Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success.

  9. Rapid genetically modified organism (GMO screening of various food products and animal feeds using multiplex polymerase chain reaction (PCR

    Directory of Open Access Journals (Sweden)

    Lisha, V.

    2017-01-01

    Full Text Available modified crops which brought up a controversy on the safety usage of genetically modified organisms (GMOs. It has been implemented globally that all GMO products and its derived ingredients should have regulations on the usage and labelling. Thus, it is necessary to develop methods that allow rapid screening of GMO products to comply with the regulations. This study employed a reliable and flexible multiplex polymerase chain reaction (PCR method for the rapid detection of transgenic elements in genetically modified soy and maize along with the soybean LECTIN gene and maize ZEIN gene respectively. The selected four common transgenic elements were 35S promoter (35S; Agrobacterium tumefaciens nopaline synthase terminator (NOS; 5-enolypyruvylshikimate-3-phosphate synthase (epsps gene; and Cry1Ab delta-endotoxin (cry1Ab gene. Optimization of the multiplex PCR methods were carried out by using 1% Roundup ReadyTM Soybean (RRS as the certified reference material for soybean that produced fourplex PCR method detecting 35S promoter, NOS terminator, epsps gene and soybean LECTIN gene and by using 1% MON810 as the certified reference material for maize that produced triplex PCR method detecting 35S promoter, cry1Ab gene and maize ZEIN gene prior to screening of the GMO traits in various food products and animal feeds. 1/9 (11.1% of the animal feed contained maize and 1/15 (6.7% of the soybean food products showed positive results for the detection of GMO transgenic gene. None of the maize food products showed positive results for GMO transgenic gene. In total, approximately 4% of the food products and animal feed were positive as GMO. This indicated GMOs have not widely entered the food chain. However, it is necessary to have an appropriate screening method due to GMOs’ unknown potential risk to humans and to animals. This rapid screening method will provide leverage in terms of being economically wise, time saving and reliable.

  10. PCR-RFLP on β-tubulin gene for rapid identification of the most clinically important species of Aspergillus.

    Science.gov (United States)

    Nasri, Tuba; Hedayati, Mohammad Taghi; Abastabar, Mahdi; Pasqualotto, Alessandro C; Armaki, Mojtaba Taghizadeh; Hoseinnejad, Akbar; Nabili, Mojtaba

    2015-10-01

    Aspergillus species are important agents of life-threatening infections in immunosuppressed patients. Proper speciation in the Aspergilli has been justified based on varied fungal virulence, clinical presentations, and antifungal resistance. Accurate identification of Aspergillus species usually relies on fungal DNA sequencing but this requires expensive equipment that is not available in most clinical laboratories. We developed and validated a discriminative low-cost PCR-based test to discriminate Aspergillus isolates at the species level. The Beta tubulin gene of various reference strains of Aspergillus species was amplified using the universal fungal primers Bt2a and Bt2b. The PCR products were subjected to digestion with a single restriction enzyme AlwI. All Aspergillus isolates were subjected to DNA sequencing for final species characterization. The PCR-RFLP test generated unique patterns for six clinically important Aspergillus species, including Aspergillus flavus, Aspergillus fumigatus, Aspergillus nidulans, Aspergillus terreus, Aspergillus clavatus and Aspergillus nidulans. The one-enzyme PCR-RFLP on Beta tubulin gene designed in this study is a low-cost tool for the reliable and rapid differentiation of the clinically important Aspergillus species. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Real-time PCR-based method for rapid detection of Aspergillus niger and Aspergillus welwitschiae isolated from coffee.

    Science.gov (United States)

    von Hertwig, Aline Morgan; Sant'Ana, Anderson S; Sartori, Daniele; da Silva, Josué José; Nascimento, Maristela S; Iamanaka, Beatriz Thie; Pelegrinelli Fungaro, Maria Helena; Taniwaki, Marta Hiromi

    2018-05-01

    Some species from Aspergillus section Nigri are morphologically very similar and altogether have been called A. niger aggregate. Although the species included in this group are morphologically very similar, they differ in their ability to produce mycotoxins and other metabolites and their taxonomical status has evolved continuously. Among them, A. niger and A. welwitschiae are ochratoxin A and fumonisin B 2 producers and their detection and/or identification is of crucial importance for food safety. The aim of this study was the development of a real-time PCR-based method for simultaneous discrimination of A. niger and A. welwitschiae from other species of the A. niger aggregate isolated from coffee beans. One primer pair and a hybridization probe specific for detection of A. niger and A. welwitschiae strains were designed based on the BenA gene sequences, and used in a Real-time PCR assay for the rapid discrimination between both these species from all others of the A. niger aggregate. The Real-time PCR assay was shown to be 100% efficient in discriminating the 73 isolates of A. niger/A. welwitschiae from the other A. niger aggregate species analyzed as a negative control. This result testifies to the use of this technique as a good tool in the rapid detection of these important toxigenic species. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. A Rapid and Simple Real-Time PCR Assay for Detecting Foodborne Pathogenic Bacteria in Human Feces.

    Science.gov (United States)

    Hanabara, Yutaro; Ueda, Yutaka

    2016-11-22

    A rapid, simple method for detecting foodborne pathogenic bacteria in human feces is greatly needed. Here, we examined the efficacy of a method that employs a combination of a commercial PCR master mix, which is insensitive to PCR inhibitors, and a DNA extraction method which used sodium dodecyl benzene sulfonate (SDBS), and Tween 20 to counteract the inhibitory effects of SDBS on the PCR assay. This method could detect the target genes (stx1 and stx2 of enterohemorrhagic Escherichia coli, invA of Salmonella Enteritidis, tdh of Vibrio parahaemolyticus, gyrA of Campylobacter jejuni, ceuE of Campylobacter coli, SEA of Staphylococcus aureus, ces of Bacillus cereus, and cpe of Clostridium perfringens) in a fecal suspension containing 1.0 × 10 1 to 1.0 × 10 3 CFU/ml. Furthermore, the assay was neither inhibited nor influenced by individual differences among the fecal samples of 10 subjects or fecal concentration (40-160 mg/ml in the fecal suspension). When we attempted to detect the genes of pathogenic bacteria in 4 actual clinical cases, we found that this method was more sensitive than standard culture method. These results showed that this assay is a rapid, simple detection method for foodborne pathogenic bacteria in human feces.

  13. TaqMan MGB probe fluorescence real-time quantitative PCR for rapid detection of Chinese Sacbrood virus.

    Directory of Open Access Journals (Sweden)

    Ma Mingxiao

    Full Text Available Sacbrood virus (SBV is a picorna-like virus that affects honey bees (Apis mellifera and results in the death of the larvae. Several procedures are available to detect Chinese SBV (CSBV in clinical samples, but not to estimate the level of CSBV infection. The aim of this study was develop an assay for rapid detection and quantification of this virus. Primers and probes were designed that were specific for CSBV structural protein genes. A TaqMan minor groove binder (MGB probe-based, fluorescence real-time quantitative PCR was established. The specificity, sensitivity and stability of the assay were assessed; specificity was high and there were no cross-reactivity with healthy larvae or other bee viruses. The assay was applied to detect CSBV in 37 clinical samples and its efficiency was compared with clinical diagnosis, electron microscopy observation, and conventional RT-PCR. The TaqMan MGB-based probe fluorescence real-time quantitative PCR for CSBV was more sensitive than other methods tested. This assay was a reliable, fast, and sensitive method that was used successfully to detect CSBV in clinical samples. The technology can provide a useful tool for rapid detection of CSBV. This study has established a useful protocol for CSBV testing, epidemiological investigation, and development of animal models.

  14. Rapid detection and typing of pathogenic nonpneumophila Legionella spp. isolates using a multiplex real-time PCR assay.

    Science.gov (United States)

    Benitez, Alvaro J; Winchell, Jonas M

    2016-04-01

    We developed a single tube multiplex real-time PCR assay that allows for the rapid detection and typing of 9 nonpneumophila Legionella spp. isolates that are clinically relevant. The multiplex assay is capable of simultaneously detecting and discriminating L. micdadei, L. bozemanii, L. dumoffii, L. longbeachae, L. feeleii, L. anisa, L. parisiensis, L. tucsonensis serogroup (sg) 1 and 3, and L. sainthelensis sg 1 and 2 isolates. Evaluation of the assay with nucleic acid from each of these species derived from both clinical and environmental isolates and typing strains demonstrated 100% sensitivity and 100% specificity when tested against 43 other Legionella spp. Typing of L. anisa, L. parisiensis, and L. tucsonensis sg 1 and 3 isolates was accomplished by developing a real-time PCR assay followed by high-resolution melt (HRM) analysis targeting the ssrA gene. Further typing of L. bozemanii, L. longbeachae, and L. feeleii isolates to the serogroup level was accomplished by developing a real-time PCR assay followed by HRM analysis targeting the mip gene. When used in conjunction with other currently available diagnostic tests, these assays may aid in rapidly identifying specific etiologies associated with Legionella outbreaks, clusters, sporadic cases, and potential environmental sources. Published by Elsevier Inc.

  15. Rapid and sensitive multiplex single-tube nested PCR for the identification of five human Plasmodium species.

    Science.gov (United States)

    Saito, Takahiro; Kikuchi, Aoi; Kaneko, Akira; Isozumi, Rie; Teramoto, Isao; Kimura, Masatsugu; Hirasawa, Noriyasu; Hiratsuka, Masahiro

    2018-06-01

    Malaria is caused by five species of Plasmodium in humans. Microscopy is currently used for pathogen detection, requiring considerable training and technical expertise as the parasites are often difficult to differentiate morphologically. Rapid diagnostic tests are as reliable as microscopy and offer faster diagnoses but possess lower detection limits and are incapable of distinguishing among the parasitic species. To improve global health efforts towards malaria control, a rapid, sensitive, species-specific, and economically viable diagnostic method is needed. In this study, we designed a malaria diagnostic method involving a multiplex single-tube nested PCR targeting Plasmodium mitochondrial cytochrome c oxidase III and single-stranded tag hybridization chromatographic printed-array strip. The detection sensitivity was found to be at least 40 times higher than that of agarose gel electrophoresis with ethidium bromide. This system also enables the identification of both single- and mixed-species malaria infections. The assay was validated with 152 Kenyan samples; using nested PCR as the standard, the assay's sensitivity and specificity were 88.7% and 100.0%, respectively. The turnaround time required, from PCR preparation to signal detection, is 90min. Our method should improve the diagnostic speed, treatment efficacy, and control of malaria, in addition to facilitating surveillance within global malaria eradication programs. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Rapid Detection Of Escherichia coli Enterohemorragic (EHEC) Bacteria by PCR (Polymerase Chain Reaction) methods

    International Nuclear Information System (INIS)

    Sudrajat, Dadang; R, Maria Lina; Suhadi, F.

    2000-01-01

    A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment

  17. Rapid Identification of Pathogenic Fungi Directly from Cultures by Using Multiplex PCR

    OpenAIRE

    Luo, Guizhen; Mitchell, Thomas G.

    2002-01-01

    A multiplex PCR method was developed to identify simultaneously multiple fungal pathogens in a single reaction. Five sets of species-specific primers were designed from the internal transcribed spacer (ITS) regions, ITS1 and ITS2, of the rRNA gene to identify Candida albicans, Candida glabrata, Candida parapsilosis, Candida tropicalis, and Aspergillus fumigatus. Another set of previously published ITS primers, CN4 and CN5, were used to identify Cryptococcus neoformans. Three sets of primers w...

  18. Rapid PCR Detection of Mycoplasma hominis, Ureaplasma urealyticum, and Ureaplasma parvum

    OpenAIRE

    Scott A. Cunningham; Jayawant N. Mandrekar; Jon E. Rosenblatt; Robin Patel

    2013-01-01

    Objective. We compared laboratory developed real-time PCR assays for detection of Mycoplasma hominis and for detection and differentiation of Ureaplasma urealyticum and parvum to culture using genitourinary specimens submitted for M. hominis and Ureaplasma culture. Methods. 283 genitourinary specimens received in the clinical bacteriology laboratory for M. hominis and Ureaplasma species culture were evaluated. Nucleic acids were extracted using the Total Nucleic Acid Kit on the MagNA Pure 2.0...

  19. Development of a Rapid Real-Time PCR Assay for Quantitation of Pneumocystis carinii f. sp. Carinii

    DEFF Research Database (Denmark)

    Larsen, Hans Henrik; Kovacs, Joseph A; Stock, Frida

    2002-01-01

    ) PCR assay for detecting P. carinii f. sp. carinii, the subspecies of P. carinii commonly used in research models of PCP. The assay was based on the single-copy dihydrofolate reductase gene and was able to detect r = 0.99) over...... 6 log values for standards containing > or =5 copies/tube. Application of the assay to a series of 10-fold dilutions of P. carinii organisms isolated from rat lung demonstrated that it was reproducibly quantitative over 5 log values (r = 0.99). The assay was applied to a recently reported in vitro....... In conclusion, a rapid, sensitive, and reproducible quantitative PCR assay for P. carinii f. sp. carinii has been developed and is applicable to in vivo as well as in vitro systems. The assay should prove useful for conducting studies in which quantification of organism burden or growth assessment is critical...

  20. Rapid Detection of Chlamydia trachomatis and Typing of the Lymphogranuloma venereum associated L-Serovars by TaqMan PCR

    Directory of Open Access Journals (Sweden)

    Henrich Birgit

    2008-04-01

    Full Text Available Abstract Background Infection due to Chlamydia trachomatis is the most common sexually transmitted bacterial disease of global health significance, and especially the L-serovars causing lymphogranuloma venereum are increasingly being found in Europe in men who have sex with men. Results The design and evaluation of a rapid, multiplex, real-time PCR targeting the major outer membrane protein (omp-1 -gene and a L-serovar-specific region of the polymorphic protein H (pmp-H -gene for the detection of Chlamydia trachomatis is reported here. The PCR takes place as a single reaction with an internal control. For L1-, L2- and L3-serovar differentiation a second set of real-time PCRs was evaluated based on the amplification of serovar-specific omp-1-regions. The detection limit of each real-time PCR, multiplexed or not, was 50 genome copies per reaction with an efficiency ranging from 90,5–95,2%. In a retrospective analysis of 50 ocular, rectal and urogenital specimens formerly tested to be positive for C. trachomatis we identified six L2-serovars in rectal specimens of HIV-positive men, one in a double-infection with L3, and one L2 in a urethral specimen of an HIV-negative male. Conclusion This unique real-time PCR is specific and convenient for the rapid routine-diagnostic detection of lymphogranuloma venereum-associated L-serovars and enables the subsequent differentiation of L1, L2 and L3 for epidemiologic studies.

  1. Rapid Detection of Chlamydia trachomatis and Typing of the Lymphogranuloma venereum associated L-Serovars by TaqMan PCR

    Science.gov (United States)

    Schaeffer, Anke; Henrich, Birgit

    2008-01-01

    Background Infection due to Chlamydia trachomatis is the most common sexually transmitted bacterial disease of global health significance, and especially the L-serovars causing lymphogranuloma venereum are increasingly being found in Europe in men who have sex with men. Results The design and evaluation of a rapid, multiplex, real-time PCR targeting the major outer membrane protein (omp-1) -gene and a L-serovar-specific region of the polymorphic protein H (pmp-H) -gene for the detection of Chlamydia trachomatis is reported here. The PCR takes place as a single reaction with an internal control. For L1-, L2- and L3-serovar differentiation a second set of real-time PCRs was evaluated based on the amplification of serovar-specific omp-1-regions. The detection limit of each real-time PCR, multiplexed or not, was 50 genome copies per reaction with an efficiency ranging from 90,5–95,2%. In a retrospective analysis of 50 ocular, rectal and urogenital specimens formerly tested to be positive for C. trachomatis we identified six L2-serovars in rectal specimens of HIV-positive men, one in a double-infection with L3, and one L2 in a urethral specimen of an HIV-negative male. Conclusion This unique real-time PCR is specific and convenient for the rapid routine-diagnostic detection of lymphogranuloma venereum-associated L-serovars and enables the subsequent differentiation of L1, L2 and L3 for epidemiologic studies. PMID:18447917

  2. Use of allele-specific FAIRE to determine functional regulatory polymorphism using large-scale genotyping arrays.

    Directory of Open Access Journals (Sweden)

    Andrew J P Smith

    Full Text Available Following the widespread use of genome-wide association studies (GWAS, focus is turning towards identification of causal variants rather than simply genetic markers of diseases and traits. As a step towards a high-throughput method to identify genome-wide, non-coding, functional regulatory variants, we describe the technique of allele-specific FAIRE, utilising large-scale genotyping technology (FAIRE-gen to determine allelic effects on chromatin accessibility and regulatory potential. FAIRE-gen was explored using lymphoblastoid cells and the 50,000 SNP Illumina CVD BeadChip. The technique identified an allele-specific regulatory polymorphism within NR1H3 (coding for LXR-α, rs7120118, coinciding with a previously GWAS-identified SNP for HDL-C levels. This finding was confirmed using FAIRE-gen with the 200,000 SNP Illumina Metabochip and verified with the established method of TaqMan allelic discrimination. Examination of this SNP in two prospective Caucasian cohorts comprising 15,000 individuals confirmed the association with HDL-C levels (combined beta = 0.016; p = 0.0006, and analysis of gene expression identified an allelic association with LXR-α expression in heart tissue. Using increasingly comprehensive genotyping chips and distinct tissues for examination, FAIRE-gen has the potential to aid the identification of many causal SNPs associated with disease from GWAS.

  3. A multiplex RT-PCR assay for the rapid and differential diagnosis of classical swine fever and other pestivirus infections.

    Science.gov (United States)

    Díaz de Arce, Heidy; Pérez, Lester J; Frías, Maria T; Rosell, Rosa; Tarradas, Joan; Núñez, José I; Ganges, Llilianne

    2009-11-18

    Classical swine fever is a highly contagious viral disease causing severe economic losses in pig production almost worldwide. All pestivirus species can infect pigs, therefore accurate and rapid pestivirus detection and differentiation is of great importance to assure control measures in swine farming. Here we describe the development and evaluation of a novel multiplex, highly sensitive and specific RT-PCR for the simultaneous detection and rapid differentiation between CSFV and other pestivirus infections in swine. The universal and differential detection was based on primers designed to amplify a fragment of the 5' non-coding genome region for the detection of pestiviruses and a fragment of the NS5B gene for the detection of classical swine fever virus. The assay proved to be specific when different pestivirus strains from swine and ruminants were evaluated. The analytical sensitivity was estimated to be as little as 0.89TCID(50). The assay analysis of 30 tissue homogenate samples from naturally infected and non-CSF infected animals and 40 standard serum samples evaluated as part of two European Inter-laboratory Comparison Tests conducted by the European Community Reference Laboratory, Hanover, Germany proved that the multiplex RT-PCR method provides a rapid, highly sensitive, and cost-effective laboratory diagnosis for classical swine fever and other pestivirus infections in swine.

  4. Comparison of Enzymatic Method Rapid Yeast Plus System with RFLP-PCR for Identification of Isolated Yeast from Vulvovaginal Candidiasis.

    Science.gov (United States)

    Hossein, Moallaei; Mirhendi, Seied Hossein; Brandão, João; Mirdashti, Reza; Rosado, Laura

    2011-09-01

    To compare two identification methods, i.e., restriction fragment length polymorphism (RFLP)-PCR analysis and enzymatic method Rapid TM Yeast Plus System to identify different species causing vulvovaginal candidiasis (VVC). Vaginal discharges of women who had attended the gynecology outpatient clinic of Mobini Hospital in Sabzevar, Iran were collected using cotton swabs and were cultured on Sabouraud dextrose agar. Isolated yeasts were identified by germ-tube testing and Rapid TM Yeast Plus System (Remel USA). For molecular identification, the isolated DNA was amplified with ITS1 and ITS4 universal primers and PCR products digested with the enzyme HpaІІ followed by agarose gel electrophoresis. Epidemiological and clinical features of women with respect to identified species were also evaluated. Out of 231 subjects enrolled, 62 VVC cases were detected. The isolated species were identified as follows: Candida albicans, 24 (38.7%), C. glabrata, 15 (24.2%), C. kefyr, 13 (21.0%) C. krusei, 9 (14.5%), and Saccharomyces cerevisiae, 1 (1.6%) by RFLP-PCR method; whereas findings by Rapid TM Yeast Plus System were C. albicans, 24 (38.7%), C. glabrata, 5 (8%), C. kefyr, 11 (17.7%) C. krusei, 2 (3.2%), S. cerevisiae, 9 (14.5%), and C. tropicalis, 6 (9.6%) as well as other nonpathogenic yeasts, 4 (6.9%). Statistical comparison showed that there is no significant difference in identification of C. albicans by the two methods; although, in this study, it was not true about other species of yeasts. A correlation between clinical and laboratory findings is important as it enables us to administer an appropriate treatment on time.

  5. PCR approach for rapid detection of Escherichia coli in tempe using a specific primer

    Directory of Open Access Journals (Sweden)

    Siti Harnina Bintari

    2014-12-01

    Full Text Available Tempe known as a traditional fermented food originated from Indonesia. It has a unique flavour and texture. It also contains high protein and usually serves to substitute meat, fish, or egg as a complement to rice. The manufacture process of Tempe is quite complex and mostly, the traditional process has not employed the hygienic standard. In the process of Tempe making, there are two critical stages of the whole process; i.e. soaking of soybeans and solid state fermentation by Rhizopus sp. During the process, foodborne pathogen bacteria such as Escherichia coli could contaminate the product of Tempe. The bacterial contamination could be revealed through culture dependent methods which is costly, laborious, and time consuming. Therefore, the culture-independent method such as polymerase chain reaction using a specific primer could be applied to detect target microorganism to save time and labour. In this study, thirty-one Tempe samples collected from different manufacturers in Semarang, Central Java, Indonesia were analysed by PCR. In order to obtain the bacterial genomic DNA, a modified Chelex 100-Microwave method was employed. The results of DNA extraction showed that the method was an applicable method. It gave high quantity and quality of DNA; therefore, it could be applied in the PCR reaction. The DNA samples were employed in PCR for detection of Escherichia coli using Ecoli706F/R. It was found that 27 out of 31 samples were detected having Escherichia coli contamination showed by the presence of the amplified product size 706 bp. The application of this method could significantly reduce costs and time of analysis in the laboratory. Further response after E. coli were detected could be employed, including investigation of the critical factors in Tempe manufacturing process which allowed E. coli contamination.

  6. Solid-phase PCR for rapid multiplex detection of Salmonella spp. at the subspecies level, with amplification efficiency comparable to conventional PCR

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    Solid-phase PCR (SP-PCR) has attracted considerable interest in different research fields since it allows parallel DNA amplification on the surface of a solid substrate. However, the applications of SP-PCR have been hampered by the low efficiency of the solid-phase amplification. In order to incr...... diagnosis, high-throughput DNA sequencing, and single-nucleotide polymorphism analysis. Graphical abstract Schematic representation of solid-phase PCR....

  7. Rapid detection of Lactobacillus kefiranofaciens in kefir grain and kefir milk using newly developed real-time PCR.

    Science.gov (United States)

    Kim, Dong-Hyeon; Chon, Jung-Whan; Kim, Hong-Seok; Yim, Jin-Hyeok; Kim, Hyunsook; Seo, Kun-Ho

    2015-04-01

    Lactobacillus kefiranofaciens is an indicator microorganism for kefir and a key factor in kefir grain formation and kefiran production. We designed a novel real-time PCR primer and probe set, LKF_KU504, for the rapid detection of L. kefiranofaciens. In inclusivity and exclusivity tests, only 14 L. kefiranofaciens strains were positive among 61 microorganisms, indicating 100 % sensitivity and specificity. The LKF_KU504 set also differentiated kefir milk from 30 commercial nonkefir yogurts. The levels of L. kefiranofaciens in kefir grain and kefir milk were significantly different, indicating L. kefiranofaciens was more concentrated in kefir grain than in kefir milk.

  8. A rapid and simple method of detection of Blepharisma japonicum using PCR and immobilisation on FTA paper

    Science.gov (United States)

    Hide, Geoff; Hughes, Jacqueline M; McNuff, Robert

    2003-01-01

    Background The rapid expansion in the availability of genome and DNA sequence information has opened up new possibilities for the development of methods for detecting free-living protozoa in environmental samples. The protozoan Blepharisma japonicum was used to investigate a rapid and simple detection system based on polymerase chain reaction amplification (PCR) from organisms immobilised on FTA paper. Results Using primers designed from the α-tubulin genes of Blepharisma, specific and sensitive detection to the equivalent of a single Blepharisma cell could be achieved. Similar detection levels were found using water samples, containing Blepharisma, which were dried onto Whatman FTA paper. Conclusion This system has potential as a sensitive convenient detection system for Blepharisma and could be applied to other protozoan organisms. PMID:14516472

  9. Rapid detection of Salmonella in pet food: design and evaluation of integrated methods based on real-time PCR detection.

    Science.gov (United States)

    Balachandran, Priya; Friberg, Maria; Vanlandingham, V; Kozak, K; Manolis, Amanda; Brevnov, Maxim; Crowley, Erin; Bird, Patrick; Goins, David; Furtado, Manohar R; Petrauskene, Olga V; Tebbs, Robert S; Charbonneau, Duane

    2012-02-01

    Reducing the risk of Salmonella contamination in pet food is critical for both companion animals and humans, and its importance is reflected by the substantial increase in the demand for pathogen testing. Accurate and rapid detection of foodborne pathogens improves food safety, protects the public health, and benefits food producers by assuring product quality while facilitating product release in a timely manner. Traditional culture-based methods for Salmonella screening are laborious and can take 5 to 7 days to obtain definitive results. In this study, we developed two methods for the detection of low levels of Salmonella in pet food using real-time PCR: (i) detection of Salmonella in 25 g of dried pet food in less than 14 h with an automated magnetic bead-based nucleic acid extraction method and (ii) detection of Salmonella in 375 g of composite dry pet food matrix in less than 24 h with a manual centrifugation-based nucleic acid preparation method. Both methods included a preclarification step using a novel protocol that removes food matrix-associated debris and PCR inhibitors and improves the sensitivity of detection. Validation studies revealed no significant differences between the two real-time PCR methods and the standard U.S. Food and Drug Administration Bacteriological Analytical Manual (chapter 5) culture confirmation method.

  10. Rapid and Accurate Identification by Real-Time PCR of Biotoxin-Producing Dinoflagellates from the Family Gymnodiniaceae

    Directory of Open Access Journals (Sweden)

    Kirsty F. Smith

    2014-03-01

    Full Text Available The identification of toxin-producing dinoflagellates for monitoring programmes and bio-compound discovery requires considerable taxonomic expertise. It can also be difficult to morphologically differentiate toxic and non-toxic species or strains. Various molecular methods have been used for dinoflagellate identification and detection, and this study describes the development of eight real-time polymerase chain reaction (PCR assays targeting the large subunit ribosomal RNA (LSU rRNA gene of species from the genera Gymnodinium, Karenia, Karlodinium, and Takayama. Assays proved to be highly specific and sensitive, and the assay for G. catenatum was further developed for quantification in response to a bloom in Manukau Harbour, New Zealand. The assay estimated cell densities from environmental samples as low as 0.07 cells per PCR reaction, which equated to three cells per litre. This assay not only enabled conclusive species identification but also detected the presence of cells below the limit of detection for light microscopy. This study demonstrates the usefulness of real-time PCR as a sensitive and rapid molecular technique for the detection and quantification of micro-algae from environmental samples.

  11. Rapid and accurate identification by real-time PCR of biotoxin-producing dinoflagellates from the family gymnodiniaceae.

    Science.gov (United States)

    Smith, Kirsty F; de Salas, Miguel; Adamson, Janet; Rhodes, Lesley L

    2014-03-07

    The identification of toxin-producing dinoflagellates for monitoring programmes and bio-compound discovery requires considerable taxonomic expertise. It can also be difficult to morphologically differentiate toxic and non-toxic species or strains. Various molecular methods have been used for dinoflagellate identification and detection, and this study describes the development of eight real-time polymerase chain reaction (PCR) assays targeting the large subunit ribosomal RNA (LSU rRNA) gene of species from the genera Gymnodinium, Karenia, Karlodinium, and Takayama. Assays proved to be highly specific and sensitive, and the assay for G. catenatum was further developed for quantification in response to a bloom in Manukau Harbour, New Zealand. The assay estimated cell densities from environmental samples as low as 0.07 cells per PCR reaction, which equated to three cells per litre. This assay not only enabled conclusive species identification but also detected the presence of cells below the limit of detection for light microscopy. This study demonstrates the usefulness of real-time PCR as a sensitive and rapid molecular technique for the detection and quantification of micro-algae from environmental samples.

  12. Standardisation and evaluation of a quantitative multiplex real-time PCR assay for the rapid identification of Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Feroze Ahmed Ganaie

    2015-01-01

    Full Text Available Rapid diagnosis of Streptococcus pneumoniae can play a significant role in decreasing morbidity and mortality of infection. The accurate diagnosis of pneumococcal disease is hampered by the difficulties in growing the isolates from clinical specimens and also by misidentification. Molecular methods have gained popularity as they offer improvement in the detection of causative pathogens with speed and ease. The present study aims at validating and standardising the use of 4 oligonucleotide primer-probe sets (pneumolysin [ply], autolysin [lytA], pneumococcal surface adhesion A [psaA] and Spn9802 [DNA fragment] in a single-reaction mixture for the detection and discrimination of S. pneumoniae. Here, we validate a quantitative multiplex real-time PCR (qmPCR assay with a panel consisting of 43 S. pneumoniae and 29 non-pneumococcal isolates, 20 culture positive, 26 culture negative and 30 spiked serum samples. A standard curve was obtained using S. pneumoniae ATCC 49619 strain and glyceraldehyde 3-phosphate dehydrogenase (GAPDH gene was used as an endogenous internal control. The experiment showed high sensitivity with lower limit of detection equivalent to 4 genome copies/µl. The efficiency of the reaction was 100% for ply, lytA, Spn9802 and 97% for psaA. The test showed sensitivity and specificity of 100% with culture isolates and serum specimens. This study demonstrates that qmPCR analysis of sera using 4 oligonucleotide primers appears to be an appropriate method for the genotypic identification of S. pneumoniae infection.

  13. Rapid detection of human parechoviruses in clinical samples by real-time PCR

    NARCIS (Netherlands)

    Benschop, Kimberley; Molenkamp, Richard; van der Ham, Alwin; Wolthers, Katja; Beld, Marcel

    2008-01-01

    BACKGROUND: Human parechoviruses (HPeVs) have been associated with severe conditions such as neonatal sepsis and meningitis in young children. Rapid identification of an infectious agent in such serious conditions in these patients is essential for adequate decision making regarding treatment and

  14. Development and validation of real-time PCR for rapid detection of Mecistocirrus digitatus.

    Directory of Open Access Journals (Sweden)

    Subhra Subhadra

    Full Text Available Hematophagous activity of Mecistocirrus digitatus, which causes substantial blood and weight loss in large ruminants, is an emerging challenge due to the economic loss it brings to the livestock industry. Infected animals are treated with anthelmintic drugs, based on the identification of helminth species and the severity of infection; however, traditional methods such as microscopic identification and the counting of eggs for diagnosis and determination of level of infection are laborious, cumbersome and unreliable. To facilitate the detection of this parasite, a SYBR green-based real-time PCR was standardized and validated for the detection of M. digitatus infection in cattle and buffaloes. Oligonucleotides were designed to amplify partial Internal Transcribed Spacer (ITS-1 sequence of M. digitatus. The specificity of the primers was confirmed by non-amplification of DNA extracted from other commonly occurring gastrointestinal nematodes in ruminants. Plasmids were ligated with partial ITS-1 sequence of M. digitatus, serially diluted (hundred fold and used as standards in the real-time PCR assay. The quantification cycle (Cq values were plotted against the standard DNA concentration to produce a standard curve. The assay was sensitive enough to detect one plasmid containing the M. digitatus DNA. Clinical application of this assay was validated by testing the DNA extracted from the faeces of naturally infected cattle (n = 40 and buffaloes (n = 25. The results were compared with our standard curve to calculate the quantity of M. digitatus in each faecal sample. The Cq value of the assay depicted a strong linear relationship with faecal DNA content, with a regression coefficient of 0.984 and efficiency of 99%. This assay has noteworthy advantages over the conventional methods of diagnosis because it is more specific, sensitive and reliable.

  15. Rapid qualitative urinary tract infection pathogen identification by SeptiFast real-time PCR.

    Directory of Open Access Journals (Sweden)

    Lutz E Lehmann

    2011-02-01

    Full Text Available Urinary tract infections (UTI are frequent in outpatients. Fast pathogen identification is mandatory for shortening the time of discomfort and preventing serious complications. Urine culture needs up to 48 hours until pathogen identification. Consequently, the initial antibiotic regimen is empirical.To evaluate the feasibility of qualitative urine pathogen identification by a commercially available real-time PCR blood pathogen test (SeptiFast® and to compare the results with dipslide and microbiological culture.Pilot study with prospectively collected urine samples.University hospital.82 prospectively collected urine samples from 81 patients with suspected UTI were included. Dipslide urine culture was followed by microbiological pathogen identification in dipslide positive samples. In parallel, qualitative DNA based pathogen identification (SeptiFast® was performed in all samples.61 samples were SeptiFast® positive, whereas 67 samples were dipslide culture positive. The inter-methodological concordance of positive and negative findings in the gram+, gram- and fungi sector was 371/410 (90%, 477/492 (97% and 238/246 (97%, respectively. Sensitivity and specificity of the SeptiFast® test for the detection of an infection was 0.82 and 0.60, respectively. SeptiFast® pathogen identifications were available at least 43 hours prior to culture results.The SeptiFast® platform identified bacterial DNA in urine specimens considerably faster compared to conventional culture. For UTI diagnosis sensitivity and specificity is limited by its present qualitative setup which does not allow pathogen quantification. Future quantitative assays may hold promise for PCR based UTI pathogen identification as a supplementation of conventional culture methods.

  16. PCR-based verification of positive rapid diagnostic tests for intestinal protozoa infections with variable test band intensity.

    Science.gov (United States)

    Becker, Sören L; Müller, Ivan; Mertens, Pascal; Herrmann, Mathias; Zondie, Leyli; Beyleveld, Lindsey; Gerber, Markus; du Randt, Rosa; Pühse, Uwe; Walter, Cheryl; Utzinger, Jürg

    2017-10-01

    Stool-based rapid diagnostic tests (RDTs) for pathogenic intestinal protozoa (e.g. Cryptosporidium spp. and Giardia intestinalis) allow for prompt diagnosis and treatment in resource-constrained settings. Such RDTs can improve individual patient management and facilitate population-based screening programmes in areas without microbiological laboratories for confirmatory testing. However, RDTs are difficult to interpret in case of 'trace' results with faint test band intensities and little is known about whether such ambiguous results might indicate 'true' infections. In a longitudinal study conducted in poor neighbourhoods of Port Elizabeth, South Africa, a total of 1428 stool samples from two cohorts of schoolchildren were examined on the spot for Cryptosporidium spp. and G. intestinalis using an RDT (Crypto/Giardia DuoStrip; Coris BioConcept). Overall, 121 samples were positive for G. intestinalis and the RDT suggested presence of cryptosporidiosis in 22 samples. After a storage period of 9-10 months in cohort 1 and 2-3 months in cohort 2, samples were subjected to multiplex PCR (BD Max™ Enteric Parasite Panel, Becton Dickinson). Ninety-three percent (112/121) of RDT-positive samples for G. intestinalis were confirmed by PCR, with a correlation between RDT test band intensity and quantitative pathogen load present in the sample. For Cryptosporidium spp., all positive RDTs had faintly visible lines and these were negative on PCR. The performance of the BD Max™ PCR was nearly identical in both cohorts, despite the prolonged storage at disrupted cold chain conditions in cohort 1. The Crypto/Giardia DuoStrip warrants further validation in communities with a high incidence of diarrhoea. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Rapid-Viability PCR Method for Detection of Live, Virulent Bacillus anthracis in Environmental Samples ▿

    OpenAIRE

    Létant, Sonia E.; Murphy, Gloria A.; Alfaro, Teneile M.; Avila, Julie R.; Kane, Staci R.; Raber, Ellen; Bunt, Thomas M.; Shah, Sanjiv R.

    2011-01-01

    In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real...

  18. DNA microarray-based solid-phase RT-PCR for rapid detection and identification of influenza virus type A and subtypes H5 and H7

    DEFF Research Database (Denmark)

    Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

    2011-01-01

    of RNA extract in the liquid phase with sequence-specific nested PCR on the solid phase. A simple ultraviolet cross-linking method was used to immobilize the DNA probes over an unmodified glass surface, which makes solid-phase PCR a convenient possibility for AIV screening. The testing of 33 avian fecal....... In this article, a DNA microarray-based solid-phase polymerase chain reaction (PCR) approach has been developed for rapid detection of influenza virus type A and for simultaneous identification of pathogenic virus subtypes H5 and H7. This solid-phase RT-PCR method combined reverse-transcription amplification...

  19. An insulated isothermal PCR method on a field-deployable device for rapid and sensitive detection of canine parvovirus type 2 at points of need.

    Science.gov (United States)

    Wilkes, Rebecca P; Lee, Pei-Yu A; Tsai, Yun-Long; Tsai, Chuan-Fu; Chang, Hsiu-Hui; Chang, Hsiao-Fen G; Wang, Hwa-Tang T

    2015-08-01

    Canine parvovirus type 2 (CPV-2), including subtypes 2a, 2b and 2c, causes an acute enteric disease in both domestic and wild animals. Rapid and sensitive diagnosis aids effective disease management at points of need (PON). A commercially available, field-deployable and user-friendly system, designed with insulated isothermal PCR (iiPCR) technology, displays excellent sensitivity and specificity for nucleic acid detection. An iiPCR method was developed for on-site detection of all circulating CPV-2 strains. Limit of detection was determined using plasmid DNA. CPV-2a, 2b and 2c strains, a feline panleukopenia virus (FPV) strain, and nine canine pathogens were tested to evaluate assay specificity. Reaction sensitivity and performance were compared with an in-house real-time PCR using serial dilutions of a CPV-2b strain and 100 canine fecal clinical samples collected from 2010 to 2014, respectively. The 95% limit of detection of the iiPCR method was 13 copies of standard DNA and detection limits for CPV-2b DNA were equivalent for iiPCR and real-time PCR. The iiPCR reaction detected CPV-2a, 2b and 2c and FPV. Non-targeted pathogens were not detected. Test results of real-time PCR and iiPCR from 99 fecal samples agreed with each other, while one real-time PCR-positive sample tested negative by iiPCR. Therefore, excellent agreement (k = 0.98) with sensitivity of 98.41% and specificity of 100% in detecting CPV-2 in feces was found between the two methods. In conclusion, the iiPCR system has potential to serve as a useful tool for rapid and accurate PON, molecular detection of CPV-2. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  20. Have you tried spermine? A rapid and cost-effective method to eliminate dextran sodium sulfate inhibition of PCR and RT-PCR.

    Science.gov (United States)

    Krych, Łukasz; Kot, Witold; Bendtsen, Katja M B; Hansen, Axel K; Vogensen, Finn K; Nielsen, Dennis S

    2018-01-01

    The Dextran Sulfate Sodium (DSS) induced colitis mouse model is commonly used to investigate human inflammatory bowel disease (IBD). Nucleic acid extracts originating from these animals are often contaminated with DSS, which is a strong inhibitor of many enzymatic based molecular biology reactions including PCR and reverse-transcription (RT). Methods for removing DSS from nucleic acids extracts exist for RNA, but no effective protocol for DNA or cDNA is currently available. However, spermine has previously been shown to be an effective agent for counteracting DSS inhibition of polynucleotide kinase, which led to the hypothesis, that spermine could be used to counteract DSS inhibition of PCR and RT. We investigated the means of adding spermine in an adequate concentration to PCR based protocols (including qPCR, two-step RT-qPCR, and amplicon sequencing library preparation) to remove DSS inhibition. Within the range up to 0.01g/L, spermine can be added to PCR/qPCR or RT prophylactically without a significant reduction of reaction efficiency. Addition of spermine at the concentration of 0.08g/L can be used to recover qualitative PCR signal inhibited by DSS in concentrations up to 0.32g/L. For optimal quantitative analysis, the concentration of spermine requires fine adjustment. Hence, we present here a simple fluorometric based method for adjusting the concentration of spermine ensuring an optimal efficiency of the reaction exposed to an unknown concentration of DSS. In conclusion, we demonstrate a cost effective and easy method to counteract DSS inhibition in PCR and two-step RT-qPCR. Fixed or fine-tuned concentrations of spermine can be administered depending on the qualitative or quantitative character of the analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. A new real-time PCR assay for rapid identification of the S. aureus/MRSA strains

    Directory of Open Access Journals (Sweden)

    Ivan Manga

    2013-01-01

    Full Text Available The Methicillin-resistant Staphylococcus aureus (MRSA with the livestock-associated MRSA (LA-MRSA are of great interest to scientists and general public. The aim of our study was to present a new more rapid and reliable diagnostic method working on the RT-PCR platform applicable for monitoring of MRSA/S. aureus. The parallel testing of the S. aureus specific nuc gene sequence and the mecA gene sequence was utilised for this purpose. A collection of ten S. aureus/MRSA reference strains, fifteen genetically related non S. aureus reference strains and fifty-six environmental samples was employed for estimation of the assay performance and parameters. The environmental samples acquired in the Czech livestock farms were represented with the livestock and human nasal mucosae or skin swabs, the slaughter meat swabs and were chosen preferentially from individuals with previously confi rmed or suspected positive MRSA/S. aureus cases. The classic selective cultivation approach with the biochemical test and agar disk diffusion test was accepted as reference diagnostic method. As there were no culture positive samples that were negative using RT-PCR, our method featured with 100% sensitivity in comparison to reference method. The limit of detection allowed to identify from tens to hundreds copies of S. aureus/MRSA genome. Further, the RT-PCR assay featured with 100% inclusivity and 95% exclusivity at Cq value below 30. These parameters suggested on powerful and reliable diagnostic method with real potential of practical utilisation. We consider our method as ideal for testing of individual suspected colonies, when the results can be acquired in less than 1.5 hour.

  2. Rapid detection of food-borne Salmonella contamination using IMBs-qPCR method based on pagC gene

    Directory of Open Access Journals (Sweden)

    Jiashun Wang

    Full Text Available Abstract Detection of Salmonella is very important to minimize the food safety risk. In this study, the recombinant PagC protein and PagC antibody were prepared and coupled with immunomagnetic beads (IMBs to capture Salmonella cells from pork and milk samples. And then the SYBR Green qualitative PCR was developed to detect the pathogenic Salmonella. The results showed that the PagC polyclonal antiserum is of good specificity and the capture rate of 0.1 mg IMBs for Salmonella tended to be stable at the range of 70-74% corresponding to the concentrations between 101 and 104 CFU/mL. The method developed demonstrated high specificity for the positive Salmonella samples when compared to non-specific DNA samples, such as Escherichia coli, Staphylococcus aureus, Yersinia enterocolitica, and Yersinia pseudotuberculosis. The limit of detection of this assay was 18 CFU/mL. Detection and quantitative enumeration of Salmonella in samples of pork or milk shows good recoveries of 54.34% and 52.07%. In conclusion, the polyclonal antibody of recombinant PagC protein is effective to capture Salmonella from detected samples. The developed pagC antibody IMBs-qPCR method showed efficiency, sensitivity and specificity for 30 Salmonella detection, enabling detection within 10 h, which is a promising rapid method to detect Salmonella in emergency.

  3. A rapid Q-PCR titration protocol for adenovirus and helper-dependent adenovirus vectors that produces biologically relevant results

    Science.gov (United States)

    Gallaher, Sean D.; Berk, Arnold J.

    2013-01-01

    Adenoviruses are employed in the study of cellular processes and as expression vectors used in gene therapy. The success and reproducibility of these studies is dependent in part on having accurate and meaningful titers of replication competent and helper-dependent adenovirus stocks, which is problematic due to the use of varied and divergent titration protocols. Physical titration methods, which quantify the total number of viral particles, are used by many, but are poor at estimating activity. Biological titration methods, such as plaque assays, are more biologically relevant, but are time consuming and not applicable to helper-dependent gene therapy vectors. To address this, a protocol was developed called “infectious genome titration” in which viral DNA is isolated from the nuclei of cells ~3 h post-infection, and then quantified by Q-PCR. This approach ensures that only biologically active virions are counted as part of the titer determination. This approach is rapid, robust, sensitive, reproducible, and applicable to all forms of adenovirus. Unlike other Q-PCR-based methods, titers determined by this protocol are well correlated with biological activity. PMID:23624118

  4. Loop-mediated isothermal amplification (LAMP) as an alternative to PCR: A rapid on-site detection of gene doping.

    Science.gov (United States)

    Salamin, Olivier; Kuuranne, Tiia; Saugy, Martial; Leuenberger, Nicolas

    2017-11-01

    Innovation in medical research has been diverted at multiple occasions to enhance human performance. The predicted great progress in gene therapy has raised some concerns regarding its misuse in the world of sports (gene doping) for several years now. Even though there is no evidence that gene doping has ever been used in sports, the continuous improvement of gene therapy techniques increases the likelihood of abuse. Therefore, since 2004, efforts have been invested by the anti-doping community and WADA for the development of detection methods. Several nested PCR and qPCR-based strategies exploiting the absence of introns in the transgenic DNA have been proposed for the long-term detection of transgene in blood. Despite their great sensitivity, those protocols are hampered by limitations of the techniques that can be cumbersome and costly. The purpose of this perspective is to describe a new approach based on loop-mediated isothermal amplification (LAMP) for the detection of gene doping. This protocol enables a rapid and simple method to amplify nucleic acids with a high sensitivity and specificity and with a simple visual detection of the results. LAMP is already being used in clinical application for the detection of viruses or mutations. Therefore, this technique has the potential to be further developed for the detection of foreign genetic material in elite athletes. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  5. Real-Time PCR Typing of Escherichia coli Based on Multiple Single Nucleotide Polymorphisms--a Convenient and Rapid Method.

    Science.gov (United States)

    Lager, Malin; Mernelius, Sara; Löfgren, Sture; Söderman, Jan

    2016-01-01

    Healthcare-associated infections caused by Escherichia coli and antibiotic resistance due to extended-spectrum beta-lactamase (ESBL) production constitute a threat against patient safety. To identify, track, and control outbreaks and to detect emerging virulent clones, typing tools of sufficient discriminatory power that generate reproducible and unambiguous data are needed. A probe based real-time PCR method targeting multiple single nucleotide polymorphisms (SNP) was developed. The method was based on the multi locus sequence typing scheme of Institute Pasteur and by adaptation of previously described typing assays. An 8 SNP-panel that reached a Simpson's diversity index of 0.95 was established, based on analysis of sporadic E. coli cases (ESBL n = 27 and non-ESBL n = 53). This multi-SNP assay was used to identify the sequence type 131 (ST131) complex according to the Achtman's multi locus sequence typing scheme. However, it did not fully discriminate within the complex but provided a diagnostic signature that outperformed a previously described detection assay. Pulsed-field gel electrophoresis typing of isolates from a presumed outbreak (n = 22) identified two outbreaks (ST127 and ST131) and three different non-outbreak-related isolates. Multi-SNP typing generated congruent data except for one non-outbreak-related ST131 isolate. We consider multi-SNP real-time PCR typing an accessible primary generic E. coli typing tool for rapid and uniform type identification.

  6. Multiplex-PCR As a Rapid and Sensitive Method for Identification of Meat Species in Halal-Meat Products.

    Science.gov (United States)

    Alikord, Mahsa; Keramat, Javad; Kadivar, Mahdi; Momtaz, Hassan; Eshtiaghi, Mohammad N; Homayouni-Rad, Aziz

    2017-01-01

    Species identification and authentication in meat products are important subjects for ensuring the health of consumers. The multiplex-PCR amplification and species- specific primer set were used for the identification of horse, donkey, pig and other ruminants in raw and processed meat products. Oligonucleotid primers were designed and patented for amplification of species-specific mitochondrial DNA sequences of each species and samples were prepared from binary meat mixtures. The results showed that meat species were accurately determined in all combinations by multiplex-PCR, and the sensitivity of this method was 0.001 ng, rendering this technique open to and suitable for use in industrial meat products. It is concluded that more fraud is seen in lower percentage industrial meat products than in higher percentage ones. There was also more fraud found in processed products than in raw ones. This rapid and useful test is recommended for quality control firms for applying more rigorous controls over industrial meat products, for the benefit of target consumers. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  7. Development of a Rapid Real-Time PCR Assay for Quantitation of Pneumocystis carinii f. sp. Carinii

    DEFF Research Database (Denmark)

    Larsen, Hans Henrik; Kovacs, Joseph A; Stock, Frida

    2002-01-01

    A method for reliable quantification of Pneumocystis carinii in research models of P. carinii pneumonia (PCP) that is more convenient and reproducible than microscopic enumeration of organisms would greatly facilitate investigations of this organism. We developed a rapid quantitative touchdown (QTD......) PCR assay for detecting P. carinii f. sp. carinii, the subspecies of P. carinii commonly used in research models of PCP. The assay was based on the single-copy dihydrofolate reductase gene and was able to detect ... 6 log values for standards containing > or =5 copies/tube. Application of the assay to a series of 10-fold dilutions of P. carinii organisms isolated from rat lung demonstrated that it was reproducibly quantitative over 5 log values (r = 0.99). The assay was applied to a recently reported in vitro...

