Rapid ABO genotyping by high-speed droplet allele-specific PCR using crude samples.
Taira, Chiaki; Matsuda, Kazuyuki; Takeichi, Naoya; Furukawa, Satomi; Sugano, Mitsutoshi; Uehara, Takeshi; Okumura, Nobuo; Honda, Takayuki
2018-01-01
ABO genotyping has common tools for personal identification of forensic and transplantation field. We developed a new method based on a droplet allele-specific PCR (droplet-AS-PCR) that enabled rapid PCR amplification. We attempted rapid ABO genotyping using crude DNA isolated from dried blood and buccal cells. We designed allele-specific primers for three SNPs (at nucleotides 261, 526, and 803) in exons 6 and 7 of the ABO gene. We pretreated dried blood and buccal cells with proteinase K, and obtained crude DNAs without DNA purification. Droplet-AS-PCR allowed specific amplification of the SNPs at the three loci using crude DNA, with results similar to those for DNA extracted from fresh peripheral blood. The sensitivity of the methods was 5%-10%. The genotyping of extracted DNA and crude DNA were completed within 8 and 9 minutes, respectively. The genotypes determined by the droplet-AS-PCR method were always consistent with those obtained by direct sequencing. The droplet-AS-PCR method enabled rapid and specific amplification of three SNPs of the ABO gene from crude DNA treated with proteinase K. ABO genotyping by the droplet-AS-PCR has the potential to be applied to various fields including a forensic medicine and transplantation medical care. © 2017 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Zapparoli, Giada V; Jorissen, Robert N; Hewitt, Chelsee A; McBean, Michelle; Westerman, David A; Dobrovic, Alexander
2013-01-01
The JAK2 V617F mutation is the most frequent somatic change in myeloproliferative neoplasms, making it an important tumour-specific marker for diagnostic purposes and for the detection of minimal residual disease. Sensitive quantitative assays are required for both applications, particularly for the monitoring of minimal residual disease, which requires not only high sensitivity but also very high specificity. We developed a highly sensitive probe-free quantitative mutant-allele detection method, Quantitative Threefold Allele-Specific PCR (QuanTAS-PCR), that is performed in a closed-tube system, thus eliminating the manipulation of PCR products. QuantTAS-PCR uses a threefold approach to ensure allele-specific amplification of the mutant sequence: (i) a mutant allele-specific primer, (ii) a 3′dideoxy blocker to suppress false-positive amplification from the wild-type template and (iii) a PCR specificity enhancer, also to suppress false-positive amplification from the wild-type template. Mutant alleles were quantified relative to exon 9 of JAK2. We showed that the addition of the 3′dideoxy blocker suppressed but did not eliminate false-positive amplification from the wild-type template. However, the addition of the PCR specificity enhancer near eliminated false-positive amplification from the wild-type allele. Further discrimination between true and false positives was enabled by using the quantification cycle (Cq) value of a single mutant template as a cut-off point, thus enabling robust distinction between true and false positives. As 10,000 JAK2 templates were used per replicate, the assay had a sensitivity of 1/10 -4 per replicate. Greater sensitivity could be reached by increasing the number of replicates analysed. Variation in replicates when low mutant-allele templates were present necessitated the use of a statistics-based approach to estimate the load of mutant JAK2 copies. QuanTAS-PCR showed comparable quantitative results when validated against a
Altınel, Ahmet
2017-01-01
Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256
Kinetic characterisation of primer mismatches in allele-specific PCR: a quantitative assessment.
Waterfall, Christy M; Eisenthal, Robert; Cobb, Benjamin D
2002-12-20
A novel method of estimating the kinetic parameters of Taq DNA polymerase during rapid cycle PCR is presented. A model was constructed using a simplified sigmoid function to represent substrate accumulation during PCR in combination with the general equation describing high substrate inhibition for Michaelis-Menten enzymes. The PCR progress curve was viewed as a series of independent reactions where initial rates were accurately measured for each cycle. Kinetic parameters were obtained for allele-specific PCR (AS-PCR) amplification to examine the effect of mismatches on amplification. A high degree of correlation was obtained providing evidence of substrate inhibition as a major cause of the plateau phase that occurs in the later cycles of PCR.
Mistri, S K; Sultana, M; Kamal, S M M; Alam, M M; Irin, F; Nessa, J; Ahsan, C R; Yasmin, M
2016-05-01
For an effective control of tuberculosis, rapid detection of multidrug resistant tuberculosis (MDR-TB) is necessary. Therefore, we developed a modified nested multiplex allele-specific polymerase chain reaction (MAS-PCR) method that enables rapid MDR-TB detection directly from sputum samples. The efficacy of this method was evaluated using 79 sputum samples collected from suspected tuberculosis patients. The performance of nested MAS-PCR method was compared with other MDR-TB detection methods like drug susceptibility testing (DST) and DNA sequencing. As rifampicin (RIF) resistance conforms to MDR-TB in greater than 90% cases, only the presence of RIF-associated mutations in rpoB gene was determined by DNA sequencing and nested MAS-PCR to detect MDR-TB. The concordance between nested MAS-PCR and DNA sequencing results was found to be 96·3%. When compared with DST, the sensitivity and specificity of nested MAS-PCR for RIF-resistance detection were determined to be 92·9 and 100% respectively. For developing- and high-TB burden countries, molecular-based tests have been recommended by the World Health Organization for rapid detection of MDR-TB. The results of this study indicate that, nested MAS-PCR assay might be a practical and relatively cost effective molecular method for rapid detection of MDR-TB from suspected sputum samples in developing countries with resource poor settings. © 2016 The Society for Applied Microbiology.
Directory of Open Access Journals (Sweden)
Zahra Derakhshani Nezhad
2012-09-01
Full Text Available Background & Objectives: Ethambutol is one of the four main drugs in treatment of tuberculosis. The most common mutation associated with this drug resistance usually occurs in codon 306 of embB. The aim of this study was to detect ethambutol resistance using Allele-Specific PCR and Spoligotyping in various subtypes of Mycobacterium tuberculosis. Methods : 140 sputum specimens were collected from suspected TB patients. They were digested and decontaminated using Pettrof method before culturing them on LJ medium. Drug susceptibility testing was performed on 106 culture positive specimens using proportional method. DNA was extracted from the isolated organisms and subsequently subjected to Allele-Specific PCR to detect any mutationin embB306. Spoligotyping was then used to determine the subtypes. Results: Out of 106 cultures positive samples, 36 samples (33.9% showed resistance to ethambutol using proportional method. Allele-Specific PCR assay identified 93 as sensitive and 13 (27.6% as resistant strains. The results of PCR were in agreement with result of proportional method. The PCR method revealed that 61.5% of mutation occurred in the first and 38.5% in third nucleotides. Spoligotyping differentiated Mycobacterium tuberculosis strains into Beijing (10 9.4%, Bovis (2 1.8%, CAS (24 22.6%, EAI (1 0.9%, Haarlem (27 25.4%, LAM (5 4.7%, Manu (5 4.7%, T (27 25.4% and U( 2 1,8% families. The high frequency of mutation in embB gene was belonged to Haarlem, CAS and T subfamilies. Conclusion: Based on results current study, mutations in the genes other than embB might have occurred in the resistant strains that gave negative result in Allele-Specific PCR assay. Therefore other mechanisms of resistance to this antibiotic should be investigated.
[Molecular authentication of Jinyinhua formula granule by using allele-specific PCR].
Jiang, Chao; Tu, Li-Chan; Yuan, Yuan; Huang, Lu-Qi; Gao, Wei; Jin, Yan
2017-07-01
Traditional authentication method is hard to identify herb's authenticity of traditional Chinese medicine(TCM) formula granules because they have lost all their morphological characteristics. In this study, a new allele-specific PCR method was established for identifying the authentication of Jinyinhua formula granule (made from Lonicerae Japonicae Flos) based on an SNP site in trnL-trnF fragment. Genomic DNA was successfully extracted from Lonicerae Japonicae Flos and its formula granules by using an improved spin column method and then PCR was performed with the designed primer. Approximately 110 bp specific bands was obtained only in the authentic Lonicerae Japonicae Flos and its formula granules, while no bands were found in fake mixed products. In addition, the PCR product sequence was proved from Lonicerae Japonicae Flos trnL-trnF sequence by using BLAST method. Therefore, DNA molecular authentication method could make up the limitations of character identification method and microscopic identification, and quickly identify herb's authenticity of TCM formula granules, with enormous potential for market supervision and quality control. Copyright© by the Chinese Pharmaceutical Association.
Galmozzi, E; Facchetti, F; Degasperi, E; Aghemo, A; Lampertico, P
2013-02-01
Recently, genome-wide association studies (GWAS) in patients with chronic hepatitis C virus (HCV) infection have identified two functional single nucleotide polymorphisms (SNPs) in the inosine triphosphatase (ITPA) gene, that are associated strongly and independently with hemolytic anemia in patients exposed to pegylated-interferon (Peg-IFN) plus ribavirin (RBV) combined therapy. Here has been developed a simplified allele discrimination polymerase chain reaction (PCR) assay named allelic inhibition of displacement activity (AIDA) for evaluation of ITPA polymorphisms. AIDA system relies on three unlabeled primers only, two outer common primers and one inner primer with allele-specific 3' terminus mismatch. DNA samples from 192 patients with chronic HCV infection were used to validate the AIDA system and results were compared with the gold standard TaqMan(®) SNP genotyping assay. Concordant data were obtained for all samples, granting for high specificity of the method. In conclusion, AIDA is a practical one-tube method to reproducibly and to assess accurately rs7270101 and rs1127354 ITPA SNPs. Copyright © 2012 Elsevier B.V. All rights reserved.
Rapid detection of the CYP2A6*12 hybrid allele by Pyrosequencing® technology
Directory of Open Access Journals (Sweden)
Gallagher Margaret L
2009-08-01
Full Text Available Abstract Background Identification of CYP2A6 alleles associated with reduced enzyme activity is important in the study of inter-individual differences in drug metabolism. CYP2A6*12 is a hybrid allele that results from unequal crossover between CYP2A6 and CYP2A7 genes. The 5' regulatory region and exons 1–2 are derived from CYP2A7, and exons 3–9 are derived from CYP2A6. Conventional methods for detection of CYP2A6*12 consist of two-step PCR protocols that are laborious and unsuitable for high-throughput genotyping. We developed a rapid and accurate method to detect the CYP2A6*12 allele by Pyrosequencing technology. Methods A single set of PCR primers was designed to specifically amplify both the CYP2A6*1 wild-type allele and the CYP2A6*12 hybrid allele. An internal Pyrosequencing primer was used to generate allele-specific sequence information, which detected homozygous wild-type, heterozygous hybrid, and homozygous hybrid alleles. We first validated the assay on 104 DNA samples that were also genotyped by conventional two-step PCR and by cycle sequencing. CYP2A6*12 allele frequencies were then determined using the Pyrosequencing assay on 181 multi-ethnic DNA samples from subjects of African American, European Caucasian, Pacific Rim, and Hispanic descent. Finally, we streamlined the Pyrosequencing assay by integrating liquid handling robotics into the workflow. Results Pyrosequencing results demonstrated 100% concordance with conventional two-step PCR and cycle sequencing methods. Allele frequency data showed slightly higher prevalence of the CYP2A6*12 allele in European Caucasians and Hispanics. Conclusion This Pyrosequencing assay proved to be a simple, rapid, and accurate alternative to conventional methods, which can be easily adapted to the needs of higher-throughput studies.
Development of allele-specific multiplex PCR to determine the length of poly-T in intron 8 of CFTR
Directory of Open Access Journals (Sweden)
Neng Chen
2014-07-01
Full Text Available Cystic fibrosis transmembrane conductance regulator (CFTR gene mutation analysis has been implemented for Cystic Fibrosis (CF carrier screening, and molecular diagnosis of CF and congenital bilateral absence of the vas deferens (CBAVD. Although poly-T allele analysis in intron 8 of CFTR is required when a patient is positive for R117H, it is not recommended for routine carrier screening. Therefore, commercial kits for CFTR mutation analysis were designed either to mask the poly-T allele results, unless a patient is R117H positive, or to have the poly-T analysis as a standalone reflex test using the same commercial platform. There are other standalone assays developed to detect poly-T alleles, such as heteroduplex analysis, High Resolution Melting (HRM curve analysis, allele-specific PCR (AS-PCR and Sanger sequencing. In this report, we developed a simple and easy-to-implement multiplex AS-PCR assay using unlabeled standard length primers, which can be used as a reflex or standalone test for CFTR poly-T track analysis. Out of 115 human gDNA samples tested, results from our new AS-PCR matched to the previous known poly-T results or results from Sanger sequencing.
An SSP-PCR method for the rapid detection of disease-associated alleles HLA-A*29 and HLA-B*51.
Amstutz, U; Schaerer, D; Andrey, G; Wirthmueller, U; Largiadèr, C R
2018-05-15
HLA-A*29 and HLA-B*51 are associated with birdshot uveitis and Behçet's disease, respectively, and are used as a diagnostic criterion in patients with suspected disease, requiring their detection in diagnostic laboratories. While commercial tests for individual HLA alleles are available for other disease-associated HLA variants, no similar allele-specific assays are available for HLA-A*29 and -B*51. Here, we report SSP-PCR methods for the detection of HLA-A*29 and -B*51 using a single PCR reaction per allele. The assays were tested in 30 and 32 previously HLA-typed samples, respectively, representing >97% of HLA-A alleles and >93% of HLA-B alleles in a European population. A concordance of 100% was observed with previous typing results, validating these methods for use in a diagnostic or research context. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Detection of MPL mutations by a novel allele-specific PCR-based strategy.
Furtado, Larissa V; Weigelin, Helmut C; Elenitoba-Johnson, Kojo S J; Betz, Bryan L
2013-11-01
MPL mutation testing is recommended in patients with suspected primary myelofibrosis or essential thrombocythemia who lack the JAK2 V617F mutation. MPL mutations can occur at allelic levels below 15%, which may escape detection by commonly used mutation screening methods such as Sanger sequencing. We developed a novel multiplexed allele-specific PCR assay capable of detecting most recurrent MPL exon 10 mutations associated with primary myelofibrosis and essential thrombocythemia (W515L, W515K, W515A, and S505N) down to a sensitivity of 2.5% mutant allele. Test results were reviewed from 15 reference cases and 1380 consecutive specimens referred to our laboratory for testing. Assay performance was compared to Sanger sequencing across a series of 58 specimens with MPL mutations. Positive cases consisted of 45 with W515L, 6 with S505N, 5 with W515K, 1 with W515A, and 1 with both W515L and S505N. Seven cases had mutations below 5% that were undetected by Sanger sequencing. Ten additional cases had mutation levels between 5% and 15% that were not consistently detected by sequencing. All results were easily interpreted in the allele-specific test. This assay offers a sensitive and reliable solution for MPL mutation testing. Sanger sequencing appears insufficiently sensitive for robust MPL mutation detection. Our data also suggest the relative frequency of S505N mutations may be underestimated, highlighting the necessity for inclusion of this mutation in MPL test platforms. Copyright © 2013 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Wang, Shaohui; Meng, Qingmei; Dai, Jianjun; Han, Xiangan; Han, Yue; Ding, Chan; Liu, Haiwen; Yu, Shengqing
2014-01-01
Systemic infections by avian pathogenic Escherichia coli (APEC) are economically devastating to poultry industries worldwide. E. coli strains belonging to serotypes O1, O2, O18 and O78 are preferentially associated with avian colibacillosis. The rfb gene cluster controlling O antigen synthesis is usually various among different E. coli serotypes. In present study, the rfb gene clusters of E. coli serotypes O1, O2, O18 and O78 were characterized and compared. Based on the serotype-specific genes in rfb gene cluster, an allele-specific polymerase chain reaction (PCR) assay was developed. This PCR assay was highly specific and reliable for sero-typing of APEC O1, O2, O18 and O78 strains. The sensitivity of the assay was determined as 10 pg DNA or 10 colony forming units (CFUs) bacteria for serotypes O2 and O18 strains, and 500 pg DNA or 1,000 CFUs bacteria for serotypes O1 and O78 strains. Using this PCR system, APEC isolates and the infected tissue samples were categorized successfully. Furthermore, it was able to differentiate the serotypes for the samples with multi-agglutination in the traditional serum agglutination assay. Therefore, the allele-specific PCR is more simple, rapid and accurate assay for APEC diagnosis, epidemiologic study and vaccine development.
Directory of Open Access Journals (Sweden)
Shaohui Wang
Full Text Available Systemic infections by avian pathogenic Escherichia coli (APEC are economically devastating to poultry industries worldwide. E. coli strains belonging to serotypes O1, O2, O18 and O78 are preferentially associated with avian colibacillosis. The rfb gene cluster controlling O antigen synthesis is usually various among different E. coli serotypes. In present study, the rfb gene clusters of E. coli serotypes O1, O2, O18 and O78 were characterized and compared. Based on the serotype-specific genes in rfb gene cluster, an allele-specific polymerase chain reaction (PCR assay was developed. This PCR assay was highly specific and reliable for sero-typing of APEC O1, O2, O18 and O78 strains. The sensitivity of the assay was determined as 10 pg DNA or 10 colony forming units (CFUs bacteria for serotypes O2 and O18 strains, and 500 pg DNA or 1,000 CFUs bacteria for serotypes O1 and O78 strains. Using this PCR system, APEC isolates and the infected tissue samples were categorized successfully. Furthermore, it was able to differentiate the serotypes for the samples with multi-agglutination in the traditional serum agglutination assay. Therefore, the allele-specific PCR is more simple, rapid and accurate assay for APEC diagnosis, epidemiologic study and vaccine development.
Lyon, Elaine; Laver, Thomas; Yu, Ping; Jama, Mohamed; Young, Keith; Zoccoli, Michael; Marlowe, Natalia
2010-01-01
Population screening has been proposed for Fragile X syndrome to identify premutation carrier females and affected newborns. We developed a PCR-based assay capable of quickly detecting the presence or absence of an expanded FMR1 allele with high sensitivity and specificity. This assay combines a triplet repeat primed PCR with high-throughput automated capillary electrophoresis. We evaluated assay performance using archived samples sent for Fragile X diagnostic testing representing a range of Fragile X CGG-repeat expansions. Two hundred five previously genotyped samples were tested with the new assay. Data were analyzed for the presence of a trinucleotide “ladder” extending beyond 55 repeats, which was set as a cut-off to identify expanded FMR1 alleles. We identified expanded FMR1 alleles in 132 samples (59 premutation, 71 full mutation, 2 mosaics) and normal FMR1 alleles in 73 samples. We found 100% concordance with previous results from PCR and Southern blot analyses. In addition, we show feasibility of using this assay with DNA extracted from dried-blood spots. Using a single PCR combined with high-throughput fragment analysis on the automated capillary electrophoresis instrument, we developed a rapid and reproducible PCR-based laboratory assay that meets many of the requirements for a first-tier test for population screening. PMID:20431035
Takei, Hiraku; Morishita, Soji; Araki, Marito; Edahiro, Yoko; Sunami, Yoshitaka; Hironaka, Yumi; Noda, Naohiro; Sekiguchi, Yuji; Tsuneda, Satoshi; Ohsaka, Akimichi; Komatsu, Norio
2014-01-01
A gain-of-function mutation in the myeloproliferative leukemia virus (MPL) gene, which encodes the thrombopoietin receptor, has been identified in patients with essential thrombocythemia and primary myelofibrosis, subgroups of classic myeloproliferative neoplasms (MPNs). The presence of MPL gene mutations is a critical diagnostic criterion for these diseases. Here, we developed a rapid, simple, and cost-effective method of detecting two major MPL mutations, MPLW515L/K, in a single PCR assay; we termed this method DARMS (dual amplification refractory mutation system)-PCR. DARMS-PCR is designed to produce three different PCR products corresponding to MPLW515L, MPLW515K, and all MPL alleles. The amplicons are later detected and quantified using a capillary sequencer to determine the relative frequencies of the mutant and wild-type alleles. Applying DARMS-PCR to human specimens, we successfully identified MPL mutations in MPN patients, with the exception of patients bearing mutant allele frequencies below the detection limit (5%) of this method. The MPL mutant allele frequencies determined using DARMS-PCR correlated strongly with the values determined using deep sequencing. Thus, we demonstrated the potential of DARMS-PCR to detect MPL mutations and determine the allele frequencies in a timely and cost-effective manner.
Directory of Open Access Journals (Sweden)
Hiraku Takei
Full Text Available A gain-of-function mutation in the myeloproliferative leukemia virus (MPL gene, which encodes the thrombopoietin receptor, has been identified in patients with essential thrombocythemia and primary myelofibrosis, subgroups of classic myeloproliferative neoplasms (MPNs. The presence of MPL gene mutations is a critical diagnostic criterion for these diseases. Here, we developed a rapid, simple, and cost-effective method of detecting two major MPL mutations, MPLW515L/K, in a single PCR assay; we termed this method DARMS (dual amplification refractory mutation system-PCR. DARMS-PCR is designed to produce three different PCR products corresponding to MPLW515L, MPLW515K, and all MPL alleles. The amplicons are later detected and quantified using a capillary sequencer to determine the relative frequencies of the mutant and wild-type alleles. Applying DARMS-PCR to human specimens, we successfully identified MPL mutations in MPN patients, with the exception of patients bearing mutant allele frequencies below the detection limit (5% of this method. The MPL mutant allele frequencies determined using DARMS-PCR correlated strongly with the values determined using deep sequencing. Thus, we demonstrated the potential of DARMS-PCR to detect MPL mutations and determine the allele frequencies in a timely and cost-effective manner.
Delimiting Allelic Imbalance of TYMS by Allele-Specific Analysis.
Balboa-Beltrán, Emilia; Cruz, Raquel; Carracedo, Angel; Barros, Francisco
2015-07-01
Allelic imbalance of thymidylate synthase (TYMS) is attributed to polymorphisms in the 5'- and 3'-untranslated region (UTR). These polymorphisms have been related to the risk of suffering different cancers, for example leukemia, breast or gastric cancer, and response to different drugs, among which are methotrexate glutamates, stavudine, and specifically 5-fluorouracil (5-FU), as TYMS is its direct target. A vast literature has been published in relation to 5-FU, even suggesting the sole use of these polymorphisms to effectively manage 5-FU dosage. Estimates of the extent to which these polymorphisms influence in TYMS expression have in the past been based on functional analysis by luciferase assays and quantification of TYMS mRNA, but both these studies, as the association studies with cancer risk or with toxicity or response to 5-FU, are very contradictory. Regarding functional assays, the artificial genetic environment created in luciferase assay and the problems derived from quantitative polymerase chain reactions (qPCRs), for example the use of a reference gene, may have distorted the results. To avoid these sources of interference, we have analyzed the allelic imbalance of TYMS by allelic-specific analysis in peripheral blood mononuclear cells (PBMCs) from patients.Allelic imbalance in PBMCs, taken from 40 patients with suspected myeloproliferative haematological diseases, was determined by fluorescent fragment analysis (for the 3'-UTR polymorphism), Sanger sequencing and allelic-specific qPCR in multiplex (for the 5'-UTR polymorphisms).For neither the 3'- nor the 5'-UTR polymorphisms did the observed allelic imbalance exceed 1.5 fold. None of the TYMS polymorphisms is statistically associated with allelic imbalance.The results acquired allow us to deny the previously established assertion of an influence of 2 to 4 fold of the rs45445694 and rs2853542 polymorphisms in the expression of TYMS and narrow its allelic imbalance to 1.5 fold, in our population
Allele-Specific DNA Methylation Detection by Pyrosequencing®
DEFF Research Database (Denmark)
Kristensen, Lasse Sommer; Johansen, Jens Vilstrup; Grønbæk, Kirsten
2015-01-01
DNA methylation is an epigenetic modification that plays important roles in healthy as well as diseased cells, by influencing the transcription of genes. In spite the fact that human somatic cells are diploid, most of the currently available methods for the study of DNA methylation do not provide......-effective protocol for allele-specific DNA methylation detection based on Pyrosequencing(®) of methylation-specific PCR (MSP) products including a single nucleotide polymorphism (SNP) within the amplicon....
Woo, Hye In; Joo, Eun Yeon; Lee, Kyung Wha
2012-01-01
Background Narcolepsy is a neurologic disorder characterized by excessive daytime sleepiness, symptoms of abnormal rapid eye movement (REM) sleep, and a strong association with HLA-DRB1*1501, -DQA1*0102, and -DQB1*0602. Here, we investigated the clinico-physical characteristics of Korean patients with narcolepsy, their HLA types, and the clinical utility of high-resolution PCR with sequence-specific primers (PCR-SSP) as a simple typing method for identifying DRB1*15/16, DQA1, and DQB1 alleles. Methods The study population consisted of 67 consecutively enrolled patients having unexplained daytime sleepiness and diagnosed narcolepsy based on clinical and neurological findings. Clinical data and the results of the multiple sleep latency test and polysomnography were reviewed, and HLA typing was performed using both high-resolution PCR-SSP and sequence-based typing (SBT). Results The 44 narcolepsy patients with cataplexy displayed significantly higher frequencies of DRB1*1501 (Pc= 0.003), DQA1*0102 (Pc=0.001), and DQB1*0602 (Pc=0.014) than the patients without cataplexy. Among patients carrying DRB1*1501-DQB1*0602 or DQA1*0102, the frequencies of a mean REM sleep latency of less than 20 min in nocturnal polysomnography and clinical findings, including sleep paralysis and hypnagogic hallucination were significantly higher. SBT and PCR-SSP showed 100% concordance for high-resolution typing of DRB1*15/16 alleles and DQA1 and DQB1 loci. Conclusions The clinical characteristics and somnographic findings of narcolepsy patients were associated with specific HLA alleles, including DRB1*1501, DQA1*0102, and DQB1*0602. Application of high-resolution PCR-SSP, a reliable and simple method, for both allele- and locus-specific HLA typing of DRB1*15/16, DQA1, and DQB1 would be useful for characterizing clinical status among subjects with narcolepsy. PMID:22259780
Directory of Open Access Journals (Sweden)
Yongbin Zeng
Full Text Available BACKGROUND: Long-term use of nucleos(tide analogues can increase risk of HBV drug-resistance mutations. The rtM204I (ATT coding for isoleucine is one of the most important resistance mutation sites. Establishing a simple, rapid, reliable and highly sensitive assay to detect the resistant mutants as early as possible is of great clinical significance. METHODS: Recombinant plasmids for HBV YMDD (tyrosine-methionine-aspartate-aspartate and YIDD (tyrosine-isoleucine-aspartate-aspartate were constructed by TA cloning. Real time allele specific locked nucleic acid quantitative PCR (RT-AS-LNA-qPCR with SYBR Green I was established by LNA-modified primers and evaluated with standard recombinant plasmids, clinical templates (the clinical wild type and mutant HBV DNA mixture and 102 serum samples from nucleos(tide analogues-experienced patients. The serum samples from a chronic hepatitis B (CHB patient firstly received LMV mono therapy and then switched to LMV + ADV combined therapy were also dynamically analyzed for 10 times. RESULTS: The linear range of the assay was between 1×10(9 copies/μl and 1 × 10(2 copies/μl. The low detection limit was 1 × 10(1 copies/μl. Sensitivity of the assay were 10(-6, 10(-4 and 10(-2 in the wild-type background of 1 × 10(9 copies/μl, 1 × 10(7 copies/μl and 1 × 10(5 copies/μl, respectively. The sensitivity of the assay in detection of clinical samples was 0.03%. The complete coincidence rate between RT-AS-LNA-qPCR and direct sequencing was 91.2% (93/102, partial coincidence rate was 8.8% (9/102, and no complete discordance was observed. The two assays showed a high concordance (Kappa = 0.676, P = 0.000. Minor variants can be detected 18 weeks earlier than the rebound of HBV DNA load and alanine aminotransferase level. CONCLUSIONS: A rapid, cost-effective, high sensitive, specific and reliable method of RT-AS-LNA-qPCR with SYBR Green I for early and absolute quantification of HBV YIDD (ATT coding for isoleucine
Directory of Open Access Journals (Sweden)
Dong Chen
Full Text Available Genotyping of thiopurine S-methyltransferase (TPMT is recommended for predicting the adverse drug response of thiopurines. In the current study, a novel version of allele-specific PCR (AS-PCR, termed competitive real-time fluorescent AS-PCR (CRAS-PCR was developed to analyze the TPMT*2 genotype in ethnic Chinese. This technique simultaneously uses wild-type and mutant allele-specific scorpion primers in a single reaction. To determine the optimal conditions for both traditional AS-PCR and CRAS-PCR, we used the Taguchi method, an engineering optimization process that balances the concentrations of all components using an orthogonal array rather than a factorial array. Instead of running up to 264 experiments with the conventional factorial method, the Taguchi method achieved the same optimization using only 16 experiments. The optimized CRAS-PCR system completely avoided non-specific amplification occurring in traditional AS-PCR and could be performed at much more relaxed reaction conditions at 1% sensitivity, similar to traditional AS-PCR. TPMT*2 genotyping of 240 clinical samples was consistent with published data. In conclusion, CRAS-PCR is a novel and robust genotyping method, and the Taguchi method is an effective tool for the optimization of molecular analysis techniques.
Svitek, N; Nzau, B; Steinaa, L; Nene, V
2015-04-01
We have developed a polymerase chain reaction-sequence-specific primers-restriction fragment length polymorphism (PCR-SSP-RFLP) method to rapidly differentiate between the A18 and A18 variant (v) BoLA haplotypes and between A14 and A15/A15v BoLA haplotypes in Holstein/Friesian cattle. We used published SSP to PCR amplify BoLA alleles expressed in animals of known haplotype and exposed the amplicons to the restriction enzyme PvuII that was predicted to cut at a unique site in the middle of BoLA-6*01302 (A18v) and BoLA-1*00901 (A15) but not in BoLA-6*01301 (A18) or BoLA-1*02301 (A14) alleles. Whereas the method does not discriminate between the A15 and A15v haplotypes, as the BoLA-1*00902 allele associated with A15v also contains a PvuII site, we are interested in cattle of A18 and A14 haplotype for vaccine related studies. Our results also indicated that the BoLA-6*01302 (A18v) allele is much more abundant than BoLA-6*01301 (A18) in the cattle that we sampled. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Human minisatellite alleles detectable only after PCR amplification.
Armour, J A; Crosier, M; Jeffreys, A J
1992-01-01
We present evidence that a proportion of alleles at two human minisatellite loci is undetected by standard Southern blot hybridization. In each case the missing allele(s) can be identified after PCR amplification and correspond to tandem arrays too short to detect by hybridization. At one locus, there is only one undetected allele (population frequency 0.3), which contains just three repeat units. At the second locus, there are at least five undetected alleles (total population frequency 0.9) containing 60-120 repeats; they are not detected because these tandem repeats give very poor signals when used as a probe in standard Southern blot hybridization, and also cross-hybridize with other sequences in the genome. Under these circumstances only signals from the longest tandemly repeated alleles are detectable above the nonspecific background. The structures of these loci have been compared in human and primate DNA, and at one locus the short human allele containing three repeat units is shown to be an intermediate state in the expansion of a monomeric precursor allele in primates to high copy number in the longer human arrays. We discuss the implications of such loci for studies of human populations, minisatellite isolation by cloning, and the evolution of highly variable tandem arrays.
IDENTIFIKASI TIPE HLA KELAS II DENGAN TEKNIK PCR
Directory of Open Access Journals (Sweden)
Ervi Salwati
2012-09-01
Full Text Available HLA (Human Leukocyte Antigen contains a set of genes located together on the short arm of chromosome 6. These genes control immune responses, graft acceptance or rejection and tumor surveillance. These abilities have close relationship with genetic variation (occur in "many forms" or alleles that bind and present antigens to T lymphocytes. Using advanced technology and molecular biology approaches (PCR technique detection of genetic variation in the HLA region (or HLA typing has been performed based on DNA.. PCR is an in vitro technique to amplify the DNA sequence enzymatically. "Sequence Specific Primers" (SSP are designed for this PCR to obtain amplification of specific alleles or groups of alleles. The PCR products are visualized through agarose gel electrophoresis stained with ethidium bromide. The PCR technique requires small amount of whole blood (0.5 - 1 ml, gives rapid, accurate and complete result. This paper discuss identification of HLA class II typing using PCR-SSP technique and show the examples of the results. Key words: HLA (Human Leukocyte Antigen class II, PCR (Polymerase Chain Reaction
Czech Academy of Sciences Publication Activity Database
Muneta, Y.; Minagawa, Y.; Kusumoto, M.; Shinkai, H.; Uenishi, H.; Šplíchal, Igor
2012-01-01
Roč. 74, č. 5 (2012), s. 553-559 ISSN 0916-7250 R&D Projects: GA ČR GA524/09/0365 Institutional support: RVO:61388971 Keywords : allele-specific PCR * Mycoplasma hyopneumoniae * single nucleotide polymorphism Subject RIV: EC - Immunology Impact factor: 0.876, year: 2012
Directory of Open Access Journals (Sweden)
Ito Takashi
2011-06-01
Full Text Available Abstract Background We previously developed a simple method termed HpaII-McrBC PCR (HM-PCR to discriminate allelic methylation status of the genomic sites of interest, and successfully applied it to a comprehensive analysis of CpG islands (CGIs on human chromosome 21q. However, HM-PCR requires 200 ng of genomic DNA to examine one target site, thereby precluding its application to such samples that are limited in quantity. Findings We developed HpaII-McrBC whole-genome-amplification PCR (HM-WGA-PCR that uses whole-genome-amplified DNA as the template. HM-WGA-PCR uses only 1/100th the genomic template material required for HM-PCR. Indeed, we successfully analyzed 147 CGIs by HM-WGA-PCR using only ~300 ng of DNA, whereas previous HM-PCR study had required ~30 μg. Furthermore, we confirmed that allelic methylation status revealed by HM-WGA-PCR is identical to that by HM-PCR in every case of the 147 CGIs tested, proving high consistency between the two methods. Conclusions HM-WGA-PCR would serve as a reliable alternative to HM-PCR in the analysis of allelic methylation status when the quantity of DNA available is limited.
Shibuta, K; Abe, M; Suzuki, T
1994-01-01
The K variant of human butyrylcholinesterase is caused by a G/A transition in the butyrylcholinesterase gene, which neither creates nor destroys any restriction site. In an attempt to detect the K variant both simply and rapidly, we developed a two step method of "PCR primer introduced restriction analysis" (PCR-PIRA). The first step was used to introduce a new Fun4HI site into the normal allele for a screening test, while the second step was performed to create a new MaeIII site on the variant allele for a specific test. This method thus enabled us to distinguish clearly the K variant from the normal allele, and also showed that the frequency of the K variant allele is 0.164 in the Japanese population. Images PMID:7966197
Allele Workbench: transcriptome pipeline and interactive graphics for allele-specific expression.
Directory of Open Access Journals (Sweden)
Carol A Soderlund
Full Text Available Sequencing the transcriptome can answer various questions such as determining the transcripts expressed in a given species for a specific tissue or condition, evaluating differential expression, discovering variants, and evaluating allele-specific expression. Differential expression evaluates the expression differences between different strains, tissues, and conditions. Allele-specific expression evaluates expression differences between parental alleles. Both differential expression and allele-specific expression have been studied for heterosis (hybrid vigor, where the hybrid has improved performance over the parents for one or more traits. The Allele Workbench software was developed for a heterosis study that evaluated allele-specific expression for a mouse F1 hybrid using libraries from multiple tissues with biological replicates. This software has been made into a distributable package, which includes a pipeline, a Java interface to build the database, and a Java interface for query and display of the results. The required input is a reference genome, annotation file, and one or more RNA-Seq libraries with optional replicates. It evaluates allelic imbalance at the SNP and transcript level and flags transcripts with significant opposite directional allele-specific expression. The Java interface allows the user to view data from libraries, replicates, genes, transcripts, exons, and variants, including queries on allele imbalance for selected libraries. To determine the impact of allele-specific SNPs on protein folding, variants are annotated with their effect (e.g., missense, and the parental protein sequences may be exported for protein folding analysis. The Allele Workbench processing results in transcript files and read counts that can be used as input to the previously published Transcriptome Computational Workbench, which has a new algorithm for determining a trimmed set of gene ontology terms. The software with demo files is available
[Application of rapid PCR to authenticate medicinal snakes].
Chen, Kang; Jiang, Chao; Yuan, Yuan; Huang, Lu-Qi; Li, Man
2014-10-01
To obtained an accurate, rapid and efficient method for authenticate medicinal snakes listed in Chinese Pharmacopoeia (Zaocysd humnades, Bungarus multicinctus, Agkistrodon acutus), a rapid PCR method for authenticate snakes and its adulterants was established based on the classic molecular authentication methods. DNA was extracted by alkaline lysis and the specific primers were amplified by two-steps PCR amplification method. The denatured and annealing temperature and cycle numbers were optimized. When 100 x SYBR Green I was added in the PCR product, strong green fluorescence was visualized under 365 nm UV whereas adulterants without. The whole process can complete in 30-45 minutes. The established method provides the technical support for authentication of the snakes on field.
Rapid diagnostic tests as a source of DNA for Plasmodium species-specific real-time PCR
Directory of Open Access Journals (Sweden)
Van Esbroeck Marjan
2011-03-01
Full Text Available Abstract Background This study describes the use of malaria rapid diagnostic tests (RDTs as a source of DNA for Plasmodium species-specific real-time PCR. Methods First, the best method to recover DNA from RDTs was investigated and then the applicability of this DNA extraction method was assessed on 12 different RDT brands. Finally, two RDT brands (OptiMAL Rapid Malaria Test and SDFK60 malaria Ag Plasmodium falciparum/Pan test were comprehensively evaluated on a panel of clinical samples submitted for routine malaria diagnosis at ITM. DNA amplification was done with the 18S rRNA real-time PCR targeting the four Plasmodium species. Results of PCR on RDT were compared to those obtained by PCR on whole blood samples. Results Best results were obtained by isolating DNA from the proximal part of the nitrocellulose component of the RDT strip with a simple DNA elution method. The PCR on RDT showed a detection limit of 0.02 asexual parasites/μl, which was identical to the same PCR on whole blood. For all 12 RDT brands tested, DNA was detected except for one brand when a low parasite density sample was applied. In RDTs with a plastic seal covering the nitrocellulose strip, DNA extraction was hampered. PCR analysis on clinical RDT samples demonstrated correct identification for single species infections for all RDT samples with asexual parasites of P. falciparum (n = 60, Plasmodium vivax (n = 10, Plasmodium ovale (n = 10 and Plasmodium malariae (n = 10. Samples with only gametocytes were detected in all OptiMAL and in 10 of the 11 SDFK60 tests. None of the negative samples (n = 20 gave a signal by PCR on RDT. With PCR on RDT, higher Ct-values were observed than with PCR on whole blood, with a mean difference of 2.68 for OptiMAL and 3.53 for SDFK60. Mixed infections were correctly identified with PCR on RDT in 4/5 OptiMAL tests and 2/5 SDFK60 tests. Conclusions RDTs are a reliable source of DNA for Plasmodium real-time PCR. This study demonstrates the
Directory of Open Access Journals (Sweden)
Trognitz Friederike
2007-02-01
Full Text Available Abstract Background The diploid, Solanum caripense, a wild relative of potato and tomato, possesses valuable resistance to potato late blight and we are interested in the genetic base of this resistance. Due to extremely low levels of genetic variation within the S. caripense genome it proved impossible to generate a dense genetic map and to assign individual Solanum chromosomes through the use of conventional chromosome-specific SSR, RFLP, AFLP, as well as gene- or locus-specific markers. The ease of detection of DNA polymorphisms depends on both frequency and form of sequence variation. The narrow genetic background of close relatives and inbreds complicates the detection of persisting, reduced polymorphism and is a challenge to the development of reliable molecular markers. Nonetheless, monomorphic DNA fragments representing not directly usable conventional markers can contain considerable variation at the level of single nucleotide polymorphisms (SNPs. This can be used for the design of allele-specific molecular markers. The reproducible detection of allele-specific markers based on SNPs has been a technical challenge. Results We present a fast and cost-effective protocol for the detection of allele-specific SNPs by applying Sequence Polymorphism-Derived (SPD markers. These markers proved highly efficient for fingerprinting of individuals possessing a homogeneous genetic background. SPD markers are obtained from within non-informative, conventional molecular marker fragments that are screened for SNPs to design allele-specific PCR primers. The method makes use of primers containing a single, 3'-terminal Locked Nucleic Acid (LNA base. We demonstrate the applicability of the technique by successful genetic mapping of allele-specific SNP markers derived from monomorphic Conserved Ortholog Set II (COSII markers mapped to Solanum chromosomes, in S. caripense. By using SPD markers it was possible for the first time to map the S. caripense alleles
Analysis of ELA-DQB exon 2 polymorphism in Argentine Creole horses by PCR-RFLP and PCR-SSCP.
Villegas-Castagnasso, E E; Díaz, S; Giovambattista, G; Dulout, F N; Peral-García, P
2003-08-01
The second exon of equine leucocyte antigen (ELA)-DQB genes was amplified from genomic DNA of 32 Argentine Creole horses by PCR. Amplified DNA was analysed by PCR-restriction fragment length polymorphism (RFLP) and PCR-single-strand conformation polymorphism (SSCP). The PCR-RFLP analysis revealed two HaeIII patterns, four RsaI patterns, five MspI patterns and two HinfI patterns. EcoRI showed no variation in the analysed sample. Additional patterns that did not account for known exon 2 DNA sequences were observed, suggesting the existence of novel ELA-DQB alleles. PCR-SSCP analysis exhibited seven different band patterns, and the number of bands per animal ranged from four to nine. Both methods indicated that at least two DQB genes are present. The presence of more than two alleles in each animal showed that the primers employed in this work are not specific for a unique DQB locus. The improvement of this PCR-RFLP method should provide a simple and rapid technique for an accurate definition of ELA-DQB typing in horses.
High-specificity detection of rare alleles with Paired-End Low Error Sequencing (PELE-Seq).
Preston, Jessica L; Royall, Ariel E; Randel, Melissa A; Sikkink, Kristin L; Phillips, Patrick C; Johnson, Eric A
2016-06-14
Polymorphic loci exist throughout the genomes of a population and provide the raw genetic material needed for a species to adapt to changes in the environment. The minor allele frequencies of rare Single Nucleotide Polymorphisms (SNPs) within a population have been difficult to track with Next-Generation Sequencing (NGS), due to the high error rate of standard methods such as Illumina sequencing. We have developed a wet-lab protocol and variant-calling method that identifies both sequencing and PCR errors, called Paired-End Low Error Sequencing (PELE-Seq). To test the specificity and sensitivity of the PELE-Seq method, we sequenced control E. coli DNA libraries containing known rare alleles present at frequencies ranging from 0.2-0.4 % of the total reads. PELE-Seq had higher specificity and sensitivity than standard libraries. We then used PELE-Seq to characterize rare alleles in a Caenorhabditis remanei nematode worm population before and after laboratory adaptation, and found that minor and rare alleles can undergo large changes in frequency during lab-adaptation. We have developed a method of rare allele detection that mitigates both sequencing and PCR errors, called PELE-Seq. PELE-Seq was evaluated using control E. coli populations and was then used to compare a wild C. remanei population to a lab-adapted population. The PELE-Seq method is ideal for investigating the dynamics of rare alleles in a broad range of reduced-representation sequencing methods, including targeted amplicon sequencing, RAD-Seq, ddRAD, and GBS. PELE-Seq is also well-suited for whole genome sequencing of mitochondria and viruses, and for high-throughput rare mutation screens.
Rapid identification of capybara (Hydrochaeris hydrochaeris through allele-specific PCR
Directory of Open Access Journals (Sweden)
Flávio Henrique-Silva
2005-07-01
Full Text Available The capybara is the largest rodent in the world and is widely distributed throughout Central and South America. It is an animal of economic interest due to the pleasant flavor of its meat and higher protein content in comparison to beef and pork meat. The hide, hair and fat also have economic advantages. Thus, as an animal with such high economic potential, it is the target of hunters, even though hunting capybara is prohibited by law in Brazil. Due to their similarities, capybara meat is easily confused with pork meat. This occurs upon the apprehension of the meat from hunters, as well as in some restaurants that serve capybara meat that was slaughtered clandestinely. In both cases, when the meat is confiscated, those responsible for the crimes claim it is pork meat, hindering the enforcement of the law. A practical course was ministered to undergraduate biology students enrolled in the elective course Introduction to Genetic Engineering at Federal University of Sao Carlos (UFSCar, Sao Paulo State, Brazil. The objective of the course was to establish and apply a Polymerase Chain Reaction (PCR assay to identify capybara meat and discriminate it in relation to other types of meat, including pork. Primers were designed based on 12S rRNA, transthyretin and growth hormone receptor genes. The primers generated capybara specific fragments of approximately 220, 290 and 330 bp for transthyretin,12S rRNA and growth hormone receptor, respectively. The duplexes developed in the present work can be used effectively to discriminate capybara meat from other animals, contributing to combating predatory capybara hunting. The results were extensively discussed and the students have contributed to written a paper to be submitted to a publication.
Drop-out probabilities of IrisPlex SNP alleles
DEFF Research Database (Denmark)
Andersen, Jeppe Dyrberg; Tvedebrink, Torben; Mogensen, Helle Smidt
2013-01-01
In certain crime cases, information about a perpetrator's phenotype, including eye colour, may be a valuable tool if no DNA profile of any suspect or individual in the DNA database matches the DNA profile found at the crime scene. Often, the available DNA material is sparse and allelic drop-out...... of true alleles is possible. As part of the validation of the IrisPlex assay in our ISO17025 accredited, forensic genetic laboratory, we estimated the probability of drop-out of specific SNP alleles using 29 and 30 PCR cycles and 25, 50 and 100 Single Base Extension (SBE) cycles. We observed no drop-out...... when the amount of DNA was greater than 125 pg for 29 cycles of PCR and greater than 62 pg for 30 cycles of PCR. With the use of a logistic regression model, we estimated the allele specific probability of drop-out in heterozygote systems based on the signal strength of the observed allele...
SASqPCR: robust and rapid analysis of RT-qPCR data in SAS.
Directory of Open Access Journals (Sweden)
Daijun Ling
Full Text Available Reverse transcription quantitative real-time PCR (RT-qPCR is a key method for measurement of relative gene expression. Analysis of RT-qPCR data requires many iterative computations for data normalization and analytical optimization. Currently no computer program for RT-qPCR data analysis is suitable for analytical optimization and user-controllable customization based on data quality, experimental design as well as specific research aims. Here I introduce an all-in-one computer program, SASqPCR, for robust and rapid analysis of RT-qPCR data in SAS. This program has multiple macros for assessment of PCR efficiencies, validation of reference genes, optimization of data normalizers, normalization of confounding variations across samples, and statistical comparison of target gene expression in parallel samples. Users can simply change the macro variables to test various analytical strategies, optimize results and customize the analytical processes. In addition, it is highly automatic and functionally extendable. Thus users are the actual decision-makers controlling RT-qPCR data analyses. SASqPCR and its tutorial are freely available at http://code.google.com/p/sasqpcr/downloads/list.
Rapid identification of HPV 16 and 18 by multiplex nested PCR-immunochromatographic test.
Kuo, Yung-Bin; Li, Yi-Shuan; Chan, Err-Cheng
2015-02-01
Human papillomavirus (HPV) types 16 and 18 are known to be high-risk viruses that cause cervical cancer. An HPV rapid testing kit that could help physicians to make early and more informed decisions regarding patient care is needed urgently but not yet available. This study aimed to develop a multiplex nested polymerase chain reaction-immunochromatographic test (PCR-ICT) for the rapid identification of HPV 16 and 18. A multiplex nested PCR was constructed to amplify the HPV 16 and 18 genotype-specific L1 gene fragments and followed by ICT which coated with antibodies to identify rapidly the different PCR products. The type-specific gene regions of high-risk HPV 16 and 18 could be amplified successfully by multiplex nested PCR at molecular sizes of approximately 99 and 101bp, respectively. The capture antibodies raised specifically against the moleculars labeled on the PCR products could be detected simultaneously both HPV 16 and 18 in one strip. Under optimal conditions, this PCR-ICT assay had the capability to detect HPV in a sample with as low as 100 copies of HPV viral DNA. The PCR-ICT system has the advantage of direct and simultaneous detection of two high-risk HPV 16 and 18 DNA targets in one sample, which suggested a significant potential of this assay for clinical application. Copyright © 2014. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Sirirat Seekhuntod
Full Text Available Patients with KRAS mutations do not respond to epidermal growth factor receptor (EGFR inhibitors and fail to benefit from adjuvant chemotherapy. Mutation analysis of KRAS is needed before starting treatment with monoclonal anti-EGFR antibodies in patients with metastatic colorectal cancer (mCRC. The objective of this study is to develop a multiplex allele-specific PCR (MAS-PCR assay to detect KRAS mutations.We developed a single-tube MAS-PCR assay for the detection of seven KRAS mutations (G12D, G12A, G12R, G12C, G12S, G12V, and G13D. We performed MAS-PCR assay analysis for KRAS on DNA isolated from 270 formalin-fixed paraffin-embedded (FFPE colorectal cancer tissues. Sequences of all 270 samples were determined by pyrosequencing. Seven known point-mutation DNA samples diluted with wild-type DNA were assayed to determine the limitation of detection and reproducibility of the MAS-PCR assay.Overall, the results of MAS-PCR assay were in good concordance with pyrosequencing, and only seven discordant samples were found. The MAS-PCR assay reproducibly detected 1 to 2% mutant alleles. The most common mutations were G13D in codon 13 (49.17%, G12D (25.83% and G12V (12.50% in codon 12.The MAS-PCR assay provides a rapid, cost-effective, and reliable diagnostic tool for accurate detection of KRAS mutations in routine FFPE colorectal cancer tissues.
Directory of Open Access Journals (Sweden)
Vlatka Cubric-Curik
2002-01-01
Full Text Available The objective of this study was to develop a DNA test for rapid characterisation of goat κ-casein (κ-CN A and B variants and to study this polymorphism in Italian goat breeds. Genetic polymorphism of κ-CN gene was, in addition to isoelectric focusing, analysed according to a new technique designated as amplification created restriction site. Two alleles that differ in one nucleotide mutation (G Ø A in exon 4 were characterised. The 167-bp PCR product surrounding the nucleotide mutation was amplified from genomic DNA and the PCR product was digested with MaeIII. After digestion the A allele gives three fragments of 77, 65 and 25 bp in comparison with the B allele which gives two fragments of 90 and 77 bp. The analysis of allele frequency distribution at κ-CN locus, based on 401 individual samples, revealed significant differences among three goat breeds from the north of Italy (Nera di Verzasca, Frontalasca and Alpine with frequency of κ-CN B allele around 0.3, versus two goat breeds from the south of Italy (Maltese and Sarda with frequency of κ-CN B allele around 0.5. While two goat breeds (Maltese and Nera di Verzasca did not show significant deviations from the Hardy-Weinberg equilibrium, a highly significant excess of heterozygote genotype (AB was observed in Alpine, Frontalasca and Sarda goats. Here the developed DNA method and observed relatively high frequency of κ-CN B allele give a prerequisite for the assessment of research related to the simultaneous estimation of the effects of composite αs1/κ-CN genotypes on milk production and cheese-making properties.
Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.
Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing
2018-02-01
The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.
DEFF Research Database (Denmark)
Weber, Britta; Meldgaard, Peter; Hager, Henrik
2014-01-01
samples with allele-specific PCR assays. METHODS: Pairs of the diagnostic biopsy and plasma obtained just prior to start of erlotinib treatment were collected from 199 patients with adenocarcinoma of non-small-cell lung cancer. DNA from both sample types was isolated and examined for the presence...... of mutations in exons 18-21 of the EGFR gene, employing the cobas(®) EGFR Tissue Test and cobas(®) EGFR Blood Test (in development, Roche Molecular Systems, Inc., CA, USA). RESULTS: Test results were obtained in all 199 (100%) plasma samples and 196/199 (98%) of the biopsies. EGFR-activating mutations were...... identified in 24/199 (12%) plasma samples and 28/196 (14%) biopsy samples, and 17/196 (9%) matched pairs contained the same mutation. Six EGFR mutations were present only in plasma samples but not in the biopsy samples. The overall concordance of the EGFR gene mutations detected in plasma and biopsy tissue...
Rapid detection of Pseudomonas aeruginosa from positive blood cultures by quantitative PCR
Directory of Open Access Journals (Sweden)
Cattoir Vincent
2010-08-01
Full Text Available Abstract Background Pseudomonas aeruginosa is responsible for numerous bloodstream infections associated with severe adverse outcomes in case of inappropriate initial antimicrobial therapy. The present study was aimed to develop a novel quantitative PCR (qPCR assay, using ecfX as the specific target gene, for the rapid and accurate identification of P. aeruginosa from positive blood cultures (BCs. Methods Over the period August 2008 to June 2009, 100 BC bottles positive for gram-negative bacilli were tested in order to evaluate performances of the qPCR technique with conventional methods as gold standard (i.e. culture and phenotypic identification. Results Thirty-three strains of P. aeruginosa, 53 strains of Enterobactericaeae, nine strains of Stenotrophomonas maltophilia and two other gram-negative species were isolated while 3 BCs were polymicrobial including one mixture containing P. aeruginosa. All P. aeruginosa clinical isolates were detected by qPCR except a single strain in mixed culture. Performances of the qPCR technique were: specificity, 100%; positive predictive value, 100%; negative predictive value, 98.5%; and sensitivity, 97%. Conclusions This reliable technique may offer a rapid (
Pure chromosome-specific PCR libraries from single sorted chromosomes
VanDevanter, D. R.; Choongkittaworn, N. M.; Dyer, K. A.; Aten, J. A.; Otto, P.; Behler, C.; Bryant, E. M.; Rabinovitch, P. S.
1994-01-01
Chromosome-specific DNA libraries can be very useful in molecular and cytogenetic genome mapping studies. We have developed a rapid and simple method for the generation of chromosome-specific DNA sequences that relies on polymerase chain reaction (PCR) amplification of a single flow-sorted
Allele specific expression and methylation in the bumblebee, Bombus terrestris
Directory of Open Access Journals (Sweden)
Zoë Lonsdale
2017-09-01
Full Text Available The social hymenoptera are emerging as models for epigenetics. DNA methylation, the addition of a methyl group, is a common epigenetic marker. In mammals and flowering plants methylation affects allele specific expression. There is contradictory evidence for the role of methylation on allele specific expression in social insects. The aim of this paper is to investigate allele specific expression and monoallelic methylation in the bumblebee, Bombus terrestris. We found nineteen genes that were both monoallelically methylated and monoallelically expressed in a single bee. Fourteen of these genes express the hypermethylated allele, while the other five express the hypomethylated allele. We also searched for allele specific expression in twenty-nine published RNA-seq libraries. We found 555 loci with allele-specific expression. We discuss our results with reference to the functional role of methylation in gene expression in insects and in the as yet unquantified role of genetic cis effects in insect allele specific methylation and expression.
Directory of Open Access Journals (Sweden)
Xingmei Xie
Full Text Available Sex chromosome aneuploidies occur commonly in the general population, with an incidence of 1 in 400 newborns. However, no tests specifically targeting sex chromosomes have been carried out in prenatal diagnosis or newborn screening, resulting in late recognition of these diseases. In this study, a rapid diagnostic method for sex chromosome aneuploidies was established using Quantitative Fluorescent-PCR (QF-PCR. Ten markers were included in one multiplex QF-PCR assay, including two sex determination genes (AMXY and SRY, five X-linked short tandem repeats (STRs; DXS1053, DXS981, DXS6809, DXS1187, and DXS8377, one X/Y-common STR (X22, and two autosomal STRs (D13S305 and D21S11. Retrospective tests of 70 cases with known cytogenetic results indicated that the 10-plex QF-PCR assay could well determine sex chromosome copy numbers by both allelic peak numbers and a sex chromosome dosage calculation with the autosomal STRs as internal controls. Prospective comparison with cytogenetic karyotyping on 534 cases confirmed that the 10-plex QF-PCR assay could be well employed for sex chromosome aneuploidy diagnosis in at least the Chinese Han population. This is the first QF-PCR test for the diagnosis of sex chromosome aneuploidies in the Chinese population. This test is superior to previous designs by including up to 8 sex-linked markers covering different parts of sex chromosomes as well as employing internal controls for copy number dosage calculation in a single PCR reaction. Due to simple technique and data analysis, as well as easy implementation within routine clinical services, this method is of great clinical application value and could be widely applied.
DEFF Research Database (Denmark)
Kaczmarczyk, Agnieszka Ewa; Bowra, Steve; Elek, Zoltan
2012-01-01
expression combined with genetic variation in large multigene families with high homology among the alleles is very challenging. Results We designed a rapid qRT-PCR system with the aim of characterising the variation in the expression of hordein genes families. All the known D-, C-, B-, and gamma......-hordein sequences coding full length open reading frames were collected from commonly available databases. Phylogenetic analysis was performed and the members of the different hordein families were classified into subfamilies. Primer sets were designed to discriminate the gene expression level of whole families...... and its subgroups. More over the results indicate the genotypic specific gene expression. Conclusions Quantitative RT-PCR with SYBR Green labelling can be a useful technique to follow gene expression levels of large gene families with highly homologues members. We showed variation in the temporal...
A duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains.
Benacer, Douadi; Zain, Siti Nursheena Mohd; Lewis, John W; Khalid, Mohd Khairul Nizam Mohd; Thong, Kwai Lin
2017-01-01
This study aimed to develop a duplex endpoint PCR assay for rapid detection and differentiation of Leptospira strains. Primers were designed to target the rrs (LG1/LG2) and ligB (LP1/LP2) genes to confirm the presence of the Leptospira genus and the pathogenic species, respectively. The assay showed 100% specificity against 17 Leptospira strains with a limit of detection of 23.1pg/µl of leptospiral DNA and sensitivity of 103 leptospires/ml in both spiked urine and water. Our duplex endpoint PCR assay is suitable for rapid early detection of Leptospira with high sensitivity and specificity.
Kohyama, Moeko; Tada, Naomi; Mitsui, Hiroko; Tomioka, Hitomi; Tsutsui, Toshihiko; Yabuki, Akira; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Mizukami, Keijiro; Yamato, Osamu
2016-03-01
Canine progressive rod-cone degeneration (PRCD) is a middle- to late-onset, autosomal recessive, inherited retinal disorder caused by a substitution (c.5G>A) in the canine PRCD gene that has been identified in 29 or more purebred dogs. In the present study, a TaqMan probe-based real-time PCR assay was developed and evaluated for rapid genotyping and large-scale screening of the mutation. Furthermore, a genotyping survey was carried out in a population of the three most popular breeds in Japan (Toy Poodles, Chihuahuas and Miniature Dachshunds) to determine the current mutant allele frequency. The assay separated all the genotypes of canine PRCD rapidly, indicating its suitability for large-scale surveys. The results of the survey showed that the mutant allele frequency in Toy Poodles was high enough (approximately 0.09) to allow the establishment of measures for the prevention and control of this disorder in breeding kennels. The mutant allele was detected in Chihuahuas for the first time, but the frequency was lower (approximately 0.02) than that in Toy Poodles. The mutant allele was not detected in Miniature Dachshunds. This assay will allow the selective breeding of dogs from the two most popular breeds (Toy Poodle and Chihuahua) in Japan and effective prevention or control of the disorder.
ALEA: a toolbox for allele-specific epigenomics analysis.
Younesy, Hamid; Möller, Torsten; Heravi-Moussavi, Alireza; Cheng, Jeffrey B; Costello, Joseph F; Lorincz, Matthew C; Karimi, Mohammad M; Jones, Steven J M
2014-04-15
The assessment of expression and epigenomic status using sequencing based methods provides an unprecedented opportunity to identify and correlate allelic differences with epigenomic status. We present ALEA, a computational toolbox for allele-specific epigenomics analysis, which incorporates allelic variation data within existing resources, allowing for the identification of significant associations between epigenetic modifications and specific allelic variants in human and mouse cells. ALEA provides a customizable pipeline of command line tools for allele-specific analysis of next-generation sequencing data (ChIP-seq, RNA-seq, etc.) that takes the raw sequencing data and produces separate allelic tracks ready to be viewed on genome browsers. The pipeline has been validated using human and hybrid mouse ChIP-seq and RNA-seq data. The package, test data and usage instructions are available online at http://www.bcgsc.ca/platform/bioinfo/software/alea CONTACT: : mkarimi1@interchange.ubc.ca or sjones@bcgsc.ca Supplementary information: Supplementary data are available at Bioinformatics online. © The Author 2013. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Holcomb, C L; Rastrou, M; Williams, T C; Goodridge, D; Lazaro, A M; Tilanus, M; Erlich, H A
2014-01-01
The high-resolution human leukocyte antigen (HLA) genotyping assay that we developed using 454 sequencing and Conexio software uses generic polymerase chain reaction (PCR) primers for DRB exon 2. Occasionally, we observed low abundance DRB amplicon sequences that resulted from in vitro PCR 'crossing over' between DRB1 and DRB3/4/5. These hybrid sequences, revealed by the clonal sequencing property of the 454 system, were generally observed at a read depth of 5%-10% of the true alleles. They usually contained at least one mismatch with the IMGT/HLA database, and consequently, were easily recognizable and did not cause a problem for HLA genotyping. Sometimes, however, these artifactual sequences matched a rare allele and the automatic genotype assignment was incorrect. These observations raised two issues: (1) could PCR conditions be modified to reduce such artifacts? and (2) could some of the rare alleles listed in the IMGT/HLA database be artifacts rather than true alleles? Because PCR crossing over occurs during late cycles of PCR, we compared DRB genotypes resulting from 28 and (our standard) 35 cycles of PCR. For all 21 cell line DNAs amplified for 35 cycles, crossover products were detected. In 33% of the cases, these hybrid sequences corresponded to named alleles. With amplification for only 28 cycles, these artifactual sequences were not detectable. To investigate whether some rare alleles in the IMGT/HLA database might be due to PCR artifacts, we analyzed four samples obtained from the investigators who submitted the sequences. In three cases, the sequences were generated from true alleles. In one case, our 454 sequencing revealed an error in the previously submitted sequence. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Nested PCR Assay for Eight Pathogens: A Rapid Tool for Diagnosis of Bacterial Meningitis.
Bhagchandani, Sharda P; Kubade, Sushant; Nikhare, Priyanka P; Manke, Sonali; Chandak, Nitin H; Kabra, Dinesh; Baheti, Neeraj N; Agrawal, Vijay S; Sarda, Pankaj; Mahajan, Parikshit; Ganjre, Ashish; Purohit, Hemant J; Singh, Lokendra; Taori, Girdhar M; Daginawala, Hatim F; Kashyap, Rajpal S
2016-02-01
Bacterial meningitis is a dreadful infectious disease with a high mortality and morbidity if remained undiagnosed. Traditional diagnostic methods for bacterial meningitis pose a challenge in accurate identification of pathogen, making prognosis difficult. The present study is therefore aimed to design and evaluate a specific and sensitive nested 16S rDNA genus-based polymerase chain reaction (PCR) assay using clinical cerebrospinal fluid (CSF) for rapid diagnosis of eight pathogens causing the disease. The present work was dedicated to development of an in-house genus specific 16S rDNA nested PCR covering pathogens of eight genera responsible for causing bacterial meningitis using newly designed as well as literature based primers for respective genus. A total 150 suspected meningitis CSF obtained from the patients admitted to Central India Institute of Medical Sciences (CIIMS), India during the period from August 2011 to May 2014, were used to evaluate clinical sensitivity and clinical specificity of optimized PCR assays. The analytical sensitivity and specificity of our newly designed genus-specific 16S rDNA PCR were found to be ≥92%. With such a high sensitivity and specificity, our in-house nested PCR was able to give 100% sensitivity in clinically confirmed positive cases and 100% specificity in clinically confirmed negative cases indicating its applicability in clinical diagnosis. Our in-house nested PCR system therefore can diagnose the accurate pathogen causing bacterial meningitis and therefore be useful in selecting a specific treatment line to minimize morbidity. Results are obtained within 24 h and high sensitivity makes this nested PCR assay a rapid and accurate diagnostic tool compared to traditional culture-based methods.
Ganster, Christina; Wernstedt, Annekatrin; Kehrer-Sawatzki, Hildegard; Messiaen, Ludwine; Schmidt, Konrad; Rahner, Nils; Heinimann, Karl; Fonatsch, Christa; Zschocke, Johannes; Wimmer, Katharina
2010-05-01
Sequence exchange between PMS2 and its pseudogene PMS2CL, embedded in an inverted duplication on chromosome 7p22, has been reported to be an ongoing process that leads to functional PMS2 hybrid alleles containing PMS2- and PMS2CL-specific sequence variants at the 5'-and the 3'-end, respectively. The frequency of PMS2 hybrid alleles, their biological significance, and the mechanisms underlying their formation are largely unknown. Here we show that overall hybrid alleles account for one-third of 384 PMS2 alleles analyzed in individuals of different ethnic backgrounds. Depending on the population, 14-60% of hybrid alleles carry PMS2CL-specific sequences in exons 13-15, the remainder only in exon 15. We show that exons 13-15 hybrid alleles, named H1 hybrid alleles, constitute different haplotypes but trace back to a single ancient intrachromosomal recombination event with crossover. Taking advantage of an ancestral sequence variant specific for all H1 alleles we developed a simple gDNA-based polymerase chain reaction (PCR) assay that can be used to identify H1-allele carriers with high sensitivity and specificity (100 and 99%, respectively). Because H1 hybrid alleles harbor missense variant p.N775S of so far unknown functional significance, we assessed the H1-carrier frequency in 164 colorectal cancer patients. So far, we found no indication that the variant plays a major role with regard to cancer susceptibility. (c) 2010 Wiley-Liss, Inc.
A PCR-based protocol to accurately size C9orf72 intermediate-length alleles.
Biasiotto, Giorgio; Archetti, Silvana; Di Lorenzo, Diego; Merola, Francesca; Paiardi, Giulia; Borroni, Barbara; Alberici, Antonella; Padovani, Alessandro; Filosto, Massimiliano; Bonvicini, Cristian; Caimi, Luigi; Zanella, Isabella
2017-04-01
Although large expansions of the non-coding GGGGCC repeat in C9orf72 gene are clearly defined as pathogenic for Amyotrophic Lateral Sclerosis (ALS) and Frontotemporal Lobar Degeneration (FTLD), intermediate-length expansions have also been associated with those and other neurodegenerative diseases. Intermediate-length allele sizing is complicated by intrinsic properties of current PCR-based methodologies, in that somatic mosaicism could be suspected. We designed a protocol that allows the exact sizing of intermediate-length alleles, as well as the identification of large expansions. Copyright © 2016 Elsevier Ltd. All rights reserved.
Mizukami, Keijiro; Chang, Hye-Sook; Yabuki, Akira; Kawamichi, Takuji; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Yamato, Osamu
2012-01-01
P-glycoprotein, encoded by the MDR1 or ABCB1 gene, is an integral component of the blood-brain barrier as an efflux pump for xenobiotics crucial in limiting drug uptake into the central nervous system. Dogs homozygous for a 4-base pair deletion of the canine MDR1 gene show altered expression or function of P-glycoprotein, resulting in neurotoxicosis after administration of the substrate drugs. In the present study, the usefulness of microchip electrophoresis for genotyping assays detecting this deletion mutation was evaluated. Mutagenically separated polymerase chain reaction (MS-PCR) and real-time PCR assays were newly developed and evaluated. Furthermore, a genotyping survey was carried out in a population of Border Collies dogs in Japan to determine the allele frequency in this breed. Microchip electrophoresis showed advantages in detection sensitivity and time saving over other modes of electrophoresis. The MS-PCR assay clearly discriminated all genotypes. Real-time PCR assay was most suitable for a large-scale survey due to its high throughput and rapidity. The genotyping survey demonstrated that the carrier and mutant allele frequencies were 0.49% and 0.25%, respectively, suggesting that the mutant allele frequency in Border Collies is markedly low compared to that in the susceptible dog breeds such as rough and smooth Collies.
DEFF Research Database (Denmark)
Maria Irlund Pedersen, Line; Stangegaard, Michael; Mogensen, Helle Smidt
2011-01-01
and the quality of the DNA profiles without re-amplification of the sample. We have validated and implemented an automated method to purify and 2-fold concentrate PCR products resulting in allelic peaks with higher intensity (a median height across all loci from 130 to 404 RFU), fewer allelic dropouts...
Directory of Open Access Journals (Sweden)
Halime Ekici
Full Text Available To assess the presence of two major non-nucleoside reverse transcriptase inhibitors (NNRTI drug resistance mutations (DRMs, Y181C and K103N, in minor viral quasispecies of treatment naïve HIV-1 infected East-African and Swedish patients by allele-specific polymerase chain reaction (AS-PCR.Treatment naïve adults (n=191 with three epidemiological backgrounds were included: 92 Ethiopians living in Ethiopia; 55 East-Africans who had migrated to Sweden; and 44 Caucasians living in Sweden. The pol gene was analysed by standard population sequencing and by AS-PCR for the detection of Y181C and K103N.The Y181C was detected in the minority quasispecies of six Ethiopians (6.5%, in two Caucasians (4.5%, and in one East-African (1.8%. The K103N was detected in one East- African (1.8%, by both methods. The proportion of mutants ranged from 0.25% to 17.5%. Additional DRMs were found in all three treatment naïve patient groups by population sequencing.Major NNRTI mutations can be found by AS-PCR in minor quasispecies of treatment naïve HIV-1 infected Ethiopians living in Ethiopia, in East-African and Caucasian patients living in Sweden in whom population sequencing reveal wild-type virus only. Surveys with standard sequencing are likely to underestimate transmitted drug resistance and the presence of resistant minor quasispecies in treatment naïve patients should be topic for future large scale studies.
Use of species-specific PCR for the identification of 10 sea cucumber species
Wen, Jing; Zeng, Ling
2014-11-01
We developed a species-specific PCR method to identify species among dehydrated products of 10 sea cucumber species. Ten reverse species-specific primers designed from the 16S rRNA gene, in combination with one forward universal primer, generated PCR fragments of ca. 270 bp length for each species. The specificity of the PCR assay was tested with DNA of samples of 21 sea cucumber species. Amplification was observed in specific species only. The species-specific PCR method we developed was successfully applied to authenticate species of commercial products of dehydrated sea cucumber, and was proven to be a useful, rapid, and low-cost technique to identify the origin of the sea cucumber product.
Directory of Open Access Journals (Sweden)
Serrano Oscar K
2008-10-01
Full Text Available Abstract Background The adoptive transfer of autologous tumor reactive lymphocytes can mediate significant tumor regression in some patients with refractory metastatic cancer. However, a significant obstacle for this promising therapy has been the availability of highly efficient methods to rapidly isolate and expand a variety of potentially rare tumor reactive lymphocytes from the natural repertoire of cancer patients. Methods We developed a novel in vitro T cell cloning methodology using high throughput quantitative RT-PCR (qPCR assay as a rapid functional screen to detect and facilitate the limiting dilution cloning of a variety of low frequency T cells from bulk PBMC. In preclinical studies, this strategy was applied to the isolation and expansion of gp100 specific CD8+ T cell clones from the peripheral blood of melanoma patients. Results In optimization studies, the qPCR assay could detect the reactivity of 1 antigen specific T cell in 100,000 background cells. When applied to short term sensitized PBMC microcultures, this assay could detect T cell reactivity against a variety of known melanoma tumor epitopes. This screening was combined with early limiting dilution cloning to rapidly isolate gp100154–162 reactive CD8+ T cell clones. These clones were highly avid against peptide pulsed targets and melanoma tumor lines. They had an effector memory phenotype and showed significant proliferative capacity to reach cell numbers appropriate for adoptive transfer trials (~1010 cells. Conclusion This report describes a novel high efficiency strategy to clone tumor reactive T cells from peripheral blood for use in adoptive immunotherapy.
