WorldWideScience

Sample records for rapid allele-specific pcr

  1. Rapid ABO genotyping by high-speed droplet allele-specific PCR using crude samples.

    Science.gov (United States)

    Taira, Chiaki; Matsuda, Kazuyuki; Takeichi, Naoya; Furukawa, Satomi; Sugano, Mitsutoshi; Uehara, Takeshi; Okumura, Nobuo; Honda, Takayuki

    2018-01-01

    ABO genotyping has common tools for personal identification of forensic and transplantation field. We developed a new method based on a droplet allele-specific PCR (droplet-AS-PCR) that enabled rapid PCR amplification. We attempted rapid ABO genotyping using crude DNA isolated from dried blood and buccal cells. We designed allele-specific primers for three SNPs (at nucleotides 261, 526, and 803) in exons 6 and 7 of the ABO gene. We pretreated dried blood and buccal cells with proteinase K, and obtained crude DNAs without DNA purification. Droplet-AS-PCR allowed specific amplification of the SNPs at the three loci using crude DNA, with results similar to those for DNA extracted from fresh peripheral blood. The sensitivity of the methods was 5%-10%. The genotyping of extracted DNA and crude DNA were completed within 8 and 9 minutes, respectively. The genotypes determined by the droplet-AS-PCR method were always consistent with those obtained by direct sequencing. The droplet-AS-PCR method enabled rapid and specific amplification of three SNPs of the ABO gene from crude DNA treated with proteinase K. ABO genotyping by the droplet-AS-PCR has the potential to be applied to various fields including a forensic medicine and transplantation medical care. © 2017 Wiley Periodicals, Inc.

  2. Detection of the MYD88 mutation by the combination of the allele-specific PCR and quenching probe methods.

    Science.gov (United States)

    Nogami, S; Kawaguchi-Ihara, N; Shiratori, E; Ohtaka, M; Itoh, M; Tohda, S

    2017-04-01

    The MYD88 missense mutation c.794T>C, p.Leu265Pro, is found in patients with Waldenstörm's macroglobulinemia and lymphoma. Direct sequencing, allele-specific PCR (AS-PCR), PCR-restriction fragment length polymorphism (PCR-RFLP), and high-resolution melting analysis (HRM) are currently used to detect the mutation; however, they are either time-consuming or have low detection sensitivity. Here, we developed a novel highly sensitive and rapid detection method based on the quenching probe (QP) technique and AS-PCR. A lymphoma cell line heterozygous for the MYD88 mutation, two wild-type cell lines, and two samples from Waldenstörm's macroglobulinemia patients were analyzed by AS-PCR, PCR-RFLP, HRM, and QP, and their detection sensitivity was examined using the mixtures of the mutant and wild-type DNA. For mutation-carrying heterozygous samples, the QP method produced W-shaped melting profiles presenting curves derived from the wild-type and mutant alleles. The QP analysis was performed in 2 h and demonstrated the detection limit of 5%, which was similar to that of the other methods. However, the combination of AS-PCR and QP (AS-QP) improved the sensitivity to 0.62% of the mutant allele. The AS-QP analysis is rapid and minimally improves detection sensitivity compared to the AS-PCR. © 2016 John Wiley & Sons Ltd.

  3. Citrus (Rutaceae SNP Markers Based on Competitive Allele-Specific PCR; Transferability Across the Aurantioideae Subfamily

    Directory of Open Access Journals (Sweden)

    Andres Garcia-Lor

    2013-04-01

    Full Text Available Premise of the study: Single nucleotide polymorphism (SNP markers based on Competitive Allele-Specific PCR (KASPar were developed from sequences of three Citrus species. Their transferability was tested in 63 Citrus genotypes and 19 relative genera of the subfamily Aurantioideae to estimate the potential of SNP markers, selected from a limited intrageneric discovery panel, for ongoing broader diversity analysis at the intra- and intergeneric levels and systematic germplasm bank characterization. Methods and Results: Forty-two SNP markers were developed using KASPar technology. Forty-one were successfully genotyped in all of the Citrus germplasm, where intra- and interspecific polymorphisms were observed. The transferability and diversity decreased with increasing taxonomic distance. Conclusions: SNP markers based on the KASPar method developed from sequence data of a limited intrageneric discovery panel provide a valuable molecular resource for genetic diversity analysis of germplasm within a genus and should be useful for germplasm fingerprinting at a much broader diversity level.

  4. Use of multiplex allele-specific polymerase chain reaction (MAS-PCR to detect multidrug-resistant tuberculosis in Panama.

    Directory of Open Access Journals (Sweden)

    Bing-Shao Chia

    Full Text Available The frequency of individual genetic mutations conferring drug resistance (DR to Mycobacterium tuberculosis has not been studied previously in Central America, the place of origin of many immigrants to the United States. The current gold standard for detecting multidrug-resistant tuberculosis (MDR-TB is phenotypic drug susceptibility testing (DST, which is resource-intensive and slow, leading to increased MDR-TB transmission in the community. We evaluated multiplex allele-specific polymerase chain reaction (MAS-PCR as a rapid molecular tool to detect MDR-TB in Panama. Based on DST, 67 MDR-TB and 31 drug-sensitive clinical isolates were identified and cultured from an archived collection. Primers were designed to target five mutation hotspots that confer resistance to the first-line drugs isoniazid and rifampin, and MAS-PCR was performed. Whole-genome sequencing confirmed DR mutations identified by MAS-PCR, and provided frequencies of genetic mutations. DNA sequencing revealed 70.1% of MDR strains to have point mutations at codon 315 of the katG gene, 19.4% within mabA-inhA promoter, and 98.5% at three hotspots within rpoB. MAS-PCR detected each of these mutations, yielding 82.8% sensitivity and 100% specificity for isoniazid resistance, and 98.4% sensitivity and 100% specificity for rifampin resistance relative to DST. The frequency of individual DR mutations among MDR strains in Panama parallels that of other TB-endemic countries. The performance of MAS-PCR suggests that it may be a relatively inexpensive and technically feasible method for rapid detection of MDR-TB in developing countries.

  5. Lateral flow strip for visual detection of K-ras mutations based on allele-specific PCR.

    Science.gov (United States)

    Wang, Cong; Chen, Xiaomin; Wu, Yuying; Li, Hao; Wang, Yu; Pan, Xiaofu; Tang, Tingting; Liu, Ziying; Li, Xiaokun

    2016-10-01

    To develop a convenient and sensitive point-of-care test for detecting gene mutations based on allele-specific PCR. To develop a lateral flow strip for visual detection of K-ras mutations based on a modified PCR, a specific DNA tag was covalently linked to the 5'-end of each primer by a nine-carbon linker to produce a sticky end. One of the sticky ends of the PCR products bound to gold nano-particles, while the other sticky end was captured onto a nitrocellulose membrane of lateral flow strips. The lateral flow strip showed a great sensitivity, which detected mutations in as low as 10 tumor cells. The positive rate and accuracy of the lateral flow strip for blood samples were over 92 and 96 %, respectively. The lateral flow strip provides an easy method for sensitive detection of gene mutations based on allele specific-PCR.

  6. Screening the three LHON primary mutations in the general Chinese population by using an optimized multiplex allele-specific PCR.

    Science.gov (United States)

    Bi, Rui; Zhang, A-Mei; Yu, Dandan; Chen, Diana; Yao, Yong-Gang

    2010-11-11

    Leber hereditary optic neuropathy (LHON) is one of the most common mitochondrial diseases, which is mainly caused by three mitochondrial DNA (mtDNA) mutations (m.3460G>A, m.11778G>A and m.14484T>C). Incomplete penetrance suggests that there might be asymptomatic carriers in general populations. These asymptomatic carriers are clinically important as they are potential future patients and the female carriers could transfer the pathogenic mutations to their offspring. Thus, screening the three LHON primary mutations in general populations is important for genetic counseling. We optimized a multiplex allele-specific PCR method based on previous studies, and the sensitivity was evaluated. The three LHON primary mutations were screened by using this MAS-PCR method in 1571 subjects from general Chinese populations that are without symptoms or family history of optic neuropathy. The optimized MAS-PCR approach can detect a heteroplasmy level at 5%, 5%, and 20% for m.3460G>A, m.11778G>A and m.14484T>C, respectively. None of the three LHON primary mutations was detected in the 1571 subjects. The three LHON primary mutations are rare in general Chinese populations. The optimized MAS-PCR assay provides an easier, faster and more cost-effective method for detection of the three LHON primary mutations, making it practical for clinical diagnosis. 2010 Elsevier B.V. All rights reserved.

  7. Allele Specific Locked Nucleic Acid Quantitative PCR (ASLNAqPCR): An Accurate and Cost-Effective Assay to Diagnose and Quantify KRAS and BRAF Mutation

    Science.gov (United States)

    Morandi, Luca; de Biase, Dario; Visani, Michela; Cesari, Valentina; De Maglio, Giovanna; Pizzolitto, Stefano; Pession, Annalisa; Tallini, Giovanni

    2012-01-01

    The use of tyrosine kinase inhibitors (TKIs) requires the testing for hot spot mutations of the molecular effectors downstream the membrane-bound tyrosine kinases since their wild type status is expected for response to TKI therapy. We report a novel assay that we have called Allele Specific Locked Nucleic Acid quantitative PCR (ASLNAqPCR). The assay uses LNA-modified allele specific primers and LNA-modified beacon probes to increase sensitivity, specificity and to accurately quantify mutations. We designed primers specific for codon 12/13 KRAS mutations and BRAF V600E, and validated the assay with 300 routine samples from a variety of sources, including cytology specimens. All were analyzed by ASLNAqPCR and Sanger sequencing. Discordant cases were pyrosequenced. ASLNAqPCR correctly identified BRAF and KRAS mutations in all discordant cases and all had a mutated/wild type DNA ratio below the analytical sensitivity of the Sanger method. ASLNAqPCR was 100% specific with greater accuracy, positive and negative predictive values compared with Sanger sequencing. The analytical sensitivity of ASLNAqPCR is 0.1%, allowing quantification of mutated DNA in small neoplastic cell clones. ASLNAqPCR can be performed in any laboratory with real-time PCR equipment, is very cost-effective and can easily be adapted to detect hot spot mutations in other oncogenes. PMID:22558339

  8. Allele specific locked nucleic acid quantitative PCR (ASLNAqPCR: an accurate and cost-effective assay to diagnose and quantify KRAS and BRAF mutation.

    Directory of Open Access Journals (Sweden)

    Luca Morandi

    Full Text Available The use of tyrosine kinase inhibitors (TKIs requires the testing for hot spot mutations of the molecular effectors downstream the membrane-bound tyrosine kinases since their wild type status is expected for response to TKI therapy. We report a novel assay that we have called Allele Specific Locked Nucleic Acid quantitative PCR (ASLNAqPCR. The assay uses LNA-modified allele specific primers and LNA-modified beacon probes to increase sensitivity, specificity and to accurately quantify mutations. We designed primers specific for codon 12/13 KRAS mutations and BRAF V600E, and validated the assay with 300 routine samples from a variety of sources, including cytology specimens. All were analyzed by ASLNAqPCR and Sanger sequencing. Discordant cases were pyrosequenced. ASLNAqPCR correctly identified BRAF and KRAS mutations in all discordant cases and all had a mutated/wild type DNA ratio below the analytical sensitivity of the Sanger method. ASLNAqPCR was 100% specific with greater accuracy, positive and negative predictive values compared with Sanger sequencing. The analytical sensitivity of ASLNAqPCR is 0.1%, allowing quantification of mutated DNA in small neoplastic cell clones. ASLNAqPCR can be performed in any laboratory with real-time PCR equipment, is very cost-effective and can easily be adapted to detect hot spot mutations in other oncogenes.

  9. Comparison of Kompetitive Allele Specific PCR (KASP) and genotyping by sequencing (GBS) for quality control analysis in maize.

    Science.gov (United States)

    Ertiro, Berhanu Tadesse; Ogugo, Veronica; Worku, Mosisa; Das, Biswanath; Olsen, Michael; Labuschagne, Maryke; Semagn, Kassa

    2015-11-06

    Quality control (QC) analysis is an important component in maize breeding and seed systems. Genotyping by next-generation sequencing (GBS) is an emerging method of SNP genotyping, which is being increasingly adopted for discovery applications, but its suitability for QC analysis has not been explored. The objectives of our study were 1) to evaluate the level of genetic purity and identity among two to nine seed sources of 16 inbred lines using 191 Kompetitive Allele Specific PCR (KASP) and 257,268 GBS markers, and 2) compare the correlation between the KASP-based low and the GBS-based high marker density on QC analysis. Genetic purity within each seed source varied from 49 to 100% for KASP and from 74 to 100% for GBS. All except one of the inbred lines obtained from CIMMYT showed 98 to 100% homogeneity irrespective of the marker type. On the contrary, only 16 and 21% of the samples obtained from EIAR and partners showed ≥95% purity for KASP and GBS, respectively. The genetic distance among multiple sources of the same line designation varied from 0.000 to 0.295 for KASP and from 0.004 to 0.230 for GBS. Five lines from CIMMYT showed ≤ 0.05 distance among multiple sources of the same line designation; the remaining eleven inbred lines, including two from CIMMYT and nine from Ethiopia showed higher than expected genetic distances for two or more seed sources. The correlation between the 191 KASP and 257,268 GBS markers was 0.88 for purity and 0.93 for identity. A reduction in the number of GBS markers to 1,343 decreased the correlation coefficient only by 0.03. Our results clearly showed high discrepancy both in genetic purity and identity by the origin of the seed sources (institutions) irrespective of the type of genotyping platform and number of markers used for analyses. Although there were some numerical differences between KASP and GBS, the overall conclusions reached from both methods was basically similar, which clearly suggests that smaller subset of

  10. Establishment of real time allele specific locked nucleic acid quantitative PCR for detection of HBV YIDD (ATT mutation and evaluation of its application.

    Directory of Open Access Journals (Sweden)

    Yongbin Zeng

    Full Text Available BACKGROUND: Long-term use of nucleos(tide analogues can increase risk of HBV drug-resistance mutations. The rtM204I (ATT coding for isoleucine is one of the most important resistance mutation sites. Establishing a simple, rapid, reliable and highly sensitive assay to detect the resistant mutants as early as possible is of great clinical significance. METHODS: Recombinant plasmids for HBV YMDD (tyrosine-methionine-aspartate-aspartate and YIDD (tyrosine-isoleucine-aspartate-aspartate were constructed by TA cloning. Real time allele specific locked nucleic acid quantitative PCR (RT-AS-LNA-qPCR with SYBR Green I was established by LNA-modified primers and evaluated with standard recombinant plasmids, clinical templates (the clinical wild type and mutant HBV DNA mixture and 102 serum samples from nucleos(tide analogues-experienced patients. The serum samples from a chronic hepatitis B (CHB patient firstly received LMV mono therapy and then switched to LMV + ADV combined therapy were also dynamically analyzed for 10 times. RESULTS: The linear range of the assay was between 1×10(9 copies/μl and 1 × 10(2 copies/μl. The low detection limit was 1 × 10(1 copies/μl. Sensitivity of the assay were 10(-6, 10(-4 and 10(-2 in the wild-type background of 1 × 10(9 copies/μl, 1 × 10(7 copies/μl and 1 × 10(5 copies/μl, respectively. The sensitivity of the assay in detection of clinical samples was 0.03%. The complete coincidence rate between RT-AS-LNA-qPCR and direct sequencing was 91.2% (93/102, partial coincidence rate was 8.8% (9/102, and no complete discordance was observed. The two assays showed a high concordance (Kappa = 0.676, P = 0.000. Minor variants can be detected 18 weeks earlier than the rebound of HBV DNA load and alanine aminotransferase level. CONCLUSIONS: A rapid, cost-effective, high sensitive, specific and reliable method of RT-AS-LNA-qPCR with SYBR Green I for early and absolute quantification of HBV YIDD (ATT coding for isoleucine

  11. Development of a Melting Curve-Based Allele-Specific PCR of Apolipoprotein E (APOE Genotyping Method for Genomic DNA, Guthrie Blood Spot, and Whole Blood.

    Directory of Open Access Journals (Sweden)

    Chia-Hsiang Chen

    Full Text Available Genetic polymorphisms of apolipoprotein E (APOE are associated with various health conditions and diseases, such as Alzheimer's disease, cardiovascular diseases, type 2 diabetes, etc. Hence, genotyping of APOE has broad applications in biomedical research and clinical settings, particularly in the era of precision medicine. The study aimed to develop a convenient and accurate method with flexible throughput to genotype the APOE polymorphisms. A melting curve-based allele-specific PCR method was developed to genotype two single nucleotide polymorphisms (SNPs of APOE, i.e. rs429358 at codon 112 and rs7412 at codon 158. These two SNPs determine the genotype of APOE2, E3, and E4. PCR-based Sanger sequencing was used as the reference method for APOE genotyping. A 100% concordance rate was obtained in 300 subjects between the melting curve-based allele-specific PCR method and the Sanger sequencing method. This method was applied to a genetic association analysis of APOE and schizophrenia consisting of 711 patients with schizophrenia and 665 control subjects from Taiwan. However, no significant differences in the allele and genotype frequencies were detected between these two groups. Further experiments showed that DNA dissolved from blood collected on Guthrie filter paper and total blood cell lysate without DNA extraction can be used in the melting curve-based allele-specific PCR method. Thus, we suggest that this is a fast, accurate and robust APOE genotyping method with a flexible throughput and suitable for DNA template from different preparations. This convenient method shall meet the different needs of various research and clinical laboratories.

  12. Detection of EGFR mutations in plasma and biopsies from non-small cell lung cancer patients by allele-specific PCR assays.

    Science.gov (United States)

    Weber, Britta; Meldgaard, Peter; Hager, Henrik; Wu, Lin; Wei, Wen; Tsai, Julie; Khalil, Azza; Nexo, Ebba; Sorensen, Boe S

    2014-04-28

    Lung cancer patients with mutations in the epidermal growth factor receptor (EGFR) are primary candidates for EGFR-targeted therapy. Reliable analyses of such mutations have previously been possible only in tumour tissue. Here, we demonstrate that mutations can be detected in plasma samples with allele-specific PCR assays. Pairs of the diagnostic biopsy and plasma obtained just prior to start of erlotinib treatment were collected from 199 patients with adenocarcinoma of non-small-cell lung cancer. DNA from both sample types was isolated and examined for the presence of mutations in exons 18-21 of the EGFR gene, employing the cobas(®) EGFR Tissue Test and cobas(®) EGFR Blood Test (in development, Roche Molecular Systems, Inc., CA, USA). Test results were obtained in all 199 (100%) plasma samples and 196/199 (98%) of the biopsies. EGFR-activating mutations were identified in 24/199 (12%) plasma samples and 28/196 (14%) biopsy samples, and 17/196 (9%) matched pairs contained the same mutation. Six EGFR mutations were present only in plasma samples but not in the biopsy samples. The overall concordance of the EGFR gene mutations detected in plasma and biopsy tissue was 179/196 (91%) (kappa value: 0.621). Mutational analysis of the EGFR gene in plasma samples is feasible with allele-specific PCR assays and represents a non-invasive supplement to biopsy analysis. M-20080012 from March 10, 2008 and reported to ClinicalTrials.gov: NCT00815971.

  13. Detection of EGFR mutations in plasma and biopsies from non-small cell lung cancer patients by allele-specific PCR assays

    DEFF Research Database (Denmark)

    Weber, Britta; Meldgaard, Peter; Hager, Henrik

    2014-01-01

    samples with allele-specific PCR assays. METHODS: Pairs of the diagnostic biopsy and plasma obtained just prior to start of erlotinib treatment were collected from 199 patients with adenocarcinoma of non-small-cell lung cancer. DNA from both sample types was isolated and examined for the presence...... of mutations in exons 18-21 of the EGFR gene, employing the cobas(®) EGFR Tissue Test and cobas(®) EGFR Blood Test (in development, Roche Molecular Systems, Inc., CA, USA). RESULTS: Test results were obtained in all 199 (100%) plasma samples and 196/199 (98%) of the biopsies. EGFR-activating mutations were...... identified in 24/199 (12%) plasma samples and 28/196 (14%) biopsy samples, and 17/196 (9%) matched pairs contained the same mutation. Six EGFR mutations were present only in plasma samples but not in the biopsy samples. The overall concordance of the EGFR gene mutations detected in plasma and biopsy tissue...

  14. Development of Nuclear Microsatellite Loci and Mitochondrial Single Nucleotide Polymorphisms for the Natterjack Toad, Bufo (Epidalea) calamita (Bufonidae), Using Next Generation Sequencing and Competitive Allele Specific PCR (KASPar).

    Science.gov (United States)

    Faucher, Leslie; Godé, Cécile; Arnaud, Jean-François

    2016-01-01

    Amphibians are undergoing a major decline worldwide and the steady increase in the number of threatened species in this particular taxa highlights the need for conservation genetics studies using high-quality molecular markers. The natterjack toad, Bufo (Epidalea) calamita, is a vulnerable pioneering species confined to specialized habitats in Western Europe. To provide efficient and cost-effective genetic resources for conservation biologists, we developed and characterized 22 new nuclear microsatellite markers using next-generation sequencing. We also used sequence data acquired from Sanger sequencing to develop the first mitochondrial markers for KASPar assay genotyping. Genetic polymorphism was then analyzed for 95 toads sampled from 5 populations in France. For polymorphic microsatellite loci, number of alleles and expected heterozygosity ranged from 2 to 14 and from 0.035 to 0.720, respectively. No significant departures from panmixia were observed (mean multilocus F IS = -0.015) and population differentiation was substantial (mean multilocus F ST = 0.222, P < 0.001). From a set of 18 mitochondrial SNPs located in the 16S and D-loop region, we further developed a fast and cost-effective SNP genotyping method based on competitive allele-specific PCR amplification (KASPar). The combination of allelic states for these mitochondrial DNA SNP markers yielded 10 different haplotypes, ranging from 2 to 5 within populations. Populations were highly differentiated (G ST = 0.407, P < 0.001). These new genetic resources will facilitate future parentage, population genetics and phylogeographical studies and will be useful for both evolutionary and conservation concerns, especially for the set-up of management strategies and the definition of distinct evolutionary significant units. © The American Genetic Association 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Genotyping of the 19-bp insertion/deletion polymorphism in the 5' flank of beta-hydroxylase gene by dissociation analysis of allele-specific PCR products

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Werge, Thomas

    2005-01-01

    and a conventional approach based upon agarose gel electrophoresis of amplified fragments revealed complete concordance between the two procedures. The insights obtained in this study may be utilized to develop assays based upon dissociation analysis of PCR products for genotyping of other insertion...

  16. Determination of cis/trans phase of variations in the MC1R gene with allele-specific PCR and single base extension

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Børsting, Claus; Sanchez, Juan J

    2008-01-01

    The MC1R gene encodes a protein with key regulatory functions in the melanin synthesis. A multiplex PCR and a multiplex single base extension protocol were established for genotyping six exonic MC1R variations highly penetrant for red hair (R), four exonic MC1R variations weakly penetrant for red...

  17. 454 next generation-sequencing outperforms allele-specific PCR, Sanger sequencing, and pyrosequencing for routine KRAS mutation analysis of formalin-fixed, paraffin-embedded samples

    Science.gov (United States)

    Altimari, Annalisa; de Biase, Dario; De Maglio, Giovanna; Gruppioni, Elisa; Capizzi, Elisa; Degiovanni, Alessio; D’Errico, Antonia; Pession, Annalisa; Pizzolitto, Stefano; Fiorentino, Michelangelo; Tallini, Giovanni

    2013-01-01

    Detection of KRAS mutations in archival pathology samples is critical for therapeutic appropriateness of anti-EGFR monoclonal antibodies in colorectal cancer. We compared the sensitivity, specificity, and accuracy of Sanger sequencing, ARMS-Scorpion (TheraScreen®) real-time polymerase chain reaction (PCR), pyrosequencing, chip array hybridization, and 454 next-generation sequencing to assess KRAS codon 12 and 13 mutations in 60 nonconsecutive selected cases of colorectal cancer. Twenty of the 60 cases were detected as wild-type KRAS by all methods with 100% specificity. Among the 40 mutated cases, 13 were discrepant with at least one method. The sensitivity was 85%, 90%, 93%, and 92%, and the accuracy was 90%, 93%, 95%, and 95% for Sanger sequencing, TheraScreen real-time PCR, pyrosequencing, and chip array hybridization, respectively. The main limitation of Sanger sequencing was its low analytical sensitivity, whereas TheraScreen real-time PCR, pyrosequencing, and chip array hybridization showed higher sensitivity but suffered from the limitations of predesigned assays. Concordance between the methods was k = 0.79 for Sanger sequencing and k > 0.85 for the other techniques. Tumor cell enrichment correlated significantly with the abundance of KRAS-mutated deoxyribonucleic acid (DNA), evaluated as ΔCt for TheraScreen real-time PCR (P = 0.03), percentage of mutation for pyrosequencing (P = 0.001), ratio for chip array hybridization (P = 0.003), and percentage of mutation for 454 next-generation sequencing (P = 0.004). Also, 454 next-generation sequencing showed the best cross correlation for quantification of mutation abundance compared with all the other methods (P < 0.001). Our comparison showed the superiority of next-generation sequencing over the other techniques in terms of sensitivity and specificity. Next-generation sequencing will replace Sanger sequencing as the reference technique for diagnostic detection of KRAS mutation in archival tumor tissues. PMID

  18. 454 next generation-sequencing outperforms allele-specific PCR, Sanger sequencing, and pyrosequencing for routine KRAS mutation analysis of formalin-fixed, paraffin-embedded samples

    Directory of Open Access Journals (Sweden)

    Altimari A

    2013-08-01

    Full Text Available Annalisa Altimari,1,* Dario de Biase,2,* Giovanna De Maglio,3 Elisa Gruppioni,1 Elisa Capizzi,1 Alessio Degiovanni,1 Antonia D'Errico,1 Annalisa Pession,2 Stefano Pizzolitto,3 Michelangelo Fiorentino,1,# Giovanni Tallini2,#1Laboratory of Molecular Oncologic and Transplantation Pathology, S. Orsola-Malpighi Hospital, Bologna, 2Laboratory of Molecular Pathology, Anatomic Pathology, Bellaria Hospital, Bologna, 3Department of Pathology, S. Maria della Misericordia Hospital, Udine, Italy*These authors contributed equally to this work #These authors share senior authorshipAbstract: Detection of KRAS mutations in archival pathology samples is critical for therapeutic appropriateness of anti-EGFR monoclonal antibodies in colorectal cancer. We compared the sensitivity, specificity, and accuracy of Sanger sequencing, ARMS-Scorpion (TheraScreen® real-time polymerase chain reaction (PCR, pyrosequencing, chip array hybridization, and 454 next-generation sequencing to assess KRAS codon 12 and 13 mutations in 60 nonconsecutive selected cases of colorectal cancer. Twenty of the 60 cases were detected as wild-type KRAS by all methods with 100% specificity. Among the 40 mutated cases, 13 were discrepant with at least one method. The sensitivity was 85%, 90%, 93%, and 92%, and the accuracy was 90%, 93%, 95%, and 95% for Sanger sequencing, TheraScreen real-time PCR, pyrosequencing, and chip array hybridization, respectively. The main limitation of Sanger sequencing was its low analytical sensitivity, whereas TheraScreen real-time PCR, pyrosequencing, and chip array hybridization showed higher sensitivity but suffered from the limitations of predesigned assays. Concordance between the methods was k = 0.79 for Sanger sequencing and k > 0.85 for the other techniques. Tumor cell enrichment correlated significantly with the abundance of KRAS-mutated deoxyribonucleic acid (DNA, evaluated as ΔCt for TheraScreen real-time PCR (P = 0.03, percentage of mutation for

  19. Evolutionary divergence in Chenopodium and validation of SNPs in chloroplast rbcL and matk genes by allele-specific PCR for development of Chenopodium quinoa-specific markers

    Directory of Open Access Journals (Sweden)

    Rajkumari Jashmi Devi

    2017-02-01

    Full Text Available The genus Chenopodium comprises about 150 species, of which Chenopodium quinoa and C. album are important for their nutritional value. Evaluation of variation in qualitative morphological traits of plants and SNPs in chloroplast rbcL and matK gene sequences in 19 accessions representing C. quinoa and C. album indicated that the accessions IC-411824 and IC-411825, which have white seeds, belong to C. quinoa rather than C. album. This observation was also supported by a time tree that indicated IC-411824 and IC-411825 to be a sister clade to accessions of C. quinoa with an estimated age of 1.2 Mya. Whereas multiple alignments of rbcL gene sequences from the 19 accessions revealed 1.26% parsimony-informative sites with 0.68% interspecific sequence diversity, alignment of nucleotide sequences of amplicons representing the matK gene revealed 4.97% parsimony-informative sites and 2.81% interspecific sequence diversity. Validation of SNPs in the cp rbcL and matK regions of 36 accessions belonging to C. quinoa and C. album was performed by allele-specific PCR with primers carrying a single base change at the 3′ end. We report the first C. quinoa-specific SNP-based primer, R1RQ-AFR, designed from rbcL sequences, that could differentiate quinoa from 64 genera including 13 species of the genus Chenopodium. With an estimated age of 10.5–4.1 million years (Myr, the Himalayan chenopods are evolutionarily younger than the Andean chenopods. The results establish the paraphyletic origin of the genus Chenopodium.

  20. Comparison of 454 Ultra-Deep Sequencing and Allele-Specific Real-Time PCR with Regard to the Detection of Emerging Drug-Resistant Minor HIV-1 Variants after Antiretroviral Prophylaxis for Vertical Transmission.

    Directory of Open Access Journals (Sweden)

    Andrea Hauser

    Full Text Available Pregnant HIV-infected women were screened for the development of HIV-1 drug resistance after implementation of a triple-antiretroviral transmission prophylaxis as recommended by the WHO in 2006. The study offered the opportunity to compare amplicon-based 454 ultra-deep sequencing (UDS and allele-specific real-time PCR (ASPCR for the detection of drug-resistant minor variants in the HIV-1 reverse transcriptase (RT.Plasma samples from 34 Tanzanian women were previously analysed by ASPCR for key resistance mutations in the viral RT selected by AZT, 3TC, and NVP (K70R, K103N, Y181C, M184V, T215Y/F. In this study, the RT region of the same samples was investigated by amplicon-based UDS for resistance mutations using the 454 GS FLX System.Drug-resistant HIV-variants were identified in 69% (20/29 of women by UDS and in 45% (13/29 by ASPCR. The absolute number of resistance mutations identified by UDS was twice that identified by ASPCR (45 vs 24. By UDS 14 of 24 ASPCR-detected resistance mutations were identified at the same position. The overall concordance between UDS and ASPCR was 61.0% (25/41. The proportions of variants quantified by UDS were approximately 2-3 times lower than by ASPCR. Amplicon generation from samples with viral loads below 20,000 copies/ml failed more frequently by UDS compared to ASPCR (limit of detection = 650 copies/ml, resulting in missing or insufficient sequence coverage.Both methods can provide useful information about drug-resistant minor HIV-1 variants. ASPCR has a higher sensitivity than UDS, but is restricted to single resistance mutations. In contrast, UDS is limited by its requirement for high viral loads to achieve sufficient sequence coverage, but the sequence information reveals the complete resistance patterns within the genomic region analysed. Improvements to the UDS limit of detection are in progress, and UDS could then facilitate monitoring of drug-resistant minor variants in the HIV-1 quasispecies.

  1. Allele-specific gene expression in carcinogenesis

    Directory of Open Access Journals (Sweden)

    O. M. Krivtsova

    2016-01-01

    Full Text Available Recent large-scale genomic studies established the occurrence of multiple DNA sequence variants in genomes of healthy individuals that differ from the reference sequence. Among these variants mostly represented by germline single nucleotide polymorphisms disease-related alleles are detected including alleles which are associated with monogenic disorders, and putative deleterious genetic variants. Apart from functional significance of a particular variant and of a gene harboring it, the penetrance of these allelic variants depends on their expression level and can be determined by preferential expression of a particular allele, or allele-specific expression. It is estimated that 20–30 % of genes present in the human genome display allelic bias in a tissue-specific manner. Allele-specific expression is defined by a range of genetic and epigenetic mechanisms including cis-regulatory polymorphisms, allele-specific binding of transcription factors, allele-specific DNA methylation and regulation through non-coding RNA.Although the data on the issue are scarce, allele-specific expression has been reported to be implicated in several hereditary disorders including benign and malignant tumors of the large intestine. Recent studies that estimate allele-specific expression incidence in tumors and identify wide range of genes displaying allelic imbalance indicate that allele-specific expression might play a significant role in carcinogenesis. Eventually, estimation of transcriptional rate of allelic variants which cause dysfunction of oncogenes and tumor suppressors may prove to be essential for rational choice of antitumor therapeutic strategy. In this review, we outline the main concepts and mechanisms of allele-specific expression and the data on allelic imbalance in tumors.

  2. Allele-specific KRT1 expression is a complex trait

    National Research Council Canada - National Science Library

    Tao, Heng; Cox, David R; Frazer, Kelly A

    2006-01-01

    ... responsible for allele-specific expression differences. We have used a variety of experimental approaches to identify and characterize cis-regulatory polymorphisms responsible for the extreme allele-specific expression differences of keratin-1 (KRT1...

  3. Allele-Specific DNA Methylation Detection by Pyrosequencing®

    DEFF Research Database (Denmark)

    Sommer Kristensen, Lasse; Johansen, Jens Vilstrup; Grønbæk, Kirsten

    2015-01-01

    DNA methylation is an epigenetic modification that plays important roles in healthy as well as diseased cells, by influencing the transcription of genes. In spite the fact that human somatic cells are diploid, most of the currently available methods for the study of DNA methylation do not provide......-effective protocol for allele-specific DNA methylation detection based on Pyrosequencing(®) of methylation-specific PCR (MSP) products including a single nucleotide polymorphism (SNP) within the amplicon....... information on the methylation status of individual alleles of genes. This information may be of importance in many situations. In particular, in cancer both alleles of tumour suppressor genes generally need to be inactivated for a phenotypic effect to be observed. Here, we present a simple and cost...

  4. Allele specific expression and methylation in the bumblebee, Bombus terrestris

    Directory of Open Access Journals (Sweden)

    Zoë Lonsdale

    2017-09-01

    Full Text Available The social hymenoptera are emerging as models for epigenetics. DNA methylation, the addition of a methyl group, is a common epigenetic marker. In mammals and flowering plants methylation affects allele specific expression. There is contradictory evidence for the role of methylation on allele specific expression in social insects. The aim of this paper is to investigate allele specific expression and monoallelic methylation in the bumblebee, Bombus terrestris. We found nineteen genes that were both monoallelically methylated and monoallelically expressed in a single bee. Fourteen of these genes express the hypermethylated allele, while the other five express the hypomethylated allele. We also searched for allele specific expression in twenty-nine published RNA-seq libraries. We found 555 loci with allele-specific expression. We discuss our results with reference to the functional role of methylation in gene expression in insects and in the as yet unquantified role of genetic cis effects in insect allele specific methylation and expression.

  5. Rapid detection of methicillin-resistant staphylococci by multiplex PCR

    African Journals Online (AJOL)

    A rapid and sensitive method for excluding the presence of methicillin-resistant Staphylococcus aureus (MRSA) in clinical samples was developed. The combination of MRSA detection by mecA coaA PCR with prior enrichment in selective broth was tested for 300 swabs. PCR identified 26 MRSApositive samples, ...

  6. Template preparation for rapid PCR in Colletotrichum lindemuthianum

    Directory of Open Access Journals (Sweden)

    Roca M. Gabriela

    2003-01-01

    Full Text Available Isolation of DNA for PCR is time-consuming and involves many reagents. The aim of this work was to optimise a rapid and easy PCR methodology without previous DNA isolation. Different strains of the phytopathogenic fungus Colletotrichum lindemuthianum were used. Protoplasts were generated using lytic enzymes under high incubation temperatures using different methodologies to obtain the template. A rapid (10 minute methodology was successful for smaller amplicons (<750 bp.

  7. Multiplex single nucleotide polymorphism genotyping by adapter ligation-mediated allele-specific amplification.

    Science.gov (United States)

    Wang, Wei-peng; Ni, Kun-yi; Zhou, Guo-hua

    2006-08-15

    An improved approach for increasing the multiplex level of single nucleotide polymorphism (SNP) typing by adapter ligation-mediated allele-specific amplification (ALM-ASA) has been developed. Based on an adapter ligation, each reaction requires n allele-specific primers plus an adapter-specific primer that is common for all SNPs. Thus, only n+1 primers are used for an n-plex PCR amplification. The specificity of ALM-ASA was increased by a special design of the adapter structure and PCR suppression. Given that the genetic polymorphisms in the liver enzyme cytochrome P450 CYP2D6 (debrisoquine 4-hydroxylase) have profound effects on responses of individuals to a particular drug, we selected 17 SNPs in the CYP2D6 gene as an example for the multiplex SNP typing. Without extensive optimization, we successfully typed 17-plex SNPs in the CYP2D6 gene by ALM-ASA. The results for genotyping 70 different genome samples by the 17-plex ALM-ASA were completely consistent with those obtained by both Sanger's sequencing and PCR restriction fragment length polymorphism (PCR-RFLP) analysis. ALM-ASA is a potential method for SNP typing at an ultra-low cost because of a high multiplex level and a simple optimization step for PCR. High-throughput SNP typing could be readily realized by coupling ALM-ASA with a well-developed automation device for sample processing.

  8. [Rapid detection of Shigella dysenteriae by PCR assay].

    Science.gov (United States)

    Chen, Hongyuan; Zhong, Qingping; Wang, Li; Sun, Yuanming

    2010-09-01

    Based on the invasive plasmid antigen H gene (ipaH) of S. dysenteriae, one pair of specific primers was designed for PCR assays in this study. The concentrations of dNTP, Mg2+ and primer, dosage of Taq DNA polymerase, annealing temperature and circulating parameter in the PCR amplification system were optimized. In this way, a rapid and stable method of PCR assay for the detection of S. dysenteriae was established. The specificity and sensitivity of PCR were also analyzed. The detection limits of pure culture and genomic DNA in the PCR assay were 1.06 x 10(2) cfu/ml and 106.34 pg/PCR system, respectively. The detection limit for S. dysenteriae in artificially contaminated food samples was 3.21 x 10(4) cfu/ml. These results indicated that the PCR method for S. dysenteriae detection was simple, rapid, high in specificity and sensitivity and suitable for the detection of pathogens in foods caused by Shigella dysenteriae.

  9. SASqPCR: robust and rapid analysis of RT-qPCR data in SAS.

    Directory of Open Access Journals (Sweden)

    Daijun Ling

    Full Text Available Reverse transcription quantitative real-time PCR (RT-qPCR is a key method for measurement of relative gene expression. Analysis of RT-qPCR data requires many iterative computations for data normalization and analytical optimization. Currently no computer program for RT-qPCR data analysis is suitable for analytical optimization and user-controllable customization based on data quality, experimental design as well as specific research aims. Here I introduce an all-in-one computer program, SASqPCR, for robust and rapid analysis of RT-qPCR data in SAS. This program has multiple macros for assessment of PCR efficiencies, validation of reference genes, optimization of data normalizers, normalization of confounding variations across samples, and statistical comparison of target gene expression in parallel samples. Users can simply change the macro variables to test various analytical strategies, optimize results and customize the analytical processes. In addition, it is highly automatic and functionally extendable. Thus users are the actual decision-makers controlling RT-qPCR data analyses. SASqPCR and its tutorial are freely available at http://code.google.com/p/sasqpcr/downloads/list.

  10. [Application of rapid PCR to authenticate medicinal snakes].

    Science.gov (United States)

    Chen, Kang; Jiang, Chao; Yuan, Yuan; Huang, Lu-Qi; Li, Man

    2014-10-01

    To obtained an accurate, rapid and efficient method for authenticate medicinal snakes listed in Chinese Pharmacopoeia (Zaocysd humnades, Bungarus multicinctus, Agkistrodon acutus), a rapid PCR method for authenticate snakes and its adulterants was established based on the classic molecular authentication methods. DNA was extracted by alkaline lysis and the specific primers were amplified by two-steps PCR amplification method. The denatured and annealing temperature and cycle numbers were optimized. When 100 x SYBR Green I was added in the PCR product, strong green fluorescence was visualized under 365 nm UV whereas adulterants without. The whole process can complete in 30-45 minutes. The established method provides the technical support for authentication of the snakes on field.

  11. Rapid detection of methicillin-resistant staphylococci by multiplex PCR

    African Journals Online (AJOL)

    Administrator

    2010-11-08

    Nov 8, 2010 ... Deletion screening of the Duchenne muscular dystrophy locus via multiplex DNA amplification. Nucleic Acids Res. 16: 11141-11156. Fang H, Hedin G (2003). Rapid screening and identification of methicillin-resistant Staphylococcus aureus from clinical samples by selective-broth and real-time PCR assay.

  12. Allele-specific KRT1 expression is a complex trait.

    Directory of Open Access Journals (Sweden)

    Heng Tao

    2006-06-01

    Full Text Available The differential expression of alleles occurs commonly in humans and is likely an important genetic factor underlying heritable differences in phenotypic traits. Understanding the molecular basis of allelic expression differences is thus an important challenge. Although many genes have been shown to display differential allelic expression, this is the first study to examine in detail the cumulative effects of multiple cis-regulatory polymorphisms responsible for allele-specific expression differences. We have used a variety of experimental approaches to identify and characterize cis-regulatory polymorphisms responsible for the extreme allele-specific expression differences of keratin-1 (KRT1 in human white blood cells. The combined data from our analyses provide strong evidence that the KRT1 allelic expression differences result from the haplotypic combinations and interactions of five cis-regulatory single nucleotide polymorphisms (SNPs whose alleles differ in their affinity to bind transcription factors and modulate KRT1 promoter activity. Two of these cis-regulatory SNPs bind transcriptional activators with the alleles on the high-expressing KRT1 haplotype pattern having a higher affinity than the alleles on the low-expressing haplotype pattern. In contrast, the other three cis-regulatory SNPs bind transcriptional inhibitors with the alleles on the low-expressing haplotype pattern having a higher affinity than the alleles on the high-expressing haplotype pattern. Our study provides important new insights into the degree of complexity that the cis-regulatory sequences responsible for allele-specific transcriptional regulation have. These data suggest that allelic expression differences result from the cumulative contribution of multiple DNA sequence polymorphisms, with each having a small effect, and that allele-specific expression can thus be viewed as a complex trait.

  13. Allele-specific KRT1 expression is a complex trait.

    Science.gov (United States)

    Tao, Heng; Cox, David R; Frazer, Kelly A

    2006-06-01

    The differential expression of alleles occurs commonly in humans and is likely an important genetic factor underlying heritable differences in phenotypic traits. Understanding the molecular basis of allelic expression differences is thus an important challenge. Although many genes have been shown to display differential allelic expression, this is the first study to examine in detail the cumulative effects of multiple cis-regulatory polymorphisms responsible for allele-specific expression differences. We have used a variety of experimental approaches to identify and characterize cis-regulatory polymorphisms responsible for the extreme allele-specific expression differences of keratin-1 (KRT1) in human white blood cells. The combined data from our analyses provide strong evidence that the KRT1 allelic expression differences result from the haplotypic combinations and interactions of five cis-regulatory single nucleotide polymorphisms (SNPs) whose alleles differ in their affinity to bind transcription factors and modulate KRT1 promoter activity. Two of these cis-regulatory SNPs bind transcriptional activators with the alleles on the high-expressing KRT1 haplotype pattern having a higher affinity than the alleles on the low-expressing haplotype pattern. In contrast, the other three cis-regulatory SNPs bind transcriptional inhibitors with the alleles on the low-expressing haplotype pattern having a higher affinity than the alleles on the high-expressing haplotype pattern. Our study provides important new insights into the degree of complexity that the cis-regulatory sequences responsible for allele-specific transcriptional regulation have. These data suggest that allelic expression differences result from the cumulative contribution of multiple DNA sequence polymorphisms, with each having a small effect, and that allele-specific expression can thus be viewed as a complex trait.

  14. Allele-Specific KRT1 Expression Is a Complex Trait

    OpenAIRE

    Heng Tao; David R Cox; Frazer, Kelly A

    2006-01-01

    The differential expression of alleles occurs commonly in humans and is likely an important genetic factor underlying heritable differences in phenotypic traits. Understanding the molecular basis of allelic expression differences is thus an important challenge. Although many genes have been shown to display differential allelic expression, this is the first study to examine in detail the cumulative effects of multiple cis-regulatory polymorphisms responsible for allele-specific expression dif...

  15. Rapid diagnosis of aneuploidy using segmental duplication quantitative fluorescent PCR.

    Directory of Open Access Journals (Sweden)

    Xiangdong Kong

    Full Text Available The aim of this study was use a simple and rapid procedure, called segmental duplication quantitative fluorescent polymerase chain reaction (SD-QF-PCR, for the prenatal diagnosis of fetal chromosomal aneuploidies. This method is based on the co-amplification of segmental duplications located on two different chromosomes using a single pair of fluorescent primers. The PCR products of different sizes were subsequently analyzed through capillary electrophoresis, and the aneuploidies were determined based on the relative dosage between the two chromosomes. Each primer set, containing five pairs of primers, was designed to simultaneously detect aneuploidies located on chromosomes 21, 18, 13, X and Y in a single reaction. We applied these two primer sets to DNA samples isolated from individuals with trisomy 21 (n = 36; trisomy 18 (n = 6; trisomy 13 (n = 4; 45, X (n = 5; 47, XXX (n = 3; 48, XXYY (n = 2; and unaffected controls (n = 40. We evaluated the performance of this method using the karyotyping results. A correct and unambiguous diagnosis with 100% sensitivity and 100% specificity, was achieved for clinical samples examined. Thus, the present study demonstrates that SD-QF-PCR is a robust, rapid and sensitive method for the diagnosis of common aneuploidies, and these analyses can be performed in less than 4 hours for a single sample, providing a competitive alternative for routine use.

  16. Rapid identification of Sporothrix schenckii in biopsy tissue by PCR.

    Science.gov (United States)

    Liu, X; Zhang, Z; Hou, B; Wang, D; Sun, T; Li, F; Wang, H; Han, S

    2013-12-01

    The dimorphic fungus Sporothrix schenckii is the etiological agent of sporotrichosis, an important cutaneous mycosis with a worldwide distribution. At present, it is challenging to rapidly discover and identify Sporothrix schenckii in biopsy tissues nowadays. To explore new methods for rapid diagnosis of sporotrichosis. We screened specific primers for Sporothrix schenckii using 50 clinical isolates from patients with sporotrichosis. DNA was extracted from the lesions of 30 cases of clinically suspected sporotrichosis using the Graham s method of CTAB and amplified by PCR using the screened specific primers. The primer S2-R2 was applicable for the identification of S. schenckii from different geographic areas and clinical types with high specificity and sensitivity. Twenty-five out of the thirty cases (83.3%) amplified using the primer S2-R2 showed positive bands. Further positive bands were observed in 95.6% of cases tested positive by fungal culture. Using the PCR technique and specific primers, we developed a new diagnostic method that can rapidly diagnose sporotrichosis with tissues obtained from clinical biopsies. © 2012 The Authors. Journal of the European Academy of Dermatology and Venereology © 2012 European Academy of Dermatology and Venereology.

  17. Allele-Specific KRT1 Expression Is a Complex Trait: e93

    National Research Council Canada - National Science Library

    Heng Tao; David R Cox; Kelly A Frazer

    2006-01-01

    ... responsible for allele-specific expression differences. We have used a variety of experimental approaches to identify and characterize cis-regulatory polymorphisms responsible for the extreme allele-specific expression differences of keratin-1 (KRT1...

  18. Rapid diagnostic multiplex PCR (RD-PCR) to discriminate Schistosoma haematobium and S. bovis.

    Science.gov (United States)

    Webster, B L; Rollinson, D; Stothard, J R; Huyse, T

    2010-03-01

    Schistosoma haematobium and S. bovis are widespread schistosome species causing human and cattle schistosomiasis, respectively, in Africa. The sympatric occurrence of these two species and their ability to infect the same Bulinus intermediate snail hosts necessitates precise methods of identification of the larval stages. A rapid diagnostic 'mulitplex' one-step polymerase chain reaction protocol (RD-PCR) was developed using cytochrome oxidase subunit 1 (COX1) mitochondrial DNA (mtDNA) to discriminate between S. haematobium and S. bovis. A single forward primer and two species-specific reverse primers were used to produce a polymerase chain reaction (PCR) fragment of 306 bp and 543 bp for S. bovis and S. haematobium, respectively. Serial dilutions were carried out on various lifecycle stages and species combinations to test the sensitivity and specificity of the primers. This RD-PCR proved highly sensitive, detecting a single larval stage and as little as 0.78 ng of genomic DNA (gDNA) from an adult schistosome, providing a cost-effective, rapid and robust molecular tool for high-throughput screening of S. haematobium and S. bovis populations. In areas where human and cattle schistosomiasis overlap and are transmitted in close proximity, this mitochondrial assay will be a valuable identification tool for epidemiological studies, especially when used in conjunction with other nuclear diagnostic markers.

  19. Rapid sex determination using PCR technique compared to classic cytogenetics.

    Science.gov (United States)

    Settin, Ahmad; Elsobky, Ezzat; Hammad, Ayman; Al-Erany, Abeer

    2008-01-01

    Fetal sexual differentiation relies on the translation of chromosomal sex established at fertilization into gonadal sex and somatic sex as development proceeds. In cases where chromosomal, gonadal, and somatic sex are incongruent in human infants and children, rapid establishment of the diagnosis and implementation of medical and surgical management is of paramount importance, since the gender identity is so important to the psychological well-being throughout life. This work was done in order to test the value of PCR technique for rapid sex determination compared to classic cytogenetic technique. Subjects included 20, cases including 10 neonates with ambiguous genitalia, 2 adult females with delayed puberty and 8 adult males with infertility, in addition to 20 normal infants of both sexes as a control group. The diagnosis of sex was attempted through examination, cytogenetic study, ultrasonography, gonadal biopsy and hormonal analysis, in addition to PCR amplification for the detection of SRY and ATL1 gene loci on Y and X chromosomes respectively. Four neonates were diagnosed as partial testicular feminization showed both positive bands for the Y and X chromosomes and a karyogram of 46/XY. Three neonates were diagnosed as true hermaphrodites showed positive amplification for both Y and X chromosomes with a mosaic karyogram 46,XX/XY. Three neonates were diagnosed as cases of adrenogenital syndrome showed positive amplification of only the Xchromosome and had a karyogram of 46/XX. One of the two adult females was diagnosed as turner syndrome showed positive amplification of the X chromosome and a karyogram of 45/XO; the other one was diagnosed as complete testicular feminization had a positive amplification of X and Y chromosomes and a karyogram of 46/XY. The 8 adult males with infertility showed a positive amplification of X and Y chromosome and a karyogram of 47/XXY (Klinefelter syndrome) in 7 cases and 46/XY gonadal dysgenesis in one case. We concluded that PCR

  20. A single-tube allele specific-polymerase chain reaction to detect T315I resistant mutation in chronic myeloid leukemia patients

    Directory of Open Access Journals (Sweden)

    Auewarakul Chirayu U

    2011-02-01

    Full Text Available Abstract Background BCR-ABL kinase domain (KD mutation is the major mechanism contributing to suboptimal response to tyrosine kinase inhibitors (TKI in BCR-ABL-positive chronic myeloid leukemia (CML patients. T315I mutation, as one of the most frequent KD mutations, has been shown to be strongly associated with TKI resistance and subsequent therapeutic failure. A simple and sensitive method is thus required to detect T315I mutation at the earliest stage. Methods A single-tube allele specific-polymerase chain reaction (AS-PCR method was developed to detect T315I mutation in a mixture of normal and mutant alleles of varying dilutions. Denaturing high performance liquid chromatography (DHPLC and direct sequencing were performed as a comparison to AS-PCR. Results T315I mutant bands were observed in the mixtures containing as low as 0.5-1% of mutant alleles by AS-PCR. The detection sensitivity of DHPLC was around 1.5-3% dilution whereas sequencing analysis was unable to detect below 6.25% dilution. Conclusion A single-tube AS-PCR is a rapid and sensitive screening method for T315I mutation. Detection of the most resistant leukemic clone in CML patients undergoing TKI therapy should be feasible with this simple and inexpensive method.

  1. Real-Time PCR and High-Resolution Melt Analysis for Rapid Detection of Mycobacterium leprae Drug Resistance Mutations and Strain Types

    Science.gov (United States)

    Li, Wei; Matsuoka, Masanori; Kai, Masanori; Thapa, Pratibha; Khadge, Saraswoti; Hagge, Deanna A.; Brennan, Patrick J.

    2012-01-01

    Drug resistance surveillance and strain typing of Mycobacterium leprae are necessary to investigate ongoing transmission of leprosy in regions of endemicity. To enable wider implementation of these molecular analyses, novel real-time PCR–high-resolution melt (RT-PCR-HRM) assays without allele-specific primers or probes and post-PCR sample handling were developed. For the detection of mutations within drug resistance-determining regions (DRDRs) of folP1, rpoB, and gyrA, targets for dapsone, rifampin, and fluoroquinolones, real-time PCR-HRM assays were developed. Wild-type and drug-resistant mouse footpad-derived strains that included three folP1, two rpoB, and one gyrA mutation types in a reference panel were tested. RT-PCR-HRM correctly distinguished the wild type from the mutant strains. In addition, RT-PCR-HRM analyses aided in recognizing samples with mixed or minor alleles and also a mislabeled sample. When tested in 121 sequence-characterized clinical strains, HRM identified all the folP1 mutants representing two mutation types, including one not within the reference panel. The false positives (PCR inhibition. A second set of RT-PCR-HRM assays for identification of three previously reported single nucleotide polymorphisms (SNPs) that have been used for strain typing were developed and validated in 22 reference and 25 clinical strains. Real-time PCR-HRM is a sensitive, simple, rapid, and high-throughput tool for routine screening known DRDR mutants in new and relapsed cases, SNP typing, and detection of minor mutant alleles in the wild-type background at lower costs than current methods and with the potential for quality control in leprosy investigations. PMID:22170923

  2. Allele specific expression in worker reproduction genes in the bumblebee Bombus terrestris

    Directory of Open Access Journals (Sweden)

    Harindra E. Amarasinghe

    2015-07-01

    Full Text Available Methylation has previously been associated with allele specific expression in ants. Recently, we found methylation is important in worker reproduction in the bumblebee Bombus terrestris. Here we searched for allele specific expression in twelve genes associated with worker reproduction in bees. We found allele specific expression in Ecdysone 20 monooxygenase and IMP-L2-like. Although we were unable to confirm a genetic or epigenetic cause for this allele specific expression, the expression patterns of the two genes match those predicted for imprinted genes.

  3. Allele specific expression in worker reproduction genes in the bumblebee Bombus terrestris.

    Science.gov (United States)

    Amarasinghe, Harindra E; Toghill, Bradley J; Nathanael, Despina; Mallon, Eamonn B

    2015-01-01

    Methylation has previously been associated with allele specific expression in ants. Recently, we found methylation is important in worker reproduction in the bumblebee Bombus terrestris. Here we searched for allele specific expression in twelve genes associated with worker reproduction in bees. We found allele specific expression in Ecdysone 20 monooxygenase and IMP-L2-like. Although we were unable to confirm a genetic or epigenetic cause for this allele specific expression, the expression patterns of the two genes match those predicted for imprinted genes.

  4. Rapid and sustained clearance of circulating lymphoma cells after chemotherapy plus rituximab: clinical significance of quantitative t(14;18) PCR monitoring in advanced stage follicular lymphoma patients.

    Science.gov (United States)

    Hirt, Carsten; Schüler, Frank; Kiefer, Thomas; Schwenke, Cornelia; Haas, Antje; Niederwieser, Dietger; Neser, Sabine; Assmann, Michael; Srock, Stefanie; Rohrberg, Robert; Dachselt, Klaus; Leithäuser, Malte; Rabkin, Charles S; Herold, Michael; Dölken, Gottfried

    2008-05-01

    This study of first-line treatment in advanced-stage follicular lymphoma patients analysed the effects of MCP (mitoxantrone, chlorambucil and prednisolone) chemotherapy alone or in combination with rituximab (R-MCP) on circulating lymphoma cells (CLC) and assessed the prognostic value of a quantitative monitoring of CLC. CLC numbers were determined by quantitative polymerase chain reaction (PCR) for the t(14;18)-translocation or by allele-specific PCR for rearranged immunoglobulin heavy chain genes. We analysed blood samples from 43 patients treated in a randomized trial comparing eight cycles of MCP versus R-MCP. Clearance of CLC at the end of therapy was achieved in 21/25 patients (84%) treated with R-MCP compared with 0/18 after MCP alone (P or = 2 log CLC reduction was associated with a favourable clinical response (P = 0.0004) and prolonged event-free survival (P = 0.02). In R-MCP patients, stable CLC numbers or consistently PCR-negative blood samples were associated with a continuing clinical remission whereas in two patients a relapse was preceded by a > or = 2 log CLC increase. This study demonstrated that R-MCP led to a rapid and sustained eradication of CLC and a > or = 2 log CLC reduction was associated with a superior quality and duration of the clinical response.

  5. Application of Reverse Transcriptase -PCR (RT-PCR) for rapid detection of viable Escherichia coli in drinking water samples.

    Science.gov (United States)

    Molaee, Neda; Abtahi, Hamid; Ghannadzadeh, Mohammad Javad; Karimi, Masoude; Ghaznavi-Rad, Ehsanollah

    2015-01-01

    Polymerase chain reaction (PCR) is preferred to other methods for detecting Escherichia coli (E. coli) in water in terms of speed, accuracy and efficiency. False positive result is considered as the major disadvantages of PCR. For this reason, reverse transcriptase-polymerase chain reaction (RT-PCR) can be used to solve this problem. The aim of present study was to determine the efficiency of RT-PCR for rapid detection of viable Escherichia coli in drinking water samples and enhance its sensitivity through application of different filter membranes. Specific primers were designed for 16S rRNA and elongation Factor II genes. Different concentrations of bacteria were passed through FHLP and HAWP filters. Then, RT-PCR was performed using 16srRNA and EF -Tu primers. Contamination of 10 wells was determined by RT-PCR in Arak city. To evaluate RT-PCR efficiency, the results were compared with most probable number (MPN) method. RT-PCR is able to detect bacteria in different concentrations. Application of EF II primers reduced false positive results compared to 16S rRNA primers. The FHLP hydrophobic filters have higher ability to absorb bacteria compared with HAWB hydrophilic filters. So the use of hydrophobic filters will increase the sensitivity of RT-PCR. RT-PCR shows a higher sensitivity compared to conventional water contamination detection method. Unlike PCR, RT-PCR does not lead to false positive results. The use of EF-Tu primers can reduce the incidence of false positive results. Furthermore, hydrophobic filters have a higher ability to absorb bacteria compared to hydrophilic filters.

  6. Allele specific LAMP- gold nanoparticle for characterization of single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Fábio Ferreira Carlos

    2017-12-01

    Full Text Available Due to their relevance as disease biomarkers and for diagnostics, screening of single nucleotide polymorphism (SNPs requires simple and straightforward strategies capable to provide results in medium throughput settings. Suitable approaches relying on isothermal amplification techniques have been evolving to substitute the cumbersome and highly specialized PCR amplification detection schemes. Nonetheless, identification of an individual’s genotype still requires sophisticated equipment and laborious methods.Here, we present a low-cost and reliable approach based on the allele specific loop-mediated isothermal amplification (AS-LAMP coupled to ssDNA functionalized gold nanoparticle (Au-nanoprobe colorimetric sequence discrimination. The Au-nanoprobe integration allows for the colorimetric detection of AS-LAMP amplification product that can be easily interpreted in less than 15 min. We targeted a clinical relevant SNP responsible for lactose intolerance (-13910C/T dbSNP rs#: 4988235 to demonstrate its proof of concept and full potential of this novel approach. Keywords: SNP, Isothermal amplification, Gold nanoparticles, Gold nanoprobes, Lactose intolerance

  7. SCALE: modeling allele-specific gene expression by single-cell RNA sequencing.

    Science.gov (United States)

    Jiang, Yuchao; Zhang, Nancy R; Li, Mingyao

    2017-04-26

    Allele-specific expression is traditionally studied by bulk RNA sequencing, which measures average expression across cells. Single-cell RNA sequencing allows the comparison of expression distribution between the two alleles of a diploid organism and the characterization of allele-specific bursting. Here, we propose SCALE to analyze genome-wide allele-specific bursting, with adjustment of technical variability. SCALE detects genes exhibiting allelic differences in bursting parameters and genes whose alleles burst non-independently. We apply SCALE to mouse blastocyst and human fibroblast cells and find that cis control in gene expression overwhelmingly manifests as differences in burst frequency.

  8. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  9. RUCS: rapid identification of PCR primers for unique core sequences.

    Science.gov (United States)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik; Kaya, Hülya; Lund, Ole

    2017-12-15

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs for the targets in silico. Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin resistance gene. Three of the predicted pairs were chosen for experimental validation using PCR and gel electrophoresis. All three pairs successfully produced an amplicon with the target length for the samples containing mcr-1 and no amplification products were produced for the negative samples. The novel methods presented in this manuscript can reduce the time needed to identify target sequences, and provide a quick virtual PCR validation to eliminate time wasted on ambiguously binding primers. Source code is freely available on https://bitbucket.org/genomicepidemiology/rucs. Web service is freely available on https://cge.cbs.dtu.dk/services/RUCS. mcft@cbs.dtu.dk. Supplementary data are available at Bioinformatics online.

  10. Using Allele-Specific PCR with Molecular Beams as a Means for Genotyping the Diallelic Indels

    Energy Technology Data Exchange (ETDEWEB)

    Doktycz, M.J.; Weber, J.L. (Marshfield Medical Research Foundation)

    2000-06-01

    The first Specific Aim for this grant was to identify and characterize an average of 500 human insertion/deletion polymorphisms per grant year (1500 total). This task was carried out entirely at MMRF. They substantially exceeded this goal by confirming about 2,300 diallelic indels. Complete characterization information for these polymorphisms is available from the Marshfield web site. A manuscript describing results for the first 2,000 diallelic indels was published earlier this year in the American Journal of Human Genetics. The Second Specific Aim of the grant was to investigate and develop improved methods for analysis of diallelic polymorphisms using miniaturized DNA arrays. The initial genotyping technology efforts focused on various hybridization and extension protocols with oligo arrays on flow-through channel glass. Channel glass is a porous material that permits reagents to be passed through the arrays. They devoted roughly 19 months at the beginning of the grant in pursuit of this methodology, but for various technological reasons, progress was limited.

  11. A computational workflow to identify allele-specific expression and epigenetic modification in maize.

    Science.gov (United States)

    Wei, Xiaoxing; Wang, Xiangfeng

    2013-08-01

    Allele-specific expression refers to the preferential expression of one of the two alleles in a diploid genome, which has been thought largely attributable to the associated cis-element variation and allele-specific epigenetic modification patterns. Allele-specific expression may contribute to the heterosis (or hybrid vigor) effect in hybrid plants that are produced from crosses of closely-related species, subspecies and/or inbred lines. In this study, using Illumina high-throughput sequencing of maize transcriptomics, chromatic H3K27me3 histone modification and DNA methylation data, we developed a new computational framework to identify allele-specifically expressed genes by simultaneously tracking allele-specific gene expression patterns and the epigenetic modification landscape in the seedling tissues of hybrid maize. This approach relies on detecting nucleotide polymorphisms and any genomic structural variation between two parental genomes in order to distinguish paternally or maternally derived sequencing reads. This computational pipeline also incorporates a modified Chi-square test to statistically identify allele-specific gene expression and epigenetic modification based on the Poisson distribution. Copyright © 2013. Production and hosting by Elsevier Ltd.

  12. PCR-based rapid genotyping of Stenotrophomonas maltophilia isolates

    Directory of Open Access Journals (Sweden)

    Zarrilli Raffaele

    2008-11-01

    Full Text Available Abstract Background All bacterial genomes contain repetitive sequences which are members of specific DNA families. Such repeats may occur as single units, or found clustered in multiple copies in a head-to-tail configuration at specific loci. The number of clustered units per locus is a strain-defining parameter. Assessing the length variability of clusters of repeats is a versatile typing methodology known as multilocus variable number of tandem repeat analysis (MLVA. Results Stenotrophomonas maltophilia is an environmental bacterium increasingly involved in nosocomial infections and resistant to most antibiotics. The availability of the whole DNA sequence of the S. maltophilia strain K279a allowed us to set up fast and accurate PCR-based diagnostic protocols based on the measurement of length variations of loci carrying a variable number of short palindromic repeats marking the S. maltophilia genome. On the basis of the amplimers size, it was possible to deduce the number of repeats present at 12 different loci in a collection of S. maltophilia isolates, and therefore label each of them with a digit. PCR-negative regions were labelled 0. Co-amplification of two pairs of loci provided a 4-digit code sufficient for immediate subtyping. By increasing the number of loci analyzed, it should be possible to assign a more specific digit profile to isolates. In general, MLVA data match genotyping data obtained by PFGE (pulsed-field gel electrophoresis. However, some isolates exhibiting the same PCR profiles at all loci display distinct PFGE patterns. Conclusion The utilization of the present protocol allows to type several S. maltophilia isolates in hours. The results are immediately interpretable without the need for sophisticated softwares. The data can be easily reproducible, and compared among different laboratories.

  13. Rapid detection and ruling out of neonatal sepsis by PCR coupled with Electrospray Ionization Mass Spectrometry (PCR/ESI-MS).

    Science.gov (United States)

    Delcò, Cristina; Karam, Oliver; Pfister, Riccardo; Gervaix, Alain; Renzi, Gesuele; Emonet, Stéphane; Schrenzel, Jacques; Posfay-Barbe, Klara M

    2017-05-01

    Sepsis is an important cause of morbidity and mortality in neonates and clinicians are typically required to administer empiric antibiotics while waiting for blood culture results. However, prolonged and inappropriate use of antibiotics is associated with various complications and adverse events. Better tools to rapidly rule out bacterial infections are therefore needed. We aimed to assess the negative predictive value of PCR coupled with Electrospray Ionization Mass Spectrometry (PCR/ESI-MS) compared to conventional blood cultures in neonatal sepsis. Prospective observational study. All consecutive neonates (PCR/ESI-MS analysis were collected at the same time as samples for the blood culture, before the initiation of antibiotics. Our primary objective was to evaluate the negative predictive value of PCR/ESI-MS for the detection of bacteria in the bloodstream of newborns with suspected sepsis. Our secondary objective was the evaluation of the sensitivity, specificity and positive predictive value of the PCR/ESI-MS in such a neonatal population. We analysed 114 samples over 14months. The median age and weight were 32weeks+3days and 1840g, respectively. Two patients had negative PCR/ESI-MS results, but positive blood cultures. Overall, the negative predictive value was 98% (95%CI: 92% to 100%). Based on these results, PCR/ESI-MS analysis of blood samples of neonates with suspected sepsis appears to have a very good negative predictive value when compared to blood cultures as gold standard. This novel test might allow for early reassessment of the need for antibiotics. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. [Evaluation of the efficacies of rapid antigen test, multiplex PCR, and real-time PCR for the detection of a novel influenza A (H1N1) virus].

    Science.gov (United States)

    Hwang, Yusun; Kim, Kyounghee; Lee, Miae

    2010-04-01

    In April 2009, a novel influenza A (H1N1) virus was detected in the US, and at the time of conducting this study, H1N1 infection had reached pandemic proportions. In Korea, rapid antigen tests and PCR assays have been developed to detect the H1N1 virus. We evaluated the efficacies of rapid antigen test, multiplex PCR, and real-time PCR for detecting the H1N1 virus. From August to September 2009, we tested 734 samples obtained from nasopharyngeal swab or nasal swab using rapid antigen test (SD Influenza Antigen, Standard Diagnostics, Inc., Korea) and multiplex PCR (Seeplex FluA ACE Subtyping, Seegene, Korea). We also tested 224 samples using the AdvanSure real-time PCR (LG Life Sciences, Korea) to compare the results obtained using real-time PCR with those obtained using multiplex PCR. Furthermore, 99 samples were tested using the AdvanSure real-time PCR and the AccuPower real-time PCR (Bioneer, Korea). In comparison with the results of multiplex PCR, the sensitivity and specificity of the rapid antigen test were 48.0% and 99.8%, respectively. The concordance rate for multiplex PCR and the AdvanSure real-time PCR was 99.6% (kappa=0.991, P=0.000), and that for the AdvanSure real-time PCR and the AccuPower real-time PCR was 97.0% (kappa=0.936, P=0.000). The rapid antigen test is significantly less sensitive than PCR assay; therefore, it is not useful for H1N1 detection; however multiplex PCR, the AdvanSure real-time PCR, and the Accu-Power real-time PCR can be useful for H1N1 detection.

  15. Rapid identification of Brucella isolates to the species level by real time PCR based single nucleotide polymorphism (SNP analysis

    Directory of Open Access Journals (Sweden)

    Smith Catherine J

    2008-06-01

    Full Text Available Abstract Background Brucellosis, caused by members of the genus Brucella, remains one of the world's major zoonotic diseases. Six species have classically been recognised within the family Brucella largely based on a combination of classical microbiology and host specificity, although more recently additional isolations of novel Brucella have been reported from various marine mammals and voles. Classical identification to species level is based on a biotyping approach that is lengthy, requires extensive and hazardous culturing and can be difficult to interpret. Here we describe a simple and rapid approach to identification of Brucella isolates to the species level based on real-time PCR analysis of species-specific single nucleotide polymorphisms (SNPs that were identified following a robust and extensive phylogenetic analysis of the genus. Results Seven pairs of short sequence Minor Groove Binding (MGB probes were designed corresponding to SNPs shown to possess an allele specific for each of the six classical Brucella spp and the marine mammal Brucella. Assays were optimised to identical reaction parameters in order to give a multiple outcome assay that can differentiate all the classical species and Brucella isolated from marine mammals. The scope of the assay was confirmed by testing of over 300 isolates of Brucella, all of which typed as predicted when compared to other phenotypic and genotypic approaches. The assay is sensitive being capable of detecting and differentiating down to 15 genome equivalents. We further describe the design and testing of assays based on three additional SNPs located within the 16S rRNA gene that ensure positive discrimination of Brucella from close phylogenetic relatives on the same platform. Conclusion The multiple-outcome assay described represents a new tool for the rapid, simple and unambiguous characterisation of Brucella to the species level. Furthermore, being based on a robust phylogenetic framework, the

  16. Allele Workbench: transcriptome pipeline and interactive graphics for allele-specific expression.

    Directory of Open Access Journals (Sweden)

    Carol A Soderlund

    Full Text Available Sequencing the transcriptome can answer various questions such as determining the transcripts expressed in a given species for a specific tissue or condition, evaluating differential expression, discovering variants, and evaluating allele-specific expression. Differential expression evaluates the expression differences between different strains, tissues, and conditions. Allele-specific expression evaluates expression differences between parental alleles. Both differential expression and allele-specific expression have been studied for heterosis (hybrid vigor, where the hybrid has improved performance over the parents for one or more traits. The Allele Workbench software was developed for a heterosis study that evaluated allele-specific expression for a mouse F1 hybrid using libraries from multiple tissues with biological replicates. This software has been made into a distributable package, which includes a pipeline, a Java interface to build the database, and a Java interface for query and display of the results. The required input is a reference genome, annotation file, and one or more RNA-Seq libraries with optional replicates. It evaluates allelic imbalance at the SNP and transcript level and flags transcripts with significant opposite directional allele-specific expression. The Java interface allows the user to view data from libraries, replicates, genes, transcripts, exons, and variants, including queries on allele imbalance for selected libraries. To determine the impact of allele-specific SNPs on protein folding, variants are annotated with their effect (e.g., missense, and the parental protein sequences may be exported for protein folding analysis. The Allele Workbench processing results in transcript files and read counts that can be used as input to the previously published Transcriptome Computational Workbench, which has a new algorithm for determining a trimmed set of gene ontology terms. The software with demo files is available

  17. Allele-specific polymerase chain reaction typing and sequencing of mitochondrial D-loop region in broiler chickens in Japan.

    Science.gov (United States)

    Harumi, Takashi; Kobayashi, Eiji; Naito, Mitsuru

    2015-09-01

    This study aimed to comprehend a feature of single nucleotide polymorphism (SNP) in mitochondrial DNA (mtDNA) mainly of general broiler chickens in Japan. We typed two SNP sites (199C/T and 792A/G) of the D-loop region in mtDNA by allele-specific PCR (AS-PCR) in 359 broiler (182 chunky and 177 cobb) and 506 layer (233 White Leghorn, 140 Barred Plymouth Rock and 133 Rhode Island Red) chickens. The SNP of 199C or 792A by AS-PCR was observed in the chunky and cobb chickens, and not in the layers. The haplotype 199T/792G was observed in a part of cobb and all layers. By the result of AS-PCR haplotyping and the broiler brands, the D-loop region was sequenced in 44 broiler chickens (20 chunky and 24 cobb) and compared with the layers' sequence data. Among the broiler and layer chickens, 21 SNP sites (including one insertion) and 11 sequence haplotypes were observed. Haplotype variation or correspondence was observed in and between the broiler brands. This study provides important information to establish a chicken meat traceability system by SNP haplotyping of mtDNA in Japan. © 2015 Japanese Society of Animal Science.

  18. Rapid Identification of Measles Virus Vaccine Genotype by Real-Time PCR.

    Science.gov (United States)

    Roy, Felicia; Mendoza, Lillian; Hiebert, Joanne; McNall, Rebecca J; Bankamp, Bettina; Connolly, Sarah; Lüdde, Amy; Friedrich, Nicole; Mankertz, Annette; Rota, Paul A; Severini, Alberto

    2017-03-01

    During measles outbreaks, it is important to be able to rapidly distinguish between measles cases and vaccine reactions to avoid unnecessary outbreak response measures such as case isolation and contact investigations. We have developed a real-time reverse transcription-PCR (RT-PCR) method specific for genotype A measles virus (MeV) (MeVA RT-quantitative PCR [RT-qPCR]) that can identify measles vaccine strains rapidly, with high throughput, and without the need for sequencing to determine the genotype. We have evaluated the method independently in three measles reference laboratories using two platforms, the Roche LightCycler 480 system and the Applied Biosystems (ABI) 7500 real-time PCR system. In comparison to the standard real-time RT-PCR method, the MeVA RT-qPCR showed 99.5% specificity for genotype A and 94% sensitivity for both platforms. The new assay was able to detect RNA from five currently used vaccine strains, AIK-C, CAM-70, Edmonston-Zagreb, Moraten, and Shanghai-191. The MeVA RT-qPCR assay has been used successfully for measles surveillance in reference laboratories, and it could be readily deployed to national and subnational laboratories on a wide scale. Copyright © 2017 American Society for Microbiology.

  19. Gold Nanorod-based Photo-PCR System for One-Step, Rapid Detection of Bacteria.

    Science.gov (United States)

    Kim, Jinjoo; Kim, Hansol; Park, Ji Ho; Jon, Sangyong

    2017-01-01

    The polymerase chain reaction (PCR) has been an essential tool for diagnosis of infectious diseases, but conventional PCR still has some limitations with respect to applications to point-of-care (POC) diagnostic systems that require rapid detection and miniaturization. Here we report a light-based PCR method, termed as photo-PCR, which enables rapid detection of bacteria in a single step. In the photo-PCR system, poly(enthylene glycol)-modified gold nanorods (PEG-GNRs), used as a heat generator, are added into the PCR mixture, which is subsequently periodically irradiated with a 808-nm laser to create thermal cycling. Photo-PCR was able to significantly reduce overall thermal cycling time by integrating bacterial cell lysis and DNA amplification into a single step. Furthermore, when combined with KAPA2G fast polymerase and cooling system, the entire process of bacterial genomic DNA extraction and amplification was further shortened, highlighting the potential of photo-PCR for use in a portable, POC diagnostic system.

  20. A rapid and direct real time PCR-based method for identification of Salmonella spp

    DEFF Research Database (Denmark)

    Rodriguez-Lazaro, D.; Hernández, Marta; Esteve, T.