  8. Development of a Rapid Real-Time PCR Assay for Quantitation of Pneumocystis carinii f. sp. Carinii

    DEFF Research Database (Denmark)

    Larsen, Hans Henrik; Kovacs, Joseph A; Stock, Frida

    2002-01-01

    6 log values for standards containing > or =5 copies/tube. Application of the assay to a series of 10-fold dilutions of P. carinii organisms isolated from rat lung demonstrated that it was reproducibly quantitative over 5 log values (r = 0.99). The assay was applied to a recently reported in vitro...... axenic cultivation system for P. carinii and confirmed our microscopy findings that no organism multiplication had occurred during culture. For all cultures analyzed, QTD PCR assays showed a decrease in P. carinii DNA that exceeded the expected decrease due to dilution of the inoculum upon transfer......A method for reliable quantification of Pneumocystis carinii in research models of P. carinii pneumonia (PCP) that is more convenient and reproducible than microscopic enumeration of organisms would greatly facilitate investigations of this organism. We developed a rapid quantitative touchdown (QTD...

  9. Real-time PCR-based method for the rapid detection of extended RAS mutations using bridged nucleic acids in colorectal cancer.

    Science.gov (United States)

    Iida, Takao; Mizuno, Yukie; Kaizaki, Yasuharu

    2017-10-27

    Mutations in RAS and BRAF are predictors of the efficacy of anti-epidermal growth factor receptor (EGFR) therapy in patients with metastatic colorectal cancer (mCRC). Therefore, simple, rapid, cost-effective methods to detect these mutations in the clinical setting are greatly needed. In the present study, we evaluated BNA Real-time PCR Mutation Detection Kit Extended RAS (BNA Real-time PCR), a real-time PCR method that uses bridged nucleic acid clamping technology to rapidly detect mutations in RAS exons 2-4 and BRAF exon 15. Genomic DNA was extracted from 54 formalin-fixed paraffin-embedded (FFPE) tissue samples obtained from mCRC patients. Among the 54 FFPE samples, BNA Real-time PCR detected 21 RAS mutations (38.9%) and 5 BRAF mutations (9.3%), and the reference assay (KRAS Mutation Detection Kit and MEBGEN™ RASKET KIT) detected 22 RAS mutations (40.7%). The concordance rate of detected RAS mutations between the BNA Real-time PCR assay and the reference assays was 98.2% (53/54). The BNA Real-time PCR assay proved to be a more simple, rapid, and cost-effective method for detecting KRAS and RAS mutations compared with existing assays. These findings suggest that BNA Real-time PCR is a valuable tool for predicting the efficacy of early anti-EGFR therapy in mCRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. PCR detection of potato cyst nematode.

    Science.gov (United States)

    Reid, Alex

    2009-01-01

    Potato cyst nematode (PCN) is responsible for losses in potato production totalling millions of euros every year in the EC. It is important for growers to know which species is present in their land as this determines its subsequent use. The two species Globodera pallida and Globodera rostochiensis can be differentiated using an allele-specific PCR.

  11. High-throughput analysis of candidate imprinted genes and allele-specific gene expression in the human term placenta

    Directory of Open Access Journals (Sweden)

    Clark Taane G

    2010-04-01

    Full Text Available Abstract Background Imprinted genes show expression from one parental allele only and are important for development and behaviour. This extreme mode of allelic imbalance has been described for approximately 56 human genes. Imprinting status is often disrupted in cancer and dysmorphic syndromes. More subtle variation of gene expression, that is not parent-of-origin specific, termed 'allele-specific gene expression' (ASE is more common and may give rise to milder phenotypic differences. Using two allele-specific high-throughput technologies alongside bioinformatics predictions, normal term human placenta was screened to find new imprinted genes and to ascertain the extent of ASE in this tissue. Results Twenty-three family trios of placental cDNA, placental genomic DNA (gDNA and gDNA from both parents were tested for 130 candidate genes with the Sequenom MassArray system. Six genes were found differentially expressed but none imprinted. The Illumina ASE BeadArray platform was then used to test 1536 SNPs in 932 genes. The array was enriched for the human orthologues of 124 mouse candidate genes from bioinformatics predictions and 10 human candidate imprinted genes from EST database mining. After quality control pruning, a total of 261 informative SNPs (214 genes remained for analysis. Imprinting with maternal expression was demonstrated for the lymphocyte imprinted gene ZNF331 in human placenta. Two potential differentially methylated regions (DMRs were found in the vicinity of ZNF331. None of the bioinformatically predicted candidates tested showed imprinting except for a skewed allelic expression in a parent-specific manner observed for PHACTR2, a neighbour of the imprinted PLAGL1 gene. ASE was detected for two or more individuals in 39 candidate genes (18%. Conclusions Both Sequenom and Illumina assays were sensitive enough to study imprinting and strong allelic bias. Previous bioinformatics approaches were not predictive of new imprinted genes

  12. Rapid detection of Puccinia triticina causing leaf rust of wheat by PCR and loop mediated isothermal amplification.

    Science.gov (United States)

    Manjunatha, C; Sharma, Sapna; Kulshreshtha, Deepika; Gupta, Sangeeta; Singh, Kartar; Bhardwaj, Subhash C; Aggarwal, Rashmi

    2018-01-01

    Leaf rust of wheat caused by Puccinia triticina has significant impact on wheat production worldwide. Effective and quick detection methodologies are required to mitigate yield loss and time constraints associated with monitoring and management of leaf rust of wheat. In the present study, detection of P. triticina has been simplified by developing a rapid, reliable, efficient and visual colorimetric method i.e., loop mediated isothermal amplification of DNA (LAMP). Based on in silico analysis of P. triticina genome, PTS68, a simple sequence repeat was found highly specific to leaf rust fungus. A marker (PtRA68) was developed and its specificity was validated through PCR technique which gave a unique and sharp band of 919 bp in P. triticina pathotypes only. A novel gene amplification method LAMP which enables visual detection of pathogen by naked eye was developed for leaf rust pathogen. A set of six primers was designed from specific region of P. triticina and conditions were optimised to complete the observation process in 60 minutes at 65o C. The assay developed in the study could detect presence of P. triticina on wheat at 24 hpi (pre-symptomatic stage) which was much earlier than PCR without requiring thermal cycler. Sensitivity of LAMP assay developed in the study was 100 fg which was more sensitive than conventional PCR (50 pg) and equivalent to qPCR (100 fg). The protocol developed in the study was utilized for detection of leaf rust infected samples collected from different wheat fields. LAMP based colorimetric detection assay showed sky blue color in positive reaction and violet color in negative reaction after addition of 120 μM hydroxyl napthol blue (HNB) solution to reaction mixture. Similarly, 0.6 mg Ethidium bromide/ml was added to LAMP products, placed on transilluminator to witness full brightness in positive reaction and no such brightness could be seen in negative reaction mixture. Further, LAMP products spread in a ladder like banding pattern in

  13. Rapid detection and differentiation of Clonorchis sinensis and Opisthorchis viverrini using real-time PCR and high resolution melting analysis.

    Science.gov (United States)

    Cai, Xian-Quan; Yu, Hai-Qiong; Li, Rong; Yue, Qiao-Yun; Liu, Guo-Hua; Bai, Jian-Shan; Deng, Yan; Qiu, De-Yi; Zhu, Xing-Quan

    2014-01-01

    Clonorchis sinensis and Opisthorchis viverrini are both important fish-borne pathogens, causing serious public health problem in Asia. The present study developed an assay integrating real-time PCR and high resolution melting (HRM) analysis for the specific detection and rapid identification of C. sinensis and O. viverrini. Primers targeting COX1 gene were highly specific for these liver flukes, as evidenced by the negative amplification of closely related trematodes. Assays using genomic DNA extracted from the two flukes yielded specific amplification and their identity was confirmed by sequencing, having the accuracy of 100% in reference to conventional methods. The assay was proved to be highly sensitive with a detection limit below 1 pg of purified genomic DNA, 5 EPG, or 1 metacercaria of C. sinensis. Moreover, C. sinensis and O. viverrini were able to be differentiated by their HRM profiles. The method can reduce labor of microscopic examination and the contamination of agarose electrophoresis. Moreover, it can differentiate these two flukes which are difficult to be distinguished using other methods. The established method provides an alternative tool for rapid, simple, and duplex detection of C. sinensis and O. viverrini.

  14. Rapid Detection and Differentiation of Clonorchis sinensis and Opisthorchis viverrini Using Real-Time PCR and High Resolution Melting Analysis

    Directory of Open Access Journals (Sweden)

    Xian-Quan Cai

    2014-01-01

    Full Text Available Clonorchis sinensis and Opisthorchis viverrini are both important fish-borne pathogens, causing serious public health problem in Asia. The present study developed an assay integrating real-time PCR and high resolution melting (HRM analysis for the specific detection and rapid identification of C. sinensis and O. viverrini. Primers targeting COX1 gene were highly specific for these liver flukes, as evidenced by the negative amplification of closely related trematodes. Assays using genomic DNA extracted from the two flukes yielded specific amplification and their identity was confirmed by sequencing, having the accuracy of 100% in reference to conventional methods. The assay was proved to be highly sensitive with a detection limit below 1 pg of purified genomic DNA, 5 EPG, or 1 metacercaria of C. sinensis. Moreover, C. sinensis and O. viverrini were able to be differentiated by their HRM profiles. The method can reduce labor of microscopic examination and the contamination of agarose electrophoresis. Moreover, it can differentiate these two flukes which are difficult to be distinguished using other methods. The established method provides an alternative tool for rapid, simple, and duplex detection of C. sinensis and O. viverrini.

  15. Development of a nested-PCR assay for the rapid detection of Pilidiella granati in pomegranate fruit

    Science.gov (United States)

    Yang, Xue; Hameed, Uzma; Zhang, Ai-Fang; Zang, Hao-Yu; Gu, Chun-Yan; Chen, Yu; Xu, Yi-Liu

    2017-01-01

    Pilidiella granati, a causal agent of twig blight and crown rot of pomegranate, is an emerging threat that may cause severe risk to the pomegranate industry in the future. Development of a rapid assay for the timely and accurate detection of P. granati will be helpful in the active surveillance and management of the disease caused by this pathogen. In this study, a nested PCR method was established for the detection of P. granati. Comparative analysis of genetic diversity within 5.8S rDNA internal transcribed spacer (ITS) sequences of P. granati and 21 other selected fungal species was performed to design species-specific primers (S1 and S2). This primer pair successfully amplified a 450 bp product exclusively from the genomic DNA of P. granati. The developed method can detect 10 pg genomic DNA of the pathogen in about 6 h. This technique was successfully applied to detect the natural infection of P. granati in the pomegranate fruit. The designed protocol is rapid and precise with a high degree of sensitivity. PMID:28106107

  16. Allele-specific Gene Silencing of Mutant mRNA Restores Cellular Function in Ullrich Congenital Muscular Dystrophy Fibroblasts

    Directory of Open Access Journals (Sweden)

    Satoru Noguchi

    2014-01-01

    Full Text Available Ullrich congenital muscular dystrophy (UCMD is an inherited muscle disorder characterized clinically by muscle weakness, distal joint hyperlaxity, and proximal joint contractures. Sporadic and recessive mutations in the three collagen VI genes, COL6A1, COL6A2, and COL6A3, are reported to be causative. In the sporadic forms, a heterozygous point mutation causing glycine substitution in the triple helical domain has been identified in higher rate. In this study, we examined the efficacy of siRNAs, which target point mutation site, on specific knockdown toward transcripts from mutant allele and evaluated consequent cellular phenotype of UCMD fibroblasts. We evaluated the effect of siRNAs targeted to silence-specific COL6A1 alleles in UCMD fibroblasts, where simultaneous expression of both wild-type and mutant collagen VI resulted in defective collagen localization. Addition of mutant-specific siRNAs allowed normal extracellular localization of collagen VI surrounding fibroblasts, suggesting selective inhibition of mutant collagen VI. Targeting the single-nucleotide COL6A1 c.850G>A (p.G284R mutation responsible a sporadic autosomal dominant form of UCMD can potently and selectively block expression of mutant collagen VI. These results suggest that allele-specific knockdown of the mutant mRNA can potentially be considered as a therapeutic procedure in UCMD due to COL6A1 point mutations.

  17. Allele-Specific DNA Methylation and Its Interplay with Repressive Histone Marks at Promoter-Mutant TERT Genes

    Directory of Open Access Journals (Sweden)

    Josh Lewis Stern

    2017-12-01

    Full Text Available A mutation in the promoter of the Telomerase Reverse Transcriptase (TERT gene is the most frequent noncoding mutation in cancer. The mutation drives unusual monoallelic expression of TERT, allowing immortalization. Here, we find that DNA methylation of the TERT CpG island (CGI is also allele-specific in multiple cancers. The expressed allele is hypomethylated, which is opposite to cancers without TERT promoter mutations. The continued presence of Polycomb repressive complex 2 (PRC2 on the inactive allele suggests that histone marks of repressed chromatin may be causally linked to high DNA methylation. Consistent with this hypothesis, TERT promoter DNA containing 5-methyl-CpG has much increased affinity for PRC2 in vitro. Thus, CpG methylation and histone marks appear to collaborate to maintain the two TERT alleles in different epigenetic states in TERT promoter mutant cancers. Finally, in several cancers, DNA methylation levels at the TERT CGI correlate with altered patient survival.

  18. Allele-Specific DNA Methylation and Its Interplay with Repressive Histone Marks at Promoter-Mutant TERT Genes.

    Science.gov (United States)

    Stern, Josh Lewis; Paucek, Richard D; Huang, Franklin W; Ghandi, Mahmoud; Nwumeh, Ronald; Costello, James C; Cech, Thomas R

    2017-12-26

    A mutation in the promoter of the Telomerase Reverse Transcriptase (TERT) gene is the most frequent noncoding mutation in cancer. The mutation drives unusual monoallelic expression of TERT, allowing immortalization. Here, we find that DNA methylation of the TERT CpG island (CGI) is also allele-specific in multiple cancers. The expressed allele is hypomethylated, which is opposite to cancers without TERT promoter mutations. The continued presence of Polycomb repressive complex 2 (PRC2) on the inactive allele suggests that histone marks of repressed chromatin may be causally linked to high DNA methylation. Consistent with this hypothesis, TERT promoter DNA containing 5-methyl-CpG has much increased affinity for PRC2 in vitro. Thus, CpG methylation and histone marks appear to collaborate to maintain the two TERT alleles in different epigenetic states in TERT promoter mutant cancers. Finally, in several cancers, DNA methylation levels at the TERT CGI correlate with altered patient survival. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  19. Advantage of using allele-specific copy numbers when testing for association in regions with common copy number variants.

    Directory of Open Access Journals (Sweden)

    Gaëlle Marenne

    Full Text Available Copy number variants (CNV can be called from SNP-arrays; however, few studies have attempted to combine both CNV and SNP calls to test for association with complex diseases. Even when SNPs are located within CNVs, two separate association analyses are necessary, to compare the distribution of bi-allelic genotypes in cases and controls (referred to as SNP-only strategy and the number of copies of a region (referred to as CNV-only strategy. However, when disease susceptibility is actually associated with allele specific copy-number states, the two strategies may not yield comparable results, raising a series of questions about the optimal analytical approach. We performed simulations of the performance of association testing under different scenarios that varied genotype frequencies and inheritance models. We show that the SNP-only strategy lacks power under most scenarios when the SNP is located within a CNV; frequently it is excluded from analysis as it does not pass quality control metrics either because of an increased rate of missing calls or a departure from fitness for Hardy-Weinberg proportion. The CNV-only strategy also lacks power because the association testing depends on the allele which copy number varies. The combined strategy performs well in most of the scenarios. Hence, we advocate the use of this combined strategy when testing for association with SNPs located within CNVs.

  20. Identification and removal of low-complexity sites in allele-specific analysis of ChIP-seq data.

    Science.gov (United States)

    Waszak, Sebastian M; Kilpinen, Helena; Gschwind, Andreas R; Orioli, Andrea; Raghav, Sunil K; Witwicki, Robert M; Migliavacca, Eugenia; Yurovsky, Alisa; Lappalainen, Tuuli; Hernandez, Nouria; Reymond, Alexandre; Dermitzakis, Emmanouil T; Deplancke, Bart

    2014-01-15

    High-throughput sequencing technologies enable the genome-wide analysis of the impact of genetic variation on molecular phenotypes at unprecedented resolution. However, although powerful, these technologies can also introduce unexpected artifacts. We investigated the impact of library amplification bias on the identification of allele-specific (AS) molecular events from high-throughput sequencing data derived from chromatin immunoprecipitation assays (ChIP-seq). Putative AS DNA binding activity for RNA polymerase II was determined using ChIP-seq data derived from lymphoblastoid cell lines of two parent-daughter trios. We found that, at high-sequencing depth, many significant AS binding sites suffered from an amplification bias, as evidenced by a larger number of clonal reads representing one of the two alleles. To alleviate this bias, we devised an amplification bias detection strategy, which filters out sites with low read complexity and sites featuring a significant excess of clonal reads. This method will be useful for AS analyses involving ChIP-seq and other functional sequencing assays. The R package abs filter for library clonality simulations and detection of amplification-biased sites is available from http://updepla1srv1.epfl.ch/waszaks/absfilter

  1. A novel temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    DEFF Research Database (Denmark)

    Bu, Minqiang; R. Perch-Nielsen, Ivan; Sørensen, Karen Skotte

    steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature dependent fluorescence......We present a new temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with external heater and temperature sensor. The method employs optimized temperature overshooting and undershooting...

  2. A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    DEFF Research Database (Denmark)

    Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen Skotte

    2013-01-01

    steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence......We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting...

  3. A Novel Reverse-Transcriptase Real-Time PCR Method for Quantification of Viable Vibrio Parahemolyticus in Raw Shrimp Based on a Rapid Construction of Standard Curve Method

    OpenAIRE

    Mengtong Jin; Haiquan Liu; Wenshuo Sun; Qin Li; Zhaohuan Zhang; Jibing Li; Yingjie Pan; Yong Zhao

    2015-01-01

    Vibrio parahemolyticus is an important pathogen that leads to food illness associated seafood. Therefore, rapid and reliable methods to detect and quantify the total viable V. parahaemolyticus in seafood are needed. In this assay, a RNA-based real-time reverse-transcriptase PCR (RT-qPCR) without an enrichment step has been developed for detection and quantification of the total viable V. parahaemolyticus in shrimp. RNA standards with the target segments were synthesized in vitro with T7 RNA p...

  4. Rapid identification of Campylobacter, Arcobacter, and Helicobacter isolates by PCR-restriction fragment length polymorphism analysis of the 16S rRNA gene.

    Science.gov (United States)

    Marshall, S M; Melito, P L; Woodward, D L; Johnson, W M; Rodgers, F G; Mulvey, M R

    1999-12-01

    A rapid two-step identification scheme based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 16S rRNA gene was developed in order to differentiate isolates belonging to the Campylobacter, Arcobacter, and Helicobacter genera. For 158 isolates (26 reference cultures and 132 clinical isolates), specific RFLP patterns were obtained and species were successfully identified by this assay.

  5. Diagnostic accuracy of the ROCHE Septifast PCR system for the rapid detection of blood pathogens in neonatal sepsis-A prospective clinical trial.

    Science.gov (United States)

    Straub, Julia; Paula, Helga; Mayr, Michaela; Kasper, David; Assadian, Ojan; Berger, Angelika; Rittenschober-Böhm, Judith

    2017-01-01

    Diagnosis of neonatal sepsis remains a major challenge in neonatology. Most molecular-based methods are not customized for neonatal requirements. The aim of the present study was to assess the diagnostic accuracy of a modified multiplex PCR protocol for the detection of neonatal sepsis using small blood volumes. 212 episodes of suspected neonatal late onset sepsis were analyzed prospectively using the Roche SeptiFast® MGRADE PCR with a modified DNA extraction protocol and software-handling tool. Results were compared to blood culture, laboratory biomarkers and clinical signs of sepsis. Of 212 episodes, 85 (40.1%) were categorized as "not infected". Among these episodes, 1 was false positive by blood culture (1.2%) and 23 were false positive by PCR (27.1%). Of 51 (24.1%) episodes diagnosed as "culture proven sepsis", the same pathogen was detected by blood culture and PCR in 39 episodes (76.5%). In 8 episodes, more pathogens were detected by PCR compared to blood culture, and in 4 episodes the pathogen detected by blood culture was not found by PCR. One of these episodes was caused by Bacillus cereus, a pathogen not included in the PCR panel. In 76/212 (35.8%) episodes, clinical sepsis was diagnosed. Among these, PCR yielded positive results in 39.5% of episodes (30/76 episodes). For culture-positive sepsis, PCR showed a sensitivity of 90.2% (95%CI 86.2-94.2%) and a specificity of 72.9% (95%CI 67.0-79.0%). The Roche SeptiFast® MGRADE PCR using a modified DNA extraction protocol showed acceptable results for rapid detection of neonatal sepsis in addition to conventional blood culture. The benefit of rapid pathogen detection has to be balanced against the considerable risk of contamination, loss of information on antibiotic sensitivity pattern and increased costs.

  6. Rapid and sensitive detection of cytokines using functionalized gold nanoparticle-based immuno-PCR, comparison with immuno-PCR and ELISA

    Czech Academy of Sciences Publication Activity Database

    Potůčková, Lucie; Franko, Filip; Bambousková, Monika; Dráber, Petr

    2011-01-01

    Roč. 371, 1-2 (2011), s. 38-47 ISSN 0022-1759 R&D Projects: GA AV ČR KAN200520701; GA MŠk 1M0506; GA MŠk LC545; GA ČR GA301/09/1826; GA ČR GAP302/10/1759; GA ČR(CZ) GD204/05/H023 Grant - others:AV ČR(CZ) M200520901 Institutional research plan: CEZ:AV0Z50520514 Keywords : immuno-PCR * nano-iPCR * nanogold particles Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.203, year: 2011

  7. Infrequent detection of germline allele-specific expression of TGFBR1 in lymphoblasts and tissues of colon cancer patients.

    LENUS (Irish Health Repository)

    Guda, Kishore

    2009-06-15

    Recently, germline allele-specific expression (ASE) of the gene encoding for transforming growth factor-beta type I receptor (TGFBR1) has been proposed to be a major risk factor for cancer predisposition in the colon. Germline ASE results in a lowered expression of one of the TGFBR1 alleles (>1.5-fold), and was shown to occur in approximately 20% of informative familial and sporadic colorectal cancer (CRC) cases. In the present study, using the highly quantitative pyrosequencing technique, we estimated the frequency of ASE in TGFBR1 in a cohort of affected individuals from familial clusters of advanced colon neoplasias (cancers and adenomas with high-grade dysplasia), and also from a cohort of individuals with sporadic CRCs. Cases were considered positive for the presence of ASE if demonstrating an allelic expression ratio <0.67 or >1.5. Using RNA derived from lymphoblastoid cell lines, we find that of 46 informative Caucasian advanced colon neoplasia cases with a family history, only 2 individuals display a modest ASE, with allelic ratios of 1.65 and 1.73, respectively. Given that ASE of TGFBR1, if present, would likely be more pronounced in the colon compared with other tissues, we additionally determined the allele ratios of TGFBR1 in the RNA derived from normal-appearing colonic mucosa of sporadic CRC cases. We, however, found no evidence of ASE in any of 44 informative sporadic cases analyzed. Taken together, we find that germline ASE of TGFBR1, as assayed in lymphoblastoid and colon epithelial cells of colon cancer patients, is a relatively rare event.

  8. Bamgineer: Introduction of simulated allele-specific copy number variants into exome and targeted sequence data sets.

    Science.gov (United States)

    Samadian, Soroush; Bruce, Jeff P; Pugh, Trevor J

    2018-03-01

    Somatic copy number variations (CNVs) play a crucial role in development of many human cancers. The broad availability of next-generation sequencing data has enabled the development of algorithms to computationally infer CNV profiles from a variety of data types including exome and targeted sequence data; currently the most prevalent types of cancer genomics data. However, systemic evaluation and comparison of these tools remains challenging due to a lack of ground truth reference sets. To address this need, we have developed Bamgineer, a tool written in Python to introduce user-defined haplotype-phased allele-specific copy number events into an existing Binary Alignment Mapping (BAM) file, with a focus on targeted and exome sequencing experiments. As input, this tool requires a read alignment file (BAM format), lists of non-overlapping genome coordinates for introduction of gains and losses (bed file), and an optional file defining known haplotypes (vcf format). To improve runtime performance, Bamgineer introduces the desired CNVs in parallel using queuing and parallel processing on a local machine or on a high-performance computing cluster. As proof-of-principle, we applied Bamgineer to a single high-coverage (mean: 220X) exome sequence file from a blood sample to simulate copy number profiles of 3 exemplar tumors from each of 10 tumor types at 5 tumor cellularity levels (20-100%, 150 BAM files in total). To demonstrate feasibility beyond exome data, we introduced read alignments to a targeted 5-gene cell-free DNA sequencing library to simulate EGFR amplifications at frequencies consistent with circulating tumor DNA (10, 1, 0.1 and 0.01%) while retaining the multimodal insert size distribution of the original data. We expect Bamgineer to be of use for development and systematic benchmarking of CNV calling algorithms by users using locally-generated data for a variety of applications. The source code is freely available at http://github.com/pughlab/bamgineer.

  9. Bamgineer: Introduction of simulated allele-specific copy number variants into exome and targeted sequence data sets.

    Directory of Open Access Journals (Sweden)

    Soroush Samadian

    2018-03-01

    Full Text Available Somatic copy number variations (CNVs play a crucial role in development of many human cancers. The broad availability of next-generation sequencing data has enabled the development of algorithms to computationally infer CNV profiles from a variety of data types including exome and targeted sequence data; currently the most prevalent types of cancer genomics data. However, systemic evaluation and comparison of these tools remains challenging due to a lack of ground truth reference sets. To address this need, we have developed Bamgineer, a tool written in Python to introduce user-defined haplotype-phased allele-specific copy number events into an existing Binary Alignment Mapping (BAM file, with a focus on targeted and exome sequencing experiments. As input, this tool requires a read alignment file (BAM format, lists of non-overlapping genome coordinates for introduction of gains and losses (bed file, and an optional file defining known haplotypes (vcf format. To improve runtime performance, Bamgineer introduces the desired CNVs in parallel using queuing and parallel processing on a local machine or on a high-performance computing cluster. As proof-of-principle, we applied Bamgineer to a single high-coverage (mean: 220X exome sequence file from a blood sample to simulate copy number profiles of 3 exemplar tumors from each of 10 tumor types at 5 tumor cellularity levels (20-100%, 150 BAM files in total. To demonstrate feasibility beyond exome data, we introduced read alignments to a targeted 5-gene cell-free DNA sequencing library to simulate EGFR amplifications at frequencies consistent with circulating tumor DNA (10, 1, 0.1 and 0.01% while retaining the multimodal insert size distribution of the original data. We expect Bamgineer to be of use for development and systematic benchmarking of CNV calling algorithms by users using locally-generated data for a variety of applications. The source code is freely available at http://github.com/pughlab/bamgineer.

  10. Establishment of a nested-ASP-PCR method to determine the clarithromycin resistance of Helicobacter pylori.

    Science.gov (United States)

    Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun

    2016-07-07

    To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and

  11. Allele-specific gene expression patterns in primary leukemic cells reveal regulation of gene expression by CpG site methylation

    DEFF Research Database (Denmark)

    Milani, Lili; Lundmark, Anders; Nordlund, Jessica

    2008-01-01

    To identify genes that are regulated by cis-acting functional elements in acute lymphoblastic leukemia (ALL) we determined the allele-specific expression (ASE) levels of 2, 529 genes by genotyping a genome-wide panel of single nucleotide polymorphisms in RNA and DNA from bone marrow and blood...

  12. Rapid real-time PCR assay for culture and tissue identification of Geomyces destructans: the etiologic agent of bat geomycosis (white nose syndrome).

    Science.gov (United States)

    Chaturvedi, Sudha; Rudd, Robert J; Davis, April; Victor, Tanya R; Li, Xiaojiang; Appler, Kim A; Rajkumar, Sunanda S; Chaturvedi, Vishnu

    2011-10-01

    Geomyces destructans is the etiologic agent of bat geomycosis, commonly referred to as white nose syndrome (WNS). This infection has caused severe morbidity and mortality in little brown bats (Myotis lucifugus) and has also spread to other bat species with significant decline in the populations. Currently, G. destructans infection is identified by culture, ITS-PCR, and histopathology. We hypothesized that a real-time PCR assay would considerably improve detection of G. destructans in bats. The 100 bp sequence of the Alpha-L-Rhamnosidase gene was validated as a target for real-time PCR. The assay sensitivity was determined from serial dilution of DNA extracted from G. destructans conidia (5 × 10(-1)-5 × 10(7)), and the specificity was tested using DNA from 30 closely and distantly related fungi and 5 common bacterial pathogens. The real-time PCR assay was highly sensitive with detection limit of two G. destructans conidia per reaction at 40 PCR cycles. The assay was also highly specific as none of the other fungal or bacterial DNA cross-reacted in the real-time PCR assay. One hundred and forty-seven bat tissue samples, suspected of infection with G. destructans, were used to compare the real-time PCR assay to other methods employed for the detection of G. destructans. Real-time PCR was highly sensitive with 80 of 147 (55%) samples testing positive for G. destructans DNA. In comparison, histopathology examination revealed 64/147 (44%) positive samples. The internal transcribed spacer (ITS)-PCR yielded positive amplicon for G. destructans from 37 tissue samples (25%). The least sensitive assay was the fungal culture with only 17 tissue samples (12%) yielding G. destructans in culture. The data suggested that the real-time PCR assay is highly promising for rapid, sensitive, and specific identification of G. destructans. Further trials and inter-laboratory comparisons of this novel assay are recommended to improve the diagnosis of bat geomycosis.

  13. Potassium hydroxide-ethylene diamine tetraacetic acid method for the rapid preparation of small-scale PCR template DNA from actinobacteria.

    Science.gov (United States)

    Sun, Zhibin; Huang, Yan; Wang, Yanzhuo; Zhao, Yuguo; Cui, Zhongli

    2014-01-01

    Genomic DNA extraction from Gram-positive bacteria is a laborious and time-consuming process. A rapid and convenient method was established to extract genomic DNA from a single colony as a PCR template. KOH-EDTA is used as a lysis buffer to disrupt the cell envelope, releasing genomic DNA, and Tris-HCl (pH = 4) is then added to neutralize the lysate. The lysate can be used directly as a template for PCR amplification. 16S rDNA was successfully amplified from Gram-positive bacteria from the genera of Bacillus, Streptomyces, Micromonospora, Nonomuraea, Microbispora, and Staphylococcus. Amplification of the trpB gene indicated that this method could also be applied to the amplification of functional genes. Compared to colony PCR methods without KOH-EDTA, this method is extremely fast and efficient, and it is applicable to high-throughput PCR amplifications.

  14. New LightCycler PCR for Rapid and Sensitive Quantification of Parvovirus B19 DNA Guides Therapeutic Decision-Making in Relapsing Infections

    Science.gov (United States)

    Harder, Timm C.; Hufnagel, Markus; Zahn, Katrin; Beutel, Karin; Schmitt, Heinz-Josef; Ullmann, Uwe; Rautenberg, Peter

    2001-01-01

    Detection of parvovirus B19 DNA offers diagnostic advantages over serology, particularly in persistent infections of immunocompromised patients. A rapid, novel method of B19 DNA detection and quantification is introduced. This method, a quantitative PCR assay, is based on real-time glass capillary thermocycling (LightCycler [LC]) and fluorescence resonance energy transfer (FRET). The PCR assay allowed quantification over a dynamic range of over 7 logs and could quantify as little as 250 B19 genome equivalents (geq) per ml as calculated for plasmid DNA (i.e., theoretically ≥5 geq per assay). Interrater agreement analysis demonstrated equivalence of LC-FRET PCR and conventional nested PCR in the diagnosis of an active B19 infection (kappa coefficient = 0.83). The benefit of the new method was demonstrated in an immunocompromised child with a relapsing infection, who required an attenuation of the immunosuppressive therapy in addition to repeated doses of immunoglobulin to eliminate the virus. PMID:11724854

  15. Comparison of false-negative rates and limits of detection following macrofoam-swab sampling of Bacillus anthracis surrogates via Rapid Viability PCR and plate culture.

    Science.gov (United States)

    Hutchison, J R; Piepel, G F; Amidan, B G; Hess, B M; Sydor, M A; Deatherage Kaiser, B L

    2018-05-01

    We evaluated the effects of Bacillus anthracis surrogates, low surface concentrations, surface materials and assay methods on false-negative rate (FNR) and limit of detection (LOD 95 ) for recovering Bacillus spores using a macrofoam-swab sampling procedure. Bacillus anthracis Sterne or Bacillus atrophaeus Nakamura spores were deposited over a range of low target concentrations (2-500 per coupon) onto glass, stainless steel, vinyl tile and plastic. Samples were assayed using a modified Rapid Viability-PCR (mRV-PCR) method and the traditional plate culture method to obtain FNR and LOD 95 results. Mean FNRs tended to be lower for mRV-PCR compared to culturing, and increased as spore concentration decreased for all surface materials. Surface material, but not B. anthracis surrogate, influenced FNRs with the mRV-PCR method. The mRV-PCR LOD 95 was lowest for glass and highest for vinyl tile. LOD 95 values overall were lower for mRV-PCR than for the culture method. This study adds to the limited data on FNR and LOD 95 for mRV-PCR and culturing methods with low concentrations of B. anthracis sampled from various surface materials by the CDC macrofoam-swab method. These are key inputs for planning characterization and clearance studies for low contamination levels of B. anthracis. © 2018 The Society for Applied Microbiology.

  16. Development of three allele-specific co-Dominant PCR markers suitable for marker-assisted selection of amylose class and paste viscosity of rice

    Science.gov (United States)

    Most rice is consumed as whole kernel cooked rice, and the consumer preferences for cooked rice texture and other sensory properties differ among regions of the world. Rice is also used as an ingredient in a multitude of foods by food-processing companies across the globe. These sensory and function...

  17. Clinical Application of Picodroplet Digital PCR Technology for Rapid Detection of EGFR T790M in Next-Generation Sequencing Libraries and DNA from Limited Tumor Samples.

    Science.gov (United States)

    Borsu, Laetitia; Intrieri, Julie; Thampi, Linta; Yu, Helena; Riely, Gregory; Nafa, Khedoudja; Chandramohan, Raghu; Ladanyi, Marc; Arcila, Maria E

    2016-11-01

    Although next-generation sequencing (NGS) is a robust technology for comprehensive assessment of EGFR-mutant lung adenocarcinomas with acquired resistance to tyrosine kinase inhibitors, it may not provide sufficiently rapid and sensitive detection of the EGFR T790M mutation, the most clinically relevant resistance biomarker. Here, we describe a digital PCR (dPCR) assay for rapid T790M detection on aliquots of NGS libraries prepared for comprehensive profiling, fully maximizing broad genomic analysis on limited samples. Tumor DNAs from patients with EGFR-mutant lung adenocarcinomas and acquired resistance to epidermal growth factor receptor inhibitors were prepared for Memorial Sloan-Kettering-Integrated Mutation Profiling of Actionable Cancer Targets sequencing, a hybrid capture-based assay interrogating 410 cancer-related genes. Precapture library aliquots were used for rapid EGFR T790M testing by dPCR, and results were compared with NGS and locked nucleic acid-PCR Sanger sequencing (reference high sensitivity method). Seventy resistance samples showed 99% concordance with the reference high sensitivity method in accuracy studies. Input as low as 2.5 ng provided a sensitivity of 1% and improved further with increasing DNA input. dPCR on libraries required less DNA and showed better performance than direct genomic DNA. dPCR on NGS libraries is a robust and rapid approach to EGFR T790M testing, allowing most economical utilization of limited material for comprehensive assessment. The same assay can also be performed directly on any limited DNA source and cell-free DNA. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  18. Impact of pre-existing MSP142-allele specific immunity on potency of an erythrocytic Plasmodium falciparum vaccine

    Directory of Open Access Journals (Sweden)

    Bergmann-Leitner Elke S

    2012-09-01

    Full Text Available Abstract Background MSP1 is the major surface protein on merozoites and a prime candidate for a blood stage malaria vaccine. Preclinical and seroepidemiological studies have implicated antibodies to MSP1 in protection against blood stage parasitaemia and/or reduced parasite densities, respectively. Malaria endemic areas have multiple strains of Plasmodium falciparum circulating at any given time, giving rise to complex immune responses, an issue which is generally not addressed in clinical trials conducted in non-endemic areas. A lack of understanding of the effect of pre-existing immunity to heterologous parasite strains may significantly contribute to vaccine failure in the field. The purpose of this study was to model the effect of pre-existing immunity to MSP142 on the immunogenicity of blood-stage malaria vaccines based on alternative MSP1 alleles. Methods Inbred and outbred mice were immunized with various recombinant P. falciparum MSP142 proteins that represent the two major alleles of MSP142, MAD20 (3D7 and Wellcome (K1, FVO. Humoral immune responses were analysed by ELISA and LuminexTM, and functional activity of induced MSP142-specific antibodies was assessed by growth inhibition assays. T-cell responses were characterized using ex vivo ELISpot assays. Results Analysis of the immune responses induced by various immunization regimens demonstrated a strong allele-specific response at the T cell level in both inbred and outbred mice. The success of heterologous regimens depended on the degree of homology of the N-terminal p33 portion of the MSP142, likely due to the fact that most T cell epitopes reside in this part of the molecule. Analysis of humoral immune responses revealed a marked cross-reactivity between the alleles. Functional analyses showed that some of the heterologous regimens induced antibodies with improved growth inhibitory activities. Conclusion The development of a more broadly efficacious MSP1 based vaccine may be

  19. Rapid molecular characterization of Acinetobacter baumannii clones with rep-PCR and evaluation of carbapenemase genes by new multiplex PCR in Hospital District of Helsinki and Uusimaa.

    Directory of Open Access Journals (Sweden)

    Tanja Pasanen

    Full Text Available Multidrug-resistant Acinetobacter baumannii (MDRAB is an increasing problem worldwide. Prevalence of carbapenem resistance in Acinetobacter spp. due to acquired carbapenemase genes is not known in Finland. The purpose of this study was to examine prevalence and clonal spread of multiresistant A. baumannii group species, and their carbapenemase genes. A total of 55 Acinetobacter isolates were evaluated with repetitive PCR (DiversiLab to analyse clonality of isolates, in conjunction with antimicrobial susceptibility profile for ampicillin/sulbactam, colistin, imipenem, meropenem, rifampicin and tigecycline. In addition, a new real-time PCR assay, detecting most clinically important carbapenemase genes just in two multiplex reactions, was developed. The assay detects genes for KPC, VIM, IMP, GES-1/-10, OXA-48, NDM, GIM-1, SPM-1, IMI/NMC-A, SME, CMY-10, SFC-1, SIM-1, OXA-23-like, OXA-24/40-like, OXA-58 and ISAbaI-OXA-51-like junction, and allows confident detection of isolates harbouring acquired carbapenemase genes. There was a time-dependent, clonal spread of multiresistant A. baumannii strongly correlating with carbapenamase gene profile, at least in this geographically restricted study material. The new carbapenemase screening assay was able to detect all the genes correctly suggesting it might be suitable for epidemiologic screening purposes in clinical laboratories.

  20. Development of simple and rapid PCR-fingerprinting methods for Vibrio cholerae on the basis of genetic diversity of the superintegron.

    Science.gov (United States)

    Chowdhury, N; Asakura, M; Neogi, S B; Hinenoya, A; Haldar, S; Ramamurthy, T; Sarkar, B L; Faruque, S M; Yamasaki, S

    2010-07-01

    To develop simple and rapid PCR-fingerprinting methods for Vibrio cholerae O1 (El Tor and classical biotypes) and O139 serogroup strains which cause major cholera epidemics, on the basis of the diversity of superintegron (SI) carried by these strains. PCR-restriction fragment length polymorphism (PCR-RFLP) assay was developed targeting region between integrase gene in the SI and its nearby ORF, followed by BglI digestion. Besides, a V. cholerae repeat-amplified fragment length polymorphism (VCR-AFLP) assay was also developed. In the PCR-RFLP, 94 El Tor, 29 classical and 54 O139 strains produced nine, three and six different DNA fingerprints, respectively. On the other hand, VCR-AFLP distinguished these El Tor, classical and O139 strains into five, nine and two DNA fingerprints, respectively. Combining both assays the El Tor, classical and O139 strains could be differentiated into 11, 10 and seven different types, respectively. In a comparative study, pulsed-field gel electrophoresis (PFGE) showed similar differentiation for El Tor (11 types), but lower discrimination for O139 (two types) and classical strains (five types). The PCR assays based on SI diversity can be used as a useful typing tool for epidemiological studies of V. cholerae. This newly developed method is more discriminatory, simple, rapid and cost-effective in comparison with PFGE, and thus can be widely applicable. © 2010 The Authors. Journal compilation © 2010 The Society for Applied Microbiology.

  1. A rapid method of accurate detection and differentiation of Newcastle disease virus pathotypes by demonstrating multiple bands in degenerate primer based nested RT-PCR.

    Science.gov (United States)

    Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K

    2015-02-01

    A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Clinical evaluation of β-tubulin real-time PCR for rapid diagnosis of dermatophytosis, a comparison with mycological methods.

    Science.gov (United States)

    Motamedi, Marjan; Mirhendi, Hossein; Zomorodian, Kamiar; Khodadadi, Hossein; Kharazi, Mahboobeh; Ghasemi, Zeinab; Shidfar, Mohammad Reza; Makimura, Koichi

    2017-10-01

    Following our previous report on evaluation of the beta tubulin real-time PCR for detection of dermatophytosis, this study aimed to compare the real-time PCR assay with conventional methods for the clinical assessment of its diagnostic performance. Samples from a total of 853 patients with suspected dermatophyte lesions were subjected to direct examination (all samples), culture (499 samples) and real-time PCR (all samples). Fungal DNA was extracted directly from clinical samples using a conical steel bullet, followed by purification with a commercial kit and subjected to the Taq-Man probe-based real-time PCR. The study showed that among the 499 specimens for which all three methods were used, 156 (31.2%), 128 (25.6%) and 205 (41.0%) were found to be positive by direct microscopy, culture and real-time PCR respectively. Real-time PCR significantly increased the detection rate of dermatophytes compared with microscopy (288 vs 229) with 87% concordance between the two methods. The sensitivity, specificity, positive predictive value, and negative predictive value of the real-time PCR was 87.5%, 85%, 66.5% and 95.2% respectively. Although real-time PCR performed better on skin than on nail samples, it should not yet fully replace conventional diagnosis. © 2017 Blackwell Verlag GmbH.

  3. EVALUATION OF A RAPID, QUANTITATIVE REAL-TIME PCR METHOD FOR ENUMERATION OF PATHOGENIC CANDIDA CELLS IN WATER

    Science.gov (United States)

    Quantitative Real-Time PCR (QRT-PCR) technology, incorporating fluorigenic 5' nuclease (TaqMan?) chemistry, was developed for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C....

  4. Reduction of the use of antimicrobial drugs following the rapid detection of Streptococcus agalactiae in the vagina at delivery by real-time PCR assay.

    Science.gov (United States)

    Poncelet-Jasserand, E; Forges, F; Varlet, M-N; Chauleur, C; Seffert, P; Siani, C; Pozzetto, B; Ros, A

    2013-08-01

    To assess whether the determination of the presence of group B streptococci (GBS) in the vagina using a rapid polymerase chain reaction (PCR) assay at delivery was able to spare useless antimicrobial treatments, as compared with conventional culture at 34-38 weeks of gestation. Practical evaluation and prospective cost-effectiveness analysis. A university hospital in France. A cohort of 225 women in labour at the University-Hospital of Saint-Etienne. Each woman had a conventional culture performed at 34-38 weeks of gestation. At the beginning of labour, two vaginal swabs were sampled for rapid PCR testing and culture. The decision to prescribe a prophylactic antimicrobial treatment or not was taken according to the result of the PCR test. A comparative cost-effectiveness analysis of the two diagnostic strategies was carried out. Number of women receiving inadequate prophylactic antimicrobial drugs following each testing strategy, costs of PCR testing and culture, frequency of vaginal GBS, and diagnostic performance of the PCR test at delivery. The percentage of unnecessarily treated women was significantly reduced using the rapid test versus conventional culture (4.5 and 13.6%, respectively; P < 0.001). The rate of vaginal GBS at delivery was 12.5%. The incremental cost-effectiveness ratio (ICER) for each inadequate management avoided was €36 and €173 from the point of view of the healthcare system and hospital, respectively. The PCR assay reduced the number of inadequate antimicrobial treatments aimed to prevent the early onset of GBS disease. However, this strategy generates extra costs that must be put into balance with its clinical benefits. © 2013 The Authors BJOG An International Journal of Obstetrics and Gynaecology © 2013 RCOG.

  5. A locked nucleic acid (LNA-based real-time PCR assay for the rapid detection of multiple bacterial antibiotic resistance genes directly from positive blood culture.

    Directory of Open Access Journals (Sweden)

    Lingxiang Zhu

    Full Text Available Bacterial strains resistant to various antibiotic drugs are frequently encountered in clinical infections, and the rapid identification of drug-resistant strains is highly essential for clinical treatment. We developed a locked nucleic acid (LNA-based quantitative real-time PCR (LNA-qPCR method for the rapid detection of 13 antibiotic resistance genes and successfully used it to distinguish drug-resistant bacterial strains from positive blood culture samples. A sequence-specific primer-probe set was designed, and the specificity of the assays was assessed using 27 ATCC bacterial strains and 77 negative blood culture samples. No cross-reaction was identified among bacterial strains and in negative samples, indicating 100% specificity. The sensitivity of the assays was determined by spiking each bacterial strain into negative blood samples, and the detection limit was 1-10 colony forming units (CFU per reaction. The LNA-qPCR assays were first applied to 72 clinical bacterial isolates for the identification of known drug resistance genes, and the results were verified by the direct sequencing of PCR products. Finally, the LNA-qPCR assays were used for the detection in 47 positive blood culture samples, 19 of which (40.4% were positive for antibiotic resistance genes, showing 91.5% consistency with phenotypic susceptibility results. In conclusion, LNA-qPCR is a reliable method for the rapid detection of bacterial antibiotic resistance genes and can be used as a supplement to phenotypic susceptibility testing for the early detection of antimicrobial resistance to allow the selection of appropriate antimicrobial treatment and to prevent the spread of resistant isolates.

  6. Rapid detection of Enterovirus and Coxsackievirus A10 by a TaqMan based duplex one-step real time RT-PCR assay.

    Science.gov (United States)

    Chen, Jingfang; Zhang, Rusheng; Ou, Xinhua; Yao, Dong; Huang, Zheng; Li, Linzhi; Sun, Biancheng

    2017-06-01

    A TaqMan based duplex one-step real time RT-PCR (rRT-PCR) assay was developed for the rapid detection of Coxsackievirus A10 (CV-A10) and other enterovirus (EVs) in clinical samples. The assay was fully evaluated and found to be specific and sensitive. When applied in 115 clinical samples, a 100% diagnostic sensitivity in CV-A10 detection and 97.4% diagnostic sensitivity in other EVs were found. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Rapid Discrimination between Candida glabrata, Candida nivariensis, and Candida bracarensis by Use of a Singleplex PCR

    OpenAIRE

    Enache-Angoulvant, A.; Guitard, J.; Grenouillet, F.; Martin, T.; Durrens, P.; Fairhead, C.; Hennequin, C.

    2011-01-01

    We report here a PCR-based assay using a single primer pair targeting the RPL31 gene that allows discrimination between Candida glabrata, Candida bracarensis, and Candida nivariensis according to the size of the generated amplicon.

  8. A genome-wide screen in human embryonic stem cells reveals novel sites of allele-specific histone modification associated with known disease loci

    LENUS (Irish Health Repository)

    Prendergast, James G D

    2012-05-19

    AbstractBackgroundChromatin structure at a given site can differ between chromosome copies in a cell, and such imbalances in chromatin structure have been shown to be important in understanding the molecular mechanisms controlling several disease loci. Human genetic variation, DNA methylation, and disease have been intensely studied, uncovering many sites of allele-specific DNA methylation (ASM). However, little is known about the genome-wide occurrence of sites of allele-specific histone modification (ASHM) and their relationship to human disease. The aim of this study was to investigate the extent and characteristics of sites of ASHM in human embryonic stem cells (hESCs).ResultsUsing a statistically rigorous protocol, we investigated the genomic distribution of ASHM in hESCs, and their relationship to sites of allele-specific expression (ASE) and DNA methylation. We found that, although they were rare, sites of ASHM were substantially enriched at loci displaying ASE. Many were also found at known imprinted regions, hence sites of ASHM are likely to be better markers of imprinted regions than sites of ASM. We also found that sites of ASHM and ASE in hESCs colocalize at risk loci for developmental syndromes mediated by deletions, providing insights into the etiology of these disorders.ConclusionThese results demonstrate the potential importance of ASHM patterns in the interpretation of disease loci, and the protocol described provides a basis for similar studies of ASHM in other cell types to further our understanding of human disease susceptibility.