Allele-specific MMP-3 transcription under in vivo conditions
Energy Technology Data Exchange (ETDEWEB)
Chaoyong, Zhu [Atherosclerosis Research Unit, King Gustav V Research Institute, Department of Medicine, Karolinska Institute, Stockholm (Sweden); Odeberg, Jacob [Atherosclerosis Research Unit, King Gustav V Research Institute, Department of Medicine, Karolinska Institute, Stockholm (Sweden); Department of Biotechnology, AlbaNova University Center, Royal Institute of Technology, Stockholm (Sweden); Hamsten, Anders [Atherosclerosis Research Unit, King Gustav V Research Institute, Department of Medicine, Karolinska Institute, Stockholm (Sweden); Eriksson, Per [Atherosclerosis Research Unit, King Gustav V Research Institute, Department of Medicine, Karolinska Institute, Stockholm (Sweden)
2006-09-29
A common matrix metalloproteinases-3 (MMP-3) -1612 5A/6A promoter polymorphism is associated with risk for cardiovascular disease, rheumatoid arthritis, and other diseases. Here we used the haplotype chromatin immunoprecipitation method to study allele-specific MMP-3 expression under in vivo conditions in heterozygous THP-1 cells. Pyrosequencing was used to analyse the ratio of 5A-allele to 6A-allele after chromatin immunoprecipitation using an antibody against phosphorylated active RNA polymerase II. There was no allele-specific difference in transcriptional activity during basal conditions, i.e., in unstimulated monocytic THP-1 cells. However, after stimulation of MMP-3 expression by monocyte differentiation or incubation with IL-1{beta}, the haplotype containing the 5A-allele was associated with higher transcriptional activity compared with the 6A-containing haplotype. Electromobility shift assay demonstrated increased binding of nuclear proteins to the 5A-allele after monocyte differentiation. In conclusion, the common MMP-3 5A/6A promoter polymorphism appears to be functional only during specific environmental conditions involving inflammation.
Fong, Wai-Ying; Ho, Chi-Chun; Poon, Wing-Tat
2017-05-12
Thiopurine intolerance and treatment-related toxicity, such as fatal myelosuppression, is related to non-function genetic variants encoding thiopurine S-methyltransferase (TPMT) and Nudix hydrolase 15 (NUDT15). Genetic testing of the common variants NUDT15:NM_018283.2:c.415C>T (Arg139Cys, dbSNP rs116855232 T allele) and TPMT: NM_000367.4:c.719A>G (TPMT*3C, dbSNP rs1142345 G allele) in East Asians including Chinese can potentially prevent treatment-related complications. Two complementary genotyping approaches, real-time PCR-high resolution melt (PCR-HRM) and PCR-restriction fragment length morphism (PCR-RFLP) analysis were evaluated using conventional PCR and Sanger sequencing genotyping as the gold standard. Sixty patient samples were tested, revealing seven patients (11.7%) heterozygous for NUDT15 c.415C>T, one patient homozygous for the variant and one patient heterozygous for the TPMT*3C non-function allele. No patient was found to harbor both variants. In total, nine out of 60 (15%) patients tested had genotypic evidence of thiopurine intolerance, which may require dosage adjustment or alternative medication should they be started on azathioprine, mercaptopurine or thioguanine. The two newly developed assays were more efficient and showed complete concordance (60/60, 100%) compared to the Sanger sequencing results. Accurate and cost-effective genotyping assays by real-time PCR-HRM and PCR-RFLP for NUDT15 c.415C>T and TPMT*3C were successfully developed. Further studies may establish their roles in genotype-informed clinical decision-making in the prevention of morbidity and mortality due to thiopurine intolerance.
Mizukami, Keijiro; Chang, Hye-Sook; Yabuki, Akira; Kawamichi, Takuji; Kawahara, Natsuko; Hayashi, Daisuke; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Yamato, Osamu
2011-11-01
Neuronal ceroid lipofuscinosis (NCL) constitutes a group of recessively inherited lysosomal storage diseases that primarily affect neuronal cells. Such diseases share certain clinical and pathologic features in human beings and animals. Neuronal ceroid lipofuscinosis in Border Collie dogs was first detected in Australia in the 1980s, and the pathogenic mutation was shown to be a nonsense mutation (c.619C>T) in exon 4 in canine CLN5 gene. In the present study, novel rapid genotyping assays including polymerase chain reaction (PCR)-restriction fragment length polymorphism, PCR primer-induced restriction analysis, mutagenically separated PCR, and real-time PCR with TaqMan minor groove binder probes, were developed. The utility of microchip electrophoresis was also evaluated. Furthermore, a genotyping survey was carried out in a population of Border Collies in Japan using these assays to determine the current allele frequency in Japan, providing information to control and prevent this disease in the next stage. All assays developed in the current study are available to discriminate these genotypes, and microchip electrophoresis showed a timesaving advantage over agarose gel electrophoresis. Of all assays, real-time PCR was the most suitable for large-scale examination because of its high throughput. The genotyping survey demonstrated that the carrier frequency was 8.1%. This finding suggested that the mutant allele frequency of NCL in Border Collies is high enough in Japan that measures to control and prevent the disease would be warranted. The genotyping assays developed in the present study could contribute to the prevention of NCL in Border Collies.
Transient neonatal diabetes mellitus with macroglossia diagnosed by methylation specific PCR (MS-PCR
Directory of Open Access Journals (Sweden)
Hye Young Jin
2010-03-01
Full Text Available Transient neonatal diabetes mellitus (TNDM has been associated with paternal uniparental isodisomy of chromosome 6, paternally inherited duplication of 6q24, or a methylation defect at a CpG island of the ZAC or HYMAI gene. We experienced a case of TNDM in which the patient presented with hyperglycemia, macroglossia, and intrauterine growth retardation, caused by a paternally derived HYMAI. An 18-day-old female infant was admitted to the hospital because of macroglossia and recurrent hyperglycemia. In addition to the macroglossia, she also presented with large fontanelles, micrognathia, and prominent eyes. Serum glucose levels were 200–300 mg/dL and they improved spontaneously 2 days after admission. To identify the presence of a maternal methylated allele, bisulfite-treated genomic DNA from peripheral blood was prepared and digested with BssHII after polymerase chain reaction (PCR amplification with methylation-specific HYMAI primers. PCR and restriction fragment length polymorphism analysis showed that the patient had only the paternal origin of the HYMA1 gene. TNDM is associated with a methylation defect in chromosome 6, suggesting that an imprinted gene on chromosome 6 is responsible for this phenotype.
Immunomagnetic nanoparticle based quantitative PCR for rapid detection of Salmonella
International Nuclear Information System (INIS)
Bakthavathsalam, Padmavathy; Rajendran, Vinoth Kumar; Saran, Uttara; Chatterjee, Suvro; Ali, Baquir Mohammed Jaffar
2013-01-01
We have developed a rapid and sensitive method for immunomagnetic separation (IMS) of Salmonella along with their real time detection via PCR. Silica-coated magnetic nanoparticles were functionalized with carboxy groups to which anti-Salmonella antibody raised against heat-inactivated whole cells of Salmonella were covalently attached. The immuno-captured target cells were detected in beverages like milk and lemon juice by multiplex PCR and real time PCR with a detection limit of 10 4 cfu.mL −1 and 10 3 cfu.mL −1 , respectively. We demonstrate that IMS can be used for selective concentration of target bacteria from beverages for subsequent use in PCR detection. PCR also enables differentiation of Salmonella typhi and Salmonella paratyphi A using a set of four specific primers. In addition, IMS—PCR can be used as a screening tool in the food and beverage industry for the detection of Salmonella within 3–4 h which compares favorably to the time of several days that is needed in case of conventional detection based on culture and biochemical methods. (author)
Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.
Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R
2001-10-01
Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.
Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco
1999-01-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy pr...
DEFF Research Database (Denmark)
Fugger, L; Morling, N; Ryder, L P
1990-01-01
The polymerase chain reaction (PCR) is an effective method for in vitro DNA amplification which combined with probing with synthetic oligonucleotides can be used for, e.g., HLA-typing. We have studied the technical aspects of HLA-DP typing with the technique. DNA from mononuclear nucleated cells...... was extracted with either a simple salting out method or phenol/chloroform. Both DNAs could be readily used for PCR. The MgC2 concentration of the PCR buffer and the annealing temperature of the thermal cycle of the PCR were the two most important variables. The MgCl2 concentration and the temperature must...... be carefully titrated for each primer pair in the PCR. The influence of mismatches between the primer and the DNA template were studied and we found that, by using primers differing only from each other at the 3' end, cross-amplification of closely homologous alleles could be avoided. Thus, single base...
Paliwal, Anupam; Temkin, Alexis M; Kerkel, Kristi; Yale, Alexander; Yotova, Iveta; Drost, Natalia; Lax, Simon; Nhan-Chang, Chia-Ling; Powell, Charles; Borczuk, Alain; Aviv, Abraham; Wapner, Ronald; Chen, Xiaowei; Nagy, Peter L; Schork, Nicholas; Do, Catherine; Torkamani, Ali; Tycko, Benjamin
2013-08-01
Allele-specific DNA methylation (ASM) is well studied in imprinted domains, but this type of epigenetic asymmetry is actually found more commonly at non-imprinted loci, where the ASM is dictated not by parent-of-origin but instead by the local haplotype. We identified loci with strong ASM in human tissues from methylation-sensitive SNP array data. Two index regions (bisulfite PCR amplicons), one between the C3orf27 and RPN1 genes in chromosome band 3q21 and the other near the VTRNA2-1 vault RNA in band 5q31, proved to be new examples of imprinted DMRs (maternal alleles methylated) while a third, between STEAP3 and C2orf76 in chromosome band 2q14, showed non-imprinted haplotype-dependent ASM. Using long-read bisulfite sequencing (bis-seq) in 8 human tissues we found that in all 3 domains the ASM is restricted to single differentially methylated regions (DMRs), each less than 2kb. The ASM in the C3orf27-RPN1 intergenic region was placenta-specific and associated with allele-specific expression of a long non-coding RNA. Strikingly, the discrete DMRs in all 3 regions overlap with binding sites for the insulator protein CTCF, which we found selectively bound to the unmethylated allele of the STEAP3-C2orf76 DMR. Methylation mapping in two additional genes with non-imprinted haplotype-dependent ASM, ELK3 and CYP2A7, showed that the CYP2A7 DMR also overlaps a CTCF site. Thus, two features of imprinted domains, highly localized DMRs and allele-specific insulator occupancy by CTCF, can also be found in chromosomal domains with non-imprinted ASM. Arguing for biological importance, our analysis of published whole genome bis-seq data from hES cells revealed multiple genome-wide association study (GWAS) peaks near CTCF binding sites with ASM.
Directory of Open Access Journals (Sweden)
Anupam Paliwal
2013-08-01
Full Text Available Allele-specific DNA methylation (ASM is well studied in imprinted domains, but this type of epigenetic asymmetry is actually found more commonly at non-imprinted loci, where the ASM is dictated not by parent-of-origin but instead by the local haplotype. We identified loci with strong ASM in human tissues from methylation-sensitive SNP array data. Two index regions (bisulfite PCR amplicons, one between the C3orf27 and RPN1 genes in chromosome band 3q21 and the other near the VTRNA2-1 vault RNA in band 5q31, proved to be new examples of imprinted DMRs (maternal alleles methylated while a third, between STEAP3 and C2orf76 in chromosome band 2q14, showed non-imprinted haplotype-dependent ASM. Using long-read bisulfite sequencing (bis-seq in 8 human tissues we found that in all 3 domains the ASM is restricted to single differentially methylated regions (DMRs, each less than 2kb. The ASM in the C3orf27-RPN1 intergenic region was placenta-specific and associated with allele-specific expression of a long non-coding RNA. Strikingly, the discrete DMRs in all 3 regions overlap with binding sites for the insulator protein CTCF, which we found selectively bound to the unmethylated allele of the STEAP3-C2orf76 DMR. Methylation mapping in two additional genes with non-imprinted haplotype-dependent ASM, ELK3 and CYP2A7, showed that the CYP2A7 DMR also overlaps a CTCF site. Thus, two features of imprinted domains, highly localized DMRs and allele-specific insulator occupancy by CTCF, can also be found in chromosomal domains with non-imprinted ASM. Arguing for biological importance, our analysis of published whole genome bis-seq data from hES cells revealed multiple genome-wide association study (GWAS peaks near CTCF binding sites with ASM.
Template preparation for rapid PCR in Colletotrichum lindemuthianum
Directory of Open Access Journals (Sweden)
Roca M. Gabriela
2003-01-01
Full Text Available Isolation of DNA for PCR is time-consuming and involves many reagents. The aim of this work was to optimise a rapid and easy PCR methodology without previous DNA isolation. Different strains of the phytopathogenic fungus Colletotrichum lindemuthianum were used. Protoplasts were generated using lytic enzymes under high incubation temperatures using different methodologies to obtain the template. A rapid (10 minute methodology was successful for smaller amplicons (<750 bp.
Caws, Maxine; Tho, Dau Quang; Duy, Phan Minh; Lan, Nguyen Thi Ngoc; Hoa, Dai Viet; Torok, Mili Estee; Chau, Tran Thi Hong; Van Vinh Chau, Nguyen; Chinh, Nguyen Tran; Farrar, Jeremy
2007-01-01
PCR-restriction fragment length poymorphism (PCR-RFLP) is a simple, robust technique for the rapid identification of isoniazid-resistant Mycobacterium tuberculosis. One hundred consecutive isolates from a Vietnamese tuberculosis hospital were tested by MspA1I PCR-RFLP for the detection of isoniazid-resistant katG_315 mutants. The test had a sensitivity of 80% and a specificity of 100% against conventional phenotypic drug susceptibility testing. The positive and negative predictive values were 1 and 0.86, respectively. None of the discrepant isolates had mutant katG_315 codons by sequencing. The test is cheap (less than $1.50 per test), specific, and suitable for the rapid identification of isoniazid resistance in regions with a high prevalence of katG_315 mutants among isoniazid-resistant M. tuberculosis isolates. PMID:17428939
Directory of Open Access Journals (Sweden)
Kirill V Sergueev
Full Text Available BACKGROUND: Yersinia pestis, the agent of plague, has caused many millions of human deaths and still poses a serious threat to global public health. Timely and reliable detection of such a dangerous pathogen is of critical importance. Lysis by specific bacteriophages remains an essential method of Y. pestis detection and plague diagnostics. METHODOLOGY/PRINCIPAL FINDINGS: The objective of this work was to develop an alternative to conventional phage lysis tests--a rapid and highly sensitive method of indirect detection of live Y. pestis cells based on quantitative real-time PCR (qPCR monitoring of amplification of reporter Y. pestis-specific bacteriophages. Plague diagnostic phages phiA1122 and L-413C were shown to be highly effective diagnostic tools for the detection and identification of Y. pestis by using qPCR with primers specific for phage DNA. The template DNA extraction step that usually precedes qPCR was omitted. phiA1122-specific qPCR enabled the detection of an initial bacterial concentration of 10(3 CFU/ml (equivalent to as few as one Y. pestis cell per 1-microl sample in four hours. L-413C-mediated detection of Y. pestis was less sensitive (up to 100 bacteria per sample but more specific, and thus we propose parallel qPCR for the two phages as a rapid and reliable method of Y. pestis identification. Importantly, phiA1122 propagated in simulated clinical blood specimens containing EDTA and its titer rise was detected by both a standard plating test and qPCR. CONCLUSIONS/SIGNIFICANCE: Thus, we developed a novel assay for detection and identification of Y. pestis using amplification of specific phages monitored by qPCR. The method is simple, rapid, highly sensitive, and specific and allows the detection of only live bacteria.
Directory of Open Access Journals (Sweden)
Tian-Min Qiao
2016-10-01
Full Text Available Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP were developed for detection of C. scoparium based on factor 1-alpha (tef1 and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.
Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui
2016-01-01
Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products. PMID:27721691
Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui
2016-10-01
Eucalyptus dieback disease, caused by Cylindrocladium scoparium , has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium . The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.
Development of a high-speed real-time PCR system for rapid and precise nucleotide recognition
Terazono, Hideyuki; Takei, Hiroyuki; Hattori, Akihiro; Yasuda, Kenji
2010-04-01
Polymerase chain reaction (PCR) is a common method used to create copies of a specific target region of a DNA sequence and to produce large quantities of DNA. A few DNA molecules, which act as templates, are rapidly amplified by PCR into many billions of copies. PCR is a key technology in genome-based biological analysis, revolutionizing many life science fields such as medical diagnostics, food safety monitoring, and countermeasures against bioterrorism. Thus, many applications have been developed with the thermal cycling. For these PCR applications, one of the most important key factors is reduction in the data acquisition time. To reduce the acquisition time, it is necessary to decrease the temperature transition time between the high and low ends as much as possible. We have developed a novel rapid real-time PCR system based on rapid exchange of media maintained at different temperatures. This system consists of two thermal reservoirs and a reaction chamber for PCR observation. The temperature transition was achieved within 0.3 sec, and good thermal stability was achieved during thermal cycling with rapid exchange of circulating media. This system allows rigorous optimization of the temperatures required for each stage of the PCR processes. Resulting amplicons were confirmed by electrophoresis. Using the system, rapid DNA amplification was accomplished within 3.5 min, including initial heating and complete 50 PCR cycles. It clearly shows that the device could allow us faster temperature switching than the conventional conduction-based heating systems based on Peltier heating/cooling.
A PCR detection method for rapid identification of Melissococcus pluton in honeybee larvae.
Govan, V A; Brözel, V; Allsopp, M H; Davison, S
1998-05-01
Melissococcus pluton is the causative agent of European foulbrood, a disease of honeybee larvae. This bacterium is particularly difficult to isolate because of its stringent growth requirements and competition from other bacteria. PCR was used selectively to amplify specific rRNA gene sequences of M. pluton from pure culture, from crude cell lysates, and directly from infected bee larvae. The PCR primers were designed from M. pluton 16S rRNA sequence data. The PCR products were visualized by agarose gel electrophoresis and confirmed as originating from M. pluton by sequencing in both directions. Detection was highly specific, and the probes did not hybridize with DNA from other bacterial species tested. This method enabled the rapid and specific detection and identification of M. pluton from pure cultures and infected bee larvae.
Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.
Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis
2018-03-01
Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.
RHD alleles in the Tunisian population
Ouchari, Mouna; Jemni-Yaacoub, Saloua; Chakroun, Taher; Abdelkefi, Saida; Houissa, Batoul; Hmida, Slama
2013-01-01
Background: A comprehensive survey of RHD alleles in Tunisia population was lacking. The aim of this study was to use a multiplex RHD typing assay for simultaneous detection of partial D especially with RHD/RHCE deoxyribonucleic acid (DNA) sequence exchange mechanism and some weak D alleles. Materials and Methods: Six RHD specific primer sets were designed to amplify RHD exons 3, 4, 5, 6, 7 and 9. DNA from 2000 blood donors (1777 D+ and 223 D-) from several regions was selected for RHD genotyping using a PCR multiplex assay. Further molecular investigations were done to characterize the RHD variants that were identified by the PCR multiplex assay. Results: In the 1777 D+ samples, only 10 individuals showed the absence of amplification of exons 4 and 5 that were subsequently identified by PCR-SSP as weak D type 4 variants. No hybrid allele was detected. In the 223 D-, RHD amplification of some exons was observed only in 5 samples: 4 individuals expressed only RHD exon 9, and one subject lacking exons 4 and 5. These samples were then screened by PCR-SSPs on d(C) ces and weak D type 4, respectively. Conclusion: The weak D type 4 appears to be the most common D variant allele. We have not found any partial D variant. Findings also indicated that RHD gene deletion is the most prevalent cause of the D- phenotype in the Tunisian population. PMID:24014941
Zhang, D F; Zhang, Q Q; Li, A H
2014-11-01
Species of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus are the most common fish pathogenic bacteria that cause economically devastating losses in aquaculture. A multiplex polymerase chain reaction (mPCR) was developed for the simultaneous detection and differentiation of the four genera of fish pathogenic bacteria. Through the use of genus-specific primers instead of species-specific ones, the current mPCR covered much more target bacterial species compared with previously reported species-specific mPCR methods. The specificity of the four putative genus-specific primers was validated experimentally while used exclusively (uniplex PCR) or combined (mPCR) against bacterial genomic DNA templates of the target bacteria and nontarget bacteria. The PCR amplicons for the following genera were obtained as expected: Aeromonas (875 bp), Vibrio (524 bp), Edwardsiella (302 bp) and Streptococcus (197 bp), and the fragments could be separated clearly on the agarose gel electrophoresis. The mPCR did not produce nonspecific amplification products when used to amplify 21 nontarget species of bacteria. The mPCR detection limits for each target bacterial genera were 50 colony-forming units (CFU) in pure culture and 100 CFU in fish tissue samples. In conclusion, the mPCR assay was proven to be a powerful alternative to the conventional culture-based method, given its rapid, specific, sensitive and reliable detection of target pathogens. The fish pathogenic bacteria of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus frequently cause severe outbreaks of diseases in cultured fish, and the genus-specific multiplex PCR assay developed in this study can detect the bacteria of the four genera when present in the samples either alone or mixed. The mPCR assay is expected to identify the causative agents more efficiently than uniplex PCR or species-specific multiplex PCR for clinical diagnosis, resulting in the earlier implementation of control measures. This mPCR
Czech Academy of Sciences Publication Activity Database
Muneta, Y.; Minagawa, Y.; Kusumoto, M.; Shinkai, H.; Uenishi, H.; Šplíchal, Igor
2012-01-01
Roč. 56, č. 6 (2012), s. 385-391 ISSN 0385-5600 R&D Projects: GA ČR GA524/09/0365 Institutional support: RVO:61388971 Keywords : allele-specific PCR * Salmonella enterica serovar Choleraesuis * single nucleotide polymorphism Subject RIV: EC - Immunology Impact factor: 1.545, year: 2012
Xu, Xiaodan; Li, Yingcong; Zhao, Heng; Wen, Si-yuan; Wang, Sheng-qi; Huang, Jian; Huang, Kun-lun; Luo, Yun-bo
2005-05-18
To devise a rapid and reliable method for the detection and identification of genetically modified (GM) events, we developed a multiplex polymerase chain reaction (PCR) coupled with a DNA microarray system simultaneously aiming at many targets in a single reaction. The system included probes for screening gene, species reference gene, specific gene, construct-specific gene, event-specific gene, and internal and negative control genes. 18S rRNA was combined with species reference genes as internal controls to assess the efficiency of all reactions and to eliminate false negatives. Two sets of the multiplex PCR system were used to amplify four and five targets, respectively. Eight different structure genes could be detected and identified simultaneously for Roundup Ready soybean in a single microarray. The microarray specificity was validated by its ability to discriminate two GM maizes Bt176 and Bt11. The advantages of this method are its high specificity and greatly reduced false-positives and -negatives. The multiplex PCR coupled with microarray technology presented here is a rapid and reliable tool for the simultaneous detection of GM organism ingredients.
A rapid method for screening arrayed plasmid cDNA library by PCR
International Nuclear Information System (INIS)
Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong
1999-01-01
Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency
Allele specific expression in worker reproduction genes in the bumblebee Bombus terrestris
Directory of Open Access Journals (Sweden)
Harindra E. Amarasinghe
2015-07-01
Full Text Available Methylation has previously been associated with allele specific expression in ants. Recently, we found methylation is important in worker reproduction in the bumblebee Bombus terrestris. Here we searched for allele specific expression in twelve genes associated with worker reproduction in bees. We found allele specific expression in Ecdysone 20 monooxygenase and IMP-L2-like. Although we were unable to confirm a genetic or epigenetic cause for this allele specific expression, the expression patterns of the two genes match those predicted for imprinted genes.
Directory of Open Access Journals (Sweden)
Fangjun Zhu
Full Text Available The all-female Amazon molly (Poecilia formosa is the result of a hybridization of the Atlantic molly (P. mexicana and the sailfin molly (P. latipinna approximately 120,000 years ago. As a gynogenetic species, P. formosa needs to copulate with heterospecific males including males from one of its bisexual ancestral species. However, the sperm only triggers embryogenesis of the diploid eggs. The genetic information of the sperm donor typically will not contribute to the next generation of P. formosa. Hence, P. formosa possesses generally one allele from each of its ancestral species at any genetic locus. This raises the question whether both ancestral alleles are equally expressed in P. formosa. Allele-specific expression (ASE has been previously assessed in various organisms, e.g., human and fish, and ASE was found to be important in the context of phenotypic variability and disease. In this study, we utilized Real-Time PCR techniques to estimate ASE of the androgen receptor alpha (arα gene in several distinct tissues of Amazon mollies. We found an allelic bias favoring the maternal ancestor (P. mexicana allele in ovarian tissue. This allelic bias was not observed in the gill or the brain tissue. Sequencing of the promoter regions of both alleles revealed an association between an Indel in a known CpG island and differential expression. Future studies may reveal whether our observed cis-regulatory divergence is caused by an ovary-specific trans-regulatory element, preferentially activating the allele of the maternal ancestor.
Directory of Open Access Journals (Sweden)
Costa Elena
2011-05-01
Full Text Available Abstract Background 22q11.2 microdeletion is responsible for the DiGeorge Syndrome, characterized by heart defects, psychiatric disorders, endocrine and immune alterations and a 1 in 4000 live birth prevalence. Real-time quantitative PCR (qPCR approaches for allelic copy number determination have recently been investigated in 22q11.2 microdeletions detection. The qPCR method was performed for 22q11.2 microdeletions detection as a first-level screening approach in a genetically unknown series of patients with congenital heart defects. A technical issue related to the VPREB1 qPCR marker was pointed out. Methods A set of 100 unrelated Italian patients with congenital heart defects were tested for 22q11.2 microdeletions by a qPCR method using six different markers. Fluorescence In Situ Hybridization technique (FISH was used for confirmation. Results qPCR identified six patients harbouring the 22q11.2 microdeletion, confirmed by FISH. The VPREB1 gene marker presented with a pattern consistent with hemideletion in one 3 Mb deleted patient, suggestive for a long distal deletion, and in additional five non-deleted patients. The long distal 22q11.2 deletion was not confirmed by Comparative Genomic Hybridization. Indeed, the VPREB1 gene marker generated false positive results in association with the rs1320 G/A SNP, a polymorphism localized within the VPREB1 marker reverse primer sequence. Patients heterozygous for rs1320 SNP, showed a qPCR profile consistent with the presence of a hemideletion. Conclusions Though the qPCR technique showed advantages as a screening approach in terms of cost and time, the VPREB1 marker case revealed that single nucleotide polymorphisms can interfere with qPCR data generating erroneous allelic copy number interpretations.
International Nuclear Information System (INIS)
Khalafalla, A.I.; Buettner, M.; Rziha, H.-J.
2005-01-01
Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)
Torriani, S; Zapparoli, G; Dellaglio, F
1999-10-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.
Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco
1999-01-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059
Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.
Kageyama, A; Benno, Y
2001-01-01
PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.
New multiplex PCR methods for rapid screening of genetically modified organisms in foods.
Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris
2015-01-01
We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.
New multiplex PCR methods for rapid screening of genetically modified organisms in foods
Directory of Open Access Journals (Sweden)
Nelly eDatukishvili
2015-07-01
Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.
A Simple PCR Method for Rapid Genotype Analysis of Mycobacterium ulcerans
Stinear, Timothy; Davies, John K.; Jenkin, Grant A.; Portaels, Françoise; Ross, Bruce C.; OppEdIsano, Frances; Purcell, Maria; Hayman, John A.; Johnson, Paul D. R.
2000-01-01
Two high-copy-number insertion sequences, IS2404 and IS2606, were recently identified in Mycobacterium ulcerans and were shown by Southern hybridization to possess restriction fragment length polymorphism between strains from different geographic origins. We have designed a simple genotyping method that captures these differences by PCR amplification of the region between adjacent copies of IS2404 and IS2606. We have called this system 2426 PCR. The method is rapid, reproducible, sensitive, and specific for M. ulcerans, and it has confirmed previous studies suggesting a clonal population structure of M. ulcerans within a geographic region. M. ulcerans isolates from Australia, Papua New Guinea, Malaysia, Surinam, Mexico, Japan, China, and several countries in Africa were easily differentiated based on an array of 4 to 14 PCR products ranging in size from 200 to 900 bp. Numerical analysis of the banding patterns suggested a close evolutionary link between M. ulcerans isolates from Africa and southeast Asia. The application of 2426 PCR to total DNA, extracted directly from M. ulcerans-infected tissue specimens without culture, demonstrated the sensitivity and specificity of this method and confirmed for the first time that both animal and human isolates from areas of endemicity in southeast Australia have the same genotype. PMID:10747130
Rapid diagnosis of aneuploidy using segmental duplication quantitative fluorescent PCR.
Directory of Open Access Journals (Sweden)
Xiangdong Kong
Full Text Available The aim of this study was use a simple and rapid procedure, called segmental duplication quantitative fluorescent polymerase chain reaction (SD-QF-PCR, for the prenatal diagnosis of fetal chromosomal aneuploidies. This method is based on the co-amplification of segmental duplications located on two different chromosomes using a single pair of fluorescent primers. The PCR products of different sizes were subsequently analyzed through capillary electrophoresis, and the aneuploidies were determined based on the relative dosage between the two chromosomes. Each primer set, containing five pairs of primers, was designed to simultaneously detect aneuploidies located on chromosomes 21, 18, 13, X and Y in a single reaction. We applied these two primer sets to DNA samples isolated from individuals with trisomy 21 (n = 36; trisomy 18 (n = 6; trisomy 13 (n = 4; 45, X (n = 5; 47, XXX (n = 3; 48, XXYY (n = 2; and unaffected controls (n = 40. We evaluated the performance of this method using the karyotyping results. A correct and unambiguous diagnosis with 100% sensitivity and 100% specificity, was achieved for clinical samples examined. Thus, the present study demonstrates that SD-QF-PCR is a robust, rapid and sensitive method for the diagnosis of common aneuploidies, and these analyses can be performed in less than 4 hours for a single sample, providing a competitive alternative for routine use.
Methylation-Specific PCR Unraveled
Directory of Open Access Journals (Sweden)
Sarah Derks
2004-01-01
Full Text Available Methylation‐specific PCR (MSP is a simple, quick and cost‐effective method to analyze the DNA methylation status of virtually any group of CpG sites within a CpG island. The technique comprises two parts: (1 sodium bisulfite conversion of unmethylated cytosine's to uracil under conditions whereby methylated cytosines remains unchanged and (2 detection of the bisulfite induced sequence differences by PCR using specific primer sets for both unmethylated and methylated DNA. This review discusses the critical parameters of MSP and presents an overview of the available MSP variants and the (clinical applications.
Modified DNA extraction for rapid PCR detection of methicillin-resistant staphylococci
International Nuclear Information System (INIS)
Japoni, A.; Alborzi, A.; Rasouli, M.; Pourabbas, B.
2004-01-01
Nosocomial infection caused by methicillin-resistant staphylococci poses a serious problem in many countries. The aim of this study was to rapidly and reliably detect methicillin-resistant-staphylococci in order to suggest appropriate therapy. The presence or absence of the methicillin-resistance gene in 115 clinical isolates of staphylococcus aureus and 50 isolates of coagulase negative staphylococci was examined by normal PCR. DNA extraction for PCR performance was then modified by omission of achromopeptadiase and proteinase K digestion, phenol/chloroform extraction and ethanol precipitation. All isolates with Mic>8 μ g/ml showed positive PCR. No differences in PCR detection have been observed when normal and modified DNA extractions have been performed. Our modified DNA extraction can quickly detect methicillin-resistant staphylococci by PCR. The advantage of rapid DNA extraction extends to both reduction of time and cost of PCR performance. This modified DNA extraction is suitable for different PCR detection, when staphylococci are the subject of DNA analysis
Directory of Open Access Journals (Sweden)
Aaron J. Stevens
2017-03-01
Full Text Available Loss of one allele during polymerase chain reaction (PCR amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST. We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1, BLCAP, DNMT1, PLAGL1, KCNQ1, and GRB10. These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations.
QuASAR: quantitative allele-specific analysis of reads.
Harvey, Chris T; Moyerbrailean, Gregory A; Davis, Gordon O; Wen, Xiaoquan; Luca, Francesca; Pique-Regi, Roger
2015-04-15
Expression quantitative trait loci (eQTL) studies have discovered thousands of genetic variants that regulate gene expression, enabling a better understanding of the functional role of non-coding sequences. However, eQTL studies are costly, requiring large sample sizes and genome-wide genotyping of each sample. In contrast, analysis of allele-specific expression (ASE) is becoming a popular approach to detect the effect of genetic variation on gene expression, even within a single individual. This is typically achieved by counting the number of RNA-seq reads matching each allele at heterozygous sites and testing the null hypothesis of a 1:1 allelic ratio. In principle, when genotype information is not readily available, it could be inferred from the RNA-seq reads directly. However, there are currently no existing methods that jointly infer genotypes and conduct ASE inference, while considering uncertainty in the genotype calls. We present QuASAR, quantitative allele-specific analysis of reads, a novel statistical learning method for jointly detecting heterozygous genotypes and inferring ASE. The proposed ASE inference step takes into consideration the uncertainty in the genotype calls, while including parameters that model base-call errors in sequencing and allelic over-dispersion. We validated our method with experimental data for which high-quality genotypes are available. Results for an additional dataset with multiple replicates at different sequencing depths demonstrate that QuASAR is a powerful tool for ASE analysis when genotypes are not available. http://github.com/piquelab/QuASAR. fluca@wayne.edu or rpique@wayne.edu Supplementary Material is available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Single tube genotyping of sickle cell anaemia using PCR-based SNP analysis.
Waterfall, C M; Cobb, B D
2001-12-01
Allele-specific amplification (ASA) is a generally applicable technique for the detection of known single nucleotide polymorphisms (SNPs), deletions, insertions and other sequence variations. Conventionally, two reactions are required to determine the zygosity of DNA in a two-allele system, along with significant upstream optimisation to define the specific test conditions. Here, we combine single tube bi-directional ASA with a 'matrix-based' optimisation strategy, speeding up the whole process in a reduced reaction set. We use sickle cell anaemia as our model SNP system, a genetic disease that is currently screened using ASA methods. Discriminatory conditions were rapidly optimised enabling the unambiguous identification of DNA from homozygous sickle cell patients (HbS/S), heterozygous carriers (HbA/S) or normal DNA in a single tube. Simple downstream mathematical analyses based on product yield across the optimisation set allow an insight into the important aspects of priming competition and component interactions in this competitive PCR. This strategy can be applied to any polymorphism, defining specific conditions using a multifactorial approach. The inherent simplicity and low cost of this PCR-based method validates bi-directional ASA as an effective tool in future clinical screening and pharmacogenomic research where more expensive fluorescence-based approaches may not be desirable.
Genome-wide survey of allele-specific splicing in humans
Directory of Open Access Journals (Sweden)
Scheffler Konrad
2008-06-01
Full Text Available Abstract Background Accurate mRNA splicing depends on multiple regulatory signals encoded in the transcribed RNA sequence. Many examples of mutations within human splice regulatory regions that alter splicing qualitatively or quantitatively have been reported and allelic differences in mRNA splicing are likely to be a common and important source of phenotypic diversity at the molecular level, in addition to their contribution to genetic disease susceptibility. However, because the effect of a mutation on the efficiency of mRNA splicing is often difficult to predict, many mutations that cause disease through an effect on splicing are likely to remain undiscovered. Results We have combined a genome-wide scan for sequence polymorphisms likely to affect mRNA splicing with analysis of publicly available Expressed Sequence Tag (EST and exon array data. The genome-wide scan uses published tools and identified 30,977 SNPs located within donor and acceptor splice sites, branch points and exonic splicing enhancer elements. For 1,185 candidate splicing polymorphisms the difference in splicing between alternative alleles was corroborated by publicly available exon array data from 166 lymphoblastoid cell lines. We developed a novel probabilistic method to infer allele-specific splicing from EST data. The method uses SNPs and alternative mRNA isoforms mapped to EST sequences and models both regulated alternative splicing as well as allele-specific splicing. We have also estimated heritability of splicing and report that a greater proportion of genes show evidence of splicing heritability than show heritability of overall gene expression level. Our results provide an extensive resource that can be used to assess the possible effect on splicing of human polymorphisms in putative splice-regulatory sites. Conclusion We report a set of genes showing evidence of allele-specific splicing from an integrated analysis of genomic polymorphisms, EST data and exon array
Khalafalla, Abdelmalik I; Al-Busada, Khalid A; El-Sabagh, Ibrahim M
2015-07-07
Pox and pox-like diseases of camels are a group of exanthematous skin conditions that have become increasingly important economically. Three distinct viruses may cause them: camelpox virus (CMLV), camel parapox virus (CPPV) and camelus dromedary papilloma virus (CdPV). These diseases are often difficult to differentiate based on clinical presentation in disease outbreaks. Molecular methods such as PCR targeting species-specific genes have been developed and used to identify these diseases, but not simultaneously in a single tube. Recently, multiplex PCR has gained reputation as a convenient diagnostic method with cost-and timesaving benefits. In the present communication, we describe the development, optimization and validation of a multiplex PCR assay able to detect simultaneously the genome of the three viruses in one single test allowing for rapid and efficient molecular diagnosis. The assay was developed based on the evaluation and combination of published and new primer sets and was validated with viral genomic DNA extracted from known virus strains (n = 14) and DNA extracted from homogenized clinical skin specimens (n = 86). The assay detects correctly the target pathogens by amplification of targeted genes, even in case of co-infection. The method showed high sensitivity, and the specificity was confirmed by PCR-product sequencing. This assay provide rapid, sensitive and specific method for identifying three important viruses in specimens collected from dromedary camels with varying clinical presentations.
Cho, Min Seok; Park, Duck Hwan; Ahn, Tae-Young; Park, Dong Suk
2015-09-01
The aim of this study was to develop a SYBR Green-based real-time PCR assay for the rapid, specific, and sensitive detection of Acidovorax avenae subsp. citrulli, which causes bacterial fruit blotch (BFB), a serious disease of cucurbit plants. The molecular and serological methods currently available for the detection of this pathogen are insufficiently sensitive and specific. Thus, a novel SYBR Green-based real-time PCR assay targeting the YD-repeat protein gene of A. avenae subsp. citrulli was developed. The specificity of the primer set was evaluated using DNA purified from 6 isolates of A. avenae subsp. citrulli, 7 other Acidovorax species, and 22 of non-targeted strains, including pathogens and non-pathogens. The AC158F/R primer set amplified a single band of the expected size from genomic DNA obtained from the A. avenae subsp. citrulli strains but not from the genomic DNA of other Acidovorax species, including that of other bacterial genera. Using this assay, it was possible to detect at least one genomeequivalents of the cloned amplified target DNA using 5 × 10(0) fg/μl of purified genomic DNA per reaction or using a calibrated cell suspension, with 6.5 colony-forming units per reaction being employed. In addition, this assay is a highly sensitive and reliable method for identifying and quantifying the target pathogen in infected samples that does not require DNA extraction. Therefore, we suggest that this approach is suitable for the rapid and efficient diagnosis of A. avenae subsp. citrulli contaminations of seed lots and plants.
Two-temperature LATE-PCR endpoint genotyping
Directory of Open Access Journals (Sweden)
Reis Arthur H
2006-12-01
Full Text Available Abstract Background In conventional PCR, total amplicon yield becomes independent of starting template number as amplification reaches plateau and varies significantly among replicate reactions. This paper describes a strategy for reconfiguring PCR so that the signal intensity of a single fluorescent detection probe after PCR thermal cycling reflects genomic composition. The resulting method corrects for product yield variations among replicate amplification reactions, permits resolution of homozygous and heterozygous genotypes based on endpoint fluorescence signal intensities, and readily identifies imbalanced allele ratios equivalent to those arising from gene/chromosomal duplications. Furthermore, the use of only a single colored probe for genotyping enhances the multiplex detection capacity of the assay. Results Two-Temperature LATE-PCR endpoint genotyping combines Linear-After-The-Exponential (LATE-PCR (an advanced form of asymmetric PCR that efficiently generates single-stranded DNA and mismatch-tolerant probes capable of detecting allele-specific targets at high temperature and total single-stranded amplicons at a lower temperature in the same reaction. The method is demonstrated here for genotyping single-nucleotide alleles of the human HEXA gene responsible for Tay-Sachs disease and for genotyping SNP alleles near the human p53 tumor suppressor gene. In each case, the final probe signals were normalized against total single-stranded DNA generated in the same reaction. Normalization reduces the coefficient of variation among replicates from 17.22% to as little as 2.78% and permits endpoint genotyping with >99.7% accuracy. These assays are robust because they are consistent over a wide range of input DNA concentrations and give the same results regardless of how many cycles of linear amplification have elapsed. The method is also sufficiently powerful to distinguish between samples with a 1:1 ratio of two alleles from samples comprised of
Directory of Open Access Journals (Sweden)
Yusuke Ohnishi
Full Text Available Allele-specific gene silencing by RNA interference (RNAi is therapeutically useful for specifically inhibiting the expression of disease-associated alleles without suppressing the expression of corresponding wild-type alleles. To realize such allele-specific RNAi (ASP-RNAi, the design and assessment of small interfering RNA (siRNA duplexes conferring ASP-RNAi is vital; however, it is also difficult. In a previous study, we developed an assay system to assess ASP-RNAi with mutant and wild-type reporter alleles encoding the Photinus and Renilla luciferase genes. In line with experiments using the system, we realized that it is necessary and important to enhance allele discrimination between mutant and corresponding wild-type alleles. Here, we describe the improvement of ASP-RNAi against mutant alleles carrying single nucleotide variations by introducing base substitutions into siRNA sequences, where original variations are present in the central position. Artificially mismatched siRNAs or short-hairpin RNAs (shRNAs against mutant alleles of the human Prion Protein (PRNP gene, which appear to be associated with susceptibility to prion diseases, were examined using this assessment system. The data indicates that introduction of a one-base mismatch into the siRNAs and shRNAs was able to enhance discrimination between the mutant and wild-type alleles. Interestingly, the introduced mismatches that conferred marked improvement in ASP-RNAi, appeared to be largely present in the guide siRNA elements, corresponding to the 'seed region' of microRNAs. Due to the essential role of the 'seed region' of microRNAs in their association with target RNAs, it is conceivable that disruption of the base-pairing interactions in the corresponding seed region, as well as the central position (involved in cleavage of target RNAs, of guide siRNA elements could influence allele discrimination. In addition, we also suggest that nucleotide mismatches at the 3'-ends of sense
An improved assay for the determination of Huntington`s disease allele size
Energy Technology Data Exchange (ETDEWEB)
Reeves, C.; Klinger, K.; Miller, G. [Intergrated Genetics, Framingham, MA (United States)
1994-09-01
The hallmark of Huntington`s disease (HD) is the expansion of a polymorphic (CAG)n repeat. Several methods have been published describing PCR amplification of this region. Most of these assays require a complex PCR reaction mixture to amplify this GC-rich region. A consistent problem with trinucleotide repeat PCR amplification is the presence of a number of {open_quotes}stutter bands{close_quotes} which may be caused by primer or amplicon slippage during amplification or insufficient polymerase processivity. Most assays for HD arbitrarily select a particular band for diagnostic purposes. Without a clear choice for band selection such an arbitrary selection may result in inconsistent intra- or inter-laboratory findings. We present an improved protocol for the amplification of the HD trinucleotide repeat region. This method simplifies the PCR reaction buffer and results in a set of easily identifiable bands from which to determine allele size. HD alleles were identified by selecting bands of clearly greater signal intensity. Stutter banding was much reduced thus permitting easy identification of the most relevant PCR product. A second set of primers internal to the CCG polymorphism was used in selected samples to confirm allele size. The mechanism of action of N,N,N trimethylglycine in the PCR reaction is not clear. It may be possible that the minimal isostabilizing effect of N,N,N trimethylglycine at 2.5 M is significant enough to affect primer specificity. The use of N,N,N trimethylglycine in the PCR reaction facilitated identification of HD alleles and may be appropriate for use in other assays of this type.
Stevens, Aaron J; Taylor, Millie G; Pearce, Frederick Grant; Kennedy, Martin A
2017-03-10
Loss of one allele during polymerase chain reaction (PCR) amplification of DNA, known as allelic dropout, can be caused by a variety of mechanisms. Allelic dropout during PCR may have profound implications for molecular diagnostic and research procedures that depend on PCR and assume biallelic amplification has occurred. Complete allelic dropout due to the combined effects of cytosine methylation and G-quadruplex formation was previously described for a differentially methylated region of the human imprinted gene, MEST We now demonstrate that this parent-of-origin specific allelic dropout can potentially occur at several other genomic regions that display genomic imprinting and have propensity for G-quadruplex formation, including AIM1 , BLCAP , DNMT1 , PLAGL1 , KCNQ1 , and GRB10 These findings demonstrate that systematic allelic dropout during PCR is a general phenomenon for regions of the genome where differential allelic methylation and G-quadruplex motifs coincide, and suggest that great care must be taken to ensure biallelic amplification is occurring in such situations. Copyright © 2017 Stevens et al.
QuASAR-MPRA: accurate allele-specific analysis for massively parallel reporter assays.
Kalita, Cynthia A; Moyerbrailean, Gregory A; Brown, Christopher; Wen, Xiaoquan; Luca, Francesca; Pique-Regi, Roger
2018-03-01
The majority of the human genome is composed of non-coding regions containing regulatory elements such as enhancers, which are crucial for controlling gene expression. Many variants associated with complex traits are in these regions, and may disrupt gene regulatory sequences. Consequently, it is important to not only identify true enhancers but also to test if a variant within an enhancer affects gene regulation. Recently, allele-specific analysis in high-throughput reporter assays, such as massively parallel reporter assays (MPRAs), have been used to functionally validate non-coding variants. However, we are still missing high-quality and robust data analysis tools for these datasets. We have further developed our method for allele-specific analysis QuASAR (quantitative allele-specific analysis of reads) to analyze allele-specific signals in barcoded read counts data from MPRA. Using this approach, we can take into account the uncertainty on the original plasmid proportions, over-dispersion, and sequencing errors. The provided allelic skew estimate and its standard error also simplifies meta-analysis of replicate experiments. Additionally, we show that a beta-binomial distribution better models the variability present in the allelic imbalance of these synthetic reporters and results in a test that is statistically well calibrated under the null. Applying this approach to the MPRA data, we found 602 SNPs with significant (false discovery rate 10%) allele-specific regulatory function in LCLs. We also show that we can combine MPRA with QuASAR estimates to validate existing experimental and computational annotations of regulatory variants. Our study shows that with appropriate data analysis tools, we can improve the power to detect allelic effects in high-throughput reporter assays. http://github.com/piquelab/QuASAR/tree/master/mpra. fluca@wayne.edu or rpique@wayne.edu. Supplementary data are available online at Bioinformatics. © The Author (2017). Published by
Directory of Open Access Journals (Sweden)
Ma Mingxiao
Full Text Available Sacbrood virus (SBV is a picorna-like virus that affects honey bees (Apis mellifera and results in the death of the larvae. Several procedures are available to detect Chinese SBV (CSBV in clinical samples, but not to estimate the level of CSBV infection. The aim of this study was develop an assay for rapid detection and quantification of this virus. Primers and probes were designed that were specific for CSBV structural protein genes. A TaqMan minor groove binder (MGB probe-based, fluorescence real-time quantitative PCR was established. The specificity, sensitivity and stability of the assay were assessed; specificity was high and there were no cross-reactivity with healthy larvae or other bee viruses. The assay was applied to detect CSBV in 37 clinical samples and its efficiency was compared with clinical diagnosis, electron microscopy observation, and conventional RT-PCR. The TaqMan MGB-based probe fluorescence real-time quantitative PCR for CSBV was more sensitive than other methods tested. This assay was a reliable, fast, and sensitive method that was used successfully to detect CSBV in clinical samples. The technology can provide a useful tool for rapid detection of CSBV. This study has established a useful protocol for CSBV testing, epidemiological investigation, and development of animal models.
Chae, H S; Park, G N; Kim, S H; Jo, H J; Kim, J T; Jeoung, H Y; An, D J; Kim, N H; Shin, B W; Kang, Y I; Chang, K S
2012-08-01
Isolation and identification of Cryptococcus neoformans and pathogenic yeast-like fungi from pigeon droppings has been taken for a long time and requires various nutrients for its growth. In this study, we attempted to establish a rapid direct identification method of Cr. neoformans from pigeon dropping samples by nested-PCR using internal transcribed spacer (ITS) CAP64 and CNLAC1 genes, polysaccharide capsule gene and laccase-associated gene to produce melanin pigment, respectively, which are common genes of yeasts. The ITS and CAP64 genes were amplified in all pathogenic yeasts, but CNLAC1 was amplified only in Cr. neoformans. The ITS gene was useful for yeast genotyping depending on nucleotide sequence. Homology of CAP64 genes among the yeasts were very high. The specificity of PCR using CNLAC1 was demonstrated in Cr. neoformans environmental strains but not in other yeast-like fungi. The CNLAC1 gene was detected in 5 serotypes of Cr. neoformans. The nested-PCR amplified up to 10(-11) μg of the genomic DNA and showed high sensitivity. All pigeon droppings among 31 Cr. neoformans-positive samples were positive and all pigeon droppings among 348 Cr. neoformans-negative samples were negative by the direct nested-PCR. In addition, after primary enrichment of pigeon droppings in Sabouraud dextrose broth, all Cr. neoformans-negative samples were negative by the nested-PCR, which showed high specificity. The nested-PCR showed high sensitivity without culture of pigeon droppings. Nested-PCR using CNLAC1 provides a rapid and reliable molecular diagnostic method to overcome weak points such as long culture time of many conventional methods.
Directory of Open Access Journals (Sweden)
Touseef Hussain
2018-05-01
Full Text Available Phytophthora infestans (mont de Bary is a pathogen of great concern across the globe, and accurate detection is an important component in responding to the outbreaks of potential disease. Although the molecular diagnostic protocol used in regulatory programs has been evaluated but till date methods implying direct comparison has rarely used. In this study, a known area soil samples from potato fields where light blight appear every year (both A1 and A2 mating type was assayed by soil bait method, PCR assay detection and quantification of the inoculums. Suspected disease symptoms appeared on bait tubers were further confirmed by rapid PCR, inoculums were quantified through Real Time PCR, which confirms presence of P. infestans. These diagnostic methods can be highly correlated with one another. Potato tuber baiting increased the sensitivity of the assay compared with direct extraction of DNA from tuber and soil samples. Our study determines diagnostic sensitivity and specificity of the assays to determine the performance of each method. Overall, molecular techniques based on different types of PCR amplification and Real-time PCR can lead to high throughput, faster and more accurate detection method which can be used in quarantine programmes in potato industry and diagnostic laboratory.
Directory of Open Access Journals (Sweden)
Véronique Bolduc
2014-01-01
Full Text Available Congenital muscular dystrophy type Ullrich (UCMD is a severe disorder of early childhood onset for which currently there is no effective treatment. UCMD commonly is caused by dominant-negative mutations in the genes coding for collagen type VI, a major microfibrillar component of the extracellular matrix surrounding the muscle fibers. To explore RNA interference (RNAi as a potential therapy for UCMD, we designed a series of small interfering RNA (siRNA oligos that specifically target the most common mutations resulting in skipping of exon 16 in the COL6A3 gene and tested them in UCMD-derived dermal fibroblasts. Transcript analysis by semiquantitative and quantitative reverse transcriptase PCR showed that two of these siRNAs were the most allele-specific, i.e., they efficiently knocked down the expression from the mutant allele, without affecting the normal allele. In HEK293T cells, these siRNAs selectively suppressed protein expression from a reporter construct carrying the mutation, with no or minimal suppression of the wild-type (WT construct, suggesting that collagen VI protein levels are as also reduced in an allele-specific manner. Furthermore, we found that treating UCMD fibroblasts with these siRNAs considerably improved the quantity and quality of the collagen VI matrix, as assessed by confocal microscopy. Our current study establishes RNAi as a promising molecular approach for treating dominant COL6-related dystrophies.
Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun
2016-07-07
To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and
Létant, Sonia E; Murphy, Gloria A; Alfaro, Teneile M; Avila, Julie R; Kane, Staci R; Raber, Ellen; Bunt, Thomas M; Shah, Sanjiv R
2011-09-01
In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real-time PCR analysis is conducted on samples before and after incubation. The method, referred to as rapid-viability (RV)-PCR, uses the change in cycle threshold after incubation to detect the presence of live organisms. In this article, we report a novel RV-PCR method for detection of live, virulent Bacillus anthracis, in which the incubation time was reduced from 14 h to 9 h, bringing the total turnaround time for results below 15 h. The method incorporates a magnetic bead-based DNA extraction and purification step prior to PCR analysis, as well as specific real-time PCR assays for the B. anthracis chromosome and pXO1 and pXO2 plasmids. A single laboratory verification of the optimized method applied to the detection of virulent B. anthracis in environmental samples was conducted and showed a detection level of 10 to 99 CFU/sample with both manual and automated RV-PCR methods in the presence of various challenges. Experiments exploring the relationship between the incubation time and the limit of detection suggest that the method could be further shortened by an additional 2 to 3 h for relatively clean samples.
[Analysis of allele dropout at TH01 locus in paternity testing].
Lai, Li; Shen, Xiao-li; Xue, Shi-jie; Hu, Jie
2013-10-01
To analyze allele dropout at TH01 locus in paternity testing in order to determine the accurate genotype. To use a two STR loci genotyping system to verify an abnormal genotype for the TH01 locus with PCR using specific primers, cloning and DNA sequencing. A rare allele at TH01 locus named 5.2, which was undetectable with PowerPlex 21 system, was detected with an Identifiler system. Genetic variations may result in rare alleles and loci loss. To avoid misjudgment, laboratories should have a variety of methods for detecting loci loss.
Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K
2000-06-15
Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.
Roffler, Stefan; Stirnweis, Daniel; Treier, Georges; Herren, Gerhard; Korol, Abraham B.; Wicker, Thomas
2015-01-01
In cereals, several mildew resistance genes occur as large allelic series; for example, in wheat (Triticum aestivum and Triticum turgidum), 17 functional Pm3 alleles confer agronomically important race-specific resistance to powdery mildew (Blumeria graminis). The molecular basis of race specificity has been characterized in wheat, but little is known about the corresponding avirulence genes in powdery mildew. Here, we dissected the genetics of avirulence for six Pm3 alleles and found that three major Avr loci affect avirulence, with a common locus_1 involved in all AvrPm3-Pm3 interactions. We cloned the effector gene AvrPm3a2/f2 from locus_2, which is recognized by the Pm3a and Pm3f alleles. Induction of a Pm3 allele-dependent hypersensitive response in transient assays in Nicotiana benthamiana and in wheat demonstrated specificity. Gene expression analysis of Bcg1 (encoded by locus_1) and AvrPm3 a2/f2 revealed significant differences between isolates, indicating that in addition to protein polymorphisms, expression levels play a role in avirulence. We propose a model for race specificity involving three components: an allele-specific avirulence effector, a resistance gene allele, and a pathogen-encoded suppressor of avirulence. Thus, whereas a genetically simple allelic series controls specificity in the plant host, recognition on the pathogen side is more complex, allowing flexible evolutionary responses and adaptation to resistance genes. PMID:26452600
Directory of Open Access Journals (Sweden)
Melissa D Lage
Full Text Available Primary Hyperoxaluria Type 1 (PH1 is a rare autosomal recessive kidney stone disease caused by deficiency of the peroxisomal enzyme alanine: glyoxylate aminotransferase (AGT, which is involved in glyoxylate detoxification. Over 75 different missense mutations in AGT have been found associated with PH1. While some of the mutations have been found to affect enzyme activity, stability, and/or localization, approximately half of these mutations are completely uncharacterized. In this study, we sought to systematically characterize AGT missense mutations associated with PH1. To facilitate analysis, we used two high-throughput yeast-based assays: one that assesses AGT specific activity, and one that assesses protein stability. Approximately 30% of PH1-associated missense mutations are found in conjunction with a minor allele polymorphic variant, which can interact to elicit complex effects on protein stability and trafficking. To better understand this allele interaction, we functionally characterized each of 34 mutants on both the major (wild-type and minor allele backgrounds, identifying mutations that synergize with the minor allele. We classify these mutants into four distinct categories depending on activity/stability results in the different alleles. Twelve mutants were found to display reduced activity in combination with the minor allele, compared with the major allele background. When mapped on the AGT dimer structure, these mutants reveal localized regions of the protein that appear particularly sensitive to interactions with the minor allele variant. While the majority of the deleterious effects on activity in the minor allele can be attributed to synergistic interaction affecting protein stability, we identify one mutation, E274D, that appears to specifically affect activity when in combination with the minor allele.
Meylan, Sylvain; Robert, Daniel; Estrade, Christine; Grimbuehler, Valérie; Péter, Olivier; Meylan, Pascal R; Sahli, Roland
2008-02-01
HSV-1 and HSV-2 cause CNS infections of dissimilar clinico-pathological characteristics with prognostic and therapeutic implications. To validate a type-specific real-time PCR that uses MGB/LNA Taqman probes and to review the virologico-clinical data of 25 eligible patients with non-neonatal CNS infections. This real-time PCR was evaluated against conventional PCR (26 CSF and 20 quality controls), and LightCycler assay (51 mucocutaneous, 8 CSF and 32 quality controls) and culture/immunofluorescence (75 mucocutaneous) to assess typing with independent methods. Taqman real-time PCR detected 240 HSV genomes per ml CSF, a level appropriate for the management of patients, and provided unambiguous typing for the 104 positive (62 HSV-1 and 42 HSV-2) out the 160 independent clinical samples tested. HSV type diagnosed by Taqman real-time PCR predicted final diagnosis (meningitis versus encephalitis/meningoencephalitis, p<0.001) in 24/25 patients at time of presentation, in contrast to clinical evaluation. Our real-time PCR, as a sensitive and specific means for type-specific HSV diagnosis, provided rapid prognostic information for patient management.
Allele specific LAMP- gold nanoparticle for characterization of single nucleotide polymorphisms
Directory of Open Access Journals (Sweden)
Fábio Ferreira Carlos
2017-12-01
Full Text Available Due to their relevance as disease biomarkers and for diagnostics, screening of single nucleotide polymorphism (SNPs requires simple and straightforward strategies capable to provide results in medium throughput settings. Suitable approaches relying on isothermal amplification techniques have been evolving to substitute the cumbersome and highly specialized PCR amplification detection schemes. Nonetheless, identification of an individualâs genotype still requires sophisticated equipment and laborious methods.Here, we present a low-cost and reliable approach based on the allele specific loop-mediated isothermal amplification (AS-LAMP coupled to ssDNA functionalized gold nanoparticle (Au-nanoprobe colorimetric sequence discrimination. The Au-nanoprobe integration allows for the colorimetric detection of AS-LAMP amplification product that can be easily interpreted in less than 15Â min. We targeted a clinical relevant SNP responsible for lactose intolerance (-13910C/T dbSNP rs#: 4988235 to demonstrate its proof of concept and full potential of this novel approach. Keywords: SNP, Isothermal amplification, Gold nanoparticles, Gold nanoprobes, Lactose intolerance
Enhanced low-template DNA analysis conditions and investigation of allele dropout patterns.
Hedell, Ronny; Dufva, Charlotte; Ansell, Ricky; Mostad, Petter; Hedman, Johannes
2015-01-01
Forensic DNA analysis applying PCR enables profiling of minute biological samples. Enhanced analysis conditions can be applied to further push the limit of detection, coming with the risk of visualising artefacts and allele imbalances. We have evaluated the consecutive increase of PCR cycles from 30 to 35 to investigate the limitations of low-template (LT) DNA analysis, applying the short tandem repeat (STR) analysis kit PowerPlex ESX 16. Mock crime scene DNA extracts of four different quantities (from around 8-84 pg) were tested. All PCR products were analysed using 5, 10 and 20 capillary electrophoresis (CE) injection seconds. Bayesian models describing allele dropout patterns, allele peak heights and heterozygote balance were developed to assess the overall improvements in EPG quality with altered PCR/CE settings. The models were also used to evaluate the impact of amplicon length, STR marker and fluorescent label on the risk for allele dropout. The allele dropout probability decreased for each PCR cycle increment from 30 to 33 PCR cycles. Irrespective of DNA amount, the dropout probability was not affected by further increasing the number of PCR cycles. For the 42 and 84 pg samples, mainly complete DNA profiles were generated applying 32 PCR cycles. For the 8 and 17 pg samples, the allele dropouts decreased from 100% using 30 cycles to about 75% and 20%, respectively. The results for 33, 34 and 35 PCR cycles indicated that heterozygote balance and stutter ratio were mainly affected by DNA amount, and not directly by PCR cycle number and CE injection settings. We found 32 and 33 PCR cycles with 10 CE injection seconds to be optimal, as 34 and 35 PCR cycles did not improve allele detection and also included CE saturation problems. We find allele dropout probability differences between several STR markers. Markers labelled with the fluorescent dyes CXR-ET (red in electropherogram) and TMR-ET (shown as black) generally have higher dropout risks compared with those
François, Patrice; Bonetti, Eve-Julie; Fankhauser, Carolina; Baud, Damien; Cherkaoui, Abdessalam; Schrenzel, Jacques; Harbarth, Stephan
2017-09-01
Escherichia coli sequence type 131 is increasingly described in severe hospital infections. We developed a rapid real-time allelic discrimination assay for the rapid identification of E. coli ST131 isolates. This rapid assay represents an affordable alternative to sequence-based strategies before completing characterization of potentially highly virulent isolates of E. coli. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Parida Manmohan
2008-01-01
Full Text Available Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Japanese encephalitis, West Nile, Yellow fever and alphavirus (Chikungunya. The feasibility of M-RT-PCR assay for clinical diagnosis was validated with 620 acute phase dengue patient sera samples of recent epidemics in India. The comparative evaluation vis a vis conventional virus isolation revealed higher sensitivity. None of the forty healthy serum samples screened in the present study revealed any amplification, thereby establishing specificity of the reported assay for dengue virus only. Conclusion These findings clearly suggested that M-RT-PCR assay reported in the present study is the rapid and cost-effective method for simultaneous detection as well as typing of the dengue virus in acute phase patient serum samples. Thus, the M-RT-PCR assay developed in this study will serve as a very useful tool for rapid diagnosis and typing of dengue infections in endemic areas.
PCR specific for Actinobacillus pleuropneumoniae serotype 3
DEFF Research Database (Denmark)
Zhou, L.; Jones, S.C.P.; Angen, Øystein
2008-01-01
, but the method has liminations, for example, cross-reactions between serotypes 3, 6, and 8. This study describes the development of a serotype 3-specific PCR, based on the capsule locus, which can be used in a multiplex format with the organism's specific gene apxIV. The PCR test was evaluated on 266 strains...
Directory of Open Access Journals (Sweden)
Badolo Athanase
2012-07-01
Full Text Available Abstract Background Malaria control relies heavily on treated bed nets and indoor residual spraying with pyrethroid insecticides. Unfortunately, the resistance to pyrethroid insecticides, mainly due to the kdr mutation, is spreading in the main malaria vector Anopheles gambiae s.l., decreasing the insecticides’ efficacy. To manage the insecticide resistance rapidly and flexibly, simple and effective tools for the early detection of resistant mosquitoes are needed. This study aimed to develop an allele-specific, loop-mediated, isothermal amplification (AS-LAMP method to detect the West African-type kdr mutation (kdr-w; L1014F in field-collected mosquitoes. Methods DNA fragments of the wild-type and the mutated kdr gene were used to select the primers and develop the method. The primers were designed with the mutation at the 5’ end of the backward inner primer (BIP. The AS-LAMP method was compared to the AS-PCR method using the genomic DNA of 120 field-collected mosquitoes. Results The AS-LAMP method could discriminate between the wild-type homozygote, the heterozygote, and the kdr-w homozygote within 75 min. The AS-LAMP method has the advantage of being faster and at least as sensitive and specific as the AS-PCR method. Conclusions The AS-LAMP method can be used to detect the kdr mutation for quick decision-making, even in less well-equipped laboratories.
Internal amplification control of PCR for the Glu1-Dx5 allele in wheat.
Heim, H N; Vieira, E S N; Polo, L R T; Lima, N K; Silva, G J; Linde, G A; Colauto, N B; Schuster, I
2017-08-17
One of the limiting factors in using dominant markers is the unique amplification of the target fragment. Therefore, failures in polymerase chain reaction (PCR) or non-amplifications can be interpreted as an absence of the allele. The possibility of false negatives implies in reduced efficiency in the selection process in genetic breeding programs besides the loss of valuable genetic material. Thus, this study aimed to evaluate the viability of a microsatellite marker as an internal amplification control with a dominant marker for the wheat Glu1-Dx5 gene. A population of 77 wheat cultivars/breeding lines was analyzed. Fourteen microsatellite markers were analyzed in silico regarding the formation of dimers and clamps. The biplex reaction conditions were optimized, and the Xbarc117 marker was selected as the internal amplification control with a Glu1-Dx5 marker in wheat. It was concluded that the Xbarc117 microsatellite marker was effective in the simultaneous amplification with a dominant Glu1-Dx5 marker, making biplex PCR viable in wheat for the studied markers.
A silent allele in the locus D5S818 contained within the PowerPlex®21 PCR Amplification Kit.
Chen, Ling; Tai, Yunchun; Qiu, Pingming; Du, Weian; Liu, Chao
2015-11-01
Three paternity tests cases were found with a single locus mismatch at the locus D5S818 with PowerPlex®21 PCR Amplification Kit (Promega). Forward and reverse primers were redesigned to type the samples again and to evaluate if there were alleles dropped out. The results showed the existence of a silent allele 12 in all the three families, due to a point mutation that changed cytosine to adenine at 90 nucleotides upstream from the 5' end of the AGAT repeat sequences in all the six individuals. A single locus mismatch due to a silent allele may occur in any locus using any kit. Therefore, we recommend using multiple kits to confirm the results in paternity testing cases with mismatches, especially when there is a single locus mismatch with homozygote involved. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Ambagala, A; Fisher, M; Goolia, M; Nfon, C; Furukawa-Stoffer, T; Ortega Polo, R; Lung, O
2017-10-01
Foot-and-mouth disease (FMD) is a highly contagious viral disease of cloven-hoofed animals, which can decimate the livestock industry and economy of countries previously free of this disease. Rapid detection of foot-and-mouth disease virus (FMDV) is critical to containing an FMD outbreak. Availability of a rapid, highly sensitive and specific, yet simple and field-deployable assay would support local decision-making during an FMDV outbreak. Here we report validation of a novel reverse transcription-insulated isothermal PCR (RT-iiPCR) assay that can be performed on a commercially available, compact and portable POCKIT ™ analyser that automatically analyses data and displays '+' or '-' results. The FMDV RT-iiPCR assay targets the 3D region of the FMDV genome and was capable of detecting 9 copies of in vitro-transcribed RNA standard with 95% confidence. It accurately identified 63 FMDV strains belonging to all seven serotypes and showed no cross-reactivity with viruses causing similar clinical diseases in cloven-hoofed animals. The assay was able to identify FMDV RNA in multiple sample types including oral, nasal and lesion swabs, epithelial tissue suspensions, vesicular and oral fluid samples, even before the appearance of clinical signs. Clinical sensitivity of the assay was comparable or slightly higher than the laboratory-based real-time RT-PCR assay in use. The assay was able to detect FMDV RNA in vesicular fluid samples without nucleic acid extraction. For RNA extraction from more complex sample types, a commercially available taco ™ mini transportable magnetic bead-based, automated extraction system was used. This assay provides a potentially useful field-deployable diagnostic tool for rapid detection of FMDV in an outbreak in FMD-free countries or for routine diagnostics in endemic countries with less structured laboratory systems. © 2016 Her Majesty the Queen in Right of Canada.
JAK2V617F mutation is associated with special alleles in essential thrombocythemia.
Hsiao, Hui-Hua; Liu, Yi-Chang; Tsai, Hui-Jen; Lee, Ching-Ping; Hsu, Jui-Feng; Lin, Sheng-Fung
2011-03-01
Janus kinase 2 mutation (JAK2V617F) has been identified in myeloproliferative neoplasms. Furthermore, special single nucleoside polymorphisms (SNPs) have been found to be associated with the JAK2V617F mutation. Therefore, the associations among JAK2V617F and special SNPs and the allelic location between them were investigated in patients with essential thrombocythemia (ET). A total of 61 patients with ET and 106 healthy individuals were enrolled. The PCR-RFLP method was applied to investigate the pattern of three SNPs, rs10974944, rs12343867, and rs12340895. Allele-specific PCR was used to examine the allelic location between rs10974944 and JAK2V617F. Among the patients with ET, 34 (55.7%, 34/61) were JAK2V617F positive (heterozygous) while the other 27 (44.3%, 27/61) were negative, and there were no MPLW515L/K mutations noted. The pattern of special SNPs in JAK2V617F(+) was significantly different from that in normal individuals (p <0.05), while there was no difference between JAK2V617F(-) patients and normal individuals. Allele-specific PCR showed high association of a cis-location between the special G-allele of rs10974944 and JAK2V617F(+). Based on this small numbered study, the results show the association between special SNPs and JAK2V617F mutation and a cis-location between the special G-allelic form of rs10974944 and the JAK2V617F mutation. These data highlight a close relationship between them in patients with ET.
Walsh, Thomas J; Wissel, Mark C; Grantham, Kevin J; Petraitiene, Ruta; Petraitis, Vidmantas; Kasai, Miki; Francesconi, Andrea; Cotton, Margaret P; Hughes, Johanna E; Greene, Lora; Bacher, John D; Manna, Pradip; Salomoni, Martin; Kleiboeker, Steven B; Reddy, Sushruth K
2011-12-01
Diagnosis of invasive pulmonary aspergillosis (IPA) remains a major challenge to clinical microbiology laboratories. We developed rapid and sensitive quantitative PCR (qPCR) assays for genus- and species-specific identification of Aspergillus infections by use of TaqMan technology. In order to validate these assays and understand their potential diagnostic utility, we then performed a blinded study of bronchoalveolar lavage (BAL) fluid specimens from well-characterized models of IPA with the four medically important species. A set of real-time qPCR primers and probes was developed by utilizing unique ITS1 regions for genus- and species-specific detection of the four most common medically important Aspergillus species (Aspergillus fumigatus, A. flavus, A. niger, and A. terreus). Pan-Aspergillus and species-specific qPCRs with BAL fluid were more sensitive than culture for detection of IPA caused by A. fumigatus in untreated (P < 0.0007) and treated (P ≤ 0.008) animals, respectively. For infections caused by A. terreus and A. niger, culture and PCR amplification from BAL fluid yielded similar sensitivities for untreated and treated animals. Pan-Aspergillus PCR was more sensitive than culture for detection of A. flavus in treated animals (P = 0.002). BAL fluid pan-Aspergillus and species-specific PCRs were comparable in sensitivity to BAL fluid galactomannan (GM) assay. The copy numbers from the qPCR assays correlated with quantitative cultures to determine the pulmonary residual fungal burdens in lung tissue. Pan-Aspergillus and species-specific qPCR assays may improve the rapid and accurate identification of IPA in immunocompromised patients.