    2003-01-01

    The aim of this work was the validation of a rapid, real-time PCR assay based on TaqMan((R)) technology for the unequivocal identification of Salmonella spp. to be used directly on an agar-grown colony. A real-time PCR system targeting at the Salmonella spp. invA gene was optimized and validated...... to be especially convenient because the pre-mix containing all PCR reagents except for the bacterial cells could be kept at -20 degreesC for at least I month before its use. The optimized TaqMan((R)) real-time PCR assay is a useful, simple and rapid method for routine identification of Salmonella spp...

  1. DNA Sequence Signatures for Rapid Detection of Six Target Bacterial Pathogens Using PCR Assays

    Directory of Open Access Journals (Sweden)

    Kenjiro Nagamine

    2015-01-01

    Full Text Available Using Streptococcus pyogenes as a model, we previously established a stepwise computational workflow to effectively identify species-specific DNA signatures that could be used as PCR primer sets to detect target bacteria with high specificity and sensitivity. In this study, we extended the workflow for the rapid development of PCR assays targeting Enterococcus faecalis, Enterococcus faecium, Clostridium perfringens, Clostridium difficile, Clostridium tetani , and Staphylococcus aureus , which are of safety concern for human tissue intended for transplantation. Twenty-one primer sets that had sensitivity of detecting 5–50 fg DNA from target bacteria with high specificity were selected. These selected primer sets can be used in a PCR array for detecting target bacteria with high sensitivity and specificity. The workflow could be widely applicable for the rapid development of PCR-based assays for a wide range of target bacteria, including those of biothreat agents.

  2. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    OpenAIRE

    Nelly eDatukishvili; Tamara eKutateladze; Inga eGabriadze; Kakha eBitskinashvili; Boris eVishnepolsky

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of C...

  3. SCAR makers and multiplex PCR-based rapid molecular typing of Lentinula edodes strains.

    Science.gov (United States)

    Wu, Xueqian; Li, Haibo; Zhao, Weiwei; Fu, Lizhong; Peng, Huazheng; He, Liang; Cheng, Junwen; Wei, Hailong; Wu, Qingqi

    2010-11-01

    Lentinula edodes is the second most important cultivated mushroom worldwide, the most commercial strains have been identified only through traditional phenotypic analysis. In this study, a simple rapid PCR-based molecular method was developed for distinguishing commercial strains of L. edodes by developing specific sequence characterized amplified region (SCAR) markers and establishing multiplex PCR assays with the SCAR primers. Derived from the randomly amplified polymorphic DNA (RAPD) and sequence-related amplified polymorphism (SRAP) techniques, 10 informative SCAR markers were generated from 10 polymorphic RAPD and SRAP bands. The differences in SCAR phenotypes among different strains made these SCAR markers potentially useful to characterize 6 strains and identify them from other studied strains. Moreover, different SCAR phenotypes also made the other 17 studied strains to be divided into four distinguishable groups. The multiplex PCR assays were further established for the joint use of some SCAR markers efficiently. Compared with some identification methods reported previously, the special feature of this new molecular method is technically rapid and convenient in the practical use and suitable for analyzing large numbers of samples. Thus, the simple rapid PCR-based molecular method can be used as a helpful assistant tool for the lentinula industry. To our knowledge, this study is the first to describe a development of a new SCAR maker-based multiplex PCR assay for rapid molecular typing of edible mushroom.

  4. A duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains.

    Science.gov (United States)

    Benacer, Douadi; Zain, Siti Nursheena Mohd; Lewis, John W; Khalid, Mohd Khairul Nizam Mohd; Thong, Kwai Lin

    2017-01-01

    This study aimed to develop a duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains. Primers were designed to target the rrs (LG1/LG2) and ligB (LP1/LP2) genes to confirm the presence of the Leptospira genus and the pathogenic species, respectively. The assay showed 100% specificity against 17 Leptospira strains with a limit of detection of 23.1pg/µl of leptospiral DNA and sensitivity of 103 leptospires/ml in both spiked urine and water. Our duplex endpoint PCR assay is suitable for rapid early detection of Leptospira with high sensitivity and specificity.

  5. Simultaneous SNP identification and assessment of allele-specific bias from ChIP-seq data

    Directory of Open Access Journals (Sweden)

    Ni Yunyun

    2012-09-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs have been associated with many aspects of human development and disease, and many non-coding SNPs associated with disease risk are presumed to affect gene regulation. We have previously shown that SNPs within transcription factor binding sites can affect transcription factor binding in an allele-specific and heritable manner. However, such analysis has relied on prior whole-genome genotypes provided by large external projects such as HapMap and the 1000 Genomes Project. This requirement limits the study of allele-specific effects of SNPs in primary patient samples from diseases of interest, where complete genotypes are not readily available. Results In this study, we show that we are able to identify SNPs de novo and accurately from ChIP-seq data generated in the ENCODE Project. Our de novo identified SNPs from ChIP-seq data are highly concordant with published genotypes. Independent experimental verification of more than 100 sites estimates our false discovery rate at less than 5%. Analysis of transcription factor binding at de novo identified SNPs revealed widespread heritable allele-specific binding, confirming previous observations. SNPs identified from ChIP-seq datasets were significantly enriched for disease-associated variants, and we identified dozens of allele-specific binding events in non-coding regions that could distinguish between disease and normal haplotypes. Conclusions Our approach combines SNP discovery, genotyping and allele-specific analysis, but is selectively focused on functional regulatory elements occupied by transcription factors or epigenetic marks, and will therefore be valuable for identifying the functional regulatory consequences of non-coding SNPs in primary disease samples.

  6. Simultaneous SNP identification and assessment of allele-specific bias from ChIP-seq data

    Science.gov (United States)

    2012-01-01

    Background Single nucleotide polymorphisms (SNPs) have been associated with many aspects of human development and disease, and many non-coding SNPs associated with disease risk are presumed to affect gene regulation. We have previously shown that SNPs within transcription factor binding sites can affect transcription factor binding in an allele-specific and heritable manner. However, such analysis has relied on prior whole-genome genotypes provided by large external projects such as HapMap and the 1000 Genomes Project. This requirement limits the study of allele-specific effects of SNPs in primary patient samples from diseases of interest, where complete genotypes are not readily available. Results In this study, we show that we are able to identify SNPs de novo and accurately from ChIP-seq data generated in the ENCODE Project. Our de novo identified SNPs from ChIP-seq data are highly concordant with published genotypes. Independent experimental verification of more than 100 sites estimates our false discovery rate at less than 5%. Analysis of transcription factor binding at de novo identified SNPs revealed widespread heritable allele-specific binding, confirming previous observations. SNPs identified from ChIP-seq datasets were significantly enriched for disease-associated variants, and we identified dozens of allele-specific binding events in non-coding regions that could distinguish between disease and normal haplotypes. Conclusions Our approach combines SNP discovery, genotyping and allele-specific analysis, but is selectively focused on functional regulatory elements occupied by transcription factors or epigenetic marks, and will therefore be valuable for identifying the functional regulatory consequences of non-coding SNPs in primary disease samples. PMID:22950704

  7. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-02-07

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.

    Science.gov (United States)

    Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing

    2018-02-01

    The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.

  9. Rapid Diagnosis of Azole-Resistant Aspergillosis by Direct PCR Using Tissue Specimens

    NARCIS (Netherlands)

    van der Linden, Jan W. M.; Snelders, Eveline; Arends, Jan P.; Daenen, Simon M.; Melchers, Willem J. G.; Verweij, Paul E.

    We report the use of PCR techniques on a formalin-fixed and paraffin-embedded tissue specimen for direct detection of one dominant azole resistance mechanism in a case of disseminated invasive aspergillosis. Rapid detection of mutations associated with azole resistance directly in tissue

  10. Rapid diagnosis of azole-resistant aspergillosis by direct PCR using tissue specimens.

    NARCIS (Netherlands)

    Linden, J.W.M. van der; Snelders, E.; Arends, J.P.; Daenen, S.M.G.J.; Melchers, W.J.G.; Verweij, P.E.

    2010-01-01

    We report the use of PCR techniques on a formalin-fixed and paraffin-embedded tissue specimen for direct detection of one dominant azole resistance mechanism in a case of disseminated invasive aspergillosis. Rapid detection of mutations associated with azole resistance directly in tissue

  11. A duplex PCR for rapid and simultaneous detection of Brucella spp. in human blood samples.

    Science.gov (United States)

    Mirnejad, Reza; Mohamadi, Mozafar; Piranfar, Vahbeh; Mortazavi, Seied Mojtaba; Kachuei, Reza

    2013-06-01

    To design a duplex PCR for rapid and simultaneous detection of Brucella species. in human blood samples. Fifty-two peripheral bloods samples were collected from suspicious patients with brucellosis. Following DNA extraction, PCR assay were performed, using three primers that could simultaneously identify and differentiate three major species of pathogenic Brucella in humans and animals. Of the 52 peripheral bloods samples tested, 25 sample (48%) showed positive reactions in PCR. Twelve samples were positive for Brucella abortus 39 (B. abortus 39) (23%), 13 for Brucella melitensis 39 (B. melitensis 39) (25%) and 0 for Brucella ovis 39 (B. ovis 39) (0%). This work demonstrates that in case where specific primers were utilized, duplex PCR has proved to be a simple, fast, and relatively inexpensive method for simultaneous detection of important species of Brucella in clinical samples. Copyright © 2013 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  12. PCR

    African Journals Online (AJOL)

    sunny

    (5'-. MGATAAGRTGTAATCCW-3') and. (5'-. TGGAAGCCATCATCGACGAAGCCAT-3') were designed to amplify a new partial rbcS gene by PCR. About 400 bp DNA fragment was obtained by PCR. This DNA fragment was cloned into the pMD18-T vector. (TakaRa) for sequencing. Sequence analysis of this DNA fragment.

  13. Spatiotemporal allele organization by allele-specific CRISPR live-cell imaging (SNP-CLING).

    Science.gov (United States)

    Maass, Philipp G; Barutcu, A Rasim; Shechner, David M; Weiner, Catherine L; Melé, Marta; Rinn, John L

    2018-02-01

    Imaging and chromatin capture techniques have provided important insights into our understanding of nuclear organization. A limitation of these techniques is the inability to resolve allele-specific spatiotemporal properties of genomic loci in living cells. Here, we describe an allele-specific CRISPR live-cell DNA imaging technique (SNP-CLING) to provide the first comprehensive insights into allelic positioning across space and time in mouse embryonic stem cells and fibroblasts. With 3D imaging, we studied alleles on different chromosomes in relation to one another and relative to nuclear substructures such as the nucleolus. We find that alleles maintain similar positions relative to each other and the nucleolus; however, loci occupy unique positions. To monitor spatiotemporal dynamics by SNP-CLING, we performed 4D imaging and determined that alleles are either stably positioned or fluctuating during cell state transitions, such as apoptosis. SNP-CLING is a universally applicable technique that enables the dissection of allele-specific spatiotemporal genome organization in live cells.

  14. Rapid detection of Pseudomonas aeruginosa from positive blood cultures by quantitative PCR

    Directory of Open Access Journals (Sweden)

    Cattoir Vincent

    2010-08-01

    Full Text Available Abstract Background Pseudomonas aeruginosa is responsible for numerous bloodstream infections associated with severe adverse outcomes in case of inappropriate initial antimicrobial therapy. The present study was aimed to develop a novel quantitative PCR (qPCR assay, using ecfX as the specific target gene, for the rapid and accurate identification of P. aeruginosa from positive blood cultures (BCs. Methods Over the period August 2008 to June 2009, 100 BC bottles positive for gram-negative bacilli were tested in order to evaluate performances of the qPCR technique with conventional methods as gold standard (i.e. culture and phenotypic identification. Results Thirty-three strains of P. aeruginosa, 53 strains of Enterobactericaeae, nine strains of Stenotrophomonas maltophilia and two other gram-negative species were isolated while 3 BCs were polymicrobial including one mixture containing P. aeruginosa. All P. aeruginosa clinical isolates were detected by qPCR except a single strain in mixed culture. Performances of the qPCR technique were: specificity, 100%; positive predictive value, 100%; negative predictive value, 98.5%; and sensitivity, 97%. Conclusions This reliable technique may offer a rapid (

  15. Real-time PCR for rapidly detecting aniline-degrading bacteria in activated sludge.

    Science.gov (United States)

    Kayashima, Takakazu; Suzuki, Hisako; Maeda, Toshinari; Ogawa, Hiroaki I

    2013-05-01

    We developed a detection method that uses quantitative real-time PCR (qPCR) and the TaqMan system to easily and rapidly assess the population of aniline-degrading bacteria in activated sludge prior to conducting a biodegradability test on a chemical compound. A primer and probe set for qPCR was designed by a multiple alignment of conserved amino acid sequences encoding the large (α) subunit of aniline dioxygenase. PCR amplification tests showed that the designed primer and probe set targeted aniline-degrading strains such as Acidovorax sp., Gordonia sp., Rhodococcus sp., and Pseudomonas putida, thereby suggesting that the developed method can detect a wide variety of aniline-degrading bacteria. There was a strong correlation between the relative copy number of the α-aniline dioxygenase gene in activated sludge obtained with the developed qPCR method and the number of aniline-degrading bacteria measured by the Most Probable Number method, which is the conventional method, and a good correlation with the lag time of the BOD curve for aniline degradation produced by the biodegradability test in activated sludge samples collected from eight different wastewater treatment plants in Japan. The developed method will be valuable for the rapid and accurate evaluation of the activity of inocula prior to conducting a ready biodegradability test. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. PCR

    African Journals Online (AJOL)

    Jane

    2011-07-11

    Jul 11, 2011 ... The overall prevalence of human cytomegalovirus (HCMV) infection in 16 ... Key words: Cytomegalovirus, PCR, human cytomegalovirus (HCMV) and ELISA. .... McGeoch DJ, Hayward GS (2003). The human cytomegalovirus genome revisited: Comparison with the chimpanzee cytomegalovirus genome.

  17. Nested PCR Assay for Eight Pathogens: A Rapid Tool for Diagnosis of Bacterial Meningitis.

    Science.gov (United States)

    Bhagchandani, Sharda P; Kubade, Sushant; Nikhare, Priyanka P; Manke, Sonali; Chandak, Nitin H; Kabra, Dinesh; Baheti, Neeraj N; Agrawal, Vijay S; Sarda, Pankaj; Mahajan, Parikshit; Ganjre, Ashish; Purohit, Hemant J; Singh, Lokendra; Taori, Girdhar M; Daginawala, Hatim F; Kashyap, Rajpal S

    2016-02-01

    Bacterial meningitis is a dreadful infectious disease with a high mortality and morbidity if remained undiagnosed. Traditional diagnostic methods for bacterial meningitis pose a challenge in accurate identification of pathogen, making prognosis difficult. The present study is therefore aimed to design and evaluate a specific and sensitive nested 16S rDNA genus-based polymerase chain reaction (PCR) assay using clinical cerebrospinal fluid (CSF) for rapid diagnosis of eight pathogens causing the disease. The present work was dedicated to development of an in-house genus specific 16S rDNA nested PCR covering pathogens of eight genera responsible for causing bacterial meningitis using newly designed as well as literature based primers for respective genus. A total 150 suspected meningitis CSF obtained from the patients admitted to Central India Institute of Medical Sciences (CIIMS), India during the period from August 2011 to May 2014, were used to evaluate clinical sensitivity and clinical specificity of optimized PCR assays. The analytical sensitivity and specificity of our newly designed genus-specific 16S rDNA PCR were found to be ≥92%. With such a high sensitivity and specificity, our in-house nested PCR was able to give 100% sensitivity in clinically confirmed positive cases and 100% specificity in clinically confirmed negative cases indicating its applicability in clinical diagnosis. Our in-house nested PCR system therefore can diagnose the accurate pathogen causing bacterial meningitis and therefore be useful in selecting a specific treatment line to minimize morbidity. Results are obtained within 24 h and high sensitivity makes this nested PCR assay a rapid and accurate diagnostic tool compared to traditional culture-based methods.

  18. Clinical usefulness of multiplex PCR lateral flow in MRSA detection: a novel, rapid genetic testing method.

    Science.gov (United States)

    Nihonyanagi, Shin; Kanoh, Yuhsaku; Okada, Kiyomi; Uozumi, Toshiki; Kazuyama, Yukumasa; Yamaguchi, Tokiko; Nakazaki, Nobuhiko; Sakurai, Keizou; Hirata, Yasuyoshi; Munekata, Shinichi; Ohtani, Shinichi; Takemoto, Tsuyoshi; Bandoh, Yuki; Akahoshi, Tohru

    2012-06-01

    Methicillin-resistant Staphylococcus aureus (MRSA) with exogenous cassette DNA containing the methicillin-resistant gene mecA (SCCmec) poses a problem as a drug-resistant bacterium responsible for hospital- and community-acquired infections. The frequency of MRSA detection has recently been increasing rapidly in Japan, and SCCmec has also been classified more diversely into types I-V. A rapid test is essential for early diagnosis and treatment of MRSA infections, but detection by conventional methods requires at least two days. The newly developed multiplex PCR lateral flow method allows specific amplification of femA to detect S. aureus, mecA to detect SCCmec, and kdpC to detect SCCmec type II; moreover, PCR products can be evaluated visually in about 3 h. In the present study, we developed a PCR lateral flow method for MRSA using this method and investigated its clinical usefulness in the detection of MRSA. The results showed a diagnostic concordance rate of 91.7% for MRSA and methicillin-susceptible S. aureus between bacteriological examination and PCR lateral flow, and a high level of specificity in PCR lateral flow. In addition, a higher detection rate for S. aureus using the same sample was observed for PCR lateral flow (70.2%) than for bacteriological tests (48.6%). The above results show that PCR lateral flow for MRSA detection has high sensitivity, specificity, and speed, and its clinical application as a method for early diagnosis of MRSA infections appears to be feasible.

  19. Rapid and sensitive diagnosis of fungal keratitis with direct PCR without template DNA extraction.

    Science.gov (United States)

    Zhao, G; Zhai, H; Yuan, Q; Sun, S; Liu, T; Xie, L

    2014-10-01

    This study was aimed at developing a direct PCR assay without template DNA extraction for the rapid and sensitive diagnosis of infectious keratitis. Eighty corneal scrapings from 67 consecutive patients with clinically suspected infectious keratitis were analysed prospectively. Direct PCR was performed with all scrapings, with specific primers for fungi, bacteria, herpes simplex virus-1 (HSV-1) and Acanthamoeba simultaneously. The results were compared with those obtained from culture, smear, and confocal microscopy. Discrepant results were resolved according to the therapeutic effects of the corresponding antimicrobial drugs. The lowest detection limit of direct PCR was ten copies of each pathogen. Sixty-six scrapings yielded positive results with direct PCR, giving a total positive detection rate of 82.5% (66/80). For 34 patients with high suspicion of fungal keratitis, the positive detection rate of direct PCR was 84.8% (39/46). This rate increased to 91.2% (31/34) when repeated scrapings were excluded, and was significantly higher than the rates obtained with culture (35.3%, 12/34) and smear (64.7%, 22/34) (p keratitis with direct PCR and culture were 98.0% and 47.1% (p keratitis, and it is expected to have an impact on the diagnosis and treatment of infectious keratitis in the future. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

  20. New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

    Science.gov (United States)

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  1. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    Directory of Open Access Journals (Sweden)

    Nelly eDatukishvili

    2015-07-01

    Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  2. Development of multiplex-PCR assay for rapid detection of Candida spp.

    Directory of Open Access Journals (Sweden)

    Ni Made A. Tarini

    2010-05-01

    Full Text Available Aim Candida spp. infection commonly occur in immunocompromised patients. Biochemical assay for identification of Candida spp. is time-consuming and shows many undetermined results. Specific detection for antibody, antigen and metabolites of Candida spp. had low sensitivity and specificity. In this study, we developed a rapid diagnostic method, Multiplex-PCR, to identify Candida spp.Methods Five Candida spp. isolates were cultured, identifi ed with germ tube and API® 20 C AUX (BioMerieux® SA kit. Furthermore, DNA was purified by QIAamp DNA mini (Qiagen® kit for Multiplex-PCR assay.Results DNA detection limit by Multiplex-PCR assays for C. albicans, C. tropicalis, C. parapsilosis, C. krusei and C. glabrata were 4 pg, 0.98 pg, 0.98 pg, 0.5 pg and 16 pg respectively. This assay was also more sensitive than culture in that Multiplex-PCR could detect 2.6-2.9 x 100 CFU/ml, whereas culture 2.6-2.9 x 102 CFU/ml.Conclusion Multiplex-PCR is much more sensitive than culture and thus, can be recommended as a sensitive and specific assay for identification of Candida spp. (Med J Indones 2010; 19:83-7Keywords: Candida spp., multiplex-PCR

  3. Development of a Multiplex PCR Assay for Rapid Molecular Serotyping of Haemophilus parasuis

    Science.gov (United States)

    Peters, Sarah E.; Wang, Jinhong; Hernandez-Garcia, Juan; Weinert, Lucy A.; Luan, Shi-Lu; Chaudhuri, Roy R.; Angen, Øystein; Aragon, Virginia; Williamson, Susanna M.; Langford, Paul R.; Rycroft, Andrew N.; Wren, Brendan W.; Maskell, Duncan J.; Tucker, Alexander W.

    2015-01-01

    Haemophilus parasuis causes Glässer's disease and pneumonia in pigs. Indirect hemagglutination (IHA) is typically used to serotype this bacterium, distinguishing 15 serovars with some nontypeable isolates. The capsule loci of the 15 reference strains have been annotated, and significant genetic variation was identified between serovars, with the exception of serovars 5 and 12. A capsule locus and in silico serovar were identified for all but two nontypeable isolates in our collection of >200 isolates. Here, we describe the development of a multiplex PCR, based on variation within the capsule loci of the 15 serovars of H. parasuis, for rapid molecular serotyping. The multiplex PCR (mPCR) distinguished between all previously described serovars except 5 and 12, which were detected by the same pair of primers. The detection limit of the mPCR was 4.29 × 105 ng/μl bacterial genomic DNA, and high specificity was indicated by the absence of reactivity against closely related commensal Pasteurellaceae and other bacterial pathogens of pigs. A subset of 150 isolates from a previously sequenced H. parasuis collection was used to validate the mPCR with 100% accuracy compared to the in silico results. In addition, the two in silico-nontypeable isolates were typeable using the mPCR. A further 84 isolates were analyzed by mPCR and compared to the IHA serotyping results with 90% concordance (excluding those that were nontypeable by IHA). The mPCR was faster, more sensitive, and more specific than IHA, enabling the differentiation of 14 of the 15 serovars of H. parasuis. PMID:26424843

  4. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    , in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...... of newly designed primers targeting Salmonella spp. at subtype level were incorporated in the multiplex Direct PCR. To maximize the efficiency of the Direct PCR, the ratio between sample and dilution buffer was optimized. The sensitivity and specificity of the multiplex Direct PCR were tested using...... and integration into a point-of-need Lab-on-a-chip system for rapid online pathogen detection....

  5. Comprehensive and Rapid Real-Time PCR Analysis of 21 Foodborne Outbreaks

    Directory of Open Access Journals (Sweden)

    Hiroshi Fukushima

    2009-01-01

    Full Text Available A set of four duplex SYBR Green I PCR (SG-PCR assay combined with DNA extraction using QIAamp DNA Stool Mini kit was evaluated for the detection of foodborne bacteria from 21 foodborne outbreaks. The causative pathogens were detected in almost all cases in 2 hours or less. The first run was for the detection of 8 main foodborne pathogens in 5 stool specimens within 2 hours and the second run was for the detection of other unusual suspect pathogens within a further 45 minutes. After 2 to 4 days, the causative agents were isolated and identified. The results proved that for comprehensive and rapid molecular diagnosis in foodborne outbreaks, Duplex SG-PCR assay is not only very useful, but is also economically viable for one-step differentiation of causative pathogens in fecal specimens obtained from symptomatic patients. This then allows for effective diagnosis and management of foodborne outbreaks.

  6. Multiplex Solid-Phase PCR for Rapid Detection and Identification of Salmonella spp. at Sub-species

    DEFF Research Database (Denmark)

    Cao, Cuong; Høgberg, Jonas; Wolff, Anders

    -PCR gel electrophoresis. The method will be useful for development of point-of-care devices for rapid detection and identification of Salmonella spp. A solid-phase PCR for rapid detection and identification of S. enteritidis, S. typhimurium and S. dublin is developed. The method offers advantages......This study presents a solid-phase PCR (SP-PCR) for rapid detection, identification, and sub-typing of various Salmonella species, the major food-borne cause of salmonellosis. The target DNA is firstly amplified with PCR primers (one primer is labeled with fluorophores) in the liquid phase...... by the liquid phase primer thus generating new templates for the SP-PCR. After the reaction, PCR products labeled with fluorophores remain attached to the substrate and can be visualized directly by fluorescence readout devices. Using this method, S. enteritidis, S. typhimurium and S. dublin can be detected...

  7. A Rapid and Low-Cost PCR Thermal Cycler for Low Resource Settings.

    Directory of Open Access Journals (Sweden)

    Grace Wong

    Full Text Available Many modern molecular diagnostic assays targeting nucleic acids are typically confined to developed countries or to the national reference laboratories of developing-world countries. The ability to make technologies for the rapid diagnosis of infectious diseases broadly available in a portable, low-cost format would mark a revolutionary step forward in global health. Many molecular assays are also developed based on polymerase chain reactions (PCR, which require thermal cyclers that are relatively heavy (>20 pounds and need continuous electrical power. The temperature ramping speed of most economical thermal cyclers are relatively slow (2 to 3 °C/s so a polymerase chain reaction can take 1 to 2 hours. Most of all, these thermal cyclers are still too expensive ($2k to $4k for low-resource setting uses.In this article, we demonstrate the development of a low-cost and rapid water bath based thermal cycler that does not require active temperature control or continuous power supply during PCR. This unit costs $130 to build using commercial off-the-shelf items. The use of two or three vacuum-insulated stainless-steel Thermos food jars containing heated water (for denaturation and annealing/extension steps and a layer of oil on top of the water allow for significantly stabilized temperatures for PCR to take place. Using an Arduino-based microcontroller, we automate the "archaic" method of hand-transferring PCR tubes between water baths.We demonstrate that this innovative unit can deliver high speed PCR (17 s per PCR cycle with the potential to go beyond the 1,522 bp long amplicons tested in this study and can amplify from templates down to at least 20 copies per reaction. The unit also accepts regular PCR tubes and glass capillary tubes. The PCR efficiency of our thermal cycler is not different from other commercial thermal cyclers. When combined with a rapid nucleic acid detection approach, the thermos thermal cycler (TTC can enable on-site molecular

  8. Single-step blood direct PCR: A robust and rapid method to diagnose triplet repeat disorders.

    Science.gov (United States)

    Singh, Inder; Swarup, Vishnu; Shakya, Sunil; Goyal, Vinay; Faruq, Mohammed; Srivastava, Achal Kumar

    2017-08-15

    DNA extraction prior to polymerase chain reaction (PCR) amplification in genetic diagnoses of triplet repeat disorders (TRDs) is tedious and labour-intensive and has the limitations of sample contamination with foreign DNA, including that from preceding samples. Therefore, we aimed to develop a rapid, robust, and cost-effective method for expeditious genetic investigation of TRDs from whole blood as a DNA template. Peripheral blood samples were collected from 70 clinically suspected patients of progressive ataxia. The conventional method using genomic DNA and single-step Blood-Direct PCR (BD-PCR) method with just 2μl of whole blood sample were tested to amplify triplet repeat expansion in genes related to spinocerebellar ataxia (SCA) types 1, 2, 3, 12 and Friedreich's ataxia (FRDA). Post-PCR, the allele sizes were mapped and repeat numbers were calculated using GeneMapper and macros run in Microsoft Excel programmes. Successful amplification of target regions was achieved in all samples by both methods. The frequency of the normal and mutated allele was concordant between both methods, diagnosing 37% positive for a mutation in either of the candidate genes. The BD-PCR resulted in higher intensities of product peaks of normal and pathogenic alleles. The nearly-accurate sizing of the normal and expanded allele was achieved in a shorter time (4-5h), without DNA extraction and any risk of cross contamination, which suggests the BD-PCR to be a reliable, inexpensive, and rapid method to confirm TRDs. This technique can be introduced in routine diagnostic procedures of other tandem repeat disorders. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Rapid Molecular Detection of Multidrug-Resistant Tuberculosis by PCR-Nucleic Acid Lateral Flow Immunoassay

    Science.gov (United States)

    Kamphee, Hatairat; Chaiprasert, Angkana; Prammananan, Therdsak; Wiriyachaiporn, Natpapas; Kanchanatavee, Airin; Dharakul, Tararaj

    2015-01-01

    Several existing molecular tests for multidrug-resistant tuberculosis (MDR-TB) are limited by complexity and cost, hindering their widespread application. The objective of this proof of concept study was to develop a simple Nucleic Acid Lateral Flow (NALF) immunoassay as a potential diagnostic alternative, to complement conventional PCR, for the rapid molecular detection of MDR-TB. The NALF device was designed using antibodies for the indirect detection of labeled PCR amplification products. Multiplex PCR was optimized to permit the simultaneous detection of the drug resistant determining mutations in the 81-bp hot spot region of the rpoB gene (rifampicin resistance), while semi-nested PCR was optimized for the S315T mutation detection in the katG gene (isoniazid resistance). The amplification process additionally targeted a conserved region of the genes as Mycobacterium tuberculosis (Mtb) DNA control. The optimized conditions were validated with the H37Rv wild-type (WT) Mtb isolate and Mtb isolates with known mutations (MT) within the rpoB and katG genes. Results indicate the correct identification of WT (drug susceptible) and MT (drug resistant) Mtb isolates, with the least limit of detection (LOD) being 104 genomic copies per PCR reaction. NALF is a simple, rapid and low-cost device suitable for low resource settings where conventional PCR is already employed on a regular basis. Moreover, the use of antibody-based NALF to target primer-labels, without the requirement for DNA hybridization, renders the device generic, which could easily be adapted for the molecular diagnosis of other infectious and non-infectious diseases requiring nucleic acid detection. PMID:26355296

  10. Rapid Molecular Detection of Multidrug-Resistant Tuberculosis by PCR-Nucleic Acid Lateral Flow Immunoassay.

    Directory of Open Access Journals (Sweden)

    Hatairat Kamphee

    Full Text Available Several existing molecular tests for multidrug-resistant tuberculosis (MDR-TB are limited by complexity and cost, hindering their widespread application. The objective of this proof of concept study was to develop a simple Nucleic Acid Lateral Flow (NALF immunoassay as a potential diagnostic alternative, to complement conventional PCR, for the rapid molecular detection of MDR-TB. The NALF device was designed using antibodies for the indirect detection of labeled PCR amplification products. Multiplex PCR was optimized to permit the simultaneous detection of the drug resistant determining mutations in the 81-bp hot spot region of the rpoB gene (rifampicin resistance, while semi-nested PCR was optimized for the S315T mutation detection in the katG gene (isoniazid resistance. The amplification process additionally targeted a conserved region of the genes as Mycobacterium tuberculosis (Mtb DNA control. The optimized conditions were validated with the H37Rv wild-type (WT Mtb isolate and Mtb isolates with known mutations (MT within the rpoB and katG genes. Results indicate the correct identification of WT (drug susceptible and MT (drug resistant Mtb isolates, with the least limit of detection (LOD being 104 genomic copies per PCR reaction. NALF is a simple, rapid and low-cost device suitable for low resource settings where conventional PCR is already employed on a regular basis. Moreover, the use of antibody-based NALF to target primer-labels, without the requirement for DNA hybridization, renders the device generic, which could easily be adapted for the molecular diagnosis of other infectious and non-infectious diseases requiring nucleic acid detection.

  11. Rapid method for simulating gas spectra using reversed PCR temperature calibration models based on Hitran data

    DEFF Research Database (Denmark)

    Bak, J.

    1999-01-01

    A computer program was produced to make rapid simulations of CO gas spectra at a spectral resolution of 1 cm(-1) and at temperatures ranging from 295 to 845 K and concentrations from 5 to 400 mg/m(3). The program is based on loadings and scores from three principal component regression (PCR) temp...... a uniform slab of gas at various temperatures, concentrations, and pathlengths. The gain in speed of the calculations of the spectra is based on the fact that the PCR models include mathematical pretreatments and compress the data effectively.......A computer program was produced to make rapid simulations of CO gas spectra at a spectral resolution of 1 cm(-1) and at temperatures ranging from 295 to 845 K and concentrations from 5 to 400 mg/m(3). The program is based on loadings and scores from three principal component regression (PCR......) temperature calibration models. Three sets of 12 Hitran-simulated high-density spectra, each set spanning the entire temperature range at constant concentrations (50, 150, and 300 mg/m(3)), were used as calibration spectra in the PCR temperature models. All the spectra were convoluted with a sine...

  12. Real-time PCR TaqMan assay for rapid screening of bloodstream infection

    Science.gov (United States)

    2014-01-01

    Background Sepsis is one of the main causes of mortality and morbidity. The rapid detection of pathogens in blood of septic patients is essential for adequate antimicrobial therapy and better prognosis. This study aimed to accelerate the detection and discrimination of Gram-positive (GP) and Gram-negative (GN) bacteria and Candida species in blood culture samples by molecular methods. Methods The Real-GP®, -GN®, and -CAN® real-time PCR kit (M&D, Wonju, Republic of Korea) assays use the TaqMan probes for detecting pan-GP, pan-GN, and pan-Candida species, respectively. The diagnostic performances of the real-time PCR kits were evaluated with 115 clinical isolates, 256 positive and 200 negative blood culture bottle samples, and the data were compared to results obtained from conventional blood culture. Results Eighty-seven reference strains and 115 clinical isolates were correctly identified with specific probes corresponding to GP-bacteria, GN-bacteria and Candida, respectively. The overall sensitivity and specificity of the real-time PCR kit with blood culture samples were 99.6% and 89.5%, respectively. Conclusions The Real-GP®, -GN®, and -CAN® real-time PCR kits could be useful tools for the rapid and accurate screening of bloodstream infections (BSIs). PMID:24393579

  13. Real-time PCR assay for rapid qualitative and quantitative detection of Entamoeba histolytica.

    Science.gov (United States)

    Orosz, Erika; Perkátai, Katalin; Kapusinszky, Beatrix; Farkas, Agnes; Kucsera, István

    2012-12-01

    Simple real-time PCR assay with one set of primer and probe for rapid, sensitive qualitative and quantitative detection of Entamoeba histolytica has been used. Consensus sequences were used to amplify a species-specific region of the 16S rRNA gene, and fluorescence resonance energy transfer hybridization probes were used for detection in a LightCycler platform (Roche). The anchor probe sequence was designed to be a perfect match for the 16S rRNA gene of Entamoeba species, while the acceptor probe sequence was designed for Entamoeba histolytica, which allowed differentiation. The performed characteristics of the real-time PCR assay were compared with ELISA antigen and microscopical detection from 77 samples of individuals with suspected clinical diagnosis of imported E. histolytica infection. Stool and liver abscess pus samples were examined with analytical sensitivity of 5 parasites per PCR reaction. The melting curve means Tms (standard deviation) in clinical isolates were 54°C. The real-time assay was 100% sensitive and specific for differentiation of Entamoeba histolytica, compared with conventional ELISA or microscopy. This real-time PCR assay with melting curve analysis is rapid, and specific for the detection and differentiation of Entamoeba histolytica. The suitability for routine use of this assay in clinical diagnostic laboratories is discussed.

  14. An asymmetric PCR-based, reliable and rapid single-tube native DNA engineering strategy

    OpenAIRE

    Bi Yanzhen; Qiao Xianfeng; Hua Zaidong; Zhang Liping; Liu Ximei; Li Li; Hua Wenjun; Xiao Hongwei; Zhou Jingrong; Wei Qingxin; Zheng Xinmin

    2012-01-01

    Abstract Background Widely used restriction-dependent cloning methods are labour-intensive and time-consuming, while several types of ligase-independent cloning approaches have inherent limitations. A rapid and reliable method of cloning native DNA sequences into desired plasmids are highly desired. Results This paper introduces ABI-REC, a novel strategy combining asymmetric bridge PCR with intramolecular homologous recombination in bacteria for native DNA cloning. ABI-REC was developed to pr...

  15. Rapid detection of Listeria monocytogenes in food using culture enrichment combined with real-time PCR.

    Science.gov (United States)

    O'Grady, Justin; Ruttledge, Margaret; Sedano-Balbás, Sara; Smith, Terry J; Barry, Thomas; Maher, Majella

    2009-02-01

    A rapid method for the detection of Listeria monocytogenes in foods combining culture enrichment and real-time PCR was compared to the ISO 11290-1 standard method. The culture enrichment component of the rapid method is based on the ISO standard and includes 24h incubation in half-Fraser broth, 4h incubation in Fraser broth followed by DNA extraction and real-time PCR detection of the ssrA gene of L. monocytogenes. An internal amplification control, which is co-amplified with the same primers as the L. monocytogenes DNA, was also included in the assay. The method has a limit of detection of 1-5CFU/25g food sample and can be performed in 2 working days compared to up to 7days for the ISO standard. A variety of food samples from retail outlets and food processing plants (n=175) and controls (n=31) were tested using rapid and conventional methods. The rapid method was 99.44% specific, 96.15% sensitive and 99.03% accurate when compared to the standard method. This method has the potential to be used as an alternative to the standard method for food quality assurance providing rapid detection of L. monocytogenes in food.

  16. Investigation of QF-PCR Application for Rapid Prenatal Diagnosis of Chromosomal Aneuploidies in Iranian Population.

    Science.gov (United States)

    Nasiri, Habib; Noori-Dalooi, Mohammad-Reza; Dastan, Jila; Ghaffari, Saeed-Reza

    2011-03-01

    G-Banding followed by standard chromosome analysis is routinely used for prenatal detection of chromosomal abnormalities. In recent years, molecular cytogenetic techniques have been developed for rapid diagnosis of chromosomal abnormalities. Among these methods Quantitative Florescence Polymerase Chain Reaction (QF-PCR) has been widely used for this purpose. Heterozygosity of short tandem repeat (STR) markers which leads to informativity is the most critical requirement for feasibility of QF-PCR. In this study we analyzed several short tandem repeats on chromosomes 13, 18, 21, X and Y on amniotic fluid samples obtained from PND candidates to diagnose conditions such as Down, Edward and Patau syndromes and also numerical sex chromosome abnormalities such as Klinefelter and Turner syndromes. Most of the analyzed STRs had acceptable heterozygosity (66.3-94.7) to be used in QF-PCR based prenatal diagnosis. Moreover, results obtained from both methods (standard karyotype and QF-PCR) for all samples were in accordance with each other. In case of using appropriate STR markers, and in certain clinical indications, QF-PCR could be used as useful technique for prenatal diagnosis even in consanguine populations such as Iranians.

  17. Rapid multiplex PCR assay to identify respiratory viral pathogens: moving forward diagnosing the common cold.

    Science.gov (United States)

    Layman, Clifton P; Gordon, Sarah M; Elegino-Steffens, Diane U; Agee, Willie; Barnhill, Jason; Hsue, Gunther

    2013-09-01

    Upper respiratory tract infections (URIs) can be a serious burden to the healthcare system. The majority of URIs are viral in etiology, but definitive diagnosis can prove difficult due to frequently overlapping clinical presentations of viral and bacterial infections, and the variable sensitivity, and lengthy turn-around time of viral culture. We tested new automated nested multiplex PCR technology, the FilmArray(®) system, in the TAMC department of clinical investigations, to determine the feasibility of replacing the standard viral culture with a rapid turn-around system. We conducted a feasibility study using a single-blinded comparison study, comparing PCR results with archived viral culture results from a convenience sample of cryopreserved archived nasopharyngeal swabs from acutely ill ED patients who presented with complaints of URI symptoms. A total of 61 archived samples were processed. Viral culture had previously identified 31 positive specimens from these samples. The automated nested multiplex PCR detected 38 positive samples. In total, PCR was 94.5% concordant with the previously positive viral culture results. However, PCR was only 63.4% concordant with the negative viral culture results, owing to PCR detection of 11 additional viral pathogens not recovered on viral culture. The average time to process a sample was 75 minutes. We determined that an automated nested multiplex PCR is a feasible alternative to viral culture in an acute clinical setting. We were able to detect at least 94.5% as many viral pathogens as viral culture is able to identify, with a faster turn-around time.

  18. Allelic Specificity of Ube3a Expression in the Mouse Brain during Postnatal Development

    Science.gov (United States)

    JUDSON, MATTHEW C.; SOSA-PAGAN, JASON O.; DEL CID, WILMER A.; HAN, JI EUN; PHILPOT, BENJAMIN D.

    2014-01-01

    Genetic alterations of the maternal UBE3A allele result in Angelman syndrome (AS), a neurodevelopmental disorder characterized by severe developmental delay, lack of speech, and difficulty with movement and balance. The combined effects of maternal UBE3A mutation and cell type-specific epigenetic silencing of paternal UBE3A are hypothesized to result in a complete loss of functional UBE3A protein in neurons. However, the allelic specificity of UBE3A expression in neurons and other cell types in the brain has yet to be characterized throughout development, including the early postnatal period when AS phenotypes emerge. Here we define maternal and paternal allele-specific Ube3a protein expression throughout postnatal brain development in the mouse, a species which exhibits orthologous epigenetic silencing of paternal Ube3a in neurons and AS-like behavioral phenotypes subsequent to maternal Ube3a deletion. We find that neurons downregulate paternal Ube3a protein expression as they mature and, with the exception of neurons born from postnatal stem cell niches, do not express detectable paternal Ube3a beyond the first postnatal week. By contrast, neurons express maternal Ube3a throughout postnatal development, during which time localization of the protein becomes increasingly nuclear. Unlike neurons, astrocytes and oligodendrotyes biallelically express Ube3a. Notably, mature oligodendrocytes emerge as the predominant Ube3a-expressing glial cell type in the cortex and white matter tracts during postnatal development. These findings demonstrate the spatiotemporal characteristics of allele-specific Ube3a expression in key brain cell types, thereby improving our understanding of the developmental parameters of paternal Ube3a silencing and the cellular basis of AS. PMID:24254964

  19. Genome-wide survey of allele-specific splicing in humans

    Directory of Open Access Journals (Sweden)

    Scheffler Konrad

    2008-06-01

    Full Text Available Abstract Background Accurate mRNA splicing depends on multiple regulatory signals encoded in the transcribed RNA sequence. Many examples of mutations within human splice regulatory regions that alter splicing qualitatively or quantitatively have been reported and allelic differences in mRNA splicing are likely to be a common and important source of phenotypic diversity at the molecular level, in addition to their contribution to genetic disease susceptibility. However, because the effect of a mutation on the efficiency of mRNA splicing is often difficult to predict, many mutations that cause disease through an effect on splicing are likely to remain undiscovered. Results We have combined a genome-wide scan for sequence polymorphisms likely to affect mRNA splicing with analysis of publicly available Expressed Sequence Tag (EST and exon array data. The genome-wide scan uses published tools and identified 30,977 SNPs located within donor and acceptor splice sites, branch points and exonic splicing enhancer elements. For 1,185 candidate splicing polymorphisms the difference in splicing between alternative alleles was corroborated by publicly available exon array data from 166 lymphoblastoid cell lines. We developed a novel probabilistic method to infer allele-specific splicing from EST data. The method uses SNPs and alternative mRNA isoforms mapped to EST sequences and models both regulated alternative splicing as well as allele-specific splicing. We have also estimated heritability of splicing and report that a greater proportion of genes show evidence of splicing heritability than show heritability of overall gene expression level. Our results provide an extensive resource that can be used to assess the possible effect on splicing of human polymorphisms in putative splice-regulatory sites. Conclusion We report a set of genes showing evidence of allele-specific splicing from an integrated analysis of genomic polymorphisms, EST data and exon array

  20. Allele-specific, age-dependent and BMI-associated DNA methylation of human MCHR1.

    Directory of Open Access Journals (Sweden)

    Stefanie Stepanow

    Full Text Available BACKGROUND: Melanin-concentrating hormone receptor 1 (MCHR1 plays a significant role in regulation of energy balance, food intake, physical activity and body weight in humans and rodents. Several association studies for human obesity showed contrary results concerning the SNPs rs133072 (G/A and rs133073 (T/C, which localize to the first exon of MCHR1. The variations constitute two main haplotypes (GT, AC. Both SNPs affect CpG dinucleotides, whereby each haplotype contains a potential methylation site at one of the two SNP positions. In addition, 15 CpGs in close vicinity of these SNPs constitute a weak CpG island. Here, we studied whether DNA methylation in this sequence context may contribute to population- and age-specific effects of MCHR1 alleles in obesity. PRINCIPAL FINDINGS: We analyzed DNA methylation of a 315 bp region of MCHR1 encompassing rs133072 and rs133073 and the CpG island in blood samples of 49 individuals by bisulfite sequencing. The AC haplotype shows a significantly higher methylation level than the GT haplotype. This allele-specific methylation is age-dependent. In young individuals (20-30 years the difference in DNA methylation between haplotypes is significant; whereas in individuals older than 60 years it is not detectable. Interestingly, the GT allele shows a decrease in methylation status with increasing BMI, whereas the methylation of the AC allele is not associated with this phenotype. Heterozygous lymphoblastoid cell lines show the same pattern of allele-specific DNA methylation. The cell line, which exhibits the highest difference in methylation levels between both haplotypes, also shows allele-specific transcription of MCHR1, which can be abolished by treatment with the DNA methylase inhibitor 5-aza-2'-deoxycytidine. CONCLUSIONS: We show that DNA methylation at MCHR1 is allele-specific, age-dependent, BMI-associated and affects transcription. Conceivably, this epigenetic regulation contributes to the age- and

  1. Impact of a Rapid Herpes Simplex Virus PCR Assay on Duration of Acyclovir Therapy.

    Science.gov (United States)

    Van, Tam T; Mongkolrattanothai, Kanokporn; Arevalo, Melissa; Lustestica, Maryann; Dien Bard, Jennifer

    2017-05-01

    Herpes simplex virus (HSV) infections of the central nervous system (CNS) are associated with significant morbidity and mortality rates in children. This study assessed the impact of a direct HSV (dHSV) PCR assay on the time to result reporting and the duration of acyclovir therapy for children with signs and symptoms of meningitis and encephalitis. A total of 363 patients with HSV PCR results from cerebrospinal fluid (CSF) samples were included in this retrospective analysis, divided into preimplementation and postimplementation groups. For the preimplementation group, CSF testing was performed using a laboratory-developed real-time PCR assay; for the postimplementation group, CSF samples were tested using a direct sample-to-answer assay. All CSF samples were negative for HSV. Over 60% of patients from both groups were prescribed acyclovir. The average HSV PCR test turnaround time for the postimplementation group was reduced by 14.5 h (23.6 h versus 9.1 h; P < 0.001). Furthermore, 79 patients (43.6%) in the postimplementation group had dHSV PCR results reported <4 h after specimen collection. The mean time from specimen collection to acyclovir discontinuation was 17.1 h shorter in the postimplementation group (31.1 h versus 14 h; P < 0.001). The median duration of acyclovir therapy was also significantly reduced in the postimplementation group (29.2 h versus 14.3 h; P = 0.01). Our investigation suggests that implementation of rapid HSV PCR testing can decrease turnaround times and the duration of unnecessary acyclovir therapy. Copyright © 2017 American Society for Microbiology.

  2. In vivo evaluation of candidate allele-specific mutant huntingtin gene silencing antisense oligonucleotides.

    Science.gov (United States)

    Southwell, Amber L; Skotte, Niels H; Kordasiewicz, Holly B; Østergaard, Michael E; Watt, Andrew T; Carroll, Jeffrey B; Doty, Crystal N; Villanueva, Erika B; Petoukhov, Eugenia; Vaid, Kuljeet; Xie, Yuanyun; Freier, Susan M; Swayze, Eric E; Seth, Punit P; Bennett, Clarence Frank; Hayden, Michael R

    2014-12-01

    Huntington disease (HD) is a dominant, genetic neurodegenerative disease characterized by progressive loss of voluntary motor control, psychiatric disturbance, and cognitive decline, for which there is currently no disease-modifying therapy. HD is caused by the expansion of a CAG tract in the huntingtin (HTT) gene. The mutant HTT protein (muHTT) acquires toxic functions, and there is significant evidence that muHTT lowering would be therapeutically efficacious. However, the wild-type HTT protein (wtHTT) serves vital functions, making allele-specific muHTT lowering strategies potentially safer than nonselective strategies. CAG tract expansion is associated with single nucleotide polymorphisms (SNPs) that can be targeted by gene silencing reagents such as antisense oligonucleotides (ASOs) to accomplish allele-specific muHTT lowering. Here we evaluate ASOs targeted to HD-associated SNPs in acute in vivo studies including screening, distribution, duration of action and dosing, using a humanized mouse model of HD, Hu97/18, that is heterozygous for the targeted SNPs. We have identified four well-tolerated lead ASOs that potently and selectively silence muHTT at a broad range of doses throughout the central nervous system for 16 weeks or more after a single intracerebroventricular (ICV) injection. With further validation, these ASOs could provide a therapeutic option for individuals afflicted with HD.

  3. Rapid detection of Actinobacillus actinomycetemcomitans, Prevotella intermedia and Porphyromona gingivalis by multiplex PCR.

    Science.gov (United States)

    García, L; Tercero, J C; Legido, B; Ramos, J A; Alemany, J; Sanz, M

    1998-01-01

    The identification of specific periodontal pathogens by conventional methods, mainly anaerobic cultivation, is difficult, time consuming and even sometimes unreliable. Therefore, a multiplex PCR method for simultaneous detection of Actinobacillus actinomycetemcomitans (A.a.), Porphyromona gingivalis (P.g.) and Prevotella intermedia (P.i.) was developed for rapid and easy identification of these specific bacterial pathogens in subgingival plaque samples. In this paper, there is a detailed description of the oligonucleotide primer selection, DNA extraction and PCR conditions and the sequencing of the amplified products. The locus chosen to be amplified is a highly variable region in the 16S ribosomal DNA. For the development of this technique ATCC cultures and pure cultures from subgingival plaque samples taken from periodontitis patients were used. As an internal positive control a recombinant plasmid was developed. This simple DNA extraction procedure and the DNA amplification and visualization of the amplified product permits the detection of the bacteria in a working day. Thus, this multiplex PCR method is a rapid and effective detection method for specific periodontal pathogens.

  4. Autoclave method for rapid preparation of bacterial PCR-template DNA.

    Science.gov (United States)

    Simmon, Keith E; Steadman, Dewey D; Durkin, Sarah; Baldwin, Amy; Jeffrey, Wade H; Sheridan, Peter; Horton, Rene; Shields, Malcolm S

    2004-02-01

    An autoclave method for preparing bacterial DNA for PCR template is presented, it eliminates the use of detergents, organic solvents, and mechanical cellular disruption approaches, thereby significantly reducing processing time and costs while increasing reproducibility. Bacteria are lysed by rapid heating and depressurization in an autoclave. The lysate, cleared by microcentrifugation, was either used directly in the PCR reaction, or concentrated by ultrafiltration. This approach was compared with seven established methods of DNA template preparation from four bacterial sources which included boiling Triton X-100 and SDS, bead beating, lysozyme/proteinase K, and CTAB lysis method components. Bacteria examined were Enterococcus and Escherichia coli, a natural marine bacterial community and an Antarctic cyanobacterial-mat. DNAs were tested for their suitability as PCR templates by repetitive element random amplified polymorphic DNA (RAPD) and denaturing gradient gel electrophoresis (DGGE) analysis. The autoclave method produced PCR amplifiable template comparable or superior to the other methods, with greater reproducibility, much shorter processing time, and at a significantly lower cost.

  5. Rapid identification and differentiation of Saccharomyces cerevisiae, Saccharomyces bayanus and their hybrids by multiplex PCR.

    Science.gov (United States)

    Torriani, S; Zapparoli, G; Malacrinò, P; Suzzi, G; Dellaglio, F

    2004-01-01

    To develop a multiplex PCR assay for the specific identification and differentiation of Saccharomyces cerevisiae, S. bayanus and their hybrids. Two sets of primers with sequences complementary to the region YBR033w were used. A single amplicon of 1710 bp or 329 bp was obtained with species S. cerevisiae and S. bayanus, respectively, while the presence of both bands was observed in S. pastorianus because of its hybrid nature. Both amplification products were also obtained after amplification from DNA of several laboratory S. cerevisiae x S. bayanus hybrid strains. Multiplex PCR was optimized for the rapid and reliable identification of S. cerevisiae, S. bayanus and their hybrids. The procedure may be used for routine detection of the most common Saccharomyces sensu stricto yeasts involved in industrial fermentation processes, overcoming the problems of conventional techniques.

  6. Development of a real-time SYBR Green PCR assay for the rapid detection of Dermatophilus congolensis.

    Science.gov (United States)

    García, Alfredo; Martínez, Remigio; Benitez-Medina, José Manuel; Risco, David; Garcia, Waldo Luis; Rey, Joaquín; Alonso, Juan Manuel; Hermoso de Mendoza, Javier

    2013-01-01

    Methods such as real time (RT)-PCR have not been developed for the rapid detection and diagnosis of Dermatophilus (D.) congolensis infection. In the present study, a D. congolensis-specific SYBR Green RT-PCR assay was evaluated. The detection limit of the RT-PCR assay was 1 pg of DNA per PCR reaction. No cross-reaction with nucleic acids extracted from Pseudomonas aeruginosa, Mycobacterium tuberculosis, Staphylococcus aureus, or Austwickia chelonae was observed. Finally, the RT-PCR assay was used to evaluate clinical samples collected from naturally infected animals with D. congolensis. The results showed that this assay is a fast and reliable method for diagnosing dermatophilosis.

  7. Development of a real-time SYBR Green PCR assay for the rapid detection of Dermatophilus congolensis

    OpenAIRE

    García, Alfredo; Martínez, Remigio; Benitez-Medina, José Manuel; Risco, David; García, Waldo Luis; Rey, Joaquín; Alonso, Juan Manuel; de Mendoza, Javier Hermoso

    2013-01-01

    Methods such as real time (RT)-PCR have not been developed for the rapid detection and diagnosis of Dermatophilus (D.) congolensis infection. In the present study, a D. congolensis-specific SYBR Green RT-PCR assay was evaluated. The detection limit of the RT-PCR assay was 1 pg of DNA per PCR reaction. No cross-reaction with nucleic acids extracted from Pseudomonas aeruginosa, Mycobacterium tuberculosis, Staphylococcus aureus, or Austwickia chelonae was observed. Finally, the RT-PCR assay was ...

  8. Rapid and sensitive detection of salmonid alphavirus using TaqMan real-time PCR.

    Science.gov (United States)

    Shi, Wen; Song, Aochen; Gao, Shuai; Wang, Yuting; Tang, Lijie; Xu, Yigang; Ren, Tong; Li, Yijing; Liu, Min

    2017-08-01

    Salmonid alphavirus (SAV) infection has led to the spread of salmon pancreas disease (PD) and sleeping disease (SD) to salmonids in several countries in Europe, resulting in tremendous economic losses to the fish farming industry. Recently, with increases in the fish import trade, many countries in which SAV has been unreported, such as China, may be seriously threatened by these diseases. It is therefore necessary to develop efficient detection methods for the prevention and diagnosis of SAV infection. In this study, a rapid and sensitive TaqMan real-time PCR method was established and assessed for this purpose. A specificity assay showed no cross-reactions with other common RNA viruses. Regression analysis and standard curves calculated from the Ct values of 10-fold serial dilutions of the standard plasmid showed that the assay was highly reproducible over a wide range of RNA input concentrations. The real-time PCR assay was able to detect SAV at a concentration as low as 1.5 × 10 1 copies, indicating that it is 10 7 times more sensitive than the approved conventional RT-PCR method (detection limit, 1.5 × 10 7 copies) after use on the same samples. Assessment of infected fish samples showed that this assay has a higher sensitivity than the previously reported Q_nsP1 assay. Thus, this TaqMan real-time PCR assay provides a rapid, sensitive, and specific detection method for SAV, offering improved technical support for the clinical diagnosis and epidemiology of SAV. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Development of a high-speed real-time PCR system for rapid and precise nucleotide recognition

    Science.gov (United States)

    Terazono, Hideyuki; Takei, Hiroyuki; Hattori, Akihiro; Yasuda, Kenji

    2010-04-01

    Polymerase chain reaction (PCR) is a common method used to create copies of a specific target region of a DNA sequence and to produce large quantities of DNA. A few DNA molecules, which act as templates, are rapidly amplified by PCR into many billions of copies. PCR is a key technology in genome-based biological analysis, revolutionizing many life science fields such as medical diagnostics, food safety monitoring, and countermeasures against bioterrorism. Thus, many applications have been developed with the thermal cycling. For these PCR applications, one of the most important key factors is reduction in the data acquisition time. To reduce the acquisition time, it is necessary to decrease the temperature transition time between the high and low ends as much as possible. We have developed a novel rapid real-time PCR system based on rapid exchange of media maintained at different temperatures. This system consists of two thermal reservoirs and a reaction chamber for PCR observation. The temperature transition was achieved within 0.3 sec, and good thermal stability was achieved during thermal cycling with rapid exchange of circulating media. This system allows rigorous optimization of the temperatures required for each stage of the PCR processes. Resulting amplicons were confirmed by electrophoresis. Using the system, rapid DNA amplification was accomplished within 3.5 min, including initial heating and complete 50 PCR cycles. It clearly shows that the device could allow us faster temperature switching than the conventional conduction-based heating systems based on Peltier heating/cooling.

  10. Rapid identification of Yersinia pestis and Brucella melitensis by chip-based continuous flow PCR

    Science.gov (United States)

    Dietzsch, Michael; Hlawatsch, Nadine; Melzer, Falk; Tomaso, Herbert; Gärtner, Claudia; Neubauer, Heinrich

    2012-06-01

    To combat the threat of biological agents like Yersinia pestis and Brucella melitensis in bioterroristic scenarios requires fast, easy-to-use and safe identification systems. In this study we describe a system for rapid amplification of specific genetic markers for the identification of Yersinia pestis and Brucella melitensis. Using chip based PCR and continuous flow technology we were able to amplify the targets simultaneously with a 2-step reaction profile within 20 minutes. The subsequent analysis of amplified fragments by standard gel electrophoresis requires another 45 minutes. We were able to detect both pathogens within 75 minutes being much faster than most other nucleic acid amplification technologies.

  11. Rapid Preclinical Detection of Sheeppox Virus by a Real-Time PCR Assay▿

    Science.gov (United States)

    Balinsky, C. A.; Delhon, G.; Smoliga, G.; Prarat, M.; French, R. A.; Geary, S. J.; Rock, D. L.; Rodriguez, L. L.

    2008-01-01

    Sheeppox virus (SPPV) is a member of the Capripoxvirus (CaPV) genus of the Poxviridae family. Members of this genus, which also include goatpox and lumpy skin disease viruses, cause economically significant disease in sheep, goats, and cattle. A rapid diagnostic assay for CaPV would be useful for disease surveillance as well as for detection of CaPV in clinical samples and for outbreak management. Here we describe a fluorogenic probe hydrolysis (TaqMan) PCR assay designed for rapid detection of CaPV and tested on sheep experimentally infected with a virulent strain of SPPV. This assay can detect SPPV in buffy coats, nasal swabs, oral swabs, scabs, and skin lesions as well as in lung and lymph nodes collected at necropsy. This single-tube diagnostic assay can be performed in 2 h or less and can detect viral DNA in preclinical, clinical, and postmortem samples. PMID:18032617

  12. Rapid preclinical detection of sheeppox virus by a real-time PCR assay.

    Science.gov (United States)

    Balinsky, C A; Delhon, G; Smoliga, G; Prarat, M; French, R A; Geary, S J; Rock, D L; Rodriguez, L L

    2008-02-01

    Sheeppox virus (SPPV) is a member of the Capripoxvirus (CaPV) genus of the Poxviridae family. Members of this genus, which also include goatpox and lumpy skin disease viruses, cause economically significant disease in sheep, goats, and cattle. A rapid diagnostic assay for CaPV would be useful for disease surveillance as well as for detection of CaPV in clinical samples and for outbreak management. Here we describe a fluorogenic probe hydrolysis (TaqMan) PCR assay designed for rapid detection of CaPV and tested on sheep experimentally infected with a virulent strain of SPPV. This assay can detect SPPV in buffy coats, nasal swabs, oral swabs, scabs, and skin lesions as well as in lung and lymph nodes collected at necropsy. This single-tube diagnostic assay can be performed in 2 h or less and can detect viral DNA in preclinical, clinical, and postmortem samples.

  13. Development of a novel multiplex PCR assay for rapid detection of virulence associated genes of Pasteurella multocida from pigs

    National Research Council Canada - National Science Library

    Rajkhowa, S

    2015-01-01

    Significance and Impact of the Study: The study reports the development and evaluation of a novel multiplex PCR assay for the rapid detection of 11 important VAGs of Pasteurella multocida isolates from pigs...

  14. The Rotary Zone Thermal Cycler: A Low-Power System Enabling Automated Rapid PCR

    Science.gov (United States)

    Bartsch, Michael S.; Renzi, Ronald F.; Van de Vreugde, James L.; Kim, Hanyoup; Knight, Daniel L.; Sinha, Anupama; Branda, Steven S.; Patel, Kamlesh D.

    2015-01-01

    Advances in molecular biology, microfluidics, and laboratory automation continue to expand the accessibility and applicability of these methods beyond the confines of conventional, centralized laboratory facilities and into point of use roles in clinical, military, forensic, and field-deployed applications. As a result, there is a growing need to adapt the unit operations of molecular biology (e.g., aliquoting, centrifuging, mixing, and thermal cycling) to compact, portable, low-power, and automation-ready formats. Here we present one such adaptation, the rotary zone thermal cycler (RZTC), a novel wheel-based device capable of cycling up to four different fixed-temperature blocks into contact with a stationary 4-microliter capillary-bound sample to realize 1-3 second transitions with steady state heater power of less than 10 W. We demonstrate the utility of the RZTC for DNA amplification as part of a highly integrated rotary zone PCR (rzPCR) system that uses low-volume valves and syringe-based fluid handling to automate sample loading and unloading, thermal cycling, and between-run cleaning functionalities in a compact, modular form factor. In addition to characterizing the performance of the RZTC and the efficacy of different online cleaning protocols, we present preliminary results for rapid single-plex PCR, multiplex short tandem repeat (STR) amplification, and second strand cDNA synthesis. PMID:25826708

  15. Rapid and high-throughput pan-Orthopoxvirus detection and identification using PCR and mass spectrometry.

    Directory of Open Access Journals (Sweden)

    Mark W Eshoo

    2009-07-01

    Full Text Available The genus Orthopoxvirus contains several species of related viruses, including the causative agent of smallpox (Variola virus. In addition to smallpox, several other members of the genus are capable of causing human infection, including monkeypox, cowpox, and other zoonotic rodent-borne poxviruses. Therefore, a single assay that can accurately identify all orthopoxviruses could provide a valuable tool for rapid broad orthopovirus identification. We have developed a pan-Orthopoxvirus assay for identification of all members of the genus based on four PCR reactions targeting Orthopoxvirus DNA and RNA helicase and polymerase genes. The amplicons are detected using electrospray ionization-mass spectrometry (PCR/ESI-MS on the Ibis T5000 system. We demonstrate that the assay can detect and identify a diverse collection of orthopoxviruses, provide sub-species information and characterize viruses from the blood of rabbitpox infected rabbits. The assay is sensitive at the stochastic limit of PCR and detected virus in blood containing approximately six plaque-forming units per milliliter from a rabbitpox virus-infected rabbit.

  16. New 16-plex PCR method for rapid detection of diarrheagenic Escherichia coli directly from stool samples.

    Science.gov (United States)

    Antikainen, J; Tarkka, E; Haukka, K; Siitonen, A; Vaara, M; Kirveskari, J

    2009-08-01

    A rapid 16-plex polymerase chain reaction (PCR) suitable for routine diagnostics of diarrheagenic Escherichia coli (EHEC, EIEC, EAEC, ETEC, and EPEC) was developed, validated with control strains, and tested with 250 diarrhoeal stool samples. The specificity was 100% when tested with 289 control bacterial strains, and the analytical sensitivity of automated DNA extraction directly from stool samples was made by boiling the bacterial culture (10(4)-10(5) colony forming units/ml). The assay design starting directly from extraction of stool DNA allowed same day analysis without compromising sensitivity and specificity, which makes it superior compared to PCR after culturing the bacteria. The 16-plex PCR method demonstrated high prevalence of diarrheagenic E. coli in stool samples of patients returning from abroad (39.0%) in contrast to the patients with no travel history (8.7%; p < 0.001). The high prevalence of diarrheagenic E. coli suggests that their screening should be part of normal diarrhoea diagnostics, at least in the leading diagnostic laboratories.

  17. Rapid PCR-based assay for Sclerotinia sclerotiorum detection on soybean seeds

    Directory of Open Access Journals (Sweden)

    Edilaine Mauricia Gelinski Grabicoski

    2015-02-01

    Full Text Available Caused by Sclerotinia sclerotiorum, white mold is an important seed-transmitted disease of soybean (Glycine max. Incubation-based methods available for the detection and quantification of seed-borne inoculum such as the blotter test, paper roll and Neon-S assay are time-consuming, laborious, and not always sensitive. In this study, we developed and evaluated a molecular assay for the detection of S. sclerotiorum in soybean seeds using a species-specific PCR (polymerase chain reaction primer set and seed soaking (without DNA extraction for up to 72 h. The PCR products were amplified in all the samples infected with the pathogen, but not in the other samples of plant material or the other seed-borne fungi DNA. The minimum amount of DNA detected was 10 pg, or one artificially infested seed in a 400-seed sample (0.25 % fungal incidence and one naturally infected seed in a 300-seed sample (0.33 % incidence. The PCR-based assay was rapid (< 9 h, did not require DNA extraction and was very sensitive.

  18. The rotary zone thermal cycler: a low-power system enabling automated rapid PCR.

    Directory of Open Access Journals (Sweden)

    Michael S Bartsch

    Full Text Available Advances in molecular biology, microfluidics, and laboratory automation continue to expand the accessibility and applicability of these methods beyond the confines of conventional, centralized laboratory facilities and into point of use roles in clinical, military, forensic, and field-deployed applications. As a result, there is a growing need to adapt the unit operations of molecular biology (e.g., aliquoting, centrifuging, mixing, and thermal cycling to compact, portable, low-power, and automation-ready formats. Here we present one such adaptation, the rotary zone thermal cycler (RZTC, a novel wheel-based device capable of cycling up to four different fixed-temperature blocks into contact with a stationary 4-microliter capillary-bound sample to realize 1-3 second transitions with steady state heater power of less than 10 W. We demonstrate the utility of the RZTC for DNA amplification as part of a highly integrated rotary zone PCR (rzPCR system that uses low-volume valves and syringe-based fluid handling to automate sample loading and unloading, thermal cycling, and between-run cleaning functionalities in a compact, modular form factor. In addition to characterizing the performance of the RZTC and the efficacy of different online cleaning protocols, we present preliminary results for rapid single-plex PCR, multiplex short tandem repeat (STR amplification, and second strand cDNA synthesis.

  19. A rapid minor groove binder PCR method for distinguishing the vaccine strain Brucella abortus 104M.

    Science.gov (United States)

    Nan, Wenlong; Qin, Lide; Wang, Yong; Zhang, Yueyong; Tan, Pengfei; Chen, Yuqi; Mao, Kairong; Chen, Yiping

    2018-01-24

    Brucellosis is a widespread zoonotic disease caused by Gram-negative Brucella bacteria. Immunisation with attenuated vaccine is an effective method of prevention, but it can interfere with diagnosis. Live, attenuated Brucella abortus strain 104M has been used for the prevention of human brucellosis in China since 1965. However, at present, no fast and reliable method exists that can distinguish this strain from field strains. Single nucleotide polymorphism (SNP)-based assays offer a new approach for such discrimination. SNP-based minor groove binder (MGB) and Cycleave assays have been used for rapid identification of four Brucella vaccine strains (B. abortus strains S19, A19 and RB51, and B. melitensis Rev1). The main objective of this study was to develop a PCR assay for rapid and specific detection of strain 104M. We developed a SNP-based MGB PCR assay that could successfully distinguish strain 104M from 18 representative strains of Brucella (B. abortus biovars 1, 2, 3, 4, 5, 6, 7 and 9, B. melitensis biovars 1, 2 and 3, B. suis biovars 1, 2, 3 and 4, B. canis, B. neotomae, and B. ovis), four Brucella vaccine strains (A19, S19, S2, M5), and 55 Brucella clinical field strains. The assay gave a negative reaction with four non-Brucella species (Escherichia coli, Pasteurella multocida, Streptococcus suis and Pseudomonas aeruginosa). The minimum sensitivity of the assay, evaluated using 10-fold dilutions of chromosomal DNA, was 220 fg for the 104M strain and 76 fg for the single non-104M Brucella strain tested (B. abortus A19). The assay was also reproducible (intra- and inter-assay coefficients of variation = 0.006-0.022 and 0.012-0.044, respectively). A SNP-based MGB PCR assay was developed that could straightforwardly and unambiguously distinguish B. abortus vaccine strain 104M from non-104M Brucella strains. Compared to the classical isolation and identification approaches of bacteriology, this real-time PCR assay has substantial advantages in terms of

  20. Real time PCR for the rapid identification and drug susceptibility of Mycobacteria present in Bronchial washings

    Directory of Open Access Journals (Sweden)

    Thilini Piushani Keerthirathne

    2016-10-01

    Full Text Available Abstract Background Mycobacteria have a spectrum of virulence and different susceptibilities to antibiotics. Distinguishing mycobacterial species is vital as patients with non-tuberculous mycobacterial (NTM infections present clinical features that are similar to those of patients with tuberculosis. Thus, rapid differentiation of Mycobacterium tuberculosis complex from NTM is critical to administer appropriate treatment. Hence the aim of the study was to rapid identification of mycobacterial species present in bronchial washings using multiplex real time Polymerase Chain Reaction (PCR and to determine the drug susceptibility in identified mycobacterial species. Methods Sputum smear negative bronchoscopy specimens (n = 150 were collected for a period of one year, from patients attending the General Hospital Kandy, Sri Lanka. The specimens were processed with modified Petroff’s method and were cultured on Löwenstein– Jensen medium. DNA, extracted from the mycobacterial isolates were subjected to a SYBR green mediated real time multiplex, PCR assay with primers specific for the M. tuberculosis complex, M. avium complex, M. chelonae-M.abscessus group and M. fortuitum group. DNA sequencing was performed for the species confirmation, by targeting the 16S rRNA gene and the drug susceptibility testing was performed for the molecularly identified isolates of M. tuberculosis and NTM. Results The optimized SYBR Green mediated multiplex real-time PCR assay was able to identify the presence of genus Mycobacterium in 25 out of 26 AFB positive isolates, two M. tuberculosis complex, three M. avium complex and two isolates belonging to M. chelonae-M. abscessus group. DNA sequencing confirmed the presence of M. tuberculosis, M. chelonae-M. abscessus, M. intracellulare, M. avium, Rhodococcus sp. and M. celatum. Remaining isolates were identified as Mycobacterium sp. All the NTM isolates were sensitive to amikacin and seven were resistant to ciproflaxacin

  1. Rapid differentiation of mycobacteria by simplex real-time PCR with melting temperature calling analysis.

    Science.gov (United States)

    Lin, L; Yin, X; Wang, Q

    2015-09-01

    This study aimed to develop a rapid, simple and cost-effective method for the differentiation of Mycobacterium species. A total of 80 clinical mycobacterial isolates belonging to 12 different species and 16 reference strains of 16 different species were differentiated by the simplex real-time PCR coupled with melting temperature calling analysis. By comparing their melting profiles with those of the reference strains, all clinical mycobacterial isolates were differentiated as Mycobacterium tuberculosis complex or nontuberculous mycobacteria, and the latter were further divided into five groups. In comparison with 16S-23S internal transcribed spacer sequencing method as the gold standard method, both sensitivity and specificity of the assay were 100% when it was used for the differentiation between Myco. tuberculosis complex and nontuberculous mycobacteria. The simplex real-time PCR coupled with melting temperature calling analysis could be an alternative method for the differentiation between Myco. tuberculosis complex and nontuberculous mycobacteria. Rapid differentiation of mycobacteria could shorten the diagnostic time of mycobacterial diseases. It is also helpful for achieving optimal therapy and appropriate patient management. © 2015 The Society for Applied Microbiology.

  2. Real-time PCR using mycobacteriophage DNA for rapid phenotypic drug susceptibility results for Mycobacterium tuberculosis.

    Science.gov (United States)

    Pholwat, Suporn; Ehdaie, Beeta; Foongladda, Suporn; Kelly, Kimberly; Houpt, Eric

    2012-03-01

    Managing drug-resistant Mycobacterium tuberculosis requires drug susceptibility testing, yet conventional drug susceptibility testing is slow, and molecular testing does not yield results for all antituberculous drugs. We addressed these challenges by utilizing real-time PCR of mycobacteriophage D29 DNA to evaluate the drug resistance of clinical M. tuberculosis isolates. Mycobacteriophages infect and replicate in viable bacterial cells faster than bacterial cells replicate and have been used for detection and drug resistance testing for M. tuberculosis either by using reporter cells or phages with engineered reporter constructs. Our primary protocol involved culturing M. tuberculosis isolates for 48 h with and without drugs at critical concentrations, followed by incubation with 10(3) PFU/ml of D29 mycobacteriophage for 24 h and then real-time PCR. Many drugs could be incubated instantly with M. tuberculosis and phage for 24 h alone. The change in phage DNA real-time PCR cycle threshold (C(T)) between control M. tuberculosis and M. tuberculosis treated with drugs was calculated and correlated with conventional agar proportion drug susceptibility results. Specifically, 9 susceptible clinical isolates, 22 multidrug-resistant (MDR), and 1 extensively drug-resistant (XDR) M. tuberculosis strains were used and C(T) control-C(T) drug cutoffs of between +0.3 and -6.0 yielded 422/429 (98%) accurate results for isoniazid, rifampin, streptomycin, ethambutol, amikacin, kanamycin, capreomycin, ofloxacin, moxifloxacin, ethionamide, para-aminosalicylic acid, cycloserine, and linezolid. Moreover, the ΔC(T) values correlated with isolate MIC for most agents. This D29 quantitative PCR assay offers a rapid, accurate, 1- to 3-day phenotypic drug susceptibility test for first- and second-line drugs and may suggest an approximate MIC.

  3. A Rapid and Low-Cost PCR Thermal Cycler for Infectious Disease Diagnostics.

    Science.gov (United States)

    Chan, Kamfai; Wong, Pui-Yan; Yu, Peter; Hardick, Justin; Wong, Kah-Yat; Wilson, Scott A; Wu, Tiffany; Hui, Zoe; Gaydos, Charlotte; Wong, Season S

    2016-01-01

    The ability to make rapid diagnosis of infectious diseases broadly available in a portable, low-cost format would mark a great step forward in global health. Many molecular diagnostic assays are developed based on using thermal cyclers to carry out polymerase chain reaction (PCR) and reverse-transcription PCR for DNA and RNA amplification and detection, respectively. Unfortunately, most commercial thermal cyclers are expensive and need continuous electrical power supply, so they are not suitable for uses in low-resource settings. We have previously reported a low-cost and simple approach to amplify DNA using vacuum insulated stainless steel thermoses food cans, which we have named it thermos thermal cycler or TTC. Here, we describe the use of an improved set up to enable the detection of viral RNA targets by reverse-transcription PCR (RT-PCR), thus expanding the TTC's ability to identify highly infectious, RNA virus-based diseases in low resource settings. The TTC was successful in demonstrating high-speed and sensitive detection of DNA or RNA targets of sexually transmitted diseases, HIV/AIDS, Ebola hemorrhagic fever, and dengue fever. Our innovative TTC costs less than $200 to build and has a capacity of at least eight tubes. In terms of speed, the TTC's performance exceeded that of commercial thermal cyclers tested. When coupled with low-cost endpoint detection technologies such as nucleic acid lateral-flow assay or a cell-phone-based fluorescence detector, the TTC will increase the availability of on-site molecular diagnostics in low-resource settings.