  9. Systematic evaluation of the impact of ChIP-seq read designs on genome coverage, peak identification, and allele-specific binding detection.

    Science.gov (United States)

    Zhang, Qi; Zeng, Xin; Younkin, Sam; Kawli, Trupti; Snyder, Michael P; Keleş, Sündüz

    2016-02-24

    Chromatin immunoprecipitation followed by sequencing (ChIP-seq) experiments revolutionized genome-wide profiling of transcription factors and histone modifications. Although maturing sequencing technologies allow these experiments to be carried out with short (36-50 bps), long (75-100 bps), single-end, or paired-end reads, the impact of these read parameters on the downstream data analysis are not well understood. In this paper, we evaluate the effects of different read parameters on genome sequence alignment, coverage of different classes of genomic features, peak identification, and allele-specific binding detection. We generated 101 bps paired-end ChIP-seq data for many transcription factors from human GM12878 and MCF7 cell lines. Systematic evaluations using in silico variations of these data as well as fully simulated data, revealed complex interplay between the sequencing parameters and analysis tools, and indicated clear advantages of paired-end designs in several aspects such as alignment accuracy, peak resolution, and most notably, allele-specific binding detection. Our work elucidates the effect of design on the downstream analysis and provides insights to investigators in deciding sequencing parameters in ChIP-seq experiments. We present the first systematic evaluation of the impact of ChIP-seq designs on allele-specific binding detection and highlights the power of pair-end designs in such studies.

  10. Single tube multiplex real-time PCR for the rapid detection of herpesvirus infections of the central nervous system.

    Science.gov (United States)

    Sankuntaw, Nipaporn; Sukprasert, Saovaluk; Engchanil, Chulapan; Kaewkes, Wanlop; Chantratita, Wasun; Pairoj, Vantanit; Lulitanond, Viraphong

    2011-01-01

    Human herpesvirus infection of immunocompromised hosts may lead to central nervous system (CNS) infection and diseases. In this study, a single tube multiplex real-time PCR was developed for the detection of five herpesviruses (HSV-1, HSV-2, VZV, EBV and CMV) in clinical cerebrospinal fluid (CSF) specimens. Two primer pairs specific for the herpesvirus polymerase gene and five hybridization probe pairs for the specific identification of the herpesvirus types were used in a LightCycler multiplex real-time PCR. A singleplex real-time PCR was first optimized and then applied to the multiplex real-time PCR. The singleplex and multiplex real-time PCRs showed no cross-reactivity. The sensitivity of the singleplex real-time PCR was 1 copy per reaction for each herpesvirus, while that of the multiplex real-time PCR was 1 copy per reaction for HSV-1 and VZV and 10 copies per reaction for HSV-2, EBV and CMV. Intra and inter-assay variations of the single tube multiplex assay were in the range of 0.02%-3.67% and 0.79%-4.35%, respectively. The assay was evaluated by testing 62 clinical CSF samples and was found to have equivalent sensitivity, specificity and agreement as the routine real-time PCR, but reducing time, cost and amount of used sample. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. Rapid detection of enterovirus in cerebrospinal fluid by a fully-automated PCR assay is associated with improved management of aseptic meningitis in adult patients.

    Science.gov (United States)

    Giulieri, Stefano G; Chapuis-Taillard, Caroline; Manuel, Oriol; Hugli, Olivier; Pinget, Christophe; Wasserfallen, Jean-Blaise; Sahli, Roland; Jaton, Katia; Marchetti, Oscar; Meylan, Pascal

    2015-01-01

    Enterovirus (EV) is the most frequent cause of aseptic meningitis (AM). Lack of microbiological documentation results in unnecessary antimicrobial therapy and hospitalization. To assess the impact of rapid EV detection in cerebrospinal fluid (CSF) by a fully-automated PCR (GeneXpert EV assay, GXEA) on the management of AM. Observational study in adult patients with AM. Three groups were analyzed according to EV documentation in CSF: group A = no PCR or negative PCR (n=17), group B = positive real-time PCR (n = 20), and group C = positive GXEA (n = 22). Clinical, laboratory and health-care costs data were compared. Clinical characteristics were similar in the 3 groups. Median turn-around time of EV PCR decreased from 60 h (IQR (interquartile range) 44-87) in group B to 5h (IQR 4-11) in group C (p<0.0001). Median duration of antibiotics was 1 (IQR 0-6), 1 (0-1.9), and 0.5 days (single dose) in groups A, B, and C, respectively (p < 0.001). Median length of hospitalization was 4 days (2.5-7.5), 2 (1-3.7), and 0.5 (0.3-0.7), respectively (p < 0.001). Median hospitalization costs were $5458 (2676-6274) in group A, $2796 (2062-5726) in group B, and $921 (765-1230) in group C (p < 0.0001). Rapid EV detection in CSF by a fully-automated PCR improves management of AM by significantly reducing antibiotic use, hospitalization length and costs. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. A Rapid Protocol of Crude RNA/DNA Extraction for RT-qPCR Detection and Quantification of 'Candidatus Phytoplasma prunorum'.

    Science.gov (United States)

    Minguzzi, Stefano; Terlizzi, Federica; Lanzoni, Chiara; Poggi Pollini, Carlo; Ratti, Claudio

    2016-01-01

    Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum ('Ca. P. prunorum') detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor 'Ca. P. prunorum' infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect 'Ca. P. prunorum' and Plum pox virus (PPV) in Prunus.

  13. Rapid Genome Detection of Schmallenberg Virus and Bovine Viral Diarrhea Virus by Use of Isothermal Amplification Methods and High-Speed Real-Time Reverse Transcriptase PCR

    OpenAIRE

    Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin

    2014-01-01

    Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (R...

  14. Development of a rapid HRM qPCR for the diagnosis of the four most prevalent Plasmodium lineages in New Zealand.

    Science.gov (United States)

    Schoener, E R; Hunter, S; Howe, L

    2017-07-01

    Although wildlife rehabilitation and translocations are important tools in wildlife conservation in New Zealand, disease screening of birds has not been standardized. Additionally, the results of the screening programmes are often difficult to interpret due to missing disease data in resident or translocating avian populations. Molecular methods have become the most widespread method for diagnosing avian malaria (Plasmodium spp.) infections. However, these methods can be time-consuming, expensive and are less specific in diagnosing mixed infections. Thus, this study developed a new real-time PCR (qPCR) method that was able to detect and specifically identify infections of the three most common lineages of avian malaria in New Zealand (Plasmodium (Novyella) sp. SYAT05, Plasmodium elongatum GRW6 and Plasmodium spp. LINN1) as well as a less common, pathogenic Plasmodium relictum GRW4 lineage. The assay was also able to discern combinations of these parasites in the same sample and had a detection limit of five parasites per microlitre. Due to concerns relating to the presence of the potentially highly pathogenic P. relictum GRW4 lineage in avian populations, an additional confirmatory high resolution (HRM) qPCR was developed to distinguish between commonly identified P. elongatum GRW6 from P. relictum GRW4. The new qPCR assays were tested using tissue samples containing Plasmodium schizonts from three naturally infected dead birds resulting in the identified infection of P. elongatum GRW6. Thus, these rapid qPCR assays have shown to be cost-effective and rapid screening tools for the detection of Plasmodium infection in New Zealand native birds.

  15. [Rapid detection of hot spot mutations of FGFR3 gene with PCR-high resolution melting assay].

    Science.gov (United States)

    Li, Shan; Wang, Han; Su, Hua; Gao, Jinsong; Zhao, Xiuli

    2017-08-10

    To identify the causative mutations in five individuals affected with dyschondroplasia and develop an efficient procedure for detecting hot spot mutations of the FGFR3 gene. Genomic DNA was extracted from peripheral blood samples with a standard phenol/chloroform method. PCR-Sanger sequencing was used to analyze the causative mutations in the five probands. PCR-high resolution melting (HRM) was developed to detect the identified mutations. A c.1138G>A mutation in exon 8 was found in 4 probands, while a c.1620C>G mutation was found in exon 11 of proband 5 whom had a mild phenotype. All patients were successfully distinguished from healthy controls with the PCR-HRM method. The results of HRM analysis were highly consistent with that of Sanger sequencing. The Gly380Arg and Asn540Lys are hot spot mutations of the FGFR3 gene among patients with ACH/HCH. PCR-HRM analysis is more efficient for detecting hot spot mutations of the FGFR3 gene.

  16. Eukaryote-Made Thermostable DNA Polymerase Enables Rapid PCR-Based Detection of Mycoplasma, Ureaplasma and Other Bacteria in the Amniotic Fluid of Preterm Labor Cases.

    Science.gov (United States)

    Ueno, Tomohiro; Niimi, Hideki; Yoneda, Noriko; Yoneda, Satoshi; Mori, Masashi; Tabata, Homare; Minami, Hiroshi; Saito, Shigeru; Kitajima, Isao

    2015-01-01

    Intra-amniotic infection has long been recognized as the leading cause of preterm delivery. Microbial culture is the gold standard for the detection of intra-amniotic infection, but several days are required, and many bacterial species in the amniotic fluid are difficult to cultivate. We developed a novel nested-PCR-based assay for detecting Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples within three hours of sample collection. To detect prokaryotes, eukaryote-made thermostable DNA polymerase, which is free from bacterial DNA contamination, is used in combination with bacterial universal primers. In contrast, to detect eukaryotes, conventional bacterially-made thermostable DNA polymerase is used in combination with fungal universal primers. To assess the validity of the PCR assay, we compared the PCR and conventional culture results using 300 amniotic fluid samples. Based on the detection level (positive and negative), 93.3% (280/300) of Mycoplasma, 94.3% (283/300) of Ureaplasma, 89.3% (268/300) of other bacteria and 99.7% (299/300) of fungi matched the culture results. Meanwhile, concerning the detection of bacteria other than Mycoplasma and Ureaplasma, 228 samples were negative according to the PCR method, 98.2% (224/228) of which were also negative based on the culture method. Employing the devised primer sets, mixed amniotic fluid infections of Mycoplasma, Ureaplasma and/or other bacteria could be clearly distinguished. In addition, we also attempted to compare the relative abundance in 28 amniotic fluid samples with mixed infection, and judged dominance by comparing the Ct values of quantitative real-time PCR. We developed a novel PCR assay for the rapid detection of Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples. This assay can also be applied to accurately diagnose the absence of bacteria in samples. We believe that this assay will positively contribute to the treatment of intra-amniotic infection and

  17. Comparison of DNA probe, PCR amplification, ELISA and culture methods for the rapid detection of Salmonella in poultry

    International Nuclear Information System (INIS)

    Qasem, J.A.; Al-Mouqati, S.; Rajkumar, G.

    2005-01-01

    The identification of Salmonella spp. from poultry meat was studied by comparing bacterial detection using the Gene-Trak colorimetric hybridization method, a PCR amplification kit and an Enzyme Linked Immunosorbent Assay (ELISA), and these methods were compared with the conventional methodology proposed by the United States Food and Drug Administration (US FDA) for detection of Salmonella in food samples. Forty positive and negative samples were studied. The three methods yielded similar results with levels of Salmonella greater than 10 CFU per sample, even when the samples were highly contaminated with competing bacteria. In contrast, 20 CFU of seed inoculum per sample was the lowest level of Salmonella detectable with all three methods and the standard culture method. The detection limits of the PCR and ELISA assays were 5 CFU/g after enrichment at 37 deg. C for 6 and 9 hours, respectively. Compared with conventional bacteriology, all three methods here demonstrated high sensitivity and specificity for Salmonella. (author)

  18. A rapid real-time PCR method to differentiate between mottled skate (Beringraja pulchra) and other skate and ray species.

    Science.gov (United States)

    Kim, Mi-Ra; Kwon, Kisung; Jung, Yoo-Kyung; Kang, Tae Sun

    2018-07-30

    Skates and rays are commercially important fish in South Korea, and among them, Beringraja pulchra has the highest economic value. However, the similar morphological traits among skates and rays are often exploited for seafood fraud. Here, we designed both Beringraja pulchra-specific and skate-universal primer sets, capable of detecting short sequences in the cytochrome oxidase subunit I gene, and developed highly sensitive and reliable quantitative real-time PCR (qPCR) assays to differentiate between Beringraja pulchra and other skate and ray species. AΔCq method based on differences in the amplification efficiency was developed, validated, and then used to confirm the presence of Beringraja pulchra in twenty-six commercial skate products. The averageΔCq value obtained for other skate species (18.94 ± 3.46) was significantly higher than that of Beringraja pulchra (1.18 ± 0.15). For on-site applications, we developed an ultra-fast qPCR assay, allowing for completion of the entire analytical procedure within 30 min. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Development of a quantitative PCR assay for rapid detection of Lactobacillus plantarum and Lactobacillus fermentum in cocoa bean fermentation.

    Science.gov (United States)

    Schwendimann, Livia; Kauf, Peter; Fieseler, Lars; Gantenbein-Demarchi, Corinne; Miescher Schwenninger, Susanne

    2015-08-01

    To monitor dominant species of lactic acid bacteria during cocoa bean fermentation, i.e. Lactobacillus plantarum and Lactobacillus fermentum, a fast and reliable culture-independent qPCR assay was developed. A modified DNA isolation procedure using a commercial kit followed by two species-specific qPCR assays resulted in 100% sensitivity for L. plantarum and L. fermentum. Kruskal-Wallis and post-hoc analyses of data obtained from experiments with cocoa beans that were artificially spiked with decimal concentrations of L. plantarum and L. fermentum strains allowed the calculation of a regression line suitable for the estimation of both species with a detection limit of 3 to 4 Log cells/g cocoa beans. This process was successfully tested for efficacy through the analyses of samples from laboratory-scale cocoa bean fermentations with both the qPCR assay and a culture-dependent method which resulted in comparable results. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Investigation of parameters that affect the success rate of microarray-based allele-specific hybridization assays.

    Directory of Open Access Journals (Sweden)

    Lena Poulsen

    Full Text Available BACKGROUND: The development of microarray-based genetic tests for diseases that are caused by known mutations is becoming increasingly important. The key obstacle to developing functional genotyping assays is that such mutations need to be genotyped regardless of their location in genomic regions. These regions include large variations in G+C content, and structural features like hairpins. METHODS/FINDINGS: We describe a rational, stable method for screening and combining assay conditions for the genetic analysis of 42 Phenylketonuria-associated mutations in the phenylalanine hydroxylase gene. The mutations are located in regions with large variations in G+C content (20-75%. Custom-made microarrays with different lengths of complementary probe sequences and spacers were hybridized with pooled PCR products of 12 exons from each of 38 individual patient DNA samples. The arrays were washed with eight buffers with different stringencies in a custom-made microfluidic system. The data were used to assess which parameters play significant roles in assay development. CONCLUSIONS: Several assay development methods found suitable probes and assay conditions for a functional test for all investigated mutation sites. Probe length, probe spacer length, and assay stringency sufficed as variable parameters in the search for a functional multiplex assay. We discuss the optimal assay development methods for several different scenarios.

  1. Performance of rapid diagnostic test, blood-film microscopy and PCR for the diagnosis of malaria infection among febrile children from Korogwe District, Tanzania

    DEFF Research Database (Denmark)

    Mahende, Coline; Ngasala, Billy; Lusingu, John

    2016-01-01

    with fever and/or history of fever in the previous 48 h attending outpatient clinics. Blood samples were collected for identification of Plasmodium falciparum infection using histidine-rich-protein-2 (HRP-2)-based malaria RDT, light microscopy and conventional PCR. Results: A total of 867 febrile patients......Background: Rapid diagnostic tests (RDT) and light microscopy are still recommended for diagnosis to guide the clinical management of malaria despite difficult challenges in rural settings. The performance of these tests may be affected by several factors, including malaria prevalence and intensity...... of transmission. The study evaluated the diagnostic performance of malaria RDT, light microscopy and polymerase chain reaction (PCR) in detecting malaria infections among febrile children at outpatient clinic in Korogwe District, northeastern Tanzania. Methods: The study enrolled children aged 2-59 months...

  2. Quantitative RT-PCR based platform for rapid quantification of the transcripts of highly homologous multigene families and their members during grain development

    DEFF Research Database (Denmark)

    Kaczmarczyk, Agnieszka Ewa; Bowra, Steve; Elek, Zoltan

    2012-01-01

    expression combined with genetic variation in large multigene families with high homology among the alleles is very challenging. Results We designed a rapid qRT-PCR system with the aim of characterising the variation in the expression of hordein genes families. All the known D-, C-, B-, and gamma......-hordein sequences coding full length open reading frames were collected from commonly available databases. Phylogenetic analysis was performed and the members of the different hordein families were classified into subfamilies. Primer sets were designed to discriminate the gene expression level of whole families...... and its subgroups. More over the results indicate the genotypic specific gene expression. Conclusions Quantitative RT-PCR with SYBR Green labelling can be a useful technique to follow gene expression levels of large gene families with highly homologues members. We showed variation in the temporal...

  3. The − 5 A/G single-nucleotide polymorphism in the core promoter region of MT2A and its effect on allele-specific gene expression and Cd, Zn and Cu levels in laryngeal cancer

    Energy Technology Data Exchange (ETDEWEB)

    Starska, Katarzyna, E-mail: katarzyna.starska@umed.lodz.pl [I Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Kopcinskiego 22, 90-153 Łódź (Poland); Krześlak, Anna; Forma, Ewa [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland); Olszewski, Jurek [II Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Żeromskiego 113, 90-549 Łódź (Poland); Morawiec-Sztandera, Alina [Department of Head and Neck Surgery, Medical University of Łódź, Paderewskiego 4, 93-509 Łódź (Poland); Aleksandrowicz, Paweł [Department of Otolaryngology and Laryngological Oncology, Medical University of Lublin, Jaczewskiego 8, 20-954 Lublin (Poland); Lewy-Trenda, Iwona [Department of Pathology, Medical University of Łódź, Pomorska 251, 92-213 Łódź (Poland); and others

    2014-10-15

    Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was determined by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that − 5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer. - Highlights: • MT2A gene expression and metal content in laryngeal cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn and Cu levels • Negative correlation between MT2A gene expression and Cd, Zn and Cu levels.

  4. The − 5 A/G single-nucleotide polymorphism in the core promoter region of MT2A and its effect on allele-specific gene expression and Cd, Zn and Cu levels in laryngeal cancer

    International Nuclear Information System (INIS)

    Starska, Katarzyna; Krześlak, Anna; Forma, Ewa; Olszewski, Jurek; Morawiec-Sztandera, Alina; Aleksandrowicz, Paweł; Lewy-Trenda, Iwona

    2014-01-01

    Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was determined by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that − 5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer. - Highlights: • MT2A gene expression and metal content in laryngeal cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn and Cu levels • Negative correlation between MT2A gene expression and Cd, Zn and Cu levels

  5. Rapid, actionable diagnosis of urban epidemic leptospirosis using a pathogenic Leptospira lipL32-based real-time PCR assay.

    Directory of Open Access Journals (Sweden)

    Irina N Riediger

    2017-09-01

    Full Text Available With a conservatively estimated 1 million cases of leptospirosis worldwide and a 5-10% fatality rate, the rapid diagnosis of leptospirosis leading to effective clinical and public health decision making is of high importance, and yet remains a challenge.Based on parallel, population-based studies in two leptospirosis-endemic regions in Brazil, a real-time PCR assay which detects lipL32, a gene specifically present in pathogenic Leptospira, was assessed for the diagnostic effectiveness and accuracy. Patients identified by active hospital-based surveillance in Salvador and Curitiba during large urban leptospirosis epidemics were tested. Real-time PCR reactions were performed with DNA-extracted samples obtained from 127 confirmed and 23 unconfirmed cases suspected of leptospirosis, 122 patients with an acute febrile illness other than leptospirosis, and 60 healthy blood donors.The PCR assay had a limit of detection of 280 Leptospira genomic equivalents/mL. Sensitivity for confirmed cases was 61% for whole blood and 29% for serum samples. Sensitivity was higher (86% for samples collected within the first 6 days after onset of illness compared to those collected after 7 days (34%. The real-time PCR assay was able to detect leptospiral DNA in blood from 56% of serological non-confirmed cases. The overall specificity of the assay was 99%.These findings indicate that real-time PCR may be a reliable tool for early diagnosis of leptospirosis, which is decisive for clinical management of severe and life-threatening cases and for public health decision making.

  6. Rapid, actionable diagnosis of urban epidemic leptospirosis using a pathogenic Leptospira lipL32-based real-time PCR assay.

    Science.gov (United States)

    Riediger, Irina N; Stoddard, Robyn A; Ribeiro, Guilherme S; Nakatani, Sueli M; Moreira, Suzana D R; Skraba, Irene; Biondo, Alexander W; Reis, Mitermayer G; Hoffmaster, Alex R; Vinetz, Joseph M; Ko, Albert I; Wunder, Elsio A

    2017-09-01

    With a conservatively estimated 1 million cases of leptospirosis worldwide and a 5-10% fatality rate, the rapid diagnosis of leptospirosis leading to effective clinical and public health decision making is of high importance, and yet remains a challenge. Based on parallel, population-based studies in two leptospirosis-endemic regions in Brazil, a real-time PCR assay which detects lipL32, a gene specifically present in pathogenic Leptospira, was assessed for the diagnostic effectiveness and accuracy. Patients identified by active hospital-based surveillance in Salvador and Curitiba during large urban leptospirosis epidemics were tested. Real-time PCR reactions were performed with DNA-extracted samples obtained from 127 confirmed and 23 unconfirmed cases suspected of leptospirosis, 122 patients with an acute febrile illness other than leptospirosis, and 60 healthy blood donors. The PCR assay had a limit of detection of 280 Leptospira genomic equivalents/mL. Sensitivity for confirmed cases was 61% for whole blood and 29% for serum samples. Sensitivity was higher (86%) for samples collected within the first 6 days after onset of illness compared to those collected after 7 days (34%). The real-time PCR assay was able to detect leptospiral DNA in blood from 56% of serological non-confirmed cases. The overall specificity of the assay was 99%. These findings indicate that real-time PCR may be a reliable tool for early diagnosis of leptospirosis, which is decisive for clinical management of severe and life-threatening cases and for public health decision making.

  7. Rapid differentiation of Staphylococcus aureus isolates harbouring egc loci with pseudogenes psient1 and psient2 and the selu or seluv gene using PCR-RFLP.

    Science.gov (United States)

    Collery, Mark M; Smyth, Cyril J

    2007-02-01

    The egc locus of Staphylococus aureus harbours two enterotoxin genes (seg and sei) and three enterotoxin-like genes (selm, seln and selo). Between the sei and seln genes are located two pseudogenes, psient1 and psient2, or the selu or seluv gene. While these two alternative sei-seln intergenic regions can be distinguished by PCR, to date, DNA sequencing has been the only confirmatory option because of the very high degree of sequence similarity between egc loci bearing the pseudogenes and the selu or seluv gene. In silico restriction enzyme digestion of genomic regions encompassing the egc locus from the 3' end of the sei gene through the 5' first quarter of the seln gene allowed pseudogene- and selu- or seluv-bearing egc loci to be distinguished by PCR-RFLP. Experimental application of these findings demonstrated that endonuclease HindIII cleaved PCR amplimers bearing pseudogenes but not those with a selu or seluv gene, while selu- or seluv-bearing amplimers were susceptible to cleavage by endonuclease HphI, but not by endonuclease HindIII. The restriction enzyme BccI cleaved selu- or seluv-harbouring amplimers at a unique restriction site created by their signature 15 bp insertion compared with pseudogene-bearing amplimers, thereby allowing distinction of these egc loci. PCR-RFLP analysis using these restriction enzymes provides a rapid, easy to interpret alternative to DNA sequencing for verification of PCR findings on the nature of an egc locus type, and can also be used for the primary identification of the intergenic sei-seln egc locus type.

  8. Use of high throughput qPCR screening to rapidly clone low frequency tumour specific T-cells from peripheral blood for adoptive immunotherapy

    Directory of Open Access Journals (Sweden)

    Serrano Oscar K

    2008-10-01

    Full Text Available Abstract Background The adoptive transfer of autologous tumor reactive lymphocytes can mediate significant tumor regression in some patients with refractory metastatic cancer. However, a significant obstacle for this promising therapy has been the availability of highly efficient methods to rapidly isolate and expand a variety of potentially rare tumor reactive lymphocytes from the natural repertoire of cancer patients. Methods We developed a novel in vitro T cell cloning methodology using high throughput quantitative RT-PCR (qPCR assay as a rapid functional screen to detect and facilitate the limiting dilution cloning of a variety of low frequency T cells from bulk PBMC. In preclinical studies, this strategy was applied to the isolation and expansion of gp100 specific CD8+ T cell clones from the peripheral blood of melanoma patients. Results In optimization studies, the qPCR assay could detect the reactivity of 1 antigen specific T cell in 100,000 background cells. When applied to short term sensitized PBMC microcultures, this assay could detect T cell reactivity against a variety of known melanoma tumor epitopes. This screening was combined with early limiting dilution cloning to rapidly isolate gp100154–162 reactive CD8+ T cell clones. These clones were highly avid against peptide pulsed targets and melanoma tumor lines. They had an effector memory phenotype and showed significant proliferative capacity to reach cell numbers appropriate for adoptive transfer trials (~1010 cells. Conclusion This report describes a novel high efficiency strategy to clone tumor reactive T cells from peripheral blood for use in adoptive immunotherapy.

  9. Development of a Taqman real-time PCR assay for rapid detection and quantification of Vibrio tapetis in extrapallial fluids of clams

    Directory of Open Access Journals (Sweden)

    Adeline Bidault

    2015-12-01

    Full Text Available The Gram-negative bacterium Vibrio tapetis is known as the causative agent of Brown Ring Disease (BRD in the Manila clam Venerupis (=Ruditapes philippinarum. This bivalve is the second most important species produced in aquaculture and has a high commercial value. In spite of the development of several molecular methods, no survey has been yet achieved to rapidly quantify the bacterium in the clam. In this study, we developed a Taqman real-time PCR assay targeting virB4 gene for accurate and quantitative identification of V. tapetis strains pathogenic to clams. Sensitivity and reproducibility of the method were assessed using either filtered sea water or extrapallial fluids of clam injected with the CECT4600T V. tapetis strain. Quantification curves of V. tapetis strain seeded in filtered seawater (FSW or extrapallial fluids (EF samples were equivalent showing reliable qPCR efficacies. With this protocol, we were able to specifically detect V. tapetis strains down to 1.125 101 bacteria per mL of EF or FSW, taking into account the dilution factor used for appropriate template DNA preparation. This qPCR assay allowed us to monitor V. tapetis load both experimentally or naturally infected Manila clams. This technique will be particularly useful for monitoring the kinetics of massive infections by V. tapetis and for designing appropriate control measures for aquaculture purposes.

  10. Rapid BRAF mutation tests in patients with advanced melanoma : Comparison of immunohistochemistry, Droplet Digital PCR, and the Idylla Mutation Platform

    NARCIS (Netherlands)

    Bisschop, Cornelis; Ter Elst, Arja; Bosman, Lisette J; Platteel, Inge; Jalving, Mathilde; van den Berg, Anke; Diepstra, Arjan; van Hemel, Bettien; Diercks, Gilles F H; Hospers, Geke A P; Schuuring, Ed

    BRAF mutational testing has become a common practice in the diagnostic process of patients with advanced melanoma. Although time-consuming, DNA sequencing techniques are the current gold standard for mutational testing. However, in certain clinical situations, a rapid test result is required. In

  11. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations.

    Science.gov (United States)

    You, David J; Yoon, Jeong-Yeol

    2012-09-04

    A computer numerical control (CNC) apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using "wire-guided" method (a pipette tip was used in this study). This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate). Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction). The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability), in rapid succession (using droplets), and with a high level of

  12. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations

    Directory of Open Access Journals (Sweden)

    You David J

    2012-09-01

    Full Text Available Abstract A computer numerical control (CNC apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using “wire-guided” method (a pipette tip was used in this study. This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate. Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction. The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability, in rapid succession (using droplets

  13. Rapid detection of Listeria monocytogenes in raw milk and soft cheese by a redox potential measurement based method combined with real-time PCR.

    Science.gov (United States)

    Erdősi, Orsolya; Szakmár, Katalin; Reichart, Olivér; Szili, Zsuzsanna; László, Noémi; Székely Körmöczy, Péter; Laczay, Péter

    2014-09-01

    The incidence of outbreaks of foodborne listeriosis has indicated the need for a reliable and rapid detection of the microbe in different foodstuffs. A method combining redox potential measurement and real-time polymerase chain reaction (PCR) was developed to detect Listeria monocytogenes in artificially contaminated raw milk and soft cheese. Food samples of 25 g or 25 ml were homogenised in 225 ml of Listeria Enrichment Broth (LEB) with Oxford supplement, and the redox potential measurement technique was applied. For Listeria species the measuring time was maximum 34 h. The absence of L. monocytogenes could reliably be proven by the redox potential measurement method, but Listeria innocua and Bacillus subtilis could not be differentiated from L. monocytogenes on the basis of the redox curves. The presence of L. monocytogenes had to be confirmed by real-time PCR. The combination of these two methods proved to detect < 10 cfu/g of L. monocytogenes in a cost- and time-effective manner. This method can potentially be used as an alternative to the standard nutrient method for the rapid detection of L. monocytogenes in food.

  14. PCR method for the rapid detection and discrimination of Legionella spp. based on the amplification of pcs, pmtA, and 16S rRNA genes.

    Science.gov (United States)

    Janczarek, Monika; Palusińska-Szysz, Marta

    2016-05-01

    Legionella bacteria are organisms of public health interest due to their ability to cause pneumonia (Legionnaires' disease) in susceptible humans and their ubiquitous presence in water supply systems. Rapid diagnosis of Legionnaires' disease allows the use of therapy specific for the disease. L. pneumophila serogroup 1 is the most common cause of infection acquired in community and hospital environments. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this work, simplex and duplex PCR assays with the use of new molecular markers pcs and pmtA involved in phosphatidylcholine synthesis were specified for rapid and cost-efficient identification and distinguishing Legionella species. The sets of primers developed were found to be sensitive and specific for reliable detection of Legionella belonging to the eight most clinically relevant species. Among these, four primer sets I, II, VI, and VII used for duplex-PCRs proved to have the highest identification power and reliability in the detection of the bacteria. Application of this PCR-based method should improve detection of Legionella spp. in both clinical and environmental settings and facilitate molecular typing of these organisms.

  15. Rapid screening of pyogenic Staphylococcus aureus for confirmation of genus and species, methicillin resistance and virulence factors by using two novel multiplex PCR.

    Science.gov (United States)

    Haque, Abdul; Haque, Asma; Saeed, Muhammad; Azhar, Aysha; Rasool, Samreen; Shan, Sidra; Ehsan, Beenish; Nisar, Zohaib

    2017-01-01

    Emergence of methicillin resistant Staphylococcus aureus (MRSA) is a major medical problem of current era. These bacteria are resistant to most drugs and rapid diagnosis can provide a clear guideline to clinicians. They possess specific virulence factors and relevant information can be very useful. We designed this study to develop multiplex PCRs to provide rapid information. We studied 60 Staphylococcus aureus isolates and detected methicillin resistance by cefoxitin sensitivity and targeting of mecA gene. After initial studies with uniplex PCRs we optimized two multiplex PCRs with highly reproducible results. The first multiplex PCR was developed to confirm genus, species and methicillin resistance simultaneously, and the second multiplex PCR was for screening of virulence factors. We found 38.33% isolates as methicillin resistant. α -toxin, the major cytotoxic factor, was detected in 40% whereas β-hemolysin was found in 25% cases. Panton Valentine leucocidin was detected in 8.33% and toxic shock syndrome toxin in5% cases. The results of uniplex and multiplex PCRs were highly compatible. These two multiplex PCRs when run simultaneously can provide vital information about methicillin resistance and virulence status of the isolate within a few hours as compared to several days needed by routine procedures.

  16. Rapid identification and quantification of Campylobacter coli and Campylobacter jejuni by real-time PCR in pure cultures and in complex samples

    Directory of Open Access Journals (Sweden)

    Denis Martine

    2011-05-01

    Full Text Available Abstract Background Campylobacter spp., especially Campylobacter jejuni (C. jejuni and Campylobacter coli (C. coli, are recognized as the leading human foodborne pathogens in developed countries. Livestock animals carrying Campylobacter pose an important risk for human contamination. Pigs are known to be frequently colonized with Campylobacter, especially C. coli, and to excrete high numbers of this pathogen in their faeces. Molecular tools, notably real-time PCR, provide an effective, rapid, and sensitive alternative to culture-based methods for the detection of C. coli and C. jejuni in various substrates. In order to serve as a diagnostic tool supporting Campylobacter epidemiology, we developed a quantitative real-time PCR method for species-specific detection and quantification of C. coli and C. jejuni directly in faecal, feed, and environmental samples. Results With a sensitivity of 10 genome copies and a linear range of seven to eight orders of magnitude, the C. coli and C. jejuni real-time PCR assays allowed a precise quantification of purified DNA from C. coli and C. jejuni. The assays were highly specific and showed a 6-log-linear dynamic range of quantification with a quantitative detection limit of approximately 2.5 × 102 CFU/g of faeces, 1.3 × 102 CFU/g of feed, and 1.0 × 103 CFU/m2 for the environmental samples. Compared to the results obtained by culture, both C. coli and C. jejuni real-time PCR assays exhibited a specificity of 96.2% with a kappa of 0.94 and 0.89 respectively. For faecal samples of experimentally infected pigs, the coefficients of correlation between the C. coli or C. jejuni real-time PCR assay and culture enumeration were R2 = 0.90 and R2 = 0.93 respectively. Conclusion The C. coli and C. jejuni real-time quantitative PCR assays developed in this study provide a method capable of directly detecting and quantifying C. coli and C. jejuni in faeces, feed, and environmental samples. These assays represent a new

  17. Rapid and sensitive detection of Pseudomonas aeruginosa in chlorinated water and aerosols targeting gyrB gene using real-time PCR.

    Science.gov (United States)

    Lee, C S; Wetzel, K; Buckley, T; Wozniak, D; Lee, J

    2011-10-01

    For the rapid detection of Pseudomonas aeruginosa from chlorinated water and aerosols, gyrB gene-based real-time PCR assay was developed and investigated. Two novel primer sets (pa722F/746MGB/899R and pa722F/746MGB/788R) were designed using the most updated 611 Pseudomonas and 748 other bacterial gyrB genes for achieving high specificity. Their specificity showed 100% accuracy when tested with various strains including clinical isolates from cystic fibrosis patients. The assay was tested with Ps. aeruginosa-containing chlorinated water and aerosols to simulate the waterborne and airborne transmission routes (detection limit 3·3 × 10² CFU per PCR-2·3 × 10³ CFU per PCR). No chlorine interference in real-time PCR was observed at drinking water level (c. 1 mg l⁻¹), but high level of chorine (12 mg l⁻¹) interfered the assay, and thus neutralization was needed. Pseudomonas aeruginosa in aerosol was successfully detected after capturing with gelatin filters with minimum 2 min of sampling time when the initial concentration of 10⁴ CFU ml⁻¹ bacteria existed in the nebulizer. A highly specific and rapid assay (2-3 h) was developed by targeting gyrB gene for the detection of Ps. aeruginosa in chlorinated water and aerosols, combined with optimized sample collection methods and sample processing, so the direct DNA extraction from either water or aerosol was possible while achieving the desired sensitivity of the method.   The new assay can provide timely and accurate risk assessment to prevent Ps. aeruginosa exposure from water and aerosol, resulting in reduced disease burden, especially among immune-compromised and susceptible individuals. This approach can be easily utilized as a platform technology for the detection of other types of micro-organisms, especially for those that are transmitted via water and aerosol routes, such as Legionella pneumophila. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

  18. Rapid detection of Opisthorchis viverrini and Strongyloides stercoralis in human fecal samples using a duplex real-time PCR and melting curve analysis.

    Science.gov (United States)

    Janwan, Penchom; Intapan, Pewpan M; Thanchomnang, Tongjit; Lulitanond, Viraphong; Anamnart, Witthaya; Maleewong, Wanchai

    2011-12-01

    Human opisthorchiasis caused by the liver fluke Opisthorchis viverrini is an endemic disease in Southeast Asian countries including the Lao People's Democratic Republic, Cambodia, Vietnam, and Thailand. Infection with the soil-transmitted roundworm Strongyloides stercoralis is an important problem worldwide. In some areas, both parasitic infections are reported as co-infections. A duplex real-time fluorescence resonance energy transfer (FRET) PCR merged with melting curve analysis was developed for the rapid detection of O. viverrini and S. stercoralis in human fecal samples. Duplex real-time FRET PCR is based on fluorescence melting curve analysis of a hybrid of amplicons generated from two genera of DNA elements: the 162 bp pOV-A6 DNA sequence specific to O. viverrini and the 244 bp 18S rRNA sequence specific to S. stercoralis, and two pairs of specific fluorophore-labeled probes. Both O. viverrini and S. stercoralis can be differentially detected in infected human fecal samples by this process through their different fluorescence channels and melting temperatures. Detection limit of the method was as little as two O. viverrini eggs and four S. stercoralis larvae in 100 mg of fecal sample. The assay could distinguish the DNA of both parasites from the DNA of negative fecal samples and fecal samples with other parasite materials, as well as from the DNA of human leukocytes and other control parasites. The technique showed 100% sensitivity and specificity. The introduced duplex real-time FRET PCR can reduce labor time and reagent costs and is not prone to carry over contamination. The method is important for simultaneous detection especially in areas where both parasites overlap incidence and is useful as the screening tool in the returning travelers and immigrants to industrialized countries where number of samples in the diagnostic units will become increasing.

  19. Rapid genome detection of Schmallenberg virus and bovine viral diarrhea virus by use of isothermal amplification methods and high-speed real-time reverse transcriptase PCR.

    Science.gov (United States)

    Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin

    2014-06-01

    Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (RT-qPCR) and the two isothermal amplification techniques loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) represent three promising candidates for integration into mobile pen-side tests. The aim of this study was to investigate the performance of these amplification strategies and to evaluate their suitability for field application. In order to enable a valid comparison, novel pathogen-specific assays have been developed for the detection of Schmallenberg virus and bovine viral diarrhea virus. The newly developed assays were evaluated in comparison with established standard RT-qPCR using samples from experimentally or field-infected animals. Even though all assays allowed detection of the target virus in less than 30 min, major differences were revealed concerning sensitivity, specificity, robustness, testing time, and complexity of assay design. These findings indicated that the success of an assay will depend on the integrated amplification technology. Therefore, the application-specific pros and cons of each method that were identified during this study provide very valuable insights for future development and optimization of pen-side tests. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  20. Development of rapid and simple method for DNA extraction from cannabis resin based on the evaluation of relative PCR amplification ability.

    Science.gov (United States)

    Yamamuro, Tadashi; Iwata, Yuko T; Segawa, Hiroki; Kuwayama, Kenji; Tsujikawa, Kenji; Kanamori, Tatsuyuki; Inoue, Hiroyuki

    2018-04-04

    In recent years, analysis of cannabis DNA has been increasingly used in forensic drug tests. However, in the case of cannabis resin, a processed marijuana product, complicated procedures are required for the extraction of clean DNA, as the presence of various impurities inhibits PCR amplification. Therefore, in this study, we attempted to identify the factors that would allow quick and simple DNA extraction from cannabis resin with a commercially available kit. We also constructed a simple assay system for comparing relative amplification efficiencies by end-point PCR and used it to evaluate the purity of the obtained DNA solutions. For extraction with a kit that contains a silica column, reducing the starting amount of resin, using the residue remaining after methanol extraction, dilution of the final solution, extraction with an equal amount of powdered activated carbon or an excess amount of polyvinylpolypyrrolidone, and the addition of an appropriate amount of polyvinylpyrrolidone to the solution after extraction were effective measures that improved amplification efficiency. Furthermore, the use of the most rapid alkaline extraction kit combined with the addition of powdered activated carbon allowed obtaining DNA solutions with sufficient amplification efficiency in about 10min. These findings should be useful for routine DNA analysis of cannabis resin during forensic examination. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Rapid detection of most frequent Slovenian germ-line mutations in BRCA1 gene using real-time PCR and melting curve analysis

    International Nuclear Information System (INIS)

    Novakovic, S.; Stegel, V.

    2005-01-01

    Background. Detection of inherited mutations in cancer susceptibility genes is of great importance in some types of cancers including the colorectal cancer (mutations of APC gene in familial adenomatous polyposis - FAP, mutations in mismatch repair genes in hereditary nonpolyposis colorectal cancer - HNPCC), malignant melanoma (mutations in CDKN2A and CDK4 genes) and breast cancer (mutations in BRCA1 and BRCA2 genes). Methods. This article presents the technical data for the detection of five mutations in BRCA1 gene in breast cancer patients and their relatives. The mutations - 1806C>T, 300T>G, 300T>A, 310G>A, 5382insC - were determined by the real-time PCR and the melting curve analysis. Results and conclusion. In comparison to direct sequencing, this method proved to be sensitive and rapid enough for the routine daily determination of mutations in DNA isolated from the peripheral blood. (author)

  2. Rapid detection of Shigella and enteroinvasive Escherichia coli in produce enrichments by a conventional multiplex PCR assay.

    Science.gov (United States)

    Binet, Rachel; Deer, Deanne M; Uhlfelder, Samantha J

    2014-06-01

    Faster detection of contaminated foods can prevent adulterated foods from being consumed and minimize the risk of an outbreak of foodborne illness. A sensitive molecular detection method is especially important for Shigella because ingestion of as few as 10 of these bacterial pathogens can cause disease. The objectives of this study were to compare the ability of four DNA extraction methods to detect Shigella in six types of produce, post-enrichment, and to evaluate a new and rapid conventional multiplex assay that targets the Shigella ipaH, virB and mxiC virulence genes. This assay can detect less than two Shigella cells in pure culture, even when the pathogen is mixed with background microflora, and it can also differentiate natural Shigella strains from a control strain and eliminate false positive results due to accidental laboratory contamination. The four DNA extraction methods (boiling, PrepMan Ultra [Applied Biosystems], InstaGene Matrix [Bio-Rad], DNeasy Tissue kit [Qiagen]) detected 1.6 × 10(3)Shigella CFU/ml post-enrichment, requiring ∼18 doublings to one cell in 25 g of produce pre-enrichment. Lower sensitivity was obtained, depending on produce type and extraction method. The InstaGene Matrix was the most consistent and sensitive and the multiplex assay accurately detected Shigella in less than 90 min, outperforming, to the best of our knowledge, molecular assays currently in place for this pathogen. Published by Elsevier Ltd.

  3. Rapid and Specific Detection of Acidovorax avenae subsp. citrulli Using SYBR Green-Based Real-Time PCR Amplification of the YD-Repeat Protein Gene.

    Science.gov (United States)

    Cho, Min Seok; Park, Duck Hwan; Ahn, Tae-Young; Park, Dong Suk

    2015-09-01

    The aim of this study was to develop a SYBR Green-based real-time PCR assay for the rapid, specific, and sensitive detection of Acidovorax avenae subsp. citrulli, which causes bacterial fruit blotch (BFB), a serious disease of cucurbit plants. The molecular and serological methods currently available for the detection of this pathogen are insufficiently sensitive and specific. Thus, a novel SYBR Green-based real-time PCR assay targeting the YD-repeat protein gene of A. avenae subsp. citrulli was developed. The specificity of the primer set was evaluated using DNA purified from 6 isolates of A. avenae subsp. citrulli, 7 other Acidovorax species, and 22 of non-targeted strains, including pathogens and non-pathogens. The AC158F/R primer set amplified a single band of the expected size from genomic DNA obtained from the A. avenae subsp. citrulli strains but not from the genomic DNA of other Acidovorax species, including that of other bacterial genera. Using this assay, it was possible to detect at least one genomeequivalents of the cloned amplified target DNA using 5 × 10(0) fg/μl of purified genomic DNA per reaction or using a calibrated cell suspension, with 6.5 colony-forming units per reaction being employed. In addition, this assay is a highly sensitive and reliable method for identifying and quantifying the target pathogen in infected samples that does not require DNA extraction. Therefore, we suggest that this approach is suitable for the rapid and efficient diagnosis of A. avenae subsp. citrulli contaminations of seed lots and plants.

  4. MALDI-TOF MS performance compared to direct examination, culture, and 16S rDNA PCR for the rapid diagnosis of bone and joint infections.

    Science.gov (United States)

    Lallemand, E; Coiffier, G; Arvieux, C; Brillet, E; Guggenbuhl, P; Jolivet-Gougeon, A

    2016-05-01

    The rapid identification of bacterial species involved in bone and joint infections (BJI) is an important element to optimize the diagnosis and care of patients. The aim of this study was to evaluate the usefulness of matrix-assisted laser desorption ionization mass spectrometry (MALDI-TOF MS) for the rapid diagnosis of bone infections, directly on synovial fluid (SF) or on crushed osteoarticular samples (CS). From January to October 2013, we prospectively analyzed 111 osteoarticular samples (bone and joint samples, BJS) from 78 patients in care at the University Hospital of Rennes, France. The diagnosis procedure leading to the sample collection was linked to a suspicion of infection, inflammatory disease, arthritis, or for any bone or joint abnormalities. Standard bacteriological diagnosis and molecular biology analysis [16S rRNA polymerase chain reaction (PCR) and sequencing] were conducted. In addition, analysis by MALDI-TOF MS was performed directly on the osteoarticular samples, as soon as the amount allowed. Culture, which remains the gold standard for the diagnosis of BJI, has the highest sensitivity (85.9 %) and remains necessary to test antimicrobial susceptibility. The 16S rDNA PCR results were positive in the group with positive BJI (28.6 %) and negative in the group without infection. Direct examination remains insensitive (31.7 %) but more effective than MALDI-TOF MS directly on the sample (6.3 %). The specificity was 100 % in all cases, except for culture (74.5 %). Bacterial culture remains the gold standard, especially enrichment in blood bottles. Direct analysis of bone samples with MALDI-TOF MS is not useful, possibly due to the low inoculum of BJS.

  5. Rapid diagnosis of avian influenza virus in wild birds: Use of a portable rRT-PCR and freeze-dried reagents in the field

    Science.gov (United States)

    Takekawa, John Y.; Hill, N.J.; Schultz, A.K.; Iverson, S.A.; Cardona, C.J.; Boyce, W.M.; Dudley, J.P.

    2011-01-01

    Wild birds have been implicated in the spread of highly pathogenic avian influenza (HPAI) of the H5N1 subtype, prompting surveillance along migratory flyways. Sampling of wild birds for avian influenza virus (AIV) is often conducted in remote regions, but results are often delayed because of the need to transport samples to a laboratory equipped for molecular testing. Real-time reverse transcriptase polymerase chain reaction (rRT-PCR) is a molecular technique that offers one of the most accurate and sensitive methods for diagnosis of AIV. The previously strict lab protocols needed for rRT-PCR are now being adapted for the field. Development of freeze-dried (lyophilized) reagents that do not require cold chain, with sensitivity at the level of wet reagents has brought on-site remote testing to a practical goal. Here we present a method for the rapid diagnosis of AIV in wild birds using an rRT-PCR unit (Ruggedized Advanced Pathogen Identification Device or RAPID, Idaho Technologies, Salt Lake City, UT) that employs lyophilized reagents (Influenza A Target 1 Taqman; ASAY-ASY-0109, Idaho Technologies). The reagents contain all of the necessary components for testing at appropriate concentrations in a single tube: primers, probes, enzymes, buffers and internal positive controls, eliminating errors associated with improper storage or handling of wet reagents. The portable unit performs a screen for Influenza A by targeting the matrix gene and yields results in 2-3 hours. Genetic subtyping is also possible with H5 and H7 primer sets that target the hemagglutinin gene. The system is suitable for use on cloacal and oropharyngeal samples collected from wild birds, as demonstrated here on the migratory shorebird species, the western sandpiper (Calidrus mauri) captured in Northern California. Animal handling followed protocols approved by the Animal Care and Use Committee of the U.S. Geological Survey Western Ecological Research Center and permits of the U.S. Geological Survey

  6. Enhancement of allele discrimination by introduction of nucleotide mismatches into siRNA in allele-specific gene silencing by RNAi.