Zhang, Jing; Hung, Guo-Chiuan; Nagamine, Kenjiro; Li, Bingjie; Tsai, Shien; Lo, Shyh-Ching
2016-01-01
Culture-based identification methods have been the gold standard for the diagnosis of fungal infection. Currently, molecular technologies such as real-time PCR assays with short turnaround time can provide desirable alternatives for the rapid detection of Candida microbes. However, most of the published PCR primer sets are not Candida specific and likely to amplify DNA from common environmental contaminants, such as Aspergillus microbes. In this study, we designed pan-Candida primer sets based on the ribosomal DNA-coding regions conserved within Candida but distinct from those of Aspergillus and Penicillium. We demonstrate that the final two selected pan-Candida primer sets would not amplify Aspergillus DNA and could be used to differentiate eight medically important Candida pathogens in real-time PCR assays based on their melting profiles, with a sensitivity of detection as low as 10 fg of Candida genomic DNA. Moreover, we further evaluated and selected species-specific primer sets covering Candida albicans, Candida glabrata, Candida tropicalis, and Candida dubliniensis and show that they had high sensitivity and specificity. These real-time PCR primer sets could potentially be assembled into a single PCR array for the rapid detection of Candida species in various clinical settings, such as corneal transplantation.
Directory of Open Access Journals (Sweden)
Henrich Birgit
2008-04-01
Full Text Available Abstract Background Infection due to Chlamydia trachomatis is the most common sexually transmitted bacterial disease of global health significance, and especially the L-serovars causing lymphogranuloma venereum are increasingly being found in Europe in men who have sex with men. Results The design and evaluation of a rapid, multiplex, real-time PCR targeting the major outer membrane protein (omp-1 -gene and a L-serovar-specific region of the polymorphic protein H (pmp-H -gene for the detection of Chlamydia trachomatis is reported here. The PCR takes place as a single reaction with an internal control. For L1-, L2- and L3-serovar differentiation a second set of real-time PCRs was evaluated based on the amplification of serovar-specific omp-1-regions. The detection limit of each real-time PCR, multiplexed or not, was 50 genome copies per reaction with an efficiency ranging from 90,5–95,2%. In a retrospective analysis of 50 ocular, rectal and urogenital specimens formerly tested to be positive for C. trachomatis we identified six L2-serovars in rectal specimens of HIV-positive men, one in a double-infection with L3, and one L2 in a urethral specimen of an HIV-negative male. Conclusion This unique real-time PCR is specific and convenient for the rapid routine-diagnostic detection of lymphogranuloma venereum-associated L-serovars and enables the subsequent differentiation of L1, L2 and L3 for epidemiologic studies.
Schaeffer, Anke; Henrich, Birgit
2008-01-01
Background Infection due to Chlamydia trachomatis is the most common sexually transmitted bacterial disease of global health significance, and especially the L-serovars causing lymphogranuloma venereum are increasingly being found in Europe in men who have sex with men. Results The design and evaluation of a rapid, multiplex, real-time PCR targeting the major outer membrane protein (omp-1) -gene and a L-serovar-specific region of the polymorphic protein H (pmp-H) -gene for the detection of Chlamydia trachomatis is reported here. The PCR takes place as a single reaction with an internal control. For L1-, L2- and L3-serovar differentiation a second set of real-time PCRs was evaluated based on the amplification of serovar-specific omp-1-regions. The detection limit of each real-time PCR, multiplexed or not, was 50 genome copies per reaction with an efficiency ranging from 90,5–95,2%. In a retrospective analysis of 50 ocular, rectal and urogenital specimens formerly tested to be positive for C. trachomatis we identified six L2-serovars in rectal specimens of HIV-positive men, one in a double-infection with L3, and one L2 in a urethral specimen of an HIV-negative male. Conclusion This unique real-time PCR is specific and convenient for the rapid routine-diagnostic detection of lymphogranuloma venereum-associated L-serovars and enables the subsequent differentiation of L1, L2 and L3 for epidemiologic studies. PMID:18447917
Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR
Directory of Open Access Journals (Sweden)
Hansson Per
2005-11-01
Full Text Available Abstract Background Gremmeniella abietina (Lagerb. Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities.
Integration of nanoparticle cell lysis and microchip PCR for one-step rapid detection of bacteria.
Wan, Weijie; Yeow, John T W
2012-04-01
This paper describes an integrated microchip system as an efficient and cost-effective solution involving Nanotechnology and Lab-on-a-Chip technology for the rapid detection of bacteria. The system is based on using surface-modified gold nanoparticles for efficient cell lysis followed by microchip PCR without having to remove the nanoparticles from the PCR solution. Poly(quaternary ammonium) modified gold nanoparticles are used to provide a novel and efficient cell lysis method without the need to go through time-consuming, expensive and complicated microfabrication processes as most of current cell lysis methods for Lab-on-a-Chip applications do. It also facilitates the integration of cell lysis and PCR by sharing the same reaction chamber as PCR uses. It is integrated with a prototype microchip PCR system consisting of a physical microchip PCR device and an automated temperature control mechanism. The research work explores solutions for the problem of PCR inhibition caused by gold nanoparticles as well as for the problem of non-specific PCR amplification in the integrated microchip system. It also explores the possibility of greatly reducing PCR cycling time to achieve the same result compared to the protocol for a regular PCR machine. The simplicity of the setup makes it easy to be integrated with other Lab-on-a-Chip functional modules to create customized solutions for target applications.
Target-Specific Assay for Rapid and Quantitative Detection of Mycobacterium chimaera DNA.
Zozaya-Valdés, Enrique; Porter, Jessica L; Coventry, John; Fyfe, Janet A M; Carter, Glen P; Gonçalves da Silva, Anders; Schultz, Mark B; Seemann, Torsten; Johnson, Paul D R; Stewardson, Andrew J; Bastian, Ivan; Roberts, Sally A; Howden, Benjamin P; Williamson, Deborah A; Stinear, Timothy P
2017-06-01
Mycobacterium chimaera is an opportunistic environmental mycobacterium belonging to the Mycobacterium avium - M. intracellulare complex. Although most commonly associated with pulmonary disease, there has been growing awareness of invasive M. chimaera infections following cardiac surgery. Investigations suggest worldwide spread of a specific M. chimaera clone, associated with contaminated hospital heater-cooler units used during the surgery. Given the global dissemination of this clone, its potential to cause invasive disease, and the laboriousness of current culture-based diagnostic methods, there is a pressing need to develop rapid and accurate diagnostic assays specific for M. chimaera Here, we assessed 354 mycobacterial genome sequences and confirmed that M. chimaera is a phylogenetically coherent group. In silico comparisons indicated six DNA regions present only in M. chimaera We targeted one of these regions and developed a TaqMan quantitative PCR (qPCR) assay for M. chimaera with a detection limit of 100 CFU/ml in whole blood spiked with bacteria. In vitro screening against DNA extracted from 40 other mycobacterial species and 22 bacterial species from 21 diverse genera confirmed the in silico -predicted specificity for M. chimaera Screening 33 water samples from heater-cooler units with this assay highlighted the increased sensitivity of PCR compared to culture, with 15 of 23 culture-negative samples positive by M. chimaera qPCR. We have thus developed a robust molecular assay that can be readily and rapidly deployed to screen clinical and environmental specimens for M. chimaera . Copyright © 2017 American Society for Microbiology.
Saito, Takahiro; Kikuchi, Aoi; Kaneko, Akira; Isozumi, Rie; Teramoto, Isao; Kimura, Masatsugu; Hirasawa, Noriyasu; Hiratsuka, Masahiro
2018-06-01
Malaria is caused by five species of Plasmodium in humans. Microscopy is currently used for pathogen detection, requiring considerable training and technical expertise as the parasites are often difficult to differentiate morphologically. Rapid diagnostic tests are as reliable as microscopy and offer faster diagnoses but possess lower detection limits and are incapable of distinguishing among the parasitic species. To improve global health efforts towards malaria control, a rapid, sensitive, species-specific, and economically viable diagnostic method is needed. In this study, we designed a malaria diagnostic method involving a multiplex single-tube nested PCR targeting Plasmodium mitochondrial cytochrome c oxidase III and single-stranded tag hybridization chromatographic printed-array strip. The detection sensitivity was found to be at least 40 times higher than that of agarose gel electrophoresis with ethidium bromide. This system also enables the identification of both single- and mixed-species malaria infections. The assay was validated with 152 Kenyan samples; using nested PCR as the standard, the assay's sensitivity and specificity were 88.7% and 100.0%, respectively. The turnaround time required, from PCR preparation to signal detection, is 90min. Our method should improve the diagnostic speed, treatment efficacy, and control of malaria, in addition to facilitating surveillance within global malaria eradication programs. Copyright © 2018 Elsevier B.V. All rights reserved.
Benitez, Alvaro J; Winchell, Jonas M
2016-04-01
We developed a single tube multiplex real-time PCR assay that allows for the rapid detection and typing of 9 nonpneumophila Legionella spp. isolates that are clinically relevant. The multiplex assay is capable of simultaneously detecting and discriminating L. micdadei, L. bozemanii, L. dumoffii, L. longbeachae, L. feeleii, L. anisa, L. parisiensis, L. tucsonensis serogroup (sg) 1 and 3, and L. sainthelensis sg 1 and 2 isolates. Evaluation of the assay with nucleic acid from each of these species derived from both clinical and environmental isolates and typing strains demonstrated 100% sensitivity and 100% specificity when tested against 43 other Legionella spp. Typing of L. anisa, L. parisiensis, and L. tucsonensis sg 1 and 3 isolates was accomplished by developing a real-time PCR assay followed by high-resolution melt (HRM) analysis targeting the ssrA gene. Further typing of L. bozemanii, L. longbeachae, and L. feeleii isolates to the serogroup level was accomplished by developing a real-time PCR assay followed by HRM analysis targeting the mip gene. When used in conjunction with other currently available diagnostic tests, these assays may aid in rapidly identifying specific etiologies associated with Legionella outbreaks, clusters, sporadic cases, and potential environmental sources. Published by Elsevier Inc.
[Cloning and sequencing of KIR2DL1 framework gene cDNA and identification of a novel allele].
Sun, Ge; Wang, Chang; Zhen, Jianxin; Zhang, Guobin; Xu, Yunping; Deng, Zhihui
2016-10-01
To develop an assay for cDNA cloning and haplotype sequencing of KIR2DL1 framework gene and determine the genotype of an ethnic Han from southern China. Total RNA was isolated from peripheral blood sample, and complementary DNA (cDNA) transcript was synthesized by RT-PCR. The entire coding sequence of the KIR2DL1 framework gene was amplified with a pair of KIR2DL1-specific PCR primers. The PCR products with a length of approximately 1.2 kb were then subjected to cloning and haplotype sequencing. A specific target fragment of the KIR2DL1 framework gene was obtained. Following allele separation, a wild-type KIR2DL1*00302 allele and a novel variant allele, KIR2DL1*031, were identified. Sequence alignment with KIR2DL1 alleles from the IPD-KIR Database showed that the novel allele KIR2DL1*031 has differed from the closest allele KIR2DL1*00302 by a non-synonymous mutation at CDS nt 188A>G (codon 42 GAG>GGG) in exon 4, which has caused an amino acid change Glu42Gly. The sequence of the novel allele KIR2DL1*031 was submitted to GenBank under the accession number KP025960 and to the IPD-KIR Database under the submission number IWS40001982. A name KIR2DL1*031 has been officially assigned by the World Health Organization (WHO) Nomenclature Committee. An assay for cDNA cloning and haplotype sequencing of KIR2DL1 has been established, which has a broad applications in KIR studies at allelic level.
Allele-specific cytokine responses at the HLA-C locus, implications for psoriasis
Hundhausen, Christian; Bertoni, Anna; Mak, Rose K; Botti, Elisabetta; Di Meglio, Paola; Clop, Alex; Laggner, Ute; Chimenti, Sergio; Hayday, Adrian C; Barker, Jonathan N; Trembath, Richard C; Capon, Francesca; Nestle, Frank O
2011-01-01
Psoriasis is an inflammatory skin disorder that is inherited as a complex trait. Genetic studies have repeatedly highlighted HLA-C as the major determinant for psoriasis susceptibility, with the Cw*0602 allele conferring significant disease risk in a wide-range of populations. Despite the potential importance of HLA-C variation in psoriasis, either via an effect on peptide presentation or immuno-inhibitory activity, allele-specific expression patterns have not been investigated. Here, we used reporter assays to characterize two regulatory variants, which virtually abolished the response to TNF-α (rs2524094) and IFN-γ (rs10657191) in HLA-Cw*0602 and a cluster of related alleles. We validated these findings through the analysis of HLA-Cw*0602 expression in primary keratinocytes treated with TNF-α and IFN-γ. Finally, we showed that HLA-Cw*0602 transcripts are not increased in psoriatic skin lesions, despite highly elevated TNF-α levels. Thus, our findings demonstrate the presence of allele-specific differences in HLA-C expression and indicate that HLA-Cw*0602 is unresponsive to up-regulation by key pro-inflammatory cytokines in psoriasis. These data pave the way for functional studies into the pathogenic role of the major psoriasis susceptibility allele. PMID:22113476
Allele-specific cytokine responses at the HLA-C locus: implications for psoriasis.
Hundhausen, Christian; Bertoni, Anna; Mak, Rose K; Botti, Elisabetta; Di Meglio, Paola; Clop, Alex; Laggner, Ute; Chimenti, Sergio; Hayday, Adrian C; Barker, Jonathan N; Trembath, Richard C; Capon, Francesca; Nestle, Frank O
2012-03-01
Psoriasis is an inflammatory skin disorder that is inherited as a complex trait. Genetic studies have repeatedly highlighted HLA-C as the major determinant for psoriasis susceptibility, with the Cw*0602 allele conferring significant disease risk in a wide range of populations. Despite the potential importance of HLA-C variation in psoriasis, either via an effect on peptide presentation or immuno-inhibitory activity, allele-specific expression patterns have not been investigated. Here, we used reporter assays to characterize two regulatory variants, which virtually abolished the response to tumor necrosis factor (TNF)-α (rs2524094) and IFN-γ (rs10657191) in HLA-Cw*0602 and a cluster of related alleles. We validated these findings through the analysis of HLA-Cw*0602 expression in primary keratinocytes treated with TNF-α and IFN-γ. Finally, we showed that HLA-Cw*0602 transcripts are not increased in psoriatic skin lesions, despite highly elevated TNF-α levels. Thus, our findings demonstrate the presence of allele-specific differences in HLA-C expression and indicate that HLA-Cw*0602 is unresponsive to upregulation by key proinflammatory cytokines in psoriasis. These data pave the way for functional studies into the pathogenic role of the major psoriasis susceptibility allele.
Directory of Open Access Journals (Sweden)
Jesus Perez-Losada
Full Text Available Genome-wide association studies (GWAS have been successful in finding associations between specific genetic variants and cancer susceptibility in human populations. These studies have identified a range of highly statistically significant associations between single nucleotide polymorphisms (SNPs and susceptibility to development of a range of human tumors. However, the effect of each SNP in isolation is very small, and all of the SNPs combined only account for a relatively minor proportion of the total genetic risk (5-10%. There is therefore a major requirement for alternative routes to the discovery of genetic risk factors for cancer. We have previously shown using mouse models that chromosomal regions harboring susceptibility genes identified by linkage analysis frequently exhibit allele-specific genetic alterations in tumors. We demonstrate here that the Fbxw7 gene, a commonly mutated gene in a wide range of mouse and human cancers, shows allele-specific deletions in mouse lymphomas and skin tumors. Lymphomas from three different F1 hybrids show 100% allele-specificity in the patterns of allelic loss. Parental alleles from 129/Sv or Spretus/Gla mice are lost in tumors from F1 hybrids with C57BL/6 animals, due to the presence of a specific non-synonymous coding sequence polymorphism at the N-terminal portion of the gene. A specific genetic test of association between this SNP and lymphoma susceptibility in interspecific backcross mice showed a significant linkage (p = 0.001, but only in animals with a functional p53 gene. These data therefore identify Fbxw7 as a p53-dependent tumor susceptibility gene. Increased p53-dependent tumor susceptibility and allele-specific losses were also seen in a mouse skin model of skin tumor development. We propose that analysis of preferential allelic imbalances in tumors may provide an efficient means of uncovering genetic variants that affect mouse and human tumor susceptibility.
Directory of Open Access Journals (Sweden)
Chang-Gi Back
2015-09-01
Full Text Available In this study, we developed a species-specific PCR assay for rapid and accurate detection of three Xanthomonas species, X. axonopodis pv. poinsettiicola (XAP, X. hyacinthi (XH and X. campestris pv. zantedeschiae (XCZ, based on their draft genome sequences. XAP, XH and XCZ genomes consist of single chromosomes that contain 5,221, 4,395 and 7,986 protein coding genes, respectively. Species-specific primers were designed from variable regions of the draft genome sequence data and assessed by a PCR-based detection method. These primers were also tested for specificity against 17 allied Xanthomonas species as well as against the host DNA and the microbial community of the host surface. Three primer sets were found to be very specific and no amplification product was obtained with the host DNA and the microbial community of the host surface. In addition, a detection limit of 1 pg/μl per PCR reaction was detected when these primer sets were used to amplify corresponding bacterial DNAs. Therefore, these primer sets and the developed species-specific PCR assay represent a valuable, sensitive, and rapid diagnostic tool that can be used to detect three specific pathogens at early stages of infection and may help control diseases.
A Rapid and Low-Cost PCR Thermal Cycler for Low Resource Settings.
Directory of Open Access Journals (Sweden)
Grace Wong
Full Text Available Many modern molecular diagnostic assays targeting nucleic acids are typically confined to developed countries or to the national reference laboratories of developing-world countries. The ability to make technologies for the rapid diagnosis of infectious diseases broadly available in a portable, low-cost format would mark a revolutionary step forward in global health. Many molecular assays are also developed based on polymerase chain reactions (PCR, which require thermal cyclers that are relatively heavy (>20 pounds and need continuous electrical power. The temperature ramping speed of most economical thermal cyclers are relatively slow (2 to 3 °C/s so a polymerase chain reaction can take 1 to 2 hours. Most of all, these thermal cyclers are still too expensive ($2k to $4k for low-resource setting uses.In this article, we demonstrate the development of a low-cost and rapid water bath based thermal cycler that does not require active temperature control or continuous power supply during PCR. This unit costs $130 to build using commercial off-the-shelf items. The use of two or three vacuum-insulated stainless-steel Thermos food jars containing heated water (for denaturation and annealing/extension steps and a layer of oil on top of the water allow for significantly stabilized temperatures for PCR to take place. Using an Arduino-based microcontroller, we automate the "archaic" method of hand-transferring PCR tubes between water baths.We demonstrate that this innovative unit can deliver high speed PCR (17 s per PCR cycle with the potential to go beyond the 1,522 bp long amplicons tested in this study and can amplify from templates down to at least 20 copies per reaction. The unit also accepts regular PCR tubes and glass capillary tubes. The PCR efficiency of our thermal cycler is not different from other commercial thermal cyclers. When combined with a rapid nucleic acid detection approach, the thermos thermal cycler (TTC can enable on-site molecular
Directory of Open Access Journals (Sweden)
Wang Zhen
2011-11-01
Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.
WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations
Directory of Open Access Journals (Sweden)
Assawamakin Anunchai
2007-08-01
Full Text Available Abstract Background Allele-specific (AS Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number
Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.
Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia
2014-01-01
The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.
Leach, L; Zhu, Y; Chaturvedi, S
2018-02-01
Candida auris is an emerging multidrug-resistant yeast causing invasive health care-associated infection with high mortality worldwide. Rapid identification of C. auris is of primary importance for the implementation of public health measures to control the spread of infection. To achieve these goals, we developed and validated a TaqMan-based real-time PCR assay targeting the internal transcribed spacer 2 ( ITS 2) region of the ribosomal gene. The assay was highly specific, reproducible, and sensitive, with the detection limit of 1 C. auris CFU/PCR. The performance of the C. auris real-time PCR assay was evaluated by using 623 surveillance samples, including 365 patient swabs and 258 environmental sponges. Real-time PCR yielded positive results from 49 swab and 58 sponge samples, with 89% and 100% clinical sensitivity with regard to their respective culture-positive results. The real-time PCR also detected C. auris DNA from 1% and 12% of swab and sponge samples with culture-negative results, indicating the presence of dead or culture-impaired C. auris The real-time PCR yielded results within 4 h of sample processing, compared to 4 to 14 days for culture, reducing turnaround time significantly. The new real-time PCR assay allows for accurate and rapid screening of C. auris and can increase effective control and prevention of this emerging multidrug-resistant fungal pathogen in health care facilities. Copyright © 2018 Leach et al.
Minguzzi, Stefano; Terlizzi, Federica; Lanzoni, Chiara; Poggi Pollini, Carlo; Ratti, Claudio
2016-01-01
Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum ('Ca. P. prunorum') detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor 'Ca. P. prunorum' infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect 'Ca. P. prunorum' and Plum pox virus (PPV) in Prunus.
PCR detection of potato cyst nematode.
Reid, Alex
2009-01-01
Potato cyst nematode (PCN) is responsible for losses in potato production totalling millions of euros every year in the EC. It is important for growers to know which species is present in their land as this determines its subsequent use. The two species Globodera pallida and Globodera rostochiensis can be differentiated using an allele-specific PCR.
Wilkes, Rebecca Penrose; Kania, Stephen A; Tsai, Yun-Long; Lee, Pei-Yu Alison; Chang, Hsiu-Hui; Ma, Li-Juan; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas
2015-07-01
Feline immunodeficiency virus (FIV) is an important infectious agent of cats. Clinical syndromes resulting from FIV infection include immunodeficiency, opportunistic infections, and neoplasia. In our study, a 5' long terminal repeat/gag region-based reverse transcription insulated isothermal polymerase chain reaction (RT-iiPCR) was developed to amplify all known FIV strains to facilitate point-of-need FIV diagnosis. The RT-iiPCR method was applied in a point-of-need PCR detection platform--a field-deployable device capable of generating automatically interpreted RT-iiPCR results from nucleic acids within 1 hr. Limit of detection 95% of FIV RT-iiPCR was calculated to be 95 copies standard in vitro transcription RNA per reaction. Endpoint dilution studies with serial dilutions of an ATCC FIV type strain showed that the sensitivity of lyophilized FIV RT-iiPCR reagent was comparable to that of a reference nested PCR. The established reaction did not amplify any nontargeted feline pathogens, including Felid herpesvirus 1, feline coronavirus, Feline calicivirus, Feline leukemia virus, Mycoplasma haemofelis, and Chlamydophila felis. Based on analysis of 76 clinical samples (including blood and bone marrow) with the FIV RT-iiPCR, test sensitivity was 97.78% (44/45), specificity was 100.00% (31/31), and agreement was 98.65% (75/76), determined against a reference nested-PCR assay. A kappa value of 0.97 indicated excellent correlation between these 2 methods. The lyophilized FIV RT-iiPCR reagent, deployed on a user-friendly portable device, has potential utility for rapid and easy point-of-need detection of FIV in cats. © 2015 The Author(s).
Wilkes, Rebecca P; Lee, Pei-Yu A; Tsai, Yun-Long; Tsai, Chuan-Fu; Chang, Hsiu-Hui; Chang, Hsiao-Fen G; Wang, Hwa-Tang T
2015-08-01
Canine parvovirus type 2 (CPV-2), including subtypes 2a, 2b and 2c, causes an acute enteric disease in both domestic and wild animals. Rapid and sensitive diagnosis aids effective disease management at points of need (PON). A commercially available, field-deployable and user-friendly system, designed with insulated isothermal PCR (iiPCR) technology, displays excellent sensitivity and specificity for nucleic acid detection. An iiPCR method was developed for on-site detection of all circulating CPV-2 strains. Limit of detection was determined using plasmid DNA. CPV-2a, 2b and 2c strains, a feline panleukopenia virus (FPV) strain, and nine canine pathogens were tested to evaluate assay specificity. Reaction sensitivity and performance were compared with an in-house real-time PCR using serial dilutions of a CPV-2b strain and 100 canine fecal clinical samples collected from 2010 to 2014, respectively. The 95% limit of detection of the iiPCR method was 13 copies of standard DNA and detection limits for CPV-2b DNA were equivalent for iiPCR and real-time PCR. The iiPCR reaction detected CPV-2a, 2b and 2c and FPV. Non-targeted pathogens were not detected. Test results of real-time PCR and iiPCR from 99 fecal samples agreed with each other, while one real-time PCR-positive sample tested negative by iiPCR. Therefore, excellent agreement (k = 0.98) with sensitivity of 98.41% and specificity of 100% in detecting CPV-2 in feces was found between the two methods. In conclusion, the iiPCR system has potential to serve as a useful tool for rapid and accurate PON, molecular detection of CPV-2. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Feng, Qin; Gai, Fei; Sang, Yaxiong; Zhang, Jie; Wang, Ping; Wang, Yue; Liu, Bing; Lin, Dongmei; Yu, Yang; Fang, Jian
2018-01-01
The AURA3 clinical trial has shown that advanced non-small cell lung cancer (NSCLC) patients with EGFR T790M mutations in circulating tumor DNA (ctDNA) could benefit from osimertinib. The aim of this study was to assess the usefulness of QuantStudio™ 3D Digital PCR System platform for the detection of plasma EGFR T790M mutations in NSCLC patients, and compare the performances of 3D Digital PCR and ARMS-PCR. A total of 119 Chinese patients were enrolled in this study. Mutant allele frequency of plasma EGFR T790M was detected by 3D Digital PCR, then 25 selected samples were verified by ARMS-PCR and four of them were verified by next generation sequencing (NGS). In total, 52.94% (69/119) had EGFR T790M mutations detected by 3D Digital PCR. In 69 positive samples, the median mutant allele frequency (AF) was 1.09% and three cases presented low concentration (AF Digital PCR) was identified as T790M- by ARMS-PCR. Four samples were identified as T790M+ by both NGS and 3D Digital PCR, and typically three samples (3/4) presented at a low ratio (AF Digital PCR is a novel method with high sensitivity and specificity to detect EGFR T790M mutation in plasma.
PCR approach for rapid detection of Escherichia coli in tempe using a specific primer
Directory of Open Access Journals (Sweden)
Siti Harnina Bintari
2014-12-01
Full Text Available Tempe known as a traditional fermented food originated from Indonesia. It has a unique flavour and texture. It also contains high protein and usually serves to substitute meat, fish, or egg as a complement to rice. The manufacture process of Tempe is quite complex and mostly, the traditional process has not employed the hygienic standard. In the process of Tempe making, there are two critical stages of the whole process; i.e. soaking of soybeans and solid state fermentation by Rhizopus sp. During the process, foodborne pathogen bacteria such as Escherichia coli could contaminate the product of Tempe. The bacterial contamination could be revealed through culture dependent methods which is costly, laborious, and time consuming. Therefore, the culture-independent method such as polymerase chain reaction using a specific primer could be applied to detect target microorganism to save time and labour. In this study, thirty-one Tempe samples collected from different manufacturers in Semarang, Central Java, Indonesia were analysed by PCR. In order to obtain the bacterial genomic DNA, a modified Chelex 100-Microwave method was employed. The results of DNA extraction showed that the method was an applicable method. It gave high quantity and quality of DNA; therefore, it could be applied in the PCR reaction. The DNA samples were employed in PCR for detection of Escherichia coli using Ecoli706F/R. It was found that 27 out of 31 samples were detected having Escherichia coli contamination showed by the presence of the amplified product size 706 bp. The application of this method could significantly reduce costs and time of analysis in the laboratory. Further response after E. coli were detected could be employed, including investigation of the critical factors in Tempe manufacturing process which allowed E. coli contamination.
Directory of Open Access Journals (Sweden)
Lingxiang Zhu
Full Text Available Bacterial strains resistant to various antibiotic drugs are frequently encountered in clinical infections, and the rapid identification of drug-resistant strains is highly essential for clinical treatment. We developed a locked nucleic acid (LNA-based quantitative real-time PCR (LNA-qPCR method for the rapid detection of 13 antibiotic resistance genes and successfully used it to distinguish drug-resistant bacterial strains from positive blood culture samples. A sequence-specific primer-probe set was designed, and the specificity of the assays was assessed using 27 ATCC bacterial strains and 77 negative blood culture samples. No cross-reaction was identified among bacterial strains and in negative samples, indicating 100% specificity. The sensitivity of the assays was determined by spiking each bacterial strain into negative blood samples, and the detection limit was 1-10 colony forming units (CFU per reaction. The LNA-qPCR assays were first applied to 72 clinical bacterial isolates for the identification of known drug resistance genes, and the results were verified by the direct sequencing of PCR products. Finally, the LNA-qPCR assays were used for the detection in 47 positive blood culture samples, 19 of which (40.4% were positive for antibiotic resistance genes, showing 91.5% consistency with phenotypic susceptibility results. In conclusion, LNA-qPCR is a reliable method for the rapid detection of bacterial antibiotic resistance genes and can be used as a supplement to phenotypic susceptibility testing for the early detection of antimicrobial resistance to allow the selection of appropriate antimicrobial treatment and to prevent the spread of resistant isolates.
Kletzel, Morris; Huang, Wei; Olszewski, Marie; Khan, Sana
2013-01-01
Post-hematopoietic stem cell transplantation (HSCT) chimerism monitoring is important to assess relapse and therapeutic intervention. The purpose of our study is to compare two methods variable number tandem repeats (VNTR) vs. quantitative real- time polymerase chain reaction (qPCR) in terms of determining chimerism. 127 (peripheral blood n=112, bone marrow n=15) samples were simultaneously tested by VNTR using APO-B, D1S80, D1S111, D17S30, gene loci SRY and ZP3 and qPCR using 34 assays (CA001-CA034) that are designed to a bi-allelic insertion/deletion (indel) polymorphism in the human genome. Samples were separated in three subsets: total WBC, T-cell and Myeloid cells. Extraction of DNA was performed then quantified. We analyzed column statistics, paired t-test and regression analysis for both methods. There was complete correlation between the two methods. The simplicity and rapidity of the test results from the qPCR method is more efficient and accurate to assess chimerism.
Marshall, S M; Melito, P L; Woodward, D L; Johnson, W M; Rodgers, F G; Mulvey, M R
1999-12-01
A rapid two-step identification scheme based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 16S rRNA gene was developed in order to differentiate isolates belonging to the Campylobacter, Arcobacter, and Helicobacter genera. For 158 isolates (26 reference cultures and 132 clinical isolates), specific RFLP patterns were obtained and species were successfully identified by this assay.
Energy Technology Data Exchange (ETDEWEB)
Alonso, S.; Castro, A.; Fernandez-Fernandez, I.; Pancorbo, M.M. de [Universidad del Pais Vasco, Vizcaya (Spain)
1997-02-01
Short VNTR alleles that go undetected after conventional Southern blot hybridization may constitute an alternative explanation for the heterozygosity deficiency observed at some minisatellite loci. To examine this hypothesis, we have employed a screening procedure based on PCR amplification of those individuals classified as homozygotes in our databases for the loci D1S7, D7S21, and D12S11. The results obtained indicate that the frequency of these short alleles is related to the heterozygosity deficiency observed. For the most polymorphic locus, D1S7, {approximately}60% of those individuals previously classified as homozygotes were in fact heterozygotes for a short allele. After the inclusion of these new alleles, the agreement between observed and expected heterozygosity, along with other statistical tests employed, provide additional evidence for lack of population substructuring. Comparisons of allele frequency distributions reveal greater differences between racial groups than between closely related populations. 45 refs., 3 figs., 6 tabs.
Blood grouping based on PCR methods and agarose gel electrophoresis.
Sell, Ana Maria; Visentainer, Jeane Eliete Laguila
2015-01-01
The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.
Directory of Open Access Journals (Sweden)
Feng Q
2018-01-01
(AF =1.09%, P7 (AF =2.09%, and P8 (AF =2.21%. It is worth mentioning that sample P9 (AF =2.05%, analyzed by 3D Digital PCR was identified as T790M- by ARMS-PCR. Four samples were identified as T790M+ by both NGS and 3D Digital PCR, and typically three samples (3/4 presented at a low ratio (AF <0.5%. Conclusion: Our study demonstrated that 3D Digital PCR is a novel method with high sensitivity and specificity to detect EGFR T790M mutation in plasma. Keywords: 3D Digital PCR, allele frequency, EGFR TKIs, resistance, osimertinib, erlotinib, gefitinib, icotinib
Simultaneous SNP identification and assessment of allele-specific bias from ChIP-seq data
Directory of Open Access Journals (Sweden)
Ni Yunyun
2012-09-01
Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs have been associated with many aspects of human development and disease, and many non-coding SNPs associated with disease risk are presumed to affect gene regulation. We have previously shown that SNPs within transcription factor binding sites can affect transcription factor binding in an allele-specific and heritable manner. However, such analysis has relied on prior whole-genome genotypes provided by large external projects such as HapMap and the 1000 Genomes Project. This requirement limits the study of allele-specific effects of SNPs in primary patient samples from diseases of interest, where complete genotypes are not readily available. Results In this study, we show that we are able to identify SNPs de novo and accurately from ChIP-seq data generated in the ENCODE Project. Our de novo identified SNPs from ChIP-seq data are highly concordant with published genotypes. Independent experimental verification of more than 100 sites estimates our false discovery rate at less than 5%. Analysis of transcription factor binding at de novo identified SNPs revealed widespread heritable allele-specific binding, confirming previous observations. SNPs identified from ChIP-seq datasets were significantly enriched for disease-associated variants, and we identified dozens of allele-specific binding events in non-coding regions that could distinguish between disease and normal haplotypes. Conclusions Our approach combines SNP discovery, genotyping and allele-specific analysis, but is selectively focused on functional regulatory elements occupied by transcription factors or epigenetic marks, and will therefore be valuable for identifying the functional regulatory consequences of non-coding SNPs in primary disease samples.
Directory of Open Access Journals (Sweden)
Babita Singh
2017-10-01
Full Text Available Heterosis is an important phenomenon for the breeding in agricultural crops as it influences yield related traits such as biomass yield, seed number and weight, adaptive and reproductive traits. However, the level of heterosis greatly varies for different traits and different genotypes. The present study focuses on identification of physical interactions between alleles and their role in transcriptional regulation in heterotic plants. Here, we used two Arabidopsis ecotypes; Col-0 and C24 as parent for crosses. We performed crossing between these ecotypes and screened the F1 hybrids on the basis of different SSR markers. Further, we used Hi-C to capture intra- and inter-chromosomal physical interactions between alleles on genome-wide level. Then, we identified allele-specific chromatin interactions and constructed genome-wide allele-specific contact maps at different resolutions for the entire chromosome. We also performed RNA-seq of hybrids and their parents. RNA-seq analysis identified several differentially expressed genes and non-additively expressed genes in hybrids with respect to their parents. Further, to understand the biological significance of these chromatin interactions, we annotated these interactions and correlated with the transcriptome data. Thus, our study provides alleles-specific chromatin interactions in genome-wide fashion which play a crucial role in regulation of different genes that may be important for heterosis.
Sex-specific allelic transmission bias suggests sexual conflict at MC1R.
Ducret, Valérie; Gaigher, Arnaud; Simon, Céline; Goudet, Jérôme; Roulin, Alexandre
2016-09-01
Sexual conflict arises when selection in one sex causes the displacement of the other sex from its phenotypic optimum, leading to an inevitable tension within the genome - called intralocus sexual conflict. Although the autosomal melanocortin-1-receptor gene (MC1R) can generate colour variation in sexually dichromatic species, most previous studies have not considered the possibility that MC1R may be subject to sexual conflict. In the barn owl (Tyto alba), the allele MC1RWHITE is associated with whitish plumage coloration, typical of males, and the allele MC1RRUFOUS is associated with dark rufous coloration, typical of females, although each sex can express any phenotype. Because each colour variant is adapted to specific environmental conditions, the allele MC1RWHITE may be more strongly selected in males and the allele MC1RRUFOUS in females. We therefore investigated whether MC1R genotypes are in excess or deficit in male and female fledglings compared with the expected Hardy-Weinberg proportions. Our results show an overall deficit of 7.5% in the proportion of heterozygotes in males and of 12.9% in females. In males, interannual variation in assortative pairing with respect to MC1R explained the year-specific deviations from Hardy-Weinberg proportions, whereas in females, the deficit was better explained by the interannual variation in the probability of inheriting the MC1RWHITE or MC1RRUFOUS allele. Additionally, we observed that sons inherit the MC1RRUFOUS allele from their fathers on average slightly less often than expected under the first Mendelian law. Transmission ratio distortion may be adaptive in this sexually dichromatic species if males and females are, respectively, selected to display white and rufous plumages. © 2016 John Wiley & Sons Ltd.
A novel polymerase chain reaction (PCR) for rapid isolation of a new ...
African Journals Online (AJOL)
mediated self-formed panhandle PCR, for gene or chromosome walking. It combined the advantages of ligation-mediated PCR in its specificity and of panhandle PCR in its efficiency. Self-formed panhandle PCR was used for a new rbcS gene ...
Reissmann, Monika; Musa, Lutfi; Zakizadeh, Sonia; Ludwig, Arne
2016-11-01
Considering the hidden mode of inheritance of some coat-color-associated alleles, we investigated the presence/absence of coat-color-associated alleles in 1093 domestic horses of 55 breeds and 20 specimens of Przewalski's horse. For coat-color genotyping, allele specific PCR, pyrosequencing and Li-Cor analyses were conducted on 12 coat-color-associated alleles of five genes. Our data provide deep insight into the distribution of coat-color-associated alleles within breeds. We found that the alleles for the basic colorations (bay, black, and chestnut) are widely distributed and occur in nearly all breeds. Alleles leading to dilutions or patterns are rare in domestic breeds and were not found in Przewalski's horse. Higher frequencies of these alleles are only found in breeds that are selected for their expressed phenotypes (e.g., Kinsky horse, Lewitzer, Tinker). Nevertheless, our study produced strong evidence that molecular testing of the coat color is necessary for well-defined phenotyping to avoid unexpected colorations of offspring that can result in legal action.
Kang, Sung-Il; Her, Moon; Kim, Ji-Yeon; Lee, Jin Ju; Lee, Kichan; Sung, So-Ra; Jung, Suk Chan
2015-06-01
A rapid and accurate diagnosis of brucellosis is required to reduce and prevent the spread of disease among animals and the risk of transfer to humans. In this study, a Brucella abortus-specific (Ba) LAMP assay was developed, that had six primers designed from the BruAb2_0168 region of chromosome I. The specificity of this LAMP assay was confirmed with Brucella reference strains, B. abortus vaccine strains, B. abortus isolates and phylogenetically or serologically related strains. The detection limit of target DNA was up to 20 fg/μl within 60 min. The sensitivity of the new LAMP assay was equal to or slightly higher than other PCR based assays. Moreover, this Ba-LAMP assay could specifically amplify all B. abortus biovars compared to previous PCR assays. To our knowledge, this is the first report of specific detection of B. abortus using a LAMP assay. The Ba-LAMP assay can offer a rapid, sensitive and accurate diagnosis of bovine brucellosis in the field. Copyright © 2015 Elsevier Ltd. All rights reserved.
A rapid minor groove binder PCR method for distinguishing the vaccine strain Brucella abortus 104M.
Nan, Wenlong; Qin, Lide; Wang, Yong; Zhang, Yueyong; Tan, Pengfei; Chen, Yuqi; Mao, Kairong; Chen, Yiping
2018-01-24
Brucellosis is a widespread zoonotic disease caused by Gram-negative Brucella bacteria. Immunisation with attenuated vaccine is an effective method of prevention, but it can interfere with diagnosis. Live, attenuated Brucella abortus strain 104M has been used for the prevention of human brucellosis in China since 1965. However, at present, no fast and reliable method exists that can distinguish this strain from field strains. Single nucleotide polymorphism (SNP)-based assays offer a new approach for such discrimination. SNP-based minor groove binder (MGB) and Cycleave assays have been used for rapid identification of four Brucella vaccine strains (B. abortus strains S19, A19 and RB51, and B. melitensis Rev1). The main objective of this study was to develop a PCR assay for rapid and specific detection of strain 104M. We developed a SNP-based MGB PCR assay that could successfully distinguish strain 104M from 18 representative strains of Brucella (B. abortus biovars 1, 2, 3, 4, 5, 6, 7 and 9, B. melitensis biovars 1, 2 and 3, B. suis biovars 1, 2, 3 and 4, B. canis, B. neotomae, and B. ovis), four Brucella vaccine strains (A19, S19, S2, M5), and 55 Brucella clinical field strains. The assay gave a negative reaction with four non-Brucella species (Escherichia coli, Pasteurella multocida, Streptococcus suis and Pseudomonas aeruginosa). The minimum sensitivity of the assay, evaluated using 10-fold dilutions of chromosomal DNA, was 220 fg for the 104M strain and 76 fg for the single non-104M Brucella strain tested (B. abortus A19). The assay was also reproducible (intra- and inter-assay coefficients of variation = 0.006-0.022 and 0.012-0.044, respectively). A SNP-based MGB PCR assay was developed that could straightforwardly and unambiguously distinguish B. abortus vaccine strain 104M from non-104M Brucella strains. Compared to the classical isolation and identification approaches of bacteriology, this real-time PCR assay has substantial advantages in terms of
Temperature Switch PCR (TSP: Robust assay design for reliable amplification and genotyping of SNPs
Directory of Open Access Journals (Sweden)
Mather Diane E
2009-12-01
Full Text Available Abstract Background Many research and diagnostic applications rely upon the assay of individual single nucleotide polymorphisms (SNPs. Thus, methods to improve the speed and efficiency for single-marker SNP genotyping are highly desirable. Here, we describe the method of temperature-switch PCR (TSP, a biphasic four-primer PCR system with a universal primer design that permits amplification of the target locus in the first phase of thermal cycling before switching to the detection of the alleles. TSP can simplify assay design for a range of commonly used single-marker SNP genotyping methods, and reduce the requirement for individual assay optimization and operator expertise in the deployment of SNP assays. Results We demonstrate the utility of TSP for the rapid construction of robust and convenient endpoint SNP genotyping assays based on allele-specific PCR and high resolution melt analysis by generating a total of 11,232 data points. The TSP assays were performed under standardised reaction conditions, requiring minimal optimization of individual assays. High genotyping accuracy was verified by 100% concordance of TSP genotypes in a blinded study with an independent genotyping method. Conclusion Theoretically, TSP can be directly incorporated into the design of assays for most current single-marker SNP genotyping methods. TSP provides several technological advances for single-marker SNP genotyping including simplified assay design and development, increased assay specificity and genotyping accuracy, and opportunities for assay automation. By reducing the requirement for operator expertise, TSP provides opportunities to deploy a wider range of single-marker SNP genotyping methods in the laboratory. TSP has broad applications and can be deployed in any animal and plant species.
A small asparagine-rich protein required for S-allele-specific pollen rejection in Nicotiana.
McClure, B; Mou, B; Canevascini, S; Bernatzky, R
1999-11-09
Although S-locus RNases (S-RNases) determine the specificity of pollen rejection in self-incompatible (SI) solanaceous plants, they alone are not sufficient to cause S-allele-specific pollen rejection. To identify non-S-RNase sequences that are required for pollen rejection, a Nicotiana alata cDNA library was screened by differential hybridization. One clone, designated HT, hybridized strongly to RNA from N. alata styles but not to RNA from Nicotiana plumbaginifolia, a species known to lack one or more factors necessary for S-allele-specific pollen rejection. Sequence analysis revealed a 101-residue ORF including a putative secretion signal and an asparagine-rich domain near the C terminus. RNA blot analysis showed that the HT-transcript accumulates in the stigma and style before anthesis. The timing of HT-expression lags slightly behind S(C10)-RNase in SI N. alata S(C10)S(C10) and is well correlated with the onset of S-allele-specific pollen rejection in the style. An antisense-HT construct was prepared to test for a role in pollen rejection. Transformed (N. plumbaginifolia x SI N. alata S(C10)S(C10)) hybrids with reduced levels of HT-protein continued to express S(C10)-RNase but failed to reject S(C10)-pollen. Control hybrids expressing both S(C10)-RNase and HT-protein showed a normal S-allele-specific pollen rejection response. We conclude that HT-protein is directly implicated in pollen rejection.
Schoener, E R; Hunter, S; Howe, L
2017-07-01
Although wildlife rehabilitation and translocations are important tools in wildlife conservation in New Zealand, disease screening of birds has not been standardized. Additionally, the results of the screening programmes are often difficult to interpret due to missing disease data in resident or translocating avian populations. Molecular methods have become the most widespread method for diagnosing avian malaria (Plasmodium spp.) infections. However, these methods can be time-consuming, expensive and are less specific in diagnosing mixed infections. Thus, this study developed a new real-time PCR (qPCR) method that was able to detect and specifically identify infections of the three most common lineages of avian malaria in New Zealand (Plasmodium (Novyella) sp. SYAT05, Plasmodium elongatum GRW6 and Plasmodium spp. LINN1) as well as a less common, pathogenic Plasmodium relictum GRW4 lineage. The assay was also able to discern combinations of these parasites in the same sample and had a detection limit of five parasites per microlitre. Due to concerns relating to the presence of the potentially highly pathogenic P. relictum GRW4 lineage in avian populations, an additional confirmatory high resolution (HRM) qPCR was developed to distinguish between commonly identified P. elongatum GRW6 from P. relictum GRW4. The new qPCR assays were tested using tissue samples containing Plasmodium schizonts from three naturally infected dead birds resulting in the identified infection of P. elongatum GRW6. Thus, these rapid qPCR assays have shown to be cost-effective and rapid screening tools for the detection of Plasmodium infection in New Zealand native birds.
Species-specific nested PCR as a diagnostic tool for Brucella ovis infection in rams
Directory of Open Access Journals (Sweden)
L.F. Costa
2013-02-01
Full Text Available The aim of the present study was to evaluate a species-specific nested PCR based on a previously described species-specific PCR for detection of B. ovis in semen and urine samples of experimentally infected rams. The performance of the species-specific nested PCR was compared with the results of a genus-specific PCR. Fourteen rams were experimentally infected with the Brucella ovis REO 198 strain and samples of semen and urine were collected every week up to 180 days post infection. Out of 83 semen samples collected, 42 (50.6% were positive for the species-specific nested PCR, and 23 (27.7% were positive for the genus-specific PCR. Out of 75 urine samples, 49 (65.3% were positive for the species-specific nested PCR, whereas 11 (14.6% were genus-specific PCR positive. Species-specific nested PCR was significantly more sensitive (P<0.001 than the genus-specific PCR in semen and urine from experimentally infected rams. In conclusion, the species-specific nested PCR developed in this study may be used as a diagnostic tool for the detection of B. ovis in semen and urine samples from suspected rams.
Iwasa, Masahiro A; Kawamura, Sayaka; Myoshu, Hikari; Suzuki, Taichi A
2018-03-01
It has been thought that the Japanese house mouse carries the A w allele at the agouti locus causing light-colored bellies, but they do not always show this coloration. Thus, the presence of the A w allele seems to be doubtful in them. To ascertain whether the A w allele is present, a two-pronged approach was used. First, we compared lengths of DNA fragments obtained from three PCRs conducted on them to the known fragment sizes generated from mouse strains exhibiting homozygosities of either a/a, A/A, or A w /A w . PCR I, PCR II, and PCR III amplify only in the A and A w alleles, the a and A w alleles, and the a allele, respectively, and we detected amplifications in strains with A/A and A w /A w by PCR I, in those with a/a and the Japanese house mouse by PCR II, and in those with a/a by PCR III. Second, we sequenced the exon 1A region of the agouti gene and obtained sequences corresponding to the above strains and the Japanese house mouse, but their sequences were similar to those of the a allele. We concluded that their agouti allele is not identical to the A w allele and seems to be a novel type similar to the a allele.
Díaz de Arce, Heidy; Pérez, Lester J; Frías, Maria T; Rosell, Rosa; Tarradas, Joan; Núñez, José I; Ganges, Llilianne
2009-11-18
Classical swine fever is a highly contagious viral disease causing severe economic losses in pig production almost worldwide. All pestivirus species can infect pigs, therefore accurate and rapid pestivirus detection and differentiation is of great importance to assure control measures in swine farming. Here we describe the development and evaluation of a novel multiplex, highly sensitive and specific RT-PCR for the simultaneous detection and rapid differentiation between CSFV and other pestivirus infections in swine. The universal and differential detection was based on primers designed to amplify a fragment of the 5' non-coding genome region for the detection of pestiviruses and a fragment of the NS5B gene for the detection of classical swine fever virus. The assay proved to be specific when different pestivirus strains from swine and ruminants were evaluated. The analytical sensitivity was estimated to be as little as 0.89TCID(50). The assay analysis of 30 tissue homogenate samples from naturally infected and non-CSF infected animals and 40 standard serum samples evaluated as part of two European Inter-laboratory Comparison Tests conducted by the European Community Reference Laboratory, Hanover, Germany proved that the multiplex RT-PCR method provides a rapid, highly sensitive, and cost-effective laboratory diagnosis for classical swine fever and other pestivirus infections in swine.
Cai, Xian-Quan; Yu, Hai-Qiong; Li, Rong; Yue, Qiao-Yun; Liu, Guo-Hua; Bai, Jian-Shan; Deng, Yan; Qiu, De-Yi; Zhu, Xing-Quan
2014-01-01
Clonorchis sinensis and Opisthorchis viverrini are both important fish-borne pathogens, causing serious public health problem in Asia. The present study developed an assay integrating real-time PCR and high resolution melting (HRM) analysis for the specific detection and rapid identification of C. sinensis and O. viverrini. Primers targeting COX1 gene were highly specific for these liver flukes, as evidenced by the negative amplification of closely related trematodes. Assays using genomic DNA...
Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong
2004-10-15
This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.
[Development and evaluation of a rapid PCR detection kit for Ophiocordyceps sinensis].
Hou, Fei-Xia; Cao, Jing; Wang, Sha-Sha; Wang, Xi; Yuan, Yuan; Peng, Cheng; Wan, De-Guang; Guo, Jin-Lin
2017-03-01
Ophiocordyceps sinensis is a valuable traditional Chinese medicine. Due to resource shortage, expensive price and huge market demand, there are many adulterants of O. sinensis in markets. Therefore, it is necessary to establish a rapid and effective method for distinguishing O. sinensis. Based on the species-specific PCR of O. sinensis, this study developed a detection kit by optimizing the components and evaluated the specificity, detection limit, repeatability and shelf life of the kit. The results showed that when the quality of O. sinensis accounted for more than 1/200 of that mixture, it could be detected successfully. Moreover, only O. sinensis could be amplified and glowed bright green fluorescence under ultraviolet light. The kit was still in effect when it was placed at 37 ℃ for three days, which indicated that it was stable and effective for one year stored in 4 ℃. The kit in the same batch under different operation conditions, and in different batch under the same operation conditions gave the same result and accuracy, which showed good repeatability of the kit. It is simple, rapid and accurate to distinguish O. sinensis from its adulterants using the kit, and lays the foundation for commercialization of traditional Chinese medicine fast detection kit. Copyright© by the Chinese Pharmaceutical Association.
Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K
2015-02-01
A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.
Characterization of ROP18 alleles in human toxoplasmosis.
Sánchez, Víctor; de-la-Torre, Alejandra; Gómez-Marín, Jorge Enrique
2014-04-01
The role of the virulent gene ROP18 polymorphisms is not known in human toxoplasmosis. A total of 320 clinical samples were analyzed. In samples positive for ROP18 gene, we determined by an allele specific PCR, if patients got the upstream insertion positive ROP18 sequence Toxoplasma strain (mouse avirulent strain) or the upstream insertion negative ROP18 sequence Toxoplasma strain (mouse virulent strain). We designed an ELISA assay for antibodies against ROP18 derived peptides from the three major clonal lineages of Toxoplasma. 20 clinical samples were of quality for ROP18 allele analysis. In patients with ocular toxoplasmosis, a higher inflammatory reaction on eye was associated to a PCR negative result for the upstream region of ROP18. 23.3%, 33% and 16.6% of serums from individuals with ocular toxoplasmosis were positive for type I, type II and type III ROP18 derived peptides, respectively but this assay was affected by cross reaction. The absence of Toxoplasma ROP18 promoter insertion sequence in ocular toxoplasmosis was correlated with severe ocular inflammatory response. Determination of antibodies against ROP18 protein was not useful for serotyping in human toxoplasmosis. © 2013.
Chen, Jingfang; Zhang, Rusheng; Ou, Xinhua; Yao, Dong; Huang, Zheng; Li, Linzhi; Sun, Biancheng
2017-06-01
A TaqMan based duplex one-step real time RT-PCR (rRT-PCR) assay was developed for the rapid detection of Coxsackievirus A10 (CV-A10) and other enterovirus (EVs) in clinical samples. The assay was fully evaluated and found to be specific and sensitive. When applied in 115 clinical samples, a 100% diagnostic sensitivity in CV-A10 detection and 97.4% diagnostic sensitivity in other EVs were found. Copyright © 2017 Elsevier Ltd. All rights reserved.
Perreten, Vincent; Endimiani, Andrea; Thomann, Andreas; Wipf, Juliette R K; Rossano, Alexandra; Bodmer, Michèle; Raemy, Andreas; Sannes-Lowery, Kristin A; Ecker, David J; Sampath, Rangarajan; Bonomo, Robert A; Washington, Cicely
2013-06-01
Bovine mastitis, an inflammatory disease of the mammary gland, is one of the most costly diseases affecting the dairy industry. The treatment and prevention of this disease is linked heavily to the use of antibiotics in agriculture and early detection of the primary pathogen is essential to control the disease. Milk samples (n=67) from cows suffering from mastitis were analyzed for the presence of pathogens using PCR electrospray-ionization mass spectrometry (PCR/ESI-MS) and were compared with standard culture diagnostic methods. Concurrent identification of the primary mastitis pathogens was obtained for 64% of the tested milk samples, whereas divergent results were obtained for 27% of the samples. The PCR/ESI-MS failed to identify some of the primary pathogens in 18% of the samples, but identified other pathogens as well as microorganisms in samples that were negative by culture. The PCR/ESI-MS identified bacteria to the species level as well as yeasts and molds in samples that contained a mixed bacterial culture (9%). The sensitivity of the PCR/ESI-MS for the most common pathogens ranged from 57.1 to 100% and the specificity ranged from 69.8 to 100% using culture as gold standard. The PCR/ESI-MS also revealed the presence of the methicillin-resistant gene mecA in 16.2% of the milk samples, which correlated with the simultaneous detection of staphylococci including Staphylococcus aureus. We demonstrated that PCR/ESI-MS, a more rapid diagnostic platform compared with bacterial culture, has the significant potential to serve as an important screening method in the diagnosis of bovine clinical mastitis and has the capacity to be used in infection control programs for both subclinical and clinical disease. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
[Real-time PCR in rapid diagnosis of Aeromonas hydrophila necrotizing soft tissue infections].
Kohayagawa, Yoshitaka; Izumi, Yoko; Ushita, Misuzu; Niinou, Norio; Koshizaki, Masayuki; Yamamori, Yuji; Kaneko, Sakae; Fukushima, Hiroshi
2009-11-01
We report a case of rapidly progressive necrotizing soft tissue infection and sepsis followed by a patient's death. We suspected Vibrio vulnificus infection because the patient's underlying disease was cirrhosis and the course extremely rapid. No microbe had been detected at death. We extracted DNA from a blood culture bottle. SYBR green I real-time PCR was conducted but could not detect V. vulnificus vvh in the DNA sample. Aeromonas hydrophila was cultured and identified in blood and necrotized tissue samples. Real-time PCR was conducted to detect A. hydrophila ahh1, AHCYTOEN and aerA in the DNA sample extracted from the blood culture bottle and an isolated necrotized tissue strain, but only ahh1 was positive. High-mortality in necrotizing soft tissue infections makes it is crucial to quickly detect V. vulnificus and A. hydrophila. We found real-time PCR for vvh, ahh1, AHCYTOEN, and aerA useful in detecting V. vulnificus and A. hydrophila in necrotizing soft tissue infections.
DEFF Research Database (Denmark)
Fugger, L; Morling, N; Ryder, L P
1989-01-01
DP gene typing using in vitro DNA amplification combined with sequence-specific oligonucleotide probes has recently been reported. The resulting DNA amplification was specific for the HLA-DPB locus. Typing for the individual DPB alleles was exclusively dependent on the hybridizations of the probe...
Allele-specific gene expression in a wild nonhuman primate population
Tung, J.; Akinyi, M. Y.; Mutura, S.; Altmann, J.; Wray, G. A.; Alberts, S. C.
2015-01-01
Natural populations hold enormous potential for evolutionary genetic studies, especially when phenotypic, genetic and environmental data are all available on the same individuals. However, untangling the genotype-phenotype relationship in natural populations remains a major challenge. Here, we describe results of an investigation of one class of phenotype, allele-specific gene expression (ASGE), in the well-studied natural population of baboons of the Amboseli basin, Kenya. ASGE measurements identify cases in which one allele of a gene is overexpressed relative to the alternative allele of the same gene, within individuals, thus providing a control for background genetic and environmental effects. Here, we characterize the incidence of ASGE in the Amboseli baboon population, focusing on the genetic and environmental contributions to ASGE in a set of eleven genes involved in immunity and defence. Within this set, we identify evidence for common ASGE in four genes. We also present examples of two relationships between cis-regulatory genetic variants and the ASGE phenotype. Finally, we identify one case in which this relationship is influenced by a novel gene-environment interaction. Specifically, the dominance rank of an individual’s mother during its early life (an aspect of that individual’s social environment) influences the expression of the gene CCL5 via an interaction with cis-regulatory genetic variation. These results illustrate how environmental and ecological data can be integrated into evolutionary genetic studies of functional variation in natural populations. They also highlight the potential importance of early life environmental variation in shaping the genetic architecture of complex traits in wild mammals. PMID:21226779
Ahonsi, Monday O; Ling, Yin; Kageyama, Koji
2010-11-01
Phytophthora nicotianae and Pythium helicoides are important water-borne oomycete pathogens of irrigated ornamentals particularly ebb-and-flow irrigated kalanchoe in Japan. We developed novel PCR-based sequence characterized amplified region markers and assays for rapid identification and species-specific detection of both pathogens in separate PCR reactions or simultaneously in a duplex PCR.
Rapid Methods to Distinguish Heterodera schachtii from Heterodera glycines Using PCR Technique
Directory of Open Access Journals (Sweden)
Hyoung Rai Ko
2017-09-01
Full Text Available The purpose of this study was to develop rapid methods for distinguishing between Heterodera schachtii and H. glycines detected from chinese cabbage fields of highland in Gangwon, Korea. To do this, we performed PCR-RFLP and PCR with the primers set developed in this study for GC147, GC408 and PM001 population, H. schachtii, and YS224, DA142 and BC115 population, H. glycines. Eight restriction enzymes generated RFLP profiles of mtDNA COI region for populations of H. schachtii and H. glycines, repectively. As a result, treatment of two restriction enzymes, RsaI and HinfI, were allowed to distinguish H. schachtii from H. glycines based on the differences of DNA band patterns. The primer set, #JBS1, #JBG1 and #JB3R, amplified specific fragments with 277 and 339 bp of H. schachtii, 339 bp of H. glycines, respectively, while it did not amplify fragments from three root-knot nematodes and two root-lesion nematodes. Thus, the primer set developed in this study could be a good method, which is used to distinguish between H. schachtii and H. glycines.
DEFF Research Database (Denmark)
Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong
2011-01-01
of RNA extract in the liquid phase with sequence-specific nested PCR on the solid phase. A simple ultraviolet cross-linking method was used to immobilize the DNA probes over an unmodified glass surface, which makes solid-phase PCR a convenient possibility for AIV screening. The testing of 33 avian fecal....... In this article, a DNA microarray-based solid-phase polymerase chain reaction (PCR) approach has been developed for rapid detection of influenza virus type A and for simultaneous identification of pathogenic virus subtypes H5 and H7. This solid-phase RT-PCR method combined reverse-transcription amplification...
A high-throughput method for genotyping S-RNase alleles in apple
DEFF Research Database (Denmark)
Larsen, Bjarne; Ørgaard, Marian; Toldam-Andersen, Torben Bo
2016-01-01
We present a new efficient screening tool for detection of S-alleles in apple. The protocol using general and multiplexed primers for PCR reaction and fragment detection on an automatized capillary DNA sequencer exposed a higher number of alleles than any previous studies. Analysis of alleles...
A rapid and direct real time PCR-based method for identification of Salmonella spp
DEFF Research Database (Denmark)
Rodriguez-Lazaro, D.; Hernández, Marta; Esteve, T.
2003-01-01
The aim of this work was the validation of a rapid, real-time PCR assay based on TaqMan((R)) technology for the unequivocal identification of Salmonella spp. to be used directly on an agar-grown colony. A real-time PCR system targeting at the Salmonella spp. invA gene was optimized and validated ...
Tomasello, Salvatore; Heubl, Günther
2017-07-01
The fruits of Xanthium sibiricum have been widely used in traditional Chinese medicine for the treatment of nasal sinusitis and headaches. The genus Xanthium (cocklebur) is a taxonomically complex genus. Different taxonomic concepts have been proposed, some including several species, others lumping the different taxa in a few extremely polymorphic species. Due to the morphological similarities between species, the correct authentication of X. sibiricum is very difficult. Therefore, we established a polymerase chain reaction-restriction fragment length polymorphism method and diagnostic PCR based on nuclear internal transcribed spacer and chloroplast trnQ-rps16 barcodes to differentiate X. sibirium from related species.Results from the phylogenetic analyses based on sequence information from four marker regions (plastidal psbA-trnH and trnQ-rps16 and nuclear ITS and D35 ) support those taxonomic concepts accepting a reduced number of species, as four to five major clades are revealed in the phylogenetic reconstructions. X. sibiricum , together with some accessions from closely related taxa, is always supported as monophyletic, constituting a well-defined genetic entity. Allele-specific primer pairs for ITS and trnQ-rps16 were designed to amplify diagnostic products from the genomic DNA of X. sibiricum . Specific PCR in combination with digestion using the restriction enzyme Mse I allowed for the identification of X. sibiricum by producing specific restriction patterns. The results demonstrate that the applied techniques provide effective and accurate authentication of X. sibiricum . Georg Thieme Verlag KG Stuttgart · New York.
Allele-Specific Chromatin Recruitment and Therapeutic Vulnerabilities of ESR1 Activating Mutations.
Jeselsohn, Rinath; Bergholz, Johann S; Pun, Matthew; Cornwell, MacIntosh; Liu, Weihan; Nardone, Agostina; Xiao, Tengfei; Li, Wei; Qiu, Xintao; Buchwalter, Gilles; Feiglin, Ariel; Abell-Hart, Kayley; Fei, Teng; Rao, Prakash; Long, Henry; Kwiatkowski, Nicholas; Zhang, Tinghu; Gray, Nathanael; Melchers, Diane; Houtman, Rene; Liu, X Shirley; Cohen, Ofir; Wagle, Nikhil; Winer, Eric P; Zhao, Jean; Brown, Myles
2018-02-12
Estrogen receptor α (ER) ligand-binding domain (LBD) mutations are found in a substantial number of endocrine treatment-resistant metastatic ER-positive (ER + ) breast cancers. We investigated the chromatin recruitment, transcriptional network, and genetic vulnerabilities in breast cancer models harboring the clinically relevant ER mutations. These mutants exhibit both ligand-independent functions that mimic estradiol-bound wild-type ER as well as allele-specific neomorphic properties that promote a pro-metastatic phenotype. Analysis of the genome-wide ER binding sites identified mutant ER unique recruitment mediating the allele-specific transcriptional program. Genetic screens identified genes that are essential for the ligand-independent growth driven by the mutants. These studies provide insights into the mechanism of endocrine therapy resistance engendered by ER mutations and potential therapeutic targets. Copyright © 2018 Elsevier Inc. All rights reserved.
Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Lina; Chu, Wen-Shen
2015-12-01
This study described the use of species-specific PCR in combination with SNaPshot mini-sequencing to achieve species identification and strain differentiation in Lactobacillus rhamnosus. To develop species-specific PCR and strain subtyping primers, the dnaJ gene was used as a target, and its corresponding sequences were analyzed both in Lb. rhamnosus and in a subset of its phylogenetically closest species. The results indicated that the species-specific primer pair was indeed specific for Lb. rhamnosus, and the mini-sequencing assay was able to unambiguously distinguish Lb. rhamnosus strains into different haplotypes. In conclusion, we have successfully developed a rapid, accurate and cost-effective assay for inter- and intraspecies discrimination of Lb. rhamnosus, which can be applied to achieve efficient quality control of probiotic products. Copyright © 2015 Elsevier Ltd. All rights reserved.
A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.
Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh
2015-06-01
Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.
Domb, Katherine; Keidar, Danielle; Yaakov, Beery; Khasdan, Vadim; Kashkush, Khalil
2017-10-27
Natural populations of the tetraploid wild emmer wheat (genome AABB) were previously shown to demonstrate eco-geographically structured genetic and epigenetic diversity. Transposable elements (TEs) might make up a significant part of the genetic and epigenetic variation between individuals and populations because they comprise over 80% of the wild emmer wheat genome. In this study, we performed detailed analyses to assess the dynamics of transposable elements in 50 accessions of wild emmer wheat collected from 5 geographically isolated sites. The analyses included: the copy number variation of TEs among accessions in the five populations, population-unique insertional patterns, and the impact of population-unique/specific TE insertions on structure and expression of genes. We assessed the copy numbers of 12 TE families using real-time quantitative PCR, and found significant copy number variation (CNV) in the 50 wild emmer wheat accessions, in a population-specific manner. In some cases, the CNV difference reached up to 6-fold. However, the CNV was TE-specific, namely some TE families showed higher copy numbers in one or more populations, and other TE families showed lower copy numbers in the same population(s). Furthermore, we assessed the insertional patterns of 6 TE families using transposon display (TD), and observed significant population-specific insertional patterns. The polymorphism levels of TE-insertional patterns reached 92% among all wild emmer wheat accessions, in some cases. In addition, we observed population-specific/unique TE insertions, some of which were located within or close to protein-coding genes, creating allelic variations in a population-specific manner. We also showed that those genes are differentially expressed in wild emmer wheat. For the first time, this study shows that TEs proliferate in wild emmer wheat in a population-specific manner, creating new alleles of genes, which contribute to the divergent evolution of homeologous genes
Rapid screening of β-Globin gene mutations by Real-Time PCR in ...
African Journals Online (AJOL)
Introduction of the real time PCR has made a revolution in the time taken for the PCR reactions. We present a method for the diagnosis of the common mutations of the B-thalassemia in Egyptian children & families. The procedure depends on the real-time PCR using specific fluorescently labeled hybridization probes.
A rapid PCR-based approach for molecular identification of filamentous fungi.
Chen, Yuanyuan; Prior, Bernard A; Shi, Guiyang; Wang, Zhengxiang
2011-08-01
In this study, a novel rapid and efficient DNA extraction method based on alkaline lysis, which can deal with a large number of filamentous fungal isolates in the same batch, was established. The filamentous fungal genomic DNA required only 20 min to prepare and can be directly used as a template for PCR amplification. The amplified internal transcribed spacer regions were easy to identify by analysis. The extracted DNA also can be used to amplify other protein-coding genes for fungal identification. This method can be used for rapid systematic identification of filamentous fungal isolates.
Smith, Kirsty F; de Salas, Miguel; Adamson, Janet; Rhodes, Lesley L
2014-03-07
The identification of toxin-producing dinoflagellates for monitoring programmes and bio-compound discovery requires considerable taxonomic expertise. It can also be difficult to morphologically differentiate toxic and non-toxic species or strains. Various molecular methods have been used for dinoflagellate identification and detection, and this study describes the development of eight real-time polymerase chain reaction (PCR) assays targeting the large subunit ribosomal RNA (LSU rRNA) gene of species from the genera Gymnodinium, Karenia, Karlodinium, and Takayama. Assays proved to be highly specific and sensitive, and the assay for G. catenatum was further developed for quantification in response to a bloom in Manukau Harbour, New Zealand. The assay estimated cell densities from environmental samples as low as 0.07 cells per PCR reaction, which equated to three cells per litre. This assay not only enabled conclusive species identification but also detected the presence of cells below the limit of detection for light microscopy. This study demonstrates the usefulness of real-time PCR as a sensitive and rapid molecular technique for the detection and quantification of micro-algae from environmental samples.
von Hertwig, Aline Morgan; Sant'Ana, Anderson S; Sartori, Daniele; da Silva, Josué José; Nascimento, Maristela S; Iamanaka, Beatriz Thie; Pelegrinelli Fungaro, Maria Helena; Taniwaki, Marta Hiromi
2018-05-01
Some species from Aspergillus section Nigri are morphologically very similar and altogether have been called A. niger aggregate. Although the species included in this group are morphologically very similar, they differ in their ability to produce mycotoxins and other metabolites and their taxonomical status has evolved continuously. Among them, A. niger and A. welwitschiae are ochratoxin A and fumonisin B 2 producers and their detection and/or identification is of crucial importance for food safety. The aim of this study was the development of a real-time PCR-based method for simultaneous discrimination of A. niger and A. welwitschiae from other species of the A. niger aggregate isolated from coffee beans. One primer pair and a hybridization probe specific for detection of A. niger and A. welwitschiae strains were designed based on the BenA gene sequences, and used in a Real-time PCR assay for the rapid discrimination between both these species from all others of the A. niger aggregate. The Real-time PCR assay was shown to be 100% efficient in discriminating the 73 isolates of A. niger/A. welwitschiae from the other A. niger aggregate species analyzed as a negative control. This result testifies to the use of this technique as a good tool in the rapid detection of these important toxigenic species. Copyright © 2018 Elsevier B.V. All rights reserved.
Rapid identification of Yersinia pestis and Brucella melitensis by chip-based continuous flow PCR
Dietzsch, Michael; Hlawatsch, Nadine; Melzer, Falk; Tomaso, Herbert; Gärtner, Claudia; Neubauer, Heinrich
2012-06-01
To combat the threat of biological agents like Yersinia pestis and Brucella melitensis in bioterroristic scenarios requires fast, easy-to-use and safe identification systems. In this study we describe a system for rapid amplification of specific genetic markers for the identification of Yersinia pestis and Brucella melitensis. Using chip based PCR and continuous flow technology we were able to amplify the targets simultaneously with a 2-step reaction profile within 20 minutes. The subsequent analysis of amplified fragments by standard gel electrophoresis requires another 45 minutes. We were able to detect both pathogens within 75 minutes being much faster than most other nucleic acid amplification technologies.