  4. A Rapid and Low-Cost PCR Thermal Cycler for Infectious Disease Diagnostics.

    Directory of Open Access Journals (Sweden)

    Kamfai Chan

    Full Text Available The ability to make rapid diagnosis of infectious diseases broadly available in a portable, low-cost format would mark a great step forward in global health. Many molecular diagnostic assays are developed based on using thermal cyclers to carry out polymerase chain reaction (PCR and reverse-transcription PCR for DNA and RNA amplification and detection, respectively. Unfortunately, most commercial thermal cyclers are expensive and need continuous electrical power supply, so they are not suitable for uses in low-resource settings. We have previously reported a low-cost and simple approach to amplify DNA using vacuum insulated stainless steel thermoses food cans, which we have named it thermos thermal cycler or TTC. Here, we describe the use of an improved set up to enable the detection of viral RNA targets by reverse-transcription PCR (RT-PCR, thus expanding the TTC's ability to identify highly infectious, RNA virus-based diseases in low resource settings. The TTC was successful in demonstrating high-speed and sensitive detection of DNA or RNA targets of sexually transmitted diseases, HIV/AIDS, Ebola hemorrhagic fever, and dengue fever. Our innovative TTC costs less than $200 to build and has a capacity of at least eight tubes. In terms of speed, the TTC's performance exceeded that of commercial thermal cyclers tested. When coupled with low-cost endpoint detection technologies such as nucleic acid lateral-flow assay or a cell-phone-based fluorescence detector, the TTC will increase the availability of on-site molecular diagnostics in low-resource settings.

  5. siRNA-mediated Allele-specific Silencing of a COL6A3 Mutation in a Cellular Model of Dominant Ullrich Muscular Dystrophy

    Directory of Open Access Journals (Sweden)

    Véronique Bolduc

    2014-01-01

    Full Text Available Congenital muscular dystrophy type Ullrich (UCMD is a severe disorder of early childhood onset for which currently there is no effective treatment. UCMD commonly is caused by dominant-negative mutations in the genes coding for collagen type VI, a major microfibrillar component of the extracellular matrix surrounding the muscle fibers. To explore RNA interference (RNAi as a potential therapy for UCMD, we designed a series of small interfering RNA (siRNA oligos that specifically target the most common mutations resulting in skipping of exon 16 in the COL6A3 gene and tested them in UCMD-derived dermal fibroblasts. Transcript analysis by semiquantitative and quantitative reverse transcriptase PCR showed that two of these siRNAs were the most allele-specific, i.e., they efficiently knocked down the expression from the mutant allele, without affecting the normal allele. In HEK293T cells, these siRNAs selectively suppressed protein expression from a reporter construct carrying the mutation, with no or minimal suppression of the wild-type (WT construct, suggesting that collagen VI protein levels are as also reduced in an allele-specific manner. Furthermore, we found that treating UCMD fibroblasts with these siRNAs considerably improved the quantity and quality of the collagen VI matrix, as assessed by confocal microscopy. Our current study establishes RNAi as a promising molecular approach for treating dominant COL6-related dystrophies.

  6. Allele-specific expression at the androgen receptor alpha gene in a hybrid unisexual fish, the Amazon molly (Poecilia formosa.

    Directory of Open Access Journals (Sweden)

    Fangjun Zhu

    Full Text Available The all-female Amazon molly (Poecilia formosa is the result of a hybridization of the Atlantic molly (P. mexicana and the sailfin molly (P. latipinna approximately 120,000 years ago. As a gynogenetic species, P. formosa needs to copulate with heterospecific males including males from one of its bisexual ancestral species. However, the sperm only triggers embryogenesis of the diploid eggs. The genetic information of the sperm donor typically will not contribute to the next generation of P. formosa. Hence, P. formosa possesses generally one allele from each of its ancestral species at any genetic locus. This raises the question whether both ancestral alleles are equally expressed in P. formosa. Allele-specific expression (ASE has been previously assessed in various organisms, e.g., human and fish, and ASE was found to be important in the context of phenotypic variability and disease. In this study, we utilized Real-Time PCR techniques to estimate ASE of the androgen receptor alpha (arα gene in several distinct tissues of Amazon mollies. We found an allelic bias favoring the maternal ancestor (P. mexicana allele in ovarian tissue. This allelic bias was not observed in the gill or the brain tissue. Sequencing of the promoter regions of both alleles revealed an association between an Indel in a known CpG island and differential expression. Future studies may reveal whether our observed cis-regulatory divergence is caused by an ovary-specific trans-regulatory element, preferentially activating the allele of the maternal ancestor.

  7. Oncogene mutations, copy number gains and mutant allele specific imbalance (MASI frequently occur together in tumor cells.

    Directory of Open Access Journals (Sweden)

    Junichi Soh

    Full Text Available BACKGROUND: Activating mutations in one allele of an oncogene (heterozygous mutations are widely believed to be sufficient for tumorigenesis. However, mutant allele specific imbalance (MASI has been observed in tumors and cell lines harboring mutations of oncogenes. METHODOLOGY/PRINCIPAL FINDINGS: We determined 1 mutational status, 2 copy number gains (CNGs and 3 relative ratio between mutant and wild type alleles of KRAS, BRAF, PIK3CA and EGFR genes by direct sequencing and quantitative PCR assay in over 400 human tumors, cell lines, and xenografts of lung, colorectal, and pancreatic cancers. Examination of a public database indicated that homozygous mutations of five oncogenes were frequent (20% in 833 cell lines of 12 tumor types. Our data indicated two major forms of MASI: 1 MASI with CNG, either complete or partial; and 2 MASI without CNG (uniparental disomy; UPD, due to complete loss of wild type allele. MASI was a frequent event in mutant EGFR (75% and was due mainly to CNGs, while MASI, also frequent in mutant KRAS (58%, was mainly due to UPD. Mutant: wild type allelic ratios at the genomic level were precisely maintained after transcription. KRAS mutations or CNGs were significantly associated with increased ras GTPase activity, as measured by ELISA, and the two molecular changes were synergistic. Of 237 lung adenocarcinoma tumors, the small number with both KRAS mutation and CNG were associated with shortened survival. CONCLUSIONS: MASI is frequently present in mutant EGFR and KRAS tumor cells, and is associated with increased mutant allele transcription and gene activity. The frequent finding of mutations, CNGs and MASI occurring together in tumor cells indicates that these three genetic alterations, acting together, may have a greater role in the development or maintenance of the malignant phenotype than any individual alteration.

  8. An asymmetric PCR-based, reliable and rapid single-tube native DNA engineering strategy

    Directory of Open Access Journals (Sweden)

    Bi Yanzhen

    2012-07-01

    Full Text Available Abstract Background Widely used restriction-dependent cloning methods are labour-intensive and time-consuming, while several types of ligase-independent cloning approaches have inherent limitations. A rapid and reliable method of cloning native DNA sequences into desired plasmids are highly desired. Results This paper introduces ABI-REC, a novel strategy combining asymmetric bridge PCR with intramolecular homologous recombination in bacteria for native DNA cloning. ABI-REC was developed to precisely clone inserts into defined location in a directional manner within recipient plasmids. It featured an asymmetric 3-primer PCR performed in a single tube that could robustly amplify a chimeric insert-plasmid DNA sequence with homologous arms at both ends. Intramolecular homologous recombination occurred to the chimera when it was transformed into E.coli and produced the desired recombinant plasmids with high efficiency and fidelity. It is rapid, and does not involve any operational nucleotides. We proved the reliability of ABI-REC using a double-resistance reporter assay, and investigated the effects of homology and insert length upon its efficiency. We found that 15 bp homology was sufficient to initiate recombination, while 25 bp homology had the highest cloning efficiency. Inserts up to 4 kb in size could be cloned by this method. The utility and advantages of ABI-REC were demonstrated through a series of pig myostatin (MSTN promoter and terminator reporter plasmids, whose transcriptional activity was assessed in mammalian cells. We finally used ABI-REC to construct a pig MSTN promoter-terminator cassette reporter and showed that it could work coordinately to express EGFP. Conclusions ABI-REC has the following advantages: (i rapid and highly efficient; (ii native DNA cloning without introduction of extra bases; (iii restriction-free; (iv easy positioning of directional and site-specific recombination owing to formulated primer design. ABI

  9. An asymmetric PCR-based, reliable and rapid single-tube native DNA engineering strategy.

    Science.gov (United States)

    Bi, Yanzhen; Qiao, Xianfeng; Hua, Zaidong; Zhang, Liping; Liu, Ximei; Li, Li; Hua, Wenjun; Xiao, Hongwei; Zhou, Jingrong; Wei, Qingxin; Zheng, Xinmin

    2012-07-06

    Widely used restriction-dependent cloning methods are labour-intensive and time-consuming, while several types of ligase-independent cloning approaches have inherent limitations. A rapid and reliable method of cloning native DNA sequences into desired plasmids are highly desired. This paper introduces ABI-REC, a novel strategy combining asymmetric bridge PCR with intramolecular homologous recombination in bacteria for native DNA cloning. ABI-REC was developed to precisely clone inserts into defined location in a directional manner within recipient plasmids. It featured an asymmetric 3-primer PCR performed in a single tube that could robustly amplify a chimeric insert-plasmid DNA sequence with homologous arms at both ends. Intramolecular homologous recombination occurred to the chimera when it was transformed into E.coli and produced the desired recombinant plasmids with high efficiency and fidelity. It is rapid, and does not involve any operational nucleotides. We proved the reliability of ABI-REC using a double-resistance reporter assay, and investigated the effects of homology and insert length upon its efficiency. We found that 15 bp homology was sufficient to initiate recombination, while 25 bp homology had the highest cloning efficiency. Inserts up to 4 kb in size could be cloned by this method. The utility and advantages of ABI-REC were demonstrated through a series of pig myostatin (MSTN) promoter and terminator reporter plasmids, whose transcriptional activity was assessed in mammalian cells. We finally used ABI-REC to construct a pig MSTN promoter-terminator cassette reporter and showed that it could work coordinately to express EGFP. ABI-REC has the following advantages: (i) rapid and highly efficient; (ii) native DNA cloning without introduction of extra bases; (iii) restriction-free; (iv) easy positioning of directional and site-specific recombination owing to formulated primer design. ABI-REC is a novel approach to DNA engineering and gene functional

  10. Use of TaqMan® real-time PCR for rapid detection of Salmonella enterica serovar Typhi.

    Science.gov (United States)

    Ranjbar, Reza; Naghoni, Ali; Farshad, Shohreh; Lashini, Hadi; Najafi, Ali; Sadeghifard, Nourkhoda; Mammina, Caterina

    2014-06-01

    We evaluated the performances of a newly designed real-time polymerase chain reaction (PCR) assay using TaqMan® probes to detect Salmonella Typhi. TaqMan® real-time PCR assays were performed by designed primers and probe based on the staG gene for detecting S. Typhi. The specificity of the assay was evaluated on 15 Salmonella serovars. The analytical specificity was evaluated on 20 non-Salmonella microorganisms. The analytical sensitivity was assessed using decreasing DNA quantities of S. Typhi ATCC 19430. Finally the detection capability of the TaqMan® real-time PCR assay on isolates recovered from patients with Salmonella infections was compared to the conventional PCR assay. Only S. Typhi strain had positive results when subjected to the assay using Typhi-specific real-time PCR. No amplification products were observed in real-time PCR with any of the non-Salmonella microorganisms tested. The TaqMan® real-time PCR was more sensitive than the conventional PCR. In conclusion, we found that the easy-to-use real-time PCR assays were faster than conventional PCR systems. The staG-based TaqMan® real-time PCR assay showed to be specific and sensitive method for the safe and rapid detection of the S. Typhi.

  11. Fusion primer and nested integrated PCR (FPNI-PCR): a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    Science.gov (United States)

    2011-01-01

    Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809

  12. Rapid detection of Mycobacterium avium in stool samples from AIDS patients by immunomagnetic PCR.

    OpenAIRE

    Li, Z; Bai, G H; von Reyn, C. F.; Marino, P.; Brennan, M J; Gine, N; Morris, S. L.

    1996-01-01

    Direct PCR detection of bacteria in clinical samples is often hindered by the presence of compounds that inhibit the PCR. To improve and accelerate the diagnosis of Mycobacterium avium-M. intracellulare complex infections, an immunomagnetic PCR (IM-PCR) assay was developed. This IM-PCR procedure combines the separation of mycobacteria by antimycobacterial monoclonal antibody coupled to magnetic beads with an M. avium-M. intracellulare complex-specific PCR protocol based on 16S rRNA gene seque...

  13. Typing for HLA-DPB1*03 and HLA-DPB1*06 using allele-specific DNA in vitro amplification and allele-specific oligonucleotide probes. Detection of "new" DPB1*06 variants

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1989-01-01

    DP gene typing using in vitro DNA amplification combined with sequence-specific oligonucleotide probes has recently been reported. The resulting DNA amplification was specific for the HLA-DPB locus. Typing for the individual DPB alleles was exclusively dependent on the hybridizations of the probes...... but hampered by close sequence homology between different DP alleles yielding complex patterns of reactivity with a panel of probes. We report the combined use of allele-specific DNA in vitro amplification and allele-specific oligonucleotides in typing for DPB1*03 and DPB1*06. Complete concordance with PLT...

  14. Rapid Purification of Salmonella DNA in Minced Meat and Detection by Real-time PCR

    DEFF Research Database (Denmark)

    Jenikova, G.; Jensen, Annette Nygaard; Demnerova, K.

    2001-01-01

    of DNeasy was found to be 6-8 CFU in just 19 end-point fluorescence (C-t) values, while this was 22 C-t for a combination of DNeasy and BactXtractor. Extraction by DNeasy resulted in C-t cells per 25 g, when the samples were inoculated with Salmonella......Four rapid and simple DNA purification and sample treatment protocols were evaluated for detection of Salmonella enterica in spiked minced meat, using a fluorogenic 5' nuclease (TaqMan) PCR assay in an ABI-Prism 7700 Sequence Detector. The detection limit with the single separation treatment...... before the overnight preenrichment. The method is currently being adapted to a BioRobot 3000 platform. However, the use of paramagnetic beads (DNA Direct) resulted in poor and variable detection limit....

  15. Rapid detection of Ceratocystis platani inoculum by quantitative real-time PCR assay.

    Science.gov (United States)

    Luchi, Nicola; Ghelardini, Luisa; Belbahri, Lassaâd; Quartier, Marion; Santini, Alberto

    2013-09-01

    Ceratocystis platani is the causal agent of canker stain of plane trees, a lethal disease able to kill mature trees in one or two successive growing seasons. The pathogen is a quarantine organism and has a negative impact on anthropogenic and natural populations of plane trees. Contaminated sawdust produced during pruning and sanitation fellings can contribute to disease spread. The goal of this study was to design a rapid, real-time quantitative PCR assay to detect a C. platani airborne inoculum. Airborne inoculum traps (AITs) were placed in an urban setting in the city of Florence, Italy, where the disease was present. Primers and TaqMan minor groove binder (MGB) probes were designed to target cerato-platanin (CP) and internal transcribed spacer 2 (ITS2) genes. The detection limits of the assay were 0.05 pg/μl and 2 fg/μl of fungal DNA for CP and ITS, respectively. Pathogen detection directly from AITs demonstrated specificity and high sensitivity for C. platani, detecting DNA concentrations as low as 1.2 × 10(-2) to 1.4 × 10(-2) pg/μl, corresponding to ∼10 conidia per ml. Airborne inoculum traps were able to detect the C. platani inoculum within 200 m of the closest symptomatic infected plane tree. The combination of airborne trapping and real-time quantitative PCR assay provides a rapid and sensitive method for the specific detection of a C. platani inoculum. This technique may be used to identify the period of highest risk of pathogen spread in a site, thus helping disease management.

  16. Utilising polymorphisms to achieve allele-specific genome editing in zebrafish

    Directory of Open Access Journals (Sweden)

    Samuel J. Capon

    2017-01-01

    Full Text Available The advent of genome editing has significantly altered genetic research, including research using the zebrafish model. To better understand the selectivity of the commonly used CRISPR/Cas9 system, we investigated single base pair mismatches in target sites and examined how they affect genome editing in the zebrafish model. Using two different zebrafish strains that have been deep sequenced, CRISPR/Cas9 target sites containing polymorphisms between the two strains were identified. These strains were crossed (creating heterozygotes at polymorphic sites and CRISPR/Cas9 complexes that perfectly complement one strain injected. Sequencing of targeted sites showed biased, allele-specific editing for the perfectly complementary sequence in the majority of cases (14/19. To test utility, we examined whether phenotypes generated by F0 injection could be internally controlled with such polymorphisms. Targeting of genes bmp7a and chordin showed reduction in the frequency of phenotypes in injected ‘heterozygotes’ compared with injecting the strain with perfect complementarity. Next, injecting CRISPR/Cas9 complexes targeting two separate sites created deletions, but deletions were biased to selected chromosomes when one CRISPR/Cas9 target contained a polymorphism. Finally, integration of loxP sequences occurred preferentially in alleles with perfect complementarity. These experiments demonstrate that single nucleotide polymorphisms (SNPs present throughout the genome can be utilised to increase the efficiency of in cis genome editing using CRISPR/Cas9 in the zebrafish model.

  17. Allele-specific deposition of macroH2A1 in Imprinting Control Regions

    Energy Technology Data Exchange (ETDEWEB)

    Choo, J H; Kim, J D; Chung, J H; Stubbs, L; Kim, J

    2006-01-13

    In the current study, we analyzed the deposition patterns of macroH2A1 at a number of different genomic loci located in X chromosome and autosomes. MacroH2A1 is preferentially deposited at methylated CpG CpG-rich regions located close to promoters. The macroH2A1 deposition patterns at the methylated CpG islands of several imprinted domains, including the Imprinting Control Regions (ICRs) of Xist, Peg3, H19/Igf2 Igf2, Gtl2/Dlk1, and Gnas domains, show consistent allele-specificity towards inactive, methylated alleles. The macroH2A1 deposition levels at the ICRs and other Differentially Methylated Regions (DMRs) of these domains are also either higher or comparable to those observed at the inactive X chromosome of female mammals. Overall, our results indicate that besides DNA methylation macroH2A1 is another epigenetic component in the chromatin of ICRs displaying differential association with two parental alleles.

  18. Allele-specific behavior of molecular networks: understanding small-molecule drug response in yeast.

    Directory of Open Access Journals (Sweden)

    Fan Zhang

    Full Text Available The study of systems genetics is changing the way the genetic and molecular basis of phenotypic variation, such as disease susceptibility and drug response, is being analyzed. Moreover, systems genetics aids in the translation of insights from systems biology into genetics. The use of systems genetics enables greater attention to be focused on the potential impact of genetic perturbations on the molecular states of networks that in turn affects complex traits. In this study, we developed models to detect allele-specific perturbations on interactions, in which a genetic locus with alternative alleles exerted a differing influence on an interaction. We utilized the models to investigate the dynamic behavior of an integrated molecular network undergoing genetic perturbations in yeast. Our results revealed the complexity of regulatory relationships between genetic loci and networks, in which different genetic loci perturb specific network modules. In addition, significant within-module functional coherence was found. We then used the network perturbation model to elucidate the underlying molecular mechanisms of individual differences in response to 100 diverse small molecule drugs. As a result, we identified sub-networks in the integrated network that responded to variations in DNA associated with response to diverse compounds and were significantly enriched for known drug targets. Literature mining results provided strong independent evidence for the effectiveness of these genetic perturbing networks in the elucidation of small-molecule responses in yeast.

  19. A novel polymerase chain reaction (PCR) for rapid isolation of a new ...

    African Journals Online (AJOL)

    mediated self-formed panhandle PCR, for gene or chromosome walking. It combined the advantages of ligation-mediated PCR in its specificity and of panhandle PCR in its efficiency. Self-formed panhandle PCR was used for a new rbcS gene ...

  20. Development a rapid and accurate multiplex real time PCR method for the detection Chlamydia trachomatis and Mycoplasma hominis.

    Science.gov (United States)

    Safarkar, Roya; Mehrabadi, Jalil Fallah; Noormohammadi, Zahra; Mirnejad, Reza

    2017-11-01

    Sexually transmitted diseases easily spread among sexually active people and often have no symptoms. Rapid and accurate method for detecting these infections are necessary in early stages. The traditional detection methods of them are difficult and time-consuming. In this study, multiplex real time PCR was optimized for rapid identification of Chlamydia trachomatis and Mycoplasma hominis in a single tube and was performed with our designed primers. The sensitivity test was carried out to designed primers with diluted genomic DNA. To defined the specificity, non STD bacteria were used as DNA template. This study indicated that the developed multiplex real time PCR can be an effective alternative procedure to the conventional methods for rapid and accurate identification of C Chlamydia trachomatis and Mycoplasma hominis. Multiplex real-time PCR Results of them were checked with melting curves. The sensitivity of our designed primer by multiplex real time PCR for Chlamydia trachomatis and Mycoplasma hominis were 4.78×1010 and 8.35×1010 , respectively, Which the primers did not amplify any product from a non-STD species. Multiplex real time PCR by our new primers and analysis of melting curves were successfully usable for rapid and accurate detection of Chlamydia trachomatis and Mycoplasma hominis. This assay instead of traditional culture method, has considerable potential to be rapid, accurate and highly sensitive molecular diagnostic tool for simultaneous and direct detection. © 2017 Wiley Periodicals, Inc.

  1. Rapid detection of equine influenza virus H3N8 subtype by insulated isothermal RT-PCR (iiRT-PCR) assay using the POCKIT™ Nucleic Acid Analyzer.

    Science.gov (United States)

    Balasuriya, Udeni B R; Lee, Pei-Yu Alison; Tiwari, Ashish; Skillman, Ashley; Nam, Bora; Chambers, Thomas M; Tsai, Yun-Long; Ma, Li-Juan; Yang, Pai-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

    2014-10-01

    Equine influenza (EI) is an acute, highly contagious viral respiratory disease of equids. Currently, equine influenza virus (EIV) subtype H3N8 continues to be the most important respiratory pathogen of horses in many countries around the world. The need to achieve a rapid diagnosis and to implement effective quarantine and movement restrictions is critical in controlling the spread of EIV. In this study, a novel, inexpensive and user-friendly assay based on an insulated isothermal RT-PCR (iiRT-PCR) method on the POCKIT™, a field-deployable device, was described and validated for point-of-need detection of EIV-H3N8 in clinical samples. The newly established iiRT-PCR assay targeting the EIV HA3 gene was evaluated for its sensitivity using in vitro transcribed (IVT) RNA, as well as ten-fold serial dilutions of RNA extracted from the prototype H3N8 strain A/equine/Miami/1/63. Inclusivity and exclusivity panels were tested for specificity evaluation. Published real-time RT-PCR (rRT-PCR) assays targeting the NP and HA3 genes were used as the reference standards for comparison of RNA extracted from field strains and from nasal swab samples collected from experimentally infected horses, respectively. Limit of detection with a 95% probability (LoD95%) was estimated to be 11copies of IVT RNA. Clinical sensitivity analysis using RNA prepared from serial dilutions of a prototype EIV (Miami 1/63/H3N8) showed that the iiRT-PCR assay was about 100-fold more sensitive than the rRT-PCR assay targeting the NP gene of EIV subtype H3N8. The iiRT-PCR assay identified accurately fifteen EIV H3N8 strains and two canine influenza virus (CIV) H3N8 strains, and did not cross-react with H6N2, H7N7, H1N1 subtypes or any other equine respiratory viral pathogens. Finally, 100% agreement was found between the iiRT-PCR assay and the universal influenza virus type A rRT-PCR assay in detecting the EIV A/equine/Kentucky/7/07 strain in 56 nasal swab samples collected from experimentally inoculated

  2. Direct Detection of Erythromycin-Resistant Bordetella pertussis in Clinical Specimens by PCR.

    Science.gov (United States)

    Wang, Zengguo; Han, Ruijun; Liu, Ying; Du, Quanli; Liu, Jifeng; Ma, Chaofeng; Li, Hengxin; He, Qiushui; Yan, Yongping

    2015-11-01

    Resistance of Bordetella pertussis to erythromycin has been increasingly reported. We developed an allele-specific PCR method for rapid detection of erythromycin-resistant B. pertussis directly from nasopharyngeal (NP) swab samples submitted for diagnostic PCR. Based on the proven association of erythromycin resistance with the A2047G mutation in the 23S rRNA of B. pertussis, four primers, two of which were designed to be specific for either the wild-type or the mutant allele, were used in two different versions of the allele-specific PCR assay. The methods were verified with results obtained by PCR-based sequencing of 16 recent B. pertussis isolates and 100 NP swab samples submitted for diagnostic PCR. The detection limits of the two PCR assays ranged from 10 to 100 fg per reaction for both erythromycin-susceptible and -resistant B. pertussis. Two amplified fragments of each PCR, of 286 and 112 bp, respectively, were obtained from a mutant allele of the isolates and/or NP swab samples containing B. pertussis DNAs. For the wild-type allele, only a 286-bp fragment was visible when the allele-specific PCR assay 1 was performed. No amplification was found when a number of non-Bordetella bacterial pathogens and NP swab samples that did not contain the DNAs of B. pertussis were examined. This assay can serve as an alternative for PCR-based sequencing, especially for local laboratories in resource-poor countries. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  3. Evaluation of a quantitative real-time PCR for rapid detection of Riemerella Anatipestifer infection in birds.

    Science.gov (United States)

    Zhang, Qingshan; Wan, Chunhe; Li, Chenxi; Bai, Xiaofei; Liu, Ming; Liu, Siguo; Zhang, Yun

    2017-08-05

    To establish an accurate, rapid, and a quantifiable method for the detection of Riemerella anatipestifer infection, a widespread infectious disease in birds, we developed a TaqMan-based real-time PCR assay by using DtxR gene-specific primers and a TaqMan probe. The standard curve established with a linear correlation (R2) of 0.998 and efficiency of 99% between the Ct value and the logarithm of the plasmid copy number. The reproducibility and specificity of the real-time PCR assay were confirmed by using plasmids containing DtxR genes or DNAs extracted from well-known bacteria or viruses causing duck diseases. The real-time PCR assay was 100 times more sensitive than the conventional PCR. The results reveal that the established real-time PCR assay might be a useful method for diagnosis and quantitative detection of Riemerella anatipestifer in birds.

  4. Detection of Imprinted Genes by Single-Cell Allele-Specific Gene Expression.

    Science.gov (United States)

    Santoni, Federico A; Stamoulis, Georgios; Garieri, Marco; Falconnet, Emilie; Ribaux, Pascale; Borel, Christelle; Antonarakis, Stylianos E

    2017-03-02

    Genomic imprinting results in parental-specific gene expression. Imprinted genes are involved in the etiology of rare syndromes and have been associated with common diseases such as diabetes and cancer. Standard RNA bulk cell sequencing applied to whole-tissue samples has been used to detect imprinted genes in human and mouse models. However, lowly expressed genes cannot be detected by using RNA bulk approaches. Here, we report an original and robust method that combines single-cell RNA-seq and whole-genome sequencing into an optimized statistical framework to analyze genomic imprinting in specific cell types and in different individuals. Using samples from the probands of 2 family trios and 3 unrelated individuals, 1,084 individual primary fibroblasts were RNA sequenced and more than 700,000 informative heterozygous single-nucleotide variations (SNVs) were genotyped. The allele-specific coverage per gene of each SNV in each single cell was used to fit a beta-binomial distribution to model the likelihood of a gene being expressed from one and the same allele. Genes presenting a significant aggregate allelic ratio (between 0.9 and 1) were retained to identify of the allelic parent of origin. Our approach allowed us to validate the imprinting status of all of the known imprinted genes expressed in fibroblasts and the discovery of nine putative imprinted genes, thereby demonstrating the advantages of single-cell over bulk RNA-seq to identify imprinted genes. The proposed single-cell methodology is a powerful tool for establishing a cell type-specific map of genomic imprinting. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  5. Development and Validation of a Real-Time PCR Assay for Rapid Detection of Candida auris from Surveillance Samples.

    Science.gov (United States)

    Leach, L; Zhu, Y; Chaturvedi, S

    2018-02-01

    Candida auris is an emerging multidrug-resistant yeast causing invasive health care-associated infection with high mortality worldwide. Rapid identification of C. auris is of primary importance for the implementation of public health measures to control the spread of infection. To achieve these goals, we developed and validated a TaqMan-based real-time PCR assay targeting the internal transcribed spacer 2 ( ITS 2) region of the ribosomal gene. The assay was highly specific, reproducible, and sensitive, with the detection limit of 1 C. auris CFU/PCR. The performance of the C. auris real-time PCR assay was evaluated by using 623 surveillance samples, including 365 patient swabs and 258 environmental sponges. Real-time PCR yielded positive results from 49 swab and 58 sponge samples, with 89% and 100% clinical sensitivity with regard to their respective culture-positive results. The real-time PCR also detected C. auris DNA from 1% and 12% of swab and sponge samples with culture-negative results, indicating the presence of dead or culture-impaired C. auris The real-time PCR yielded results within 4 h of sample processing, compared to 4 to 14 days for culture, reducing turnaround time significantly. The new real-time PCR assay allows for accurate and rapid screening of C. auris and can increase effective control and prevention of this emerging multidrug-resistant fungal pathogen in health care facilities. Copyright © 2018 Leach et al.

  6. Optimization of real-time PCR assay for rapid and sensitive detection of eubacterial 16S ribosomal DNA in platelet concentrates.

    NARCIS (Netherlands)

    Mohammadi, T.; Reesink, H.W.; Vandenbroucke-Grauls, C.M.J.E.; Savelkoul, P.H.M.

    2003-01-01

    A real-time PCR assay was developed for rapid detection of eubacterial 16S ribosomal DNA in platelet concentrates. The sensitivity of this assay can be hampered by contaminating DNA in the PCR reagents. Digestion of the PCR reagents with Sau3AI prior to PCR amplification was effective in eliminating

  7. Molecular Basis of Allele-Specific Efficacy of a Blood-Stage Malaria Vaccine: Vaccine Development Implications

    Science.gov (United States)

    Ouattara, Amed; Takala-Harrison, Shannon; Thera, Mahamadou A.; Coulibaly, Drissa; Niangaly, Amadou; Saye, Renion; Tolo, Youssouf; Dutta, Sheetij; Heppner, D. Gray; Soisson, Lorraine; Diggs, Carter L.; Vekemans, Johan; Cohen, Joe; Blackwelder, William C.; Dube, Tina; Laurens, Matthew B.; Doumbo, Ogobara K.; Plowe, Christopher V.

    2013-01-01

    The disappointing efficacy of blood-stage malaria vaccines may be explained in part by allele-specific immune responses that are directed against polymorphic epitopes on blood-stage antigens. FMP2.1/AS02A, a blood-stage candidate vaccine based on apical membrane antigen 1 (AMA1) from the 3D7 strain of Plasmodium falciparum, had allele-specific efficacy against clinical malaria in a phase II trial in Malian children. We assessed the cross-protective efficacy of the malaria vaccine and inferred which polymorphic amino acid positions in AMA1 were the targets of protective allele-specific immune responses. FMP2.1/AS02A had the highest efficacy against AMA1 alleles that were identical to the 3D7 vaccine-type allele at 8 highly polymorphic amino acid positions in the cluster 1 loop (c1L) but differed from 3D7 elsewhere in the molecule. Comparison of the incidence of vaccine-type alleles before and after vaccination in the malaria vaccine and control groups and examination of the patterns of allele change at polymorphic positions in consecutive malaria episodes suggest that the highly polymorphic amino acid position 197 in c1L was the most critical determinant of allele-specific efficacy. These results indicate that a multivalent AMA1 vaccine with broad efficacy could include only a limited set of key alleles of this extremely polymorphic antigen. PMID:23204168

  8. Universal Probe Library based real-time PCR for rapid detection of bacterial pathogens from positive blood culture bottles.

    Science.gov (United States)

    Zhu, Lingxiang; Shen, Ding-Xia; Zhou, Qiming; Liu, Chao-Jun; Li, Zexia; Fang, Xiangdong; Li, Quan-Zhen

    2014-03-01

    A set of real-time PCR based assays using the locked nucleic acid probes from Roche Universal ProbeLibrary were developed for rapid detection of eight bacterial species from positive blood culture bottles. Four duplex real-time PCR reactions targeting to one Gram-positive bacterium and one Gram-negative bacterium were optimized for species identification according to Gram stain results. We also included mecA-specific primers and probes in the assays to indicate the presence of methicillin resistance in the bacterial species. The analytical sensitivity was in the range of 1-10 CFU per PCR reaction mixture. The specificity and cross reactivity of the assay was validated by 28 ATCC reference strains and 77 negative blood culture specimens. No cross-reactivity was observed in these samples thus demonstrating 100 % specificity. 72 previously characterized clinical isolates were tested by the real-time PCR assay and validated the accuracy and feasibility of the real-time PCR assay. Furthermore, 55 positive blood culture samples were tested using real-time PCR and 50 (90.9 %) of them were identified as the same species as judged by biochemical analysis. In total, real-time PCR showed 98.2 % consistent to that of traditional methods. Real-time PCR can be used as a supplement for early detection of the frequently-occurred pathogens from the positive blood cultures.

  9. Rapid and sensitive detection of Yersinia pestis using amplification of plague diagnostic bacteriophages monitored by real-time PCR.

    Directory of Open Access Journals (Sweden)

    Kirill V Sergueev

    Full Text Available BACKGROUND: Yersinia pestis, the agent of plague, has caused many millions of human deaths and still poses a serious threat to global public health. Timely and reliable detection of such a dangerous pathogen is of critical importance. Lysis by specific bacteriophages remains an essential method of Y. pestis detection and plague diagnostics. METHODOLOGY/PRINCIPAL FINDINGS: The objective of this work was to develop an alternative to conventional phage lysis tests--a rapid and highly sensitive method of indirect detection of live Y. pestis cells based on quantitative real-time PCR (qPCR monitoring of amplification of reporter Y. pestis-specific bacteriophages. Plague diagnostic phages phiA1122 and L-413C were shown to be highly effective diagnostic tools for the detection and identification of Y. pestis by using qPCR with primers specific for phage DNA. The template DNA extraction step that usually precedes qPCR was omitted. phiA1122-specific qPCR enabled the detection of an initial bacterial concentration of 10(3 CFU/ml (equivalent to as few as one Y. pestis cell per 1-microl sample in four hours. L-413C-mediated detection of Y. pestis was less sensitive (up to 100 bacteria per sample but more specific, and thus we propose parallel qPCR for the two phages as a rapid and reliable method of Y. pestis identification. Importantly, phiA1122 propagated in simulated clinical blood specimens containing EDTA and its titer rise was detected by both a standard plating test and qPCR. CONCLUSIONS/SIGNIFICANCE: Thus, we developed a novel assay for detection and identification of Y. pestis using amplification of specific phages monitored by qPCR. The method is simple, rapid, highly sensitive, and specific and allows the detection of only live bacteria.

  10. Field-Deployable Reverse Transcription-Insulated Isothermal PCR (RT-iiPCR) Assay for Rapid and Sensitive Detection of Foot-and-Mouth Disease Virus.

    Science.gov (United States)

    Ambagala, A; Fisher, M; Goolia, M; Nfon, C; Furukawa-Stoffer, T; Ortega Polo, R; Lung, O

    2017-10-01

    Foot-and-mouth disease (FMD) is a highly contagious viral disease of cloven-hoofed animals, which can decimate the livestock industry and economy of countries previously free of this disease. Rapid detection of foot-and-mouth disease virus (FMDV) is critical to containing an FMD outbreak. Availability of a rapid, highly sensitive and specific, yet simple and field-deployable assay would support local decision-making during an FMDV outbreak. Here we report validation of a novel reverse transcription-insulated isothermal PCR (RT-iiPCR) assay that can be performed on a commercially available, compact and portable POCKIT™ analyser that automatically analyses data and displays '+' or '-' results. The FMDV RT-iiPCR assay targets the 3D region of the FMDV genome and was capable of detecting 9 copies of in vitro-transcribed RNA standard with 95% confidence. It accurately identified 63 FMDV strains belonging to all seven serotypes and showed no cross-reactivity with viruses causing similar clinical diseases in cloven-hoofed animals. The assay was able to identify FMDV RNA in multiple sample types including oral, nasal and lesion swabs, epithelial tissue suspensions, vesicular and oral fluid samples, even before the appearance of clinical signs. Clinical sensitivity of the assay was comparable or slightly higher than the laboratory-based real-time RT-PCR assay in use. The assay was able to detect FMDV RNA in vesicular fluid samples without nucleic acid extraction. For RNA extraction from more complex sample types, a commercially available taco™ mini transportable magnetic bead-based, automated extraction system was used. This assay provides a potentially useful field-deployable diagnostic tool for rapid detection of FMDV in an outbreak in FMD-free countries or for routine diagnostics in endemic countries with less structured laboratory systems. © 2016 Her Majesty the Queen in Right of Canada.

  11. Rapid screening of β-Globin gene mutations by Real-Time PCR in ...

    African Journals Online (AJOL)

    Introduction of the real time PCR has made a revolution in the time taken for the PCR reactions. We present a method for the diagnosis of the common mutations of the B-thalassemia in Egyptian children & families. The procedure depends on the real-time PCR using specific fluorescently labeled hybridization probes.

  12. Development of a novel multiplex PCR assay for rapid detection of virulence associated genes of Pasteurella multocida from pigs.

    Science.gov (United States)

    Rajkhowa, S

    2015-09-01

    As the pathogenicity of Pasteurella multocida is associated with various virulence factors (VFs), the aim of the study was to develop a novel multiplex PCR (m-PCR) assay for the rapid detection of important virulence associated genes (VAGs) of P. multocida isolates from pigs. The target recognized VFs used in the study were diverse adhesins (ptfA and pfhA), toxins (toxA), siderophores (tonB and hgbA), sialidases (nanB, nanH) and outer membrane proteins (ompA, ompH, oma87 and plpB). The primers for the genes encoding these VFs were designed by primer3 software (http://bioinfo.ut.ee/primer3-0.4.0/) using gene sequences available in Genbank. The detection limit of the developed assay was 10(2)  CFU ml(-1) . The m-PCR did not produce any nonspecific amplification products when tested against Bordetella bronchiseptica which also commonly infects pigs. We applied m-PCR to the field samples, and the results obtained were the same as the single PCR results. The developed assay would be very useful for veterinary diagnostic laboratories and for others interested in the rapid virulence profiling of porcine P. multocida isolates circulating in the piggeries. The study reports the development and evaluation of a novel multiplex PCR assay for the rapid detection of 11 important VAGs of Pasteurella multocida isolates from pigs. Rapid and simultaneous detection of recognized VFs of the organism are essential to know the virulo-types of P. multocida isolates circulating in the piggeries. The developed novel assay will be very useful for the rapid detection of VAGs of P. multocida isolates from pigs. © 2015 The Society for Applied Microbiology.

  13. Rapid identification and enumeration of Saccharomyces cerevisiae cells in wine by real-time PCR.

    Science.gov (United States)

    Martorell, P; Querol, A; Fernández-Espinar, M T

    2005-11-01

    Despite the beneficial role of Saccharomyces cerevisiae in the food industry for food and beverage production, it is able to cause spoilage in wines. We have developed a real-time PCR method to directly detect and quantify this yeast species in wine samples to provide winemakers with a rapid and sensitive method to detect and prevent wine spoilage. Specific primers were designed for S. cerevisiae using the sequence information obtained from a cloned random amplified polymorphic DNA band that differentiated S. cerevisiae from its sibling species Saccharomyces bayanus, Saccharomyces pastorianus, and Saccharomyces paradoxus. The specificity of the primers was demonstrated for typical wine spoilage yeast species. The method was useful for estimating the level of S. cerevisiae directly in sweet wines and red wines without preenrichment when yeast is present in concentrations as low as 3.8 and 5 CFU per ml. This detection limit is in the same order as that obtained from glucose-peptone-yeast growth medium (GPY). Moreover, it was possible to quantify S. cerevisiae in artificially contaminated samples accurately. Limits for accurate quantification in wine were established, from 3.8 x 10(5) to 3.8 CFU/ml in sweet wine and from 5 x 10(6) to 50 CFU/ml in red wine.

  14. Use of Triplex PCR for Rapid Detection of PVL and Differentiation of MRSA from Methicillin Resistant Coagulase Negative Staphylococci

    Science.gov (United States)

    Abimanyu, Nagarajan; Krishnan, Arunkumar; Murugesan, Saravanan; Subramanian G, Kaushik; Gurumurthy, Sivakumar; Krishnan, Padma

    2013-01-01

    Introduction: Methicillin-Resistant Staphylococcus aureus (MRSA) has become a major public health problem in both hospitals and communities. Panton – Valentine Leucocidin (PVL) has been reported to be an important marker for the highly pathogenic community acquired S. aureus infections. A rapid detection of these MRSA is very important for its treatment. The specific detection of MRSA is always a problem due to the prevalence of methicillin resistance among the coagulase negative Staphylococci. Hence, this study was done to develop a rapid triplex PCR for the detection of PVL positive MRSA and for the simultaneous differentiation of MRSA from Coagulase Negative Staphylococci (CoNS). Materials and Methods: We developed a triplex PCR for the specific detection of PVL positive Community Acquired (CA) – MRSA and for its simultaneous differentiation from the coagulase negative Staphylococci. We used PCR for targeting the fem A gene which is specific for S. aureus, mecA which is specific for methicillin-resistance and luk - PV which is specific for the PVL toxin. The method was evaluated with a total of 100 clinical isolates of Staphylococcus spp. Results: The triplex PCR was successfully standardized by using the reference strains and it was evaluated by using clinical strains. The method was found to be rapid, highly sensitive (100%), specific (99%) and cost effective. Conclusion: Triplex PCR can be used as a diagnostic tool for the detection of the highly pathogenic strains of CA-MRSA. PMID:23542876

  15. Novel Multitarget Real-Time PCR Assay for Rapid Detection of Bordetella Species in Clinical Specimens ▿

    Science.gov (United States)

    Tatti, Kathleen M.; Sparks, Kansas N.; Boney, Kathryn O.; Tondella, Maria Lucia

    2011-01-01

    A novel multitarget real-time PCR (RT-PCR) assay for the rapid identification of Bordetella pertussis, B. parapertussis, and B. holmesii was developed using multicopy insertion sequences (ISs) in combination with the pertussis toxin subunit S1 (ptxS1) singleplex assay. The RT-PCR targets for the multiplex assay include IS481, commonly found in B. pertussis and B. holmesii; IS1001 of B. parapertussis; and the IS1001-like sequence of B. holmesii. Overall, 402 Bordetella species and 66 non-Bordetella species isolates were tested in the multitarget assay. Cross-reactivity was found only with 5 B. bronchiseptica isolates, which were positive with IS1001 of B. parapertussis. The lower limit of detection (LLOD) of the multiplex assay was similar to the LLOD of each target in an individual assay format, which was approximately 1 genomic equivalent per reaction for all targets. A total of 197 human clinical specimens obtained during cough-illness outbreak investigations were used to evaluate the multitarget RT-PCR assay. The multiplex assay results from 87 clinical specimens were compared to the individual RT-PCR assay and culture results. The multitarget assay is useful as a diagnostic tool to confirm B. pertussis infections and to rapidly identify other Bordetella species. In conclusion, the use of this multitarget RT-PCR approach increases specificity, while it decreases the amount of time, reagents, and specimen necessary for RT-PCRs used for accurate diagnosis of pertussis-like illness. PMID:21940464

  16. Development and application of a multiplex PCR assay for rapid detection of 4 major bacterial pathogens in ducks.

    Science.gov (United States)

    Wei, B; Cha, S-Y; Kang, M; Park, I-J; Moon, O-K; Park, C-K; Jang, H-K

    2013-05-01

    Infections with Pasteurella multocida, Salmonella enterica, Riemerella anatipestifer, and Escherichia coli result in high morbidity and mortality, which cause significant economic loss in the poultry industry. It can be difficult to distinguish these pathogens based on clinical signs because these pathogens can cause similar clinical signs and coinfections can occur. Thus, rapid and sensitive detection of these 4 major bacterial pathogens are important in ducks. The aim of this study was to develop a multiplex PCR (mPCR) assay for simultaneously detecting and identifying these 4 pathogenic bacteria in a single tube reaction. The target genes used were KMT1 of P. multocida, the invasion protein gene of S. enterica, 16S rDNA of R. anatipestifer, and the alkaline phosphatase gene of E. coli. The detection limit of the assay for all bacterial DNA was 10 pg. The mPCR did not produce any nonspecific amplification products when tested against other related pathogens, including Staphylococcus aureus, Streptococcus pyogenes, Clostridium perfringens, Mycoplasma gallinarum, Mycoplasma synoviae, and Mycoplasma gallisepticum, which can also infect ducks. We applied mPCR to field samples, and the results were the same as the single PCR results. These results suggest that mPCR for the 4 bacteria is a useful and rapid technique to apply to field samples.

  17. Rapid detection of Panton-Valentine leukocidin from clinical isolates of Staphylococcus aureus strains by real-time PCR

    NARCIS (Netherlands)

    Deurenberg, Ruud H; Vink, Cornelis; Driessen, Christel; Bes, Michèle; London, Nancy; Etienne, Jerome; Stobberingh, Ellen E

    2004-01-01

    To allow rapid identification of Panton-Valentine leukocidin (PVL)-producing Staphylococcus aureus strains, a real-time PCR assay for detection of PVL was developed. This assay is convenient, since it can be applied directly on bacterial suspensions and does not require previous DNA purification.

  18. Development of a multiplex PCR assay for rapid identification of Burkholderia pseudomallei, Burkholderia thailandensis, Burkholderia mallei and Burkholderia cepacia complex.

    Science.gov (United States)

    Koh, Seng Fook; Tay, Sun Tee; Sermswan, Rasana; Wongratanacheewin, Surasakdi; Chua, Kek Heng; Puthucheary, Savithri D

    2012-09-01

    We have developed a multiplex PCR assay for rapid identification and differentiation of cultures for Burkholderia pseudomallei, Burkholderia thailandensis, Burkholderia mallei and Burkholderia cepacia complex. The assay is valuable for use in clinical and veterinary laboratories, and in a deployable laboratory during outbreaks. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples.

    Science.gov (United States)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas; Quyen, Than Linh; Engelsmann, Pia; Wolff, Anders; Bang, Dang Duong

    2017-04-01

    Salmonellosis, an infectious disease caused by Salmonella spp., is one of the most common foodborne diseases. Isolation and identification of Salmonella by conventional bacterial culture method is time consuming. In response to the demand for rapid on line or at site detection of pathogens, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair of newly designed primers targeting Salmonella spp. at subtype level were incorporated in the multiplex Direct PCR. To maximize the efficiency of the Direct PCR, the ratio between sample and dilution buffer was optimized. The sensitivity and specificity of the multiplex Direct PCR were tested using naturally contaminated pork meat samples for detecting and subtyping of Salmonella spp. Conventional bacterial culture methods were used as reference to evaluate the performance of the multiplex Direct PCR. Relative accuracy, sensitivity and specificity of 98.8%; 97.6% and 100%, respectively, were achieved by the method. Application of the multiplex Direct PCR to detect Salmonella in pork meat at slaughter reduces the time of detection from 5 to 6 days by conventional bacterial culture and serotyping methods to 14 h (including 12 h enrichment time). Furthermore, the method poses a possibility of miniaturization and integration into a point-of-need Lab-on-a-chip system for rapid online pathogen detection. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Rapid diagnostic tests as a source of DNA for Plasmodium species-specific real-time PCR

    Directory of Open Access Journals (Sweden)

    Van Esbroeck Marjan

    2011-03-01

    Full Text Available Abstract Background This study describes the use of malaria rapid diagnostic tests (RDTs as a source of DNA for Plasmodium species-specific real-time PCR. Methods First, the best method to recover DNA from RDTs was investigated and then the applicability of this DNA extraction method was assessed on 12 different RDT brands. Finally, two RDT brands (OptiMAL Rapid Malaria Test and SDFK60 malaria Ag Plasmodium falciparum/Pan test were comprehensively evaluated on a panel of clinical samples submitted for routine malaria diagnosis at ITM. DNA amplification was done with the 18S rRNA real-time PCR targeting the four Plasmodium species. Results of PCR on RDT were compared to those obtained by PCR on whole blood samples. Results Best results were obtained by isolating DNA from the proximal part of the nitrocellulose component of the RDT strip with a simple DNA elution method. The PCR on RDT showed a detection limit of 0.02 asexual parasites/μl, which was identical to the same PCR on whole blood. For all 12 RDT brands tested, DNA was detected except for one brand when a low parasite density sample was applied. In RDTs with a plastic seal covering the nitrocellulose strip, DNA extraction was hampered. PCR analysis on clinical RDT samples demonstrated correct identification for single species infections for all RDT samples with asexual parasites of P. falciparum (n = 60, Plasmodium vivax (n = 10, Plasmodium ovale (n = 10 and Plasmodium malariae (n = 10. Samples with only gametocytes were detected in all OptiMAL and in 10 of the 11 SDFK60 tests. None of the negative samples (n = 20 gave a signal by PCR on RDT. With PCR on RDT, higher Ct-values were observed than with PCR on whole blood, with a mean difference of 2.68 for OptiMAL and 3.53 for SDFK60. Mixed infections were correctly identified with PCR on RDT in 4/5 OptiMAL tests and 2/5 SDFK60 tests. Conclusions RDTs are a reliable source of DNA for Plasmodium real-time PCR. This study demonstrates the

  1. Rapid Detection of Enterotoxigenic Clostridium perfringens by Real-Time Fluorescence Resonance Energy Transfer PCR

    National Research Council Canada - National Science Library

    dela Cruz, Wilfred P; Gozum, Mary M.A; Lineberry, Sarah F; Stassen, Sarah D; Daughtry, Marianne; Stassen, Nicholas A; Jones, Morris S; Johnson, Oswald L

    2006-01-01

    ...) produced by some strains during sporulation. We developed a quantitative real-time PCR assay based on fluorescence resonance energy transfer hybridization chemistry that targets the C. perfringens...

  2. A multiplex PCR for rapid identification of Brassica species in the triangle of U.

    Science.gov (United States)

    Koh, Joshua C O; Barbulescu, Denise M; Norton, Sally; Redden, Bob; Salisbury, Phil A; Kaur, Sukhjiwan; Cogan, Noel; Slater, Anthony T

    2017-01-01

    Within the Brassicaceae, six species from the genus Brassica are widely cultivated throughout the world as oilseed, condiment, fodder or vegetable crops. The genetic relationships among the six Brassica species are described by U's triangle model. Extensive shared traits and diverse morphotypes among Brassica species make identification and classification based on phenotypic data alone challenging and unreliable, especially when dealing with large germplasm collections. Consequently, a major issue for genebank collections is ensuring the correct identification of species. Molecular genotyping based on simple sequence repeat (SSR) marker sequencing or the Illumina Infinium Brassica napus 60K single nucleotide polymorphism (SNP) array has been used to identify species and assess genetic diversity of Brassica collections. However, these methods are technically challenging, expensive and time-consuming, making them unsuitable for routine or rapid screening of Brassica accessions for germplasm management. A cheaper, faster and simpler method for Brassica species identification is described here. A multiplex polymerase chain reaction (MPCR) consisting of new and existing primers specific to the Brassica A, B and C genomes was able to reliably distinguish all six Brassica species in the triangle of U with 16 control samples of known species identity. Further validation against 120 Brassica accessions previously genotyped showed that the MPCR is highly accurate and comparable to more advanced techniques such as SSR marker sequencing or the Illumina Infinium B. napus 60K SNP array. In addition, the MPCR was sensitive enough to detect seed contaminations in pooled seed samples of Brassica accessions. A cheap and fast multiplex PCR assay for identification of Brassica species in the triangle of U was developed and validated in this study. The MPCR assay can be readily implemented in any basic molecular laboratory and should prove useful for the management of Brassica

  3. Multiplex real-time PCR assay for rapid detection of methicillin-resistant staphylococci directly from positive blood cultures.

    Science.gov (United States)

    Wang, Hye-Young; Kim, Sunghyun; Kim, Jungho; Park, Soon-Deok; Uh, Young; Lee, Hyeyoung

    2014-06-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is the most prevalent cause of bloodstream infections (BSIs) and is recognized as a major nosocomial pathogen. This study aimed to evaluate a newly designed multiplex real-time PCR assay capable of the simultaneous detection of mecA, S. aureus, and coagulase-negative staphylococci (CoNS) in blood culture specimens. The Real-MRSA and Real-MRCoNS multiplex real-time PCR assays (M&D, Republic of Korea) use the TaqMan probes 16S rRNA for Staphylococcus spp., the nuc gene for S. aureus, and the mecA gene for methicillin resistance. The detection limit of the multiplex real-time PCR assay was 10(3) CFU/ml per PCR for each gene target. The multiplex real-time PCR assay was evaluated using 118 clinical isolates from various specimen types and a total of 350 positive blood cultures from a continuous monitoring blood culture system. The results obtained with the multiplex real-time PCR assay for the three targets were in agreement with those of conventional identification and susceptibility testing methods except for one organism. Of 350 positive bottle cultures, the sensitivities of the multiplex real-time PCR kit were 100% (166/166 cultures), 97.2% (35/36 cultures), and 99.2% (117/118 cultures) for the 16S rRNA, nuc, and mecA genes, respectively, and the specificities for all three targets were 100%. The Real-MRSA and Real-MRCoNS multiplex real-time PCR assays are very useful for the rapid accurate diagnosis of staphylococcal BSIs. In addition, the Real-MRSA and Real-MRCoNS multiplex real-time PCR assays could have an important impact on the choice of appropriate antimicrobial therapy, based on detection of the mecA gene. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  4. Multiplex Real-Time PCR Assay for Rapid Detection of Methicillin-Resistant Staphylococci Directly from Positive Blood Cultures

    Science.gov (United States)

    Wang, Hye-young; Kim, Sunghyun; Kim, Jungho; Park, Soon-Deok

    2014-01-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is the most prevalent cause of bloodstream infections (BSIs) and is recognized as a major nosocomial pathogen. This study aimed to evaluate a newly designed multiplex real-time PCR assay capable of the simultaneous detection of mecA, S. aureus, and coagulase-negative staphylococci (CoNS) in blood culture specimens. The Real-MRSA and Real-MRCoNS multiplex real-time PCR assays (M&D, Republic of Korea) use the TaqMan probes 16S rRNA for Staphylococcus spp., the nuc gene for S. aureus, and the mecA gene for methicillin resistance. The detection limit of the multiplex real-time PCR assay was 103 CFU/ml per PCR for each gene target. The multiplex real-time PCR assay was evaluated using 118 clinical isolates from various specimen types and a total of 350 positive blood cultures from a continuous monitoring blood culture system. The results obtained with the multiplex real-time PCR assay for the three targets were in agreement with those of conventional identification and susceptibility testing methods except for one organism. Of 350 positive bottle cultures, the sensitivities of the multiplex real-time PCR kit were 100% (166/166 cultures), 97.2% (35/36 cultures), and 99.2% (117/118 cultures) for the 16S rRNA, nuc, and mecA genes, respectively, and the specificities for all three targets were 100%. The Real-MRSA and Real-MRCoNS multiplex real-time PCR assays are very useful for the rapid accurate diagnosis of staphylococcal BSIs. In addition, the Real-MRSA and Real-MRCoNS multiplex real-time PCR assays could have an important impact on the choice of appropriate antimicrobial therapy, based on detection of the mecA gene. PMID:24648566

  5. Application of rapid onsite PCR (TaqMan) for Phytophthora ramorum under U.S. conditions

    Science.gov (United States)

    Kelvin Hughes; Jenny Tomlinson; Neil Boonham; Kelly Ivors; Matteo Garbelotto; Ian Barker

    2006-01-01

    Currently, diagnosis of Phytophthora ramorum involves sending samples to a laboratory for traditional isolation and morphological characterisation, and/or PCR analysis. This can take as long as 2 weeks from sampling to final diagnosis. However, the Plant Health Group, Central Science Laboratory, has produced on-site DNA extraction and real-time PCR (...

  6. Rapid and Inexpensive Screening of Genomic Copy Number Variations Using a Novel Quantitative Fluorescent PCR Method

    Directory of Open Access Journals (Sweden)

    Martin Stofanko

    2013-01-01

    Full Text Available Detection of human microdeletion and microduplication syndromes poses significant burden on public healthcare systems in developing countries. With genome-wide diagnostic assays frequently inaccessible, targeted low-cost PCR-based approaches are preferred. However, their reproducibility depends on equally efficient amplification using a number of target and control primers. To address this, the recently described technique called Microdeletion/Microduplication Quantitative Fluorescent PCR (MQF-PCR was shown to reliably detect four human syndromes by quantifying DNA amplification in an internally controlled PCR reaction. Here, we confirm its utility in the detection of eight human microdeletion syndromes, including the more common WAGR, Smith-Magenis, and Potocki-Lupski syndromes with 100% sensitivity and 100% specificity. We present selection, design, and performance evaluation of detection primers using variety of approaches. We conclude that MQF-PCR is an easily adaptable method for detection of human pathological chromosomal aberrations.

  7. Huntingtin Haplotypes Provide Prioritized Target Panels for Allele-specific Silencing in Huntington Disease Patients of European Ancestry.

    Science.gov (United States)

    Kay, Chris; Collins, Jennifer A; Skotte, Niels H; Southwell, Amber L; Warby, Simon C; Caron, Nicholas S; Doty, Crystal N; Nguyen, Betty; Griguoli, Annamaria; Ross, Colin J; Squitieri, Ferdinando; Hayden, Michael R

    2015-11-01

    Huntington disease (HD) is a dominant neurodegenerative disorder caused by a CAG repeat expansion in the Huntingtin gene (HTT). Heterozygous polymorphisms in cis with the mutation allow for allele-specific suppression of the pathogenic HTT transcript as a therapeutic strategy. To prioritize target selection, precise heterozygosity estimates are needed across diverse HD patient populations. Here we present the first comprehensive investigation of all common target alleles across the HTT gene, using 738 reference haplotypes from the 1000 Genomes Project and 2364 haplotypes from HD patients and relatives in Canada, Sweden, France, and Italy. The most common HD haplotypes (A1, A2, and A3a) define mutually exclusive sets of polymorphisms for allele-specific therapy in the greatest number of patients. Across all four populations, a maximum of 80% are treatable using these three target haplotypes. We identify a novel deletion found exclusively on the A1 haplotype, enabling potent and selective silencing of mutant HTT in approximately 40% of the patients. Antisense oligonucleotides complementary to the deletion reduce mutant A1 HTT mRNA by 78% in patient cells while sparing wild-type HTT expression. By suppressing specific haplotypes on which expanded CAG occurs, we demonstrate a rational approach to the development of allele-specific therapy for a monogenic disorder.

  8. Huntingtin Haplotypes Provide Prioritized Target Panels for Allele-specific Silencing in Huntington Disease Patients of European Ancestry

    Science.gov (United States)

    Kay, Chris; Collins, Jennifer A; Skotte, Niels H; Southwell, Amber L; Warby, Simon C; Caron, Nicholas S; Doty, Crystal N; Nguyen, Betty; Griguoli, Annamaria; Ross, Colin J; Squitieri, Ferdinando; Hayden, Michael R

    2015-01-01

    Huntington disease (HD) is a dominant neurodegenerative disorder caused by a CAG repeat expansion in the Huntingtin gene (HTT). Heterozygous polymorphisms in cis with the mutation allow for allele-specific suppression of the pathogenic HTT transcript as a therapeutic strategy. To prioritize target selection, precise heterozygosity estimates are needed across diverse HD patient populations. Here we present the first comprehensive investigation of all common target alleles across the HTT gene, using 738 reference haplotypes from the 1000 Genomes Project and 2364 haplotypes from HD patients and relatives in Canada, Sweden, France, and Italy. The most common HD haplotypes (A1, A2, and A3a) define mutually exclusive sets of polymorphisms for allele-specific therapy in the greatest number of patients. Across all four populations, a maximum of 80% are treatable using these three target haplotypes. We identify a novel deletion found exclusively on the A1 haplotype, enabling potent and selective silencing of mutant HTT in approximately 40% of the patients. Antisense oligonucleotides complementary to the deletion reduce mutant A1 HTT mRNA by 78% in patient cells while sparing wild-type HTT expression. By suppressing specific haplotypes on which expanded CAG occurs, we demonstrate a rational approach to the development of allele-specific therapy for a monogenic disorder. PMID:26201449

  9. Interlaboratory validation of a real-time PCR 24-hour rapid method for detection of Salmonella in foods.

    Science.gov (United States)

    Cheng, Chorng-Ming; Van Khanh, T; Lin, Wen; Ruby, Richard M

    2009-05-01

    The efficacy of a 24-h Salmonella real-time, or quantitative, PCR (qPCR) detection method was assessed through a collaborative effort involving eight Federal and state laboratories. Eleven foods including mashed potatoes, soft cheese, chili powder, chocolate, eggs, sprouts, apple juice, fish, shrimp, ground beef, and ground chicken were tested. For each food, seven blind samples were distributed to each participant for testing. These included six samples equivalently inoculated with 1 to 5 CFU/25 g of various serotypes of Salmonella (Gaminara, Weltevreden, Heidelberg, Senftenberg, Enteritidis, Newport, Typhimurium, and Kentucky for each food) and 10 to 50 CFU/25 g of the competitor Enterobacter cloacae. The seventh sample was inoculated with 10 to 50 CFU/25 g of the competitor, E. cloacae, only. These samples were tested for Salmonella by using four methods in parallel: (i) 24-h qPCR method detecting Salmonella from modified buffered peptone water enrichment medium; (ii) 48-h qPCR method detecting Salmonella from a secondary selective enrichment broth; (iii) modified Bacteriological Analytical Manual method; and (iv) VIDAS, an immunoassay system. The results of the statistical analysis showed there was no significant (P > or = 0.05) difference between either of the qPCR methods and the modified Bacteriological Analytical Manual method for 10 of 11 foods. For the one exception, sprouts, detection by qPCR required 48 h. Both qPCR methods showed a detection limit of 0.08 to 0.2 CFU/g. These results provide a solid basis for using this 24-h qPCR rapid screening method to detect Salmonella in foods.

  10. Nested PCR for Rapid Detection of Mumps Virus in Cerebrospinal Fluid from Patients with Neurological Diseases

    OpenAIRE

    Poggio, Gustavo Palacios; Rodriguez, Claudia; Cisterna, Daniel; Freire, María Cecilia; Cello, Jerónimo

    2000-01-01

    In this study, we have developed a reverse transcription (RT)-nested polymerase chain reaction (n-PCR) for the detection of mumps virus RNA in cerebrospinal fluid (CSF) from patients with neurological infections. A specific 112-bp fragment was amplified by this method with primers from the nucleoprotein of the mumps virus genome. The mumps virus RT–n-PCR was capable of detecting 0.001 PFU/ml and 0.005 50% tissue culture infective dose/ml. This method was found to be specific, since no PCR pro...

  11. Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil

    Directory of Open Access Journals (Sweden)

    Vlademir Cantarelli

    2011-10-01

    Full Text Available INTRODUCTION: Laboratory-based surveillance is an important component in the control of vancomycin resistant enterococci (VRE. METHODS: The study aimed to evaluate real-time polymerase chain reaction (RT-PCR (genes vanA-vanB for VRE detection on 115 swabs from patients included in a surveillance program. RESULTS: Sensitivity of RT-PCR was similar to primary culture (75% and 79.5%, respectively when compared to broth enriched culture, whereas specificity was 83.1%. CONCLUSIONS: RT-PCR provides same day results, however it showed low sensitivity for VRE detection.

  12. Development and validation of allele-specific SNP/indel markers for eight yield-enhancing genes using whole-genome sequencing strategy to increase yield potential of rice, Oryza sativa L.

    Science.gov (United States)

    Kim, Sung-Ryul; Ramos, Joie; Ashikari, Motoyuki; Virk, Parminder S; Torres, Edgar A; Nissila, Eero; Hechanova, Sherry Lou; Mauleon, Ramil; Jena, Kshirod K

    2016-12-01

    Rice is one of the major staple foods in the world, especially in the developing countries of Asia. Its consumption as a dietary source is also increasing in Africa. To meet the demand for rice to feed the increasing human population, increasing rice yield is essential. Improving the genetic yield potential of rice is one ideal solution. It is imperative to introduce the identified yield-enhancing gene(s) into modern rice cultivars for the rapid improvement of yield potential through marker-assisted breeding. We report the development of PCR-gel-based markers for eight yield-related functional genes (Gn1a, OsSPL14, SCM2, Ghd7, DEP1, SPIKE, GS5, and TGW6) to introduce yield-positive alleles from the donor lines. Six rice cultivars, including three each of donor and recipient lines, respectively, were sequenced by next-generation whole-genome sequencing to detect DNA polymorphisms between the genotypes. Additionally, PCR products containing functional nucleotide polymorphism (FNP) or putative FNPs for yield-related genes were sequenced. DNA polymorphisms discriminating yield-positive alleles and non-target alleles for each gene were selected through sequence analysis and the allele-specific PCR-gel-based markers were developed. The markers were validated with our intermediate breeding lines produced from crosses between the donors and 12 elite indica rice cultivars as recipients. Automated capillary electrophoresis was tested and fluorescence-labeled SNP genotyping markers (Fluidigm SNP genotyping platform) for Gn1a, OsSPL14, Ghd7, GS5, and GS3 genes were developed for high-throughput genotyping. The SNP/indel markers linked to yield related genes functioned properly in our marker-assisted breeding program with identified high yield potential lines. These markers can be utilized in local favorite rice cultivars for yield enhancement. The marker designing strategy using both next generation sequencing and Sanger sequencing methods can be used for suitable marker

  13. SNP genotyping using single-tube fluorescent bidirectional PCR.

    Science.gov (United States)

    Waterfall, Christy M; Cobb, Benjamin D

    2002-07-01

    SNP genotyping is a well-populatedfield with a large number of assay formats offering accurate allelic discrimination. However, there remains a discord between the ultimate goal of rapid, inexpensive assays that do not require complex design considerations and involved optimization strategies. We describe the first integration of bidirectional allele-specific amplification, SYBR Green I, and rapid-cycle PCR to provide a homogeneous SNP-typing assay. Wild-type, mutant, and heterozygous alleles were easily discriminated in a single tube using melt curve profiling of PCR products alone. We demonstrate the effectiveness and reliability of this assay with a blinded trial using clinical samples from individuals with sickle cell anemia, sickle cell trait, or unaffected individuals. The tests were completed in less than 30 min without expensive fluorogenic probes, prohibiting design rules, or lengthy downstream processing for product analysis.

  14. A multiplex RT-PCR for rapid and simultaneous detection of viruses and viroids in chrysanthemum.

    Science.gov (United States)

    Song, A; You, Y; Chen, F; Li, P; Jiang, J; Chen, S

    2013-01-01

    Chrysanthemum plants are subject to serious virus diseases, so detection and identification of virus pathogens is important to prevent the virus spread. A reliable one-step multiplex RT-PCR was developed to simultaneously detect two viruses and two viriods: chrysanthemum virus B, tomato Aspermy virus, chrysanthemum stunt viroid and chrysanthemum chlorotic mottle viroid. In addition, we investigated the detection limit and the efficiency of single and multiplex RT-PCR assays. The results showed that the multiplex RT-PCR assay proved to be as sensitive as the single one. In conclusion, this technique is potentially useful in routine diagnosis of chrysanthemum viruses and viroids. The multiplex RT-PCR assay described in this study is the first report of simultaneous detection of virus and viroid in chrysanthemum, which provides a fast, convenient, cost-saving way to detect the virus and viroid mixed infections in plants. © 2012 The Society for Applied Microbiology.

  15. Development of a Rapid Real-Time PCR Assay for Quantitation of Pneumocystis carinii f. sp. Carinii

    DEFF Research Database (Denmark)

    Larsen, Hans Henrik; Kovacs, Joseph A; Stock, Frida

    2002-01-01

    ) PCR assay for detecting P. carinii f. sp. carinii, the subspecies of P. carinii commonly used in research models of PCP. The assay was based on the single-copy dihydrofolate reductase gene and was able to detect ... axenic cultivation system for P. carinii and confirmed our microscopy findings that no organism multiplication had occurred during culture. For all cultures analyzed, QTD PCR assays showed a decrease in P. carinii DNA that exceeded the expected decrease due to dilution of the inoculum upon transfer....... In conclusion, a rapid, sensitive, and reproducible quantitative PCR assay for P. carinii f. sp. carinii has been developed and is applicable to in vivo as well as in vitro systems. The assay should prove useful for conducting studies in which quantification of organism burden or growth assessment is critical...

  16. A One-Step, Real-Time PCR Assay for Rapid Detection of Rhinovirus

    Science.gov (United States)

    Do, Duc H.; Laus, Stella; Leber, Amy; Marcon, Mario J.; Jordan, Jeanne A.; Martin, Judith M.; Wadowsky, Robert M.

    2010-01-01

    One-step, real-time PCR assays for rhinovirus have been developed for a limited number of PCR amplification platforms and chemistries, and some exhibit cross-reactivity with genetically similar enteroviruses. We developed a one-step, real-time PCR assay for rhinovirus by using a sequence detection system (Applied Biosystems; Foster City, CA). The primers were designed to amplify a 120-base target in the noncoding region of picornavirus RNA, and a TaqMan (Applied Biosystems) degenerate probe was designed for the specific detection of rhinovirus amplicons. The PCR assay had no cross-reactivity with a panel of 76 nontarget nucleic acids, which included RNAs from 43 enterovirus strains. Excellent lower limits of detection relative to viral culture were observed for the PCR assay by using 38 of 40 rhinovirus reference strains representing different serotypes, which could reproducibly detect rhinovirus serotype 2 in viral transport medium containing 10 to 10,000 TCID50 (50% tissue culture infectious dose endpoint) units/ml of the virus. However, for rhinovirus serotypes 59 and 69, the PCR assay was less sensitive than culture. Testing of 48 clinical specimens from children with cold-like illnesses for rhinovirus by the PCR and culture assays yielded detection rates of 16.7% and 6.3%, respectively. For a batch of 10 specimens, the entire assay was completed in 4.5 hours. This real-time PCR assay enables detection of many rhinovirus serotypes with the Applied Biosystems reagent-instrument platform. PMID:19948820

  17. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    Energy Technology Data Exchange (ETDEWEB)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  18. Application of Reverse Transcriptase-PCR-DGGE as a rapid method for routine determination of Vibrio spp. in foods.

    Science.gov (United States)

    Chahorm, Kanchana; Prakitchaiwattana, Cheunjit

    2018-01-02

    The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004

  19. Rapid and specific detection of porcine parvovirus using real-time PCR and high resolution melting (HRM) analysis.

    Science.gov (United States)

    Yu, Hai-Qiong; Cai, Xian-Quan; Lin, Zhi-Xiong; Li, Xiang-Li; Yue, Qiao-Yun; Li, Rong; Zhu, Xing-Quan

    2015-02-28

    Porcine parvovirus (PPV) is the important causative agent for infectious infertility, which is a fairly tough virus that multiplies normally in the intestine of pigs without causing clinical signs in the world. We developed an assay integrating real-time PCR and high resolution melting (HRM) analysis for the detection of PPV. Primers targeting the VP gene were highly specific, as evidenced by the negative amplification of closely related viruses, such as porcine circovirus 2 (PCV2), porcine reproductive and respiratory syndrome virus (PRRSV), pseudorabies virus (PRV), classical swine fever virus (CSFV), or Japanese encephalitis virus (JEV). The performance of unlabeled real time PCR was compared to TaqMan real time PCR, and the detection limits of the two methods were nearly equal. Moreover, there was good correlation between Cp and diluted genomic DNA when tested with the two methods. The assay has the accuracy of 100% in reference to labeled real time PCR, when it was tested on 45 clinical samples. The present study demonstrated that the established assay integrating real-time PCR and HRM is relatively cost-effective and more stable, which provides an alternative tool for rapid, simple, specific and sensitive detection of PPV.

  20. A Rapid and Sensitive Diagnosis of Typhoid Fever Based On Nested PCR-Voltammetric DNA Biosensor Using Flagellin Gene Fragment

    Directory of Open Access Journals (Sweden)

    Yeni Wahyuni Hartati

    2016-03-01

    Full Text Available Typhoid fever caused by Salmonella typhi is an important issue for public health in the world. Laboratory methods for rapid and sensitive diagnosis are very important for disease management. The purpose of this study was to determine the performance of nested PCR–voltammetric DNA biosensor using flagellin gene (fla of S. typhi as a marker. The differential pulse voltammetry using pencil graphite electrode was applied to measure the guanine oxidation signal of probes vs synthetic target stDNA and probes vs fla PCR product hybridizations. The probe DNA selectivity was examined by hybridized probes vs non-complementary sequence. The result showed that the first round nested PCR product can not be visualized by agarose electrophoresis, whereas using the voltammetric biosensor methods can be detected both for the first or second round nested PCR product. The average peak current of hybridized probe vs first and second round of PCR product was 2.32 and 1.47 μA respectively, at 0.9 V. Detection of the DNA sequences of the infectious diseases from PCR amplified real sample was also carried out using this voltammetric DNA biosensor methods.

  1. A simple PCR-based method for the rapid genotyping of inherited fifth complement component (C5)-deficient mice.

    Science.gov (United States)

    Wang, Qingkai; Wang, Na; Zhang, Xin; Hu, Weiguo

    2015-01-01

    The fifth component of complement (C5) is considered to be the center of complement activation and function. However, there are no genetically engineered knockout mice for this gene, and the only commercially available inherited C5-deficient mice, in which a "TA" nucleotide deletion in the coding frame was previously identified, are in theC57BL/10Sn genetic background rather than the commonly used backgrounds C57BL/6 and BALB/c. Therefore, these mice must be backcrossed into the desired genetic background. Here, we developed an ARMS (amplification refractory mutation system) PCR method using a specific primer pair that was able to discriminate between the genotypes when the resulting product was analyzed by agarose gel electrophoresis. These results were supported by quantitative RT-PCR and semi-quantitative PCR and were consistent with the results from sequencing each backcrossed generation. Using ARMS-PCR method, we generated C5-deficient mice in the C57BL/6 background over 9 backcrossed generations and further verified the phenotype using complement-mediated hemolytic assays. In this study, we describe a simple, rapid and reliable PCR-based method for genotyping inherited C5-deficient mice that may be used to backcross C57BL/10Sn mice into other genetic backgrounds.

  2. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP for rapid diagnosis of neonatal sepsis

    Directory of Open Access Journals (Sweden)

    Anusha Rohit

    2016-01-01

    Full Text Available Background & objectives: The difficulties in diagnosis of neonatal sepsis are due to varied clinical presentation, low sensitivity of blood culture which is considered the gold standard and empirical antibiotic usage affecting the outcome of results. Though polymerase chain reaction (PCR based detection of bacterial 16S rRNA gene has been reported earlier, this does not provide identification of the causative agent. In this study, we used restriction fragment length polymorphism (RFLP of amplified 16S rRNA gene to identify the organisms involved in neonatal sepsis and compared the findings with blood culture. Methods: Blood samples from 97 neonates were evaluated for diagnosis of neonatal sepsis using BacT/Alert (automated blood culture and PCR-RFLP. Results: Bacterial DNA was detected by 16S rRNA gene PCR in 55 cases, while BacT/Alert culture was positive in 34 cases. Staphylococcus aureus was the most common organism detected with both methods. Klebsiella spp. was isolated from four samples by culture but was detected by PCR-RFLP in five cases while Acinetobacter spp. was isolated from one case but detected in eight cases by PCR-RFLP. The sensitivity of PCR was found to be 82.3 per cent with a negative predictive value of 85.7 per cent. Eighty of the 97 neonates had prior exposure to antibiotics. Interpretation & conclusions:The results of our study demonstrate that PCR-RFLP having a rapid turnaround time may be useful for the early diagnosis of culture negative neonatal sepsis.