    Directory of Open Access Journals (Sweden)

    Yusuke Ohnishi

    Full Text Available Allele-specific gene silencing by RNA interference (RNAi is therapeutically useful for specifically inhibiting the expression of disease-associated alleles without suppressing the expression of corresponding wild-type alleles. To realize such allele-specific RNAi (ASP-RNAi, the design and assessment of small interfering RNA (siRNA duplexes conferring ASP-RNAi is vital; however, it is also difficult. In a previous study, we developed an assay system to assess ASP-RNAi with mutant and wild-type reporter alleles encoding the Photinus and Renilla luciferase genes. In line with experiments using the system, we realized that it is necessary and important to enhance allele discrimination between mutant and corresponding wild-type alleles. Here, we describe the improvement of ASP-RNAi against mutant alleles carrying single nucleotide variations by introducing base substitutions into siRNA sequences, where original variations are present in the central position. Artificially mismatched siRNAs or short-hairpin RNAs (shRNAs against mutant alleles of the human Prion Protein (PRNP gene, which appear to be associated with susceptibility to prion diseases, were examined using this assessment system. The data indicates that introduction of a one-base mismatch into the siRNAs and shRNAs was able to enhance discrimination between the mutant and wild-type alleles. Interestingly, the introduced mismatches that conferred marked improvement in ASP-RNAi, appeared to be largely present in the guide siRNA elements, corresponding to the 'seed region' of microRNAs. Due to the essential role of the 'seed region' of microRNAs in their association with target RNAs, it is conceivable that disruption of the base-pairing interactions in the corresponding seed region, as well as the central position (involved in cleavage of target RNAs, of guide siRNA elements could influence allele discrimination. In addition, we also suggest that nucleotide mismatches at the 3'-ends of sense

  7. Rapid PCR using nested primers of the 16S rRNA and the hippuricase (hipO) genes to detect Campylobacter jejuni and Campylobacter coli in environmental samples

    DEFF Research Database (Denmark)

    Bang, Dang Duong; Wedderkopp, A.; Pedersen, Karl

    2002-01-01

    sensitivity due to the use of selective media, the low number of bacteria in the samples and possibly also due to the presence of non-culturable or sub-lethally injured stages of the bacteria. The present paper describes a rapid PCR assay using nested primers of the 16S rRNA or the hippuricase (hipO) genes...... to detect Campylobacter jejuni and Campylobacter coli in environmental samples. The sensitivity of the nested PCR was determined to be 0.01 pg/PCR, corresponding to 2-3 colony forming units (cfu) per ml. The nested PCR assays were applied to detect C. jejuni and C. coli in 269 environmental samples...... collected from ten broiler farms. The sensitivity, specificity and the usefulness of the PCR assay for detection of C. jejuni and C coli in environmental samples are presented and discussed....

  8. A and MdMYB1 allele-specific markers controlling apple (Malus x domestica Borkh.) skin color and suitability for marker-assisted selection.

    Science.gov (United States)

    Zhang, X J; Wang, L X; Chen, X X; Liu, Y L; Meng, R; Wang, Y J; Zhao, Z Y

    2014-10-31

    Pre-selection for fruit skin color at the seedling stage would be highly advantageous, with marker-assisted selection offering a potential method for apple pre-selection. A and MdMYB1 alleles are allele-specific DNA markers that are potentially associated with apple skin color, and co-segregate with the Rf and Rni loci, respectively. Here, we assessed the potential application of these 2 alleles for marker-assisted breeding across 30 diverse cultivars and 2 apple seedling progenies. The red skin color phenotype was usually associated with the MdMYB1-1 allele and A(1) allele, respectively, while the 2 molecular markers provided approximately 91% predictability in the 'Fuji' x 'Cripps Pink' and 'Fuji' x 'Gala' progenies. The results obtained from the 30 cultivars and 2 progenies were consistent for the 2 molecular markers. Hence, the results supported that Rf and Rni could be located in a gene cluster, or even correspond to alleles of the same gene. Our results are consistent with the hypothesis that red/yellow dimorphism is controlled by a monogenic system, with the presence of the red anthocyanin pigmentation being dominant. In addition, our results supported that the practical utilization of the 2 function markers to efficiently and accurately select red-skinned apple cultivars in apple scion breeding programs.

  9. Multiple Avirulence Loci and Allele-Specific Effector Recognition Control the Pm3 Race-Specific Resistance of Wheat to Powdery Mildew[OPEN

    Science.gov (United States)

    Roffler, Stefan; Stirnweis, Daniel; Treier, Georges; Herren, Gerhard; Korol, Abraham B.; Wicker, Thomas

    2015-01-01

    In cereals, several mildew resistance genes occur as large allelic series; for example, in wheat (Triticum aestivum and Triticum turgidum), 17 functional Pm3 alleles confer agronomically important race-specific resistance to powdery mildew (Blumeria graminis). The molecular basis of race specificity has been characterized in wheat, but little is known about the corresponding avirulence genes in powdery mildew. Here, we dissected the genetics of avirulence for six Pm3 alleles and found that three major Avr loci affect avirulence, with a common locus_1 involved in all AvrPm3-Pm3 interactions. We cloned the effector gene AvrPm3a2/f2 from locus_2, which is recognized by the Pm3a and Pm3f alleles. Induction of a Pm3 allele-dependent hypersensitive response in transient assays in Nicotiana benthamiana and in wheat demonstrated specificity. Gene expression analysis of Bcg1 (encoded by locus_1) and AvrPm3 a2/f2 revealed significant differences between isolates, indicating that in addition to protein polymorphisms, expression levels play a role in avirulence. We propose a model for race specificity involving three components: an allele-specific avirulence effector, a resistance gene allele, and a pathogen-encoded suppressor of avirulence. Thus, whereas a genetically simple allelic series controls specificity in the plant host, recognition on the pathogen side is more complex, allowing flexible evolutionary responses and adaptation to resistance genes. PMID:26452600

  10. Technical aspects of typing for HLA-DP alleles using allele-specific DNA in vitro amplification and sequence-specific oligonucleotide probes. Detection of single base mismatches

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1990-01-01

    The polymerase chain reaction (PCR) is an effective method for in vitro DNA amplification which combined with probing with synthetic oligonucleotides can be used for, e.g., HLA-typing. We have studied the technical aspects of HLA-DP typing with the technique. DNA from mononuclear nucleated cells...... was extracted with either a simple salting out method or phenol/chloroform. Both DNAs could be readily used for PCR. The MgC2 concentration of the PCR buffer and the annealing temperature of the thermal cycle of the PCR were the two most important variables. The MgCl2 concentration and the temperature must...... be carefully titrated for each primer pair in the PCR. The influence of mismatches between the primer and the DNA template were studied and we found that, by using primers differing only from each other at the 3' end, cross-amplification of closely homologous alleles could be avoided. Thus, single base...

  11. SU94. Allele-Specific and Trauma-Related Epigenetic Changes in the FKBP5 Gene: Differences Between Psychotic Patients and Healthy Controls

    Science.gov (United States)

    Mihaljevic, Marina; Franic, Dusica; Soldatovic, Ivan; Andric, Sanja; Mirjanic, Tijana; Novakovic, Ivana; Adzic, Miroslav; Maric, Nadja

    2017-01-01

    Abstract Background: Hypothalamic-pituitary-adrenal (HPA) axis dysregulation is a proposed etiological mechanism of psychosis. Recent studies highlighted impact of the FKBP5 gene and its functional variant rs1360780, which risk (T) allele affects the activity of HPA axis following stress exposure, on psychotic patients exposed to early trauma (1). Additionally, risk allele and trauma dependent FKBP5 demethylation in intron 7 was observed in traumatized individuals (2). Thus, the purpose of this pilot study was to investigate influence of the risk allele and trauma on FKBP5 DNA methylation levels at intron 7 in psychotic patients and to compare it with healthy individuals. Methods: The sample consisted of 24 psychosis spectrum patients and 24 controls matched by age and gender. All participants were genotyped for rs1360780 and divided into 2 groups depending on the presence of the risk allele (risk and nonrisk group). DNA methylation levels at 3 CpG sites (CpG1, CpG2, and CpG3) in intron 7 were analyzed by Sanger sequencing. Early-life adversities were measured by Childhood Trauma Questionnaire. Pearson correlation and t test were performed as appropriate. Results: Analyses revealed decreased FKBP5 methylation at targeted CpG sites and averaged methylation level (AML) at intron 7 in patients compared to controls (P = .026, P = .017, P = .027, and P = .003, respectively). Decreased AML and methylation at CpG3 were observed comparing risk and nonrisk patients’ groups (P = .018 and P = .016, respectively). Additionally, decreased methylation was found in risk patients’ group compared to risk controls’ group. No differences were found comparing nonrisk groups. Furthermore, strong negative associations between trauma and methylation at CpG3 and AML were observed only in risk controls’ group (r = −0.707, P = .007; r = −0.741, P = .004, respectively). Conclusion: Our preliminary results revealed allele-specific epigenetic changes of the FKBP

  12. SAAS-CNV: A Joint Segmentation Approach on Aggregated and Allele Specific Signals for the Identification of Somatic Copy Number Alterations with Next-Generation Sequencing Data.

    Science.gov (United States)

    Zhang, Zhongyang; Hao, Ke

    2015-11-01

    Cancer genomes exhibit profound somatic copy number alterations (SCNAs). Studying tumor SCNAs using massively parallel sequencing provides unprecedented resolution and meanwhile gives rise to new challenges in data analysis, complicated by tumor aneuploidy and heterogeneity as well as normal cell contamination. While the majority of read depth based methods utilize total sequencing depth alone for SCNA inference, the allele specific signals are undervalued. We proposed a joint segmentation and inference approach using both signals to meet some of the challenges. Our method consists of four major steps: 1) extracting read depth supporting reference and alternative alleles at each SNP/Indel locus and comparing the total read depth and alternative allele proportion between tumor and matched normal sample; 2) performing joint segmentation on the two signal dimensions; 3) correcting the copy number baseline from which the SCNA state is determined; 4) calling SCNA state for each segment based on both signal dimensions. The method is applicable to whole exome/genome sequencing (WES/WGS) as well as SNP array data in a tumor-control study. We applied the method to a dataset containing no SCNAs to test the specificity, created by pairing sequencing replicates of a single HapMap sample as normal/tumor pairs, as well as a large-scale WGS dataset consisting of 88 liver tumors along with adjacent normal tissues. Compared with representative methods, our method demonstrated improved accuracy, scalability to large cancer studies, capability in handling both sequencing and SNP array data, and the potential to improve the estimation of tumor ploidy and purity.

  13. Genome-wide identification and quantification of cis- and trans-regulated genes responding to Marek’s disease virus infection via analysis of allele-specific expression

    Directory of Open Access Journals (Sweden)

    Sean eMaceachern

    2012-01-01

    Full Text Available Marek’s disease (MD is a commercially important neoplastic disease of chickens caused by Marek’s disease virus (MDV, an oncogenic alphaherpesvirus. Selecting for increased genetic resistance to MD is a control strategy that can augment vaccinal control measures. To identify high-confidence candidate MD resistance genes, we conducted a genome-wide screen for allele-specific expression (ASE amongst F1 progeny of two inbred chicken lines that differ in MD resistance. High throughput sequencing was used to profile transcriptomes from pools of uninfected and infected individuals at 4 days post-infection to identify any genes showing ASE in response to MDV infection. RNA sequencing identified 22,655 single nucleotide polymorphisms (SNPs of which 5,360 in 3,773 genes exhibited significant allelic imbalance. Illumina GoldenGate assays were subsequently used to quantify regulatory variation controlled at the gene (cis and elsewhere in the genome (trans by examining differences in expression between F1 individuals and artificial F1 RNA pools over 6 time periods in 1,536 of the most significant SNPs identified by RNA sequencing. Allelic imbalance as a result of cis-regulatory changes was confirmed in 861 of the 1,233 GoldenGate assays successfully examined. Furthermore we have identified 7 genes that display trans-regulation only in infected animals and approximately 500 SNP that show a complex interaction between cis- and trans-regulatory changes. Our results indicate ASE analyses are a powerful approach to identify regulatory variation responsible for differences in transcript abundance in genes underlying complex traits. And the genes with SNPs exhibiting ASE provide a strong foundation to further investigate the causative polymorphisms and genetic mechanisms for MD resistance. Finally, the methods used here for identifying specific genes and SNPs may have practical implications for applying marker-assisted selection to complex traits that are

  14. TumorBoost: Normalization of allele-specific tumor copy numbers from a single pair of tumor-normal genotyping microarrays

    Directory of Open Access Journals (Sweden)

    Neuvial Pierre

    2010-05-01

    Full Text Available Abstract Background High-throughput genotyping microarrays assess both total DNA copy number and allelic composition, which makes them a tool of choice for copy number studies in cancer, including total copy number and loss of heterozygosity (LOH analyses. Even after state of the art preprocessing methods, allelic signal estimates from genotyping arrays still suffer from systematic effects that make them difficult to use effectively for such downstream analyses. Results We propose a method, TumorBoost, for normalizing allelic estimates of one tumor sample based on estimates from a single matched normal. The method applies to any paired tumor-normal estimates from any microarray-based technology, combined with any preprocessing method. We demonstrate that it increases the signal-to-noise ratio of allelic signals, making it significantly easier to detect allelic imbalances. Conclusions TumorBoost increases the power to detect somatic copy-number events (including copy-neutral LOH in the tumor from allelic signals of Affymetrix or Illumina origin. We also conclude that high-precision allelic estimates can be obtained from a single pair of tumor-normal hybridizations, if TumorBoost is combined with single-array preprocessing methods such as (allele-specific CRMA v2 for Affymetrix or BeadStudio's (proprietary XY-normalization method for Illumina. A bounded-memory implementation is available in the open-source and cross-platform R package aroma.cn, which is part of the Aroma Project (http://www.aroma-project.org/.

  15. Mutant Allele-Specific Uncoupling of PENETRATION3 Functions Reveals Engagement of the ATP-Binding Cassette Transporter in Distinct Tryptophan Metabolic Pathways1[OPEN

    Science.gov (United States)

    Lu, Xunli; Dittgen, Jan; Piślewska-Bednarek, Mariola; Molina, Antonio; Schneider, Bernd; Doubský, Jan; Schneeberger, Korbinian; Schulze-Lefert, Paul

    2015-01-01

    Arabidopsis (Arabidopsis thaliana) PENETRATION (PEN) genes quantitatively contribute to the execution of different forms of plant immunity upon challenge with diverse leaf pathogens. PEN3 encodes a plasma membrane-resident pleiotropic drug resistance-type ATP-binding cassette transporter and is thought to act in a pathogen-inducible and PEN2 myrosinase-dependent metabolic pathway in extracellular defense. This metabolic pathway directs the intracellular biosynthesis and activation of tryptophan-derived indole glucosinolates for subsequent PEN3-mediated efflux across the plasma membrane at pathogen contact sites. However, PEN3 also functions in abiotic stress responses to cadmium and indole-3-butyric acid (IBA)-mediated auxin homeostasis in roots, raising the possibility that PEN3 exports multiple functionally unrelated substrates. Here, we describe the isolation of a pen3 allele, designated pen3-5, that encodes a dysfunctional protein that accumulates in planta like wild-type PEN3. The specific mutation in pen3-5 uncouples PEN3 functions in IBA-stimulated root growth modulation, callose deposition induced with a conserved peptide epitope of bacterial flagellin (flg22), and pathogen-inducible salicylic acid accumulation from PEN3 activity in extracellular defense, indicating the engagement of multiple PEN3 substrates in different PEN3-dependent biological processes. We identified 4-O-β-d-glucosyl-indol-3-yl formamide (4OGlcI3F) as a pathogen-inducible, tryptophan-derived compound that overaccumulates in pen3 leaf tissue and has biosynthesis that is dependent on an intact PEN2 metabolic pathway. We propose that a precursor of 4OGlcI3F is the PEN3 substrate in extracellular pathogen defense. These precursors, the shared indole core present in IBA and 4OGlcI3F, and allele-specific uncoupling of a subset of PEN3 functions suggest that PEN3 transports distinct indole-type metabolites in distinct biological processes. PMID:26023163

  16. Comparison of the novel Partec rapid malaria test to the conventional Giemsa stain and the gold standard real-time PCR.

    Science.gov (United States)

    Nkrumah, Bernard; Agyekum, Alex; Acquah, Samuel E K; May, Jürgen; Tannich, Egbert; Brattig, Norbert; Nguah, Samuel Blay; von Thien, Heidrun; Adu-Sarkodie, Yaw; Huenger, Frank

    2010-08-01

    Malaria remains the single most frequent cause of death in Africa, killing one child every 30 s, but treatment decisions are often made only on clinical diagnosis, as laboratory techniques to confirm the clinical suspicion are labor intensive and costly. In this study, we evaluated the recently developed Partec rapid malaria test (PM) for the detection of Plasmodium spp. in human blood from patients in an area where malaria is endemic and compared the results with those of thick blood film Giemsa stain (GS) in terms of its performance and operational characteristics, using real-time (RT) PCR as the gold standard. The sensitivities of the PM and the GS were 62.2% (95% CI, 56.3 to 67.8) and 61.8% (95% CI, 55.9 to 67.4), respectively, while the specificities were 96.0% (95% CI, 92.3 to 98.3) and 98% (95% CI, 95.0 to 99.5), respectively. There was an excellent agreement between the results for the PM and those of the GS (k [level of agreement] = 0.96; P < 0.001). The results for the PM were obtained more quickly and at less cost than those for the GS. The performance characteristics of the PM were almost equal to those of the GS, but the operational characteristics were better, and the PM can therefore be considered as an alternative method for GS.

  17. Comparison of the Novel Partec Rapid Malaria Test to the Conventional Giemsa Stain and the Gold Standard Real-Time PCR

    Science.gov (United States)

    Nkrumah, Bernard; Agyekum, Alex; Acquah, Samuel E. K.; May, Jürgen; Tannich, Egbert; Brattig, Norbert; Nguah, Samuel Blay; von Thien, Heidrun; Adu-Sarkodie, Yaw; Huenger, Frank

    2010-01-01

    Malaria remains the single most frequent cause of death in Africa, killing one child every 30 s, but treatment decisions are often made only on clinical diagnosis, as laboratory techniques to confirm the clinical suspicion are labor intensive and costly. In this study, we evaluated the recently developed Partec rapid malaria test (PM) for the detection of Plasmodium spp. in human blood from patients in an area where malaria is endemic and compared the results with those of thick blood film Giemsa stain (GS) in terms of its performance and operational characteristics, using real-time (RT) PCR as the gold standard. The sensitivities of the PM and the GS were 62.2% (95% CI, 56.3 to 67.8) and 61.8% (95% CI, 55.9 to 67.4), respectively, while the specificities were 96.0% (95% CI, 92.3 to 98.3) and 98% (95% CI, 95.0 to 99.5), respectively. There was an excellent agreement between the results for the PM and those of the GS (k [level of agreement] = 0.96; P < 0.001). The results for the PM were obtained more quickly and at less cost than those for the GS. The performance characteristics of the PM were almost equal to those of the GS, but the operational characteristics were better, and the PM can therefore be considered as an alternative method for GS. PMID:20554822

  18. Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group- and species-specific primers derived from the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA.

    Science.gov (United States)

    Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K

    2000-06-15

    Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.

  19. Evaluation of a Rapid One-step Real-time PCR Method as a High-throughput Screening for Quantification of Hepatitis B Virus DNA in a Resource-limited Setting.

    Science.gov (United States)

    Rashed-Ul Islam, S M; Jahan, Munira; Tabassum, Shahina

    2015-01-01

    Virological monitoring is the best predictor for the management of chronic hepatitis B virus (HBV) infections. Consequently, it is important to use the most efficient, rapid and cost-effective testing systems for HBV DNA quantification. The present study compared the performance characteristics of a one-step HBV polymerase chain reaction (PCR) vs the two-step HBV PCR method for quantification of HBV DNA from clinical samples. A total of 100 samples consisting of 85 randomly selected samples from patients with chronic hepatitis B (CHB) and 15 samples from apparently healthy individuals were enrolled in this study. Of the 85 CHB clinical samples tested, HBV DNA was detected from 81% samples by one-step PCR method with median HBV DNA viral load (VL) of 7.50 × 10 3 lU/ml. In contrast, 72% samples were detected by the two-step PCR system with median HBV DNA of 3.71 × 10 3 lU/ml. The one-step method showed strong linear correlation with two-step PCR method (r = 0.89; p Tabassum S. Evaluation of a Rapid One-step Real-time PCR Method as a High-throughput Screening for Quantification of Hepatitis B Virus DNA in a Resource-limited Setting. Euroasian J Hepato-Gastroenterol 2015;5(1):11-15.

  20. High-resolution melting-curve analysis of ligation-mediated real-time PCR for rapid evaluation of an epidemiological outbreak of extended-spectrum-beta-lactamase-producing Escherichia coli.

    Science.gov (United States)

    Woksepp, Hanna; Jernberg, Cecilia; Tärnberg, Maria; Ryberg, Anna; Brolund, Alma; Nordvall, Michaela; Olsson-Liljequist, Barbro; Wisell, Karin Tegmark; Monstein, Hans-Jürg; Nilsson, Lennart E; Schön, Thomas

    2011-12-01

    Methods for the confirmation of nosocomial outbreaks of bacterial pathogens are complex, expensive, and time-consuming. Recently, a method based on ligation-mediated PCR (LM/PCR) using a low denaturation temperature which produces specific melting-profile patterns of DNA products has been described. Our objective was to further develop this method for real-time PCR and high-resolution melting analysis (HRM) in a single-tube system optimized in order to achieve results within 1 day. Following the optimization of LM/PCR for real-time PCR and HRM (LM/HRM), the method was applied for a nosocomial outbreak of extended-spectrum-beta-lactamase (ESBL)-producing and ST131-associated Escherichia coli isolates (n = 15) and control isolates (n = 29), including four previous clusters. The results from LM/HRM were compared to results from pulsed-field gel electrophoresis (PFGE), which served as the gold standard. All isolates from the nosocomial outbreak clustered by LM/HRM, which was confirmed by gel electrophoresis of the LM/PCR products and PFGE. Control isolates that clustered by LM/PCR (n = 4) but not by PFGE were resolved by confirmatory gel electrophoresis. We conclude that LM/HRM is a rapid method for the detection of nosocomial outbreaks of bacterial infections caused by ESBL-producing E. coli strains. It allows the analysis of isolates in a single-tube system within a day, and the discriminatory power is comparable to that of PFGE.

  1. High-Resolution Melting-Curve Analysis of Ligation-Mediated Real-Time PCR for Rapid Evaluation of an Epidemiological Outbreak of Extended-Spectrum-Beta-Lactamase-Producing Escherichia coli ▿

    Science.gov (United States)

    Woksepp, Hanna; Jernberg, Cecilia; Tärnberg, Maria; Ryberg, Anna; Brolund, Alma; Nordvall, Michaela; Olsson-Liljequist, Barbro; Wisell, Karin Tegmark; Monstein, Hans-Jürg; Nilsson, Lennart E.; Schön, Thomas

    2011-01-01

    Methods for the confirmation of nosocomial outbreaks of bacterial pathogens are complex, expensive, and time-consuming. Recently, a method based on ligation-mediated PCR (LM/PCR) using a low denaturation temperature which produces specific melting-profile patterns of DNA products has been described. Our objective was to further develop this method for real-time PCR and high-resolution melting analysis (HRM) in a single-tube system optimized in order to achieve results within 1 day. Following the optimization of LM/PCR for real-time PCR and HRM (LM/HRM), the method was applied for a nosocomial outbreak of extended-spectrum-beta-lactamase (ESBL)-producing and ST131-associated Escherichia coli isolates (n = 15) and control isolates (n = 29), including four previous clusters. The results from LM/HRM were compared to results from pulsed-field gel electrophoresis (PFGE), which served as the gold standard. All isolates from the nosocomial outbreak clustered by LM/HRM, which was confirmed by gel electrophoresis of the LM/PCR products and PFGE. Control isolates that clustered by LM/PCR (n = 4) but not by PFGE were resolved by confirmatory gel electrophoresis. We conclude that LM/HRM is a rapid method for the detection of nosocomial outbreaks of bacterial infections caused by ESBL-producing E. coli strains. It allows the analysis of isolates in a single-tube system within a day, and the discriminatory power is comparable to that of PFGE. PMID:21956981

  2. Comparison of false-negative rates and limits of detection following macrofoam-swab sampling of Bacillus anthracis surrogates via Rapid Viability PCR and plate culture

    Energy Technology Data Exchange (ETDEWEB)

    Hutchison, J. R. [National Security Directorate, Pacific Northwest National Laboratory, Richland WA USA; Piepel, G. F. [National Security Directorate, Pacific Northwest National Laboratory, Richland WA USA; Amidan, B. G. [National Security Directorate, Pacific Northwest National Laboratory, Richland WA USA; Hess, B. M. [National Security Directorate, Pacific Northwest National Laboratory, Richland WA USA; Sydor, M. A. [National Security Directorate, Pacific Northwest National Laboratory, Richland WA USA; Deatherage Kaiser, B. L. [National Security Directorate, Pacific Northwest National Laboratory, Richland WA USA

    2018-03-13

    Aims: We evaluated the effects of Bacillus anthracis surrogates, low surface concentrations, surface materials, and assay methods on false-negative rate (FNR) and limit of detection (LOD95) for recovering Bacillus spores using a macrofoam-swab sampling procedure. Methods and Results: Bacillus anthracis Sterne or Bacillus atrophaeus Nakamura spores were deposited over a range of low target concentrations (2 – 500 coupon-1) onto glass, stainless steel, vinyl tile, and plastic. Samples were assayed using a modified Rapid Viability-PCR (mRV-PCR) method and the traditional plate culture method to obtain FNR and LOD95 results. Conclusions: Mean FNRs tended to be lower for mRV-PCR compared to culturing, and increased as spore concentration decreased for all surface materials. Surface material, but not B. anthracis surrogate, influenced FNRs with the mRV-PCR method. The mRV-PCR LOD95 was lowest for glass and highest for vinyl tile. LOD95 values overall were lower for mRV-PCR than for the culture method. Significance and Impact of Study: This study adds to the limited data on FNR and LOD95 for mRV-PCR and culturing methods with low concentrations of B. anthracis sampled from various surface materials by the CDC macrofoam-swab method. These are key inputs for planning characterization and clearance studies for low contamination levels of B. anthracis.

  3. Promoter Boundaries for the luxCDABE and betIBA-proXWV Operons in Vibrio harveyi Defined by the Method Rapid Arbitrary PCR Insertion Libraries (RAIL).

    Science.gov (United States)

    Hustmyer, Christine M; Simpson, Chelsea A; Olney, Stephen G; Rusch, Douglas B; Bochman, Matthew L; van Kessel, Julia C

    2018-06-01

    Experimental studies of transcriptional regulation in bacteria require the ability to precisely measure changes in gene expression, often accomplished through the use of reporter genes. However, the boundaries of promoter sequences required for transcription are often unknown, thus complicating the construction of reporters and genetic analysis of transcriptional regulation. Here, we analyze reporter libraries to define the promoter boundaries of the luxCDABE bioluminescence operon and the betIBA-proXWV osmotic stress operon in Vibrio harveyi We describe a new method called r apid a rbitrary PCR i nsertion l ibraries (RAIL) that combines the power of arbitrary PCR and isothermal DNA assembly to rapidly clone promoter fragments of various lengths upstream of reporter genes to generate large libraries. To demonstrate the versatility and efficiency of RAIL, we analyzed the promoters driving expression of the luxCDABE and betIBA-proXWV operons and created libraries of DNA fragments from these loci fused to fluorescent reporters. Using flow cytometry sorting and deep sequencing, we identified the DNA regions necessary and sufficient for maximum gene expression for each promoter. These analyses uncovered previously unknown regulatory sequences and validated known transcription factor binding sites. We applied this high-throughput method to gfp , mCherry , and lacZ reporters and multiple promoters in V. harveyi We anticipate that the RAIL method will be easily applicable to other model systems for genetic, molecular, and cell biological applications. IMPORTANCE Gene reporter constructs have long been essential tools for studying gene regulation in bacteria, particularly following the recent advent of fluorescent gene reporters. We developed a new method that enables efficient construction of promoter fusions to reporter genes to study gene regulation. We demonstrate the versatility of this technique in the model bacterium Vibrio harveyi by constructing promoter libraries

  4. Development and first evaluation of a novel multiplex real-time PCR on whole blood samples for rapid pathogen identification in critically ill patients with sepsis.

    Science.gov (United States)

    van de Groep, Kirsten; Bos, Martine P; Savelkoul, Paul H M; Rubenjan, Anna; Gazenbeek, Christel; Melchers, Willem J G; van der Poll, Tom; Juffermans, Nicole P; Ong, David S Y; Bonten, Marc J M; Cremer, Olaf L

    2018-04-26

    Molecular tests may enable early adjustment of antimicrobial therapy and be complementary to blood culture (BC) which has imperfect sensitivity in critically ill patients. We evaluated a novel multiplex real-time PCR assay to diagnose bloodstream pathogens directly in whole blood samples (BSI-PCR). BSI-PCR included 11 species- and four genus-specific PCRs, a molecular Gram-stain PCR, and two antibiotic resistance markers. We collected 5 mL blood from critically ill patients simultaneously with clinically indicated BC. Microbial DNA was isolated using the Polaris method followed by automated DNA extraction. Sensitivity and specificity were calculated using BC as reference. BSI-PCR was evaluated in 347 BC-positive samples (representing up to 50 instances of each pathogen covered by the test) and 200 BC-negative samples. Bacterial species-specific PCR sensitivities ranged from 65 to 100%. Sensitivity was 26% for the Gram-positive PCR, 32% for the Gram-negative PCR, and ranged 0 to 7% for yeast PCRs. Yeast detection was improved to 40% in a smaller set-up. There was no overall association between BSI-PCR sensitivity and time-to-positivity of BC (which was highly variable), yet Ct-values were lower for true-positive versus false-positive PCR results. False-positive results were observed in 84 (4%) of the 2200 species-specific PCRs in 200 culture-negative samples, and ranged from 0 to 6% for generic PCRs. Sensitivity of BSI-PCR was promising for individual bacterial pathogens, but still insufficient for yeasts and generic PCRs. Further development of BSI-PCR will focus on improving sensitivity by increasing input volumes and on subsequent implementation as a bedside test.

  5. Validation of the Abbreviated Brucella AMOS PCR as a Rapid Screening Method for Differentiation of Brucella abortus Field Strain Isolates and the Vaccine Strains, 19 and RB51

    OpenAIRE

    Ewalt, Darla R.; Bricker, Betsy J.

    2000-01-01

    The Brucella AMOS PCR assay was previously developed to identify and differentiate specific Brucella species. In this study, an abbreviated Brucella AMOS PCR test was evaluated to determine its accuracy in differentiating Brucella abortus into three categories: field strains, vaccine strain 19 (S19), and vaccine strain RB51/parent strain 2308 (S2308). Two hundred thirty-one isolates were identified and tested by the conventional biochemical tests and Brucella AMOS PCR. This included 120 isola...

  6. Rapid identification of the medicinal plant Taraxacum formosanum ...

    African Journals Online (AJOL)

    Original identification of medicinal plants is essential for quality control. In this study, the internal transcribed spacer 2 (ITS2) nuclear ribosomal DNA served as a DNA barcode and was amplified by allele-specific PCR. This approach was exploited to differentiate Taraxacum formosanum from five related adulterants. Using a ...

  7. Inter- and intra-individual variation in allele-specific DNA methylation and gene expression in children conceived using assisted reproductive technology.

    Directory of Open Access Journals (Sweden)

    Nahid Turan

    2010-07-01

    Full Text Available Epidemiological studies have reported a higher incidence of rare disorders involving imprinted genes among children conceived using assisted reproductive technology (ART, suggesting that ART procedures may be disruptive to imprinted gene methylation patterns. We examined intra- and inter-individual variation in DNA methylation at the differentially methylated regions (DMRs of the IGF2/H19 and IGF2R loci in a population of children conceived in vitro or in vivo. We found substantial variation in allele-specific methylation at both loci in both groups. Aberrant methylation of the maternal IGF2/H19 DMR was more common in the in vitro group, and the overall variance was also significantly greater in the in vitro group. We estimated the number of trophoblast stem cells in each group based on approximation of the variance of the binomial distribution of IGF2/H19 methylation ratios, as well as the distribution of X chromosome inactivation scores in placenta. Both of these independent measures indicated that placentas of the in vitro group were derived from fewer stem cells than the in vivo conceived group. Both IGF2 and H19 mRNAs were significantly lower in placenta from the in vitro group. Although average birth weight was lower in the in vitro group, we found no correlation between birth weight and IGF2 or IGF2R transcript levels or the ratio of IGF2/IGF2R transcript levels. Our results show that in vitro conception is associated with aberrant methylation patterns at the IGF2/H19 locus. However, very little of the inter- or intra-individual variation in H19 or IGF2 mRNA levels can be explained by differences in maternal DMR DNA methylation, in contrast to the expectations of current transcriptional imprinting models. Extraembryonic tissues of embryos cultured in vitro appear to be derived from fewer trophoblast stem cells. It is possible that this developmental difference has an effect on placental and fetal growth.

  8. Validation of the Pockit Dengue Virus Reagent Set for Rapid Detection of Dengue Virus in Human Serum on a Field-Deployable PCR System.

    Science.gov (United States)

    Tsai, Jih-Jin; Liu, Li-Teh; Lin, Ping-Chang; Tsai, Ching-Yi; Chou, Pin-Hsing; Tsai, Yun-Long; Chang, Hsiao-Fen Grace; Lee, Pei-Yu Alison

    2018-05-01

    Dengue virus (DENV) infection, a mosquito-borne disease, is a major public health problem in tropical countries. Point-of-care DENV detection with good sensitivity and specificity enables timely early diagnosis of DENV infection, facilitating effective disease management and control, particularly in regions of low resources. The Pockit dengue virus reagent set (GeneReach Biotech), a reverse transcription insulated isothermal PCR (RT-iiPCR), is available to detect all four serotypes of DENV on the field-deployable Pockit system, which is ready for on-site applications. In this study, analytical and clinical performances of the assay were evaluated. The index assay did not react with 14 non-DENV human viruses, indicating good specificity. Compared to the U.S. CDC DENV-1-4 real-time quantitative RT-PCR (qRT-PCR) assay, testing with serial dilutions of virus-spiked human sera demonstrated that the index assay had detection endpoints that were separately comparable with the 4 serotypes. Excellent reproducibility was observed among repeat tests done by six operators at three sites. In clinical performance, 195 clinical sera collected around Kaohsiung city in 2012 and 21 DENV-4-spiked sera were tested with the RT-iiPCR and qRT-PCR assays in parallel. The 121 (11 DENV-1, 78 DENV-2, 11 DENV-3, and 21 DENV-4) qRT-PCR-positive and 95 qRT-PCR-negative samples were all positive and negative by the RT-iiPCR reagent results, respectively, demonstrating high (100%) interrater agreement (95% confidence interval [CI 95% ], ∼98.81% to 100%; κ = 1). With analytical and clinical performance equivalent to those of the reference qRT-PCR assay, the index PCR assay on the field-deployable system can serve as a highly sensitive and specific on-site tool for DENV detection. Copyright © 2018 American Society for Microbiology.

  9. Polymeric LabChip real-time PCR as a point-of-care-potential diagnostic tool for rapid detection of influenza A/H1N1 virus in human clinical specimens.

    Directory of Open Access Journals (Sweden)

    Hyun-Ok Song

    Full Text Available It is clinically important to be able to detect influenza A/H1N1 virus using a fast, portable, and accurate system that has high specificity and sensitivity. To achieve this goal, it is necessary to develop a highly specific primer set that recognizes only influenza A viral genes and a rapid real-time PCR system that can detect even a single copy of the viral gene. In this study, we developed and validated a novel fluidic chip-type real-time PCR (LabChip real-time PCR system that is sensitive and specific for the detection of influenza A/H1N1, including the pandemic influenza strain A/H1N1 of 2009. This LabChip real-time PCR system has several remarkable features: (1 It allows rapid quantitative analysis, requiring only 15 min to perform 30 cycles of real-time PCR. (2 It is portable, with a weight of only 5.5 kg. (3 The reaction cost is low, since it uses disposable plastic chips. (4 Its high efficiency is equivalent to that of commercially available tube-type real-time PCR systems. The developed disposable LabChip is an economic, heat-transferable, light-transparent, and easy-to-fabricate polymeric chip compared to conventional silicon- or glass-based labchip. In addition, our LabChip has large surface-to-volume ratios in micro channels that are required for overcoming time consumed for temperature control during real-time PCR. The efficiency of the LabChip real-time PCR system was confirmed using novel primer sets specifically targeted to the hemagglutinin (HA gene of influenza A/H1N1 and clinical specimens. Eighty-five human clinical swab samples were tested using the LabChip real-time PCR. The results demonstrated 100% sensitivity and specificity, showing 72 positive and 13 negative cases. These results were identical to those from a tube-type real-time PCR system. This indicates that the novel LabChip real-time PCR may be an ultra-fast, quantitative, point-of-care-potential diagnostic tool for influenza A/H1N1 with a high sensitivity and

  10. Evaluation of repetitive-PCR and matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS for rapid strain typing of Bacillus coagulans.

    Directory of Open Access Journals (Sweden)

    Jun Sato

    Full Text Available In order to establish rapid and accurate typing method for Bacillus coagulans strains which is important for controlling in some canned foods and tea-based beverages manufacturing because of the high-heat resistance of the spores and high tolerance of the vegetative cells to catechins and chemicals, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS and repetitive-PCR (rep-PCR were evaluated. For this purpose, 28 strains of B. coagulans obtained from various culture collections were tested. DNA sequence analyses of the genes encoding 16S rRNA and DNA gyrase classified the test strains into two and three groups, respectively, regardless of their phenotypes. Both MALDI-TOF MS and rep-PCR methods classified the test strains in great detail. Strains classified in each group showed similar phenotypes, such as carbohydrate utilization determined using API 50CH. In particular, the respective two pairs of strains which showed the same metabolic characteristic were classified into the same group by both MALDI-TOF MS and rep-PCR methods separating from the other strains. On the other hand, the other strains which have the different profiles of carbohydrate utilization were separated into different groups by these methods. These results suggested that the combination of MALDI-TOF MS and rep-PCR analyses was advantageous for the rapid and detailed typing of bacterial strains in respect to both phenotype and genotype.

  11. Evaluation of repetitive-PCR and matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) for rapid strain typing of Bacillus coagulans.

    Science.gov (United States)

    Sato, Jun; Nakayama, Motokazu; Tomita, Ayumi; Sonoda, Takumi; Hasumi, Motomitsu; Miyamoto, Takahisa

    2017-01-01

    In order to establish rapid and accurate typing method for Bacillus coagulans strains which is important for controlling in some canned foods and tea-based beverages manufacturing because of the high-heat resistance of the spores and high tolerance of the vegetative cells to catechins and chemicals, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) and repetitive-PCR (rep-PCR) were evaluated. For this purpose, 28 strains of B. coagulans obtained from various culture collections were tested. DNA sequence analyses of the genes encoding 16S rRNA and DNA gyrase classified the test strains into two and three groups, respectively, regardless of their phenotypes. Both MALDI-TOF MS and rep-PCR methods classified the test strains in great detail. Strains classified in each group showed similar phenotypes, such as carbohydrate utilization determined using API 50CH. In particular, the respective two pairs of strains which showed the same metabolic characteristic were classified into the same group by both MALDI-TOF MS and rep-PCR methods separating from the other strains. On the other hand, the other strains which have the different profiles of carbohydrate utilization were separated into different groups by these methods. These results suggested that the combination of MALDI-TOF MS and rep-PCR analyses was advantageous for the rapid and detailed typing of bacterial strains in respect to both phenotype and genotype.

  12. Real-time PCR assay using fine-needle aspirates and tissue biopsy specimens for rapid diagnosis of mycobacterial lymphadenitis in children

    NARCIS (Netherlands)

    Bruijnesteijn van Coppenraet, E. S.; Lindeboom, J. A.; Prins, J. M.; Peeters, M. F.; Claas, E. C. J.; Kuijper, E. J.

    2004-01-01

    A real-time PCR assay was developed to diagnose and identify the causative agents of suspected mycobacterial lymphadenitis. Primers and probes for the real-time PCR were designed on the basis of the internal transcribed spacer sequence, enabling the recognition of the genus Mycobacterium and the

  13. A Lab on a chip device for rapid identification of Avian Influenza virus by on-chip sample preparation and solid phase PCR

    DEFF Research Database (Denmark)

    Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

    2009-01-01

    In this paper, we describe a novel lab-on-a-chip device for fast AIV screening by integrating DNA microarray-based solid phase PCR on microchip. The device can handle viral samples in an automatic way. Moreover, multiplex PCR and sequence detection are done in one-step, which greatly simplifies...

  14. Rapid detection of pathological mutations and deletions of the haemoglobin beta gene (HBB) by High Resolution Melting (HRM) analysis and Gene Ratio Analysis Copy Enumeration PCR (GRACE-PCR).

    Science.gov (United States)

    Turner, Andrew; Sasse, Jurgen; Varadi, Aniko

    2016-10-19

    Inherited disorders of haemoglobin are the world's most common genetic diseases, resulting in significant morbidity and mortality. The large number of mutations associated with the haemoglobin beta gene (HBB) makes gene scanning by High Resolution Melting (HRM) PCR an attractive diagnostic approach. However, existing HRM-PCR assays are not able to detect all common point mutations and have only a very limited ability to detect larger gene rearrangements. The aim of the current study was to develop a HBB assay, which can be used as a screening test in highly heterogeneous populations, for detection of both point mutations and larger gene rearrangements. The assay is based on a combination of conventional HRM-PCR and a novel Gene Ratio Analysis Copy Enumeration (GRACE) PCR method. HRM-PCR was extensively optimised, which included the use of an unlabelled probe and incorporation of universal bases into primers to prevent interference from common non-pathological polymorphisms. GRACE-PCR was employed to determine HBB gene copy numbers relative to a reference gene using melt curve analysis to detect rearrangements in the HBB gene. The performance of the assay was evaluated by analysing 410 samples. A total of 44 distinct pathological genotypes were detected. In comparison with reference methods, the assay has a sensitivity of 100 % and a specificity of 98 %. We have developed an assay that detects both point mutations and larger rearrangements of the HBB gene. This assay is quick, sensitive, specific and cost effective making it suitable as an initial screening test that can be used for highly heterogeneous cohorts.

  15. Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

    Science.gov (United States)

    Kim, S A; Park, S H; Lee, S I; Ricke, S C

    2017-12-01

    The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

  16. Rapid PCR-mediated synthesis of competitor molecules for accurate quantification of beta(2) GABA(A) receptor subunit mRNA.

    Science.gov (United States)

    Vela, J; Vitorica, J; Ruano, D

    2001-12-01

    We describe a fast and easy method for the synthesis of competitor molecules based on non-specific conditions of PCR. RT-competitive PCR is a sensitive technique that allows quantification of very low quantities of mRNA molecules in small tissue samples. This technique is based on the competition established between the native and standard templates for nucleotides, primers or other factors during PCR. Thus, the most critical parameter is the use of good internal standards to generate a standard curve from which the amount of native sequences can be properly estimated. At the present time different types of internal standards and methods for their synthesis have been described. Normally, most of these methods are time-consuming and require the use of different sets of primers, different rounds of PCR or specific modifications, such as site-directed mutagenesis, that need subsequent analysis of the PCR products. Using our method, we obtained in a single round of PCR and with the same primer pair, competitor molecules that were successfully used in RT-competitive PCR experiments. The principal advantage of this method is high versatility and economy. Theoretically it is possible to synthesize a specific competitor molecule for each primer pair used. Finally, using this method we have been able to quantify the increase in the expression of the beta(2) GABA(A) receptor subunit mRNA that occurs during rat hippocampus development.

  17. Rapid and Quantitative Detection of Leifsonia xyli subsp. xyli in Sugarcane Stalk Juice Using a Real-Time Fluorescent (TaqMan PCR Assay

    Directory of Open Access Journals (Sweden)

    Hua-Ying Fu

    2016-01-01

    Full Text Available Ratoon stunting disease (RSD of sugarcane, one of the most important diseases seriously affecting the productivity of sugarcane crops, was caused by the bacterial agent Leifsonia xyli subsp. xyli (Lxx. A TaqMan probe-based real-time quantitative polymerase chain reaction (qPCR assay was established in this study for the quantification of Lxx detection in sugarcane stalk juice. A pair of PCR primers (Pat1-QF/Pat1-QR and a fluorogenic probe (Pat1-QP targeting the Part1 gene of Lxx were used for the qPCR assay. The assay had a detection limit of 100 copies of plasmid DNA and 100 fg of Lxx genomic DNA, which was 100-fold more sensitive than the conventional PCR. Fifty (28.7% of 174 stalk juice samples from two field trials were tested to be positive by qPCR assay, whereas, by conventional PCR, only 12.1% (21/174 were tested to be positive with a published primer pair CxxITSf#5/CxxITSr#5 and 15.5% (27/174 were tested to be positive with a newly designed primer pair Pat1-F2/Pat1-R2. The new qPCR assay can be used as an alternative to current diagnostic methods for Lxx, especially when dealing with certificating a large number of healthy cane seedlings and determining disease incidence accurately in commercial fields.

  18. Single tube genotyping of sickle cell anaemia using PCR-based SNP analysis.

    Science.gov (United States)

    Waterfall, C M; Cobb, B D

    2001-12-01

    Allele-specific amplification (ASA) is a generally applicable technique for the detection of known single nucleotide polymorphisms (SNPs), deletions, insertions and other sequence variations. Conventionally, two reactions are required to determine the zygosity of DNA in a two-allele system, along with significant upstream optimisation to define the specific test conditions. Here, we combine single tube bi-directional ASA with a 'matrix-based' optimisation strategy, speeding up the whole process in a reduced reaction set. We use sickle cell anaemia as our model SNP system, a genetic disease that is currently screened using ASA methods. Discriminatory conditions were rapidly optimised enabling the unambiguous identification of DNA from homozygous sickle cell patients (HbS/S), heterozygous carriers (HbA/S) or normal DNA in a single tube. Simple downstream mathematical analyses based on product yield across the optimisation set allow an insight into the important aspects of priming competition and component interactions in this competitive PCR. This strategy can be applied to any polymorphism, defining specific conditions using a multifactorial approach. The inherent simplicity and low cost of this PCR-based method validates bi-directional ASA as an effective tool in future clinical screening and pharmacogenomic research where more expensive fluorescence-based approaches may not be desirable.

  19. Cross-platform evaluation of commercial real-time SYBR green RT-PCR kits for sensitive and rapid detection of European bat Lyssavirus type 1.

    Science.gov (United States)

    Picard-Meyer, Evelyne; Peytavin de Garam, Carine; Schereffer, Jean Luc; Marchal, Clotilde; Robardet, Emmanuelle; Cliquet, Florence

    2015-01-01

    This study evaluates the performance of five two-step SYBR Green RT-qPCR kits and five one-step SYBR Green qRT-PCR kits using real-time PCR assays. Two real-time thermocyclers showing different throughput capacities were used. The analysed performance evaluation criteria included the generation of standard curve, reaction efficiency, analytical sensitivity, intra- and interassay repeatability as well as the costs and the practicability of kits, and thermocycling times. We found that the optimised one-step PCR assays had a higher detection sensitivity than the optimised two-step assays regardless of the machine used, while no difference was detected in reaction efficiency, R (2) values, and intra- and interreproducibility between the two methods. The limit of detection at the 95% confidence level varied between 15 to 981 copies/µL and 41 to 171 for one-step kits and two-step kits, respectively. Of the ten kits tested, the most efficient kit was the Quantitect SYBR Green qRT-PCR with a limit of detection at 95% of confidence of 20 and 22 copies/µL on the thermocyclers Rotor gene Q MDx and MX3005P, respectively. The study demonstrated the pivotal influence of the thermocycler on PCR performance for the detection of rabies RNA, as well as that of the master mixes.

  20. Cross-Platform Evaluation of Commercial Real-Time SYBR Green RT-PCR Kits for Sensitive and Rapid Detection of European Bat Lyssavirus Type 1

    Directory of Open Access Journals (Sweden)

    Evelyne Picard-Meyer

    2015-01-01

    Full Text Available This study evaluates the performance of five two-step SYBR Green RT-qPCR kits and five one-step SYBR Green qRT-PCR kits using real-time PCR assays. Two real-time thermocyclers showing different throughput capacities were used. The analysed performance evaluation criteria included the generation of standard curve, reaction efficiency, analytical sensitivity, intra- and interassay repeatability as well as the costs and the practicability of kits, and thermocycling times. We found that the optimised one-step PCR assays had a higher detection sensitivity than the optimised two-step assays regardless of the machine used, while no difference was detected in reaction efficiency, R2 values, and intra- and interreproducibility between the two methods. The limit of detection at the 95% confidence level varied between 15 to 981 copies/µL and 41 to 171 for one-step kits and two-step kits, respectively. Of the ten kits tested, the most efficient kit was the Quantitect SYBR Green qRT-PCR with a limit of detection at 95% of confidence of 20 and 22 copies/µL on the thermocyclers Rotor gene Q MDx and MX3005P, respectively. The study demonstrated the pivotal influence of the thermocycler on PCR performance for the detection of rabies RNA, as well as that of the master mixes.