Condie, Brian G; Urbanski, William M
2014-01-01
Effective tools for searching the biomedical literature are essential for identifying reagents or mouse strains as well as for effective experimental design and informed interpretation of experimental results. We have built the Textpresso Site Specific Recombinases (Textpresso SSR) Web server to enable researchers who use mice to perform in-depth searches of a rapidly growing and complex part of the mouse literature. Our Textpresso Web server provides an interface for searching the full text of most of the peer-reviewed publications that report the characterization or use of mouse strains that express Cre or Flp recombinase. The database also contains most of the publications that describe the characterization or analysis of strains carrying conditional alleles or transgenes that can be inactivated or activated by site-specific recombinases such as Cre or Flp. Textpresso SSR complements the existing online databases that catalog Cre and Flp expression patterns by providing a unique online interface for the in-depth text mining of the site specific recombinase literature.
Koller, Teresa; Brunner, Susanne; Herren, Gerhard; Hurni, Severine; Keller, Beat
2018-04-01
The combined effects of enhanced total transgene expression level and allele-specificity combination in transgenic allele-pyramided Pm3 wheat lines result in improved powdery mildew field resistance without negative pleiotropic effects. Allelic Pm3 resistance genes of wheat confer race-specific resistance to powdery mildew (Blumeria graminis f. sp. tritici, Bgt) and encode nucleotide-binding domain, leucine-rich repeat (NLR) receptors. Transgenic wheat lines overexpressing alleles Pm3a, b, c, d, f, and g have previously been generated by transformation of cultivar Bobwhite and tested in field trials, revealing varying degrees of powdery mildew resistance conferred by the transgenes. Here, we tested four transgenic lines each carrying two pyramided Pm3 alleles, which were generated by crossbreeding of lines transformed with single Pm3 alleles. All four allele-pyramided lines showed strongly improved powdery mildew resistance in the field compared to their parental lines. The improved resistance results from the two effects of enhanced total transgene expression levels and allele-specificity combinations. In contrast to leaf segment tests on greenhouse-grown seedlings, no allelic suppression was observed in the field. Plant development and yield scores of the pyramided lines were similar to the mean scores of the corresponding parental lines, and thus, the allele pyramiding did not cause any negative effects. On the contrary, in pyramided line, Pm3b × Pm3f normal plant development was restored compared to the delayed development and reduced seed set of parental line Pm3f. Allele-specific RT qPCR revealed additive transgene expression levels of the two Pm3 alleles in the pyramided lines. A positive correlation between total transgene expression level and powdery mildew field resistance was observed. In summary, allele pyramiding of Pm3 transgenes proved to be successful in enhancing powdery mildew field resistance.
Interlaboratory diagnostic accuracy of a Salmonella specific PCR-based method
DEFF Research Database (Denmark)
Malorny, B.; Hoorfar, Jeffrey; Hugas, M.
2003-01-01
A collaborative study involving four European laboratories was conducted to investigate the diagnostic accuracy of a Salmonella specific PCR-based method, which was evaluated within the European FOOD-PCR project (http://www.pcr.dk). Each laboratory analysed by the PCR a set of independent obtained...... presumably naturally contaminated samples and compared the results with the microbiological culture method. The PCR-based method comprised a preenrichment step in buffered peptone water followed by a thermal cell lysis using a closed tube resin-based method. Artificially contaminated minced beef and whole......-based diagnostic methods and is currently proposed as international standard document....
Aloisio, Michelangelo; Bortot, Barbara; Gandin, Ilaria; Severini, Giovanni Maria; Athanasakis, Emmanouil
2017-02-01
Chimerism status evaluation of post-allogeneic hematopoietic stem cell transplantation samples is essential to predict post-transplant relapse. The most commonly used technique capable of detecting small increments of chimerism is quantitative real-time PCR. Although this method is already used in several laboratories, previously described protocols often lack sensitivity and the amount of the DNA required for each chimerism analysis is too high. In the present study, we compared a novel semi-nested allele-specific real-time PCR (sNAS-qPCR) protocol with our in-house standard allele-specific real-time PCR (gAS-qPCR) protocol. We selected two genetic markers and analyzed technical parameters (slope, y-intercept, R2, and standard deviation) useful to determine the performances of the two protocols. The sNAS-qPCR protocol showed better sensitivity and precision. Moreover, the sNAS-qPCR protocol requires, as input, only 10 ng of DNA, which is at least 10-fold less than the gAS-qPCR protocols described in the literature. Finally, the proposed sNAS-qPCR protocol could prove very useful for performing chimerism analysis with a small amount of DNA, as in the case of blood cell subsets.
Al-Harthi, Saeed A
2015-12-01
Molecular tools are increasingly accepted as the most sensitive and reliable techniques for malaria diagnosis and epidemiological surveys. Also, collection of finger prick blood spots onto filter papers is the most simple and affordable method for samples preservation and posterior molecular analysis, especially in rural endemic regions where malaria remains a major health problem. Two malaria molecular diagnostic tests, a Plasmodium genus-specific conventional PCR and a Plasmodium species-specific Nested PCR, were evaluated using DNA templates prepared from Whatman-FTA cards' dry blood spots using both, Methanol-fixation/Heat-extraction and FTA commercial purification kit. A total of 121 blood samples were collected from six Saudi south-western endemic districts both, as thick and thin films for routine microscopic screening and onto FTA cards for molecular studies. Out of the 121 samples, 75 were P. falciparum positive by at least one technique. No other species of Plasmodium were detected. P. falciparum parasites were identified in 69/75 (92%) samples by microscopic screening in health care centers. P. genus-specific PCR was able to amplify P. falciparum DNA in 41/75 (55%) and 59/75 (79%) samples using Methanol-fixation/Heat-extraction and FTA purification kit, respectively. P. species-specific Nested PCR revealed 68/75 (91%) and 75/75 (100%) positive samples using DNA templates were isolated by Methanol-fixation/Heat- extraction and FTA purification methods, respectively. The species-specific Nested PCR applied to Whatman-FTA preserved and processed blood samples represents the best alternative to classical microscopy for malaria diagnosis, particularly in epidemiological screening.
Directory of Open Access Journals (Sweden)
Loo Keat
2012-05-01
Full Text Available Abstract Background Hyperhomocysteinemia as a consequence of the MTHFR 677 C > T variant is associated with cardiovascular disease and stroke. Another factor that can potentially contribute to these disorders is a depleted nitric oxide level, which can be due to the presence of eNOS +894 G > T and eNOS −786 T > C variants that make an individual more susceptible to endothelial dysfunction. A number of genotyping methods have been developed to investigate these variants. However, simultaneous detection methods using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP analysis are still lacking. In this study, a novel multiplex PCR-RFLP method for the simultaneous detection of MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C variants was developed. A total of 114 healthy Malay subjects were recruited. The MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C variants were genotyped using the novel multiplex PCR-RFLP and confirmed by DNA sequencing as well as snpBLAST. Allele frequencies of MTHFR 677 C > T and eNOS +894 G > T and eNOS −786 T > C were calculated using the Hardy Weinberg equation. Methods The 114 healthy volunteers were recruited for this study, and their DNA was extracted. Primer pair was designed using Primer 3 Software version 0.4.0 and validated against the BLAST database. The primer specificity, functionality and annealing temperature were tested using uniplex PCR methods that were later combined into a single multiplex PCR. Restriction Fragment Length Polymorphism (RFLP was performed in three separate tubes followed by agarose gel electrophoresis. PCR product residual was purified and sent for DNA sequencing. Results The allele frequencies for MTHFR 677 C > T were 0.89 (C allele and 0.11 (T allele; for eNOS +894 G > T, the allele frequencies were 0.58 (G allele and 0.43 (T allele; and for eNOS −786 T > C, the allele
A software pipeline for prediction of allele-specific alternative RNA processing events using single RNA-seq data. The current version focuses on prediction of alternative splicing and alternative polyadenylation modulated by genetic variants.
Comprehensive and Rapid Real-Time PCR Analysis of 21 Foodborne Outbreaks
Directory of Open Access Journals (Sweden)
Hiroshi Fukushima
2009-01-01
Full Text Available A set of four duplex SYBR Green I PCR (SG-PCR assay combined with DNA extraction using QIAamp DNA Stool Mini kit was evaluated for the detection of foodborne bacteria from 21 foodborne outbreaks. The causative pathogens were detected in almost all cases in 2 hours or less. The first run was for the detection of 8 main foodborne pathogens in 5 stool specimens within 2 hours and the second run was for the detection of other unusual suspect pathogens within a further 45 minutes. After 2 to 4 days, the causative agents were isolated and identified. The results proved that for comprehensive and rapid molecular diagnosis in foodborne outbreaks, Duplex SG-PCR assay is not only very useful, but is also economically viable for one-step differentiation of causative pathogens in fecal specimens obtained from symptomatic patients. This then allows for effective diagnosis and management of foodborne outbreaks.
Directory of Open Access Journals (Sweden)
Andrew J P Smith
Full Text Available Following the widespread use of genome-wide association studies (GWAS, focus is turning towards identification of causal variants rather than simply genetic markers of diseases and traits. As a step towards a high-throughput method to identify genome-wide, non-coding, functional regulatory variants, we describe the technique of allele-specific FAIRE, utilising large-scale genotyping technology (FAIRE-gen to determine allelic effects on chromatin accessibility and regulatory potential. FAIRE-gen was explored using lymphoblastoid cells and the 50,000 SNP Illumina CVD BeadChip. The technique identified an allele-specific regulatory polymorphism within NR1H3 (coding for LXR-α, rs7120118, coinciding with a previously GWAS-identified SNP for HDL-C levels. This finding was confirmed using FAIRE-gen with the 200,000 SNP Illumina Metabochip and verified with the established method of TaqMan allelic discrimination. Examination of this SNP in two prospective Caucasian cohorts comprising 15,000 individuals confirmed the association with HDL-C levels (combined beta = 0.016; p = 0.0006, and analysis of gene expression identified an allelic association with LXR-α expression in heart tissue. Using increasingly comprehensive genotyping chips and distinct tissues for examination, FAIRE-gen has the potential to aid the identification of many causal SNPs associated with disease from GWAS.
Reyes-Valdés, M Humberto; Burgueño, Juan; Singh, Sukhwinder; Martínez, Octavio; Sansaloni, Carolina Paola
2018-01-01
Germplasm banks are growing in their importance, number of accessions and amount of characterization data, with a large emphasis on molecular genetic markers. In this work, we offer an integrated view of accessions and marker data in an information theory framework. The basis of this development is the mutual information between accessions and allele frequencies for molecular marker loci, which can be decomposed in allele specificities, as well as in rarity and divergence of accessions. In this way, formulas are provided to calculate the specificity of the different marker alleles with reference to their distribution across accessions, accession rarity, defined as the weighted average of the specificity of its alleles, and divergence, defined by the Kullback-Leibler formula. Albeit being different measures, it is demonstrated that average rarity and divergence are equal for any collection. These parameters can contribute to the knowledge of the structure of a germplasm collection and to make decisions about the preservation of rare variants. The concepts herein developed served as the basis for a strategy for core subset selection called HCore, implemented in a publicly available R script. As a proof of concept, the mathematical view and tools developed in this research were applied to a large collection of Mexican wheat accessions, widely characterized by SNP markers. The most specific alleles were found to be private of a single accession, and the distribution of this parameter had its highest frequencies at low levels of specificity. Accession rarity and divergence had largely symmetrical distributions, and had a positive, albeit non-strictly linear relationship. Comparison of the HCore approach for core subset selection, with three state-of-the-art methods, showed it to be superior for average divergence and rarity, mean genetic distance and diversity. The proposed approach can be used for knowledge extraction and decision making in germplasm collections of
Silva, Felipe Carneiro; Torrezan, Giovana Tardin; Brianese, Rafael Canfield; Stabellini, Raquel; Carraro, Dirce Maria
2017-07-01
Hereditary breast and ovarian cancer is characterized by mutations in BRCA1 or BRCA2 genes and PCR-based screening techniques, such as capillary sequencing and next-generation sequencing (NGS), are considered gold standard methods for detection of pathogenic mutations in these genes. Single-nucleotide polymorphisms (SNPs) constitute a vast source of variation in the human genome and represent a risk for misdiagnosis in genetic testing, since the presence of a SNP in primer-annealing sites may cause false negative results due to allele dropout. However, few reports are available and the frequency of this phenomenon in diagnostic assays remains unknown. In this article, we investigated the causes of a false negative capillary sequencing result in BRCA1 involving a mother-daughter dyad. Using several molecular strategies, including different DNA polymerases, primer redesign, allele-specific PCR and NGS, we established that the initial misdiagnosis was caused by a SNP located in the primer-annealing region, leading to allele dropout of the mutated allele. Assuming that this problem can also occur in any PCR-based method that are widely used in diagnostic settings, the clinical report presented here draws attention for one of the limitations of genetic testing in general, for which medical and laboratory communities need to be aware.
Specific PCR-based detection of Alternaria helianthi
DEFF Research Database (Denmark)
Udayashankar, A.C.; Nayaka, S. Chandra; Archana, B.
2012-01-01
Alternaria helianthi is an important seed-borne pathogenic fungus responsible for blight disease in sunflower. The current detection methods, which are based on culture and morphological identification, are time-consuming, laborious and are not always reliable. A PCR-based diagnostic method...... tested. The detection limit of the PCR method was of 10 pg from template DNA. The primers could also detect the pathogen in infected sunflower seed. This species-specific PCR method provides a quick, simple, powerful and reliable alternative to conventional methods in the detection and identification...
Directory of Open Access Journals (Sweden)
Hyun-Ok Song
Full Text Available It is clinically important to be able to detect influenza A/H1N1 virus using a fast, portable, and accurate system that has high specificity and sensitivity. To achieve this goal, it is necessary to develop a highly specific primer set that recognizes only influenza A viral genes and a rapid real-time PCR system that can detect even a single copy of the viral gene. In this study, we developed and validated a novel fluidic chip-type real-time PCR (LabChip real-time PCR system that is sensitive and specific for the detection of influenza A/H1N1, including the pandemic influenza strain A/H1N1 of 2009. This LabChip real-time PCR system has several remarkable features: (1 It allows rapid quantitative analysis, requiring only 15 min to perform 30 cycles of real-time PCR. (2 It is portable, with a weight of only 5.5 kg. (3 The reaction cost is low, since it uses disposable plastic chips. (4 Its high efficiency is equivalent to that of commercially available tube-type real-time PCR systems. The developed disposable LabChip is an economic, heat-transferable, light-transparent, and easy-to-fabricate polymeric chip compared to conventional silicon- or glass-based labchip. In addition, our LabChip has large surface-to-volume ratios in micro channels that are required for overcoming time consumed for temperature control during real-time PCR. The efficiency of the LabChip real-time PCR system was confirmed using novel primer sets specifically targeted to the hemagglutinin (HA gene of influenza A/H1N1 and clinical specimens. Eighty-five human clinical swab samples were tested using the LabChip real-time PCR. The results demonstrated 100% sensitivity and specificity, showing 72 positive and 13 negative cases. These results were identical to those from a tube-type real-time PCR system. This indicates that the novel LabChip real-time PCR may be an ultra-fast, quantitative, point-of-care-potential diagnostic tool for influenza A/H1N1 with a high sensitivity and
Han, Bang-Xing; Yuan, Yuan; Huang, Lu-Qi; Zhao, Qun; Tan, Ling-Ling; Song, Xiang-Wen; He, Xiao-Mei; Xu, Tao; Liu, Feng; Wang, Jian
2017-01-01
The traditional Chinese medicine (TCM) Qianhu and Zihuaqianhu are the dried roots of Peucedanum praeruptorum and Angelica decursiva , respectively. Since the plant sources of Qianhu and Zihuaqianhu are more complex, the chemical compositions of P. praeruptorum and A. decursiva are significantly different, and many adulterants exist because of the differences in traditional understanding and medication habits. Therefore, the rapid and accurate identification methods are required. The aim was to study the feasibility of using DNA barcoding to distinguish between Traditional Chinese medicine Qianhu ( Peucedanum praeruptorum ), Zihuaqianhu ( Angelica decursiva ), and common adulterants, based on internal transcribed spacer (ITS) sequences, as well as specific PCR identification between P. praeruptorum and A. decursiva . The ITS sequences of P. praeruptorum , A. decursiva , and adulterant were studied, and a phylogenetic tree was constructed. Based on the ITS barcode, the specific PCR primer pairs QH-CP19s/QH-CP19a and ZHQH-CP3s/ZHQH-CP3a were designed for P. praeruptorum and A. decursiva , respectively. The amplification conditions were optimized, and specific PCR products were obtained. The results showed that the phylogenetic trees constructed using the BI and MP methods were consistent, and P. praeruptorum and A. decursiva sequence haplotypes formed their own monophyly. The experimental results showed that in PCR products, the target bands appeared in the genuine drug and not in the adulterant, which suggests the high specificity of the two primer pairs. The ITS sequence was ideal DNA barcode to identify P. praeruptorum , A. decursiva , and adulterant. The specific PCR is a quick and effective method to distinguish between P. praeruptorum and A. decursiva . Peucedanum praeruptorum and Angelica decursiva sequence haplotypes formed their own monophyly.The ITS sequence was ideal DNA barcode to identify P. praeruptorum , A. decursiva , and adulterant.Specific PCR is a
Directory of Open Access Journals (Sweden)
Mousa Rasouli
2017-12-01
Full Text Available The evaluation of an almond collection using morphological variables and identification of self-incompatibility genotype is useful for selecting pollinizers and for the design of crossing in almond breeding programs. In this study, important morphological traits and self-incompatibilities in 71 almond cultivars and genotypes were studied. Simple and multiplex specific PCR analyses were used in order to identify self-incompatibility alleles. Based on the results, cultivars and genotypes including ‘Dir Ras–e-Savojbolagh’, ‘D-124’, ‘D-99’, ‘Shahrood 12’, ‘Tuono’, ‘Nonpareil’, ‘Price’, ‘Mirpanj-e-Tehran’, ‘Pakotahe-e- Taleghan’, ‘V-13-34’, ‘V-16-8, ‘V-11-10’, ‘Zarghan 10’, ‘Uromiyeh 68’, ‘Barg dorosht-e-Hamedan’ and ‘Yazd 60’ were late flowering and had the highest quality of nut and kernel characters. The result of the PCR method using combined primers AS1II and AmyC5R showed amplification of ten self-incompatibility alleles (S1, S2, S3, S5, S6, S7, S8, S10, S12,and S unknown allele and three Sfalleles. Moreover, S1 had the highest frequencies in comparison with other known S-alleles. Also, unknown alleles with different sizes were detected and 58 new bands were found in some cultivars.
Riediger, Irina N; Stoddard, Robyn A; Ribeiro, Guilherme S; Nakatani, Sueli M; Moreira, Suzana D R; Skraba, Irene; Biondo, Alexander W; Reis, Mitermayer G; Hoffmaster, Alex R; Vinetz, Joseph M; Ko, Albert I; Wunder, Elsio A
2017-09-01
With a conservatively estimated 1 million cases of leptospirosis worldwide and a 5-10% fatality rate, the rapid diagnosis of leptospirosis leading to effective clinical and public health decision making is of high importance, and yet remains a challenge. Based on parallel, population-based studies in two leptospirosis-endemic regions in Brazil, a real-time PCR assay which detects lipL32, a gene specifically present in pathogenic Leptospira, was assessed for the diagnostic effectiveness and accuracy. Patients identified by active hospital-based surveillance in Salvador and Curitiba during large urban leptospirosis epidemics were tested. Real-time PCR reactions were performed with DNA-extracted samples obtained from 127 confirmed and 23 unconfirmed cases suspected of leptospirosis, 122 patients with an acute febrile illness other than leptospirosis, and 60 healthy blood donors. The PCR assay had a limit of detection of 280 Leptospira genomic equivalents/mL. Sensitivity for confirmed cases was 61% for whole blood and 29% for serum samples. Sensitivity was higher (86%) for samples collected within the first 6 days after onset of illness compared to those collected after 7 days (34%). The real-time PCR assay was able to detect leptospiral DNA in blood from 56% of serological non-confirmed cases. The overall specificity of the assay was 99%. These findings indicate that real-time PCR may be a reliable tool for early diagnosis of leptospirosis, which is decisive for clinical management of severe and life-threatening cases and for public health decision making.
Hide, Geoff; Hughes, Jacqueline M; McNuff, Robert
2003-01-01
Background The rapid expansion in the availability of genome and DNA sequence information has opened up new possibilities for the development of methods for detecting free-living protozoa in environmental samples. The protozoan Blepharisma japonicum was used to investigate a rapid and simple detection system based on polymerase chain reaction amplification (PCR) from organisms immobilised on FTA paper. Results Using primers designed from the α-tubulin genes of Blepharisma, specific and sensitive detection to the equivalent of a single Blepharisma cell could be achieved. Similar detection levels were found using water samples, containing Blepharisma, which were dried onto Whatman FTA paper. Conclusion This system has potential as a sensitive convenient detection system for Blepharisma and could be applied to other protozoan organisms. PMID:14516472
Straub, Julia; Paula, Helga; Mayr, Michaela; Kasper, David; Assadian, Ojan; Berger, Angelika; Rittenschober-Böhm, Judith
2017-01-01
Diagnosis of neonatal sepsis remains a major challenge in neonatology. Most molecular-based methods are not customized for neonatal requirements. The aim of the present study was to assess the diagnostic accuracy of a modified multiplex PCR protocol for the detection of neonatal sepsis using small blood volumes. 212 episodes of suspected neonatal late onset sepsis were analyzed prospectively using the Roche SeptiFast® MGRADE PCR with a modified DNA extraction protocol and software-handling tool. Results were compared to blood culture, laboratory biomarkers and clinical signs of sepsis. Of 212 episodes, 85 (40.1%) were categorized as "not infected". Among these episodes, 1 was false positive by blood culture (1.2%) and 23 were false positive by PCR (27.1%). Of 51 (24.1%) episodes diagnosed as "culture proven sepsis", the same pathogen was detected by blood culture and PCR in 39 episodes (76.5%). In 8 episodes, more pathogens were detected by PCR compared to blood culture, and in 4 episodes the pathogen detected by blood culture was not found by PCR. One of these episodes was caused by Bacillus cereus, a pathogen not included in the PCR panel. In 76/212 (35.8%) episodes, clinical sepsis was diagnosed. Among these, PCR yielded positive results in 39.5% of episodes (30/76 episodes). For culture-positive sepsis, PCR showed a sensitivity of 90.2% (95%CI 86.2-94.2%) and a specificity of 72.9% (95%CI 67.0-79.0%). The Roche SeptiFast® MGRADE PCR using a modified DNA extraction protocol showed acceptable results for rapid detection of neonatal sepsis in addition to conventional blood culture. The benefit of rapid pathogen detection has to be balanced against the considerable risk of contamination, loss of information on antibiotic sensitivity pattern and increased costs.
Directory of Open Access Journals (Sweden)
Bing Zhang
2016-09-01
Full Text Available Babesia spp. are tick-transmitted haemoparasites causing tick fever in cattle. In Australia, economic losses to the cattle industry from tick fever are estimated at AUD$26 Million per annum. If animals recover from these infections, they become immune carriers. Here we describe a novel multiplex TaqMan qPCR targeting cytochrome b genes for the identification of Babesia spp. The assay shows high sensitivity, specificity and reproducibility, and allows quantification of parasite DNA from Babesia bovis and B. bigemina compared to standard PCR assays. A previously published cytochrome b SYBR Green qPCR was also tested in this study, showing slightly higher sensitivity than the Taqman qPCRs but requires melting curve analysis post-PCR to confirm specificity. The SYBR Green assays were further evaluated using both diagnostic submissions and vaccinated cattle (at 7, 9, 11 and 14 days post-inoculation showed that B. bigemina can be detected more frequently than B. bovis. Due to fewer circulating parasites, B. bovis detection in carrier animals requires higher DNA input. Preliminary data for a novel fluorescent PCR genotyping based on the Internal Transcribed Spacer 1 region to detect vaccine and field alleles of B. bovis are described. This assay is capable of detecting vaccine and novel field isolate alleles in a single sample.
Alikord, Mahsa; Keramat, Javad; Kadivar, Mahdi; Momtaz, Hassan; Eshtiaghi, Mohammad N; Homayouni-Rad, Aziz
2017-01-01
Species identification and authentication in meat products are important subjects for ensuring the health of consumers. The multiplex-PCR amplification and species- specific primer set were used for the identification of horse, donkey, pig and other ruminants in raw and processed meat products. Oligonucleotid primers were designed and patented for amplification of species-specific mitochondrial DNA sequences of each species and samples were prepared from binary meat mixtures. The results showed that meat species were accurately determined in all combinations by multiplex-PCR, and the sensitivity of this method was 0.001 ng, rendering this technique open to and suitable for use in industrial meat products. It is concluded that more fraud is seen in lower percentage industrial meat products than in higher percentage ones. There was also more fraud found in processed products than in raw ones. This rapid and useful test is recommended for quality control firms for applying more rigorous controls over industrial meat products, for the benefit of target consumers. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Barakat, Hassan; El-Garhy, Hoda A S; Moustafa, Mahmoud M A
2014-12-01
Detection of pork meat adulteration in "halal" meat products is a crucial issue in the fields of modern food inspection according to implementation of very strict procedures for halal food labelling. Present study aims at detecting and quantifying pork adulteration in both raw and cooked manufactured sausages. This is by applying an optimized species-specific PCR procedure followed by QIAxcel capillary electrophoresis system. Manufacturing experiment was designed by incorporating pork with beef meat at 0.01 to 10 % substitution levels beside beef and pork sausages as negative and positive controls, respectively. Subsequently, sausages were divided into raw and cooked sausages then subjected to DNA extraction. Results indicated that PCR amplifications of mitochondrial D-loop and cytochrome b (cytb) genes by porcine-specific primers produced 185 and 117 bp pork-specific DNA fragments in sausages, respectively. No DNA fragments were detected when PCR was applied on beef sausage DNA confirming primers specificity. For internal control, a 141-bp DNA fragment of eukaryotic 18S ribosomal RNA (rRNA) gene was amplified from pork and beef DNA templates. Although PCR followed by either QIAxcel or agarose techniques were efficient for targeted DNA fragments differentiation even as low as 0.01 % (pork/meat: w/w). For proficiency, adequacy, and performance, PCR-QIA procedure is highly sensitive, a time-saver, electronically documented, mutagenic-reagent free, of little manual errors, accurate in measuring PCR fragments length, and quantitative data supplier. In conclusion, it can be suggested that optimized PCR-QAI is considered as a rapid and sensitive method for routine pork detection and quantification in raw or processed meat.
Directory of Open Access Journals (Sweden)
Retno W. Susilowati
2017-05-01
Full Text Available Background: Arylamine N-acetyltransferase 2 (NAT2 polymorphism was previously reported to have association with the risk of drug toxicities and the development of various diseases. Previous research on the Indonesian population, especially Javanese and Sundanese, showed that there were 33% NAT2 slow acetylator phenotype. The aim of this study was to map the NAT2 variation in the Malay ethnic to gain a deeper insight into NAT2 haplotypic composition in this ethnic.Methods: 50 healthy samples from the Indonesian Malay ethnic were obtained. They were interviewed about their ethnic backgrounds for the last three generations. DNA was extracted from peripheral blood and NAT2 genotyping was done using the PCR direct Sequencing. Data were compiled according to the genotype and allele frequencies estimated from the observed numbers of each specific allele. Haplotype reconstruction was performed using PHASE v2.1.1 software.Results: We found 7 haplotypes consisting of 6 SNPs and 14 NAT2 genotype variations in Indonesian Malay population. The most frequent allele was NAT2*6A (38% which was classified as a slow acetylator allele. According to bimodal distribution, the predicted phenotype of the Malay population was composed of 62% rapid acetylator and 38% slow acetylator. According to trimodal distribution, the predicted phenotypes for rapid, intermediate and slow acetylators were 10%, 52% and 38% respectively.Conclusion: Our result indicates the presence of the allelic distribution and revealed the most frequent acetylator status and phenotype for the Indonesian Malay population. The result of this study will be helpful for future epidemiological or clinical studies and for understanding the genetic basis of acetylation polymorphism in Indonesia.
Directory of Open Access Journals (Sweden)
Kirsty F. Smith
2014-03-01
Full Text Available The identification of toxin-producing dinoflagellates for monitoring programmes and bio-compound discovery requires considerable taxonomic expertise. It can also be difficult to morphologically differentiate toxic and non-toxic species or strains. Various molecular methods have been used for dinoflagellate identification and detection, and this study describes the development of eight real-time polymerase chain reaction (PCR assays targeting the large subunit ribosomal RNA (LSU rRNA gene of species from the genera Gymnodinium, Karenia, Karlodinium, and Takayama. Assays proved to be highly specific and sensitive, and the assay for G. catenatum was further developed for quantification in response to a bloom in Manukau Harbour, New Zealand. The assay estimated cell densities from environmental samples as low as 0.07 cells per PCR reaction, which equated to three cells per litre. This assay not only enabled conclusive species identification but also detected the presence of cells below the limit of detection for light microscopy. This study demonstrates the usefulness of real-time PCR as a sensitive and rapid molecular technique for the detection and quantification of micro-algae from environmental samples.
Directory of Open Access Journals (Sweden)
Clark Taane G
2010-04-01
Full Text Available Abstract Background Imprinted genes show expression from one parental allele only and are important for development and behaviour. This extreme mode of allelic imbalance has been described for approximately 56 human genes. Imprinting status is often disrupted in cancer and dysmorphic syndromes. More subtle variation of gene expression, that is not parent-of-origin specific, termed 'allele-specific gene expression' (ASE is more common and may give rise to milder phenotypic differences. Using two allele-specific high-throughput technologies alongside bioinformatics predictions, normal term human placenta was screened to find new imprinted genes and to ascertain the extent of ASE in this tissue. Results Twenty-three family trios of placental cDNA, placental genomic DNA (gDNA and gDNA from both parents were tested for 130 candidate genes with the Sequenom MassArray system. Six genes were found differentially expressed but none imprinted. The Illumina ASE BeadArray platform was then used to test 1536 SNPs in 932 genes. The array was enriched for the human orthologues of 124 mouse candidate genes from bioinformatics predictions and 10 human candidate imprinted genes from EST database mining. After quality control pruning, a total of 261 informative SNPs (214 genes remained for analysis. Imprinting with maternal expression was demonstrated for the lymphocyte imprinted gene ZNF331 in human placenta. Two potential differentially methylated regions (DMRs were found in the vicinity of ZNF331. None of the bioinformatically predicted candidates tested showed imprinting except for a skewed allelic expression in a parent-specific manner observed for PHACTR2, a neighbour of the imprinted PLAGL1 gene. ASE was detected for two or more individuals in 39 candidate genes (18%. Conclusions Both Sequenom and Illumina assays were sensitive enough to study imprinting and strong allelic bias. Previous bioinformatics approaches were not predictive of new imprinted genes
Directory of Open Access Journals (Sweden)
Brian B Tuch
Full Text Available Due to growing throughput and shrinking cost, massively parallel sequencing is rapidly becoming an attractive alternative to microarrays for the genome-wide study of gene expression and copy number alterations in primary tumors. The sequencing of transcripts (RNA-Seq should offer several advantages over microarray-based methods, including the ability to detect somatic mutations and accurately measure allele-specific expression. To investigate these advantages we have applied a novel, strand-specific RNA-Seq method to tumors and matched normal tissue from three patients with oral squamous cell carcinomas. Additionally, to better understand the genomic determinants of the gene expression changes observed, we have sequenced the tumor and normal genomes of one of these patients. We demonstrate here that our RNA-Seq method accurately measures allelic imbalance and that measurement on the genome-wide scale yields novel insights into cancer etiology. As expected, the set of genes differentially expressed in the tumors is enriched for cell adhesion and differentiation functions, but, unexpectedly, the set of allelically imbalanced genes is also enriched for these same cancer-related functions. By comparing the transcriptomic perturbations observed in one patient to his underlying normal and tumor genomes, we find that allelic imbalance in the tumor is associated with copy number mutations and that copy number mutations are, in turn, strongly associated with changes in transcript abundance. These results support a model in which allele-specific deletions and duplications drive allele-specific changes in gene expression in the developing tumor.
Oueslati, Amel; Ollitrault, Frederique; Baraket, Ghada; Salhi-Hannachi, Amel; Navarro, Luis; Ollitrault, Patrick
2016-08-18
Chloroplast DNA is a primary source of molecular variations for phylogenetic analysis of photosynthetic eukaryotes. However, the sequencing and analysis of multiple chloroplastic regions is difficult to apply to large collections or large samples of natural populations. The objective of our work was to demonstrate that a molecular taxonomic key based on easy, scalable and low-cost genotyping method should be developed from a set of Single Nucleotide Polymorphisms (SNPs) diagnostic of well-established clades. It was applied to the Aurantioideae subfamily, the largest group of the Rutaceae family that includes the cultivated citrus species. The publicly available nucleotide sequences of eight plastid genomic regions were compared for 79 accessions of the Aurantioideae subfamily to search for SNPs revealing taxonomic differentiation at the inter-tribe, inter-subtribe, inter-genus and interspecific levels. Diagnostic SNPs (DSNPs) were found for 46 of the 54 clade levels analysed. Forty DSNPs were selected to develop KASPar markers and their taxonomic value was tested by genotyping 108 accessions of the Aurantioideae subfamily. Twenty-seven markers diagnostic of 24 clades were validated and they displayed a very high rate of transferability in the Aurantioideae subfamily (only 1.2 % of missing data on average). The UPGMA from the validated markers produced a cladistic organisation that was highly coherent with the previous phylogenetic analysis based on the sequence data of the eight plasmid regions. In particular, the monophyletic origin of the "true citrus" genera plus Oxanthera was validated. However, some clarification remains necessary regarding the organisation of the other wild species of the Citreae tribe. We validated the concept that with well-established clades, DSNPs can be selected and efficiently transformed into competitive allele-specific PCR markers (KASPar method) allowing cost-effective highly efficient cladistic analysis in large collections at
Directory of Open Access Journals (Sweden)
Duborjal Hervé
2008-02-01
Full Text Available Abstract Background Pathogens such as fungi, bacteria and especially viruses, are highly variable even within an individual host, intensifying the difficulty of distinguishing and accurately quantifying numerous allelic variants co-existing in a single nucleic acid sample. The majority of currently available techniques are based on real-time PCR or primer extension and often require multiplexing adjustments that impose a practical limitation of the number of alleles that can be monitored simultaneously at a single locus. Results Here, we describe a novel method that allows the simultaneous quantification of numerous allelic variants in a single reaction tube and without multiplexing. Quantitative Single-letter Sequencing (QSS begins with a single PCR amplification step using a pair of primers flanking the polymorphic region of interest. Next, PCR products are submitted to single-letter sequencing with a fluorescently-labelled primer located upstream of the polymorphic region. The resulting monochromatic electropherogram shows numerous specific diagnostic peaks, attributable to specific variants, signifying their presence/absence in the DNA sample. Moreover, peak fluorescence can be quantified and used to estimate the frequency of the corresponding variant in the DNA population. Using engineered allelic markers in the genome of Cauliflower mosaic virus, we reliably monitored six different viral genotypes in DNA extracted from infected plants. Evaluation of the intrinsic variance of this method, as applied to both artificial plasmid DNA mixes and viral genome populations, demonstrates that QSS is a robust and reliable method of detection and quantification for variants with a relative frequency of between 0.05 and 1. Conclusion This simple method is easily transferable to many other biological systems and questions, including those involving high throughput analysis, and can be performed in any laboratory since it does not require specialized
Patel, Divya A.; Shih, Yang-Jen; Newton, Duane W.; Michael, Claire W.; Oeth, Paul A.; Kane, Michael D.; Opipari, Anthony W.; Ruffin, Mack T.; Kalikin, Linda M.; Kurnit, David M.
2010-01-01
Knowledge of the central role of high-risk human papillomavirus (HPV) in cervical carcinogenesis, coupled with an emerging need to monitor the efficacy of newly introduced HPV vaccines, warrant development and evaluation of type-specific, quantitative HPV detection methods. In the present study, a prototype PCR and mass spectroscopy (PCR-MS)-based method to detect and quantitate 13 high-risk HPV types is compared to the Hybrid Capture 2 High Risk HPV DNA test (HC2; Digene Corp., Gaithersburg, MD) in 199 cervical scraping samples and to DNA sequencing in 77 cervical tumor samples. High-risk HPV types were detected in 76/77 (98.7%) cervical tumor samples by PCR-MS. Degenerate and type-specific sequencing confirmed the types detected by PCR-MS. In 199 cervical scraping samples, all 13 HPV types were detected by PCR-MS. Eighteen (14.5%) of 124 cervical scraping samples that were positive for high-risk HPV by HC2 were negative by PCR-MS. In all these cases, degenerate DNA sequencing failed to detect any of the 13 high-risk HPV types. Nearly half (46.7%) of the 75 cervical scraping samples that were negative for high-risk HPV by the HC2 assay were positive by PCR-MS. Type-specific sequencing in a subset of these samples confirmed the HPV type detected by PCR-MS. Quantitative PCR-MS results demonstrated that 11/75 (14.7%) samples contained as much HPV copies/cell as HC2-positive samples. These findings suggest that this prototype PCR-MS assay performs at least as well as HC2 for HPV detection, while offering the additional, unique advantages of type-specific identification and quantitation. Further validation work is underway to define clinically meaningful HPV detection thresholds and to evaluate the potential clinical application of future generations of the PCR-MS assay. PMID:19410602
Patel, Divya A; Shih, Yang-Jen; Newton, Duane W; Michael, Claire W; Oeth, Paul A; Kane, Michael D; Opipari, Anthony W; Ruffin, Mack T; Kalikin, Linda M; Kurnit, David M
2009-09-01
Knowledge of the central role of high-risk human papillomavirus (HPV) in cervical carcinogenesis, coupled with an emerging need to monitor the efficacy of newly introduced HPV vaccines, warrant development and evaluation of type-specific, quantitative HPV detection methods. In the present study, a prototype PCR and mass spectroscopy (PCR-MS)-based method to detect and quantitate 13 high-risk HPV types is compared to the Hybrid Capture 2 High-Risk HPV DNA test (HC2; Digene Corp., Gaithersburg, MD) in 199 cervical scraping samples and to DNA sequencing in 77 cervical tumor samples. High-risk HPV types were detected in 76/77 (98.7%) cervical tumor samples by PCR-MS. Degenerate and type-specific sequencing confirmed the types detected by PCR-MS. In 199 cervical scraping samples, all 13 HPV types were detected by PCR-MS. Eighteen (14.5%) of 124 cervical scraping samples that were positive for high-risk HPV by HC2 were negative by PCR-MS. In all these cases, degenerate DNA sequencing failed to detect any of the 13 high-risk HPV types. Nearly half (46.7%) of the 75 cervical scraping samples that were negative for high-risk HPV by the HC2 assay were positive by PCR-MS. Type-specific sequencing in a subset of these samples confirmed the HPV type detected by PCR-MS. Quantitative PCR-MS results demonstrated that 11/75 (14.7%) samples contained as much HPV copies/cell as HC2-positive samples. These findings suggest that this prototype PCR-MS assay performs at least as well as HC2 for HPV detection, while offering the additional, unique advantages of type-specific identification and quantitation. Further validation work is underway to define clinically meaningful HPV detection thresholds and to evaluate the potential clinical application of future generations of the PCR-MS assay.
Halal authenticity of gelatin using species-specific PCR.
Shabani, Hessam; Mehdizadeh, Mehrangiz; Mousavi, Seyed Mohammad; Dezfouli, Ehsan Ansari; Solgi, Tara; Khodaverdi, Mahdi; Rabiei, Maryam; Rastegar, Hossein; Alebouyeh, Mahmoud
2015-10-01
Consumption of food products derived from porcine sources is strictly prohibited in Islam. Gelatin, mostly derived from bovine and porcine sources, has many applications in the food and pharmaceutical industries. To ensure that food products comply with halal regulations, development of valid and reliable analytical methods is very much required. In this study, a species-specific polymerase chain reaction (PCR) assay using conserved regions of mitochondrial DNA (cytochrome b gene) was performed to evaluate the halal authenticity of gelatin. After isolation of DNA from gelatin powders with known origin, conventional PCR using species-specific primers was carried out on the extracted DNA. The amplified expected PCR products of 212 and 271 bp were observed for porcine and bovine gelatin, respectively. The sensitivity of the method was tested on binary gelatin mixtures containing 0.1%, 1%, 10%, and 100% (w/w) of porcine gelatin within bovine gelatin and vice versa. Although most of the DNA is degraded due to the severe processing steps of gelatin production, the minimum level of 0.1% w/w of both porcine and bovine gelatin was detected. Moreover, eight food products labeled as containing bovine gelatin and eight capsule shells were subjected to PCR examination. The results showed that all samples contained bovine gelatin, and the absence of porcine gelatin was verified. This method of species authenticity is very useful to verify whether gelatin and gelatin-containing food products are derived from halal ingredients. Copyright © 2015 Elsevier Ltd. All rights reserved.
Lee, C S; Wetzel, K; Buckley, T; Wozniak, D; Lee, J
2011-10-01
For the rapid detection of Pseudomonas aeruginosa from chlorinated water and aerosols, gyrB gene-based real-time PCR assay was developed and investigated. Two novel primer sets (pa722F/746MGB/899R and pa722F/746MGB/788R) were designed using the most updated 611 Pseudomonas and 748 other bacterial gyrB genes for achieving high specificity. Their specificity showed 100% accuracy when tested with various strains including clinical isolates from cystic fibrosis patients. The assay was tested with Ps. aeruginosa-containing chlorinated water and aerosols to simulate the waterborne and airborne transmission routes (detection limit 3·3 × 10² CFU per PCR-2·3 × 10³ CFU per PCR). No chlorine interference in real-time PCR was observed at drinking water level (c. 1 mg l⁻¹), but high level of chorine (12 mg l⁻¹) interfered the assay, and thus neutralization was needed. Pseudomonas aeruginosa in aerosol was successfully detected after capturing with gelatin filters with minimum 2 min of sampling time when the initial concentration of 10⁴ CFU ml⁻¹ bacteria existed in the nebulizer. A highly specific and rapid assay (2-3 h) was developed by targeting gyrB gene for the detection of Ps. aeruginosa in chlorinated water and aerosols, combined with optimized sample collection methods and sample processing, so the direct DNA extraction from either water or aerosol was possible while achieving the desired sensitivity of the method. The new assay can provide timely and accurate risk assessment to prevent Ps. aeruginosa exposure from water and aerosol, resulting in reduced disease burden, especially among immune-compromised and susceptible individuals. This approach can be easily utilized as a platform technology for the detection of other types of micro-organisms, especially for those that are transmitted via water and aerosol routes, such as Legionella pneumophila. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.
Saingamsook, Jassada; Saeung, Atiporn; Yanola, Jintana; Lumjuan, Nongkran; Walton, Catherine; Somboon, Pradya
2017-10-10
Mutation of the voltage-gated sodium channel (VGSC) gene, or knockdown resistance (kdr) gene, is an important resistance mechanism of the dengue vector Aedes aegypti mosquitoes against pyrethroids. In many countries in Asia, a valine to glycine substitution (V1016G) and a phenylalanine to cysteine substitution (F1534C) are common in Ae. aegypti populations. The G1016 and C1534 allele frequencies have been increasing in recent years, and hence there is a need to have a simple and inexpensive tool to monitor the alleles in large scale. A multiplex PCR to detect V1016G and F1534C mutations has been developed in the current study. This study utilized primers from previous studies for detecting the mutation at position 1016 and newly designed primers to detect variants at position 1534. The PCR conditions were validated and compared with DNA sequencing using known kdr mutant laboratory strains and field collected mosquitoes. The efficacy of this method was also compared with allele-specific PCR (AS-PCR). The results of our multiplex PCR were in complete agreement with sequencing data and better than the AS-PCR. In addition, the efficiency of two non-toxic DNA staining dyes, Ultrapower™ and RedSafe™, were evaluated by comparing with ethidium bromide (EtBr) and the results were satisfactory. Our multiplex PCR method is highly reliable and useful for implementing vector surveillance in locations where the two alleles co-occur.
A multiplex PCR for detection of six viruses in ducks.
Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong
2017-10-01
In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Sabrina Weiss
2016-09-01
Full Text Available Rapid typing of Leptospira is currently impaired by requiring time consuming culture of leptospires. The objective of this study was to develop an assay that provides multilocus sequence typing (MLST data direct from patient specimens while minimising costs for subsequent sequencing.An existing PCR based MLST scheme was modified by designing nested primers including anchors for facilitated subsequent sequencing. The assay was applied to various specimen types from patients diagnosed with leptospirosis between 2014 and 2015 in the United Kingdom (UK and the Lao Peoples Democratic Republic (Lao PDR. Of 44 clinical samples (23 serum, 6 whole blood, 3 buffy coat, 12 urine PCR positive for pathogenic Leptospira spp. at least one allele was amplified in 22 samples (50% and used for phylogenetic inference. Full allelic profiles were obtained from ten specimens, representing all sample types (23%. No nonspecific amplicons were observed in any of the samples. Of twelve PCR positive urine specimens three gave full allelic profiles (25% and two a partial profile. Phylogenetic analysis allowed for species assignment. The predominant species detected was L. interrogans (10/14 and 7/8 from UK and Lao PDR, respectively. All other species were detected in samples from only one country (Lao PDR: L. borgpetersenii [1/8]; UK: L. kirschneri [1/14], L. santarosai [1/14], L. weilii [2/14].Typing information of pathogenic Leptospira spp. was obtained directly from a variety of clinical samples using a modified MLST assay. This assay negates the need for time-consuming culture of Leptospira prior to typing and will be of use both in surveillance, as single alleles enable species determination, and outbreaks for the rapid identification of clusters.
Directory of Open Access Journals (Sweden)
Yuny Erwanto
2013-03-01
Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction ABSTRAK Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang
Energy Technology Data Exchange (ETDEWEB)
Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.
2013-06-28
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource
International Nuclear Information System (INIS)
Jothikumar, N.; Hill, Vincent R.
2013-01-01
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource
Directory of Open Access Journals (Sweden)
Kang Feng-feng
2012-03-01
Full Text Available Objective To investigate the clinical application of Real-Time PCR for rapid detection of methicillin-resistant Staphylococcus aureus (MRSA directly from nasopharyngeal swab specimens.
Parida Manmohan; Shrivastava Ambuj; Santhosh SR; Dash Paban; Saxena Parag; Rao PV
2008-01-01
Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR) for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Jap...
Directory of Open Access Journals (Sweden)
Irina N Riediger
2017-09-01
Full Text Available With a conservatively estimated 1 million cases of leptospirosis worldwide and a 5-10% fatality rate, the rapid diagnosis of leptospirosis leading to effective clinical and public health decision making is of high importance, and yet remains a challenge.Based on parallel, population-based studies in two leptospirosis-endemic regions in Brazil, a real-time PCR assay which detects lipL32, a gene specifically present in pathogenic Leptospira, was assessed for the diagnostic effectiveness and accuracy. Patients identified by active hospital-based surveillance in Salvador and Curitiba during large urban leptospirosis epidemics were tested. Real-time PCR reactions were performed with DNA-extracted samples obtained from 127 confirmed and 23 unconfirmed cases suspected of leptospirosis, 122 patients with an acute febrile illness other than leptospirosis, and 60 healthy blood donors.The PCR assay had a limit of detection of 280 Leptospira genomic equivalents/mL. Sensitivity for confirmed cases was 61% for whole blood and 29% for serum samples. Sensitivity was higher (86% for samples collected within the first 6 days after onset of illness compared to those collected after 7 days (34%. The real-time PCR assay was able to detect leptospiral DNA in blood from 56% of serological non-confirmed cases. The overall specificity of the assay was 99%.These findings indicate that real-time PCR may be a reliable tool for early diagnosis of leptospirosis, which is decisive for clinical management of severe and life-threatening cases and for public health decision making.
Arbitrarily primed PCR- A rapid and simple method for typing of leptospiral serovars
Directory of Open Access Journals (Sweden)
Ramadass P
2002-01-01
Full Text Available PURPOSE: To investigate the use of arbitrarily primed polymerase chain reaction (AP-PCR for typing of leptospiral serovars. METHODS: AP-PCR was adopted for identification of laboratory strains of leptospires and leptospiral cultures at serovar level. A primer of 12 bp was used for amplifying DNA of 13 laboratory strains of leptospires as well as culture pellets of leptospires. RESULTS: Each serovar produced distinct DNA fingerprint which was characteristic for each serovar. These patterns were used for typing of 81 serum culture samples obtained from human leptospiral cases. Of these samples, 39 could be typed based on AP-PCR fingerprints belonging to serovars autumnalis, pomona, canicola, javanica, icterohaemorrhagiae, patoc and pyrogenes. These results were confirmed by RAPD fingerprinting of the DNA samples of the respective leptospiral serovars after culturing -FNx01them in EMJH media. One of the important findings of this work was that straight culture sample could be used for AP-PCR assay, without purification of DNA. By having more number of AP-PCR reference fingerprints, more serovars could be typed. CONCLUSIONS: AP-PCR technique provides great potential for simple and rapid identification of leptospires at serovar level, which could be useful in molecular epidemiological studies of leptospirosis.
Rapid detection of food-borne Salmonella contamination using IMBs-qPCR method based on pagC gene
Directory of Open Access Journals (Sweden)
Jiashun Wang
Full Text Available Abstract Detection of Salmonella is very important to minimize the food safety risk. In this study, the recombinant PagC protein and PagC antibody were prepared and coupled with immunomagnetic beads (IMBs to capture Salmonella cells from pork and milk samples. And then the SYBR Green qualitative PCR was developed to detect the pathogenic Salmonella. The results showed that the PagC polyclonal antiserum is of good specificity and the capture rate of 0.1 mg IMBs for Salmonella tended to be stable at the range of 70-74% corresponding to the concentrations between 101 and 104 CFU/mL. The method developed demonstrated high specificity for the positive Salmonella samples when compared to non-specific DNA samples, such as Escherichia coli, Staphylococcus aureus, Yersinia enterocolitica, and Yersinia pseudotuberculosis. The limit of detection of this assay was 18 CFU/mL. Detection and quantitative enumeration of Salmonella in samples of pork or milk shows good recoveries of 54.34% and 52.07%. In conclusion, the polyclonal antibody of recombinant PagC protein is effective to capture Salmonella from detected samples. The developed pagC antibody IMBs-qPCR method showed efficiency, sensitivity and specificity for 30 Salmonella detection, enabling detection within 10 h, which is a promising rapid method to detect Salmonella in emergency.
Chaturvedi, Sudha; Rudd, Robert J; Davis, April; Victor, Tanya R; Li, Xiaojiang; Appler, Kim A; Rajkumar, Sunanda S; Chaturvedi, Vishnu
2011-10-01
Geomyces destructans is the etiologic agent of bat geomycosis, commonly referred to as white nose syndrome (WNS). This infection has caused severe morbidity and mortality in little brown bats (Myotis lucifugus) and has also spread to other bat species with significant decline in the populations. Currently, G. destructans infection is identified by culture, ITS-PCR, and histopathology. We hypothesized that a real-time PCR assay would considerably improve detection of G. destructans in bats. The 100 bp sequence of the Alpha-L-Rhamnosidase gene was validated as a target for real-time PCR. The assay sensitivity was determined from serial dilution of DNA extracted from G. destructans conidia (5 × 10(-1)-5 × 10(7)), and the specificity was tested using DNA from 30 closely and distantly related fungi and 5 common bacterial pathogens. The real-time PCR assay was highly sensitive with detection limit of two G. destructans conidia per reaction at 40 PCR cycles. The assay was also highly specific as none of the other fungal or bacterial DNA cross-reacted in the real-time PCR assay. One hundred and forty-seven bat tissue samples, suspected of infection with G. destructans, were used to compare the real-time PCR assay to other methods employed for the detection of G. destructans. Real-time PCR was highly sensitive with 80 of 147 (55%) samples testing positive for G. destructans DNA. In comparison, histopathology examination revealed 64/147 (44%) positive samples. The internal transcribed spacer (ITS)-PCR yielded positive amplicon for G. destructans from 37 tissue samples (25%). The least sensitive assay was the fungal culture with only 17 tissue samples (12%) yielding G. destructans in culture. The data suggested that the real-time PCR assay is highly promising for rapid, sensitive, and specific identification of G. destructans. Further trials and inter-laboratory comparisons of this novel assay are recommended to improve the diagnosis of bat geomycosis.
Liu, Hong-Mei; Cheng, Peng; Huang, Xiaodan; Dai, Yu-Hua; Wang, Hai-Fang; Liu, Li-Juan; Zhao, Yu-Qiang; Wang, Huai-Wei; Gong, Mao-Qing
2013-02-01
The present study aimed to investigate deltamethrin resistance in Culex pipiens pallens (C. pipiens pallens) mosquitoes and its correlation with knockdown resistance (kdr) mutations. In addition, mosquito‑resistance testing methods were analyzed. Using specific primers in polymerase chain reaction (PCR) and allele-specific (AS)-PCR, kdr gene sequences isolated from wild C. pipiens pallens mosquitoes were sequenced. Linear regression analysis was used to determine the correlation between the mutations and deltamethrin resistance. A kdr allelic gene was cloned and sequenced. Analysis of the DNA sequences revealed the presence of two point mutations at the L1014 residue in the IIS6 transmembrane segment of the voltage‑gated sodium channel (VGSC): L1014F, TTA→TTT, replacing a leucine (L) with a phenylalanine (F); L1014S, TTA→TCA, replacing leucine (L) with serine (S). Two alternative kdr-like mutations, L1014F and L1014S, were identified to be positively correlated with the deltamethrin-resistant phenotype. In addition a novel mutation, TCT, was identified in the VGSC of C. pipiens pallens. PCR and AS-PCR yielded consistent results with respect to mosquito resistance. However, the detection rate of PCR was higher than that of AS-PCR. Further studies are required to determine the specific resistance mechanism. PCR and AS-PCR demonstrated suitability for mosquito resistance field tests, however, the former method may be superior to the latter.
Rapid identification of the medicinal plant Taraxacum formosanum ...
African Journals Online (AJOL)
Original identification of medicinal plants is essential for quality control. In this study, the internal transcribed spacer 2 (ITS2) nuclear ribosomal DNA served as a DNA barcode and was amplified by allele-specific PCR. This approach was exploited to differentiate Taraxacum formosanum from five related adulterants. Using a ...
Barbau-Piednoir, Elodie; De Keersmaecker, Sigrid C J; Delvoye, Maud; Gau, Céline; Philipp, Patrick; Roosens, Nancy H
2015-11-11
Recently, the presence of an unauthorized genetically modified (GM) Bacillus subtilis bacterium overproducing vitamin B2 in a feed additive was notified by the Rapid Alert System for Food and Feed (RASFF). This has demonstrated that a contamination by a GM micro-organism (GMM) may occur in feed additives and has confronted for the first time,the enforcement laboratories with this type of RASFF. As no sequence information of this GMM nor any specific detection or identification method was available, Next GenerationSequencing (NGS) was used to generate sequence information. However, NGS data analysis often requires appropriate tools, involving bioinformatics expertise which is not alwayspresent in the average enforcement laboratory. This hampers the use of this technology to rapidly obtain critical sequence information in order to be able to develop a specific qPCRdetection method. Data generated by NGS were exploited using a simple BLAST approach. A TaqMan® qPCR method was developed and tested on isolated bacterial strains and on the feed additive directly. In this study, a very simple strategy based on the common BLAST tools that can be used by any enforcement lab without profound bioinformatics expertise, was successfully used toanalyse the B. subtilis data generated by NGS. The results were used to design and assess a new TaqMan® qPCR method, specifically detecting this GM vitamin B2 overproducing bacterium. The method complies with EU critical performance parameters for specificity, sensitivity, PCR efficiency and repeatability. The VitB2-UGM method also could detect the B. subtilis strain in genomic DNA extracted from the feed additive, without prior culturing step. The proposed method, provides a crucial tool for specifically and rapidly identifying this unauthorized GM bacterium in food and feed additives by enforcement laboratories. Moreover, this work can be seen as a case study to substantiate how the use of NGS data can offer an added value to easily
Directory of Open Access Journals (Sweden)
Laetitia Fabre
Full Text Available BACKGROUND: Serotype-specific PCR assays targeting Salmonella enterica serotypes Typhi and Paratyphi A, the causal agents of typhoid and paratyphoid fevers, are required to accelerate formal diagnosis and to overcome the lack of typing sera and, in some situations, the need for culture. However, the sensitivity and specificity of such assays must be demonstrated on large collections of strains representative of the targeted serotypes and all other bacterial populations producing similar clinical symptoms. METHODOLOGY: Using a new family of repeated DNA sequences, CRISPR (clustered regularly interspaced short palindromic repeats, as a serotype-specific target, we developed a conventional multiplex PCR assay for the detection and differentiation of serotypes Typhi and Paratyphi A from cultured isolates. We also developed EvaGreen-based real-time singleplex PCR assays with the same two sets of primers. PRINCIPAL FINDINGS: We achieved 100% sensitivity and specificity for each protocol after validation of the assays on 188 serotype Typhi and 74 serotype Paratyphi A strains from diverse genetic groups, geographic origins and time periods and on 70 strains of bacteria frequently encountered in bloodstream infections, including 29 other Salmonella serotypes and 42 strains from 38 other bacterial species. CONCLUSIONS: The performance and convenience of our serotype-specific PCR assays should facilitate the rapid and accurate identification of these two major serotypes in a large range of clinical and public health laboratories with access to PCR technology. These assays were developed for use with DNA from cultured isolates, but with modifications to the assay, the CRISPR targets could be used in the development of assays for use with clinical and other samples.
Directory of Open Access Journals (Sweden)
Matjaž HLADNIK
2018-04-01
Full Text Available Microsatellites have been identified as the marker of choice in plant genotyping projects. However, due to length discrepancies obtained between different laboratories for the same allele, interlaboratory comparison of fingerprinting results is often a difficult task. The objectives of this study were to compare genotyping results of two laboratories, to evaluate genetic parameters of microsatellite markers and to determine reference allele sizes for fig cultivars from the Istrian peninsula.Genotyping results of ninety fig (Ficus carica L. accessions were comparable between the laboratories despite differences observed when comparing electropherograms of different capillary electrophoresis systems. Differences in lengths of the same alleles were detected due to different PCR methods and laboratory equipment, but the distances between alleles of the same locus were preserved. However, locus FSYC01 exhibited one allele dropout which led to misidentification of 28 heterozygotes as homozygote individuals suggesting this locus as unreliable. Allele dropout was assigned to the tail PCR technology or to a touchdown PCR protocol.Genotypes of twenty-four reference cultivars from the Istrian peninsula were confirmed by both laboratories. These results will contribute to the usage of markers with greater reliability, discrimination power and consequently, to more reliable standardization with other fig genotyping projects.
Yang, Mingjuan; Ke, Yuehua; Wang, Xuesong; Ren, Hang; Liu, Wei; Lu, Huijun; Zhang, Wenyi; Liu, Shiwei; Chang, Guohui; Tian, Shuguang; Wang, Lihua; Huang, Liuyu; Liu, Chao; Yang, Ruifu; Chen, Zeliang
2016-06-01
Confirming Ebola virus disease (EVD), a deadly infectious disease, requires real-time RT-PCR, which takes up to a few hours to yield results. Therefore, a rapid diagnostic assay is imperative for EVD diagnosis. A rapid nucleic acid test based on recombinase polymerase amplification (EBOV-RPA) was developed to specifically detect the 2014 outbreak strains. The EBOV-RPA assay was evaluated by testing samples from suspected EVD patients in parallel with RT-PCR. An EBOV-RPA, which could be completed in 20 min, was successfully developed. Of 271 patients who tested positive for Ebola virus by RT-PCR, 264 (sensitivity: 97%, 95% CI: 95.5-99.3%) were positive by EBOV-RPA; 101 of 104 patients (specificity: 97%, 95% CI: 93.9-100%) who tested negative by RT-PCR were also negative by EBOV-RPA. The sensitivity values for samples with a Ct value of RPA had significantly high Ct values. Results of external quality assessment samples with EBOV-RPA were 100%, consistent with those of RT-PCR. The EBOV-RPA assay showed 97% sensitivity and 97% specificity for all EVD samples tested, making it a rapid and sensitive test for EVD diagnosis.
The loss-of-allele assay for ES cell screening and mouse genotyping.
Frendewey, David; Chernomorsky, Rostislav; Esau, Lakeisha; Om, Jinsop; Xue, Yingzi; Murphy, Andrew J; Yancopoulos, George D; Valenzuela, David M
2010-01-01
(qPCR) as our method of allele quantification, but any method that can reliably distinguish the difference between one and two copies of the target gene can be used to develop an LOA assay. We have designed qPCR LOA assays for deletions, insertions, point mutations, domain swaps, conditional, and humanized alleles and have used the insert assays to quantify the copy number of random insertion BAC transgenics. Because of its quantitative precision, specificity, and compatibility with high throughput robotic operations, the LOA assay eliminates bottlenecks in ES cell screening and mouse genotyping and facilitates maximal speed and throughput for knockout mouse production. Copyright (c) 2010 Elsevier Inc. All rights reserved.
Szabó, P E; Mann, J R
1996-01-01
It has often been suggested that the parental-specific expression of mammalian imprinted genes might be dependent on maternal-paternal intergenomic or interallelic interactions. Using quantitative allele-specific RT-PCR single nucleotide primer extension assays developed for two imprinted genes, Snrpn and Igf2r, we demonstrate: (i) No role for maternal-paternal allelic interactions: the modes of parental-specific expression of Snrpn and Igf2r in normal ova were unchanged in gynogenetic and an...
Kim, Dong-Hyeon; Chon, Jung-Whan; Kim, Hong-Seok; Yim, Jin-Hyeok; Kim, Hyunsook; Seo, Kun-Ho
2015-04-01
Lactobacillus kefiranofaciens is an indicator microorganism for kefir and a key factor in kefir grain formation and kefiran production. We designed a novel real-time PCR primer and probe set, LKF_KU504, for the rapid detection of L. kefiranofaciens. In inclusivity and exclusivity tests, only 14 L. kefiranofaciens strains were positive among 61 microorganisms, indicating 100 % sensitivity and specificity. The LKF_KU504 set also differentiated kefir milk from 30 commercial nonkefir yogurts. The levels of L. kefiranofaciens in kefir grain and kefir milk were significantly different, indicating L. kefiranofaciens was more concentrated in kefir grain than in kefir milk.
A Ribeiroia spp. (Class: Trematoda) - Specific PCR-based diagnostic
Reinitz, David M.; Yoshino, T.P.; Cole, Rebecca A.
2007-01-01
Increased reporting of amphibian malformations in North America has been noted with concern in light of reports that amphibian numbers and species are declining worldwide. Ribeiroia ondatrae has been shown to cause a variety of types of malformations in amphibians. However, little is known about the prevalence of R. ondatrae in North America. To aid in conducting field studies of Ribeiroia spp., we have developed a polymerase chain reaction (PCR)-based diagnostic. Herein, we describe the development of an accurate, rapid, simple, and cost-effective diagnostic for detection of Ribeiroia spp. infection in snails (Planorbella trivolvis). Candidate oligonucleotide primers for PCR were designed via DNA sequence analyses of multiple ribosomal internal transcribed spacer-2 regions from Ribeiroia spp. and Echinostoma spp. Comparison of consensus sequences determined from both genera identified areas of sequence potentially unique to Ribeiroia spp. The PCR reliably produced a diagnostic 290-base pair (bp) product in the presence of a wide concentration range of snail or frog DNA. Sensitivity was examined with DNA extracted from single R. ondatrae cercaria. The single-tube PCR could routinely detect less than 1 cercariae equivalent, because DNA isolated from a single cercaria could be diluted at least 1:50 and still yield a positive result via gel electrophoresis. An even more sensitive nested PCR also was developed that routinely detected 100 fg of the 290-bp fragment. The assay did not detect furcocercous cercariae of certain Schistosomatidae, Echinostoma sp., or Sphaeridiotrema globulus nor adults of Clinostomum sp. or Cyathocotyle bushiensis. Field testing of 137 P. trivolvis identified 3 positives with no overt environmental cross-reactivity, and results concurred with microscopic examinations in all cases. ?? American Society of Parasitologists 2007.
Iida, Takao; Mizuno, Yukie; Kaizaki, Yasuharu
2017-10-27
Mutations in RAS and BRAF are predictors of the efficacy of anti-epidermal growth factor receptor (EGFR) therapy in patients with metastatic colorectal cancer (mCRC). Therefore, simple, rapid, cost-effective methods to detect these mutations in the clinical setting are greatly needed. In the present study, we evaluated BNA Real-time PCR Mutation Detection Kit Extended RAS (BNA Real-time PCR), a real-time PCR method that uses bridged nucleic acid clamping technology to rapidly detect mutations in RAS exons 2-4 and BRAF exon 15. Genomic DNA was extracted from 54 formalin-fixed paraffin-embedded (FFPE) tissue samples obtained from mCRC patients. Among the 54 FFPE samples, BNA Real-time PCR detected 21 RAS mutations (38.9%) and 5 BRAF mutations (9.3%), and the reference assay (KRAS Mutation Detection Kit and MEBGEN™ RASKET KIT) detected 22 RAS mutations (40.7%). The concordance rate of detected RAS mutations between the BNA Real-time PCR assay and the reference assays was 98.2% (53/54). The BNA Real-time PCR assay proved to be a more simple, rapid, and cost-effective method for detecting KRAS and RAS mutations compared with existing assays. These findings suggest that BNA Real-time PCR is a valuable tool for predicting the efficacy of early anti-EGFR therapy in mCRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.
Allele frequency distribution for 21 autosomal STR loci in Nepal.
Kraaijenbrink, T; van Driem, G L; Opgenort, J R M L; Tuladhar, N M; de Knijff, P
2007-05-24
The allele frequency distributions of 21 autosomal loci contained in the AmpFlSTR Identifiler, the Powerplex 16 and the FFFL multiplex PCR kits, was studied in 953 unrelated individuals from Nepal. Several new alleles (i.e. not yet reported in the NIST Short Tandem Repeat DNA Internet DataBase [http://www.cstl.nist.gov/biotech/strbase/]) have been detected in the process.
Wang, Jianchang; Wang, Jinfeng; Cui, Yuan; Nan, Huizhu; Yuan, Wanzhe
2017-08-01
A real-time PCR assay was developed for specific detection of novel duck-origin goose parvovirus (N-GPV), the etiological agent of duck beak atrophy and dwarfism syndrome (BADS). The detection limit of the assay was 10 2 copies. The assay was useful in the prevention and control of BADS. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Ishikawa Shumpei
2006-02-01
Full Text Available Abstract Background DNA copy number alterations are one of the main characteristics of the cancer cell karyotype and can contribute to the complex phenotype of these cells. These alterations can lead to gains in cellular oncogenes as well as losses in tumor suppressor genes and can span small intervals as well as involve entire chromosomes. The ability to accurately detect these changes is central to understanding how they impact the biology of the cell. Results We describe a novel algorithm called CARAT (Copy Number Analysis with Regression And Tree that uses probe intensity information to infer copy number in an allele-specific manner from high density DNA oligonuceotide arrays designed to genotype over 100, 000 SNPs. Total and allele-specific copy number estimations using CARAT are independently evaluated for a subset of SNPs using quantitative PCR and allelic TaqMan reactions with several human breast cancer cell lines. The sensitivity and specificity of the algorithm are characterized using DNA samples containing differing numbers of X chromosomes as well as a test set of normal individuals. Results from the algorithm show a high degree of agreement with results from independent verification methods. Conclusion Overall, CARAT automatically detects regions with copy number variations and assigns a significance score to each alteration as well as generating allele-specific output. When coupled with SNP genotype calls from the same array, CARAT provides additional detail into the structure of genome wide alterations that can contribute to allelic imbalance.
Feng, Jiawang; Tang, Shiming; Liu, Lideng; Kuang, Xiaoshan; Wang, Xiaoyu; Hu, Songnan; You, Shuzhu
2015-03-01
Here, we developed a loop-mediated isothermal amplification (LAMP) assay for 11 common transgenic target DNA in GMOs. Six sets of LAMP primer candidates for each target were designed and their specificity, sensitivity, and reproductivity were evaluated. With the optimized LAMP primers, this LAMP assay was simply run within 45-60 min to detect all these targets in GMOs tested. The sensitivity, specificity, and reproductivity of the LAMP assay were further analyzed in comparison with those of Real-Time PCR. In consistent with real-time PCR, detection of 0.5% GMOs in equivalent background DNA was possible using this LAMP assay for all targets. In comparison with real-time PCR, the LAMP assay showed the same results with simple instruments. Hence, the LAMP assay developed can provide a rapid and simple approach for routine screening as well as specific events detection of many GMOs.
HLA alleles and haplotypes in Burmese (Myanmarese) and Karen in Thailand.
Kongmaroeng, C; Romphruk, A; Puapairoj, C; Leelayuwat, C; Kulski, J K; Inoko, H; Dunn, D S; Romphruk, A V
2015-09-01
This is the first report on human leukocyte antigen (HLA) allele and haplotype frequencies at three class I loci and two class II loci in unrelated healthy individuals from two ethnic groups, 170 Burmese and 200 Karen, originally from Burma (Myanmar), but sampled while residing in Thailand. Overall, the HLA allele and haplotype frequencies detected by polymerase chain reaction sequence-specific primer (PCR-SSP) at five loci (A, B, C, DRB1 and DRQB1) at low resolution showed distinct differences between the Burmese and Karen. In Burmese, five HLA-B*15 haplotypes with different HLA-A and HLA-DR/DQ combinations were detected with three of these not previously reported in other Asian populations. The data are important in the fields of anthropology, transplantation and disease-association studies. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Nested PCR for specific diagnosis of Taenia solium taeniasis.
Mayta, Holger; Gilman, Robert H; Prendergast, Emily; Castillo, Janeth P; Tinoco, Yeny O; Garcia, Hector H; Gonzalez, Armando E; Sterling, Charles R
2008-01-01
Taeniasis due to Taenia solium is a disease with important public health consequences, since the larval stage is not exclusive to the animal intermediate, the pig, but also infects humans, causing neurocysticercosis. Early diagnosis and treatment of T. solium tapeworm carriers is important to prevent human cysticercosis. Current diagnosis based on microscopic observation of eggs lacks both sensitivity and specificity. In the present study, a nested-PCR assay targeting the Tso31 gene was developed for the specific diagnosis of taeniasis due to T. solium. Initial specificity and sensitivity testing was performed using stored known T. solium-positive and -negative samples. The assay was further analyzed under field conditions by conducting a case-control study of pretreatment stool samples collected from a population in an area of endemicity. Using the archived samples, the assay showed 97% (31/32) sensitivity and 100% (123/123) specificity. Under field conditions, the assay had 100% sensitivity and specificity using microscopy/enzyme-linked immunosorbent assay coproantigen testing as the gold standards. The Tso31 nested PCR described here might be a useful tool for the early diagnosis and prevention of taeniasis/cysticercosis.
DEFF Research Database (Denmark)
Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas
2017-01-01
, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair...