  3. Establishment of a 10-Plex Quantitative Fluorescent-PCR Assay for rapid diagnosis of sex chromosome aneuploidies.

    Directory of Open Access Journals (Sweden)

    Xingmei Xie

    Full Text Available Sex chromosome aneuploidies occur commonly in the general population, with an incidence of 1 in 400 newborns. However, no tests specifically targeting sex chromosomes have been carried out in prenatal diagnosis or newborn screening, resulting in late recognition of these diseases. In this study, a rapid diagnostic method for sex chromosome aneuploidies was established using Quantitative Fluorescent-PCR (QF-PCR. Ten markers were included in one multiplex QF-PCR assay, including two sex determination genes (AMXY and SRY, five X-linked short tandem repeats (STRs; DXS1053, DXS981, DXS6809, DXS1187, and DXS8377, one X/Y-common STR (X22, and two autosomal STRs (D13S305 and D21S11. Retrospective tests of 70 cases with known cytogenetic results indicated that the 10-plex QF-PCR assay could well determine sex chromosome copy numbers by both allelic peak numbers and a sex chromosome dosage calculation with the autosomal STRs as internal controls. Prospective comparison with cytogenetic karyotyping on 534 cases confirmed that the 10-plex QF-PCR assay could be well employed for sex chromosome aneuploidy diagnosis in at least the Chinese Han population. This is the first QF-PCR test for the diagnosis of sex chromosome aneuploidies in the Chinese population. This test is superior to previous designs by including up to 8 sex-linked markers covering different parts of sex chromosomes as well as employing internal controls for copy number dosage calculation in a single PCR reaction. Due to simple technique and data analysis, as well as easy implementation within routine clinical services, this method is of great clinical application value and could be widely applied.

  4. Effect on MRSA transmission of rapid PCR testing of patients admitted to critical care.

    Science.gov (United States)

    Cunningham, R; Jenks, P; Northwood, J; Wallis, M; Ferguson, S; Hunt, S

    2007-01-01

    We report a significant reduction in the rate of meticillin-resistant Staphylococcus aureus (MRSA) transmission on a critical care unit when admission screening by culture was replaced with a same-day polymerase chain reaction (PCR) test. This was an observational cohort study, set in a 19-bed mixed medical and surgical adult critical care unit in southwest England. We studied 1305 patients admitted between April 2005 and February 2006. Standard MRSA culture methods were used to screen 612 patients between April 2005 and August 2005, and the IDI MRSA PCR test was used to screen 693 patients between September 2005 and February 2006. Standard infection control precautions were instituted when positive results were obtained by either method. Outcome measures included carriage rate, turnaround time for results and rate of subsequent MRSA transmission on the unit. The overall carriage rate on admission to the unit was 7.0%. Culture results were available in three working days, PCR results within one working day. The mean incidence of MRSA transmission was 13.89/1000 patient days during the culture phase and 4.9/1000 patient days during the PCR phase (relative risk reduction 0.65, 95% CI 0.28-1.07). PCR screening for MRSA on admission to critical care units is feasible in routine clinical practice, provides quicker results than culture-based screening and is associated with a significant reduction in subsequent MRSA transmission.

  5. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  6. Rapid and Specific Detection of Salmonella spp. in Animal Feed Samples by PCR after Culture Enrichment

    Science.gov (United States)

    Löfström, Charlotta; Knutsson, Rickard; Axelsson, Charlotta Engdahl; Rådström, Peter

    2004-01-01

    A PCR procedure has been developed for routine analysis of viable Salmonella spp. in feed samples. The objective was to develop a simple PCR-compatible enrichment procedure to enable DNA amplification without any sample pretreatment such as DNA extraction or cell lysis. PCR inhibition by 14 different feed samples and natural background flora was circumvented by the use of the DNA polymerase Tth. This DNA polymerase was found to exhibit a high level of resistance to PCR inhibitors present in these feed samples compared to DyNAzyme II, FastStart Taq, Platinum Taq, Pwo, rTth, Taq, and Tfl. The specificity of the Tth assay was confirmed by testing 101 Salmonella and 43 non-Salmonella strains isolated from feed and food samples. A sample preparation method based on culture enrichment in buffered peptone water and DNA amplification with Tth DNA polymerase was developed. The probability of detecting small numbers of salmonellae in feed, in the presence of natural background flora, was accurately determined and found to follow a logistic regression model. From this model, the probability of detecting 1 CFU per 25 g of feed in artificially contaminated soy samples was calculated and found to be 0.81. The PCR protocol was evaluated on 155 naturally contaminated feed samples and compared to an established culture-based method, NMKL-71. Eight percent of the samples were positive by PCR, compared with 3% with the conventional method. The reasons for the differences in sensitivity are discussed. Use of this method in the routine analysis of animal feed samples would improve safety in the food chain. PMID:14711627

  7. Allele-Specific Transcriptome and Methylome Analysis Reveals Stable Inheritance and Cis-Regulation of DNA Methylation in Nasonia.

    Directory of Open Access Journals (Sweden)

    Xu Wang

    2016-07-01

    Full Text Available Gene expression divergence between closely related species could be attributed to both cis- and trans- DNA sequence changes during evolution, but it is unclear how the evolutionary dynamics of epigenetic marks are regulated. In eutherian mammals, biparental DNA methylation marks are erased and reset during gametogenesis, resulting in paternal or maternal imprints, which lead to genomic imprinting. Whether DNA methylation reprogramming exists in insects is not known. Wasps of the genus Nasonia are non-social parasitoids that are emerging as a model for studies of epigenetic processes in insects. In this study, we quantified allele-specific expression and methylation genome-wide in Nasonia vitripennis and Nasonia giraulti and their reciprocal F1 hybrids. No parent-of-origin effect in allelic expression was found for >8,000 covered genes, suggesting a lack of genomic imprinting in adult Nasonia. As we expected, both significant cis- and trans- effects are responsible for the expression divergence between N. vitripennis and N. giraulti. Surprisingly, all 178 differentially methylated genes are also differentially methylated between the two alleles in F1 hybrid offspring, recapitulating the parental methylation status with nearly 100% fidelity, indicating the presence of strong cis-elements driving the target of gene body methylation. In addition, we discovered that total and allele-specific expression are positively correlated with allele-specific methylation in a subset of the differentially methylated genes. The 100% cis-regulation in F1 hybrids suggests the methylation machinery is conserved and DNA methylation is targeted by cis features in Nasonia. The lack of genomic imprinting and parent-of-origin differentially methylated regions in Nasonia, together with the stable inheritance of methylation status between generations, suggests either a cis-regulatory motif for methylation at the DNA level or highly stable inheritance of an epigenetic

  8. Rapid genetically modified organism (GMO screening of various food products and animal feeds using multiplex polymerase chain reaction (PCR

    Directory of Open Access Journals (Sweden)

    Lisha, V.

    2017-01-01

    Full Text Available modified crops which brought up a controversy on the safety usage of genetically modified organisms (GMOs. It has been implemented globally that all GMO products and its derived ingredients should have regulations on the usage and labelling. Thus, it is necessary to develop methods that allow rapid screening of GMO products to comply with the regulations. This study employed a reliable and flexible multiplex polymerase chain reaction (PCR method for the rapid detection of transgenic elements in genetically modified soy and maize along with the soybean LECTIN gene and maize ZEIN gene respectively. The selected four common transgenic elements were 35S promoter (35S; Agrobacterium tumefaciens nopaline synthase terminator (NOS; 5-enolypyruvylshikimate-3-phosphate synthase (epsps gene; and Cry1Ab delta-endotoxin (cry1Ab gene. Optimization of the multiplex PCR methods were carried out by using 1% Roundup ReadyTM Soybean (RRS as the certified reference material for soybean that produced fourplex PCR method detecting 35S promoter, NOS terminator, epsps gene and soybean LECTIN gene and by using 1% MON810 as the certified reference material for maize that produced triplex PCR method detecting 35S promoter, cry1Ab gene and maize ZEIN gene prior to screening of the GMO traits in various food products and animal feeds. 1/9 (11.1% of the animal feed contained maize and 1/15 (6.7% of the soybean food products showed positive results for the detection of GMO transgenic gene. None of the maize food products showed positive results for GMO transgenic gene. In total, approximately 4% of the food products and animal feed were positive as GMO. This indicated GMOs have not widely entered the food chain. However, it is necessary to have an appropriate screening method due to GMOs’ unknown potential risk to humans and to animals. This rapid screening method will provide leverage in terms of being economically wise, time saving and reliable.

  9. Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes

    Directory of Open Access Journals (Sweden)

    Georg Walch

    2016-04-01

    Full Text Available Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success.

  10. A PCR-based strategy for simple and rapid identification of rough presumptive Salmonella isolates

    DEFF Research Database (Denmark)

    Hoorfar, Jeffrey; Baggesen, Dorte Lau; Porting, P.H.

    1999-01-01

    The purpose of the present study was to investigate the application of ready-to-go Salmonella PCR tests, based on dry chemistry, for final identification of rough presumptive Salmonella isolates. The results were compared with two different biotyping methods performed at two different laboratories...

  11. Rapid detection of carbapenemase genes by multiplex real-time PCR.

    Science.gov (United States)

    Monteiro, Jussimara; Widen, Raymond H; Pignatari, Antonio C C; Kubasek, Carly; Silbert, Suzane

    2012-04-01

    To develop a single multiplex real-time PCR assay to detect six different genetic types of carbapenemases already identified in Enterobacteriaceae (KPC, GES, NDM, IMP, VIM and OXA-48). A total of 58 bacterial isolates were tested. Thirty were previously characterized as resistant to carbapenems and documented by PCR and sequencing analysis to carry the following genes: bla(KPC) type, bla(GES) type, bla(IMP) type, bla(VIM) type, bla(OXA-48) and bla(NDM-1). These positive strains included 21 Enterobacteriaceae, 1 Acinetobacter baumannii and 8 Pseudomonas aeruginosa isolates. The remaining 28 isolates previously tested susceptible to carbapenems and were negative for these genes. Bacterial DNA was extracted using the easyMag extractor (bioMérieux, France). The real-time PCR was performed using the Rotor-Gene 6000 instrument (Corbett Life Science, Australia) and specific primers for each carbapenemase target were designed using the DNAStar software (Madison, WI, USA). Each one of the six carbapenemase genes tested presented a different melting curve after PCR amplification. The melting temperature (T(m)) analysis of the amplicons identified was as follows: bla(IMP) type (T(m) 80.1°C), bla(OXA-48) (T(m) 81.6°C), bla(NDM-1) (T(m) 84°C), bla(GES) type (T(m) 88.6°C), bla(VIM) type (T(m) 90.3°C) and bla(KPC) type (T(m) 91.6°C). No amplification was detected among the negative samples. The results showed 100% concordance with the genotypes previously identified. The new assay was able to detect the presence of six different carbapenemase gene types in a single 3 h PCR.

  12. Duplex real-time PCR assay for rapid identification of Staphylococcus aureus isolates from dairy cow milk.

    Science.gov (United States)

    Pilla, Rachel; Snel, Gustavo G M; Malvisi, Michela; Piccinini, Renata

    2013-05-01

    Staphylococcus aureus isolates from dairy cow mastitis are not always consistent with the characteristic morphology described, and molecular investigation is often needed. The aim of the study was to develop a duplex real-time PCR assay for rapid identification of Staph. aureus isolates, targeting both nuc and Sa442. Overall, 140 isolates collected from dairy cow mastitis in 90 different herds, were tested. All strains had been identified using morphological and biochemical characteristics. DNA from each strain was amplified in real-time PCR assay, to detect nuc or Sa442. Thereafter, a duplex real-time PCR assay was performed, and specificity of the amplified products was assessed by high resolution melting curve analysis. Out of 124 Staph. aureus isolates, 33 did not show the typical morphology or enzymic activity; in 118 strains, the two melt-curve peaks consistent with nuc and Sa442 were revealed, while 2 isolates showed only the peak consistent with Sa442. Four isolates bacteriologically identified as Staph. aureus, were PCR-negative and were further identified as Staph. pseudintermedius by sequencing. Staph. pseudintermedius and coagulase-negative staphylococci did not carry nuc or Sa442. The results showed the correct identification of all isolates, comprehending also coagulase-or nuc-negative Staph. aureus, while other coagulase-positive Staphylococci were correctly identified as non-Staph. aureus. Both sensitivity and specificity were 100%. High resolution melting analysis allowed easy detection of unspecific products. Finally, the duplex real-time PCR was applied directly to 40 milk samples, to detect infected mammary quarters. The assay confirmed the results of bacteriological analysis, on Staph. aureus-positive or-negative samples. Therefore, the proposed duplex real-time PCR could be used in laboratory routine as a cost-effective and powerful tool for high-throughput identification of atypical Staph. aureus isolates causing dairy cow mastitis. Also, it

  13. Development of a specific immunomagnetic capture-PCR for rapid detection of viable Mycoplasma agalactiae in sheep milk samples.

    Science.gov (United States)

    Sanna, G; Lecca, V; Foddai, A; Tola, S

    2014-12-01

    To develop an immunomagnetic capture (IMC) to detect viable Mycoplasma agalactiae in routine ovine milk samples. Polyclonal antibodies against two M. agalactiae membrane surface proteins (P80 and P55) were covalently conjugated to magnetic beads (MBs) to form MB-Ab80 and MB-Ab55. Mycoplasma agalactiae cells were captured by a specific antigen-antibody reaction and magnetic separation. Immunomagnetic capture (IMC) was used to isolate and concentrate M. agalactiae in serial decimal dilutions and in artificially contaminated milk to facilitate subsequent detection by PCR. A 375-bp fragment of M. agalactiae was amplified using a pair of M. agalactiae-specific primers in PCR. The limit of detection of IMC-PCR method ranged from 10 to 10(2)  CCU ml(-1) when mycoplasmas were resuspended in PBS and from 10(2) to 10(3)  CCU ml(-1) when mycoplasmas were resuspended in uncontaminated ovine milk. This study also describes the application of IMC-PCR method to test for M. agalactiae in 516 milk samples collected from sheep with suspected contagious agalactia. Its performance was evaluated relative to culture. This report has demonstrated for the first time, the effective use of rapid and reliable IMC combined with PCR assay for the detection of viable M. agalactiae. The method IMC-PCR provides an alternative to conventional microbiological detection, method and it could be applied to quick detection of M. agalactiae in routine sheep milk samples. © 2014 The Authors published by John Wiley & Sons Ltd on behalf of Society for Applied Microbiology.

  14. Rapid detection and typing of pathogenic nonpneumophila Legionella spp. isolates using a multiplex real-time PCR assay.

    Science.gov (United States)

    Benitez, Alvaro J; Winchell, Jonas M

    2016-04-01

    We developed a single tube multiplex real-time PCR assay that allows for the rapid detection and typing of 9 nonpneumophila Legionella spp. isolates that are clinically relevant. The multiplex assay is capable of simultaneously detecting and discriminating L. micdadei, L. bozemanii, L. dumoffii, L. longbeachae, L. feeleii, L. anisa, L. parisiensis, L. tucsonensis serogroup (sg) 1 and 3, and L. sainthelensis sg 1 and 2 isolates. Evaluation of the assay with nucleic acid from each of these species derived from both clinical and environmental isolates and typing strains demonstrated 100% sensitivity and 100% specificity when tested against 43 other Legionella spp. Typing of L. anisa, L. parisiensis, and L. tucsonensis sg 1 and 3 isolates was accomplished by developing a real-time PCR assay followed by high-resolution melt (HRM) analysis targeting the ssrA gene. Further typing of L. bozemanii, L. longbeachae, and L. feeleii isolates to the serogroup level was accomplished by developing a real-time PCR assay followed by HRM analysis targeting the mip gene. When used in conjunction with other currently available diagnostic tests, these assays may aid in rapidly identifying specific etiologies associated with Legionella outbreaks, clusters, sporadic cases, and potential environmental sources. Published by Elsevier Inc.

  15. Rapid detection of Orthopoxvirus by semi-nested PCR directly from clinical specimens: a useful alternative for routine laboratories.

    Science.gov (United States)

    Abrahão, Jônatas Santos; Drumond, Betânia Paiva; Trindade, Giliane de Souza; da Silva-Fernandes, André Tavares; Ferreira, Jaqueline Maria Siqueira; Alves, Pedro Augusto; Campos, Rafael Kroon; Siqueira, Larissa; Bonjardim, Cláudio Antônio; Ferreira, Paulo César Peregrino; Kroon, Erna Geessien

    2010-04-01

    Orthopoxvirus (OPV) has been associated with worldwide exanthematic outbreaks, which have resulted in serious economic losses as well as impact on public health. Although the current classical and molecular methods are useful for the diagnosis of OPV, they are largely inaccessible to unsophisticated clinical laboratories. The major reason for the inaccessibility is that they require both virus isolation and DNA manipulation. In this report, a rapid, sensitive and low-cost semi-nested PCR method is described for the detection of OPV DNA directly from clinical specimens. A set of primers was designed to amplify the conserved OPV vgf gene. The most useful thermal and chemical conditions were selected and minimum non-inhibitory dilutions were determined. More than 100 Brazilian Vaccinia virus (VACV) field clinical specimens were tested using this semi-nested PCR in order to confirm its applicability. Cowpox virus was also detected by PCR from the ear scabs of scarified Balb/c mice. In addition, the method was highly sensitive for the detection of VACV DNA in murine blood and excreta, which are among the suggested reservoirs of OPV. Together, these data suggest that semi-nested PCR can be used for initial screening for OPV and as a routine diagnostic laboratory method. 2010 Wiley-Liss, Inc.

  16. Allele-specific up-regulation of FGFR2 increases susceptibility to breast cancer.

    Directory of Open Access Journals (Sweden)

    Kerstin B Meyer

    2008-05-01

    Full Text Available The recent whole-genome scan for breast cancer has revealed the FGFR2 (fibroblast growth factor receptor 2 gene as a locus associated with a small, but highly significant, increase in the risk of developing breast cancer. Using fine-scale genetic mapping of the region, it has been possible to narrow the causative locus to a haplotype of eight strongly linked single nucleotide polymorphisms (SNPs spanning a region of 7.5 kilobases (kb in the second intron of the FGFR2 gene. Here we describe a functional analysis to define the causative SNP, and we propose a model for a disease mechanism. Using gene expression microarray data, we observed a trend of increased FGFR2 expression in the rare homozygotes. This trend was confirmed using real-time (RT PCR, with the difference between the rare and the common homozygotes yielding a Wilcox p-value of 0.028. To elucidate which SNPs might be responsible for this difference, we examined protein-DNA interactions for the eight most strongly disease-associated SNPs in different breast cell lines. We identify two cis-regulatory SNPs that alter binding affinity for transcription factors Oct-1/Runx2 and C/EBPbeta, and we demonstrate that both sites are occupied in vivo. In transient transfection experiments, the two SNPs can synergize giving rise to increased FGFR2 expression. We propose a model in which the Oct-1/Runx2 and C/EBPbeta binding sites in the disease-associated allele are able to lead to an increase in FGFR2 gene expression, thereby increasing the propensity for tumour formation.

  17. Characterization of the ptfA gene of avian Pasteurella multocida strains by allele-specific polymerase chain reaction.

    Science.gov (United States)

    Sellyei, Boglárka; Bányai, Krisztián; Magyar, Tibor

    2010-07-01

    Pasteurella multocida is the causative agent of fowl cholera in domesticated and wild birds. The disease outcome is affected by various host- and pathogen-specific determinants. Several putative virulence factors have been proposed to play a key role in this interaction, including the ptfA gene, the products of which assemble to form type 4 fimbriae on the bacterial surface. One way to understand more precisely how ptfA contributes to pathogenesis is to gather molecular features of this gene in circulating avian P. multocida strains. Therefore, molecular characterization of the ptfA gene of P. multocida strains isolated from domestic poultry was performed using the combination of nucleotide sequence analysis and a newly developed allele-specific polymerase chain reaction assay. Two major ptfA alleles were identified among 31 strains, representing various serogroups and somatic serotypes. It was noteworthy that allele specificity and case severity of a subset of strains correlated with the available gross pathology data. Therefore, the acquisition of comprehensive clinical and epidemiological data together with molecular characteristics of individual strains will help to design and implement adequate preventive and intervention strategies.

  18. Quantitative measurement of allele-specific protein expression in a diploid yeast hybrid by LC-MS.

    Science.gov (United States)

    Khan, Zia; Bloom, Joshua S; Amini, Sasan; Singh, Mona; Perlman, David H; Caudy, Amy A; Kruglyak, Leonid

    2012-01-01

    Understanding the genetic basis of gene regulatory variation is a key goal of evolutionary and medical genetics. Regulatory variation can act in an allele-specific manner (cis-acting) or it can affect both alleles of a gene (trans-acting). Differential allele-specific expression (ASE), in which the expression of one allele differs from another in a diploid, implies the presence of cis-acting regulatory variation. While microarrays and high-throughput sequencing have enabled genome-wide measurements of transcriptional ASE, methods for measurement of protein ASE (pASE) have lagged far behind. We describe a flexible, accurate, and scalable strategy for measurement of pASE by liquid chromatography-coupled mass spectrometry (LC-MS). We apply this approach to a hybrid between the yeast species Saccharomyces cerevisiae and Saccharomyces bayanus. Our results provide the first analysis of the relative contribution of cis-acting and trans-acting regulatory differences to protein expression divergence between yeast species.

  19. Rapid Detection of Species of the Opportunistic Yeast Trichosporon by PCR

    Science.gov (United States)

    Sugita, Takashi; Nishikawa, Akemi; Shinoda, Takako

    1998-01-01

    Trichosporon species are opportunistic pathogens, associated with a high mortality rate in immunocompromised patients. Oligonucleotide primers were used to amplify a 170-bp fragment of small-subunit ribosomal DNA of all species in the genus Trichosporon by PCR. The primers amplify DNAs of all species in the genus Trichosporon, including six causative agents of trichosporonosis. DNAs of other medically important yeasts, such as Candida albicans and Cryptococcus neoformans, are not amplified by this detection system. PMID:9574732

  20. Development and Evaluation of a Blood Culture PCR Assay for Rapid Detection of Salmonella Paratyphi A in Clinical Samples.

    Science.gov (United States)

    Zhou, Liqing; Jones, Claire; Gibani, Malick M; Dobinson, Hazel; Thomaides-Brears, Helena; Shrestha, Sonu; Blohmke, Christoph J; Darton, Thomas C; Pollard, Andrew J

    2016-01-01

    Enteric fever remains an important cause of morbidity in many low-income countries and Salmonella Paratyphi A has emerged as the aetiological agent in an increasing proportion of cases. Lack of adequate diagnostics hinders early diagnosis and prompt treatment of both typhoid and paratyphoid but development of assays to identify paratyphoid has been particularly neglected. Here we describe the development of a rapid and sensitive blood culture PCR method for detection of Salmonella Paratyphi A from blood, potentially allowing for appropriate diagnosis and antimicrobial treatment to be initiated on the same day. Venous blood samples from volunteers experimentally challenged orally with Salmonella Paratyphi A, who subsequently developed paratyphoid, were taken on the day of diagnosis; 10 ml for quantitative blood culture and automated blood culture, and 5 ml for blood culture PCR. In the latter assay, bacteria were grown in tryptone soy broth containing 2.4% ox bile and micrococcal nuclease for 5 hours (37°C) before bacterial DNA was isolated for PCR detection targeting the fliC-a gene of Salmonella Paratyphi A. An optimized broth containing 2.4% ox bile and micrococcal nuclease, as well as a PCR test was developed for a blood culture PCR assay of Salmonella Paratyphi A. The volunteers diagnosed with paratyphoid had a median bacterial burden of 1 (range 0.1-6.9) CFU/ml blood. All the blood culture PCR positive cases where a positive bacterial growth was shown by quantitative blood culture had a bacterial burden of ≥ 0.3 CFU/ ml blood. The blood culture PCR assay identified an equal number of positive cases as automated blood culture at higher bacterial loads (≥0.3 CFU/ml blood), but utilized only half the volume of specimens. The blood culture PCR method for detection of Salmonella Paratyphi A can be completed within 9 hours and offers the potential for same-day diagnosis of enteric fever. Using 5 ml blood, it exhibited a lower limit of detection equal to 0.3 CFU

  1. Development and Evaluation of a Blood Culture PCR Assay for Rapid Detection of Salmonella Paratyphi A in Clinical Samples.

    Directory of Open Access Journals (Sweden)

    Liqing Zhou

    Full Text Available Enteric fever remains an important cause of morbidity in many low-income countries and Salmonella Paratyphi A has emerged as the aetiological agent in an increasing proportion of cases. Lack of adequate diagnostics hinders early diagnosis and prompt treatment of both typhoid and paratyphoid but development of assays to identify paratyphoid has been particularly neglected. Here we describe the development of a rapid and sensitive blood culture PCR method for detection of Salmonella Paratyphi A from blood, potentially allowing for appropriate diagnosis and antimicrobial treatment to be initiated on the same day.Venous blood samples from volunteers experimentally challenged orally with Salmonella Paratyphi A, who subsequently developed paratyphoid, were taken on the day of diagnosis; 10 ml for quantitative blood culture and automated blood culture, and 5 ml for blood culture PCR. In the latter assay, bacteria were grown in tryptone soy broth containing 2.4% ox bile and micrococcal nuclease for 5 hours (37°C before bacterial DNA was isolated for PCR detection targeting the fliC-a gene of Salmonella Paratyphi A.An optimized broth containing 2.4% ox bile and micrococcal nuclease, as well as a PCR test was developed for a blood culture PCR assay of Salmonella Paratyphi A. The volunteers diagnosed with paratyphoid had a median bacterial burden of 1 (range 0.1-6.9 CFU/ml blood. All the blood culture PCR positive cases where a positive bacterial growth was shown by quantitative blood culture had a bacterial burden of ≥ 0.3 CFU/ ml blood. The blood culture PCR assay identified an equal number of positive cases as automated blood culture at higher bacterial loads (≥0.3 CFU/ml blood, but utilized only half the volume of specimens.The blood culture PCR method for detection of Salmonella Paratyphi A can be completed within 9 hours and offers the potential for same-day diagnosis of enteric fever. Using 5 ml blood, it exhibited a lower limit of detection

  2. Systematic review and meta-analysis: rapid diagnostic tests versus placental histology, microscopy and PCR for malaria in pregnant women

    Directory of Open Access Journals (Sweden)

    Kattenberg Johanna H

    2011-10-01

    Full Text Available Abstract Background During pregnancy, malaria infection with Plasmodium falciparum or Plasmodium vivax is related to adverse maternal health and poor birth outcomes. Diagnosis of malaria, during pregnancy, is complicated by the absence or low parasite densities in peripheral blood. Diagnostic methods, other than microscopy, are needed for detection of placental malaria. Therefore, the diagnostic accuracy of rapid diagnostic tests (RDTs, detecting antigen, and molecular techniques (PCR, detecting DNA, for the diagnosis of Plasmodium infections in pregnancy was systematically reviewed. Methods MEDLINE, EMBASE and Web of Science were searched for studies assessing the diagnostic accuracy of RDTs, PCR, microscopy of peripheral and placental blood and placental histology for the detection of malaria infection (all species in pregnant women. Results The results of 49 studies were analysed in metandi (Stata, of which the majority described P. falciparum infections. Although both placental and peripheral blood microscopy cannot reliably replace histology as a reference standard for placental P. falciparum infection, many studies compared RDTs and PCR to these tests. The proportion of microscopy positives in placental blood (sensitivity detected by peripheral blood microscopy, RDTs and PCR are respectively 72% [95% CI 62-80], 81% [95% CI 55-93] and 94% [95% CI 86-98]. The proportion of placental blood microscopy negative women that were negative in peripheral blood microscopy, RDTs and PCR (specificity are 98% [95% CI 95-99], 94% [95% CI 76-99] and 77% [95% CI 71-82]. Based on the current data, it was not possible to determine if the false positives in RDTs and PCR are caused by sequestered parasites in the placenta that are not detected by placental microscopy. Conclusion The findings suggest that RDTs and PCR may have good performance characteristics to serve as alternatives for the diagnosis of malaria in pregnancy, besides any other limitations and

  3. Development and Evaluation of a Blood Culture PCR Assay for Rapid Detection of Salmonella Paratyphi A in Clinical Samples

    Science.gov (United States)

    Zhou, Liqing; Jones, Claire; Gibani, Malick M.; Dobinson, Hazel; Thomaides-Brears, Helena; Shrestha, Sonu; Blohmke, Christoph J.; Darton, Thomas C.; Pollard, Andrew J.

    2016-01-01

    Background Enteric fever remains an important cause of morbidity in many low-income countries and Salmonella Paratyphi A has emerged as the aetiological agent in an increasing proportion of cases. Lack of adequate diagnostics hinders early diagnosis and prompt treatment of both typhoid and paratyphoid but development of assays to identify paratyphoid has been particularly neglected. Here we describe the development of a rapid and sensitive blood culture PCR method for detection of Salmonella Paratyphi A from blood, potentially allowing for appropriate diagnosis and antimicrobial treatment to be initiated on the same day. Methods Venous blood samples from volunteers experimentally challenged orally with Salmonella Paratyphi A, who subsequently developed paratyphoid, were taken on the day of diagnosis; 10 ml for quantitative blood culture and automated blood culture, and 5 ml for blood culture PCR. In the latter assay, bacteria were grown in tryptone soy broth containing 2.4% ox bile and micrococcal nuclease for 5 hours (37°C) before bacterial DNA was isolated for PCR detection targeting the fliC-a gene of Salmonella Paratyphi A. Results An optimized broth containing 2.4% ox bile and micrococcal nuclease, as well as a PCR test was developed for a blood culture PCR assay of Salmonella Paratyphi A. The volunteers diagnosed with paratyphoid had a median bacterial burden of 1 (range 0.1–6.9) CFU/ml blood. All the blood culture PCR positive cases where a positive bacterial growth was shown by quantitative blood culture had a bacterial burden of ≥ 0.3 CFU/ ml blood. The blood culture PCR assay identified an equal number of positive cases as automated blood culture at higher bacterial loads (≥0.3 CFU/ml blood), but utilized only half the volume of specimens. Conclusions The blood culture PCR method for detection of Salmonella Paratyphi A can be completed within 9 hours and offers the potential for same-day diagnosis of enteric fever. Using 5 ml blood, it exhibited a

  4. Rapid detection and differentiation of mycobacterial species using a multiplex PCR system

    Directory of Open Access Journals (Sweden)

    Andrea Santos Lima

    2013-07-01

    Full Text Available Introduction The early diagnosis of mycobacterial infections is a critical step for initiating treatment and curing the patient. Molecular analytical methods have led to considerable improvements in the speed and accuracy of mycobacteria detection. Methods The purpose of this study was to evaluate a multiplex polymerase chain reaction system using mycobacterial strains as an auxiliary tool in the differential diagnosis of tuberculosis and diseases caused by nontuberculous mycobacteria (NTM Results Forty mycobacterial strains isolated from pulmonary and extrapulmonary origin specimens from 37 patients diagnosed with tuberculosis were processed. Using phenotypic and biochemical characteristics of the 40 mycobacteria isolated in LJ medium, 57.5% (n=23 were characterized as the Mycobacterium tuberculosis complex (MTBC and 20% (n=8 as nontuberculous mycobacteria (NTM, with 22.5% (n=9 of the results being inconclusive. When the results of the phenotypic and biochemical tests in 30 strains of mycobacteria were compared with the results of the multiplex PCR, there was 100% concordance in the identification of the MTBC and NTM species, respectively. A total of 32.5% (n=13 of the samples in multiplex PCR exhibited a molecular pattern consistent with NTM, thus disagreeing with the final diagnosis from the attending physician. Conclusions Multiplex PCR can be used as a differential method for determining TB infections caused by NTM a valuable tool in reducing the time necessary to make clinical diagnoses and begin treatment. It is also useful for identifying species that were previously not identifiable using conventional biochemical and phenotypic techniques.

  5. A rapid PCR-SSP assay for the hemochromatosis-associated Tyr250Stop mutation in the TFR2 gene.

    Science.gov (United States)

    Rivers, C A; Barton, J C; Acton, R T

    2001-01-01

    Several genes associated with hemochromatosis and primary iron overload have been identified. Mutations in the HFE gene have been detected in 60-100% of hemochromatosis patients of northern, central, and western European descent, although the frequencies of these mutations vary among racial and ethnic groups. Recently, a mutation in the gene encoding transferrin receptor-2 (exon 6, nucleotide 750 C --> G; Y250X) was detected by a PCR-restriction fragment length polymorphism (RFLP) method in Sicilians with hemochromatosis. We describe a modification of the original assay in which the sequence-specific priming PCR assay does not require the use of restriction endonuclease. The modified assay is robust and cost-efficient, and may be more useful for large-scale population studies because it can be performed rapidly on DNA extracted from buccal swabs.

  6. Microchip-based one step DNA extraction and real-time PCR in one chamber for rapid pathogen identification.

    Science.gov (United States)

    Lee, Jeong-Gun; Cheong, Kwang Ho; Huh, Nam; Kim, Suhyeon; Choi, Jeong-Woo; Ko, Christopher

    2006-07-01

    Optimal detection of a pathogen present in biological samples depends on the ability to extract DNA molecules rapidly and efficiently. In this paper, we report a novel method for efficient DNA extraction and subsequent real-time detection in a single microchip by combining laser irradiation and magnetic beads. By using a 808 nm laser and carboxyl-terminated magnetic beads, we demonstrate that a single pulse of 40 seconds lysed pathogens including E. coli and Gram-positive bacterial cells as well as the hepatitis B virus mixed with human serum. We further demonstrate that the real-time pathogen detection was performed with pre-mixed PCR reagents in a real-time PCR machine using the same microchip, after laser irradiation in a hand-held device equipped with a small laser diode. These results suggest that the new sample preparation method is well suited to be integrated into lab-on-a-chip application of the pathogen detection system.

  7. Nested PCR for Rapid Detection of Mumps Virus in Cerebrospinal Fluid from Patients with Neurological Diseases

    Science.gov (United States)

    Poggio, Gustavo Palacios; Rodriguez, Claudia; Cisterna, Daniel; Freire, María Cecilia; Cello, Jerónimo

    2000-01-01

    In this study, we have developed a reverse transcription (RT)-nested polymerase chain reaction (n-PCR) for the detection of mumps virus RNA in cerebrospinal fluid (CSF) from patients with neurological infections. A specific 112-bp fragment was amplified by this method with primers from the nucleoprotein of the mumps virus genome. The mumps virus RT–n-PCR was capable of detecting 0.001 PFU/ml and 0.005 50% tissue culture infective dose/ml. This method was found to be specific, since no PCR product was detected in each of the CSF samples from patients with proven non-mumps virus-related meningitis or encephalitis. Mumps virus RNA was detected in all 18 CSF samples confirmed by culture to be infected with mumps virus. Positive PCR results were obtained for the CSF of 26 of 28 patients that were positive for signs of mumps virus infection (i.e., cultivable virus from urine or oropharyngeal samples or positivity for anti-mumps virus immunoglobulin M) but without cultivable virus in their CSF. Overall, mumps virus RNA was detected in CSF of 96% of the patients with a clinical diagnosis of viral central nervous system (CNS) disease and confirmed mumps virus infection, while mumps virus was isolated in CSF of only 39% of the patients. Furthermore, in a retrospective study, we were able to detect mumps virus RNA in 25 of 55 (46%) CSF samples from patients with a clinical diagnosis of viral CNS disease and negative laboratory evidence of viral infection including mumps virus infection. The 25 patients represent 12% of the 236 patients who had a clinical diagnosis of viral CNS infections and whose CSF was examined at our laboratory for a 2-year period. The findings confirm the importance of mumps virus as a causative agent of CNS infections in countries with low vaccine coverage rates. In summary, our study demonstrates the usefulness of the mumps virus RT–n-PCR for the diagnosis of mumps virus CNS disease and suggests that this assay may soon become the “gold standard

  8. Engineering Biological C-H Functionalization Leads to Allele-Specific Regulation of Histone Demethylases.

    Science.gov (United States)

    Breski, Megan; Dey, Debasis; Obringer, Sara; Sudhamalla, Babu; Islam, Kabirul

    2016-10-06

    Oxidative C-H hydroxylation of methyl groups, followed by their removal from DNA, RNA or histones, is an epigenetic process critical to transcriptional reprogramming and cell fate determination. This reaction is catalyzed by Fe(II)-dependent dioxygenases using the essential metabolite 2-ketoglutarate (2KG) as a cofactor. Given that the human genome encodes for more than 60 2KG-dependent dioxygenases, assigning their individual functions remains a significant challenge. Here we describe a protein-ligand interface engineering approach to break the biochemical degeneracy of these enzymes. Using histone lysine demethylase 4 (KDM4) as a proof-of-concept, we show that the enzyme active site can be expanded to employ bulky 2KG analogues that do not sensitize wild type demethylases. We establish the orthogonality, substrate specificity and catalytic competency of the engineered demethylation apparatus in biochemical assays. We further demonstrate demethylation of cognate substrates in physiologically relevant settings. Our results provide a para-digm for rapid and conditional manipulation of histone deme-thylases to uncloak their isoform-specific functions.

  9. Rapid identification of Campylobacter jejuni from poultry carcasses and slaughtering environment samples by real-time PCR.

    Science.gov (United States)

    Ivanova, Mirena; Singh, Randhir; Dharmasena, Muthu; Gong, Chao; Krastanov, Albert; Jiang, Xiuping

    2014-06-01

    The objective of this study was to develop a real-time PCR assay for rapid identification of Campylobacter jejuni and to apply the method in analyzing samples from poultry processing. A C. jejuni-specific primer set targeting a portion of the C. jejuni hippuricase gene was developed. The specificity of the newly designed primer pair was verified using 5 C. jejuni strains and 20 other bacterial strains. Sensitivity was determined to be as low as 1 genome copy per reaction. A total of 73 samples were collected at different sites along the processing line during 2 visits to a poultry slaughterhouse and were examined by direct plating onto modified charcoal cefoperazone deoxycholate agar or after enrichment in Bolton broth followed by plating on modified charcoal cefoperazone deoxycholate agar. The newly developed real-time PCR assay was used to identify the presumptive colonies as belonging to C. jejuni. A real-time PCR assay targeting 16S ribosomal RNA was also applied to determine Campylobacter spp. prevalence. Results from the real-time PCR analysis indicated considerable variability in Campylobacter contamination, with incidence rates of 72.7 and 27.6% for sampling days A and B, respectively. Campylobacter was isolated from 100% of prescalded and preeviscerated carcasses on sampling day A. In contrast, on sampling day B, the highest number of Campylobacter-positive carcasses was recovered after evisceration (60%). The chilling process significantly reduced (P Campylobacter population, but the percentage of positive samples on sampling day A increased to 80%. All samples collected from the processing environment, except scalding tank 3 and the prechiller and chiller tanks, were 100% positive on day A, whereas no campylobacters were isolated from machinery on sampling day B. Our results revealed the widespread of C. jejuni in poultry processing and proved that the newly developed real-time PCR assay is a simple, specific, and inexpensive method for rapid C. jejuni

  10. Rapid detection and differentiation of important Campylobacter spp. in poultry samples by dot blot and PCR.

    Science.gov (United States)

    Fontanot, Marco; Iacumin, Lucilla; Cecchini, Francesca; Comi, Giuseppe; Manzano, Marisa

    2014-10-01

    The detection of Campylobacter, the most commonly reported cause of foodborne gastroenteritis in the European Union, is very important for human health. The most commonly recognised risk factor for infection is the handling and/or consumption of undercooked poultry meat. The methods typically applied to evaluate the presence/absence of Campylobacter in food samples are direct plating and/or enrichment culture based on the Horizontal Method for Detection and Enumeration of Campylobacter spp. (ISO 10272-1B: 2006) and PCR. Molecular methods also allow for the detection of cells that are viable but cannot be cultivated on agar media and that decrease the time required for species identification. The current study proposes the use of two molecular methods for species identification: dot blot and PCR. The dot blot method had a sensitivity of 25 ng for detection of DNA extracted from a pure culture using a digoxigenin-labelled probe for hybridisation; the target DNA was extracted from the enrichment broth at 24 h. PCR was performed using a pair of sensitive and specific primers for the detection of Campylobacter jejuni and Campylobacter coli after 24 h of enrichment in Preston broth. The initial samples were contaminated by 5 × 10 C. jejuni cells/g and 1.5 × 10(2)C. coli cells/g, thus the number of cells present in the enrichment broth at 0 h was 1 or 3 cell/g, respectively. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. PCR approach for rapid detection of Escherichia coli in tempe using a specific primer

    Directory of Open Access Journals (Sweden)

    Siti Harnina Bintari

    2014-12-01

    Full Text Available Tempe known as a traditional fermented food originated from Indonesia. It has a unique flavour and texture. It also contains high protein and usually serves to substitute meat, fish, or egg as a complement to rice. The manufacture process of Tempe is quite complex and mostly, the traditional process has not employed the hygienic standard. In the process of Tempe making, there are two critical stages of the whole process; i.e. soaking of soybeans and solid state fermentation by Rhizopus sp. During the process, foodborne pathogen bacteria such as Escherichia coli could contaminate the product of Tempe. The bacterial contamination could be revealed through culture dependent methods which is costly, laborious, and time consuming. Therefore, the culture-independent method such as polymerase chain reaction using a specific primer could be applied to detect target microorganism to save time and labour. In this study, thirty-one Tempe samples collected from different manufacturers in Semarang, Central Java, Indonesia were analysed by PCR. In order to obtain the bacterial genomic DNA, a modified Chelex 100-Microwave method was employed. The results of DNA extraction showed that the method was an applicable method. It gave high quantity and quality of DNA; therefore, it could be applied in the PCR reaction. The DNA samples were employed in PCR for detection of Escherichia coli using Ecoli706F/R. It was found that 27 out of 31 samples were detected having Escherichia coli contamination showed by the presence of the amplified product size 706 bp. The application of this method could significantly reduce costs and time of analysis in the laboratory. Further response after E. coli were detected could be employed, including investigation of the critical factors in Tempe manufacturing process which allowed E. coli contamination.

  12. Solid-phase PCR for rapid multiplex detection of Salmonella spp. at the subspecies level, with amplification efficiency comparable to conventional PCR

    DEFF Research Database (Denmark)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas

    2017-01-01

    Solid-phase PCR (SP-PCR) has attracted considerable interest in different research fields since it allows parallel DNA amplification on the surface of a solid substrate. However, the applications of SP-PCR have been hampered by the low efficiency of the solid-phase amplification. In order...

  13. Rapid detection of human parechoviruses in clinical samples by real-time PCR

    NARCIS (Netherlands)

    Benschop, Kimberley; Molenkamp, Richard; van der Ham, Alwin; Wolthers, Katja; Beld, Marcel

    2008-01-01

    BACKGROUND: Human parechoviruses (HPeVs) have been associated with severe conditions such as neonatal sepsis and meningitis in young children. Rapid identification of an infectious agent in such serious conditions in these patients is essential for adequate decision making regarding treatment and

  14. Rapid detection and simultaneous genotyping of Cronobacter spp. (formerly Enterobacter sakazakii) in powdered infant formula using real-time PCR and high resolution melting (HRM) analysis

    National Research Council Canada - National Science Library

    Cai, Xian-Quan; Yu, Hai-Qiong; Ruan, Zhou-Xi; Yang, Lei-Liang; Bai, Jian-Shan; Qiu, De-Yi; Jian, Zhi-Hua; Xiao, Yi-Qian; Yang, Jie-Yang; Le, Thanh Hoa; Zhu, Xing-Quan

    2013-01-01

    .... The present study developed an assay integrating real-time PCR and high resolution melting (HRM) analysis targeting the OmpA gene for the specific detection and rapid identification of Cronobacter spp...

  15. Rapid Detection and Simultaneous Genotyping of Cronobacter spp. (formerly Enterobacter sakazakii) in Powdered Infant Formula Using Real-time PCR and High Resolution Melting (HRM) Analysis: e67082

    National Research Council Canada - National Science Library

    Xian-Quan Cai; Hai-Qiong Yu; Zhou-Xi Ruan; Lei-Liang Yang; Jian-Shan Bai; De-Yi Qiu; Zhi-Hua Jian; Yi-Qian Xiao; Jie-Yang Yang; Thanh Hoa Le; Xing-Quan Zhu

    2013-01-01

    .... The present study developed an assay integrating real-time PCR and high resolution melting (HRM) analysis targeting the OmpA gene for the specific detection and rapid identification of Cronobacter spp...

  16. Rapid detection of Salmonella in pet food: design and evaluation of integrated methods based on real-time PCR detection.

    Science.gov (United States)

    Balachandran, Priya; Friberg, Maria; Vanlandingham, V; Kozak, K; Manolis, Amanda; Brevnov, Maxim; Crowley, Erin; Bird, Patrick; Goins, David; Furtado, Manohar R; Petrauskene, Olga V; Tebbs, Robert S; Charbonneau, Duane

    2012-02-01

    Reducing the risk of Salmonella contamination in pet food is critical for both companion animals and humans, and its importance is reflected by the substantial increase in the demand for pathogen testing. Accurate and rapid detection of foodborne pathogens improves food safety, protects the public health, and benefits food producers by assuring product quality while facilitating product release in a timely manner. Traditional culture-based methods for Salmonella screening are laborious and can take 5 to 7 days to obtain definitive results. In this study, we developed two methods for the detection of low levels of Salmonella in pet food using real-time PCR: (i) detection of Salmonella in 25 g of dried pet food in less than 14 h with an automated magnetic bead-based nucleic acid extraction method and (ii) detection of Salmonella in 375 g of composite dry pet food matrix in less than 24 h with a manual centrifugation-based nucleic acid preparation method. Both methods included a preclarification step using a novel protocol that removes food matrix-associated debris and PCR inhibitors and improves the sensitivity of detection. Validation studies revealed no significant differences between the two real-time PCR methods and the standard U.S. Food and Drug Administration Bacteriological Analytical Manual (chapter 5) culture confirmation method.

  17. Rapid and Accurate Identification by Real-Time PCR of Biotoxin-Producing Dinoflagellates from the Family Gymnodiniaceae

    Directory of Open Access Journals (Sweden)

    Kirsty F. Smith

    2014-03-01

    Full Text Available The identification of toxin-producing dinoflagellates for monitoring programmes and bio-compound discovery requires considerable taxonomic expertise. It can also be difficult to morphologically differentiate toxic and non-toxic species or strains. Various molecular methods have been used for dinoflagellate identification and detection, and this study describes the development of eight real-time polymerase chain reaction (PCR assays targeting the large subunit ribosomal RNA (LSU rRNA gene of species from the genera Gymnodinium, Karenia, Karlodinium, and Takayama. Assays proved to be highly specific and sensitive, and the assay for G. catenatum was further developed for quantification in response to a bloom in Manukau Harbour, New Zealand. The assay estimated cell densities from environmental samples as low as 0.07 cells per PCR reaction, which equated to three cells per litre. This assay not only enabled conclusive species identification but also detected the presence of cells below the limit of detection for light microscopy. This study demonstrates the usefulness of real-time PCR as a sensitive and rapid molecular technique for the detection and quantification of micro-algae from environmental samples.

  18. Rapid assembly of multiple DNA fragments through direct transformation of PCR products into E. coli and Lactobacillus.

    Science.gov (United States)

    Cao, Pinghua; Wang, Lei; Zhou, Guangxian; Wang, Yaoyue; Chen, Yulin

    2014-11-01

    This article describes a rapid, highly efficient and versatile method for seamlessly assembling multiple DNA fragments into a vector at any desired position. The inserted fragments and vector backbone were amplified by high-fidelity PCR containing 20 bp to 50 bp overlapping regions at 3' and/or 5' termini. These linearised fragments were equimolarly mixed, and then cyclised in a prolonged overlap extension PCR without adding primers. The resulting PCR products were DNA multimers that could be directly transformed into host strains, yielding the desired chimeric plasmid. The proposed method was illustrated by constructing an Escherichia coli co-expression vector. The feasibility of the method in Lactobacillus was further validated by assembling an E. coli-Lactobacillus shuttle vector. Results showed that three to four fragments could be simultaneously and precisely inserted in a vector in only 2-3 days using the proposed method. The acceptable transformation efficiency was determined through the tested host strains; more than 95% of the colonies were positive transformants. Therefore, the proposed method is sufficiently competent for high-efficiency insertion of multiple DNA fragments into a plasmid and has theoretically good application potential for gene cloning and protein expression because it is simple, easy to implement, flexible and yields highly positive clones. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Rapid detection and identification of 12 respiratory viruses using a dual priming oligonucleotide system-based multiplex PCR assay.

    Science.gov (United States)

    Kim, Suk Ran; Ki, Chang-Seok; Lee, Nam Yong

    2009-03-01

    Acute viral respiratory infections are among the most common causes of human disease. Rapid and accurate diagnosis of viral respiratory infections is important for providing timely therapeutic interventions. This study evaluated a new multiplex PCR assay (Seegene Inc., Seoul, Korea) for simultaneous detection and identification of 12 respiratory viruses using two primer mixes. The viruses included parainfluenza viruses 1, 2, and 3, human metapneumovirus, human coronavirus 229E/NL63 and OC43, adenovirus, influenza viruses A and B, human respiratory syncytial viruses A and B, and human rhinovirus A. The analytical sensitivity of the assay was 10-100 copies per reaction for each type of virus. There was no cross-reactivity with common bacterial or viral pathogens. A comparison with conventional viral culture and immunofluorescence was carried out using 101 respiratory specimens from 92 patients. Using viral culture, 57 specimens (56.4%) were positive without co-infection. The same viruses were identified in all 57 specimens using the multiplex PCR. Seven of the 57 specimens (12.3%) were found to be co-infected with other respiratory viruses, and 19 of 44 (43.2%) specimens which were negative by culture were positive by the multiplex PCR. The Seeplex Respiratory Virus Detection assay represents a significant improvement over the conventional methods for the detection of a broad spectrum of respiratory viruses.

  20. Rapid restriction enzyme-free cloning of PCR products: a high-throughput method applicable for library construction.

    Directory of Open Access Journals (Sweden)

    Vijay K Chaudhary

    Full Text Available Herein, we describe a novel cloning strategy for PCR-amplified DNA which employs the type IIs restriction endonuclease BsaI to create a linearized vector with four base-long 5'-overhangs, and T4 DNA polymerase treatment of the insert in presence of a single dNTP to create vector-compatible four base-long overhangs. Notably, the insert preparation does not require any restriction enzyme treatment. The BsaI sites in the vector are oriented in such a manner that upon digestion with BsaI, a stuffer sequence along with both BsaI recognition sequences is removed. The sequence of the four base-long overhangs produced by BsaI cleavage were designed to be non-palindromic, non-compatible to each other. Therefore, only ligation of an insert carrying compatible ends allows directional cloning of the insert to the vector to generate a recombinant without recreating the BsaI sites. We also developed rapid protocols for insert preparation and cloning, by which the entire process from PCR to transformation can be completed in 6-8 h and DNA fragments ranging in size from 200 to 2200 bp can be cloned with equal efficiencies. One protocol uses a single tube for insert preparation if amplification is performed using polymerases with low 3'-exonuclease activity. The other protocol is compatible with any thermostable polymerase, including those with high 3'-exonuclease activity, and does not significantly increase the time required for cloning. The suitability of this method for high-throughput cloning was demonstrated by cloning batches of 24 PCR products with nearly 100% efficiency. The cloning strategy is also suitable for high efficiency cloning and was used to construct large libraries comprising more than 108 clones/µg vector. Additionally, based on this strategy, a variety of vectors were constructed for the expression of proteins in E. coli, enabling large number of different clones to be rapidly generated.

  1. A new real-time PCR method for rapid and specific detection of ling (Molva molva).

    Science.gov (United States)

    Taboada, Ledicia; Sánchez, Ana; Sotelo, Carmen G

    2017-08-01

    Seafood fraud - often involving substitution of one species by another - has attracted much attention as it is prevalent worldwide. Whilst DNA analysis has helped to combat this type of fraud some of the methods currently in use are time-consuming and require sophisticated equipment or highly-trained personnel. This work describes the development of a new, real-time PCR TaqMan assay for the detection of ling (Molva molva) in seafood products. For this purpose, specific primers and a minor groove binding (MGB) TaqMan probe were designed to amplify the 81bp region on the cyt b gene. Efficiency, specificity and cross-reactivity assays showed statistically significant differences between the average Ct value obtained for Molva molva DNA (19.45±0.65) and the average Ct for non-target species DNA (38.3±2.8), even with closely related species such as Molva dypterygia (34.9±0.09). The proposed methodology has been validated with 31 commercial samples. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Rapid concentration and sensitive detection of hookworm ova from wastewater matrices using a real-time PCR method.

    Science.gov (United States)

    Gyawali, P; Sidhu, J P S; Ahmed, W; Jagals, P; Toze, S

    2015-12-01

    The risk of human hookworm infections from land application of wastewater matrices could be high in regions with high hookworm prevalence. A rapid, sensitive and specific hookworm detection method from wastewater matrices is required in order to assess human health risks. Currently available methods used to identify hookworm ova to the species level are time consuming and lack accuracy. In this study, a real-time PCR method was developed for the rapid, sensitive and specific detection of canine hookworm (Ancylostoma caninum) ova from wastewater matrices. A. caninum was chosen because of its morphological similarity to the human hookworm (Ancylostoma duodenale and Necator americanus). The newly developed PCR method has high detection sensitivity with the ability to detect less than one A. caninum ova from 1 L of secondary treated wastewater at the mean threshold cycle (CT) values ranging from 30.1 to 34.3. The method is also able to detect four A. caninum ova from 1 L of raw wastewater and from ∼4 g of treated sludge with mean CT values ranging from 35.6 to 39.8 and 39.8 to 39.9, respectively. The better detection sensitivity obtained for secondary treated wastewater compared to raw wastewater and sludge samples could be attributed to sample turbidity. The proposed method appears to be rapid, sensitive and specific compared to traditional methods and has potential to aid in the public health risk assessment associated with land application of wastewater matrices. Furthermore, the method can be adapted to detect other helminth ova of interest from wastewater matrices. Crown Copyright © 2015. Published by Elsevier Inc. All rights reserved.

  3. An insulated isothermal PCR method on a field-deployable device for rapid and sensitive detection of canine parvovirus type 2 at points of need.

    Science.gov (United States)

    Wilkes, Rebecca P; Lee, Pei-Yu A; Tsai, Yun-Long; Tsai, Chuan-Fu; Chang, Hsiu-Hui; Chang, Hsiao-Fen G; Wang, Hwa-Tang T

    2015-08-01

    Canine parvovirus type 2 (CPV-2), including subtypes 2a, 2b and 2c, causes an acute enteric disease in both domestic and wild animals. Rapid and sensitive diagnosis aids effective disease management at points of need (PON). A commercially available, field-deployable and user-friendly system, designed with insulated isothermal PCR (iiPCR) technology, displays excellent sensitivity and specificity for nucleic acid detection. An iiPCR method was developed for on-site detection of all circulating CPV-2 strains. Limit of detection was determined using plasmid DNA. CPV-2a, 2b and 2c strains, a feline panleukopenia virus (FPV) strain, and nine canine pathogens were tested to evaluate assay specificity. Reaction sensitivity and performance were compared with an in-house real-time PCR using serial dilutions of a CPV-2b strain and 100 canine fecal clinical samples collected from 2010 to 2014, respectively. The 95% limit of detection of the iiPCR method was 13 copies of standard DNA and detection limits for CPV-2b DNA were equivalent for iiPCR and real-time PCR. The iiPCR reaction detected CPV-2a, 2b and 2c and FPV. Non-targeted pathogens were not detected. Test results of real-time PCR and iiPCR from 99 fecal samples agreed with each other, while one real-time PCR-positive sample tested negative by iiPCR. Therefore, excellent agreement (k = 0.98) with sensitivity of 98.41% and specificity of 100% in detecting CPV-2 in feces was found between the two methods. In conclusion, the iiPCR system has potential to serve as a useful tool for rapid and accurate PON, molecular detection of CPV-2. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  4. [Rapid identification of Riemerella anatipestifer on the basis of specific PCR amplifying 16S rDNA].

    Science.gov (United States)

    Qu, Feng-fa; Cai, Chang; Zheng, Xian-jin; Zhang, Da-bing

    2006-02-01

    which were probably infected with RA were chosen to identify the accuracy and sensitivity of this PCR method. Several other conventional detecting methods including bacteria isolating, differentiating culture, biochemical experiments and serotyping were used at the same time. The templates of PCR were extracted from brains or livers by boiling method with Chelex 100. Finally, 3 cases were identified as RA infection by the conventional methods and 4 by the PCR method, which proved the good accuracy and sensitivity of the PCR method. Thus, this PCR assay provides a rapid and accurate method for identification of Riemerella anatipestifer. It will help to make the final decision in clinical diagnose or species identification, especially when a new serotype or sub-serotype of RA comes up.

  5. Reverse transcription-PCR-electrospray ionization mass spectrometry for rapid detection of biothreat and common respiratory pathogens.

    Science.gov (United States)

    Jeng, Kevin; Hardick, Justin; Rothman, Richard; Yang, Samuel; Won, Helen; Peterson, Stephen; Hsieh, Yu-Hsiang; Masek, Billie Jo; Carroll, Karen C; Gaydos, Charlotte A

    2013-10-01

    Electrospray ionization mass spectrometry (ESI-MS) analysis of reverse transcription (RT)-PCR amplicons from human respiratory samples allows for broad pathogen identification approximately 8 h after collection. We investigated the performance characteristics of a high-throughput RT-PCR-coupled ESI-MS assay for distinguishing biothreat (BT) agents from common bacterial, fungal, and viral respiratory pathogens in bronchoalveolar lavage (BAL) fluid specimens from subjects with suspected respiratory infections. In a retrospective case series, 202 BAL fluid specimens were collected at the Johns Hopkins Hospital between August 2010 and February 2011 from patients with suspected acute respiratory infections. Samples were processed using standard bacterial, viral, and fungal testing in the clinical microbiology laboratory as part of routine care and then were blindly spiked with either water or nucleic acids from BT organisms (Bacillus anthracis, Yersinia pestis, Francisella tularensis, Brucella spp., Burkholderia spp., and Rickettsia prowazekii) and tested by RT-PCR-ESI-MS. The sensitivities and specificities of RT-PCR-ESI-MS versus standard clinical methods were as follows: for mock BT DNA, 98.5% sensitivity (95% confidence interval [CI], 94.2 to 99.7%) and 100% specificity (95% CI, 93.1 to 100.0%); for bacterial pathogens, 81.8% sensitivity (95% CI, 74.3 to 87.6%) and 73.6% specificity (95% CI, 64.2 to 81.4%); for viral pathogens, 93.3% sensitivity (95% CI, 66.0 to 99.7%) and 97.3% specificity (95% CI, 89.7 to 99.5%); for fungal pathogens, 42.6% sensitivity (95% CI, 29.5 to 56.7%) and 97.8% specificity (95% CI, 91.8 to 99.6%). Our data suggest that RT-PCR-ESI-MS is a useful adjunct to standard culture protocols for rapid detection of both BT and common respiratory pathogens; further study is required for assay validation, especially for fungal detection, and potential implementation.

  6. Development and application of a reverse transcriptase droplet digital PCR (RT-ddPCR) for sensitive and rapid detection of Japanese encephalitis virus.

    Science.gov (United States)

    Wu, Xulong; Lin, Hua; Chen, Shijie; Xiao, Lu; Yang, Miao; An, Wei; Wang, Yin; Yao, Xueping; Yang, Zexiao

    2017-10-01

    Japanese encephalitis (JE) is one of the most common zoonoses caused by Japanese encephalitis virus (JEV). Droplet digital PCR (ddPCR) is a novel sensitive, accurate method that enables absolute quantitation without the need for calibration curves. The aim of this study was to develop a RT-ddPCR method to detect JEV, and to compare its sensitivity with real-time TaqMan RT-PCR by analysis of clinical samples. The methods of JEV real-time RT-PCR and RT-ddPCR were established and optimal reaction conditions were confirmed. Each method was evaluated for linearity, limit of detection and specificity. A total of 103 porcine samples were analysed by both methods and the detection rate was calculated. Both methods showed a high degree of linearity and positive correlation for standards (R(2)≥0.999). The assays indicated that the detection limit for RT-ddPCR was approximately 2 copies/20μL well, a 100-fold greater sensitivity than TaqMan real-time RT-PCR. The detection results for clinical samples showed that the positive detection rate of RT-ddPCR (27.2%) was higher than that of TaqMan real-time RT-PCR (16.5%). The cross-reaction was performed with other porcine pathogens, and negative amplification of the cross-reaction assay demonstrated the high specificity of this method. The novel JEV RT-ddPCR assay could be used as an efficient molecular biology tool to diagnose JEV, which would facilitate the surveillance of reproductive failure disease in swineries and would be beneficial for public health security. Copyright © 2017. Published by Elsevier B.V.

  7. Rapid PCR Detection of Staphylococcus aureus Clonal Complex 398 by Targeting the Restriction-Modification System Carrying sau1-hsdS1

    NARCIS (Netherlands)

    Stegger, M.; Lindsay, J.A.; Moodley, A.; Skov, R.; Broens, E.M.; Guardabassi, L.

    2011-01-01

    A PCR targeting sau1-hsdS1 was developed for rapid detection of Staphylococcus aureus clonal complex 398 (CC398). High sensitivity (100%) and specificity (100%) were shown by evaluating the test on a large strain collection (n = 1,307). We recommend this test for accurate, rapid, and inexpensive

  8. Have you tried spermine? A rapid and cost-effective method to eliminate dextran sodium sulfate inhibition of PCR and RT-PCR.

    Science.gov (United States)

    Krych, Łukasz; Kot, Witold; Bendtsen, Katja M B; Hansen, Axel K; Vogensen, Finn K; Nielsen, Dennis S

    2018-01-01

    The Dextran Sulfate Sodium (DSS) induced colitis mouse model is commonly used to investigate human inflammatory bowel disease (IBD). Nucleic acid extracts originating from these animals are often contaminated with DSS, which is a strong inhibitor of many enzymatic based molecular biology reactions including PCR and reverse-transcription (RT). Methods for removing DSS from nucleic acids extracts exist for RNA, but no effective protocol for DNA or cDNA is currently available. However, spermine has previously been shown to be an effective agent for counteracting DSS inhibition of polynucleotide kinase, which led to the hypothesis, that spermine could be used to counteract DSS inhibition of PCR and RT. We investigated the means of adding spermine in an adequate concentration to PCR based protocols (including qPCR, two-step RT-qPCR, and amplicon sequencing library preparation) to remove DSS inhibition. Within the range up to 0.01g/L, spermine can be added to PCR/qPCR or RT prophylactically without a significant reduction of reaction efficiency. Addition of spermine at the concentration of 0.08g/L can be used to recover qualitative PCR signal inhibited by DSS in concentrations up to 0.32g/L. For optimal quantitative analysis, the concentration of spermine requires fine adjustment. Hence, we present here a simple fluorometric based method for adjusting the concentration of spermine ensuring an optimal efficiency of the reaction exposed to an unknown concentration of DSS. In conclusion, we demonstrate a cost effective and easy method to counteract DSS inhibition in PCR and two-step RT-qPCR. Fixed or fine-tuned concentrations of spermine can be administered depending on the qualitative or quantitative character of the analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. A new real-time PCR assay for rapid identification of the S. aureus/MRSA strains

    Directory of Open Access Journals (Sweden)

    Ivan Manga

    2013-01-01

    Full Text Available The Methicillin-resistant Staphylococcus aureus (MRSA with the livestock-associated MRSA (LA-MRSA are of great interest to scientists and general public. The aim of our study was to present a new more rapid and reliable diagnostic method working on the RT-PCR platform applicable for monitoring of MRSA/S. aureus. The parallel testing of the S. aureus specific nuc gene sequence and the mecA gene sequence was utilised for this purpose. A collection of ten S. aureus/MRSA reference strains, fifteen genetically related non S. aureus reference strains and fifty-six environmental samples was employed for estimation of the assay performance and parameters. The environmental samples acquired in the Czech livestock farms were represented with the livestock and human nasal mucosae or skin swabs, the slaughter meat swabs and were chosen preferentially from individuals with previously confi rmed or suspected positive MRSA/S. aureus cases. The classic selective cultivation approach with the biochemical test and agar disk diffusion test was accepted as reference diagnostic method. As there were no culture positive samples that were negative using RT-PCR, our method featured with 100% sensitivity in comparison to reference method. The limit of detection allowed to identify from tens to hundreds copies of S. aureus/MRSA genome. Further, the RT-PCR assay featured with 100% inclusivity and 95% exclusivity at Cq value below 30. These parameters suggested on powerful and reliable diagnostic method with real potential of practical utilisation. We consider our method as ideal for testing of individual suspected colonies, when the results can be acquired in less than 1.5 hour.

  10. Evaluation of a rapid, quantitative real-time PCR method for enumeration of pathogenic Candida cells in water

    Science.gov (United States)

    Brinkman, Nichole E.; Haugland, Richard A.; Wymer, Larry J.; Byappanahalli, Muruleedhara N.; Whitman, Richard L.; Vesper, Stephen J.

    2003-01-01

    Quantitative PCR (QPCR) technology, incorporating fluorigenic 5′ nuclease (TaqMan) chemistry, was utilized for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C. lusitaniae) in water. Known numbers of target cells were added to distilled and tap water samples, filtered, and disrupted directly on the membranes for recovery of DNA for QPCR analysis. The assay's sensitivities were between one and three cells per filter. The accuracy of the cell estimates was between 50 and 200% of their true value (95% confidence level). In similar tests with surface water samples, the presence of PCR inhibitory compounds necessitated further purification and/or dilution of the DNA extracts, with resultant reductions in sensitivity but generally not in quantitative accuracy. Analyses of a series of freshwater samples collected from a recreational beach showed positive correlations between the QPCR results and colony counts of the corresponding target species. Positive correlations were also seen between the cell quantities of the target Candida species detected in these analyses and colony counts of Enterococcus organisms. With a combined sample processing and analysis time of less than 4 h, this method shows great promise as a tool for rapidly assessing potential exposures to waterborne pathogenic Candida species from drinking and recreational waters and may have applications in the detection of fecal pollution.

  11. Economic Impact of a New Rapid PCR Assay for Detecting Influenza Virus in an Emergency Department and Hospitalized Patients.

    Science.gov (United States)

    Soto, Marcelo; Sampietro-Colom, Laura; Vilella, Anna; Pantoja, Efraín; Asenjo, María; Arjona, Ruth; Hurtado, Juan Carlos; Trilla, Antoni; Alvarez-Martínez, Míriam José; Mira, Aurea; Vila, Jordi; Marcos, María Angeles

    2016-01-01

    Seasonal influenza causes significant morbidity and mortality and has a substantial economic impact on the healthcare system. The main objective of this study was to compare the cost per patient for a rapid commercial PCR assay (Xpert® Flu) with an in-house real-time PCR test for detecting influenza virus. Community patients with influenza like-illness attending the Emergency Department (ED) as well as hospitalized patients in the Hospital Clínic of Barcelona were included. Costs were evaluated from the perspective of the hospital considering the use of resources directly related to influenza testing and treatment. For the purpose of this study, 366 and 691 patients were tested in 2013 and 2014, respectively. The Xpert® Flu test reduced the mean waiting time for patients in the ED by 9.1 hours and decreased the mean isolation time of hospitalized patients by 23.7 hours. This was associated with a 103€ (or about $113) reduction in the cost per patient tested in the ED and 64€ ($70) per hospitalized patient. Sensitivity analyses showed that Xpert® Flu is likely to be cost-saving in hospitals with different contexts and prices.

  12. Loop-mediated isothermal amplification (LAMP) as an alternative to PCR: A rapid on-site detection of gene doping.

    Science.gov (United States)

    Salamin, Olivier; Kuuranne, Tiia; Saugy, Martial; Leuenberger, Nicolas

    2017-10-17

    Innovation in medical research has been diverted at multiple occasions to enhance human performance. The predicted great progress in gene therapy has raised some concerns regarding its misuse in the world of sports (gene doping) for several years now. Even though there is no evidence that gene doping has ever been used in sports, the continuous improvement of gene therapy techniques increases the likelihood of abuse. Therefore, since 2004, efforts have been invested by the anti-doping community and WADA for the development of detection methods. Several nested PCR and qPCR-based strategies exploiting the absence of introns in the transgenic DNA have been proposed for the long-term detection of transgene in blood. Despite their great sensitivity, those protocols are hampered by limitations of the techniques that can be cumbersome and costly. The purpose of this perspective is to describe a new approach based on loop-mediated isothermal amplification (LAMP) for the detection of gene doping. This protocol enables a rapid and simple method to amplify nucleic acids with a high sensitivity and specificity and with a simple visual detection of the results. LAMP is already being used in clinical application for the detection of viruses or mutations. Therefore, this technique has the potential to be further developed for the detection of foreign genetic material in elite athletes. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  13. A rapid Q-PCR titration protocol for adenovirus and helper-dependent adenovirus vectors that produces biologically relevant results

    Science.gov (United States)

    Gallaher, Sean D.; Berk, Arnold J.

    2013-01-01

    Adenoviruses are employed in the study of cellular processes and as expression vectors used in gene therapy. The success and reproducibility of these studies is dependent in part on having accurate and meaningful titers of replication competent and helper-dependent adenovirus stocks, which is problematic due to the use of varied and divergent titration protocols. Physical titration methods, which quantify the total number of viral particles, are used by many, but are poor at estimating activity. Biological titration methods, such as plaque assays, are more biologically relevant, but are time consuming and not applicable to helper-dependent gene therapy vectors. To address this, a protocol was developed called “infectious genome titration” in which viral DNA is isolated from the nuclei of cells ~3 h post-infection, and then quantified by Q-PCR. This approach ensures that only biologically active virions are counted as part of the titer determination. This approach is rapid, robust, sensitive, reproducible, and applicable to all forms of adenovirus. Unlike other Q-PCR-based methods, titers determined by this protocol are well correlated with biological activity. PMID:23624118

  14. Comparison of concentration methods for rapid detection of hookworm ova in wastewater matrices using quantitative PCR.

    Science.gov (United States)

    Gyawali, P; Ahmed, W; Jagals, P; Sidhu, J P S; Toze, S

    2015-12-01

    Hookworm infection contributes around 700 million infections worldwide especially in developing nations due to increased use of wastewater for crop production. The effective recovery of hookworm ova from wastewater matrices is difficult due to their low concentrations and heterogeneous distribution. In this study, we compared the recovery rates of (i) four rapid hookworm ova concentration methods from municipal wastewater, and (ii) two concentration methods from sludge samples. Ancylostoma caninum ova were used as surrogate for human hookworm (Ancylostoma duodenale and Necator americanus). Known concentration of A. caninum hookworm ova were seeded into wastewater (treated and raw) and sludge samples collected from two wastewater treatment plants (WWTPs) in Brisbane and Perth, Australia. The A. caninum ova were concentrated from treated and raw wastewater samples using centrifugation (Method A), hollow fiber ultrafiltration (HFUF) (Method B), filtration (Method C) and flotation (Method D) methods. For sludge samples, flotation (Method E) and direct DNA extraction (Method F) methods were used. Among the four methods tested, filtration (Method C) method was able to recover higher concentrations of A. caninum ova consistently from treated wastewater (39-50%) and raw wastewater (7.1-12%) samples collected from both WWTPs. The remaining methods (Methods A, B and D) yielded variable recovery rate ranging from 0.2 to 40% for treated and raw wastewater samples. The recovery rates for sludge samples were poor (0.02-4.7), although, Method F (direct DNA extraction) provided 1-2 orders of magnitude higher recovery rate than Method E (flotation). Based on our results it can be concluded that the recovery rates of hookworm ova from wastewater matrices, especially sludge samples, can be poor and highly variable. Therefore, choice of concentration method is vital for the sensitive detection of hookworm ova in wastewater matrices. Crown Copyright © 2015. Published by Elsevier

  15. Real-time PCR-based method for the rapid detection of extended RAS mutations using bridged nucleic acids in colorectal cancer.

    Science.gov (United States)

    Iida, Takao; Mizuno, Yukie; Kaizaki, Yasuharu

    2017-10-27

    Mutations in RAS and BRAF are predictors of the efficacy of anti-epidermal growth factor receptor (EGFR) therapy in patients with metastatic colorectal cancer (mCRC). Therefore, simple, rapid, cost-effective methods to detect these mutations in the clinical setting are greatly needed. In the present study, we evaluated BNA Real-time PCR Mutation Detection Kit Extended RAS (BNA Real-time PCR), a real-time PCR method that uses bridged nucleic acid clamping technology to rapidly detect mutations in RAS exons 2-4 and BRAF exon 15. Genomic DNA was extracted from 54 formalin-fixed paraffin-embedded (FFPE) tissue samples obtained from mCRC patients. Among the 54 FFPE samples, BNA Real-time PCR detected 21 RAS mutations (38.9%) and 5 BRAF mutations (9.3%), and the reference assay (KRAS Mutation Detection Kit and MEBGEN™ RASKET KIT) detected 22 RAS mutations (40.7%). The concordance rate of detected RAS mutations between the BNA Real-time PCR assay and the reference assays was 98.2% (53/54). The BNA Real-time PCR assay proved to be a more simple, rapid, and cost-effective method for detecting KRAS and RAS mutations compared with existing assays. These findings suggest that BNA Real-time PCR is a valuable tool for predicting the efficacy of early anti-EGFR therapy in mCRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Single-Step qPCR and dPCR Detection of Diverse CRISPR-Cas9 Gene Editing Events In Vivo

    Directory of Open Access Journals (Sweden)

    Micol Falabella

    2017-10-01

    Full Text Available Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR-CRISPR-associated protein 9 (Cas9-based technology is currently the most flexible means to create targeted mutations by recombination or indel mutations by nonhomologous end joining. During mouse transgenesis, recombinant and indel alleles are often pursued simultaneously. Multiple alleles can be formed in each animal to create significant genetic complexity that complicates the CRISPR-Cas9 approach and analysis. Currently, there are no rapid methods to measure the extent of on-site editing with broad mutation sensitivity. In this study, we demonstrate the allelic diversity arising from targeted CRISPR editing in founder mice. Using this DNA sample collection, we validated specific quantitative and digital PCR methods (qPCR and dPCR, respectively for measuring the frequency of on-target editing in founder mice. We found that locked nucleic acid (LNA probes combined with an internal reference probe (Drop-Off Assay provide accurate measurements of editing rates. The Drop-Off LNA Assay also detected on-target CRISPR-Cas9 gene editing in blastocysts with a sensitivity comparable to PCR-clone sequencing. Lastly, we demonstrate that the allele-specific LNA probes used in qPCR competitor assays can accurately detect recombinant mutations in founder mice. In summary, we show that LNA-based qPCR and dPCR assays provide a rapid method for quantifying the extent of on-target genome editing in vivo, testing RNA guides, and detecting recombinant mutations.

  17. Single-Step qPCR and dPCR Detection of Diverse CRISPR-Cas9 Gene Editing Events in Vivo

    Science.gov (United States)

    Falabella, Micol; Sun, Linqing; Barr, Justin; Pena, Andressa Z.; Kershaw, Erin E.; Gingras, Sebastien; Goncharova, Elena A.; Kaufman, Brett A.

    2017-01-01

    Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR-associated protein 9 (Cas9)-based technology is currently the most flexible means to create targeted mutations by recombination or indel mutations by nonhomologous end joining. During mouse transgenesis, recombinant and indel alleles are often pursued simultaneously. Multiple alleles can be formed in each animal to create significant genetic complexity that complicates the CRISPR-Cas9 approach and analysis. Currently, there are no rapid methods to measure the extent of on-site editing with broad mutation sensitivity. In this study, we demonstrate the allelic diversity arising from targeted CRISPR editing in founder mice. Using this DNA sample collection, we validated specific quantitative and digital PCR methods (qPCR and dPCR, respectively) for measuring the frequency of on-target editing in founder mice. We found that locked nucleic acid (LNA) probes combined with an internal reference probe (Drop-Off Assay) provide accurate measurements of editing rates. The Drop-Off LNA Assay also detected on-target CRISPR-Cas9 gene editing in blastocysts with a sensitivity comparable to PCR-clone sequencing. Lastly, we demonstrate that the allele-specific LNA probes used in qPCR competitor assays can accurately detect recombinant mutations in founder mice. In summary, we show that LNA-based qPCR and dPCR assays provide a rapid method for quantifying the extent of on-target genome editing in vivo, testing RNA guides, and detecting recombinant mutations. PMID:28860183

  18. Solid-phase PCR for rapid multiplex detection of Salmonella spp. at the subspecies level, with amplification efficiency comparable to conventional PCR.