  1. Development of single-step multiplex real-time RT-PCR assays for rapid diagnosis of enterovirus 71, coxsackievirus A6, and A16 in patients with hand, foot, and mouth disease.

    Science.gov (United States)

    Puenpa, Jiratchaya; Suwannakarn, Kamol; Chansaenroj, Jira; Vongpunsawad, Sompong; Poovorawan, Yong

    2017-10-01

    Real-time reverse-transcription polymerase chain reaction (rRT-PCR) to detect enterovirus 71 (EV-A71) and coxsackievirus A16 (CV-A16) has facilitated the rapid and accurate identification of the two most common etiological agents underlying hand, foot, and mouth disease (HFMD). However, the worldwide emergence of CV-A6 infection in HFMD necessitates development of an improved multiplex rRT-PCR method. To rapidly determine the etiology of HFMD, two rRT-PCR assays using TaqMan probes were developed to differentiate among three selected common enteroviruses (EV-A71, CV-A16 and CV-A6) and to enable broad detection of enteroviruses (pan-enterovirus assay). No cross-reactions were observed with other RNA viruses examined. The detection limits of both assays were 10 copies per microliter for EV-A71, CV-A6 and CV-A16, and pan-enterovirus. The methods showed high accuracy (EV-A71, 90.6%; CV-A6, 92.0%; CV-A16, 100%), sensitivity (EV-A71, 96.5%; CV-A6, 95.8%; CV-A16, 99.0%), and specificity (EV-A71, 100%; CV-A6, 99.9%; CV-A16, 99.9%) in testing clinical specimens (n=1049) during 2014-2016, superior to those of conventional RT-PCR. Overall, the multiplex rRT-PCR assays enabled highly sensitive detection and rapid simultaneous typing of EV-A71, CV-A6 and CV-A16, and enteroviruses, rendering them feasible and attractive methods for large-scale surveillance of enteroviruses associated with HFMD outbreaks. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Rapid Identification and Quantification of Aureococcus anophagefferens by qPCR Method (Taqman) in the Qinhuangdao Coastal Area: A Region for Recurrent Brown Tide Breakout in China.

    Science.gov (United States)

    Wang, Li-Ping; Lei, Kun

    2016-12-01

    Since 2009, Aureococcus anophagefferens has caused brown tide to occur recurrently in Qinhuangdao coastal area, China. Because the algal cells of A. anophagefferens are so tiny (~3 µm) that it is very hard to identify exactly under a microscope for natural water samples, it is very urgent to develop a method for efficient and continuous monitoring. Here specific primers and Taqman probe are designed to develop a real-time quantitative PCR (qPCR) method for identification and quantification continually. The algal community and cell abundance of A. anophagefferens in the study area (E 119°20'-119°50' and N 39°30'-39°50') from April to October in 2013 are detected by pyrosequencing, and are used to validate the specification and precision of qPCR method for natural samples. Both pyrosequencing and qPCR shows that the targeted cells are present only in May, June and July, and the cell abundance are July > June > May. Although there are various algal species including dinoflagellata, diatom, Cryptomonadales, Chrysophyceae and Chlorophyta living in the natural seawater simultaneously, no disturbance happens to qPCR method. This qPCR method could detect as few as 10 targeted cells, indicating it is able to detect the algal cells at pre-bloom levels. Therefore, qPCR with Taqman probe provides a powerful and sensitive method to monitor the brown tide continually in Qinhuangdao coastal area, China. The results provide a necessary technology support for forecasting the brown tide initiation, in China.

  3. Development of a Rapid Real-Time PCR Method as a Tool To Quantify Viable Photobacterium phosphoreum Bacteria in Salmon (Salmo salar) Steaks

    DEFF Research Database (Denmark)

    Macé, Sabrina; Mamlouk, Kelthoum; Chipchakova, Stoyka

    2013-01-01

    A specific real-time PCR quantification method combined with a propidium monoazide sample treatment step was developed to determine quantitatively the viable population of the Photobacterium phosphoreum species group in raw modified-atmosphere-packed salmon. Primers were designed to amplify a 350......-bp fragment of the gyrase subunit B gene (gyrB) of P. phosphoreum. The specificity of the two primers was demonstrated by using purified DNA from 81 strains of 52 different bacterial species. When these primers were used for real-time PCR in pure culture, a good correlation (R2 of 0.99) was obtained...... between this method and conventional enumeration on marine agar (MA). Quantification was linear over 5 log units as confirmed by using inoculated salmon samples. On naturally contaminated fresh salmon, the new real-time PCR method performed successfully with a quantification limit of 3 log CFU...

  4. Rapid and Accurate Detection of Bacteriophage Activity against Escherichia coli O157:H7 by Propidium Monoazide Real-Time PCR

    Directory of Open Access Journals (Sweden)

    Hui Liu

    2014-01-01

    Full Text Available Conventional methods to determine the efficacy of bacteriophage (phage for biocontrol of E. coli require several days, due to the need to culture bacteria. Furthermore, cell surface-attached phage particles may lyse bacterial cells during experiments, leading to an overestimation of phage activity. DNA-based real-time quantitative polymerase chain reaction (qPCR is a fast, sensitive, and highly specific means of enumerating pathogens. However, qPCR may underestimate phage activity due to its inability to distinguish viable from nonviable cells. In this study, we evaluated the suitability of propidium monoazide (PMA, a microbial membrane-impermeable dye that inhibits amplification of extracellular DNA and DNA within dead or membrane-compromised cells as a means of using qPCR to identify only intact E. coli cells that survive phage exposure. Escherichia coli O157:H7 strain R508N and 4 phages (T5-like, T1-like, T4-like, and O1-like were studied. Results compared PMA-qPCR and direct plating and confirmed that PMA could successfully inhibit amplification of DNA from compromised/damaged cells E. coli O157:H7. Compared to PMA-qPCR, direct plating overestimated (P < 0.01 phage efficacy as cell surface-attached phage particles lysed E. coli O157:H7 during the plating process. Treatment of samples with PMA in combination with qPCR can therefore be considered beneficial when assessing the efficacy of bacteriophage for biocontrol of E. coli O157:H7.

  5. Rapid, sensitive, type specific PCR detection of the E7 region of human papillomavirus type 16 and 18 from paraffin embedded sections of cervical carcinoma

    DEFF Research Database (Denmark)

    Lesnikova, Iana; Lidang, Marianne; Hamilton-Dutoit, Stephen Jacques

    2010-01-01

    ABSTRACT: Human papillomavirus (HPV) infection, and in particularly infection with HPVs 16 and 18 is a central carcinogenic factor in the uterine cervix. We established and optimized a PCR assay for the detection and discrimination of HPV types 16 and 18 in archival formaldehyde fixed and paraffin...... embedded (FFPE) sections of cervical cancer. Tissue blocks from 35 cases of in situ or invasive cervical squamouscell carcinoma and surrogate FFPE sections containing the cell lines HeLa and SiHa were tested for HPV 16 and HPV18 and for the housekeeping gene beta-actin by conventional PCR using type...

  6. Rapid, sensitive, type specific PCR detection of the E7 region of human papillomavirus type 16 and 18 from paraffin embedded sections of cervical carcinoma

    DEFF Research Database (Denmark)

    Lesnikova, Iana; Lidang, Marianne; Hamilton-Dutoit, Steven

    2010-01-01

    ABSTRACT: Human papillomavirus (HPV) infection, and in particularly infection with HPVs 16 and 18, is a central carcinogenic factor in the uterine cervix. We established and optimized a PCR assay for the detection and discrimination of HPV types 16 and 18 in archival formaldehyde fixed and paraffin...... embedded (FFPE) sections of cervical cancer.Tissue blocks from 35 cases of in situ or invasive cervical squamous cell carcinoma and surrogate FFPE sections containing the cell lines HeLa and SiHa were tested for HPV 16 and HPV18 by conventional PCR using type specific primers, and for the housekeeping gene...

  7. Rapid detection of Salmonella in meat: Comparative and collaborative validation of a non-complex and cost effective pre-PCR protocol

    DEFF Research Database (Denmark)

    Löfström, Charlotta; Hansen, F.; Mansdal, S.

    2011-01-01

    samples using a real-time PCR method. The protocol included incubation in buffered peptone water, centrifugation of an aliquot and a boiling procedure. The validation study included comparative and collaborative trials recommended by the Nordic Organization for Validation of Alternative Methods (NordVal......). The comparative trial was performed against a culture based reference method (NMKL187, 2007) and a previously NordVal approved PCR method with a semi-automated magnetic bead-based DNA extraction step using 122 artificially contaminated samples. The limit of detection (LOD50) was found to be 3.0, 3.2 and 3.4 CFU...

  8. PCR Assay Based on the gyrB Gene for Rapid Identification of Acinetobacter baumannii-calcoaceticus Complex at Specie Level.

    Science.gov (United States)

    Teixeira, Aline B; Barin, Juliana; Hermes, Djuli M; Barth, Afonso L; Martins, Andreza F

    2017-05-01

    The genus Acinetobacter sp. comprises more than 50 species, and four are closely related and difficult to be distinguished by either phenotypic or genotypic methods: the Acinetobacter calcoaceticus-baumannii complex (ABC). The correct identification at species level is necessary mainly due to the epidemiological aspects. We evaluated a multiplex PCR for gyrB gene to identify the species of the ABC using the sequencing of the ITS 16S-23S fragment as a gold standard. Isolates identified as Acinetobacter calcoaceticus-baumannii from three hospitals at southern Brazil in 2011 were included in this study. A total of 117 isolates were obtained and 106 (90.6%) were confirmed as A. baumannii, 6 (5.1%) as A. nosocomialis and 4 (3.4%) as A. pittii by PCR for gyrB gene. Only one isolate did not present a product of the PCR for the gyrB gene; this isolate was identified as Acinetobacter genospecie 10 by sequencing of ITS. We also noted that the non-A. baumannii isolates were recovered from respiratory tract (8/72.7%), blood (2/18.2%) and urine (1/9.1%), suggesting that these species can cause serious infection. These findings evidenced that the multiplex PCR of the gyrB is a feasible and simple method to identify isolates of the ABC at the species level. © 2016 Wiley Periodicals, Inc.

  9. Tick-borne encephalitis virus-specific RT-PCR - a rapid test for detection of the pathogen without viral RNA purification

    Czech Academy of Sciences Publication Activity Database

    Rudenko, Natalia; Golovchenko, Maryna; Cihlářová, Věra; Grubhoffer, Libor

    2004-01-01

    Roč. 48, č. 3 (2004), s. 167-171 ISSN 0001-723X R&D Projects: GA ČR GA524/03/1326 Institutional research plan: CEZ:AV0Z6022909 Keywords : Ixodes ricinus * tick-borne encephalitis virus * RT-PCR Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 0.605, year: 2004

  10. Development of a taqman-based real-time PCR assay for the rapid and specific detection of novel duck- origin goose parvovirus.

    Science.gov (United States)

    Wang, Jianchang; Wang, Jinfeng; Cui, Yuan; Nan, Huizhu; Yuan, Wanzhe

    2017-08-01

    A real-time PCR assay was developed for specific detection of novel duck-origin goose parvovirus (N-GPV), the etiological agent of duck beak atrophy and dwarfism syndrome (BADS). The detection limit of the assay was 10 2 copies. The assay was useful in the prevention and control of BADS. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Rapid detection of coliforms in drinking water of Arak city using multiplex PCR method in comparison with the standard method of culture (Most Probably Number

    Directory of Open Access Journals (Sweden)

    Dehghan fatemeh

    2014-05-01

    Conclusions: Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN.

  12. A highly sensitive, multiplex broad-spectrum PCR-DNA-enzyme immunoassay and reverse hybridization assay for rapid detection and identification of Chlamydia trachomatis serovars.

    NARCIS (Netherlands)

    Quint, K.D.; Doorn, L.J. van; Kleter, B.; Koning, M.N. de; Munckhof, H.A. van den; Morre, S.A.; Harmsel, B. ter; Weiderpass, E.; Harbers, G.; Melchers, W.J.G.; Quint, W.G.V.

    2007-01-01

    Chlamydia trachomatis (Ct) comprises distinct serogroups and serovars. The present study evaluates a novel Ct amplification, detection, and genotyping method (Ct-DT assay). The Ct-DT amplification step is a multiplex broad-spectrum PCR for the cryptic plasmid and the VD2-region of ompl. The Ct-DT

  13. High-resolution melt PCR analysis for rapid identification of Chlamydia abortus live vaccine strain 1B among C. abortus strains and field isolates.

    Science.gov (United States)

    Vorimore, Fabien; Cavanna, Noémie; Vicari, Nadia; Magnino, Simone; Willems, Hermann; Rodolakis, Annie; Siarkou, Victoria I; Laroucau, Karine

    2012-09-01

    We describe a novel high-resolution melt assay that clearly differentiates Chlamydia abortus live vaccine strain 1B from field C. abortus strains and field wild-type isolates based on previously described single nucleotide polymorphisms. This modern genotyping technique is inexpensive, easy to use, and less time-consuming than PCR-RFLP. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. A rapid silica spin column-based method of RNA extraction from fruit trees for RT-PCR detection of viruses.

    Science.gov (United States)

    Yang, Fan; Wang, Guoping; Xu, Wenxing; Hong, Ni

    2017-09-01

    Efficient recovery of high quality RNA is very important for successful RT-PCR detection of plant RNA viruses. High levels of polyphenols and polysaccharides in plant tissues can irreversibly bind to and/or co-precipitate with RNA, which influences RNA isolation. In this study, a silica spin column-based RNA isolation method was developed by using commercially available silica columns combined with the application of a tissue lysis solution, and binding and washing buffers with high concentration guanidinium thiocyanate (GuSCN, 50% w/v), which helps remove plant proteins, polysaccharides and polyphenolic compounds. The method was successfully used to extract high quality RNA from citrus (Citrus aurantifolia), grapevine (Vitis vinifera), peach (Prunus persica), pear (Pyrus spp.), taro (Colocosia esculenta) and tobacco (Nicotiana benthamiana) samples. The method was comparable to conventional CTAB method in RNA isolation efficiency, but it was more sample-adaptable and cost-effective than commercial kits. High quality RNA isolated using silica spin column-based method was successfully used for the RT-PCR and/or multiplex RT-PCR amplification of woody fruit tree viruses and a viroid. The study provided a useful tool for the detection and characterization of plant viruses. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

    Science.gov (United States)

    Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

    2004-10-15

    This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

  16. Sixty-five radiation hybrids for the short arm of human chromosome 6: their value as a mapping panel and as a source for rapid isolation of new probes using repeat element-mediated PCR

    International Nuclear Information System (INIS)

    Zoghbi, H.Y.; McCall, A.E.; LeBorgne-Demarquoy, F.

    1991-01-01

    We have used an irradiation and fusion procedure to generate somatic cell hybrids that retain fragments of the short arm of human chromosome 6 (6p). To identify hybrids retaining human material, we performed repeat element-mediated PCR on crude lysates of cells from individual clones. Sixty-five hybrids were shown to contain human material and fifty of those contained one or more 6p-specific probes. Detailed characterization of these hybrids identified a subset that divides 6p into ten mapping intervals. Using repeat element-mediated PCR, we were able to isolate and map 61 new DNA fragments from specific regions of 6p. Fifteen of these fragments were used to screen for restriction fragment length polymorphisms (RFLPs), and nine identified RFLPs with one or more enzymes. The radiation hybrids described in this study provide a valuable resource for high-resolution mapping of 6p and for the rapid isolation of region-specific markers

  17. Lipoprotein(a) and HIV: Allele-Specific Apolipoprotein(a) Levels Predict Carotid Intima-Media Thickness in HIV-Infected Young Women in the Women's Interagency HIV Study.

    Science.gov (United States)

    Enkhmaa, Byambaa; Anuurad, Erdembileg; Zhang, Wei; Li, Chin-Shang; Kaplan, Robert; Lazar, Jason; Merenstein, Dan; Karim, Roksana; Aouizerat, Brad; Cohen, Mardge; Butler, Kenneth; Pahwa, Savita; Ofotokun, Igho; Adimora, Adaora A; Golub, Elizabeth; Berglund, Lars

    2017-05-01

    In the general population, lipoprotein(a) [Lp(a)] has been established as an independent causal risk factor for cardiovascular disease. Lp(a) levels are to a major extent regulated by a size polymorphism in the apolipoprotein(a) [apo(a)] gene. The roles of Lp(a)/apo(a) in human immunodeficiency virus (HIV)-related elevated cardiovascular disease risk remain unclear. The associations between total plasma Lp(a) level, allele-specific apo(a) level, an Lp(a) level carried by individual apo(a) alleles, and common carotid artery intima-media thickness were assessed in 150 HIV-infected and 100 HIV-uninfected women in the WIHS (Women's Interagency HIV Study). Linear regression analyses with and without adjustments were used. The cohort was young (mean age, ≈31 years), with the majority being Blacks (≈70%). The prevalence of a small size apo(a) (≤22 Kringle repeats) or a high Lp(a) level (≥30 mg/dL) was similar by HIV status. Total plasma Lp(a) level ( P =0.029) and allele-specific apo(a) level carried by the smaller apo(a) sizes ( P =0.022) were significantly associated with carotid artery intima-media thickness in the HIV-infected women only. After accounting for confounders (age, race, smoking, body mass index, blood pressure, hepatitis C virus coinfection, menopause, plasma lipids, treatment status, CD4 + T cell count, and HIV/RNA viral load), the association remained significant for both Lp(a) ( P =0.035) and allele-specific apo(a) level carried by the smaller apo(a) sizes ( P =0.010) in the HIV-infected women. Notably, none of the other lipids/lipoproteins was associated with carotid artery intima-media thickness. Lp(a) and allele-specific apo(a) levels predict carotid artery intima-media thickness in HIV-infected young women. Further research is needed to identify underlying mechanisms of an increased Lp(a) atherogenicity in HIV infection. © 2017 American Heart Association, Inc.

  18. Rapid Quantification of Viable Campylobacter Bacteria on Chicken Carcasses, Using Real-Time PCR and Propidium Monoazide Treatment, as a Tool for Quantitative Risk Assessment

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann; Löfström, Charlotta; Hansen, Tina Beck

    2010-01-01

    A number of intervention strategies against Campylobacter contaminated poultry focus on post-slaughter reduction of the number of cells, emphasizing the need for rapid and reliable quantitative detection of only viable Campylobacter. We present a new and rapid quantitative approach for enumeration...... method does not detect DNA from dead Campylobacter, but recognises the infectious potential of the VBNC state, and is thereby able to assess the effect of control strategies, and provide trustworthy data for risk assessment....

  19. Temperature Switch PCR (TSP: Robust assay design for reliable amplification and genotyping of SNPs

    Directory of Open Access Journals (Sweden)

    Mather Diane E

    2009-12-01

    Full Text Available Abstract Background Many research and diagnostic applications rely upon the assay of individual single nucleotide polymorphisms (SNPs. Thus, methods to improve the speed and efficiency for single-marker SNP genotyping are highly desirable. Here, we describe the method of temperature-switch PCR (TSP, a biphasic four-primer PCR system with a universal primer design that permits amplification of the target locus in the first phase of thermal cycling before switching to the detection of the alleles. TSP can simplify assay design for a range of commonly used single-marker SNP genotyping methods, and reduce the requirement for individual assay optimization and operator expertise in the deployment of SNP assays. Results We demonstrate the utility of TSP for the rapid construction of robust and convenient endpoint SNP genotyping assays based on allele-specific PCR and high resolution melt analysis by generating a total of 11,232 data points. The TSP assays were performed under standardised reaction conditions, requiring minimal optimization of individual assays. High genotyping accuracy was verified by 100% concordance of TSP genotypes in a blinded study with an independent genotyping method. Conclusion Theoretically, TSP can be directly incorporated into the design of assays for most current single-marker SNP genotyping methods. TSP provides several technological advances for single-marker SNP genotyping including simplified assay design and development, increased assay specificity and genotyping accuracy, and opportunities for assay automation. By reducing the requirement for operator expertise, TSP provides opportunities to deploy a wider range of single-marker SNP genotyping methods in the laboratory. TSP has broad applications and can be deployed in any animal and plant species.

  20. Direct Quantification of Campylobacter jejuni in Chicken Fecal Samples Using Real-Time PCR: Evaluation of Six Rapid DNA Extraction Methods

    DEFF Research Database (Denmark)

    Garcia Clavero, Ana Belén; Kamara, Judy N.; Vigre, Håkan

    2013-01-01

    of this study, the Easy-DNA (Invitrogen) method generated lower Ct values, the best amplification efficiency (AE = 93.2 %) and good precision (R squared = 0.996). The method NucleoSpin® Tissue was able to detect samples spiked with the lowest Campylobacter concentration level (10 CFU/ml) but the amplification...... efficiency was not optimal (AE = 139.5 %). DNA extraction methods Easy-DNA Invitrogen, MiniMAG® and NucleoSpin® Tissue produced good real-time PCR reproducibility generating standard deviations from 0.3 to 0.8 between replicates....

  1. Clinical applicability and prognostic significance of molecular response assessed by fluorescent-PCR of immunoglobulin genes in multiple myeloma. Results from a GEM/PETHEMA study.

    Science.gov (United States)

    Martinez-Lopez, Joaquin; Fernández-Redondo, Elena; García-Sánz, Ramón; Montalbán, María Angeles; Martínez-Sánchez, Pilar; Pavia, Bruno; Mateos, María Victoria; Rosiñol, Laura; Martín, Marisa; Ayala, Rosa; Martínez, Rafael; Blanchard, María Jesus; Alegre, Adrian; Besalduch, Joan; Bargay, Joan; Hernandez, Miguel T; Sarasquete, María Eugenia; Sanchez-Godoy, Pedro; Fernández, Manuela; Blade, Joan; San Miguel, Jesús F; Lahuerta, Juan Jose

    2013-12-01

    Minimal residual disease monitoring is becoming increasingly important in multiple myeloma (MM), but multiparameter flow cytometry (MFC) and allele-specific oligonucleotide polymerase chain reaction (ASO-PCR) techniques are not routinely available. This study investigated the prognostic influence of achieving molecular response assessed by fluorescent-PCR (F-PCR) in 130 newly diagnosed MM patients from Grupo Español Multidisciplinar de Melanoma (GEM)2000/GEM05 trials (NCT00560053, NCT00443235, NCT00464217) who achieved almost very good partial response after induction therapy. As a reference, we used the results observed with simultaneous MFC. F-PCR at diagnosis was performed on DNA using three different multiplex PCRs: IGH D-J, IGK V-J and KDE rearrangements. The applicability of F-PCR was 91·5%. After induction therapy, 64 patients achieved molecular response and 66 non-molecular response; median progression-free survival (PFS) was 61 versus 36 months, respectively (P = 0·001). Median overall survival (OS) was not reached (NR) in molecular response patients (5-year survival: 75%) versus 66 months in the non-molecular response group (P = 0·03). The corresponding PFS and OS values for patients with immunophenotypic versus non-immunophenotypic response were 67 versus 42 months (P = 0·005) and NR (5-year survival: 95%) versus 69 months (P = 0·004), respectively. F-PCR analysis is a rapid, affordable, and easily performable technique that, in some circumstances, may be a valid approach for minimal residual disease investigations in MM. © 2013 John Wiley & Sons Ltd.

  2. Utility of dengue NS1 antigen rapid diagnostic test for use in difficult to reach areas and its comparison with dengue NS1 ELISA and qRT-PCR.

    Science.gov (United States)

    Shukla, Mohan K; Singh, Neeru; Sharma, Ravendra K; Barde, Pradip V

    2017-07-01

    The objective of this study was to demonstrate the utility of dengue virus (DENV) non structural protein 1 (NS1) based rapid diagnostic test (RDT) for use in tribal and difficult to reach areas for early dengue (DEN) diagnosis in acute phase patients and evaluate its sensitivity and specificity against DENV NS1 enzyme linked immune sorbent assay (ELISA) and real time reverse transcriptase polymerase chain reaction (qRT-PCR). The DENV NS1 RDT was used for preliminary diagnosis during outbreaks in difficult to reach rural and tribal areas. The diagnosis was confirmed by DENV NS1 ELISA in the laboratory. The samples were also tested and serotyped by qRT-PCR. The results were evaluated using statistical tests. The DENV NS1 RDT showed 99.2% sensitivity and 96.0% specificity when analyzed using DENV NS1 ELISA as standard. The specificity and sensitivity of the RDT when compared with qRT-PCR was 93.6% and 91.1%, respectively. The serotype specific evaluation showed more than 90% sensitivity and specificity for DENV-1, 2, and 3. The RDT proved a good diagnostic tool in difficult to reach rural and tribal areas. Further evaluation studies with different commercially available RDTs in different field conditions are essential, that will help clinicians and patients for treatment and programme managers for timely intervention. © 2017 Wiley Periodicals, Inc.

  3. Use of a Real-Time PCR TaqMan Assay for Rapid Identification and Differentiation of Burkholderia pseudomallei and Burkholderia mallei

    OpenAIRE

    U'Ren, Jana M.; Van Ert, Matthew N.; Schupp, James M.; Easterday, W. Ryan; Simonson, Tatum S.; Okinaka, Richard T.; Pearson, Talima; Keim, Paul

    2005-01-01

    A TaqMan allelic-discrimination assay designed around a synonymous single-nucleotide polymorphism was used to genotype Burkholderia pseudomallei and Burkholderia mallei isolates. The assay rapidly identifies and discriminates between these two highly pathogenic bacteria and does not cross-react with genetic near neighbors, such as Burkholderia thailandensis and Burkholderia cepacia.

  4. Validation of a commercial insulated isothermal PCR-based POCKIT test for rapid and easy detection of white spot syndrome virus infection in Litopenaeus vannamei.

    Directory of Open Access Journals (Sweden)

    Yun-Long Tsai

    Full Text Available Timely pond-side detection of white spot syndrome virus (WSSV plays a critical role in the implementation of bio-security measures to help minimize economic losses caused by white spot syndrome disease, an important threat to shrimp aquaculture industry worldwide. A portable device, namely POCKIT™, became available recently to complete fluorescent probe-based insulated isothermal PCR (iiPCR, and automatic data detection and interpretation within one hour. Taking advantage of this platform, the IQ Plus™ WSSV Kit with POCKIT system was established to allow simple and easy WSSV detection for on-site users. The assay was first evaluated for its analytical sensitivity and specificity performance. The 95% limit of detection (LOD of the assay was 17 copies of WSSV genomic DNA per reaction (95% confidence interval [CI], 13 to 24 copies per reaction. The established assay has detection sensitivity similar to that of OIE-registered IQ2000™ WSSV Detection and Protection System with serial dilutions of WSSV-positive Litopenaeus vannamei DNA. No cross-reaction signals were generated from infectious hypodermal and haematopoietic necrosis virus (IHHNV, monodon baculovirus (MBV, and hepatopancreatic parvovirus (HPV positive samples. Accuracy analysis using 700 L. vannamei of known WSSV infection status shows that the established assayhassensitivity93.5% (95% CI: 90.61-95.56% and specificity 97% (95% CI: 94.31-98.50%. Furthermore, no discrepancy was found between the two assays when 100 random L. vannamei samples were tested in parallel. Finally, excellent correlation was observed among test results of three batches of reagents with 64 samples analyzed in three different laboratories. Working in a portable device, IQ Plus™ WSSV Kit with POCKIT system allows reliable, sensitive and specific on-site detection of WSSV in L. vannamei.

  5. A Real-Time PCR Assay Based on 5.8S rRNA Gene (5.8S rDNA) for Rapid Detection of Candida from Whole Blood Samples.

    Science.gov (United States)

    Guo, Yi; Yang, Jing-Xian; Liang, Guo-Wei

    2016-06-01

    The prevalence of Candida in bloodstream infections (BSIs) has increased. To date, the identification of Candida in BSIs still mainly relies on blood culture and serological tests, but they have various limitations. Therefore, a real-time PCR assay for the detection of Candida from whole blood is presented. The unique primers/probe system was designed on 5.8S rRNA gene (5.8S rDNA) of Candida genus. The analytical sensitivity was determined by numbers of positive PCRs in 12 repetitions. At the concentration of 10(1) CFU/ml blood, positive PCR rates of 100 % were obtained for C. albicans, C. parapsilosis, C. tropicalis, and C. krusei. The detection rate for C. glabrata was 75 % at 10(1) CFU/ml blood. The reaction specificity was 100 % when evaluating the assay using DNA samples from clinical isolates and human blood. The maximum CVs of intra-assay and inter-assay for the detection limit were 1.22 and 2.22 %, respectively. To assess the clinical applicability, 328 blood samples from 82 patients were prospectively tested and real-time PCR results were compared with results from blood culture. Diagnostic sensitivity of the PCR was 100 % using as gold standard blood culture, and specificity was 98.4 %. Our data suggest that the developed assay can be used in clinical laboratories as an accurate and rapid screening test for the Candida from whole blood. Although further evaluation is warranted, our assay holds promise for earlier diagnosis of candidemia.

  6. Rapid differentiation of Staphylococcus aureus, Staphylococcus epidermidis and other coagulase-negative staphylococci and meticillin susceptibility testing directly from growth-positive blood cultures by multiplex real-time PCR.

    Science.gov (United States)

    Jukes, Leanne; Mikhail, Jane; Bome-Mannathoko, Naledi; Hadfield, Stephen J; Harris, Llinos G; El-Bouri, Khalid; Davies, Angharad P; Mack, Dietrich

    2010-12-01

    This study evaluated a multiplex real-time PCR method specific for the mecA, femA-SA and femA-SE genes for rapid identification of Staphylococcus aureus, Staphylococcus epidermidis and non-S. epidermidis coagulase-negative staphylococci (CoNS), and meticillin susceptibility testing directly in positive blood cultures that grew Gram-positive cocci in clusters. A total of 100 positive blood cultures produced: 39 S. aureus [12 meticillin-resistant S. aureus (MRSA), 31% of all the S. aureus]; 30 S. epidermidis (56.6% of the CoNS), 8 Staphylococcus capitis (15.1%), 3 Staphylococcus saprophyticus (5.7%), 4 Staphylococcus hominis (7.5%), 3 Staphylococcus haemolyticus (5.7%), 2 Staphylococcus warneri (3.8%), 1 Staphylococcus cohnii (1.9%) and 2 unidentified Staphylococcus spp. (3.8%); and 1 Micrococcus luteus in pure culture. Two blood cultures had no growth on subculture and five blood cultures grew mixed CoNS. For the 95 blood cultures with pure growth or no growth on subculture, there was very good agreement between real-time PCR and the BD Phoenix identification system for staphylococcal species categorization in S. aureus, S. epidermidis and non-S. epidermidis CoNS and meticillin-resistance determination (Cohen's unweighted kappa coefficient κ=0.882). All MRSA and meticillin-susceptible S. aureus were correctly identified by mecA amplification. PCR amplification of mecA was more sensitive for direct detection of meticillin-resistant CoNS in positive blood cultures than testing with the BD Phoenix system. There were no major errors when identifying staphylococcal isolates and their meticillin susceptibility within 2.5 h. Further studies are needed to evaluate the clinical benefit of using such a rapid test on the consumption of glycopeptide antibiotics and the alteration of empiric therapy in the situation of positive blood cultures growing staphylococci, and the respective clinical outcomes.

  7. Development and systematic validation of qPCR assays for rapid and reliable differentiation of Xylella fastidiosa strains causing citrus variegated chlorosis.

    Science.gov (United States)

    Li, Wenbin; Teixeira, Diva C; Hartung, John S; Huang, Qi; Duan, Yongping; Zhou, Lijuan; Chen, Jianchi; Lin, Hong; Lopes, Silvio; Ayres, A Juliano; Levy, Laurene

    2013-01-01

    The xylem-limited, Gram-negative, fastidious plant bacterium Xylella fastidiosa is the causal agent of citrus variegated chlorosis (CVC), a destructive disease affecting approximately half of the citrus plantations in the State of São Paulo, Brazil. The disease was recently found in Central America and is threatening the multi-billion U.S. citrus industry. Many strains of X. fastidiosa are pathogens or endophytes in various plants growing in the U.S., and some strains cross infect several host plants. In this study, a TaqMan-based assay targeting the 16S rDNA signature region was developed for the identification of X. fastidiosa at the species level. Another TaqMan-based assay was developed for the specific identification of the CVC strains. Both new assays have been systematically validated in comparison with the primer/probe sets from four previously published assays on one platform and under similar PCR conditions, and shown to be superior. The species specific assay detected all X. fastidiosa strains and did not amplify any other citrus pathogen or endophyte tested. The CVC-specific assay detected all CVC strains but did not amplify any non-CVC X. fastidiosa nor any other citrus pathogen or endophyte evaluated. Both sets were multiplexed with a reliable internal control assay targeting host plant DNA, and their diagnostic specificity and sensitivity remained unchanged. This internal control provides quality assurance for DNA extraction, performance of PCR reagents, platforms and operators. The limit of detection for both assays was equivalent to 2 to 10 cells of X. fastidiosa per reaction for field citrus samples. Petioles and midribs of symptomatic leaves of sweet orange harbored the highest populations of X. fastidiosa, providing the best materials for detection of the pathogen. These new species specific assay will be invaluable for molecular identification of X. fastidiosa at the species level, and the CVC specific assay will be very powerful for the

  8. Rapid diagnosis and identification by PCR of Yersinia ruckeri isolated of Oncorhynchus mykiss from Canta, Lima, Peru Diagnóstico e identificación rápidos por PCR de Yersinia ruckeri aislada de Oncorhynchus mykiss procedentes de Canta, Lima, Perú

    Directory of Open Access Journals (Sweden)

    Susana Sirvas-Cornejo

    2012-02-01

    Full Text Available Twenty individuals of rainbow trout were sampled (fry and juveniles from Acochinchan Fishfarm (Canta, Lima - Peru, and analyzed with the Polimerase Chain Reaction test (PCR in order to achieve a rapid identification of Yersinia ruckeri, which is the pathogen agent that causes the enteric red mouth disease (ERM and produces high rates of mortality. Nine fish samples were asymptomatic, while 11 of them showed signs of ERM. In addition, 22 bacterial strains were isolated from the liver, spleen and kidney. PCR and specific primers (16S rRNA, were used to amplified a specific 575 bp DNA fragment of Yersinia ruckeri. Nineteen strains were identified as Yersinia ruckeri by PCR in symptomatic and asymptomatic fishes. It was established a diagnosis time of 26 hours, compared with the 2 or 3 days that would take the diagnosis using biochemical tests.Se muestrearon 20 ejemplares (alevines y juveniles de trucha arco iris cultivados en la piscifactoría Acochinchán (Canta, Lima, Perú, y se les aplico la técnica de la Reacción en Cadena de la Polimerasa (PCR con la finalidad de obtener una identificación rápida del agente patógeno Yersinia ruckeri que produce la enfermedad entérica de la boca roja (ERM y genera elevadas tasas de mortalidad. Nueve ejemplares fueron asintomáticos mientras que 11 presentaron signos de ERM. Se aislaron 22 cepas bacterianas del hígado, bazo y riñón. Se empleó la técnica de la PCR para la amplificación y cebadores específicos (ARNr 16S, que permitieron amplificar un fragmento de ADN de 575 pb de Yersinia ruckeri. Diecinueve cepas fueron identificadas como Yersinia ruckeri mediante la PCR, tanto en peces sintomáticos como asintomáticos. Se estableció un tiempo de diagnóstico de 26 horas, en comparación con los 2 ó 3 días que duraría el diagnóstico empleando las pruebas bioquímicas.

  9. Four-channel asymmetric Real-Time PCR hybridization probe assay: a rapid pre-screening method for critical BCR-ABL kinase domain mutations.

    Science.gov (United States)

    Martinez-Serra, Jordi; Gutiérrez, Antonio; Marcús, Toni F; Soverini, Simona; Amat, Juan Carlos; Navarro-Palou, María; Ros, Teresa; Bex, Teresa; Ballester, Carmen; Bauça, Josep Miquel; SanFelix, Sara; Novo, Andrés; Vidal, Carmen; Santos, Carmen; Besalduch, Joan

    2012-03-01

    Within the laboratory protocols, used for the study of BCR-ABL resistance mutations in chronic myeloid leukemia patients treated with Imatinib, direct sequencing remains the reference method. Since the incidence of patients with a mutation-related loss of response is not very high, it is very useful in the routine laboratory to perform a fast pre-screening method. With this in mind, we have designed a new technique, based on a single Real-Time FRET-based PCR, followed by a study of melting peaks. This new tool, developed in a LightCycler 2.0, combines four different fluorescence channels for the simultaneous detection, in a single close tube, of critical mutations within the ABL kinase domain. Assay evaluation performed on 33 samples, previously genotyped by sequentiation, resulted in full concordance of results. This new methodology detects in a few steps the presence of critical mutations associated to Imatinib resistance. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. A rapid genotyping method for an obligate fungal pathogen, Puccinia striiformis f.sp. tritici, based on DNA extraction from infected leaf and Multiplex PCR genotyping

    Directory of Open Access Journals (Sweden)

    Enjalbert Jérôme

    2011-07-01

    Full Text Available Abstract Background Puccinia striiformis f.sp. tritici (PST, an obligate fungal pathogen causing wheat yellow/stripe rust, a serious disease, has been used to understand the evolution of crop pathogen using molecular markers. However, numerous questions regarding its evolutionary history and recent migration routes still remains to be addressed, which need the genotyping of a large number of isolates, a process that is limited by both DNA extraction and genotyping methods. To address the two issues, we developed here a method for direct DNA extraction from infected leaves combined with optimized SSR multiplexing. Findings We report here an efficient protocol for direct fungal DNA extraction from infected leaves, avoiding the costly and time consuming step of spore multiplication. The genotyping strategy we propose, amplified a total of 20 SSRs in three Multiplex PCR reactions, which were highly polymorphic and were able to differentiate different PST populations with high efficiency and accuracy. Conclusion These two developments enabled a genotyping strategy that could contribute to the development of molecular epidemiology of yellow rust disease, both at a regional or worldwide scale.

  11. Rapid detection and identification of Stachybotrys and Chaetomium species using tissue PCR analysis

    DEFF Research Database (Denmark)

    Lewinska, Anna Malgorzata; Peuhkuri, Ruut Hannele; Rode, Carsten

    2016-01-01

    level is essential for health risk assessment and building remediation. This study focuses on molecular identification of two common indoor fungal genera: Stachybotrys and Chaetomium. This study proposes two new DNA barcode candidates for Stachybotrys and Chaetomium: the gene encoding mitogen activated...... protein kinase (hogA) and the intergenic region between histone 3 and histone 4 (h3-h4) as well as it introduces a rapid - 3.5 h - protocol for direct Stachybotrys and Chaetomium species identification, which bypasses culture cultivation, DNA extraction and DNA sequencing....

  12. Rapid detection of the H275Y oseltamivir resistance mutation in influenza A/H1N1 2009 by single base pair RT-PCR and high-resolution melting.

    Directory of Open Access Journals (Sweden)

    Steven Y C Tong

    Full Text Available We aimed to design a real-time reverse-transcriptase-PCR (rRT-PCR, high-resolution melting (HRM assay to detect the H275Y mutation that confers oseltamivir resistance in influenza A/H1N1 2009 viruses.A novel strategy of amplifying a single base pair, the relevant SNP at position 823 of the neuraminidase gene, was chosen to maintain specificity of the assay. Wildtype and mutant virus were differentiated when using known reference samples of cell-cultured virus. However, when dilutions of these reference samples were assayed, amplification of non-specific primer-dimer was evident and affected the overall melting temperature (T(m of the amplified products. Due to primer-dimer appearance at >30 cycles we found that if the cycle threshold (C(T for a dilution was >30, the HRM assay did not consistently discriminate mutant from wildtype. Where the C(T was 32.98 would have an H275Y assay C(T>30. Analysis of the TaqMan C(T values for 609 consecutive clinical samples predicted that 207 (34% of the samples would result in an HRM assay C(T>30 and therefore not be amenable to the HRM assay.The use of single base pair PCR and HRM can be useful for specifically interrogating SNPs. When applied to H1N1 09, the constraints this placed on primer design resulted in amplification of primer-dimer products. The impact primer-dimer had on HRM curves was adjusted for by plotting T(m against C(T. Although less sensitive than TaqMan assays, the HRM assay can rapidly, and at low cost, screen samples with moderate viral concentrations.

  13. HRP2 and pLDH-Based Rapid Diagnostic Tests, Expert Microscopy, and PCR for Detection of Malaria Infection during Pregnancy and at Delivery in Areas of Varied Transmission: A Prospective Cohort Study in Burkina Faso and Uganda.

    Directory of Open Access Journals (Sweden)

    Daniel J Kyabayinze

    Full Text Available Intermittent screening and treatment (IST of malaria during pregnancy has been proposed as an alternative to intermittent preventive treatment in pregnancy (IPTp, where IPTp is failing due to drug resistance. However, the antenatal parasitaemias are frequently very low, and the most appropriate screening test for IST has not been defined.We conducted a multi-center prospective study of 990 HIV-uninfected women attending ANC in two different malaria transmission settings at Tororo District Hospital, eastern Uganda and Colsama Health Center in western Burkina Faso. Women were enrolled in the study in the second or third trimester of pregnancy and followed to delivery, generating 2,597 blood samples for analysis. Screening tests included rapid diagnostic tests (RDTs targeting histidine-rich protein 2 (HRP2 and parasite lactate dehydrogenase (pLDH and microscopy, compared to nPCR as a reference standard. At enrolment, the proportion of pregnant women who were positive for P. falciparum by HRP2/pan pLDH RDT, Pf pLDH/pan pLDH RDT, microscopy and PCR was 38%, 29%, 36% and 44% in Uganda and 21%, 16%, 15% and 35% in Burkina Faso, respectively. All test positivity rates declined during follow-up. In comparison to PCR, the sensitivity of the HRP2/pan pLDH RDT, Pf pLDH/pan pLDH RDT and microscopy was 75.7%, 60.1% and 69.7% in Uganda, 55.8%, 42.6% and 55.8% in Burkina Faso respectively for all antenatal visits. Specificity was greater than 96% for all three tests. Comparison of accuracy using generalized estimating equation revealed that the HRP2- detecting RDT was the most accurate test in both settings.The study suggests that HRP2-based RDTs are the most appropriate point-of-care test currently available for use during pregnancy especially for symptomatic women, but will still miss some PCR-positive women. The clinical significance of these very low density infections needs to be better defined.

  14. Multiplex real-time quantitative PCR, microscopy and rapid diagnostic immuno-chromatographic tests for the detection of Plasmodium spp: performance, limit of detection analysis and quality assurance

    Directory of Open Access Journals (Sweden)

    Ralevski Filip

    2009-12-01

    Full Text Available Abstract Background Accurate laboratory diagnosis of malaria species in returning travelers is paramount in the treatment of this potentially fatal infectious disease. Materials and methods A total of 466 blood specimens from returning travelers to Africa, Asia, and South/Central America with suspected malaria infection were collected between 2007 and 2009 at the reference public health laboratory. These specimens were assessed by reference microscopy, multipex real-time quantitative polymerase chain reaction (QPCR, and two rapid diagnostic immuno-chromatographic tests (ICT in a blinded manner. Key clinical laboratory parameters such as limit of detection (LOD analysis on clinical specimens by parasite stage, inter-reader variability of ICTs, staffing implications, quality assurance and cost analysis were evaluated. Results QPCR is the most analytically sensitive method (sensitivity 99.41%, followed by CARESTART (sensitivity 88.24%, and BINAXNOW (sensitivity 86.47% for the diagnosis of malaria in returning travelers when compared to reference microscopy. However, microscopy was unable to specifically identify Plasmodia spp. in 18 out of 170 positive samples by QPCR. Moreover, the 17 samples that were negative by microscopy and positive by QPCR were also positive by ICTs. Quality assurance was achieved for QPCR by exchanging a blinded proficiency panel with another reference laboratory. The Kappa value of inter-reader variability among three readers for BINAXNOW and CARESTART was calculated to be 0.872 and 0.898 respectively. Serial dilution studies demonstrated that the QPCR cycle threshold correlates linearly with parasitemia (R2 = 0.9746 in a clinically relevant dynamic range and retains a LOD of 11 rDNA copies/μl for P. falciparum, which was several log lower than reference microscopy and ICTs. LOD for QPCR is affected not only by parasitemia but the parasite stage distribution of each clinical specimen. QPCR was approximately 6-fold more

  15. Development of a multiplex real-time PCR for the rapid detection of the predominant beta-lactamase genes CTX-M, SHV, TEM and CIT-type AmpCs in Enterobacteriaceae.

    Directory of Open Access Journals (Sweden)

    Nicole Roschanski

    Full Text Available Beta-lactamase resistant bacteria and especially ESBL producing Enterobacteriaceae are an increasing problem worldwide. For this reason a major interest in efficient and reliable methods for rapid screening of high sample numbers is recognizable. Therefore, a multiplex real-time PCR was developed to detect the predominant class A beta-lactamase genes blaCTX-M, blaSHV, blaTEM and CIT-type AmpCs in a one-step reaction. A set of 114 Enterobacteriaceae containing previously identified resistance gene subtypes and in addition 20 undefined animal and environmental isolates were used for the validation of this assay. To confirm the accessibility in variable settings, the real-time runs were performed analogous in two different laboratories using different real-time cyclers. The obtained results showed complete accordance between the real-time data and the predetermined genotypes. Even if sequence analyses are further necessary for a comprehensive characterization, this method was proofed to be reliable for rapid screening of high sample numbers and therefore could be an important tool for e. g. epidemiological purposes or support infection control measures.

  16. Estudio comparativo entre una prueba rápida y RT-PCR tiempo real en el diagnóstico de influenza AH1N1 2009 Comparative study of a rapid testing with real time RT-PCR for diagnosis of influenza AH1N1 2009

    Directory of Open Access Journals (Sweden)

    Luz Araceli Castro-Cárdenas

    2011-08-01

    Full Text Available OBJETIVO: Comparar la prueba QuickVue Influenza A+B empleando como estándar la RT-PCR tiempo real para influenza AH1N1 2009. MATERIAL Y MÉTODOS: Estudio retrospectivo-comparativo de 135 muestras de vías respiratorias de individuos sintomáticos para influenza procesadas de mayo 2009 a octubre 2010.Las pruebas citadas se realizaron simultáneamente. Se utilizó el software Confidence Interval Analysis 2000. RESULTADOS: Sensibilidad 62.96; especificidad 94.44; valor predictivo negativo 62.9; valor predictivo positivo 94.44; razón de probabilidad positiva 11.33 y razón de probabilidad negativa 0.39. Se calcularon intervalos de confianza a 95. DISCUSIÓN: Los valores obtenidos concuerdan con otros estudios donde la sensibilidad fluctúa de 50 a 70 y especificidad entre 90 y 95 por ciento. La prueba QuickVue Influenza A+B es rápida, simple y de menor costo que el RT-PCR tiempo real, útil para identificar el tipo de virus en brotes de influenza de una población determinadaOBJECTIVE: Compare QuickVue Influenza A+B test with real-time RT-PCR for the diagnosis of influenza AH1N1 2009. MATERIAL AND METHODS: Retrospective-comparative study of 135 respiratory specimens from individuals with symptoms of influenza processed from May 2009 to October 2010.The above mentioned tests were performed simultaneously. For statistic analysisthe softwareof Confidence IntervalAnalysis 2000 was used. RESULTS: The parameters obtained were: sensitivity 62.96; specificity 94.44; negative predictive value 62.9; positive predictive value 94.44; positive likelihood ratio 11.33; negative likelihood ratio 0.39. Confidence intervals to 95,were calculated to all of the above data. DISCUSSION: The test QuickVue InfluenzaA+B is a rapid,simple test,with lower cost than real-time RT-PCR useful for identifying the type of virus outbreaks of influenza in a given population.It correlates well with more specific test and similar reports.

  17. Rapid detection of the CYP2A6*12 hybrid allele by Pyrosequencing® technology

    Directory of Open Access Journals (Sweden)

    Gallagher Margaret L

    2009-08-01

    Full Text Available Abstract Background Identification of CYP2A6 alleles associated with reduced enzyme activity is important in the study of inter-individual differences in drug metabolism. CYP2A6*12 is a hybrid allele that results from unequal crossover between CYP2A6 and CYP2A7 genes. The 5' regulatory region and exons 1–2 are derived from CYP2A7, and exons 3–9 are derived from CYP2A6. Conventional methods for detection of CYP2A6*12 consist of two-step PCR protocols that are laborious and unsuitable for high-throughput genotyping. We developed a rapid and accurate method to detect the CYP2A6*12 allele by Pyrosequencing technology. Methods A single set of PCR primers was designed to specifically amplify both the CYP2A6*1 wild-type allele and the CYP2A6*12 hybrid allele. An internal Pyrosequencing primer was used to generate allele-specific sequence information, which detected homozygous wild-type, heterozygous hybrid, and homozygous hybrid alleles. We first validated the assay on 104 DNA samples that were also genotyped by conventional two-step PCR and by cycle sequencing. CYP2A6*12 allele frequencies were then determined using the Pyrosequencing assay on 181 multi-ethnic DNA samples from subjects of African American, European Caucasian, Pacific Rim, and Hispanic descent. Finally, we streamlined the Pyrosequencing assay by integrating liquid handling robotics into the workflow. Results Pyrosequencing results demonstrated 100% concordance with conventional two-step PCR and cycle sequencing methods. Allele frequency data showed slightly higher prevalence of the CYP2A6*12 allele in European Caucasians and Hispanics. Conclusion This Pyrosequencing assay proved to be a simple, rapid, and accurate alternative to conventional methods, which can be easily adapted to the needs of higher-throughput studies.