Alexander, William G; Doering, Drew T; Hittinger, Chris Todd
2014-11-01
Current genome editing techniques available for Saccharomyces yeast species rely on auxotrophic markers, limiting their use in wild and industrial strains and species. Taking advantage of the ancient loss of thymidine kinase in the fungal kingdom, we have developed the herpes simplex virus thymidine kinase gene as a selectable and counterselectable marker that forms the core of novel genome engineering tools called the H: aploid E: ngineering and R: eplacement P: rotocol (HERP) cassettes. Here we show that these cassettes allow a researcher to rapidly generate heterogeneous populations of cells with thousands of independent chromosomal allele replacements using mixed PCR products. We further show that the high efficiency of this approach enables the simultaneous replacement of both alleles in diploid cells. Using these new techniques, many of the most powerful yeast genetic manipulation strategies are now available in wild, industrial, and other prototrophic strains from across the diverse Saccharomyces genus. Copyright © 2014 by the Genetics Society of America.
Lu, Sha; Li, Xiqing; Calderone, Richard; Zhang, Jing; Ma, Jianchi; Cai, Wenying; Xi, Liyan
2016-02-01
Talaromyces marneffei is a dimorphic pathogenic fungus, which is a life-threatening invasive mycosis in the immunocompromised host. Prompt diagnosis of T. marneffei infection remains difficult although there has been progress in attempts to expedite the diagnosis of this infection. We previously demonstrated the value of nested polymerase chain reaction (PCR) to detect T. marneffei in paraffin embedded tissue samples with high sensitivity and specificity. In this study, this assay was used to detect the DNA of T. marneffei in whole blood samples. Real-time PCR assay was also evaluated to identify T. marneffei in the same samples. Twenty out of 30 whole blood samples (67%) collected from 23 patients were found positive by using the nested PCR assay, while 23/30 (77%) samples were found positive by using the real-time PCR assay. In order to express accurately the fungal loads, we used a normalized linearized plasmid as an internal control for real-time PCR. The assay results were correlated as the initial quantity (copies/μl) with fungal burden. These data indicate that combination of nested PCR and real-time PCR assay provides an attractive alternative for identification of T. marneffei DNA in whole blood samples of HIV-infected patients. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
RUCS: Rapid identification of PCR primers for unique core sequences
DEFF Research Database (Denmark)
Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik
2017-01-01
Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...
Engelsma, K.A.; Veerkamp, R.F.; Calus, M.P.L.; Windig, J.J.
2014-01-01
When animals are selected for one specific allele, for example for inclusion in a gene bank, this may result in the loss of diversity in other parts of the genome. The aim of this study was to quantify the risk of losing diversity across the genome when targeting a single allele for conservation
Rapid quantification of plant-powdery mildew interactions by qPCR and conidiospore counts.
Weßling, Ralf; Panstruga, Ralph
2012-08-31
The powdery mildew disease represents a valuable patho-system to study the interaction between plant hosts and obligate biotrophic fungal pathogens. Numerous discoveries have been made on the basis of the quantitative evaluation of plant-powdery mildew interactions, especially in the context of hyper-susceptible and/or resistant plant mutants. However, the presently available methods to score the pathogenic success of powdery mildew fungi are laborious and thus not well suited for medium- to high-throughput analysis. Here we present two new protocols that allow the rapid quantitative assessment of powdery mildew disease development. One procedure depends on quantitative polymerase chain reaction (qPCR)-based evaluation of fungal biomass, while the other relies on the quantification of fungal conidiospores. We validated both techniques using the powdery mildew pathogen Golovinomyces orontii on a set of hyper-susceptible and resistant Arabidopsis thaliana mutants and found that both cover a wide dynamic range of one to two (qPCR) and four to five (quantification of conidia) orders of magnitude, respectively. The two approaches yield reproducible results and are easy to perform without specialized equipment. The qPCR and spore count assays rapidly and reproducibly quantify powdery mildew pathogenesis. Our methods are performed at later stages of infection and discern mutant phenotypes accurately. The assays therefore complement currently used procedures of powdery mildew quantification and can overcome some of their limitations. In addition, they can easily be adapted to other plant-powdery mildew patho-systems.
Luijt, DS; Bos, PAJ; van Zwet, AA; Vader, PCV; Schirm, J
A total of 3,023 clinical specimens were tested for Neisseria gonorrhoeae by using COBAS AMPLICOR (CA) PCR and confirmation of positives by N. gonorrhoeae-specific 16S rRNA PCR. The sensitivity of CA plus 16S rRNA PCR was 98.8%, compared to 68.2% for culture. Confirmation of CA positives increased
Directory of Open Access Journals (Sweden)
Josh Lewis Stern
2017-12-01
Full Text Available A mutation in the promoter of the Telomerase Reverse Transcriptase (TERT gene is the most frequent noncoding mutation in cancer. The mutation drives unusual monoallelic expression of TERT, allowing immortalization. Here, we find that DNA methylation of the TERT CpG island (CGI is also allele-specific in multiple cancers. The expressed allele is hypomethylated, which is opposite to cancers without TERT promoter mutations. The continued presence of Polycomb repressive complex 2 (PRC2 on the inactive allele suggests that histone marks of repressed chromatin may be causally linked to high DNA methylation. Consistent with this hypothesis, TERT promoter DNA containing 5-methyl-CpG has much increased affinity for PRC2 in vitro. Thus, CpG methylation and histone marks appear to collaborate to maintain the two TERT alleles in different epigenetic states in TERT promoter mutant cancers. Finally, in several cancers, DNA methylation levels at the TERT CGI correlate with altered patient survival.
Yamashita, S; Nakagawa, H; Sakaguchi, T; Arima, T-H; Kikoku, Y
2018-01-01
Heat-resistant fungi occur sporadically and are a continuing problem for the food and beverage industry. The genus Talaromyces, as a typical fungus, is capable of producing the heat-resistant ascospores responsible for the spoilage of processed food products. Isocitrate lyase, a signature enzyme of the glyoxylate cycle, is required for the metabolism of non-fermentable carbon compounds, like acetate and ethanol. Here, species-specific primer sets for detection and identification of DNA derived from Talaromyces macrosporus and Talaromyces trachyspermus were designed based on the nucleotide sequences of their isocitrate lyase genes. Polymerase chain reaction (PCR) using a species-specific primer set amplified products specific to T. macrosporus and T. trachyspermus. Other fungal species, such as Byssochlamys fulva and Hamigera striata, which cause food spoilage, were not detected using the Talaromyces-specific primer sets. The detection limit for each species-specific primer set was determined as being 50 pg of template DNA, without using a nested PCR method. The specificity of each species-specific primer set was maintained in the presence of 1,000-fold amounts of genomic DNA from other fungi. The method also detected fungal DNA extracted from blueberry inoculated with T. macrosporus. This PCR method provides a quick, simple, powerful and reliable way to detect T. macrosporus and T. trachyspermus. Polymerase chain reaction (PCR)-based detection is rapid, convenient and sensitive compared with traditional methods of detecting heat-resistant fungi. In this study, a PCR-based method was developed for the detection and identification of amplification products from Talaromyces macrosporus and Talaromyces trachyspermus using primer sets that target the isocitrate lyase gene. This method could be used for the on-site detection of T. macrosporus and T. trachyspermus in the near future, and will be helpful in the safety control of raw materials and in food and beverage
Multiplex PCR assay for simultaneous detection of six major bacterial pathogens of rice.
Cui, Z; Ojaghian, M R; Tao, Z; Kakar, K U; Zeng, J; Zhao, W; Duan, Y; Vera Cruz, C M; Li, B; Zhu, B; Xie, G
2016-05-01
The aim of this study was to develop a multiplex PCR (mPCR) assay for rapid, sensitive and simultaneous detection of six important rice pathogens: Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, Pseudomonas fuscovaginae, Burkholderia glumae, Burkholderia gladioli and Acidovorax avenae subsp. avenae. Specific primers were designed through a bioinformatics pipeline. Sensitivity of detection was established using both traditional PCR and quantitative real-time PCR on isolated DNA and on bacterial cells both in vitro and in simulated diseased seeds and the parameters were optimized for an mPCR assay. A total of 150 bacterial strains were tested for specificity. The mPCR assay accurately predicted the presence of pathogens among 44 symptomatic and asymptomatic rice seed, sheath and leaf samples. This study confirmed that this mPCR assay is a rapid, reliable and simple tool for the simultaneous detection of six important rice bacterial pathogens. This study is the first report of a method allowing simultaneous detection of six major rice pathogens. The ability to use crude extracts from plants without bacterial isolation or DNA extraction enhances the value of this mPCR technology for rapid detection and aetiological/epidemiological studies. © 2016 The Society for Applied Microbiology.
RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK
Directory of Open Access Journals (Sweden)
Edith Burbano
2006-05-01
Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses
Karthik, K; Rathore, Rajesh; Thomas, Prasad; Arun, T R; Viswas, K N; Agarwal, R K; Manjunathachar, H V; Dhama, Kuldeep
2014-01-01
Brucella abortus, the major causative agent of abortion in cattle and a zoonotic pathogen, needs to be diagnosed at an early stage. Loop-mediated isothermal amplification (LAMP) test is easy to perform and also promising to be adapted at field level. To develop a LAMP assay for specific and rapid detection of B. abortus from clinical samples of cattle. LAMP primers were designed targeting BruAb2_0168 region using specific software tool and LAMP was optimized. The developed LAMP was tested for its specificity with 3 Brucella spp. and 11 other non-Brucella spp. Sensitivity of the developed LAMP was also carried out with known quantity of DNA. Cattle whole blood samples and aborted fetal stomach contents were collected and used for testing with developed LAMP assay and results were compared with polymerase chain reaction (PCR). The developed LAMP assay works at 61 °C for 60 min and the detection limit was observed to be 100-fold more than the conventional PCR that is commonly used for diagnosis of B. abortus. Clinical sensitivity and specificity of the developed LAMP assay was 100% when compared with Rose Bengal plate test and standard tube agglutination test. SYB® green dye I was used to visualize the result with naked eye. The novelty of the developed LAMP assay for specifically detecting B. abortus infection in cattle along with its inherent rapidness and high sensitivity can be employed for detecting this economically important pathogen of cattle at field level as well be exploited for screening of human infections.
Association of primary biliary cirrhosis with the allele HLA-DPB1*0301 in a German population.
Mella, J G; Roschmann, E; Maier, K P; Volk, B A
1995-02-01
The major histocompatibility complex class II alleles at the HLA-DPB1 locus were investigated in 32 German Caucasoid patients with primary biliary cirrhosis (PBC) and compared with those from 47 normal control patients using molecular genotyping techniques. The second exon of the HLA-DPB1 gene was amplified by polymerase chain reaction (PCR) and hybridized with 25 sequence-specific oligonucleotides (SSOs) to assign the HLA-DPB1 alleles on the basis of known sequence variations, according to the protocols of the Eleventh International Histocompatibility Workshop. A strong association of PBC was found with the allele HLA-DPB1*0301. The allele HLA DPB1*0301 was present in 50% (16 of 32) of the patients with PBC compared with 13% (6 of 47) of normal controls (P corrected < .015), whereas the other HLA-DPB1 alleles showed no significant differences in both groups. The relative risk (RR) estimate for the allele HLA-DPB1*0301 was 6.8 (95% confidence limits: 2.27 to 20.57). In summary, this study clearly demonstrates an association of PBC with the HLA-DPB1*0301 allele in German Caucasoids and may add new data to the immunogenetic background of PBC, suggesting a contribution of the HLA-DPB1 gene to the genetic susceptibility of the disease.
Fibrillin levels in a severely affected Marfan syndrome patient with a null allele
Energy Technology Data Exchange (ETDEWEB)
Boxer, M.; Withers, A.P.; Al-Ghaban, Z. [Univ. of Wales, Cardiff (United Kingdom)]|[Ninewells Hospital and Medical School, Dundee (United Kingdom)] [and others
1994-09-01
Marfan syndrome is an autosomal dominantly inherited connective tissue disorder characterized by defects in the cardiovascular, skeletal and ocular systems. A patient was first examined in 1992 having survived an acute sortic dissection with subsequent composite repair and insertion of a prosthetic aortic valve. Clinical examination revealed arachnodactyly, narrow, high arched palate with dental crowding, an arm span exceeding her height by 10.5 cm, joint laxity and bilateral lens subluxation. Analysis of the family showed affected members in three generations and the fibrillin gene, FBN1, was shown to segregate with the disease when using polymorphic markers including an RsaI polymorphism in the 3{prime}-untranslated region of the gene. Analysis of patient mRNA for this RsaI polymorphism by RT-PCR (reverse transcriptase-PCR) amplification and restriction enzyme digestion of the PCR products showed that the copy of the gene segregating with the disease was not transcribed. No low level expression of this allele was observed despite RT-PCR amplification incorporating radioactively labelled dCTP, thus revealing a null allele phenotype. Western blotting analysis of fibrillin secreted by the patient`s dermal fibroblasts using fibrillin-specific antibodies showed only normal sized fibrillin protein. However, immunohistochemical studies of the patient`s tissue and fibroblasts showed markedly lowered levels in staining of microfibrillar structures compared with age-matched controls. This low level of expression of the protein affected in Marfan syndrome in a patient with such severe clinical manifestations is surprising since current understanding would suggest that this molecular phenotype should lead to a mild clinical disorder.
Wang, Bi; Yu, Lei; Yang, Guo-Zhen; Luo, Xin; Huang, Lin
2015-01-01
To explore the application of multiplex nested methylated specific polymerase chain reaction (PCR) in the early diagnosis of epithelial ovarian carcinoma (EOC). Serum and fresh tissue samples were collected from 114 EOC patients. RUNX3, TFPI2 and OPCML served as target genes. Methylation levels of tissues were assessed by multiplex nested methylated specific PCR, the results being compared with those for carcinoma antigen 125 (CA125). The serum free deoxyribose nucleic acid (DNA) methylation spectrum of EOC patients was completely contained in the DNA spectrum of cancer tissues, providing an accurate reflection of tumor DNA methylation conditions. Serum levels of CA125 and free DNA methylation in the EOC group were evidently higher than those in benign lesion and control groups (p0.05). The sensitivity, specificity and positive predicative value (PPV) of multiplex nested methylated specific PCR were significantly higher for detection of all patients and those with early EOC than those for CA125 (pnested methylated specific PCR (p>0.05), but there was no significant difference in sensitivity (p>0.05). Serum free DNA methylation can be used as a biological marker for EOC and multiplex nested methylated specific PCR should be considered for early diagnosis since it can accurately determine tumor methylation conditions.
Directory of Open Access Journals (Sweden)
Zhenming Yu
Full Text Available Targeted DNA enrichment coupled with next generation sequencing has been increasingly used for interrogation of select sub-genomic regions at high depth of coverage in a cost effective manner. Specificity measured by on-target efficiency is a key performance metric for target enrichment. Non-specific capture leads to off-target reads, resulting in waste of sequencing throughput on irrelevant regions. Microdroplet-PCR allows simultaneous amplification of up to thousands of regions in the genome and is among the most commonly used strategies for target enrichment. Here we show that carryover of single-stranded template genomic DNA from microdroplet-PCR constitutes a major contributing factor for off-target reads in the resultant libraries. Moreover, treatment of microdroplet-PCR enrichment products with a nuclease specific to single-stranded DNA alleviates off-target load and improves enrichment specificity. We propose that nuclease treatment of enrichment products should be incorporated in the workflow of targeted sequencing using microdroplet-PCR for target capture. These findings may have a broad impact on other PCR based applications for which removal of template DNA is beneficial.
DEFF Research Database (Denmark)
Bachanek-Bankowska, Katarzyna; Mero, Herieth R.; Wadsworth, Jemma
2016-01-01
Rapid, reliable and accurate diagnostic methods provide essential support to programmes that monitor and control foot-and-mouth disease (FMD). While pan-specific molecular tests for FMD virus (FMDV) detection are well established and widely used in endemic and FMD-free countries, current serotyping...... methods mainly rely either on antigen detection ELISAs or nucleotide sequencing approaches. This report describes the development of a panel of serotype-specific real-time RT-PCR assays (rRT-PCR) tailored to detect FMDV lineages currently circulating in East Africa. These assays target sequences within...... sequencing. Samples (n = 71) representing serotype A (topotype AFRICA, lineage G-I), serotype O (topotypes EA-2 and EA-4), serotype SAT 1 (topotype I (NWZ)) and serotype SAT2 (topotype IV) were correctly identified with these rRT-PCR assays. Furthermore, FMDV RNA from samples that did not contain infectious...
Quadruplex genotype analysis at HumTH01, HumTPOX, HumCSF1PO and amelogenin Loci by FoLT-PCR
Energy Technology Data Exchange (ETDEWEB)
Lee, Y.H.; Lim, S.K.; Kang, P.W.; Choi, D.H.; Yoon, S.R.; Han, M.S. [National Institute of Scientific Investigation, Seoul (Korea)
1999-06-01
A simple and rapid procedure, called FoLT-PCR(Formamide Low Temperature-Polymerase Chain Reaction) was applied to amplifying DNA directly from various forensic biological evidences including human blood, saliva, hair root, or semen without any DNA preparative steps. We added washing step with non-ionic detergent, 1% Triton X-100, and used Taq DNA polymerase instead of Tth DNA polymerase to amplify 3 STR loci and gender allele simultaneously. Optimal concentration of formamide and annealing temperature were determined empirically to 8%(v/v), and 48{sup o} C respectively. We also compared this method with standard PCR. 8 refs., 4 figs.
Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok
2018-03-01
We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.
DEFF Research Database (Denmark)
Bang, Dang Duong; Wedderkopp, A.; Pedersen, Karl
2002-01-01
sensitivity due to the use of selective media, the low number of bacteria in the samples and possibly also due to the presence of non-culturable or sub-lethally injured stages of the bacteria. The present paper describes a rapid PCR assay using nested primers of the 16S rRNA or the hippuricase (hipO) genes...... to detect Campylobacter jejuni and Campylobacter coli in environmental samples. The sensitivity of the nested PCR was determined to be 0.01 pg/PCR, corresponding to 2-3 colony forming units (cfu) per ml. The nested PCR assays were applied to detect C. jejuni and C. coli in 269 environmental samples...... collected from ten broiler farms. The sensitivity, specificity and the usefulness of the PCR assay for detection of C. jejuni and C coli in environmental samples are presented and discussed....
A one-step, real-time PCR assay for rapid detection of rhinovirus.
Do, Duc H; Laus, Stella; Leber, Amy; Marcon, Mario J; Jordan, Jeanne A; Martin, Judith M; Wadowsky, Robert M
2010-01-01
One-step, real-time PCR assays for rhinovirus have been developed for a limited number of PCR amplification platforms and chemistries, and some exhibit cross-reactivity with genetically similar enteroviruses. We developed a one-step, real-time PCR assay for rhinovirus by using a sequence detection system (Applied Biosystems; Foster City, CA). The primers were designed to amplify a 120-base target in the noncoding region of picornavirus RNA, and a TaqMan (Applied Biosystems) degenerate probe was designed for the specific detection of rhinovirus amplicons. The PCR assay had no cross-reactivity with a panel of 76 nontarget nucleic acids, which included RNAs from 43 enterovirus strains. Excellent lower limits of detection relative to viral culture were observed for the PCR assay by using 38 of 40 rhinovirus reference strains representing different serotypes, which could reproducibly detect rhinovirus serotype 2 in viral transport medium containing 10 to 10,000 TCID(50) (50% tissue culture infectious dose endpoint) units/ml of the virus. However, for rhinovirus serotypes 59 and 69, the PCR assay was less sensitive than culture. Testing of 48 clinical specimens from children with cold-like illnesses for rhinovirus by the PCR and culture assays yielded detection rates of 16.7% and 6.3%, respectively. For a batch of 10 specimens, the entire assay was completed in 4.5 hours. This real-time PCR assay enables detection of many rhinovirus serotypes with the Applied Biosystems reagent-instrument platform.
Implication of HLA-DMA Alleles in Corsican IDDM
Directory of Open Access Journals (Sweden)
P. Cucchi-Mouillot
1998-01-01
Full Text Available The HLA-DM molecule catalyses the CLIP/antigen peptide exchange in the classical class II peptide-binding groove. As such, DM is an antigen presentation regulator and may be linked to autoimmune diseases. Using PCR derived methods, a relationship was revealed between DM gene polymorphism and IDDM, in a Corsican population. The DMA*0101 allele was observed to confer a significant predisposition to this autoimmune disease while the DMA*0102 allele protected significantly. Experiments examining polymorphism of the HLA-DRB1 gene established that these relationships are not a consequence of linkage disequilibrium with HLA-DRB1 alleles implicated in this pathology. The study of the DMA gene could therefore be an additional tool for early IDDM diagnosis in the Corsican population.
Development of a PCR technique specific for Demodex injai in biological specimens.
Sastre, N; Ravera, I; Ferreira, D; Altet, L; Sánchez, A; Bardagí, M; Francino, O; Ferrer, L
2013-09-01
The identification of Demodex injai as a second Demodex species of dog opened new questions and challenges in the understanding on the Demodex-host relationships. In this paper, we describe the development of a conventional PCR technique based on published genome sequences of D. injai from GenBank that specifically detects DNA from D. injai. This technique amplifies a 238-bp fragment corresponding to a region of the mitochondrial 16S rDNA of D. injai. The PCR was positive in DNA samples obtained from mites identified morphologically as D. injai, which served as positive controls, as well as in samples from three cases of demodicosis associated with proliferation of mites identified as D. injai. Furthermore, the PCR was positive in 2 out of 19 healthy dogs. Samples of Demodex canis and Demodex folliculorum were consistently negative. Skin samples from seven dogs with generalized demodicosis caused by D. canis were all negative in the D. injai-specific PCR, demonstrating that in generalized canine demodicosis, mite proliferation is species-specific. This technique can be a useful tool in the diagnosis and in epidemiologic and pathogenic studies.
International Nuclear Information System (INIS)
Dotan, Zohar A; Dotan, Aviva; Ramon, Jacob; Avivi, Lydia
2008-01-01
Allelic counterparts of biallelically expressed genes display an epigenetic symmetry normally manifested by synchronous replication, different from genes subjected to monoallelic expression, which normally are characterized by an asynchronous mode of replication (well exemplified by the SNRPN imprinted locus). Malignancy was documented to be associated with gross modifications in the inherent replication-timing coordination between allelic counterparts of imprinted genes as well as of biallelically expressed loci. The cancer-related allelic replication timing aberrations are non-disease specific and appear in peripheral blood cells of cancer patients, including those with solid tumors. As such they offer potential blood markers for non-invasive cancer test. The present study was aimed to gain some insight into the mechanism leading to the replication timing alterations of genes in blood lymphocytes of cancer patients. Peripheral blood samples derived from patients with prostate cancer were chosen to represent the cancerous status, and samples taken from patients with no cancer but with benign prostate hyperplasia were used to portray the normal status. Fluorescence In Situ Hybridization (FISH) replication assay, applied to phytohemagglutinin (PHA)-stimulated blood lymphocytes, was used to evaluate the temporal order (either synchronous or asynchronous) of genes in the patients' cells. We demonstrated that: (i) the aberrant epigenetic profile, as delineated by the cancer status, is a reversible modification, evidenced by our ability to restore the normal patterns of replication in three unrelated loci (CEN15, SNRPN and RB1) by introducing an archetypical demethylating agent, 5-azacytidine; (ii) following the rehabilitating effect of demethylation, an imprinted gene (SNRPN) retains its original parental imprint; and (iii) the choice of an allele between early or late replication in the aberrant asynchronous replication, delineated by the cancer status, is not
Ma, X; Cai, Z; Liu, W; Ge, S; Tang, L
2017-09-01
The self-incompatibility (SI) gene that is specifically expressed in pistils encodes the SI-associated ribonuclease (S-RNase), functioning as the female-specificity determinant of a gametophytic SI system. Despite extensive surveys in Malus domestica, the S-alleles have not been fully investigated for Malus sieversii, the primary wild ancestor of the domesticated apple. Here we screened the M. sieversii S-alleles via PCR amplification and sequencing, and identified 14 distinct alleles in this species. By contrast, nearly 40 are present in its close wild relative, Malus sylvestris. We further sequenced 8 nuclear genes to provide a neutral reference, and investigated the evolution of S-alleles via genealogical and population genetic analyses. Both shared ancestral polymorphism and an excess of non-synonymous substitution were detected in the S-RNases of the tribe Maleae in Rosaceae, indicating the action of long-term balancing selection. Approximate Bayesian Computations based on the reference neutral loci revealed a severe bottleneck in four of the six studied M. sieversii populations, suggesting that the low number of S-alleles found in this species is mainly the result of diversity loss due to a drastic population contraction. Such a bottleneck may lead to ambiguous footprints of ongoing balancing selection detected at the S-locus. This study not only elucidates the constituents and number of S-alleles in M. sieversii but also illustrates the potential utility of S-allele number shifts in demographic inference for self-incompatible plant species.
Directory of Open Access Journals (Sweden)
Zhang Yi
2012-07-01
Full Text Available Abstract Background Complex vertebral malformation (CVM and bovine leukocyte adhesion deficiency (BLAD are two autosomal recessive lethal genetic defects frequently occurring in Holstein cattle, identifiable by single nucleotide polymorphisms. The objective of this study is to develop a rapid and reliable genotyping assay to screen the active Holstein sires and determine the carrier frequency of CVM and BLAD in Chinese dairy cattle population. Results We developed real-time PCR-based assays for discrimination of wild-type and defective alleles, so that carriers can be detected. Only one step was required after the DNA extraction from the sample and time consumption was about 2 hours. A total of 587 Chinese Holstein bulls were assayed, and fifty-six CVM-carriers and eight BLAD-carriers were identified, corresponding to heterozygote carrier frequencies of 9.54% and 1.36%, respectively. The pedigree analysis showed that most of the carriers could be traced back to the common ancestry, Osborndale Ivanhoe for BLAD and Pennstate Ivanhoe Star for CVM. Conclusions These results demonstrate that real-time PCR is a simple, rapid and reliable assay for BLAD and CVM defective allele detection. The high frequency of the CVM allele suggests that implementing a routine testing system is necessary to gradually eradicate the deleterious gene from the Chinese Holstein population.
Cai, Xian-Quan; Yu, Hai-Qiong; Li, Rong; Yue, Qiao-Yun; Liu, Guo-Hua; Bai, Jian-Shan; Deng, Yan; Qiu, De-Yi; Zhu, Xing-Quan
2014-01-01
Clonorchis sinensis and Opisthorchis viverrini are both important fish-borne pathogens, causing serious public health problem in Asia. The present study developed an assay integrating real-time PCR and high resolution melting (HRM) analysis for the specific detection and rapid identification of C. sinensis and O. viverrini. Primers targeting COX1 gene were highly specific for these liver flukes, as evidenced by the negative amplification of closely related trematodes. Assays using genomic DNA extracted from the two flukes yielded specific amplification and their identity was confirmed by sequencing, having the accuracy of 100% in reference to conventional methods. The assay was proved to be highly sensitive with a detection limit below 1 pg of purified genomic DNA, 5 EPG, or 1 metacercaria of C. sinensis. Moreover, C. sinensis and O. viverrini were able to be differentiated by their HRM profiles. The method can reduce labor of microscopic examination and the contamination of agarose electrophoresis. Moreover, it can differentiate these two flukes which are difficult to be distinguished using other methods. The established method provides an alternative tool for rapid, simple, and duplex detection of C. sinensis and O. viverrini.
Directory of Open Access Journals (Sweden)
Xian-Quan Cai
2014-01-01
Full Text Available Clonorchis sinensis and Opisthorchis viverrini are both important fish-borne pathogens, causing serious public health problem in Asia. The present study developed an assay integrating real-time PCR and high resolution melting (HRM analysis for the specific detection and rapid identification of C. sinensis and O. viverrini. Primers targeting COX1 gene were highly specific for these liver flukes, as evidenced by the negative amplification of closely related trematodes. Assays using genomic DNA extracted from the two flukes yielded specific amplification and their identity was confirmed by sequencing, having the accuracy of 100% in reference to conventional methods. The assay was proved to be highly sensitive with a detection limit below 1 pg of purified genomic DNA, 5 EPG, or 1 metacercaria of C. sinensis. Moreover, C. sinensis and O. viverrini were able to be differentiated by their HRM profiles. The method can reduce labor of microscopic examination and the contamination of agarose electrophoresis. Moreover, it can differentiate these two flukes which are difficult to be distinguished using other methods. The established method provides an alternative tool for rapid, simple, and duplex detection of C. sinensis and O. viverrini.
Rapid and Sensitive Detection of BLAD in Cattle Population
Directory of Open Access Journals (Sweden)
Daniela Elena Ilie
2014-05-01
Full Text Available Bovine leukocyte adhesion deficiency (BLAD is an autosomal recessive disorder with negative impact on dairy cattle breeding. The molecular basis of BLAD is a single point mutation (A→G, resulting in a single amino acid substitution (aspartic acid → glycine at amino acid 128 in the adhesion molecule CD18. The object of this study was to establish a fast and sensitive molecular genotyping assay to detect BLAD carriers using high-resolution melting (HRM curve analysis. We tested animals with known genotypes for BLAD that were previously confirmed by PCR-RFLP method, and then examined the sensitivity of mutation detection using PCR followed by HRM curve analysis. BLAD carriers were readily detectable using HRM assay. Thus, the PCR-HRM genotyping method is a rapid, easily interpretable, reliable and cost-effective assay for BLAD mutant allele detection. This assay can be useful in cattle genotyping and genetic selection.
Stern, Josh Lewis; Paucek, Richard D; Huang, Franklin W; Ghandi, Mahmoud; Nwumeh, Ronald; Costello, James C; Cech, Thomas R
2017-12-26
A mutation in the promoter of the Telomerase Reverse Transcriptase (TERT) gene is the most frequent noncoding mutation in cancer. The mutation drives unusual monoallelic expression of TERT, allowing immortalization. Here, we find that DNA methylation of the TERT CpG island (CGI) is also allele-specific in multiple cancers. The expressed allele is hypomethylated, which is opposite to cancers without TERT promoter mutations. The continued presence of Polycomb repressive complex 2 (PRC2) on the inactive allele suggests that histone marks of repressed chromatin may be causally linked to high DNA methylation. Consistent with this hypothesis, TERT promoter DNA containing 5-methyl-CpG has much increased affinity for PRC2 in vitro. Thus, CpG methylation and histone marks appear to collaborate to maintain the two TERT alleles in different epigenetic states in TERT promoter mutant cancers. Finally, in several cancers, DNA methylation levels at the TERT CGI correlate with altered patient survival. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Allele frequency analysis of Chinese chestnut ( Castanea mollissima ...
African Journals Online (AJOL)
The aim of this study was to establish a method for allele frequency detection in bulk samples. The abundance of polymerase chain reaction (PCR) products in bulk leaf samples was detected using fluorescent labeled Simple sequence repeat (SSR) primers and an Applied biosystems (AB) automatic DNA analyzer.
Paudel, Damodar; Jarman, Richard; Limkittikul, Kriengsak; Klungthong, Chonticha; Chamnanchanunt, Supat; Nisalak, Ananda; Gibbons, Robert; Chokejindachai, Watcharee
2011-01-01
Background: Dengue fever and dengue hemorrhagic fever are caused by dengue virus. Dengue infection remains a burning problem of many countries. To diagnose acute dengue in the early phase we improve the low cost, rapid SYBR green real time assay and compared the sensitivity and specificity with real time Taqman® assay and conventional nested PCR assay. Aims: To develop low cost, rapid and reliable real time SYBR green diagnostic dengue assay and compare with Taqman real-time assay and conventional nested PCR (modified Lanciotti). Materials and Methods: Eight cultured virus strains were diluted in tenth dilution down to undetectable level by the PCR to optimize the primer, temperature (annealing, and extension and to detect the limit of detection of the assay. Hundred and ninety three ELISA and PCR proved dengue clinical samples were tested with real time SYBR® Green assay, real time Taqman® assay to compare the sensitivity and specificity. Results: Sensitivity and specificity of real time SYBR® green dengue assay (84% and 66%, respectively) was almost comparable to those (81% and 74%) of Taqman real time PCR dengue assay. Real time SYBR® green RT-PCR was equally sensitive in primary and secondary infection while real time Taqman was less sensitive in the secondary infection. Sensitivity of real time Taqman on DENV3 (87%) was equal to SYBR green real time PCR dengue assay. Conclusion: We developed low cost rapid diagnostic SYBR green dengue assay. Further study is needed to make duplex primer assay for the serotyping of dengue virus. PMID:22363089
Directory of Open Access Journals (Sweden)
Satoru Noguchi
2014-01-01
Full Text Available Ullrich congenital muscular dystrophy (UCMD is an inherited muscle disorder characterized clinically by muscle weakness, distal joint hyperlaxity, and proximal joint contractures. Sporadic and recessive mutations in the three collagen VI genes, COL6A1, COL6A2, and COL6A3, are reported to be causative. In the sporadic forms, a heterozygous point mutation causing glycine substitution in the triple helical domain has been identified in higher rate. In this study, we examined the efficacy of siRNAs, which target point mutation site, on specific knockdown toward transcripts from mutant allele and evaluated consequent cellular phenotype of UCMD fibroblasts. We evaluated the effect of siRNAs targeted to silence-specific COL6A1 alleles in UCMD fibroblasts, where simultaneous expression of both wild-type and mutant collagen VI resulted in defective collagen localization. Addition of mutant-specific siRNAs allowed normal extracellular localization of collagen VI surrounding fibroblasts, suggesting selective inhibition of mutant collagen VI. Targeting the single-nucleotide COL6A1 c.850G>A (p.G284R mutation responsible a sporadic autosomal dominant form of UCMD can potently and selectively block expression of mutant collagen VI. These results suggest that allele-specific knockdown of the mutant mRNA can potentially be considered as a therapeutic procedure in UCMD due to COL6A1 point mutations.
Development of a nested-PCR assay for the rapid detection of Pilidiella granati in pomegranate fruit
Yang, Xue; Hameed, Uzma; Zhang, Ai-Fang; Zang, Hao-Yu; Gu, Chun-Yan; Chen, Yu; Xu, Yi-Liu
2017-01-01
Pilidiella granati, a causal agent of twig blight and crown rot of pomegranate, is an emerging threat that may cause severe risk to the pomegranate industry in the future. Development of a rapid assay for the timely and accurate detection of P. granati will be helpful in the active surveillance and management of the disease caused by this pathogen. In this study, a nested PCR method was established for the detection of P. granati. Comparative analysis of genetic diversity within 5.8S rDNA internal transcribed spacer (ITS) sequences of P. granati and 21 other selected fungal species was performed to design species-specific primers (S1 and S2). This primer pair successfully amplified a 450 bp product exclusively from the genomic DNA of P. granati. The developed method can detect 10 pg genomic DNA of the pathogen in about 6 h. This technique was successfully applied to detect the natural infection of P. granati in the pomegranate fruit. The designed protocol is rapid and precise with a high degree of sensitivity. PMID:28106107
Manjunatha, C; Sharma, Sapna; Kulshreshtha, Deepika; Gupta, Sangeeta; Singh, Kartar; Bhardwaj, Subhash C; Aggarwal, Rashmi
2018-01-01
Leaf rust of wheat caused by Puccinia triticina has significant impact on wheat production worldwide. Effective and quick detection methodologies are required to mitigate yield loss and time constraints associated with monitoring and management of leaf rust of wheat. In the present study, detection of P. triticina has been simplified by developing a rapid, reliable, efficient and visual colorimetric method i.e., loop mediated isothermal amplification of DNA (LAMP). Based on in silico analysis of P. triticina genome, PTS68, a simple sequence repeat was found highly specific to leaf rust fungus. A marker (PtRA68) was developed and its specificity was validated through PCR technique which gave a unique and sharp band of 919 bp in P. triticina pathotypes only. A novel gene amplification method LAMP which enables visual detection of pathogen by naked eye was developed for leaf rust pathogen. A set of six primers was designed from specific region of P. triticina and conditions were optimised to complete the observation process in 60 minutes at 65o C. The assay developed in the study could detect presence of P. triticina on wheat at 24 hpi (pre-symptomatic stage) which was much earlier than PCR without requiring thermal cycler. Sensitivity of LAMP assay developed in the study was 100 fg which was more sensitive than conventional PCR (50 pg) and equivalent to qPCR (100 fg). The protocol developed in the study was utilized for detection of leaf rust infected samples collected from different wheat fields. LAMP based colorimetric detection assay showed sky blue color in positive reaction and violet color in negative reaction after addition of 120 μM hydroxyl napthol blue (HNB) solution to reaction mixture. Similarly, 0.6 mg Ethidium bromide/ml was added to LAMP products, placed on transilluminator to witness full brightness in positive reaction and no such brightness could be seen in negative reaction mixture. Further, LAMP products spread in a ladder like banding pattern in
Energy Technology Data Exchange (ETDEWEB)
Sachse, C.; Brockmoeller, J.; Bauer, S.; Roots, I. [Humboldt Univ., Berlin (Germany)
1997-02-01
Cytochrome P450 2D6 (CYP2D6) metabolizes many important drugs. CYP2D6 activity ranges from complete deficiency to ultrafast metabolism, depending on at least 16 different known alleles. Their frequencies were determined in 589 unrelated German volunteers and correlated with enzyme activity measured by phenotyping with dextromethorphan or debrisoquine. For genotyping, nested PCR-RFLP tests from a PCR amplificate of the entire CYP2D6 gene were developed. The frequency of the CYP2D6*1 allele coding for extensive metabolizer (EM) phenotype was .364. The alleles coding for slightly (CYP2D6*2) or moderately (*9 and *10) reduced activity (intermediate metabolizer phenotype [IM]) showed frequencies of .324, .018, and .015, respectively. By use of novel PCR tests for discrimination, CYP2D6 gene duplication alleles were found with frequencies of.005 (*1 x 2), .013 (* 2 x 2), and .001 (*4 x 2). Frequencies of alleles with complete deficiency (poor metabolizer phenotype [PM]) were .207 (*4), .020 (*3 and *5), .009 (*6), and .001 (*7, *15, and *16). The defective CYP2D6 alleles *8, *11, *12, *13, and *14 were not found. All 41 PMs (7.0%) in this sample were explained by five mutations detected by four PCR-RFLP tests, which may suffice, together with the gene duplication test, for clinical prediction of CYP2D6 capacity. Three novel variants of known CYP2D6 alleles were discovered: *1C (T{sub 1957}C), *2B (additional C{sub 2558}T), and *4E (additional C{sub 2938}T). Analysis of variance showed significant differences in enzymatic activity measured by the dextromethorphan metabolic ratio (MR) between carriers of EN/PM (mean MR = .006) and IM/PM (mean MR = .014) alleles and between carriers of one (mean MR = .009) and two (mean MR = .003) functional alleles. The results of this study provide a solid basis for prediction of CYP2D6 capacity, as required in drug research and routine drug treatment. 35 refs., 4 figs., 5 tabs.
VNTR alleles associated with the {alpha}-globin locus are haplotype and population related
Energy Technology Data Exchange (ETDEWEB)
Martinson, J.J.; Clegg, J.B.; Boyce, A.J. [Univ. of Oxford (United Kingdom)
1994-09-01
The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception of closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.
PCR-based methods for the detection of L1014 kdr mutation in Anopheles culicifacies sensu lato
Singh, Om P; Bali, Prerna; Hemingway, Janet; Subbarao, Sarala K; Dash, Aditya P; Adak, Tridibes
2009-01-01
Background Anopheles culicifacies s.l., a major malaria vector in India, has developed widespread resistance to DDT and is becoming resistant to pyrethroids–the only insecticide class recommended for the impregnation of bed nets. Knock-down resistance due to a point mutation in the voltage gated sodium channel at L1014 residue (kdr) is a common mechanism of resistance to DDT and pyrethroids. The selection of this resistance may pose a serious threat to the success of the pyrethroid-impregnated bed net programme. This study reports the presence of kdr mutation (L1014F) in a field population of An. culicifacies s.l. and three new PCR-based methods for kdr genotyping. Methods The IIS4-IIS5 linker to IIS6 segments of the para type voltage gated sodium channel gene of DDT and pyrethroid resistant An. culicifacies s.l. population from the Surat district of India was sequenced. This revealed the presence of an A-to-T substitution at position 1014 leading to a leucine-phenylalanine mutation (L1014F) in a few individuals. Three molecular methods viz. Allele Specific PCR (AS-PCR), an Amplification Refractory Mutation System (ARMS) and Primer Introduced Restriction Analysis-PCR (PIRA-PCR) were developed and tested for kdr genotyping. The specificity of the three assays was validated following DNA sequencing of the samples genotyped. Results The genotyping of this An. culicifacies s.l. population by the three PCR based assays provided consistent result and were in agreement with DNA sequencing result. A low frequency of the kdr allele mostly in heterozygous condition was observed in the resistant population. Frequencies of the different genotypes were in Hardy-Weinberg equilibrium. Conclusion The Leu-Phe mutation, which generates the kdr phenotype in many insects, was detected in a pyrethroid and DDT resistant An. culicifacies s.l. population. Three PCR-based methods were developed for kdr genotyping. All the three assays were specific. The ARMS method was refractory to non-specific
PCR-based methods for the detection of L1014 kdr mutation in Anopheles culicifacies sensu lato
Directory of Open Access Journals (Sweden)
Dash Aditya P
2009-07-01
Full Text Available Abstract Background Anopheles culicifacies s.l., a major malaria vector in India, has developed widespread resistance to DDT and is becoming resistant to pyrethroids–the only insecticide class recommended for the impregnation of bed nets. Knock-down resistance due to a point mutation in the voltage gated sodium channel at L1014 residue (kdr is a common mechanism of resistance to DDT and pyrethroids. The selection of this resistance may pose a serious threat to the success of the pyrethroid-impregnated bed net programme. This study reports the presence of kdr mutation (L1014F in a field population of An. culicifacies s.l. and three new PCR-based methods for kdr genotyping. Methods The IIS4-IIS5 linker to IIS6 segments of the para type voltage gated sodium channel gene of DDT and pyrethroid resistant An. culicifacies s.l. population from the Surat district of India was sequenced. This revealed the presence of an A-to-T substitution at position 1014 leading to a leucine-phenylalanine mutation (L1014F in a few individuals. Three molecular methods viz. Allele Specific PCR (AS-PCR, an Amplification Refractory Mutation System (ARMS and Primer Introduced Restriction Analysis-PCR (PIRA-PCR were developed and tested for kdr genotyping. The specificity of the three assays was validated following DNA sequencing of the samples genotyped. Results The genotyping of this An. culicifacies s.l. population by the three PCR based assays provided consistent result and were in agreement with DNA sequencing result. A low frequency of the kdr allele mostly in heterozygous condition was observed in the resistant population. Frequencies of the different genotypes were in Hardy-Weinberg equilibrium. Conclusion The Leu-Phe mutation, which generates the kdr phenotype in many insects, was detected in a pyrethroid and DDT resistant An. culicifacies s.l. population. Three PCR-based methods were developed for kdr genotyping. All the three assays were specific. The ARMS method
Population diversity of ammonium oxidizers investigated by specific PCR amplification
Ward, B.B.; Voytek, M.A.; Witzel, K.-P.
1997-01-01
The species composition of ammonia-oxidizing bacteria in aquatic environments was investigated using PCR primers for 16S rRNA genes to amplify specific subsets of the total ammonia-oxidizer population. The specificity of the amplification reactions was determined using total genomic DNA from known nitrifying strains and non-nitrifying strains identified as having similar rDNA sequences. Specificity of amplification was determined both for direct amplification, using the nitrifier specific primers, and with nested amplification, in which the nitrifier primers were used to reamplify a fragment obtained from direct amplification with Eubacterial universal primers. The present level of specificity allows the distinction between Nitrosomonas europaea, Nitrosomonas sp. (marine) and the other known ammonia-oxidizers in the beta subclass of the Proteobacteria. Using total DNA extracted from natural samples, we used direct amplification to determine presence/absence of different species groups. Species composition was found to differ among depths in vertical profiles of lake samples and among samples and enrichments from various other aquatic environments. Nested PCR yielded several more positive reactions, which implies that nitrifier DNA was present in most samples, but often at very low levels.
Sun, Shumei; Zhou, Hao; Zhou, Bin; Hu, Ziyou; Hou, Jinlin; Sun, Jian
2012-05-01
To evaluate the sensitivity and specificity of nested PCR combined with pyrosequencing in the detection of HBV drug-resistance gene. RtM204I (ATT) mutant and rtM204 (ATG) nonmutant plasmids mixed at different ratios were detected for mutations using nested-PCR combined with pyrosequencing, and the results were compared with those by conventional PCR pyrosequencing to analyze the linearity and consistency of the two methods. Clinical specimens with different viral loads were examined for drug-resistant mutations using nested PCR pyrosequencing and nested PCR combined with dideoxy sequencing (Sanger) for comparison of the detection sensitivity and specificity. The fitting curves demonstrated good linearity of both conventional PCR pyrosequencing and nested PCR pyrosequencing (R(2)>0.99, PNested PCR showed a better consistency with the predicted value than conventional PCR, and was superior to conventional PCR for detection of samples containing 90% mutant plasmid. In the detection of clinical specimens, Sanger sequencing had a significantly lower sensitivity than nested PCR pyrosequencing (92% vs 100%, Pnested PCR and Sanger sequencing method, nested PCR pyrosequencing has a higher sensitivity especially in clinical specimens with low viral copies, which can be important for early detection of HBV mutant strains and hence more effective clinical management.
Directory of Open Access Journals (Sweden)
PAULO Z. PASSAMANI
2017-12-01
Full Text Available ABSTRACT Chromosome-specific probes have been widely used in molecular cytogenetics, being obtained with different methods. In this study, a reproducible protocol for construction of chromosome-specific probes is proposed which associates in situ amplification (PRINS, micromanipulation and degenerate oligonucleotide-primed PCR (DOP-PCR. Human lymphocyte cultures were used to obtain metaphases from male and female individuals. The chromosomes were amplified via PRINS, and subcentromeric fragments of the X chromosome were microdissected using microneedles coupled to a phase contrast microscope. The fragments were amplified by DOP-PCR and labeled with tetramethyl-rhodamine-5-dUTP. The probes were used in fluorescent in situ hybridization (FISH procedure to highlight these specific regions in the metaphases. The results show one fluorescent red spot in male and two in female X chromosomes and interphase nuclei.
Rapid Detection of the Chlamydiaceae and Other Families in the Order Chlamydiales: Three PCR Tests
Everett, Karin D. E.; Hornung, Linda J.; Andersen, Arthur A.
1999-01-01
Few identification methods will rapidly or specifically detect all bacteria in the order Chlamydiales, family Chlamydiaceae. In this study, three PCR tests based on sequence data from over 48 chlamydial strains were developed for identification of these bacteria. Two tests exclusively recognized the Chlamydiaceae: a multiplex test targeting the ompA gene and the rRNA intergenic spacer and a TaqMan test targeting the 23S ribosomal DNA. The multiplex test was able to detect as few as 200 inclusion-forming units (IFU), while the TaqMan test could detect 2 IFU. The amplicons produced in these tests ranged from 132 to 320 bp in length. The third test, targeting the 23S rRNA gene, produced a 600-bp amplicon from strains belonging to several families in the order Chlamydiales. Direct sequence analysis of this amplicon has facilitated the identification of new chlamydial strains. These three tests permit ready identification of chlamydiae for diagnostic and epidemiologic study. The specificity of these tests indicates that they might also be used to identify chlamydiae without culture or isolation. PMID:9986815
Directory of Open Access Journals (Sweden)
Bent Müller
2018-02-01
Full Text Available Abstract An increasing number of genetic variants involved in dyslexia development were discovered during the last years, yet little is known about the molecular functional mechanisms of these SNPs. In this study we investigated whether dyslexia candidate SNPs have a direct, disease-specific effect on local expression levels of the assumed target gene by using a differential allelic expression assay. In total, 12 SNPs previously associated with dyslexia and related phenotypes were suitable for analysis. Transcripts corresponding to four SNPs were sufficiently expressed in 28 cell lines originating from controls and a family affected by dyslexia. We observed a significant effect of rs600753 on expression levels of DYX1C1 in forward and reverse sequencing approaches. The expression level of the rs600753 risk allele was increased in the respective seven cell lines from members of the dyslexia family which might be due to a disturbed transcription factor binding sites. When considering our results in the context of neuroanatomical dyslexia-specific findings, we speculate that this mechanism may be part of the pathomechanisms underlying the dyslexia-specific brain phenotype. Our results suggest that allele-specific DYX1C1 expression levels depend on genetic variants of rs600753 and contribute to dyslexia. However, these results are preliminary and need replication.
Directory of Open Access Journals (Sweden)
Neuvial Pierre
2010-05-01
Full Text Available Abstract Background High-throughput genotyping microarrays assess both total DNA copy number and allelic composition, which makes them a tool of choice for copy number studies in cancer, including total copy number and loss of heterozygosity (LOH analyses. Even after state of the art preprocessing methods, allelic signal estimates from genotyping arrays still suffer from systematic effects that make them difficult to use effectively for such downstream analyses. Results We propose a method, TumorBoost, for normalizing allelic estimates of one tumor sample based on estimates from a single matched normal. The method applies to any paired tumor-normal estimates from any microarray-based technology, combined with any preprocessing method. We demonstrate that it increases the signal-to-noise ratio of allelic signals, making it significantly easier to detect allelic imbalances. Conclusions TumorBoost increases the power to detect somatic copy-number events (including copy-neutral LOH in the tumor from allelic signals of Affymetrix or Illumina origin. We also conclude that high-precision allelic estimates can be obtained from a single pair of tumor-normal hybridizations, if TumorBoost is combined with single-array preprocessing methods such as (allele-specific CRMA v2 for Affymetrix or BeadStudio's (proprietary XY-normalization method for Illumina. A bounded-memory implementation is available in the open-source and cross-platform R package aroma.cn, which is part of the Aroma Project (http://www.aroma-project.org/.
PCR-RFLP analyses for studying the diversity of GH and Pit-1 genes in Slovak Simmental cattle
Directory of Open Access Journals (Sweden)
Anna Trakovická
2013-10-01
Full Text Available The aim of this study was evaluation of growth hormone (GH and specific pituitary transcription factor (Pit-1 genes diversity in population of 353 Slovak Simmental cows. The analyses were based on single nucleotide polymorphisms GH/AluI and Pit-1/HinfI detections. A polymorphic site of GH gene (AluI has been linked to differences in circulating metabolites, metabolic hormones and milk yield. Bovine Pit-1 is responsible for pituitary development and hormone secreting gene expression, including GH gene. The Pit-1/HinfI locus was associated with growth, milk production and reproduction performance in cattle. Samples of genomic DNA were analyzed by PCR-RFLP method. Digestion of GH gene PCR products with restriction enzyme AluI revealed allele L and V with frequency 0.695 and 0.305, respectively. The digested Pit-1 gene PCR products with enzyme HinfI revealed alleles A (0.249 and B (0.751. Dominant genotypes were for GH gene heterozygous LV (0.47 and for Pit-1 gene homozygous BB (0.56 animals. The observed heterozygosity, effective allele numbers and polymorphism information content of GH/AluI and Pit-1/HinfI bovine loci population were 0.42/0.37, 1.73/1.59 and 0.33/0.30, respectively. The median polymorphic information content of loci was also transferred to the higher observed homozygosity in population (0.58/0.63. Keywords: cattle, growth hormone, leptin, PCR, Pit-1, polymorphism.
Ortiz, Alma; Capitan, Zeuz; Mendoza, Yaxelis; Cisneros, Julio; Moreno, Brechla; Zaldivar, Yamitzel; Garcia, Mariana; Smith, Rebecca E; Motta, Jorge; Pascale, Juan Miguel
2012-10-01
A one-step RT-PCR and one-enzyme RFLP was used to detect and distinguish among flaviviruses, including the four serotypes of dengue and the St. Louis Encephalitis, West Nile and Yellow Fever viruses in cultured virus samples or acute-phase human serum. Using a previously described RT-PCR, but novel RFLP procedure, results are obtained in 24 h with basic PCR and electrophoresis equipment. There is 95% agreement between RT-PCR/RFLP results and those achieved by indirect immunofluorescence assays, and 100% agreement between RT-PCR/RFLP results and gene sequencing. This method is more rapid than tests of cytopathic effect based on virus isolation in tissue culture, and simpler than real-time PCR. It does not require specialized equipment, radioisotopes or computer analysis and is a method that can be applied widely in the developing world. It allows for prompt determination of whether a flavivirus is the cause of illness in a febrile patient, rapid identification of dengue serotypes in circulation, and improved patient management in cases where prior dengue exposure make dengue hemorrhagic fever or dengue shock syndrome a risk. Copyright © 2012 Elsevier B.V. All rights reserved.
Janczarek, Monika; Palusińska-Szysz, Marta
2016-05-01
Legionella bacteria are organisms of public health interest due to their ability to cause pneumonia (Legionnaires' disease) in susceptible humans and their ubiquitous presence in water supply systems. Rapid diagnosis of Legionnaires' disease allows the use of therapy specific for the disease. L. pneumophila serogroup 1 is the most common cause of infection acquired in community and hospital environments. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this work, simplex and duplex PCR assays with the use of new molecular markers pcs and pmtA involved in phosphatidylcholine synthesis were specified for rapid and cost-efficient identification and distinguishing Legionella species. The sets of primers developed were found to be sensitive and specific for reliable detection of Legionella belonging to the eight most clinically relevant species. Among these, four primer sets I, II, VI, and VII used for duplex-PCRs proved to have the highest identification power and reliability in the detection of the bacteria. Application of this PCR-based method should improve detection of Legionella spp. in both clinical and environmental settings and facilitate molecular typing of these organisms.
Directory of Open Access Journals (Sweden)
Marize Quinhones Pires
2014-04-01
Full Text Available Introduction During a diagnostic evaluation of canine visceral leishmaniasis (VL, two of seventeen dogs were found to be co-infected by Leishmania (Viannia braziliensis and Leishmania (Leishmania chagasi. Methods Specific polymerase chain reaction (PCR and restriction fragment length polymorphism-PCR (RFLP-PCR assays were performed. Results PCR assays for Leishmania subgenus identification followed by RFLP-PCR analysis in biopsies from cutaneous lesions and the spleen confirmed the presence of Leishmania (Viannia braziliensis and Leishmania (Leishmania chagasi in those fragments. Conclusions This report reinforces the importance of using serological and molecular techniques in the epidemiological surveillance of canine populations in endemic areas in which both diseases are known to co-exist. In such cases, a reassessment of the control measures is required.
A Rapid and Low-Cost PCR Thermal Cycler for Infectious Disease Diagnostics.
Directory of Open Access Journals (Sweden)
Kamfai Chan
Full Text Available The ability to make rapid diagnosis of infectious diseases broadly available in a portable, low-cost format would mark a great step forward in global health. Many molecular diagnostic assays are developed based on using thermal cyclers to carry out polymerase chain reaction (PCR and reverse-transcription PCR for DNA and RNA amplification and detection, respectively. Unfortunately, most commercial thermal cyclers are expensive and need continuous electrical power supply, so they are not suitable for uses in low-resource settings. We have previously reported a low-cost and simple approach to amplify DNA using vacuum insulated stainless steel thermoses food cans, which we have named it thermos thermal cycler or TTC. Here, we describe the use of an improved set up to enable the detection of viral RNA targets by reverse-transcription PCR (RT-PCR, thus expanding the TTC's ability to identify highly infectious, RNA virus-based diseases in low resource settings. The TTC was successful in demonstrating high-speed and sensitive detection of DNA or RNA targets of sexually transmitted diseases, HIV/AIDS, Ebola hemorrhagic fever, and dengue fever. Our innovative TTC costs less than $200 to build and has a capacity of at least eight tubes. In terms of speed, the TTC's performance exceeded that of commercial thermal cyclers tested. When coupled with low-cost endpoint detection technologies such as nucleic acid lateral-flow assay or a cell-phone-based fluorescence detector, the TTC will increase the availability of on-site molecular diagnostics in low-resource settings.
Directory of Open Access Journals (Sweden)
Nazila Alizadeh
2016-07-01
Full Text Available Background: Human leukocyte antigen-G (HLA-G is a non-classical class I molecule highly expressed by extravillous cytotrophoblast cells. Due to a single base pair deletion, its function can be compensated by other isoforms. Investigating the frequency of null allele in Recurrent Miscarriage (RM subjects could be useful in understanding the relationship between frequency of this allele and RM in a given population. Objective: This study aimed to determine the frequency of HLA-G*0105N null allele and its potential association with down-regulation of HLA-G in subjects with RM. Materials and Methods: Western blotting was used to assess the level of HLA-G protein expression. For investigating the frequency of HLA-G*0105N null allele in RM subjects, PCR-RFLP method was used. Exon 3 of HLA-G gene was amplified by polymerase chain reaction (PCR. Subsequently, PpuM-1 enzyme was employed to digest the PCR products and fragments were analyzed using gel electrophoresis. Results: Digestion using restriction enzyme showed the presence of heterozygous HLA-G*0105N null allele in 10% of the test population. Western blotting results confirmed the decrease in expression of HLA-G in the placental tissue of subjects with RM compared to subjects who could give normal birth. Conclusion: The frequency of heterozygous HLA-G*0105N null allele was high to some extent in subjects with RM. The mutation rate in subjects suggested that there is a significant association between RM and frequency of mutations in this allele.
Alizadeh, Nazila; Mosaferi, Elnaz; Farzadi, Laya; Majidi, Jafar; Monfaredan, Amir; Yousefi, Bahman; Baradaran, Behzad
2016-01-01
Background: Human leukocyte antigen-G (HLA-G) is a non-classical class I molecule highly expressed by extravillous cytotrophoblast cells. Due to a single base pair deletion, its function can be compensated by other isoforms. Investigating the frequency of null allele in Recurrent Miscarriage (RM) subjects could be useful in understanding the relationship between frequency of this allele and RM in a given population. Objective: This study aimed to determine the frequency of HLA-G*0105N null allele and its potential association with down-regulation of HLA-G in subjects with RM. Materials and Methods: Western blotting was used to assess the level of HLA-G protein expression. For investigating the frequency of HLA-G*0105N null allele in RM subjects, PCR-RFLP method was used. Exon 3 of HLA-G gene was amplified by polymerase chain reaction (PCR). Subsequently, PpuM-1 enzyme was employed to digest the PCR products and fragments were analyzed using gel electrophoresis. Results: Digestion using restriction enzyme showed the presence of heterozygous HLA-G*0105N null allele in 10% of the test population. Western blotting results confirmed the decrease in expression of HLA-G in the placental tissue of subjects with RM compared to subjects who could give normal birth. Conclusion: The frequency of heterozygous HLA-G*0105N null allele was high to some extent in subjects with RM. The mutation rate in subjects suggested that there is a significant association between RM and frequency of mutations in this allele. PMID:27525330
A new real-time PCR assay for rapid identification of the S. aureus/MRSA strains
Directory of Open Access Journals (Sweden)
Ivan Manga
2013-01-01
Full Text Available The Methicillin-resistant Staphylococcus aureus (MRSA with the livestock-associated MRSA (LA-MRSA are of great interest to scientists and general public. The aim of our study was to present a new more rapid and reliable diagnostic method working on the RT-PCR platform applicable for monitoring of MRSA/S. aureus. The parallel testing of the S. aureus specific nuc gene sequence and the mecA gene sequence was utilised for this purpose. A collection of ten S. aureus/MRSA reference strains, fifteen genetically related non S. aureus reference strains and fifty-six environmental samples was employed for estimation of the assay performance and parameters. The environmental samples acquired in the Czech livestock farms were represented with the livestock and human nasal mucosae or skin swabs, the slaughter meat swabs and were chosen preferentially from individuals with previously confi rmed or suspected positive MRSA/S. aureus cases. The classic selective cultivation approach with the biochemical test and agar disk diffusion test was accepted as reference diagnostic method. As there were no culture positive samples that were negative using RT-PCR, our method featured with 100% sensitivity in comparison to reference method. The limit of detection allowed to identify from tens to hundreds copies of S. aureus/MRSA genome. Further, the RT-PCR assay featured with 100% inclusivity and 95% exclusivity at Cq value below 30. These parameters suggested on powerful and reliable diagnostic method with real potential of practical utilisation. We consider our method as ideal for testing of individual suspected colonies, when the results can be acquired in less than 1.5 hour.
Directory of Open Access Journals (Sweden)
U. Pagnini
2010-02-01
Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.
Impact of a Rapid Herpes Simplex Virus PCR Assay on Duration of Acyclovir Therapy.
Van, Tam T; Mongkolrattanothai, Kanokporn; Arevalo, Melissa; Lustestica, Maryann; Dien Bard, Jennifer
2017-05-01
Herpes simplex virus (HSV) infections of the central nervous system (CNS) are associated with significant morbidity and mortality rates in children. This study assessed the impact of a direct HSV (dHSV) PCR assay on the time to result reporting and the duration of acyclovir therapy for children with signs and symptoms of meningitis and encephalitis. A total of 363 patients with HSV PCR results from cerebrospinal fluid (CSF) samples were included in this retrospective analysis, divided into preimplementation and postimplementation groups. For the preimplementation group, CSF testing was performed using a laboratory-developed real-time PCR assay; for the postimplementation group, CSF samples were tested using a direct sample-to-answer assay. All CSF samples were negative for HSV. Over 60% of patients from both groups were prescribed acyclovir. The average HSV PCR test turnaround time for the postimplementation group was reduced by 14.5 h (23.6 h versus 9.1 h; P < 0.001). Furthermore, 79 patients (43.6%) in the postimplementation group had dHSV PCR results reported <4 h after specimen collection. The mean time from specimen collection to acyclovir discontinuation was 17.1 h shorter in the postimplementation group (31.1 h versus 14 h; P < 0.001). The median duration of acyclovir therapy was also significantly reduced in the postimplementation group (29.2 h versus 14.3 h; P = 0.01). Our investigation suggests that implementation of rapid HSV PCR testing can decrease turnaround times and the duration of unnecessary acyclovir therapy. Copyright © 2017 American Society for Microbiology.
Allelic Imbalance Is a Prevalent and Tissue-Specific Feature of the Mouse Transcriptome
Pinter, Stefan F.; Colognori, David; Beliveau, Brian J.; Sadreyev, Ruslan I.; Payer, Bernhard; Yildirim, Eda; Wu, Chao-ting; Lee, Jeannie T.
2015-01-01
In mammals, several classes of monoallelic genes have been identified, including those subject to X-chromosome inactivation (XCI), genomic imprinting, and random monoallelic expression (RMAE). However, the extent to which these epigenetic phenomena are influenced by underlying genetic variation is unknown. Here we perform a systematic classification of allelic imbalance in mouse hybrids derived from reciprocal crosses of divergent strains. We observe that deviation from balanced biallelic expression is common, occurring in ∼20% of the mouse transcriptome in a given tissue. Allelic imbalance attributed to genotypic variation is by far the most prevalent class and typically is tissue-specific. However, some genotype-based imbalance is maintained across tissues and is associated with greater genetic variation, especially in 5′ and 3′ termini of transcripts. We further identify novel random monoallelic and imprinted genes and find that genotype can modify penetrance of parental origin even in the setting of large imprinted regions. Examination of nascent transcripts in single cells from inbred parental strains reveals that genes showing genotype-based imbalance in hybrids can also exhibit monoallelic expression in isogenic backgrounds. This surprising observation may suggest a competition between alleles and/or reflect the combined impact of cis- and trans-acting variation on expression of a given gene. Our findings provide novel insights into gene regulation and may be relevant to human genetic variation and disease. PMID:25858912
Allelic prevalence of intron 3 insertion/deletion genetic ...
African Journals Online (AJOL)
Leila Fallahzadeh-Abarghooei
2015-03-18
Mar 18, 2015 ... Tabriz (East Azerbaijan province; belong to Azaris), and Yasuj (Kohgiluyeh va Boyer-Ahmad pro- vince; belong to Lurs), respectively. Genotypic analysis of the Ins/Del XRCC4 polymorphism was detected by the PCR method. Results: The prevalence of the Del allele in Shiraz, Abarku, Tabriz, and Yasuj was ...
DQB1*06:02 allele-specific expression varies by allelic dosage, not narcolepsy status
DEFF Research Database (Denmark)
Weiner Lachmi, Karin; Lin, Ling; Kornum, Birgitte Rahbek
2012-01-01
The association of narcolepsy-cataplexy, a sleep disorder caused by the loss of hypocretin/orexin neurons in the hypothalamus, with DQA1*01:02-DQB1*06:02 is one of the tightest known single-allele human leukocyte antigen (HLA) associations. In this study, we explored genome-wide expression...
Simultaneous genotyping of HPA-17w to -21w by PCR-SSP in Chinese Cantonese.
Zhou, Haojie; Ding, Haoqiang; Chen, Yangkai; Li, Xiaofan; Ye, Xin; Nie, Yongmei
2015-01-01
Studies have reported the polymorphism of human platelet antigen (HPA)-17w, -18w, -19w, -20w, and -21w. However, the distribution of these five antigens in Chinese Cantonese is still unknown. In this study, we designed new sequence-specific primers for HPA-19w to -21w and used published primers for HPA-17w and -18w to develop a polymerase chain reaction with the sequence-specific primers (PCR-SSP) method for simultaneously genotyping HPA-17w to -21w. A total of 820 unrelated Cantonese apheresis platelet donors in Guangzhou were involved in this study. Among the five HPAs, complete a/a homozygosity was observed for HPA-17w to -20w with an allele frequency of 1.0000. For HPA-21w, nine individuals (9/820, 1.10%) were found to be HPA-21a/bw heterozygous and the allele frequencies of HPA-21a and HPA-21bw were 0.9945 (1631/1640) and 0.0055 (9/1640), respectively. The reliability of the PCR-SSP method was determined by comparing with the genotyping results by DNA sequencing, and no inconsistencies were observed between the two methods. This study provides a reliable PCR-SSP method for simultaneously genotyping HPA-17w to -21w and could improve HPA-matched platelet transfusion in Chinese Cantonese.
Multiplex real-time PCR assay for Legionella species.
Kim, Seung Min; Jeong, Yoojung; Sohn, Jang Wook; Kim, Min Ja
2015-12-01
Legionella pneumophila serogroup 1 (sg1) accounts for the majority of infections in humans, but other Legionella species are also associated with human disease. In this study, a new SYBR Green I-based multiplex real-time PCR assay in a single reaction was developed to allow the rapid detection and differentiation of Legionella species by targeting specific gene sequences. Candidate target genes were selected, and primer sets were designed by referring to comparative genomic hybridization data of Legionella species. The Legionella species-specific groES primer set successfully detected all 30 Legionella strains tested. The xcpX and rfbA primers specifically detected L. pneumophila sg1-15 and L. pneumophila sg1, respectively. In addition, this assay was validated by testing clinical samples and isolates. In conclusion, this novel multiplex real-time PCR assay might be a useful diagnostic tool for the rapid detection and differentiation of Legionella species in both clinical and epidemiological studies. Copyright © 2015 Elsevier Ltd. All rights reserved.
Shaw, Kirsty J; Docker, Peter T; Yelland, John V; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J
2010-07-07
A microwave heating system is described for performing polymerase chain reaction (PCR) in a microfluidic device. The heating system, in combination with air impingement cooling, provided rapid thermal cycling with heating and cooling rates of up to 65 degrees C s(-1) and minimal over- or under-shoot (+/-0.1 degrees C) when reaching target temperatures. In addition, once the required temperature was reached it could be maintained with an accuracy of +/-0.1 degrees C. To demonstrate the functionality of the system, PCR was successfully performed for the amplification of the Amelogenin locus using heating rates and quantities an order of magnitude faster and smaller than current commercial instruments.
S-allele diversity in Sorbus aucuparia and Crataegus monogyna (Rosaceae: Maloideae).
Raspé, O; Kohn, J R
2002-06-01
RT-PCR was used to obtain the first estimates from natural populations of allelic diversity at the RNase-based gametophytic self-incompatibility locus in the Rosaceae. A total of 20 alleles were retrieved from 20 Sorbus aucuparia individuals, whereas 17 alleles were found in 13 Crataegus monogyna samples. Estimates of population-level allele numbers fall within the range observed in the Solanaceae, the only other family with RNase-based incompatibility for which estimates are available. The nucleotide diversity of S-allele sequences was found to be much lower in the two Rosaceae species as compared with the Solanaceae. This was not due to a lower sequence divergence among most closely related alleles. Rather, it is the depth of the entire genealogy that differs markedly in the two families, with Rosaceae S-alleles exhibiting more recent apparent coalescence. We also investigated patterns of selection at the molecular level by comparing nucleotide diversity at synonymous and nonsynonymous sites. Stabilizing selection was inferred for the 5' region of the molecule, while evidence of diversifying selection was present elsewhere.
Directory of Open Access Journals (Sweden)
Denis Martine
2011-05-01
Full Text Available Abstract Background Campylobacter spp., especially Campylobacter jejuni (C. jejuni and Campylobacter coli (C. coli, are recognized as the leading human foodborne pathogens in developed countries. Livestock animals carrying Campylobacter pose an important risk for human contamination. Pigs are known to be frequently colonized with Campylobacter, especially C. coli, and to excrete high numbers of this pathogen in their faeces. Molecular tools, notably real-time PCR, provide an effective, rapid, and sensitive alternative to culture-based methods for the detection of C. coli and C. jejuni in various substrates. In order to serve as a diagnostic tool supporting Campylobacter epidemiology, we developed a quantitative real-time PCR method for species-specific detection and quantification of C. coli and C. jejuni directly in faecal, feed, and environmental samples. Results With a sensitivity of 10 genome copies and a linear range of seven to eight orders of magnitude, the C. coli and C. jejuni real-time PCR assays allowed a precise quantification of purified DNA from C. coli and C. jejuni. The assays were highly specific and showed a 6-log-linear dynamic range of quantification with a quantitative detection limit of approximately 2.5 × 102 CFU/g of faeces, 1.3 × 102 CFU/g of feed, and 1.0 × 103 CFU/m2 for the environmental samples. Compared to the results obtained by culture, both C. coli and C. jejuni real-time PCR assays exhibited a specificity of 96.2% with a kappa of 0.94 and 0.89 respectively. For faecal samples of experimentally infected pigs, the coefficients of correlation between the C. coli or C. jejuni real-time PCR assay and culture enumeration were R2 = 0.90 and R2 = 0.93 respectively. Conclusion The C. coli and C. jejuni real-time quantitative PCR assays developed in this study provide a method capable of directly detecting and quantifying C. coli and C. jejuni in faeces, feed, and environmental samples. These assays represent a new
Screening for SNPs with Allele-Specific Methylation based on Next-Generation Sequencing Data
Hu, Bo; Ji, Yuan; Xu, Yaomin; Ting, Angela H
2013-01-01
Allele-specific methylation (ASM) has long been studied but mainly documented in the context of genomic imprinting and X chromosome inactivation. Taking advantage of the next-generation sequencing technology, we conduct a high-throughput sequencing experiment with four prostate cell lines to survey the whole genome and identify single nucleotide polymorphisms (SNPs) with ASM. A Bayesian approach is proposed to model the counts of short reads for each SNP conditional on its genotypes of multip...
A Rapid and Simple Real-Time PCR Assay for Detecting Foodborne Pathogenic Bacteria in Human Feces.