    Science.gov (United States)

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas; Hung, Tran Quang; Wolff, Anders; Bang, Dang Duong

    2017-04-01

    Solid-phase PCR (SP-PCR) has attracted considerable interest in different research fields since it allows parallel DNA amplification on the surface of a solid substrate. However, the applications of SP-PCR have been hampered by the low efficiency of the solid-phase amplification. In order to increase the yield of the solid-phase amplification, we studied various parameters including the length, the density, as well as the annealing position of the solid support primer. A dramatic increase in the signal-to-noise (S/N) ratio was observed when increasing the length of solid support primers from 45 to 80 bp. The density of the primer on the surface was found to be important for the S/N ratio of the SP-PCR, and the optimal S/N was obtained with a density of 1.49 × 1011 molecules/mm2. In addition, the use of solid support primers with a short overhang at the 5' end would help improve the S/N ratio of the SP-PCR. With optimized conditions, SP-PCR can achieve amplification efficiency comparable to conventional PCR, with a limit of detection of 1.5 copies/μl (37.5 copies/reaction). These improvements will pave the way for wider applications of SP-PCR in various fields such as clinical diagnosis, high-throughput DNA sequencing, and single-nucleotide polymorphism analysis. Graphical abstract Schematic representation of solid-phase PCR.

  19. Advantage of whole exome sequencing over allele-specific and targeted segment sequencing in detection of novel TULP1 mutation in leber congenital amaurosis

    DEFF Research Database (Denmark)

    Guo, Yiran; Prokudin, Ivan; Yu, Cong

    2015-01-01

    . A broader next-generation sequencing (NGS) strategy, such as whole exome sequencing, provides an improved molecular genetic diagnostic capacity for patients with these conditions.Materials and Methods: In a child with LCA, an allele-specific assay analyzing 135 known LCA-causing variations, followed......Background: Leber congenital amaurosis (LCA) is a severe form of retinal dystrophy with marked underlying genetic heterogeneity. Until recently, allele-specific assays and Sanger sequencing of targeted segments were the only available approaches for attempted genetic diagnosis in this condition......Eff to annotate the variants.Results: No disease-causing variants were found using the allele-specific or targeted segment Sanger sequencing assays. Analysis of variants in the exome sequence data revealed a novel homozygous nonsense mutation (c.1081C > T, p.Arg361) in TULP1, a gene with roles in photoreceptor...

  20. Advantage of using allele-specific copy numbers when testing for association in regions with common copy number variants.

    Directory of Open Access Journals (Sweden)

    Gaëlle Marenne

    Full Text Available Copy number variants (CNV can be called from SNP-arrays; however, few studies have attempted to combine both CNV and SNP calls to test for association with complex diseases. Even when SNPs are located within CNVs, two separate association analyses are necessary, to compare the distribution of bi-allelic genotypes in cases and controls (referred to as SNP-only strategy and the number of copies of a region (referred to as CNV-only strategy. However, when disease susceptibility is actually associated with allele specific copy-number states, the two strategies may not yield comparable results, raising a series of questions about the optimal analytical approach. We performed simulations of the performance of association testing under different scenarios that varied genotype frequencies and inheritance models. We show that the SNP-only strategy lacks power under most scenarios when the SNP is located within a CNV; frequently it is excluded from analysis as it does not pass quality control metrics either because of an increased rate of missing calls or a departure from fitness for Hardy-Weinberg proportion. The CNV-only strategy also lacks power because the association testing depends on the allele which copy number varies. The combined strategy performs well in most of the scenarios. Hence, we advocate the use of this combined strategy when testing for association with SNPs located within CNVs.

  1. Cardiac troponin T mutations result in allele-specific phenotypes in a mouse model for hypertrophic cardiomyopathy

    Science.gov (United States)

    Tardiff, Jil C.; Hewett, Timothy E.; Palmer, Bradley M.; Olsson, Charlotte; Factor, Stephen M.; Moore, Russell L.; Robbins, Jeffrey; Leinwand, Leslie A.

    1999-01-01

    Multiple mutations in cardiac troponin T (cTnT) can cause familial hypertrophic cardiomyopathy (FHC). Patients with cTnT mutations generally exhibit mild or no ventricular hypertrophy, yet demonstrate a high frequency of early sudden death. To understand the functional basis of these phenotypes, we created transgenic mouse lines expressing 30%, 67%, and 92% of their total cTnT as a missense (R92Q) allele analogous to one found in FHC. Similar to a mouse FHC model expressing a truncated cTnT protein, the left ventricles of all R92Q lines are smaller than those of wild-type. In striking contrast to truncation mice, however, the R92Q hearts demonstrate significant induction of atrial natriuretic factor and β-myosin heavy chain transcripts, interstitial fibrosis, and mitochondrial pathology. Isolated cardiac myocytes from R92Q mice have increased basal sarcomeric activation, impaired relaxation, and shorter sarcomere lengths. Isolated working heart data are consistent, showing hypercontractility and diastolic dysfunction, both of which are common findings in patients with FHC. These mice represent the first disease model to exhibit hypercontractility, as well as a unique model system for exploring the cellular pathogenesis of FHC. The distinct phenotypes of mice with different TnT alleles suggest that the clinical heterogeneity of FHC is at least partially due to allele-specific mechanisms. J. Clin. Invest. 104:469-481 (1999). PMID:10449439

  2. Allele-specific suppression of mutant huntingtin using antisense oligonucleotides: providing a therapeutic option for all Huntington disease patients.

    Directory of Open Access Journals (Sweden)

    Niels H Skotte

    Full Text Available Huntington disease (HD is an inherited, fatal neurodegenerative disorder caused by a CAG repeat expansion in the huntingtin gene. The mutant protein causes neuronal dysfunction and degeneration resulting in motor dysfunction, cognitive decline, and psychiatric disturbances. Currently, there is no disease altering treatment, and symptomatic therapy has limited benefit. The pathogenesis of HD is complicated and multiple pathways are compromised. Addressing the problem at its genetic root by suppressing mutant huntingtin expression is a promising therapeutic strategy for HD. We have developed and evaluated antisense oligonucleotides (ASOs targeting single nucleotide polymorphisms that are significantly enriched on HD alleles (HD-SNPs. We describe our structure-activity relationship studies for ASO design and find that adjusting the SNP position within the gap, chemical modifications of the wings, and shortening the unmodified gap are critical for potent, specific, and well tolerated silencing of mutant huntingtin. Finally, we show that using two distinct ASO drugs targeting the two allelic variants of an HD-SNP could provide a therapeutic option for all persons with HD; allele-specifically for roughly half, and non-specifically for the remainder.

  3. Allele-specific suppression of mutant huntingtin using antisense oligonucleotides: providing a therapeutic option for all Huntington disease patients.

    Science.gov (United States)

    Skotte, Niels H; Southwell, Amber L; Østergaard, Michael E; Carroll, Jeffrey B; Warby, Simon C; Doty, Crystal N; Petoukhov, Eugenia; Vaid, Kuljeet; Kordasiewicz, Holly; Watt, Andrew T; Freier, Susan M; Hung, Gene; Seth, Punit P; Bennett, C Frank; Swayze, Eric E; Hayden, Michael R

    2014-01-01

    Huntington disease (HD) is an inherited, fatal neurodegenerative disorder caused by a CAG repeat expansion in the huntingtin gene. The mutant protein causes neuronal dysfunction and degeneration resulting in motor dysfunction, cognitive decline, and psychiatric disturbances. Currently, there is no disease altering treatment, and symptomatic therapy has limited benefit. The pathogenesis of HD is complicated and multiple pathways are compromised. Addressing the problem at its genetic root by suppressing mutant huntingtin expression is a promising therapeutic strategy for HD. We have developed and evaluated antisense oligonucleotides (ASOs) targeting single nucleotide polymorphisms that are significantly enriched on HD alleles (HD-SNPs). We describe our structure-activity relationship studies for ASO design and find that adjusting the SNP position within the gap, chemical modifications of the wings, and shortening the unmodified gap are critical for potent, specific, and well tolerated silencing of mutant huntingtin. Finally, we show that using two distinct ASO drugs targeting the two allelic variants of an HD-SNP could provide a therapeutic option for all persons with HD; allele-specifically for roughly half, and non-specifically for the remainder.

  4. Allelome.PRO, a pipeline to define allele-specific genomic features from high-throughput sequencing data.

    Science.gov (United States)

    Andergassen, Daniel; Dotter, Christoph P; Kulinski, Tomasz M; Guenzl, Philipp M; Bammer, Philipp C; Barlow, Denise P; Pauler, Florian M; Hudson, Quanah J

    2015-12-02

    Detecting allelic biases from high-throughput sequencing data requires an approach that maximises sensitivity while minimizing false positives. Here, we present Allelome.PRO, an automated user-friendly bioinformatics pipeline, which uses high-throughput sequencing data from reciprocal crosses of two genetically distinct mouse strains to detect allele-specific expression and chromatin modifications. Allelome.PRO extends approaches used in previous studies that exclusively analyzed imprinted expression to give a complete picture of the 'allelome' by automatically categorising the allelic expression of all genes in a given cell type into imprinted, strain-biased, biallelic or non-informative. Allelome.PRO offers increased sensitivity to analyze lowly expressed transcripts, together with a robust false discovery rate empirically calculated from variation in the sequencing data. We used RNA-seq data from mouse embryonic fibroblasts from F1 reciprocal crosses to determine a biologically relevant allelic ratio cutoff, and define for the first time an entire allelome. Furthermore, we show that Allelome.PRO detects differential enrichment of H3K4me3 over promoters from ChIP-seq data validating the RNA-seq results. This approach can be easily extended to analyze histone marks of active enhancers, or transcription factor binding sites and therefore provides a powerful tool to identify candidate cis regulatory elements genome wide. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Rapid Detection and Differentiation of Clonorchis sinensis and Opisthorchis viverrini Using Real-Time PCR and High Resolution Melting Analysis

    Directory of Open Access Journals (Sweden)

    Xian-Quan Cai

    2014-01-01

    Full Text Available Clonorchis sinensis and Opisthorchis viverrini are both important fish-borne pathogens, causing serious public health problem in Asia. The present study developed an assay integrating real-time PCR and high resolution melting (HRM analysis for the specific detection and rapid identification of C. sinensis and O. viverrini. Primers targeting COX1 gene were highly specific for these liver flukes, as evidenced by the negative amplification of closely related trematodes. Assays using genomic DNA extracted from the two flukes yielded specific amplification and their identity was confirmed by sequencing, having the accuracy of 100% in reference to conventional methods. The assay was proved to be highly sensitive with a detection limit below 1 pg of purified genomic DNA, 5 EPG, or 1 metacercaria of C. sinensis. Moreover, C. sinensis and O. viverrini were able to be differentiated by their HRM profiles. The method can reduce labor of microscopic examination and the contamination of agarose electrophoresis. Moreover, it can differentiate these two flukes which are difficult to be distinguished using other methods. The established method provides an alternative tool for rapid, simple, and duplex detection of C. sinensis and O. viverrini.

  6. Accurate and rapid identification of the Burkholderia pseudomallei near-neighbour, Burkholderia ubonensis, using real-time PCR.

    Science.gov (United States)

    Price, Erin P; Sarovich, Derek S; Webb, Jessica R; Ginther, Jennifer L; Mayo, Mark; Cook, James M; Seymour, Meagan L; Kaestli, Mirjam; Theobald, Vanessa; Hall, Carina M; Busch, Joseph D; Foster, Jeffrey T; Keim, Paul; Wagner, David M; Tuanyok, Apichai; Pearson, Talima; Currie, Bart J

    2013-01-01

    Burkholderia ubonensis is an environmental bacterium belonging to the Burkholderia cepacia complex (Bcc), a group of genetically related organisms that are associated with opportunistic but generally nonfatal infections in healthy individuals. In contrast, the near-neighbour species Burkholderia pseudomallei causes melioidosis, a disease that can be fatal in up to 95% of cases if left untreated. B. ubonensis is frequently misidentified as B. pseudomallei from soil samples using selective culturing on Ashdown's medium, reflecting both the shared environmental niche and morphological similarities of these species. Additionally, B. ubonensis shows potential as an important biocontrol agent in B. pseudomallei-endemic regions as certain strains possess antagonistic properties towards B. pseudomallei. Current methods for characterising B. ubonensis are laborious, time-consuming and costly, and as such this bacterium remains poorly studied. The aim of our study was to develop a rapid and inexpensive real-time PCR-based assay specific for B. ubonensis. We demonstrate that a novel B. ubonensis-specific assay, Bu550, accurately differentiates B. ubonensis from B. pseudomallei and other species that grow on selective Ashdown's agar. We anticipate that Bu550 will catalyse research on B. ubonensis by enabling rapid identification of this organism from Ashdown's-positive colonies that are not B. pseudomallei.

  7. Accurate and rapid identification of the Burkholderia pseudomallei near-neighbour, Burkholderia ubonensis, using real-time PCR.

    Directory of Open Access Journals (Sweden)

    Erin P Price

    Full Text Available Burkholderia ubonensis is an environmental bacterium belonging to the Burkholderia cepacia complex (Bcc, a group of genetically related organisms that are associated with opportunistic but generally nonfatal infections in healthy individuals. In contrast, the near-neighbour species Burkholderia pseudomallei causes melioidosis, a disease that can be fatal in up to 95% of cases if left untreated. B. ubonensis is frequently misidentified as B. pseudomallei from soil samples using selective culturing on Ashdown's medium, reflecting both the shared environmental niche and morphological similarities of these species. Additionally, B. ubonensis shows potential as an important biocontrol agent in B. pseudomallei-endemic regions as certain strains possess antagonistic properties towards B. pseudomallei. Current methods for characterising B. ubonensis are laborious, time-consuming and costly, and as such this bacterium remains poorly studied. The aim of our study was to develop a rapid and inexpensive real-time PCR-based assay specific for B. ubonensis. We demonstrate that a novel B. ubonensis-specific assay, Bu550, accurately differentiates B. ubonensis from B. pseudomallei and other species that grow on selective Ashdown's agar. We anticipate that Bu550 will catalyse research on B. ubonensis by enabling rapid identification of this organism from Ashdown's-positive colonies that are not B. pseudomallei.

  8. Allele-specific analysis of cell fusion-mediated pluripotent reprograming reveals distinct and predictive susceptibilities of human X-linked genes to reactivation.

    Science.gov (United States)

    Cantone, Irene; Dharmalingam, Gopuraja; Chan, Yi-Wah; Kohler, Anne-Celine; Lenhard, Boris; Merkenschlager, Matthias; Fisher, Amanda G

    2017-01-25

    Inactivation of one X chromosome is established early in female mammalian development and can be reversed in vivo and in vitro when pluripotency factors are re-expressed. The extent of reactivation along the inactive X chromosome (Xi) and the determinants of locus susceptibility are, however, poorly understood. Here we use cell fusion-mediated pluripotent reprograming to study human Xi reactivation and allele-specific single nucleotide polymorphisms (SNPs) to identify reactivated loci. We show that a subset of human Xi genes is rapidly reactivated upon re-expression of the pluripotency network. These genes lie within the most evolutionary recent segments of the human X chromosome that are depleted of LINE1 and enriched for SINE elements, predicted to impair XIST spreading. Interestingly, this cadre of genes displays stochastic Xi expression in human fibroblasts ahead of reprograming. This stochastic variability is evident between clones, by RNA-sequencing, and at the single-cell level, by RNA-FISH, and is not attributable to differences in repressive histone H3K9me3 or H3K27me3 levels. Treatment with the DNA demethylating agent 5-deoxy-azacytidine does not increase Xi expression ahead of reprograming, but instead reveals a second cadre of genes that only become susceptible to reactivation upon induction of pluripotency. Collectively, these data not only underscore the multiple pathways that contribute to maintaining silencing along the human Xi chromosome but also suggest that transcriptional stochasticity among human cells could be useful for predicting and engineering epigenetic strategies to achieve locus-specific or domain-specific human Xi gene reactivation.

  9. A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    DEFF Research Database (Denmark)

    Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen Skotte

    2013-01-01

    We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting...... steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence...

  10. A novel temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    DEFF Research Database (Denmark)

    Bu, Minqiang; R. Perch-Nielsen, Ivan; Sørensen, Karen Skotte

    We present a new temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with external heater and temperature sensor. The method employs optimized temperature overshooting and undershooting...... steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature dependent fluorescence...

  11. Rapid detection of coliforms in drinking water of Arak city using multiplex PCR method in comparison with the standard method of culture (Most Probably Number)

    OpenAIRE

    fatemeh, Dehghan; Reza, Zolfaghari Mohammad; Mohammad, Arjomandzadegan; Salomeh, Kalantari; Reza, Ahmari Gholam; Hossein, Sarmadian; Maryam, Sadrnia; Azam, Ahmadi; Mana, Shojapoor; Negin, Najarian; Reza, Kasravi Alii; Saeed, Falahat

    2014-01-01

    Objective: To analyse molecular detection of coliforms and shorten the time of PCR. Methods: Rapid detection of coliforms by amplification of lacZ and uidA genes in a multiplex PCR reaction was designed and performed in comparison with most probably number (MPN) method for 16 artificial and 101 field samples. The molecular method was also conducted on isolated coliforms from positive MPN samples; standard sample for verification of microbial method certificated reference material; isolated...

  12. Development of a simplified RT-PCR without RNA isolation for rapid detection of RNA viruses in a single small brown planthopper (Laodelphax striatellus Fallén).

    Science.gov (United States)

    Xu, Qiufang; Liu, Haoqiu; Yuan, Pingping; Zhang, Xiaoxia; Chen, Qingqing; Jiang, Xuanli; Zhou, Yijun

    2017-05-03

    The small brown planthopper (SBPH) is an important pest of cereal crops and acts as a transmission vector for multiple RNA viruses. Rapid diagnosis of virus in the vector is crucial for efficient forecast and control of viral disease. Reverse transcription polymerase chain reaction (RT-PCR) is a rapid, sensitive and reliable method for virus detection. The traditional RT-PCR contains a RNA isolation step and is widely used for virus detection in insect. However, using the traditional RT-PCR for detecting RNA virus in individual SBPHs becomes challenging because of the expensive reagents and laborious procedure associated with RNA isolation when processing a large number of samples. We established a simplified RT-PCR method without RNA isolation for RNA virus detection in a single SBPH. This method is achieved by grinding a single SBPH in sterile water and using the crude extract directly as the template for RT-PCR. The crude extract containing the virus RNA can be prepared in approximately two minutes. Rice stripe virus (RSV), rice black streaked dwarf virus (RBSDV) and Himetobi P virus (HiPV) were successfully detected using this simplified method. The detection results were validated by sequencing and dot immunobinding assay, indicating that this simplified method is reliable for detecting different viruses in insects. The evaluation of the sensitivity of this method showed that both RSV and HiPV can be detected when the cDNA from the crude extract was diluted up to 10 3 fold. Compared to the traditional RT-PCR with RNA isolation, the simplified RT-PCR method greatly reduces the sample processing time, decreases the detection cost, and improves the efficiency by avoiding RNA isolation. A simplified RT-PCR method is developed for rapid detection of RNA virus in a single SBPH without the laborious RNA isolation step. It offers a convenient alternative to the traditional RT-PCR method.

  13. Rapid quantification of viable Campylobacter on chicken carcasses by real-time PCR and propidium monoazide as a tool for quantitative risk assessment

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann; Löfström, Charlotta; Hansen, Tina Beck

    2010-01-01

    of foodborne Campylobacter, combining real-time PCR (Q-PCR) with a simple propidium monoazide (PMA) sample treatment. In less than 3 hours, this method generates a signal from only viable and viable but non-culturable (VBNC) Campylobacter with an intact membrane. The method performance was evaluated......-values (R2 = 0.993), with a quantification range from 1×1021×107 CFU/ml. The correlation between the Campylobacter counts obtained by PMA-PCR and culture on naturally contaminated chickens was high (R2 = 0.844). The amplification efficiency of the Q-PCR method was not affected by chicken rinse matrix...... or by species of Campylobacter. No Q-PCR signals were obtained from artificially inoculated chicken rinse when PMA sample treatment was applied. In conclusion, this study presents a rapid tool for producing reliable quantitative data on viable Campylobacter in chicken carcass rinse. The proposed method does...

  14. Rapid Quantification of Viable Campylobacter Bacteria on Chicken Carcasses, Using Real-Time PCR and Propidium Monoazide Treatment, as a Tool for Quantitative Risk Assessment

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann; Löfström, Charlotta; Hansen, Tina Beck

    2010-01-01

    of foodborne Campylobacter, combining real-time PCR (Q-PCR) with a simple propidium monoazide (PMA) sample treatment. In less than 3 hours, this method generates a signal from only viable and viable but non-culturable (VBNC) Campylobacter with an intact membrane. The method performance was evaluated......-values (R(2) = 0.993), with a quantification range from 1x10(2)-1x10(7) CFU/ml. The correlation between the Campylobacter counts obtained by PMA-PCR and culture on naturally contaminated chickens was high (R(2) = 0.844). The amplification efficiency of the Q-PCR method was not affected by chicken rinse...... matrix or by species of Campylobacter. No Q-PCR signals were obtained from artificially inoculated chicken rinse when PMA sample treatment was applied. In conclusion, this study presents a rapid tool for producing reliable quantitative data on viable Campylobacter in chicken carcass rinse. The proposed...

  15. Diagnostic accuracy of the ROCHE Septifast PCR system for the rapid detection of blood pathogens in neonatal sepsis-A prospective clinical trial.

    Science.gov (United States)

    Straub, Julia; Paula, Helga; Mayr, Michaela; Kasper, David; Assadian, Ojan; Berger, Angelika; Rittenschober-Böhm, Judith

    2017-01-01

    Diagnosis of neonatal sepsis remains a major challenge in neonatology. Most molecular-based methods are not customized for neonatal requirements. The aim of the present study was to assess the diagnostic accuracy of a modified multiplex PCR protocol for the detection of neonatal sepsis using small blood volumes. 212 episodes of suspected neonatal late onset sepsis were analyzed prospectively using the Roche SeptiFast® MGRADE PCR with a modified DNA extraction protocol and software-handling tool. Results were compared to blood culture, laboratory biomarkers and clinical signs of sepsis. Of 212 episodes, 85 (40.1%) were categorized as "not infected". Among these episodes, 1 was false positive by blood culture (1.2%) and 23 were false positive by PCR (27.1%). Of 51 (24.1%) episodes diagnosed as "culture proven sepsis", the same pathogen was detected by blood culture and PCR in 39 episodes (76.5%). In 8 episodes, more pathogens were detected by PCR compared to blood culture, and in 4 episodes the pathogen detected by blood culture was not found by PCR. One of these episodes was caused by Bacillus cereus, a pathogen not included in the PCR panel. In 76/212 (35.8%) episodes, clinical sepsis was diagnosed. Among these, PCR yielded positive results in 39.5% of episodes (30/76 episodes). For culture-positive sepsis, PCR showed a sensitivity of 90.2% (95%CI 86.2-94.2%) and a specificity of 72.9% (95%CI 67.0-79.0%). The Roche SeptiFast® MGRADE PCR using a modified DNA extraction protocol showed acceptable results for rapid detection of neonatal sepsis in addition to conventional blood culture. The benefit of rapid pathogen detection has to be balanced against the considerable risk of contamination, loss of information on antibiotic sensitivity pattern and increased costs.

  16. The development of a rapid SYBR one step real-time RT-PCR for detection of porcine reproductive and respiratory syndrome virus

    Science.gov (United States)

    2010-01-01

    Background Prompt detection of PRRSV in the field samples is important for effective PRRS control, thereby reducing the potentially serious economic damage which can result from an outbreak. In this study, a rapid SYBR-based, one step real-time RT-PCR quantitative reverse transcription PCR (qRT-PCR) has been developed for the detection of porcine reproductive and respiratory syndrome virus (PRRSV). Primers were designed based on the sequence of highly conservative region of PRRSV N gene. Results The sensitivity of the real-time qRT-PCR assay was achieved through PRRSV ch-1a RNA for the generation of a standard curve. The detection limit of the assay was found to be 9.6 RNA copies per reaction mixture. This assay had excellent intra- and inter-assay reproducibility as in total 65 field samples were screened for the presence of PRRSV by conventional RT-PCR in parallel with qRT-PCR, and the detection rate increased from 60.0% to 76.9%. Moreover, the specificity result indicated that this assay could reliably differentiate PRRSV from the other swine viral diseases, such as classical swine fever virus (CSFV), swine vesicular disease virus (SVDV) and vesicular exanthema of swine virus (VESV). Conclusion The real-time qRT-PCR assay described in this report allows the rapid, specific and sensitive laboratory detection of PRRSV in field samples. PMID:20459705

  17. The development of a rapid SYBR one step real-time RT-PCR for detection of porcine reproductive and respiratory syndrome virus

    Directory of Open Access Journals (Sweden)

    Liu XiangTao

    2010-05-01

    Full Text Available Abstract Background Prompt detection of PRRSV in the field samples is important for effective PRRS control, thereby reducing the potentially serious economic damage which can result from an outbreak. In this study, a rapid SYBR-based, one step real-time RT-PCR quantitative reverse transcription PCR (qRT-PCR has been developed for the detection of porcine reproductive and respiratory syndrome virus (PRRSV. Primers were designed based on the sequence of highly conservative region of PRRSV N gene. Results The sensitivity of the real-time qRT-PCR assay was achieved through PRRSV ch-1a RNA for the generation of a standard curve. The detection limit of the assay was found to be 9.6 RNA copies per reaction mixture. This assay had excellent intra- and inter-assay reproducibility as in total 65 field samples were screened for the presence of PRRSV by conventional RT-PCR in parallel with qRT-PCR, and the detection rate increased from 60.0% to 76.9%. Moreover, the specificity result indicated that this assay could reliably differentiate PRRSV from the other swine viral diseases, such as classical swine fever virus (CSFV, swine vesicular disease virus (SVDV and vesicular exanthema of swine virus (VESV. Conclusion The real-time qRT-PCR assay described in this report allows the rapid, specific and sensitive laboratory detection of PRRSV in field samples.

  18. Rapid PCR-Based Diagnosis of Septic Arthritis by Early Gram-Type Classification and Pathogen Identification▿

    Science.gov (United States)

    Yang, Samuel; Ramachandran, Padmini; Hardick, Andrew; Hsieh, Yu-Hsiang; Quianzon, Celeste; Kuroki, Marcos; Hardick, Justin; Kecojevic, Aleksandar; Abeygunawardena, Avanthi; Zenilman, Jonathan; Melendez, Johan; Doshi, Vishal; Gaydos, Charlotte; Rothman, Richard E.

    2008-01-01

    Septic arthritis (SA) is a rheumatologic emergency associated with significant morbidity and mortality. Delayed or inadequate treatment of SA can lead to irreversible joint destruction and disability. Current methods of diagnosing SA rely on synovial fluid analysis and culture which are known to be imprecise and time-consuming. We report a novel adaptation of a probe-based real-time PCR assay targeting the 16S rRNA gene for early and accurate diagnosis of bacterial SA. The assay algorithm consists of initial broad-range eubacterial detection, followed by Gram typing and species characterization of the pathogen. The platform demonstrated a high analytical sensitivity with a limit of detection of 101 CFU/ml with a panel of SA-related organisms. Gram typing and pathogen-specific probes correctly identified their respective targets in a mock test panel of 36 common clinically relevant pathogens. One hundred twenty-one clinical synovial fluid samples from patients presenting with suspected acute SA were tested. The sensitivity and specificity of the assay were 95% and 97%, respectively, versus synovial fluid culture results. Gram-typing probes correctly identified 100% of eubacterial positive samples as to gram-positive or gram-negative status, and pathogen-specific probes correctly identified the etiologic agent in 16/20 eubacterial positive samples. The total assay time from sample collection to result is 3 h. We have demonstrated that a real-time broad-based PCR assay has high analytical and clinical performance with an improved time to detection versus culture for SA. This assay may be a useful diagnostic adjunct for clinicians, particularly those practicing in the acute care setting where rapid pathogen detection and identification would assist in disposition and treatment decisions. PMID:18305128

  19. DNA microarray-based solid-phase RT-PCR for rapid detection and identification of influenza virus type A and subtypes H5 and H7

    DEFF Research Database (Denmark)

    Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

    2011-01-01

    Endemic of avian influenza virus (AIV) in Asia and epizootics in some European regions have caused considerable public concern on a possible pandemic of AIV. A rapid method for virus detection and effective surveillance in wild avian, poultry production as well as in humans is required....... In this article, a DNA microarray-based solid-phase polymerase chain reaction (PCR) approach has been developed for rapid detection of influenza virus type A and for simultaneous identification of pathogenic virus subtypes H5 and H7. This solid-phase RT-PCR method combined reverse-transcription amplification...

  20. Identification of ASF/SF2 as a critical, allele-specific effector of the cyclin D1b oncogene.

    Science.gov (United States)

    Olshavsky, Nicholas A; Comstock, Clay E S; Schiewer, Matthew J; Augello, Michael A; Hyslop, Terry; Sette, Claudio; Zhang, Jinsong; Parysek, Linda M; Knudsen, Karen E

    2010-05-15

    The cyclin D1b oncogene arises from alternative splicing of the CCND1 transcript, and harbors markedly enhanced oncogenic functions not shared by full-length cyclin D1 (cyclin D1a). Recent studies showed that cyclin D1b is selectively induced in a subset of tissues as a function of tumorigenesis; however, the underlying mechanism(s) that control tumor-specific cyclin D1b induction remain unsolved. Here, we identify the RNA-binding protein ASF/SF2 as a critical, allele-specific, disease-relevant effector of cyclin D1b production. Initially, it was observed that SF2 associates with cyclin D1b mRNA (transcript-b) in minigene analyses and with endogenous transcript in prostate cancer (PCa) cells. SF2 association was altered by the CCND1 G/A870 polymorphism, which resides in the splice donor site controlling transcript-b production. This finding was significant, as the A870 allele promotes cyclin D1b in benign prostate tissue, but in primary PCa, cyclin D1b production is independent of A870 status. Data herein provide a basis for this disparity, as tumor-associated induction of SF2 predominantly results in binding to and accumulation of G870-derived transcript-b. Finally, the relevance of SF2 function was established, as SF2 strongly correlated with cyclin D1b (but not cyclin D1a) in human PCa. Together, these studies identify a novel mechanism by which cyclin D1b is induced in cancer, and reveal significant evidence of a factor that cooperates with a risk-associated polymorphism to alter cyclin D1 isoform production. Identification of SF2 as a disease-relevant effector of cyclin D1b provides a basis for future studies designed to suppress the oncogenic alternative splicing event. (c)2010 AACR.

  1. Imprinted chromosomal domains revealed by allele-specific replication timing of the GABRB3 and GABRA5 genes

    Energy Technology Data Exchange (ETDEWEB)

    LaSalle, J.; Flint, A.; Lalande, M. [Harvard Medical School, Boston, MA (United States)] [and others

    1994-09-01

    The GABRB3 and GABRA5 genes are organized as a cluster in chromosome 15q11-q13. The genes are separated by around 100 kb and arranged in opposite transcriptional orientations. The GABA{sub A} receptor cluster lies near the Angelman and Prader-Willi loci and displays asynchronous DNA replication, suggesting that this region is subject to parental imprinting. In order to further study the association between DNA replication and imprinting, allele-specific replication was assayed by fluorescence in situ hybridization with {lambda}-phage probes from the GABRB3/A5 region and a D15Z1 satellite probe to identify the parental origin of each chromosome. The replication kinetics of each allele was determined by using a flow sorter to fractionate mitogen-stimulated lymphocytes on the basis of cell cycle progression prior to FISH analysis. These kinetic studies reveal a 50-150 kb chromosomal domain extending from the middle of the GABRB3/A5 intergenic region into the GABRA5 5{prime}-UTR which displays maternal replication in early S with paternal replication delayed until the end of S. In contrast, genomic regions on either side of this maternal early replication domain exhibit the opposite pattern with paternal before maternal replication and both alleles replicating in the latter half of S. These results indicate that the GABRB3/A5 region is divided into domains in which replication timing is determined by parental origin. In addition to a loss of asynchronous replication, organization into replication timing domains is also lost in lymphocytes from maternal and paternal uniparental disomy 15 patients suggesting that a chromosome contribution from both parents is required for the establishment of the imprinted replication domains.

  2. Infrequent detection of germline allele-specific expression of TGFBR1 in lymphoblasts and tissues of colon cancer patients.

    LENUS (Irish Health Repository)

    Guda, Kishore

    2009-06-15

    Recently, germline allele-specific expression (ASE) of the gene encoding for transforming growth factor-beta type I receptor (TGFBR1) has been proposed to be a major risk factor for cancer predisposition in the colon. Germline ASE results in a lowered expression of one of the TGFBR1 alleles (>1.5-fold), and was shown to occur in approximately 20% of informative familial and sporadic colorectal cancer (CRC) cases. In the present study, using the highly quantitative pyrosequencing technique, we estimated the frequency of ASE in TGFBR1 in a cohort of affected individuals from familial clusters of advanced colon neoplasias (cancers and adenomas with high-grade dysplasia), and also from a cohort of individuals with sporadic CRCs. Cases were considered positive for the presence of ASE if demonstrating an allelic expression ratio <0.67 or >1.5. Using RNA derived from lymphoblastoid cell lines, we find that of 46 informative Caucasian advanced colon neoplasia cases with a family history, only 2 individuals display a modest ASE, with allelic ratios of 1.65 and 1.73, respectively. Given that ASE of TGFBR1, if present, would likely be more pronounced in the colon compared with other tissues, we additionally determined the allele ratios of TGFBR1 in the RNA derived from normal-appearing colonic mucosa of sporadic CRC cases. We, however, found no evidence of ASE in any of 44 informative sporadic cases analyzed. Taken together, we find that germline ASE of TGFBR1, as assayed in lymphoblastoid and colon epithelial cells of colon cancer patients, is a relatively rare event.

  3. Identification of transcriptome SNPs for assessing allele-specific gene expression in a super-hybrid rice Xieyou9308.

    Directory of Open Access Journals (Sweden)

    Rongrong Zhai

    Full Text Available Hybridization, a common process in nature, can give rise to a vast reservoir of allelic variants. Combination of these allelic variants may result in novel patterns of gene action and is thought to contribute to heterosis. In this study, we analyzed genome-wide allele-specific gene expression (ASGE in the super-hybrid rice variety Xieyou9308 using RNA sequencing technology (RNA-Seq. We identified 9325 reliable single nucleotide polymorphisms (SNPs distributed throughout the genome. Nearly 68% of the identified polymorphisms were CT and GA SNPs between R9308 and Xieqingzao B, suggesting the existence of DNA methylation, a heritable epigenetic mark, in the parents and their F1 hybrid. Of 2793 identified transcripts with consistent allelic biases, only 480 (17% showed significant allelic biases during tillering and/or heading stages, implying that trans effects may mediate most transcriptional differences in hybrid offspring. Approximately 67% and 62% of the 480 transcripts showed R9308 allelic expression biases at tillering and heading stages, respectively. Transcripts with higher levels of gene expression in R9308 also exhibited R9308 allelic biases in the hybrid. In addition, 125 transcripts were identified with significant allelic expression biases at both stages, of which 74% showed R9308 allelic expression biases. R9308 alleles may tend to preserve their characteristic states of activity in the hybrid and may play important roles in hybrid vigor at both stages. The allelic expression of 355 transcripts was highly stage-specific, with divergent allelic expression patterns observed at different developmental stages. Many transcripts associated with stress resistance were differently regulated in the F1 hybrid. The results of this study may provide valuable insights into molecular mechanisms of heterosis.

  4. Integrative Analysis of Hereditary Nonpolyposis Colorectal Cancer: the Contribution of Allele-Specific Expression and Other Assays to Diagnostic Algorithms

    Science.gov (United States)

    De Lellis, Laura; Aceto, Gitana Maria; Curia, Maria Cristina; Catalano, Teresa; Mammarella, Sandra; Veschi, Serena; Fantini, Fabiana; Battista, Pasquale; Stigliano, Vittoria; Messerini, Luca; Mareni, Cristina; Sala, Paola; Bertario, Lucio; Radice, Paolo; Cama, Alessandro

    2013-01-01

    The identification of germline variants predisposing to hereditary nonpolyposis colorectal cancer (HNPCC) is crucial for clinical management of carriers, but several probands remain negative for such variants or bear variants of uncertain significance (VUS). Here we describe the results of integrative molecular analyses in 132 HNPCC patients providing evidences for improved genetic testing of HNPCC with traditional or next generation methods. Patients were screened for: germline allele-specific expression (ASE), nucleotide variants, rearrangements and promoter methylation of mismatch repair (MMR) genes; germline EPCAM rearrangements; tumor microsatellite instability (MSI) and immunohistochemical (IHC) MMR protein expression. Probands negative for pathogenic variants of MMR genes were screened for germline APC and MUTYH sequence variants. Most germline defects identified were sequence variants and rearrangements of MMR genes. Remarkably, altered germline ASE of MMR genes was detected in 8/22 (36.5%) probands analyzed, including 3 cases negative at other screenings. Moreover, ASE provided evidence for the pathogenic role and guided the characterization of a VUS shared by 2 additional probands. No germline MMR gene promoter methylation was observed and only one EPCAM rearrangement was detected. In several cases, tumor IHC and MSI diverged from germline screening results. Notably, APC or biallelic MUTYH germline defects were identified in 2/19 probands negative for pathogenic variants of MMR genes. Our results show that ASE complements gDNA-based analyses in the identification of MMR defects and in the characterization of VUS affecting gene expression, increasing the number of germline alterations detected. An appreciable fraction of probands negative for MMR gene variants harbors APC or MUTYH variants. These results indicate that germline ASE analysis and screening for APC and MUTYH defects should be included in HNPCC diagnostic algorithms. PMID:24278394

  5. Novel method for analysis of allele specific expression in triploid Oryzias latipes reveals consistent pattern of allele exclusion.

    Directory of Open Access Journals (Sweden)

    Tzintzuni I Garcia

    Full Text Available Assessing allele-specific gene expression (ASE on a large scale continues to be a technically challenging problem. Certain biological phenomena, such as X chromosome inactivation and parental imprinting, affect ASE most drastically by completely shutting down the expression of a whole set of alleles. Other more subtle effects on ASE are likely to be much more complex and dependent on the genetic environment and are perhaps more important to understand since they may be responsible for a significant amount of biological diversity. Tools to assess ASE in a diploid biological system are becoming more reliable. Non-diploid systems are, however, not uncommon. In humans full or partial polyploid states are regularly found in both healthy (meiotic cells, polynucleated cell types and diseased tissues (trisomies, non-disjunction events, cancerous tissues. In this work we have studied ASE in the medaka fish model system. We have developed a method for determining ASE in polyploid organisms from RNAseq data and we have implemented this method in a software tool set. As a biological model system we have used nuclear transplantation to experimentally produce artificial triploid medaka composed of three different haplomes. We measured ASE in RNA isolated from the livers of two adult, triploid medaka fish that showed a high degree of similarity. The majority of genes examined (82% shared expression more or less evenly among the three alleles in both triploids. The rest of the genes (18% displayed a wide range of ASE levels. Interestingly the majority of genes (78% displayed generally consistent ASE levels in both triploid individuals. A large contingent of these genes had the same allele entirely suppressed in both triploids. When viewed in a chromosomal context, it is revealed that these genes are from large sections of 4 chromosomes and may be indicative of some broad scale suppression of gene expression.

  6. Rapid and sensitive detection of cytokines using functionalized gold nanoparticle-based immuno-PCR, comparison with immuno-PCR and ELISA

    Czech Academy of Sciences Publication Activity Database

    Potůčková, Lucie; Franko, Filip; Bambousková, Monika; Dráber, Petr

    2011-01-01

    Roč. 371, 1-2 (2011), s. 38-47 ISSN 0022-1759 R&D Projects: GA AV ČR KAN200520701; GA MŠk 1M0506; GA MŠk LC545; GA ČR GA301/09/1826; GA ČR GAP302/10/1759; GA ČR(CZ) GD204/05/H023 Grant - others:AV ČR(CZ) M200520901 Institutional research plan: CEZ:AV0Z50520514 Keywords : immuno-PCR * nano-iPCR * nanogold particles Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.203, year: 2011

  7. Rapid identification viruses from nasal pharyngeal aspirates in acute viral respiratory infections by RT-PCR and electrospray ionization mass spectrometry.

    Science.gov (United States)

    Chen, Kuan-Fu; Rothman, Richard E; Ramachandran, Padmini; Blyn, Lawrence; Sampath, Rangarajan; Ecker, David J; Valsamakis, Alexandra; Gaydos, Charlotte A

    2011-04-01

    Diagnosis of the etiologic agent of respiratory viral infection relies traditionally on culture or antigen detection. This pilot evaluation compared performance characteristics of the RT-PCR and electrospray ionization mass spectrometry (RT-PCR/ESI-MS) platform to conventional virologic methods for identifying multiple clinically relevant respiratory viruses in nasopharyngeal aspirates. The RT-PCR/ESI-MS respiratory virus surveillance kit was designed to detect respiratory syncytial virus, influenza A and B, parainfluenza types 1-4, adenoviridae types A-F, coronaviridae, human bocavirus, and human metapneumovirus. Patients (N=192) attending an emergency department during the 2007-2008 respiratory season consented, and "excess" frozen archived nasopharyngeal aspirates were analysed; 46 were positive by conventional virology and 69 by RT-PCR/ESI-MS, among which there were six samples with multiple viral pathogens detected. The sensitivity and specificity of the assay were 89.1% and 80.3%, respectively. Additional viruses that were not identified by conventional virology assays were detected (4 human bocaviruses and 7 coronaviruses). Samples in which the RT-PCR/ESI-MS results disagreed with conventional virology were sent for analysis by a third method using a commercial RT-PCR-based assay, which can identify viruses not detectable by conventional virologic procedures. Time to first result of RT-PCR/ESI-MS was 8h. RT-PCR/ESI-MS demonstrated capacity to detect respiratory viruses identifiable and unidentifiable by conventional methods rapidly. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. Rapid virological diagnosis of central nervous system infections by use of a multiplex reverse transcription-PCR DNA microarray.

    Science.gov (United States)

    Leveque, Nicolas; Van Haecke, Adrien; Renois, Fanny; Boutolleau, David; Talmud, Deborah; Andreoletti, Laurent

    2011-11-01

    Viruses are the main etiological cause of central nervous system (CNS) infections. A rapid molecular diagnosis is recommended to improve the therapeutic management of patients. The aim of this study was to evaluate the performances of a DNA microarray, the Clart Entherpex kit (Genomica, Coslada, Spain), allowing the rapid and simultaneous detection of 9 DNA and RNA neurotropic viruses: herpes simplex virus 1 (HSV-1), HSV-2, varicella-zoster virus (VZV), cytomegalovirus (CMV), Epstein-Barr virus (EBV), human herpesvirus 6 (HHV-6), HHV-7, HHV-8, and the human enteroviruses (HEVs). This evaluation was performed with 28 samples from the European proficiency panels (Quality Control for Molecular Diagnostics [QCMD]; Glasgow, Scotland) and then with 78 cerebrospinal fluid (CSF) specimens. The majority of the QCMD results obtained by the DNA microarray were similar to those recorded by the overall QCMD participants. The main discrepant results were observed for low concentrations of HSV-2 and HEVs. From the clinical samples, the kit detected 27 of the 28 herpesvirus CNS infections and all of the 30 HEV-positive CSF samples. No false-positive result was observed among the 20 virus-negative CSF samples. The clinical sensitivity, specificity, and negative and positive predictive values of the assay were 98.3, 100, 95.2, and 100%, respectively, when the results were compared to those of commercially available PCR assays. Interestingly, HHV-7 was detected in 11 (37%) of the 30 HEV-positive CSF samples from children suffering from aseptic meningitis causing significantly longer lengths of stay at the hospital than infection with HEVs alone (2.4 versus 1.4 days; P = 0.038). In conclusion, this preliminary study showed that this DNA microarray could be a valuable molecular diagnostic tool for single and mixed DNA and RNA virus infections of the CNS.

  9. Comparison of multiplex real-time PCR and PCR-reverse blot hybridization assay for the direct and rapid detection of bacteria and antibiotic resistance determinants in positive culture bottles.

    Science.gov (United States)

    Wang, Hye-Young; Kim, Seoyong; Kim, Jungho; Park, Soon Deok; Kim, Hyo Youl; Uh, Young; Lee, Hyeyoung

    2016-09-01

    The aim of this study was to evaluate the performance of a commercially available multiplex real-time PCR assay and a PCR-reverse blot hybridization assay (PCR-REBA) for the rapid detection of bacteria and identification of antibiotic resistance genes directly from blood culture bottles and to compare the results of these molecular assays with conventional culture methods. The molecular diagnostic methods were used to evaluate 593 blood culture bottles from patients with bloodstream infections. The detection positivity of multiplex real-time PCR assay for Gram-positive bacteria, Gram-negative bacteria and Candida spp. was equivalent to PCR-REBA as 99.6 %, 99.1 % and 100 %, respectively. Using conventional bacterial cultures as the gold standard, the sensitivity, specificity, positive predictive value and negative predictive value of these two molecular methods were 99.5 % [95 % confidence interval (CI), 0.980-1.000; PReal-methicillin-resistant Staphylococcusaureus multiplex real-time PCR assay targeting the mecA gene to detect methicillin resistance was lower than that of the PCR-REBA method, detecting an overall positivity of 98.4 % (n=182; 95 % CI, 0.964-1.000; P<0.009) and 99.5 % (n=184; 95 % CI, 0.985-1.000; P<0.0001), respectively. The entire two methods take about 3 h, while results from culture can take up to 48-72 h. Therefore, the use of these two molecular methods was rapid and reliable for the characterization of causative pathogens in bloodstream infections.

  10. Rapid detection of porcine circovirus type 2 using a TaqMan-based real-time PCR

    Directory of Open Access Journals (Sweden)

    Zhang Chunling

    2010-12-01

    Full Text Available Abstract Porcine circovirus type 2 (PCV2 and the associated disease postweaning multisystemic wasting syndrome (PMWS have caused heavy losses in global agriculture in recent decades. Rapid detection of PCV2 is very important for the effective prophylaxis and treatment of PMWS. To establish a sensitive, specific assay for the detection and quantitation of PCV2, we designed and synthesized specific primers and a probe in the open reading frame 2. The assay had a wide dynamic range with excellent linearity and reliable reproducibility, and detected between 102 and 1010 copies of the genomic DNA per reaction. The coefficient of variation for Ct values varied from 0.59% to 1.05% in the same assay and from 1.9% to 4.2% in 10 different assays. The assay did not cross-react with porcine circovirus type 1, porcine reproductive and respiratory, porcine epidemic diarrhea, transmissible gastroenteritis of pigs and rotavirus. The limits of detection and quantitation were 10 and 100 copies, respectively. Using the established real-time PCR system, 39 of the 40 samples we tested were detected as positive.

  11. PCR and PCR-RFLP of the 5S-rRNA-NTS region and salvinorin A analyses for the rapid and unequivocal determination of Salvia divinorum.

    Science.gov (United States)

    Bertea, Cinzia M; Luciano, Pino; Bossi, Simone; Leoni, Francesca; Baiocchi, Claudio; Medana, Claudio; Azzolin, Chiara M M; Temporale, Giovanni; Lombardozzi, Maria Antonietta; Maffei, Massimo E

    2006-02-01

    Salvia divinorum Epling & Játiva-M. is a perennial herb belonging to the Lamiaceae family; its active ingredient, the neoclerodane diterpene salvinorin A, is a psychotropic molecule that produces hallucinations. A comparative evaluation of S. divinorum fresh and dried leaves, S. officinalis fresh leaves, and dried powdered leaves claimed to be S. divinorum was done. HPLC-MS data confirmed the presence of salvinorin A in both S. divinorun leaf extracts and the powdered leaves, whereas no salvinorin A was found in S. officinalis. The non-transcribed spacer (NTS) in the 5S-rRNA gene of all leaf samples and the dried powdered leaves was amplified by PCR using a pair of primers located at the 3' and 5' ends of the coding sequence of 5S-rRNA gene. The resulting PCR products (about 500bp for S. divinorum and 300bp for S. officinalis) were gel purified, subcloned into pGEM-T Easy vector and sequenced. By aligning the isolated nucleotide sequences, great diversities were found in the spacer region of the two species. Specific S. divinorum primers were designed on the sequence of the 5S-rRNA gene spacer region. In addition, a PCR-restriction fragment length polymorphism (PCR-RFLP) method was applied using NdeI and TaqI restriction enzymes. An NdeI site, absent in S. officinalis, was found in S. divinorum NTS region at 428-433bp. For TaqI, multiple sites (161-164, 170-173, and 217-220bp) were found in S. officinalis, whereas a unique site was found in S. divinorum (235-238bp). The results of this work show that the combined use of analytical chemical (HPLC-MS) and molecular (DNA fingerprinting) methods lead to the precise and unequivocal identification of S. divinorum.

  12. Multiplex one-step Real-time PCR by Taqman-MGB method for rapid detection of pan and H5 subtype avian influenza viruses.

    Directory of Open Access Journals (Sweden)

    Zhujun Zhang

    Full Text Available Avian influenza virus (AIV can infect a variety of avian species and mammals, leading to severe economic losses in poultry industry and posing a substantial threat to public health. Currently, traditional virus isolation and identification is inadequate for the early diagnosis because of its labor-intensive and time-consuming features. Real-time RT-PCR (RRT-PCR is an ideal method for the detection of AIV since it is highly specific, sensitive and rapid. In addition, as the new quencher MGB is used in RRT-PCR, it only needs shorter probe and helps the binding of target gene and probe. In this study, a pan-AIV RRT-PCR for the detection of all AIVs and H5-AIV RRT-PCR for detection of H5 AIV based on NP gene of AIV and HA gene of H5 AIV were successfully established using Taqman-MGB method. We tested 14 AIV strains in total and the results showed that the pan-AIV RRT-PCR can detect AIV of various HA subtypes and the H5-AIV RRT-PCR can detect H5 AIV circulating in poultry in China in recent three years, including H5 viruses of clade 7.2, clade 2.3.4.4 and clade 2.3.2.1. Furthermore, the multiplex detection limit for pan-AIV and H5-AIV RRT-PCR was 5 copies per reaction. When this multiplex method was applied in the detection of experimental and live poultry market samples, the detection rates of pan-AIV and H5 AIV in RRT-PCR were both higher than the routine virus isolation method with embryonated chicken eggs. The multiplex RRT-PCR method established in our study showed high sensitivity, reproducibility and specificity, suggesting the promising application of our method for surveillance of both pan AIV and prevalent H5 AIV in live poultry markets and clinical samples.

  13. Impact of pre-existing MSP142-allele specific immunity on potency of an erythrocytic Plasmodium falciparum vaccine

    Directory of Open Access Journals (Sweden)

    Bergmann-Leitner Elke S

    2012-09-01

    Full Text Available Abstract Background MSP1 is the major surface protein on merozoites and a prime candidate for a blood stage malaria vaccine. Preclinical and seroepidemiological studies have implicated antibodies to MSP1 in protection against blood stage parasitaemia and/or reduced parasite densities, respectively. Malaria endemic areas have multiple strains of Plasmodium falciparum circulating at any given time, giving rise to complex immune responses, an issue which is generally not addressed in clinical trials conducted in non-endemic areas. A lack of understanding of the effect of pre-existing immunity to heterologous parasite strains may significantly contribute to vaccine failure in the field. The purpose of this study was to model the effect of pre-existing immunity to MSP142 on the immunogenicity of blood-stage malaria vaccines based on alternative MSP1 alleles. Methods Inbred and outbred mice were immunized with various recombinant P. falciparum MSP142 proteins that represent the two major alleles of MSP142, MAD20 (3D7 and Wellcome (K1, FVO. Humoral immune responses were analysed by ELISA and LuminexTM, and functional activity of induced MSP142-specific antibodies was assessed by growth inhibition assays. T-cell responses were characterized using ex vivo ELISpot assays. Results Analysis of the immune responses induced by various immunization regimens demonstrated a strong allele-specific response at the T cell level in both inbred and outbred mice. The success of heterologous regimens depended on the degree of homology of the N-terminal p33 portion of the MSP142, likely due to the fact that most T cell epitopes reside in this part of the molecule. Analysis of humoral immune responses revealed a marked cross-reactivity between the alleles. Functional analyses showed that some of the heterologous regimens induced antibodies with improved growth inhibitory activities. Conclusion The development of a more broadly efficacious MSP1 based vaccine may be

  14. Identifying breast cancer risk loci by global differential allele-specific expression (DASE analysis in mammary epithelial transcriptome

    Directory of Open Access Journals (Sweden)

    Gao Chuan

    2012-10-01

    Full Text Available Abstract Background The significant mortality associated with breast cancer (BCa suggests a need to improve current research strategies to identify new genes that predispose women to breast cancer. Differential allele-specific expression (DASE has been shown to contribute to phenotypic variables in humans and recently to the pathogenesis of cancer. We previously reported that nonsense-mediated mRNA decay (NMD could lead to DASE of BRCA1/2, which is associated with elevated susceptibility to breast cancer. In addition to truncation mutations, multiple genetic and epigenetic factors can contribute to DASE, and we propose that DASE is a functional index for cis-acting regulatory variants and pathogenic mutations, and that global analysis of DASE in breast cancer precursor tissues can be used to identify novel causative alleles for breast cancer susceptibility. Results To test our hypothesis, we employed the Illumina® Omni1-Quad BeadChip in paired genomic DNA (gDNA and double-stranded cDNA (ds-cDNA samples prepared from eight BCa patient-derived normal mammary epithelial lines (HMEC. We filtered original array data according to heterozygous genotype calls and calculated DASE values using the Log ratio of cDNA allele intensity, which was normalized to the corresponding gDNA. We developed two statistical methods, SNP- and gene-based approaches, which allowed us to identify a list of 60 candidate DASE loci (DASE ≥ 2.00, P ≤ 0.01, FDR ≤ 0.05 by both methods. Ingenuity Pathway Analysis of DASE loci revealed one major breast cancer-relevant interaction network, which includes two known cancer causative genes, ZNF331 (DASE = 2.31, P = 0.0018, FDR = 0.040 and USP6 (DASE = 4.80, P = 0.0013, FDR = 0.013, and a breast cancer causative gene, DMBT1 (DASE=2.03, P = 0.0017, FDR = 0.014. Sequence analysis of a 5′ RACE product of DMBT1 demonstrated that rs2981745, a putative breast cancer risk locus, appears to be one of the causal variants leading to DASE

  15. Genotyping of the 19-bp insertion/deletion polymorphism in the 5' flank of beta-hydroxylase gene by dissociation analysis of allele-specific PCR products

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Werge, Thomas

    2005-01-01

    DNA fragments. Mistyping of heterozygote samples due to preferential allele amplification was prevented by use of an optimized concentration of Mg(2+), addition of dimethyl sulfoxide and annealing/extension at an appropriate temperature. Comparison of results achieved by the closed-tube assay...

  16. Plasmodium falciparum: in vitro chloroquine susceptibility and allele-specific PCR detection of Pfmdr1 Asn86Tyr polymorphism in Lambarene, Gabon

    NARCIS (Netherlands)

    Grobusch, M. P.; Adagu, I. S.; Kremsner, P. G.; Warhurst, D. C.

    1998-01-01

    Plasmodium falciparum resistance to chloroquine has been described in many parts of the world particularly in Africa where malaria is endemic. High levels of chloroquine resistance in our study area, Lambarene-Gabon, has led to the use of an alternative regimen for treatment and prevention of P.

  17. Discrimination of Torymus sinensis Kamijo (Hymenoptera: Torymidae) and T. beneficus Yasumatsu et Kamijo and their hybrids by allele-specific PCR

    National Research Council Canada - National Science Library

    Yara, Kaori; Kunimi, Yasuhisa

    2009-01-01

    Torymus sinensis and Torymus beneficus (Hymenoptera: Torymidae) are, respectively, introduced and indigenous parasitoid wasps that attack the invasive chestnut gall wasp, Dryocosmus kuriphilus (Hymenoptera: Cynipidae) in Japan...

  18. Trisomy 7 mosaicism at amniocentesis: Interphase FISH, QF-PCR, and aCGH analyses on uncultured amniocytes for rapid distinguishing of true mosaicism from pseudomosaicism

    Directory of Open Access Journals (Sweden)

    Chih-Ping Chen

    2012-03-01

    Conclusion: Interphase FISH, QF-PCR, and aCGH analyses on uncultured amniocytes are useful for rapid distinguishing of true mosaicism from pseudomosaicism for trisomy 7 at amniocentesis. Cord blood sampling for confirmation of fetal trisomy 7 mosaicism is not practical.

  19. Development of a rapid, cost-effective TaqMan Real-Time PCR Assay for identification and differentiation of Coccidioides immitis and Coccidioides posadasii.

    Science.gov (United States)

    Sheff, Kelly W; York, Emily R; Driebe, Elizabeth M; Barker, Bridget M; Rounsley, Steven D; Waddell, Victor G; Beckstrom-Sternberg, Stephen M; Beckstrom-Sternberg, James S; Keim, Paul S; Engelthaler, David M

    2010-05-01

    Coccidioidomycosis is an infection caused by Coccidioides immitis or C. posadasii. We developed a TaqMan real-time PCR assay that rapidly and accurately differentiates the species. This assay can be used as a tool to improve disease surveillance, increase understanding of the natural history of the infection, and assist in clinical differentiation studies.

  20. An efficient and rapid DNA minipreparation procedure suitable for PCR/SSR and RAPD analyses in tropical forest tree species

    Directory of Open Access Journals (Sweden)

    Ana Lilia Alzate-Marin

    2009-10-01

    Full Text Available An efficient and rapid DNA minipreparation modified method for frozen samples was developed for five tropical tree species: Copaifera langsdorffii, Hymenaea courbaril, Eugenia uniflora, Tabebuia roseo alba and Cariniana estrellensis. This procedure that dispenses the use of liquid nitrogen, phenol and the addition of proteinase K, is an adaptation of the CTAB-based DNA extraction method. The modifications included the use of PVP to eliminate the polyphenols, only one chloroform-isoamyl alcohol step and the addition of RNase immediately after extraction with chloroform. The yields of the DNA samples ranged from 25.7 to 42.1 µg from 100 mg leaf tissue. The DNA samples extracted by this method were successfully used for PCR (SSR and RAPD analyses in these five and other twelve tropical tree species.Este trabalho teve como objetivo otimizar um protocolo econômico, rápido e eficaz de minipreparação de DNA genômico, para as espécies florestais Copaifera langsdorffii (Óleo de Copaíba, Hymenaea courbaril (Jatobá, Eugenia uniflora (Pitanga, Tabebuia roseo alba (Ipê Branco e Cariniana estrellensis (Jequitibá Branco. Este método é uma adaptação da técnica de extração CTAB de Doyle e Doyle (1990, o qual consiste principalmente na adição de PVP para eliminar polifenoles, somente uma etapa de extração com clorofórmio-álcool isoamílico e a adição da RNase A imediatamente após a extração com clorofórmio. O método também dispensa o uso de nitrogênio líquido, o uso do fenol e a adição de proteinase K. Os DNAs das espécies florestais extraídos apresentaram alto rendimento e boa qualidade, com rendimento de 25.7 a 42.1 µg de DNA a partir de 100 mg de tecido foliar congelado. Com este protocolo, em apenas 1 dia de trabalho, uma pessoa pode completar o isolamento do DNA de aproximadamente 50 amostras de folhas (dependendo da capacidade da centrífuga. O DNA obtido pode ser usado para métodos de análise baseados em PCR (SSR e

  1. Clinical Application of Picodroplet Digital PCR Technology for Rapid Detection of EGFR T790M in Next-Generation Sequencing Libraries and DNA from Limited Tumor Samples.

    Science.gov (United States)

    Borsu, Laetitia; Intrieri, Julie; Thampi, Linta; Yu, Helena; Riely, Gregory; Nafa, Khedoudja; Chandramohan, Raghu; Ladanyi, Marc; Arcila, Maria E

    2016-11-01

    Although next-generation sequencing (NGS) is a robust technology for comprehensive assessment of EGFR-mutant lung adenocarcinomas with acquired resistance to tyrosine kinase inhibitors, it may not provide sufficiently rapid and sensitive detection of the EGFR T790M mutation, the most clinically relevant resistance biomarker. Here, we describe a digital PCR (dPCR) assay for rapid T790M detection on aliquots of NGS libraries prepared for comprehensive profiling, fully maximizing broad genomic analysis on limited samples. Tumor DNAs from patients with EGFR-mutant lung adenocarcinomas and acquired resistance to epidermal growth factor receptor inhibitors were prepared for Memorial Sloan-Kettering-Integrated Mutation Profiling of Actionable Cancer Targets sequencing, a hybrid capture-based assay interrogating 410 cancer-related genes. Precapture library aliquots were used for rapid EGFR T790M testing by dPCR, and results were compared with NGS and locked nucleic acid-PCR Sanger sequencing (reference high sensitivity method). Seventy resistance samples showed 99% concordance with the reference high sensitivity method in accuracy studies. Input as low as 2.5 ng provided a sensitivity of 1% and improved further with increasing DNA input. dPCR on libraries required less DNA and showed better performance than direct genomic DNA. dPCR on NGS libraries is a robust and rapid approach to EGFR T790M testing, allowing most economical utilization of limited material for comprehensive assessment. The same assay can also be performed directly on any limited DNA source and cell-free DNA. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  2. Comparison of false negative rates and limits of detection following macrofoam-swab sampling of Bacillus anthracis surrogates via Rapid Viability PCR and plate culture.

    Science.gov (United States)

    Hutchison, Janine R; Piepel, Greg F; Amidan, Brett G; Hess, Becky M; Sydor, Michael A; Deatherage Kaiser, Brooke L

    2018-01-21

    We evaluated the effects of Bacillus anthracis surrogates, low surface concentrations, surface materials, and assay methods on false-negative rate (FNR) and limit of detection (LOD 95 ) for recovering Bacillus spores using a macrofoam-swab sampling procedure. Bacillus anthracis Sterne or Bacillus atrophaeus Nakamura spores were deposited over a range of low target concentrations (2 - 500 coupon -1 ) onto glass, stainless steel, vinyl tile, and plastic. Samples were assayed using a modified Rapid Viability-PCR (mRV-PCR) method and the traditional plate culture method to obtain FNR and LOD 95 results. Mean FNRs tended to be lower for mRV-PCR compared to culturing, and increased as spore concentration decreased for all surface materials. Surface material, but not B. anthracis surrogate, influenced FNRs with the mRV-PCR method. The mRV-PCR LOD 95 was lowest for glass and highest for vinyl tile. LOD 95 values overall were lower for mRV-PCR than for the culture method. This study adds to the limited data on FNR and LOD 95 for mRV-PCR and culturing methods with low concentrations of B. anthracis sampled from various surface materials by the CDC macrofoam-swab method. These are key inputs for planning characterization and clearance studies for low contamination levels of B. anthracis. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  3. Rapid detection of coliforms in drinking water of Arak city using multiplex PCR method in comparison with the standard method of culture (Most Probably Number)

    Science.gov (United States)

    Fatemeh, Dehghan; Reza, Zolfaghari Mohammad; Mohammad, Arjomandzadegan; Salomeh, Kalantari; Reza, Ahmari Gholam; Hossein, Sarmadian; Maryam, Sadrnia; Azam, Ahmadi; Mana, Shojapoor; Negin, Najarian; Reza, Kasravi Alii; Saeed, Falahat

    2014-01-01

    Objective To analyse molecular detection of coliforms and shorten the time of PCR. Methods Rapid detection of coliforms by amplification of lacZ and uidA genes in a multiplex PCR reaction was designed and performed in comparison with most probably number (MPN) method for 16 artificial and 101 field samples. The molecular method was also conducted on isolated coliforms from positive MPN samples; standard sample for verification of microbial method certificated reference material; isolated strains from certificated reference material and standard bacteria. The PCR and electrophoresis parameters were changed for reducing the operation time. Results Results of PCR for lacZ and uidA genes were similar in all of standard, operational and artificial samples and showed the 876 bp and 147 bp bands of lacZ and uidA genes by multiplex PCR. PCR results were confirmed by MPN culture method by sensitivity 86% (95% CI: 0.71-0.93). Also the total execution time, with a successful change of factors, was reduced to less than two and a half hour. Conclusions Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN. PMID:25182727

  4. Rapid detection of coliforms in drinking water of Arak city using multiplex PCR method in comparison with the standard method of culture (Most Probably Number).

    Science.gov (United States)

    Fatemeh, Dehghan; Reza, Zolfaghari Mohammad; Mohammad, Arjomandzadegan; Salomeh, Kalantari; Reza, Ahmari Gholam; Hossein, Sarmadian; Maryam, Sadrnia; Azam, Ahmadi; Mana, Shojapoor; Negin, Najarian; Reza, Kasravi Alii; Saeed, Falahat

    2014-05-01

    To analyse molecular detection of coliforms and shorten the time of PCR. Rapid detection of coliforms by amplification of lacZ and uidA genes in a multiplex PCR reaction was designed and performed in comparison with most probably number (MPN) method for 16 artificial and 101 field samples. The molecular method was also conducted on isolated coliforms from positive MPN samples; standard sample for verification of microbial method certificated reference material; isolated strains from certificated reference material and standard bacteria. The PCR and electrophoresis parameters were changed for reducing the operation time. Results of PCR for lacZ and uidA genes were similar in all of standard, operational and artificial samples and showed the 876 bp and 147 bp bands of lacZ and uidA genes by multiplex PCR. PCR results were confirmed by MPN culture method by sensitivity 86% (95% CI: 0.71-0.93). Also the total execution time, with a successful change of factors, was reduced to less than two and a half hour. Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN.

  5. Evaluation of a field-deployable reverse transcription-insulated isothermal PCR for rapid and sensitive on-site detection of Zika virus.

    Science.gov (United States)

    Carossino, Mariano; Li, Yanqiu; Lee, Pei-Yu A; Tsai, Chuan-Fu; Chou, Pin-Hsing; Williams, Dennis; Skillman, Ashley; Frank Cook, R; Brown, Grayson; Chang, Hsiao-Fen G; Wang, Hwa-Tang T; Balasuriya, Udeni B R

    2017-12-19

    The recent emergence of Zika virus (ZIKV) in Brazil and its precipitous expansion throughout the Americas has highlighted the urgent need for a rapid and reliable on-site diagnostic assay suitable for viral detection. Such point-of-need (PON), low-cost diagnostics are essential for ZIKV control in vulnerable areas with limited resources. We developed and evaluated a ZIKV-specific field-deployable RT-iiPCR reagent set targeting the E gene for rapid detection of ZIKV in ZIKV-spiked human and mosquito specimens, and compared its performance to the Center for Disease Control and Prevention (CDC) and Pan American Health Organization (PAHO) RT-qPCR assays targeting the E and NS2B genes, respectively. These assays demonstrated exclusive specificity for ZIKV (African and Asian lineages), had limits of detection ranging from 10 to 100 in vitro transcribed RNA copies/μl and detection endpoints at 10 plaque forming units/ml of infectious tissue culture fluid. Analysis of human whole blood, plasma, serum, semen, urine, and mosquito pool samples spiked with ZIKV showed an agreement of 90% (k = 0.80), 92% (k = 0.82), 95% (k = 0.86), 92% (k = 0.81), 90% (k = 0.79), and 100% (k = 1), respectively, between the RT-iiPCR assay and composite results from the reference RT-qPCR assays. Overall, the concurrence between the ZIKV RT-iiPCR and the reference RT-qPCR assays was 92% (k = 0.83). The ZIKV RT-iiPCR has a performance comparable to the reference CDC and PAHO RT-qPCR assays but provides much faster results (~1.5 h) with a field-deployable system that can be utilized as a PON diagnostic with the potential to significantly improve the quality of the health care system in vulnerable areas.

  6. Rapid and not culture-dependent assay based on multiplex PCR-SSR analysis for monitoring inoculated yeast strains in industrial wine fermentations.

    Science.gov (United States)

    Cordero-Bueso, Gustavo; Rodríguez, María Esther; Garrido, Carlos; Cantoral, Jesús Manuel

    2017-01-01

    Wine industry needs a simple method for rapid diagnosis of the dominance of inoculated strains that could be performed routinely during the fermentation process. We present a suitable, high-throughput, and low-cost method to monitor rapidly the dominance of inoculated yeast strains in industrial fermentations of red and white wines using an activated carbon cleaning pretreatment, and a rapid DNA extraction method plus multiplex PCR-SSR analysis. We apply this technique directly to samples of fermenting wines without previously isolating yeast colonies. Results are obtained in a maximum time of 4.5 h.

  7. Have you tried spermine? A rapid and cost-effective method to eliminate dextran sodium sulfate inhibition of PCR and RT-PCR

    DEFF Research Database (Denmark)

    Krych, Lukasz; Kot, Witold; Bendtsen, Katja Maria Bangsgaard

    2018-01-01

    The Dextran Sulfate Sodium (DSS) induced colitis mouse model is commonly used to investigate human inflammatory bowel disease (IBD). Nucleic acid extracts originating from these animals are often contaminated with DSS, which is a strong inhibitor of many enzymatic based molecular biology reactions...... including PCR and reverse-transcription (RT). Methods for removing DSS from nucleic acids extracts exist for RNA, but no effective protocol for DNA or cDNA is currently available. However, spermine has previously been shown to be an effective agent for counteracting DSS inhibition of polynucleotide kinase...

  8. Rapid and Efficient cDNA Library Screening by Self-Ligation ofInverse PCR Products (SLIP)

    Energy Technology Data Exchange (ETDEWEB)

    Hoskins, Roger A.; Stapleton, Mark; George, Reed A.; Yu, Charles; Wan, Kenneth H.; Carlson, Joseph W.; Celniker, Susan E.

    2005-04-22

    The production of comprehensive cDNA clone collections is an important goal of the human and model organism genome projects. cDNA sequences are used to determine the structures of transcripts, including splice junctions, polyadenylation sites, and 5' and 3' untranslated regions (UTRs). cDNA collections are also valuable resources for functional studies of genes and proteins. Expressed Sequence Tag (EST)sequencing is the method of choice for recovering cDNAs representing a majority of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a library at random, so it realizes diminishing returns as the project progresses. To drive cDNA collections toward completion new methods are needed to recover cDNAs representing specific genes and alternative transcripts, including transcripts with low expression levels. We describe a simple and effective inverse-PCR-based method for screening plasmid libraries to recover intact cDNAs for specific transcripts. We tested the method by screening libraries used in our Drosophila EST projects for 153 transcription factor genes that were not yet represented by full-length cDNAs. We recovered target-specific clones for 104 of the genes: 46 exactly match, 30 improve and 28partially match current gene annotations. Successful application of the screening method depends on cDNA library complexity and quality of the gene models. The approach should be effective for improving cDNA collections for other model organisms and the human. It also provides a simple and rapid method for isolating cDNAs of interest in any system for which plasmid cDNA libraries and complete or partial gene sequences are available.

  9. Evaluation of a rapid and completely automated real-time reverse transcriptase PCR assay for diagnosis of enteroviral meningitis.

    Science.gov (United States)

    Nolte, Frederick S; Rogers, Beverly B; Tang, Yi-Wei; Oberste, M Steven; Robinson, Christine C; Kehl, K Sue; Rand, Kenneth A; Rotbart, Harley A; Romero, Jose R; Nyquist, Ann-Christine; Persing, David H

    2011-02-01

    Nucleic acid amplification tests (NAATs) for enterovirus RNA in cerebrospinal fluid (CSF) have emerged as the new gold standard for diagnosis of enteroviral meningitis, and their use can improve the management and decrease the costs for caring for children with enteroviral meningitis. The Xpert EV assay (Cepheid, Sunnyvale, CA) is a rapid, fully automated real-time PCR test for the detection of enterovirus RNA that was approved by the U.S. Food and Drug Administration for in vitro diagnostic use in March 2007. In this multicenter trial we established the clinical performance characteristics of the Xpert EV assay in patients presenting with meningitis symptoms relative to clinical truth. Clinical truth for enteroviral meningitis was defined as clinical evidence of meningitis, the absence of another detectable pathogen in CSF, and detection of enterovirus in CSF either by two reference NAATs or by viral culture. A total of 199 prospectively and 235 retrospectively collected specimens were eligible for inclusion in this study. The overall prevalence of enteroviral meningitis was 26.04%. The Xpert EV assay had a sensitivity of 94.69% (90% confidence interval [CI] = 89.79 to 97.66%), specificity of 100% (90% CI = 99.07 to 100%), positive predictive value of 100%, negative predictive value of 98.17, and an accuracy of 98.62% relative to clinical truth. The Xpert EV assay demonstrated a high degree of accuracy for diagnosis of enteroviral meningitis. The simplicity and on-demand capability of the Xpert EV assay should prove to be a valuable adjunct to the evaluation of suspected meningitis cases.

  10. Evaluation of a Rapid and Completely Automated Real-Time Reverse Transcriptase PCR Assay for Diagnosis of Enteroviral Meningitis▿

    Science.gov (United States)

    Nolte, Frederick S.; Rogers, Beverly B.; Tang, Yi-Wei; Oberste, M. Steven; Robinson, Christine C.; Kehl, K. Sue; Rand, Kenneth A.; Rotbart, Harley A.; Romero, Jose R.; Nyquist, Ann-Christine; Persing, David H.

    2011-01-01

    Nucleic acid amplification tests (NAATs) for enterovirus RNA in cerebrospinal fluid (CSF) have emerged as the new gold standard for diagnosis of enteroviral meningitis, and their use can improve the management and decrease the costs for caring for children with enteroviral meningitis. The Xpert EV assay (Cepheid, Sunnyvale, CA) is a rapid, fully automated real-time PCR test for the detection of enterovirus RNA that was approved by the U.S. Food and Drug Administration for in vitro diagnostic use in March 2007. In this multicenter trial we established the clinical performance characteristics of the Xpert EV assay in patients presenting with meningitis symptoms relative to clinical truth. Clinical truth for enteroviral meningitis was defined as clinical evidence of meningitis, the absence of another detectable pathogen in CSF, and detection of enterovirus in CSF either by two reference NAATs or by viral culture. A total of 199 prospectively and 235 retrospectively collected specimens were eligible for inclusion in this study. The overall prevalence of enteroviral meningitis was 26.04%. The Xpert EV assay had a sensitivity of 94.69% (90% confidence interval [CI] = 89.79 to 97.66%), specificity of 100% (90% CI = 99.07 to 100%), positive predictive value of 100%, negative predictive value of 98.17, and an accuracy of 98.62% relative to clinical truth. The Xpert EV assay demonstrated a high degree of accuracy for diagnosis of enteroviral meningitis. The simplicity and on-demand capability of the Xpert EV assay should prove to be a valuable adjunct to the evaluation of suspected meningitis cases. PMID:21159942

  11. Rapid molecular characterization of Acinetobacter baumannii clones with rep-PCR and evaluation of carbapenemase genes by new multiplex PCR in Hospital District of Helsinki and Uusimaa.

    Directory of Open Access Journals (Sweden)

    Tanja Pasanen

    Full Text Available Multidrug-resistant Acinetobacter baumannii (MDRAB is an increasing problem worldwide. Prevalence of carbapenem resistance in Acinetobacter spp. due to acquired carbapenemase genes is not known in Finland. The purpose of this study was to examine prevalence and clonal spread of multiresistant A. baumannii group species, and their carbapenemase genes. A total of 55 Acinetobacter isolates were evaluated with repetitive PCR (DiversiLab to analyse clonality of isolates, in conjunction with antimicrobial susceptibility profile for ampicillin/sulbactam, colistin, imipenem, meropenem, rifampicin and tigecycline. In addition, a new real-time PCR assay, detecting most clinically important carbapenemase genes just in two multiplex reactions, was developed. The assay detects genes for KPC, VIM, IMP, GES-1/-10, OXA-48, NDM, GIM-1, SPM-1, IMI/NMC-A, SME, CMY-10, SFC-1, SIM-1, OXA-23-like, OXA-24/40-like, OXA-58 and ISAbaI-OXA-51-like junction, and allows confident detection of isolates harbouring acquired carbapenemase genes. There was a time-dependent, clonal spread of multiresistant A. baumannii strongly correlating with carbapenamase gene profile, at least in this geographically restricted study material. The new carbapenemase screening assay was able to detect all the genes correctly suggesting it might be suitable for epidemiologic screening purposes in clinical laboratories.

  12. Clinical evaluation of β-tubulin real-time PCR for rapid diagnosis of dermatophytosis, a comparison with mycological methods.