  18. Prospective evaluation of commercial antibody-based rapid tests in combination with a loop-mediated isothermal amplification PCR assay for detection of Orientia tsutsugamushi during the acute phase of scrub typhus infection.

    Science.gov (United States)

    Blacksell, Stuart D; Paris, Daniel H; Chierakul, Wirongrong; Wuthiekanun, Vanaporn; Teeratakul, Achara; Kantipong, Pacharee; Day, Nicholas P J

    2012-03-01

    Samples from 160 prospectively recruited febrile patients with typhus-like illness in an area of Thailand (Chiang Rai, northern Thailand) where scrub typhus is endemic were used to evaluate the diagnostic capabilities of four rapid immunochromatographic tests (ICTs) for the detection of Orientia tsutsugamushi IgM and total antibodies during acute scrub typhus infection. Of the 160 cases, 54 (34%) had been confirmed to have scrub typhus using the reference scrub typhus infection criteria (STIC), i.e., positive cell culture isolation, an admission IgM antibody titer of ≥1:12,800, a 4-fold rising IgM antibody titer, and/or positivity for ≥2 out of 3 PCR gene targets). The ICTs gave the following sensitivities and specificities: the Panbio IgM ICT, 46% (95% confidence interval [CI], 33 to 60) and 95% (95% CI, 89 to 98), respectively; the Standard Diagnostics IgM ICT, 68% (95% CI, 60 to 75) and 73% (95% CI, 68 to 78), respectively; the AccessBio IgM ICT, 56% (95% CI, 48 to 63) and 90% (95% CI, 87 to 94), respectively; and the AccessBio total antibody ABt ICT, 61% (95% CI, 53 to 68) and 68% (95% CI, 63 to 73), respectively. An isothermal loop amplification (LAMP) PCR assay for scrub typhus demonstrated a sensitivity of 52% (95% CI, 38 to 66) and a specificity of 94% (95% CI, 88 to 98). This study has revealed the diagnostic limitations of antibody-based assays in an acute care setting. However, the combination of ICTs with LAMP usually increased sensitivity with a minimal reduction in specificity. The best combination, the Panbio IgM ICT and LAMP, resulted in a sensitivity of 67% (95% CI, 53 to 79) and a specificity of 91% (95% CI, 83 to 95). The combination of antibody-based assays with DNA- or antigen-based tests shows promise for improved diagnostic sensitivity.

  19. A semi-nested real-time PCR method to detect low chimerism percentage in small quantity of hematopoietic stem cell transplant DNA samples.

    Science.gov (United States)

    Aloisio, Michelangelo; Bortot, Barbara; Gandin, Ilaria; Severini, Giovanni Maria; Athanasakis, Emmanouil

    2017-02-01

    Chimerism status evaluation of post-allogeneic hematopoietic stem cell transplantation samples is essential to predict post-transplant relapse. The most commonly used technique capable of detecting small increments of chimerism is quantitative real-time PCR. Although this method is already used in several laboratories, previously described protocols often lack sensitivity and the amount of the DNA required for each chimerism analysis is too high. In the present study, we compared a novel semi-nested allele-specific real-time PCR (sNAS-qPCR) protocol with our in-house standard allele-specific real-time PCR (gAS-qPCR) protocol. We selected two genetic markers and analyzed technical parameters (slope, y-intercept, R2, and standard deviation) useful to determine the performances of the two protocols. The sNAS-qPCR protocol showed better sensitivity and precision. Moreover, the sNAS-qPCR protocol requires, as input, only 10 ng of DNA, which is at least 10-fold less than the gAS-qPCR protocols described in the literature. Finally, the proposed sNAS-qPCR protocol could prove very useful for performing chimerism analysis with a small amount of DNA, as in the case of blood cell subsets.

  20. High resolution melting (HRM) analysis as a new tool for rapid identification of Salmonella enterica serovar Gallinarum biovars Pullorum and Gallinarum.

    Science.gov (United States)

    Ren, Xingxing; Fu, Ying; Xu, Chenggang; Feng, Zhou; Li, Miao; Zhang, Lina; Zhang, Jianmin; Liao, Ming

    2017-05-01

    Salmonella enterica serovar Gallinarum biovars Pullorum and Gallinarum represent the most common causative agents of chicken salmonellosis, which result in high mortality and morbidity throughout the world. It is difficult and laborious to discriminate these diseases based on biochemical or phenotypic methods. Herein, we report the development of a single nucleotide polymorphism (SNP) PCR-high resolution melt (PCR-HRM) assay for the detection and discrimination of both S. Pullorum and S. Gallinarun. The gene rfbS, which encodes a factor involved in the biosynthesis of ADP paratose in serogroup D of Salmonella, has been identified as a robust genetic marker for the identification of S. Pullorum and S. Gallinarun based on polymorphisms at positions 237 and 598. Therefore, PCR-HRM analyses were used to characterize this gene. A total of 15 reference and 33 clinical isolates of Salmonella and related Gram-negative bacteria were detected using 2 sets of primers. Our PCR-HRM assay could distinguish S. Pullorum from S. Gallinarun and other strains using the primer pair SP-237F/237R. Similarly, S. Gallinarun could be distinguished from S. Pullorum and other strains using primer set SG-598F/598R. These 2 assays showed high specificity (100%) for both S. Pullorum and S. Gallinarun; the sensitivity of these 2 assays was at least 100-fold greater than that of the allele-specific PCR assay. This present study demonstrated that HRM analysis represents a potent, simple, and economic tool for the rapid, specific, and sensitive detection of S. Pullorum and S. Gallinarun. Our approach also may aid efforts for purification of Avian Salmonella disease. © 2016 Poultry Science Association Inc.

  1. Amplificação gênica alelo-específica na caracterização das hemoglobinas S, C e D e as interações entre elas e talassemias beta Allele-specific genic amplification in the characterization of hemoglobins S, C, D and interactions among them and with beta thalassemia

    Directory of Open Access Journals (Sweden)

    Luciane Cristina Bertholo

    2006-08-01

    possible interactions, based on the allele-specific genic amplification (PCR-AE with the use in parallel two primers that differ at their 3’ extremities and are complementary to the normal or mutated sequences. RESULTS AND DISCUSSION: The results make evident the validation of this methodology in the characterization of these mutations, once this procedure is easy to execute,to reproduce, as well as it is possible to be applied to a significative number of samples.

  2. Accuracy of rapid influenza diagnostic test and immunofluorescence assay compared to real time RT-PCR in children with influenza A(H1N1pdm09 infection 

    Directory of Open Access Journals (Sweden)

    Aneta Nitsch-Osuch

    2012-10-01

    Full Text Available  Introduction:The influenza burden among children is underestimated. The aim of our study was to estimate the accuracy of the rapid influenza detection test (RIDT BD Directigen™ EZ Flu A B® and direct immunofluorescence assay (DFA used among children with influenza-like illness (ILI consulted in the ambulatory care clinic.Material/Methods:A total of 150 patients were enrolled in the study. Inclusion criteria were: age less than 59 months, presentation of ILI according to the CDC (Centers for Disease Control and Prevention definition (fever >37.8°C, cough and/or sore throat in the absence of another known cause of illness, duration of symptoms shorter than 96 hours. Two nasal swabs and one pharyngeal swab were obtained from patients and tested by RIDT, DFA and real time RT-PCR as the reference method.Results:For influenza A (H1N1pdm09 virus sensitivity of RIDT was 62.2�0(95�0CI 46.5–76.2� specificity 97.1�0(95�0CI 91.8–99.4� PPV 90.3�0(95�0CI 74.3–98� NPV 85.7�0(95�0CI 78.1–91.5� for DFA sensitivity was 60�0(95�0CI 51.9–63.2� specificity 96�0(95�0CI 88.7–98.8� PPV 93.1�0(95�0CI 80.5–98� NPV 72.7�0(95�0CI 67.2–74.9� Analysis of logistic regression revealed that the chance of receiving a true positive result of RIDT was twice as high when the test was conducted during the first 48 hours of symptoms (OR 0.40 vs OR 0.22.Conclusions:The accuracy of RIDT is comparable with DFA and both methods are very specific but moderately sensitive in diagnosis of influenza in young children. Both methods may be recommended for screening for influenza among children.

  3. Development of a quantitative PCR for rapid and sensitive diagnosis of an intranuclear coccidian parasite in Testudines (TINC), and detection in the critically endangered Arakan forest turtle (Heosemys depressa).

    Science.gov (United States)

    Alvarez, W Alexander; Gibbons, Paul M; Rivera, Sam; Archer, Linda L; Childress, April L; Wellehan, James F X

    2013-03-31

    The intranuclear coccidian parasite of Testudines (TINC) is responsible for significant disease in turtles and tortoises causing high mortality and affecting several threatened species. Diagnostic testing has been limited to relatively labor intensive and expensive pan-coccidial PCR and sequencing techniques. A qPCR assay targeting a specific and conserved region of TINC 18S rRNA was designed. The qPCR reaction was run on samples known to be TINC positive and the results were consistent and analytically specific. The assay was able to detect as little as 10 copies of target DNA in a sample. Testing of soil and invertebrates was negative and did not provide any further insights into life cycles. This assay was used to identify TINC in a novel host species, the critically endangered Arakan forest turtle (Heosemys depressa). Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Comparative analysis of minimal residual disease detection by multiparameter flow cytometry and enhanced ASO RQ-PCR in multiple myeloma

    International Nuclear Information System (INIS)

    Silvennoinen, R; Lundan, T; Kairisto, V; Pelliniemi, T-T; Putkonen, M; Anttila, P; Huotari, V; Mäntymaa, P; Siitonen, S; Uotila, L; Penttilä, T-L; Juvonen, V; Selander, T; Remes, K

    2014-01-01

    Multiparameter flow cytometry (MFC) and allele-specific oligonucleotide real-time quantitative PCR (ASO RQ-PCR) are the two most sensitive methods to detect minimal residual disease (MRD) in multiple myeloma (MM). We compared these methods in 129 paired post-therapy samples from 22 unselected, consecutive MM patients in complete/near complete remission. Appropriate immunophenotypic and ASO RQ-PCR-MRD targets could be detected and MRD analyses constructed for all patients. The high PCR coverage could be achieved by gradual widening of the primer sets used for clonality detection. In addition, for 13 (55%) of the patients, reverse orientation of the ASO primer and individual design of the TaqMan probe improved the sensitivity and specificity of ASO RQ-PCR analysis. A significant nonlinear correlation prevailed between MFC-MRD and PCR-MRD when both were positive. Discordance between the methods was found in 32 (35%) paired samples, which were negative by MFC-MRD, but positive by ASO RQ-PCR. The findings suggest that with the described technique, ASO RQ-PCR can be constructed for all patients with MM. ASO RQ-PCR is slightly more sensitive in MRD detection than 6−10-color flow cytometry. Owing to technical demands ASO RQ-PCR could be reserved for patients in immunophenotypic remission, especially in efficacy comparisons between different drugs and treatment modalities

  5. Comparison between digital PCR and real-time PCR in detection of Salmonella typhimurium in milk.

    Science.gov (United States)

    Wang, Meng; Yang, Junjie; Gai, Zhongtao; Huo, Shengnan; Zhu, Jianhua; Li, Jun; Wang, Ranran; Xing, Sheng; Shi, Guosheng; Shi, Feng; Zhang, Lei

    2018-02-02

    As a kind of zero-tolerance foodborne pathogens, Salmonella typhimurium poses a great threat to quality of food products and public health. Hence, rapid and efficient approaches to identify Salmonella typhimurium are urgently needed. Combined with PCR and fluorescence technique, real-time PCR (qPCR) and digital PCR (ddPCR) are regarded as suitable tools for detecting foodborne pathogens. To compare the effect between qPCR and ddPCR in detecting Salmonella typhimurium, a series of nucleic acid, pure strain culture and spiking milk samples were applied and the resistance to inhibitors referred in this article as well. Compared with qPCR, ddPCR exhibited more sensitive (10 -4 ng/μl or 10 2 cfu/ml) and less pre-culturing time (saving 2h). Moreover, ddPCR had stronger resistance to inhibitors than qPCR, yet absolute quantification hardly performed when target's concentration over 1ng/μl or 10 6 cfu/ml. This study provides an alternative strategy in detecting foodborne Salmonella typhimurium. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. A novel genotoxin-specific qPCR array based on the metabolically competent human HepaRG™ cell line as a rapid and reliable tool for improved in vitro hazard assessment.

    Science.gov (United States)

    Ates, Gamze; Mertens, Birgit; Heymans, Anja; Verschaeve, Luc; Milushev, Dimiter; Vanparys, Philippe; Roosens, Nancy H C; De Keersmaecker, Sigrid C J; Rogiers, Vera; Doktorova, Tatyana Y

    2018-04-01

    Although the value of the regulatory accepted batteries for in vitro genotoxicity testing is recognized, they result in a high number of false positives. This has a major impact on society and industries developing novel compounds for pharmaceutical, chemical, and consumer products, as afflicted compounds have to be (prematurely) abandoned or further tested on animals. Using the metabolically competent human HepaRG ™ cell line and toxicogenomics approaches, we have developed an upgraded, innovative, and proprietary gene classifier. This gene classifier is based on transcriptomic changes induced by 12 genotoxic and 12 non-genotoxic reference compounds tested at sub-cytotoxic concentrations, i.e., IC10 concentrations as determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The resulting gene classifier was translated into an easy-to-handle qPCR array that, as shown by pathway analysis, covers several different cellular processes related to genotoxicity. To further assess the predictivity of the tool, a set of 5 known positive and 5 known negative test compounds for genotoxicity was evaluated. In addition, 2 compounds with debatable genotoxicity data were tested to explore how the qPCR array would classify these. With an accuracy of 100%, when equivocal results were considered positive, the results showed that combining HepaRG ™ cells with a genotoxin-specific qPCR array can improve (geno)toxicological hazard assessment. In addition, the developed qPCR array was able to provide additional information on compounds for which so far debatable genotoxicity data are available. The results indicate that the new in vitro tool can improve human safety assessment of chemicals in general by basing predictions on mechanistic toxicogenomics information.

  7. Real-time PCR in virology

    OpenAIRE

    Mackay, Ian M.; Arden, Katherine E.; Nitsche, Andreas

    2002-01-01

    The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of P...

  8. Real-time PCR in virology.

    Science.gov (United States)

    Mackay, Ian M; Arden, Katherine E; Nitsche, Andreas

    2002-03-15

    The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of PCR product during real-time PCR. These are the DNA binding fluorophores, the 5' endonuclease, adjacent linear and hairpin oligoprobes and the self-fluorescing amplicons, which are described in detail. We also discuss factors that have restricted the development of multiplex real-time PCR as well as the role of real-time PCR in quantitating nucleic acids. Both amplification hardware and the fluorogenic detection chemistries have evolved rapidly as the understanding of real-time PCR has developed and this review aims to update the scientist on the current state of the art. We describe the background, advantages and limitations of real-time PCR and we review the literature as it applies to virus detection in the routine and research laboratory in order to focus on one of the many areas in which the application of real-time PCR has provided significant methodological benefits and improved patient outcomes. However, the technology discussed has been applied to other areas of microbiology as well as studies of gene expression and genetic disease.

  9. Eliminating PCR contamination

    International Nuclear Information System (INIS)

    Fox, J.C.; Ait-Khaled, Mounir; Webster, Alison; Emery, V.C.

    1991-01-01

    The sensitivity of polymerase chain reaction (PCR) can mean that even very low levels of contamination with the target DNA will result in a positive signal. At present this aspect is a major limitation in the use of PCR as a routine diagnostic method. By exposing PCR reagents to UV light, contaminating DNA can be inactivated, thus providing an opportunity to eradicate false positive reactions. UV irradiation was applied to PCR systems used for detection of human cytomegalovirus CMV and human immunodeficiency virus (HIV) and shown to be effective in eradicating both laboratory encountered contamination and plasmid DNA (below 100 pg) added to PCR systems prior to UV exposure. Sensitivity of a PCR system to amplify the long terminal repeat (LTR) sequence of HIV-1 was not affected by the irradiation procedure; however, ultimate sensitivity of a PCR system for the amplification of an early gene pro-motor sequence of the CMV genome was reduced 1000-fold. UV irradiation did not affect the size of the PCR product as determined by strand separating polyacrylamide gel electrophoresis of a 32 P-labelled amplimer. Thus, a simple pre-exposure to UV light would seem a worth-wile step to incorporate into PCR protocols provided that the effects on sensitivity have been determined empirically for each PCR system. (author). 11 refs.; 3 figs

  10. External PCR, ASN's decision

    International Nuclear Information System (INIS)

    Anon.

    2012-01-01

    The French law imposes in some situations the presence of a person skilled in radiation protection (PCR). This article describes the cases when this person must belong to the staff of the enterprise or when this person may be sub-contracted. For instance in most nuclear facilities the PCR must be on the payroll, for enterprises dedicated to nuclear transport the PCR's job can be sub-contracted. A decision given by the ASN (French Nuclear Safety Authority) sets the minimal requests (in terms of training, job contract, activities) of the sub-contracted PCR. (A.C.)

  11. Reliable allele detection using SNP-based PCR primers containing Locked Nucleic Acid: application in genetic mapping

    Directory of Open Access Journals (Sweden)

    Trognitz Friederike

    2007-02-01

    Full Text Available Abstract Background The diploid, Solanum caripense, a wild relative of potato and tomato, possesses valuable resistance to potato late blight and we are interested in the genetic base of this resistance. Due to extremely low levels of genetic variation within the S. caripense genome it proved impossible to generate a dense genetic map and to assign individual Solanum chromosomes through the use of conventional chromosome-specific SSR, RFLP, AFLP, as well as gene- or locus-specific markers. The ease of detection of DNA polymorphisms depends on both frequency and form of sequence variation. The narrow genetic background of close relatives and inbreds complicates the detection of persisting, reduced polymorphism and is a challenge to the development of reliable molecular markers. Nonetheless, monomorphic DNA fragments representing not directly usable conventional markers can contain considerable variation at the level of single nucleotide polymorphisms (SNPs. This can be used for the design of allele-specific molecular markers. The reproducible detection of allele-specific markers based on SNPs has been a technical challenge. Results We present a fast and cost-effective protocol for the detection of allele-specific SNPs by applying Sequence Polymorphism-Derived (SPD markers. These markers proved highly efficient for fingerprinting of individuals possessing a homogeneous genetic background. SPD markers are obtained from within non-informative, conventional molecular marker fragments that are screened for SNPs to design allele-specific PCR primers. The method makes use of primers containing a single, 3'-terminal Locked Nucleic Acid (LNA base. We demonstrate the applicability of the technique by successful genetic mapping of allele-specific SNP markers derived from monomorphic Conserved Ortholog Set II (COSII markers mapped to Solanum chromosomes, in S. caripense. By using SPD markers it was possible for the first time to map the S. caripense alleles

  12. Rapid method for controlling the correct labeling of products containing common octopus (Octopus vulgaris) and main substitute species (Eledone cirrhosa and Dosidicus gigas) by fast real-time PCR.

    Science.gov (United States)

    Espiñeira, Montserrat; Vieites, Juan M

    2012-12-15

    The TaqMan real-time PCR has the highest potential for automation, therefore representing the currently most suitable method for screening, allowing the detection of fraudulent or unintentional mislabeling of species. This work describes the development of a real-time polymerase chain reaction (RT-PCR) system for the detection and identification of common octopus (Octopus vulgaris) and main substitute species (Eledone cirrhosa and Dosidicus gigas). This technique is notable for the combination of simplicity, speed, sensitivity and specificity in an homogeneous assay. The method can be applied to all kinds of products; fresh, frozen and processed, including those undergoing intensive processes of transformation. This methodology was validated to check how the degree of food processing affects the method and the detection of each species. Moreover, it was applied to 34 commercial samples to evaluate the labeling of products made from them. The methodology herein developed is useful to check the fulfillment of labeling regulations for seafood products and to verify traceability in commercial trade and for fisheries control. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. Rapid Amplification of the 5'cDNA End of Reindeer Ghrelin by Inverse Nested PCR%反向嵌套PCR技术扩增驯鹿Ghrelin cDNA 5'末端序列

    Institute of Scientific and Technical Information of China (English)

    朱雪敏; 张义; 张剑平; 杨银凤

    2008-01-01

    为了研究Ghrelin在驯鹿生长发育过程中的作用和功能,以驯鹿为研究对象,采用反向嵌套PCR RACE技术原理,根据已知的序列设计1条5'末端磷酸化的特异性反转录引物和2对特异性反向嵌套PCR引物,首先进行反转录(RT),然后将反转录成的cDNA进行环化,最后进行反向嵌套巢式PCR,成功地扩增了驯鹿Ghrelin cDNA 5'末端序列.与锚定PCR相比,反向嵌套PCR法具有特异性强、扩增效率高等优点,是一种非常有效的扩增cDNA 5'末端序列的方法.

  14. Inverse fusion PCR cloning.

    Directory of Open Access Journals (Sweden)

    Markus Spiliotis

    Full Text Available Inverse fusion PCR cloning (IFPC is an easy, PCR based three-step cloning method that allows the seamless and directional insertion of PCR products into virtually all plasmids, this with a free choice of the insertion site. The PCR-derived inserts contain a vector-complementary 5'-end that allows a fusion with the vector by an overlap extension PCR, and the resulting amplified insert-vector fusions are then circularized by ligation prior transformation. A minimal amount of starting material is needed and experimental steps are reduced. Untreated circular plasmid, or alternatively bacteria containing the plasmid, can be used as templates for the insertion, and clean-up of the insert fragment is not urgently required. The whole cloning procedure can be performed within a minimal hands-on time and results in the generation of hundreds to ten-thousands of positive colonies, with a minimal background.

  15. Rapid detection of bovine coronavirus by a semi-nested RT-PCR Detecção rápida do Coronavírus Bovino (BCoV por meio de uma semi-nested RT-PCR

    Directory of Open Access Journals (Sweden)

    Karen M. Asano

    2009-11-01

    Full Text Available Bovine coronavirus (BCoV is a member of the group 2 of the Coronavirus (Nidovirales: Coronaviridae and the causative agent of enteritis in both calves and adult bovine, as well as respiratory disease in calves. The present study aimed to develop a semi-nested RT-PCR for the detection of BCoV based on representative up-to-date sequences of the nucleocapsid gene, a conserved region of coronavirus genome. Three primers were designed, the first round with a 463bp and the second (semi-nested with a 306bp predicted fragment. The analytical sensitivity was determined by 10-fold serial dilutions of the BCoV Kakegawa strain (HA titre: 256 in DEPC treated ultra-pure water, in fetal bovine serum (FBS and in a BCoV-free fecal suspension, when positive results were found up to the 10-2, 10-3 and 10-7 dilutions, respectively, which suggests that the total amount of RNA in the sample influence the precipitation of pellets by the method of extraction used. When fecal samples was used, a large quantity of total RNA serves as carrier of BCoV RNA, demonstrating a high analytical sensitivity and lack of possible substances inhibiting the PCR. The final semi-nested RT-PCR protocol was applied to 25 fecal samples from adult cows, previously tested by a nested RT-PCR RdRp used as a reference test, resulting in 20 and 17 positives for the first and second tests, respectively, and a substantial agreement was found by kappa statistics (0.694. The high sensitivity and specificity of the new proposed method and the fact that primers were designed based on current BCoV sequences give basis to a more accurate diagnosis of BCoV-caused diseases, as well as to further insights on protocols for the detection of other Coronavirus representatives of both Animal and Public Health importance.O Coronavírus bovino (BCoV pertence ao grupo 2 do gênero Coronavirus (Nidovirales: Coronaviridae e é agente causador de enterites tanto em bezerros como em bovinos adultos, bem como de doen

  16. Two-temperature LATE-PCR endpoint genotyping

    Directory of Open Access Journals (Sweden)

    Reis Arthur H

    2006-12-01

    Full Text Available Abstract Background In conventional PCR, total amplicon yield becomes independent of starting template number as amplification reaches plateau and varies significantly among replicate reactions. This paper describes a strategy for reconfiguring PCR so that the signal intensity of a single fluorescent detection probe after PCR thermal cycling reflects genomic composition. The resulting method corrects for product yield variations among replicate amplification reactions, permits resolution of homozygous and heterozygous genotypes based on endpoint fluorescence signal intensities, and readily identifies imbalanced allele ratios equivalent to those arising from gene/chromosomal duplications. Furthermore, the use of only a single colored probe for genotyping enhances the multiplex detection capacity of the assay. Results Two-Temperature LATE-PCR endpoint genotyping combines Linear-After-The-Exponential (LATE-PCR (an advanced form of asymmetric PCR that efficiently generates single-stranded DNA and mismatch-tolerant probes capable of detecting allele-specific targets at high temperature and total single-stranded amplicons at a lower temperature in the same reaction. The method is demonstrated here for genotyping single-nucleotide alleles of the human HEXA gene responsible for Tay-Sachs disease and for genotyping SNP alleles near the human p53 tumor suppressor gene. In each case, the final probe signals were normalized against total single-stranded DNA generated in the same reaction. Normalization reduces the coefficient of variation among replicates from 17.22% to as little as 2.78% and permits endpoint genotyping with >99.7% accuracy. These assays are robust because they are consistent over a wide range of input DNA concentrations and give the same results regardless of how many cycles of linear amplification have elapsed. The method is also sufficiently powerful to distinguish between samples with a 1:1 ratio of two alleles from samples comprised of

  17. Molecular diagnostic PCR handbook

    International Nuclear Information System (INIS)

    Viljoen, G.J.; Crowther, J.R.; Nel, L.H.

    2005-01-01

    The uses of nucleic acid-directed methods have increased significantly in the past five years and have made important contributions to disease control country programmes for improving national and international trade. These developments include the more routine use of PCR as a diagnostic tool in veterinary diagnostic laboratories. However, there are many problems associated with the transfer and particularly, the application of this technology. These include lack of consideration of: the establishment of quality-assured procedures, the required set-up of the laboratory and the proper training of staff. This can lead to a situation where results are not assured. This book gives a comprehensive account of the practical aspects of PCR and strong consideration is given to ensure its optimal use in a laboratory environment. This includes the setting-up of a PCR laboratory; Good Laboratory Practice and standardised PCR protocols to detect animal disease pathogens. Examples of Standard Operating Procedures as used in individual specialist laboratories and an outline of training materials necessary for PCR technology transfer are presented. The difficulties, advantages and disadvantages in PCR applications are explained and placed in context with other test systems. Emphasis is placed on the use of PCR for detection of pathogens, with a particular focus on diagnosticians and scientists from the developing world. It is hoped that this book will enable readers from various disciplines and levels of expertise to better judge the merits of PCR and to increase their skills and knowledge in order to assist in a more logical, efficient and assured use of this technology

  18. Development of a Rapid and Sensitive Method Combining a Cellulose Ester Microfilter and a Real-Time Quantitative PCR Assay To Detect Campylobacter jejuni and Campylobacter coli in 20 Liters of Drinking Water or Low-Turbidity Waters

    Science.gov (United States)

    Tissier, Adeline; Denis, Martine; Hartemann, Philippe

    2012-01-01

    Investigations of Campylobacter jejuni and Campylobacter coli in samples of drinking water suspected of being at the origin of an outbreak very often lead to negative results. One of the reasons for this failure is the small volume of water typically used for detecting these pathogens (10 to 1,000 ml). The efficiencies of three microfilters and different elution procedures were determined using real-time quantitative PCR to propose a procedure allowing detection of Campylobacter in 20 liters of drinking water or low-turbidity water samples. The results showed that more than 80% of the bacteria inoculated in 1 liter of drinking water were retained on each microfilter. An elution with a solution containing 3% beef extract, 0.05 M glycine at pH 9, combined with direct extraction of the bacterial genomes retained on the cellulose ester microfilter, allowed recovery of 87.3% (±22% [standard deviation]) of Campylobacter per 1 liter of tap water. Recoveries obtained from 20-liter volumes of tap water spiked with a C. coli strain were 69.5% (±10.3%) and 78.5% (±15.1%) for 91 CFU and 36 CFU, respectively. Finally, tests performed on eight samples of 20 liters of groundwater collected from an alluvial well used for the production of drinking water revealed the presence of C. jejuni and C. coli genomes, whereas no bacteria were detected with the normative culture method in volumes ranging from 10 to 1,000 ml. In the absence of available epidemiological data and information on bacterial viability, these last results indicate only that the water resource is not protected from contamination by Campylobacter. PMID:22138985

  19. An allele-specific polymerase chain reaction assay for the ...

    Indian Academy of Sciences (India)

    Unknown

    designated as species A, B (Green and Miles 1980), C. (Subbarao et al 1983), ... onstrated in laboratory feeding experiments on three members of An. .... in Rameshwaram Island and Sri Lanka only) are not pre- sent. For example, in most of ...

  20. An allele-specific polymerase chain reaction assay for the ...

    Indian Academy of Sciences (India)

    Unknown

    designated as species A, B (Green and Miles 1980), C. (Subbarao et al 1983), ... 3 | September 2004. O P Singh et al. 276 able to distinguish species A from species B/C when sin- gle mosquito-extract was diluted to 1/200. However such hybridization assay .... in Rameshwaram Island and Sri Lanka only) are not pre- sent.

  1. Detection and subtyping (H5 and H7) of avian type A influenza virus by reverse transcription-PCR and PCR-ELISA

    DEFF Research Database (Denmark)

    Munch, M.; Nielsen, L.P.; Handberg, Kurt

    2001-01-01

    A. A panel of reference influenza strains from various hosts including avian species, human, swine and horse were evaluated in a one tube RT-PCR using primers designed for the amplification of a 218 bp fragment of the NP gene. The PCR products were detected by PCR-ELISA by use of an internal......Avian influenza virus infections are a major cause of morbidity and rapid identification of the virus has important clinical, economical and epidemiological implications. We have developed a one-tube Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) for the rapid diagnosis of avian influenza...... catching probe confirming the NP influenza A origin. The PCR-ELISA was about 100 times more sensitive than detection of PCR products by agarose gel electrophoresis. RT-PCR and detection by PCR-ELISA is comparable in sensitivity to virus propagation in eggs. We also designed primers for the detection...

  2. DNA extraction method for PCR in mycorrhizal fungi.

    Science.gov (United States)

    Manian, S; Sreenivasaprasad, S; Mills, P R

    2001-10-01

    To develop a simple and rapid DNA extraction protocol for PCR in mycorrhizal fungi. The protocol combines the application of rapid freezing and boiling cycles and passage of the extracts through DNA purification columns. PCR amplifiable DNA was obtained from a number of endo- and ecto-mycorrhizal fungi using minute quantities of spores and mycelium, respectively. DNA extracted following the method, was used to successfully amplify regions of interest from high as well as low copy number genes. The amplicons were suitable for further downstream applications such as sequencing and PCR-RFLPs. The protocol described is simple, short and facilitates rapid isolation of PCR amplifiable genomic DNA from a large number of fungal isolates in a single day. The method requires only minute quantities of starting material and is suitable for mycorrhizal fungi as well as a range of other fungi.

  3. PCR in forensic genetics

    DEFF Research Database (Denmark)

    Morling, Niels

    2009-01-01

    Since the introduction in the mid-1980s of analyses of minisatellites for DNA analyses, a revolution has taken place in forensic genetics. The subsequent invention of the PCR made it possible to develop forensic genetics tools that allow both very informative routine investigations and still more...... and more advanced, special investigations in cases concerning crime, paternity, relationship, disaster victim identification etc. The present review gives an update on the use of DNA investigations in forensic genetics.......Since the introduction in the mid-1980s of analyses of minisatellites for DNA analyses, a revolution has taken place in forensic genetics. The subsequent invention of the PCR made it possible to develop forensic genetics tools that allow both very informative routine investigations and still more...

  4. Evaluation of PCR and multiplex PCR in relation to nested PCR for diagnosing Theileria equi

    Directory of Open Access Journals (Sweden)

    Danielle C. Leal

    2011-07-01

    Full Text Available Conventional PCR (PCRTeq for diagnosing Theileria equi and multiplex PCR (M/PCRTeq-Bc for diagnosing T. equi and Babesia caballi were comparatively evaluated with nested PCR (N/PCR-Teq for diagnosing equine piroplasmosis. In DNA sensitivity determinations, in multiple dilutions of equine blood that had tested positive for T. equi, PCR-Teq and N/PCR-Teq detected hemoparasite DNA in the larger dilutions (1:128, but did not differ significantly from the M/PCRTeq-Bc (1:64. In analyses on equine serum tested by ELISA, there was high agreement between this serological test and PCR-Teq (k = 0.780 and moderate agreement with N/PCR-Teq (k = 0.562 and M/PCRTeq-Bc (k = 0.488. PCR-Teq found a higher frequency of T. equi both in extensively and intensively reared horses, but this was not significant in relation to N/PCR-Teq (P>0.05, and both PCRs indicated that there was an endemic situation regarding T. equi in the population of horses of this sample. PCR-Teq was only significantly different from M/PCR-Teq-Bc (P<0.05. PCR-Teq presented high sensitivity and specificity, comparable to N/PCR-Teq, but with the advantage of higher speed in obtaining results and lower costs and risks of laboratory contamination. This accredits PCR-Teq for epidemiological studies and for determinations on affected horses.

  5. Whole Blood PCR Amplification with Pfu DNA Polymerase and Its Application in Single-Nucleotide Polymorphism Analysis.

    Science.gov (United States)

    Liu, Er-Ping; Wang, Yan; He, Xiao-Hui; Guan, Jun-Jie; Wang, Jin; Qin, Zheng-Hong; Sun, Wan-Ping

    2015-11-01

    Point-of-care genetic analysis may require polymerase chain reaction (PCR) to be carried out on whole blood. However, human blood contains natural inhibitors of PCR such as hemoglobin, immunoglobulin G, lactoferrin, and proteases, as well as anticoagulant agents, including EDTA and heparin that can reduce whole blood PCR efficiency. Our purpose was to develop a highly specific, direct whole blood single-nucleotide polymorphism (SNP) analysis method based on allele-specific (AS) PCR that is mediated by Pfu DNA polymerase and phosphorothioate-modified AS primers. At high Mg(2+) concentrations, Pfu DNA polymerase efficiently amplified genomic DNA in a reaction solution containing up to 14% whole blood. Among the three anticoagulants tested, Pfu DNA polymerase showed the highest activity with sodium citrate. Meanwhile, Triton X-100 and betaine inhibited Pfu DNA polymerase activity in whole blood PCR, whereas trehalose had virtually no effect. These findings provided for the development of a low-cost, simple, and fast direct whole blood genotyping method that uses Pfu DNA polymerase combined with phosphorothioate AS primers for CYP2C9*3 and VKORC1(-1639) loci. With its high DNA amplification efficiency and tolerance of various blood conditions, Pfu DNA polymerase can be used in clinical laboratories to analyze SNPs in whole blood samples.

  6. A multiplex PCR for detection of knockdown resistance mutations, V1016G and F1534C, in pyrethroid-resistant Aedes aegypti.

    Science.gov (United States)

    Saingamsook, Jassada; Saeung, Atiporn; Yanola, Jintana; Lumjuan, Nongkran; Walton, Catherine; Somboon, Pradya

    2017-10-10

    Mutation of the voltage-gated sodium channel (VGSC) gene, or knockdown resistance (kdr) gene, is an important resistance mechanism of the dengue vector Aedes aegypti mosquitoes against pyrethroids. In many countries in Asia, a valine to glycine substitution (V1016G) and a phenylalanine to cysteine substitution (F1534C) are common in Ae. aegypti populations. The G1016 and C1534 allele frequencies have been increasing in recent years, and hence there is a need to have a simple and inexpensive tool to monitor the alleles in large scale. A multiplex PCR to detect V1016G and F1534C mutations has been developed in the current study. This study utilized primers from previous studies for detecting the mutation at position 1016 and newly designed primers to detect variants at position 1534. The PCR conditions were validated and compared with DNA sequencing using known kdr mutant laboratory strains and field collected mosquitoes. The efficacy of this method was also compared with allele-specific PCR (AS-PCR). The results of our multiplex PCR were in complete agreement with sequencing data and better than the AS-PCR. In addition, the efficiency of two non-toxic DNA staining dyes, Ultrapower™ and RedSafe™, were evaluated by comparing with ethidium bromide (EtBr) and the results were satisfactory. Our multiplex PCR method is highly reliable and useful for implementing vector surveillance in locations where the two alleles co-occur.

  7. PCR, exit stage left ...

    CERN Multimedia

    2004-01-01

    The Prevessin Control Room during LEP's start up in 1989. The Prévessin Control Room (PCR) was recently engulfed in a wave of nostalgia. The PCR, scene of some of the greatest moments in CERN's history, is being dismantled to prepare for a complete overhaul. In February 2006, a new combined control centre for all the accelerators will open its doors on the same site, together with a new building currently under construction (see Bulletin issue 27/2004 of 28 June 2004). This marks the end of an important chapter in CERN's history. The Prévessin Control Room saw its first momentous event 28 years ago when the 400 GeV beam for the SPS was commissioned in the presence of Project Leader John Adams. It was also here that the first proton-antiproton collisions were observed, in 1981. Eight years later, in 1989, operators and directors alike jumped for joy at the announcement of the first electron-positron collisions at the start up of LEP, the biggest accelerator in the world. Today the 80 terminals and PCs have b...

  8. Development of RT-PCR and Nested PCR for Detecting Four Quarantine Plant Viruses Belonging to Nepovirus

    Directory of Open Access Journals (Sweden)

    Siwon Lee

    2013-09-01

    Full Text Available For quarantine purpose, we developed the RT- and nested PCR module of Tomato black ring virus (TBRV, Arabis mosaic virus (ArMV, Cherry leafroll virus (CLRV and Grapevine fanleaf virus (GFLV. The PCR modules, developed in this study make diagnosis more convenient and speedy because of same PCR condition. And also, the methods are more accurate because it can check whether the result is contamination or not using the mutation-positive control. We discard or return the 27 cases of Nepovirus infection seed by employing the module past 3 years. This study provides a rapid and useful method for detection of four quarantine plant viruses.

  9. Quantitative (real-time) PCR

    International Nuclear Information System (INIS)

    Denman, S.E.; McSweeney, C.S.

    2005-01-01

    Many nucleic acid-based probe and PCR assays have been developed for the detection tracking of specific microbes within the rumen ecosystem. Conventional PCR assays detect PCR products at the end stage of each PCR reaction, where exponential amplification is no longer being achieved. This approach can result in different end product (amplicon) quantities being generated. In contrast, using quantitative, or real-time PCR, quantification of the amplicon is performed not at the end of the reaction, but rather during exponential amplification, where theoretically each cycle will result in a doubling of product being created. For real-time PCR, the cycle at which fluorescence is deemed to be detectable above the background during the exponential phase is termed the cycle threshold (Ct). The Ct values obtained are then used for quantitation, which will be discussed later

  10. Gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of Japanese encephalitis virus

    International Nuclear Information System (INIS)

    Huang, S-H; Tsai, M-H; Lin, C-W; Yang, T-C; Chuang, P-H; Tsai, I-S; Lu, H-C; Wan Lei; Lin, Y-J; Lai, C-H

    2008-01-01

    Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples

  11. Detection of Bacillus spores using PCR and FTA filters.

    Science.gov (United States)

    Lampel, Keith A; Dyer, Deanne; Kornegay, Leroy; Orlandi, Palmer A

    2004-05-01

    Emphasis has been placed on developing and implementing rapid detection systems for microbial pathogens. We have explored the utility of expanding FTA filter technology for the preparation of template DNA for PCR from bacterial spores. Isolated spores from several Bacillus spp., B. subtilis, B. cereus, and B. megaterium, were applied to FTA filters, and specific DNA products were amplified by PCR. Spore preparations were examined microscopically to ensure that the presence of vegetative cells, if any, did not yield misleading results. PCR primers SRM86 and SRM87 targeted a conserved region of bacterial rRNA genes, whereas primers Bsub5F and Bsub3R amplified a product from a conserved sequence of the B. subtilis rRNA gene. With the use of the latter set of primers for nested PCR, the sensitivity of the PCR-based assay was increased. Overall, 53 spores could be detected after the first round of PCR, and the sensitivity was increased to five spores by nested PCR. FTA filters are an excellent platform to remove PCR inhibitors and have universal applications for environmental, clinical, and food samples.

  12. Peptide nucleic acid probe-based fluorescence melting curve analysis for rapid screening of common JAK2, MPL, and CALR mutations.

    Science.gov (United States)

    Park, Joonhong; Song, Minsik; Jang, Woori; Chae, Hyojin; Lee, Gun Dong; Kim, KyungTak; Park, Heekyung; Kim, Myungshin; Kim, Yonggoo

    2017-02-01

    We developed and evaluated the feasibility of peptide nucleic acid (PNA)-based fluorescence melting curve analysis (FMCA) to detect common mutations in myeloproliferative neoplasms (MPNs). We have set up two separate reactions of PNA-based FMCA: JAK2 V617F &CALR p.Leu367fs*46 (set A) and MPL W515L/K &CALR p.Lys385fs*47 (set B). Clinical usefulness was validated with allele-specific real-time PCR, fragment analysis, Sanger sequencing in 57 BCR-ABL1-negative MPNs. The limit of detection (LOD) of PNA-based FMCA was approximately 10% for each mutation and interference reactions using mixtures of different mutations were not observed. Non-specific amplification was not observed in normal control. PNA-based FMCA was able to detect all JAK2 V617F (n=20), CALR p.Leu367fs*46 (n=10) and p.Lys385fs*47 (n=8). Three of six MPL mutations were detected except three samples with low mutant concentration in out of LOD. JAK2 exon 12 mutations (n=7) were negative without influencing V617F results. Among six variant CALR exon 9 mutations, two were detected by this method owing to invading of probe binding site. PNA-based FMCA for detecting common JAK2, MPL, and CALR mutations is a rapid, simple, and sensitive technique in BCR-ABL1-negative MPNs with >10% mutant allele at the time of initial diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. One-stop polymerase chain reaction (PCR): An improved PCR ...

    African Journals Online (AJOL)

    Yomi

    2011-12-21

    Dec 21, 2011 ... membrane filtration was carried out with a commercial PCR product purification kit (Generay, Shanghai), according to the manufacture's instruction. In brief, 50 µl PCR product was mixed thoroughly with binding buffer, and the resultant mixture was loaded directly onto a silica membrane Gelclean column.

  14. One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus, and canine kobuvirus.

    Science.gov (United States)

    Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo

    2018-01-23

    To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.

  15. A multiplex PCR for detection of six viruses in ducks.

    Science.gov (United States)

    Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong

    2017-10-01

    In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.

  16. COMPARISON OF 16S rRNA-PCR-RFLP, LipL32-PCR AND OmpL1-PCR METHODS IN THE DIAGNOSIS OF LEPTOSPIROSIS

    Directory of Open Access Journals (Sweden)

    Tülin GÜVEN GÖKMEN

    Full Text Available SUMMARY Leptospirosis is still one of the most important health problems in developing countries located in humid tropical and subtropical regions. Human infections are generally caused by exposure to water, soil or food contaminated with the urine of infected wild and domestic animals such as rodents and dogs. The clinical course of leptospirosis is variable and may be difficult to distinguish from many other infectious diseases. The dark-field microscopy (DFM, serology and nucleic acid amplification techniques are used to diagnose leptospirosis, however, a distinctive standard reference method is still lacking. Therefore, in this study, we aimed to determine the presence of Leptospira spp., to differentiate the pathogenic L. interrogans and the non-pathogenic L. biflexa, and also to determine the sensitivity and specificity values of molecular methods as an alternative to conventional ones. A total of 133 serum samples, from 47 humans and 86 cattle were evaluated by two conventional tests: the Microagglutination Test (MAT and the DFM, as well as three molecular methods, the 16S rRNA-PCR followed by Restriction Fragment Lenght Polymorphism (RFLP of the amplification products 16S rRNA-PCR-RFLP, LipL32-PCR and OmpL1-PCR. In this study, for L. interrogans, the specificity and sensitivity rates of the 16S rRNA-PCR and the LipL32-PCR were considered similar (100% versus 98.25% and 100% versus 98.68%, respectively. The OmpL1-PCR was able to classify L. interrogans into two intergroups, but this PCR was less sensitive (87.01% than the other two PCR methods. The 16S rRNA-PCR-RFLP could detect L. biflexa DNA, but LipL32-PCR and OmpL1-PCR could not. The 16S rRNA-PCR-RFLP provided an early and accurate diagnosis and was able to distinguish pathogenic and non-pathogenic Leptospira species, hence it may be used as an alternative method to the conventional gold standard techniques for the rapid disgnosis of leptospirosis.

  17. IDENTIFIKASI TIPE HLA KELAS II DENGAN TEKNIK PCR

    Directory of Open Access Journals (Sweden)

    Ervi Salwati

    2012-09-01

    Full Text Available HLA (Human Leukocyte Antigen contains a set of genes located together on the short arm of chromosome 6. These genes control immune responses, graft acceptance or rejection and tumor surveillance. These abilities have close relationship with genetic variation (occur in "many forms" or alleles that bind and present antigens to T lymphocytes. Using advanced technology and molecular biology approaches (PCR technique detection of genetic variation in the HLA region (or HLA typing has been performed based on DNA.. PCR is an in vitro technique to amplify the DNA sequence enzymatically. "Sequence Specific Primers" (SSP are designed for this PCR to obtain amplification of specific alleles or groups of alleles. The PCR products are visualized through agarose gel electrophoresis stained with ethidium bromide. The PCR technique requires small amount of whole blood (0.5 - 1 ml, gives rapid, accurate and complete result. This paper discuss identification of HLA class II typing using PCR-SSP technique and show the examples of the results.   Key words: HLA (Human Leukocyte Antigen class II, PCR (Polymerase Chain Reaction

  18. Pure chromosome-specific PCR libraries from single sorted chromosomes

    NARCIS (Netherlands)

    VanDevanter, D. R.; Choongkittaworn, N. M.; Dyer, K. A.; Aten, J. A.; Otto, P.; Behler, C.; Bryant, E. M.; Rabinovitch, P. S.

    1994-01-01

    Chromosome-specific DNA libraries can be very useful in molecular and cytogenetic genome mapping studies. We have developed a rapid and simple method for the generation of chromosome-specific DNA sequences that relies on polymerase chain reaction (PCR) amplification of a single flow-sorted

  19. Digital PCR: A brief history

    OpenAIRE

    Morley, Alexander A.

    2014-01-01

    Digital PCR for quantification of a target of interest has been independently developed several times, being described in 1990 and 1991 using the term “limiting dilution PCR” and in 1999 using the term “digital PCR”. It came into use in the decade following its first development but its use was cut short by the description of real-time PCR in 1996. However digital PCR has now had a renaissance due to the recent development of new instruments and chemistry which have made it a much simpler and...

  20. Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR.

    Science.gov (United States)

    Tyson, Jess; Armour, John A L

    2012-12-11

    Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in) regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example.

  1. Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR

    Directory of Open Access Journals (Sweden)

    Tyson Jess

    2012-12-01

    Full Text Available Abstract Background Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. Results In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. Conclusion This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example.

  2. Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

    Directory of Open Access Journals (Sweden)

    U. Pagnini

    2010-02-01

    Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

  3. Multiplex Amplification Refractory Mutation System PCR (ARMS-PCR) provides sequencing independent typing of canine parvovirus.

    Science.gov (United States)

    Chander, Vishal; Chakravarti, Soumendu; Gupta, Vikas; Nandi, Sukdeb; Singh, Mithilesh; Badasara, Surendra Kumar; Sharma, Chhavi; Mittal, Mitesh; Dandapat, S; Gupta, V K

    2016-12-01

    Canine parvovirus-2 antigenic variants (CPV-2a, CPV-2b and CPV-2c) ubiquitously distributed worldwide in canine population causes severe fatal gastroenteritis. Antigenic typing of CPV-2 remains a prime focus of research groups worldwide in understanding the disease epidemiology and virus evolution. The present study was thus envisioned to provide a simple sequencing independent, rapid, robust, specific, user-friendly technique for detecting and typing of presently circulating CPV-2 antigenic variants. ARMS-PCR strategy was employed using specific primers for CPV-2a, CPV-2b and CPV-2c to differentiate these antigenic types. ARMS-PCR was initially optimized with reference positive controls in two steps; where first reaction was used to differentiate CPV-2a from CPV-2b/CPV-2c. The second reaction was carried out with CPV-2c specific primers to confirm the presence of CPV-2c. Initial validation of the ARMS-PCR was carried out with 24 sequenced samples and the results were matched with the sequencing results. ARMS-PCR technique was further used to screen and type 90 suspected clinical samples. Randomly selected 15 suspected clinical samples that were typed with this technique were sequenced. The results of ARMS-PCR and the sequencing matched exactly with each other. The developed technique has a potential to become a sequencing independent method for simultaneous detection and typing of CPV-2 antigenic variants in veterinary disease diagnostic laboratories globally. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Development of a PCR/LDR/flow-through hybridization assay using a capillary tube, probe DNA-immobilized magnetic beads and chemiluminescence detection.