Hanabara, Yutaro; Ueda, Yutaka
2016-11-22
A rapid, simple method for detecting foodborne pathogenic bacteria in human feces is greatly needed. Here, we examined the efficacy of a method that employs a combination of a commercial PCR master mix, which is insensitive to PCR inhibitors, and a DNA extraction method which used sodium dodecyl benzene sulfonate (SDBS), and Tween 20 to counteract the inhibitory effects of SDBS on the PCR assay. This method could detect the target genes (stx1 and stx2 of enterohemorrhagic Escherichia coli, invA of Salmonella Enteritidis, tdh of Vibrio parahaemolyticus, gyrA of Campylobacter jejuni, ceuE of Campylobacter coli, SEA of Staphylococcus aureus, ces of Bacillus cereus, and cpe of Clostridium perfringens) in a fecal suspension containing 1.0 × 10 1 to 1.0 × 10 3 CFU/ml. Furthermore, the assay was neither inhibited nor influenced by individual differences among the fecal samples of 10 subjects or fecal concentration (40-160 mg/ml in the fecal suspension). When we attempted to detect the genes of pathogenic bacteria in 4 actual clinical cases, we found that this method was more sensitive than standard culture method. These results showed that this assay is a rapid, simple detection method for foodborne pathogenic bacteria in human feces.
COMPARISON OF 16S rRNA-PCR-RFLP, LipL32-PCR AND OmpL1-PCR METHODS IN THE DIAGNOSIS OF LEPTOSPIROSIS
Directory of Open Access Journals (Sweden)
Tülin GÜVEN GÖKMEN
Full Text Available SUMMARY Leptospirosis is still one of the most important health problems in developing countries located in humid tropical and subtropical regions. Human infections are generally caused by exposure to water, soil or food contaminated with the urine of infected wild and domestic animals such as rodents and dogs. The clinical course of leptospirosis is variable and may be difficult to distinguish from many other infectious diseases. The dark-field microscopy (DFM, serology and nucleic acid amplification techniques are used to diagnose leptospirosis, however, a distinctive standard reference method is still lacking. Therefore, in this study, we aimed to determine the presence of Leptospira spp., to differentiate the pathogenic L. interrogans and the non-pathogenic L. biflexa, and also to determine the sensitivity and specificity values of molecular methods as an alternative to conventional ones. A total of 133 serum samples, from 47 humans and 86 cattle were evaluated by two conventional tests: the Microagglutination Test (MAT and the DFM, as well as three molecular methods, the 16S rRNA-PCR followed by Restriction Fragment Lenght Polymorphism (RFLP of the amplification products 16S rRNA-PCR-RFLP, LipL32-PCR and OmpL1-PCR. In this study, for L. interrogans, the specificity and sensitivity rates of the 16S rRNA-PCR and the LipL32-PCR were considered similar (100% versus 98.25% and 100% versus 98.68%, respectively. The OmpL1-PCR was able to classify L. interrogans into two intergroups, but this PCR was less sensitive (87.01% than the other two PCR methods. The 16S rRNA-PCR-RFLP could detect L. biflexa DNA, but LipL32-PCR and OmpL1-PCR could not. The 16S rRNA-PCR-RFLP provided an early and accurate diagnosis and was able to distinguish pathogenic and non-pathogenic Leptospira species, hence it may be used as an alternative method to the conventional gold standard techniques for the rapid disgnosis of leptospirosis.
Sari, Yulia; Haryati, Sri; Prasetyo, Afiono Agung; Hartono, Adnan, Zainal Arifin
2017-02-01
The human leukocyte antigen (HLA)-DQB1 gene polymorphisms may associated with the infection risk of Toxoplasma gondii in HIV patients. The HLA-DQB1*0402 in HIV-1-positive patients could be considered risk factors for developing neurological opportunistic infections, mainly Toxoplasma encephalitis. However, the HLA-DQB1*0402 gene polymorphisms status in the Javanese HIV patients is unknown. This study evaluated the prevalence of HLA-DQB*0402 alleles polymorphisms in Javanese HIV patients with positive anti-Toxoplasma gondii IgM status. Since 2009 our research group performing a molecular epidemiology of blood borne viruses in Central Java Indonesia, by collecting the epidemiological and clinical data from the high risk communities. All blood samples were screened for blood borne pathogens by serological and molecular assays including for HIV and Toxoplasma gondii. The genomic DNA was isolated from the whole blood samples. Genetic polymorphisms of HLA-DQB1*0402 alleles were detected with polymerase chain reaction-sequence-specific primers (PCR-SSPs) technique. The genotypes were defined according to generated fragment patterns in the agarose gel electrophoresis analysis of PCR products. All of the samples were tested at least in duplicate. HLA-DQB1*0402 alleles were detected in 20.8% (16/77) patients and not detected in all HIV positive samples with negative anti-Toxoplasma gondii IgM status (n= 200). The HLA-DQB1*0402 alleles polymorphisms were detected in Javanese HIV patients with positive anti-Toxoplasma gondii IgM. The polymorphisms found may have association with the infection risk of Toxoplasma gondii in HIV patients.
A PCR-based strategy for simple and rapid identification of rough presumptive Salmonella isolates
DEFF Research Database (Denmark)
Hoorfar, Jeffrey; Baggesen, Dorte Lau; Porting, P.H.
1999-01-01
The purpose of the present study was to investigate the application of ready-to-go Salmonella PCR tests, based on dry chemistry, for final identification of rough presumptive Salmonella isolates. The results were compared with two different biotyping methods performed at two different laboratories......, which did not result in any DNA band. A total of 32 out of the 36 rough presumptive isolates were positive in the PCR. All but one isolate were also identified as Salmonella by the two biochemical methods. All 80 Salmonella strains were also tested in the two multiplex serogroup tests based on PCR beads....... The sensitivity of the BAX Salmonella PCR test was assessed by testing a total of 80 Salmonella isolates, covering most serogroups, which correctly identified all the Salmonella strains by resulting in one 800-bp band in the sample tubes. The specificity of the PCR was assessed using 20 non-Salmonella strains...
Lijun, Cai; Xizhi, Ma; Lin, Kang; Kejing, Deng; Shouyuan, Zhao; Changben, Li
2003-09-01
Rice stripe disease, caused by Rice stripe virus (RSV), may lead to severe or even crippling losses in many rice-cultured countries and regions. As the most important vector of RSV, the small brown planthopper (SBPH) (Laodelphax striatellus) is largely responsible for the epidemic phase of the disease. Therefore, a rapid identification of RSV in the SBPH is of a great need for disease forecasting. A reverse transcription polymerase chain reaction (RT-PCR) assay is described to amplify a RSV gene in individual L. striatellus. By using primers matched to the viral RNA dependent RNA polymerase gene in RNA1, a 445 bp product was detected in viruliferous SBPHs. Meanwhile, the PCR products produced by the SBPH actin primers constructed across the boundary of an intron and an exon were used as RNA specific positive control for each stage of the experiment to ensure the validity of the negative results. Duplex RT-PCR conditions were established for the simultaneous detection of RSV and actin. This approach can be used for the early detection of RSV in L. striatellus and the subsequent rice stripe disease forecasting.
DEFF Research Database (Denmark)
Lesnikova, Iana; Lidang, Marianne; Hamilton-Dutoit, Steven
2010-01-01
ABSTRACT: Human papillomavirus (HPV) infection, and in particularly infection with HPVs 16 and 18, is a central carcinogenic factor in the uterine cervix. We established and optimized a PCR assay for the detection and discrimination of HPV types 16 and 18 in archival formaldehyde fixed and paraffin...... embedded (FFPE) sections of cervical cancer.Tissue blocks from 35 cases of in situ or invasive cervical squamous cell carcinoma and surrogate FFPE sections containing the cell lines HeLa and SiHa were tested for HPV 16 and HPV18 by conventional PCR using type specific primers, and for the housekeeping gene...
Butow, B J; Gale, K R; Ikea, J; Juhász, A; Bedö, Z; Tamás, L; Gianibelli, M C
2004-11-01
Increased expression of the high molecular weight glutenin subunit (HMW-GS) Bx7 is associated with improved dough strength of wheat (Triticum aestivum L.) flour. Several cultivars and landraces of widely different genetic backgrounds from around the world have now been found to contain this so-called 'over-expressing' allelic form of the Bx7 subunit encoded by Glu-B1al. Using three methods of identification, SDS-PAGE, RP-HPLC and PCR marker analysis, as well as pedigree information, we have traced the distribution and source of this allele from a Uruguayan landrace, Americano 44D, in the mid-nineteenth century. Results are supported by knowledge of the movement of wheat lines with migrants. All cultivars possessing the Glu-B1al allele can be identified by the following attributes: (1) the elution of the By sub-unit peak before the Dx sub-unit peak by RP-HPLC, (2) high expression levels of Bx7 (>39% Mol% Bx), (3) a 43 bp insertion in the matrix-attachment region (MAR) upstream of the gene promoter relative to Bx7 and an 18 bp nucleotide duplication in the coding region of the gene. Evidence is presented indicating that these 18 and 43 bp sequence insertions are not causal for the high expression levels of Bx7 as they were also found to be present in a small number of hexaploid species, including Chinese Spring, and species expressing Glu-B1ak and Glu-B1a alleles. In addition, these sequence inserts were found in different isolates of the tetraploid wheat, T. turgidum, indicating that these insertion/deletion events occurred prior to hexaploidization.
Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki
2011-03-01
The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.
U'Ren, Jana M.; Van Ert, Matthew N.; Schupp, James M.; Easterday, W. Ryan; Simonson, Tatum S.; Okinaka, Richard T.; Pearson, Talima; Keim, Paul
2005-01-01
A TaqMan allelic-discrimination assay designed around a synonymous single-nucleotide polymorphism was used to genotype Burkholderia pseudomallei and Burkholderia mallei isolates. The assay rapidly identifies and discriminates between these two highly pathogenic bacteria and does not cross-react with genetic near neighbors, such as Burkholderia thailandensis and Burkholderia cepacia.
Frequency Specific Effects of ApoE ε4 Allele on Resting-State Networks in Nondemented Elders
Directory of Open Access Journals (Sweden)
Ying Liang
2017-01-01
Full Text Available We applied resting-state functional magnetic resonance imaging (fMRI to examine the Apolipoprotein E (ApoE ε4 allele effects on functional connectivity of the default mode network (DMN and the salience network (SN. Considering the frequency specific effects of functional connectivity, we decomposed the brain network time courses into two bands: 0.01–0.027 Hz and 0.027–0.08 Hz. All scans were acquired by the Alzheimer’s Disease Neuroscience Initiative (ADNI. Thirty-two nondemented subjects were divided into two groups based on the presence (n=16 or absence (n=16 of the ApoE ε4 allele. We explored the frequency specific effects of ApoE ε4 allele on the default mode network (DMN and the salience network (SN functional connectivity. Compared to ε4 noncarriers, the DMN functional connectivity of ε4 carriers was significantly decreased while the SN functional connectivity of ε4 carriers was significantly increased. Many functional connectivities showed significant differences at the lower frequency band of 0.01–0.027 Hz or the higher frequency band of 0.027–0.08 Hz instead of the typical range of 0.01–0.08 Hz. The results indicated a frequency dependent effect of resting-state signals when investigating RSNs functional connectivity.
Frequency of CCR5Δ32 allele in healthy Bosniak population.
Directory of Open Access Journals (Sweden)
Grażyna Adler
2014-08-01
Full Text Available Recent evidence has demonstrated the role of CCR5Δ32 in a variety of human diseases: from infectious and inflammatory diseases to cancer. Several studies have confirmed that genetic variants in chemokine receptor CCR5 gene are correlated with susceptibility and resistance to HIV infection. A 32-nucleotide deletion within the CCR5 reading frame is associated with decreased susceptibility to HIV acquisition and a slower progression to AIDS. Mean frequency of CCR5Δ32 allele in Europe is approximately 10%. The highest allele frequency is observed among Nordic populations (about 12% and lower in the regions of Southeast Mediterranean (about 5%. Although the frequency of CCR5Δ32 was determined in numerous European populations, there is a lack of studies on this variant in the Bosnia and Hercegovina population. Therefore, the aim of our study was to assess the frequency of CCR5Δ32 allele in the cohort of Bosniaks and compare the results with European reports. CCR5Δ32 was detected by sequence-specific PCR in a sample of 100 healthy subjects from Bosnia and Herzegovina (DNA collected 2011-2013. Mean age of the cohort being 58.8 (±10.7 years, with 82% of women. We identified 17 heterozygotes and one mutant homozygote in study group, with mean ∆32 allele frequency of 9.5%. CCR5∆32 allele frequency among Bosniaks is comparable to that found in Caucasian populations and follows the pattern of the north-southern gradient observed for Europe. Further studies on larger cohorts with adequate female-to-male ratio are necessary.
Nakajima, T; Sano, R; Takahashi, Y; Watanabe, K; Kubo, R; Kobayashi, M; Takahashi, K; Takeshita, H; Kominato, Y
2016-01-01
Recent investigation of transcriptional regulation of the ABO genes has identified a candidate erythroid cell-specific regulatory element, named the +5·8-kb site, in the first intron of ABO. Six haplotypes of the site have been reported previously. The present genetic population study demonstrated that each haplotype was mostly linked with specific ABO alleles with a few exceptions, possibly as a result of hybrid formation between common ABO alleles. Thus, investigation of these haplotypes could provide a clue to further elucidation of ABO alleles. © 2015 International Society of Blood Transfusion.
Increased risk for CRC in diabetic patients with the nonrisk allele of SNPs at 8q24.
Ishimaru, Shinya; Mimori, Koshi; Yamamoto, Ken; Inoue, Hiroshi; Imoto, Seiya; Kawano, Shuichi; Yamaguchi, Rui; Sato, Tetsuya; Toh, Hiroyuki; Iinuma, Hisae; Maeda, Toyoki; Ishii, Hideshi; Suzuki, Sadao; Tokudome, Shinkan; Watanabe, Masahiko; Tanaka, Jun-ichi; Kudo, Shin-ei; Sugihara, Ken-ichi; Hase, Kazuo; Mochizuki, Hidetaka; Kusunoki, Masato; Yamada, Kazutaka; Shimada, Yasuhiro; Moriya, Yoshihiro; Barnard, Graham F; Miyano, Satoru; Mori, Masaki
2012-09-01
Colorectal cancer (CRC) oncogenesis was considered to be determined by interactions between genetic and environmental factors. Specific interacting factors that influence CRC morbidity have yet to be fully investigated. A multi-institutional collaborative study with 1511 CRC patients and 2098 control subjects was used to compare the odds ratios for the occurrence of polymorphisms at 11 known single nucleotide polymorphisms (SNPs). TaqMan PCR and questionnaires were used to evaluate the effects of environmental exposures. Variants of rs6983267 on 8q24 were the most significant markers of risk for CRC (odds ratio 1.16, 95% confidence interval 1.06-1.27, P = 0.0015). Non-insulin-dependent diabetes mellitus (DM), a higher body mass index at age 20, and meat consumption were environmental risk factors, whereas a tuna-rich diet and vitamin intake were protective factors. The cohort of rs6983267 SNP major (T) allele at 8q24 and DM had a 1.66-fold higher risk ratio than the cohort of major allele patients without DM. We confirmed that interactions between the genetic background and environmental factors are associated with increased risk for CRC. There is a robust risk of the minor G allele at the 8q24 rs6983267 SNP; however, a major T allele SNP could more clearly reveal a correlation with CRC specifically when DM is present.
Nikolaou, Anastasios; Saxami, Georgia; Kourkoutas, Yiannis; Galanis, Alex
2011-02-01
In this study we present a novel multiplex PCR assay for rapid and efficient detection of Lactobacillus delbrueckii subsp. bulgaricus. The accuracy of our method was confirmed by the successful identification of L. delbrueckii subsp. bulgaricus in commercial yoghurts and food supplements and it may be readily applied to the food industry. Copyright © 2010 Elsevier B.V. All rights reserved.
Comparison of PCR and common clinical tests for the diagnosis of H. pylori in dyspeptic patients.
Pacheco, N; Mago, V; Gómez, I; Gueneau, P; Guelrud, M; Reyes, N; Pericchi, L R; Domínguez-Bello, M G
2001-04-01
Helicobacter pylori has been recognized as a major gastric pathogen. The objective of this study was to assess the diagnostic value of common clinical tests to detect H. pylori infection, by comparison with PCR. Serum and gastric biopsy specimens from 106 dyspeptic patients were examined. Serology was performed with Pyloriset Dry test, and biopsies were examined histologically, for rapid urease activity and PCR amplification of an ureA gene segment of H. pylori. PCR primers were specific for H. pylori and required at least 1.47 pg of H. pylori DNA, corresponding to about 800 bacterial cells. According to serology, histology, rapid urease, and PCR, positive results were respectively found in 56%, 86%, 64%, and 85% of dyspeptic patients, primarily with gastritis. Relative to PCR, the sensitivity (and specificity) was 55% (38%) for serology, 86% (13%) for histology, 70% (69%) for urease. When combining histology and urease, Bayesian analysis of data indicated no advantage of using combined methods over rapid urease test alone. Histology should not any longer be considered a gold standard test for Helicobacter pylori. Urea breath test still seems the first option for non invasive diagnostic. If an invasive diagnostic is justified, highly specific and sensitive molecular methods should be used to examine specimens.
Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.
Lee, Seong-Hun
2014-11-01
There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.
Morton, C Oliver; White, P Lewis; Barnes, Rosemary A; Klingspor, Lena; Cuenca-Estrella, Manuel; Lagrou, Katrien; Bretagne, Stéphane; Melchers, Willem; Mengoli, Carlo; Caliendo, Angela M; Cogliati, Massimo; Debets-Ossenkopp, Yvette; Gorton, Rebecca; Hagen, Ferry; Halliday, Catriona; Hamal, Petr; Harvey-Wood, Kathleen; Jaton, Katia; Johnson, Gemma; Kidd, Sarah; Lengerova, Martina; Lass-Florl, Cornelia; Linton, Chris; Millon, Laurence; Morrissey, C Orla; Paholcsek, Melinda; Talento, Alida Fe; Ruhnke, Markus; Willinger, Birgit; Donnelly, J Peter; Loeffler, Juergen
2017-06-01
A wide array of PCR tests has been developed to aid the diagnosis of invasive aspergillosis (IA), providing technical diversity but limiting standardisation and acceptance. Methodological recommendations for testing blood samples using PCR exist, based on achieving optimal assay sensitivity to help exclude IA. Conversely, when testing more invasive samples (BAL, biopsy, CSF) emphasis is placed on confirming disease, so analytical specificity is paramount. This multicenter study examined the analytical specificity of PCR methods for detecting IA by blind testing a panel of DNA extracted from a various fungal species to explore the range of Aspergillus species that could be detected, but also potential cross reactivity with other fungal species. Positivity rates were calculated and regression analysis was performed to determine any associations between technical specifications and performance. The accuracy of Aspergillus genus specific assays was 71.8%, significantly greater (P Aspergillus species (47.2%). For genus specific assays the most often missed species were A. lentulus (25.0%), A. versicolor (24.1%), A. terreus (16.1%), A. flavus (15.2%), A. niger (13.4%), and A. fumigatus (6.2%). There was a significant positive association between accuracy and using an Aspergillus genus PCR assay targeting the rRNA genes (P = .0011). Conversely, there was a significant association between rRNA PCR targets and false positivity (P = .0032). To conclude current Aspergillus PCR assays are better suited for detecting A. fumigatus, with inferior detection of most other Aspergillus species. The use of an Aspergillus genus specific PCR assay targeting the rRNA genes is preferential. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
A matching-allele model explains host resistance to parasites.
Luijckx, Pepijn; Fienberg, Harris; Duneau, David; Ebert, Dieter
2013-06-17
The maintenance of genetic variation and sex despite its costs has long puzzled biologists. A popular idea, the Red Queen Theory, is that under rapid antagonistic coevolution between hosts and their parasites, the formation of new rare host genotypes through sex can be advantageous as it creates host genotypes to which the prevailing parasite is not adapted. For host-parasite coevolution to lead to an ongoing advantage for rare genotypes, parasites should infect specific host genotypes and hosts should resist specific parasite genotypes. The most prominent genetics capturing such specificity are matching-allele models (MAMs), which have the key feature that resistance for two parasite genotypes can reverse by switching one allele at one host locus. Despite the lack of empirical support, MAMs have played a central role in the theoretical development of antagonistic coevolution, local adaptation, speciation, and sexual selection. Using genetic crosses, we show that resistance of the crustacean Daphnia magna against the parasitic bacterium Pasteuria ramosa follows a MAM. Simulation results show that the observed genetics can explain the maintenance of genetic variation and contribute to the maintenance of sex in the facultatively sexual host as predicted by the Red Queen Theory. Copyright © 2013 Elsevier Ltd. All rights reserved.
Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil
Directory of Open Access Journals (Sweden)
Vlademir Cantarelli
2011-10-01
Full Text Available INTRODUCTION: Laboratory-based surveillance is an important component in the control of vancomycin resistant enterococci (VRE. METHODS: The study aimed to evaluate real-time polymerase chain reaction (RT-PCR (genes vanA-vanB for VRE detection on 115 swabs from patients included in a surveillance program. RESULTS: Sensitivity of RT-PCR was similar to primary culture (75% and 79.5%, respectively when compared to broth enriched culture, whereas specificity was 83.1%. CONCLUSIONS: RT-PCR provides same day results, however it showed low sensitivity for VRE detection.
Xu, R; Falardeau, J; Avis, T J; Tambong, J T
2016-02-01
The aim of this study was to develop and validate a HybProbes-based real-time PCR assay targeting the trpB gene for specific identification of Streptomyces scabies and Streptomyces europaeiscabiei. Four primer pairs and a fluorescent probe were designed and evaluated for specificity in identifying S. scabies and Streptomyces europaeiscabiei, the potato common scab pathogens. The specificity of the HybProbes-based real-time PCR assay was evaluated using 46 bacterial strains, 23 Streptomyces strains and 23 non-Streptomyces bacterial species. Specific and strong fluorescence signals were detected from all nine strains of S. scabies and Streptomyces europaeiscabiei. No fluorescence signal was detected from 14 strains of other Streptomyces species and all non-Streptomyces strains. The identification was corroborated by the melting curve analysis that was performed immediately after the amplification step. Eight of the nine S. scabies and S. europaeiscabiei strains exhibited a unique melting peak, at Tm of 69·1°C while one strain, Warba-6, had a melt peak at Tm of 65·4°C. This difference in Tm peaks could be attributed to a guanine to cytosine mutation in strain Warba-6 at the region spanning the donor HybProbe. The reported HybProbes assay provides a more specific tool for accurate identification of S. scabies and S. europaeiscabiei strains. This study reports a novel assay based on HybProbes chemistry for rapid and accurate identification of the potato common scab pathogens. Since the HybProbes chemistry requires two probes for positive identification, the assay is considered to be more specific than conventional PCR or TaqMan real-time PCR. The developed assay would be a useful tool with great potential in early diagnosis and detection of common scab pathogens of potatoes in infected plants or for surveillance of potatoes grown in soil environment. © 2015 Her Majesty the Queen in Right of Canada © 2015 The Society for Applied Microbiology.
DETECTION AND QUANTIFICATION OF COW FECAL POLLUTION WITH REAL-TIME PCR
Assessment of health risk and fecal bacteria loads associated with cow fecal pollution requires a reliable host-specific genetic marker and a rapid quantification method. We report the development of quantitative PCR assays for enumeration of two recently described cow-specific g...
Development of an improved species specific PCR test for detection of Haemophilus parasuis
DEFF Research Database (Denmark)
Angen, Øystein; Oliveira, Simone; Ahrens, Peter
2007-01-01
, the present PCR test was found to be 100% species specific for H. parasuis, in contrast to the PCR test of Oliveira et al., which also tested positive for strains belonging to A. indolicus, A. porcinus, and A. minor, species commonly occurring in the upper respiratory tract. However, when the PCR test...... with representatives of H. parasuis. The test was further evaluated on 55 clinical samples from 16 Danish pigs suspected for being infected with H. parasuis, showing polyserositis or septicemia at autopsy as well as on 492 nasal swabs. The test was compared with the performance of a PCR test earlier published...... by Oliveira et al. [Oliveira, S., Galina, L., Pijoan, C., 2001. Development of a PCR test to diagnose Haemophilus parasuis infections. J. Vet. Diagn. Invest. 13, 495-501]. The sensitivity of the present PCR test was found to be slightly lower when applied on clinical samples from diseased pigs and 10-fold...
Chander, Vishal; Chakravarti, Soumendu; Gupta, Vikas; Nandi, Sukdeb; Singh, Mithilesh; Badasara, Surendra Kumar; Sharma, Chhavi; Mittal, Mitesh; Dandapat, S; Gupta, V K
2016-12-01
Canine parvovirus-2 antigenic variants (CPV-2a, CPV-2b and CPV-2c) ubiquitously distributed worldwide in canine population causes severe fatal gastroenteritis. Antigenic typing of CPV-2 remains a prime focus of research groups worldwide in understanding the disease epidemiology and virus evolution. The present study was thus envisioned to provide a simple sequencing independent, rapid, robust, specific, user-friendly technique for detecting and typing of presently circulating CPV-2 antigenic variants. ARMS-PCR strategy was employed using specific primers for CPV-2a, CPV-2b and CPV-2c to differentiate these antigenic types. ARMS-PCR was initially optimized with reference positive controls in two steps; where first reaction was used to differentiate CPV-2a from CPV-2b/CPV-2c. The second reaction was carried out with CPV-2c specific primers to confirm the presence of CPV-2c. Initial validation of the ARMS-PCR was carried out with 24 sequenced samples and the results were matched with the sequencing results. ARMS-PCR technique was further used to screen and type 90 suspected clinical samples. Randomly selected 15 suspected clinical samples that were typed with this technique were sequenced. The results of ARMS-PCR and the sequencing matched exactly with each other. The developed technique has a potential to become a sequencing independent method for simultaneous detection and typing of CPV-2 antigenic variants in veterinary disease diagnostic laboratories globally. Copyright © 2016 Elsevier B.V. All rights reserved.
Tang, T F; Huang, A Y; Pappas, A; Slack, R; Ng, J; Hartzman, R J; Hurley, C K
2000-08-01
One hundred sixty-one individuals from each of five US population groups, Caucasians (CAU), African Americans (AFA), Asians/Pacific Islanders (API), Hispanics (HIS), and Native Americans (NAT), were randomly selected from a volunteer bone marrow registry database consisting of 14,452 HLA-DRB1*11 positive individuals. This sampling provided at least an 80% probability of detecting a rare allele that occurred at 1% in the DRB1*11 positive population. Samples were typed for DRB1*11 alleles by polymerase chain reaction-sequence specific oligonucleotide probe typing (PCR-SSOP). A total of 10 DRB1*11 alleles out of 27 possible alleles were detected. The distribution and diversity of DRB1*11 alleles varied among populations although DRB1*1101 was the predominant DRB1*11 allele in all populations. Caucasians were the least diversified; only four common alleles (DRB1*1101-*1104) were observed. As well as the four common alleles, other groups also carried one or two other less frequent alleles including DRB1*1105 (API), *1106 (API), *1110 (AFA), *1114 (HIS), *1115 (NAT), and *1117 (AFA). A subset (418) of these individuals were also typed for DRB3 alleles. Most (97.6%) showed a strong association of DRB1*11 with DRB3*0202.
Tan, Aik Choon; Fan, Jian-Bing; Karikari, Collins; Bibikova, Marina; Garcia, Eliza Wickham; Zhou, Lixin; Barker, David; Serre, David; Feldmann, Georg; Hruban, Ralph H.; Klein, Alison P.; Goggins, Michael; Couch, Fergus J.; Hudson, Thomas J.; Winslow, Raimond L.
2007-01-01
Physiologic allele-specific expression (ASE) in germline tissues occurs during random X-chromosome inactivation1 and in genomic imprinting,2 wherein the two alleles of a gene in a heterozygous individual are not expressed equally. Recent studies have confirmed the existence of ASE in apparently non-imprinted autosomal genes;3–14 however, the extent of ASE in the human genome is unknown. We explored ASE in lymphoblastoid cell lines of 145 individuals using an oligonucleotide array based assay....
Directory of Open Access Journals (Sweden)
Warhurst David C
2010-03-01
Full Text Available Abstract Background Parasite resistance to the anti-malarial drug chloroquine is common in eastern Sudan. Dynamic within-host changes in the relative abundance of both sensitive and resistant Plasmodium falciparum parasites were examined in a cohort of chloroquine-treated patients presenting with uncomplicated falciparum malaria, using a novel allele-specific quantitative approach. Methods Treatment outcomes were determined for 93 patients of all ages in a per protocol cohort using a modified 14-day WHO protocol. Parasite DNA samples at days 0, 1, 2, 3, 7 and 14 following treatment were analysed using real-time quantitative PCR methods that distinguished resistant and sensitive genotypes at amino acids 72 - 76 of the pfcrt locus. Results Chloroquine treatment was not efficacious, and of 93 assessable patients, only 10 individuals (10.7%; 95% C.I. 4.34 - 17.2% enjoyed an adequate clinical and parasitological response. Resistant parasites with the haplotype CVIET at codons 72-76 of the pfcrt locus were dominant in the starting population. Chloroquine sensitive parasites with the haplotype CVMNK were detected in 19 individuals prior to treatment (20.43%; 95% C.I. 5.14 - 18.5%. In these patients, CQ treatment rapidly selected CVIET parasites, and this haplotype overwhelmingly dominated the parasite population in each individual by day 2 after treatment. Conclusions Such rapid intra-host selection of particular genotypes after the introduction of drug will cause frequent misidentification of parasite genotypes present in the starting population. This will have a potentially serious confounding effect on clinical trials which employ PCR-corrected estimates of treatment failure, as resistant parasites below the detection threshold in the pre-treatment sample can be erroneously classified as "new" infections during follow-up, over-estimating drug efficacy.
Directory of Open Access Journals (Sweden)
Feroze Ahmed Ganaie
2015-01-01
Full Text Available Rapid diagnosis of Streptococcus pneumoniae can play a significant role in decreasing morbidity and mortality of infection. The accurate diagnosis of pneumococcal disease is hampered by the difficulties in growing the isolates from clinical specimens and also by misidentification. Molecular methods have gained popularity as they offer improvement in the detection of causative pathogens with speed and ease. The present study aims at validating and standardising the use of 4 oligonucleotide primer-probe sets (pneumolysin [ply], autolysin [lytA], pneumococcal surface adhesion A [psaA] and Spn9802 [DNA fragment] in a single-reaction mixture for the detection and discrimination of S. pneumoniae. Here, we validate a quantitative multiplex real-time PCR (qmPCR assay with a panel consisting of 43 S. pneumoniae and 29 non-pneumococcal isolates, 20 culture positive, 26 culture negative and 30 spiked serum samples. A standard curve was obtained using S. pneumoniae ATCC 49619 strain and glyceraldehyde 3-phosphate dehydrogenase (GAPDH gene was used as an endogenous internal control. The experiment showed high sensitivity with lower limit of detection equivalent to 4 genome copies/µl. The efficiency of the reaction was 100% for ply, lytA, Spn9802 and 97% for psaA. The test showed sensitivity and specificity of 100% with culture isolates and serum specimens. This study demonstrates that qmPCR analysis of sera using 4 oligonucleotide primers appears to be an appropriate method for the genotypic identification of S. pneumoniae infection.
An optimized pentaplex PCR for detecting DNA mismatch repair-deficient colorectal cancers.
Directory of Open Access Journals (Sweden)
Ajay Goel
2010-02-01
Full Text Available Microsatellite instability (MSI is used to screen colorectal cancers (CRC for Lynch Syndrome, and to predict outcome and response to treatment. The current technique for measuring MSI requires DNA from normal and neoplastic tissues, and fails to identify tumors with specific DNA mismatch repair (MMR defects. We tested a panel of five quasi-monomorphic mononucleotide repeat markers amplified in a single multiplex PCR reaction (pentaplex PCR to detect MSI.We investigated a cohort of 213 CRC patients, comprised of 114 MMR-deficient and 99 MMR-proficient tumors. Immunohistochemical (IHC analysis evaluated the expression of MLH1, MSH2, PMS2 and MSH6. MSI status was defined by differences in the quasi-monomorphic variation range (QMVR from a pool of normal DNA samples, and measuring differences in allele lengths in tumor DNA.Amplification of 426 normal alleles allowed optimization of the QMVR at each marker, and eliminated the requirement for matched reference DNA to define MSI in each sample. Using > or = 2/5 unstable markers as the criteria for MSI resulted in a sensitivity of 95.6% (95% CI = 90.1-98.1% and a positive predictive value of 100% (95% CI = 96.6%-100%. Detection of MSH6-deficiency was limited using all techniques. Data analysis with a three-marker panel (BAT26, NR21 and NR27 was comparable in sensitivity (97.4% and positive predictive value (96.5% to the five marker panel. Both approaches were superior to the standard approach to measuring MSI.An optimized pentaplex (or triplex PCR offers a facile, robust, very inexpensive, highly sensitive, and specific assay for the identification of MSI in CRC.
Directory of Open Access Journals (Sweden)
Helene Wahlström
2016-03-01
Full Text Available Introduction: A semi-automated magnetic capture probe-based DNA extraction and real-time PCR method (MC-PCR, allowing for a more efficient large-scale surveillance of Echinococcus multilocularis occurrence, has been developed. The test sensitivity has previously been evaluated using the sedimentation and counting technique (SCT as a gold standard. However, as the sensitivity of the SCT is not 1, test characteristics of the MC-PCR was also evaluated using latent class analysis, a methodology not requiring a gold standard. Materials and methods: Test results, MC-PCR and SCT, from a previous evaluation of the MC-PCR using 177 foxes shot in the spring (n=108 and autumn 2012 (n=69 in high prevalence areas in Switzerland were used. Latent class analysis was used to estimate the test characteristics of the MC-PCR. Although it is not the primary aim of this study, estimates of the test characteristics of the SCT were also obtained. Results and discussion: This study showed that the sensitivity of the MC-PCR was 0.88 [95% posterior credible interval (PCI 0.80–0.93], which was not significantly different than the SCT, 0.83 (95% PCI 0.76–0.88, which is currently considered as the gold standard. The specificity of both tests was high, 0.98 (95% PCI 0.94–0.99 for the MC-PCR and 0.99 (95% PCI 0.99–1 for the SCT. In a previous study, using fox scats from a low prevalence area, the specificity of the MC-PCR was higher, 0.999% (95% PCI 0.997–1. One reason for the lower estimate of the specificity in this study could be that the MC-PCR detects DNA from infected but non-infectious rodents eaten by foxes. When using MC-PCR in low prevalence areas or areas free from the parasite, a positive result in the MC-PCR should be regarded as a true positive. Conclusion: The sensitivity of the MC-PCR (0.88 was comparable to the sensitivity of SCT (0.83.
Detection of Epstein Barr virus in formalin-fixed paraffin tissues by fluorescent direct in situ PCR
Directory of Open Access Journals (Sweden)
N Marziliano
2009-06-01
Full Text Available Specific viral laboratory diagnosis of primary Epstein-Barr Virus (EBV infection is usually based on antibody-detection assays. However, molecular detection is also considered the reference standard assay for diagnosis of central nervous system infections and of most cases of nasopharyngeal carcinoma (NPC. One-step or nested polymerase chain reaction (PCR has rapidly replaced immunological assays based on virus-specific Ig antibodies for the laboratory diagnosis of Herpesvirus infections, even if serological methods are considered an additional tool for defining clinical diagnosis. In this article, we will present a rapid, sensitive and robust molecular tool for the viral detection of EBV (EBNA-1 within tissue specimens by making use of in situ PCR (IS-PCR.
Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng
2009-11-01
Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.
Endo, Noriyuki; Sato, Kana; Matsumura, Kiyotaka; Yoshimura, Erina; Odaka, Yukiko; Nogata, Yasuyuki
2010-11-01
Species-specific detection and quantification methods for barnacle larvae using quantitative real-time polymerase chain reaction (qPCR) were developed. Species-specific primers for qPCR were designed for 13 barnacle species in the mitochondrial 12S ribosomal RNA gene region. Primer specificity was examined by PCR using template DNA extracted from each of the 13 barnacle species, other unidentified barnacle species, and field collected zooplankton samples. The resulting PCR products comprised single bands following agarose gel electrophoresis when the templates corresponded to primers. The amplifications were highly species-specific even for the field plankton samples. The field plankton samples were subjected to qPCR assay. The calculated DNA contents for each barnacle species were closely correlated with the number of larvae measured by microscopic examination. The method could be applied to quantify barnacle larvae in natural plankton samples.
[Quantitative fluorogenic real-time PCR assay for respiratory syncytial virus detection].
Zhang, Qi-wei; You, Shang-you; Sun, Ji-min; Wu, Qi; Yu, Chun-hua; Zhang, Chu-yu
2005-07-01
To Establish a rapid and objective quantitative fluorogenic real-time PCR assay for early detection of human respiratory syncytial virus (hRSV). Two pairs of primers and one TaqMan Fluorogenic probe that are specific for the recognition of the most conservative N gene of hRSV for virus detection with LighCycler PCR in 93 nasopharyngeal secretion specimens collected from infants and young children. The assay was compared with virus isolation, routine PCR, nested PCR, and enzyme-linked immunosorbent assay (ELISA). This TaqMan assay had a sensitivity of 1 x 10(2) cDNA copies/microl with a dynamic range between 1 x 10(2) and 1 x 10(7) cDNA copies/microl, which was the same as that of nested PCR, but 10 times more sensitive than routine PCR. The specificity of the assay was evaluated by comparing hRSV with polivirus type 1, coxsackie virus type 2, influenza A, influenza B and adenovirus type 7. A PCR product of the expected size (195 bp) was produced and fluorescence signal detected for hRSV, but not for any of the other viruses. The results in LightCycler and Rotor-Gene instrument were consistent. Forty-four specimens (43.9%) were hRSV-positive with this assay and 4 (4/93,4.3%) were hRSV-positive with ELISA, showing rather low correlation between the two methods. No visible relation was found between the concentration of hRSV RNA and severity of the disease. This assay is rapid, sensitive, specific and quantitative, and has the potential of wide application for early diagnosis of hRSV infection and evaluation of the therapeutic effect.
Ren, Xingxing; Fu, Ying; Xu, Chenggang; Feng, Zhou; Li, Miao; Zhang, Lina; Zhang, Jianmin; Liao, Ming
2017-05-01
Salmonella enterica serovar Gallinarum biovars Pullorum and Gallinarum represent the most common causative agents of chicken salmonellosis, which result in high mortality and morbidity throughout the world. It is difficult and laborious to discriminate these diseases based on biochemical or phenotypic methods. Herein, we report the development of a single nucleotide polymorphism (SNP) PCR-high resolution melt (PCR-HRM) assay for the detection and discrimination of both S. Pullorum and S. Gallinarun. The gene rfbS, which encodes a factor involved in the biosynthesis of ADP paratose in serogroup D of Salmonella, has been identified as a robust genetic marker for the identification of S. Pullorum and S. Gallinarun based on polymorphisms at positions 237 and 598. Therefore, PCR-HRM analyses were used to characterize this gene. A total of 15 reference and 33 clinical isolates of Salmonella and related Gram-negative bacteria were detected using 2 sets of primers. Our PCR-HRM assay could distinguish S. Pullorum from S. Gallinarun and other strains using the primer pair SP-237F/237R. Similarly, S. Gallinarun could be distinguished from S. Pullorum and other strains using primer set SG-598F/598R. These 2 assays showed high specificity (100%) for both S. Pullorum and S. Gallinarun; the sensitivity of these 2 assays was at least 100-fold greater than that of the allele-specific PCR assay. This present study demonstrated that HRM analysis represents a potent, simple, and economic tool for the rapid, specific, and sensitive detection of S. Pullorum and S. Gallinarun. Our approach also may aid efforts for purification of Avian Salmonella disease. © 2016 Poultry Science Association Inc.
Stenhouse, Steven A; Plernsub, Suriya; Yanola, Jintana; Lumjuan, Nongkran; Dantrakool, Anchalee; Choochote, Wej; Somboon, Pradya
2013-08-30
Resistance to pyrethroid insecticides is widespread among populations of Aedes aegypti, the main vector for the dengue virus. Several different point mutations within the voltage-gated sodium channel (VGSC) gene contribute to such resistance. A mutation at position 1016 in domain II, segment 6 of the VGSC gene in Ae. aegypti leads to a valine to glycine substitution (V1016G) that confers resistance to deltamethrin. This study developed and utilized an allele-specific PCR (AS-PCR) assay that could be used to detect the V1016G mutation. The assay was validated against a number of sequenced DNA samples of known genotype and was determined to be in complete agreement. Larvae and pupae were collected from various localities throughout Thailand. Samples were reared to adulthood and their resistance status against deltamethrin was determined by standard WHO susceptibility bioassays. Deltamethrin-resistant and susceptible insects were then genotyped for the V1016G mutation. Additionally, some samples were genotyped for a second mutation at position 1534 in domain III (F1534C) which is also known to confer pyrethroid resistance. The bioassay results revealed an overall mortality of 77.6%. Homozygous 1016G individuals survived at higher rates than either heterozygous or wild-type (1016 V) mosquitoes. The 1016G mutation was significantly and positively associated with deltamethrin resistance and was widely distributed throughout Thailand. Interestingly, wild-type 1016 V mosquitoes tested were homozygous for the 1534C mutation, and all heterozygous mosquitoes were also heterozygous for 1534C. Mutant homozygous (G/G) mosquitoes expressed the wild-type (F/F) at position 1534. However, the presence of the 1534C mutation was not associated with deltamethrin resistance. Our bioassay results indicate that all populations sampled display some degree of resistance to deltamethrin. Homozygous 1016G mosquitoes were far likelier to survive such exposure. However, resistance in some
DEFF Research Database (Denmark)
Gådin, Jesper R.; van't Hooft, Ferdinand M.; Eriksson, Per
2015-01-01
the possible biases. Results: We present AllelicImblance, a software program that is designed to detect, manage, and visualize allelic imbalances comprehensively. The purpose of this software is to allow users to pose genetic questions in any RNA sequencing experiment quickly, enhancing the general utility...... of RNA sequencing. The visualization features can reveal notable, non-trivial allelic imbalance behavior over specific regions, such as exons. Conclusions: The software provides a complete framework to perform allelic imbalance analyses of aligned RNA sequencing data, from detection to visualization...
Directory of Open Access Journals (Sweden)
Strube Christina
2010-08-01
Full Text Available Abstract Background Borrelia burgdorferi sensu lato (sl, the causative agent of Lyme borreliosis, is transmitted by ticks of the genus Ixodes as vector. For identification of Borrelia infections in ticks a TaqMan™ minor groove binder (MGB probe-based quantitative real time PCR (qPCR was established targeting the 5S-23S intergenic spacer. Extension to a duplex qPCR included an Ixodes spp. positive control to verify successful DNA isolation. Besides qPCR, an ospA-specific conventional PCR for species-specific identification of B. spielmanii was established. Afterwards 1000 I. ricinus flagged in the city of Hanover, Germany, were investigated for B. burgdorferi sl infections followed by species identification. Furthermore, I. hexagonus ticks were investigated to proof applicability of the PCRs. Results Quantitative real time PCR (qPCR identifying B. burgdorferi sl in ticks was able to detect 1-10 copies per reaction. B. spielmanii ospA-specific conventional PCR was also highly specific and showed no cross reactions with the other tested Borrelia species. From 1000 hanoveranian ticks 24.3% were positive compared to only 7.4% positives by dark-field microscopy. Related to tick stage 1.7% larvae, 18.1% nymphs, and 34.6% adults were positive. The most frequent species was B. garinii, followed by B. afzelii, B. spielmanii, B. valaisiana and B. burgdorferi sensu stricto (ss. 70.6% of I. ricinus were mono-infected, whereas 28.0% and 1.4% were infected with two and three Borrelia species, respectively. From 232 I. hexagonus collected from hedgehogs in different sites of Germany, qPCR detected 5.7% to be infected with B. burgdorferi sl, which were identified as B. afzelii, B. garinii and B. spielmanii. Conclusions The evaluated qPCR to detect B. burgdorferi sl in Ixodes spp. is highly specific and sensitive. As a duplex qPCR including detection of Ixodes spp. DNA it is the first DNA based technique incorporating a control for successful DNA isolation from
Puenpa, Jiratchaya; Suwannakarn, Kamol; Chansaenroj, Jira; Vongpunsawad, Sompong; Poovorawan, Yong
2017-10-01
Real-time reverse-transcription polymerase chain reaction (rRT-PCR) to detect enterovirus 71 (EV-A71) and coxsackievirus A16 (CV-A16) has facilitated the rapid and accurate identification of the two most common etiological agents underlying hand, foot, and mouth disease (HFMD). However, the worldwide emergence of CV-A6 infection in HFMD necessitates development of an improved multiplex rRT-PCR method. To rapidly determine the etiology of HFMD, two rRT-PCR assays using TaqMan probes were developed to differentiate among three selected common enteroviruses (EV-A71, CV-A16 and CV-A6) and to enable broad detection of enteroviruses (pan-enterovirus assay). No cross-reactions were observed with other RNA viruses examined. The detection limits of both assays were 10 copies per microliter for EV-A71, CV-A6 and CV-A16, and pan-enterovirus. The methods showed high accuracy (EV-A71, 90.6%; CV-A6, 92.0%; CV-A16, 100%), sensitivity (EV-A71, 96.5%; CV-A6, 95.8%; CV-A16, 99.0%), and specificity (EV-A71, 100%; CV-A6, 99.9%; CV-A16, 99.9%) in testing clinical specimens (n=1049) during 2014-2016, superior to those of conventional RT-PCR. Overall, the multiplex rRT-PCR assays enabled highly sensitive detection and rapid simultaneous typing of EV-A71, CV-A6 and CV-A16, and enteroviruses, rendering them feasible and attractive methods for large-scale surveillance of enteroviruses associated with HFMD outbreaks. Copyright © 2017 Elsevier B.V. All rights reserved.
Quantitative Real-Time PCR (QRT-PCR) technology, incorporating fluorigenic 5' nuclease (TaqMan?) chemistry, was developed for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C....
The Rotary Zone Thermal Cycler: A Low-Power System Enabling Automated Rapid PCR
Bartsch, Michael S.; Renzi, Ronald F.; Van de Vreugde, James L.; Kim, Hanyoup; Knight, Daniel L.; Sinha, Anupama; Branda, Steven S.; Patel, Kamlesh D.
2015-01-01
Advances in molecular biology, microfluidics, and laboratory automation continue to expand the accessibility and applicability of these methods beyond the confines of conventional, centralized laboratory facilities and into point of use roles in clinical, military, forensic, and field-deployed applications. As a result, there is a growing need to adapt the unit operations of molecular biology (e.g., aliquoting, centrifuging, mixing, and thermal cycling) to compact, portable, low-power, and automation-ready formats. Here we present one such adaptation, the rotary zone thermal cycler (RZTC), a novel wheel-based device capable of cycling up to four different fixed-temperature blocks into contact with a stationary 4-microliter capillary-bound sample to realize 1-3 second transitions with steady state heater power of less than 10 W. We demonstrate the utility of the RZTC for DNA amplification as part of a highly integrated rotary zone PCR (rzPCR) system that uses low-volume valves and syringe-based fluid handling to automate sample loading and unloading, thermal cycling, and between-run cleaning functionalities in a compact, modular form factor. In addition to characterizing the performance of the RZTC and the efficacy of different online cleaning protocols, we present preliminary results for rapid single-plex PCR, multiplex short tandem repeat (STR) amplification, and second strand cDNA synthesis. PMID:25826708
The rotary zone thermal cycler: a low-power system enabling automated rapid PCR.
Directory of Open Access Journals (Sweden)
Michael S Bartsch
Full Text Available Advances in molecular biology, microfluidics, and laboratory automation continue to expand the accessibility and applicability of these methods beyond the confines of conventional, centralized laboratory facilities and into point of use roles in clinical, military, forensic, and field-deployed applications. As a result, there is a growing need to adapt the unit operations of molecular biology (e.g., aliquoting, centrifuging, mixing, and thermal cycling to compact, portable, low-power, and automation-ready formats. Here we present one such adaptation, the rotary zone thermal cycler (RZTC, a novel wheel-based device capable of cycling up to four different fixed-temperature blocks into contact with a stationary 4-microliter capillary-bound sample to realize 1-3 second transitions with steady state heater power of less than 10 W. We demonstrate the utility of the RZTC for DNA amplification as part of a highly integrated rotary zone PCR (rzPCR system that uses low-volume valves and syringe-based fluid handling to automate sample loading and unloading, thermal cycling, and between-run cleaning functionalities in a compact, modular form factor. In addition to characterizing the performance of the RZTC and the efficacy of different online cleaning protocols, we present preliminary results for rapid single-plex PCR, multiplex short tandem repeat (STR amplification, and second strand cDNA synthesis.
Yao, Yining; Yang, Qinrui; Shao, Chengchen; Liu, Baonian; Zhou, Yuxiang; Xu, Hongmei; Zhou, Yueqin; Tang, Qiqun; Xie, Jianhui
2018-01-01
Rare variants are widely observed in human genome and sequence variations at primer binding sites might impair the process of PCR amplification resulting in dropouts of alleles, named as null alleles. In this study, 5 cases from routine paternity testing using PowerPlex ® 21 System for STR genotyping were considered to harbor null alleles at TH01, FGA, D5S818, D8S1179, and D16S539, respectively. The dropout of alleles was confirmed by using alternative commercial kits AGCU Expressmarker 22 PCR amplification kit and AmpFℓSTR ® . Identifiler ® Plus Kit, and sequencing results revealed a single base variation at the primer binding site of each STR locus. Results from the collection of previous reports show that null alleles at D5S818 were frequently observed in population detected by two PowerPlex ® typing systems and null alleles at D19S433 were mostly observed in Japanese population detected by two AmpFℓSTR™ typing systems. Furthermore, the most popular mutation type appeared the transition from C to T with G to A, which might have a potential relationship with DNA methylation. Altogether, these results can provide helpful information in forensic practice to the elimination of genotyping discrepancy and the development of primer sets. Copyright © 2017 Elsevier B.V. All rights reserved.
Development of a qPCR method to rapidly assess the function of NKT cells.
Sohn, Silke; Tiper, Irina; Japp, Emily; Sun, Wenji; Tkaczuk, Katherine; Webb, Tonya J
2014-05-01
NKT cells comprise a rare, but important subset of T cells which account for ~0.2% of the total circulating T cell population. NKT cells are known to have anti-tumor functions and rapidly produce high levels of cytokines following activation. Several clinical trials have sought to exploit the effector functions of NKT cells. While some studies have shown promise, NKT cells are approximately 50% lower in cancer patients compared to healthy donors of the same age and gender, thus limiting their therapeutic efficacy. These studies indicate that baseline levels of activation should be assessed before initiating an NKT cell based immunotherapeutic strategy. The goal of this study was to develop a sensitive method to rapidly assess NKT cell function. We utilized artificial antigen presenting cells in combination with qPCR in order to determine NKT cell function in peripheral blood mononuclear cells from healthy donors and breast cancer patients. We found that NKT cell activation can be detected by qPCR, but not by ELISA, in healthy donors as well as in breast cancer patients following four hour stimulation. This method utilizing CD1d-expressing aAPCs will enhance our knowledge of NKT cell biology and could potentially be used as a novel tool in adoptive immunotherapeutic strategies. Copyright © 2014 Elsevier B.V. All rights reserved.
Shukla, Mohan K; Singh, Neeru; Sharma, Ravendra K; Barde, Pradip V
2017-07-01
The objective of this study was to demonstrate the utility of dengue virus (DENV) non structural protein 1 (NS1) based rapid diagnostic test (RDT) for use in tribal and difficult to reach areas for early dengue (DEN) diagnosis in acute phase patients and evaluate its sensitivity and specificity against DENV NS1 enzyme linked immune sorbent assay (ELISA) and real time reverse transcriptase polymerase chain reaction (qRT-PCR). The DENV NS1 RDT was used for preliminary diagnosis during outbreaks in difficult to reach rural and tribal areas. The diagnosis was confirmed by DENV NS1 ELISA in the laboratory. The samples were also tested and serotyped by qRT-PCR. The results were evaluated using statistical tests. The DENV NS1 RDT showed 99.2% sensitivity and 96.0% specificity when analyzed using DENV NS1 ELISA as standard. The specificity and sensitivity of the RDT when compared with qRT-PCR was 93.6% and 91.1%, respectively. The serotype specific evaluation showed more than 90% sensitivity and specificity for DENV-1, 2, and 3. The RDT proved a good diagnostic tool in difficult to reach rural and tribal areas. Further evaluation studies with different commercially available RDTs in different field conditions are essential, that will help clinicians and patients for treatment and programme managers for timely intervention. © 2017 Wiley Periodicals, Inc.
Janwan, Penchom; Intapan, Pewpan M; Thanchomnang, Tongjit; Lulitanond, Viraphong; Anamnart, Witthaya; Maleewong, Wanchai
2011-12-01
Human opisthorchiasis caused by the liver fluke Opisthorchis viverrini is an endemic disease in Southeast Asian countries including the Lao People's Democratic Republic, Cambodia, Vietnam, and Thailand. Infection with the soil-transmitted roundworm Strongyloides stercoralis is an important problem worldwide. In some areas, both parasitic infections are reported as co-infections. A duplex real-time fluorescence resonance energy transfer (FRET) PCR merged with melting curve analysis was developed for the rapid detection of O. viverrini and S. stercoralis in human fecal samples. Duplex real-time FRET PCR is based on fluorescence melting curve analysis of a hybrid of amplicons generated from two genera of DNA elements: the 162 bp pOV-A6 DNA sequence specific to O. viverrini and the 244 bp 18S rRNA sequence specific to S. stercoralis, and two pairs of specific fluorophore-labeled probes. Both O. viverrini and S. stercoralis can be differentially detected in infected human fecal samples by this process through their different fluorescence channels and melting temperatures. Detection limit of the method was as little as two O. viverrini eggs and four S. stercoralis larvae in 100 mg of fecal sample. The assay could distinguish the DNA of both parasites from the DNA of negative fecal samples and fecal samples with other parasite materials, as well as from the DNA of human leukocytes and other control parasites. The technique showed 100% sensitivity and specificity. The introduced duplex real-time FRET PCR can reduce labor time and reagent costs and is not prone to carry over contamination. The method is important for simultaneous detection especially in areas where both parasites overlap incidence and is useful as the screening tool in the returning travelers and immigrants to industrialized countries where number of samples in the diagnostic units will become increasing.
Ivaničová, Zuzana; Jakobson, Irena; Reis, Diana; Šafář, Jan; Milec, Zbyněk; Abrouk, Michael; Doležel, Jaroslav; Järve, Kadri; Valárik, Miroslav
2016-09-25
Flowering time variation was identified within a mapping population of doubled haploid lines developed from a cross between the introgressive line 8.1 and spring bread wheat cv. Tähti. The line 8.1 carried introgressions from tetraploid Triticum militinae in the cv. Tähti genetic background on chromosomes 1A, 2A, 4A, 5A, 7A, 1B and 5B. The most significant QTL for the flowering time variation was identified within the introgressed region on chromosome 5A and its largest effect was associated with the VRN-A1 locus, accounting for up to 70% of phenotypic variance. The allele of T. militinae origin was designated as VRN-A1f-like. The effect of the VRN-A1f-like allele was verified in two other mapping populations. QTL analysis identified that in cv. Tähti and cv. Mooni genetic background, VRN-A1f-like allele incurred a delay of 1.9-18.6 days in flowering time, depending on growing conditions. Sequence comparison of the VRN-A1f-like and VRN-A1a alleles from the parental lines of the mapping populations revealed major mutations in the promoter region as well as in the first intron, including insertion of a MITE element and a large deletion. The sequence variation allowed construction of specific diagnostic PCR markers for VRN-A1f-like allele determination. Identification and quantification of the effect of the VRN-A1f-like allele offers a useful tool for wheat breeding and for studying fine-scale regulation of flowering pathways in wheat. Copyright © 2016 Elsevier B.V. All rights reserved.
Opportunistic fungal pathogens are a concern because of the increasing number of immunocompromised patients. The goal of this research was to test a simple extraction method and rapid quantitative PCR (QPCR) measurement of the occurrence of potential pathogens, Aspergillus fumiga...
Gamper, H.A.; Leuchtmann, A.
2007-01-01
Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking
Sankuntaw, Nipaporn; Sukprasert, Saovaluk; Engchanil, Chulapan; Kaewkes, Wanlop; Chantratita, Wasun; Pairoj, Vantanit; Lulitanond, Viraphong
2011-01-01
Human herpesvirus infection of immunocompromised hosts may lead to central nervous system (CNS) infection and diseases. In this study, a single tube multiplex real-time PCR was developed for the detection of five herpesviruses (HSV-1, HSV-2, VZV, EBV and CMV) in clinical cerebrospinal fluid (CSF) specimens. Two primer pairs specific for the herpesvirus polymerase gene and five hybridization probe pairs for the specific identification of the herpesvirus types were used in a LightCycler multiplex real-time PCR. A singleplex real-time PCR was first optimized and then applied to the multiplex real-time PCR. The singleplex and multiplex real-time PCRs showed no cross-reactivity. The sensitivity of the singleplex real-time PCR was 1 copy per reaction for each herpesvirus, while that of the multiplex real-time PCR was 1 copy per reaction for HSV-1 and VZV and 10 copies per reaction for HSV-2, EBV and CMV. Intra and inter-assay variations of the single tube multiplex assay were in the range of 0.02%-3.67% and 0.79%-4.35%, respectively. The assay was evaluated by testing 62 clinical CSF samples and was found to have equivalent sensitivity, specificity and agreement as the routine real-time PCR, but reducing time, cost and amount of used sample. Copyright © 2011 Elsevier Ltd. All rights reserved.
Allele frequency distribution for 21 autosomal STR loci in Bhutan.
Kraaijenbrink, Thirsa; van Driem, George L; Tshering of Gaselô, Karma; de Knijff, Peter
2007-07-20
We studied the allele frequency distribution of 21 autosomal STR loci contained in the AmpFlSTR Identifiler (Applied Biosystems), the Powerplex 16 (Promega) and the FFFL (Promega) multiplex PCR kits among 936 individuals from the Royal Kingdom of Bhutan. As such these are the first published autosomal DNA results from this country.
Martinez-Lopez, Joaquin; Fernández-Redondo, Elena; García-Sánz, Ramón; Montalbán, María Angeles; Martínez-Sánchez, Pilar; Pavia, Bruno; Mateos, María Victoria; Rosiñol, Laura; Martín, Marisa; Ayala, Rosa; Martínez, Rafael; Blanchard, María Jesus; Alegre, Adrian; Besalduch, Joan; Bargay, Joan; Hernandez, Miguel T; Sarasquete, María Eugenia; Sanchez-Godoy, Pedro; Fernández, Manuela; Blade, Joan; San Miguel, Jesús F; Lahuerta, Juan Jose
2013-12-01
Minimal residual disease monitoring is becoming increasingly important in multiple myeloma (MM), but multiparameter flow cytometry (MFC) and allele-specific oligonucleotide polymerase chain reaction (ASO-PCR) techniques are not routinely available. This study investigated the prognostic influence of achieving molecular response assessed by fluorescent-PCR (F-PCR) in 130 newly diagnosed MM patients from Grupo Español Multidisciplinar de Melanoma (GEM)2000/GEM05 trials (NCT00560053, NCT00443235, NCT00464217) who achieved almost very good partial response after induction therapy. As a reference, we used the results observed with simultaneous MFC. F-PCR at diagnosis was performed on DNA using three different multiplex PCRs: IGH D-J, IGK V-J and KDE rearrangements. The applicability of F-PCR was 91·5%. After induction therapy, 64 patients achieved molecular response and 66 non-molecular response; median progression-free survival (PFS) was 61 versus 36 months, respectively (P = 0·001). Median overall survival (OS) was not reached (NR) in molecular response patients (5-year survival: 75%) versus 66 months in the non-molecular response group (P = 0·03). The corresponding PFS and OS values for patients with immunophenotypic versus non-immunophenotypic response were 67 versus 42 months (P = 0·005) and NR (5-year survival: 95%) versus 69 months (P = 0·004), respectively. F-PCR analysis is a rapid, affordable, and easily performable technique that, in some circumstances, may be a valid approach for minimal residual disease investigations in MM. © 2013 John Wiley & Sons Ltd.
Highly Specific Detection of Five Exotic Quarantine Plant Viruses using RT-PCR
Directory of Open Access Journals (Sweden)
Hoseong Choi
2013-03-01
Full Text Available To detect five plant viruses (Beet black scorch virus, Beet necrotic yellow vein virus, Eggplant mottled dwarf virus, Pelargonium zonate spot virus, and Rice yellow mottle virus for quarantine purposes, we designed 15 RT-PCR primer sets. Primer design was based on the nucleotide sequence of the coat protein gene, which is highly conserved within species. All but one primer set successfully amplified the targets, and gradient PCRs indicated that the optimal temperature for the 14 useful primer sets was 51.9°C. Some primer sets worked well regardless of annealing temperature while others required a very specific annealing temperature. A primer specificity test using plant total RNAs and cDNAs of other plant virus-infected samples demonstrated that the designed primer sets were highly specific and generated reproducible results. The newly developed RT-PCR primer sets would be useful for quarantine inspections aimed at preventing the entry of exotic plant viruses into Korea.
Directory of Open Access Journals (Sweden)
Maryam AlTamimi
2017-01-01
Full Text Available Dissemination of carbapenem resistance via Enterobacteriaceae, particularly among Klebsiella pneumoniae and Escherichia coli, is a major public health concern. Rapid methods for determining antimicrobial susceptibility are important to ensure adequate and appropriate use of antimicrobial agents and to limit the spread of these bacteria. In the current study, we compared the rapidity, sensitivity and specificity of traditional methods and molecular-based Xpert Carba-R PCR assay to identify sixty isolates, (26 E. coli and 34 K. pneumoniae. The specificity of MicroScan was 100% while sensitivity to ertapenem (ERT, imipenem (IMI, and meropenem (MER was 93%, 68.9%, and 55.17%, respectively. For the modified Hodge test, the specificity was 96.77% and sensitivity was 89.65%. Although some results of phenotypic assays matched with the definite PCR identification, some results were misleading. Out of the 29 positive PCR samples, three samples of K. pneumoniae were negative for the MHT and one E. coli sample was MHT positive but negative for the PCR. Nine samples were positive for the PCR but were determined as carbapenem sensitive by MicroScan. While MicroScan and MHT requires several hours and multi-steps to obtain results, Xpert Carba-R PCR assay takes less than an hour. Therefore, we recommend using Gene xpert Carba-R assay for the optimal carbapenemnase detection with reducing material, manpower and cost. Also it is important to know the type of carbapenemase is present.
Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G
2017-02-01
To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.
Sun, Zhibin; Huang, Yan; Wang, Yanzhuo; Zhao, Yuguo; Cui, Zhongli
2014-01-01
Genomic DNA extraction from Gram-positive bacteria is a laborious and time-consuming process. A rapid and convenient method was established to extract genomic DNA from a single colony as a PCR template. KOH-EDTA is used as a lysis buffer to disrupt the cell envelope, releasing genomic DNA, and Tris-HCl (pH = 4) is then added to neutralize the lysate. The lysate can be used directly as a template for PCR amplification. 16S rDNA was successfully amplified from Gram-positive bacteria from the genera of Bacillus, Streptomyces, Micromonospora, Nonomuraea, Microbispora, and Staphylococcus. Amplification of the trpB gene indicated that this method could also be applied to the amplification of functional genes. Compared to colony PCR methods without KOH-EDTA, this method is extremely fast and efficient, and it is applicable to high-throughput PCR amplifications.
Alleles of Ppd-D1 gene in the collection of Aegilops tauschii accessions and bread wheat varieties
Directory of Open Access Journals (Sweden)
Babenko D. O.
2012-04-01
Full Text Available Light period significantly influences on the growth and development of plants. One of the major genes of photoperiod sensitivity is Ppd-D1, located on the chromosome 2D. The aim of the work was to determine the alleles and molecular structure of Ppd-D1 gene in samples from the collection of Ae. tauschii accessions, which have different flowering periods, and in 29 Ukrainian wheat varieties. Methods. We used methods of allele-specific PCR with primers to the Ppd-D1 gene, sequencing and Blast-analysis. Results. The collection of Ae. tauschii accessions and several varieties of winter and spring wheat was studied. The molecular structure of the allelic variants (414, 429 and 453 b. p. of Ppd-D1b gene was determined in the collection of Aegilops. tauschii accessions. Conclusions. The Ppd-D1a allele was present in all studied varieties of winter wheat. 60 % of spring wheat is characterized by Ppd-D1b allele (size of amplification products 414 b. p.. Blast-analysis of the sequence data banks on the basis of the reference sequence of sample k-1322 from the collection of Ae. tauschii accessions has shown a high homology (80 to 100 % between the nucleotide sequences of PRR genes, that characterize the A and D genomes of representatives of the genera Triticum and Aegilops.
Droplet digital PCR analysis of NOTCH1 gene mutations in chronic lymphocytic leukemia.
Minervini, Angela; Francesco Minervini, Crescenzio; Anelli, Luisa; Zagaria, Antonella; Casieri, Paola; Coccaro, Nicoletta; Cumbo, Cosimo; Tota, Giuseppina; Impera, Luciana; Orsini, Paola; Brunetti, Claudia; Giordano, Annamaria; Specchia, Giorgina; Albano, Francesco
2016-12-27
In chronic lymphocytic leukemia (CLL), NOTCH1 gene mutations (NOTCH1mut) have been associated with adverse prognostic features but the independence of these as a prognostic factor is still controversial. In our study we validated a c.7541-7542delCT NOTCH1 mutation assay based on droplet digital PCR (ddPCR); we also analyzed the NOTCH1mut allelic burden, expressed as fractional abundance (FA), in 88 CLL patients at diagnosis to assess its prognostic role and made a longitudinal ddPCR analysis in 10 cases harboring NOTCH1mut to verify the FA variation over time. Our data revealed that with the ddPCR approach the incidence of NOTCH1mut in CLL was much higher (53.4%) than expected. However, longitudinal ddPCR analysis of CLL cases showed a statistically significant reduction of the NOTCH1mut FA detected at diagnosis after treatment (median FA 11.67 % vs 0.09 %, respectively, p = 0.01); the same difference, in terms of NOTCH1mut FA, was observed in the relapsed cases compared to the NOTCH1mut allelic fraction observed in patients in complete or partial remission (median FA 4.75% vs 0.43%, respectively, p = 0.007). Our study demonstrated a much higher incidence of NOTCH1mut in CLL than has previously been reported, and showed that the NOTCH1mut allelic burden evaluation by ddPCR might identify patients in need of a closer clinical follow-up during the "watch and wait" interval and after standard chemotherapy.
Vela, J; Vitorica, J; Ruano, D
2001-12-01
We describe a fast and easy method for the synthesis of competitor molecules based on non-specific conditions of PCR. RT-competitive PCR is a sensitive technique that allows quantification of very low quantities of mRNA molecules in small tissue samples. This technique is based on the competition established between the native and standard templates for nucleotides, primers or other factors during PCR. Thus, the most critical parameter is the use of good internal standards to generate a standard curve from which the amount of native sequences can be properly estimated. At the present time different types of internal standards and methods for their synthesis have been described. Normally, most of these methods are time-consuming and require the use of different sets of primers, different rounds of PCR or specific modifications, such as site-directed mutagenesis, that need subsequent analysis of the PCR products. Using our method, we obtained in a single round of PCR and with the same primer pair, competitor molecules that were successfully used in RT-competitive PCR experiments. The principal advantage of this method is high versatility and economy. Theoretically it is possible to synthesize a specific competitor molecule for each primer pair used. Finally, using this method we have been able to quantify the increase in the expression of the beta(2) GABA(A) receptor subunit mRNA that occurs during rat hippocampus development.
Chowdhury, N; Asakura, M; Neogi, S B; Hinenoya, A; Haldar, S; Ramamurthy, T; Sarkar, B L; Faruque, S M; Yamasaki, S
2010-07-01
To develop simple and rapid PCR-fingerprinting methods for Vibrio cholerae O1 (El Tor and classical biotypes) and O139 serogroup strains which cause major cholera epidemics, on the basis of the diversity of superintegron (SI) carried by these strains. PCR-restriction fragment length polymorphism (PCR-RFLP) assay was developed targeting region between integrase gene in the SI and its nearby ORF, followed by BglI digestion. Besides, a V. cholerae repeat-amplified fragment length polymorphism (VCR-AFLP) assay was also developed. In the PCR-RFLP, 94 El Tor, 29 classical and 54 O139 strains produced nine, three and six different DNA fingerprints, respectively. On the other hand, VCR-AFLP distinguished these El Tor, classical and O139 strains into five, nine and two DNA fingerprints, respectively. Combining both assays the El Tor, classical and O139 strains could be differentiated into 11, 10 and seven different types, respectively. In a comparative study, pulsed-field gel electrophoresis (PFGE) showed similar differentiation for El Tor (11 types), but lower discrimination for O139 (two types) and classical strains (five types). The PCR assays based on SI diversity can be used as a useful typing tool for epidemiological studies of V. cholerae. This newly developed method is more discriminatory, simple, rapid and cost-effective in comparison with PFGE, and thus can be widely applicable. © 2010 The Authors. Journal compilation © 2010 The Society for Applied Microbiology.
Haque, Abdul; Haque, Asma; Saeed, Muhammad; Azhar, Aysha; Rasool, Samreen; Shan, Sidra; Ehsan, Beenish; Nisar, Zohaib
2017-01-01
Emergence of methicillin resistant Staphylococcus aureus (MRSA) is a major medical problem of current era. These bacteria are resistant to most drugs and rapid diagnosis can provide a clear guideline to clinicians. They possess specific virulence factors and relevant information can be very useful. We designed this study to develop multiplex PCRs to provide rapid information. We studied 60 Staphylococcus aureus isolates and detected methicillin resistance by cefoxitin sensitivity and targeting of mecA gene. After initial studies with uniplex PCRs we optimized two multiplex PCRs with highly reproducible results. The first multiplex PCR was developed to confirm genus, species and methicillin resistance simultaneously, and the second multiplex PCR was for screening of virulence factors. We found 38.33% isolates as methicillin resistant. α -toxin, the major cytotoxic factor, was detected in 40% whereas β-hemolysin was found in 25% cases. Panton Valentine leucocidin was detected in 8.33% and toxic shock syndrome toxin in5% cases. The results of uniplex and multiplex PCRs were highly compatible. These two multiplex PCRs when run simultaneously can provide vital information about methicillin resistance and virulence status of the isolate within a few hours as compared to several days needed by routine procedures.