    Science.gov (United States)

    Motamedi, Marjan; Mirhendi, Hossein; Zomorodian, Kamiar; Khodadadi, Hossein; Kharazi, Mahboobeh; Ghasemi, Zeinab; Shidfar, Mohammad Reza; Makimura, Koichi

    2017-10-01

    Following our previous report on evaluation of the beta tubulin real-time PCR for detection of dermatophytosis, this study aimed to compare the real-time PCR assay with conventional methods for the clinical assessment of its diagnostic performance. Samples from a total of 853 patients with suspected dermatophyte lesions were subjected to direct examination (all samples), culture (499 samples) and real-time PCR (all samples). Fungal DNA was extracted directly from clinical samples using a conical steel bullet, followed by purification with a commercial kit and subjected to the Taq-Man probe-based real-time PCR. The study showed that among the 499 specimens for which all three methods were used, 156 (31.2%), 128 (25.6%) and 205 (41.0%) were found to be positive by direct microscopy, culture and real-time PCR respectively. Real-time PCR significantly increased the detection rate of dermatophytes compared with microscopy (288 vs 229) with 87% concordance between the two methods. The sensitivity, specificity, positive predictive value, and negative predictive value of the real-time PCR was 87.5%, 85%, 66.5% and 95.2% respectively. Although real-time PCR performed better on skin than on nail samples, it should not yet fully replace conventional diagnosis. © 2017 Blackwell Verlag GmbH.

  13. A lab-on-a-chip device for rapid identification of avian influenza viral RNA by solid-phase PCR

    DEFF Research Database (Denmark)

    Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

    2011-01-01

    This paper describes a lab-on-a-chip device for fast AIV screening by integrating DNA microarray-based solid-phase PCR on a microfluidic chip.......This paper describes a lab-on-a-chip device for fast AIV screening by integrating DNA microarray-based solid-phase PCR on a microfluidic chip....

  14. EVALUATION OF A RAPID, QUANTITATIVE REAL-TIME PCR METHOD FOR ENUMERATION OF PATHOGENIC CANDIDA CELLS IN WATER

    Science.gov (United States)

    Quantitative Real-Time PCR (QRT-PCR) technology, incorporating fluorigenic 5' nuclease (TaqMan?) chemistry, was developed for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C....

  15. Comparative evaluation of IS6110 PCR via conventional methods in rapid diagnosis of new and previously treated cases of extrapulmonary tuberculosis.

    Science.gov (United States)

    Maurya, Anand Kumar; Kant, Surya; Nag, Vijaya Lakshmi; Kushwaha, Ram Awadh Singh; Kumar, Manoj; Dhole, Tapan N

    2011-01-01

    In developing countries the diagnosis of extrapulmonary tuberculosis (EPTB) is a major burning challenge. EPTB encounters many problems like pauci-bacillary nature, inadequate specimen volume. All the limitations reflect in the poor contribution of conventional bacteriological technique in the establishment of diagnosis of EPTB. Nucleic acid amplification methods are rapid and sensitive has modified strategies for the detection of mycobacterial DNA. A fragment of DNA of 123 bp belonging to insertion sequence IS6110 based on specific gene of Mycobacterium tuberculosis complex was amplified by polymerase chain reaction (PCR) for the rapid diagnosis of EPTB. The present study was to comparative evaluation of IS6110 PCR via conventional methods in the rapid diagnosis of new and Previously treated cases of extra pulmonary tuberculosis. Four hundred fifty specimens were collected from suspected cases of EPTB were processed for Mycobacteria by Zeihl Neelson (ZN) staining and BACTEC culture for M. tuberculosis. All the specimens were also processed for IS6110 based PCR amplification with primers targeting 123 bp fragment of insertion element IS6110 of M. tuberculosis complex. We found significant difference was seen in sensitivities of different tests. Of these 450 specimens, 60 (13.4%) were positive for AFB by ZN staining, 202 (45%) for BACTEC culture and IS6110 PCR were positive for M. tuberculosis complex in 283 (63%) specimens (pEPTB. It may facilitate therapeutic decisions for those with suspected of EPTB.

  16. Rapid and accurate identification of Mycobacterium tuberculosis complex and common non-tuberculous mycobacteria by multiplex real-time PCR targeting different housekeeping genes.

    Science.gov (United States)

    Nasr Esfahani, Bahram; Rezaei Yazdi, Hadi; Moghim, Sharareh; Ghasemian Safaei, Hajieh; Zarkesh Esfahani, Hamid

    2012-11-01

    Rapid and accurate identification of mycobacteria isolates from primary culture is important due to timely and appropriate antibiotic therapy. Conventional methods for identification of Mycobacterium species based on biochemical tests needs several weeks and may remain inconclusive. In this study, a novel multiplex real-time PCR was developed for rapid identification of Mycobacterium genus, Mycobacterium tuberculosis complex (MTC) and the most common non-tuberculosis mycobacteria species including M. abscessus, M. fortuitum, M. avium complex, M. kansasii, and the M. gordonae in three reaction tubes but under same PCR condition. Genetic targets for primer designing included the 16S rDNA gene, the dnaJ gene, the gyrB gene and internal transcribed spacer (ITS). Multiplex real-time PCR was setup with reference Mycobacterium strains and was subsequently tested with 66 clinical isolates. Results of multiplex real-time PCR were analyzed with melting curves and melting temperature (T (m)) of Mycobacterium genus, MTC, and each of non-tuberculosis Mycobacterium species were determined. Multiplex real-time PCR results were compared with amplification and sequencing of 16S-23S rDNA ITS for identification of Mycobacterium species. Sensitivity and specificity of designed primers were each 100 % for MTC, M. abscessus, M. fortuitum, M. avium complex, M. kansasii, and M. gordonae. Sensitivity and specificity of designed primer for genus Mycobacterium was 96 and 100 %, respectively. According to the obtained results, we conclude that this multiplex real-time PCR with melting curve analysis and these novel primers can be used for rapid and accurate identification of genus Mycobacterium, MTC, and the most common non-tuberculosis Mycobacterium species.

  17. A New Method for Rapid Screening of End-Point PCR Products: Application to Single Genome Amplified HIV and SIV Envelope Amplicons.

    Directory of Open Access Journals (Sweden)

    Laurent Houzet

    Full Text Available PCR is the most widely applied technique for large scale screening of bacterial clones, mouse genotypes, virus genomes etc. A drawback of large PCR screening is that amplicon analysis is usually performed using gel electrophoresis, a step that is very labor intensive, tedious and chemical waste generating. Single genome amplification (SGA is used to characterize the diversity and evolutionary dynamics of virus populations within infected hosts. SGA is based on the isolation of single template molecule using limiting dilution followed by nested PCR amplification and requires the analysis of hundreds of reactions per sample, making large scale SGA studies very challenging. Here we present a novel approach entitled Long Amplicon Melt Profiling (LAMP based on the analysis of the melting profile of the PCR reactions using SYBR Green and/or EvaGreen fluorescent dyes. The LAMP method represents an attractive alternative to gel electrophoresis and enables the quick discrimination of positive reactions. We validate LAMP for SIV and HIV env-SGA, in 96- and 384-well plate formats. Because the melt profiling allows the screening of several thousands of PCR reactions in a cost-effective, rapid and robust way, we believe it will greatly facilitate any large scale PCR screening.

  18. Development of a multiplex real-time PCR assay for the rapid diagnosis of neonatal late onset sepsis.

    Science.gov (United States)

    van den Brand, Marre; Peters, Remco P H; Catsburg, Arnold; Rubenjan, Anna; Broeke, Ferdi J; van den Dungen, Frank A M; van Weissenbruch, Mirjam M; van Furth, A Marceline; Kõressaar, Triinu; Remm, Maido; Savelkoul, Paul H M; Bos, Martine P

    2014-11-01

    The diagnosis of late onset sepsis (LOS), a severe condition with high prevalence in preterm infants, is hampered by the suboptimal sensitivity and long turnaround time of blood culture. Detection of the infecting pathogen directly in blood by PCR would provide a much more timely result. Unfortunately, PCR-based assays reported so far are labor intensive and often lack direct species identification. Therefore we developed a real-time multiplex PCR assay tailored to LOS diagnosis which is easy-to-use, is applicable on small blood volumes and provides species-specific results within 4h. Species-specific PCR assays were selected from literature or developed using bioinformatic tools for the detection of the most prevalent etiologic pathogens: Enterococcus faecalis, Staphylococcus aureus, Staphylococcus spp., Streptococcus agalactiae, Escherichia coli, Pseudomonas aeruginosa, Klebsiella spp. and Serratia marcescens. The PCR assays showed 100% specificity, full coverage of the target pathogens and a limit of detection (LOD) of ≤10CFUeq./reaction. These LOD values were maintained in the multiplex format or when bacterial DNA was isolated from blood. Clinical evaluation showed high concordance between the multiplex PCR and blood culture. In conclusion, we developed a multiplex PCR that allows the direct detection of the most important bacterial pathogens causing LOS in preterm infants. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. A genome-wide screen in human embryonic stem cells reveals novel sites of allele-specific histone modification associated with known disease loci

    LENUS (Irish Health Repository)

    Prendergast, James G D

    2012-05-19

    AbstractBackgroundChromatin structure at a given site can differ between chromosome copies in a cell, and such imbalances in chromatin structure have been shown to be important in understanding the molecular mechanisms controlling several disease loci. Human genetic variation, DNA methylation, and disease have been intensely studied, uncovering many sites of allele-specific DNA methylation (ASM). However, little is known about the genome-wide occurrence of sites of allele-specific histone modification (ASHM) and their relationship to human disease. The aim of this study was to investigate the extent and characteristics of sites of ASHM in human embryonic stem cells (hESCs).ResultsUsing a statistically rigorous protocol, we investigated the genomic distribution of ASHM in hESCs, and their relationship to sites of allele-specific expression (ASE) and DNA methylation. We found that, although they were rare, sites of ASHM were substantially enriched at loci displaying ASE. Many were also found at known imprinted regions, hence sites of ASHM are likely to be better markers of imprinted regions than sites of ASM. We also found that sites of ASHM and ASE in hESCs colocalize at risk loci for developmental syndromes mediated by deletions, providing insights into the etiology of these disorders.ConclusionThese results demonstrate the potential importance of ASHM patterns in the interpretation of disease loci, and the protocol described provides a basis for similar studies of ASHM in other cell types to further our understanding of human disease susceptibility.

  20. Systematic evaluation of the impact of ChIP-seq read designs on genome coverage, peak identification, and allele-specific binding detection.

    Science.gov (United States)

    Zhang, Qi; Zeng, Xin; Younkin, Sam; Kawli, Trupti; Snyder, Michael P; Keleş, Sündüz

    2016-02-24

    Chromatin immunoprecipitation followed by sequencing (ChIP-seq) experiments revolutionized genome-wide profiling of transcription factors and histone modifications. Although maturing sequencing technologies allow these experiments to be carried out with short (36-50 bps), long (75-100 bps), single-end, or paired-end reads, the impact of these read parameters on the downstream data analysis are not well understood. In this paper, we evaluate the effects of different read parameters on genome sequence alignment, coverage of different classes of genomic features, peak identification, and allele-specific binding detection. We generated 101 bps paired-end ChIP-seq data for many transcription factors from human GM12878 and MCF7 cell lines. Systematic evaluations using in silico variations of these data as well as fully simulated data, revealed complex interplay between the sequencing parameters and analysis tools, and indicated clear advantages of paired-end designs in several aspects such as alignment accuracy, peak resolution, and most notably, allele-specific binding detection. Our work elucidates the effect of design on the downstream analysis and provides insights to investigators in deciding sequencing parameters in ChIP-seq experiments. We present the first systematic evaluation of the impact of ChIP-seq designs on allele-specific binding detection and highlights the power of pair-end designs in such studies.

  1. Rapid Discrimination between Candida glabrata, Candida nivariensis, and Candida bracarensis by Use of a Singleplex PCR

    OpenAIRE

    Enache-Angoulvant, A.; Guitard, J.; Grenouillet, F.; Martin, T; Durrens, P.; Fairhead, C.; Hennequin, C.

    2011-01-01

    We report here a PCR-based assay using a single primer pair targeting the RPL31 gene that allows discrimination between Candida glabrata, Candida bracarensis, and Candida nivariensis according to the size of the generated amplicon.

  2. Duplex real-time PCR for rapid simultaneous detection of Batrachochytrium dendrobatidis and Batrachochytrium salamandrivorans in Amphibian samples.

    Science.gov (United States)

    Blooi, M; Pasmans, F; Longcore, J E; Spitzen-van der Sluijs, A; Vercammen, F; Martel, A

    2013-12-01

    Chytridiomycosis is a lethal fungal disease contributing to declines and extinctions of amphibian species worldwide. The currently used molecular screening tests for chytridiomycosis fail to detect the recently described species Batrachochytrium salamandrivorans. In this study, we present a duplex real-time PCR that allows the simultaneous detection of B. salamandrivorans and Batrachochytrium dendrobatidis. With B. dendrobatidis- and B. salamandrivorans-specific primers and probes, detection of the two pathogens in amphibian samples is possible, with a detection limit of 0.1 genomic equivalent of zoospores of both pathogens per PCR. The developed real-time PCR shows high degrees of specificity and sensitivity, high linear correlations (r(2) > 0.995), and high amplification efficiencies (>94%) for B. dendrobatidis and B. salamandrivorans. In conclusion, the described duplex real-time PCR can be used to detect DNA of B. dendrobatidis and B. salamandrivorans with highly reproducible and reliable results.

  3. A lab-on-a-chip device for rapid identification of avian influenza viral RNA by solid-phase PCR.

    Science.gov (United States)

    Sun, Yi; Dhumpa, Raghuram; Bang, Dang Duong; Høgberg, Jonas; Handberg, Kurt; Wolff, Anders

    2011-04-21

    The endemic of Avian Influenza Virus (AIV) in Asia and epizootics in some European regions have caused serious economic losses. Multiplex reverse-transcriptase (RT) PCR has been developed to detect and subtype AIV. However, the number of targets that can be amplified in a single run is limited because of uncontrollable primer-primer interferences. In this paper, we describe a lab-on-a-chip device for fast AIV screening by integrating DNA microarray-based solid-phase PCR on a microfluidic chip. A simple UV cross-linking method was used to immobilize the DNA probes on unmodified glass surface, which makes it convenient to integrate microarray with microfluidics. This solid-phase RT-PCR method combined RT amplification of extracted RNA in the liquid phase and species-specific nested PCR on the solid phase. Using the developed approach, AIV viruses and their subtypes were unambiguously identified by the distinct patterns of amplification products. The whole process was reduced to less than 1 hour and the sample volume used in the microfluidic chip was at least 10 times less than in the literature. By spatially separating the primers, highly multiplexed amplification can be performed in solid-phase PCR. Moreover, multiplex PCR and sequence detection were done in one step, which greatly simplified the assay and reduced the processing time. Furthermore, by incorporating the microarray into a microchamber-based PCR chip, the sample and the reagent consumption were greatly reduced, and the problems of bubble formation and solution evaporation were effectively prevented. This microarray-based PCR microchip can be widely employed for virus detection and effective surveillance in wild avian and in poultry productions.

  4. Rapid quantification of viable Campylobacter bacteria on chicken carcasses, using real-time PCR and propidium monoazide treatment, as a tool for quantitative risk assessment.

    Science.gov (United States)

    Josefsen, M H; Löfström, C; Hansen, T B; Christensen, L S; Olsen, J E; Hoorfar, J

    2010-08-01

    A number of intervention strategies against Campylobacter-contaminated poultry focus on postslaughter reduction of the number of cells, emphasizing the need for rapid and reliable quantitative detection of only viable Campylobacter bacteria. We present a new and rapid quantitative approach to the enumeration of food-borne Campylobacter bacteria that combines real-time quantitative PCR (Q-PCR) with simple propidium monoazide (PMA) sample treatment. In less than 3 h, this method generates a signal from only viable and viable but nonculturable (VBNC) Campylobacter bacteria with an intact membrane. The method's performance was evaluated by assessing the contributions to variability by individual chicken carcass rinse matrices, species of Campylobacter, and differences in efficiency of DNA extraction with differing cell inputs. The method was compared with culture-based enumeration on 50 naturally infected chickens. The cell contents correlated with cycle threshold (C(T)) values (R(2) = 0.993), with a quantification range of 1 x 10(2) to 1 x 10(7) CFU/ml. The correlation between the Campylobacter counts obtained by PMA-PCR and culture on naturally contaminated chickens was high (R(2) = 0.844). The amplification efficiency of the Q-PCR method was not affected by the chicken rinse matrix or by the species of Campylobacter. No Q-PCR signals were obtained from artificially inoculated chicken rinse when PMA sample treatment was applied. In conclusion, this study presents a rapid tool for producing reliable quantitative data on viable Campylobacter bacteria in chicken carcass rinse. The proposed method does not detect DNA from dead Campylobacter bacteria but recognizes the infectious potential of the VBNC state and is thereby able to assess the effect of control strategies and provide trustworthy data for risk assessment.

  5. Direct Quantification of Campylobacter jejuni in Chicken Fecal Samples Using Real-Time PCR: Evaluation of Six Rapid DNA Extraction Methods

    DEFF Research Database (Denmark)

    Garcia Clavero, Ana Belén; Kamara, Judy N.; Vigre, Håkan

    2013-01-01

    for their effectiveness for the direct quantification (without enrichment) of Campylobacter jejuni in chicken fecal samples using real-time PCR. The presence of inhibitory substances in chicken fecal samples may reduce or even completely impede the PCR amplification process making quantification very difficult. Six rapid......Direct and accurate quantification of Campylobacter in poultry is crucial for the assessment of public health risks and the evaluation of the effectiveness of control measures against Campylobacter in poultry. The aim of this study was to assess several rapid DNA extraction methods...... of this study, the Easy-DNA (Invitrogen) method generated lower Ct values, the best amplification efficiency (AE = 93.2 %) and good precision (R squared = 0.996). The method NucleoSpin® Tissue was able to detect samples spiked with the lowest Campylobacter concentration level (10 CFU/ml) but the amplification...

  6. Rapid detection method for Bacillus anthracis using a combination of multiplexed real-time PCR and pyrosequencing and its application for food biodefense.

    Science.gov (United States)

    Janzen, Timothy W; Thomas, Matthew C; Goji, Noriko; Shields, Michael J; Hahn, Kristen R; Amoako, Kingsley K

    2015-02-01

    Bacillus anthracis, the causative agent of anthrax, has the capacity to form highly resilient spores as part of its life cycle. The potential for the dissemination of these spores using food as a vehicle is a huge public health concern and, hence, requires the development of a foodborne bioterrorism response approach. In this work, we address a critical gap in food biodefense by presenting a novel, combined, sequential method involving the use of real-time PCR and pyrosequencing for the rapid, specific detection of B. anthracis spores in three food matrices: milk, apple juice, and bottled water. The food samples were experimentally inoculated with 40 CFU ml(-1), and DNA was extracted from the spores and analyzed after immunomagnetic separation. Applying the combination of multiplex real-time PCR and pyrosequencing, we successfully detected the presence of targets on both of the virulence plasmids and the chromosome. The results showed that DNA amplicons generated from a five-target multiplexed real-time PCR detection using biotin-labeled primers can be used for single-plex pyrosequencing detection. The combined use of multiplexed real-time PCR and pyrosequencing is a novel, rapid detection method for B. anthracis from food and provides a tool for accurate, quantitative identification with potential biodefense applications.

  7. Detection of malaria infection in blood transfusion: a comparative study among real-time PCR, rapid diagnostic test and microscopy: sensitivity of Malaria detection methods in blood transfusion.

    Science.gov (United States)

    Hassanpour, Gholamreza; Mohebali, Mehdi; Raeisi, Ahmad; Abolghasemi, Hassan; Zeraati, Hojjat; Alipour, Mohsen; Azizi, Ebrahim; Keshavarz, Hossein

    2011-06-01

    The transmission of malaria by blood transfusion was one of the first transfusion-transmitted infections recorded in the world. Transfusion-transmitted malaria may lead to serious problems because infection with Plasmodium falciparum may cause rapidly fatal death. This study aimed to compare real-time polymerase chain reaction (real-time PCR) with rapid diagnostic test (RDT) and light microscopy for the detection of Plasmodium spp. in blood transfusion, both in endemic and non-endemic areas of malaria disease in Iran. Two sets of 50 blood samples were randomly collected. One set was taken from blood samples donated in blood bank of Bandar Abbas, a city located in a malarious-endemic area, and the other set from Tehran, a non-endemic one. Light microscopic examination on both thin and thick smears, RDTs, and real-time PCR were performed on the blood samples and the results were compared. Thin and thick light microscopic examinations of all samples as well as RDT results were negative for Plasmodium spp. Two blood samples from endemic area were positive only with real-time PCR. It seems that real-time PCR as a highly sensitive method can be helpful for the confirmation of malaria infection in different units of blood transfusion organization especially in malaria-endemic areas where the majority of donors may be potentially infected with malaria parasites.

  8. Development of a rapid, simple, and specific real-time PCR assay for detection of pseudorabies viral DNA in domestic swine herds.

    Science.gov (United States)

    Sayler, Katherine A; Bigelow, Troy; Koster, Leo G; Swenson, Sabrina; Bounds, Courtney; Hernández, Felipe; Wisely, Samantha M

    2017-07-01

    Despite successful eradication of pseudorabies virus (PRV) from the commercial pig industry in the United States in 2004, large populations of feral swine in certain regions act as wildlife reservoirs for the virus. Given the threat of reintroduction of the virus into domestic herds, a rapid, reliable, easily implemented assay is needed for detection of PRV. Although a real-time PCR (rtPCR) assay exists, improvements in rtPCR technology and a greater understanding of the diversity of PRV strains worldwide require an assay that would be easier to implement, more cost effective, and more specific. We developed a single-tube, rapid rtPCR that is capable of detecting 10 copies of PRV glycoprotein B ( gB) DNA per 20-µL total volume reaction. The assay did not produce a false-positive in samples known to be negative for the virus. The assay was negative for genetically similar herpesviruses and other porcine viruses. Our assay is a highly specific and sensitive assay that is also highly repeatable and reproducible. The assay should be a useful tool for early detection of PRV in pigs in the case of a suspected introduction or outbreak situation.

  9. A Rapid Protocol of Crude RNA/DNA Extraction for RT-qPCR Detection and Quantification of 'Candidatus Phytoplasma prunorum'.

    Directory of Open Access Journals (Sweden)

    Stefano Minguzzi

    Full Text Available Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum ('Ca. P. prunorum' detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor 'Ca. P. prunorum' infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect 'Ca. P. prunorum' and Plum pox virus (PPV in Prunus.

  10. [Usefulness of a rapid intrapartum real-time PCR assay in comparison with the group B Streptococcus culture screening at the end of pregnancy in pregnant women].

    Science.gov (United States)

    Defez, M; Khizar, F; Maurin, M; Biot, F; Pons, J-C; Sergent, F

    2016-11-01

    The objectives were to evaluate and compare the diagnostic accuracy of a rapid real-time PCR assay at the onset of labor with those of the current antenatal culture-based test at 34-38 weeks gestation for group B Streptococcus (GBS) screening. A prospective study including all pregnant women admitted for delivery after a 34-week gestation period was conducted in October 2012 at the Grenoble University Hospital Centre. A first culture-based GBS screening test was performed between 34 and 38 weeks of gestation followed by a second screening test at the onset of labor, using a real-time PCR Assay and a culture-based method (gold standard) in order to calculate the diagnostic accuracy. One hundred an fifty-seven patients were enrolled. The sensitivity was 94.4% (95% CI, 72.7-99.9%) with intrapartum PCR assay and 50% (95% CI, 26-74%) with antepartum culture. Prevalence of GBS colonization was 7.6% with the antepartum culture method, 11.5% with intrapartum culture and 16.6% by using PCR-test. Intrapartum PCR shows a much higher sensitivity compared to the antepartum culture-based screening mainly due to variations in GBS colonization and could allow us to target patients requiring intrapartum antibiotic prophylaxis more effectively. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  11. Detection of enteroviruses ribonucleic acid sequences in endomyocardial tissue from adult patients with chronic dilated cardiomyopathy by a rapid RT-PCR and hybridization assay.

    Science.gov (United States)

    Rey, L; Lambert, V; Wattré, P; Andréoletti, L

    2001-06-01

    A rapid reverse transcription polymerase chain reaction (RT-PCR) and microwell capture hybridisation assay with general specificity for enteroviruses was developed and compared with an improved nested RT-PCR for the detection of enteroviral RNA sequences in endomyocardial tissue from patients with chronic dilated cardiomyopathy. This method could detect as few as 20 genomic RNA copies per 100 mg of heart tissue homogenate and results could be obtained within 8 hours. Of the 55 biopsy specimens aseptically collected from the explanted hearts of 55 patients, 21 (38.2%) were positive by RT-PCR microplate assay, whereas only 19 (34.5%) were positive by nested RT-PCR assay and none were positive by classical cell culture assays. No enterovirus was detectable by RT-PCR or classical cell culture assays in any of the 55 heart biopsy specimens taken from organ donors without any known heart disease. Moreover, the nucleotide sequences of EV nested RT-PCR products showed greatest similarity to group B Coxsackieviruses [CVB3 (n = 12) or CVB5 (n = 3)], but also to group A Coxsackieviruses (CVA21 (n = 1) or CVA9 ( n= 3)]. The described RT-PCR and microwell capture hybridisation assay can be applied to the virological diagnosis of human enteroviral cardiac infections. Moreover our findings suggest that group B and group A Coxsackieviruses can persist in heart tissue from patients with end-stage chronic cardiomyopathy, supporting the hypothesis that these viruses could be implicated in the etiology of idiopathic dilated cardiomyopathy. Copyright 2001 Wiley-Liss, Inc.

  12. Sap-direct RT-PCR for the rapid detection of coleus blumei viroids of the genus Coleviroid from natural host plants.

    Science.gov (United States)

    Jiang, Dongmei; Wu, Zujian; Xie, Lianhui; Sano, Teruo; Li, Shifang

    2011-06-01

    A simple and fast sap-direct RT-PCR (reverse transcription-polymerase chain reaction) for the rapid detection of 3 viroids of the genus Coleviroid is presented. The templates for cDNA synthesis were obtained directly from the sap of coleus using a pipettor, a common tool in molecular biology laboratories, and 3 coleus blumei viroids (CbVds) were detected simultaneously using a pair of universal primers designed according to sequences in the central conserved region (CCR) of CbVds. RT-PCR results demonstrated that CbVd-1, CbVd-5, and CbVd-6 can be detected accurately in viroid-infected plants but not in viroid-free plants. The results of RT-PCR, dot-blot, sequencing, and batch-detection revealed that this method can be used to identify CbVds rapidly. The method also reduces cross-contamination among different samples to a minimum. It is considered that this rapid and simple technique is an effective method for the identification and cloning of CbVds. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.

  13. Rapid in vitro splicing of coding sequences from genomic DNA by isothermal recombination reaction-based PCR

    Directory of Open Access Journals (Sweden)

    Wenxuan Chen

    2016-09-01

    Full Text Available Cloning of coding sequence (CDS is an important step for gene function research. Here, we reported a simple and efficient strategy for assembling multiple-exon into an intron-free CDS from genomic DNA (gDNA by an isothermal recombination reaction-based PCR (IRR-PCR method. As an example, a 2067-bp full-length CDS of the anther-specific expression gene OsABCG15, which is composed of seven exons and six introns, was generated by IRR-PCR using genomic DNA of rice leaf as the template. Actually, this approach can be wildly applied to any DNA sequences assembly to achieve CDS cloning, gene fusion and multiple site-directed mutagenesis in functional genomics studies in vitro.

  14. Rapid detection and differentiation of Campylobacter jejuni, Campylobacter coli, and Campylobacter lari in food, using multiplex real-time PCR.

    Science.gov (United States)

    Mayr, A M; Lick, S; Bauer, J; Thärigen, D; Busch, U; Huber, I

    2010-02-01

    A multiplex real-time PCR assay based on four differently labeled TaqMan probes for detection and differentiation of the thermophilic Campylobacter species C. jejuni, C. coli, and C. lari was established and validated in food products. This assay combines two previously published PCR assays for C. jejuni and C. coli with a newly developed detection assay for C. lari and an internal amplification control system. The selectivity of the method was determined by analyzing 70 Campylobacter strains and 43 strains of other bacteria. The sensitivity was 50 fg of C. jejuni and C. lari DNA and 500 fg of C. coli DNA per PCR. It was possible to detect 1 to 10 CFU/25 g of food before preenrichment of all three species. More than 400 samples of various foods (poultry, seafood, and meat) were analyzed after 48 h of preenrichment parallel to the conventional diagnostic method of culture and biochemical identification. Using the established real-time PCR assay, 55.4% of the samples were recognized as positive for thermophilic Campylobacter species, whereas with the conventional method only 40.3% of the samples were positive. The real-time PCR assay also detected contaminations with two different Campylobacter species in 32.6% of the analyzed poultry samples, a finding of epidemiological interest. Compared with the original PCR method, which was established for the differentiation of bacterial isolates of C. jejuni and C. coli, this new method also detects and distinguishes C. lari, was validated as an analytical tool for food analysis, and provides reliable and extensive results within 2 days.

  15. Investigation of Parameters that Affect the Success Rate of Microarray-Based Allele-Specific Hybridization Assays

    DEFF Research Database (Denmark)

    Poulsen, Lena; Søe, Martin Jensen; Moller, Lisbeth Birk

    2011-01-01

    . These regions include large variations in G+C content, and structural features like hairpins. Methods/Findings: We describe a rational, stable method for screening and combining assay conditions for the genetic analysis of 42 Phenylketonuria-associated mutations in the phenylalanine hydroxylase gene....... The mutations are located in regions with large variations in G+C content (20-75%). Custom-made microarrays with different lengths of complementary probe sequences and spacers were hybridized with pooled PCR products of 12 exons from each of 38 individual patient DNA samples. The arrays were washed with eight......Background: The development of microarray-based genetic tests for diseases that are caused by known mutations is becoming increasingly important. The key obstacle to developing functional genotyping assays is that such mutations need to be genotyped regardless of their location in genomic regions...

  16. Simplified strategy for rapid first-line screening of fragile X syndrome: closed-tube triplet-primed PCR and amplicon melt peak analysis.

    Science.gov (United States)

    Rajan-Babu, Indhu-Shree; Law, Hai-Yang; Yoon, Chui-Sheun; Lee, Caroline G; Chong, Samuel S

    2015-05-04

    Premutation and full-mutation hyperexpansion of CGG-triplets in the X-linked Fragile X Mental Retardation 1 (FMR1) gene have been implicated in fragile X-associated tremor/ataxia syndrome, fragile X-associated primary ovarian insufficiency, and fragile X syndrome (FXS), respectively. The currently available molecular diagnostic tests are either costly or labour-intensive, which prohibits their application as a first-line FMR1 test in large-scale population-based screening programs. In this study, we demonstrate the utility of a simplified closed-tube strategy for rapid first-line screening of FXS based on melt peak temperature (Tm) analysis of direct triplet-primed polymerase chain reaction amplicons (dTP-PCR MCA). In addition, we also evaluated the correlation between Tm and CGG-repeat size based on capillary electrophoresis (CE) of dTP-PCR amplicons. The assays were initially tested on 29 FMR1 reference DNA samples, followed by a blinded validation on 107 previously characterised patient DNA samples. The dTP-PCR MCA produced distinct melt profiles of higher Tm for samples carrying an expanded allele. Among the samples tested, we also observed a good correlation between Tm and CGG-repeat size. In the blinded validation study, dTP-PCR MCA accurately classified all normal and expansion carriers, and the FMR1 genotypic classification of all samples was completely concordant with the previously determined genotypes as well as the dTP-PCR CE results. This simple and cost-effective MCA-based assay may be useful as a first-line FXS screening tool that could rapidly screen out the large majority of unaffected individuals, thus minimising the number of samples that need to be analysed by Southern blot analysis.

  17. Development of a rapid HRM qPCR for the diagnosis of the four most prevalent Plasmodium lineages in New Zealand.

    Science.gov (United States)

    Schoener, E R; Hunter, S; Howe, L

    2017-07-01

    Although wildlife rehabilitation and translocations are important tools in wildlife conservation in New Zealand, disease screening of birds has not been standardized. Additionally, the results of the screening programmes are often difficult to interpret due to missing disease data in resident or translocating avian populations. Molecular methods have become the most widespread method for diagnosing avian malaria (Plasmodium spp.) infections. However, these methods can be time-consuming, expensive and are less specific in diagnosing mixed infections. Thus, this study developed a new real-time PCR (qPCR) method that was able to detect and specifically identify infections of the three most common lineages of avian malaria in New Zealand (Plasmodium (Novyella) sp. SYAT05, Plasmodium elongatum GRW6 and Plasmodium spp. LINN1) as well as a less common, pathogenic Plasmodium relictum GRW4 lineage. The assay was also able to discern combinations of these parasites in the same sample and had a detection limit of five parasites per microlitre. Due to concerns relating to the presence of the potentially highly pathogenic P. relictum GRW4 lineage in avian populations, an additional confirmatory high resolution (HRM) qPCR was developed to distinguish between commonly identified P. elongatum GRW6 from P. relictum GRW4. The new qPCR assays were tested using tissue samples containing Plasmodium schizonts from three naturally infected dead birds resulting in the identified infection of P. elongatum GRW6. Thus, these rapid qPCR assays have shown to be cost-effective and rapid screening tools for the detection of Plasmodium infection in New Zealand native birds.

  18. Performance of a PCR assay for the rapid identification of the Klebsiella pneumoniae ST258 epidemic clone in Latin American clinical isolates.

    Science.gov (United States)

    Gomez, S A; Rapoport, M; Piergrossi, N; Faccone, D; Pasteran, F; De Belder, D; ReLAVRA-Group; Petroni, A; Corso, A

    2016-10-01

    The worldwide dissemination of Klebsiella pneumoniae carbapenemase (KPC)-producing Klebsiella pneumoniae ST258 demands a rapid PCR-based typing method to detect unique genes of the ST258 clone. This study evaluates a PCR developed by Adler et al. (2014) for the detection of ST258 in K. pneumoniae clinical isolates centered on the identification of the pilv-I and prp genes. We tested 143 clinical isolates from Argentina (n=109), Chile (n=1), Colombia (n=1), Costa Rica (n=2), Ecuador (n=5), El Salvador (n=2), Nicaragua (n=5), Panamá (n=2), Paraguay (n=2), Perú (n=3) and Trinidad and Tobago (n=11) recovered from 2006 to 2015. blaKPC, pilv-l and prp genes were detected by PCR and sequenced by standard procedures. ST258 and non-ST258 were defined by PFGE and/or MLST. Isolates were grouped according to PFGE patterns: 58 were compatible with ST258 (group 1) and 85 with non-ST258 (group 2). MLST study was done on an arbitrary selection of isolates. The pilv-l gene was present only in ST258 isolates, regardless of the presence of the blaKPC gene. Results for the prp gene were variable. Its presence did not define ST258. The pilv-I PCR had a sensitivity and specificity of 100%, respectively, for the detection of ST258 in the isolates under investigation. Given our findings, the pilv-I PCR could replace more time and resource consuming methods, allowing for more rapid detection of the circulating high risk K. pneumoniae clone ST258 in Latin American (LA) countries. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Development of a rapid diagnostic method for identification of Staphylococcus aureus and antimicrobial resistance in positive blood culture bottles using a PCR-DNA-chromatography method.

    Science.gov (United States)

    Ohshiro, Takeya; Miyagi, Chihiro; Tamaki, Yoshikazu; Mizuno, Takuya; Ezaki, Takayuki

    2016-06-01

    Blood culturing and the rapid reporting of results are essential for infectious disease clinics to obtain bacterial information that can affect patient prognosis. When gram-positive coccoid cells are observed in blood culture bottles, it is important to determine whether the strain is Staphylococcus aureus and whether the strain has resistance genes, such as mecA and blaZ, for proper antibiotic selection. Previous work led to the development of a PCR method that is useful for rapid identification of bacterial species and antimicrobial susceptibility. However, that method has not yet been adopted in community hospitals due to the high cost and methodological complexity. We report here the development of a quick PCR and DNA-chromatography test, based on single-tag hybridization chromatography, that permits detection of S. aureus and the mecA and blaZ genes; results can be obtained within 1 h for positive blood culture bottles. We evaluated this method using 42 clinical isolates. Detection of S. aureus and the resistance genes by the PCR-DNA-chromatography method was compared with that obtained via the conventional identification method and actual antimicrobial susceptibility testing. Our method had a sensitivity of 97.0% and a specificity of 100% for the identification of the bacterial species. For the detection of the mecA gene of S. aureus, the sensitivity was 100% and the specificity was 95.2%. For the detection of the blaZ gene of S. aureus, the sensitivity was 100% and the specificity was 88.9%. The speed and simplicity of this PCR-DNA-chromatography method suggest that our method will facilitate rapid diagnoses. Copyright © 2016 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  20. A multiplex PCR assay for the rapid and sensitive detection of methicillin-resistant Staphylococcus aureus and simultaneous discrimination of Staphylococcus aureus from coagulase-negative staphylococci.

    Science.gov (United States)

    Xu, Benjin; Liu, Ling; Liu, Li; Li, Xinping; Li, Xiaofang; Wang, Xin

    2012-11-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is a global health concern, which had been detected in food and food production animals. Conventional testing for detection of MRSA takes 3 to 5 d to yield complete information of the organism and its antibiotic sensitivity pattern. So, a rapid method is needed to diagnose and treat the MRSA infections. The present study focused on the development of a multiplex PCR assay for the rapid and sensitive detection of MRSA. The assay simultaneously detected 4 genes, namely, 16S rRNA of the Staphylococcus genus, femA of S. aureus, mecA that encodes methicillin resistance, and one internal control. It was rapid and yielded results within 4 h. The analytical sensitivity and specificity of the multiplex PCR assay was evaluated by comparing it with the conventional method. The analytical sensitivity of the multiplex PCR assay at the DNA level was 10 ng DNA. The analytical specificity was evaluated with 10 reference staphylococci strains and was 100%. The diagnostic evaluation of MRSA was carried out using 360 foodborne staphylococci isolates, and showed 99.1% of specificity, 96.4% of sensitivity, 97.5% of positive predictive value, and 97.3% of negative predictive value compared to the conventional method. The inclusion of an internal control in the multiplex PCR assay is important to exclude false-negative cases. This test can be used as an effective diagnostic and surveillance tool to investigate the spread and emergence of MRSA. © 2012 Institute of Food Technologists®

  1. Design of a biological method for rapid detection of presence of PCR inhibitors in aged bone DNA.

    Science.gov (United States)

    Ghasemi, Akram; Mahdieh, Nejat; Tavallaei, Mahmood; Aslani, Mohammad Mehdi; Zafari, Zahra; Shirkavand, Atefeh; Farzad, Maryam Sharafi; Naderi, Mahdi; Azariyan, Sajjad Habibi; Zeinali, Sirous

    2012-01-01

    Molecular human identification is one of the most important tests performed in forensic laboratories. Some of these tests are applied for identification of human remains from natural disasters, wars, etc., but problems may occur as a result of DNA degradation and external DNA contamination. We investigated effects of bacterial DNA on identifying the presence or absence of PCR inhibitors in aged bone DNA. DNA samples were extracted from blood, bone remains and Escherichia coli. These DNA were amplified using human and bacterial specific primers. Using different blood, aged bone, and bacterial DNA dilutions along with PCR based methods; we checked their positive, negative effects, or detecting presence of inhibitors in aged bone DNA by PCR method. Our observation indicated that the addition of bacterial DNA could be a valid biological method for testing the quality of bone DNA to enable us to obtain a usable profile for the identification of human remains. This method will help to test the presence of inhibitors, quantity or even quality of DNA which are of importance in profiling archeological remains. Our method will help to determine if PCR failure is due to presence of inhibitors or lack of amplifiable DNA either because of degradation, minute amount or absence of human DNA.

  2. Quantification by real-time PCR assay of Staphylococcus aureus load: a useful tool for rapidly identifying persistent nasal carriers.

    Science.gov (United States)

    Verhoeven, Paul O; Grattard, Florence; Carricajo, Anne; Lucht, Frédéric; Cazorla, Céline; Garraud, Olivier; Pozzetto, Bruno; Berthelot, Philippe

    2012-06-01

    The Cepheid Xpert MRSA/SA nasal PCR assay was compared to culture for quantifying Staphylococcus aureus load from 104 nasal samples (r = 0.91, P < 0.0001). Using a bacterial load-based algorithm, the test was found able to predict the carrier state in 32 of 35 healthy volunteers (22 persistent and 13 nonpersistent carriers).

  3. Development of a Rapid Real-Time PCR Assay for Quantitation of Pneumocystis carinii f. sp. Carinii

    DEFF Research Database (Denmark)

    Larsen, Hans Henrik; Kovacs, Joseph A; Stock, Frida

    2002-01-01

    axenic cultivation system for P. carinii and confirmed our microscopy findings that no organism multiplication had occurred during culture. For all cultures analyzed, QTD PCR assays showed a decrease in P. carinii DNA that exceeded the expected decrease due to dilution of the inoculum upon transfer...

  4. Rapid detection and grouping of porcine bocaviruses by an EvaGreen(®) based multiplex real-time PCR assay using melting curve analysis.

    Science.gov (United States)

    Zheng, Xiaowen; Liu, Gaopeng; Opriessnig, Tanja; Wang, Zining; Yang, Zongqi; Jiang, Yonghou

    2016-08-01

    Several novel porcine bocaviruses (PBoVs) have been identified in pigs in recent years and association of these viruses with respiratory signs or diarrhea has been suggested. In this study, an EvaGreen(®)-based multiplex real-time PCR (EG-mPCR) with melting curve analysis was developed for simultaneous detection and grouping of novel PBoVs into the same genogroups G1, G2 and G3. Each target produced a specific amplicon with a melting peak of 81.3 ± 0.34 °C for PBoV G1, 78.2 ± 0.37 °C for PBoV G2, and 85.0 ± 0.29 °C for PBoV G3. Non-specific reactions were not observed when other pig viruses were used to assess the EG-mPCR assay. The sensitivity of the EG-mPCR assay using purified plasmid constructs containing the specific viral target fragments was 100 copies for PBoV G1, 50 for PBoV G2 and 100 for PBoV G3. The assay is able to detect and distinguish three PBoV groups with intra-assay and inter-assay variations ranging from 0.13 to 1.59%. The newly established EG-mPCR assay was validated with 227 field samples from pigs. PBoV G1, G2 and G3 was detected in 15.0%, 25.1% and 41.9% of the investigated samples and coinfections of two or three PBoV groups were also detected in 25.1% of the cases, indicating that all PBoV groups are prevalent in Chinese pigs. The agreement of the EG-mPCR assay with an EvaGreen-based singleplex real-time PCR (EG-sPCR) assay was 99.1%. This EG-mPCR will serve as a rapid, sensitive, reliable and cost effective alternative for routine surveillance testing of multiple PBoVs in pigs and will enhance our understanding of the epidemiological features and possible also pathogenetic changes associated with these viruses in pigs. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Advantage of Whole Exome Sequencing over Allele-Specific and Targeted Segment Sequencing in Detection of Novel TULP1 Mutation in Leber Congenital Amaurosis.

    Science.gov (United States)

    Guo, Yiran; Prokudin, Ivan; Yu, Cong; Liang, Jinlong; Xie, Yi; Flaherty, Maree; Tian, Lifeng; Crofts, Stephanie; Wang, Fengxiang; Snyder, James; Donaldson, Craig; Abdel-Magid, Nada; Vazquez, Lyam; Keating, Brendan; Hakonarson, Hakon; Wang, Jun; Jamieson, Robyn V

    2015-01-01

    Leber congenital amaurosis (LCA) is a severe form of retinal dystrophy with marked underlying genetic heterogeneity. Until recently, allele-specific assays and Sanger sequencing of targeted segments were the only available approaches for attempted genetic diagnosis in this condition. A broader next-generation sequencing (NGS) strategy, such as whole exome sequencing, provides an improved molecular genetic diagnostic capacity for patients with these conditions. In a child with LCA, an allele-specific assay analyzing 135 known LCA-causing variations, followed by targeted segment sequencing of 61 regions in 14 causative genes was performed. Subsequently, exome sequencing was undertaken in the proband, unaffected consanguineous parents and two unaffected siblings. Bioinformatic analysis used two independent pipelines, BWA-GATK and SOAP, followed by Annovar and SnpEff to annotate the variants. No disease-causing variants were found using the allele-specific or targeted segment Sanger sequencing assays. Analysis of variants in the exome sequence data revealed a novel homozygous nonsense mutation (c.1081C > T, p.Arg361*) in TULP1, a gene with roles in photoreceptor function where mutations were previously shown to cause LCA and retinitis pigmentosa. The identified homozygous variant was the top candidate using both bioinformatic pipelines. This study highlights the value of the broad sequencing strategy of exome sequencing for disease gene identification in LCA, over other existing methods. NGS is particularly beneficial in LCA where there are a large number of causative disease genes, few distinguishing clinical features for precise candidate disease gene selection, and few mutation hotspots in any of the known disease genes.

  6. Polymorphism-specific PCR enhances the diagnostic performance of American tegumentary leishmaniasis and allows the rapid identification of Leishmania species from Argentina

    Directory of Open Access Journals (Sweden)

    Marco Jorge D

    2012-08-01

    Full Text Available Abstract Background The diagnosis of the leishmaniases poses enormous challenges in Argentina. The Polymorphism-Specific PCR (PS-PCR designed and validated in our laboratories has been proven effective for typifying the Leishmania genus from cultured material. Here we evaluated the performance of this method in the diagnosis of American tegumentary leishmaniasis (ATL and the rapid identification of Leishmania spp. directly from clinical specimens. Methods A total of 63 patients from northwestern Argentina, with cutaneous or mucocutaneous lesions, underwent an ATL diagnosis protocol which included clinical examination, Leishmanin skin test, and microscopic examination of dermal smears. In addition, we performed PS-PCR on DNA directly extracted from the specimens scraped from the lesions. Results Out of the 63 patients, 44 were classified as ATL cases and 19 as non-ATL cases. The diagnostic sensitivity of the microscopic analysis of dermal smears and PS-PCR individually were 70.5% and 81%, respectively. When performing both tests in parallel, this parameter increased significantly to 97.6% (p = 0.0018. The specificities, on the other hand, were 100%, 84.2%, and 83.3% for the combination, respectively (p > 0.05. Using the PS-PCR analysis we successfully identified the Leishmania spp. in 31 out of the 44 ATL cases. Twenty-eight (90.3% cases were caused by L. (V. braziliensis, two (6.5% by L. (V. guyanensis, and one (3.2% by L. (V. panamensis. Conclusions The efficacy of the ATL diagnosis was significantly improved by combining the dermal smear examination with a PS-PCR analysis. Our strategy allowed us to reach the diagnosis of ATL with high accuracy regarding the species of the etiological agent in 70.5% of the cases. Moreover, we diagnosed two cases of the disseminated cutaneous form caused by L. (V. braziliensis and a cutaneous case due to L. (V. panamensis infection, both findings reported for the first time in Argentina.

  7. Polymorphism-specific PCR enhances the diagnostic performance of American tegumentary leishmaniasis and allows the rapid identification of Leishmania species from Argentina.

    Science.gov (United States)

    Marco, Jorge D; Barroso, Paola A; Mimori, Tatsuyuki; Locatelli, Fabricio M; Tomatani, Ayako; Mora, María C; Cajal, S Pamela; Nasser, Julio R; Parada, Luis A; Taniguchi, Taketoshi; Korenaga, Masataka; Basombrío, Miguel A; Hashiguchi, Yoshihisa

    2012-08-15

    The diagnosis of the leishmaniases poses enormous challenges in Argentina. The Polymorphism-Specific PCR (PS-PCR) designed and validated in our laboratories has been proven effective for typifying the Leishmania genus from cultured material. Here we evaluated the performance of this method in the diagnosis of American tegumentary leishmaniasis (ATL) and the rapid identification of Leishmania spp. directly from clinical specimens. A total of 63 patients from northwestern Argentina, with cutaneous or mucocutaneous lesions, underwent an ATL diagnosis protocol which included clinical examination, Leishmanin skin test, and microscopic examination of dermal smears. In addition, we performed PS-PCR on DNA directly extracted from the specimens scraped from the lesions. Out of the 63 patients, 44 were classified as ATL cases and 19 as non-ATL cases. The diagnostic sensitivity of the microscopic analysis of dermal smears and PS-PCR individually were 70.5% and 81%, respectively. When performing both tests in parallel, this parameter increased significantly to 97.6% (p = 0.0018). The specificities, on the other hand, were 100%, 84.2%, and 83.3% for the combination, respectively (p > 0.05). Using the PS-PCR analysis we successfully identified the Leishmania spp. in 31 out of the 44 ATL cases. Twenty-eight (90.3%) cases were caused by L. (V.) braziliensis, two (6.5%) by L. (V.) guyanensis, and one (3.2%) by L. (V.) panamensis. The efficacy of the ATL diagnosis was significantly improved by combining the dermal smear examination with a PS-PCR analysis. Our strategy allowed us to reach the diagnosis of ATL with high accuracy regarding the species of the etiological agent in 70.5% of the cases. Moreover, we diagnosed two cases of the disseminated cutaneous form caused by L. (V.) braziliensis and a cutaneous case due to L. (V.) panamensis infection, both findings reported for the first time in Argentina.

  8. Development of a rapid real-time PCR method as a tool to quantify viable Photobacterium phosphoreum bacteria in salmon (Salmo salar) steaks.

    Science.gov (United States)

    Macé, Sabrina; Mamlouk, Kelthoum; Chipchakova, Stoyka; Prévost, Hervé; Joffraud, Jean-Jacques; Dalgaard, Paw; Pilet, Marie-France; Dousset, Xavier

    2013-04-01

    A specific real-time PCR quantification method combined with a propidium monoazide sample treatment step was developed to determine quantitatively the viable population of the Photobacterium phosphoreum species group in raw modified-atmosphere-packed salmon. Primers were designed to amplify a 350-bp fragment of the gyrase subunit B gene (gyrB) of P. phosphoreum. The specificity of the two primers was demonstrated by using purified DNA from 81 strains of 52 different bacterial species. When these primers were used for real-time PCR in pure culture, a good correlation (R(2) of 0.99) was obtained between this method and conventional enumeration on marine agar (MA). Quantification was linear over 5 log units as confirmed by using inoculated salmon samples. On naturally contaminated fresh salmon, the new real-time PCR method performed successfully with a quantification limit of 3 log CFU/g. A correlation coefficient (R(2)) of 0.963 was obtained between the PCR method and classic enumeration on MA, followed by identification of colonies (290 isolates identified by real-time PCR or by 16S rRNA gene sequencing). A good correlation with an R(2) of 0.940 was found between the new PCR method and an available specific conductance method for P. phosphoreum. This study presents a rapid tool for producing reliable quantitative data on viable P. phosphoreum bacteria in fresh salmon in 6 h. This new culture-independent method will be valuable for future fish inspection, the assessment of raw material quality in fish processing plants, and studies on the ecology of this important specific spoilage microorganism.

  9. Development of a Rapid Real-Time PCR Method as a Tool To Quantify Viable Photobacterium phosphoreum Bacteria in Salmon (Salmo salar) Steaks

    Science.gov (United States)

    Macé, Sabrina; Mamlouk, Kelthoum; Chipchakova, Stoyka; Prévost, Hervé; Joffraud, Jean-Jacques; Dalgaard, Paw; Pilet, Marie-France

    2013-01-01

    A specific real-time PCR quantification method combined with a propidium monoazide sample treatment step was developed to determine quantitatively the viable population of the Photobacterium phosphoreum species group in raw modified-atmosphere-packed salmon. Primers were designed to amplify a 350-bp fragment of the gyrase subunit B gene (gyrB) of P. phosphoreum. The specificity of the two primers was demonstrated by using purified DNA from 81 strains of 52 different bacterial species. When these primers were used for real-time PCR in pure culture, a good correlation (R2 of 0.99) was obtained between this method and conventional enumeration on marine agar (MA). Quantification was linear over 5 log units as confirmed by using inoculated salmon samples. On naturally contaminated fresh salmon, the new real-time PCR method performed successfully with a quantification limit of 3 log CFU/g. A correlation coefficient (R2) of 0.963 was obtained between the PCR method and classic enumeration on MA, followed by identification of colonies (290 isolates identified by real-time PCR or by 16S rRNA gene sequencing). A good correlation with an R2 of 0.940 was found between the new PCR method and an available specific conductance method for P. phosphoreum. This study presents a rapid tool for producing reliable quantitative data on viable P. phosphoreum bacteria in fresh salmon in 6 h. This new culture-independent method will be valuable for future fish inspection, the assessment of raw material quality in fish processing plants, and studies on the ecology of this important specific spoilage microorganism. PMID:23396343

  10. Development of 11-Plex MOL-PCR Assay for the Rapid Screening of Samples for Shiga Toxin-Producing Escherichia coli

    Directory of Open Access Journals (Sweden)

    Travis A Woods

    2016-08-01

    Full Text Available Strains of Shiga toxin-producing Escherichia coli (STEC are a serious threat to the public health, with approximately half of the STEC related food-borne illnesses attributable to contaminated beef. We developed an assay that was able to screen samples for several important STEC associated serogroups (O26, O45, O103, O104, O111, O121, O145, O157 and three major virulence factors (eae, stx1, stx2 in a rapid and multiplexed format using the Multiplex oligonucleotide ligation-PCR (MOL-PCR assay chemistry. This assay detected unique STEC DNA signatures and was meant to be used on samples from various sources related to beef production, providing a multiplex and high-throughput complement to the multiplex PCR assays currently in use. Multiplex oligonucleotide ligation-PCR (MOL-PCR is a nucleic acid-based assay chemistry that relies on flow cytometry/image cytometry and multiplex microsphere arrays for the detection of nucleic acid-based signatures present in target agents. The STEC MOL-PCR assay provided greater than 90% analytical specificity across all sequence markers designed when tested against panels of DNA samples that represent different STEC serogroups and toxin gene profiles. This paper describes the development of the 11-plex assay and the results of its validation. This highly multiplexed, but more importantly dynamic and adaptable screening assay allows inclusion of additional signatures as they are identified in relation to public health. As the impact of STEC associated illness on public health is explored additional information on classification will be needed on single samples; thus, this assay can serve as the backbone for a complex screening system.

  11. Characterization and PCR-based detection of benzimidazole-resistant isolates of Monilinia laxa in California.

    Science.gov (United States)

    Ma, Zhonghua; Yoshimura, Michael A; Holtz, Brent A; Michailides, Themis J

    2005-05-01

    Monilinia laxa is a pathogen of brown rot of stone fruit and almond in California, causing blossom blights and fruit rots. In this study, low-level resistance to the benzimidazole fungicides benomyl and thiophanate-methyl was detected in field isolates of M laxa collected from stone fruits and almonds in California. Low-resistant (LR) isolates grew in potato dextrose agar (PDA) plates amended with benomyl and thiophanate-methyl at 1 and 5 microg ml(-1), respectively, but not in plates amended with benomyl at 5 microg ml(-1) or thiophanate-methyl at 50 microg ml(-1). The benzimidazole LR isolates were characterized by temperature sensitivity and the DNA sequence of the beta-tubulin gene. The LR isolates showed high-temperature sensitivity, being sensitive to 1 microg ml(-1) of benomyl at 28 degrees C but resistant at 8-24 degrees C. Analysis of the DNA sequence of the beta-tubulin gene showed that the LR isolates had a point mutation at the amino-acid position 240, causing substitution of leucine by phenylalanine. Based on the point mutation, a pair of allele-specific PCR primers was developed for rapid detection of LR isolates of M laxa. In addition, a pair of PCR primers specific to M laxa was developed on the basis of the differences in the DNA sequence of the intron 6 of beta-tubulin gene from M laxa, M fructicola and other fungal species. The primer pair amplified the expected 376-bp DNA fragment from all M laxa isolates tested, but not from 14 other fungal species isolated from stone fruit and almond crops. The restriction endonuclease BsmA I recognized the sequence GTCTCC in the PCR products from sensitive (S) isolates only, but not the GTTTCC sequence in the PCR products from LR isolates. The endonuclease digested the 376-bp PCR products from S isolates to produce two bands (111 and 265 bp) on agarose gels. Thus, both allele-specific PCR and the PCR-restriction fragment length polymorphism (PCR-RFLP) methods could be useful for rapidly detecting

  12. Development of a loop-mediated isothermal amplification technique and comparison with quantitative real-time PCR for the rapid visual detection of canine neosporosis.

    Science.gov (United States)

    Mahittikorn, Aongart; Thammasonthijarern, Nipa; Roobthaisong, Amonrattana; Udonsom, Ruenruetai; Popruk, Supaluk; Siri, Sukhontha; Mori, Hirotake; Sukthana, Yaowalark

    2017-08-23

    Dogs are the definitive hosts of Neospora caninum and play an important role in the transmission of the parasite. Despite the high sensitivity of existing molecular tools such as quantitative real-time PCR (qPCR), these techniques are not suitable for use in many countries because of equipment costs and difficulties in implementing them for field diagnostics. Therefore, we developed a simplified technique, loop-mediated isothermal amplification (LAMP), for the rapid visual detection of N. caninum. LAMP specificity was evaluated using a panel containing DNA from a range of different organisms. Sensitivity was evaluated by preparing 10-fold serial dilutions of N. caninum tachyzoites and comparing the results with those obtained using qPCR. Assessment of the LAMP results was determined by recognition of a colour change after amplification. The usefulness of the LAMP assay in the field was tested on 396 blood and 115 faecal samples from dogs, and one placenta from a heifer collected in Lopburi, Nakhon Pathom, Sa Kaeo, and Ratchaburi provinces, Thailand. Specificity of the LAMP technique was shown by its inability to amplify DNA from non-target pathogens or healthy dogs. The detection limit was the equivalent of one genome for both LAMP and qPCR. LAMP and qPCR detected positive N. caninum infection in 15 of 396 (3.8%) blood samples; LAMP detected 9/115 (7.8%) positive faecal samples, while qPCR detected 5/115 (4.3%) positive faecal samples. The placental tissue was shown to be positive by both techniques. Agreement between LAMP and qPCR was perfect in blood samples (kappa value, 1.00) and substantial in faecal samples (kappa value, 0.697). This is the first known LAMP assay developed for the amplification of N. caninum. The technique effectively and rapidly detected the parasite with high sensitivity and specificity and was cost-effective. This assay could be used in the field to confirm the diagnosis of canine or bovine neosporosis.

  13. Development and validation of a SYBR Green real-time PCR assay for rapid and quantitative detection of goose interferons and proinflammatory cytokines.

    Science.gov (United States)

    Zhou, Hao; Chen, Shun; Qi, Yulin; Wang, Mingshu; Jia, Renyong; Zhu, Dekang; Liu, Mafeng; Liu, Fei; Chen, Xiaoyue; Cheng, Anchun

    2015-10-01

    Real time quantitative polymerase chain reaction (RT-qPCR) based on SYBR-Green I binding is a quick, reliable, and easy method for analyzing small amounts of mRNA. Viral pathogens are recognized at the time of infection by pattern recognition receptors; thus, the inflammatory cytokines (IL1β, IL6, and IL18) and antiviral cytokines (IFNα, IFNγ) are secreted by innate immune cells and induced to respond to the pathogens. The objective of this study was to develop an effective and sensitive RT-qPCR assay for the rapid and accurate quantification of goose cytokines: IFNα, IFNγ, IL1β, IL6, and IL18. Subsequently, the established methods were employed to detect the immune response in agonist-stimulated goose spleen cells in vitro. These data indicated that the established RT-qPCR is a reliable method for determining relative gene expression. The results revealed that Imiquimod led to the significant upregulation of goose IFNα (P < 0.01), IFNγ (P < 0.01), IL1β (P < 0.01), IL6 (P < 0.01), and IL18 (P < 0.05). The established methods are important for scientific research and clinical applications, which require rapid and accurate results in a short period of time. The technique can potentially be used in the further research of goose molecular immunology, which will help us understand the interactions between hosts and pathogens. © 2015 Poultry Science Association Inc.

  14. Rapid detection of Salmonella in raw chicken breast using real-time PCR combined with immunomagnetic separation and whole genome amplification.

    Science.gov (United States)

    Hyeon, Ji-Yeon; Deng, Xiangyu

    2017-05-01

    We presented the first attempt to combine immunomagnetic separation (IMS), whole genome amplification by multiple displacement amplification (MDA) and real-time PCR for detecting a bacterial pathogen in a food sample. This method was effective in enabling real-time PCR detection of low levels of Salmonella enterica Serotype Enteritidis (SE) (∼10 CFU/g) in raw chicken breast without culture enrichment. In addition, it was able to detect refrigeration-stressed SE cells at lower concentrations (∼0.1 CFU/g) in raw chicken breast after a 4-h culture enrichment, shortening the detection process from days to hours and displaying no statistical difference in detection rate in comparison with a culture-based detection method. By substantially improving performance in SE detection over conventional real-time PCR, we demonstrated the potential of IMS-MDA real-time PCR as a rapid, sensitive and affordable method for detecting Salmonella in food. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Rapid and sensitive detection of Cronobacter spp. (previously Enterobacter sakazakii) in food by duplex PCR combined with capillary electrophoresis-laser-induced fluorescence detector.

    Science.gov (United States)

    Ruan, Jia; Li, Ming; Liu, Ya-Pan; Li, Yuan-Qian; Li, Yong-Xin

    2013-03-15

    Cronobacter spp. (Enterobacter sakazakii) is an emerging opportunistic pathogen with a 40-80% mortality rate in infants and immunocompromised crowd resulting from the consumption of contaminated food. A novel method for detecting Cronobacter spp. in food samples by duplex polymerase chain reaction (PCR) in combination with capillary electrophoresis-laser induced fluorescence (CE-LIF) detector has been developed. The specific gene sequences of 16S-23S rDNA internal transcribed spacer (ITS) and the outer membrane protein A (OmpA) of Cronobacter spp. were amplified by duplex PCR. The PCR products were separated and determined sensitively by CE-LIF within 12min. The relative standard deviations of migration time for the detected DNA fragments were 2.01-2.91%. The detection limit was as low as 1.6×10(1)cfu/mL of Cronobacter spp. Besides, the specificity of the method was verified by 24 non-Cronobacter bacterial strains. A total of 120 commercial infant food formula were tested for the presence of Cronobacter spp. by using the proposed method. This current study demonstrates that the combination of CE-LIF method with duplex PCR is rapid, sensitive and environmental friendly, and has the potential to be adapted for the routine detection of Cronobacter spp. in food samples. To the best of our knowledge, this is the first use of CE-LIF for the detection of Cronobacter spp. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.

  16. Warfarin genotyping in a single PCR reaction for microchip electrophoresis.

    Science.gov (United States)

    Poe, Brian L; Haverstick, Doris M; Landers, James P

    2012-04-01

    Warfarin is the most commonly prescribed oral anticoagulant medication but also is the second leading cause of emergency room visits for adverse drug reactions. Genetic testing for warfarin sensitivity may reduce hospitalization rates, but prospective genotyping is impeded in part by the turnaround time and costs of genotyping. Microfluidics-based assays can reduce reagent consumption and analysis time; however, no current assay has integrated multiplexed allele-specific PCR for warfarin genotyping with electrophoretic microfluidics hardware. Ideally, such an assay would use a single PCR reaction and, without further processing, a single microchip electrophoresis (ME) run to determine the 3 single-nucleotide polymorphisms (SNPs) affecting warfarin sensitivity [i.e., CYP2C9 (cytochrome P450, family 2, subfamily C, polypeptide 9) *2, CYP2C9 *3, and the VKORC1 (vitamin K epoxide reductase complex 1) A/B haplotype]. We designed and optimized primers for a fully multiplexed assay to examine 3 biallelic SNPs with the tetraprimer amplification refractory mutation system (T-ARMS). The assay was developed with conventional PCR equipment and demonstrated for microfluidic infrared-mediated PCR. Genotypes were determined by ME on the basis of the pattern of PCR products. Thirty-five samples of human genomic DNA were analyzed with this multiplex T-ARMS assay, and 100% of the genotype determinations agreed with the results obtained by other validated methods. The sample population included several genotypes conferring warfarin sensitivity, with both homozygous and heterozygous genotypes for each SNP. Total analysis times for the PCR and ME were approximately 75 min (1-sample run) and 90 min (12-sample run). This multiplexed T-ARMS assay coupled with microfluidics hardware constitutes a promising avenue for an inexpensive and rapid platform for warfarin genotyping.

  17. Duplex Real-Time PCR for Rapid Simultaneous Detection of Batrachochytrium dendrobatidis and Batrachochytrium salamandrivorans in Amphibian Samples

    OpenAIRE

    Blooi, M.; Pasmans, F.; Longcore, J. E.; Spitzen-van der Sluijs, A.; Vercammen, F.; Martel, A.

    2013-01-01

    Chytridiomycosis is a lethal fungal disease contributing to declines and extinctions of amphibian species worldwide. The currently used molecular screening tests for chytridiomycosis fail to detect the recently described species Batrachochytrium salamandrivorans. In this study, we present a duplex real-time PCR that allows the simultaneous detection of B. salamandrivorans and Batrachochytrium dendrobatidis. With B. dendrobatidis- and B. salamandrivorans-specific primers and probes, detection ...

  18. Rapid Detection of Campylobacter jejuni, Campylobacter coli, and Campylobacter lari in Fresh Chicken Meat and By-Products in Bangkok, Thailand, Using Modified Multiplex PCR.

    Science.gov (United States)

    Saiyudthong, S; Phusri, K; Buates, S

    2015-07-01

    A multiplex PCR assay for simultaneous detection and differentiation of Campylobacter jejuni, Campylobacter coli, and Campylobacter lari was developed and validated to assess the occurrence of these bacteria in fresh chicken meat and by-products in Bangkok, Thailand, by using a new combination of four previously published PCR primers for C. jejuni, C. coli, C. lari, and a universal 16S rDNA gene as an internal control. The specificity was determined by using 13 strains of other bacteria. With pure culture DNA, the detection limit was 0.017 ng/PCR for C. jejuni and C. coli and was 0.016 ng/PCR for C. lari. It can detect 10 CFU of C. jejuni, C. coli, and C. lari in 2 g of chicken meat within a 16-h enrichment time. Our multiplex PCR assay was applied for identification of Campylobacter spp. in 122 supermarket samples and 108 fresh market samples. Of the 230 samples evaluated by multiplex PCR, 54.0, 3.3, and 10.7% of supermarket samples were positive for C. jejuni, C. coli, and mixed C. jejuni and C. coli, respectively, and 56.5 and 33.3% of fresh market samples were positive for C. jejuni and mixed C. jejuni and C. coli, respectively. No sample was positive for C. lari. Fresh market samples had significantly higher C. jejuni and C. coli contamination than those from supermarkets (relative risk: 1.3; P = 0.0001). Compared with the culture method (a gold standard), the sensitivity, specificity, positive predictive value, negative predictive value, and diagnostic accuracy of multiplex PCR were 97.7, 86.8, 96.1, 92.0, and 95.2%, respectively. No significant difference was observed between results from two methods (P = 0.55). Therefore, the established multiplex PCR was not only rapid and easy to perform but had a high sensitivity and specificity to distinguish between C. jejuni, C. coli, and C. lari, even in samples containing mixed contamination. Our study indicated that fresh chicken meat and by-products from fresh markets were significantly less hygienic than those

  19. Comparison of a PfHRP2-based rapid diagnostic test and PCR for malaria in a low prevalence setting in rural southern Zambia: implications for elimination.

    Science.gov (United States)

    Laban, Natasha M; Kobayashi, Tamaki; Hamapumbu, Harry; Sullivan, David; Mharakurwa, Sungano; Thuma, Philip E; Shiff, Clive J; Moss, William J

    2015-01-28

    Rapid diagnostic tests (RDTs) detecting histidine-rich protein 2 (PfHRP2) antigen are used to identify individuals with Plasmodium falciparum infection even in low transmission settings seeking to achieve elimination. However, these RDTs lack sensitivity to detect low-density infections, produce false negatives for P. falciparum strains lacking pfhrp2 gene and do not detect species other than P. falciparum. Results of a PfHRP2-based RDT and Plasmodium nested PCR were compared in a region of declining malaria transmission in southern Zambia using samples from community-based, cross-sectional surveys from 2008 to 2012. Participants were tested with a PfHRP2-based RDT and a finger prick blood sample was spotted onto filter paper for PCR analysis and used to prepare blood smears for microscopy. Species-specific, real-time, quantitative PCR (q-PCR) was performed on samples that tested positive either by microscopy, RDT or nested PCR. Of 3,292 total participants enrolled, 12 (0.4%) tested positive by microscopy and 42 (1.3%) by RDT. Of 3,213 (98%) samples tested by nested PCR, 57 (1.8%) were positive, resulting in 87 participants positive by at least one of the three tests. Of these, 61 tested positive for P. falciparum by q-PCR with copy numbers ≤ 2 x 10(3) copies/μL, 5 were positive for both P. falciparum and Plasmodium malariae and 2 were positive for P. malariae alone. RDT detected 32 (53%) of P. falciparum positives, failing to detect three of the dual infections with P. malariae. Among 2,975 participants enrolled during a low transmission period between 2009 and 2012, sensitivity of the PfHRP2-based RDT compared to nested PCR was only 17%, with specificity of >99%. The pfhrp gene was detected in 80% of P. falciparum positives; however, comparison of copy number between RDT negative and RDT positive samples suggested that RDT negatives resulted from low parasitaemia and not pfhrp2 gene deletion. Low-density P. falciparum infections not identified by currently

  20. Clinical impact of a commercially available multiplex PCR system for rapid detection of pathogens in patients with presumed sepsis

    Directory of Open Access Journals (Sweden)

    Linde Hans-Jörg

    2009-08-01

    Full Text Available Abstract Background Timely identification of pathogens is crucial to minimize mortality in patients with severe infections. Detection of bacterial and fungal pathogens in blood by nucleic acid amplification promises to yield results faster than blood cultures (BC. We analyzed the clinical impact of a commercially available multiplex PCR system in patients with suspected sepsis. Methods Blood samples from patients with presumed sepsis were cultured with the Bactec 9240™ system (Becton Dickinson, Heidelberg, Germany and aliquots subjected to analysis with the LightCycler® SeptiFast® (SF Test (Roche Diagnostics, Mannheim, Germany at a tertiary care centre. For samples with PCR-detected pathogens, the actual impact on clinical management was determined by chart review. Furthermore a comparison between the time to a positive blood culture result and the SF result, based on a fictive assumption that it was done either on a once or twice daily basis, was made. Results Of 101 blood samples from 77 patients, 63 (62% yielded concordant negative results, 14 (13% concordant positive and 9 (9% were BC positive only. In 14 (13% samples pathogens were detected by SF only, resulting in adjustment of antibiotic therapy in 5 patients (7,7% of patients. In 3 samples a treatment adjustment would have been made earlier resulting in a total of 8 adjustments in all 101 samples (8%. Conclusion The addition of multiplex PCR to conventional blood cultures had a relevant impact on clinical management for a subset of patients with presumed sepsis.

  1. The − 5 A/G single-nucleotide polymorphism in the core promoter region of MT2A and its effect on allele-specific gene expression and Cd, Zn and Cu levels in laryngeal cancer

    Energy Technology Data Exchange (ETDEWEB)

    Starska, Katarzyna, E-mail: katarzyna.starska@umed.lodz.pl [I Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Kopcinskiego 22, 90-153 Łódź (Poland); Krześlak, Anna; Forma, Ewa [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland); Olszewski, Jurek [II Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Żeromskiego 113, 90-549 Łódź (Poland); Morawiec-Sztandera, Alina [Department of Head and Neck Surgery, Medical University of Łódź, Paderewskiego 4, 93-509 Łódź (Poland); Aleksandrowicz, Paweł [Department of Otolaryngology and Laryngological Oncology, Medical University of Lublin, Jaczewskiego 8, 20-954 Lublin (Poland); Lewy-Trenda, Iwona [Department of Pathology, Medical University of Łódź, Pomorska 251, 92-213 Łódź (Poland); and others

    2014-10-15

    Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was determined by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that − 5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer. - Highlights: • MT2A gene expression and metal content in laryngeal cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn and Cu levels • Negative correlation between MT2A gene expression and Cd, Zn and Cu levels.

  2. Rapid detection of Salmonella in meat: Comparative and collaborative validation of a non-complex and cost effective pre-PCR protocol

    DEFF Research Database (Denmark)

    Löfström, Charlotta; Hansen, F.; Mansdal, S.

    2011-01-01

    samples using a real-time PCR method. The protocol included incubation in buffered peptone water, centrifugation of an aliquot and a boiling procedure. The validation study included comparative and collaborative trials recommended by the Nordic Organization for Validation of Alternative Methods (Nord......Cost-effective and rapid monitoring of Salmonella in the meat production chain can contribute to food safety. The objective was, for the first time, to validate an easy-to-use pre-PCR sample preparation method based on a simple boiling protocol for screening of Salmonella in meat and carcass swab....../sample for the boiling, magnetic bead-based and NMKL187 methods, respectively. When comparing the boiling method with the magnetic beads, the relative accuracy (AC), relative sensitivity (SE) and relative specificity (SP) were found to be 98%, 102% and 98%, respectively (Cohen’s kappa index 0.95). When comparing results...

  3. A rapid method for the detection of representative coliforms in water samples: polymerase chain reaction-enzyme-linked immunosorbent assay (PCR-ELISA).

    Science.gov (United States)

    Kuo, Jong-Tar; Cheng, Chiu-Yu; Huang, Hsiao-Han; Tsao, Chia-Fen; Chung, Ying-Chien

    2010-03-01

    Methods to detect the presence of coliform bacteria in drinking water usually involve a series of complex cultivating steps that are time-consuming and subject to external influences. For this reason, the new 16S rRNA probe has been developed in this study as an alternative detector PCR-ELISA technique that does not involve the culture of bacteria and that is able to detect, identify, and quantify the representative coliform species present in water samples. Our results indicate that this technique is both rapid (detection time of 4 h) and accurate (1.4% error rate). The limit of detection (LOD) was 5 CFU/100 ml for total coliforms, which meets the standards set by most countries for drinking water. Our comparative study demonstrated that this PCR-ELISA method is superior to current conventional methods in terms of detection time, LOD, and accuracy.

  4. Effect of metallothionein 2A gene polymorphism on allele-specific gene expression and metal content in prostate cancer

    Energy Technology Data Exchange (ETDEWEB)

    Krześlak, Anna; Forma, Ewa [Department of Cytobiochemistry, University of Łódź, Pomorska 141/143, 90-236 Łódź (Poland); Chwatko, Grażyna [Department of Environmental Chemistry, University of Łódź, Pomorska 163, 90-236 Łódź (Poland); Jóźwiak, Paweł; Szymczyk, Agnieszka [Department of Cytobiochemistry, University of Łódź, Pomorska 141/143, 90-236 Łódź (Poland); Wilkosz, Jacek; Różański, Waldemar [2nd Department of Urology, Medical University of Łódź, Pabianicka 62, 93-513 Łódź (Poland); Bryś, Magdalena, E-mail: zreg@biol.uni.lodz.pl [Department of Cytobiochemistry, University of Łódź, Pomorska 141/143, 90-236 Łódź (Poland)

    2013-05-01

    Metallothioneins (MTs) are highly conserved, small molecular weight, cysteine rich proteins. The major physiological functions of metallothioneins include homeostasis of essential metals Zn and Cu and protection against cytotoxicity of heavy metals. The aim of this study was to determine whether there is an association between the − 5 A/G single nucleotide polymorphism (SNP; rs28366003) in core promoter region and expression of metallothionein 2A (MT2A) gene and metal concentration in prostate cancer tissues. MT2A polymorphism was determined by the polymerase chain reaction–restriction fragment length polymorphism technique (PCR–RFLP) using 412 prostate cancer tissue samples. MT2A gene expression analysis was performed by real-time RT-PCR method. A significant association between rs28366003 genotype and MT2A expression level was found. The average mRNA level was found to be lower among minor allele carriers (the risk allele) than average expression among homozygotes for the major allele. Metal levels were analyzed by flamed atomic absorption spectrometer system. Highly statistically significant associations were detected between the SNP and Cd, Zn, Cu and Pb levels. The results of Spearman's rank correlation showed that the expressions of MT2A and Cu, Pb and Ni concentrations were negatively correlated. On the basis of the results obtained in this study, we suggest that SNP polymorphism may affect the MT2A gene expression in prostate and this is associated with some metal accumulation. - Highlights: • MT2A gene expression and metal content in prostate cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn, Cu and Pb levels • Negative correlation between MT2A gene expression and Cu, Pb and Ni levels.