    Science.gov (United States)

    Hommatsu, Manami; Okahashi, Hisamitsu; Ohta, Keisuke; Tamai, Yusuke; Tsukagoshi, Kazuhiko; Hashimoto, Masahiko

    2013-01-01

    A polymerase chain reaction (PCR)/ligase detection reaction (LDR)/flow-through hybridization assay using chemiluminescence (CL) detection was developed for analyzing point mutations in gene fragments with high diagnostic value for colorectal cancers. A flow-through hybridization format using a capillary tube, in which probe DNA-immobilized magnetic beads were packed, provided accelerated hybridization kinetics of target DNA (i.e. LDR product) to the probe DNA. Simple fluid manipulations enabled both allele-specific hybridization and the removal of non-specifically bound DNA in the wash step. Furthermore, the use of CL detection greatly simplified the detection scheme, since CL does not require a light source for excitation of the fluorescent dye tags on the LDR products. Preliminary results demonstrated that this analytical system could detect both homozygous and heterozygous mutations, without the expensive instrumentation and cumbersome procedures required by conventional DNA microarray-based methods.

  5. OPPORTUNISTIC ASPERGILLUS PATHOGENS MEASURED IN HOME AND HOSPITAL TAP WATER BY MOLD SPECIFIC QUANTITATIVE PCR (MSQPCR)

    Science.gov (United States)

    Opportunistic fungal pathogens are a concern because of the increasing number of immunocompromised patients. The goal of this research was to test a simple extraction method and rapid quantitative PCR (QPCR) measurement of the occurrence of potential pathogens, Aspergillus fumiga...

  6. Detection of hepatitis C virus RNA using reverse transcription PCR

    International Nuclear Information System (INIS)

    Yap, S.F.

    1998-01-01

    Detection of the viral genome (HCV RNA) is by a combination of cDNA synthesis and PCR followed by gel analysis and/or hybridization assay. In principle, cDNA is synthesized using the viral RNA as template and the enzyme, reverse transcriptase. The cDNA is then amplified by PCR and the product detected. Agarose gel electrophoresis provides a rapid and simple detection method; however, it is non-quantitative. The assay protocol described in this paper is adapted from that published by Chan et al. Comments on various aspects of the assay are based on experience with the method in our laboratory

  7. Increased detection of mastitis pathogens by real-time PCR compared to bacterial culture.

    Science.gov (United States)

    Keane, O M; Budd, K E; Flynn, J; McCoy, F

    2013-09-21

    Rapid and accurate identification of mastitis pathogens is important for disease control. Bacterial culture and isolate identification is considered the gold standard in mastitis diagnosis but is time consuming and results in many culture-negative samples. Identification of mastitis pathogens by PCR has been proposed as a fast and sensitive alternative to bacterial culture. The results of bacterial culture and PCR for the identification of the aetiological agent of clinical mastitis were compared. The pathogen identified by traditional culture methods was also detected by PCR in 98 per cent of cases indicating good agreement between the positive results of bacterial culture and PCR. A mastitis pathogen could not be recovered from approximately 30 per cent of samples by bacterial culture, however, an aetiological agent was identified by PCR in 79 per cent of these samples. Therefore, a mastitis pathogen was detected in significantly more milk samples by PCR than by bacterial culture (92 per cent and 70 per cent, respectively) although the clinical relevance of PCR-positive culture-negative results remains controversial. A mixed infection of two or more mastitis pathogens was also detected more commonly by PCR. Culture-negative samples due to undetected Staphylococcus aureus infections were rare. The use of PCR technology may assist in rapid mastitis diagnosis, however, accurate interpretation of PCR results in the absence of bacterial culture remains problematic.

  8. Detection of Legionella species in environmental water by the quantitative PCR method in combination with ethidium monoazide treatment.

    Science.gov (United States)

    Inoue, Hiroaki; Takama, Tomoko; Yoshizaki, Miwa; Agata, Kunio

    2015-01-01

    We detected Legionella species in 111 bath water samples and 95 cooling tower water samples by using a combination of conventional plate culture, quantitative polymerase chain reaction (qPCR) and qPCR combined with ethidium monoazide treatment (EMA-qPCR) methods. In the case of bath water samples, Legionella spp. were detected in 30 samples by plate culture, in 85 samples by qPCR, and in 49 samples by EMA-qPCR. Of 81 samples determined to be Legionella-negative by plate culture, 56 and 23 samples were positive by qPCR and EMA-qPCR, respectively. Therefore, EMA treatment decreased the number of Legionella-positive bath water samples detected by qPCR. In contrast, EMA treatment had no effect on cooling tower water samples. We therefore expect that EMA-qPCR is a useful method for the rapid detection of viable Legionella spp. from bath water samples.

  9. Identification of periodontopathogen microorganisms by PCR technique

    Directory of Open Access Journals (Sweden)

    Milićević Radovan

    2008-01-01

    Full Text Available INTRODUCTION Periodontitis is an inflammatory disease of the supporting tissues of teeth and is a major cause of tooth loss in adults. The onset and progression of periodontal disease is attributed to the presence of elevated levels of a consortium of pathogenic bacteria. Gram negative bacteria, mainly strict anaerobes, play the major role. OBJECTIVE The present study aimed to assess the presence of the main types of microorganisms involved in the aetiopathogenesis of periodontal disease: Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, Eikenella corrodens, Treponema denticola, Tanerella forsythia and Prevotella intermedia in different samples collected from the oral cavity of 90 patients diagnosed with periodontitis. METHOD Bacterial DNA detection was performed in diverse biological materials, namely in dental plaque, gingival tissue and saliva, by means of multiplex PCR, a technique that allows simultaneous identification of two different bacterial genomes. RESULTS In the dental plaque of the periodontitis patients, Treponema denticola dominated. In the gingival tissue, Tannerella forsythia and Treponema denticola were the microbiota most frequently detected, whilst in saliva Treponema denticola and Eikenella corrodens were found with the highest percentage. CONCLUSION The identification of microorganisms by multiplex PCR is specific and sensitive. Rapid and precise assessment of different types of periodontopathogens is extremely important for early detection of the infection and consequently for the prevention and treatment of periodontal disease. In everyday clinical practice, for routine bacterial evaluation in patients with periodontal disease, the dental plaque is the most suitable biological material, because it is the richest in periodontal bacteria.

  10. Species Identification of Fox-, Mink-, Dog-, and Rabbit-Derived Ingredients by Multiplex PCR and Real-Time PCR Assay.

    Science.gov (United States)

    Wu, Qingqing; Xiang, Shengnan; Wang, Wenjun; Zhao, Jinyan; Xia, Jinhua; Zhen, Yueran; Liu, Bang

    2018-05-01

    Various detection methods have been developed to date for identification of animal species. New techniques based on PCR approach have raised the hope of developing better identification methods, which can overcome the limitations of the existing methods. PCR-based methods used the mitochondrial DNA (mtDNA) as well as nuclear DNA sequences. In this study, by targeting nuclear DNA, multiplex PCR and real-time PCR methods were developed to assist with qualitative and quantitative analysis. The multiplex PCR was found to simultaneously and effectively distinguish four species (fox, dog, mink, and rabbit) ingredients by the different sizes of electrophoretic bands: 480, 317, 220, and 209 bp. Real-time fluorescent PCR's amplification profiles and standard curves showed good quantitative measurement responses and linearity, as indicated by good repeatability and coefficient of determination R 2  > 0.99. The quantitative results of quaternary DNA mixtures including mink, fox, dog, and rabbit DNA are in line with our expectations: R.D. (relative deviation) varied between 1.98 and 12.23% and R.S.D. (relative standard deviation) varied between 3.06 and 11.51%, both of which are well within the acceptance criterion of ≤ 25%. Combining the two methods is suitable for the rapid identification and accurate quantification of fox-, dog-, mink-, and rabbit-derived ingredients in the animal products.

  11. Analysis of ELA-DQB exon 2 polymorphism in Argentine Creole horses by PCR-RFLP and PCR-SSCP.

    Science.gov (United States)

    Villegas-Castagnasso, E E; Díaz, S; Giovambattista, G; Dulout, F N; Peral-García, P

    2003-08-01

    The second exon of equine leucocyte antigen (ELA)-DQB genes was amplified from genomic DNA of 32 Argentine Creole horses by PCR. Amplified DNA was analysed by PCR-restriction fragment length polymorphism (RFLP) and PCR-single-strand conformation polymorphism (SSCP). The PCR-RFLP analysis revealed two HaeIII patterns, four RsaI patterns, five MspI patterns and two HinfI patterns. EcoRI showed no variation in the analysed sample. Additional patterns that did not account for known exon 2 DNA sequences were observed, suggesting the existence of novel ELA-DQB alleles. PCR-SSCP analysis exhibited seven different band patterns, and the number of bands per animal ranged from four to nine. Both methods indicated that at least two DQB genes are present. The presence of more than two alleles in each animal showed that the primers employed in this work are not specific for a unique DQB locus. The improvement of this PCR-RFLP method should provide a simple and rapid technique for an accurate definition of ELA-DQB typing in horses.

  12. Methylation-Specific PCR Unraveled

    Directory of Open Access Journals (Sweden)

    Sarah Derks

    2004-01-01

    Full Text Available Methylation‐specific PCR (MSP is a simple, quick and cost‐effective method to analyze the DNA methylation status of virtually any group of CpG sites within a CpG island. The technique comprises two parts: (1 sodium bisulfite conversion of unmethylated cytosine's to uracil under conditions whereby methylated cytosines remains unchanged and (2 detection of the bisulfite induced sequence differences by PCR using specific primer sets for both unmethylated and methylated DNA. This review discusses the critical parameters of MSP and presents an overview of the available MSP variants and the (clinical applications.

  13. Phylogenetic Analysis and Molecular Characterization of Xanthium sibiricum Using DNA Barcoding, PCR-RFLP, and Specific Primers.

    Science.gov (United States)

    Tomasello, Salvatore; Heubl, Günther

    2017-07-01

    The fruits of Xanthium sibiricum have been widely used in traditional Chinese medicine for the treatment of nasal sinusitis and headaches. The genus Xanthium (cocklebur) is a taxonomically complex genus. Different taxonomic concepts have been proposed, some including several species, others lumping the different taxa in a few extremely polymorphic species. Due to the morphological similarities between species, the correct authentication of X. sibiricum is very difficult. Therefore, we established a polymerase chain reaction-restriction fragment length polymorphism method and diagnostic PCR based on nuclear internal transcribed spacer and chloroplast trnQ-rps16 barcodes to differentiate X. sibirium from related species.Results from the phylogenetic analyses based on sequence information from four marker regions (plastidal psbA-trnH and trnQ-rps16 and nuclear ITS and D35 ) support those taxonomic concepts accepting a reduced number of species, as four to five major clades are revealed in the phylogenetic reconstructions. X. sibiricum , together with some accessions from closely related taxa, is always supported as monophyletic, constituting a well-defined genetic entity. Allele-specific primer pairs for ITS and trnQ-rps16 were designed to amplify diagnostic products from the genomic DNA of X. sibiricum . Specific PCR in combination with digestion using the restriction enzyme Mse I allowed for the identification of X. sibiricum by producing specific restriction patterns. The results demonstrate that the applied techniques provide effective and accurate authentication of X. sibiricum . Georg Thieme Verlag KG Stuttgart · New York.

  14. pcr

    African Journals Online (AJOL)

    DR. AMINU

    Keywords: Polymerase chain reaction, Diagnosis, Bacteria, Infections. INTRODUCTION ... used to amplify a piece of DNA by in-vitro enzymatic replication (David and .... receiving antimicrobial treatment, or when the causative agents are small ...

  15. Detection of a putative virulence cadF gene of Campylobacter jejuni obtained from different sources using a microfabricated PCR chip

    DEFF Research Database (Denmark)

    Poulsen, Claus Riber; El-Ali, Jamil; Perch-Nielsen, Ivan R.

    2005-01-01

    A microfabricated polymerase chain reaction (PCR) chip made of epoxy-based photoresist (SU-8) was recently designed and developed. In this study, we tested whether the PCR chip could be used for rapid detection of a potential virulence determinant, the cadF gene of Campylobacter jejuni. PCR...... was performed using published PCR conditions and primers for the C. jejuni cadF gene. DNA isolated from a C. jejuni reference strain CCUG 11284, C. jejuni isolates obtained from different sources (chicken and human), and Campylobacter whole cells were used as templates in the PCR tests. Conventional PCR in tube...... was used as the control. After optimization of the PCR chip, PCR positives on the chip were obtained from 91.0% (10/11) of the tested chips. A fast transition time was achieved with the PCR chip, and therefore a faster cycling time and a shorter PCR program were obtained. Using the PCR chip, the cadF gene...

  16. Multiplex PCR assay for simultaneous detection of six major bacterial pathogens of rice.

    Science.gov (United States)

    Cui, Z; Ojaghian, M R; Tao, Z; Kakar, K U; Zeng, J; Zhao, W; Duan, Y; Vera Cruz, C M; Li, B; Zhu, B; Xie, G

    2016-05-01

    The aim of this study was to develop a multiplex PCR (mPCR) assay for rapid, sensitive and simultaneous detection of six important rice pathogens: Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, Pseudomonas fuscovaginae, Burkholderia glumae, Burkholderia gladioli and Acidovorax avenae subsp. avenae. Specific primers were designed through a bioinformatics pipeline. Sensitivity of detection was established using both traditional PCR and quantitative real-time PCR on isolated DNA and on bacterial cells both in vitro and in simulated diseased seeds and the parameters were optimized for an mPCR assay. A total of 150 bacterial strains were tested for specificity. The mPCR assay accurately predicted the presence of pathogens among 44 symptomatic and asymptomatic rice seed, sheath and leaf samples. This study confirmed that this mPCR assay is a rapid, reliable and simple tool for the simultaneous detection of six important rice bacterial pathogens. This study is the first report of a method allowing simultaneous detection of six major rice pathogens. The ability to use crude extracts from plants without bacterial isolation or DNA extraction enhances the value of this mPCR technology for rapid detection and aetiological/epidemiological studies. © 2016 The Society for Applied Microbiology.

  17. PCR-based methods for the detection of L1014 kdr mutation in Anopheles culicifacies sensu lato

    Science.gov (United States)

    Singh, Om P; Bali, Prerna; Hemingway, Janet; Subbarao, Sarala K; Dash, Aditya P; Adak, Tridibes

    2009-01-01

    Background Anopheles culicifacies s.l., a major malaria vector in India, has developed widespread resistance to DDT and is becoming resistant to pyrethroids–the only insecticide class recommended for the impregnation of bed nets. Knock-down resistance due to a point mutation in the voltage gated sodium channel at L1014 residue (kdr) is a common mechanism of resistance to DDT and pyrethroids. The selection of this resistance may pose a serious threat to the success of the pyrethroid-impregnated bed net programme. This study reports the presence of kdr mutation (L1014F) in a field population of An. culicifacies s.l. and three new PCR-based methods for kdr genotyping. Methods The IIS4-IIS5 linker to IIS6 segments of the para type voltage gated sodium channel gene of DDT and pyrethroid resistant An. culicifacies s.l. population from the Surat district of India was sequenced. This revealed the presence of an A-to-T substitution at position 1014 leading to a leucine-phenylalanine mutation (L1014F) in a few individuals. Three molecular methods viz. Allele Specific PCR (AS-PCR), an Amplification Refractory Mutation System (ARMS) and Primer Introduced Restriction Analysis-PCR (PIRA-PCR) were developed and tested for kdr genotyping. The specificity of the three assays was validated following DNA sequencing of the samples genotyped. Results The genotyping of this An. culicifacies s.l. population by the three PCR based assays provided consistent result and were in agreement with DNA sequencing result. A low frequency of the kdr allele mostly in heterozygous condition was observed in the resistant population. Frequencies of the different genotypes were in Hardy-Weinberg equilibrium. Conclusion The Leu-Phe mutation, which generates the kdr phenotype in many insects, was detected in a pyrethroid and DDT resistant An. culicifacies s.l. population. Three PCR-based methods were developed for kdr genotyping. All the three assays were specific. The ARMS method was refractory to non

  18. PCR-based methods for the detection of L1014 kdr mutation in Anopheles culicifacies sensu lato

    Directory of Open Access Journals (Sweden)

    Dash Aditya P

    2009-07-01

    Full Text Available Abstract Background Anopheles culicifacies s.l., a major malaria vector in India, has developed widespread resistance to DDT and is becoming resistant to pyrethroids–the only insecticide class recommended for the impregnation of bed nets. Knock-down resistance due to a point mutation in the voltage gated sodium channel at L1014 residue (kdr is a common mechanism of resistance to DDT and pyrethroids. The selection of this resistance may pose a serious threat to the success of the pyrethroid-impregnated bed net programme. This study reports the presence of kdr mutation (L1014F in a field population of An. culicifacies s.l. and three new PCR-based methods for kdr genotyping. Methods The IIS4-IIS5 linker to IIS6 segments of the para type voltage gated sodium channel gene of DDT and pyrethroid resistant An. culicifacies s.l. population from the Surat district of India was sequenced. This revealed the presence of an A-to-T substitution at position 1014 leading to a leucine-phenylalanine mutation (L1014F in a few individuals. Three molecular methods viz. Allele Specific PCR (AS-PCR, an Amplification Refractory Mutation System (ARMS and Primer Introduced Restriction Analysis-PCR (PIRA-PCR were developed and tested for kdr genotyping. The specificity of the three assays was validated following DNA sequencing of the samples genotyped. Results The genotyping of this An. culicifacies s.l. population by the three PCR based assays provided consistent result and were in agreement with DNA sequencing result. A low frequency of the kdr allele mostly in heterozygous condition was observed in the resistant population. Frequencies of the different genotypes were in Hardy-Weinberg equilibrium. Conclusion The Leu-Phe mutation, which generates the kdr phenotype in many insects, was detected in a pyrethroid and DDT resistant An. culicifacies s.l. population. Three PCR-based methods were developed for kdr genotyping. All the three assays were specific. The ARMS method

  19. Parallel susceptibility testing of bacteria through culture-quantitative PCR in 96-well plates

    Directory of Open Access Journals (Sweden)

    Jun Luo

    2018-05-01

    Full Text Available Objective: The methods combining culture and quantitative PCR(qPCR offer new solutions for rapid antibiotic susceptibility testing(AST. However, the multiple steps of DNA extraction and cold storage of PCR reagents needed make them unsuitable for rapid high throughput AST. In this study, a parallel culture-qPCR method was developed to overcome above problems. Method: In this method, bacteria culture and DNA extraction automatically and simultaneously completed through using a common PCR instrument as a controllable heating device. A lyophilized 16S rDNA targeted qPCR reagent was also developed, which was stable and could be kept at 4 °C for long time and at 37 °C for about two months. Result: Testing of 36 P. aeruginosa isolates and 28 S. aureus isolates showed that the method had good agreements with the standard broth microdilution method, with an overall agreement of 97.22% (95% CI, 85.83–99.51 for P. aeruginosa and 96.43% (95% CI, 79.76–99.81 for S. aureus. This method could test 12 samples against a panel of up to 7 antibiotics simultaneously in two 96-well PCR plates within 4 h, which greatly improves the testing efficiency of the culture-qPCR method. Conclusion: With rapidness to obtain results and the capabilities for automation and multiple-sample testing, the parallel culture-qPCR method would have great potentials in clinical labs. Keywords: Antibiotic susceptibility testing, Thermo-cold lysis, Lyophilized qPCR reagent, Quantitative PCR, Bacteria

  20. an overview on the application of polymerase chain reaction (pcr)

    African Journals Online (AJOL)

    DR. AMINU

    Hill New York Pp818. Chul, W.P., Jang-Hee, H., Jin-Hyeok, J. et al (2004). Detection rates of Bacteria in chronic Otitis. Media with Effusion in Children, Journal of. Korean Medical Sciences 19: 735-738. Cockerill, F.R. and Smith, T.F. (2002). Rapid-Cycle real time PCR: A revolution of clinical. Microbiology. ASM News 68:2.

  1. Using molecular techniques for rapid detection of Salmonella ...

    African Journals Online (AJOL)

    PRECIOUS

    2010-02-01

    Feb 1, 2010 ... A total of 152 samples of chicken and chicken products ... detection of Salmonella species in the collected field samples ... that 16 million new cases of typhoid fever occur each ... vative methods for the rapid identification of Salmonella ... saved for the PCR-Non Selective test (PCR-NS) and 1 ml of the.

  2. Development of single step RT-PCR for detection of Kyasanur forest disease virus from clinical samples

    Directory of Open Access Journals (Sweden)

    Gouri Chaubal

    2018-02-01

    Discussion and conclusion: The previously published sensitive real time RT-PCR assay requires higher cost in terms of reagents and machine setup and technical expertise has been the primary reason for development of this assay. A single step RT-PCR is relatively easy to perform and more cost effective than real time RT-PCR in smaller setups in the absence of Biosafety Level-3 facility. This study reports the development and optimization of single step RT-PCR assay which is more sensitive and less time-consuming than nested RT-PCR and cost effective for rapid diagnosis of KFD viral RNA.

  3. Quantification of viable bacteria in wastewater treatment plants by using propidium monoazide combined with quantitative PCR (PMA-qPCR).

    Science.gov (United States)

    Li, Dan; Tong, Tiezheng; Zeng, Siyu; Lin, Yiwen; Wu, Shuxu; He, Miao

    2014-02-01

    The detection of viable bacteria in wastewater treatment plants (WWTPs) is very important for public health, as WWTPs are a medium with a high potential for waterborne disease transmission. The aim of this study was to use propidium monoazide (PMA) combined with the quantitative polymerase chain reaction (PMA-qPCR) to selectively detect and quantify viable bacteria cells in full-scale WWTPs in China. PMA was added to the concentrated WWTP samples at a final concentration of 100 micromol/L and the samples were incubated in the dark for 5 min, and then lighted for 4 min prior to DNA extraction and qPCR with specific primers for Escherichia coli and Enterococci, respectively. The results showed that PMA treatment removed more than 99% of DNA from non-viable cells in all the WWTP samples, while matrices in sludge samples markedly reduced the effectiveness of PMA treatment. Compared to qPCR, PMA-qPCR results were similar and highly linearly correlated to those obtained by culture assay, indicating that DNA from non-viable cells present in WWTP samples can be eliminated by PMA treatment, and that PMA-qPCR is a reliable method for detection of viable bacteria in environmental samples. This study demonstrated that PMA-qPCR is a rapid and selective detection method for viable bacteria in WWTP samples, and that WWTPs have an obvious function in removing both viable and non-viable bacteria. The results proved that PMA-qPCR is a promising detection method that has a high potential for application as a complementary method to the standard culture-based method in the future.

  4. Development of SCAR markers and PCR assays for single or simultaneous species-specific detection of Phytophthora nicotianae and Pythium helicoides in ebb-and-flow irrigated kalanchoe.

    Science.gov (United States)

    Ahonsi, Monday O; Ling, Yin; Kageyama, Koji

    2010-11-01

    Phytophthora nicotianae and Pythium helicoides are important water-borne oomycete pathogens of irrigated ornamentals particularly ebb-and-flow irrigated kalanchoe in Japan. We developed novel PCR-based sequence characterized amplified region markers and assays for rapid identification and species-specific detection of both pathogens in separate PCR reactions or simultaneously in a duplex PCR.

  5. Two-temperature PCR for Microfluidics

    KAUST Repository

    Kodzius, Rimantas

    2010-05-01

    Since its invention in 1983, polymerase chain reaction (PCR) has been the method of choice for DNA amplification. Successful PCR depends on the optimization of several parameters, which is a cumbersome task due to the many variables (conditions and compon

  6. Two-temperature PCR for Microfluidics

    KAUST Repository

    Kodzius, Rimantas; Chang, Donald Choy; Sheng, Ping; Wen, Weijia; Wu, Jinbo; Xiao, Kang; Yu, Vivian

    2010-01-01

    Since its invention in 1983, polymerase chain reaction (PCR) has been the method of choice for DNA amplification. Successful PCR depends on the optimization of several parameters, which is a cumbersome task due to the many variables (conditions and compon

  7. Comparison of PCR with Standard Method (MPN for detection of bacterial contamination in drinking water

    Directory of Open Access Journals (Sweden)

    Fatemeh Dehghan

    2014-11-01

    Full Text Available Background: Detection of bacterial contamination in drinking water by culture method is a time and cost consuming method and spends a few days depending on contamination degree. However, the people use the tap water during that time. Molecular methods are rapid and sensitive. In this study a rapid Multiplex PCR method was used for rapid analysis both coliform bacteria and E.coli, and probable detection of VBNC bacteria in drinking water, the experiments were performed in bacteriological lab of water and Wastewater Corporation in Markazi province. Material and Methods:Amplification of a fragment from each of lacZ and uidA genes in a Multiplex PCR was used for detection of coliforms. Eight samples was taken from Arak drinking water system including 36 samples of wells, 41 samples of water distribution network and 3 samples from water storages were examined by amplification of lacZ and uidA genes in a Multiplex PCR. Equivalently, the MPN test was applied as a standard method for all samples for comparison of results. Standard bacteria, pure bacteria isolated from positive MPN and CRM were examined by PCR and MPN method. Results: The result of most samples water network, water storages, and water well were same in both MPN and PCR method .The results of standard bacteria and pure cultures of bacteria isolated from positive MPN and CRM confirmed the PCR method. Five samples were positive in PCR but negative in MPN method. Duration time of PCR was decreased about 105 min by changing the PCR program and electrophoreses factors. Conclusion: The Multiplex PCR can detect coliform bacteria and E.coli synchronous in drinking water.

  8. Inhibitory effect of common microfluidic materials on PCR outcome

    KAUST Repository

    Kodzius, Rimantas

    2012-02-20

    compatibility of various materials commonly used while producing microfluidic devices is also pertinent and beneficial to other enzymatic reactions in microfluidic devices. Most PCR-friendly materials exhibit similar signals regardless of the inclusion or not of BSA in the PCR mixture; these materials are PP, PTFE, PDMS, wax (Tm 80°C), SiO2 quartz, pyrex and soda-lime glasses, NOA68, and mineral oil. Our results showed that there was near total adsorption of template DNA when the wax (Tm 60°C) was used (RBI = 9.2×101). In contrast, when NOA61, mineral oil and acrylic glue materials were employed, significant adsorption occurred (RBI < 1.5×103). The polymerase-inhibition experiments indicate that following materials do not have strong effects (RBI > 1.1×103) on polymerase: PC, PP, PTFE, PDMS, silicon with a layer of 560 nm SiO2, SiO2 quartz, pyrex, and soda-lime glass. Slight polymerase inhibition (RBI < 9.2×102) was observed with PMMA, PVC, waxes (Tm 56°C and 80°C), silicon, and NOA68. A very strong or near total inhibition (RBI < 1.8×102) was observed with wax (Tm 60°C), ITO glass, SU-8, NOA61, metal tubes, mineral oil, epoxy, and the acrylic glues. \\tOur results show that material selection for microfluidic PCR chips, which are characterized by large SAVR, is a vital part of optimizing PCR outcome. This study of the inhibitory effect of various common microfluidics materials has provided a new rapid testing method using only a PCR cycler, and it has confirmed and expanded the list of tested materials. The type of PCR compatibility test enables the most effectual choice of materials for use in biology-related experiments.

  9. Pathogen Causing Disease of Diagnosis PCR Tecnology

    OpenAIRE

    SEVİNDİK, Emre; KIR, A. Çağrı; BAŞKEMER, Kadir; UZUN, Veysel

    2013-01-01

    Polimerase chain reaction (PCR) with which, the development of recombinant DNA tecnology, a technique commonly used in field of moleculer biology and genetic. Duplication of the target DNA is provided with this technique without the need for cloning. Some fungus species, bacteria, viruses constitutent an important group of pathogenicity in human, animals and plants. There are routinely applied types of PCR in the detection of pathogens infections diseases. These Nested- PCR, Real- Time PCR, M...

  10. PCR deduction of invasive and colonizing pneumococcal serotypes from Venezuela: a critical appraisal.

    Science.gov (United States)

    Bello Gonzalez, Teresita; Rivera-Olivero, Ismar Alejandra; Sisco, María Carolina; Spadola, Enza; Hermans, Peter W; de Waard, Jacobus H

    2014-04-15

    Serotype surveillance of Streptococcus pneumoniae is indispensable for evaluating the potential impact of pneumococcal conjugate vaccines. Serotyping by the standard Quellung reaction is technically demanding, time consuming, and expensive. A simple and economical strategy is multiplex PCR-based serotyping. We evaluated the cost effectiveness of a modified serial multiplex PCR (mPCR), resolving 24 serotypes in four PCR reactions and optimally targeting the most prevalent invasive and colonizing pneumococcal serotypes found in Venezuela. A total of 223 pneumococcal isolates, 140 invasive and 83 carriage isolates, previously serotyped by the Quellung reaction and representing the 18 most common serotypes/groups identified in Venezuela, were serotyped with the adapted mPCR. The mPCR serotyped 76% of all the strains in the first two PCR reactions and 91% after four reactions, correctly identifying 17 serotypes/groups. An isolate could be serotyped with mPCR in less than 2 minutes versus 15 minutes for the Quellung reaction, considerably lowering labor costs. A restrictive weakness of mPCR was found for the detection of 19F strains. Most Venezuelan 19F strains were not typeable using the mPCR, and two 19F cps serotype variants were identified. The mPCR assay is an accurate, rapid, and economical method for the identification of the vast majority of the serotypes from Venezuela and can be used in place of the standard Quellung reaction. An exception is the identification of serotype 19F. In this setting, most 19F strains were not detectable with mPCR, demonstrating a need of serology-based quality control for PCR-based serotyping.

  11. Pyrosequencing for classification of human FcγRIIIA allotypes: a comparison with PCR-based techniques.

    Science.gov (United States)

    Matlawska-Wasowska, Ksenia; Gale, James M; Nickl, Christian K; Khalili, Parisa; Shirley, Brian; Wilson, Bridget S; Vasef, Mohammad A; Winter, Stuart S

    2014-12-01

    Surface-specific antigens expressed by hematopoietic cells are attractive targets for antibody-mediated immunotherapy. Monoclonal antibodies (mAbs) involve various mechanisms to eliminate target cells, including antibody-dependent cellular cytotoxicity (ADCC)- and phagocytosis (ADCP)-mediated killing through natural killer (NK) and macrophage effector cells bearing FcγRIIIA (CD16). The clinical efficacy of ADCC is particularly impacted by a single nucleotide polymorphism (SNP) found in the gene encoding FcγRIIIA (FCGR3A), which generates a variable distribution of the 158 V/V, F/V or F/F CD16 allotypes (F = phenylalanine, V = valine) in the normal human population. Currently, most patients are not screened for CD16 allotypes, creating the potential to include in their treatment a mAb-based therapy that may have limited benefit. Therefore, it is important to identify CD16 allotypes when considering mAb therapies that require ADCC/ADCP. The objective of this study was to develop a reliable PCR-based assay for classification of human FcγRIIIA allotypes. We studied 42 normal human subjects for the incidence of FcγRIIIA-158 polymorphisms using comparative molecular approaches. The results of our study showed 100% accuracy in genotyping by pyrosequencing. In contrast, nested PCR-based allele-specific restriction assay and quantitative PCR techniques proved to be relatively less sensitive and less specific in distinguishing variant genotypes. Since the efficacy of the mAb-based targeted immunotherapy may be highly dependent upon the CD16 polymorphism in a given individual, we recommend pyrosequencing for CD16 allotype testing.

  12. Principles and technical aspects of PCR amplification

    National Research Council Canada - National Science Library

    Pelt-Verkuil, Elizabeth van; Belkum, Alex van; Hays, John P

    2008-01-01

    ... to illustrate any particularly important concepts or comments. Indeed, all commercial PCR biotechnology companies offer information about their products on internet sites and in online technical manuals. These online resources will be invaluable for any readers requiring more detailed PCR protocols. The authors have provided references for many PCR co...

  13. The PCR revolution: basic technologies and applications

    National Research Council Canada - National Science Library

    Bustin, Stephen A

    2010-01-01

    ... by leading authorities on the many applications of PCR and how this technology has revolutionized their respective areas of interest. This book conveys the ways in which PCR has overcome many obstacles in life science and clinical research and also charts the PCR's development from time-consuming, low throughput, nonquantitative proced...

  14. Designing multiplex PCR system of Campylobacter jejuni for efficient typing by improving monoplex PCR binary typing method.

    Science.gov (United States)

    Yamada, Kazuhiro; Ibata, Ami; Suzuki, Masahiro; Matsumoto, Masakado; Yamashita, Teruo; Minagawa, Hiroko; Kurane, Ryuichiro

    2015-01-01

    Campylobacter jejuni is responsible for the majority of Campylobacter infections. As the molecular epidemiological study of outbreaks, pulsed-field gel electrophoresis (PFGE) is performed in general. But PFGE has several problems. PCR binary typing (P-BIT) method is a typing method for Campylobacter spp. that was recently developed, and was reported to have a similar discriminatory power and stability to those of PFGE. We modified the P-BIT method from 18 monoplex PCRs to two multiplex PCR systems (mP-BIT). The same results were obtained from monoplex PCRs using original primers and multiplex PCR in the representative isolates. The mP-BIT can analyze 48 strains at a time by using 96-well PCR systems and can identify C. jejuni because mP-BIT includes C. jejuni marker. The typing of the isolates by the mP-BIT and PFGE demonstrated generally concordant results and the mP-BIT method (D = 0.980) has a similar discriminatory power to that of PFGE with SmaI digest (D = 0.975) or KpnI digest (D = 0.987) as with original article. The mP-BIT method is quick, simple and easy, and comes to be able to perform it at low cost by having become a multiplex PCR system. Therefore, the mP-BIT method with two multiplex PCR systems has high potential for a rapid first-line surveillance typing assay of C. jejuni and can be used for routine surveillance and outbreak investigations of C. jejuni in the future. Copyright © 2014 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  15. Improved thermal cycling durability and PCR compatibility of polymer coated quantum dot

    International Nuclear Information System (INIS)

    Xun Zhe; Guan Yifu; Zhao Xiaoyun

    2013-01-01

    Quantum dots have experienced rapid development in imaging, labeling and sensing in medicine and life science. To be suitable for polymerase chain reaction (PCR) assay, we have tested QD thermal cycling durability and compatibility, which have not been addressed in previous reports. In this study, we synthesized CdSe/ZnS QDs with a surface modification with high-MW amphiphilic copolymers and observed that Mg 2+ ions in the PCR reaction could induce the QDs to precipitate and reduce their fluorescence signal significantly after thermal cycling. To overcome this problem, we used mPEG2000 to conjugate the QD surface for further protection, and found that this modification enables QDs to endure 40 thermal cycles in the presence of other components essential for PCR reactions. We have also identified that QDs have different effects on rTaq and Ex Taq polymerization systems. A high QD concentration could apparently reduce the PCR efficiency, but this inhibition was relieved significantly in the Ex PCR system as the concentration of Ex Taq polymerase was increased. Real-time PCR amplification results showed that QDs could provide a sufficiently measurable fluorescence signal without excessively inhibiting the DNA amplification. Based on this improved thermal cycling durability and compatibility with the PCR system, QDs have the potential to be developed as stable fluorescent sensors in PCR and real-time PCR amplification. (paper)

  16. Real-Time PCR (qPCR) Primer Design Using Free Online Software

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…

  17. Detection of adenoviruses in shellfish by means of conventional-PCR, nested-PCR, and integrated cell culture PCR (ICC/PCR).

    Science.gov (United States)

    Rigotto, C; Sincero, T C M; Simões, C M O; Barardi, C R M

    2005-01-01

    We tested three PCR based methodologies to detect adenoviruses associated with cultivated oysters. Conventional-PCR, nested-PCR, and integrated cell culture-PCR (ICC/PCR) were first optimized using oysters seeded with know amounts of Adenovirus serotype 5 (Ad5). The maximum sensitivity for Ad5 detection was determined for each method, and then used to detect natural adenovirus contamination in oysters from three aquiculture farms in Florianopolis, Santa Catarina State, Brazil, over a period of 6 months. The results showed that the nested-PCR was more sensitive (limit of detection: 1.2 PFU/g of tissue) than conventional-PCR and ICC-PCR (limit of detection for both: 1.2 x 10(2)PFU/g of tissue) for detection of Ad5 in oyster extracts. Nested-PCR was able to detect 90% of Ad5 contamination in harvested oyster samples, while conventional-PCR was unable to detect Ad5 in any of the samples. The present work suggests that detection of human adenoviruses can be used as a tool to monitor the presence of human viruses in marine environments where shellfish grow, and that nested-PCR is the method of choice.

  18. Multiplex PCR detection of waterborne intestinal protozoa: microsporidia, Cyclospora, and Cryptosporidium.

    Science.gov (United States)

    Lee, Seung-Hyun; Joung, Migyo; Yoon, Sejoung; Choi, Kyoungjin; Park, Woo-Yoon; Yu, Jae-Ran

    2010-12-01

    Recently, emerging waterborne protozoa, such as microsporidia, Cyclospora, and Cryptosporidium, have become a challenge to human health worldwide. Rapid, simple, and economical detection methods for these major waterborne protozoa in environmental and clinical samples are necessary to control infection and improve public health. In the present study, we developed a multiplex PCR test that is able to detect all these 3 major waterborne protozoa at the same time. Detection limits of the multiplex PCR method ranged from 10(1) to 10(2) oocysts or spores. The primers for microsporidia or Cryptosporidium used in this study can detect both Enterocytozoon bieneusi and Encephalitozoon intestinalis, or both Cryptosporidium hominis and Cryptosporidium parvum, respectively. Restriction enzyme digestion of PCR products with BsaBI or BsiEI makes it possible to distinguish the 2 species of microsporidia or Cryptosporidium, respectively. This simple, rapid, and cost-effective multiplex PCR method will be useful for detecting outbreaks or sporadic cases of waterborne protozoa infections.

  19. Automated purification of Borrelia burgdorferi s.l. PCR products with KingFisherTM magnetic particle processor prior to genome sequencing

    International Nuclear Information System (INIS)

    Maekinen, Johanna; Marttila, Harri; Viljanen, Matti K.

    2001-01-01

    Borrelia burgdorferi sensu lato genospecies were differentiated by PCR-based sequencing of the borrelial flagellin gene. To evaluate the usefulness of KingFisher TM magnetic particle processor in PCR product purification, borrelia PCR products were purified with KingFisher TM magnetic particle processor prior to cycle sequencing and the quality of the sequence data received was analyzed. KingFisher was found to offer a rapid and reliable alternative for borrelial PCR product purification

  20. Evaluation of nested PCR in diagnosis of fungal rhinosinusitis.

    Science.gov (United States)

    Badiee, Parisa; Gandomi, Behrooz; Sabz, Gholamabbass; Khodami, Bijan; Choopanizadeh, Maral; Jafarian, Hadis

    2015-02-01

    Given the importance of rapid diagnosis for fungal rhinosinusitis, this study aimed to evaluate the use of nested PCR to identify Aspergillus and Mucor species in clinical samples from patients with suspected fungal rhinosinusitis. Functional endoscopic sinus surgery specimens were collected from 98 patients with rhinosinusitis from 2012 to 2013. All samples were ground and cultured on sabouraud dextrose agar. The isolated fungi were identified based on their macroscopic and microscopic features. Fungal DNA was extracted from the tissue samples and nested PCR was performed with two sets of primers for Mucor and Aspergillus. Direct microscopic showed that 5.1% contained fungal components and 9.2% exhibited growth of fungi in culture. The most common agents isolated were Aspergillus fumigatus (n= 3), Aspergillus flavus (n=2), Penicillium sp (n=3) and Alternaria sp. (n=1). Mucor sp. was identified in the pathology smear from 1 patient. Positive results for fungal rhinosinusitis were obtained for a total of 10.2% by culture or pathology smear. Positive PCR results were obtained in 72 samples for Aspergillus and 31 samples for Mucor. Our results suggest that endoscopic sinus surgery specimens are not suitable for nested PCR, probably because of the accumulation of fungi that contaminate the environmental air. This drawback is a limiting factor for diagnosis with nasal cavity specimens. Therefore, molecular methods and conventional culture techniques are helpful complementary diagnostic methods to detect fungal rhinosinusitis and determine appropriate management for these patients.

  1. Reverse transcriptase real-time PCR for detection and quantification of viable Campylobacter jejuni directly from poultry faecal samples

    DEFF Research Database (Denmark)

    Bui, Thanh Xuan; Wolff, Anders; Madsen, Mogens

    2012-01-01

    Campylobacter spp. is the most common cause of bacterial diarrhoea in humans worldwide. Therefore, rapid and reliable methods fordetection and quantification of this pathogen are required. In this study, we have developed a reverse transcription quantitative real-time PCR(RT-qPCR) for detection a...

  2. Decay Of Bacterial Pathogens, Fecal Indicators, And Real-Time Quantitative PCR Genetic Markers In Manure-Amended Soils

    Science.gov (United States)

    This study examined persistence and decay of bacterial pathogens, fecal indicator bacteria (FIB), and emerging real-time quantitative PCR (qPCR) genetic markers for rapid detection of fecal pollution in manure-amended agricultural soils. Known concentrations of transformed green...

  3. Decay Of Bacterial Pathogen, Fecal Indicators, And Real-Time Quantitative PCR Genetic Markers In Manure Amended Soils

    Science.gov (United States)

    This study examined persistence and decay of bacterial pathogens, fecal indicator bacteria, and emerging real-time quantitative PCR (qPCR) genetic markers for rapid detection of fecal pollution in manre-amended agricultural soils. Known concentrations of transformed green fluore...

  4. Sensitivity of PCR IS6110 in relation to culture and staining in Pott′s disease

    Directory of Open Access Journals (Sweden)

    Manoj Kumar

    2013-01-01

    Full Text Available Background: Rapid diagnosis is essential to decrease the morbidity and mortality of Pott′s disease. The bacteriological methods are time-consuming or insensitive. Polymerase chain reaction (PCR provides a rapid diagnostic tool and hope for early diagnosis of this disease. The aim of this study was to compare and assess of a rapid and effective method among diagnostic battery (Ziehl-Neelsen (ZN microscopy, BACTEC culture and PCR of Pott′s disease. Materials and Methods: Sixty-five specimens from clinico-radiological suspected cases of Pott′s disease were included in this study. They were processed for ZN microscopy, BACTEC culture, and PCR IS6110. The tests tool′s efficiency, positive agreement Kc (Kappa coefficient, and significance level (P value were calculated for correlation between PCR and performed tests. Results: The PCR sensitivity reached to 96% and 46.3% among positive and negative specimens on ZN microscopy. Further, 94% and 36.4% sensitivity were found among positive and negative specimens by BACTEC culture. The total 38 (58.5% specimens were detected either ZN microscopy or by BACTEC culture. Thus, the overall sensitivity and specificity of PCR were 95% and 74.1%. The kappa coefficient and P value, calculated for PCR against BACTEC culture and combined results of performed bacteriological tests were (Kc=0.60, (P<0.001 and (Kc=0.70, (P<0.001, respectively. Above statistical relations showed a fair agreement with significant differences. Conclusion: The PCR IS6110 may be useful in rapid detection of clinico-radiological suspected cases of Pott′s disease and those that are negative with bacteriological methods.

  5. Same-day PCR testing of Salmonella in meat: from research to routine application at slaughterhouses

    DEFF Research Database (Denmark)

    Hoorfar, Jeffrey; Löfström, Charlotta; Josefsen, Mathilde Hartmann

    2011-01-01

    Development of a rapid PCR technique is described, which enables slaughterhouses to apply same-day testing for Salmonella in carcasses and fresh meat. The technique is based on a shortened pre-enrichment time and 1-h DNA purification using paramagnetic beads (or an easy-to-use boiling method) fol......) followed by Salmonella detection by real-time PCR. Final protocols have been approved for meat testing (fresh meat and carcass swabs) by the Nordval validation organization for Nordic countries....

  6. Differentiation of bacterial feeding nematodes in soil ecological studies by means of arbitrarily primed PCR

    Science.gov (United States)

    Van Der Knaap, Esther; Rodriguez, Russell J.; Freckman, Diana W.

    1993-01-01

    Arbitrarily-primed polymerase chain reaction (ap-PCR) was used to differentiate closely related bacterial-feeding nematodes of the genera: Caenorhabditis, Acrobeloides, Cephalobus and Zeldia. Average percentage similarity of bands generated by ap-PCR with seven different primers between 14 isolates of Caenorhabditis elegans was ⪢ 90%, whereas between C. elegans, C. briggsae and C. remanei similarity was nematode populations were also obtained from ap-PCR analysis of single worms. Due to the difficulty of identification of soil nematodes, the ap-PCR offers potential as a rapid and reliable technique to assess biodiversity. Ap-PCR will make it feasible, for the first time, to study the ecological interactions of unique nematode genotypes in soil habitats.

  7. RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza

    DEFF Research Database (Denmark)

    Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen

    2003-01-01

    A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected wit...... of the twenty-three VI-positive specimens were negative when tested by RT-PCR-ELISA. The diagnostic sensitivity and specificity of the RT-PCR-ELISA was 91% and 97%, respectively, using VI in SPF eggs as the gold reference standard....

  8. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  9. Evaluation of a nested-PCR for mycobacterium tuberculosis detection in blood and urine samples.

    Science.gov (United States)

    da Cruz, Heidi Lacerda Alves; de Albuquerque Montenegro, Rosana; de Araújo Lima, Juliana Falcão; da Rocha Poroca, Diogo; da Costa Lima, Juliana Figueirêdo; Maria Lapa Montenegro, Lílian; Crovella, Sergio; Charifker Schindler, Haiana

    2011-01-01

    The polymerase chain reaction (PCR) and its variations, such as the nested-PCR, have been described as promising techniques for rapid diagnosis of tuberculosis (TB). With the aim of evaluating the usefulness of a nested-PCR method on samples of blood and urine of patients suspected of tuberculosis we analyzed 192 clinical samples, using as a molecular target the insertion element IS6110 specific of M. tuberculosis genome. Nested-PCR method showed higher sensitivity in patients with extrapulmonary tuberculosis (47.8% and 52% in blood and urine) when compared to patients with the pulmonary form of the disease (sensitivity of 29% and 26.9% in blood and urine), regardless of the type of biological sample used. The nested-PCR is a rapid technique that, even if not showing a good sensitivity, should be considered as a helpful tool especially in the extrapulmonary cases or in cases where confirmatory diagnosis is quite difficult to be achieved by routine methods. The performance of PCR-based techniques should be considered and tested in future works on other types of biological specimens besides sputum, like blood and urine, readily obtainable in most cases. The improving of M. tuberculosis nested-PCR detection in TB affected patients will give the possibility of an earlier detection of bacilli thus interrupting the transmission chain of the disease.

  10. Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.

    Science.gov (United States)

    Mo, Yiqun; Wan, Rong; Zhang, Qunwei

    2012-01-01

    Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.

  11. A new detection method for the K variant of butyrylcholinesterase based on PCR primer introduced restriction analysis (PCR-PIRA).

    Science.gov (United States)

    Shibuta, K; Abe, M; Suzuki, T

    1994-01-01

    The K variant of human butyrylcholinesterase is caused by a G/A transition in the butyrylcholinesterase gene, which neither creates nor destroys any restriction site. In an attempt to detect the K variant both simply and rapidly, we developed a two step method of "PCR primer introduced restriction analysis" (PCR-PIRA). The first step was used to introduce a new Fun4HI site into the normal allele for a screening test, while the second step was performed to create a new MaeIII site on the variant allele for a specific test. This method thus enabled us to distinguish clearly the K variant from the normal allele, and also showed that the frequency of the K variant allele is 0.164 in the Japanese population. Images PMID:7966197

  12. A Ribeiroia spp. (Class: Trematoda) - Specific PCR-based diagnostic

    Science.gov (United States)

    Reinitz, David M.; Yoshino, T.P.; Cole, Rebecca A.

    2007-01-01

    Increased reporting of amphibian malformations in North America has been noted with concern in light of reports that amphibian numbers and species are declining worldwide. Ribeiroia ondatrae has been shown to cause a variety of types of malformations in amphibians. However, little is known about the prevalence of R. ondatrae in North America. To aid in conducting field studies of Ribeiroia spp., we have developed a polymerase chain reaction (PCR)-based diagnostic. Herein, we describe the development of an accurate, rapid, simple, and cost-effective diagnostic for detection of Ribeiroia spp. infection in snails (Planorbella trivolvis). Candidate oligonucleotide primers for PCR were designed via DNA sequence analyses of multiple ribosomal internal transcribed spacer-2 regions from Ribeiroia spp. and Echinostoma spp. Comparison of consensus sequences determined from both genera identified areas of sequence potentially unique to Ribeiroia spp. The PCR reliably produced a diagnostic 290-base pair (bp) product in the presence of a wide concentration range of snail or frog DNA. Sensitivity was examined with DNA extracted from single R. ondatrae cercaria. The single-tube PCR could routinely detect less than 1 cercariae equivalent, because DNA isolated from a single cercaria could be diluted at least 1:50 and still yield a positive result via gel electrophoresis. An even more sensitive nested PCR also was developed that routinely detected 100 fg of the 290-bp fragment. The assay did not detect furcocercous cercariae of certain Schistosomatidae, Echinostoma sp., or Sphaeridiotrema globulus nor adults of Clinostomum sp. or Cyathocotyle bushiensis. Field testing of 137 P. trivolvis identified 3 positives with no overt environmental cross-reactivity, and results concurred with microscopic examinations in all cases. ?? American Society of Parasitologists 2007.