Directory of Open Access Journals (Sweden)
Bergmann-Leitner Elke S
2012-09-01
Full Text Available Abstract Background MSP1 is the major surface protein on merozoites and a prime candidate for a blood stage malaria vaccine. Preclinical and seroepidemiological studies have implicated antibodies to MSP1 in protection against blood stage parasitaemia and/or reduced parasite densities, respectively. Malaria endemic areas have multiple strains of Plasmodium falciparum circulating at any given time, giving rise to complex immune responses, an issue which is generally not addressed in clinical trials conducted in non-endemic areas. A lack of understanding of the effect of pre-existing immunity to heterologous parasite strains may significantly contribute to vaccine failure in the field. The purpose of this study was to model the effect of pre-existing immunity to MSP142 on the immunogenicity of blood-stage malaria vaccines based on alternative MSP1 alleles. Methods Inbred and outbred mice were immunized with various recombinant P. falciparum MSP142 proteins that represent the two major alleles of MSP142, MAD20 (3D7 and Wellcome (K1, FVO. Humoral immune responses were analysed by ELISA and LuminexTM, and functional activity of induced MSP142-specific antibodies was assessed by growth inhibition assays. T-cell responses were characterized using ex vivo ELISpot assays. Results Analysis of the immune responses induced by various immunization regimens demonstrated a strong allele-specific response at the T cell level in both inbred and outbred mice. The success of heterologous regimens depended on the degree of homology of the N-terminal p33 portion of the MSP142, likely due to the fact that most T cell epitopes reside in this part of the molecule. Analysis of humoral immune responses revealed a marked cross-reactivity between the alleles. Functional analyses showed that some of the heterologous regimens induced antibodies with improved growth inhibitory activities. Conclusion The development of a more broadly efficacious MSP1 based vaccine may be
Lama, M; Chatterjee, M; Chaudhuri, T K
2014-09-01
Asthma is a heterogeneous disease for which a strong genetic basis is firmly established. It is a complex disorder influenced by gene-environment interaction. Human leukocyte antigen (HLA) genes have been shown to be consistently associated with asthma and its related phenotypes in various populations. The aim of this study was to determine the frequency of the selected HLA classes I and II allelic groups in asthmatic and control groups. HLA typing was performed using polymerase chain reaction-sequence-specific typing (PCR-SSP) method. The allele frequency was estimated by direct counting. Frequency of each HLA allelic group was compared between asthmatic group and control group using χ(2) test. P-value was corrected by multiplying with the number of the allelic groups studied. Odds ratio (OR) and its corresponding 95% confidence interval (CI) for each allelic group were calculated using graphpad instat 3.10. The results of this study showed a significantly higher frequency of HLA-DRB1*03 in asthmatics than in controls (11.43% vs 3.64%, OR = 3.78, 95% CI = 1.61-8.85, P = 0.0025, Pcorr population. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Wang, Zhouli; Cai, Rui; Yuan, Yahong; Niu, Chen; Hu, Zhongqiu; Yue, Tianli
2014-04-03
Alicyclobacillus acidoterrestris is the most important spoilage species within the Alicyclobacillus genus and has become a major issue in the pasteurized fruit juice industry. The aim of this study was to develop a method combining immunomagnetic separation (IMS) with real-time PCR system (IMS-PCR) for rapid and specific detection of A. acidoterrestris in fruit products. A real-time PCR with the TaqMan system was designed to target the 16S rDNA genes with specific primer and probe set. The specificity of the assay was confirmed using 9 A. acidoterrestris strains and 21 non-A. acidoterrestris strains. The results indicated that no combination of the designed primers and probe was found in any Alicyclobacillus genus except A. acidoterrestris. The detection limit of the established IMS-PCR was less than 10CFU/mL and the testing process was accomplished in 2-3h. For the three types of samples (sterile water, apple juice and kiwi juice), the correlation coefficient of standard curves was greater than 0.991, and the calculated PCR efficiencies were from 108% to 109%. As compared with the standard culture method performed concurrently on the same set of samples, the sensitivity, specificity and accuracy of IMS-PCR for 196 naturally contaminated fruit products were 90.0%, 98.3% and 97.5%, respectively. The results exhibited that the proposed IMS-PCR method was effective for the rapid detection of A. acidoterrestris in fruit products. Copyright © 2014. Published by Elsevier B.V.
Allele-specific marker generation and linkage mapping on the Xiphophorus sex chromosomes.
Woolcock, B; Kazianis, S; Lucito, R; Walter, R B; Kallman, K D; Morizot, D C; Vielkind, J R
2006-01-01
There is great interest in the sex chromosomes of Xiphophorus fishes because both WY/YY and XX/XY sex-determining mechanisms function in these species, with at least one taxon possessing all three types of sex chromosomes, and because in certain interspecific hybrids melanoma arises as a consequence of inheritance of the sex-linked macromelanophore determining locus (MDL). Representational difference analysis (RDA) has been used to clone two sequences from the sex-determining region of X. maculatus, including a cholinergic receptor, nicotinic, delta polypeptide (CHRND) orthologue. Allele-specific assays for these sequences, as well as for the sex-linked XMRK1 and XMRK2 genes, were developed to distinguish W, X, and Y chromosomes derived from a X. maculatus (XX/XY) strain and a X. helleri (WY/YY) strain. Linkage mapping localized these markers to linkage group (LG) 24. No recombinants were observed between XMRK2 and MDL, confirming a role for XMRK2 in macromelanophore development. Although the master sex-determining (SD) locus certainly resides on Xiphophorus LG 24, autosomal loci are probably involved in sex determination as well, as indicated by the abnormal sex ratios in the backcross hybrids that contrast theoretical predictions based on LG 24 genotyping. Marker development and allelic discrimination on the Xiphophorus sex chromosomes should prove highly useful for studies that utilize this genus as an animal model.
Ayala-Valdovinos, Miguel Angel; Galindo-García, Jorge; Sánchez-Chiprés, David; Duifhuis-Rivera, Theodor
2017-04-01
Hydrocephalus in Friesian horses is an autosomal recessive hereditary disease that can result in an abortion, a stillbirth, or euthanization of a newborn foal. Here, the hydrocephalus-associated c.1423C > T mutation in B3GALNT2 gene was detected with PCR-RFLP and PCR-PIRA methods for horse genotyping. A preliminary genotyping survey was performed on 83 randomly selected Friesian stallion horses to determine the current allele frequency in Mexico. The frequency of the mutant T allele was 9.6%. Copyright © 2016 Elsevier Ltd. All rights reserved.
Berr, C; Dufouil, C; Brousseau, T; Richard, F; Amouyel, P; Marceteau, E; Alpérovitch, A
1996-10-25
We examined the association between apolipoprotein E (ApoE) epsilon 4 allele and cognitive performances in a population sample of 1174 high functioning volunteers aged 59-71 years. The neuropsychological battery included the Mini Mental State Examination (MMSE) and nine tests assessing visual attention, verbal memory, visual processing, logical reasoning, psychomotor rapidity, visual memory, auditory attention and verbal fluency. The ratio of genotypes with zero, one or two epsilon 4 alleles was 70.6%, 21.4% and 1.9%, respectively. The epsilon 4 allele was significantly associated with lower scores for visual attention, psychomotor rapidity and MMSE. In the best performer subgroup (MMSE score above 25, n = 1028), all relationships persisted. Our findings demonstrate that the ApoE-epsilon 4 allele is early associated with low normal cognitive performances in areas which are not specifically affected at the subclinical onset of dementia.
Bachanek-Bankowska, Katarzyna; Mero, Herieth R; Wadsworth, Jemma; Mioulet, Valerie; Sallu, Raphael; Belsham, Graham J; Kasanga, Christopher J; Knowles, Nick J; King, Donald P
2016-11-01
Rapid, reliable and accurate diagnostic methods provide essential support to programmes that monitor and control foot-and-mouth disease (FMD). While pan-specific molecular tests for FMD virus (FMDV) detection are well established and widely used in endemic and FMD-free countries, current serotyping methods mainly rely either on antigen detection ELISAs or nucleotide sequencing approaches. This report describes the development of a panel of serotype-specific real-time RT-PCR assays (rRT-PCR) tailored to detect FMDV lineages currently circulating in East Africa. These assays target sequences within the VP1-coding region that share high intra-lineage identity, but do not cross-react with FMD viruses from other serotypes that circulate in the region. These serotype-specific assays operate with the same thermal profile as the pan-diagnostic tests making it possible to run them in parallel to produce C T values comparable to the pan-diagnostic test detecting the 3D-coding region. These assays were evaluated alongside the established pan-specific molecular test using field samples and virus isolates collected from Tanzania, Kenya and Ethiopia that had been previously characterised by nucleotide sequencing. Samples (n=71) representing serotype A (topotype AFRICA, lineage G-I), serotype O (topotypes EA-2 and EA-4), serotype SAT 1 (topotype I (NWZ)) and serotype SAT2 (topotype IV) were correctly identified with these rRT-PCR assays. Furthermore, FMDV RNA from samples that did not contain infectious virus could still be serotyped using these assays. These serotype-specific real-time RT-PCR assays can detect and characterise FMDVs currently circulating in East Africa and hence improve disease control in this region. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Rapid and sensitive PCR-dipstick DNA chromatography for multiplex analysis of the oral microbiota.
Tian, Lingyang; Sato, Takuichi; Niwa, Kousuke; Kawase, Mitsuo; Tanner, Anne C R; Takahashi, Nobuhiro
2014-01-01
A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.
Rapid and Sensitive PCR-Dipstick DNA Chromatography for Multiplex Analysis of the Oral Microbiota
Directory of Open Access Journals (Sweden)
Lingyang Tian
2014-01-01
Full Text Available A complex of species has been associated with dental caries under the ecological hypothesis. This study aimed to develop a rapid, sensitive PCR-dipstick DNA chromatography assay that could be read by eye for multiplex and semiquantitative analysis of plaque bacteria. Parallel oligonucleotides were immobilized on a dipstick strip for multiplex analysis of target DNA sequences of the caries-associated bacteria, Streptococcus mutans, Streptococcus sobrinus, Scardovia wiggsiae, Actinomyces species, and Veillonella parvula. Streptavidin-coated blue-colored latex microspheres were to generate signal. Target DNA amplicons with an oligonucleotide-tagged terminus and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction and then hybridized with complementary oligonucleotides on the strip. The accumulation of captured latex beads on the test and control lines produced blue bands, enabling visual detection with the naked eye. The PCR-dipstick DNA chromatography detected quantities as low as 100 pg of DNA amplicons and demonstrated 10- to 1000-fold higher sensitivity than PCR-agarose gel electrophoresis, depending on the target bacterial species. Semiquantification of bacteria was performed by obtaining a series of chromatograms using serial 10-fold dilution of PCR-amplified DNA extracted from dental plaque samples. The assay time was less than 3 h. The semiquantification procedure revealed the relative amounts of each test species in dental plaque samples, indicating that this disposable device has great potential in analysis of microbial composition in the oral cavity and intestinal tract, as well as in point-of-care diagnosis of microbiota-associated diseases.
Association of gliadin antibodies, HLA alleles, and schizophrenia in Cuban population patients
Directory of Open Access Journals (Sweden)
José A. Galván
2016-05-01
Full Text Available Introduction: Several lines of evidence have suggested an interesting link between gluten ingestion and schizophrenia. For example, increased levels of gliadin and transglutaminase antibodies have been observed in patients with schizophrenia. Methods: To verify these observations we compared the prevalence of gliadin and transglutaminse antibodies, as well as the presence of the HLA alleles, HLA DQA1*0501-DQB1*02 (DQ2 and HLA-DQA1*0301-DQB1*0302 (DQ8, among patients with schizophrenia and healthy controls. A total of 108 patients with schizophrenia and 60 healthy controls were evaluated. Gliadin antibodies were determined by a visual semiquantitative assay and tissue transglutaminase antibodies were determined both by one-step immunochromatografic assay and ELISA. HLA typing was performed by PCR amplification using sequence-specific primers for each allele. Results: We found a strong association between the presence of gliadin antibodies and schizophrenia (OR 3.488; 95% CI, 1.43-8.44. However, tissue transglutaminase antibodies were not detected in either group neither by immunochromatograpic or ELISA. No significant association was found for the DQ2 or DQ8 heterodimer and the disease, but a significant positive association between schizophrenia and HLA alleles DQA1*0301 and DQB1*02 was present (OR = 2.80; 95% CI, 1.27-6.17, and OR = 2.37, 95% CI, 1.24-4.53, respectively. Conclusions: The present study showed that the presence of gliadin antibodies was not correlated with the presence of HLA DQA1*0301 or DQB1*02 alleles within the group of patients with schizophrenia. Our study replicates the findings that anti-gliadin antibodies are associated with schizophrenia but also suggests that the presence of these antibodies and the HLA alleles DQB1*02 and DQA1*0301 are independently associated with susceptibility to schizophrenia.
Woksepp, Hanna; Jernberg, Cecilia; Tärnberg, Maria; Ryberg, Anna; Brolund, Alma; Nordvall, Michaela; Olsson-Liljequist, Barbro; Wisell, Karin Tegmark; Monstein, Hans-Jürg; Nilsson, Lennart E; Schön, Thomas
2011-12-01
Methods for the confirmation of nosocomial outbreaks of bacterial pathogens are complex, expensive, and time-consuming. Recently, a method based on ligation-mediated PCR (LM/PCR) using a low denaturation temperature which produces specific melting-profile patterns of DNA products has been described. Our objective was to further develop this method for real-time PCR and high-resolution melting analysis (HRM) in a single-tube system optimized in order to achieve results within 1 day. Following the optimization of LM/PCR for real-time PCR and HRM (LM/HRM), the method was applied for a nosocomial outbreak of extended-spectrum-beta-lactamase (ESBL)-producing and ST131-associated Escherichia coli isolates (n = 15) and control isolates (n = 29), including four previous clusters. The results from LM/HRM were compared to results from pulsed-field gel electrophoresis (PFGE), which served as the gold standard. All isolates from the nosocomial outbreak clustered by LM/HRM, which was confirmed by gel electrophoresis of the LM/PCR products and PFGE. Control isolates that clustered by LM/PCR (n = 4) but not by PFGE were resolved by confirmatory gel electrophoresis. We conclude that LM/HRM is a rapid method for the detection of nosocomial outbreaks of bacterial infections caused by ESBL-producing E. coli strains. It allows the analysis of isolates in a single-tube system within a day, and the discriminatory power is comparable to that of PFGE.
International Nuclear Information System (INIS)
Silvennoinen, R; Lundan, T; Kairisto, V; Pelliniemi, T-T; Putkonen, M; Anttila, P; Huotari, V; Mäntymaa, P; Siitonen, S; Uotila, L; Penttilä, T-L; Juvonen, V; Selander, T; Remes, K
2014-01-01
Multiparameter flow cytometry (MFC) and allele-specific oligonucleotide real-time quantitative PCR (ASO RQ-PCR) are the two most sensitive methods to detect minimal residual disease (MRD) in multiple myeloma (MM). We compared these methods in 129 paired post-therapy samples from 22 unselected, consecutive MM patients in complete/near complete remission. Appropriate immunophenotypic and ASO RQ-PCR-MRD targets could be detected and MRD analyses constructed for all patients. The high PCR coverage could be achieved by gradual widening of the primer sets used for clonality detection. In addition, for 13 (55%) of the patients, reverse orientation of the ASO primer and individual design of the TaqMan probe improved the sensitivity and specificity of ASO RQ-PCR analysis. A significant nonlinear correlation prevailed between MFC-MRD and PCR-MRD when both were positive. Discordance between the methods was found in 32 (35%) paired samples, which were negative by MFC-MRD, but positive by ASO RQ-PCR. The findings suggest that with the described technique, ASO RQ-PCR can be constructed for all patients with MM. ASO RQ-PCR is slightly more sensitive in MRD detection than 6−10-color flow cytometry. Owing to technical demands ASO RQ-PCR could be reserved for patients in immunophenotypic remission, especially in efficacy comparisons between different drugs and treatment modalities
May, C A; Jeffreys, A J; Armour, J A
1996-11-01
Many tandemly repeated minisatellite loci display extreme levels of length variation as a consequence of high rates of spontaneous germline mutation altering repeat copy number. Direct screening for new allele lengths by small-pool PCR has shown that instability at the human minisatellite locus MS205 (D16S309) is largely germline specific and usually results in the gain or loss of just a few repeat units. Structural analysis of the order of variant repeats has shown that these events occur preferentially at one end of the tandem array and can result in complex rearrangements including the inter-allelic transfer of repeat units. In contrast, putative mutants recovered from somatic DNA occur at a substantially lower rate and are simple and non-polar in nature. Germline mutation rates vary considerably between alleles, consistent with regulation occurring in cis. Although examination of DNA sequence polymorphisms immediately flanking the minisatellite reveals no definitive associations with germline mutation rate variation, differences in rate may be paralleled by changes in mutation spectrum. These findings help to explain the diversity of MS205 allele structures in modern humans and suggest a common mutation pathway with some other minisatellites.
Clinical evaluation of a Mucorales-specific real-time PCR assay in tissue and serum samples.
Springer, Jan; Lackner, Michaela; Ensinger, Christian; Risslegger, Brigitte; Morton, Charles Oliver; Nachbaur, David; Lass-Flörl, Cornelia; Einsele, Hermann; Heinz, Werner J; Loeffler, Juergen
2016-12-01
Molecular diagnostic assays can accelerate the diagnosis of fungal infections and subsequently improve patient outcomes. In particular, the detection of infections due to Mucorales is still challenging for laboratories and physicians. The aim of this study was to evaluate a probe-based Mucorales-specific real-time PCR assay (Muc18S) using tissue and serum samples from patients suffering from invasive mucormycosis (IMM). This assay can detect a broad range of clinically relevant Mucorales species and can be used to complement existing diagnostic tests or to screen high-risk patients. An advantage of the Muc18S assay is that it exclusively detects Mucorales species allowing the diagnosis of Mucorales DNA without sequencing within a few hours. In paraffin-embedded tissue samples this PCR-based method allowed rapid identification of Mucorales in comparison with standard methods and showed 91 % sensitivity in the IMM tissue samples. We also evaluated serum samples, an easily accessible material, from patients at risk from IMM. Mucorales DNA was detected in all patients with probable/proven IMM (100 %) and in 29 % of the possible cases. Detection of IMM in serum could enable an earlier diagnosis (up to 21 days) than current methods including tissue samples, which were gained mainly post-mortem. A screening strategy for high-risk patients, which would enable targeted treatment to improve patient outcomes, is therefore possible.
BurkDiff: a real-time PCR allelic discrimination assay for Burkholderia pseudomallei and B. mallei.
Directory of Open Access Journals (Sweden)
Jolene R Bowers
2010-11-01
Full Text Available A real-time PCR assay, BurkDiff, was designed to target a unique conserved region in the B. pseudomallei and B. mallei genomes containing a SNP that differentiates the two species. Sensitivity and specificity were assessed by screening BurkDiff across 469 isolates of B. pseudomallei, 49 isolates of B. mallei, and 390 isolates of clinically relevant non-target species. Concordance of results with traditional speciation methods and no cross-reactivity to non-target species show BurkDiff is a robust, highly validated assay for the detection and differentiation of B. pseudomallei and B. mallei.
Mano, Junichi; Masubuchi, Tomoko; Hatano, Shuko; Futo, Satoshi; Koiwa, Tomohiro; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Takabatake, Reona; Kitta, Kazumi
2013-01-01
In this article, we report a novel real-time PCR-based analytical method for quantitation of the GM maize event LY038. We designed LY038-specific and maize endogenous reference DNA-specific PCR amplifications. After confirming the specificity and linearity of the LY038-specific PCR amplification, we determined the conversion factor required to calculate the weight-based content of GM organism (GMO) in a multilaboratory evaluation. Finally, in order to validate the developed method, an interlaboratory collaborative trial according to the internationally harmonized guidelines was performed with blind DNA samples containing LY038 at the mixing levels of 0, 0.5, 1.0, 5.0 and 10.0%. The precision of the method was evaluated as the RSD of reproducibility (RSDR), and the values obtained were all less than 25%. The limit of quantitation of the method was judged to be 0.5% based on the definition of ISO 24276 guideline. The results from the collaborative trial suggested that the developed quantitative method would be suitable for practical testing of LY038 maize.
Group-specific multiplex PCR detection systems for the identification of flying insect prey.
Directory of Open Access Journals (Sweden)
Daniela Sint
Full Text Available The applicability of species-specific primers to study feeding interactions is restricted to those ecosystems where the targeted prey species occur. Therefore, group-specific primer pairs, targeting higher taxonomic levels, are often desired to investigate interactions in a range of habitats that do not share the same species but the same groups of prey. Such primers are also valuable to study the diet of generalist predators when next generation sequencing approaches cannot be applied beneficially. Moreover, due to the large range of prey consumed by generalists, it is impossible to investigate the breadth of their diet with species-specific primers, even if multiplexing them. However, only few group-specific primers are available to date and important groups of prey such as flying insects have rarely been targeted. Our aim was to fill this gap and develop group-specific primers suitable to detect and identify the DNA of common taxa of flying insects. The primers were combined in two multiplex PCR systems, which allow a time- and cost-effective screening of samples for DNA of the dipteran subsection Calyptratae (including Anthomyiidae, Calliphoridae, Muscidae, other common dipteran families (Phoridae, Syrphidae, Bibionidae, Chironomidae, Sciaridae, Tipulidae, three orders of flying insects (Hymenoptera, Lepidoptera, Plecoptera and coniferous aphids within the genus Cinara. The two PCR assays were highly specific and sensitive and their suitability to detect prey was confirmed by testing field-collected dietary samples from arthropods and vertebrates. The PCR assays presented here allow targeting prey at higher taxonomic levels such as family or order and therefore improve our ability to assess (trophic interactions with flying insects in terrestrial and aquatic habitats.
Directory of Open Access Journals (Sweden)
Qing Fan
Full Text Available Foot-and-mouth disease virus (FMDV, Bluetongue virus (BTV, Vesicular stomatitis Virus (VSV, Bovine viral diarrheal (BVDV, Bovine rotavirus (BRV, and Bovine herpesvirus 1 (IBRV are common cattle infectious viruses that cause a great economic loss every year in many parts of the world. A rapid and high-throughput GenomeLab Gene Expression Profiler (GeXP analyzer-based multiplex PCR assay was developed for the simultaneous detection and differentiation of these six cattle viruses. Six pairs of chimeric primers consisting of both the gene-specific primer and a universal primer were designed and used for amplification. Then capillary electrophoresis was used to separate the fluorescent labeled PCR products according to the amplicons size. The specificity of GeXP-multiplex PCR assay was examined with samples of the single template and mixed template of six viruses. The sensitivity was evaluated using the GeXP-multiplex PCR assay on serial 10-fold dilutions of ssRNAs obtained via in vitro transcription. To further evaluate the reliability, 305 clinical samples were tested by the GeXP-multiplex PCR assay. The results showed that the corresponding virus specific fragments of genes were amplified. The detection limit of the GeXP-multiplex PCR assay was 100 copies/μL in a mixed sample of ssRNAs containing target genes of six different cattle viruses, whereas the detection limit for the Gexp-mono PCR assay for a single target gene was 10 copies/μL. In detection of viruses in 305 clinical samples, the results of GeXP were consistent with simplex real-time PCR. Analysis of positive samples by sequencing demonstrated that the GeXP-multiplex PCR assay had no false positive samples of nonspecific amplification. In conclusion, this GeXP-multiplex PCR assay is a high throughput, specific, sensitive, rapid and simple method for the detection and differentiation of six cattle viruses. It is an effective tool that can be applied for the rapid differential diagnosis
Directory of Open Access Journals (Sweden)
Farhad Shahsavar
2017-03-01
Full Text Available Anthropological studies based on the highly polymorphic gene, human leukocyte antigen (HLA, provide useful information for bone marrow donor registry, forensic medicine, disease association studies, as well as infertility treatment, designing peptide vaccines against tumors, and infectious or autoimmune diseases. The aim of this study was to determine HLA-A and HLA-B allele frequencies in 100 unrelated Lak/lᴂk/individuals from Lorestan province of Iran. Finally, we compared the results with that previously described in Iranian population. Commercial HLA-Type kits from BAG (Lich, Germany company were used for determination of the HLA-A and HLA-B allele frequencies in genomic DNA, based on polymerase chain reaction with sequence specific primer (PCR-SSP assay. The differences between the populations in distribution of HLA-A and HLA-B alleles were estimated by chi-squared test with Yate's correction. The most frequent HLA-A alleles were *24 (20%, *02 (18%, *03 (12% and *11 (10%, and the most frequent HLA-B alleles were *35 (24%, *51 (16%, *18 (6% and *38 (6% in Lak population. HLA-A*66 (1%, *74(1% and HLA-B*48 (1%, *55(1% were the least observed frequencies in Lak population. Our results based on HLA-A and HLA-B allele frequencies showed that Lak population possesses the previously reported general features of Iranians but still with unique.
Fu, Wei; Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Du, Zhixin; Tian, Wenying; Wang, Qin; Wang, Huiyu; Xu, Wentao; Zhu, Shuifang
2015-08-04
Digital PCR has developed rapidly since it was first reported in the 1990 s. It was recently reported that an improved method facilitated the detection of genetically modified organisms (GMOs). However, to use this improved method, the samples must be pretreated, which could introduce inaccuracy into the results. In our study, we explored a pretreatment-free digital PCR detection method for the screening for GMOs. We chose the CaMV35s promoter and the NOS terminator as the templates in our assay. To determine the specificity of our method, 9 events of GMOs were collected, including MON810, MON863, TC1507, MIR604, MIR162, GA21, T25, NK603 and Bt176. Moreover, the sensitivity, intra-laboratory and inter-laboratory reproducibility of our detection method were assessed. The results showed that the limit of detection of our method was 0.1%, which was lower than the labeling threshold level of the EU. The specificity and stability among the 9 events were consistent, respectively. The intra-laboratory and inter-laboratory reproducibility were both good. Finally, the perfect fitness for the detection of eight double-blind samples indicated the good practicability of our method. In conclusion, the method in our study would allow more sensitive, specific and stable screening detection of the GMO content of international trading products.
DEFF Research Database (Denmark)
Hougs, L; Barington, T; Madsen, HO
1993-01-01
reaction (PCR) using in addition a degenerate kappa light chain signal peptide region primer. The PCR product was cloned into the M13mp18 phage. The cloning efficiency was 100-600 clones/ml of blood. Of the 86 clones sequenced, 90% represented rearranged kappa light chain genes from different antibody...... of the B lymphocytes activated in vivo. Here, we present a method for rapid analysis of the rearranged kappa light chain genes used by human circulating antigen-specific B lymphocytes. After vaccination with Haemophilus influenzae type b capsular polysaccharide (HibCP) conjugated with protein, the Hib...
Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats.
Lorch, Jeffrey M; Gargas, Andrea; Meteyer, Carol Uphoff; Berlowski-Zier, Brenda M; Green, D Earl; Shearn-Bochsler, Valerie; Thomas, Nancy J; Blehert, David S
2010-03-01
A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.
Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats
Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.
2010-01-01
A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.
Nasri, Tuba; Hedayati, Mohammad Taghi; Abastabar, Mahdi; Pasqualotto, Alessandro C; Armaki, Mojtaba Taghizadeh; Hoseinnejad, Akbar; Nabili, Mojtaba
2015-10-01
Aspergillus species are important agents of life-threatening infections in immunosuppressed patients. Proper speciation in the Aspergilli has been justified based on varied fungal virulence, clinical presentations, and antifungal resistance. Accurate identification of Aspergillus species usually relies on fungal DNA sequencing but this requires expensive equipment that is not available in most clinical laboratories. We developed and validated a discriminative low-cost PCR-based test to discriminate Aspergillus isolates at the species level. The Beta tubulin gene of various reference strains of Aspergillus species was amplified using the universal fungal primers Bt2a and Bt2b. The PCR products were subjected to digestion with a single restriction enzyme AlwI. All Aspergillus isolates were subjected to DNA sequencing for final species characterization. The PCR-RFLP test generated unique patterns for six clinically important Aspergillus species, including Aspergillus flavus, Aspergillus fumigatus, Aspergillus nidulans, Aspergillus terreus, Aspergillus clavatus and Aspergillus nidulans. The one-enzyme PCR-RFLP on Beta tubulin gene designed in this study is a low-cost tool for the reliable and rapid differentiation of the clinically important Aspergillus species. Copyright © 2015 Elsevier B.V. All rights reserved.
Patient specific ankle-foot orthoses using rapid prototyping.
Mavroidis, Constantinos; Ranky, Richard G; Sivak, Mark L; Patritti, Benjamin L; DiPisa, Joseph; Caddle, Alyssa; Gilhooly, Kara; Govoni, Lauren; Sivak, Seth; Lancia, Michael; Drillio, Robert; Bonato, Paolo
2011-01-12
Prefabricated orthotic devices are currently designed to fit a range of patients and therefore they do not provide individualized comfort and function. Custom-fit orthoses are superior to prefabricated orthotic devices from both of the above-mentioned standpoints. However, creating a custom-fit orthosis is a laborious and time-intensive manual process performed by skilled orthotists. Besides, adjustments made to both prefabricated and custom-fit orthoses are carried out in a qualitative manner. So both comfort and function can potentially suffer considerably. A computerized technique for fabricating patient-specific orthotic devices has the potential to provide excellent comfort and allow for changes in the standard design to meet the specific needs of each patient. In this paper, 3D laser scanning is combined with rapid prototyping to create patient-specific orthoses. A novel process was engineered to utilize patient-specific surface data of the patient anatomy as a digital input, manipulate the surface data to an optimal form using Computer Aided Design (CAD) software, and then download the digital output from the CAD software to a rapid prototyping machine for fabrication. Two AFOs were rapidly prototyped to demonstrate the proposed process. Gait analysis data of a subject wearing the AFOs indicated that the rapid prototyped AFOs performed comparably to the prefabricated polypropylene design. The rapidly prototyped orthoses fabricated in this study provided good fit of the subject's anatomy compared to a prefabricated AFO while delivering comparable function (i.e. mechanical effect on the biomechanics of gait). The rapid fabrication capability is of interest because it has potential for decreasing fabrication time and cost especially when a replacement of the orthosis is required.
Liu, Er-Ping; Wang, Yan; He, Xiao-Hui; Guan, Jun-Jie; Wang, Jin; Qin, Zheng-Hong; Sun, Wan-Ping
2015-11-01
Point-of-care genetic analysis may require polymerase chain reaction (PCR) to be carried out on whole blood. However, human blood contains natural inhibitors of PCR such as hemoglobin, immunoglobulin G, lactoferrin, and proteases, as well as anticoagulant agents, including EDTA and heparin that can reduce whole blood PCR efficiency. Our purpose was to develop a highly specific, direct whole blood single-nucleotide polymorphism (SNP) analysis method based on allele-specific (AS) PCR that is mediated by Pfu DNA polymerase and phosphorothioate-modified AS primers. At high Mg(2+) concentrations, Pfu DNA polymerase efficiently amplified genomic DNA in a reaction solution containing up to 14% whole blood. Among the three anticoagulants tested, Pfu DNA polymerase showed the highest activity with sodium citrate. Meanwhile, Triton X-100 and betaine inhibited Pfu DNA polymerase activity in whole blood PCR, whereas trehalose had virtually no effect. These findings provided for the development of a low-cost, simple, and fast direct whole blood genotyping method that uses Pfu DNA polymerase combined with phosphorothioate AS primers for CYP2C9*3 and VKORC1(-1639) loci. With its high DNA amplification efficiency and tolerance of various blood conditions, Pfu DNA polymerase can be used in clinical laboratories to analyze SNPs in whole blood samples.
Parent-of-origin dependent gene-specific knock down in mouse embryos
International Nuclear Information System (INIS)
Iqbal, Khursheed; Kues, Wilfried A.; Niemann, Heiner
2007-01-01
In mice hemizygous for the Oct4-GFP transgene, the F1 embryos show parent-of-origin dependent expression of the marker gene. F1 embryos with a maternally derived OG2 allele (OG2 mat /-) express GFP in the oocyte and during preimplantation development until the blastocyst stage indicating a maternal and embryonic expression pattern. F1-embryos with a paternally inherited OG2 allele (OG2 pat /-) express GFP from the 4- to 8-cell stage onwards showing only embryonic expression. This allows to study allele specific knock down of GFP expression. RNA interference (RNAi) was highly efficient in embryos with the paternally inherited GFP allele, whereas embryos with the maternally inherited GFP allele showed a delayed and less stringent suppression, indicating that the initial levels of the target transcript and the half life of the protein affect RNAi efficacy. RT-PCR analysis revealed only minimum of GFP mRNA. These results have implications for studies of gene silencing in mammalian embryos
LENUS (Irish Health Repository)
Guda, Kishore
2009-06-15
Recently, germline allele-specific expression (ASE) of the gene encoding for transforming growth factor-beta type I receptor (TGFBR1) has been proposed to be a major risk factor for cancer predisposition in the colon. Germline ASE results in a lowered expression of one of the TGFBR1 alleles (>1.5-fold), and was shown to occur in approximately 20% of informative familial and sporadic colorectal cancer (CRC) cases. In the present study, using the highly quantitative pyrosequencing technique, we estimated the frequency of ASE in TGFBR1 in a cohort of affected individuals from familial clusters of advanced colon neoplasias (cancers and adenomas with high-grade dysplasia), and also from a cohort of individuals with sporadic CRCs. Cases were considered positive for the presence of ASE if demonstrating an allelic expression ratio <0.67 or >1.5. Using RNA derived from lymphoblastoid cell lines, we find that of 46 informative Caucasian advanced colon neoplasia cases with a family history, only 2 individuals display a modest ASE, with allelic ratios of 1.65 and 1.73, respectively. Given that ASE of TGFBR1, if present, would likely be more pronounced in the colon compared with other tissues, we additionally determined the allele ratios of TGFBR1 in the RNA derived from normal-appearing colonic mucosa of sporadic CRC cases. We, however, found no evidence of ASE in any of 44 informative sporadic cases analyzed. Taken together, we find that germline ASE of TGFBR1, as assayed in lymphoblastoid and colon epithelial cells of colon cancer patients, is a relatively rare event.
Directory of Open Access Journals (Sweden)
Adeline Bidault
2015-12-01
Full Text Available The Gram-negative bacterium Vibrio tapetis is known as the causative agent of Brown Ring Disease (BRD in the Manila clam Venerupis (=Ruditapes philippinarum. This bivalve is the second most important species produced in aquaculture and has a high commercial value. In spite of the development of several molecular methods, no survey has been yet achieved to rapidly quantify the bacterium in the clam. In this study, we developed a Taqman real-time PCR assay targeting virB4 gene for accurate and quantitative identification of V. tapetis strains pathogenic to clams. Sensitivity and reproducibility of the method were assessed using either filtered sea water or extrapallial fluids of clam injected with the CECT4600T V. tapetis strain. Quantification curves of V. tapetis strain seeded in filtered seawater (FSW or extrapallial fluids (EF samples were equivalent showing reliable qPCR efficacies. With this protocol, we were able to specifically detect V. tapetis strains down to 1.125 101 bacteria per mL of EF or FSW, taking into account the dilution factor used for appropriate template DNA preparation. This qPCR assay allowed us to monitor V. tapetis load both experimentally or naturally infected Manila clams. This technique will be particularly useful for monitoring the kinetics of massive infections by V. tapetis and for designing appropriate control measures for aquaculture purposes.
Borsu, Laetitia; Intrieri, Julie; Thampi, Linta; Yu, Helena; Riely, Gregory; Nafa, Khedoudja; Chandramohan, Raghu; Ladanyi, Marc; Arcila, Maria E
2016-11-01
Although next-generation sequencing (NGS) is a robust technology for comprehensive assessment of EGFR-mutant lung adenocarcinomas with acquired resistance to tyrosine kinase inhibitors, it may not provide sufficiently rapid and sensitive detection of the EGFR T790M mutation, the most clinically relevant resistance biomarker. Here, we describe a digital PCR (dPCR) assay for rapid T790M detection on aliquots of NGS libraries prepared for comprehensive profiling, fully maximizing broad genomic analysis on limited samples. Tumor DNAs from patients with EGFR-mutant lung adenocarcinomas and acquired resistance to epidermal growth factor receptor inhibitors were prepared for Memorial Sloan-Kettering-Integrated Mutation Profiling of Actionable Cancer Targets sequencing, a hybrid capture-based assay interrogating 410 cancer-related genes. Precapture library aliquots were used for rapid EGFR T790M testing by dPCR, and results were compared with NGS and locked nucleic acid-PCR Sanger sequencing (reference high sensitivity method). Seventy resistance samples showed 99% concordance with the reference high sensitivity method in accuracy studies. Input as low as 2.5 ng provided a sensitivity of 1% and improved further with increasing DNA input. dPCR on libraries required less DNA and showed better performance than direct genomic DNA. dPCR on NGS libraries is a robust and rapid approach to EGFR T790M testing, allowing most economical utilization of limited material for comprehensive assessment. The same assay can also be performed directly on any limited DNA source and cell-free DNA. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Michelacci, Valeria; Orsini, Massimiliano; Knijn, Arnold; Delannoy, Sabine; Fach, Patrick; Caprioli, Alfredo; Morabito, Stefano
2016-01-01
Shiga-toxin producing Escherichia coli (STEC) strains possess a large accessory genome composed of virulence genes existing in multiple allelic variants, which sometimes segregate with specific STEC subpopulations. We analyzed the allelic variability of 91 virulence genes of STEC by Real Time PCR followed by melting curves analysis in 713 E. coli strains including 358 STEC. The 91 genes investigated were located on the locus of enterocyte effacement (LEE), OI-57, and OI-122 pathogenicity islands and displayed a total of 476 alleles in the study population. The combinations of the 91 alleles of each strain were termed allelic signatures and used to perform cluster analyses. We termed such an approach High Resolution Virulence Allelic Profiling (HReVAP) and used it to investigate the phylogeny of STEC of multiple serogroups. The dendrograms obtained identified groups of STEC segregating approximately with the serogroups and allowed the identification of subpopulations within the single groups. The study of the allelic signatures provided further evidence of the coevolution of the LEE and OI-122, reflecting the occurrence of their acquisition through a single event. The HReVAP analysis represents a sensitive tool for studying the evolution of LEE-positive STEC. PMID:26941726
Bermudez, Adriana; Alba, Martha P.; Vanegas, Magnolia; Patarroyo, Manuel A.; Patarroyo, Manuel E.
2018-04-01
The 3D structural analysis of 62 peptides derived from highly pathogenic Plasmodium falciparum malaria parasite proteins involved in host cell invasion led to finding a striking association between particular β-turn types located in the N-terminal peripheral flanking residue region (preceding the polyproline II left-handed structures fitting into the HLA-DRβ* allele family) and modified immune protection-inducing protein structure induced long-lasting protective immunity. This is the first time association between two different secondary structures associated with a specific immunological function has been described: full, long-lasting protective immunity.
Djurisic, S; Teiblum, S; Tolstrup, C K; Christiansen, O B; Hviid, T V F
2015-03-01
The HLA-G molecule is expressed on trophoblast cells at the feto-maternal interface, where it interacts with local immune cells, and upholds tolerance against the semi-allogeneic fetus. Aberrant HLA-G expression in the placenta and reduced soluble HLA-G levels are observed in pregnancy complications, partly explained by HLA-G polymorphisms which are associated with differences in the alternative splicing pattern and of the stability of HLA-G mRNA. Of special importance is a 14 bp insertion/deletion polymorphism located in the 3'-untranslated region of the HLA-G gene. In the current study, we present novel evidence for allelic imbalance of the 14 bp insertion/deletion polymorphism, using a very accurate and sensitive Digital droplet PCR technique. Allelic imbalance in heterozygous samples was observed as differential expression levels of 14 bp insertion/deletion allele-specific mRNA transcripts, which was further associated with low levels of HLA-G surface expression on primary trophoblast cells. Full gene sequencing of HLA-G allowed us to study correlations between HLA-G extended haplotypes and single-nucleotide polymorphisms and HLA-G surface expression. We found that a 1:1 expression (allelic balance) of the 14 bp insertion/deletion mRNA alleles was associated with high surface expression of HLA-G and with a specific HLA-G extended haplotype. The 14 bp del/del genotype was associated with a significantly lower abundance of the G1 mRNA isoform, and a higher abundance of the G3 mRNA isoform. Overall, the present study provides original evidence for allelic imbalance of the 14 bp insertion/deletion polymorphism, which influences HLA-G surface expression on primary trophoblast cells, considered to be important in the pathogenesis of pre-eclampsia and other pregnancy complications. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Andrea Hauser
Full Text Available Pregnant HIV-infected women were screened for the development of HIV-1 drug resistance after implementation of a triple-antiretroviral transmission prophylaxis as recommended by the WHO in 2006. The study offered the opportunity to compare amplicon-based 454 ultra-deep sequencing (UDS and allele-specific real-time PCR (ASPCR for the detection of drug-resistant minor variants in the HIV-1 reverse transcriptase (RT.Plasma samples from 34 Tanzanian women were previously analysed by ASPCR for key resistance mutations in the viral RT selected by AZT, 3TC, and NVP (K70R, K103N, Y181C, M184V, T215Y/F. In this study, the RT region of the same samples was investigated by amplicon-based UDS for resistance mutations using the 454 GS FLX System.Drug-resistant HIV-variants were identified in 69% (20/29 of women by UDS and in 45% (13/29 by ASPCR. The absolute number of resistance mutations identified by UDS was twice that identified by ASPCR (45 vs 24. By UDS 14 of 24 ASPCR-detected resistance mutations were identified at the same position. The overall concordance between UDS and ASPCR was 61.0% (25/41. The proportions of variants quantified by UDS were approximately 2-3 times lower than by ASPCR. Amplicon generation from samples with viral loads below 20,000 copies/ml failed more frequently by UDS compared to ASPCR (limit of detection = 650 copies/ml, resulting in missing or insufficient sequence coverage.Both methods can provide useful information about drug-resistant minor HIV-1 variants. ASPCR has a higher sensitivity than UDS, but is restricted to single resistance mutations. In contrast, UDS is limited by its requirement for high viral loads to achieve sufficient sequence coverage, but the sequence information reveals the complete resistance patterns within the genomic region analysed. Improvements to the UDS limit of detection are in progress, and UDS could then facilitate monitoring of drug-resistant minor variants in the HIV-1 quasispecies.
Alpha toxin specific PCR for detection of toxigenic strains of Clostridium perfringens in Poultry
Directory of Open Access Journals (Sweden)
Malmarugan Shanmugasamy
2012-12-01
Full Text Available Aim : Isolation of clostridium perfirngens from necrotic enteritis cases in poultry and confirmation by alpha toxin specific PCR Materials and methods: Robertson cooked meat medium with Brain Heart Infusion broth was used for isolation of C. perfringens from intestinal contents of necrotic enteritis suspected birds. Positive cultures from perfringens agar were further confirmed by biochemical tests and subjected to alpha toxin specific PCR. Results: Twenty Clostridium perfringens isolates were isolated from intestinal contents of thirty five NE suspected birds. Out of the twenty isolates, fourteen were isolated from commercial broilers of 2 to 6 wk of age and six from commercial layers of 9 to 15 wk of age. Frequency of isolation of C. perfringens was more with Robertson cooked meat medium with BHI broth than thioglycollate broth alone. When positive cultures were streaked on to clostridial agar appreciable luxuriant growths were obtained and the selective streaking of these colonies on perfringens agar with supplements revealed rough and black colonies with sulphate reduction. The isolates produced rough and black colonies with sulphate reduction on perfringens agar, double zone haemolysis on sheep blood agar, stormy clot fermentation on milk medium and opalescence on egg yolk medium. The isolates were found negative for oxidase, catalase, liquefied gelatin, fermented glucose, maltose, lactose and sucrose except mannitol. All the fourteen isolates obtained from commercial broilers proved the alpha toxin producing strains of C. perfringens when they were subjected to alpha toxin specific PCR. Conclusion : This study revealed alpha toxin specific PCR is highly useful for detection of toxigenic strains of Clostridium perfringens in poultry [Vet. World 2012; 5(6.000: 365-368
Rapid identification of dairy lactic acid bacteria by M13-generated, RAPD-PCR fingerprint databases.
Rossetti, Lia; Giraffa, Giorgio
2005-11-01
About a thousand lactic acid bacteria (LAB) isolated from dairy products, especially cheeses, were identified and typed by species-specific PCR and RAPD-PCR, respectively. RAPD-PCR profiles, which were obtained by using the M13 sequence as a primer, allowed us to implement a large database of different fingerprints, which were analysed by BioNumerics software. Cluster analysis of the combined RAPD-PCR fingerprinting profiles enabled us to implement a library, which is a collection of library units, which in turn is a selection of representative database entries. A library unit, in this case, can be considered to be a definable taxon. The strains belonged to 11 main RAPD-PCR fingerprinting library units identified as Lactobacillus casei/paracasei, Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacillus helveticus, Lactobacillus delbrueckii, Lactobacillus fermentum, Lactobacillus brevis, Enterococcus faecium, Enterococcus faecalis, Streptococcus thermophilus and Lactococcus lactis. The possibility to routinely identify newly typed, bacterial isolates by consulting the library of the software was valued. The proposed method could be suggested to refine previous strain identifications, eliminate redundancy and dispose of a technologically useful LAB strain collection. The same approach could also be applied to identify LAB strains isolated from other food ecosystems.
Energy Technology Data Exchange (ETDEWEB)
Decorte, R.; Wu, R.; Marynen, P.; Cassiman, J.J.
1994-03-01
The PCR technique was used to analyze the DXYS17 locus in the pseudoautosomal region of the X and the Y chromosomes. Analysis on an automated DNA sequencer allowed for sensitive and highly accurate typing of 16 different alleles with a size between 480 and 1,100 bp. Two DXYS17 alleles migrated with the same size on agarose or denaturing polyacrylamide gels but with different mobilities on nondenaturing polyacrylamide gels. Sequence analysis showed that, while an identical number of repeats were present in both alleles, differences in the composition of the units were observed. The origin of these differences was found in the 28- and 33-bp units, which only had a specific repeat pattern at the 5' and 3' ends of the region. The genotype distribution for DXYS17 in a Caucasian population did not deviate from the values expected under Hardy-Weinberg equilibrium. However, the frequency of one allele and one genotype was significantly different between males and females. Segregation analysis showed that this difference was the result of a nonrandom distribution of certain alleles on the sex chromosomes in males. 31 refs., 4 figs., 2 tabs.
Woksepp, Hanna; Jernberg, Cecilia; Tärnberg, Maria; Ryberg, Anna; Brolund, Alma; Nordvall, Michaela; Olsson-Liljequist, Barbro; Wisell, Karin Tegmark; Monstein, Hans-Jürg; Nilsson, Lennart E.; Schön, Thomas
2011-01-01
Methods for the confirmation of nosocomial outbreaks of bacterial pathogens are complex, expensive, and time-consuming. Recently, a method based on ligation-mediated PCR (LM/PCR) using a low denaturation temperature which produces specific melting-profile patterns of DNA products has been described. Our objective was to further develop this method for real-time PCR and high-resolution melting analysis (HRM) in a single-tube system optimized in order to achieve results within 1 day. Following the optimization of LM/PCR for real-time PCR and HRM (LM/HRM), the method was applied for a nosocomial outbreak of extended-spectrum-beta-lactamase (ESBL)-producing and ST131-associated Escherichia coli isolates (n = 15) and control isolates (n = 29), including four previous clusters. The results from LM/HRM were compared to results from pulsed-field gel electrophoresis (PFGE), which served as the gold standard. All isolates from the nosocomial outbreak clustered by LM/HRM, which was confirmed by gel electrophoresis of the LM/PCR products and PFGE. Control isolates that clustered by LM/PCR (n = 4) but not by PFGE were resolved by confirmatory gel electrophoresis. We conclude that LM/HRM is a rapid method for the detection of nosocomial outbreaks of bacterial infections caused by ESBL-producing E. coli strains. It allows the analysis of isolates in a single-tube system within a day, and the discriminatory power is comparable to that of PFGE. PMID:21956981
Poncelet-Jasserand, E; Forges, F; Varlet, M-N; Chauleur, C; Seffert, P; Siani, C; Pozzetto, B; Ros, A
2013-08-01
To assess whether the determination of the presence of group B streptococci (GBS) in the vagina using a rapid polymerase chain reaction (PCR) assay at delivery was able to spare useless antimicrobial treatments, as compared with conventional culture at 34-38 weeks of gestation. Practical evaluation and prospective cost-effectiveness analysis. A university hospital in France. A cohort of 225 women in labour at the University-Hospital of Saint-Etienne. Each woman had a conventional culture performed at 34-38 weeks of gestation. At the beginning of labour, two vaginal swabs were sampled for rapid PCR testing and culture. The decision to prescribe a prophylactic antimicrobial treatment or not was taken according to the result of the PCR test. A comparative cost-effectiveness analysis of the two diagnostic strategies was carried out. Number of women receiving inadequate prophylactic antimicrobial drugs following each testing strategy, costs of PCR testing and culture, frequency of vaginal GBS, and diagnostic performance of the PCR test at delivery. The percentage of unnecessarily treated women was significantly reduced using the rapid test versus conventional culture (4.5 and 13.6%, respectively; P < 0.001). The rate of vaginal GBS at delivery was 12.5%. The incremental cost-effectiveness ratio (ICER) for each inadequate management avoided was €36 and €173 from the point of view of the healthcare system and hospital, respectively. The PCR assay reduced the number of inadequate antimicrobial treatments aimed to prevent the early onset of GBS disease. However, this strategy generates extra costs that must be put into balance with its clinical benefits. © 2013 The Authors BJOG An International Journal of Obstetrics and Gynaecology © 2013 RCOG.
Trama, Jason P; Adelson, Martin E; Mordechai, Eli
2007-12-01
Laboratory diagnosis of molluscum contagiosum virus (MCV) is important as lesions can be confused with those caused by Cryptococcus neoformans, herpes simplex virus, human papillomavirus, and varicella-zoster virus. To develop a rapid method for identifying patients infected with MCV via swab sampling. Two dual-labeled probe real-time PCR assays, one homologous to the p43K gene and one to the MC080R gene, were designed. The p43K PCR was designed to be used in conjunction with Pyrosequencing for confirmation of PCR products and discrimination between MCV1 and MCV2. Both PCR assays were optimized with respect to reaction components, thermocycling parameters, and primer and probe concentrations. The specificities of both PCR assays were confirmed by non-amplification of 38 known human pathogens. Sensitivity assays demonstrated detection of as few as 10 copies per reaction. Testing 703 swabs, concordance between the two real-time PCR assays was 99.9%. Under the developed conditions, Pyrosequencing of the p43K PCR product was capable of providing enough nucleotide sequence to definitively differentiate MCV1 and MCV2. These real-time PCR assays can be used for the rapid, sensitive, and specific detection of MCV and, when combined with Pyrosequencing, can further discriminate between MCV1 and MCV2.
HLA-DQA1 typing in Danes by two polymerase chain reaction (PCR) based methods
DEFF Research Database (Denmark)
Cowland, J B; Madsen, H O; Morling, N
1995-01-01
(ASA) method, which together recognise eight alleles. In 146 unrelated Danish individuals, the HLA-DQA1 alleles were in Hardy-Weinberg equilibrium. For identity testing, the power of discrimination (PD) of HLA-DQA1 was 0.932 with the RDB method and 0.942 with the PCR-RFLP/ASA method. For paternity...
Yamakawa, Roger Haruki; Saito, Patrícia Keiko; Gelmini, Geórgia Fernanda; da Silva, José Samuel; Bicalho, Maria da Graça; Borelli, Sueli Donizete
2017-01-01
The major histocompatibility complex (MHC) class I chain-related gene A (MICA) is located centromerically to the human leukocyte antigen (HLA)-B. The short distance between these loci in the MHC indicates the presence of linkage disequilibrium (LD). Similarly to the HLA, the MICA is highly polymorphic, and this polymorphism has not been well documented in different populations. In this study, we estimated the allelic frequencies of MICA and the linkage disequilibrium with HLA-B alleles in 346 renal-transplant candidates in southern Brazil. MICA and HLA were typed using the polymerase chain reaction-sequence-specific primer method (PCR-SSO), combined with the Luminex technology. A total of 19 MICA allele groups were identified. The most frequent allele groups were MICA*008 (21.6%), MICA*002 (17.0%) and MICA*004 (14.8%). The most common haplotypes were MICA*009-B*51 (7.8%), MICA*004-B*44 (6.06%) and MICA*002-B*35 (5.63%). As expected from the proximity of the MICA and HLA-B loci, most haplotypes showed strong LD. Renal patients and healthy subjects in the same region of Brazil showed statistically significant differences in their MICA polymorphisms. The MICA*027 allele group was more frequent in renal patients (Pc = 0.018, OR: 3.421, 95% CI: 1.516-7.722), while the MICA*019 allele group was more frequent in healthy subjects (Pc = 0.001, OR: 0.027, 95% CI: 0.002-0.469). This study provided information on the distribution of MICA polymorphisms and linkage disequilibrium with HLA-B alleles in Brazilian renal-transplant candidates. This information should help to determine the mechanisms of susceptibility to different diseases in patients with chronic kidney disease, and to elucidate the mechanisms involved in allograft rejection associated with MICA polymorphisms in a Brazilian population.
Ginther, C; Corach, D; Penacino, G A; Rey, J A; Carnese, F R; Hutz, M H; Anderson, A; Just, J; Salzano, F M; King, M C
1993-01-01
DNA samples from 60 Mapuche Indians, representing 39 maternal lineages, were genetically characterized for (1) nucleotide sequences of the mtDNA control region; (2) presence or absence of a nine base duplication in mtDNA region V; (3) HLA loci DRB1 and DQA1; (4) variation at three nuclear genes with short tandem repeats; and (5) variation at the polymorphic marker D2S44. The genetic profile of the Mapuche population was compared to other Amerinds and to worldwide populations. Two highly polymorphic portions of the mtDNA control region, comprising 650 nucleotides, were amplified by the polymerase chain reaction (PCR) and directly sequenced. The 39 maternal lineages were defined by two or three generation families identified by the Mapuches. These 39 lineages included 19 different mtDNA sequences that could be grouped into four classes. The same classes of sequences appear in other Amerinds from North, Central, and South American populations separated by thousands of miles, suggesting that the origin of the mtDNA patterns predates the migration to the Americas. The mtDNA sequence similarity between Amerind populations suggests that the migration throughout the Americas occurred rapidly relative to the mtDNA mutation rate. HLA DRB1 alleles 1602 and 1402 were frequent among the Mapuches. These alleles also occur at high frequency among other Amerinds in North and South America, but not among Spanish, Chinese or African-American populations. The high frequency of these alleles throughout the Americas, and their specificity to the Americas, supports the hypothesis that Mapuches and other Amerind groups are closely related.(ABSTRACT TRUNCATED AT 250 WORDS)
Patient specific ankle-foot orthoses using rapid prototyping
Directory of Open Access Journals (Sweden)
Sivak Seth
2011-01-01
Full Text Available Abstract Background Prefabricated orthotic devices are currently designed to fit a range of patients and therefore they do not provide individualized comfort and function. Custom-fit orthoses are superior to prefabricated orthotic devices from both of the above-mentioned standpoints. However, creating a custom-fit orthosis is a laborious and time-intensive manual process performed by skilled orthotists. Besides, adjustments made to both prefabricated and custom-fit orthoses are carried out in a qualitative manner. So both comfort and function can potentially suffer considerably. A computerized technique for fabricating patient-specific orthotic devices has the potential to provide excellent comfort and allow for changes in the standard design to meet the specific needs of each patient. Methods In this paper, 3D laser scanning is combined with rapid prototyping to create patient-specific orthoses. A novel process was engineered to utilize patient-specific surface data of the patient anatomy as a digital input, manipulate the surface data to an optimal form using Computer Aided Design (CAD software, and then download the digital output from the CAD software to a rapid prototyping machine for fabrication. Results Two AFOs were rapidly prototyped to demonstrate the proposed process. Gait analysis data of a subject wearing the AFOs indicated that the rapid prototyped AFOs performed comparably to the prefabricated polypropylene design. Conclusions The rapidly prototyped orthoses fabricated in this study provided good fit of the subject's anatomy compared to a prefabricated AFO while delivering comparable function (i.e. mechanical effect on the biomechanics of gait. The rapid fabrication capability is of interest because it has potential for decreasing fabrication time and cost especially when a replacement of the orthosis is required.
Luo, Yakun; Liang, Lin; Zhou, Ling; Zhao, Kai; Cui, Shangjin
2015-07-01
Nanoparticle-assisted polymerase chain reaction (nanoPCR) is a novel method for the simple, rapid, and specific amplification of DNA and has been used to detect viruses. A duplex nanoPCR molecular detection system was developed to detect pseudorabies virus (PRV) and porcine bocavirus (PBoV). Primers were selected to target conserved regions within the PRV gE gene and the PBoV NS1 gene. Under optimized nanoPCR reaction conditions, two specific fragments of 316 bp (PRV) and 996 bp (PBoV) were amplified by the duplex nanoPCR with a detection limit of 6 copies for PRV and 95 copies for PBoV; no fragments were amplified when other porcine viruses were used as template. When used to test 550 clinical samples, the duplex nanoPRC assay and a conventional duplex PCR assay provided very similar results (98.1% consistency); single PRV infections, single PBoV infections, and concurrent PRV and PBoV infections were detected in 37%, 15%, and 9% of the samples, respectively. The results indicate that the novel duplex nanoPCR assay is useful for the rapid detection of PRV and PBoV in pigs. Copyright © 2015 Elsevier B.V. All rights reserved.
Xu, Chang; Nezami Ranjbar, Mohammad R; Wu, Zhong; DiCarlo, John; Wang, Yexun
2017-01-03
Detection of DNA mutations at very low allele fractions with high accuracy will significantly improve the effectiveness of precision medicine for cancer patients. To achieve this goal through next generation sequencing, researchers need a detection method that 1) captures rare mutation-containing DNA fragments efficiently in the mix of abundant wild-type DNA; 2) sequences the DNA library extensively to deep coverage; and 3) distinguishes low level true variants from amplification and sequencing errors with high accuracy. Targeted enrichment using PCR primers provides researchers with a convenient way to achieve deep sequencing for a small, yet most relevant region using benchtop sequencers. Molecular barcoding (or indexing) provides a unique solution for reducing sequencing artifacts analytically. Although different molecular barcoding schemes have been reported in recent literature, most variant calling has been done on limited targets, using simple custom scripts. The analytical performance of barcode-aware variant calling can be significantly improved by incorporating advanced statistical models. We present here a highly efficient, simple and scalable enrichment protocol that integrates molecular barcodes in multiplex PCR amplification. In addition, we developed smCounter, an open source, generic, barcode-aware variant caller based on a Bayesian probabilistic model. smCounter was optimized and benchmarked on two independent read sets with SNVs and indels at 5 and 1% allele fractions. Variants were called with very good sensitivity and specificity within coding regions. We demonstrated that we can accurately detect somatic mutations with allele fractions as low as 1% in coding regions using our enrichment protocol and variant caller.
Rapid quantitative detection of Lactobacillus sakei in meat and fermented sausages by real-time PCR.
Martín, Belén; Jofré, Anna; Garriga, Margarita; Pla, Maria; Aymerich, Teresa
2006-09-01
A quick and simple method for quantitative detection of Lactobacillus sakei in fermented sausages was successfully developed. It is based on Chelex-100-based DNA purification and real-time PCR enumeration using a TaqMan fluorescence probe. Primers and probes were designed in the L. sakei 16S-23S rRNA intergenic transcribed spacer region, and the assay was evaluated using L. sakei genomic DNA and an artificially inoculated sausage model. The detection limit of this technique was approximately 3 cells per reaction mixture using both purified DNA and the inoculated sausage model. The quantification limit was established at 30 cells per reaction mixture in both models. The assay was then applied to enumerate L. sakei in real samples, and the results were compared to the MRS agar count method followed by confirmation of the percentage of L. sakei colonies. The results obtained by real-time PCR were not statistically significantly different than those obtained by plate count on MRS agar (P > 0.05), showing a satisfactory agreement between both methods. Therefore, the real-time PCR assay developed can be considered a promising rapid alternative method for the quantification of L. sakei and evaluation of the implantation of starter strains of L. sakei in fermented sausages.
Al-Serri, Ahmad; Ismael, Fatma G; Al-Bustan, Suzanne A; Al-Rashdan, Ibrahim
2015-12-01
The D allele of the common angiotensin-converting enzyme (ACE) I/D gene polymorphism (rs4646994) predisposes to type 2 diabetes mellitus (T2DM) and cardiovascular disease (CVD). However, results on which allele predisposes to disease susceptibility remain controversial in Asian populations. This study was performed to evaluate the association of the common ACE I/D gene polymorphism with both T2DM and CVD susceptibility in an Arab population. We genotyped the ACE I/D polymorphisms by direct allele-specific PCR in 183 healthy controls and 400 CVD patients with diabetes (n=204) and without (n=196). Statistical analysis comparing between the different groups were conducted using R statistic package "SNPassoc". Two genetic models were used: the additive and co-dominant models. The I allele was found to be associated with T2DM (OR=1.84, p=0.00009) after adjusting for age, sex and body mass index. However, there was no association with CVD susceptibility (p>0.05). The ACE I allele is found to be associated with T2DM; however, no association was observed with CVD. The inconsistency between studies is suggested to be attributed to genetic diversity due to the existence of sub-populations found in Asian populations. © The Author(s) 2015.
Directory of Open Access Journals (Sweden)
Lisha, V.
2017-01-01
Full Text Available modified crops which brought up a controversy on the safety usage of genetically modified organisms (GMOs. It has been implemented globally that all GMO products and its derived ingredients should have regulations on the usage and labelling. Thus, it is necessary to develop methods that allow rapid screening of GMO products to comply with the regulations. This study employed a reliable and flexible multiplex polymerase chain reaction (PCR method for the rapid detection of transgenic elements in genetically modified soy and maize along with the soybean LECTIN gene and maize ZEIN gene respectively. The selected four common transgenic elements were 35S promoter (35S; Agrobacterium tumefaciens nopaline synthase terminator (NOS; 5-enolypyruvylshikimate-3-phosphate synthase (epsps gene; and Cry1Ab delta-endotoxin (cry1Ab gene. Optimization of the multiplex PCR methods were carried out by using 1% Roundup ReadyTM Soybean (RRS as the certified reference material for soybean that produced fourplex PCR method detecting 35S promoter, NOS terminator, epsps gene and soybean LECTIN gene and by using 1% MON810 as the certified reference material for maize that produced triplex PCR method detecting 35S promoter, cry1Ab gene and maize ZEIN gene prior to screening of the GMO traits in various food products and animal feeds. 1/9 (11.1% of the animal feed contained maize and 1/15 (6.7% of the soybean food products showed positive results for the detection of GMO transgenic gene. None of the maize food products showed positive results for GMO transgenic gene. In total, approximately 4% of the food products and animal feed were positive as GMO. This indicated GMOs have not widely entered the food chain. However, it is necessary to have an appropriate screening method due to GMOs’ unknown potential risk to humans and to animals. This rapid screening method will provide leverage in terms of being economically wise, time saving and reliable.
Recent rapid rise of a permethrin knock down resistance allele in Aedes aegypti in México.
García, Gustavo Ponce; Flores, Adriana E; Fernández-Salas, Ildefonso; Saavedra-Rodríguez, Karla; Reyes-Solis, Guadalupe; Lozano-Fuentes, Saul; Guillermo Bond, J; Casas-Martínez, Mauricio; Ramsey, Janine M; García-Rejón, Julián; Domínguez-Galera, Marco; Ranson, Hilary; Hemingway, Janet; Eisen, Lars; Black IV, William C
2009-10-13
Aedes aegypti, the 'yellow fever mosquito', is the primary vector to humans of dengue and yellow fever flaviviruses (DENV, YFV), and is a known vector of the chikungunya alphavirus (CV). Because vaccines are not yet available for DENV or CV or are inadequately distributed in developing countries (YFV), management of Ae. aegypti remains the primary option to prevent and control outbreaks of the diseases caused by these arboviruses. Permethrin is one of the most widely used active ingredients in insecticides for suppression of adult Ae. aegypti. In 2007, we documented a replacement mutation in codon 1,016 of the voltage-gated sodium channel gene (para) of Ae. aegypti that encodes an isoleucine rather than a valine and confers resistance to permethrin. Ile1,016 segregates as a recessive allele conferring knockdown resistance to homozygous mosquitoes at 5-10 microg of permethrin in bottle bioassays. A total of 81 field collections containing 3,951 Ae. aegypti were made throughout México from 1996 to 2009. These mosquitoes were analyzed for the frequency of the Ile1,016 mutation using a melting-curve PCR assay. Dramatic increases in frequencies of Ile1,016 were recorded from the late 1990's to 2006-2009 in several states including Nuevo León in the north, Veracruz on the central Atlantic coast, and Yucatán, Quintana Roo and Chiapas in the south. From 1996 to 2000, the overall frequency of Ile1,016 was 0.04% (95% confidence interval (CI95) = 0.12%; n = 1,359 mosquitoes examined). The earliest detection of Ile1,016 was in Nuevo Laredo on the U.S. border in 1997. By 2003-2004 the overall frequency of Ile1,016 had increased approximately 100-fold to 2.7% (+ or - 0.80% CI95; n = 808). When checked again in 2006, the frequency had increased slightly to 3.9% (+ or - 1.15% CI95; n = 473). This was followed in 2007-2009 by a sudden jump in Ile1,016 frequency to 33.2% (+ or - 1.99% CI95; n = 1,074 mosquitoes). There was spatial heterogeneity in Ile1,016 frequencies among 2007
Recent rapid rise of a permethrin knock down resistance allele in Aedes aegypti in México.
Directory of Open Access Journals (Sweden)
Gustavo Ponce García
Full Text Available BACKGROUND: Aedes aegypti, the 'yellow fever mosquito', is the primary vector to humans of dengue and yellow fever flaviviruses (DENV, YFV, and is a known vector of the chikungunya alphavirus (CV. Because vaccines are not yet available for DENV or CV or are inadequately distributed in developing countries (YFV, management of Ae. aegypti remains the primary option to prevent and control outbreaks of the diseases caused by these arboviruses. Permethrin is one of the most widely used active ingredients in insecticides for suppression of adult Ae. aegypti. In 2007, we documented a replacement mutation in codon 1,016 of the voltage-gated sodium channel gene (para of Ae. aegypti that encodes an isoleucine rather than a valine and confers resistance to permethrin. Ile1,016 segregates as a recessive allele conferring knockdown resistance to homozygous mosquitoes at 5-10 microg of permethrin in bottle bioassays. METHODS AND FINDINGS: A total of 81 field collections containing 3,951 Ae. aegypti were made throughout México from 1996 to 2009. These mosquitoes were analyzed for the frequency of the Ile1,016 mutation using a melting-curve PCR assay. Dramatic increases in frequencies of Ile1,016 were recorded from the late 1990's to 2006-2009 in several states including Nuevo León in the north, Veracruz on the central Atlantic coast, and Yucatán, Quintana Roo and Chiapas in the south. From 1996 to 2000, the overall frequency of Ile1,016 was 0.04% (95% confidence interval (CI95 = 0.12%; n = 1,359 mosquitoes examined. The earliest detection of Ile1,016 was in Nuevo Laredo on the U.S. border in 1997. By 2003-2004 the overall frequency of Ile1,016 had increased approximately 100-fold to 2.7% (+ or - 0.80% CI95; n = 808. When checked again in 2006, the frequency had increased slightly to 3.9% (+ or - 1.15% CI95; n = 473. This was followed in 2007-2009 by a sudden jump in Ile1,016 frequency to 33.2% (+ or - 1.99% CI95; n = 1,074 mosquitoes. There was spatial
Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin
2014-06-01
Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (RT-qPCR) and the two isothermal amplification techniques loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) represent three promising candidates for integration into mobile pen-side tests. The aim of this study was to investigate the performance of these amplification strategies and to evaluate their suitability for field application. In order to enable a valid comparison, novel pathogen-specific assays have been developed for the detection of Schmallenberg virus and bovine viral diarrhea virus. The newly developed assays were evaluated in comparison with established standard RT-qPCR using samples from experimentally or field-infected animals. Even though all assays allowed detection of the target virus in less than 30 min, major differences were revealed concerning sensitivity, specificity, robustness, testing time, and complexity of assay design. These findings indicated that the success of an assay will depend on the integrated amplification technology. Therefore, the application-specific pros and cons of each method that were identified during this study provide very valuable insights for future development and optimization of pen-side tests. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Pierce, Kenneth E; Wangh, Lawrence J
2007-01-01
Accurate detection of gene sequences in single cells is the ultimate challenge to polymerase chain reaction (PCR) sensitivity. Unfortunately, commonly used conventional and real-time PCR techniques are often too unreliable at that level to provide the accuracy needed for clinical diagnosis. Here we provide details of linear-after-the-exponential-PCR (LATE-PCR), a method similar to asymmetric PCR in the use of primers at different concentrations, but with novel design criteria to ensure high efficiency and specificity. Compared with conventional PCR, LATE-PCR increases the signal strength and allele discrimination capability of oligonucleotide probes such as molecular beacons and reduces variability among replicate samples. The analysis of real-time kinetics of LATE-PCR signals provides a means for improving the accuracy of single cell genetic diagnosis.
Lee, S; Kim, C S; Shin, Y G; Kim, J H; Kim, Y S; Jheong, W H
2016-03-01
The Peach rosette mosaic virus (PRMV) is a plant pathogen of the genus Nepovirus, and has been designated as a controlled quarantine virus in Korea. In this study, a specific reverse transcription (RT)-PCR marker set, nested PCR marker set, and modified-plasmid positive control were developed to promptly and accurately diagnose PRMV at plant-quarantine sites. The final selected PRMV-specific RT-PCR marker was PRMV-N10/C70 (967 bp), and the nested PCR product of 419 bp was finally amplified. The modified-plasmid positive control, in which the SalI restriction-enzyme region (GTCGAC) was inserted, verified PRMV contamination in a comparison with the control, enabling a more accurate diagnosis. It is expected that the developed method will continuously contribute to the plant-quarantine process in Korea.
Witsenboer, H; Michelmore, R W; Vogel, J
1997-12-01
Selectively amplified microsatellite polymorphic locus (SAMPL) analysis is a method of amplifying microsatellite loci using generic PCR primers. SAMPL analysis uses one AFLP primer in combination with a primer complementary to microsatellite sequences. SAMPL primers based on compound microsatellite sequences provided the clearest amplification patterns. We explored the potential of SAMPL analysis in lettuce to detect PCR-based codominant microsatellite markers. Fifty-eight SAMPLs were identified and placed on the genetic map. Seventeen were codominant. SAMPLs were dispersed with RFLP markers on 11 of the 12 main linkage groups in lettuce, indicating that they have a similar genomic distribution. Some but not all fragments amplified by SAMPL analysis were confirmed to contain microsatellite sequences by Southern hybridization. Forty-five cultivars of lettuce and five wild species of Lactuca were analyzed to determine the allelic diversity for codominant SAMPLs. From 3 to 11 putative alleles were found for each SAMPL; 2-6 alleles were found within Lactuca sativa and 1-3 alleles were found among the crisphead genotypes, the most genetically homogeneous plant type of L. sativa. This allelic diversity is greater than that found for RFLP markers. Numerous new alleles were observed in the wild species; however, there were frequent null alleles. Therefore, SAMPL analysis is more applicable to intraspecific than to interspecific comparisons. A phenetic analysis based on SAMPLs resulted in a dendrogram similar to those based on RFLP and AFLP markers.
RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza
DEFF Research Database (Denmark)
Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen
2003-01-01
A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected wit...... of the twenty-three VI-positive specimens were negative when tested by RT-PCR-ELISA. The diagnostic sensitivity and specificity of the RT-PCR-ELISA was 91% and 97%, respectively, using VI in SPF eggs as the gold reference standard....
International Nuclear Information System (INIS)
Godai, Ten-i; Sakuma, Yuji; Tsuchiya, Eiju; Kameda, Yoichi; Akaike, Makoto; Miyagi, Yohei; Suda, Tetsuji; Sugano, Nobuhiro; Tsuchida, Kazuhito; Shiozawa, Manabu; Sekiguchi, Hironobu; Sekiyama, Akiko; Yoshihara, Mitsuyo; Matsukuma, Shoichi
2009-01-01
Although postoperative chemotherapy is widely accepted as the standard modality for Dukes' stage C or earlier stage colorectal cancer (CRC) patients, biomarkers to predict those who may benefit from the therapy have not been identified. Previous in vitro and clinical investigations reported that CRC patients with wild-type p53 gene (TP53)-tumors benefit from 5-fluorouracil (5-FU) based chemotherapy, while those with mutated TP53-tumors do not. However, these studies evaluated the mutation-status of TP53 by immunohistochemistry with or without single-strand conformation polymorphism, and the mutation frequency was different from study to study. In addition, the polymorphic status at p53 codon 72, which results in arginine or proline residues (R72P) and is thought to influence the function of the protein significantly, was not examined. To evaluate the significance of the TP53 mutation as a molecular marker to predict the prognosis of CRC patients, especially those who received postoperative chemotherapy, we examined the mutation by direct sequencing from fresh CRC tumors and evaluated the R72P polymorphism of the mutated TP53 by a combined mutant allele- and polymorphic allele-specific polymerase chain reaction (PCR). The TP53 mutation occurred in 147 (70%) of 211 Japanese CRC tumors. The mutation was observed in 93 (63%) tumors on the R72 allele and in 54 (37%) tumors on the P72 allele. Although the alterations to TP53 have no prognostic significance for CRC patients overall, we found that Dukes' stage C CRC patients who did not receive postoperative chemotherapy and carried the mutated TP53-R72 showed significantly longer survival times than those with the mutated TP53-P72 when evaluated by overall survival (p = 0.012). Using a combined mutant allele- and polymorphic allele-specific PCR, we defined the codon 72 polymorphic status of the TP53 mutated allele in Japanese CRC patients. We raised a possibility that Dukes' stage C colorectal cancer
Zhang, X J; Wang, L X; Chen, X X; Liu, Y L; Meng, R; Wang, Y J; Zhao, Z Y
2014-10-31
Pre-selection for fruit skin color at the seedling stage would be highly advantageous, with marker-assisted selection offering a potential method for apple pre-selection. A and MdMYB1 alleles are allele-specific DNA markers that are potentially associated with apple skin color, and co-segregate with the Rf and Rni loci, respectively. Here, we assessed the potential application of these 2 alleles for marker-assisted breeding across 30 diverse cultivars and 2 apple seedling progenies. The red skin color phenotype was usually associated with the MdMYB1-1 allele and A(1) allele, respectively, while the 2 molecular markers provided approximately 91% predictability in the 'Fuji' x 'Cripps Pink' and 'Fuji' x 'Gala' progenies. The results obtained from the 30 cultivars and 2 progenies were consistent for the 2 molecular markers. Hence, the results supported that Rf and Rni could be located in a gene cluster, or even correspond to alleles of the same gene. Our results are consistent with the hypothesis that red/yellow dimorphism is controlled by a monogenic system, with the presence of the red anthocyanin pigmentation being dominant. In addition, our results supported that the practical utilization of the 2 function markers to efficiently and accurately select red-skinned apple cultivars in apple scion breeding programs.
Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei
2017-09-01
It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.
Wu, Qingzhong; Prager, Katherine C; Goldstein, Tracey; Alt, David P; Galloway, Renee L; Zuerner, Richard L; Lloyd-Smith, James O; Schwacke, Lori
2014-08-11
Several real-time PCR assays are currently used for detection of pathogenic Leptospira spp.; however, few methods have been described for the successful evaluation of clinical urine samples. This study reports a rapid assay for the detection of pathogenic Leptospira spp. in California sea lions Zalophus californianus using real-time PCR with primers and a probe targeting the lipL32 gene. The PCR assay had high analytic sensitivity-the limit of detection was 3 genome copies per PCR volume using L. interrogans serovar Pomona DNA and 100% analytic specificity; it detected all pathogenic leptospiral serovars tested and none of the non-pathogenic Leptospira species (L. biflexa and L. meyeri serovar Semaranga), the intermediate species L. inadai, or the non-Leptospira pathogens tested. Our assay had an amplification efficiency of 1.00. Comparisons between the real-time PCR assay and culture isolation for detection of pathogenic Leptospira spp. in urine and kidney tissue samples from California sea lions showed that samples were more often positive by real-time PCR than by culture methods. Inclusion of an internal amplification control in the real-time PCR assay showed no inhibitory effects in PCR negative samples. These studies indicated that our real-time PCR assay has high analytic sensitivity and specificity for the rapid detection of pathogenic Leptospira species in urine and kidney tissue samples.
Development of a Rapid Real-Time PCR Assay for Quantitation of Pneumocystis carinii f. sp. Carinii
DEFF Research Database (Denmark)
Larsen, Hans Henrik; Kovacs, Joseph A; Stock, Frida
2002-01-01
) PCR assay for detecting P. carinii f. sp. carinii, the subspecies of P. carinii commonly used in research models of PCP. The assay was based on the single-copy dihydrofolate reductase gene and was able to detect r = 0.99) over...... 6 log values for standards containing > or =5 copies/tube. Application of the assay to a series of 10-fold dilutions of P. carinii organisms isolated from rat lung demonstrated that it was reproducibly quantitative over 5 log values (r = 0.99). The assay was applied to a recently reported in vitro....... In conclusion, a rapid, sensitive, and reproducible quantitative PCR assay for P. carinii f. sp. carinii has been developed and is applicable to in vivo as well as in vitro systems. The assay should prove useful for conducting studies in which quantification of organism burden or growth assessment is critical...
Tus-Ter-lock immuno-PCR assays for the sensitive detection of tropomyosin-specific IgE antibodies.
Johnston, Elecia B; Kamath, Sandip D; Lopata, Andreas L; Schaeffer, Patrick M
2014-02-01
The increasing prevalence of food allergies requires development of specific and sensitive tests capable of identifying the allergen responsible for the disease. The development of serologic tests that can detect specific IgE antibodies to allergenic proteins would, therefore, be highly received. Here we present two new quantitative immuno-PCR assays for the sensitive detection of antibodies specific to the shrimp allergen tropomyosin. Both assays are based on the self-assembling Tus-Ter-lock protein-DNA conjugation system. Significantly elevated levels of tropomyosin-specific IgE were detected in sera from patients allergic to shrimp. This is the first time an allergenic protein has been fused with Tus to enable specific IgE antibody detection in human sera by quantitative immuno-PCR.
Karelov, A V; Pilipenko, L A; Kozub, N A; Bondus, R A; Borzykh, A U; Sozinov, I A; Blium, Ia B; Sozinov, A A
2013-01-01
The purpose of our investigation was determination of allelic state of the H1 resistance gene against the pathotypes Ro1 and Ro4 of golden potato cyst nematode (Globodera rostochiensis) among Ukrainian and world potato (Solanum tuberosum ssp. tuberosum) cultivars. The allelic condition of the TG689 marker was determined by PCR with DNA samples isolated from tubers of potato and primers, one pair of which flanks the allele-specific region and the other one was used for the control of DNA quality. Among analyzed 77 potato cultivars the allele of marker associated with the H1-type resistance was found in 74% of Ukrainian and 90% foreign ones although some of those cultivars proved to be susceptible to the golden potato nematode in field. The obtained data confirm the presence of H1-resistance against golden nematode pathotypes Ro1 and Ro4 among the Ukrainian potato cultivars and efficiency of the used marker within the accuracy that has been declared by its authors.
Size Polymorphism in Alleles of the Myoglobin Gene from Biomphalaria Mollusks
Directory of Open Access Journals (Sweden)
Marcelo M. Santoro
2010-10-01
Full Text Available Introns are common among all eukaryotes, while only a limited number of introns are found in prokaryotes. Globin and globin-like proteins are widely distributed in nature, being found even in prokaryotes and a wide range of patterns of intron-exon have been reported in several eukaryotic globin genes. Globin genes in invertebrates show considerable variation in the positions of introns; globins can be found without introns, with only one intron or with three introns in different positions. In this work we analyzed the introns in the myoglobin gene from Biomphalaria glabrata, B. straminea and B. tenagophila. In the Biomphalaria genus, the myoglobin gene has three introns; these were amplified by PCR and analyzed by PCR-RFLP. Results showed that the size (number or nucleotides and the nucleotide sequence of the coding gene of the myoglobin are variable in the three species. We observed the presence of size polymorphisms in intron 2 and 3; this characterizes a homozygous/heterozygous profile and it indicates the existence of two alleles which are different in size in each species of Biomphalaria. This polymorphism could be explored for specific identification of Biomphalaria individuals.
Hossein, Moallaei; Mirhendi, Seied Hossein; Brandão, João; Mirdashti, Reza; Rosado, Laura
2011-09-01
To compare two identification methods, i.e., restriction fragment length polymorphism (RFLP)-PCR analysis and enzymatic method Rapid TM Yeast Plus System to identify different species causing vulvovaginal candidiasis (VVC). Vaginal discharges of women who had attended the gynecology outpatient clinic of Mobini Hospital in Sabzevar, Iran were collected using cotton swabs and were cultured on Sabouraud dextrose agar. Isolated yeasts were identified by germ-tube testing and Rapid TM Yeast Plus System (Remel USA). For molecular identification, the isolated DNA was amplified with ITS1 and ITS4 universal primers and PCR products digested with the enzyme HpaІІ followed by agarose gel electrophoresis. Epidemiological and clinical features of women with respect to identified species were also evaluated. Out of 231 subjects enrolled, 62 VVC cases were detected. The isolated species were identified as follows: Candida albicans, 24 (38.7%), C. glabrata, 15 (24.2%), C. kefyr, 13 (21.0%) C. krusei, 9 (14.5%), and Saccharomyces cerevisiae, 1 (1.6%) by RFLP-PCR method; whereas findings by Rapid TM Yeast Plus System were C. albicans, 24 (38.7%), C. glabrata, 5 (8%), C. kefyr, 11 (17.7%) C. krusei, 2 (3.2%), S. cerevisiae, 9 (14.5%), and C. tropicalis, 6 (9.6%) as well as other nonpathogenic yeasts, 4 (6.9%). Statistical comparison showed that there is no significant difference in identification of C. albicans by the two methods; although, in this study, it was not true about other species of yeasts. A correlation between clinical and laboratory findings is important as it enables us to administer an appropriate treatment on time.
Allelic frequencies of two microsatellite loci in four populations of brown trout (Salmo trutta)
EDIT VARDHAMI; ANILA HODA; ADIOLA BIBA; MANUELA GUALTIERI; MASSIMO MECATTI; AGIM REXHEPI
2014-01-01
Two microsatellite loci, Str60Inra and Ssa197, were PCR amplified on 30 individuals for each populations of brown trout (Salmo trutta). A total of 120 individuals were selected from rivers of the Florence province (Italy), Valbona and Cen (Albania), Lepenci (Kosovo). There were identified 32 different alleles for Str60Inra and 41 for the locus Ssa197. Mean number of alleles ranged from 9 (Cen) to 20.5 (Florence). The mean observed and expected heterosygosities values were 0.329 and 0.755, res...
Evaluation of two real time PCR assays for the detection of bacterial DNA in amniotic fluid.
Girón de Velasco-Sada, Patricia; Falces-Romero, Iker; Quiles-Melero, Inmaculada; García-Perea, Adela; Mingorance, Jesús
2018-01-01
The aim of this study was to evaluate two non-commercial Real-Time PCR assays for the detection of microorganisms in amniotic fluid followed by identification by pyrosequencing. We collected 126 amniotic fluids from 2010 to 2015 for the evaluation of two Real-Time PCR assays for detection of bacterial DNA in amniotic fluid (16S Universal PCR and Ureaplasma spp. specific PCR). The method was developed in the Department of Microbiology of the University Hospital La Paz. Thirty-seven samples (29.3%) were positive by PCR/pyrosequencing and/or culture, 4 of them were mixed cultures with Ureaplasma urealyticum. The Universal 16S Real-Time PCR was compared with the standard culture (81.8% sensitivity, 97.4% specificity, 75% positive predictive value, 98% negative predictive value). The Ureaplasma spp. specific Real-Time PCR was compared with the Ureaplasma/Mycoplasma specific culture (92.3% sensitivity, 89.4% specificity, 50% positive predictive value, 99% negative predictive value) with statistically significant difference (p=0.005). Ureaplasma spp. PCR shows a rapid response time (5h from DNA extraction until pyrosequencing) when comparing with culture (48h). So, the response time of bacteriological diagnosis in suspected chorioamnionitis is reduced. Copyright © 2017 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Starska, Katarzyna, E-mail: katarzyna.starska@umed.lodz.pl [I Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Kopcinskiego 22, 90-153 Łódź (Poland); Krześlak, Anna; Forma, Ewa [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland); Olszewski, Jurek [II Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Żeromskiego 113, 90-549 Łódź (Poland); Morawiec-Sztandera, Alina [Department of Head and Neck Surgery, Medical University of Łódź, Paderewskiego 4, 93-509 Łódź (Poland); Aleksandrowicz, Paweł [Department of Otolaryngology and Laryngological Oncology, Medical University of Lublin, Jaczewskiego 8, 20-954 Lublin (Poland); Lewy-Trenda, Iwona [Department of Pathology, Medical University of Łódź, Pomorska 251, 92-213 Łódź (Poland); and others
2014-10-15
Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was determined by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that − 5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer. - Highlights: • MT2A gene expression and metal content in laryngeal cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn and Cu levels • Negative correlation between MT2A gene expression and Cd, Zn and Cu levels.
International Nuclear Information System (INIS)
Starska, Katarzyna; Krześlak, Anna; Forma, Ewa; Olszewski, Jurek; Morawiec-Sztandera, Alina; Aleksandrowicz, Paweł; Lewy-Trenda, Iwona
2014-01-01
Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was determined by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that − 5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer. - Highlights: • MT2A gene expression and metal content in laryngeal cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn and Cu levels • Negative correlation between MT2A gene expression and Cd, Zn and Cu levels
A rapid cycleave PCR method for distinguishing the vaccine strain Brucella abortus A19 in China.
Nan, Wenlong; Zhang, Yueyong; Tan, Pengfei; Xu, Zouliang; Chen, Yuqi; Mao, Kairong; Chen, Yiping
2016-05-01
Brucellosis is a widespread zoonotic disease caused by Brucella spp. Immunization with attenuated vaccines has proved to be an effective method of prevention; however, it may also interfere with diagnosis. Brucella abortus strain A19, which is homologous to B. abortus strain S19, is widely used for the prevention of bovine brucellosis in China. For effective monitoring of the control of brucellosis, it is essential to distinguish A19 from field strains. Single-nucleotide polymorphism-based assays offer a new approach to such discrimination studies. In the current study, we developed a cycleave PCR assay that successfully distinguished attenuated vaccine strains A19 and S19 from 22 strains of B. abortus and 57 strains of 5 other Brucella species. The assay gave a negative reaction with 4 non-Brucella species. The minimum sensitivity of the assay, evaluated using 10-fold dilutions of chromosomal DNA, was 7.6 fg for the A19 strain and 220 fg for the single non-A19/non-S19 Brucella strain tested (B. abortus 104M). The assay was also reproducible (intra- and interassay coefficients of variation: 0.003-0.01 and 0.004-0.025, respectively). The cycleave assay gave an A19/S19-specific reaction in 3 out of 125 field serum samples, with the same 3 samples being positive in an alternative A19/S19-specific molecular assay. The cycleave assay gave a total of 102 Brucella-specific reactions (3 being the A19/S19-specific reactions), whereas an alternative Brucella-specific assay gave 92 positive reactions (all also positive in the cycleave assay). Therefore, this assay represents a simple, rapid, sensitive, and specific tool for use in brucellosis control. © 2016 The Author(s).
Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.
D'Souza, T M; Boominathan, K; Reddy, C A
1996-01-01
Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429
Directory of Open Access Journals (Sweden)
Narender S Maan
Full Text Available Bluetongue (BT is an arthropod-borne viral disease, which primarily affects ruminants in tropical and temperate regions of the world. Twenty six bluetongue virus (BTV serotypes have been recognised worldwide, including nine from Europe and fifteen in the United States. Identification of BTV serotype is important for vaccination programmes and for BTV epidemiology studies. Traditional typing methods (virus isolation and serum or virus neutralisation tests (SNT or VNT are slow (taking weeks, depend on availability of reference virus-strains or antisera and can be inconclusive. Nucleotide sequence analyses and phylogenetic comparisons of genome segment 2 (Seg-2 encoding BTV outer-capsid protein VP2 (the primary determinant of virus serotype were completed for reference strains of BTV-1 to 26, as well as multiple additional isolates from different geographic and temporal origins. The resulting Seg-2 database has been used to develop rapid (within 24 h and reliable RT-PCR-based typing assays for each BTV type. Multiple primer-pairs (at least three designed for each serotype were widely tested, providing an initial identification of serotype by amplification of a cDNA product of the expected size. Serotype was confirmed by sequencing of the cDNA amplicons and phylogenetic comparisons to previously characterised reference strains. The results from RT-PCR and sequencing were in perfect agreement with VNT for reference strains of all 26 BTV serotypes, as well as the field isolates tested. The serotype-specific primers showed no cross-amplification with reference strains of the remaining 25 serotypes, or multiple other isolates of the more closely related heterologous BTV types. The primers and RT-PCR assays developed in this study provide a rapid, sensitive and reliable method for the identification and differentiation of the twenty-six BTV serotypes, and will be updated periodically to maintain their relevance to current BTV distribution and
Detection of Bacillus spores using PCR and FTA filters.
Lampel, Keith A; Dyer, Deanne; Kornegay, Leroy; Orlandi, Palmer A
2004-05-01
Emphasis has been placed on developing and implementing rapid detection systems for microbial pathogens. We have explored the utility of expanding FTA filter technology for the preparation of template DNA for PCR from bacterial spores. Isolated spores from several Bacillus spp., B. subtilis, B. cereus, and B. megaterium, were applied to FTA filters, and specific DNA products were amplified by PCR. Spore preparations were examined microscopically to ensure that the presence of vegetative cells, if any, did not yield misleading results. PCR primers SRM86 and SRM87 targeted a conserved region of bacterial rRNA genes, whereas primers Bsub5F and Bsub3R amplified a product from a conserved sequence of the B. subtilis rRNA gene. With the use of the latter set of primers for nested PCR, the sensitivity of the PCR-based assay was increased. Overall, 53 spores could be detected after the first round of PCR, and the sensitivity was increased to five spores by nested PCR. FTA filters are an excellent platform to remove PCR inhibitors and have universal applications for environmental, clinical, and food samples.
Rapid Identification of Pathogenic Fungi Directly from Cultures by Using Multiplex PCR
Luo, Guizhen; Mitchell, Thomas G.
2002-01-01
A multiplex PCR method was developed to identify simultaneously multiple fungal pathogens in a single reaction. Five sets of species-specific primers were designed from the internal transcribed spacer (ITS) regions, ITS1 and ITS2, of the rRNA gene to identify Candida albicans, Candida glabrata, Candida parapsilosis, Candida tropicalis, and Aspergillus fumigatus. Another set of previously published ITS primers, CN4 and CN5, were used to identify Cryptococcus neoformans. Three sets of primers w...
DEFF Research Database (Denmark)
Milani, Lili; Lundmark, Anders; Nordlund, Jessica
2008-01-01
To identify genes that are regulated by cis-acting functional elements in acute lymphoblastic leukemia (ALL) we determined the allele-specific expression (ASE) levels of 2, 529 genes by genotyping a genome-wide panel of single nucleotide polymorphisms in RNA and DNA from bone marrow and blood...
Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR
Energy Technology Data Exchange (ETDEWEB)
D`Souza, T.M.; Boominathan, K.; Reddy, C.A. [Michigan State Univ., East Lansing, MI (United States)
1996-10-01
Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.
Detection of SEA-type α-thalassemia in embryo biopsies by digital PCR.
Lee, Ta-Hsien; Hsu, Ya-Chiung; Chang, Chia Lin
2017-08-01
Accurate and efficient pre-implantation genetic diagnosis (PGD) based on the analysis of single or oligo-cells is needed for timely identification of embryos that are affected by deleterious genetic traits in in vitro fertilization (IVF) clinics. Polymerase chain reaction (PCR) is the backbone of modern genetic diagnoses, and a spectrum of PCR-based techniques have been used to detect various thalassemia mutations in prenatal diagnosis (PND) and PGD. Among thalassemias, SEA-type α-thalassemia is the most common variety found in Asia, and can lead to Bart's hydrops fetalis and serious maternal complications. To formulate an efficient digital PCR for clinical diagnosis of SEA-type α-thalassemia in cultured embryos, we conducted a pilot study to detect the α-globin and SEA-type deletion alleles in blastomere biopsies with a highly sensitive microfluidics-based digital PCR method. Genomic DNA from embryo biopsy samples were extracted, and crude DNA extracts were first amplified by a conventional PCR procedure followed by a nested PCR reaction with primers and probes that are designed for digital PCR amplification. Analysis of microfluidics-based PCR reactions showed that robust signals for normal α-globin and SEA-type deletion alleles, together with an internal control gene, can be routinely generated using crude embryo biopsies after a 10 6 -fold dilution of primary PCR products. The SEA-type deletion in cultured embryos can be sensitively diagnosed with the digital PCR procedure in clinics. The adoption of this robust PGD method could prevent the implantation of IVF embryos that are destined to develop Bart's hydrops fetalis in a timely manner. The results also help inform future development of a standard digital PCR procedure for cost-effective PGD of α-thalassemia in a standard IVF clinic. Copyright © 2017. Published by Elsevier B.V.
Zhang, Qi; Zeng, Xin; Younkin, Sam; Kawli, Trupti; Snyder, Michael P; Keleş, Sündüz
2016-02-24
Chromatin immunoprecipitation followed by sequencing (ChIP-seq) experiments revolutionized genome-wide profiling of transcription factors and histone modifications. Although maturing sequencing technologies allow these experiments to be carried out with short (36-50 bps), long (75-100 bps), single-end, or paired-end reads, the impact of these read parameters on the downstream data analysis are not well understood. In this paper, we evaluate the effects of different read parameters on genome sequence alignment, coverage of different classes of genomic features, peak identification, and allele-specific binding detection. We generated 101 bps paired-end ChIP-seq data for many transcription factors from human GM12878 and MCF7 cell lines. Systematic evaluations using in silico variations of these data as well as fully simulated data, revealed complex interplay between the sequencing parameters and analysis tools, and indicated clear advantages of paired-end designs in several aspects such as alignment accuracy, peak resolution, and most notably, allele-specific binding detection. Our work elucidates the effect of design on the downstream analysis and provides insights to investigators in deciding sequencing parameters in ChIP-seq experiments. We present the first systematic evaluation of the impact of ChIP-seq designs on allele-specific binding detection and highlights the power of pair-end designs in such studies.
Harkey, Michael A; Villagran, Alexandra M; Venkataraman, Gopalakrishnan M; Leisenring, Wendy M; Hullar, Meredith A J; Torok-Storb, Beverly J
2017-08-01
OBJECTIVE To determine whether specific alleles of candidate genes of the major histocompatibility complex (MHC) and innate immune system were associated with gastric dilatation-volvulus (GDV) in Great Danes. ANIMALS 42 healthy Great Danes (control group) and 39 Great Danes with ≥ 1 GDV episode. PROCEDURES Variable regions of the 2 most polymorphic MHC genes (DLA88 and DRB1) were amplified and sequenced from the dogs in each group. Similarly, regions of 3 genes associated with the innate immune system (TLR5, NOD2, and ATG16L1), which have been linked to inflammatory bowel disease, were amplified and sequenced. Alleles were evaluated for associations with GDV, controlling for age and dog family. RESULTS Specific alleles of genes DLA88, DRB1, and TLR5 were significantly associated with GDV. One allele of each gene had an OR > 2 in the unadjusted univariate analyses and retained a hazard ratio > 2 after controlling for temperament, age, and familial association in the multivariate analysis. CONCLUSIONS AND CLINICAL RELEVANCE The 3 GDV-associated alleles identified in this study may serve as diagnostic markers for identification of Great Danes at risk for GDV. Additional research is needed to determine whether other dog breeds have the same genetic associations. These findings also provided a new target for research into the etiology of, and potential treatments for, GDV in dogs.
Kim, H; Hwang, S-M; Lee, J H; Oh, M; Han, J W; Choi, G J
2017-08-01
Fusarium oxysporum, a causal agent of Fusarium wilt, is one of the most important fungal pathogens worldwide, and detection of F. oxysporum DNA at the forma specialis level is crucial for disease diagnosis and control. In this study, two novel F. oxysporum f. sp. raphani (For)-specific primer sets were designed, FOR1-F/FOR1-R and FOR2-F/FOR2-R, to target FOQG_17868 and FOQG_17869 ORFs, respectively, which were selected based on the genome comparison of other formae speciales of F. oxysporum including conglutinans, cubense, lycopersici, melonis, and pisi. The primer sets FOR1-F/FOR1-R and FOR2-F/FOR2-R that amplified a 610- and 425-bp DNA fragment, respectively, were specific to For isolates which was confirmed using a total of 40 F. oxysporum isolates. From infected plants, the FOR2-F/FOR2-R primer set directly detected the DNA fragment of For isolates even when the radish plants were collected in their early stage of disease development. Although the loci targeted by the For-specific primer sets were not likely involved in the pathogenesis, the primer set FOR2-F/FOR2-R is available for the determination of pathogenicity of radish-infecting F. oxysporum isolates. This study is the first report providing novel primer sets to detect F. oxysporum f. sp. raphani. Because plant pathogenic Fusarium oxysporum has been classified into special forms based on its host specificity, identification of F. oxysporum usually requires a pathogenicity assay as well as knowledge of the morphological characteristics. For rapid and reliable diagnosis, this study provides PCR primer sets that specifically detect Fusarium oxysporum f. sp. raphani (For) which is a devastating pathogen of radish plants. Because one of the primer sets directly detected the DNA fragment of For isolates from infected plants, the specific PCR method demonstrated in this study will provide a foundation for integrated disease management practices in commodity crops. © 2017 The Society for Applied Microbiology.
Rapid Molecular detection of citrus brown spot disease using ACT gene in Alternaria alternata
Directory of Open Access Journals (Sweden)
Hamid Moghimi
2017-06-01
Full Text Available Introduction:Using rapid detection methods is important for detection of plant pathogens and also prevention through spreading pests in agriculture. Citrus brown spot disease caused by pathogenic isolates of Alternaria alternata is a common disease in Iran. Materials and methods: In this study, for the first time a PCR based molecular method was used for rapid diagnosis of brown spot disease. Nine isolates of A. Alternata were isolated in PDA medium from different citrus gardens. The plant pathogenic activity was examined in tangerine leaves for isolates. Results showed that these isolates are the agents of brown spot disease. PCR amplification of specific ACT-toxin gene was performed for DNA extracted from A. alternata isolates, with 11 different fungal isolates as negative controls and 5 DNA samples extracted from soil. Results: Results showed that A. alternata, the causal agent of brown spot disease, can be carefully distinguished from other pathogenic agents by performing PCR amplification with specific primers for ACT toxin gene. Also, the results from Nested-PCR method confirmed the primary reaction and the specificity of A. alternata for brown spot disease. PCR results to control samples of the other standard fungal isolates, showed no amplification band. In addition, PCR with the DNA extracted from contaminated soils confirmed the presence of ACT toxin gene. Discussion and conclusion: Molecular procedure presented here can be used in rapid identification and prevention of brown spot infection in citrus gardens all over the country.
Takabatake, Reona; Akiyama, Hiroshi; Sakata, Kozue; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Teshima, Reiko; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi
2011-01-01
A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event; A2704-12. During the plant transformation, DNA fragments derived from pUC19 plasmid were integrated in A2704-12, and the region was found to be A2704-12 specific. The pUC19-derived DNA sequences were used as primers for the specific detection of A2704-12. We first tried to construct a standard plasmid for A2704-12 quantification using pUC19. However, non-specific signals appeared with both qualitative and quantitative PCR analyses using the specific primers with pUC19 as a template, and we then constructed a plasmid using pBR322. The conversion factor (C(f)), which is required to calculate the amount of the genetically modified organism (GMO), was experimentally determined with two real-time PCR instruments, the Applied Biosystems 7900HT and the Applied Biosystems 7500. The determined C(f) values were both 0.98. The quantitative method was evaluated by means of blind tests in multi-laboratory trials using the two real-time PCR instruments. The limit of quantitation for the method was estimated to be 0.1%. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSD(R)), and the determined bias and RSD(R) values for the method were each less than 20%. These results suggest that the developed method would be suitable for practical analyses for the detection and quantification of A2704-12.
A multiplex PCR method for rapid identification of Brachionus rotifers.
Vasileiadou, Kalliopi; Papakostas, Spiros; Triantafyllidis, Alexander; Kappas, Ilias; Abatzopoulos, Theodore J
2009-01-01
Cryptic species are increasingly being recognized in many organisms. In Brachionus rotifers, many morphologically similar yet genetically distinct species/biotypes have been described. A number of Brachionus cryptic species have been recognized among hatchery strains. In this study, we present a simple, one-step genetic method to detect the presence of those Brachionus sp. rotifers that have been found in hatcheries. With the proposed technique, each of the B. plicatilis sensu stricto, B. ibericus, Brachionus sp. Nevada, Brachionus sp. Austria, Brachionus sp. Manjavacas, and Brachionus sp. Cayman species and/or biotypes can be identified with polymerase chain reaction (PCR) analysis. Based on 233 cytochrome c oxidase subunit I sequences, we reviewed all the available cryptic Brachionus sp. genetic polymorphisms, and we designed six nested primers. With these primers, a specific amplicon of distinct size is produced for every one of the involved species/biotypes. Two highly sensitive protocols were developed for using the primers. Many of the primers can be combined in the same PCR. The proposed method has been found to be an effective and practical tool to investigate the presence of the above six cryptic species/biotypes in both individual and communal (bulk) rotifer deoxyribonucleic acid extractions from hatcheries. With this technique, hatchery managers could easily determine their rotifer composition at the level of cryptic species and monitor their cultures more efficiently.
Forensic genetic informativeness of an SNP panel consisting of 19 multi-allelic SNPs.
Gao, Zehua; Chen, Xiaogang; Zhao, Yuancun; Zhao, Xiaohong; Zhang, Shu; Yang, Yiwen; Wang, Yufang; Zhang, Ji
2018-05-01
Current research focusing on forensic personal identification, phenotype inference and ancestry information on single-nucleotide polymorphisms (SNPs) has been widely reported. In the present study, we focused on tetra-allelic SNPs in the Chinese Han population. A total of 48 tetra-allelic SNPs were screened out from the Chinese Han population of the 1000 Genomes Database, including Chinese Han in Beijing (CHB) and Chinese Han South (CHS). Considering the forensic genetic requirement for the polymorphisms, only 11 tetra-allelic SNPs with a heterozygosity >0.06 were selected for further multiplex panel construction. In order to meet the demands of personal identification and parentage identification, an additional 8 tri-allelic SNPs were combined into the final multiplex panel. To ensure application in the degraded DNA analysis, all the PCR products were designed to be 87-188 bp. Employing multiple PCR reactions and SNaPshot minisequencing, 511 unrelated Chinese Han individuals from Sichuan were genotyped. The combined match probability (CMP), combined discrimination power (CDP), and cumulative probability of exclusion (CPE) of the panel were 6.07 × 10 -11 , 0.9999999999393 and 0.996764, respectively. Based on the population data retrieved from the 1000 Genomes Project, Fst values between Chinese Han in Sichuan (SCH) and all the populations included in the 1000 Genomes Project were calculated. The results indicated that two SNPs in this panel may contain ancestry information and may be used as markers of forensic biogeographical ancestry inference. Copyright © 2018 Elsevier B.V. All rights reserved.
Routine clinical application of the FRAXA Pfu PCR assay: limits and utility.
Condorelli, D F; Milana, G; Dell'Albani, P; Roccazzello, A M; Insirello, E; Pavone, L; Mollica, F
1996-11-01
Fragile X genotype is characterized by the excessive amplification of an unstable region of DNA: a trinucleotide repeat CGG of variable copy number present in the FRAXA locus. Methods based on polymerase chain reaction (PCR) amplification of the CGG repeat region could facilitate the development of a rapid screening assay. Unfortunately, amplification across CGG repeats can be inefficient and unreliable due to their 100% G + C base composition. The utility of the exonuclease-deficient Pfu polymerase for amplification and detection of the CGG repeats at the FRAXA locus has been reported. In the present study we analysed the utility of a Pfu PCR assay as a rapid initial screening method to rule out a diagnosis of fragile X syndrome in males with mental retardation. Affected males did not show any amplification products or a smear of amplification products between 350 and 550 bp. Only 10% of affected male samples did not show any amplification products, while the vast majority showed the amplification smear. The amplification smears represent a serious drawback of the method, since they cannot be distinguished from the amplification products of normal samples after separation in 1% agarose gel. Several modifications of the PCR conditions were attempted to eliminate this problem, but none was appropriate for clinical applications. However, the problem was easily solved by using a higher resolution electrophoretic system that allows a clear distinction of normal bands from pathological smears. We tested the specificity of the Pfu PCR assay, followed by an improved MetaPhor gel electrophoretic separation of PCR products, on 50 samples from normal males and 24 samples form affected males. The results showed that this method is a rapid, sensitive and specific assay for the exclusion of fragile X syndrome diagnosis in mentally retarded males.
Sensitivity of PCR IS6110 in relation to culture and staining in Pott′s disease
Directory of Open Access Journals (Sweden)
Manoj Kumar
2013-01-01
Full Text Available Background: Rapid diagnosis is essential to decrease the morbidity and mortality of Pott′s disease. The bacteriological methods are time-consuming or insensitive. Polymerase chain reaction (PCR provides a rapid diagnostic tool and hope for early diagnosis of this disease. The aim of this study was to compare and assess of a rapid and effective method among diagnostic battery (Ziehl-Neelsen (ZN microscopy, BACTEC culture and PCR of Pott′s disease. Materials and Methods: Sixty-five specimens from clinico-radiological suspected cases of Pott′s disease were included in this study. They were processed for ZN microscopy, BACTEC culture, and PCR IS6110. The tests tool′s efficiency, positive agreement Kc (Kappa coefficient, and significance level (P value were calculated for correlation between PCR and performed tests. Results: The PCR sensitivity reached to 96% and 46.3% among positive and negative specimens on ZN microscopy. Further, 94% and 36.4% sensitivity were found among positive and negative specimens by BACTEC culture. The total 38 (58.5% specimens were detected either ZN microscopy or by BACTEC culture. Thus, the overall sensitivity and specificity of PCR were 95% and 74.1%. The kappa coefficient and P value, calculated for PCR against BACTEC culture and combined results of performed bacteriological tests were (Kc=0.60, (P<0.001 and (Kc=0.70, (P<0.001, respectively. Above statistical relations showed a fair agreement with significant differences. Conclusion: The PCR IS6110 may be useful in rapid detection of clinico-radiological suspected cases of Pott′s disease and those that are negative with bacteriological methods.
Customizable PCR-microplate array for differential identification of multiple pathogens.
Woubit, Abdela; Yehualaeshet, Teshome; Roberts, Sherrelle; Graham, Martha; Kim, Moonil; Samuel, Temesgen
2013-11-01
Customizable PCR-microplate arrays were developed for the rapid identification of Salmonella Typhimurium, Salmonella Saintpaul, Salmonella Typhi, Shigella dysenteriae, Escherichia coli O157:H7, Francisella tularensis subsp. tularensis, Francisella tularensis subsp. novicida, Vibrio cholerae, Vibrio parahaemolyticus, Yersinia pestis, and Yersinia pseudotuberculosis. Previously, we identified highly specific primers targeting each of these pathogens. Here, we report the development of customizable PCR-microplate arrays for simultaneous identification of the pathogens using the primers identified. A mixed aliquot of genomic DNA from 38 strains was used to validate three PCR-microplate array formats. Identical PCR conditions were used to run all the samples on the three formats. Specific amplifications were obtained on all three custom plates. In preliminary tests performed to evaluate the sensitivity of these assays in samples inoculated in the laboratory with Salmonella Typhimurium, amplifications were obtained from 1 g of beef hot dog inoculated at as low as 9 CFU/ml or from milk inoculated at as low as 78 CFU/ml. Such microplate arrays could be valuable tools for initial identification or secondary confirmation of contamination by these pathogens.
Turner, Andrew; Sasse, Jurgen; Varadi, Aniko
2016-10-19
Inherited disorders of haemoglobin are the world's most common genetic diseases, resulting in significant morbidity and mortality. The large number of mutations associated with the haemoglobin beta gene (HBB) makes gene scanning by High Resolution Melting (HRM) PCR an attractive diagnostic approach. However, existing HRM-PCR assays are not able to detect all common point mutations and have only a very limited ability to detect larger gene rearrangements. The aim of the current study was to develop a HBB assay, which can be used as a screening test in highly heterogeneous populations, for detection of both point mutations and larger gene rearrangements. The assay is based on a combination of conventional HRM-PCR and a novel Gene Ratio Analysis Copy Enumeration (GRACE) PCR method. HRM-PCR was extensively optimised, which included the use of an unlabelled probe and incorporation of universal bases into primers to prevent interference from common non-pathological polymorphisms. GRACE-PCR was employed to determine HBB gene copy numbers relative to a reference gene using melt curve analysis to detect rearrangements in the HBB gene. The performance of the assay was evaluated by analysing 410 samples. A total of 44 distinct pathological genotypes were detected. In comparison with reference methods, the assay has a sensitivity of 100 % and a specificity of 98 %. We have developed an assay that detects both point mutations and larger rearrangements of the HBB gene. This assay is quick, sensitive, specific and cost effective making it suitable as an initial screening test that can be used for highly heterogeneous cohorts.
Chahorm, Kanchana; Prakitchaiwattana, Cheunjit
2018-01-02
The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004
Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR
Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan
2002-01-01
AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381
A one-step multiplex RT-PCR assay for simultaneous detection of four viruses that infect peach.
Yu, Y; Zhao, Z; Jiang, D; Wu, Z; Li, S
2013-10-01
A multiplex reverse transcription polymerase chain reaction (mRT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect peach, namely Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV). In this study, four pairs of primers, one specific for each virus, were designed; the corresponding PCR products were 632, 439, 346 and 282 bp in length for ACLSV, CGRMV, PNRSV and APCLSV, respectively, and the fragments could be distinguished clearly by agarose gel electrophoresis. The sensitivity and specificity of the method were tested using individual RT-PCR and enzyme-linked immunosorbent assay (ELISA), and the identity of the RT-PCR amplification products was also confirmed by DNA sequencing. The results of RT-PCR and ELISA, along with batch detection using samples collected from peach orchards, revealed that this rapid and simple technique is an effective way to identify the four viruses simultaneously. The mRT-PCR assay described in this study was developed for the simultaneous detection of four peach viruses from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method is useful for large-scale surveys of viruses that infect peach. © 2013 The Society for Applied Microbiology.
Guo, Yi; Yang, Jing-Xian; Liang, Guo-Wei
2016-06-01
The prevalence of Candida in bloodstream infections (BSIs) has increased. To date, the identification of Candida in BSIs still mainly relies on blood culture and serological tests, but they have various limitations. Therefore, a real-time PCR assay for the detection of Candida from whole blood is presented. The unique primers/probe system was designed on 5.8S rRNA gene (5.8S rDNA) of Candida genus. The analytical sensitivity was determined by numbers of positive PCRs in 12 repetitions. At the concentration of 10(1) CFU/ml blood, positive PCR rates of 100 % were obtained for C. albicans, C. parapsilosis, C. tropicalis, and C. krusei. The detection rate for C. glabrata was 75 % at 10(1) CFU/ml blood. The reaction specificity was 100 % when evaluating the assay using DNA samples from clinical isolates and human blood. The maximum CVs of intra-assay and inter-assay for the detection limit were 1.22 and 2.22 %, respectively. To assess the clinical applicability, 328 blood samples from 82 patients were prospectively tested and real-time PCR results were compared with results from blood culture. Diagnostic sensitivity of the PCR was 100 % using as gold standard blood culture, and specificity was 98.4 %. Our data suggest that the developed assay can be used in clinical laboratories as an accurate and rapid screening test for the Candida from whole blood. Although further evaluation is warranted, our assay holds promise for earlier diagnosis of candidemia.
Salamin, Olivier; Kuuranne, Tiia; Saugy, Martial; Leuenberger, Nicolas
2017-11-01
Innovation in medical research has been diverted at multiple occasions to enhance human performance. The predicted great progress in gene therapy has raised some concerns regarding its misuse in the world of sports (gene doping) for several years now. Even though there is no evidence that gene doping has ever been used in sports, the continuous improvement of gene therapy techniques increases the likelihood of abuse. Therefore, since 2004, efforts have been invested by the anti-doping community and WADA for the development of detection methods. Several nested PCR and qPCR-based strategies exploiting the absence of introns in the transgenic DNA have been proposed for the long-term detection of transgene in blood. Despite their great sensitivity, those protocols are hampered by limitations of the techniques that can be cumbersome and costly. The purpose of this perspective is to describe a new approach based on loop-mediated isothermal amplification (LAMP) for the detection of gene doping. This protocol enables a rapid and simple method to amplify nucleic acids with a high sensitivity and specificity and with a simple visual detection of the results. LAMP is already being used in clinical application for the detection of viruses or mutations. Therefore, this technique has the potential to be further developed for the detection of foreign genetic material in elite athletes. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.
Tomás, Gonzalo; Hernández, Martín; Marandino, Ana; Techera, Claudia; Grecco, Sofia; Hernández, Diego; Banda, Alejandro; Panzera, Yanina; Pérez, Ruben
2017-04-01
The infectious bursal disease virus (IBDV) is a major health threat to the world's poultry industry despite intensive controls including proper biosafety practices and vaccination. IBDV (Avibirnavirus, Birnaviridae) is a non-enveloped virus with a bisegmented double-stranded RNA genome. The virus is traditionally classified into classic, variant and very virulent strains, each with different epidemiological relevance and clinical implications. Recently, a novel worldwide spread genetic lineage was described and denoted as distinct (d) IBDV. Here, we report the development and validation of a reverse transcription-quantitative polymerase chain reaction (RT-qPCR) assay for the specific detection of dIBDVs in the global poultry industry. The assay employs a TaqMan-MGB probe that hybridizes with a unique molecular signature of dIBDV. The assay successfully detected all the assessed strains belonging to the dIBDV genetic lineage, showing high specificity and absence of cross-reactivity with non-dIBDVs, IBDV-negative samples and other common avian viruses. Using serial dilutions of in vitro-transcribed RNA we obtained acceptable PCR efficiencies and determination coefficients, and relatively small intra- and inter-assay variability. The assay demonstrated a wide dynamic range between 10 3 and 10 8 RNA copies/reaction. This rapid, specific and quantitative assay is expected to improve IBDV surveillance and control worldwide and to increase our understanding of the molecular epidemiology of this economically detrimental poultry pathogen.
Mackay, Ian M; Arden, Katherine E; Nitsche, Andreas
2002-03-15
The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of PCR product during real-time PCR. These are the DNA binding fluorophores, the 5' endonuclease, adjacent linear and hairpin oligoprobes and the self-fluorescing amplicons, which are described in detail. We also discuss factors that have restricted the development of multiplex real-time PCR as well as the role of real-time PCR in quantitating nucleic acids. Both amplification hardware and the fluorogenic detection chemistries have evolved rapidly as the understanding of real-time PCR has developed and this review aims to update the scientist on the current state of the art. We describe the background, advantages and limitations of real-time PCR and we review the literature as it applies to virus detection in the routine and research laboratory in order to focus on one of the many areas in which the application of real-time PCR has provided significant methodological benefits and improved patient outcomes. However, the technology discussed has been applied to other areas of microbiology as well as studies of gene expression and genetic disease.
Sun, Yajuan; Chen, Jiajun; Li, Jia; Xu, Yawei; Jin, Hui; Xu, Na; Yin, Rui; Hu, Guohua
2017-01-01
Rapid and sensitive detection of Mycobacterium tuberculosis (M. Tb) in cerebrospinal fluid is crucial in the diagnosis of tuberculous meningitis (TBM), but conventional diagnostic technologies have limited sensitivity and specificity or are time-consuming. In this work, a novel, highly sensitive molecular diagnostic method, one-tube nested PCR-lateral flow strip test (OTNPCR-LFST), was developed for detecting M. tuberculosis. This one-tube nested PCR maintains the sensitivity of conventional two-step nested PCR and reduces both the chance of cross-contamination and the time required for analysis. The PCR product was detected by a lateral flow strip assay, which provided a basis for migration of the test to a point-of-care (POC) microfluidic format. The developed assay had an improved sensitivity compared with traditional PCR, and the limit of detection was up to 1 fg DNA isolated from M. tuberculosis. The assay was also specific for M. tuberculosis, and no cross-reactions were found in other non-target bacteria. The application of this technique to clinical samples was successfully evaluated, and OTNPCR-LFST showed 89% overall sensitivity and 100% specificity for TBM patients. This one-tube nested PCR-lateral flow strip assay is useful for detecting M. tuberculosis in TBM due to its rapidity, high sensitivity and simple manipulation.
Directory of Open Access Journals (Sweden)
Paola Parrella
2009-01-01
Full Text Available Normal brain tissue from 28 individuals and 50 glioma samples were analyzed by real-time Quantitative Methylation-Specific PCR (QMSP. Data from this analysis were compared with results obtained on the same samples by MSP. QMSP analysis demonstrated a statistically significant difference in both methylation level (P=.000009 Mann Whitney Test and frequencies (P=.0000007, Z-test in tumour samples as compared with normal brain tissues. Although QMSP and MSP showed similar sensitivity, the specificity of QMSP analysis was significantly higher (93%; CI95%: 84%–100% as compared with MSP (64%; 95%CI: 46%–82%. Our results suggest that QMSP analysis may represent a powerful tool to identify glioma patients that will benefit from alkylating agents chemotherapy.
Detection of Mycoplasma synoviae in clinical samples by VlhA-PCR method
Directory of Open Access Journals (Sweden)
H Ansari
2010-02-01
Full Text Available As one of the major pathogens of avian species, Mycoplasma Synoviae causes significant economic losses to the poultry industry. The main purpose of this study was to detect Mycoplasma Synoviae in clinical samples using the VlhA-PCR method. For serological screening test, 373 serum samples were collected from 25 breeder farms and rapid serum agglutination test conducted which revealed that 143 samples equivalent to 19 breeder farms were positive. For VlhA-PCR assay, 20 of the previously mentioned breeder farms were selected and sterile swab were collected from the palatine cleft, trachea, air sacs and lungs. Three swabs from 3 birds were placed in a test tube containing 1 ml of PBS and transferred to the laboratory for PCR test. Specific primers for VIhA gene were employed in this study. The PCR product from specific primers showed 350-400 bp for all field isolated on electrophoresis gel in 8 farms. VlhA-PCR with high sensitivity could be employed in definitive diagnosis of Mycoplasma Synoviae infection in the laboratory.
Characterization of the peptide binding specificity of the HLA class I alleles B*38:01 and B*39:06.
Sidney, John; Schloss, Jennifer; Moore, Carrie; Lindvall, Mikaela; Wriston, Amanda; Hunt, Donald F; Shabanowitz, Jeffrey; DiLorenzo, Teresa P; Sette, Alessandro
2016-03-01
B*38:01 and B*39:06 are present with phenotypic frequencies 39:06 is the B allele most associated with type 1 diabetes susceptibility and 38:01 is most protective. A previous study derived putative main anchor motifs for both alleles based on peptide elution data. The present study has utilized panels of single amino acid substitution peptide libraries to derive detailed quantitative motifs accounting for both primary and secondary influences on peptide binding. From these analyses, both alleles were confirmed to utilize the canonical position 2/C-terminus main anchor spacing. B*38:01 preferentially bound peptides with the positively charged or polar residues H, R, and Q in position 2 and the large hydrophobic residues I, F, L, W, and M at the C-terminus. B*39:06 had a similar preference for R in position 2, but also well-tolerated M, Q, and K. A more dramatic contrast between the two alleles was noted at the C-terminus, where the specificity of B*39:06 was clearly for small residues, with A as most preferred, followed by G, V, S, T, and I. Detailed position-by-position and residue-by-residue coefficient values were generated from the panels to provide detailed quantitative B*38:01 and B*39:06 motifs. It is hoped that these detailed motifs will facilitate the identification of T cell epitopes recognized in the context of two class I alleles associated with dramatically different dispositions towards type 1 diabetes, offering potential avenues for the investigation of the role of CD8 T cells in this disease.
Assigning breed origin to alleles in crossbred animals.
Vandenplas, Jérémie; Calus, Mario P L; Sevillano, Claudia A; Windig, Jack J; Bastiaansen, John W M
2016-08-22
For some species, animal production systems are based on the use of crossbreeding to take advantage of the increased performance of crossbred compared to purebred animals. Effects of single nucleotide polymorphisms (SNPs) may differ between purebred and crossbred animals for several reasons: (1) differences in linkage disequilibrium between SNP alleles and a quantitative trait locus; (2) differences in genetic backgrounds (e.g., dominance and epistatic interactions); and (3) differences in environmental conditions, which result in genotype-by-environment interactions. Thus, SNP effects may be breed-specific, which has led to the development of genomic evaluations for crossbred performance that take such effects into account. However, to estimate breed-specific effects, it is necessary to know breed origin of alleles in crossbred animals. Therefore, our aim was to develop an approach for assigning breed origin to alleles of crossbred animals (termed BOA) without information on pedigree and to study its accuracy by considering various factors, including distance between breeds. The BOA approach consists of: (1) phasing genotypes of purebred and crossbred animals; (2) assigning breed origin to phased haplotypes; and (3) assigning breed origin to alleles of crossbred animals based on a library of assigned haplotypes, the breed composition of crossbred animals, and their SNP genotypes. The accuracy of allele assignments was determined for simulated datasets that include crosses between closely-related, distantly-related and unrelated breeds. Across these scenarios, the percentage of alleles of a crossbred animal that were correctly assigned to their breed origin was greater than 90 %, and increased with increasing distance between breeds, while the percentage of incorrectly assigned alleles was always less than 2 %. For the remaining alleles, i.e. 0 to 10 % of all alleles of a crossbred animal, breed origin could not be assigned. The BOA approach accurately assigns
Aron, Y; Swierczewski, E; Lockhart, A
1994-10-01
We describe a rapid and reliable micromethod for DNA isolation from buccal epithelial cells from the interior mouth mucosa. This convenient, noninvasive method could be applied to genetic typing in a small number of cells (about 2000 cells per cheek). We have shown that DNA released by this method is suitable for further amplification by polymerase chain reaction (PCR). Using this protocol, coupled with the PCR-RFLP (restriction fragment length polymorphism) method, we analyzed the allelic sequence diversity of the human lymphocyte antigen (HLA) class II genes in an extended family of 33 persons containing 14 asthmatic or atopic members. Six of eight DQA1 alleles, and 11 DQB1, 20 DPB1, and 10 DR haplotypes could be identified in a single DNA sample. Our results suggest that the DR53 group haplotype is frequently associated with allergic asthma and atopy. The micromethod described here may be useful in genetic epidemiology, especially in family studies involving small children.
Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M
2016-01-01
Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.
HLA –DRB1*, DQB1* Alleles In Hydatid Patients By Molecular Typing
Directory of Open Access Journals (Sweden)
mehdi Mosayebi
2007-10-01
Full Text Available Mosayebi M1, Dalimi Asl A2, Moazeni M3, Mosayebi Gh4 1. Ph.D Student, Department of Parasitology, Faculty of medicine, Tarbiat Modarres University 2. Professor, Department of Parasitology, Faculty of medicine, Tarbiat Modarres University 3. Professor, Department of Immunology, Faculty of medicine, Tarbiat Modarres University 4. Assistant professor, Department of Immunology, Faculty of medicine, Arak Medical Sciences University Abstract Background: Hydatidosis is a important disease that results from infection with larvae of the dog tape worm , Echinococcus granulosus in human and farm animals .Resistance or susceptibility to infectious diseases , for example , cystic and alveolar echinococcosis is restricted by individual host factors and immunologic responses,in many surveys has been shown.The target of this study that is the first survey dealing with the correlation between HLA-DRB1*& DQB1* alleles and cystic echinococcosis in Iranian patient,is investigation HLA-DRB1*and DQB1* allelic polymorphism in Iranian patient with hydatidosis . Materials and methods: The study was carried out on 56 patients with confirmed cystic echinococcosis and 30 apparently healthy individuals living on Arak area by HLA-DRB1*& DQB1* typing with PCR-SSP method.The first step was founding patients and blood sampling .DNA was prepared from whole blood and we used PCR-SSP with 31 primer mixes for per sample . PCR reaction mixtures were loaded in agarose gels and after electrophoresis , geles were examine under UV illumination and gel document . Analyse of results carried out with specific software and frequency& interpretation tables and homogeneity test for calculation of P-value in χ2 test with fisher΄s exact test . significant samples with logistic regression analysed and Odds-ratio calculate . Results: A statistically significant positive association was found between HLA-DQB1*02 and the occurrence of cystic echinococcosis(P<0.05,(Odds-ratio=2.87 Conclusion: The
Directory of Open Access Journals (Sweden)
Abhishek Mewara
2017-01-01
Full Text Available Background: The clinical features of Acanthamoeba keratitis (AK are non-specific and closely resemble bacterial, viral and fungal keratitis. Materials and Methods: We compared loop-mediated isothermal amplification (LAMP with microscopy, non-nutrient agar (NNA culture and polymerase chain reaction (PCR in clinical suspects of AK. Results: Of 52 clinical samples (42 AK suspects and 10 proven bacterial, viral or fungal keratitis, 3 were positive by direct microscopy (sensitivity 60%, confidence interval [CI]: 17%–92.7%, and 5 by NNA culture, 18S rDNA PCR and LAMP (sensitivity 100%, CI: 46.3%–100%. The limit of detection of Acanthamoeba DNA was 1 pg/μl by both LAMP and PCR. Conclusion: PCR and LAMP assays targeting 18S rDNA gene were found particularly suitable for a rapid and accurate diagnosis of AK. LAMP assay takes 2–3 h lesser than PCR, and thus offers a rapid, highly sensitive and specific, simple and affordable diagnostic modality for patients suspected of AK, especially in resource limited settings
A common mutation associated with the Duarte galactosemia allele
Energy Technology Data Exchange (ETDEWEB)
Elsas, L.J.; Dembure, P.P.; Langley, S.; Paulk, E.M.; Hjelm, L.N.; Fridovich-Keil, J. (Emory Univ. School of Medicine, Atlanta, GA (United States))
1994-06-01
The human cDNA and gene for galactose-1-phosphate uridyl transferase (GALT) have been cloned and sequenced. A prevalant mutation (Q188R) is known to cause classic galactosemia (G/G). G/G galactosemia has an incidence of 1/38,886 in 1,396,766 Georgia live-born infants, but a more common variant of galactosemia, Duarte, has an unknown incidence. The proposed Duarte biochemical phenotypes of GALT are as follows: D/N, D/D, and D/G, which have [approximately]75%, 50%, and 25% of normal GALT activity, respectively. In addition, the D allele has isoforms of its enzyme that have more acidic pI than normal. Here the authors systematically determine (a) the prevalence of an A-to-G transition at base pair 2744 of exon 10 in the GALT gene, a transition that produces a codon change converting asparagine to aspartic acid at position 314 (N314D), and (b) the association of this mutation with the Duarte biochemical phenotype. The 2744G nucleotide change adds an AvaII (SinI) cut site, which was identified in PCR-amplified DNA. In 111 biochemically unphenotyped controls with no history of galactosemia, 13 N314D alleles were identified (prevalence 5.9%). In a prospective study, 40 D alleles were biochemically phenotyped, and 40 N314D alleles were found. By contrast, in 36 individuals known not to have the Duarte biochemical phenotype, no N314D alleles were found. The authors conclude that the N314D mutation is a common allele that probably causes the Duarte GALT biochemical phenotype and occurs in a predominantly Caucasian, nongalactosemic population, with a prevalence of 5.9%. 36 refs., 3 figs., 2 tabs.
DEFF Research Database (Denmark)
Munch, M.; Nielsen, L.P.; Handberg, Kurt
2001-01-01
A. A panel of reference influenza strains from various hosts including avian species, human, swine and horse were evaluated in a one tube RT-PCR using primers designed for the amplification of a 218 bp fragment of the NP gene. The PCR products were detected by PCR-ELISA by use of an internal......Avian influenza virus infections are a major cause of morbidity and rapid identification of the virus has important clinical, economical and epidemiological implications. We have developed a one-tube Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) for the rapid diagnosis of avian influenza...... catching probe confirming the NP influenza A origin. The PCR-ELISA was about 100 times more sensitive than detection of PCR products by agarose gel electrophoresis. RT-PCR and detection by PCR-ELISA is comparable in sensitivity to virus propagation in eggs. We also designed primers for the detection...
Motamedi, Marjan; Mirhendi, Hossein; Zomorodian, Kamiar; Khodadadi, Hossein; Kharazi, Mahboobeh; Ghasemi, Zeinab; Shidfar, Mohammad Reza; Makimura, Koichi
2017-10-01
Following our previous report on evaluation of the beta tubulin real-time PCR for detection of dermatophytosis, this study aimed to compare the real-time PCR assay with conventional methods for the clinical assessment of its diagnostic performance. Samples from a total of 853 patients with suspected dermatophyte lesions were subjected to direct examination (all samples), culture (499 samples) and real-time PCR (all samples). Fungal DNA was extracted directly from clinical samples using a conical steel bullet, followed by purification with a commercial kit and subjected to the Taq-Man probe-based real-time PCR. The study showed that among the 499 specimens for which all three methods were used, 156 (31.2%), 128 (25.6%) and 205 (41.0%) were found to be positive by direct microscopy, culture and real-time PCR respectively. Real-time PCR significantly increased the detection rate of dermatophytes compared with microscopy (288 vs 229) with 87% concordance between the two methods. The sensitivity, specificity, positive predictive value, and negative predictive value of the real-time PCR was 87.5%, 85%, 66.5% and 95.2% respectively. Although real-time PCR performed better on skin than on nail samples, it should not yet fully replace conventional diagnosis. © 2017 Blackwell Verlag GmbH.
Validation of the AmpFlSTR« SEfiler Plus(TM) PCR Amplification kit for forensic STR analysis
DEFF Research Database (Denmark)
Fredslund, Stine Frisk; Mogensen, Helle Smidt; Morling, Niels
2009-01-01
Validation of the AmpFlSTR« SEfiler Plus(TM) PCR Amplification kit with 29 and 30 PCR cycles for forensic STR analysis demonstrated that the kit had fewer artefacts than the AmpFlSTR« SGM Plus(TM) kit (28 PCR cycles). The SEfiler Plus kit was more sensitive and devoid of colour artefacts, but sho......, but showed more stutters, drop-ins, drop-outs and allelic imbalances...
DEFF Research Database (Denmark)
Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen Skotte
2013-01-01
steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence......We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting...
Gayet-Ageron, Angèle; Lautenschlager, Stephan; Ninet, Béatrice; Perneger, Thomas V; Combescure, Christophe
2013-05-01
To systematically review and estimate pooled sensitivity and specificity of the polymerase chain reaction (PCR) technique compared to recommended reference tests in the diagnosis of suspected syphilis at various stages and in various biological materials. Systematic review and meta-analysis. Search of three electronic bibliographic databases from January 1990 to January 2012 and the abstract books of five congresses specialized in the infectious diseases' field (1999-2011). Search key terms included syphilis, Treponema pallidum or neurosyphilis and molecular amplification, polymerase chain reaction or PCR. We included studies that used both reference tests to diagnose syphilis plus PCR and we presented pooled estimates of PCR sensitivity, specificity, and positive and negative likelihood ratios (LR) per syphilis stages and biological materials. Of 1160 identified abstracts, 69 were selected and 46 studies used adequate reference tests to diagnose syphilis. Sensitivity was highest in the swabs from primary genital or anal chancres (78.4%; 95% CI: 68.2-86.0) and in blood from neonates with congenital syphilis (83.0%; 55.0-95.2). Most pooled specificities were ∼95%, except those in blood. A positive PCR is highly informative with a positive LR around 20 in ulcers or skin lesions. In the blood, the positive LR was syphilis diagnosis in lesions. PCR is a useful diagnostic tool in ulcers, especially when serology is still negative and in medical settings with a high prevalence of syphilis.
International Nuclear Information System (INIS)
Zoghbi, H.Y.; McCall, A.E.; LeBorgne-Demarquoy, F.
1991-01-01
We have used an irradiation and fusion procedure to generate somatic cell hybrids that retain fragments of the short arm of human chromosome 6 (6p). To identify hybrids retaining human material, we performed repeat element-mediated PCR on crude lysates of cells from individual clones. Sixty-five hybrids were shown to contain human material and fifty of those contained one or more 6p-specific probes. Detailed characterization of these hybrids identified a subset that divides 6p into ten mapping intervals. Using repeat element-mediated PCR, we were able to isolate and map 61 new DNA fragments from specific regions of 6p. Fifteen of these fragments were used to screen for restriction fragment length polymorphisms (RFLPs), and nine identified RFLPs with one or more enzymes. The radiation hybrids described in this study provide a valuable resource for high-resolution mapping of 6p and for the rapid isolation of region-specific markers
Directory of Open Access Journals (Sweden)
Soji Morishita
Full Text Available Detection of the JAK2V617F mutation is essential for diagnosing patients with classical myeloproliferative neoplasms (MPNs. However, detection of the low-frequency JAK2V617F mutation is a challenging task due to the necessity of discriminating between true-positive and false-positive results. Here, we have developed a highly sensitive and accurate assay for the detection of JAK2V617F and named it melting curve analysis after T allele enrichment (MelcaTle. MelcaTle comprises three steps: 1 two cycles of JAK2V617F allele enrichment by PCR amplification followed by BsaXI digestion, 2 selective amplification of the JAK2V617F allele in the presence of a bridged nucleic acid (BNA probe, and 3 a melting curve assay using a BODIPY-FL-labeled oligonucleotide. Using this assay, we successfully detected nearly a single copy of the JAK2V617F allele, without false-positive signals, using 10 ng of genomic DNA standard. Furthermore, MelcaTle showed no positive signals in 90 assays screening healthy individuals for JAK2V617F. When applying MelcaTle to 27 patients who were initially classified as JAK2V617F-positive on the basis of allele-specific PCR analysis and were thus suspected as having MPNs, we found that two of the patients were actually JAK2V617F-negative. A more careful clinical data analysis revealed that these two patients had developed transient erythrocytosis of unknown etiology but not polycythemia vera, a subtype of MPNs. These findings indicate that the newly developed MelcaTle assay should markedly improve the diagnosis of JAK2V617F-positive MPNs.
Mutant DNA quantification by digital PCR can be confounded by heating during DNA fragmentation.
Kang, Qing; Parkin, Brian; Giraldez, Maria D; Tewari, Muneesh
2016-04-01
Digital PCR (dPCR) is gaining popularity as a DNA mutation quantification method for clinical specimens. Fragmentation prior to dPCR is required for non-fragmented genomic DNA samples; however, the effect of fragmentation on DNA analysis has not been well-studied. Here we evaluated three fragmentation methods for their effects on dPCR point mutation assay performance. Wild-type (WT) human genomic DNA was fragmented by heating, restriction digestion, or acoustic shearing using a Covaris focused-ultrasonicator. dPCR was then used to determine the limit of blank (LoB) by quantifying observed WT and mutant allele counts of the proto-oncogenes KRAS and BRAF in the WT DNA sample. DNA fragmentation by heating to 95°C, while the simplest and least expensive method, produced a high background mutation frequency for certain KRAS mutations relative to the other methods. This was due to heat-induced mutations, specifically affecting dPCR assays designed to interrogate guanine to adenine (G>A) mutations. Moreover, heat-induced fragmentation overestimated gene copy number, potentially due to denaturation and partition of single-stranded DNA into different droplets. Covaris acoustic shearing and restriction enzyme digestion showed similar LoBs and gene copy number estimates to one another. It should be noted that moderate heating, commonly used in genomic DNA extraction protocols, did not significantly increase observed KRAS mutation counts.
Harder, Timm C.; Hufnagel, Markus; Zahn, Katrin; Beutel, Karin; Schmitt, Heinz-Josef; Ullmann, Uwe; Rautenberg, Peter
2001-01-01
Detection of parvovirus B19 DNA offers diagnostic advantages over serology, particularly in persistent infections of immunocompromised patients. A rapid, novel method of B19 DNA detection and quantification is introduced. This method, a quantitative PCR assay, is based on real-time glass capillary thermocycling (LightCycler [LC]) and fluorescence resonance energy transfer (FRET). The PCR assay allowed quantification over a dynamic range of over 7 logs and could quantify as little as 250 B19 genome equivalents (geq) per ml as calculated for plasmid DNA (i.e., theoretically ≥5 geq per assay). Interrater agreement analysis demonstrated equivalence of LC-FRET PCR and conventional nested PCR in the diagnosis of an active B19 infection (kappa coefficient = 0.83). The benefit of the new method was demonstrated in an immunocompromised child with a relapsing infection, who required an attenuation of the immunosuppressive therapy in addition to repeated doses of immunoglobulin to eliminate the virus. PMID:11724854
Development of quantitative real-time PCR for detection and enumeration of Enterobacteriaceae.
Takahashi, Hajime; Saito, Rumi; Miya, Satoko; Tanaka, Yuichiro; Miyamura, Natsumi; Kuda, Takashi; Kimura, Bon
2017-04-04
The family Enterobacteriaceae, members of which are widely distributed in the environment, includes many important human pathogens. In this study, a rapid real-time PCR method targeting rplP, coding for L16 protein, a component of the ribosome large subunit, was developed for enumerating Enterobacteriaceae strains, and its efficiency was evaluated using naturally contaminated food products. The rplP-targeted real-time PCR amplified Enterobacteriaceae species with Ct values of 14.0-22.8, whereas the Ct values for non-Enterobacteriaceae species were >30, indicating the specificity of this method for the Enterobacteriaceae. Using a calibration curve of Ct=-3.025 (log CFU/g)+37.35, which was calculated from individual plots of the cell numbers in different concentrations of 5 Enterobacteriaceae species, the rplP-targeted real-time PCR was applied to 51 food samples. A Enterobacteriaceae species in foods rapidly and accurately, and therefore, it can be used for the microbiological risk analysis of foods. Copyright © 2017 Elsevier B.V. All rights reserved.
Specific Silencing of L392V PSEN1 Mutant Allele by RNA Interference
Directory of Open Access Journals (Sweden)
Malgorzata Sierant
2011-01-01
Full Text Available RNA interference (RNAi technology provides a powerful molecular tool to reduce an expression of selected genes in eukaryotic cells. Short interfering RNAs (siRNAs are the effector molecules that trigger RNAi. Here, we describe siRNAs that discriminate between the wild type and mutant (1174 C→G alleles of human Presenilin1 gene (PSEN1. This mutation, resulting in L392V PSEN1 variant, contributes to early onset familial Alzheimer's disease. Using the dual fluorescence assay, flow cytometry and fluorescent microscopy we identified positions 8th–11th, within the central part of the antisense strand, as the most sensitive to mismatches. 2-Thiouridine chemical modification introduced at the 3′-end of the antisense strand improved the allele discrimination, but wobble base pairing adjacent to the mutation site abolished the siRNA activity. Our data indicate that siRNAs can be designed to discriminate between the wild type and mutant alleles of genes that differ by just a single nucleotide.
Ugozzoli, L A; Lowery, J D; Reyes, A A; Lin, C I; Re, A; Locati, F; Galanello, R; Macioni, L; Maggio, A; Giambona, A; Loutradi, A; Boussiou, M; Wallace, R B
1998-11-01
We describe the evaluation of the Bio-Rad BeTha Gene 1 kit (Bio-Rad Laboratories, Hercules, CA), a DNA-probe assay designed for the qualitative determination of the eight most common Mediterranean beta-thalassemia mutations. The kit utilizes the principle of allele-specific oligonucleotide (ASO) hybridization. Following sample preparation and in vitro DNA amplification by the polymerase chain reaction (PCR), an allele-specific detection of the amplified products by a nonradioactive enzymatic assay is performed. Genomic DNA is prepared from an individual's whole blood with a DNA purification matrix. In a second step, the beta-globin gene is amplified in a multiplex PCR reaction containing four 5' biotinylated oligonucleotide primers. In a final step, an aliquot of the PCR reaction is first chemically denatured and then captured in two eight-well strips of a 96-well enzyme-linked immunosorbent assay (ELISA) plate by hybridization to an immobilized ASO probe. Each DNA sequence at each of the eight mutation sites is represented by one normal and one mutant ASO. During this capture/hybridization step, which is performed at 37 degrees C, only perfectly matched PCR products will be captured by an ASO. Subsequently, the allele-specific captured biotin-labeled PCR products are detected by a colorimetric enzymatic reaction. The system permits the detection of 16 beta-thalassemia alleles using a high-throughput format that can be automated easily. A clinical feasibility study was performed to evaluate the functionality (method comparison study, assay validity using samples previously collected and stored at various temperatures for different periods of time, interference on kit performance, and assay validity for prenatal diagnosis) and the usability (ease of use, sample throughput) of the kit. The analysis of 110 samples previously studied with reference methods showed 100% clinical sensitivity and specificity. We demonstrate here that the procedure not only increases the
Detection of Tomato black ring virus by real-time one-step RT-PCR.
Harper, Scott J; Delmiglio, Catia; Ward, Lisa I; Clover, Gerard R G
2011-01-01
A TaqMan-based real-time one-step RT-PCR assay was developed for the rapid detection of Tomato black ring virus (TBRV), a significant plant pathogen which infects a wide range of economically important crops. Primers and a probe were designed against existing genomic sequences to amplify a 72 bp fragment from RNA-2. The assay amplified all isolates of TBRV tested, but no amplification was observed from the RNA of other nepovirus species or healthy host plants. The detection limit of the assay was estimated to be around nine copies of the TBRV target region in total RNA. A comparison with conventional RT-PCR and ELISA, indicated that ELISA, the current standard test method, lacked specificity and reacted to all nepovirus species tested, while conventional RT-PCR was approximately ten-fold less sensitive than the real-time RT-PCR assay. Finally, the real-time RT-PCR assay was tested using five different RT-PCR reagent kits and was found to be robust and reliable, with no significant differences in sensitivity being found. The development of this rapid assay should aid in quarantine and post-border surveys for regulatory agencies. Copyright © 2010 Elsevier B.V. All rights reserved.
Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.
Directory of Open Access Journals (Sweden)
Yong Huang
Full Text Available Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus and PCV2 (DNA virus from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29% and TGEV (11.7% preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.