  5. MGB probe assay for rapid detection of mtDNA11778 mutation in the Chinese LHON patients by real-time PCR*

    Science.gov (United States)

    Wang, Jian-yong; Gu, Yang-shun; Wang, Jing; Tong, Yi; Wang, Ying; Shao, Jun-bing; Qi, Ming

    2008-01-01

    Objective: Leber’s hereditary optic neuropathy (LHON) is a maternally inherited degeneration of the optic nerve caused by point mutations of mitochondrial DNA (mtDNA). Many unsolved questions regarding the penetrance and pathophysiological mechanism of LHON demand efficient and reliable mutation testing. This study aims to develop a minor groove binder (MGB) probe assay for rapid detection of mtDNA11778 mutation and heteroplasmy in Chinese LHON patients by real-time polymerase chain reaction (PCR). Methods: Forty-eight patients suspected of having LHON and their maternal relatives underwent a molecular genetic evaluation, with 20 normal individuals as a control group at the same time. A real-time PCR involving two MGB probes was used to detect the mtDNA11778 mutation and heteroplasmy. A linear standard curve was obtained by pUCmLHONG and pUCmLHONA clones. Results: All 48 LHON patients and their maternal relatives were positive for mtDNA11778 mutation in our assay, 27 heteroplasmic and 21 homoplasmic. Eighteen cases did not show an occurrence of the disease, while 9 developed the disease among the 27 heteroplasmic mutation cases. Eleven did not show an occurrence of the disease, while 10 cases developed the disease among 21 homoplasmic mutation cases. There was a significant difference in the incidence between the heteroplasmic and the homoplasmic mutation types. The time needed for running a real-time PCR assay was only 80 min. Conclusion: This real-time PCR assay is a rapid, reliable method for mtDNA mutation detection as well as heteroplasmy quantification. Detecting this ratio is very important for predicting phenotypic expression of unaffected carriers. PMID:18763310

  6. MGB probe assay for rapid detection of mtDNA11778 mutation in the Chinese LHON patients by real-time PCR.

    Science.gov (United States)

    Wang, Jian-yong; Gu, Yang-shun; Wang, Jing; Tong, Yi; Wang, Ying; Shao, Jun-bing; Qi, Ming

    2008-08-01

    Leber's hereditary optic neuropathy (LHON) is a maternally inherited degeneration of the optic nerve caused by point mutations of mitochondrial DNA (mtDNA). Many unsolved questions regarding the penetrance and pathophysiological mechanism of LHON demand efficient and reliable mutation testing. This study aims to develop a minor groove binder (MGB) probe assay for rapid detection of mtDNA11778 mutation and heteroplasmy in Chinese LHON patients by real-time polymerase chain reaction (PCR). Forty-eight patients suspected of having LHON and their maternal relatives underwent a molecular genetic evaluation, with 20 normal individuals as a control group at the same time. A real-time PCR involving two MGB probes was used to detect the mtDNA11778 mutation and heteroplasmy. A linear standard curve was obtained by pUCmLHONG and pUCmLHONA clones. All 48 LHON patients and their maternal relatives were positive for mtDNA11778 mutation in our assay, 27 heteroplasmic and 21 homoplasmic. Eighteen cases did not show an occurrence of the disease, while 9 developed the disease among the 27 heteroplasmic mutation cases. Eleven did not show an occurrence of the disease, while 10 cases developed the disease among 21 homoplasmic mutation cases. There was a significant difference in the incidence between the heteroplasmic and the homoplasmic mutation types. The time needed for running a real-time PCR assay was only 80 min. This real-time PCR assay is a rapid, reliable method for mtDNA mutation detection as well as heteroplasmy quantification. Detecting this ratio is very important for predicting phenotypic expression of unaffected carriers.

  7. A Rapid and High-Throughput Screening Approach for Methicillin-Resistant Staphylococcus aureus Based on the Combination of Two Different Real-Time PCR Assays

    Science.gov (United States)

    van Maarseveen, Noortje M.; van Hannen, Erik J.; van Zwet, Anton A.; Mascini, Ellen M.

    2014-01-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is an important pathogen that has been responsible for major nosocomial epidemics worldwide. For infection control programs, rapid and adequate detection of MRSA is of great importance. We developed a rapid and high-throughput molecular screening approach that consists of an overnight selective broth enrichment, followed by mecA, mecC, and S. aureus-specific (SA442 gene) real-time PCR assays, with subsequent confirmation using a staphylococcal cassette chromosome mec element (SCCmec)-orfX-based real-time PCR assay (GeneOhm MRSA assay) and culture. Here, the results of the screening approach over a 2-year period are presented. During this period, a total of 13,387 samples were analyzed for the presence of MRSA, 2.6% of which were reported as MRSA positive. No MRSA isolates carrying the mecC gene were detected during this study. Based on the results of the real-time PCR assays only, 95.2% of the samples could be reported as negative within 24 h. Furthermore, the performance of these real-time PCR assays was evaluated using a set of 104 assorted MRSA isolates, which demonstrated high sensitivity for both the combination of mecA and mecC with SA442 and the BD GeneOhm MRSA assay (98.1% and 97.1%, respectively). This molecular screening approach proved to be an accurate method for obtaining reliable negative results within 24 h after arrival at the laboratory and contributes to improvement of infection control programs, especially in areas with a low MRSA prevalence. PMID:24871220

  8. Rapid and Accurate Determination of Lipopolysaccharide O-Antigen Types in Klebsiella pneumoniae with a Novel PCR-Based O-Genotyping Method

    Science.gov (United States)

    Shih, Yun-Jui; Cheong, Cheng-Man; Yi, Wen-Ching

    2015-01-01

    Klebsiella pneumoniae, a Gram-negative bacillus that causes life-threatening infections in both hospitalized patients and ambulatory persons, can be classified into nine lipopolysaccharide (LPS) O-antigen serotypes. The O-antigen type has important clinical and epidemiological significance. However, K. pneumoniae O serotyping is cumbersome, and the reagents are not commercially available. To overcome the limitations of conventional serotyping methods, we aimed to create a rapid and accurate PCR method for K. pneumoniae O genotyping. We sequenced the genetic determinants of LPS O antigen from serotypes O1, O2a, O2ac, O3, O4, O5, O8, O9, and O12. We established a two-step genotyping scheme, based on the two genomic regions associated with O-antigen biosynthesis. The first set of PCR primers, which detects alleles at the wzm-wzt loci of the wb gene cluster, distinguishes between O1/O2, O3, O4, O5, O8, O9, and O12. The second set of PCR primers, which detects alleles at the wbbY region, further differentiates between O1, O2a, and O2ac. We verified the specificity of O genotyping against the O-serotype reference strains. We then tested the sensitivity and specificity of O genotyping in K. pneumoniae, using the 56 K-serotype reference strains with known O serotypes determined by an inhibition enzyme-linked immunosorbent assay (iELISA). There is a very good correlation between the O genotypes and classical O serotypes. Three discrepancies were observed and resolved by nucleotide sequencing—all in favor of O genotyping. The PCR-based O genotyping, which can be easily performed in clinical and research microbiology laboratories, is a rapid and accurate method for determining the LPS O-antigen types of K. pneumoniae isolates. PMID:26719438

  9. Performance of rapid diagnostic test, blood-film microscopy and PCR for the diagnosis of malaria infection among febrile children from Korogwe District, Tanzania.

    Science.gov (United States)

    Mahende, Coline; Ngasala, Billy; Lusingu, John; Yong, Tai-Soon; Lushino, Paminus; Lemnge, Martha; Mmbando, Bruno; Premji, Zul

    2016-07-26

    Rapid diagnostic tests (RDT) and light microscopy are still recommended for diagnosis to guide the clinical management of malaria despite difficult challenges in rural settings. The performance of these tests may be affected by several factors, including malaria prevalence and intensity of transmission. The study evaluated the diagnostic performance of malaria RDT, light microscopy and polymerase chain reaction (PCR) in detecting malaria infections among febrile children at outpatient clinic in Korogwe District, northeastern Tanzania. The study enrolled children aged 2-59 months with fever and/or history of fever in the previous 48 h attending outpatient clinics. Blood samples were collected for identification of Plasmodium falciparum infection using histidine-rich-protein-2 (HRP-2)-based malaria RDT, light microscopy and conventional PCR. A total of 867 febrile patients were enrolled into the study. Malaria-positive samples were 85/867 (9.8 %, 95 % CI, 7.9-12.0 %) by RDT, 72/867 (8.3 %, 95 % CI, 6.5-10.1 %) by microscopy and 79/677 (11.7 %, 95 % CI, 9.3-14.3 %) by PCR. The performance of malaria RDT compared with microscopy results had sensitivity and positive predictive value (PPV) of 88.9 % (95 % CI, 79.3-95.1 %) and 75.3 % (95 % CI, 64.8-84.0 %), respectively. Confirmation of P. falciparum infection with PCR analysis provided lower sensitivity and PPV of 88.6 % (95 % CI, 79.5-94.7 %) and 84.3 % (95 % CI, 74.7-91.4 %) for RDT compared to microscopy. Diagnosis of malaria infection is still a challenge due to variation in results among diagnostic methods. HRP-2 malaria RDT and microscopy were less sensitive than PCR. Diagnostic tools with high sensitivity are required in areas of low malaria transmission.

  10. Rapid, actionable diagnosis of urban epidemic leptospirosis using a pathogenic Leptospira lipL32-based real-time PCR assay.

    Science.gov (United States)

    Riediger, Irina N; Stoddard, Robyn A; Ribeiro, Guilherme S; Nakatani, Sueli M; Moreira, Suzana D R; Skraba, Irene; Biondo, Alexander W; Reis, Mitermayer G; Hoffmaster, Alex R; Vinetz, Joseph M; Ko, Albert I; Wunder, Elsio A

    2017-09-01

    With a conservatively estimated 1 million cases of leptospirosis worldwide and a 5-10% fatality rate, the rapid diagnosis of leptospirosis leading to effective clinical and public health decision making is of high importance, and yet remains a challenge. Based on parallel, population-based studies in two leptospirosis-endemic regions in Brazil, a real-time PCR assay which detects lipL32, a gene specifically present in pathogenic Leptospira, was assessed for the diagnostic effectiveness and accuracy. Patients identified by active hospital-based surveillance in Salvador and Curitiba during large urban leptospirosis epidemics were tested. Real-time PCR reactions were performed with DNA-extracted samples obtained from 127 confirmed and 23 unconfirmed cases suspected of leptospirosis, 122 patients with an acute febrile illness other than leptospirosis, and 60 healthy blood donors. The PCR assay had a limit of detection of 280 Leptospira genomic equivalents/mL. Sensitivity for confirmed cases was 61% for whole blood and 29% for serum samples. Sensitivity was higher (86%) for samples collected within the first 6 days after onset of illness compared to those collected after 7 days (34%). The real-time PCR assay was able to detect leptospiral DNA in blood from 56% of serological non-confirmed cases. The overall specificity of the assay was 99%. These findings indicate that real-time PCR may be a reliable tool for early diagnosis of leptospirosis, which is decisive for clinical management of severe and life-threatening cases and for public health decision making.

  11. Rapid, actionable diagnosis of urban epidemic leptospirosis using a pathogenic Leptospira lipL32-based real-time PCR assay.

    Directory of Open Access Journals (Sweden)

    Irina N Riediger

    2017-09-01

    Full Text Available With a conservatively estimated 1 million cases of leptospirosis worldwide and a 5-10% fatality rate, the rapid diagnosis of leptospirosis leading to effective clinical and public health decision making is of high importance, and yet remains a challenge.Based on parallel, population-based studies in two leptospirosis-endemic regions in Brazil, a real-time PCR assay which detects lipL32, a gene specifically present in pathogenic Leptospira, was assessed for the diagnostic effectiveness and accuracy. Patients identified by active hospital-based surveillance in Salvador and Curitiba during large urban leptospirosis epidemics were tested. Real-time PCR reactions were performed with DNA-extracted samples obtained from 127 confirmed and 23 unconfirmed cases suspected of leptospirosis, 122 patients with an acute febrile illness other than leptospirosis, and 60 healthy blood donors.The PCR assay had a limit of detection of 280 Leptospira genomic equivalents/mL. Sensitivity for confirmed cases was 61% for whole blood and 29% for serum samples. Sensitivity was higher (86% for samples collected within the first 6 days after onset of illness compared to those collected after 7 days (34%. The real-time PCR assay was able to detect leptospiral DNA in blood from 56% of serological non-confirmed cases. The overall specificity of the assay was 99%.These findings indicate that real-time PCR may be a reliable tool for early diagnosis of leptospirosis, which is decisive for clinical management of severe and life-threatening cases and for public health decision making.

  12. Development and Validation of a Real-Time PCR Assay for Rapid Detection of Two-Spotted Spider Mite, Tetranychus urticae (Acari: Tetranychidae.

    Directory of Open Access Journals (Sweden)

    Dongmei Li

    Full Text Available Spider mites of the genus Tetranychus are difficult to identify due to their limited diagnostic characters. Many of them are morphologically similar and males are needed for species-level identification. Tetranychus urticae is a common interception and non-regulated pest at New Zealand's borders, however, most of the intercepted specimens are females and the identification was left at Tetranychus sp. Consequently, the shipments need to be fumigated. DNA sequencing and PCR-restriction fragment length polymorphism (PCR-RFLP protocols could be used to facilitate the accurate identification. However, in the context of border security practiced in New Zealand, insect identifications are required to be provided within four hours of receiving the samples; thus, those molecular methods are not sufficient to meet this requirement. Therefore, a real-time PCR TaqMan assay was developed for identification of T. urticae by amplification of a 142 bp Internal Transcribed Spacer (ITS 1 sequence. The developed assay is rapid, detects all life stages of T. urticae within three hours, and does not react with closely related species. Plasmid DNA containing ITS1 sequence of T. uritcae was serially diluted and used as standards in the real-time PCR assay. The quantification cycle (Cq value of the assay depicted a strong linear relationship with T. urticae DNA content, with a regression coefficient of 0.99 and efficiency of 98%. The detection limit was estimated to be ten copies of the T. urticae target region. The assay was validated against a range of T. urticae specimens from various countries and hosts in a blind panel test. Therefore the application of the assay at New Zealand will reduce the unnecessary fumigation and be beneficial to both the importers and exporters. It is expected that the implementation of this real-time PCR assay would have wide applications in diagnostic and research agencies worldwide.

  13. Development and Validation of a Real-Time PCR Assay for Rapid Detection of Two-Spotted Spider Mite, Tetranychus urticae (Acari: Tetranychidae).

    Science.gov (United States)

    Li, Dongmei; Fan, Qing-Hai; Waite, David W; Gunawardana, Disna; George, Sherly; Kumarasinghe, Lalith

    2015-01-01

    Spider mites of the genus Tetranychus are difficult to identify due to their limited diagnostic characters. Many of them are morphologically similar and males are needed for species-level identification. Tetranychus urticae is a common interception and non-regulated pest at New Zealand's borders, however, most of the intercepted specimens are females and the identification was left at Tetranychus sp. Consequently, the shipments need to be fumigated. DNA sequencing and PCR-restriction fragment length polymorphism (PCR-RFLP) protocols could be used to facilitate the accurate identification. However, in the context of border security practiced in New Zealand, insect identifications are required to be provided within four hours of receiving the samples; thus, those molecular methods are not sufficient to meet this requirement. Therefore, a real-time PCR TaqMan assay was developed for identification of T. urticae by amplification of a 142 bp Internal Transcribed Spacer (ITS) 1 sequence. The developed assay is rapid, detects all life stages of T. urticae within three hours, and does not react with closely related species. Plasmid DNA containing ITS1 sequence of T. uritcae was serially diluted and used as standards in the real-time PCR assay. The quantification cycle (Cq) value of the assay depicted a strong linear relationship with T. urticae DNA content, with a regression coefficient of 0.99 and efficiency of 98%. The detection limit was estimated to be ten copies of the T. urticae target region. The assay was validated against a range of T. urticae specimens from various countries and hosts in a blind panel test. Therefore the application of the assay at New Zealand will reduce the unnecessary fumigation and be beneficial to both the importers and exporters. It is expected that the implementation of this real-time PCR assay would have wide applications in diagnostic and research agencies worldwide.

  14. Rapid, actionable diagnosis of urban epidemic leptospirosis using a pathogenic Leptospira lipL32-based real-time PCR assay

    Science.gov (United States)

    Stoddard, Robyn A.; Ribeiro, Guilherme S.; Nakatani, Sueli M.; Moreira, Suzana D. R.; Skraba, Irene; Biondo, Alexander W.; Reis, Mitermayer G.; Hoffmaster, Alex R.; Vinetz, Joseph M.; Ko, Albert I.; Wunder, Elsio A.

    2017-01-01

    Background With a conservatively estimated 1 million cases of leptospirosis worldwide and a 5–10% fatality rate, the rapid diagnosis of leptospirosis leading to effective clinical and public health decision making is of high importance, and yet remains a challenge. Methodology Based on parallel, population-based studies in two leptospirosis-endemic regions in Brazil, a real-time PCR assay which detects lipL32, a gene specifically present in pathogenic Leptospira, was assessed for the diagnostic effectiveness and accuracy. Patients identified by active hospital-based surveillance in Salvador and Curitiba during large urban leptospirosis epidemics were tested. Real-time PCR reactions were performed with DNA-extracted samples obtained from 127 confirmed and 23 unconfirmed cases suspected of leptospirosis, 122 patients with an acute febrile illness other than leptospirosis, and 60 healthy blood donors. Principal findings The PCR assay had a limit of detection of 280 Leptospira genomic equivalents/mL. Sensitivity for confirmed cases was 61% for whole blood and 29% for serum samples. Sensitivity was higher (86%) for samples collected within the first 6 days after onset of illness compared to those collected after 7 days (34%). The real-time PCR assay was able to detect leptospiral DNA in blood from 56% of serological non-confirmed cases. The overall specificity of the assay was 99%. Conclusions These findings indicate that real-time PCR may be a reliable tool for early diagnosis of leptospirosis, which is decisive for clinical management of severe and life-threatening cases and for public health decision making. PMID:28915243

  15. Use of high throughput qPCR screening to rapidly clone low frequency tumour specific T-cells from peripheral blood for adoptive immunotherapy

    Directory of Open Access Journals (Sweden)

    Serrano Oscar K

    2008-10-01

    Full Text Available Abstract Background The adoptive transfer of autologous tumor reactive lymphocytes can mediate significant tumor regression in some patients with refractory metastatic cancer. However, a significant obstacle for this promising therapy has been the availability of highly efficient methods to rapidly isolate and expand a variety of potentially rare tumor reactive lymphocytes from the natural repertoire of cancer patients. Methods We developed a novel in vitro T cell cloning methodology using high throughput quantitative RT-PCR (qPCR assay as a rapid functional screen to detect and facilitate the limiting dilution cloning of a variety of low frequency T cells from bulk PBMC. In preclinical studies, this strategy was applied to the isolation and expansion of gp100 specific CD8+ T cell clones from the peripheral blood of melanoma patients. Results In optimization studies, the qPCR assay could detect the reactivity of 1 antigen specific T cell in 100,000 background cells. When applied to short term sensitized PBMC microcultures, this assay could detect T cell reactivity against a variety of known melanoma tumor epitopes. This screening was combined with early limiting dilution cloning to rapidly isolate gp100154–162 reactive CD8+ T cell clones. These clones were highly avid against peptide pulsed targets and melanoma tumor lines. They had an effector memory phenotype and showed significant proliferative capacity to reach cell numbers appropriate for adoptive transfer trials (~1010 cells. Conclusion This report describes a novel high efficiency strategy to clone tumor reactive T cells from peripheral blood for use in adoptive immunotherapy.

  16. Development of a rapid PCR assay for screening of maternal colonization by group B streptococcus and neonatal invasive Escherichia coli during labor.

    Science.gov (United States)

    Martínez de Tejada, Begoña; Stan, Catalin M; Boulvain, Michel; Renzi, Gesuele; François, Patrice; Irion, Olivier; Schrenzel, Jacques

    2010-01-01

    Group B Streptococcus (GBS) and Escherichiacoli(E. coli) are the leading causes of early-onset neonatal disease (EOD). Intrapartum antibiotic prophylaxis of GBS-colonized women decreases vertical transmission and EOD due to GBS. Nevertheless, no intervention has been developed to reduce the risk of EOD related to E. coli. Timely and accurate identification of colonized mothers is necessary to implement preventive strategies against neonatal sepsis. To screen for colonization during labor, we developed a real-time PCR assay for the simultaneous detection of GBS and neonatal invasive strains of E. coli. Specific DNA targets for GBS are publicly available. For neonatal invasive E. coli, we analyzed candidate DNA targets by DNA hybridization on microarrays of invasive strains isolated from neonatal E. coli sepsis or meningitis (K1 and not K1 'invasive' serotypes). Specificity of DNA probes was tested against a panel of bacteria and by simulating clinical conditions (spiking vaginal samples from pregnant women). Then, the characteristics of the selected probes were evaluated in a pilot study including 200 women in labor. Prevalence of rectovaginal GBS and of vaginal and cervical E. coliserotype K1 colonization were 16.0, 3.5 and 3.5% by culture and 27, 10 and 8.5% by PCR, respectively. The prevalence of other invasive E. coli in the vagina and in the cervix, detected by PCR, was around 10%. Compared to the culture, considered as the gold standard, the sensitivities of the PCRs for the GBS and E. coli K1 were 97 and 71%, respectively. Specificities were 86 and 92%, respectively. Specificity is difficult to interpret, as a false-positive PCR result may in fact be a false-negative result of the culture. The turnaround time needed for PCR analysis was 2.5 h, compared to a minimum of 48 h for the culture. Our rapid PCR is reliable in detecting GBS in women in labor. Optimization of the PCR for invasive E. coli is needed before its implementation in clinical practice. More

  17. Rapid quantitative PCR assays for the simultaneous detection of herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein-Barr virus, and human herpesvirus 6 DNA in blood and other clinical specimens

    NARCIS (Netherlands)

    Engelmann, I.; Petzold, D. R.; Kosinska, A.; Hepkema, B. G.; Schulz, T. F.; Heim, A.

    Rapid diagnosis of human herpesvirus primary infections or reactivations is facilitated by quantitative PCRs. Quantitative PCR assays with a standard thermal cycling profile permitting simultaneous detection of herpes simplex virus (HSV), varicella zoster virus (VZV), cytomegalovirus (CMV),

  18. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations

    Directory of Open Access Journals (Sweden)

    You David J

    2012-09-01

    Full Text Available Abstract A computer numerical control (CNC apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using “wire-guided” method (a pipette tip was used in this study. This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate. Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction. The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability, in rapid succession (using droplets

  19. Development of a Taqman real-time PCR assay for rapid detection and quantification of Vibrio tapetis in extrapallial fluids of clams

    Directory of Open Access Journals (Sweden)

    Adeline Bidault

    2015-12-01

    Full Text Available The Gram-negative bacterium Vibrio tapetis is known as the causative agent of Brown Ring Disease (BRD in the Manila clam Venerupis (=Ruditapes philippinarum. This bivalve is the second most important species produced in aquaculture and has a high commercial value. In spite of the development of several molecular methods, no survey has been yet achieved to rapidly quantify the bacterium in the clam. In this study, we developed a Taqman real-time PCR assay targeting virB4 gene for accurate and quantitative identification of V. tapetis strains pathogenic to clams. Sensitivity and reproducibility of the method were assessed using either filtered sea water or extrapallial fluids of clam injected with the CECT4600T V. tapetis strain. Quantification curves of V. tapetis strain seeded in filtered seawater (FSW or extrapallial fluids (EF samples were equivalent showing reliable qPCR efficacies. With this protocol, we were able to specifically detect V. tapetis strains down to 1.125 101 bacteria per mL of EF or FSW, taking into account the dilution factor used for appropriate template DNA preparation. This qPCR assay allowed us to monitor V. tapetis load both experimentally or naturally infected Manila clams. This technique will be particularly useful for monitoring the kinetics of massive infections by V. tapetis and for designing appropriate control measures for aquaculture purposes.

  20. Rapid differentiation of Dirofilaria immitis and Dirofilaria repens in canine peripheral blood by real-time PCR coupled to high resolution melting analysis.

    Science.gov (United States)

    Albonico, Francesca; Loiacono, Monica; Gioia, Gloria; Genchi, Claudio; Genchi, Marco; Mortarino, Michele

    2014-02-24

    Dirofilaria immitis and D. repens are the principal causative agents of canine filariosis and, although the number of dogs subjected to specific prevention is increasing, the prevalence of these parasites remains high in many areas of the world. The discrimination between the two Dirofilaria species using the classical diagnostic methods can be difficult and may lead to misdiagnosis especially on samples from areas where both Dirofilaria are present. Over the last years, several molecular methods with higher sensitivity and specificity compared to classical microscopy and ELISA assays were designed. Nevertheless, a need for simple, rapid, and cost-effective molecular protocols to accurately discriminate between D. immitis and D. repens still remains. High resolution melting analysis coupled to real-time PCR (real-time PCR-HRMA) is a widely used technique to target sequence polymorphisms of the same gene in different species without the need to perform DNA sequencing or to use species-specific probes. In this work, a fast and cost-effective real-time PCR-HRMA protocol to detect and differentiate simultaneously and unequivocally D. immitis and D. repens microfilarial DNA extracted from peripheral dog blood samples is described. The present method is simpler to use than most other DNA-based methods and provides comparable discrimination between the two sibling species. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Allele specific expression analysis identifies regulatory variation associated with stress-related genes in the Mexican highland maize landrace Palomero Toluqueño.

    Science.gov (United States)

    Aguilar-Rangel, M Rocío; Chávez Montes, Ricardo A; González-Segovia, Eric; Ross-Ibarra, Jeffrey; Simpson, June K; Sawers, Ruairidh J H

    2017-01-01

    Gene regulatory variation has been proposed to play an important role in the adaptation of plants to environmental stress. In the central highlands of Mexico, farmer selection has generated a unique group of maize landraces adapted to the challenges of the highland niche. In this study, gene expression in Mexican highland maize and a reference maize breeding line were compared to identify evidence of regulatory variation in stress-related genes. It was hypothesised that local adaptation in Mexican highland maize would be associated with a transcriptional signature observable even under benign conditions. Allele specific expression analysis was performed using the seedling-leaf transcriptome of an F1 individual generated from the cross between the highland adapted Mexican landrace Palomero Toluqueño and the reference line B73, grown under benign conditions. Results were compared with a published dataset describing the transcriptional response of B73 seedlings to cold, heat, salt and UV treatments. A total of 2,386 genes were identified to show allele specific expression. Of these, 277 showed an expression difference between Palomero Toluqueño and B73 alleles under benign conditions that anticipated the response of B73 cold, heat, salt and/or UV treatments, and, as such, were considered to display a prior stress response. Prior stress response candidates included genes associated with plant hormone signaling and a number of transcription factors. Construction of a gene co-expression network revealed further signaling and stress-related genes to be among the potential targets of the transcription factors candidates. Prior activation of responses may represent the best strategy when stresses are severe but predictable. Expression differences observed here between Palomero Toluqueño and B73 alleles indicate the presence of cis-acting regulatory variation linked to stress-related genes in Palomero Toluqueño. Considered alongside gene annotation and population data

  2. Rapid screening of pyogenic Staphylococcus aureus for confirmation of genus and species, methicillin resistance and virulence factors by using two novel multiplex PCR.

    Science.gov (United States)

    Haque, Abdul; Haque, Asma; Saeed, Muhammad; Azhar, Aysha; Rasool, Samreen; Shan, Sidra; Ehsan, Beenish; Nisar, Zohaib

    2017-01-01

    Emergence of methicillin resistant Staphylococcus aureus (MRSA) is a major medical problem of current era. These bacteria are resistant to most drugs and rapid diagnosis can provide a clear guideline to clinicians. They possess specific virulence factors and relevant information can be very useful. We designed this study to develop multiplex PCRs to provide rapid information. We studied 60 Staphylococcus aureus isolates and detected methicillin resistance by cefoxitin sensitivity and targeting of mecA gene. After initial studies with uniplex PCRs we optimized two multiplex PCRs with highly reproducible results. The first multiplex PCR was developed to confirm genus, species and methicillin resistance simultaneously, and the second multiplex PCR was for screening of virulence factors. We found 38.33% isolates as methicillin resistant. α -toxin, the major cytotoxic factor, was detected in 40% whereas β-hemolysin was found in 25% cases. Panton Valentine leucocidin was detected in 8.33% and toxic shock syndrome toxin in5% cases. The results of uniplex and multiplex PCRs were highly compatible. These two multiplex PCRs when run simultaneously can provide vital information about methicillin resistance and virulence status of the isolate within a few hours as compared to several days needed by routine procedures.

  3. Development of a rapid DNA extraction method and one-step nested PCR for the detection of Naegleria fowleri from the environment.

    Science.gov (United States)

    Ahmad, Arine Fadzlun; Lonnen, James; Andrew, Peter W; Kilvington, Simon

    2011-10-15

    Naegleria fowleri is a small free-living amoebo-flagellate found in natural and manmade thermal aquatic habitats worldwide. The organism is pathogenic to man causing fatal primary amoebic meningoencephalitis (PAM). Infection typically results from bathing in contaminated water and is usually fatal. It is, therefore, important to identify sites containing N. fowleri in the interests of preventive public health microbiology. Culture of environmental material is the conventional method for the isolation of N. fowleri but requires several days incubation and subsequent biochemical or molecular tests to confirm identification. Here, a nested one-step PCR test, in conjunction with a direct DNA extraction from water or sediment material, was developed for the rapid and reliable detection of N. fowleri from the environment. Here, the assay detected N, fowleri in 18/109 river water samples associated with a nuclear power plant in South West France and 0/10 from a similar site in the UK. Although culture of samples yielded numerous thermophilic free-living amoebae, none were N. fowleri or other thermophilic Naegleria spp. The availability of a rapid, reliable and sensitive one-step nested PCR method for the direct detection of N. fowleri from the environment may aid ecological studies and enable intervention to prevent PAM cases. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

  4. PCR method for the rapid detection and discrimination of Legionella spp. based on the amplification of pcs, pmtA, and 16S rRNA genes.

    Science.gov (United States)

    Janczarek, Monika; Palusińska-Szysz, Marta

    2016-05-01

    Legionella bacteria are organisms of public health interest due to their ability to cause pneumonia (Legionnaires' disease) in susceptible humans and their ubiquitous presence in water supply systems. Rapid diagnosis of Legionnaires' disease allows the use of therapy specific for the disease. L. pneumophila serogroup 1 is the most common cause of infection acquired in community and hospital environments. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this work, simplex and duplex PCR assays with the use of new molecular markers pcs and pmtA involved in phosphatidylcholine synthesis were specified for rapid and cost-efficient identification and distinguishing Legionella species. The sets of primers developed were found to be sensitive and specific for reliable detection of Legionella belonging to the eight most clinically relevant species. Among these, four primer sets I, II, VI, and VII used for duplex-PCRs proved to have the highest identification power and reliability in the detection of the bacteria. Application of this PCR-based method should improve detection of Legionella spp. in both clinical and environmental settings and facilitate molecular typing of these organisms.

  5. Rapid detection and identification of Wuchereria bancrofti, Brugia malayi, B. pahangi, and Dirofilaria immitis in mosquito vectors and blood samples by high resolution melting real-time PCR.

    Science.gov (United States)

    Thanchomnang, Tongjit; Intapan, Pewpan M; Tantrawatpan, Chairat; Lulitanond, Viraphong; Chungpivat, Sudchit; Taweethavonsawat, Piyanan; Kaewkong, Worasak; Sanpool, Oranuch; Janwan, Penchom; Choochote, Wej; Maleewong, Wanchai

    2013-12-01

    A simple, rapid, and high-throughput method for detection and identification of Wuchereria bancrofti, Brugia malayi, Brugia pahangi, and Dirofilaria immitis in mosquito vectors and blood samples was developed using a real-time PCR combined with high-resolution melting (HRM) analysis. Amplicons of the 4 filarial species were generated from 5S rRNA and spliced leader sequences by the real-time PCR and their melting temperatures were determined by the HRM method. Melting of amplicons from W. bancrofti, B. malayi, D. immitis, and B. pahangi peaked at 81.5±0.2℃, 79.0±0.3℃, 76.8±0.1℃, and 79.9±0.1℃, respectively. This assay is relatively cheap since it does not require synthesis of hybridization probes. Its sensitivity and specificity were 100%. It is a rapid and technically simple approach, and an important tool for population surveys as well as molecular xenomonitoring of parasites in vectors.

  6. Rapid Identification of Pathogens from Positive Blood Cultures by Multiplex PCR using the FilmArray System

    Science.gov (United States)

    Blaschke, Anne J.; Heyrend, Caroline; Byington, Carrie L.; Fisher, Mark A.; Barker, Elizabeth; Garrone, Nicholas F.; Thatcher, Stephanie A.; Pavia, Andrew T.; Barney, Trenda; Alger, Garrison D.; Daly, Judy A.; Ririe, Kirk M.; Ota, Irene; Poritz, Mark A.

    2012-01-01

    Sepsis is a leading cause of death. Rapid and accurate identification of pathogens and antimicrobial resistance directly from blood culture could improve patient outcomes. The FilmArray® (FA; Idaho Technology, Inc., Salt Lake City, UT) Blood Culture (BC) panel can identify > 25 pathogens and 4 antibiotic resistance genes from positive blood cultures in 1 hour. We compared a development version of the panel to conventional culture and susceptibility testing on 102 archived blood cultures from adults and children with bacteremia. Of 109 pathogens identified by culture, 95% were identified by FA. Among 111 prospectively collected blood cultures, the FA identified 84 of 92 pathogens (91%) covered by the panel. Among 25 Staphylococcus aureus and 21 Enterococcus species detected, FA identified all culture-proven MRSA and VRE. The FA BC panel is an accurate method for the rapid identification of pathogens and resistance genes from blood culture. PMID:22999332

  7. Use of Triplex PCR for Rapid Detection of PVL and Differentiation of MRSA from Methicillin Resistant Coagulase Negative Staphylococci

    OpenAIRE

    Abimanyu, Nagarajan; Krishnan, Arunkumar; Murugesan, Saravanan; Subramanian G, Kaushik; Gurumurthy, Sivakumar; Krishnan, Padma

    2013-01-01

    Introduction: Methicillin-Resistant Staphylococcus aureus (MRSA) has become a major public health problem in both hospitals and communities. Panton – Valentine Leucocidin (PVL) has been reported to be an important marker for the highly pathogenic community acquired S. aureus infections. A rapid detection of these MRSA is very important for its treatment. The specific detection of MRSA is always a problem due to the prevalence of methicillin resistance among the coagulase negative Staphylococc...

  8. Rapid and Sensitive Detection of Yersinia pestis Using Amplification of Plague Diagnostic Bacteriophages Monitored by Real-Time PCR

    Science.gov (United States)

    2010-06-01

    plating test for bacteriophage l quantitation [43] and then successfully applied for the indirect detection of Bacillus anthracis [44] and the plant ...of Listeria monocytogenes in the peresence of Listeria innocua. In: Campbell AK, Kricka LJ, Stanley PE, eds. Bioluminescence and chemilumi- nescence...rapid and sensitive detection of viable Listeria cells. Appl Environ Microbiol 62: 1133–1140. 37. Banaiee N, Bobadilla-Del-Valle M, Bardarov S, Jr

  9. Rapid real-time diagnostic PCR for Trichophyton rubrum and Trichophyton mentagrophytes in patients with tinea unguium and tinea pedis using specific fluorescent probes.

    Science.gov (United States)

    Miyajima, Yoshiharu; Satoh, Kazuo; Uchida, Takao; Yamada, Tsuyoshi; Abe, Michiko; Watanabe, Shin-ichi; Makimura, Miho; Makimura, Koichi

    2013-03-01

    Trichophyton rubrum and Trichophyton mentagrophytes human-type (synonym, Trichophyton interdigitale (anthropophilic)) are major causative pathogens of tinea unguium. For suitable diagnosis and treatment, rapid and accurate identification of etiologic agents in clinical samples using reliable molecular based method is required. For identification of organisms causing tinea unguium, we developed a new real-time polymerase chain reaction (PCR) with a pan-fungal primer set and probe, as well as specific primer sets and probes for T. rubrum and T. mentagrophytes human-type. We designed two sets of primers from the internal transcribed spacer 1 (ITS1) region of fungal ribosomal DNA (rDNA) and three quadruple fluorescent probes, one for detection wide range pathogenic fungi and two for classification of T. rubrum and T. mentagrophytes by specific binding to different sites in the ITS1 region. We investigated the specificity of these primer sets and probes using fungal genomic DNA, and also examined 42 clinical specimens with our real-time PCR. The primers and probes specifically detected T. rubrum, T. mentagrophytes, and a wide range of pathogenic fungi. The causative pathogens were identified in 42 nail and skin samples from 32 patients. The total time required for identification of fungal species in each clinical specimen was about 3h. The copy number of each fungal DNA in the clinical specimens was estimated from the intensity of fluorescence simultaneously. This PCR system is one of the most rapid and sensitive methods available for diagnosing dermatophytosis, including tinea unguium and tinea pedis. Copyright © 2012 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  10. Rapid identification and quantification of Campylobacter coli and Campylobacter jejuni by real-time PCR in pure cultures and in complex samples.

    Science.gov (United States)

    Leblanc-Maridor, Mily; Beaudeau, François; Seegers, Henri; Denis, Martine; Belloc, Catherine

    2011-05-22

    Campylobacter spp., especially Campylobacter jejuni (C. jejuni) and Campylobacter coli (C. coli), are recognized as the leading human foodborne pathogens in developed countries. Livestock animals carrying Campylobacter pose an important risk for human contamination. Pigs are known to be frequently colonized with Campylobacter, especially C. coli, and to excrete high numbers of this pathogen in their faeces. Molecular tools, notably real-time PCR, provide an effective, rapid, and sensitive alternative to culture-based methods for the detection of C. coli and C. jejuni in various substrates. In order to serve as a diagnostic tool supporting Campylobacter epidemiology, we developed a quantitative real-time PCR method for species-specific detection and quantification of C. coli and C. jejuni directly in faecal, feed, and environmental samples. With a sensitivity of 10 genome copies and a linear range of seven to eight orders of magnitude, the C. coli and C. jejuni real-time PCR assays allowed a precise quantification of purified DNA from C. coli and C. jejuni. The assays were highly specific and showed a 6-log-linear dynamic range of quantification with a quantitative detection limit of approximately 2.5 × 10² CFU/g of faeces, 1.3 × 10² CFU/g of feed, and 1.0 × 10³ CFU/m² for the environmental samples. Compared to the results obtained by culture, both C. coli and C. jejuni real-time PCR assays exhibited a specificity of 96.2% with a kappa of 0.94 and 0.89 respectively. For faecal samples of experimentally infected pigs, the coefficients of correlation between the C. coli or C. jejuni real-time PCR assay and culture enumeration were R² = 0.90 and R² = 0.93 respectively. The C. coli and C. jejuni real-time quantitative PCR assays developed in this study provide a method capable of directly detecting and quantifying C. coli and C. jejuni in faeces, feed, and environmental samples. These assays represent a new diagnostic tool for studying the epidemiology of

  11. Rapid identification and quantification of Campylobacter coli and Campylobacter jejuni by real-time PCR in pure cultures and in complex samples

    Directory of Open Access Journals (Sweden)

    Denis Martine

    2011-05-01

    Full Text Available Abstract Background Campylobacter spp., especially Campylobacter jejuni (C. jejuni and Campylobacter coli (C. coli, are recognized as the leading human foodborne pathogens in developed countries. Livestock animals carrying Campylobacter pose an important risk for human contamination. Pigs are known to be frequently colonized with Campylobacter, especially C. coli, and to excrete high numbers of this pathogen in their faeces. Molecular tools, notably real-time PCR, provide an effective, rapid, and sensitive alternative to culture-based methods for the detection of C. coli and C. jejuni in various substrates. In order to serve as a diagnostic tool supporting Campylobacter epidemiology, we developed a quantitative real-time PCR method for species-specific detection and quantification of C. coli and C. jejuni directly in faecal, feed, and environmental samples. Results With a sensitivity of 10 genome copies and a linear range of seven to eight orders of magnitude, the C. coli and C. jejuni real-time PCR assays allowed a precise quantification of purified DNA from C. coli and C. jejuni. The assays were highly specific and showed a 6-log-linear dynamic range of quantification with a quantitative detection limit of approximately 2.5 × 102 CFU/g of faeces, 1.3 × 102 CFU/g of feed, and 1.0 × 103 CFU/m2 for the environmental samples. Compared to the results obtained by culture, both C. coli and C. jejuni real-time PCR assays exhibited a specificity of 96.2% with a kappa of 0.94 and 0.89 respectively. For faecal samples of experimentally infected pigs, the coefficients of correlation between the C. coli or C. jejuni real-time PCR assay and culture enumeration were R2 = 0.90 and R2 = 0.93 respectively. Conclusion The C. coli and C. jejuni real-time quantitative PCR assays developed in this study provide a method capable of directly detecting and quantifying C. coli and C. jejuni in faeces, feed, and environmental samples. These assays represent a new

  12. Rapid identification and quantification of Campylobacter coli and Campylobacter jejuni by real-time PCR in pure cultures and in complex samples

    Science.gov (United States)

    2011-01-01

    Background Campylobacter spp., especially Campylobacter jejuni (C. jejuni) and Campylobacter coli (C. coli), are recognized as the leading human foodborne pathogens in developed countries. Livestock animals carrying Campylobacter pose an important risk for human contamination. Pigs are known to be frequently colonized with Campylobacter, especially C. coli, and to excrete high numbers of this pathogen in their faeces. Molecular tools, notably real-time PCR, provide an effective, rapid, and sensitive alternative to culture-based methods for the detection of C. coli and C. jejuni in various substrates. In order to serve as a diagnostic tool supporting Campylobacter epidemiology, we developed a quantitative real-time PCR method for species-specific detection and quantification of C. coli and C. jejuni directly in faecal, feed, and environmental samples. Results With a sensitivity of 10 genome copies and a linear range of seven to eight orders of magnitude, the C. coli and C. jejuni real-time PCR assays allowed a precise quantification of purified DNA from C. coli and C. jejuni. The assays were highly specific and showed a 6-log-linear dynamic range of quantification with a quantitative detection limit of approximately 2.5 × 102 CFU/g of faeces, 1.3 × 102 CFU/g of feed, and 1.0 × 103 CFU/m2 for the environmental samples. Compared to the results obtained by culture, both C. coli and C. jejuni real-time PCR assays exhibited a specificity of 96.2% with a kappa of 0.94 and 0.89 respectively. For faecal samples of experimentally infected pigs, the coefficients of correlation between the C. coli or C. jejuni real-time PCR assay and culture enumeration were R2 = 0.90 and R2 = 0.93 respectively. Conclusion The C. coli and C. jejuni real-time quantitative PCR assays developed in this study provide a method capable of directly detecting and quantifying C. coli and C. jejuni in faeces, feed, and environmental samples. These assays represent a new diagnostic tool for studying

  13. Real-time PCR followed by high-resolution melting curve analysis: A rapid and pragmatic approach for screening of multidrug-resistant extrapulmonary tuberculosis.

    Science.gov (United States)

    Sharma, Kusum; Sharma, Megha; Singh, Shreya; Modi, Manish; Sharma, Aman; Ray, Pallab; Varma, Subhash

    2017-09-01

    Multidrug resistance (MDR) in extrapulmonary tuberculosis (EPTB) is a diagnostic challenge in an endemic country like India. Timely detection of MDR-TB can contribute to a better patient outcome. To perform real-time PCR (qPCR) using rpoB, mpb64 and IS6110 gene on a variety of EPTB samples and to compare the performance of different gene targets. All qPCR positive samples were subjected to high resolution melt-curve analysis (HRM analysis) for rpoB and katG gene to evaluate its potential for MDR screening among different sample types. Real-time PCR using rpoB, mpb64 and IS6110 genes was carried out on 200 cases of study group and 100 cases of non-TB control group. The study group consisted of 100 culture-confirmed and 100 clinically suspected cases of EPTB. Phenotypic drug susceptibility testing (DST) for culture isolates was performed by the 1% indirect agar proportion method. DNA extracted from all qPCR positive samples was subjected to rpoB and katG HRM analysis for screening of MDR. Sequencing was used to confirm the results of HRM analysis and the results were also compared with phenotypic DST in all culture positive cases. The sensitivity of qPCR using rpoB, mpb64 and IS6110 was 86.5%, 86.5% and 76.5%, respectively. All isolates from the control group were negative by all the three targets, giving a specificity of 100%. HRM analysis detected MDR in 22/200 (11%) isolates. 3/200 (1.5%) had mono-rifampicin resistance while 8/200 (4%) had mono-isoniazid resistance. HRM analysis identified an additional 4 MDR cases directly from the samples which were negative by culture. On sequencing, mutations were observed at codon 531 (60%); 533 (16%); 516 (12%) and 526 (12%) of the rpoB gene and at codon 315 (100%) of the katG gene. There was 100% concordance in the results of phenotypic DST, HRM analysis and sequencing. The HRM analysis can play a promising role in the reliable and rapid screening of EPTB samples for detection of MDR. Copyright © 2017 Elsevier Ltd. All

  14. An experimental study for rapid detection and quantification of endodontic microbiota following photo-activated disinfection via new multiplex real-time PCR assay.

    Science.gov (United States)

    Pourhajibagher, Maryam; Raoofian, Reza; Ghorbanzadeh, Roghayeh; Bahador, Abbas

    2018-01-11

    The infected root canal system harbors one of the highest accumulations of polymicrobial infections. Since the eradication of endopathogenic microbiota is a major goal in endodontic infection therapy, photo-activated disinfection (PAD) can be used as an alternative therapeutic method in endodontic treatment. Compared to cultivation-based approaches, molecular techniques are more reliable for identifying microbial agents associated with endodontic infections. The purpose of this study was to evaluate the ability of designed multiplex real-time PCR protocol for the rapid detection and quantification of six common microorganisms involved in endodontic infection before and after the PAD. Samples were taken from the root canals of 50 patients with primary and secondary/persistent endodontic infections using sterile paper points. PAD with toluidine blue O (TBO) plus diode laser was performed on root canals. Resampling was then performed, and the samples were transferred to transport medium. Then, six target microorganisms were detected using multiplex real-time PCR before and after the PAD. Veillonella parvula was found using multiplex real-time PCR to have the highest frequency among samples collected before the PAD (29.4%), followed by Porphyromonas. gingivalis (23.1%), Aggregatibacter actinomycetemcomitans (13.6%), Actinomyces naeslundii (13.0%), Enterococcus faecalis (11.5%), and Lactobacillus rhamnosus (9.4%). After TBO-mediated PAD, P. gingivalis strains, the most resistance microorganisms, were recovered in 41.7% of the samples using molecular approach (P > 0.05). As the results shown, multiplex real-time PCR as an accurate detection approach with high-throughput and TBO-mediated PAD as an efficient antimicrobial strategy due to the significant reduction of the endopathogenic count can be used for detection and treatment of microbiota involved in infected root canals, respectively. Copyright © 2018. Published by Elsevier B.V.

  15. Rapid detection of novel caprine parainfluenza virus type 3 (CPIV3) using a TaqMan-based RT-qPCR.

    Science.gov (United States)

    Li, Jizong; Li, Wenliang; Mao, Li; Hao, Fei; Yang, Leilei; Zhang, Wenwen; Jiang, Jieyuan

    2016-10-01

    Parainfluenza virus type 3 (PIV3) is one of the most important respiratory pathogens for humans and many animals. A novel caprine PIV3 (CPIV3) was recently identified and isolated from Chinese goat flocks with respiratory disease. In order to develop rapid and sensitive methods for CPIV3 detection in infected goats, a TaqMan RT-qPCR was established in this study based on the primers and probe designed to amplify a 150 nucleotide-long region located within the M gene of the virus. The method was able to detect about 1.0×10(1) DNA copies/μL with an efficiency of 99.6% and a R(2) value of 0.997. There were no cross-reaction observed using this technique against peste des petits ruminants virus (PPRV), border disease virus (BDV), bluetongue virus (BTV) and bovine viral diarrhea virus (BVDV). One hundred and fourteen samples, including nasal swabs, feces swabs, sera, hearts, livers, spleens, lungs, kidneys, tracheas and hilar lymph nodes (HLNs) from six challenged goats, were evaluated by this technique. Using TaqMan RT-qPCR, CPIV3 was positively detected in 51 of 114 samples (44.74%), which was higher than RT-PCR (27.19%, 31/114) and virus isolation (14.9%, 17/114), respectively. The method also gave higher positive detection rate (35%, 42/120) than RT-PCR (28.33%, 34/120) from clinical samples. These data indicated that this method could be used for faster and more accurate monitoring of viral load, disease progression and vaccination efficacy of CPIV3 in goat flocks. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Genotype-specific real-time PCR combined with high-resolution melting analysis for rapid identification of red-spotted grouper nervous necrosis virus.

    Science.gov (United States)

    Toubanaki, Dimitra K; Karagouni, Evdokia

    2017-08-01

    A real-time genotype-specific polymerase chain reaction (PCR) assay combined with high-resolution melting (HRM) analysis was developed to assess the most common genotypes of nervous necrosis viruses or nodaviruses. Nodaviruses are the causal agents of viral nervous necrosis infections, which have been wreaking havoc in the aquaculture industry worldwide, with fish mortality up to 100%. The four different genotypes of nodaviruses correlate with differences in viral pathogenicity. Therefore, rational development of effective vaccines and diagnostics requires analysis of genetic variation among viruses. The aim of the present study was to develop a real-time tetra-primer genotype-specific PCR assay for genotype identification. Four primers were utilized for simultaneous amplification of nodavirus genotype-specific products in a single closed-tube PCR after a reverse-transcription reaction using RNA isolated from fish samples. For high-throughput sample analysis, SYBR Green-based real-time PCR was used in combination with HRM analysis. The assay was evaluated in terms of specificity and sensitivity. The analysis resulted in melting curves that were indicative of each genotype. The detection limit when using reference plasmids was 100 ag/µL for both genotypes, while the sensitivity of the assays when testing a complex mixture was 10 fg/µL for red-spotted grouper nervous necrosis virus (RGNNV) and 100 fg/µL for striped jack nervous necrosis virus (SJNNV). To test the capability of this method under real-world conditions, 58 samples were examined. All samples belonged to the RGNNV genotype, which was fully validated. The results were in full agreement with genotyping by reference methods. The proposed methodology provides a rapid, sensitive, specific, robust and automatable assay for nodavirus genotyping, making it a useful tool for diagnosis and screening for epidemiological studies.

  17. Allele-specific gene expression patterns in primary leukemic cells reveal regulation of gene expression by CpG site methylation

    DEFF Research Database (Denmark)

    Milani, Lili; Lundmark, Anders; Nordlund, Jessica

    2008-01-01

    To identify genes that are regulated by cis-acting functional elements in acute lymphoblastic leukemia (ALL) we determined the allele-specific expression (ASE) levels of 2, 529 genes by genotyping a genome-wide panel of single nucleotide polymorphisms in RNA and DNA from bone marrow and blood...... of these sites. Our results demonstrate that CpG site methylation is one of the factors that regulates gene expression in ALL cells....... overexpression of one allele to apparent monoallelic expression. For genes exhibiting ASE, 55% displayed bidirectional ASE in which overexpression of either of the two SNP alleles occurred. For bidirectional ASE we also observed overall higher levels of ASE and correlation with the methylation level...

  18. Performance of the Real Fungus-ID kit based on multiplex RT-PCR assay for the rapid detection and identification of Trichophyton spp. and Microsporum spp. in clinical specimens with suspected dermatophyte infection.

    Science.gov (United States)

    Wang, H-Y; Kim, H; Choi, E H; Lee, H

    2016-01-01

    The aim of this study was to evaluate the performance of a commercially available multiplex RT-PCR assay for the rapid detection and identification of dermatophytes directly from clinical samples and cultures. The multiplex RT-PCR assay was used to evaluate 118 clinical isolates from various specimen types and a total of 140 known specimens were compared with both conventional methods, commercially available PCR-REBA, and ITS sequence analysis. In this study, multiplex RT-PCR assay yield significantly more positive results than culture (91·9 vs 39·5%) and conventional methods including KOH microscopy (91·9 vs 71·3%). Although the results among the multiplex RT-PCR, PCR-REBA and ITS sequence analysis were concordant (100%) in 118 clinical isolates, concordant results between multiplex RT-PCR assay and culture were at 66% (78/118). The overall positive rates for the PCR-REBA, multiplex RT-PCR assay and ITS sequence analysis were 98·8, 91·9, and 52·9% respectively. In addition, the concordance rate of multiplex RT-PCR assay and the PCR-REBA assay was 93% (95% confidence interval (CI), 89·9-96·1, P culture can take up to 2-3 weeks. The use of the multiplex RT-PCR molecular diagnostic assay was rapid and reliable for detecting pathogen infections. Even though the use of molecular diagnostic technology is more expensive than conventional methods, the clinical and economic benefit of saving time relative to expense remains to be elucidated. Therefore, the multiplex RT-PCR assay may provide the essential information to accelerate therapeutic decisions for earlier and adequate antibiotic treatment in the acute phase of fungal pathogen infections. © 2015 The Society for Applied Microbiology.

  19. Multiplex PCR system for the rapid diagnosis of respiratory virus infection: systematic review and meta-analysis.

    Science.gov (United States)

    Huang, H-S; Tsai, C-L; Chang, J; Hsu, T-C; Lin, S; Lee, C-C

    2017-12-05

    To provide a summary of evidence for the diagnostic accuracies of three multiplex PCR systems (mPCRs)-BioFire FilmArray RP (FilmArray), Nanosphere Verigene RV+ test (Verigene RV+) and Hologic Gen-Probe Prodesse assays-on the detection of viral respiratory infections. A comprehensive search up to 1 July 2017 was conducted on Medline and Embase for studies that utilized FilmArray, Verigene RV+ and Prodesse for diagnosis of viral respiratory infections. A summary of diagnostic accuracies for the following five viruses were calculated: influenza A virus (FluA), influenza B virus, respiratory syncytial virus, human metapneumovirus and adenovirus. Hierarchical summary receiver operating curves were used for estimating the viral detection performance per assay. Twenty studies of 5510 patient samples were eligible for analysis. Multiplex PCRs demonstrated high diagnostic accuracy, with area under the receiver operating characteristic curve (AUROC) equal to or more than 0.98 for all the above viruses except for adenovirus (AUROC 0.89). FilmArray, Verigene RV+ and ProFlu+ (the only Prodesse assay with enough data) demonstrated a summary sensitivity for FluA of 0.911 (95% confidence interval, 0.848-0.949), 0.949 (95% confidence interval, 0.882-0.979) and 0.954 (95% confidence interval, 0.871-0.985), respectively. The three mPCRs were comparable in terms of detection of FluA. Point estimates calculated from eligible studies showed that the three mPCRs (FilmArray, Verigene RV+ and ProFlu+) are highly accurate and may provide important diagnostic information for early identification of respiratory virus infections. In patients with low pretest probability for FluA, these three mPCRs can predict a low possibility of infection and may justify withholding empirical antiviral treatments. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  20. Rapid Diagnosis of Staphylococcal Catheter-Related Bacteraemia in Direct Blood Samples by Real-Time PCR.

    Science.gov (United States)

    Zboromyrska, Yuliya; De la Calle, Cristina; Soto, Marcelo; Sampietro-Colom, Laura; Soriano, Alex; Alvarez-Martínez, Míriam José; Almela, Manel; Marco, Francesc; Arjona, Ruth; Cobos-Trigueros, Nazaret; Morata, Laura; Mensa, José; Martínez, José Antonio; Mira, Aurea; Vila, Jordi

    2016-01-01

    Catheter-related bacteremia (CRB) is an important cause of morbidity and mortality among hospitalized patients, being staphylococci the main etiologic agents. The objective of this study was to assess the use of a PCR-based assay for detection of staphylococci directly from blood obtained through the catheter to diagnose CRB caused by these microorganisms and to perform a cost-effectiveness analysis. A total of 92 patients with suspected CRB were included in the study. Samples were obtained through the catheter. Paired blood cultures were processed by standard culture methods and 4 ml blood samples were processed by GeneXpert-MRSA assay for the detection of methicillin-susceptible (MSSA) or methicillin-resistant (MRSA) Staphylococcus aureus, and methicillin-resistant coagulase-negative staphylococci (MR-CoNS). Sixteen CRB caused by staphylococci were diagnosed among 92 suspected patients. GeneXpert detected 14 out of 16 cases (87.5%), including 4 MSSA and 10 MR-CoNS in approximately 1 hour after specimen receipt. The sensitivity and specificity of GeneXpert were 87.5% (CI 95%: 60.4-97.8) and 92.1% (CI 95%: 83-96.7), respectively, compared with standard culture methods. The sensitivity of GeneXpert for S. aureus was 100%. Regarding a cost-effectiveness analysis, the incremental cost of using GeneXpert was of 31.1€ per patient while the incremental cost-effectiveness ratio of GeneXpert compared with blood culture alones was about 180€ per life year gained. In conclusion, GeneXpert can be used directly with blood samples obtained through infected catheters to detect S. aureus and MR-CoNS in approximately 1h after sampling. In addition, it is cost-effective especially in areas with high prevalence of staphylococcal CRB.

  1. Rapid identification of Iranian Acinetobacter baumannii strains by single PCR assay using BLA oxa-51 -like carbapenemase and evaluation of the antimicrobial resistance profiles of the isolates.

    Science.gov (United States)

    Akbari, Mahdi; Mahdi, Akbari; Niakan, Mohammad; Mohammad, Niakan; Taherikalani, Morovat; Morovat, Taherikalani; Feizabadi, Mohammad Mehdi; Mhammad-Mahdi, Feizabadi; Azadi, Namam Ali; Namam-Ali, Azadi; Soroush, Setareh; Setareh, Soroush; Emaneini, Mohammad; Mohammad, Emaneini; Abdolkarimi, Amir; Amir, Abdolkarimi; Maleki, Abbas; Abbas, Maleki; Hematian, Ali; Ali, Hematian

    2010-06-01

    The rapid identification of relevant bacterial pathogens is of utmost importance in clinical settings. The aim of this study was to test a rapid identification technique for A. baumannii strains from Tehran Hospitals and to determine the antibiotic resistance profiles of the isolates. A hundred strains of Acinetobacter spp. grown from clinical specimens were identified as A. baumannii by conventional methods. Using PCR a bla OXA-51 -like gene was detected in all A. baumannii isolates but not in other species of acinetobacter. More than half of the isolates proved resistant to a variety of antibiotics by the disk diffusion technique. The rate of resistance to gentamicin, imipenem, ampicillin-sulbactam and amikacin was determined to be 45%, 53%, 62% and 62%, respectively. Moreover, most isolates (more than 90%) showed resistance to cephalosporins. This study shows that the demonstration of the bla OXA-51-like gene is a reliable and rapid way for the presumptive identification of A. baumannii and reveals that the rate of antibiotic resistance is high in Iranian A. baumannii isolates to a variety of antibiotics.

  2. Rapid detection of Shigella and enteroinvasive Escherichia coli in produce enrichments by a conventional multiplex PCR assay.

    Science.gov (United States)

    Binet, Rachel; Deer, Deanne M; Uhlfelder, Samantha J

    2014-06-01

    Faster detection of contaminated foods can prevent adulterated foods from being consumed and minimize the risk of an outbreak of foodborne illness. A sensitive molecular detection method is especially important for Shigella because ingestion of as few as 10 of these bacterial pathogens can cause disease. The objectives of this study were to compare the ability of four DNA extraction methods to detect Shigella in six types of produce, post-enrichment, and to evaluate a new and rapid conventional multiplex assay that targets the Shigella ipaH, virB and mxiC virulence genes. This assay can detect less than two Shigella cells in pure culture, even when the pathogen is mixed with background microflora, and it can also differentiate natural Shigella strains from a control strain and eliminate false positive results due to accidental laboratory contamination. The four DNA extraction methods (boiling, PrepMan Ultra [Applied Biosystems], InstaGene Matrix [Bio-Rad], DNeasy Tissue kit [Qiagen]) detected 1.6 × 10(3)Shigella CFU/ml post-enrichment, requiring ∼18 doublings to one cell in 25 g of produce pre-enrichment. Lower sensitivity was obtained, depending on produce type and extraction method. The InstaGene Matrix was the most consistent and sensitive and the multiplex assay accurately detected Shigella in less than 90 min, outperforming, to the best of our knowledge, molecular assays currently in place for this pathogen. Published by Elsevier Ltd.

  3. A broadly reactive one-step SYBR Green I real-time RT-PCR assay for rapid detection of murine norovirus.

    Directory of Open Access Journals (Sweden)

    Ken-Ichi Hanaki

    Full Text Available A one-step SYBR Green I real-time RT-PCR assay was developed for the detection and quantification of a broad range of murine noroviruses (MNVs. The primer design was based on the multiple sequence alignments of 101 sequences of the open reading frame (ORF1-ORF2 junction of MNV. The broad reactivity and quantitative capacity of the assay were validated using 7 MNV plasmids. The assay was completed within 1 h, and the reliable detection limit was 10 copies of MNV plasmid or 0.063 median tissue culture infective doses per milliliter of RAW264 cell culture-propagated viruses. The diagnostic performance of the assay was evaluated using 158 mouse fecal samples, 91 of which were confirmed to be positive. The melting curve analysis demonstrated the diversity of MNV in the samples. This is the first report of a broadly reactive one-step SYBR Green I real-time RT-PCR assay for detecting of MNVs. The rapid and sensitive performance of this assay makes it a powerful tool for diagnostic applications.

  4. Enhancement of allele discrimination by introduction of nucleotide mismatches into siRNA in allele-specific gene silencing by RNAi.

    Directory of Open Access Journals (Sweden)

    Yusuke Ohnishi

    Full Text Available Allele-specific gene silencing by RNA interference (RNAi is therapeutically useful for specifically inhibiting the expression of disease-associated alleles without suppressing the expression of corresponding wild-type alleles. To realize such allele-specific RNAi (ASP-RNAi, the design and assessment of small interfering RNA (siRNA duplexes conferring ASP-RNAi is vital; however, it is also difficult. In a previous study, we developed an assay system to assess ASP-RNAi with mutant and wild-type reporter alleles encoding the Photinus and Renilla luciferase genes. In line with experiments using the system, we realized that it is necessary and important to enhance allele discrimination between mutant and corresponding wild-type alleles. Here, we describe the improvement of ASP-RNAi against mutant alleles carrying single nucleotide variations by introducing base substitutions into siRNA sequences, where original variations are present in the central position. Artificially mismatched siRNAs or short-hairpin RNAs (shRNAs against mutant alleles of the human Prion Protein (PRNP gene, which appear to be associated with susceptibility to prion diseases, were examined using this assessment system. The data indicates that introduction of a one-base mismatch into the siRNAs and shRNAs was able to enhance discrimination between the mutant and wild-type alleles. Interestingly, the introduced mismatches that conferred marked improvement in ASP-RNAi, appeared to be largely present in the guide siRNA elements, corresponding to the 'seed region' of microRNAs. Due to the essential role of the 'seed region' of microRNAs in their association with target RNAs, it is conceivable that disruption of the base-pairing interactions in the corresponding seed region, as well as the central position (involved in cleavage of target RNAs, of guide siRNA elements could influence allele discrimination. In addition, we also suggest that nucleotide mismatches at the 3'-ends of sense

  5. Rapid diagnosis of avian influenza virus in wild birds: Use of a portable rRT-PCR and freeze-dried reagents in the field

    Science.gov (United States)

    Takekawa, John Y.; Hill, N.J.; Schultz, A.K.; Iverson, S.A.; Cardona, C.J.; Boyce, W.M.; Dudley, J.P.

    2011-01-01

    Wild birds have been implicated in the spread of highly pathogenic avian influenza (HPAI) of the H5N1 subtype, prompting surveillance along migratory flyways. Sampling of wild birds for avian influenza virus (AIV) is often conducted in remote regions, but results are often delayed because of the need to transport samples to a laboratory equipped for molecular testing. Real-time reverse transcriptase polymerase chain reaction (rRT-PCR) is a molecular technique that offers one of the most accurate and sensitive methods for diagnosis of AIV. The previously strict lab protocols needed for rRT-PCR are now being adapted for the field. Development of freeze-dried (lyophilized) reagents that do not require cold chain, with sensitivity at the level of wet reagents has brought on-site remote testing to a practical goal. Here we present a method for the rapid diagnosis of AIV in wild birds using an rRT-PCR unit (Ruggedized Advanced Pathogen Identification Device or RAPID, Idaho Technologies, Salt Lake City, UT) that employs lyophilized reagents (Influenza A Target 1 Taqman; ASAY-ASY-0109, Idaho Technologies). The reagents contain all of the necessary components for testing at appropriate concentrations in a single tube: primers, probes, enzymes, buffers and internal positive controls, eliminating errors associated with improper storage or handling of wet reagents. The portable unit performs a screen for Influenza A by targeting the matrix gene and yields results in 2-3 hours. Genetic subtyping is also possible with H5 and H7 primer sets that target the hemagglutinin gene. The system is suitable for use on cloacal and oropharyngeal samples collected from wild birds, as demonstrated here on the migratory shorebird species, the western sandpiper (Calidrus mauri) captured in Northern California. Animal handling followed protocols approved by the Animal Care and Use Committee of the U.S. Geological Survey Western Ecological Research Center and permits of the U.S. Geological Survey

  6. Rapid diagnosis of avian influenza virus in wild birds: use of a portable rRT-PCR and freeze-dried reagents in the field.

    Science.gov (United States)

    Takekawa, John Y; Hill, Nichola J; Schultz, Annie K; Iverson, Samuel A; Cardona, Carol J; Boyce, Walter M; Dudley, Joseph P

    2011-08-02

    Wild birds have been implicated in the spread of highly pathogenic avian influenza (HPAI) of the H5N1 subtype, prompting surveillance along migratory flyways. Sampling of wild birds for avian influenza virus (AIV) is often conducted in remote regions, but results are often delayed because of the need to transport samples to a laboratory equipped for molecular testing. Real-time reverse transcriptase polymerase chain reaction (rRT-PCR) is a molecular technique that offers one of the most accurate and sensitive methods for diagnosis of AIV. The previously strict lab protocols needed for rRT-PCR are now being adapted for the field. Development of freeze-dried (lyophilized) reagents that do not require cold chain, with sensitivity at the level of wet reagents has brought on-site remote testing to a practical goal. Here we present a method for the rapid diagnosis of AIV in wild birds using an rRT-PCR unit (Ruggedized Advanced Pathogen Identification Device or RAPID, Idaho Technologies, Salt Lake City, UT) that employs lyophilized reagents (Influenza A Target 1 Taqman; ASAY-ASY-0109, Idaho Technologies). The reagents contain all of the necessary components for testing at appropriate concentrations in a single tube: primers, probes, enzymes, buffers and internal positive controls, eliminating errors associated with improper storage or handling of wet reagents. The portable unit performs a screen for Influenza A by targeting the matrix gene and yields results in 2-3 hours. Genetic subtyping is also possible with H5 and H7 primer sets that target the hemagglutinin gene. The system is suitable for use on cloacal and oropharyngeal samples collected from wild birds, as demonstrated here on the migratory shorebird species, the western sandpiper (Calidrus mauri) captured in Northern California. Animal handling followed protocols approved by the Animal Care and Use Committee of the U.S. Geological Survey Western Ecological Research Center and permits of the U.S. Geological Survey

  7. Rapid identification of mycobacteria and rapid detection of drug resistance in Mycobacterium tuberculosis in cultured isolates and in respiratory specimens.

    Science.gov (United States)

    Yam, Wing-Cheong; Siu, Kit-Hang Gilman

    2013-01-01

    Recent advances in molecular biology and better understanding of the genetic basis of drug resistance have allowed rapid identification of mycobacteria and rapid detection of drug resistance of Mycobacterium tuberculosis present in cultured isolates or in respiratory specimens. In this chapter, several simple nucleic acid amplification-based techniques are introduced as molecular approach for clinical diagnosis of tuberculosis. A one-tube nested IS6110-based polymerase chain reaction (PCR) is used for M. tuberculosis complex identification; the use of a multiplex allele-specific PCR is demonstrated to detect the isoniazid resistance; PCR-sequencing assays are applied for rifampicin and ofloxacin resistance detection and 16S rDNA sequencing is utilized for identification of mycobacterial species from cultures of acid fast bacilli (AFB). Despite the high specificity and sensitivity of the molecular techniques, mycobacterial culture remains the "Gold Standard" for tuberculosis diagnosis. Negative results of molecular tests never preclude the infection or the presence of drug resistance. These technological advancements are, therefore, not intended to replace the conventional tests, but rather have major complementary roles in tuberculosis diagnosis.

  8. A Rapid Multiplex Real-Time PCR High-Resolution Melt Curve Assay for the Simultaneous Detection of Bacillus cereus, Listeria monocytogenes, and Staphylococcus aureus in Food.

    Science.gov (United States)

    Forghani, Fereidoun; Wei, Shuai; Oh, Deog-Hwan

    2016-05-01

    Three important foodborne pathogens, Bacillus cereus, Listeria monocytogenes, and Staphylococcus aureus, are of great concern for food safety. They may also coexist in food matrices and, in the case of B. cereus and S. aureus, the resulting illnesses can resemble each other owing to similar symptoms. Therefore, their simultaneous detection may have advantages in terms of cost savings and rapidity. Given this context, a rapid multiplex real-time PCR high-resolution melt curve assay for the simultaneous detection of these three pathogens in food was developed. The assay successfully detected B. cereus (gyrB), L. monocytogenes (hly), and S. aureus (nuc) in a single reaction, and the average melting temperatures were 76.23, 80.19, and 74.01°C, respectively. The application of SYTO9 dye and a slow melt curve analysis ramp rate (0.1°C/s) enabled the production of sharp, high-resolution melt curve peaks that were easily distinguishable from each other. The detection limit in food (milk, rice, and lettuce) was 3.7 × 10(3) CFU/g without an enrichment step and 3.7 × 10(1) CFU/g following the 10-h enrichment. Hence, the assay developed here is specific and sensitive, providing an efficient tool for implementation in food for the simultaneous detection of B. cereus, L. monocytogenes, and S. aureus .

  9. A Generalized Linear Model for Decomposing Cis-regulatory, Parent-of-Origin, and Maternal Effects on Allele-Specific Gene Expression

    Directory of Open Access Journals (Sweden)

    Yasuaki Takada

    2017-07-01

    Full Text Available Joint quantification of genetic and epigenetic effects on gene expression is important for understanding the establishment of complex gene regulation systems in living organisms. In particular, genomic imprinting and maternal effects play important roles in the developmental process of mammals and flowering plants. However, the influence of these effects on gene expression are difficult to quantify because they act simultaneously with cis-regulatory mutations. Here we propose a simple method to decompose cis-regulatory (i.e., allelic genotype, genomic imprinting [i.e., parent-of-origin (PO], and maternal [i.e., maternal genotype (MG] effects on allele-specific gene expression using RNA-seq data obtained from reciprocal crosses. We evaluated the efficiency of method using a simulated dataset and applied the method to whole-body Drosophila and mouse trophoblast stem cell (TSC and liver RNA-seq data. Consistent with previous studies, we found little evidence of PO and MG effects in adult Drosophila samples. In contrast, we identified dozens and hundreds of mouse genes with significant PO and MG effects, respectively. Interestingly, a similar number of genes with significant PO effect were detect in mouse TSCs and livers, whereas more genes with significant MG effect were observed in livers. Further application of this method will clarify how these three effects influence gene expression levels in different tissues and developmental stages, and provide novel insight into the evolution of gene expression regulation.

  10. cisASE: a likelihood-based method for detecting putative cis-regulated allele-specific expression in RNA sequencing data.

    Science.gov (United States)

    Liu, Zhi; Gui, Tuantuan; Wang, Zhen; Li, Hong; Fu, Yunhe; Dong, Xiao; Li, Yixue

    2016-11-01

    Allele-specific expression (ASE) is a useful way to identify cis-acting regulatory variation, which provides opportunities to develop new therapeutic strategies that activate beneficial alleles or silence mutated alleles at specific loci. However, multiple problems hinder the identification of ASE in next-generation sequencing (NGS) data. We developed cisASE, a likelihood-based method for detecting ASE on single nucleotide variant (SNV), exon and gene levels from sequencing data without requiring phasing or parental information. cisASE uses matched DNA-seq data to control technical bias and copy number variation (CNV) in putative cis-regulated ASE identification. Compared with state-of-the-art methods, cisASE exhibits significantly increased accuracy and speed. cisASE works moderately well for datasets without DNA-seq and thus is widely applicable. By applying cisASE to real datasets, we identified specific ASE characteristics in normal and cancer tissues, thus indicating that cisASE has potential for wide applications in cancer genomics. cisASE is freely available at http://lifecenter.sgst.cn/cisASE CONTACT: biosinodx@gmail.com or yxli@sibs.ac.cnSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  11. Potent and selective antisense oligonucleotides targeting single-nucleotide polymorphisms in the Huntington disease gene / allele-specific silencing of mutant huntingtin.

    Science.gov (United States)

    Carroll, Jeffrey B; Warby, Simon C; Southwell, Amber L; Doty, Crystal N; Greenlee, Sarah; Skotte, Niels; Hung, Gene; Bennett, C Frank; Freier, Susan M; Hayden, Michael R

    2011-12-01

    Huntington disease (HD) is an autosomal dominant neurodegenerative disorder caused by CAG-expansion in the huntingtin gene (HTT) that results in a toxic gain of function in the mutant huntingtin protein (mHTT). Reducing the expression of mHTT is therefore an attractive therapy for HD. However, wild-type HTT protein is essential for development and has critical roles in maintaining neuronal health. Therapies for HD that reduce wild-type HTT may therefore generate unintended negative consequences. We have identified single-nucleotide polymorphism (SNP) targets in the human HD population for the disease-specific targeting of the HTT gene. Using primary cells from patients with HD and the transgenic YAC18 and BACHD mouse lines, we developed antisense oligonucleotide (ASO) molecules that potently and selectively silence mHTT at both exonic and intronic SNP sites. Modification of these ASOs with S-constrained-ethyl (cET) motifs significantly improves potency while maintaining allele selectively in vitro. The developed ASO is potent and selective for mHTT in vivo after delivery to the mouse brain. We demonstrate that potent and selective allele-specific knockdown of the mHTT protein can be achieved at therapeutically relevant SNP sites using ASOs in vitro and in vivo.

  12. Performance of the Cobas® Influenza A/B Assay for Rapid Pcr-Based Detection of Influenza Compared to Prodesse ProFlu+ and Viral Culture

    Science.gov (United States)

    Chen, L.; Tian, Y.; Chen, S.; Liesenfeld, O.

    2015-01-01

    Rapid and accurate diagnosis of influenza is important for patient management and infection control. We determined the performance of the cobas® Influenza A/B assay, a rapid automated nucleic acid assay performed on the cobas® Liat System for qualitative detection of influenza A and influenza B from nasopharyngeal (NP) swab specimens. Retrospective frozen and prospectively collected NP swabs from patients with signs and symptoms of influenza collected in universal transport medium (UTM) were tested at multiple sites including CLIA-waived sites using the cobas® Influenza A/B assay. Results were compared to the Prodesse Pro-Flu+ assay and to viral culture. Compared to the Prodesse ProFlu+ Assay, sensitivities of the cobas® Influenza A/B assay for influenza A and B were 97.7 and 98.6%, respectively; specificity was 99.2 and 99.4%. Compared to viral culture, the cobas® Influenza A/B assay showed sensitivities of 97.5 and 96.9% for influenza virus A and B, respectively; specificities were 97.9% for both viruses. Polymerase chain reaction (PCR)/sequencing showed that the majority of viral culture negative but cobas® Influenza A/B positive results were true positive results, indicating that the cobas® Influenza A/B assay has higher sensitivity compared to viral culture. In conclusion, the excellent accuracy, rapid time to result, and remarkable ease of use make the cobas® Influenza A/B nucleic acid assay for use on the cobas® Liat System a highly suitable point-of-care solution for the management of patients with suspected influenza A and B infection. PMID:26716012

  13. Technical aspects of typing for HLA-DP alleles using allele-specific DNA in vitro amplification and sequence-specific oligonucleotide probes. Detection of single base mismatches

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1990-01-01

    was extracted with either a simple salting out method or phenol/chloroform. Both DNAs could be readily used for PCR. The MgC2 concentration of the PCR buffer and the annealing temperature of the thermal cycle of the PCR were the two most important variables. The MgCl2 concentration and the temperature must......The polymerase chain reaction (PCR) is an effective method for in vitro DNA amplification which combined with probing with synthetic oligonucleotides can be used for, e.g., HLA-typing. We have studied the technical aspects of HLA-DP typing with the technique. DNA from mononuclear nucleated cells...

  14. Development of a rapid method for identifying carryover contamination of positive control DNA, using a chimeric positive control and restriction enzyme for the diagnosis of white spot syndrome virus by nested PCR.

    Science.gov (United States)

    Kim, Hyoung Jun; Kwon, Se Ryun

    2014-12-01

    Chimeric positive plasmids have been developed to minimize false-positive reactions caused by polymerase chain reaction (PCR) contamination. Here, we developed a rapid method for identifying false-positive results while detecting white spot syndrome virus (WSSV) by nested PCR, using chimeric positive plasmids. The results of PCRs using WSSV diagnostic primer sets showed PCR products of a similar size (WSSV 1st PCR product, 1,447 bp; WSSV 2nd PCR product, 941 bp) using WSSV chimeric plasmids or DNA from shrimp infected with WSSV. The PCR products were digested with DraI for 1 h at 37 °C. The digested chimeric DNA separated into two DNA bands; however, the WSSV-infected shrimp DNA did not separate. Thus, chimeric plasmid DNA may be used as positive control DNA instead of DNA from WSSV-infected shrimp, in order to prevent PCR contamination. Thus, the use of restriction enzyme digestion allowed us to rapidly distinguish between WSSV DNA and WSSV chimeric plasmid DNA.

  15. Genome-wide identification and quantification of cis- and trans-regulated genes responding to Marek’s disease virus infection via analysis of allele-specific expression

    Directory of Open Access Journals (Sweden)

    Sean eMaceachern

    2012-01-01

    Full Text Available Marek’s disease (MD is a commercially important neoplastic disease of chickens caused by Marek’s disease virus (MDV, an oncogenic alphaherpesvirus. Selecting for increased genetic resistance to MD is a control strategy that can augment vaccinal control measures. To identify high-confidence candidate MD resistance genes, we conducted a genome-wide screen for allele-specific expression (ASE amongst F1 progeny of two inbred chicken lines that differ in MD resistance. High throughput sequencing was used to profile transcriptomes from pools of uninfected and infected individuals at 4 days post-infection to identify any genes showing ASE in response to MDV infection. RNA sequencing identified 22,655 single nucleotide polymorphisms (SNPs of which 5,360 in 3,773 genes exhibited significant allelic imbalance. Illumina GoldenGate assays were subsequently used to quantify regulatory variation controlled at the gene (cis and elsewhere in the genome (trans by examining differences in expression between F1 individuals and artificial F1 RNA pools over 6 time periods in 1,536 of the most significant SNPs identified by RNA sequencing. Allelic imbalance as a result of cis-regulatory changes was confirmed in 861 of the 1,233 GoldenGate assays successfully examined. Furthermore we have identified 7 genes that display trans-regulation only in infected animals and approximately 500 SNP that show a complex interaction between cis- and trans-regulatory changes. Our results indicate ASE analyses are a powerful approach to identify regulatory variation responsible for differences in transcript abundance in genes underlying complex traits. And the genes with SNPs exhibiting ASE provide a strong foundation to further investigate the causative polymorphisms and genetic mechanisms for MD resistance. Finally, the methods used here for identifying specific genes and SNPs may have practical implications for applying marker-assisted selection to complex traits that are

  16. Characterization of new Spt3 and TATA-binding protein mutants of Saccharomyces cerevisiae: Spt3 TBP allele-specific interactions and bypass of Spt8.

    Science.gov (United States)

    Laprade, Lisa; Rose, David; Winston, Fred

    2007-12-01

    The Spt-Ada-Gcn5-acetyltransferase (SAGA) complex of Saccharomyces cerevisiae is a multifunctional coactivator complex that has been shown to regulate transcription by distinct mechanisms. Previous results have shown that the Spt3 and Spt8 components of SAGA regulate initiation of transcription of particular genes by controlling the level of TATA-binding protein (TBP/Spt15) associated with the TATA box. While biochemical evidence exists for direct Spt8-TBP interactions, similar evidence for Spt3-TBP interactions has been lacking. To learn more about Spt3-TBP interactions in vivo, we have isolated a new class of spt3 mutations that cause a dominant-negative phenotype when overexpressed. These mutations all cluster within a conserved region of Spt3. The isolation of extragenic suppressors of one of these spt3 mutations has identified two new spt15 mutations that show allele-specific interactions with spt3 mutations with respect to transcription and the recruitment of TBP to particular promoters. In addition, these new spt15 mutations partially bypass an spt8 null mutation. Finally, we have examined the level of SAGA-TBP physical interaction in these mutants. While most spt3, spt8, and spt15 mutations do not alter SAGA-TBP interactions, one spt3 mutation, spt3-401, causes a greatly increased level of SAGA-TBP physical association. These results, taken together, suggest that a direct Spt3-TBP interaction is required for normal TBP levels at Spt3-dependent promoters in vivo.

  17. SAAS-CNV: A Joint Segmentation Approach on Aggregated and Allele Specific Signals for the Identification of Somatic Copy Number Alterations with Next-Generation Sequencing Data.

    Science.gov (United States)

    Zhang, Zhongyang; Hao, Ke

    2015-11-01

    Cancer genomes exhibit profound somatic copy number alterations (SCNAs). Studying tumor SCNAs using massively parallel sequencing provides unprecedented resolution and meanwhile gives rise to new challenges in data analysis, complicated by tumor aneuploidy and heterogeneity as well as normal cell contamination. While the majority of read depth based methods utilize total sequencing depth alone for SCNA inference, the allele specific signals are undervalued. We proposed a joint segmentation and inference approach using both signals to meet some of the challenges. Our method consists of four major steps: 1) extracting read depth supporting reference and alternative alleles at each SNP/Indel locus and comparing the total read depth and alternative allele proportion between tumor and matched normal sample; 2) performing joint segmentation on the two signal dimensions; 3) correcting the copy number baseline from which the SCNA state is determined; 4) calling SCNA state for each segment based on both signal dimensions. The method is applicable to whole exome/genome sequencing (WES/WGS) as well as SNP array data in a tumor-control study. We applied the method to a dataset containing no SCNAs to test the specificity, created by pairing sequencing replicates of a single HapMap sample as normal/tumor pairs, as well as a large-scale WGS dataset consisting of 88 liver tumors along with adjacent normal tissues. Compared with representative methods, our method demonstrated improved accuracy, scalability to large cancer studies, capability in handling both sequencing and SNP array data, and the potential to improve the estimation of tumor ploidy and purity.

  18. SAAS-CNV: A Joint Segmentation Approach on Aggregated and Allele Specific Signals for the Identification of Somatic Copy Number Alterations with Next-Generation Sequencing Data.

    Directory of Open Access Journals (Sweden)

    Zhongyang Zhang

    2015-11-01

    Full Text Available Cancer genomes exhibit profound somatic copy number alterations (SCNAs. Studying tumor SCNAs using massively parallel sequencing provides unprecedented resolution and meanwhile gives rise to new challenges in data analysis, complicated by tumor aneuploidy and heterogeneity as well as normal cell contamination. While the majority of read depth based methods utilize total sequencing depth alone for SCNA inference, the allele specific signals are undervalued. We proposed a joint segmentation and inference approach using both signals to meet some of the challenges. Our method consists of four major steps: 1 extracting read depth supporting reference and alternative alleles at each SNP/Indel locus and comparing the total read depth and alternative allele proportion between tumor and matched normal sample; 2 performing joint segmentation on the two signal dimensions; 3 correcting the copy number baseline from which the SCNA state is determined; 4 calling SCNA state for each segment based on both signal dimensions. The method is applicable to whole exome/genome sequencing (WES/WGS as well as SNP array data in a tumor-control study. We applied the method to a dataset containing no SCNAs to test the specificity, created by pairing sequencing replicates of a single HapMap sample as normal/tumor pairs, as well as a large-scale WGS dataset consisting of 88 liver tumors along with adjacent normal tissues. Compared with representative methods, our method demonstrated improved accuracy, scalability to large cancer studies, capability in handling both sequencing and SNP array data, and the potential to improve the estimation of tumor ploidy and purity.

  19. Allele-specific virulence attenuation of the Pseudomonas syringae HopZ1a type III effector via the Arabidopsis ZAR1 resistance protein.

    Science.gov (United States)

    Lewis, Jennifer D; Wu, Ronald; Guttman, David S; Desveaux, Darrell

    2010-04-01

    Plant resistance (R) proteins provide a robust surveillance system to defend against potential pathogens. Despite their importance in plant innate immunity, relatively few of the approximately 170 R proteins in Arabidopsis have well-characterized resistance specificity. In order to identify the R protein responsible for recognition of the Pseudomonas syringae type III secreted effector (T3SE) HopZ1a, we assembled an Arabidopsis R gene T-DNA Insertion Collection (ARTIC) from publicly available Arabidopsis thaliana insertion lines and screened it for plants lacking HopZ1a-induced immunity. This reverse genetic screen revealed that the Arabidopsis R protein HOPZ-activated resistance 1 (ZAR1; At3g50950) is required for recognition of HopZ1a in Arabidopsis. ZAR1 belongs to the coiled-coil (CC) class of nucleotide binding site and leucine-rich repeat (NBS-LRR) containing R proteins; however, the ZAR1 CC domain phylogenetically clusters in a clade distinct from other related Arabidopsis R proteins. ZAR1-mediated immunity is independent of several genes required by other R protein signaling pathways, including NDR1 and RAR1, suggesting that ZAR1 possesses distinct signaling requirements. The closely-related T3SE protein, HopZ1b, is still recognized by zar1 Arabidopsis plants indicating that Arabidopsis has evolved at least two independent R proteins to recognize the HopZ T3SE family. Also, in Arabidopsis zar1 plants HopZ1a promotes P. syringae growth indicative of an ancestral virulence function for this T3SE prior to the evolution of recognition by the host resistance protein ZAR1. Our results demonstrate that the Arabidopsis resistance protein ZAR1 confers allele-specific recognition and virulence attenuation of the Pseudomonas syringae T3SE protein HopZ1a.

  20. Allele-specific virulence attenuation of the Pseudomonas syringae HopZ1a type III effector via the Arabidopsis ZAR1 resistance protein.

    Directory of Open Access Journals (Sweden)

    Jennifer D Lewis

    2010-04-01

    Full Text Available Plant resistance (R proteins provide a robust surveillance system to defend against potential pathogens. Despite their importance in plant innate immunity, relatively few of the approximately 170 R proteins in Arabidopsis have well-characterized resistance specificity. In order to identify the R protein responsible for recognition of the Pseudomonas syringae type III secreted effector (T3SE HopZ1a, we assembled an Arabidopsis R gene T-DNA Insertion Collection (ARTIC from publicly available Arabidopsis thaliana insertion lines and screened it for plants lacking HopZ1a-induced immunity. This reverse genetic screen revealed that the Arabidopsis R protein HOPZ-activated resistance 1 (ZAR1; At3g50950 is required for recognition of HopZ1a in Arabidopsis. ZAR1 belongs to the coiled-coil (CC class of nucleotide binding site and leucine-rich repeat (NBS-LRR containing R proteins; however, the ZAR1 CC domain phylogenetically clusters in a clade distinct from other related Arabidopsis R proteins. ZAR1-mediated immunity is independent of several genes required by other R protein signaling pathways, including NDR1 and RAR1, suggesting that ZAR1 possesses distinct signaling requirements. The closely-related T3SE protein, HopZ1b, is still recognized by zar1 Arabidopsis plants indicating that Arabidopsis has evolved at least two independent R proteins to recognize the HopZ T3SE family. Also, in Arabidopsis zar1 plants HopZ1a promotes P. syringae growth indicative of an ancestral virulence function for this T3SE prior to the evolution of recognition by the host resistance protein ZAR1. Our results demonstrate that the Arabidopsis resistance protein ZAR1 confers allele-specific recognition and virulence attenuation of the Pseudomonas syringae T3SE protein HopZ1a.

  1. Comparison of four rapid diagnostic tests, ELISA, microscopy and PCR for the detection of Giardia lamblia, Cryptosporidium spp. and Entamoeba histolytica in feces.

    Science.gov (United States)

    Van den Bossche, Dorien; Cnops, Lieselotte; Verschueren, Jacob; Van Esbroeck, Marjan

    2015-03-01

    Microscopy is the diagnostic reference standard for the detection of parasites, but it is labor-intensive and requires experience. Rapid diagnostic tests (RDTs) can provide an alternative to microscopy. RDTs from four different manufacturers were compared to enzyme-linked immunosorbent assay (ELISA), microscopy and/or parasite-specific real-time PCR: ImmunoCardSTAT!®CGE (Meridian Bioscience Inc., Cincinnati, Ohio, USA) (A), Crypto/Giardia Duo-Strip (Coris Bioconcepts, Gembloux, Belgium) (B), RIDA®QUICK Cryptosporidium/Giardia/Entamoeba Combi (R-BioPharm, Darmstadt, Germany) (C) and Giardia/Cryptosporidium Quik Chek (Techlab Inc., Blacksburg, Virginia, USA) (D). Thirty frozen samples were analyzed retrospectively. For Giardia lamblia (n=12) and Cryptosporidium (n=12) sensitivities ranged from 58% (B), over 83% (A, C) to 100% (D) and from 92% (B) to 100% (A, C, D), respectively. Specificity for both G. lamblia and Cryptosporidium was 100% for all RDT brands. Sensitivity for Entamoeba histolytica (n=5) was 100%, while specificity reached 80% (A) to 88% (C). In a prospective study, fresh samples were tested. For G. lamblia (n=30), sensitivity ranged from 66% (B), over 79% (A) and 83% (C) to 100% (D) and specificity varied between 94% (D) and 100% (A, B, C). For Cryptosporidium (n=3), sensitivity was 100% for all brands except (B) (67%) and specificities were 95% (A, B), 98% (C) and 100% (D). E. histolytica (n=1) was detected by both (A) and (C), while specificity was 81% and 87% respectively. RDTs can be a valuable tool when microscopic expertise is poor and in remote and outbreak settings where other techniques are often not available and rapid diagnosis is required. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Self-collected buccal swabs and rapid, real-time PCR during a large measles outbreak in Wales: Evidence for the protective effect of prior MMR immunisation.

    Science.gov (United States)

    Moore, Catherine; Cottrell, Simon; Hoffmann, Jörg; Carr, Michael; Evans, Hannah; Dunford, Linda; Lawson, Heather; Brown, Kevin E; Jones, Rachel

    2015-06-01

    We describe the laboratory response to a large measles outbreak that occurred during 2012-2013 centred in mid and west Wales, UK. To demonstrate the impact of rapid measles testing on the management of a large outbreak, to show the complex molecular epidemiology and determine the role of previous MMR immunisation on a large cohort of exposed people. Results from oral fluid antibody testing and self-collected buccal swabs tested by real-time PCR were reconciled and analysed to determine level of agreement and to calculate MMR vaccine efficacy during the outbreak. During the outbreak 1435 notifications of measles were received from across Wales. Samples were received from 70% of notified cases with a positivity rate of 56% within the outbreak compared to 15% for the rest of Wales. Measles RNA was detected in 53 cases with previous history of MMR immunisation, but viral loads were lower than those detected in unimmunised cases. The molecular epidemiology showed at least two distinct D8 strains of measles virus were introduced into Wales along with a separate introduction of a B3 strain outside the outbreak area. Molecular testing of all notified measles cases offers the most rapid way of confirming the introduction of measles into a population potentially before secondary transmission has already occurred. The outbreak data confirms the protective effect of the MMR vaccine with vaccine efficacy calculated at 96% for one dose and 99% for two doses supporting the WHO recommendations for a two dose MMR immunisation schedule. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Rapid and accurate species and genomic species identification and exhaustive population diversity assessment of Agrobacterium spp. using recA-based PCR.

    Science.gov (United States)

    Shams, M; Vial, L; Chapulliot, D; Nesme, X; Lavire, C

    2013-07-01

    Agrobacteria are common soil bacteria that interact with plants as commensals, plant growth promoting rhizobacteria or alternatively as pathogens. Indigenous agrobacterial populations are composites, generally with several species and/or genomic species and several strains per species. We thus developed a recA-based PCR approach to accurately identify and specifically detect agrobacteria at various taxonomic levels. Specific primers were designed for all species and/or genomic species of Agrobacterium presently known, including 11 genomic species of the Agrobacterium tumefaciens complex (G1-G9, G13 and G14, among which only G2, G4, G8 and G14 still received a Latin epithet: pusense, radiobacter, fabrum and nepotum, respectively), A. larrymoorei, A. rubi, R. skierniewicense, A. sp. 1650, and A. vitis, and for the close relative Allorhizobium undicola. Specific primers were also designed for superior taxa, Agrobacterium spp. and Rhizobiaceace. Primer specificities were assessed with target and non-target pure culture DNAs as well as with DNAs extracted from composite agrobacterial communities. In addition, we showed that the amplicon cloning-sequencing approach used with Agrobacterium-specific or Rhizobiaceae-specific primers is a way to assess the agrobacterial diversity of an indigenous agrobacterial population. Hence, the agrobacterium-specific primers designed in the present study enabled the first accurate and rapid identification of all species and/or genomic species of Agrobacterium, as well as their direct detection in environmental samples. Copyright © 2013 Elsevier GmbH. All rights reserved.

  4. Detection and differentiation of Plum pox virus using real-time multiplex PCR with SYBR Green and melting curve analysis: a rapid method for strain typing.

    Science.gov (United States)

    Varga, Aniko; James, Delano

    2005-02-01

    A real-time multiplex PCR procedure with melting curve analysis, using the green fluorescence dye SYBR Green I, was developed for rapid and reliable identification of Plum pox virus (PPV) isolates of strains D and M. Members of the different strains were identified by their distinctive melting temperatures (T(m)s); 84.3-84.43 degrees C for D isolates, and 85.34-86.11 degrees C for M isolates. The associated amplicon sizes were 114 and 380 bp, respectively. The procedure was used for detection and identification of PPV in both herbaceous and woody hosts. The Tm for members of a particular strain was very similar, with a host effect that did not hinder strain identification. Universal primers included in the study detected all isolates of PPV tested, amplifying a 74 bp fragment. The Tm of this fragment varied from 80.12 to 81.52 degrees C and may have supplementary value for PPV identification. SYBR Green-based detection was compared to detection using a hybridization LUX fluorogenic primer. Better resolution of the melting peaks was observed with SYBR Green I, than with the LUX primers, hence strain identification with SYBR Green I was more reliable. This is a simple approach to PPV strain identification with the relatively inexpensive dye SYBR Green I, and eliminates any need for electrophoretic analysis of amplicons or RFLP patterns using ethidium bromide.

  5. Rapidly discriminate commercial medicinal Pulsatilla chinensis (Bge.) Regel from its adulterants using ITS2 barcoding and specific PCR-RFLP assay.

    Science.gov (United States)

    Shi, Yuhua; Zhao, Mingming; Yao, Hui; Yang, Pei; Xin, Tianyi; Li, Bin; Sun, Wei; Chen, Shilin

    2017-01-06

    Pulsatillae radix is a conventional traditional Chinese medicine (TCM) with common name Baitouweng, and has notable effects on inflammation and dysentery. Pulsatilla chinensis (Bge.) Regel is the only source plant of Baitouweng recorded in Chinese Pharmacopoeia, but its adulteration often occurs in the market that possibly affects medicinal efficacy and safety. We have established an internal transcribed spacer 2 (ITS2) barcode library based on 105 plant samples from 12 Pulsatilla species and 10 common adulterants. Results indicate that ITS2 barcoding can accurately distinguish Pulsatilla species from their adulterants. Pulsatilla chinensis can be discriminated from 11 congeneric species by two stable single nucleotide polymorphisms (SNPs) in the ITS2 region. Additionally, a quick specific PCR-RFLP identification assay based on the ITS2 barcode was developed. Using specific primers ITS2/PR1 combined with restriction enzyme Bgl I, Pu. chinensis can rapidly be differentiated from other species via simple and low-cost test procedures. Furthermore, 30 commercial Baitouweng products were tested and only two products were derived from authentic Pu. chinensis. Thus, these two molecular approaches provide practical tools for quick identification of commercial Baitouweng products and can help ensure the safe use of this TCM product.

  6. Rapid PCR using nested primers of the 16S rRNA and the hippuricase (hipO) genes to detect Campylobacter jejuni and Campylobacter coli in environmental samples

    DEFF Research Database (Denmark)

    Bang, Dang Duong; Wedderkopp, A.; Pedersen, Karl

    2002-01-01

    to detect Campylobacter jejuni and Campylobacter coli in environmental samples. The sensitivity of the nested PCR was determined to be 0.01 pg/PCR, corresponding to 2-3 colony forming units (cfu) per ml. The nested PCR assays were applied to detect C. jejuni and C. coli in 269 environmental samples......Identification of sources Campylobacter infection in the poultry houses is in general problematic due to the lack of reliable methods to detect campylobacteria in environmental samples. Detection of campylobacteria in environmental samples by conventional culture methods is difficult and of limited...... sensitivity due to the use of selective media, the low number of bacteria in the samples and possibly also due to the presence of non-culturable or sub-lethally injured stages of the bacteria. The present paper describes a rapid PCR assay using nested primers of the 16S rRNA or the hippuricase (hipO) genes...

  7. Development and validation of a multiplex reverse transcription quantitative PCR (RT-qPCR) assay for the rapid detection of Citrus tristeza virus, Citrus psorosis virus, and Citrus leaf blotch virus.

    Science.gov (United States)

    Osman, Fatima; Hodzic, Emir; Kwon, Sun-Jung; Wang, Jinbo; Vidalakis, Georgios

    2015-08-01

    A single real-time multiplex reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay for the simultaneous detection of Citrus tristeza virus (CTV), Citrus psorosis virus (CPsV), and Citrus leaf blotch virus (CLBV) was developed and validated using three different fluorescently labeled minor groove binding qPCR probes. To increase the detection reliability, coat protein (CP) genes from large number of different isolates of CTV, CPsV and CLBV were sequenced and a multiple sequence alignment was generated with corresponding CP sequences from the GenBank and a robust multiplex RT-qPCR assay was designed. The capacity of the multiplex RT-qPCR assay in detecting the viruses was compared to singleplex RT-qPCR designed specifically for each virus and was assessed using multiple virus isolates from diverse geographical regions and citrus species as well as graft-inoculated citrus plants infected with various combination of the three viruses. No significant difference in detection limits was found and specificity was not affected by the inclusion of the three assays in a multiplex RT-qPCR reaction. Comparison of the viral load for each virus using singleplex and multiplex RT-qPCR assays, revealed no significant differences between the two assays in virus detection. No significant difference in Cq values was detected when using one-step and two-step multiplex RT-qPCR detection formats. Optimizing the RNA extraction technique for citrus tissues and testing the quality of the extracted RNA using RT-qPCR targeting the cytochrome oxidase citrus gene as an RNA specific internal control proved to generate better diagnostic assays. Results showed that the developed multiplex RT-qPCR can streamline viruses testing of citrus nursery stock by replacing three separate singleplex assays, thus reducing time and labor while retaining the same sensitivity and specificity. The three targeted RNA viruses are regulated pathogens for California's mandatory "Section 3701

  8. Rapid identification of the medicinal plant Taraxacum formosanum ...

    African Journals Online (AJOL)

    Administrator

    2011-06-06

    Jun 6, 2011 ... Original identification of medicinal plants is essential for quality control. In this study, the internal transcribed spacer 2 (ITS2) nuclear ribosomal DNA served as a DNA barcode and was amplified by allele-specific PCR. This approach was exploited to differentiate Taraxacum formosanum from five.

  9. Inter- and intra-individual variation in allele-specific DNA methylation and gene expression in children conceived using assisted reproductive technology.

    Directory of Open Access Journals (Sweden)

    Nahid Turan

    2010-07-01

    Full Text Available Epidemiological studies have reported a higher incidence of rare disorders involving imprinted genes among children conceived using assisted reproductive technology (ART, suggesting that ART procedures may be disruptive to imprinted gene methylation patterns. We examined intra- and inter-individual variation in DNA methylation at the differentially methylated regions (DMRs of the IGF2/H19 and IGF2R loci in a population of children conceived in vitro or in vivo. We found substantial variation in allele-specific methylation at both loci in both groups. Aberrant methylation of the maternal IGF2/H19 DMR was more common in the in vitro group, and the overall variance was also significantly greater in the in vitro group. We estimated the number of trophoblast stem cells in each group based on approximation of the variance of the binomial distribution of IGF2/H19 methylation ratios, as well as the distribution of X chromosome inactivation scores in placenta. Both of these independent measures indicated that placentas of the in vitro group were derived from fewer stem cells than the in vivo conceived group. Both IGF2 and H19 mRNAs were significantly lower in placenta from the in vitro group. Although average birth weight was lower in the in vitro group, we found no correlation between birth weight and IGF2 or IGF2R transcript levels or the ratio of IGF2/IGF2R transcript levels. Our results show that in vitro conception is associated with aberrant methylation patterns at the IGF2/H19 locus. However, very little of the inter- or intra-individual variation in H19 or IGF2 mRNA levels can be explained by differences in maternal DMR DNA methylation, in contrast to the expectations of current transcriptional imprinting models. Extraembryonic tissues of embryos cultured in vitro appear to be derived from fewer trophoblast stem cells. It is possible that this developmental difference has an effect on placental and fetal growth.

  10. Enrichment followed by quantitative PCR both for rapid detection and as a tool for quantitative risk assessment of food-borne thermotolerant campylobacters

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann; Jacobsen, N. R.; Hoorfar, Jeffrey

    2004-01-01

    As part of a large international project for standardization of PCR (Food-PCR; www.pcr.dk), a multiplex, multiplatform, ready-to-go enrichment followed by a real-time PCR method, including an internal amplification control, was developed for detection of food-borne thermotolerant campylobacters...... Organization (ISO)-based culture method by testing low, medium, and high levels of 12 spiked and 66 unspiked, presumably naturally contaminated, chicken rinse samples. In the RotorGene, a positive PCR response was detected in 40 samples of the 66. This was in complete agreement with the enriched ISO culture...... naturally contaminated chicken samples, which indicates PCR's additional potential as a tool for quantitative risk assessment. Signal from the internal amplification control was detected in all culture-negative samples (VIC Ct: 23.1 to 28.1). The method will be taken further and validated...

  11. An immunomagnetic separation-reverse transcription polymerase chain reaction (IMS-RT-PCR) test for sensitive and rapid detection of viable waterborne Cryptosporidium parvum.

    Science.gov (United States)

    Hallier-Soulier, Sylvie; Guillot, Emmanuelle

    2003-07-01

    The public health problem posed by the waterborne parasite Cryptosporidium parvum incited the water supply industry to develop very accurate analytical tools able to assess the presence of viable oocysts in drinking water. In this study, we report the development of a viability assay for C. parvum oocysts based on immunomagnetic separation and reverse transcription polymerase chain reaction (IMS-RT-PCR). The detection limit of the IMS-RT-PCR assay, which targets the hsp70 heat shock-induced mRNA, was in the range of ten viable oocysts per 100-l tap water samples. Purified Cryptosporidium parvum oocysts were exposed to heating, freezing and three chemical disinfection treatments namely, chlorination, chlorine dioxide treatment and ozonation under conventional doses used in water treatment plants, then detected by IMS-PCR and IMS-RT-PCR. The results obtained by IMS-PCR showed that none of the treatments had an effect on oocyst detection. The inactivation of oocysts by boiling resulted in no RT-PCR signal. Chlorine as well as chlorine dioxide did not influence oocyst viability as determined by IMS-RT-PCR. Ozone more effectively inactivated oocysts. The IMS-RT-PCR assay in conjunction with IMS-PCR marks the development of a combined detection and viability test which can be used for drinking water quality control as well as for reliable evaluation of treatment efficiency.

  12. Polymeric LabChip Real-Time PCR as a Point-of-Care-Potential Diagnostic Tool for Rapid Detection of Influenza A/H1N1 Virus in Human Clinical Specimens

    Science.gov (United States)

    Song, Hyun-Ok; Kim, Je-Hyoung; Ryu, Ho-Sun; Lee, Dong-Hoon; Kim, Sun-Jin; Kim, Deog-Joong; Suh, In Bum; Choi, Du Young; In, Kwang-Ho; Kim, Sung-Woo; Park, Hyun

    2012-01-01

    It is clinically important to be able to detect influenza A/H1N1 virus using a fast, portable, and accurate system that has high specificity and sensitivity. To achieve this goal, it is necessary to develop a highly specific primer set that recognizes only influenza A viral genes and a rapid real-time PCR system that can detect even a single copy of the viral gene. In this study, we developed and validated a novel fluidic chip-type real-time PCR (LabChip real-time PCR) system that is sensitive and specific for the detection of influenza A/H1N1, including the pandemic influenza strain A/H1N1 of 2009. This LabChip real-time PCR system has several remarkable features: (1) It allows rapid quantitative analysis, requiring only 15 min to perform 30 cycles of real-time PCR. (2) It is portable, with a weight of only 5.5 kg. (3) The reaction cost is low, since it uses disposable plastic chips. (4) Its high efficiency is equivalent to that of commercially available tube-type real-time PCR systems. The developed disposable LabChip is an economic, heat-transferable, light-transparent, and easy-to-fabricate polymeric chip compared to conventional silicon- or glass-based labchip. In addition, our LabChip has large surface-to-volume ratios in micro channels that are required for overcoming time consumed for temperature control during real-time PCR. The efficiency of the LabChip real-time PCR system was confirmed using novel primer sets specifically targeted to the hemagglutinin (HA) gene of influenza A/H1N1 and clinical specimens. Eighty-five human clinical swab samples were tested using the LabChip real-time PCR. The results demonstrated 100% sensitivity and specificity, showing 72 positive and 13 negative cases. These results were identical to those from a tube-type real-time PCR system. This indicates that the novel LabChip real-time PCR may be an ultra-fast, quantitative, point-of-care-potential diagnostic tool for influenza A/H1N1 with a high sensitivity and specificity

  13. Polymeric LabChip real-time PCR as a point-of-care-potential diagnostic tool for rapid detection of influenza A/H1N1 virus in human clinical specimens.

    Directory of Open Access Journals (Sweden)

    Hyun-Ok Song

    Full Text Available It is clinically important to be able to detect influenza A/H1N1 virus using a fast, portable, and accurate system that has high specificity and sensitivity. To achieve this goal, it is necessary to develop a highly specific primer set that recognizes only influenza A viral genes and a rapid real-time PCR system that can detect even a single copy of the viral gene. In this study, we developed and validated a novel fluidic chip-type real-time PCR (LabChip real-time PCR system that is sensitive and specific for the detection of influenza A/H1N1, including the pandemic influenza strain A/H1N1 of 2009. This LabChip real-time PCR system has several remarkable features: (1 It allows rapid quantitative analysis, requiring only 15 min to perform 30 cycles of real-time PCR. (2 It is portable, with a weight of only 5.5 kg. (3 The reaction cost is low, since it uses disposable plastic chips. (4 Its high efficiency is equivalent to that of commercially available tube-type real-time PCR systems. The developed disposable LabChip is an economic, heat-transferable, light-transparent, and easy-to-fabricate polymeric chip compared to conventional silicon- or glass-based labchip. In addition, our LabChip has large surface-to-volume ratios in micro channels that are required for overcoming time consumed for temperature control during real-time PCR. The efficiency of the LabChip real-time PCR system was confirmed using novel primer sets specifically targeted to the hemagglutinin (HA gene of influenza A/H1N1 and clinical specimens. Eighty-five human clinical swab samples were tested using the LabChip real-time PCR. The results demonstrated 100% sensitivity and specificity, showing 72 positive and 13 negative cases. These results were identical to those from a tube-type real-time PCR system. This indicates that the novel LabChip real-time PCR may be an ultra-fast, quantitative, point-of-care-potential diagnostic tool for influenza A/H1N1 with a high sensitivity and

  14. Evaluation of repetitive-PCR and matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) for rapid strain typing of Bacillus coagulans.

    Science.gov (United States)

    Sato, Jun; Nakayama, Motokazu; Tomita, Ayumi; Sonoda, Takumi; Hasumi, Motomitsu; Miyamoto, Takahisa

    2017-01-01

    In order to establish rapid and accurate typing method for Bacillus coagulans strains which is important for controlling in some canned foods and tea-based beverages manufacturing because of the high-heat resistance of the spores and high tolerance of the vegetative cells to catechins and chemicals, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) and repetitive-PCR (rep-PCR) were evaluated. For this purpose, 28 strains of B. coagulans obtained from various culture collections were tested. DNA sequence analyses of the genes encoding 16S rRNA and DNA gyrase classified the test strains into two and three groups, respectively, regardless of their phenotypes. Both MALDI-TOF MS and rep-PCR methods classified the test strains in great detail. Strains classified in each group showed similar phenotypes, such as carbohydrate utilization determined using API 50CH. In particular, the respective two pairs of strains which showed the same metabolic characteristic were classified into the same group by both MALDI-TOF MS and rep-PCR methods separating from the other strains. On the other hand, the other strains which have the different profiles of carbohydrate utilization were separated into different groups by these methods. These results suggested that the combination of MALDI-TOF MS and rep-PCR analyses was advantageous for the rapid and detailed typing of bacterial strains in respect to both phenotype and genotype.

  15. Evaluation of repetitive-PCR and matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS for rapid strain typing of Bacillus coagulans.

    Directory of Open Access Journals (Sweden)

    Jun Sato

    Full Text Available In order to establish rapid and accurate typing method for Bacillus coagulans strains which is important for controlling in some canned foods and tea-based beverages manufacturing because of the high-heat resistance of the spores and high tolerance of the vegetative cells to catechins and chemicals, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS and repetitive-PCR (rep-PCR were evaluated. For this purpose, 28 strains of B. coagulans obtained from various culture collections were tested. DNA sequence analyses of the genes encoding 16S rRNA and DNA gyrase classified the test strains into two and three groups, respectively, regardless of their phenotypes. Both MALDI-TOF MS and rep-PCR methods classified the test strains in great detail. Strains classified in each group showed similar phenotypes, such as carbohydrate utilization determined using API 50CH. In particular, the respective two pairs of strains which showed the same metabolic characteristic were classified into the same group by both MALDI-TOF MS and rep-PCR methods separating from the other strains. On the other hand, the other strains which have the different profiles of carbohydrate utilization were separated into different groups by these methods. These results suggested that the combination of MALDI-TOF MS and rep-PCR analyses was advantageous for the rapid and detailed typing of bacterial strains in respect to both phenotype and genotype.

  16. A Lab on a chip device for rapid identification of Avian Influenza virus by on-chip sample preparation and solid phase PCR

    DEFF Research Database (Denmark)

    Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong

    2009-01-01

    In this paper, we describe a novel lab-on-a-chip device for fast AIV screening by integrating DNA microarray-based solid phase PCR on microchip. The device can handle viral samples in an automatic way. Moreover, multiplex PCR and sequence detection are done in one-step, which greatly simplifies...

  17. Combining COLD-PCR and high-resolution melt analysis for rapid detection of low-level, rifampin-resistant mutations in Mycobacterium tuberculosis.

    Science.gov (United States)

    Pang, Yu; Liu, Guan; Wang, Yufeng; Zheng, Suhua; Zhao, Yan-Lin

    2013-04-01

    Multidrug-resistant Mycobacterium tuberculosis (M. tuberculosis) remains a serious threat to public health. Mutational analysis of the gene encoding the beta subunit of RNA polymerase (rpoB) is an established and widely used surrogate marker for multidrug-resistant tuberculosis (MDR-TB). The rpoB-based drug-resistant assay requires relatively less time to detect drug resistance in M. tuberculosis, yet it fails to detect low-level mutations in wild-type DNA. Here, we describe a low-level mutation detection method that combines co-amplification at lower denaturation temperature polymerase chain reaction (COLD-PCR) with high-resolution melting (HRM) analysis, aimed at detecting low-level, rifampin-resistant mutations in M. tuberculosis. Compared to conventional polymerase chain reaction (PCR), dilution experiments demonstrated a four- to eightfold improvement in selectivity using COLD-PCR/HRM to detect low-level, rifampin-resistant mutations. The mutation detection limit of conventional PCR/HRM was approximately 20%, whereas COLD-PCR/HRM had a mutation detection limit of 2.5%. Using traditional PCR/HRM and DNA sequencing, we found rpoB mutation in 110 rifampin-resistant isolates. The use of COLD-PCR/HRM allowed us to detect 10 low-level, rifampin-resistant mutations in 16 additional drug-resistant isolates. The sensitivity of COLD-PCR/HRM (95.2%) is significantly higher than that of PCR/HRM (87.3%). Our findings demonstrate that combined use of COLD-PCR with HRM can provide a sensitivity of at least 5% in detecting rpoB-mutated populations in a wild-type background, decreasing the delay in drug-resistant TB diagnosis and leading to faster, cheaper, more efficient, and more personalized antibiotic treatment, especially for low-level drug resistance mutations among the excess wild-type DNA. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Rapid detection of pathological mutations and deletions of the haemoglobin beta gene (HBB) by High Resolution Melting (HRM) analysis and Gene Ratio Analysis Copy Enumeration PCR (GRACE-PCR).

    Science.gov (United States)

    Turner, Andrew; Sasse, Jurgen; Varadi, Aniko

    2016-10-19

    Inherited disorders of haemoglobin are the world's most common genetic diseases, resulting in significant morbidity and mortality. The large number of mutations associated with the haemoglobin beta gene (HBB) makes gene scanning by High Resolution Melting (HRM) PCR an attractive diagnostic approach. However, existing HRM-PCR assays are not able to detect all common point mutations and have only a very limited ability to detect larger gene rearrangements. The aim of the current study was to develop a HBB assay, which can be used as a screening test in highly heterogeneous populations, for detection of both point mutations and larger gene rearrangements. The assay is based on a combination of conventional HRM-PCR and a novel Gene Ratio Analysis Copy Enumeration (GRACE) PCR method. HRM-PCR was extensively optimised, which included the use of an unlabelled probe and incorporation of universal bases into primers to prevent interference from common non-pathological polymorphisms. GRACE-PCR was employed to determine HBB gene copy numbers relative to a reference gene using melt curve analysis to detect rearrangements in the HBB gene. The performance of the assay was evaluated by analysing 410 samples. A total of 44 distinct pathological genotypes were detected. In comparison with reference methods, the assay has a sensitivity of 100 % and a specificity of 98 %. We have developed an assay that detects both point mutations and larger rearrangements of the HBB gene. This assay is quick, sensitive, specific and cost effective making it suitable as an initial screening test that can be used for highly heterogeneous cohorts.

  19. H19-DMR allele-specific methylation analysis reveals epigenetic heterogeneity of CTCF binding site 6 but not of site 5 in head-and-neck carcinomas

    DEFF Research Database (Denmark)

    De Castro Valente Esteves, Leda Isabel; De Karla Cervigne, Nilva; Do Carmo Javaroni, Afonso

    2006-01-01

    of CTCF binding sites 5 and 6 using methylation-sensitive restriction enzyme PCR followed by RFLP analysis in matched tumoral and lymphocyte DNA from head-and-neck squamous cell carcinoma (HNSCC) patients, as well as in lymphocyte DNA from control individuals who were cancer-free. The monoallelic...

  20. Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

    Science.gov (United States)

    Kim, S A; Park, S H; Lee, S I; Ricke, S C

    2017-12-01

    The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

  1. Rapid and Quantitative Detection of Leifsonia xyli subsp. xyli in Sugarcane Stalk Juice Using a Real-Time Fluorescent (TaqMan PCR Assay

    Directory of Open Access Journals (Sweden)

    Hua-Ying Fu

    2016-01-01

    Full Text Available Ratoon stunting disease (RSD of sugarcane, one of the most important diseases seriously affecting the productivity of sugarcane crops, was caused by the bacterial agent Leifsonia xyli subsp. xyli (Lxx. A TaqMan probe-based real-time quantitative polymerase chain reaction (qPCR assay was established in this study for the quantification of Lxx detection in sugarcane stalk juice. A pair of PCR primers (Pat1-QF/Pat1-QR and a fluorogenic probe (Pat1-QP targeting the Part1 gene of Lxx were used for the qPCR assay. The assay had a detection limit of 100 copies of plasmid DNA and 100 fg of Lxx genomic DNA, which was 100-fold more sensitive than the conventional PCR. Fifty (28.7% of 174 stalk juice samples from two field trials were tested to be positive by qPCR assay, whereas, by conventional PCR, only 12.1% (21/174 were tested to be positive with a published primer pair CxxITSf#5/CxxITSr#5 and 15.5% (27/174 were tested to be positive with a newly designed primer pair Pat1-F2/Pat1-R2. The new qPCR assay can be used as an alternative to current diagnostic methods for Lxx, especially when dealing with certificating a large number of healthy cane seedlings and determining disease incidence accurately in commercial fields.

  2. Sensitivity of rapid influenza antigen tests in the diagnosis of pandemic (H1N1)2009 compared with the standard rRT-PCR technique during the 2009 pandemic in Turkey.

    Science.gov (United States)

    Ciblak, Meral Akcay; Kanturvardar, Melis; Asar, Serkan; Bozkaya, Emel; Yenen, O Sadi; Badur, Selim

    2010-12-01

    The real-time reverse transcription polymerase chain reaction (rRT-PCR) technique has been used as the reference technique for the diagnosis of pandemic (H1N1)2009 virus infections. However, rapid influenza diagnostics tests (RIDTs) have been considered in the diagnosis of pandemic (H1N1)2009 by some healthcare institutions in Turkey due to their ease of use and generation of fast results. Nevertheless, their low sensitivity has caused concern during the control of the pandemic. This study aimed to determine the sensitivity of 4 different rapid tests available on the market in Turkey in the diagnosis of pandemic (H1N1)2009 infections compared to the reference rRT-PCR technique. One hundred and four patient samples that tested positive and 88 samples that tested negative for pandemic (H1N1)2009 by rRT-PCR were tested with RIDTs available on the market. The sensitivity of the rapid tests ranged from 31.7% to 50% depending on the brand of RIDT. Specificity ranged from 97.7% to 100%. Currently available RIDTs are not sensitive enough and could lead physicians to delay the treatment of patients, adversely affecting control efforts to mitigate the pandemic. Therefore, these tests should only be used for screening, and negative results should not rule out influenza. More sensitive and rapid point-of-care techniques are needed to meet the demands of point-of-care testing.

  3. Multiplex PCR provides a low-cost alternative to DNA probe methods for rapid identification of Mycobacterium avium and Mycobacterium intracellulare.

    OpenAIRE

    Cousins, D; Francis, B; Dawson, D

    1996-01-01

    A multiplex PCR designed to differentiate Mycobacterium tuberculosis complex organisms from M. avium and M. intracellulare was used to test 105 isolates identified by DNA probe methods as M. avium, M. intracellulare, or M. avium complex type X. The multiple PCR correctly identified 33 of 34 isolates identified by commercial probe methods as M. avium and all 51 isolates identified as M. intracellulare. The 20 isolates identified as M. avium complex type X by probe were identified as Mycobacter...

  4. Evaluation of Different PCR-Based Assays and LAMP Method for Rapid Detection of Phytophthora infestans by Targeting the Ypt1 Gene

    Directory of Open Access Journals (Sweden)

    Mehran Khan

    2017-10-01

    Full Text Available Late blight, caused by the oomycete Phytophthora infestans, is one of the most devastating diseases affecting potato and tomato worldwide. Early diagnosis of the P. infestans pathogen causing late blight should be the top priority for addressing disease epidemics and management. In this study, we performed a loop-mediated isothermal amplification (LAMP assay, conventional polymerase chain reaction (PCR, nested PCR, and real-time PCR to verify and compare the sensitivity and specificity of the reaction based on the Ypt1 (Ras-related protein gene of P. infestans. In comparison with the PCR-based assays, the LAMP technique led to higher specificity and sensitivity, using uncomplicated equipment with an equivalent time frame. All 43 P. infestans isolates, yielded positive detection results using LAMP assay showing no cross reaction with other Phytophthora spp., oomycetes or fungal pathogens. The LAMP assay yielded the lowest detectable DNA concentration (1.28 × 10-4 ng μL-1, being 10 times more sensitive than nested PCR (1.28 × 10-3 ng μL-1, 100 times more sensitive than real-time PCR (1.28 × 10-2 ng μL-1 and 103 times more sensitive than the conventional PCR assay (1.28 × 10-1 ng μL-1. In the field experiment, the LAMP assay outperformed the other tests by amplifying only diseased tissues (leaf and stem, and showing no positive reaction in healthy tissues. Overall, the LAMP assay developed in this study provides a specific, sensitive, simple, and effective visual method for detection of the P. infestans pathogen, and is therefore suitable for application in early prediction of the disease to reduce the risk of epidemics.

  5. Evaluation of Different PCR-Based Assays and LAMP Method for Rapid Detection of Phytophthora infestans by Targeting the Ypt1 Gene.

    Science.gov (United States)

    Khan, Mehran; Li, Benjin; Jiang, Yue; Weng, Qiyong; Chen, Qinghe

    2017-01-01

    Late blight, caused by the oomycete Phytophthora infestans, is one of the most devastating diseases affecting potato and tomato worldwide. Early diagnosis of the P. infestans pathogen causing late blight should be the top priority for addressing disease epidemics and management. In this study, we performed a loop-mediated isothermal amplification (LAMP) assay, conventional polymerase chain reaction (PCR), nested PCR, and real-time PCR to verify and compare the sensitivity and specificity of the reaction based on the Ypt1 (Ras-related protein) gene of P. infestans. In comparison with the PCR-based assays, the LAMP technique led to higher specificity and sensitivity, using uncomplicated equipment with an equivalent time frame. All 43 P. infestans isolates, yielded positive detection results using LAMP assay showing no cross reaction with other Phytophthora spp., oomycetes or fungal pathogens. The LAMP assay yielded the lowest detectable DNA concentration (1.28 × 10-4 ng μL-1), being 10 times more sensitive than nested PCR (1.28 × 10-3 ng μL-1), 100 times more sensitive than real-time PCR (1.28 × 10-2 ng μL-1) and 103 times more sensitive than the conventional PCR assay (1.28 × 10-1 ng μL-1). In the field experiment, the LAMP assay outperformed the other tests by amplifying only diseased tissues (leaf and stem), and showing no positive reaction in healthy tissues. Overall, the LAMP assay developed in this study provides a specific, sensitive, simple, and effective visual method for detection of the P. infestans pathogen, and is therefore suitable for application in early prediction of the disease to reduce the risk of epidemics.

  6. Rapid Identification and Quantification of Aureococcus anophagefferens by qPCR Method (Taqman) in the Qinhuangdao Coastal Area: A Region for Recurrent Brown Tide Breakout in China.

    Science.gov (United States)

    Wang, Li-Ping; Lei, Kun

    2016-12-01

    Since 2009, Aureococcus anophagefferens has caused brown tide to occur recurrently in Qinhuangdao coastal area, China. Because the algal cells of A. anophagefferens are so tiny (~3 µm) that it is very hard to identify exactly under a microscope for natural water samples, it is very urgent to develop a method for efficient and continuous monitoring. Here specific primers and Taqman probe are designed to develop a real-time quantitative PCR (qPCR) method for identification and quantification continually. The algal community and cell abundance of A. anophagefferens in the study area (E 119°20'-119°50' and N 39°30'-39°50') from April to October in 2013 are detected by pyrosequencing, and are used to validate the specification and precision of qPCR method for natural samples. Both pyrosequencing and qPCR shows that the targeted cells are present only in May, June and July, and the cell abundance are July > June > May. Although there are various algal species including dinoflagellata, diatom, Cryptomonadales, Chrysophyceae and Chlorophyta living in the natural seawater simultaneously, no disturbance happens to qPCR method. This qPCR method could detect as few as 10 targeted cells, indicating it is able to detect the algal cells at pre-bloom levels. Therefore, qPCR with Taqman probe provides a powerful and sensitive method to monitor the brown tide continually in Qinhuangdao coastal area, China. The results provide a necessary technology support for forecasting the brown tide initiation, in China.

  7. Development of SCAR markers for rapid and specific detection of Pseudomonas syringae pv. morsprunorum races 1 and 2, using conventional and real-time PCR.

    Science.gov (United States)

    Kałużna, Monika; Albuquerque, Pedro; Tavares, Fernando; Sobiczewski, Piotr; Puławska, Joanna

    2016-04-01

    Specific primers were developed to detect the causal agent of stone fruit bacterial canker using conventional and real-time polymerase chain reaction (PCR) methods. PCR melting profile (PCR MP) used for analysis of diversity of Pseudomonas syringae strains, allowed to pinpoint the amplified fragments specific for P. syringae pv. morsprunorum race 1 (Psm1) and race 2 (Psm2), which were sequenced. Using obtained data, specific sequence characterised amplified region (SCAR) primers were designed. Conventional and real-time PCRs, using genomic DNA isolated from different bacterial strains belonging to the Pseudomonas genus, confirmed the specificity of selected primers. Additionally, the specificity of the selected DNA regions for Psm1 and Psm2 was confirmed by dot blot hybridisation. Conventional and real-time PCR assays enabled accurate detection of Psm1 and Psm2 in pure cultures and in plant material. For conventional PCR, the detection limits were the order of magnitude ~10(0) cfu/reaction for Psm1 and 10(1) cfu/reaction for Psm2 in pure cultures, while in plant material were 10(0)-10(1) cfu/reaction using primers for Psm1 and 3 × 10(2) cfu/reaction using primers for Psm2. Real-time PCR assays with SYBR Green I showed a higher limit of detection (LOD) - 10(0) cfu/reaction in both pure culture and in plant material for each primer pairs designed, which corresponds to 30-100 and 10-50 fg of DNA of Psm1 and Psm2, respectively. To our knowledge, this is the first PCR-based method for detection of the causal agents of bacterial canker of stone fruit trees.

  8. Development of a rapid multiplex PCR assay to genotype Pasteurella multocida strains by use of the lipopolysaccharide outer core biosynthesis locus.

    Science.gov (United States)

    Harper, Marina; John, Marietta; Turni, Conny; Edmunds, Mark; St Michael, Frank; Adler, Ben; Blackall, P J; Cox, Andrew D; Boyce, John D

    2015-02-01

    Pasteurella multocida is a Gram-negative bacterial pathogen that is the causative agent of a wide range of diseases in many animal species, including humans. A widely used method for differentiation of P. multocida strains involves the Heddleston serotyping scheme. This scheme was developed in the early 1970s and classifies P. multocida strains into 16 somatic or lipopolysaccharide (LPS) serovars using an agar gel diffusion precipitin test. However, this gel diffusion assay is problematic, with difficulties reported in accuracy, reproducibility, and the sourcing of quality serovar-specific antisera. Using our knowledge of the genetics of LPS biosynthesis in P. multocida, we have developed a multiplex PCR (mPCR) that is able to differentiate strains based on the genetic organization of the LPS outer core biosynthesis loci. The accuracy of the LPS-mPCR was compared with classical Heddleston serotyping using LPS compositional data as the "gold standard." The LPS-mPCR correctly typed 57 of 58 isolates; Heddleston serotyping was able to correctly and unambiguously type only 20 of the 58 isolates. We conclude that our LPS-mPCR is a highly accurate LPS genotyping method that should replace the Heddleston serotyping scheme for the classification of P. multocida strains. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  9. Fluorescent detection of Southern blots and PCR-based genetic typing tests

    Energy Technology Data Exchange (ETDEWEB)

    Mansfield, E.S.; Worley, J.M. [Molecular Dynamics, Inc., Sunnyvale, CA (United States); Zimmerman, P.A. [Laboratory of Parasitic Diseases, Bethesda, MD (United States)] [and others

    1994-09-01

    The Southern blot is used to study gene organization, to identify disease-causing genomic rearrangements, or for typing RFLP markers in forensic, paternity, or prenatal diagnostic testing. Fluorescence offers a much greater dynamic range and a more linear response than film used in radioactive or chemiluminescent detection of RFLPs. We therefore investigated using the Fluorimager{trademark} 575 (Molecular Dynamics, Inc.) for analyzing Southern blots. Using a single-locus probe to D2S44 (YNH24) (Promega Corp.), we detect as little as 100 ng (0.05 attomole) genomic DNA. The alkaline phosphatase-labeled probe is detected using AttoPhos (JBL Scientific), and the developed membrane is scanned with the Fluorimager. Biotinylated hybridization probes can also be developed using a streptavidin-alkaline phosphatase conjugate and AttoPhos. The instrument scan parameters can be adjusted to prevent overexposure and accompanying loss of resolution in images of blots, gels, or 96-well microplates. We have used these other sample formats in PCR-based genetic typing assays. We use FluorKit DQS (Molecular Dynamics) to accurately quantify PCR template DNA (1-500 ng) in 96-well microplates scanned using the same instrument. Mutation detection assays run include heteroduplex gels (5% polyacrylamide, 2.7 M urea), short tandem repeat (STR) markers, amplified fragment length polymorphisms (AmpFLP), competitive priming PCR, and allele-specific oligotyping. These assays are run using either 1- or 2-color labeling. We detect unlabeled PCR products, such as the AmpFLP marker D1S80 (Perkin-Elmer) by post-staining gels for 10 minutes with SYBR Green 1 (Molecular Probes) and scanning the wet gel. The Fluorimager scans a 20 x 25 cm sample within three minutes, allowing rapid optimization of fluorescent protocols and high sample throughput.

  10. Rapid and Accurate Detection of Bacteriophage Activity against Escherichia coli O157:H7 by Propidium Monoazide Real-Time PCR

    Directory of Open Access Journals (Sweden)

    Hui Liu

    2014-01-01

    Full Text Available Conventional methods to determine the efficacy of bacteriophage (phage for biocontrol of E. coli require several days, due to the need to culture bacteria. Furthermore, cell surface-attached phage particles may lyse bacterial cells during experiments, leading to an overestimation of phage activity. DNA-based real-time quantitative polymerase chain reaction (qPCR is a fast, sensitive, and highly specific means of enumerating pathogens. However, qPCR may underestimate phage activity due to its inability to distinguish viable from nonviable cells. In this study, we evaluated the suitability of propidium monoazide (PMA, a microbial membrane-impermeable dye that inhibits amplification of extracellular DNA and DNA within dead or membrane-compromised cells as a means of using qPCR to identify only intact E. coli cells that survive phage exposure. Escherichia coli O157:H7 strain R508N and 4 phages (T5-like, T1-like, T4-like, and O1-like were studied. Results compared PMA-qPCR and direct plating and confirmed that PMA could successfully inhibit amplification of DNA from compromised/damaged cells E. coli O157:H7. Compared to PMA-qPCR, direct plating overestimated (P < 0.01 phage efficacy as cell surface-attached phage particles lysed E. coli O157:H7 during the plating process. Treatment of samples with PMA in combination with qPCR can therefore be considered beneficial when assessing the efficacy of bacteriophage for biocontrol of E. coli O157:H7.

  11. Development of a TaqMan-based real-time PCR assay for rapid and specific detection of fowl aviadenovirus serotype 4.

    Science.gov (United States)

    Wang, Jianchang; Wang, Jinfeng; Chen, Ping; Liu, Libing; Yuan, Wanzhe

    2017-06-01

    Twelve serotypes of fowl aviadenovirus, namely, FAdV-(1-8a and 8b-11), have been identified, among which FAdV-4 is the aetiologic agent of hepatitis hydropericardium syndrome (HHS) in chickens. Outbreaks of HHS have been documented in many countries, causing significant economic losses. Real-time PCR methods described so far in the literature cross-detect different serotypes of FAdVs. In this study, we aimed to develop a TaqMan-based real-time PCR assay for the specific detection of FAdV-4. A pair of primers targeting the hexon gene and a TaqMan probe were designed. Using different copy numbers of plasmid DNA carrying the hexon gene as template, we showed the detection limit of this assay was 101 copies/reaction, which was 10 times higher than conventional PCR. The assay was highly specific for FAdV-4 and did not cross-detect 11 other serotypes of FAdVs, avian influenza virus, Newcastle disease virus, infectious bronchitis virus or subgroup J of the avian leukosis virus. The reproducibility of the assay was assessed by five independent reactions using different copy numbers of plasmid DNA (103 and 105) as template, and the results showed 0.56-1.15% coefficient of variation for inter-assay variability. Furthermore, the assay was validated with 80 clinical samples. Real-time PCR showed that 76 out of 80 samples were positive for FAdV-4 (95.0% positivity) while 68 out of 80 were tested positive by conventional PCR (85.0% positivity). Our data suggest this real-time PCR assay could be an attractive tool for screening, confirmatory diagnosis and specific differentiation of FAdV-4 infection.

  12. A rapid and efficient method for studies of virus interaction at the host cell surface using enteroviruses and real-time PCR

    Directory of Open Access Journals (Sweden)

    Israelsson Stina

    2009-12-01

    Full Text Available Abstract Background Measuring virus attachment to host cells is of great importance when trying to identify novel receptors. The presence of a usable receptor is a major determinant of viral host range and cell tropism. Furthermore, identification of appropriate receptors is central for the understanding of viral pathogenesis and gives possibilities to develop antiviral drugs. Attachment is presently measured using radiolabeled and subsequently gradient purified viruses. Traditional methods are expensive and time-consuming and not all viruses are stable during a purification procedure; hence there is room for improvement. Real-time PCR (RT-PCR has become the standard method to detect and quantify virus infections, including enteroviruses, in clinical samples. For instance, primers directed to the highly conserved 5' untranslated region (5'UTR of the enterovirus genome enable detection of a wide spectrum of enteroviruses. Here, we evaluate the capacity of the RT-PCR technology to study enterovirus host cell interactions at the cell surface and compare this novel implementation with an established assay using radiolabeled viruses. Results Both purified and crude viral extracts of CVB5 generated comparable results in attachment studies when analyzed with RT-PCR. In addition, receptor binding studies regarding viruses with coxsackie- and adenovirus receptor (CAR and/or decay accelerating factor (DAF affinity, further demonstrated the possibility to use RT-PCR to measure virus attachment to host cells. Furthermore, the RT-PCR technology and crude viral extracts was used to study attachment with low multiplicity of infection (0.05 × 10-4TCID50/cell and low cell numbers (250, which implies the range of potential implementations of the presented technique. Conclusion We have implemented the well-established RT-PCR technique to measure viral attachment to host cells with high accuracy and reproducibility, at low cost and with less effort than

  13. A rapid and efficient method for studies of virus interaction at the host cell surface using enteroviruses and real-time PCR.

    Science.gov (United States)

    Jonsson, Nina; Gullberg, Maria; Israelsson, Stina; Lindberg, A Michael

    2009-12-07

    Measuring virus attachment to host cells is of great importance when trying to identify novel receptors. The presence of a usable receptor is a major determinant of viral host range and cell tropism. Furthermore, identification of appropriate receptors is central for the understanding of viral pathogenesis and gives possibilities to develop antiviral drugs. Attachment is presently measured using radiolabeled and subsequently gradient purified viruses. Traditional methods are expensive and time-consuming and not all viruses are stable during a purification procedure; hence there is room for improvement. Real-time PCR (RT-PCR) has become the standard method to detect and quantify virus infections, including enteroviruses, in clinical samples. For instance, primers directed to the highly conserved 5' untranslated region (5'UTR) of the enterovirus genome enable detection of a wide spectrum of enteroviruses. Here, we evaluate the capacity of the RT-PCR technology to study enterovirus host cell interactions at the cell surface and compare this novel implementation with an established assay using radiolabeled viruses. Both purified and crude viral extracts of CVB5 generated comparable results in attachment studies when analyzed with RT-PCR. In addition, receptor binding studies regarding viruses with coxsackie- and adenovirus receptor (CAR) and/or decay accelerating factor (DAF) affinity, further demonstrated the possibility to use RT-PCR to measure virus attachment to host cells. Furthermore, the RT-PCR technology and crude viral extracts was used to study attachment with low multiplicity of infection (0.05 x 10(-4)TCID50/cell) and low cell numbers (250), which implies the range of potential implementations of the presented technique. We have implemented the well-established RT-PCR technique to measure viral attachment to host cells with high accuracy and reproducibility, at low cost and with less effort than traditional methods. Furthermore, replacing traditional

  14. Development of a Rapid Real-Time PCR Method as a Tool To Quantify Viable Photobacterium phosphoreum Bacteria in Salmon (Salmo salar) Steaks

    DEFF Research Database (Denmark)

    Macé, Sabrina; Mamlouk, Kelthoum; Chipchakova, Stoyka

    2013-01-01

    -bp fragment of the gyrase subunit B gene (gyrB) of P. phosphoreum. The specificity of the two primers was demonstrated by using purified DNA from 81 strains of 52 different bacterial species. When these primers were used for real-time PCR in pure culture, a good correlation (R2 of 0.99) was obtained...

  15. Evaluation of a PCR-Based Universal Heteroduplex Generator Assay as a Tool for Rapid Detection of Multidrug-Resistant Mycobacterium tuberculosis in Peru

    Science.gov (United States)

    Mayta, Holger; Gilman, Robert H.; Arenas, Fanny; Valencia, Teresa; Caviedes, Luz; Montenegro, Sonia H.; Ticona, Eduardo; Ortiz, Jaime; Chumpitaz, Rosa; Evans, Carlton A.; Williams, Diana L.

    2003-01-01

    Multidrug-resistant tuberculosis is an increasing health problem worldwide, especially in developing countries. The PCR-UHG-Rif assay, which detects mutations within the rpoB gene associated with rifampin resistance, was evaluated for its ability and reliability to detect and identify drug-resistant Mycobacterium tuberculosis in a developing country where tuberculosis is highly endemic. PMID:14662980

  16. Rapid Screening Method for Compounds That Affect the Growth and Germination of Candida albicans, Using a Real-Time PCR Thermocycler

    NARCIS (Netherlands)

    Jarosz, Lucja M.; Krom, Bastiaan P.

    2011-01-01

    We propose a screening method for compounds affecting growth and germination in Candida albicans using a real-time PCR thermocycler to quantify green fluorescent protein (GFP) fluorescence. Using P(ACT1)-GFP and P(HWP1)-GFP reporter strains, the effects of a wide range of compounds on growth and

  17. Rapid detection of coliforms in drinking water of Arak city using multiplex PCR method in comparison with the standard method of culture (Most Probably Number

    Directory of Open Access Journals (Sweden)

    Dehghan fatemeh

    2014-05-01

    Conclusions: Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN.

  18. Evaluation of a PCR-based universal heteroduplex generator assay as a tool for rapid detection of multidrug-resistant Mycobacterium tuberculosis in Peru.

    Science.gov (United States)

    Mayta, Holger; Gilman, Robert H; Arenas, Fanny; Valencia, Teresa; Caviedes, Luz; Montenegro, Sonia H; Ticona, Eduardo; Ortiz, Jaime; Chumpitaz, Rosa; Evans, Carlton A; Williams, Diana L

    2003-12-01

    Multidrug-resistant tuberculosis is an increasing health problem worldwide, especially in developing countries. The PCR-UHG-Rif assay, which detects mutations within the rpoB gene associated with rifampin resistance, was evaluated for its ability and reliability to detect and identify drug-resistant Mycobacterium tuberculosis in a developing country where tuberculosis is highly endemic.

  19. Rapid, sensitive, type specific PCR detection of the E7 region of human papillomavirus type 16 and 18 from paraffin embedded sections of cervical carcinoma

    DEFF Research Database (Denmark)

    Lesnikova, Iana; Lidang, Marianne; Hamilton-Dutoit, Steven

    2010-01-01

    ABSTRACT: Human papillomavirus (HPV) infection, and in particularly infection with HPVs 16 and 18, is a central carcinogenic factor in the uterine cervix. We established and optimized a PCR assay for the detection and discrimination of HPV types 16 and 18 in archival formaldehyde fixed and paraffin...

  20. Rapid, sensitive, type specific PCR detection of the E7 region of human papillomavirus type 16 and 18 from paraffin embedded sections of cervical carcinoma

    DEFF Research Database (Denmark)

    Lesnikova, Iana; Lidang, Marianne; Hamilton-Dutoit, Stephen Jacques

    2010-01-01

    ABSTRACT: Human papillomavirus (HPV) infection, and in particularly infection with HPVs 16 and 18 is a central carcinogenic factor in the uterine cervix. We established and optimized a PCR assay for the detection and discrimination of HPV types 16 and 18 in archival formaldehyde fixed and paraffin...

  1. PCR Assay Based on the gyrB Gene for Rapid Identification of Acinetobacter baumannii-calcoaceticus Complex at Specie Level.

    Science.gov (United States)

    Teixeira, Aline B; Barin, Juliana; Hermes, Djuli M; Barth, Afonso L; Martins, Andreza F

    2017-05-01

    The genus Acinetobacter sp. comprises more than 50 species, and four are closely related and difficult to be distinguished by either phenotypic or genotypic methods: the Acinetobacter calcoaceticus-baumannii complex (ABC). The correct identification at species level is necessary mainly due to the epidemiological aspects. We evaluated a multiplex PCR for gyrB gene to identify the species of the ABC using the sequencing of the ITS 16S-23S fragment as a gold standard. Isolates identified as Acinetobacter calcoaceticus-baumannii from three hospitals at southern Brazil in 2011 were included in this study. A total of 117 isolates were obtained and 106 (90.6%) were confirmed as A. baumannii, 6 (5.1%) as A. nosocomialis and 4 (3.4%) as A. pittii by PCR for gyrB gene. Only one isolate did not present a product of the PCR for the gyrB gene; this isolate was identified as Acinetobacter genospecie 10 by sequencing of ITS. We also noted that the non-A. baumannii isolates were recovered from respiratory tract (8/72.7%), blood (2/18.2%) and urine (1/9.1%), suggesting that these species can cause serious infection. These findings evidenced that the multiplex PCR of the gyrB is a feasible and simple method to identify isolates of the ABC at the species level. © 2016 Wiley Periodicals, Inc.

  2. Performance of rapid diagnostic test, blood-film microscopy and PCR for the diagnosis of malaria infection among febrile children from Korogwe District, Tanzania

    DEFF Research Database (Denmark)

    Mahende, Coline; Ngasala, Billy; Lusingu, John

    2016-01-01

    predictive value (PPV) of 88.9 % (95 % CI, 79.3-95.1 %) and 75.3 % (95 % CI, 64.8-84.0 %), respectively. Confirmation of P. falciparum infection with PCR analysis provided lower sensitivity and PPV of 88.6 % (95 % CI, 79.5-94.7 %) and 84.3 % (95 % CI, 74.7-91.4 %) for RDT compared to microscopy. Conclusion...

  3. Development of a Rapid Real-Time PCR Method as a Tool To Quantify Viable Photobacterium phosphoreum Bacteria in Salmon (Salmo salar) Steaks

    OpenAIRE

    Macé, Sabrina; Mamlouk, Kelthoum; Chipchakova, Stoyka; Prévost, Hervé; Joffraud, Jean-jacques; Dalgaard, Paw,; Pilet, Marie-France; Dousset, Xavier

    2013-01-01

    A specific real-time PCR quantification method combined with a propidium monoazide sample treatment step was developed to determine quantitatively the viable population of the Photobacterium phosphoreum species group in raw modified-atmosphere-packed salmon. Primers were designed to amplify a 350-bp fragment of the gyrase subunit B gene (gyrB) of P. phosphoreum. The specificity of the two primers was demonstrated by using purified DNA from 81 strains of 52 different bacterial species. When th...

  4. Comparison of an in-house multiplex PCR with two commercial immuno-chromatographic tests for rapid identification and differentiation of MTB from NTM isolates.

    Science.gov (United States)

    Kumar, Parveen; Benny, Prit; Jain, Manisha; Singh, Sarman

    2014-03-01

    Species specific diagnosis of mycobacterial infection is crucial because treatment of infections caused by Mycobacterium tuberculosis (MTB) differs from that of non-tuberculous mycobacterial (NTM) species. The species identification used to be cumbersome and non-reproducible a decade ago. Recently, some commercial tests have been made available to differentiate the MTB and NTM growths in culture media. Sensitivity and specificity of these tests was evaluated. In this double blind study 572 clinical samples were cultured in an automated BACTEC-MGIT-960 system. A total of 147 (25.7%) samples were MGIT culture positive. These cultures were subjected to an in-house m-PCR (which amplifies hsp-65, esat-6 and ITS region for MAC), two commercial immune-chromatographic tests (ICTs) and phenotypic tests. Of the 147 MGIT positive cultures, m-PCR was able to correctly identify MTB in 123 cultures and NTM in 24 which included 3 MAC isolates. m-PCR showed 100% agreement with two gold standard methods-the nitrate reductase assay and PNB tests-in correctly identifying MTB. Commercial strips were able to correctly identify MTB in 120 (97.5%) of 123 cultures, while 3 (2.5%) isolates were falsely identified as NTM. However, none of the growth negative spent medium gave false positive results in any of the tests. None of the commercial strips misidentified any of the 24 NTM as MTB; hence, specificity of these strips was 100%. Of the 2 IC test systems, both SD Bioline and BD TBc strip tests missed 2.5% of MTB isolates and misidentified these as NTM. The in-house m-PCR was found to be the most accurate and efficient tool for identifying the MTB, MAC and other NTMs. Copyright © 2014 Asian-African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.

  5. PCR-Based Rapid Identification System Using Bridged Nucleic Acids for Detection of Clarithromycin-Resistant Mycobacterium avium-M. intracellulare Complex Isolates

    Science.gov (United States)

    Shiono, Ayako; Egashira, Hiroshi; Kishi, Etsuko; Hagiwara, Koichi; Nakamura, Hidetoshi; Kanazawa, Minoru; Nagata, Makoto

    2016-01-01

    The nontuberculous mycobacteria (NTM) cause miscellaneous disorders in humans, especially in the lungs, which present with a variety of radiological features. To date, knowledge of the pathogenic role of the Mycobacterium avium-intracellulare complex (MAC) in the human lung and the definitive criteria for initiating multidrug therapy are still lacking. However, there is little doubt that clarithromycin is the most efficacious drug among the various treatment regimens for lung NTM. In this study, with the use of a bridged nucleic acid (BNA) probe a detection system based on a real-time PCR (BNA-PCR) for the identification of the point mutations at position 2058 or 2059 in domain V of the 23S rRNA gene responsible for clarithromycin resistance was developed and has been assessed using MAC isolates from clinical samples. Out of 199 respiratory specimens, the drug susceptibility test demonstrated 12 strains resistant to clarithromycin, while the BNA-PCR showed 8 strains carrying the point mutation at position 2058 or 2059 of the 23S rRNA gene. This system revealed that there were mycobacterial strains resistant to clarithromycin which do not carry previously identified resistance genes. This paper documents a novel system for detecting clarithromycin-resistant strains and demonstrates that although these mutations are tacitly assumed to account for >90% of the reported resistant mutants, there is a significant fraction of resistant mutants that do not harbor these mutations. Therefore, unknown mechanisms affecting clarithromycin resistance remain to be elucidated. PMID:26739154

  6. A simple and rapid PCR-based method to isolate complete small macronuclear minichromosomes from hypotrich ciliates: 5S rDNA and S26 ribosomal protein gene of Oxytricha (Sterkiella) nova.

    Science.gov (United States)

    Callejas, Sergio; Gutiérrez, Juan Carlos

    2002-06-01

    Hypotrich ciliates present a macronuclear genome consisting of gene-sized instead of chromosome-sized DNA molecules. Exploiting this unique eukaryotic genome feature, we introduce, for the first time in ciliates, a rapid and easy PCR method using telomeric primers to isolate small complete macronuclear DNA molecules or minichromosomes. Two presumably abundant macronuclear DNA molecules, containing ribosomal genes, were amplified from the Oxytricha (Sterkiella) nova complete genome after using this method, and then were cloned and sequenced. The 5S rDNA sequence of O. (S.) nova is the third one reported among hypotrich ciliates; its primary and secondary structure is compared with other eukaryotic 5S rRNAs. The ribosomal protein S26 gene is the first one reported among ciliates. This "End-End-PCR" method might be useful to obtain similar gene-sized macronuclear molecules from other hypotrich ciliates, and, therefore, to increase our knowledge on ribosomal genes in these eukaryotic microorganisms.

  7. Rapid detection and identification of Stachybotrys and Chaetomium species using tissue PCR analysis

    DEFF Research Database (Denmark)

    Lewinska, Anna Malgorzata; Peuhkuri, Ruut Hannele; Rode, Carsten

    2016-01-01

    Indoor fungi are a worldwide problem causing negative health effects for infected building's occupants and even deterioration of building structures. Different fungal species affect buildings and their inhabitants differently. Therefore, rapid and accurate identification of fungi to the species l...

  8. Comparison of the Directigen flu A+B test, the QuickVue influenza test, and clinical case definition to viral culture and reverse transcription-PCR for rapid diagnosis of influenza virus infection.

    Science.gov (United States)

    Ruest, Annie; Michaud, Sophie; Deslandes, Sylvie; Frost, Eric H

    2003-08-01

    The diagnostic performances of the clinical case definition of influenza virus infection based on the combination of fever and cough and of two rapid influenza diagnostic tests, the Directigen Flu A+B test (Directigen; BD Diagnostic Systems, Sparks, Md.) and the QuickVue influenza test (QuickVue; Quidel, San Diego, Calif.), were compared to those of viral culture and an in-house reverse transcription (RT)-PCR during the 2000-2001 flu season. Two hundred consecutive nasopharyngeal aspirates were analyzed from 192 patients, including 122 adults and 70 children. Viral culture identified influenza virus A in 16 samples and influenza virus B in 55 samples, whereas RT-PCR identified influenza virus A in 21 samples and influenza virus B in 64 samples. When RT-PCR was used as the reference standard, the likelihood ratios for a positive test were 40.0 for Directigen, 8.6 for QuickVue, and 1.4 for the combination of fever and cough, whereas the likelihood ratios for a negative test were 0.22, 0.16, and 0.48, respectively. Our study suggests that (i). the poor specificity (35 to 58%) and the poor positive predictive value (41 to 60%) of the clinical case definition of influenza preclude its use for prediction of influenza virus infections during epidemics, especially when infection control decision making in the hospital setting is considered; (ii). Directigen has a higher diagnostic yield than QuickVue but is associated with a larger number of invalid results; (iii). the sensitivities of the rapid diagnostic tests are significantly lower with samples from adults than with samples from children, with the rates of false-negative results reaching up to 29%; and (iv). RT-PCR detects more cases of influenza than viral culture, and this greater accuracy makes it a more useful reference standard.

  9. Development and evaluation of hexaplex PCR for rapid detection of methicillin, cadmium/zinc and antiseptic-resistant staphylococci, with simultaneous identification of PVL-positive and -negative Staphylococcus aureus and coagulase negative staphylococci.

    Science.gov (United States)

    Panda, Sasmita; Kar, Sarita; Choudhury, Ranginee; Sharma, Savitri; Singh, Durg V

    2014-03-01

    We developed a multiplex PCR to detect the presence of methicillin- (mecA), cadmium/zinc-(czrC) and antiseptic-resistant (qacA/B) staphylococci and to identify Panton-Valentine leukocidin (PVL)-positive and -negative Staphylococcus aureus and coagulase-negative staphylococci (CoNS) from infected and healthy eyes. The assay was validated on 177 staphylococci comprising of 55 each of S. aureus and CoNS isolated from infected eyes and five S. aureus and 62 CoNS isolated from healthy eyes and nine direct ocular samples. Nine direct ocular samples for in situ testing consisted of corneal scrapings (4), conjunctiva swabs (2) and others (3). Multiplex PCR result was correlated with genotype data obtained with single PCR and dot-blot assay. The control strains that were positive in multiplex PCR for 16S rRNA, nuc, mecA, pvl, czrC and qacA/B genes were also positive in the dot-blot assay. The specificity of amplified genes obtained with reference strains was further confirmed by DNA sequencing. The single step-hexaplex PCR method can be used for rapid detection of mecA, nuc, pvl, czrC and qacA/B genes in staphylococci with simultaneous identification of PVL-positive and -negative S. aureus and CoNS from a variety of ocular samples. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.