  13. Pitfalls in PCR troubleshooting: Expect the unexpected?

    Directory of Open Access Journals (Sweden)

    Livia Schrick

    2016-01-01

    Full Text Available PCR is a well-understood and established laboratory technique often used in molecular diagnostics. Huge experience has been accumulated over the last years regarding the design of PCR assays and their set-up, including in-depth troubleshooting to obtain the optimal PCR assay for each purpose. Here we report a PCR troubleshooting that came up with a surprising result never observed before. With this report we hope to sensitize the reader to this peculiar problem and to save troubleshooting efforts in similar situations, especially in time-critical and ambitious diagnostic settings.

  14. Absolute quantification by droplet digital PCR versus analog real-time PCR

    Science.gov (United States)

    Hindson, Christopher M; Chevillet, John R; Briggs, Hilary A; Gallichotte, Emily N; Ruf, Ingrid K; Hindson, Benjamin J; Vessella, Robert L; Tewari, Muneesh

    2014-01-01

    Nanoliter-sized droplet technology paired with digital PCR (ddPCR) holds promise for highly precise, absolute nucleic acid quantification. Our comparison of microRNA quantification by ddPCR and real-time PCR revealed greater precision (coefficients of variation decreased by 37–86%) and improved day-to-day reproducibility (by a factor of seven) of ddPCR but with comparable sensitivity. When we applied ddPCR to serum microRNA biomarker analysis, this translated to superior diagnostic performance for identifying individuals with cancer. PMID:23995387

  15. Evaluation of two real time PCR assays for the detection of bacterial DNA in amniotic fluid.

    Science.gov (United States)

    Girón de Velasco-Sada, Patricia; Falces-Romero, Iker; Quiles-Melero, Inmaculada; García-Perea, Adela; Mingorance, Jesús

    2018-01-01

    The aim of this study was to evaluate two non-commercial Real-Time PCR assays for the detection of microorganisms in amniotic fluid followed by identification by pyrosequencing. We collected 126 amniotic fluids from 2010 to 2015 for the evaluation of two Real-Time PCR assays for detection of bacterial DNA in amniotic fluid (16S Universal PCR and Ureaplasma spp. specific PCR). The method was developed in the Department of Microbiology of the University Hospital La Paz. Thirty-seven samples (29.3%) were positive by PCR/pyrosequencing and/or culture, 4 of them were mixed cultures with Ureaplasma urealyticum. The Universal 16S Real-Time PCR was compared with the standard culture (81.8% sensitivity, 97.4% specificity, 75% positive predictive value, 98% negative predictive value). The Ureaplasma spp. specific Real-Time PCR was compared with the Ureaplasma/Mycoplasma specific culture (92.3% sensitivity, 89.4% specificity, 50% positive predictive value, 99% negative predictive value) with statistically significant difference (p=0.005). Ureaplasma spp. PCR shows a rapid response time (5h from DNA extraction until pyrosequencing) when comparing with culture (48h). So, the response time of bacteriological diagnosis in suspected chorioamnionitis is reduced. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Real-time PCR improves Helicobacter pylori detection in patients with peptic ulcer bleeding.

    Directory of Open Access Journals (Sweden)

    María José Ramírez-Lázaro

    Full Text Available BACKGROUND AND AIMS: Histological and rapid urease tests to detect H. pylori in biopsy specimens obtained during peptic ulcer bleeding episodes (PUB often produce false-negative results. We aimed to examine whether immunohistochemistry and real-time PCR can improve the sensitivity of these biopsies. PATIENTS AND METHODS: We selected 52 histology-negative formalin-fixed paraffin-embedded biopsy specimens obtained during PUB episodes. Additional tests showed 10 were true negatives and 42 were false negatives. We also selected 17 histology-positive biopsy specimens obtained during PUB to use as controls. We performed immunohistochemistry staining and real-time PCR for 16S rRNA, ureA, and 23S rRNA for H. pylori genes on all specimens. RESULTS: All controls were positive for H. pylori on all PCR assays and immunohistochemical staining. Regarding the 52 initially negative biopsies, all PCR tests were significantly more sensitive than immunohistochemical staining (p<0.01. Sensitivity and specificity were 55% and 80% for 16S rRNA PCR, 43% and 90% for ureA PCR, 41% and 80% for 23S rRNA PCR, and 7% and 100% for immunohistochemical staining, respectively. Combined analysis of PCR assays for two genes were significantly more sensitive than ureA or 23S rRNA PCR tests alone (p<0.05 and marginally better than 16S rRNA PCR alone. The best combination was 16S rRNA+ureA, with a sensitivity of 64% and a specificity of 80%. CONCLUSIONS: Real-time PCR improves the detection of H. pylori infection in histology-negative formalin-fixed paraffin-embedded biopsy samples obtained during PUB episodes. The low reported prevalence of H. pylori in PUB may be due to the failure of conventional tests to detect infection.

  17. Development of a real-time microchip PCR system for portable plant disease diagnosis.

    Directory of Open Access Journals (Sweden)

    Chiwan Koo

    Full Text Available Rapid and accurate detection of plant pathogens in the field is crucial to prevent the proliferation of infected crops. Polymerase chain reaction (PCR process is the most reliable and accepted method for plant pathogen diagnosis, however current conventional PCR machines are not portable and require additional post-processing steps to detect the amplified DNA (amplicon of pathogens. Real-time PCR can directly quantify the amplicon during the DNA amplification without the need for post processing, thus more suitable for field operations, however still takes time and require large instruments that are costly and not portable. Microchip PCR systems have emerged in the past decade to miniaturize conventional PCR systems and to reduce operation time and cost. Real-time microchip PCR systems have also emerged, but unfortunately all reported portable real-time microchip PCR systems require various auxiliary instruments. Here we present a stand-alone real-time microchip PCR system composed of a PCR reaction chamber microchip with integrated thin-film heater, a compact fluorescence detector to detect amplified DNA, a microcontroller to control the entire thermocycling operation with data acquisition capability, and a battery. The entire system is 25 × 16 × 8 cm(3 in size and 843 g in weight. The disposable microchip requires only 8-µl sample volume and a single PCR run consumes 110 mAh of power. A DNA extraction protocol, notably without the use of liquid nitrogen, chemicals, and other large lab equipment, was developed for field operations. The developed real-time microchip PCR system and the DNA extraction protocol were used to successfully detect six different fungal and bacterial plant pathogens with 100% success rate to a detection limit of 5 ng/8 µl sample.

  18. Development of a Real-Time Microchip PCR System for Portable Plant Disease Diagnosis

    Science.gov (United States)

    Kim, Hyun Soo; Cifci, Osman S.; Vaughn-Diaz, Vanessa L.; Ma, Bo; Kim, Sungman; Abdel-Raziq, Haron; Ong, Kevin; Jo, Young-Ki; Gross, Dennis C.; Shim, Won-Bo; Han, Arum

    2013-01-01

    Rapid and accurate detection of plant pathogens in the field is crucial to prevent the proliferation of infected crops. Polymerase chain reaction (PCR) process is the most reliable and accepted method for plant pathogen diagnosis, however current conventional PCR machines are not portable and require additional post-processing steps to detect the amplified DNA (amplicon) of pathogens. Real-time PCR can directly quantify the amplicon during the DNA amplification without the need for post processing, thus more suitable for field operations, however still takes time and require large instruments that are costly and not portable. Microchip PCR systems have emerged in the past decade to miniaturize conventional PCR systems and to reduce operation time and cost. Real-time microchip PCR systems have also emerged, but unfortunately all reported portable real-time microchip PCR systems require various auxiliary instruments. Here we present a stand-alone real-time microchip PCR system composed of a PCR reaction chamber microchip with integrated thin-film heater, a compact fluorescence detector to detect amplified DNA, a microcontroller to control the entire thermocycling operation with data acquisition capability, and a battery. The entire system is 25×16×8 cm3 in size and 843 g in weight. The disposable microchip requires only 8-µl sample volume and a single PCR run consumes 110 mAh of power. A DNA extraction protocol, notably without the use of liquid nitrogen, chemicals, and other large lab equipment, was developed for field operations. The developed real-time microchip PCR system and the DNA extraction protocol were used to successfully detect six different fungal and bacterial plant pathogens with 100% success rate to a detection limit of 5 ng/8 µl sample. PMID:24349341

  19. Validated reverse transcription droplet digital PCR serves as a higher order method for absolute quantification of Potato virus Y strains.

    Science.gov (United States)

    Mehle, Nataša; Dobnik, David; Ravnikar, Maja; Pompe Novak, Maruša

    2018-05-03

    RNA viruses have a great potential for high genetic variability and rapid evolution that is generated by mutation and recombination under selection pressure. This is also the case of Potato virus Y (PVY), which comprises a high diversity of different recombinant and non-recombinant strains. Consequently, it is hard to develop reverse transcription real-time quantitative PCR (RT-qPCR) with the same amplification efficiencies for all PVY strains which would enable their equilibrate quantification; this is specially needed in mixed infections and other studies of pathogenesis. To achieve this, we initially transferred the PVY universal RT-qPCR assay to a reverse transcription droplet digital PCR (RT-ddPCR) format. RT-ddPCR is an absolute quantification method, where a calibration curve is not needed, and it is less prone to inhibitors. The RT-ddPCR developed and validated in this study achieved a dynamic range of quantification over five orders of magnitude, and in terms of its sensitivity, it was comparable to, or even better than, RT-qPCR. RT-ddPCR showed lower measurement variability. We have shown that RT-ddPCR can be used as a reference tool for the evaluation of different RT-qPCR assays. In addition, it can be used for quantification of RNA based on in-house reference materials that can then be used as calibrators in diagnostic laboratories.

  20. Development of a highly sensitive one-tube nested real-time PCR for detecting Mycobacterium tuberculosis.

    Science.gov (United States)

    Choi, Yeonim; Jeon, Bo-Young; Shim, Tae Sun; Jin, Hyunwoo; Cho, Sang-Nae; Lee, Hyeyoung

    2014-12-01

    Rapid, accurate detection of Mycobacterium tuberculosis is crucial in the diagnosis of tuberculosis (TB), but conventional diagnostic methods have limited sensitivity and specificity or are time consuming. A new highly sensitive nucleic acid amplification test, combined nested and real-time polymerase chain reaction (PCR) in a single tube (one-tube nested real-time PCR), was developed for detecting M. tuberculosis, which takes advantage of two PCR techniques, i.e., nested PCR and real-time PCR. One-tube nested real-time PCR was designed to have two sequential reactions with two sets of primers and dual probes for the insertion sequence (IS) 6110 sequence of M. tuberculosis in a single closed tube. The minimum limits of detection of IS6110 real-time PCR and IS6110 one-tube nested real-time PCR were 100 fg/μL and 1 fg/μL of M. tuberculosis DNA, respectively. AdvanSure TB/non-tuberculous mycobacteria (NTM) real-time PCR, IS6110 real-time PCR, and two-tube nested real-time PCR showed 100% sensitivity and 100% specificity for clinical M. tuberculosis isolates and NTM isolates. In comparison, the sensitivities of AdvanSure TB/NTM real-time PCR, single IS6110 real-time PCR, and one-tube nested real-time PCR were 91% (152/167), 94.6% (158/167), and 100% (167/167) for sputum specimens, respectively. In conclusion, IS6110 one-tube nested real-time PCR is useful for detecting M. tuberculosis due to its high sensitivity and simple manipulation. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Methods for microbial DNA extraction from soil for PCR amplification

    Directory of Open Access Journals (Sweden)

    Yeates C

    1998-01-01

    Full Text Available Amplification of DNA from soil is often inhibited by co-purified contaminants. A rapid, inexpensive, large-scale DNA extraction method involving minimal purification has been developed that is applicable to various soil types (1. DNA is also suitable for PCR amplification using various DNA targets. DNA was extracted from 100g of soil using direct lysis with glass beads and SDS followed by potassium acetate precipitation, polyethylene glycol precipitation, phenol extraction and isopropanol precipitation. This method was compared to other DNA extraction methods with regard to DNA purity and size.

  2. Advantages and limitations of quantitative PCR (Q-PCR)-based approaches in microbial ecology.

    Science.gov (United States)

    Smith, Cindy J; Osborn, A Mark

    2009-01-01

    Quantitative PCR (Q-PCR or real-time PCR) approaches are now widely applied in microbial ecology to quantify the abundance and expression of taxonomic and functional gene markers within the environment. Q-PCR-based analyses combine 'traditional' end-point detection PCR with fluorescent detection technologies to record the accumulation of amplicons in 'real time' during each cycle of the PCR amplification. By detection of amplicons during the early exponential phase of the PCR, this enables the quantification of gene (or transcript) numbers when these are proportional to the starting template concentration. When Q-PCR is coupled with a preceding reverse transcription reaction, it can be used to quantify gene expression (RT-Q-PCR). This review firstly addresses the theoretical and practical implementation of Q-PCR and RT-Q-PCR protocols in microbial ecology, highlighting key experimental considerations. Secondly, we review the applications of (RT)-Q-PCR analyses in environmental microbiology and evaluate the contribution and advances gained from such approaches. Finally, we conclude by offering future perspectives on the application of (RT)-Q-PCR in furthering understanding in microbial ecology, in particular, when coupled with other molecular approaches and more traditional investigations of environmental systems.

  3. Development of ultra-short PCR assay to reveal BRAF V600 mutation status in Thai colorectal cancer tissues.

    Science.gov (United States)

    Chat-Uthai, Nunthawut; Vejvisithsakul, Pichpisith; Udommethaporn, Sutthirat; Meesiri, Puttarakun; Danthanawanit, Chetiya; Wongchai, Yannawan; Teerapakpinyo, Chinachote; Shuangshoti, Shanop; Poungvarin, Naravat

    2018-01-01

    The protein kinase BRAF is one of the key players in regulating cellular responses to extracellular signals. Somatic mutations of the BRAF gene, causing constitutive activation of BRAF, have been found in various types of human cancers such as malignant melanoma, and colorectal cancer. BRAF V600E and V600K, most commonly observed mutations in these cancers, may predict response to targeted therapies. Many techniques suffer from a lack of diagnostic sensitivity in mutation analysis in clinical samples with a low cancer cell percentage or poor-quality fragmented DNA. Here we present allele-specific real-time PCR assay for amplifying 35- to 45-base target sequences in BRAF gene. Forward primer designed for BRAF V600E detection is capable of recognizing both types of BRAF V600E mutation, i.e. V600E1 (c.1799T>A) and V600E2 (c.1799_1800delTGinsAA), as well as complex tandem mutation caused by nucleotide changes in codons 600 and 601. We utilized this assay to analyze Thai formalin-fixed paraffin-embedded tissues. Forty-eight percent of 178 Thai colorectal cancer tissues has KRAS mutation detected by highly sensitive commercial assays. Although these DNA samples contain low overall yield of amplifiable DNA, our newly-developed assay successfully revealed BRAF V600 mutations in 6 of 93 formalin-fixed paraffin-embedded colorectal cancer tissues which KRAS mutation was not detected. Ultra-short PCR assay with forward mutation-specific primers is potentially useful to detect BRAF V600 mutations in highly fragmented DNA specimens from cancer patients.

  4. Development of a real-time PCR for the detection of pathogenic Leptospira spp. in California sea lions.

    Science.gov (United States)

    Wu, Qingzhong; Prager, Katherine C; Goldstein, Tracey; Alt, David P; Galloway, Renee L; Zuerner, Richard L; Lloyd-Smith, James O; Schwacke, Lori

    2014-08-11

    Several real-time PCR assays are currently used for detection of pathogenic Leptospira spp.; however, few methods have been described for the successful evaluation of clinical urine samples. This study reports a rapid assay for the detection of pathogenic Leptospira spp. in California sea lions Zalophus californianus using real-time PCR with primers and a probe targeting the lipL32 gene. The PCR assay had high analytic sensitivity-the limit of detection was 3 genome copies per PCR volume using L. interrogans serovar Pomona DNA and 100% analytic specificity; it detected all pathogenic leptospiral serovars tested and none of the non-pathogenic Leptospira species (L. biflexa and L. meyeri serovar Semaranga), the intermediate species L. inadai, or the non-Leptospira pathogens tested. Our assay had an amplification efficiency of 1.00. Comparisons between the real-time PCR assay and culture isolation for detection of pathogenic Leptospira spp. in urine and kidney tissue samples from California sea lions showed that samples were more often positive by real-time PCR than by culture methods. Inclusion of an internal amplification control in the real-time PCR assay showed no inhibitory effects in PCR negative samples. These studies indicated that our real-time PCR assay has high analytic sensitivity and specificity for the rapid detection of pathogenic Leptospira species in urine and kidney tissue samples.

  5. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  6. [E-MTAB-587] PCR_artifacts

    NARCIS (Netherlands)

    Muino Acuna, J.M.

    2011-01-01

    WARNING: This library was yield low amount of material and it was over-amplified by PCR. This libraries are used study the robustness of several statitical methods against PCR artifacts. ChIP experiments were performed on Arabidopsis wildtype inflorescences using an antibody raised against a

  7. Digital PCR for detection of citrus pathogens

    Science.gov (United States)

    Citrus trees are often infected with multiple pathogens of economic importance, especially those with insect or mite vectors. Real-time/quantitative PCR (qPCR) has been used for high-throughput detection and relative quantification of pathogens; however, target reference or standards are required. I...

  8. Testing for Genetically Modified Foods Using PCR

    Science.gov (United States)

    Taylor, Ann; Sajan, Samin

    2005-01-01

    The polymerase chain reaction (PCR) is a Nobel Prize-winning technique that amplifies a specific segment of DNA and is commonly used to test for the presence of genetic modifications. Students use PCR to test corn meal and corn-muffin mixes for the presence of a promoter commonly used in genetically modified foods, the cauliflower mosaic virus 35S…

  9. Validation of RNAi by real time PCR

    DEFF Research Database (Denmark)

    Josefsen, Knud; Lee, Ying Chiu

    2011-01-01

    Real time PCR is the analytic tool of choice for quantification of gene expression, while RNAi is concerned with downregulation of gene expression. Together, they constitute a powerful approach in any loss of function studies of selective genes. We illustrate here the use of real time PCR to verify...

  10. PCR specific for Actinobacillus pleuropneumoniae serotype 3

    DEFF Research Database (Denmark)

    Zhou, L.; Jones, S.C.P.; Angen, Øystein

    2008-01-01

    , but the method has liminations, for example, cross-reactions between serotypes 3, 6, and 8. This study describes the development of a serotype 3-specific PCR, based on the capsule locus, which can be used in a multiplex format with the organism's specific gene apxIV. The PCR test was evaluated on 266 strains...

  11. Evaluation of Legionella real-time PCR against traditional culture for routine and public health testing of water samples.

    Science.gov (United States)

    Collins, S; Stevenson, D; Walker, J; Bennett, A

    2017-06-01

    To evaluate the usefulness of Legionella qPCR alongside traditional culture for enumeration of Legionella from water samples as part of both routine and public health investigation testing. Routine water samples (n = 2002) and samples from public health investigations (n = 215) were analysed by culture and qPCR for Legionella spp., Legionella pneumophila and L. pneumophila sg-1. A negative qPCR result was highly predictive of a negative culture result for all water systems (negative predictive values, NPV from 97·4 to 100%). Positive predictive values (PPV) were lower (0-50%). Results for qPCR were generally larger than culture with average log 10 differences of 1·1 for Legionella spp. and 1·2 for L. pneumophila. Alert and action levels of 1000 and 10 000 GU per litre, respectively, are proposed for Legionella qPCR for hot and cold water systems (HCWS). The use of qPCR significantly reduced the time to results for public health investigations by rapidly identifying potential sources and ruling out others, thus enabling a more rapid and efficient response. The high NPV of qPCR supports its use to rapidly screen out negative samples without culture. Alert and action levels for Legionella qPCR for HCWS are proposed. Quantitative PCR will be a valuable tool for both routine and public health testing. This study generated comparative data of >2000 water samples by qPCR and culture. Action and alert levels have been recommended that could enable duty holders to interpret qPCR results to facilitate timely Legionella control and public health protection. © 2017 Crown copyright. Journal of Applied Microbiology © 2017 The Society for Applied Microbiology.

  12. Polymerase chain reaction methods (PCR in agrobiotechnology

    Directory of Open Access Journals (Sweden)

    Taški-Ajduković Ksenija

    2006-01-01

    Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

  13. Mathematical analysis of the real time array PCR (RTA PCR) process

    NARCIS (Netherlands)

    Dijksman, Johan Frederik; Pierik, A.

    2012-01-01

    Real time array PCR (RTA PCR) is a recently developed biochemical technique that measures amplification curves (like with quantitative real time Polymerase Chain Reaction (qRT PCR)) of a multitude of different templates in a sample. It combines two different methods in order to profit from the

  14. Development of multiplex real-time PCR assay for the detection of Brucella spp., Leptospira spp. and Campylobacter foetus

    Directory of Open Access Journals (Sweden)

    Abdelfattah M. Selim

    2014-12-01

    Full Text Available Abortion among dairy cattle is one of the major causes of economic losses in the livestock industry. This study describes a 1-step multiplex real-time polymerase chain reaction (PCR to detect Brucella spp., Leptospira spp. and Campylobacter foetus, these are significant bacteria commonly implicated in bovine abortion. ß-actin was added to the same PCR reaction as an internal control to detect any extraction failure or PCR inhibition. The detection limit of multiplex real-time PCR using purified DNA from cultured organisms was set to 5 fg for Leptospira spp. and C. foetus and to 50 fg for Brucella spp. The multiplex real-time PCR did not produce any non-specific amplification when tested with different strains of the 3 pathogens. This multiplex real-time PCR provides a valuable tool for diagnosis, simultaneous and rapid detection for the 3 pathogens causing abortion in bovine.

  15. Aspergillus section Fumigati typing by PCR-restriction fragment polymorphism.

    Science.gov (United States)

    Staab, Janet F; Balajee, S Arunmozhi; Marr, Kieren A

    2009-07-01

    Recent studies have shown that there are multiple clinically important members of the Aspergillus section Fumigati that are difficult to distinguish on the basis of morphological features (e.g., Aspergillus fumigatus, A. lentulus, and Neosartorya udagawae). Identification of these organisms may be clinically important, as some species vary in their susceptibilities to antifungal agents. In a prior study, we utilized multilocus sequence typing to describe A. lentulus as a species distinct from A. fumigatus. The sequence data show that the gene encoding beta-tubulin, benA, has high interspecies variability at intronic regions but is conserved among isolates of the same species. These data were used to develop a PCR-restriction fragment length polymorphism (PCR-RFLP) method that rapidly and accurately distinguishes A. fumigatus, A. lentulus, and N. udagawae, three major species within the section Fumigati that have previously been implicated in disease. Digestion of the benA amplicon with BccI generated unique banding patterns; the results were validated by screening a collection of clinical strains and by in silico analysis of the benA sequences of Aspergillus spp. deposited in the GenBank database. PCR-RFLP of benA is a simple method for the identification of clinically important, similar morphotypes of Aspergillus spp. within the section Fumigati.

  16. Aspergillus Section Fumigati Typing by PCR-Restriction Fragment Polymorphism▿

    Science.gov (United States)

    Staab, Janet F.; Balajee, S. Arunmozhi; Marr, Kieren A.

    2009-01-01

    Recent studies have shown that there are multiple clinically important members of the Aspergillus section Fumigati that are difficult to distinguish on the basis of morphological features (e.g., Aspergillus fumigatus, A. lentulus, and Neosartorya udagawae). Identification of these organisms may be clinically important, as some species vary in their susceptibilities to antifungal agents. In a prior study, we utilized multilocus sequence typing to describe A. lentulus as a species distinct from A. fumigatus. The sequence data show that the gene encoding β-tubulin, benA, has high interspecies variability at intronic regions but is conserved among isolates of the same species. These data were used to develop a PCR-restriction fragment length polymorphism (PCR-RFLP) method that rapidly and accurately distinguishes A. fumigatus, A. lentulus, and N. udagawae, three major species within the section Fumigati that have previously been implicated in disease. Digestion of the benA amplicon with BccI generated unique banding patterns; the results were validated by screening a collection of clinical strains and by in silico analysis of the benA sequences of Aspergillus spp. deposited in the GenBank database. PCR-RFLP of benA is a simple method for the identification of clinically important, similar morphotypes of Aspergillus spp. within the section Fumigati. PMID:19403766

  17. Validation of chimerism in pediatric recipients of allogeneic hematopoietic stem cell transplantation (HSCT) a comparison between two methods: real-time PCR (qPCR) vs. variable number tandem repeats PCR (VNTR PCR).

    Science.gov (United States)

    Kletzel, Morris; Huang, Wei; Olszewski, Marie; Khan, Sana

    2013-01-01

    Post-hematopoietic stem cell transplantation (HSCT) chimerism monitoring is important to assess relapse and therapeutic intervention. The purpose of our study is to compare two methods variable number tandem repeats (VNTR) vs. quantitative real- time polymerase chain reaction (qPCR) in terms of determining chimerism. 127 (peripheral blood n=112, bone marrow n=15) samples were simultaneously tested by VNTR using APO-B, D1S80, D1S111, D17S30, gene loci SRY and ZP3 and qPCR using 34 assays (CA001-CA034) that are designed to a bi-allelic insertion/deletion (indel) polymorphism in the human genome. Samples were separated in three subsets: total WBC, T-cell and Myeloid cells. Extraction of DNA was performed then quantified. We analyzed column statistics, paired t-test and regression analysis for both methods. There was complete correlation between the two methods. The simplicity and rapidity of the test results from the qPCR method is more efficient and accurate to assess chimerism.

  18. Detection of Tomato black ring virus by real-time one-step RT-PCR.

    Science.gov (United States)

    Harper, Scott J; Delmiglio, Catia; Ward, Lisa I; Clover, Gerard R G

    2011-01-01

    A TaqMan-based real-time one-step RT-PCR assay was developed for the rapid detection of Tomato black ring virus (TBRV), a significant plant pathogen which infects a wide range of economically important crops. Primers and a probe were designed against existing genomic sequences to amplify a 72 bp fragment from RNA-2. The assay amplified all isolates of TBRV tested, but no amplification was observed from the RNA of other nepovirus species or healthy host plants. The detection limit of the assay was estimated to be around nine copies of the TBRV target region in total RNA. A comparison with conventional RT-PCR and ELISA, indicated that ELISA, the current standard test method, lacked specificity and reacted to all nepovirus species tested, while conventional RT-PCR was approximately ten-fold less sensitive than the real-time RT-PCR assay. Finally, the real-time RT-PCR assay was tested using five different RT-PCR reagent kits and was found to be robust and reliable, with no significant differences in sensitivity being found. The development of this rapid assay should aid in quarantine and post-border surveys for regulatory agencies. Copyright © 2010 Elsevier B.V. All rights reserved.

  19. Comparison of phenotypic and PCR methods for detection of carbapenemases production by Enterobacteriaceae

    Directory of Open Access Journals (Sweden)

    Maryam AlTamimi

    2017-01-01

    Full Text Available Dissemination of carbapenem resistance via Enterobacteriaceae, particularly among Klebsiella pneumoniae and Escherichia coli, is a major public health concern. Rapid methods for determining antimicrobial susceptibility are important to ensure adequate and appropriate use of antimicrobial agents and to limit the spread of these bacteria. In the current study, we compared the rapidity, sensitivity and specificity of traditional methods and molecular-based Xpert Carba-R PCR assay to identify sixty isolates, (26 E. coli and 34 K. pneumoniae. The specificity of MicroScan was 100% while sensitivity to ertapenem (ERT, imipenem (IMI, and meropenem (MER was 93%, 68.9%, and 55.17%, respectively. For the modified Hodge test, the specificity was 96.77% and sensitivity was 89.65%. Although some results of phenotypic assays matched with the definite PCR identification, some results were misleading. Out of the 29 positive PCR samples, three samples of K. pneumoniae were negative for the MHT and one E. coli sample was MHT positive but negative for the PCR. Nine samples were positive for the PCR but were determined as carbapenem sensitive by MicroScan. While MicroScan and MHT requires several hours and multi-steps to obtain results, Xpert Carba-R PCR assay takes less than an hour. Therefore, we recommend using Gene xpert Carba-R assay for the optimal carbapenemnase detection with reducing material, manpower and cost. Also it is important to know the type of carbapenemase is present.

  20. Concurrent infections of pseudorabies virus and porcine bocavirus in China detected by duplex nanoPCR.

    Science.gov (United States)

    Luo, Yakun; Liang, Lin; Zhou, Ling; Zhao, Kai; Cui, Shangjin

    2015-07-01

    Nanoparticle-assisted polymerase chain reaction (nanoPCR) is a novel method for the simple, rapid, and specific amplification of DNA and has been used to detect viruses. A duplex nanoPCR molecular detection system was developed to detect pseudorabies virus (PRV) and porcine bocavirus (PBoV). Primers were selected to target conserved regions within the PRV gE gene and the PBoV NS1 gene. Under optimized nanoPCR reaction conditions, two specific fragments of 316 bp (PRV) and 996 bp (PBoV) were amplified by the duplex nanoPCR with a detection limit of 6 copies for PRV and 95 copies for PBoV; no fragments were amplified when other porcine viruses were used as template. When used to test 550 clinical samples, the duplex nanoPRC assay and a conventional duplex PCR assay provided very similar results (98.1% consistency); single PRV infections, single PBoV infections, and concurrent PRV and PBoV infections were detected in 37%, 15%, and 9% of the samples, respectively. The results indicate that the novel duplex nanoPCR assay is useful for the rapid detection of PRV and PBoV in pigs. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Comparison of PCR and common clinical tests for the diagnosis of H. pylori in dyspeptic patients.

    Science.gov (United States)

    Pacheco, N; Mago, V; Gómez, I; Gueneau, P; Guelrud, M; Reyes, N; Pericchi, L R; Domínguez-Bello, M G

    2001-04-01

    Helicobacter pylori has been recognized as a major gastric pathogen. The objective of this study was to assess the diagnostic value of common clinical tests to detect H. pylori infection, by comparison with PCR. Serum and gastric biopsy specimens from 106 dyspeptic patients were examined. Serology was performed with Pyloriset Dry test, and biopsies were examined histologically, for rapid urease activity and PCR amplification of an ureA gene segment of H. pylori. PCR primers were specific for H. pylori and required at least 1.47 pg of H. pylori DNA, corresponding to about 800 bacterial cells. According to serology, histology, rapid urease, and PCR, positive results were respectively found in 56%, 86%, 64%, and 85% of dyspeptic patients, primarily with gastritis. Relative to PCR, the sensitivity (and specificity) was 55% (38%) for serology, 86% (13%) for histology, 70% (69%) for urease. When combining histology and urease, Bayesian analysis of data indicated no advantage of using combined methods over rapid urease test alone. Histology should not any longer be considered a gold standard test for Helicobacter pylori. Urea breath test still seems the first option for non invasive diagnostic. If an invasive diagnostic is justified, highly specific and sensitive molecular methods should be used to examine specimens.

  2. Molecular typing for blood group antigens within 40 minutes by direct PCR from plasma or serum

    Science.gov (United States)

    Wagner, Franz Friedrich; Flegel, Willy Albert; Bittner, Rita; Döscher, Andrea

    2016-01-01

    Determining blood group antigens by serological methods may be unreliable in certain situations, such as in patients after chronic or massive transfusion. Red cell genotyping offers a complementary approach, but current methods may take much longer than conventional serological typing, limiting their utility in urgent situations. To narrow this gap, we devised a rapid method using direct polymerase chain reaction (PCR) amplification while avoiding the DNA extraction step. DNA was amplified by PCR directly from plasma or serum of blood donors followed by a melting curve analysis in a capillary rapid-cycle PCR assay. We evaluated the single nucleotide polymorphisms underlying the clinically relevant Fya, Fyb, Jka and Jkb antigens, with our analysis being completed within 40 min of receiving a plasma or serum sample. The positive predictive value was 100% and the negative predictive value at least 84%. Direct PCR with melting point analysis allowed faster red cell genotyping to predict blood group antigens than any previous molecular method. Our assay may be used as a screening tool with subsequent confirmatory testing, within the limitations of the false-negative rate. With fast turnaround times, the rapid-cycle PCR assay may eventually be developed and applied to red cell genotyping in the hospital setting. PMID:27991657

  3. Rapid shallow breathing

    Science.gov (United States)

    Tachypnea; Breathing - rapid and shallow; Fast shallow breathing; Respiratory rate - rapid and shallow ... Shallow, rapid breathing has many possible medical causes, including: Asthma Blood clot in an artery in the ...

  4. Assessment of the real-time PCR and different digital PCR platforms for DNA quantification.

    Science.gov (United States)

    Pavšič, Jernej; Žel, Jana; Milavec, Mojca

    2016-01-01

    Digital PCR (dPCR) is beginning to supersede real-time PCR (qPCR) for quantification of nucleic acids in many different applications. Several analytical properties of the two most commonly used dPCR platforms, namely the QX100 system (Bio-Rad) and the 12.765 array of the Biomark system (Fluidigm), have already been evaluated and compared with those of qPCR. However, to the best of our knowledge, direct comparison between the three of these platforms using the same DNA material has not been done, and the 37 K array on the Biomark system has also not been evaluated in terms of linearity, analytical sensitivity and limit of quantification. Here, a first assessment of qPCR, the QX100 system and both arrays of the Biomark system was performed with plasmid and genomic DNA from human cytomegalovirus. With use of PCR components that alter the efficiency of qPCR, each dPCR platform demonstrated consistent copy-number estimations, which indicates the high resilience of dPCR. Two approaches, one considering the total reaction volume and the other considering the effective reaction size, were used to assess linearity, analytical sensitivity and variability. When the total reaction volume was considered, the best performance was observed with qPCR, followed by the QX100 system and the Biomark system. In contrast, when the effective reaction size was considered, all three platforms showed almost equal limits of detection and variability. Although dPCR might not always be more appropriate than qPCR for quantification of low copy numbers, dPCR is a suitable method for robust and reproducible quantification of viral DNA, and a promising technology for the higher-order reference measurement method.

  5. Comparison of RT-PCR-Dot blot hybridization based on radioisotope 32P with conventional RT-PCR and commercial ELISA Assays for blood screening of HIV-1

    International Nuclear Information System (INIS)

    Maria Lina R; Andi Yasmon

    2011-01-01

    There are many commercial ELISA and rapid test kits that have been used for blood screening; however, the kits can give false positive and negative results. Therefore, RT-PCR (Reverse Transcription Polymerase Chain Reaction) - Dot Blot Hybridization based on radioisotope 32 P (RDBR) method was developed in this research, to compare the method with the conventional RT-PCR and commercial ELISA Enzyme-Linked lmmunosorbent Assay) kit. This method is efficient for screening of large blood specimens and surveillance study. Eighty seven samples were used and serum of the samples were tested by ELISA to detect HIV-1. The HIV-l RNA genome was extracted from plasma samples and tested using the RT-PCR and RDBR methods. Of 87 samples that were tested, the rates of positive testing of the RT-PCR, the RDBR, and the ELISA were 71.26%, 74.71%, and 80.46%, respectively. The RDBR (a combination of RTPCR and dot blot hybridization) was more sensitive than conventional RT-PCR by showing 3.45% in increase number of positive specimens. The results showed that of 9 samples (10.34%) were negative RDBR and positive ELISA, while 4 samples (4.60%) were negative ELISA and positive RDBR. The two methods showed slightly difference in the results but further validation is still needed. However, RDBR has high potential as an alternative method for screening of blood in large quantities when compared to method of conventional RT-PCR and ELISA. (author)

  6. Retrospective Review of Treponema pallidum PCR and Serology Results: Are Both Tests Necessary?

    Science.gov (United States)

    Brischetto, Anna; Gassiep, Ian; Whiley, David; Norton, Robert

    2018-05-01

    There has been a resurgence of syphilis diagnoses in Australia. We investigated whether our Treponema pallidum PCR test provides any additional diagnostic information over syphilis serology (chemiluminescence immunoassay [CMIA], Treponema pallidum particle agglutination [TPPA] assay, and the rapid plasma reagin [RPR] flocculation test). A retrospective audit of all T. pallidum PCR requests that came through our laboratory from January 2010 to June 2017 was conducted; data collected included age, gender, site of swab, and results from T. pallidum PCR, syphilis serology, and herpes simplex virus 1 (HSV-1) and HSV-2 PCRs. A total of 441 T. pallidum PCR tests were performed; on average, 3 T. pallidum PCRs per month were requested in 2011, and this rate increased to 17.2 requests per month in 2017. A total of 323 patients had both T. pallidum PCR and syphilis serology performed, with 67% of swabs taken from the genitals. T. pallidum PCR gave positive results for 61/323 (19%) patients; of these 61 patients, 59 (97%) also had positive syphilis serology results ( T. pallidum PCR sensitivity, 68%; specificity, 99%; positive predictive value, 97%; negative predictive value, 89%). Syphilis serology was positive for 91/323 patients (28%); of these 91 patients, 61 (66%) were also T. pallidum PCR positive (syphilis serology sensitivity, 97%; specificity, 88%; positive predictive value, 60%; negative predictive value, 99%). The Cohen's kappa value was 0.74, indicating substantial agreement between the two tests. Our results show that most patients with positive T. pallidum PCR results also had positive syphilis serology. Therefore, T. pallidum PCR adds little clinical value over serology for the diagnosis of syphilis in certain clinical settings. Copyright © 2018 American Society for Microbiology.

  7. Multiplex real-time PCR assay for Legionella species.

    Science.gov (United States)

    Kim, Seung Min; Jeong, Yoojung; Sohn, Jang Wook; Kim, Min Ja

    2015-12-01

    Legionella pneumophila serogroup 1 (sg1) accounts for the majority of infections in humans, but other Legionella species are also associated with human disease. In this study, a new SYBR Green I-based multiplex real-time PCR assay in a single reaction was developed to allow the rapid detection and differentiation of Legionella species by targeting specific gene sequences. Candidate target genes were selected, and primer sets were designed by referring to comparative genomic hybridization data of Legionella species. The Legionella species-specific groES primer set successfully detected all 30 Legionella strains tested. The xcpX and rfbA primers specifically detected L. pneumophila sg1-15 and L. pneumophila sg1, respectively. In addition, this assay was validated by testing clinical samples and isolates. In conclusion, this novel multiplex real-time PCR assay might be a useful diagnostic tool for the rapid detection and differentiation of Legionella species in both clinical and epidemiological studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. A novel PCR-based system for the detection of four species of human malaria parasites and Plasmodium knowlesi.

    Directory of Open Access Journals (Sweden)

    Kanako Komaki-Yasuda

    Full Text Available A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient's blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a "fast PCR enzyme". In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the "fast PCR enzyme", with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses.

  9. Use of species-specific PCR for the identification of 10 sea cucumber species

    Science.gov (United States)

    Wen, Jing; Zeng, Ling

    2014-11-01

    We developed a species-specific PCR method to identify species among dehydrated products of 10 sea cucumber species. Ten reverse species-specific primers designed from the 16S rRNA gene, in combination with one forward universal primer, generated PCR fragments of ca. 270 bp length for each species. The specificity of the PCR assay was tested with DNA of samples of 21 sea cucumber species. Amplification was observed in specific species only. The species-specific PCR method we developed was successfully applied to authenticate species of commercial products of dehydrated sea cucumber, and was proven to be a useful, rapid, and low-cost technique to identify the origin of the sea cucumber product.

  10. Material Biocompatibility for PCR Microfluidic Chips

    KAUST Repository

    Kodzius, Rimantas; Chang, Donald Choy; Gong, Xiuqing; Wen, Weijia; Wu, Jinbo; Xiao, Kang; Yi, Xin

    2010-01-01

    As part of the current miniaturization trend, biological reactions and processes are being adapted to microfluidics devices. PCR is the primary method employed in DNA amplification, its miniaturization is central to efforts to develop portable devices for diagnostics and testing purposes. A problem is the PCR-inhibitory effect due to interaction between PCR reagents and the surrounding environment, which effect is increased in high-surface-are-to-volume ration microfluidics. In this study, we evaluated the biocompatibility of various common materials employed in the fabrication of microfluidic chips, including silicon, several kinds of silicon oxide, glasses, plastics, wax, and adhesives. Two-temperature PCR was performed with these materials to determine their PCR-inhibitory effect. In most of the cases, addition of bovine serum albumin effectively improved the reaction yield. We also studied the individual PCR components from the standpoint of adsorption. Most of the materials did not inhibit the DNA, whereas they did show noticeable interaction with the DNA polymerase. Our test, instead of using microfluidic devices, can be easily conducted in common PCR tubes using a standard bench thermocycler. Our data supports an overview of the means by which the materials most bio-friendly to microfluidics can be selected.

  11. Material Biocompatibility for PCR Microfluidic Chips

    KAUST Repository

    Kodzius, Rimantas

    2010-04-23

    As part of the current miniaturization trend, biological reactions and processes are being adapted to microfluidics devices. PCR is the primary method employed in DNA amplification, its miniaturization is central to efforts to develop portable devices for diagnostics and testing purposes. A problem is the PCR-inhibitory effect due to interaction between PCR reagents and the surrounding environment, which effect is increased in high-surface-are-to-volume ration microfluidics. In this study, we evaluated the biocompatibility of various common materials employed in the fabrication of microfluidic chips, including silicon, several kinds of silicon oxide, glasses, plastics, wax, and adhesives. Two-temperature PCR was performed with these materials to determine their PCR-inhibitory effect. In most of the cases, addition of bovine serum albumin effectively improved the reaction yield. We also studied the individual PCR components from the standpoint of adsorption. Most of the materials did not inhibit the DNA, whereas they did show noticeable interaction with the DNA polymerase. Our test, instead of using microfluidic devices, can be easily conducted in common PCR tubes using a standard bench thermocycler. Our data supports an overview of the means by which the materials most bio-friendly to microfluidics can be selected.

  12. Differentiation of five enterohepatic Helicobacter species by nested PCR with high-resolution melting curve analysis.

    Science.gov (United States)

    Wu, Miaoli; Rao, Dan; Zhu, Yujun; Wang, Jing; Yuan, Wen; Zhang, Yu; Huang, Ren; Guo, Pengju

    2017-04-01

    Enterohepatic Helicobacter species (EHS) are widespread in rodent species around the world. Several studies have demonstrated that infection with EHS can interfere with the outcomes of animal experiments in cancer research and significantly influence the study results. Therefore, it is essential to establish a rapid detection and identification of EHS for biomedical research using laboratory rodents. Our study aimed to develop a rapid and sensitive method to detect and distinguish five enterohepatic Helicobacter species. Nested PCR followed by high-resolution melting curve analysis (HRM) was developed for identification of H. bilis, H. rodentium, H. muridarum, H. typhlonius, as well as H. hepaticus. To validate the accuracy of nested PCR-HRM analysis, quantitative real-time PCR methods for five different enterohepatic Helicobacter species were developed. A total of 50 cecal samples were tested using both nested PCR-HRM analysis and qPCR method. The nested PCR-HRM method could distinguish five enterohepatic Helicobacter species by different melting temperatures. The melting curve were characterized by peaks of 78.7 ± 0.12°C for H. rodentium, 80.51 ± 0.09°C for H. bilis, 81.6 ± 0.1°C for H. typhlonius, 82.11 ± 0.18°C for H. muridarum, and 82.95 ± 0.09°C for H. hepaticus. The nested PCR-HRM assay is a simple, rapid, and cost-effective assay. This assay could be a useful tool for molecular epidemiology study of enterohepatic Helicobacter infection and an attractive alternative for genotyping of enterohepatic Helicobacter species. © 2016 John Wiley & Sons Ltd.

  13. Escherichia coli H-Genotyping PCR: a Complete and Practical Platform for Molecular H Typing.

    Science.gov (United States)

    Banjo, Masaya; Iguchi, Atsushi; Seto, Kazuko; Kikuchi, Taisei; Harada, Tetsuya; Scheutz, Flemming; Iyoda, Sunao

    2018-06-01

    In Escherichia coli , more than 180 O groups and 53 H types have been recognized. The O:H serotyping of E. coli strains is an effective method for identifying strains with pathogenic potential and classifying them into clonal groups. In particular, the serotyping of Shiga toxin-producing E. coli (STEC) strains provides valuable information to evaluate the routes, sources, and prevalence of agents in outbreak investigations and surveillance. Here, we present a complete and practical PCR-based H-typing system, E. coli H-genotyping PCR, consisting of 10 multiplex PCR kits with 51 single PCR primer pairs. Primers were designed based on a detailed comparative analysis of sequences from all H-antigen (flagellin)-encoding genes, fliC and its homologs. The specificity of this system was confirmed by using all H type reference strains. Additionally, 362 serotyped wild strains were also used to evaluate its practicality. All 277 H-type-identified isolates gave PCR products that corresponded to the results of serological H typing. Moreover, 76 nonmotile and nine untypeable strains could be successfully subtyped into any H type by the PCR system. The E. coli H-genotyping PCR developed here allows broader, rapid, and low-cost subtyping of H types and will assist epidemiological studies as well as surveillance of pathogenic E. coli . Copyright © 2018 American Society for Microbiology.

  14. PCR methodology as a valuable tool for identification of endodontic pathogens.

    Science.gov (United States)

    Siqueira, José F; Rôças, Isabela N

    2003-07-01

    This paper reviews the principles of polymerase chain reaction (PCR) methodology, its application in identification of endodontic pathogens and the perspectives regarding the knowledge to be reached with the use of this highly sensitive, specific and accurate methodology as a microbial identification test. Studies published in the medical, dental and biological literature. Evaluation of published epidemiological studies examining the endodontic microbiota through PCR methodology. PCR technology has enabled the detection of bacterial species that are difficult or even impossible to culture as well as cultivable bacterial strains showing a phenotypically divergent or convergent behaviour. Moreover, PCR is more rapid, much more sensitive, and more accurate when compared with culture. Its use in endodontics to investigate the microbiota associated with infected root canals has expanded the knowledge on the bacteria involved in the pathogenesis of periradicular diseases. For instance, Tannerella forsythensis (formerly Bacteroides forsythus), Treponema denticola, other Treponema species, Dialister pneumosintes, and Prevotella tannerae were detected in infected root canals for the first time and in high prevalence when using PCR analysis. The diversity of endodontic microbiota has been demonstrated by studies using PCR amplification, cloning and sequencing of the PCR products. Moreover, other fastidious bacterial species, such as Porphyromonas endodontalis, Porphyromonas gingivalis and some Eubacterium spp., have been reported in endodontic infections at a higher prevalence than those reported by culture procedures.

  15. Use of a rep-PCR system to predict species in the Aspergillus section Nigri

    Science.gov (United States)

    The Aspergillus niger aggregate within the A. section Nigri, is a group of black-spored aspergilli which taxonomy has been elusive. REP-PCR has become a rapid and cost-effective method for genotyping fungi and bacteria. In the present study, we evaluated the discriminatory power of a semi-automate...

  16. DETECTION AND QUANTIFICATION OF COW FECAL POLLUTION WITH REAL-TIME PCR

    Science.gov (United States)

    Assessment of health risk and fecal bacteria loads associated with cow fecal pollution requires a reliable host-specific genetic marker and a rapid quantification method. We report the development of quantitative PCR assays for enumeration of two recently described cow-specific g...

  17. Random Amplified Polymorphic DNA PCR in the Teaching of Molecular Epidemiology

    Science.gov (United States)

    Reinoso, Elina B.; Bettera, Susana G.

    2016-01-01

    In this article, we describe a basic practical laboratory designed for fifth-year undergraduate students of Microbiology as part of the Epidemiology course. This practice provides the students with the tools for molecular epidemiological analysis of pathogenic microorganisms using a rapid and simple PCR technique. The aim of this work was to assay…

  18. A multiplex PCR for detection of Listeria monocytogenes and its lineages.

    Science.gov (United States)

    Rawool, Deepak B; Doijad, Swapnil P; Poharkar, Krupali V; Negi, Mamta; Kale, Satyajit B; Malik, S V S; Kurkure, Nitin V; Chakraborty, Trinad; Barbuddhe, Sukhadeo B

    2016-11-01

    A novel multiplex PCR assay was developed to identify genus Listeria, and discriminate Listeria monocytogenes and its major lineages (LI, LII, LIII). This assay is a rapid and inexpensive subtyping method for screening and characterization of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza

    DEFF Research Database (Denmark)

    Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen

    2003-01-01

    A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected